article
dict
reports
listlengths
1
3.97k
{ "abstract": "Pemphigus and pemphigus-like reactions can be triggered by a variety of medications including topical therapies, such as imiquimod. While the association between imiquimod and pemphigus-like reactions has been reported in adults, this is the first report of a generalized reaction beyond the site of imiquimod application in a child. The mechanism by which this occurs may be through a unique pathway, separate from the classic antibody-mediated pathway. Our patient had a full recovery without recurrence after cessation of the inciting drug.", "affiliations": "Harvard Medical School, Boston, MA, USA.;Departamento de Cirugía y Servicio de Dermatología, Clínica Alemana de Santiago - Facultad de Medicina Universidad del Desarrollo and Servicio de Dermatología, Hospital Exequiel González Cortés, Santiago, Chile.;Division of Dermatology, Boston Children's Hospital and Harvard Medical School, Boston, MA, USA.;Division of Pathology, Boston Children's Hospital and Harvard Medical School, Boston, MA, USA.;Division of Dermatology, Boston Children's Hospital and Harvard Medical School, Boston, MA, USA.", "authors": "Zhong|Connie S|CS|https://orcid.org/0000-0003-1222-360X;Hasbun|Maria Trinidad|MT|;Jones|Krystal M|KM|;Schmidt|Birgitta A R|BAR|;Hussain|Sadaf H|SH|", "chemical_list": "D000276:Adjuvants, Immunologic; D000077271:Imiquimod", "country": "United States", "delete": false, "doi": "10.1111/pde.14115", "fulltext": null, "fulltext_license": null, "issn_linking": "0736-8046", "issue": "37(2)", "journal": "Pediatric dermatology", "keywords": "drug reaction; imiquimod; pemphigus-like reaction", "medline_ta": "Pediatr Dermatol", "mesh_terms": "D000276:Adjuvants, Immunologic; D002675:Child, Preschool; D003875:Drug Eruptions; D005260:Female; D006801:Humans; D000077271:Imiquimod; D008976:Molluscum Contagiosum; D010392:Pemphigus", "nlm_unique_id": "8406799", "other_id": null, "pages": "379-380", "pmc": null, "pmid": "32027759", "pubdate": "2020-03", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Pemphigus-like eruption as a complication of molluscum contagiosum treatment with imiquimod in a 5-year-old girl.", "title_normalized": "pemphigus like eruption as a complication of molluscum contagiosum treatment with imiquimod in a 5 year old girl" }
[ { "companynumb": "US-BAUSCH-BL-2020-005535", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "IMIQUIMOD" }, "drugadditional": "1", ...
{ "abstract": "In spite of a substantial increase in the use of bisphosphonates at child bearing age, very little is known regarding its use in pregnancy. We describe the outcome of 24 pregnancies after pre-pregnancy or early pregnancy alendronate therapy. Based on the pregnancy outcome it seems that alendronate does not impose a major teratogenic risk.", "affiliations": "The Israeli Teratogen Information Service, Laboratory of Teratology, Hebrew University Hadassah Medical School, Israeli Ministry of Health, Jerusalem, Israel. ornoy@cc.huji.ac.il", "authors": "Ornoy|Asher|A|;Wajnberg|Rivka|R|;Diav-Citrin|Orna|O|", "chemical_list": "D050071:Bone Density Conservation Agents; D019386:Alendronate", "country": "United States", "delete": false, "doi": "10.1016/j.reprotox.2006.05.009", "fulltext": null, "fulltext_license": null, "issn_linking": "0890-6238", "issue": "22(4)", "journal": "Reproductive toxicology (Elmsford, N.Y.)", "keywords": null, "medline_ta": "Reprod Toxicol", "mesh_terms": "D000328:Adult; D019386:Alendronate; D015535:Arthritis, Psoriatic; D001172:Arthritis, Rheumatoid; D001249:Asthma; D001528:Behcet Syndrome; D001607:Berylliosis; D001835:Body Weight; D050071:Bone Density Conservation Agents; D003424:Crohn Disease; D005260:Female; D005865:Gestational Age; D019693:Hepatitis, Autoimmune; D006801:Humans; D007037:Hypothyroidism; D046150:Laron Syndrome; D008875:Middle Aged; D010024:Osteoporosis; D016878:POEMS Syndrome; D011247:Pregnancy; D011248:Pregnancy Complications; D011256:Pregnancy Outcome; D011261:Pregnancy Trimester, First; D012042:Registries", "nlm_unique_id": "8803591", "other_id": null, "pages": "578-9", "pmc": null, "pmid": "16996245", "pubdate": "2006-11", "publication_types": "D016428:Journal Article", "references": null, "title": "The outcome of pregnancy following pre-pregnancy or early pregnancy alendronate treatment.", "title_normalized": "the outcome of pregnancy following pre pregnancy or early pregnancy alendronate treatment" }
[ { "companynumb": "IL-CIPLA LTD.-2014IL02797", "fulfillexpeditecriteria": "1", "occurcountry": "IL", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ALENDRONATE SODIUM" }, "drugadditional": null...
{ "abstract": "Steroid pulse therapy with methylprednisolone (mPSL) succinate ester is the most common treatment for neuromyelitis optica (NMO); no cases of anaphylaxis have been reported to date. Here, we report two cases of anaphylactic shock induced by mPSL pulse therapy in patients with NMO and concurrent systemic lupus erythematosus. Both patients had received several courses of mPSL pulse therapy without any problems previously. Repeated mPSL pulse therapy and comorbid humoral autoimmune disease might increase the risk of anaphylaxis. Corticosteroids without succinate esters should be considered as an alternative therapy to prevent anaphylaxis.", "affiliations": "Department of Neurology and Stroke Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan.;Department of Neurology and Stroke Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan.;Department of Neurology and Stroke Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan.;Department of Neurology and Stroke Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan.;Department of Neurology and Stroke Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan.;Department of Neurology and Stroke Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan.;Department of Neurology and Stroke Medicine, Yokohama City University Graduate School of Medicine, Yokohama, Japan.", "authors": "Takahashi|Keita|K|;Asano|Tetsuya|T|;Higashiyama|Yuichi|Y|;Koyano|Shigeru|S|;Doi|Hiroshi|H|;Takeuchi|Hideyuki|H|;Tanaka|Fumiaki|F|", "chemical_list": "D000893:Anti-Inflammatory Agents; D008775:Methylprednisolone", "country": "England", "delete": false, "doi": "10.1177/1352458518763099", "fulltext": null, "fulltext_license": null, "issn_linking": "1352-4585", "issue": "24(11)", "journal": "Multiple sclerosis (Houndmills, Basingstoke, England)", "keywords": "Neuromyelitis optica; anaphylactic shock; betamethasone; methylprednisolone; succinate ester", "medline_ta": "Mult Scler", "mesh_terms": "D000328:Adult; D000707:Anaphylaxis; D000893:Anti-Inflammatory Agents; D015897:Comorbidity; D005260:Female; D006801:Humans; D008180:Lupus Erythematosus, Systemic; D008775:Methylprednisolone; D009471:Neuromyelitis Optica", "nlm_unique_id": "9509185", "other_id": null, "pages": "1514-1516", "pmc": null, "pmid": "29671689", "pubdate": "2018-10", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Two cases of anaphylactic shock by methylprednisolone in neuromyelitis optica.", "title_normalized": "two cases of anaphylactic shock by methylprednisolone in neuromyelitis optica" }
[ { "companynumb": "JP-FRESENIUS KABI-FK201811526", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "METHYLPREDNISOLONE" }, "drugadditional": ...
{ "abstract": "Merkel cell carcinoma (MCC) is an uncommon but highly malignant neuroendocrine tumor of the skin. MCC can metastasize, but involvement of the central nervous system is rare. Here, we report a case of rapidly progressing metastatic MCC to the clivus and bilateral cavernous sinus in an immunocompromised patient. This case is unique in that it is the first case report showing MCC metastasis to the clivus from a distant site. It also demonstrates that a MCC metastasis can masquerade with symptoms of Tolosa-Hunt syndrome. A literature review on MCC with CNS metastasis is presented.", "affiliations": "Department of Neurology, University of Florida, Gainesville, FL, United States.;Department of Pathology, University of Florida, Gainesville, FL, United States.;Department of Neurology, University of Florida, Gainesville, FL, United States.", "authors": "Ho|Kwo Wei David|KWD|;Drew|Peter A|PA|;Chuquilin|Miguel|M|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3389/fneur.2017.00409", "fulltext": "\n==== Front\nFront NeurolFront NeurolFront. Neurol.Frontiers in Neurology1664-2295Frontiers Media S.A. 10.3389/fneur.2017.00409NeuroscienceCase ReportMerkel Cell Carcinoma with Distant Metastasis to the Clivus Causing Symptoms Mimicking Tolosa–Hunt Syndrome: A Case Report and Literature Review Ho Kwo Wei David 1Drew Peter A. 2Chuquilin Miguel 1*1Department of Neurology, University of Florida, Gainesville, FL, United States2Department of Pathology, University of Florida, Gainesville, FL, United StatesEdited by: Daniel Monte Serrat Prevedello, The Ohio State University Columbus, United States\n\nReviewed by: Alexandre Bossi Todeschini, The Ohio State University Columbus, United States; Andrew Scott Little, Barrow Neurological Institute, United States; Pierpaolo Peruzzi, Brigham and Women’s Hospital, United States\n\n*Correspondence: Miguel Chuquilin, miguel.chuquilin@neurology.ufl.eduSpecialty section: This article was submitted to Neuro-Oncology and Neurosurgical Oncology, a section of the journal Frontiers in Neurology\n\n18 8 2017 2017 8 40914 6 2017 28 7 2017 Copyright © 2017 Ho, Drew and Chuquilin.2017Ho, Drew and ChuquilinThis is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) or licensor are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.Merkel cell carcinoma (MCC) is an uncommon but highly malignant neuroendocrine tumor of the skin. MCC can metastasize, but involvement of the central nervous system is rare. Here, we report a case of rapidly progressing metastatic MCC to the clivus and bilateral cavernous sinus in an immunocompromised patient. This case is unique in that it is the first case report showing MCC metastasis to the clivus from a distant site. It also demonstrates that a MCC metastasis can masquerade with symptoms of Tolosa–Hunt syndrome. A literature review on MCC with CNS metastasis is presented.