--- library_name: transformers license: mit pipeline_tag: text-generation tags: - biology - genomics - long-context arxiv: 2502.07272 --- # GENERator-v2-eukaryote-1.2b-base model ## **Important Notice** If you are using **GENERator** for sequence generation, please ensure that the length of each input sequence is a multiple of **6**. This can be achieved by either: 1. Padding the sequence on the left with `'A'` (**left padding**); 2. Truncating the sequence from the left (**left truncation**). This requirement arises because **GENERator** employs a 6-mer tokenizer. If the input sequence length is not a multiple of **6**, the tokenizer will append an `''` (out-of-vocabulary) token to the end of the token sequence. This can result in uninformative subsequent generations, such as repeated `'AAAAAA'`. We apologize for any inconvenience this may cause and recommend adhering to the above guidelines to ensure accurate and meaningful generation results. ## Abouts In this repository, we present GENERator-v2, a generative genomic foundation with enhanced performance in eukaryotic domain. More technical details are provided in the GENERator-v2 [technical report](https://www.biorxiv.org/content/10.64898/2026.01.27.702015v1). Python scripts for downstream analysis are available on Github: [https://github.com/GenerTeam/GENERator](https://github.com/GenerTeam/GENERator). ## How to use ### Simple example1: generation ```python import torch from transformers import AutoTokenizer, AutoModelForCausalLM # Load the tokenizer and model. tokenizer = AutoTokenizer.from_pretrained("GenerTeam/GENERator-v2-eukaryote-1.2b-base", trust_remote_code=True) model = AutoModelForCausalLM.from_pretrained("GenerTeam/GENERator-v2-eukaryote-1.2b-base") config = model.config max_length = config.max_position_embeddings # Define input sequences. sequences = [ "ATGAGGTGGCAAGAAATGGGCTAC", "GAATTCCATGAGGCTATAGAATAATCTAAGAGAAAT" ] def left_padding(sequence, padding_char='A', multiple=6): remainder = len(sequence) % multiple if remainder != 0: padding_length = multiple - remainder return padding_char * padding_length + sequence return sequence def left_truncation(sequence, multiple=6): remainder = len(sequence) % multiple if remainder != 0: return sequence[remainder:] return sequence # Apply left_padding to all sequences # padded_sequences = [left_padding(seq) for seq in sequences] # Apply left_truncation to all sequences truncated_sequences = [left_truncation(seq) for seq in sequences] # Process the sequences sequences = [tokenizer.bos_token + sequence for sequence in truncated_sequences] # Tokenize the sequences tokenizer.padding_side = "left" inputs = tokenizer( sequences, add_special_tokens=False, return_tensors="pt", padding=True, truncation=True, max_length=max_length ) # Generate the sequences with torch.inference_mode(): outputs = model.generate(**inputs, max_new_tokens=32, temperature=0.00001, top_k=1) # Decode the generated sequences decoded_sequences = tokenizer.batch_decode(outputs, skip_special_tokens=True) # Print the decoded sequences print(decoded_sequences) # It is expected to observe non-sense decoded sequences (e.g., 'AAAAAA') # The input sequences are too short to provide sufficient context. ``` ### Simple example2: embedding ```python import torch from transformers import AutoTokenizer, AutoModelForCausalLM # Load the tokenizer and model tokenizer = AutoTokenizer.from_pretrained("GENERator-v2-eukaryote-1.2b-base", trust_remote_code=True) model = AutoModelForCausalLM.from_pretrained("GENERator-v2-eukaryote-1.2b-base") # Get model configuration config = model.config max_length = config.max_position_embeddings # Define input sequences sequences = [ "ATGAGGTGGCAAGAAATGGGCTAC", "GAATTCCATGAGGCTATAGAATAATCTAAGAGAAAT" ] # Truncate each sequence to the nearest multiple of 6 processed_sequences = [tokenizer.bos_token + seq[:len(seq)//6*6] for seq in sequences] # Tokenization tokenizer.padding_side = "right" inputs = tokenizer( processed_sequences, add_special_tokens=True, return_tensors="pt", padding=True, truncation=True, max_length=max_length ) # Model Inference with torch.inference_mode(): outputs = model(**inputs, output_hidden_states=True) hidden_states = outputs.hidden_states[-1] attention_mask = inputs["attention_mask"] # Option 1: Last token (EOS) embedding last_token_indices = attention_mask.sum(dim=1) - 1 eos_embeddings = hidden_states[torch.arange(hidden_states.size(0)), last_token_indices, :] # Option 2: Mean pooling over all tokens expanded_mask = attention_mask.unsqueeze(-1).expand(hidden_states.size()).to(torch.float32) sum_embeddings = torch.sum(hidden_states * expanded_mask, dim=1) mean_embeddings = sum_embeddings / expanded_mask.sum(dim=1) # Output print("EOS (Last Token) Embeddings:", eos_embeddings) print("Mean Pooling Embeddings:", mean_embeddings) # ============================================================================ # Additional notes: # - The preprocessing step ensures sequences are multiples of 6 for 6-mer tokenizer # - For causal LM, the last token embedding (EOS) is commonly used # - Mean pooling considers all tokens including BOS and content tokens # - The choice depends on your downstream task requirements # - Both methods handle variable sequence lengths via attention mask # ============================================================================ ``` ## Citation ``` @article {li2026generator2, author = {Li, Qiuyi and Zhan, Zhihao and Feng, Shikun and Zhu, Yiheng and He, Yuan and Wu, Wei and Shi, Zhenghang and Wang, Shengjie and Hu, Zongyong and Yang, Zhao and Li, Jiaoyang and Tang, Jian and Liu, Haiguang and Qin, Tao}, title = {Functional In-Context Learning in Genomic Language Models with Nucleotide-Level Supervision and Genome Compression}, elocation-id = {2026.01.27.702015}, year = {2026}, doi = {10.64898/2026.01.27.702015}, publisher = {Cold Spring Harbor Laboratory}, URL = {https://www.biorxiv.org/content/early/2026/01/29/2026.01.27.702015}, journal = {bioRxiv} } @article{wu2025generator, title={GENERator: a long-context generative genomic foundation model}, author={Wu, Wei and Li, Qiuyi and Li, Mingyang and Fu, Kun and Feng, Fuli and Ye, Jieping and Xiong, Hui and Wang, Zheng}, journal={arXiv preprint arXiv:2502.07272}, year={2025} } ```