Update README.md
Browse files
README.md
CHANGED
|
@@ -7,4 +7,36 @@ license: gpl
|
|
| 7 |
|
| 8 |
This model has been pushed to the Hub using the [PytorchModelHubMixin](https://huggingface.co/docs/huggingface_hub/package_reference/mixins#huggingface_hub.PyTorchModelHubMixin) integration:
|
| 9 |
- Library: [More Information Needed]
|
| 10 |
-
- Docs: [More Information Needed]
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 7 |
|
| 8 |
This model has been pushed to the Hub using the [PytorchModelHubMixin](https://huggingface.co/docs/huggingface_hub/package_reference/mixins#huggingface_hub.PyTorchModelHubMixin) integration:
|
| 9 |
- Library: [More Information Needed]
|
| 10 |
+
- Docs: [More Information Needed]
|
| 11 |
+
|
| 12 |
+
## Steps to run model
|
| 13 |
+
- First install [transforna](https://github.com/gitHBDX/TransfoRNA/tree/master)
|
| 14 |
+
- Example code:
|
| 15 |
+
```
|
| 16 |
+
from transforna import GeneEmbeddModel,RnaTokenizer
|
| 17 |
+
import torch
|
| 18 |
+
model_name = 'Seq'
|
| 19 |
+
model_path = f"HBDX/{model_name}-TransfoRNA"
|
| 20 |
+
|
| 21 |
+
#load model and tokenizer
|
| 22 |
+
model = GeneEmbeddModel.from_pretrained(model_path)
|
| 23 |
+
model.eval()
|
| 24 |
+
|
| 25 |
+
#init tokenizer. Tokenizer will automatically get secondary structure of sequence using Vienna RNA package
|
| 26 |
+
tokenizer = RnaTokenizer.from_pretrained(model_path,model_name=model_name)
|
| 27 |
+
output = tokenizer(['AAAGTCGGAGGTTCGAAGACGATCAGATAC','TTTTCGGAACTGAGGCCATGATTAAGAGGG'])
|
| 28 |
+
|
| 29 |
+
#inference
|
| 30 |
+
#gene_embedds is the latent space representation of the input sequence.
|
| 31 |
+
|
| 32 |
+
gene_embedd, _, activations,attn_scores_first,attn_scores_second = \
|
| 33 |
+
model(output['input_ids'])
|
| 34 |
+
|
| 35 |
+
|
| 36 |
+
#get sub class labels
|
| 37 |
+
sub_class_labels = model.convert_ids_to_labels(activations)
|
| 38 |
+
|
| 39 |
+
#get major class labels
|
| 40 |
+
major_class_labels = model.convert_subclass_to_majorclass(sub_class_labels)
|
| 41 |
+
|
| 42 |
+
```
|