\n\nMerkel cell carcinomaclivusmetastasisTolosa–Hunt syndromecranial nerve palsiescavernous sinus\n==== Body\nIntroduction\nA 60-year-old man presented to the emergency room with right eyelid ptosis, diplopia, and pain behind the right eye. Symptoms started 3 weeks ago with pain behind the right eye that was sharp and intermittent in nature, and each time lasting a few hours. He saw his ophthalmologist 1 week after symptom onset and was told to keep the eye moist with eye drops. However, the right retroocular pain gradually worsened and became 4/10 in intensity. During this time, he also developed right-sided ptosis and diplopia with associated nausea and vomiting.\n\nHis medical history was significant for diabetes mellitus, end stage renal disease status post combined pancreatic and renal transplant 8 years ago (on tacrolimus, prednisone, and mycophenolate), coronary artery disease and left shoulder Merkel cell carcinoma (MCC) (T2 N1 M0 stage IIIB) with metastasis to the left axilla that was resected 4 months prior to his presentation. At the time of his initial diagnosis of MCC, patient refused chemotherapy because of the risk of transplant rejection and he only received local radiotherapy. In terms of surgical history, he had right cataract surgery 1 year ago.\n\nHis family history was significant for father with a stroke and mother with hypertension and renal disease. He never smoked and drank three glasses of wine per week. He did not use illicit drugs. He was a retired laboratory technician at a particle board plant. His home medications included amlodipine, aspirin, carvedilol, cholecalciferol, cyanocobalamin, doxazosin, magnesium oxide, mycophenolate, tacrolimus, albuterol, amoxicillin, atorvastatin, cetirizine, clonidine, clopidogrel, furosemide, levothyroxine, lisinopril, mometasone, multiple vitamin, prednisone, and ranitidine.\n\nOn physical exam, vital signs were BP 122/63, pulse 65, respiratory rate 14, SpO2 96%.\n\nThere was complete right-sided ptosis (he was unable to open it), with complete right eye ophthalmoplegia. The right pupil was dilated, 7 mm in size and fixed. Shining light to the right pupil constricted the left pupil. Left pupil was 3 mm in size and reactive to light, but shining light into the left pupil did not constrict the right pupil. The left eye had complete abduction paralysis (Figure 1; Video S1 in Supplementary Material). Visual acuity was 20/40 OD, 20/20 OS. Intraocular pressures were normal. Proptosis was not present. Dilated fundus exam showed temporal pallor of the disk in the right eye, and slight pallor of the disk in the left eye. Pinprick was mildly impaired in the right V1 and left V3 distributions. The rest of the neurological exam was unremarkable.\n\nFigure 1 Ptosis of the right eye and fixed and dilated right pupil.\n\nBrain MRI with contrast 4 months prior to his presentation did not reveal any abnormality. Differential diagnosis on admission included multiple cranial neuropathies secondary to Tolosa–Hunt syndrome, cavernous sinus thrombosis, infection, granulomatous process or neoplasm, especially in the setting of MCC. Brain MRI showed infiltrative, peripherally enhancing tumor centered within the clivus with soft tissue extension into the cavernous sinus (Figure 2). Brain MRV was performed without contrast due to concern for his transplanted kidney function and the cavernous sinus was not well visualized. CT of the chest showed left axillary and left low cervical lymphadenopathy but negative for lung masses. He was started on Dexamethasone 4 mg q6 hours to reduce tumor inflammation. Biopsy of the clival mass was performed with stereotactic, stealth CT-guided bilateral endoscopic sphenoidotomy and partial ethmoidectomy. The posterior vomer and intersinus septum were removed within the sphenoid and biopsies were taken from the sphenoid mass seen along the floor. H&E slides of the biopsy showed a small round blue cell tumor. Immunuohistochemical slides showed the tumor was positive for CD56, cytokeratin CAM 5.2 (perinuclear dot-like pattern), and cytokeratin 20 (perinuclear dot-like pattern). The tumor was negative for TTF-1, leukocyte common antigen (LCA), S-100, and melan-A (Figure 3). These findings were consistent with metastatic MCC. Further culture revealed colonization with Scopulariopsis species for which he was started on Posaconazole. He was started on palliative radiation therapy and he declined chemotherapy. Repeat MRI in 1 month and CT scan 2 months later did not reveal progression of the clival metastasis, but new metastatic lesions were found in the cervical spine involving C2, C3, C5, and C6 vertebral bodies. He was put on a cervical collar, but no further surgical or radiation therapy was performed as the patient was asymptomatic. Hospice was considered but the patient declined due to the need to stop his antirejection medications. At the time of submission of this manuscript, 6 months after the initial discovery of the Merkel cell metastasis to the clivus, the patient remained alive.\n\nFigure 2 MRI brain with contrast showing Merkel cell carcinoma (MCC) metastasis to the clivus and invasion into the cavernous sinus. (A) Transverse view. Arrow is pointing to the mass in the clivus. (B) Sagittal view. Arrow is pointing to the mass in the clivus. (C) Coronal view. (D) Magnified view of the cavernous sinus from (C). There is invasion of the metastatic MCC into the cavernous sinus with likely impingement on the cranial nerves.\n\nFigure 3 Histological and immunophenotypical features of the clival mass. (A) H&E stain at 20× showing small round blue cells. (B) CD56 stain positive. (C) Cytokeratin CAM 5.2 stain positive. (D) Magnified view of the cytokeratin CAM 5.2 stain showing perinuclear dot-like pattern.\n\nBackground\nMerkel cell carcinoma is a rare but aggressive cutaneous neuroendocrine tumor. Our case is unique in that the patient presented with right III, IV, V1, VI and left V3, VI cranial nerve palsies without proptosis, mimicking Tolosa–Hunt syndrome or bilateral cavernous sinus thrombosis. This is the first case showing distant MCC metastasis to the clivus with invasion of the cavernous sinuses. His presentation with complete right ptosis, fixed and dilated pupil along with impairment of all extraocular movement of the right eye is unique. The only case report of metastatic MCC involving the cavernous sinus was by Chang et al. (1). However, that case presented only with retro-orbital pain and hemifacial, hemi-tongue numbness. In addition, the primary site of the MCC was on the face 2 years prior to his presentation, with subsequent perineural spread to the brain and leptomeningeal dissemination.\n\nClivus is a part of the cranium at the skull base sitting adjacent to the sphenoid sinuses and cavernous sinuses. The abducens nerves tracks along the clivus and a tumor within the clival space can often cause abducens nerve palsies (2). This patient presented with bilateral abducens nerve palsy, which is compatible with the clival metastasis. The infiltration into the cavernous sinuses caused right CN III, IV, V1. The left V3 nerve can be secondary to the clival mass or to extension of the cavernous sinus tumor infiltration since V3 is located adjacent to both structures (Figure 2D).\n\nMerkel cell carcinoma brain metastases typically occur after a mean period of 19.7 months (3). The patient presented here was diagnosed and treated for MCC just 4 months prior to his presentation. The growth of his MCC metastasis was also rapid. Brain MRI with contrast 3 months prior to his ocular symptoms did not show any sign of metastasis. He progressed rapidly within 3 weeks of symptom onset and his clinical picture was not concerning enough for an ophthalmologist who examined him 2 weeks prior to his presentation.\n\nOur literature review revealed a total of 40 cases of MCC metastasis to the central nervous system (Table 1). The average age at the time of metastasis is 63.66 years old with 60% of the cases being male. 97% of the cases (39 out of 40 cases) had metastasis to the brain or leptomeninges, with the only exception being the report by Chang et al. with perineural spread to the bilateral acoustic meatus and trigeminal cistern (1). The average time for CNS spread after the primary diagnosis is 24.77 months. The survival rate after the CNS diagnosis is 73% at 6 months and 33% at 1 year. This is consistent with the previous report of a median survival time of 8.5 months after a diagnosis of Merkel cell CNS metastasis (4). None of the reported cases described prior immunosuppression before MCC was detected. The reported case here was diagnosed at age of 60, 4 months after the diagnosis of the primary tumor. He had multiple comorbidities including multiorgan transplant status which, along with metastatic MCC, indicate a poor prognosis.\n\nTable 1 Literature review of central nervous system metastasis of Merkel cell carcinoma.