DOC: Blacken example code block

README.md

@@ -16,19 +16,21 @@ To use **BarcodeBERT** as a feature extractor:
 from transformers import AutoTokenizer, AutoModel
 
 # Load the tokenizer
-tokenizer = AutoTokenizer.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
+tokenizer = AutoTokenizer.from_pretrained(
+    "bioscan-ml/BarcodeBERT", trust_remote_code=True
+)
 
-#Load the model 
+# Load the model
 model = AutoModel.from_pretrained("bioscan-ml/BarcodeBERT", trust_remote_code=True)
 
 # Sample sequence
-dna_seq = 'ACGCGCTGACGCATCAGCATACGA'
+dna_seq = "ACGCGCTGACGCATCAGCATACGA"
 
 # Tokenize
-input_seq = tokenizer(dna_seq, return_tensors = 'pt')['input_ids']
+input_seq = tokenizer(dna_seq, return_tensors="pt")["input_ids"]
 
 # Pass through the model
-output = model(input_seq.unsqueeze(0))['hidden_states'][-1]
+output = model(input_seq.unsqueeze(0))["hidden_states"][-1]
 
 # Compute Global Average Pooling 
 features = output.mean(1)