Create README.md

README.md

@@ -0,0 +1,62 @@
+---
+license: mit
+language:
+- en
+---
+
+# BarcodeBERT for Taxonomic Classification
+
+A pre-trained transformer model for inference on insect DNA barcoding data.  
+
+To use **BarcodeBERT** as a feature extractor:
+
+```python
+from transformers import AutoTokenizer, AutoModel
+
+# Load the tokenizer
+tokenizer = AutoTokenizer.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
+
+#Load the model 
+model = AutoModel.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
+
+# Sample sequence
+dna_seq = 'ACGCGCTGACGCATCAGCATACGA'
+
+# Tokenize
+input_seq = tokenizer(dna_seq, return_tensors = 'pt')['input_ids']
+
+# Pass through the model
+output = model(input_seq)['hidden_states'][-1]
+
+# Compute Global Average Pooling 
+features = output.mean(1)
+```
+
+## Citation 
+
+If you find BarcodeBERT useful in your research please consider citing:
+
+    @misc{arias2023barcodebert,
+      title={{BarcodeBERT}: Transformers for Biodiversity Analysis},
+      author={Pablo Millan Arias
+        and Niousha Sadjadi
+        and Monireh Safari
+        and ZeMing Gong
+        and Austin T. Wang
+        and Scott C. Lowe
+        and Joakim Bruslund Haurum
+        and Iuliia Zarubiieva
+        and Dirk Steinke
+        and Lila Kari
+        and Angel X. Chang
+        and Graham W. Taylor
+      },
+      year={2023},
+      eprint={2311.02401},
+      archivePrefix={arXiv},
+      primaryClass={cs.LG},
+      doi={10.48550/arxiv.2311.02401},
+    }
+
+
+