\n\nCase\tAge/sex\tPrimary lesion\tLocation of metastasis\tTime to CNS disease after primary Dx\tSurvival after CNS metastasis\tImmunosuppression before primary lesion\t\nKroll et al. (5)\t48M\tNA\tBrain\tNA\tNA\tNone\t\nKroll et al. (5)\t70M\tNA\tBrain\tNA\tNA\tNone\t\nKroll et al. (5)\t72F\tNA\tMeninges\tNA\tNA\tNone\t\nWick et al. (6)\t62M\tFace\tBrain\t12 months\t1 month\tNone\t\nWick et al. (6)\t76M\tRight retroauricular area\tBrain\t3 years\t0 month\tNone\t\nGoepfert et al. (7)\tNA\tNA\tBrain\tNA\tNA\tNone\t\nGiannone et al. (8)\t57F\tScalp\tRight frontoparietal\t2 months\t4 months, survived\tNone\t\nGrosh et al. (9)\t57F\tNA\tBrain\t2 months\t12 months\tNone\t\nGrosh et al. (9)\t56M\tNA\tBrain\t≥21 months\tNA\tNone\t\nHitchcock et al. (10)\t52M\tLeft breast\tBrain\t3 months\t9 months\tNone\t\nKnox et al. (11)\t75F\tRight neck\tLeft cerebellum\t4 years\tNA\tNone\t\nKnox et al. (11)\t60M\tInguinal nodes\tLeptomeninges\t10 months\t14 months\tNone\t\nDudley et al. (12)\t64M\tNA\tLeptomeninges\t17 months\t6 days\tNone\t\nAlexander et al. (13)\t56M\tLeft face\tRight parietal\tPresent at dx\t3 years\tNone\t\nWojak and Murali (14)\t78F\tNA\tCalvaria, Dura\tPresent at dx\t≥1 year\tNone\t\nManome et al. (15)\t57F\tNA\tFrontal skull base, brain\tPresent at dx\tNA\tNone\t\nSmall et al. (16)\t56M\tNA\tBrain\tPresent at dx\t22 months\tNone\t\nYiengpruksawan et al. (17)\tNA\tNA\tBrain\tNA\tNA\tNone\t\nSharma et al. (18)\t57M\t\tBrain\tPresent at dx\t13 months\tNone\t\nSnodgrass et al. (19)\t61M\tForehead\tRight parietal, leptomeninges\t1 year\t6 months\tNone\t\nEftekhari et al. (20)\tNA\tNA\tBrain\tNA\tNA\tNone\t\nEftekhari et al. (20)\tNA\tNA\tBrain\tNA\tNA\tNone\t\nEftekhari et al. (20)\tNA\tNA\tBrain\tNA\tNA\tNone\t\nMatula et al. (21)\t47M\tNA\tAnterior skull base, dura, brain\tPresent at dx\t12 months\tNone\t\nStraka et al. (22)\t71F\tNA\tBrain\t10 months\t2 months\tNone\t\nLitofsky et al. (23)\t86F\tExternal auditory canal\tBrain\t16 months\t≥8 months\tNone\t\nIkawa et al. (24)\t48F\tLeft elbow\tRight cerebellum\t5 years\t11 months\tNone\t\nEggers et al. (25)\t69M\tNA\tPons and midbrain, leptomeninges\t17 months\t<2 months\tNone\t\nBarkdull et al. (26)\t55M\tScalp\tCalvaria, Dura\tPresent at dx\t10 months\tNone\t\nFaye et al. (27)\t85M\tNA\tRight parietal\t1 year\tNA\tNone\t\nFaye et al. (27)\t68M\tNA\tBrain, leptomeninges\t1 year\t7 months\tNone\t\nChang et al. (1)\t45M\tLeft temporal skin\tBilateral internal acoustic meatus, left trigeminal cistern\t2 years\t≥3 months\tNone\t\nDe Cicco et al. (28)\t69M\tNA\tBrain\t22 months\t6 months\tNone\t\nFeletti et al. (3)\t65F\tNA\tPituitary\t3.5 years\t≥8 months\tNone\t\nBailey et al. (4)\t75F\tNasal ala\tRight parietal\t1 year\t7 months\tNone\t\nBailey et al. (4)\t77F\tLeft scalp\tParietal lobe, scalp\tPresent at dx\t≥16 months\tNone\t\nBailey et al. (4)\t51F\tRight calf/inguinal lymph nodes\tRight temporal lobe\t4 years\t>21 months, survived\tNone\t\nAbul-Kasim et al. (29)\t65M\tLeft inguinal, iliac, aortocaval lymph nodes\tRight parietal, lumbar spine\tNA\t8 months, survived\tNone\t\nSeaman et al. (30)\t78M\tRight groin\tLeft central pontine angle mass\t2 months\t5 months, survived\tNone\t\nThis report\t60M\tLeft shoulder\tClivus, cavernous sinus\t4 months\t–\tYes\t\nAverage\t63.66 years old\t–\t–\t24.76 ± 19.5 months\t6 months survival: 73%\t\t\n60% M\t12 months survival: 33%\t\nDiscussion\nWhen the patient first presented, Tolosa–Hunt syndrome and cavernous sinus thrombosis were the top two differential diagnoses. However, cavernous sinus thrombosis typically presents with proptosis (80–100%) (31), and our patient did not, making Tolosa–Hunt syndrome a more compelling etiology on presentation. Tolosa–Hunt syndrome is an idiopathic, sterile inflammation affecting the cavernous sinus. It is defined by the International Headache Society as “episodic orbital pain associated with paralysis of one or more of the third, fourth, and/or sixth cranial nerves, which usually resolves spontaneously but tends to relapse and remit” (32). Tolosa–Hunt syndrome is typically unilateral, with bilateral symptoms occurring in only about 4% of the cases (33). Cranial nerve III is the most commonly affected cranial nerve (78.3%), followed by cranial nerve VI (41.3%), cranial nerve IV (30.4%), the ophthalmic branch of cranial nerve V (28.1%), and cranial nerve II (10.9%). Multiple nerves may be affected simultaneously in 54.3% of patients (33). The maxillary and mandibular divisions of the fifth nerve and even facial nerve may be affected (34, 35). Abnormal MRI findings occurr in only 52% of the patients (33). The patient presented here had involvement of the right cranial nerve III, IV, VI, and ophthalmic branch of V, as well as left cranial nerve VI and mandibular division of V. There was orbital pain behind the right eye. Other than the prolonged duration (3 weeks), the clinical picture would fit Tolosa–Hunt syndrome. MCC metastasis did not become the top differential diagnosis until MRI brain was obtained.\n\nThe patient was immunocompromised due to the use of immunosuppressants for his renal and pancreatic transplants. Immunosuppression is a significant risk factor, as the risk of developing MCC significantly increases with human immunodeficiency virus (36, 37), and chronic lymphocytic leukemia (38, 39). Solid organ transplant status has also been shown to increase the risk of developing MCC by 23.8-fold (40). In the study by Clarke et al., the incidence of MCC in renal transplant was 13.8 per 100,000 person-year, which translates to 25.7-fold increase in risk of developing MCC compared to the general population. In another study, the standardized incidence ratio of MCC is as high as 66 for patients with renal transplant (41). In that study, three cases of MCC were detected among 4,200 individuals who underwent renal transplantation. All three identified cases were on immunosuppressive medications. The latency between transplant and MCC ranged from 6 to 19 years. All three cases died and the survival time between diagnosis of MCC and death ranged from 0.5 to 2.1 years. Our patient had both renal and pancreatic transplant, which likely increased his risk of developing MCC. He developed MCC 8 years after his renal and pancreatic transplant, which is in line with the reported latency.\n\nMerkel cell polyoma virus was detected in about 80% of all MCCs (42). Because immunosuppression has been shown to be a significant risk factor, it has been hypothesized that immunosuppression after an organ transplant increases the risk of Merkel cell polyoma virus infection and thus increases the risk of developing MCC. However, the study by Koljonen et al. (41) showed that only one out of the three MCC cases with renal transplant status (33%) was tested positive for Merkel cell polyoma virus. This rate was lower than the 80% expected in the general population. Even though these data argue against the hypothesis of polyoma virus being the underlying cause of MCC in organ transplant patients, the sample size is currently too small to draw a conclusion. Unfortunately, in the case presented here, we do not have the Merkel cell polyoma virus data available.\n\nConcluding Remarks\nThis case is unique because it is the only case report showing MCC metastasis to the clivus from a distant site. It also demonstrates that MCC metastasis symptoms can progress rapidly within weeks and can masquerade as symptoms of Tolosa–Hunt syndrome or cavernous sinus thrombosis.\n\nEthics Statement\nRetrospective case report (exempted). Informed consent was signed for publication. Patient was not identified.\n\nAuthor Contributions\nKH drafted the manuscript and compiled the figures, tables, and videos. PD provided pathological images and reviewed the manuscript. MC designed and supervised the work and critically reviewed the manuscript.\n\nConflict of Interest Statement\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest. The reviewer, AT, and handling editor declared their shared affiliation and the handling editor states that the process nevertheless met the standards of a fair and objective review.\n\nFunding. Publication of this article was funded in part by the University of Florida Open Access Publishing Fund.\n\nSupplementary Material\nThe Supplementary Material for this article can be found online at http://journal.frontiersin.org/article/10.3389/fneur.2017.00409/full#supplementary-material.\n\nVideo S1 Extraocular movements of the patient.\n\nClick here for additional data file.\n==== Refs\nReferences\n1 Chang DT Mancuso AA Riggs CE Mendenhall WM . Merkel cell carcinoma of the skin with leptomeningeal metastases . Am J Otolaryngol (2005 ) 26 :210 –3 .10.1016/j.amjoto.2004.11.013 15858780 \n2 Pallini R Sabatino G Doglietto F Lauretti L Fernandez E Maira G \nClivus metastases: report of seven patients and literature review . Acta Neurochir (Wien) (2009 ) 151 :291 –6; discussion 296 .10.1007/s00701-009-0229-1 19259614 \n3 Feletti A Marton E Rossi S Canal F Longatti P Billeci D . Pituitary metastasis of Merkel cell carcinoma . J Neurooncol (2010 ) 97 :295 –9 .10.1007/s11060-009-0025-z 19806319 \n4 Bailey TL Fung MA Gandour-Edwards R Ellis WG Schrot RJ . Clinical emergence of neurometastatic merkel cell carcinoma: a surgical case series and literature review . J Neurooncol (2011 ) 102 :147 –55 .10.1007/s11060-010-0304-8 20668913 \n5 Kroll MH Toker C . Trabecular carcinoma of the skin: further clinicopathologic and morphologic study . Arch Pathol Lab Med (1982 ) 106 :404 –8 .6896631 \n6 Wick MR Goellner JR Scheithauer BW Thomas JR Sanchez NP Schroeter AL . Primary neuroendocrine carcinomas of the skin (Merkel cell tumors). A clinical, histologic, and ultrastructural study of thirteen cases . Am J Clin Pathol (1983 ) 79 :6 –13 .10.1093/ajcp/79.1.6 6336886 \n7 Goepfert H Remmler D Silva E Wheeler B . Merkel cell carcinoma (endocrine carcinoma of the skin) of the head and neck . Arch Otolaryngol (1984 ) 110 :707 –12 .10.1001/archotol.1984.00800370009002 6487123 \n8 Giannone L Johnson DH Grosh WW Davis BW Marangos PJ Greco FA . Serum neuron-specific enolase in metastatic Merkel cell tumors . Med Pediatr Oncol (1985 ) 13 :357 –62 .10.1002/mpo.2950130611 3900664 \n9 Grosh WW Giannone L Hande KR Johnson DH . Disseminated Merkel cell tumor. Treatment with systemic chemotherapy . Am J Clin Oncol (1987 ) 10 :227 –30 .10.1097/00000421-198706000-00011 3591743 \n10 Hitchcock CL Bland KI Laney RG Franzini D Harris B Copeland EM . Neuroendocrine (Merkel cell) carcinoma of the skin. Its natural history, diagnosis, and treatment . Ann Surg (1988 ) 207 :201 –7 .10.1097/00000658-198802000-00015 3277546 \n11 Knox SJ Kapp DS . Hyperthermia and radiation therapy in the treatment of recurrent Merkel cell tumors . Cancer (1988 ) 62 :1479 –86 .10.1002/1097-0142(19881015)62:8<1479::AID-CNCR2820620806>3.0.CO;2-H 3048629 \n12 Dudley TH Moinuddin S . Cytologic and immunohistochemical diagnosis of neuroendocrine (Merkel cell) carcinoma in cerebrospinal fluid . Am J Clin Pathol (1989 ) 91 :714 –7 .10.1093/ajcp/91.6.714 2471404 \n13 Alexander E Rossitch E Small K Rosenwasser GO Abson P \nMerkel cell carcinoma. Long term survival in a patient with proven brain metastasis and presumed choroid metastasis . Clin Neurol Neurosurg (1989 ) 91 :317 –20 .10.1016/0303-8467(89)90007-3 2555091 \n14 Wojak JC Murali R . Primary neuroendocrine (Merkel cell) carcinoma presenting in the calvarium: case report . Neurosurgery (1990 ) 26 :137 –9 .10.1227/00006123-199001000-00021 2294466 \n15 Manome Y Yamaoka R Yuhki K Hano H Kitajima T Ikeuchi S \n[Intracranial invasion of neuroendocrine carcinoma: a case report] . No Shinkei Geka (1990 ) 18 :483 –7 .2385325 \n16 Small KW Rosenwasser GO Alexander E Rossitch G Dutton JJ . Presumed choroidal metastasis of Merkel cell carcinoma . Ann Ophthalmol (1990 ) 22 :187 –90 .2195954 \n17 Yiengpruksawan A Coit DG Thaler HT Urmacher C Knapper WK \nMerkel cell carcinoma. Prognosis and management . Arch Surg (1991 ) 126 :1514 –9 .10.1001/archsurg.1991.01410360088014 1842182 \n18 Sharma D Flora G Grunberg SM . Chemotherapy of metastatic Merkel cell carcinoma: case report and review of the literature . Am J Clin Oncol (1991 ) 14 :166 –9 .10.1097/00000421-199104000-00014 2028925 \n19 Snodgrass SM Landy H Markoe AM Feun L . Neurologic complications of Merkel cell carcinoma . J Neurooncol (1994 ) 22 :231 –4 .10.1007/BF01052924 7760100 \n20 Eftekhari F Wallace S Silva EG Lenzi R . Merkel cell carcinoma of the skin: imaging and clinical features in 93 cases . Br J Radiol (1996 ) 69 :226 –33 .10.1259/0007-1285-69-819-226 8800866 \n21 Matula C Roessler K Burian M Schuster H Trattnig S Hainfellner JA \nPrimary neuroendocrine (Merkel cell) carcinoma of the anterior skull base . Skull Base Surg (1997 ) 7 :151 –8 .10.1055/s-2008-1058607 17171025 \n22 Straka JA Straka MB \nA review of Merkel cell carcinoma with emphasis on lymph node disease in the absence of a primary site . Am J Otolaryngol (1997 ) 18 :55 –65 .10.1016/S0196-0709(97)90050-8 9006679 \n23 Litofsky NS Smith TW Megerian CA . Merkel cell carcinoma of the external auditory canal invading the intracranial compartment . Am J Otolaryngol (1998 ) 19 :330 –4 .10.1016/S0196-0709(98)90008-4 9758183 \n24 Ikawa F Kiya K Uozumi T Yuki K Takeshita S Hamasaki O \nBrain metastasis of Merkel cell carcinoma. Case report and review of the literature . Neurosurg Rev (1999 ) 22 :54 –7 .10.1007/s101430050010 10348209 \n25 Eggers SD Salomao DR Dinapoli RP Vernino S . Paraneoplastic and metastatic neurologic complications of Merkel cell carcinoma . Mayo Clin Proc (2001 ) 76 :327 –30 .10.4065/76.3.327 11243282 \n26 Barkdull GC Healy JF Weisman RA . Intracranial spread of Merkel cell carcinoma through intact skull . Ann Otol Rhinol Laryngol (2004 ) 113 :683 –7 .10.1177/000348940411300901 15453522 \n27 Faye N Lafitte F Martin Duverneuil N Guillevin R Teriitehau C Cordoliani YS \nMerkel cell tumor: report of two cases and review of the literature . J Neuroradiol (2005 ) 32 :138 –41 .10.1016/S0150-9861(05)83129-3 15984406 \n28 De Cicco L Vavassori A Jereczek-Fossa BA Pruneri G Catalano G Ferrari AM \nLymph node metastases of Merkel cell carcinoma from unknown primary site: report of three cases . Tumori (2008 ) 94 :758 –61 .19112956 \n29 Abul-Kasim K Söderström K Hallsten L . Extensive central nervous system involvement in Merkel cell carcinoma: a case report and review of the literature . J Med Case Rep (2011 ) 5 :35 .10.1186/1752-1947-5-35 21269448 \n30 Seaman B Brem S Fromm A Staller A McCardle T Jain S . Intracranial spread of Merkel cell carcinoma to the cerebellopontine angle . J Cutan Med Surg (2012 ) 16 :54 –60 .10.1177/120347541201600111 22417997 \n31 Ebright JR Pace MT Niazi AF . Septic thrombosis of the cavernous sinuses . Arch Intern Med (2001 ) 161 :2671 –6 .10.1001/archinte.161.22.2671 11732931 \n32 Headache Classification Committee of the International Headache Society (IHS) . The international classification of headache disorders, 3rd edition (beta version) . Cephalalgia (2013 ) 33 :629 –808 .10.1177/0333102413485658 23771276 \n33 Zhang X Zhou Z Steiner TJ Zhang W Liu R Dong Z \nValidation of ICHD-3 beta diagnostic criteria for 13.7 Tolosa-Hunt syndrome: analysis of 77 cases of painful ophthalmoplegia . Cephalalgia (2014 ) 34 :624 –32 .10.1177/0333102413520082 24477599 \n34 Tessitore E Tessitore A . Tolosa-Hunt syndrome preceded by facial palsy . Headache (2000 ) 40 :393 –6 .10.1046/j.1526-4610.2000.00060.x 10849035 \n35 Inzitari D Sità D Marconi GP Barontini F . The Tolosa-Hunt syndrome: further clinical and pathogenetic considerations based on the study of eight cases . J Neurol (1981 ) 224 :221 –8 .10.1007/BF00313284 6162018 \n36 An KP Ratner D . Merkel cell carcinoma in the setting of HIV infection . J Am Acad Dermatol (2001 ) 45 :309 –12 .10.1067/mjd.2001.114732 11464198 \n37 Engels EA Frisch M Goedert JJ Biggar RJ Miller RW . Merkel cell carcinoma and HIV infection . Lancet (2002 ) 359 :497 –8 .10.1016/S0140-6736(02)07668-7 11853800 \n38 Kaae J Hansen AV Biggar RJ Boyd HA Moore PS Wohlfahrt J \nMerkel cell carcinoma: incidence, mortality, and risk of other cancers . J Natl Cancer Inst (2010 ) 102 :793 –801 .10.1093/jnci/djq120 20424236 \n39 Howard RA Dores GM Curtis RE Anderson WF Travis LB . Merkel cell carcinoma and multiple primary cancers . Cancer Epidemiol Biomarkers Prev (2006 ) 15 :1545 –9 .10.1158/1055-9965.EPI-05-0895 16896047 \n40 Clarke CA Robbins HA Tatalovich Z Lynch CF Pawlish KS Finch JL \nRisk of Merkel cell carcinoma after solid organ transplantation . J Natl Cancer Inst (2015 ) 107 :dju382 10.1093/jnci/dju382 25575645 \n41 Koljonen V Kukko H Tukiainen E Böhling T Sankila R Pukkala E \nIncidence of Merkel cell carcinoma in renal transplant recipients . Nephrol Dial Transplant (2009 ) 24 :3231 –5 .10.1093/ndt/gfp334 19586970 \n42 Feng H Shuda M Chang Y Moore PS . Clonal integration of a polyomavirus in human Merkel cell carcinoma . Science (2008 ) 319 :1096 –100 .10.1126/science.1152586 18202256\n\n", "fulltext_license": "CC BY", "issn_linking": "1664-2295", "issue": "8()", "journal": "Frontiers in neurology", "keywords": "Merkel cell carcinoma; Tolosa–Hunt syndrome; cavernous sinus; clivus; cranial nerve palsies; metastasis", "medline_ta": "Front Neurol", "mesh_terms": null, "nlm_unique_id": "101546899", "other_id": null, "pages": "409", "pmc": null, "pmid": "28868044", "pubdate": "2017", "publication_types": "D002363:Case Reports", "references": "19586970;20668913;1842182;2028925;15984406;6487123;2385325;21269448;6896631;3277546;10348209;11464198;18202256;6162018;19259614;2555091;8800866;17171025;19806319;9758183;20424236;3900664;9006679;22417997;2471404;2195954;3048629;25575645;7760100;3591743;15858780;23771276;19112956;6336886;15453522;2294466;10849035;11243282;16896047;24477599;11853800;11732931", "title": "Merkel Cell Carcinoma with Distant Metastasis to the Clivus Causing Symptoms Mimicking Tolosa-Hunt Syndrome: A Case Report and Literature Review.", "title_normalized": "merkel cell carcinoma with distant metastasis to the clivus causing symptoms mimicking tolosa hunt syndrome a case report and literature review" }
[ { "companynumb": "US-WEST-WARD PHARMACEUTICALS CORP.-US-H14001-17-03639", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, ...
{ "abstract": "Pulmonary hypertension causes substantial morbidity and mortality in infants. Although Food and Drug Administration approved to treat pulmonary arterial hypertension in adults, sildenafil is not approved for infants. We sought to describe sildenafil exposure and associated diagnoses and outcomes in infants.\n\n\n\nRetrospective cohort of neonates discharged from more than 300 neonatal intensive care units from 2001 to 2016.\n\n\n\nSildenafil was administered to 1,336/1,161,808 infants (0.11%; 1.1 per 1,000 infants); 0/35,977 received sildenafil in 2001 versus 151/90,544 (0.17%; 1.7 per 1,000 infants) in 2016. Among infants <32 weeks' gestational age (GA) with enough data to determine respiratory outcome, 666/704 (95%) had bronchopulmonary dysplasia (BPD). Among infants ≥32 weeks GA, 248/455 (55%) had BPD and 76/552 (14%) were diagnosed with meconium aspiration. Overall, 209/921 (23%) died prior to discharge.\n\n\n\nThe use of sildenafil has increased since 2001. Exposed infants were commonly diagnosed with BPD. Further studies evaluating dosing, safety, and efficacy of sildenafil are needed.", "affiliations": "Department of Pediatrics, Duke University Medical Center, Durham, North Carolina.;Department of Pediatrics, University of Washington, Seattle, Washington.;Department of Pediatrics, Duke Clinical Research Institute, Duke University School of Medicine, Durham, North Carolina.;Department of Pediatrics, Duke Clinical Research Institute, Duke University School of Medicine, Durham, North Carolina.;Pediatrix-Obstetrix Center for Research and Education, Sunrise, Florida.;Department of Pediatrics, University of Washington, Seattle, Washington.", "authors": "Thompson|Elizabeth J|EJ|;Perez|Krystle|K|;Hornik|Christoph P|CP|;Smith|P Brian|PB|;Clark|Reese H|RH|;Laughon|Matthew|M|;|||", "chemical_list": "D014665:Vasodilator Agents; D000068677:Sildenafil Citrate", "country": "United States", "delete": false, "doi": "10.1055/s-0038-1667378", "fulltext": null, "fulltext_license": null, "issn_linking": "0735-1631", "issue": "36(3)", "journal": "American journal of perinatology", "keywords": null, "medline_ta": "Am J Perinatol", "mesh_terms": "D001997:Bronchopulmonary Dysplasia; D004363:Drug Utilization; D005260:Female; D006801:Humans; D006976:Hypertension, Pulmonary; D007231:Infant, Newborn; D007234:Infant, Premature; D007235:Infant, Premature, Diseases; D007363:Intensive Care Units, Neonatal; D008297:Male; D008471:Meconium Aspiration Syndrome; D012189:Retrospective Studies; D000068677:Sildenafil Citrate; D014665:Vasodilator Agents", "nlm_unique_id": "8405212", "other_id": null, "pages": "262-267", "pmc": null, "pmid": "30081404", "pubdate": "2019-02", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural", "references": "23625986;21833954;22954271;23796045;22766743;20199882;26490498;24420987;23344111;22341543;16291984;26491852;14736800;15823634;14711900;23769501;28777888;19836028;3335964;24583505;19829144;18055675;27589542;21278430;25824807;25796626;25843770;17209664;22564297;18950791;15665374;22128226;11401896;15956137;17991881;16585301;27053698;26012476;15870496;24637559;19866403;21941230;12937112", "title": "Sildenafil Exposure in the Neonatal Intensive Care Unit.", "title_normalized": "sildenafil exposure in the neonatal intensive care unit" }
[ { "companynumb": "US-AMNEAL PHARMACEUTICALS-2019AMN00246", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "SILDENAFIL" }, "drugadditional":...
{ "abstract": "BACKGROUND\nCancer during pregnancy is rare (about 1/1000 pregnancies) and its diagnosis raises the question of whether or not to continue the pregnancy.\n\n\nOBJECTIVE\nThe primary objective of our study was to evaluate associated factors with termination of pregnancy in cases of cancer during pregnancy. Secondary objectives were to evaluate maternal and neonatal outcomes when pregnancy is continued.\n\n\nMETHODS\nWe conducted a retrospective, single-center study between January 2009 and December 2019 including 2 groups of patients those who underwent termination of pregnancy and those who continued pregnancy. Patients were distributed in 3 categories breast cancer, blood cancer and other cancers.\n\n\nRESULTS\nA total of 71 pregnancies associated with cancer were included. Twenty patients (28.16 %) underwent termination of pregnancy. The median gestational age at diagnosis was significantly earlier in the termination of pregnancy group compared with the ongoing pregnancy group (9 vs 22 weeks, p < 0.01). Blood cancer was more frequent in the termination group 7 (35 %) compared to continuous pregnancy 8 (15.7 %) as other cancers 8 (40 %) in the termination group vs 5 (9,8 %). Conversely breast cancer what was less frequent in the termination group 5 (25 %) vs 38 (74,5 %) (p < 0.01). In the continued pregnancy group, there was a high rate of induced prematurity (35.5 %) and scheduled delivery to optimize maternal oncologic management (78.4 %).\n\n\nCONCLUSIONS\nThe rate of termination of pregnancy remains high particularly in case of non-breast cancer and early pregnancy detection. Scheduled preterm birth is frequent when pregnancy is continued in order to optimize of cancer management.", "affiliations": "Maternité Port-Royal, AP-HP, Hôpital Cochin, FHU PREMA, F-75014, Paris, France. Electronic address: mathilde.barrois@aphp.fr.;Maternité Port-Royal, AP-HP, Hôpital Cochin, FHU PREMA, F-75014, Paris, France.;Curie Institute, Department of Medical Oncology, 26 rue d'Ulm, 75248, Paris Cedex 05, France.;Oncology Department, Cochin Hospital, APHP, DHU CARPEM, 123 Bd Port-Royal, 75014, Paris, France.;Hematology Department, Cochin Hospital, APHP, 53 avenue de l'Observatoire, 75014, Paris, France.;Maternité Port-Royal, AP-HP, Hôpital Cochin, FHU PREMA, F-75014, Paris, France.;Maternité Port-Royal, AP-HP, Hôpital Cochin, FHU PREMA, F-75014, Paris, France; Curie Institute, Department of Medical Oncology, 26 rue d'Ulm, 75248, Paris Cedex 05, France; Université de Paris, INSERM UMR 1153, F-75014, Paris, France.;Maternité Port-Royal, AP-HP, Hôpital Cochin, FHU PREMA, F-75014, Paris, France; Curie Institute, Department of Medical Oncology, 26 rue d'Ulm, 75248, Paris Cedex 05, France; Université de Paris, INSERM UMR -S 1139, Physiopathologie et pharmacotoxicologie placentaire humaine, F-75006, Paris, France.", "authors": "Barrois|Mathilde|M|;Anselem|Olivia|O|;Pierga|Jean Yves|JY|;Goldwasser|François|F|;Bouscary|Didier|D|;Alessandrini|Vivien|V|;Goffinet|François|F|;Tsatsaris|Vassilis|V|", "chemical_list": null, "country": "Ireland", "delete": false, "doi": "10.1016/j.ejogrb.2021.04.020", "fulltext": null, "fulltext_license": null, "issn_linking": "0301-2115", "issue": "261()", "journal": "European journal of obstetrics, gynecology, and reproductive biology", "keywords": "Cancer; Obstetrical outcomes; Oncological management; Pregnancy; Termination of pregnancy", "medline_ta": "Eur J Obstet Gynecol Reprod Biol", "mesh_terms": "D005260:Female; D005865:Gestational Age; D006801:Humans; D007231:Infant, Newborn; D009369:Neoplasms; D011247:Pregnancy; D011256:Pregnancy Outcome; D047928:Premature Birth; D012189:Retrospective Studies", "nlm_unique_id": "0375672", "other_id": null, "pages": "110-115", "pmc": null, "pmid": "33930826", "pubdate": "2021-06", "publication_types": "D016428:Journal Article", "references": null, "title": "Cancer during pregnancy: Factors associated with termination of pregnancy and perinatal outcomes.", "title_normalized": "cancer during pregnancy factors associated with termination of pregnancy and perinatal outcomes" }
[ { "companynumb": "FR-SUN PHARMACEUTICAL INDUSTRIES LTD-2021R1-301121", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "LEUCOVORIN" }, "drug...
{ "abstract": "Data on the use in pregnancy of the new antiepileptic drugs (AED) are limited. We analysed data collected by the Australian Pregnancy Register to provide information on their relative teratogenicity. The database containing pregnancy outcomes from 1317 women with epilepsy (WWE) was examined for three widely used new AED in monotherapy in the first trimester--lamotrigine, levetiracetam and topiramate. This was compared with outcomes of pregnant WWE on monotherapy with three traditional AED, and with untreated women. The incidence of malformations associated with lamotrigine monotherapy was 12/231 (5.2%), with topiramate 1/31 (3.2%) and with levetiracetam 0/22 (0%). This compares with rates of 1/35 (2.9%) for phenytoin, 35/215 (16.3%) for valproate (VPA), 19/301 (6.3%) for carbamazepine and 6/116 (5.2%) for untreated women. There was no evidence of dose-dependent risks of foetal malformation, except with VPA monotherapy. We conclude that the new AED appear no more teratogenic than traditional drugs in monotherapy.", "affiliations": "Department of Medicine, University of Melbourne, Royal Parade, Parkville, Victoria 3050, Australia. Frank.Vajda@mh.org.au", "authors": "Vajda|F J E|FJ|;Graham|J|J|;Roten|A|A|;Lander|C M|CM|;O'Brien|T J|TJ|;Eadie|M|M|", "chemical_list": "D000927:Anticonvulsants; D014227:Triazines; D000077236:Topiramate; D005632:Fructose; D000077287:Levetiracetam; D000077213:Lamotrigine; D010889:Piracetam", "country": "Scotland", "delete": false, "doi": "10.1016/j.jocn.2011.08.003", "fulltext": null, "fulltext_license": null, "issn_linking": "0967-5868", "issue": "19(1)", "journal": "Journal of clinical neuroscience : official journal of the Neurosurgical Society of Australasia", "keywords": null, "medline_ta": "J Clin Neurosci", "mesh_terms": "D000014:Abnormalities, Drug-Induced; D000927:Anticonvulsants; D001315:Australia; D004334:Drug Administration Schedule; D005260:Female; D005632:Fructose; D006801:Humans; D000077213:Lamotrigine; D000077287:Levetiracetam; D010889:Piracetam; D011247:Pregnancy; D012042:Registries; D000077236:Topiramate; D014227:Triazines", "nlm_unique_id": "9433352", "other_id": null, "pages": "57-9", "pmc": null, "pmid": "22104350", "pubdate": "2012-01", "publication_types": "D003160:Comparative Study; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Teratogenicity of the newer antiepileptic drugs--the Australian experience.", "title_normalized": "teratogenicity of the newer antiepileptic drugs the australian experience" }
[ { "companynumb": "AU-UNICHEM LABORATORIES LIMITED-UCM201608-000193", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "TOPIRAMATE" }, "druga...
{ "abstract": "We report the presentation and management of 17 cases of Exophiala dermatitidis and Rhodotorula mucilaginosa bloodstream infections caused by a compounded parenteral medication at an oncology clinic. Twelve patients were asymptomatic. All central venous catheters were removed and antifungal therapy, primarily voriconazole, was administered to patients. Three patients died.", "affiliations": "Epidemic Intelligence Service, Centers for Disease Control and Prevention, Atlanta, Georgia.;Lenox Hill Hospital, Northwell Health System, New York, New York.;Division of Foodborne, Waterborne, and Environmental Diseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia.;Division of Foodborne, Waterborne, and Environmental Diseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia.;Lenox Hill Hospital, Northwell Health System, New York, New York.;Lenox Hill Hospital, Northwell Health System, New York, New York.;Division of Foodborne, Waterborne, and Environmental Diseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia.;University of Alabama at Birmingham.;Duke University Hospital, Durham, North Carolina.;Wayne State University, Detroit, Michigan.;Division of Foodborne, Waterborne, and Environmental Diseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia.;Division of Foodborne, Waterborne, and Environmental Diseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia.;New York City Department of Health and Mental Hygiene, New York.;Division of Foodborne, Waterborne, and Environmental Diseases, National Center for Emerging and Zoonotic Infectious Diseases, Centers for Disease Control and Prevention, Atlanta, Georgia.", "authors": "Vasquez|Amber|A|;Zavasky|D|D|;Chow|N A|NA|;Gade|L|L|;Zlatanic|E|E|;Elkind|S|S|;Litvintseva|A P|AP|;Pappas|P G|PG|;Perfect|J R|JR|;Revankar|S|S|;Lockhart|S R|SR|;Chiller|T|T|;Ackelsberg|J|J|;Vallabhaneni|S|S|", "chemical_list": "D000935:Antifungal Agents", "country": "United States", "delete": false, "doi": "10.1093/cid/cix948", "fulltext": null, "fulltext_license": null, "issn_linking": "1058-4838", "issue": "66(6)", "journal": "Clinical infectious diseases : an official publication of the Infectious Diseases Society of America", "keywords": null, "medline_ta": "Clin Infect Dis", "mesh_terms": "D000368:Aged; D000554:Ambulatory Care Facilities; D000935:Antifungal Agents; D058345:Asymptomatic Infections; D019468:Disease Management; D004196:Disease Outbreaks; D004340:Drug Contamination; D005093:Exophiala; D005260:Female; D016469:Fungemia; D006801:Humans; D016867:Immunocompromised Host; D008297:Male; D008875:Middle Aged; D016522:Oncology Service, Hospital; D010045:Outpatients; D060446:Phaeohyphomycosis; D012248:Rhodotorula", "nlm_unique_id": "9203213", "other_id": null, "pages": "959-962", "pmc": null, "pmid": "29121235", "pubdate": "2018-03-05", "publication_types": "D016428:Journal Article", "references": null, "title": "Management of an Outbreak of Exophiala dermatitidis Bloodstream Infections at an Outpatient Oncology Clinic.", "title_normalized": "management of an outbreak of exophiala dermatitidis bloodstream infections at an outpatient oncology clinic" }
[ { "companynumb": "US-PFIZER INC-2018130821", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CEFTAZIDIME" }, "drugadditional": "3", ...
{ "abstract": "Spontaneous retroperitoneal hemorrhage (SRH) is a rare, life-threatening clinical entity most commonly associated with renal cell cancers. Systemic vasculitis has also been described as a rare cause of SRH. The current report describes a patient with acute kidney failure complicated by massive SRH, which occurred in the setting of anti-neutrophil cytoplasmic antibody (ANCA)-negative systemic necrotizing angiocentric granulomatous vasculitis involving multiple organs with minimal constitutional symptoms and no respiratory tract involvement.", "affiliations": null, "authors": "Vo|Hieu|H|;Showkat|Arif|A|;Chikkalingaiah|K Mandya|KM|;Nguyen|Cuong|C|;Wall|Barry M|BM|", "chemical_list": "D019268:Antibodies, Antineutrophil Cytoplasmic", "country": "Germany", "delete": false, "doi": "10.5414/CN108150", "fulltext": null, "fulltext_license": null, "issn_linking": "0301-0430", "issue": "83(4)", "journal": "Clinical nephrology", "keywords": null, "medline_ta": "Clin Nephrol", "mesh_terms": "D000368:Aged; D019268:Antibodies, Antineutrophil Cytoplasmic; D005260:Female; D006099:Granuloma; D006470:Hemorrhage; D006801:Humans; D007668:Kidney; D009336:Necrosis; D012187:Retroperitoneal Space; D014657:Vasculitis", "nlm_unique_id": "0364441", "other_id": null, "pages": "249-52", "pmc": null, "pmid": "25707453", "pubdate": "2015-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Spontaneous massive bilateral peri-renal hemorrhage as a complication of ANCA-negative granulomatous vasculitis.", "title_normalized": "spontaneous massive bilateral peri renal hemorrhage as a complication of anca negative granulomatous vasculitis" }
[ { "companynumb": "US-IROKO PHARMACEUTICALS LLC-US-I09001-16-00078", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "AMLODIPINE BESYLATE" }, ...
{ "abstract": "Methaemoglobin is a form of haemoglobin in which the ferrous (Fe2+) ion contained in the iron-porphyrin complex of haem is oxidised to its ferric (Fe3+) state. Methaemoglobinaemia, the presence of methaemoglobin in the blood, is most commonly treated with methylene blue. However, methylene blue cannot be used in patients with glucose-6-phosphate dehydrogenase (G6PD) deficiency as it is ineffective in such patients and it can worsen G6PD deficiency haemolysis. We report the case of a 30-year-old man who presented with clinical features of G6PD deficiency-associated haemolysis and was found to have severe methaemoglobinaemia (35%). He was administered blood transfusions and intravenous ascorbic acid. His methaemoglobinaemia resolved within 24 hours. This case demonstrates the successful management of a patient with severe methaemoglobinaemia in the setting of G6PD deficiency haemolysis. Emergency physicians should be aware of the possible co-occurrence of severe methaemoglobinaemia in a patient with G6PD deficiency haemolysis.", "affiliations": "Department of Biological and Biomedical Sciences, Aga Khan University, Karachi, Pakistan.;Department of Medicine, Hamad Medical Corporation, Doha, Qatar.;Department of Medicine, Hamad Medical Corporation, Doha, Qatar.;Department of Medicine, Hamad Medical Corporation, Doha, Qatar.", "authors": "Rehman|Abdul|A|http://orcid.org/0000-0002-8398-7810;Shehadeh|Mohanad|M|;Khirfan|Diala|D|;Jones|Akhnuwhkh|A|", "chemical_list": "D000975:Antioxidants; D001205:Ascorbic Acid", "country": "England", "delete": false, "doi": "10.1136/bcr-2017-223369", "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "2018()", "journal": "BMJ case reports", "keywords": "emergency medicine; general practice / family medicine; haematology (drugs and medicines); haematology (incl blood transfusion)", "medline_ta": "BMJ Case Rep", "mesh_terms": "D000208:Acute Disease; D000328:Adult; D000743:Anemia, Hemolytic; D000975:Antioxidants; D001205:Ascorbic Acid; D001803:Blood Transfusion; D003937:Diagnosis, Differential; D005955:Glucosephosphate Dehydrogenase Deficiency; D006801:Humans; D008297:Male; D008708:Methemoglobinemia; D009390:Nepal; D012720:Severity of Illness Index", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "29592989", "pubdate": "2018-03-28", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "15342970;10809266;9523930;27040960;19224791;965487;12000225;7444473;21352269;21954509;21852596;18561168;10377640;29298156;1389948;20701405;12845393;8130867;11668106;10736124;22024786;12897322;17489100;24439259;18177777;24914501;16848758;9681784;16140723;8693563;2288829;10533013;11824767;17615278;10916676", "title": "Severe acute haemolytic anaemia associated with severe methaemoglobinaemia in a G6PD-deficient man.", "title_normalized": "severe acute haemolytic anaemia associated with severe methaemoglobinaemia in a g6pd deficient man" }
[ { "companynumb": "PHHY2018PK001238", "fulfillexpeditecriteria": "1", "occurcountry": "PK", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "CIPROFLOXACIN" }, "drugadditional": "1", "dr...
{ "abstract": "The efficacy and safety of infliximab in patients with plaque psoriasis, psoriatic arthritis, pustular psoriasis (excluding localized type) and psoriatic erythroderma were assessed in clinical practice. Without washout of the existing treatment of psoriasis, treatment was switched to infliximab, which was given at a dose of 5 mg/kg at weeks 0, 2 and 6 and then every 8 weeks up to week 46. The primary end-points were 75% improvement in Psoriasis Area and Severity Index score (PASI 75 response rate) for plaque psoriasis, 20% improvement in American College of Rheumatology criteria (ACR 20 response rate) for psoriatic arthritis, and global improvement in pustular psoriasis and psoriatic erythroderma. The PASI 75 response rate in plaque psoriasis was 72.2% at week 10 and 53.6% at week 50. The ACR 20 response rate in psoriatic arthritis was 66.7% at week 14 and 80.0% at week 46. The response defined as global improvement in pustular psoriasis was between 66.7% and 100.0% during the 2–50-week period. The response defined as global improvement in psoriatic erythroderma was between 75.0% and 100.0% during the week-2–50 period. There were 14 discontinued patients. The most frequently reported reason for discontinuation was the development of adverse events. However, there were no serious respiratory diseases, infections or infusion reactions. In patients with plaque psoriasis, psoriatic arthritis, pustular psoriasis and psoriatic erythroderma, infliximab was well tolerated, regardless of prior treatment, and also showed superior efficacy over a period of approximately 1 year.", "affiliations": "Division of Dermatology, Social Insurance Central General Hospital, Tokyo, Japan. toriimd@shahochu.jp", "authors": "Torii|Hideshi|H|;Nakagawa|Hidemi|H|;|||", "chemical_list": "D000911:Antibodies, Monoclonal; D000069285:Infliximab", "country": "England", "delete": false, "doi": "10.1111/j.1346-8138.2010.00971.x", "fulltext": null, "fulltext_license": null, "issn_linking": "0385-2407", "issue": "38(4)", "journal": "The Journal of dermatology", "keywords": null, "medline_ta": "J Dermatol", "mesh_terms": "D000328:Adult; D000911:Antibodies, Monoclonal; D015535:Arthritis, Psoriatic; D003873:Dermatitis, Exfoliative; D005260:Female; D006801:Humans; D000069285:Infliximab; D007564:Japan; D008297:Male; D008875:Middle Aged; D010267:Parapsoriasis; D011565:Psoriasis; D016896:Treatment Outcome", "nlm_unique_id": "7600545", "other_id": null, "pages": "321-34", "pmc": null, "pmid": "21544940", "pubdate": "2011-04", "publication_types": "D016428:Journal Article; D016448:Multicenter Study", "references": null, "title": "Long-term study of infliximab in Japanese patients with plaque psoriasis, psoriatic arthritis, pustular psoriasis and psoriatic erythroderma.", "title_normalized": "long term study of infliximab in japanese patients with plaque psoriasis psoriatic arthritis pustular psoriasis and psoriatic erythroderma" }
[ { "companynumb": "JP-JNJFOC-20110406583", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "INFLIXIMAB" }, "drugadditional": "3", "...
{ "abstract": "To report the effectiveness and safety of transcatheter arterial sclerosing embolization (TASE) for the treatment of parotid infantile hemangiomas that did not respond appreciably to propranolol.\n\n\n\nA total of 21 infants (12 male and 9 female) with large propranolol-resistant infantile hemangiomas in the parotid region were enrolled in this study. During TASE, the feeding arteries of the lesions were embolized using pingyangmycin-lipiodol emulsion and polyvinyl alcohol particles (300-500 μm) to reduce the blood flow rate. All children were followed up as outpatients at 2 weeks and monthly thereafter. The curative effect was evaluated at the 1- and 3-month follow-up visits.\n\n\n\nNine lesions were located on the right side of the parotid gland, whereas 12 were located on the left side. The feeding arteries in all patients originated from branches of the external carotid artery. TASE was technically successful in all patients. The mean (± SD) maximal diameter of the hemangiomas significantly decreased from 6.50 cm ± 2.28 before treatment to 3.56 cm ± 1.84 at 1 month after TASE (P <. 05). Three months after TASE, the mean maximal diameter further significantly decreased to 1.94 cm ± 1.58 (P <. 05). During the follow-up period, 16 cases were rated as excellent and 5 as good; no recurrence or serious complications were noted. Minor side effects, such as slight pain, mild fever, and tissue swelling, were observed.\n\n\n\nTASE significantly decreased the size of the parotid hemangiomas with minor side effects during a short follow-up period.", "affiliations": "Department of Vascular Anomalies and Interventional Radiology, Qilu Children'sHospital of Shandong University, Room 23976, Jingshi Road, Jinan City, Shandong prov. CN 250022.;Department of Vascular Anomalies and Interventional Radiology, Qilu Children'sHospital of Shandong University, Room 23976, Jingshi Road, Jinan City, Shandong prov. CN 250022.;Department of Vascular Anomalies and Interventional Radiology, Qilu Children'sHospital of Shandong University, Room 23976, Jingshi Road, Jinan City, Shandong prov. CN 250022.;Department of Vascular Anomalies and Interventional Radiology, Qilu Children'sHospital of Shandong University, Room 23976, Jingshi Road, Jinan City, Shandong prov. CN 250022.;Department of Vascular Anomalies and Interventional Radiology, Qilu Children'sHospital of Shandong University, Room 23976, Jingshi Road, Jinan City, Shandong prov. CN 250022.;Department of Vascular Anomalies and Interventional Radiology, Qilu Children'sHospital of Shandong University, Room 23976, Jingshi Road, Jinan City, Shandong prov. CN 250022.;Department of Stomatology, Qilu Children'sHospital of Shandong University, Room 23976, Jingshi Road, Jinan City, Shandong prov. CN 250022. Electronic address: zhangyunkui2019@126.com.", "authors": "Guo|Lei|L|;Wu|Changhua|C|;Song|Dan|D|;Wang|Liang|L|;Li|Jing|J|;Sun|Jiali|J|;Zhang|Yunkui|Y|", "chemical_list": "D000970:Antineoplastic Agents; D012597:Sclerosing Solutions; D001761:Bleomycin; C025703:bleomycetin; D004998:Ethiodized Oil; D011142:Polyvinyl Alcohol; D011433:Propranolol", "country": "United States", "delete": false, "doi": "10.1016/j.jvir.2020.09.029", "fulltext": null, "fulltext_license": null, "issn_linking": "1051-0443", "issue": "32(2)", "journal": "Journal of vascular and interventional radiology : JVIR", "keywords": null, "medline_ta": "J Vasc Interv Radiol", "mesh_terms": "D000970:Antineoplastic Agents; D001761:Bleomycin; D019008:Drug Resistance, Neoplasm; D004621:Embolization, Therapeutic; D004998:Ethiodized Oil; D005260:Female; D006391:Hemangioma; D006801:Humans; D007223:Infant; D008297:Male; D010307:Parotid Neoplasms; D011142:Polyvinyl Alcohol; D011433:Propranolol; D012597:Sclerosing Solutions; D015911:Sclerotherapy; D013997:Time Factors; D016896:Treatment Outcome; D047368:Tumor Burden", "nlm_unique_id": "9203369", "other_id": null, "pages": "293-298", "pmc": null, "pmid": "33221193", "pubdate": "2021-02", "publication_types": "D016428:Journal Article", "references": null, "title": "Transcatheter Arterial Sclerosing Embolization for the Treatment of Giant Propranolol-Resistant Infantile Hemangiomas in the Parotid Region.", "title_normalized": "transcatheter arterial sclerosing embolization for the treatment of giant propranolol resistant infantile hemangiomas in the parotid region" }
[ { "companynumb": "CN-FRESENIUS KABI-FK202104083", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "BLEOMYCIN A5" }, "drugadditional": null,...
{ "abstract": "Case Scenerio: A 26-year-old patient presents to the dermatology clinic with severe nodulocystic scarring acne. The patient identifies as a transgender male and notes that he has been receiving hormone replacement therapy for the past 4 years with weekly intramuscular testosterone injections.", "affiliations": null, "authors": "Sanchez|Daniela P|DP|;Brownstone|Nicholas|N|;Thibodeaux|Quinn|Q|;Reddy|Vidhatha|V|;Myers|Bridget|B|;Chan|Stephanie|S|;Bhutani|Tina|T|", "chemical_list": "D003879:Dermatologic Agents; D013739:Testosterone; D015474:Isotretinoin", "country": "United States", "delete": false, "doi": "10.36849/JDD.5400", "fulltext": null, "fulltext_license": null, "issn_linking": "1545-9616", "issue": "20(1)", "journal": "Journal of drugs in dermatology : JDD", "keywords": null, "medline_ta": "J Drugs Dermatol", "mesh_terms": "D000014:Abnormalities, Drug-Induced; D000152:Acne Vulgaris; D000328:Adult; D003879:Dermatologic Agents; D003880:Dermatology; D011307:Drug Prescriptions; D005260:Female; D005783:Gender Identity; D006801:Humans; D015474:Isotretinoin; D008297:Male; D017410:Practice Guidelines as Topic; D057829:Sex Reassignment Procedures; D013739:Testosterone; D063106:Transgender Persons", "nlm_unique_id": "101160020", "other_id": null, "pages": "106-108", "pmc": null, "pmid": "33400408", "pubdate": "2021-01-01", "publication_types": "D016421:Editorial", "references": null, "title": "Prescribing Isotretinoin for Transgender Patients: A Call to Action and Recommendations.", "title_normalized": "prescribing isotretinoin for transgender patients a call to action and recommendations" }
[ { "companynumb": "US-DRREDDYS-SPO/USA/21/0137868", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "TESTOSTERONE" }, "drugadditional": "3", ...
{ "abstract": "Mastocytosis is a heterogeneous group of diseases characterized by excessive proliferation and accumulation of mast cells--in one or more organs. The number of symptoms and clinical prognosis vary depending on the disease. One of the most severe potential outcome of mastocytosis is anaphylactic shock. Early diagnosis and identification of triggers enables education and avoidance them. We describe the case of a 31-year-old woman with systemic mastocytosis (SM) without skin symptoms with multiple anaphylactic reactions, including two severe. Systemic mastocytosis was confirmed in bone marrow and genetic studies. We identify allergic triggers: latex and cefuroxime and also other non-immunological triggers as non-steroidal anti-inflammatory drugs (NSAIDs). The patient never had any allergic reaction after Hymenoptera stings. Only one result of serum tryptase was elevated. There was a need to determine the safety of antibiotic use and anesthetic drugs before cesarean. The moment when the disease was diagnosed and triggers were identifie, helped avoid further severe reactions.", "affiliations": null, "authors": "Stobiecki|Marcin|M|;Sacha|Małgorzata|M|;Czarnobilska|Ewa|E|", "chemical_list": "D000894:Anti-Inflammatory Agents, Non-Steroidal; D002444:Cefuroxime", "country": "Poland", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0033-2240", "issue": "72(12)", "journal": "Przeglad lekarski", "keywords": null, "medline_ta": "Przegl Lek", "mesh_terms": "D000328:Adult; D000707:Anaphylaxis; D000894:Anti-Inflammatory Agents, Non-Steroidal; D002444:Cefuroxime; D004342:Drug Hypersensitivity; D005260:Female; D006801:Humans; D020315:Latex Hypersensitivity; D008415:Mastocytosis", "nlm_unique_id": "19840720R", "other_id": null, "pages": "783-6", "pmc": null, "pmid": "27024961", "pubdate": "2015", "publication_types": "D002363:Case Reports; D004740:English Abstract; D016428:Journal Article", "references": null, "title": "Anaphylaxis as part of a clinical diagnosis of mastocytosi - case demonstration.", "title_normalized": "anaphylaxis as part of a clinical diagnosis of mastocytosi case demonstration" }
[ { "companynumb": "PL-MYLANLABS-2016M1024788", "fulfillexpeditecriteria": "1", "occurcountry": "PL", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "KETOPROFEN" }, "drugadditional": null, ...
{ "abstract": "Intensified immunochemotherapy with rituximab, doxorubicin, cyclophosphamide, vindesine, bleomycin, and prednisone (R-ACVBP) improves outcomes in younger adults with diffuse large B-cell lymphomas (DLBCL) compared with R-CHOP. Due to vindesine unavailability, we assessed the safety and efficacy of replacing vindesine with vincristine in a modified R-ACVBP protocol (mR-ACVBP).\n\n\n\nThis is a retrospective study including all consecutive adult patients with newly diagnosed DLBCL who received first-line mR-ACVBP. Vindesine was replaced with vincristine 1.5 mg on days 1 and 5 of each cycle. Responders continued with published R-ACVBP consolidation. Patients with inadequate response on interim imaging were offered consolidative autologous stem cell transplantation.\n\n\n\nWe identified 56 patients with DLBCL, with a median age of 41 years (range, 21-67). Thirty-seven (66%) patients had an age-adjusted International Prognostic Index of ≥ 2. Complete response was achieved in 41 (80%) patients and partial response in 6 (12%). The most common adverse events during induction were anemia (91%), febrile neutropenia (64%; grade 4 in 46%), thrombocytopenia (39%), and mucositis (21%). Peripheral neuropathy was encountered in 7 (12%) patients (grade 3; n = 1). Two deaths from septic shock were reported in patients with initial poor performance status. After a median follow-up of 17 months, the 2-year progression-free survival and overall survival rates were 86% and 87%, respectively.\n\n\n\nThe replacement of vindesine with vincristine in mR-ACVBP seems feasible, with manageable adverse events and excellent 2-year progression-free survival. These data need validation in larger prospective trials.", "affiliations": "Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon.;Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon.;Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon.;Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon.;Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon.;Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon.;Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon.;Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon.;Hematology/Oncology Division, American University of Beirut Medical Center, Beirut, Lebanon. Electronic address: je46@aub.edu.lb.", "authors": "El Sayed|Rola|R|;El Darsa|Haidar|H|;Kort|Jeries|J|;Al Chami|Farouk|F|;Ibrahim|Ali|A|;Charafeddine|Maya|M|;Bazarbachi|Ali|A|;Abou Dalle|Iman|I|;El Cheikh|Jean|J|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1016/j.clml.2021.05.011", "fulltext": null, "fulltext_license": null, "issn_linking": "2152-2669", "issue": "21(10)", "journal": "Clinical lymphoma, myeloma & leukemia", "keywords": "DLBCL; High-grade B-cell lymphoma; R-ACVBP; Vincristine; Vindesine", "medline_ta": "Clin Lymphoma Myeloma Leuk", "mesh_terms": null, "nlm_unique_id": "101525386", "other_id": null, "pages": "711-719", "pmc": null, "pmid": "34140260", "pubdate": "2021-10", "publication_types": "D016428:Journal Article", "references": null, "title": "Safety and Efficacy of Replacing Vindesine with Vincristine in R-ACVBP Regimen for the Treatment of Large B Cell Lymphomas.", "title_normalized": "safety and efficacy of replacing vindesine with vincristine in r acvbp regimen for the treatment of large b cell lymphomas" }
[ { "companynumb": "LB-AMGEN-LBNSP2021173099", "fulfillexpeditecriteria": "2", "occurcountry": "LB", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "FILGRASTIM" }, "drugadditional": "4", ...
{ "abstract": "BACKGROUND\nGastrointestinal and extraintestinal malignancies are long-term complications in patients with inflammatory bowel disease (IBD), likely as a result of chronic inflammation and the use of immunosuppressive medications used to control inflammation. Here, we assessed the frequency of malignancies in a large tertiary IBD centre at the University Hospital Zurich.\n\n\nMETHODS\nWe performed a retrospective analysis of data from 1,026 patients from our IBD clinic treated between 2007 and 2014.\n\n\nRESULTS\nTwenty two of the 1,026 patients developed 28 cases of malignancies, 14 patients were male and 8 patients female. The median latency between IBD diagnosis and first malignancy was 13 years (range 2-27 years). Most common malignancies were non-Hodgkin lymphoma, colorectal cancer (CRC), urothelial carcinoma, cholangiocellular carcinoma (CCC) and prostate cancer. The most common tumour type in Crohn's disease patients (13/22) was lymphoma (5 cases), in ulcerative colitis patients (9/22) CCC (2 cases) and CRC (2 cases). The observed incidence of lymphoma (32.5/100,000), bladder carcinoma (21.7/100,000) and CCC (10.8/100,000) was higher than expected and known from general population. All of the patients that developed a malignancy had received immunosuppressive therapy. Compared to a cohort of 927 IBD patients without malignancies there were no statistical differences regarding gender, antibodies targeting tumour necrosis factor and thiopurine use.\n\n\nCONCLUSIONS\nOur data support the assumption that a long-standing disease course and immunosuppressive therapy increase the risk for developing malignancies in IBD patients.", "affiliations": "Division of Gastroenterology and Hepatology, Kantonsspital St. Gallen, St. Gallen, Switzerland.", "authors": "Madanchi|Mehdi|M|;Zeitz|Jonas|J|;Barthel|Christiane|C|;Samaras|Panagiotis|P|;Scharl|Sylvie|S|;Sulz|Michael C|MC|;Biedermann|Luc|L|;Frei|Pascal|P|;Vavricka|Stephan R|SR|;Rogler|Gerhard|G|;Scharl|Michael|M|", "chemical_list": "D007166:Immunosuppressive Agents", "country": "Switzerland", "delete": false, "doi": "10.1159/000447259", "fulltext": null, "fulltext_license": null, "issn_linking": "0012-2823", "issue": "94(1)", "journal": "Digestion", "keywords": null, "medline_ta": "Digestion", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D001650:Bile Duct Neoplasms; D002295:Carcinoma, Transitional Cell; D018281:Cholangiocarcinoma; D015179:Colorectal Neoplasms; D005260:Female; D006801:Humans; D007166:Immunosuppressive Agents; D015994:Incidence; D015212:Inflammatory Bowel Diseases; D008228:Lymphoma, Non-Hodgkin; D008297:Male; D008875:Middle Aged; D011471:Prostatic Neoplasms; D012189:Retrospective Studies; D012307:Risk Factors; D013557:Switzerland; D001749:Urinary Bladder Neoplasms; D055815:Young Adult", "nlm_unique_id": "0150472", "other_id": null, "pages": "1-8", "pmc": null, "pmid": "27318857", "pubdate": "2016", "publication_types": "D016428:Journal Article", "references": null, "title": "Malignancies in Patients with Inflammatory Bowel Disease: A Single-Centre Experience.", "title_normalized": "malignancies in patients with inflammatory bowel disease a single centre experience" }
[ { "companynumb": "CH-TEVA-766778ROM", "fulfillexpeditecriteria": "1", "occurcountry": "CH", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "AZATHIOPRINE" }, "drugadditional": null, "d...
{ "abstract": "OBJECTIVE\nFingolimod is a sphingosine 1-phosphate receptor modulator, which sequesters lymphocytes in lymph nodes and prevents them from entering the central nervous system. There have been increasing reports of severe rebounds with tumefactive demyelinatinglesions (TDLs) in patients with multiple sclerosis under fingolimod treatment, as well as following therapy discontinuation. Our objective is to review the clinico-radiological characteristics of patients with TDLs associated with fingolimod.\n\n\nMETHODS\nRetrospective review of medical records of MS patients from our center, who were treated with fingolimod and developed TDLs. We review the literature.\n\n\nRESULTS\nWe found 5 cases: 4 developed TDLs as rebounds after treatment cessation and 1 under treatment. The 4 rebound cases were women, with a mean age of 34.7 years (SD = 3.6) and a mean disease duration of 10.2 years (SD = 4.1). The mean duration of fingolimod treatment before discontinuation was 36.2 months (SD = 22.4) and the mean time lapse between treatment withdrawal and rebound was 9.75 weeks (SD = 7.4). The total pre-rebound lymphocyte count (cells/mm3) was 482.5 (SD = 325.7) and1017.5 (SD = 364.8) during rebound. The TDL patient under fingolimod was a 36-year-old man who had been on fingolimod for 32 months after switching from glatiramer acetate. TDLs were multiple in 2 cases and solitary in 3. Acute treatment for rebound included high dose steroids (5/5), plasma exchange (3/5) and rituximab (2/5). Treatment after fingolimod included rituximab (2/5), alemtuzumab (2/5) and glatiramer acetate (1/5).\n\n\nCONCLUSIONS\nOur study, along with similar reports in literature, highlights the need for close monitoring in patients who plan to switch from fingolimod to other treatments because of the risk of severe rebound. The etiopathogenic association between fingolimod and TDLs is not clear, but given the increasing reports of cases it should be taken into account for treatment selection in patients with this type of lesions.", "affiliations": "Demyelinating Disorders Unit, Neurology Department, Hospital Universitario de La Princesa, Madrid. Instituto de Investigación Sanitaria La Princesa, Spain. Electronic address: pedro.sanchez.lopez.med@gmail.com.;Demyelinating Disorders Unit, Neurology Department, Hospital Universitario de La Princesa, Madrid. Instituto de Investigación Sanitaria La Princesa, Spain.;Demyelinating Disorders Unit, Neurology Department, Hospital Universitario de La Princesa, Madrid. Instituto de Investigación Sanitaria La Princesa, Spain.", "authors": "Sánchez|Pedro|P|;Meca-Lallana|Virginia|V|;Vivancos|José|J|", "chemical_list": "D007166:Immunosuppressive Agents; D000068717:Glatiramer Acetate; D000068876:Fingolimod Hydrochloride", "country": "Netherlands", "delete": false, "doi": "10.1016/j.msard.2018.07.001", "fulltext": null, "fulltext_license": null, "issn_linking": "2211-0348", "issue": "25()", "journal": "Multiple sclerosis and related disorders", "keywords": "Fingolimod; Rebound; Tumefactive", "medline_ta": "Mult Scler Relat Disord", "mesh_terms": "D000328:Adult; D004185:Disability Evaluation; D005260:Female; D000068876:Fingolimod Hydrochloride; D000068717:Glatiramer Acetate; D006801:Humans; D007166:Immunosuppressive Agents; D008279:Magnetic Resonance Imaging; D009103:Multiple Sclerosis; D010951:Plasma Exchange; D012189:Retrospective Studies", "nlm_unique_id": "101580247", "other_id": null, "pages": "95-98", "pmc": null, "pmid": "30056362", "pubdate": "2018-10", "publication_types": "D016428:Journal Article", "references": null, "title": "Tumefactive multiple sclerosis lesions associated with fingolimod treatment: Report of 5 cases.", "title_normalized": "tumefactive multiple sclerosis lesions associated with fingolimod treatment report of 5 cases" }
[ { "companynumb": "PHHY2017ES180058", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "FINGOLIMOD HYDROCHLORIDE" }, "drugadditional": null, ...
{ "abstract": "Immune checkpoint inhibitors (ICI) eliminate cancer cells through release of inhibition of cytotoxic CD8+ lymphocytes. Potent systemic activation of immune cells provides unprecedented efficacy in some types of advanced cancer therapy, but also often induces serious immune related adverse events (irAEs) that can be devastating if not promptly identified and properly managed. Herein, we describe the case of multiple major irAEs manifesting after administration of combination ICI therapy in a patient with vaginal melanoma.Case:A 54-year-old, G2P0 woman with recurrent metastatic vaginal melanoma, following three doses of combination nivolumab-ipilimumab immunotherapy, presented for admission at our tertiary care center for the work-up of sudden-onset of colitis of unknown etiology. Prior to admission at our facility, the patient was diagnosed with a severe maculopapular rash, headaches and hyponatremia in the weeks immediately following initiation of therapy. During work up of the colitis, infectious etiologies were ruled out, and the patient was discharged on a steroid taper for treatment of presumed immune-related colitis. Consideration of salt-supplement resistant hyponatremia with new onset frontal headache in the setting of immune-related colitis indicated possible hypophysitis. With high suspicion for multiple high grade irAEs, ICI was discontinued, and the patient was given high dose intravenous steroids prior to discharge with a prednisone dose taper for outpatient management. After control of irAEs was achieved, ipilimumab therapy was subsequently discontinued to minimize the chance of recurrent irAEs, yet nivolumab monotherapy was resumed in an attempt to control disease progression that could occur in with iatrogenic immunosuppression.\nICIs have demonstrated the ability to induce improved long-term survival in metastatic cutaneous or mucosal melanomas, including those of gynecologic origin. As ICI therapy becomes more widespread, healthcare providers across all fields of medicine need be vigilant to recognize the symptoms of irAEs that can often masquerade as common illnesses to prevent potentially dangerous irreversible immune toxicities.", "affiliations": "University of Alabama at Birmingham, School of Medicine. Birmingham, AL, United States.;University of Alabama at Birmingham, School of Medicine. Birmingham, AL, United States.;University of Alabama at Birmingham, Department of Obstetrics and Gynecology, Birmingham, Division of Gynecology Oncology. Birmingham, AL, United States.", "authors": "Norwood|T Graham|TG|;Wang|Michelle J|MJ|;Huh|Warner K|WK|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.gore.2019.100508", "fulltext": "\n==== Front\nGynecol Oncol RepGynecol Oncol RepGynecologic Oncology Reports2352-5789Elsevier S2352-5789(19)30097-910.1016/j.gore.2019.100508100508Case ReportCombination checkpoint inhibitor therapy induces multiple immune major related adverse events in the treatment of vaginal melanoma: A cautionary case report Norwood T. Graham aWang Michelle J. a1Huh Warner K. whuh@uabmc.edub⁎a University of Alabama at Birmingham, School of Medicine. Birmingham, AL, United Statesb University of Alabama at Birmingham, Department of Obstetrics and Gynecology, Birmingham, Division of Gynecology Oncology. Birmingham, AL, United States⁎ Corresponding author: Department of Obstetrics and Gynecology, Division of Gynecology Oncology, University of Alabama at Birmingham, 619 19th Street South, Birmingham, AL 35233, United States. whuh@uabmc.edu1 Present Address: Boston Medical Center, Department of Obstetrics & Gynecology. Boston, MA, United States.\n\n31 10 2019 11 2019 31 10 2019 30 1005082 8 2019 3 10 2019 7 10 2019 © 2019 Published by Elsevier Inc.2019This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).Highlights\n• As more ICIs are approved, better education is needed for patients and providers.\n\n• Major irAEs, signs of worsening immune toxicity, can present with benign symptoms.\n\n• IrAEs should be considered when patients on ICIs present with new symptoms.\n\n• Patients on ICIs may present to a variety of healthcare settings with irAEs.\n\n• Providers should be educated on basic work-up and treatment options for irAEs.\n\n\n\nBackground\nImmune checkpoint inhibitors (ICI) eliminate cancer cells through release of inhibition of cytotoxic CD8+ lymphocytes. Potent systemic activation of immune cells provides unprecedented efficacy in some types of advanced cancer therapy, but also often induces serious immune related adverse events (irAEs) that can be devastating if not promptly identified and properly managed. Herein, we describe the case of multiple major irAEs manifesting after administration of combination ICI therapy in a patient with vaginal melanoma.\n\nCase:\n\nA 54-year-old, G2P0 woman with recurrent metastatic vaginal melanoma, following three doses of combination nivolumab-ipilimumab immunotherapy, presented for admission at our tertiary care center for the work-up of sudden-onset of colitis of unknown etiology. Prior to admission at our facility, the patient was diagnosed with a severe maculopapular rash, headaches and hyponatremia in the weeks immediately following initiation of therapy. During work up of the colitis, infectious etiologies were ruled out, and the patient was discharged on a steroid taper for treatment of presumed immune-related colitis. Consideration of salt-supplement resistant hyponatremia with new onset frontal headache in the setting of immune-related colitis indicated possible hypophysitis. With high suspicion for multiple high grade irAEs, ICI was discontinued, and the patient was given high dose intravenous steroids prior to discharge with a prednisone dose taper for outpatient management. After control of irAEs was achieved, ipilimumab therapy was subsequently discontinued to minimize the chance of recurrent irAEs, yet nivolumab monotherapy was resumed in an attempt to control disease progression that could occur in with iatrogenic immunosuppression.\n\nConclusion\nICIs have demonstrated the ability to induce improved long-term survival in metastatic cutaneous or mucosal melanomas, including those of gynecologic origin. As ICI therapy becomes more widespread, healthcare providers across all fields of medicine need be vigilant to recognize the symptoms of irAEs that can often masquerade as common illnesses to prevent potentially dangerous irreversible immune toxicities.\n\nKeywords\nImmunotherapyImmune toxicityImmune-related adverse eventsMelanoma\n==== Body\n1 Introduction\nThe development of immunotherapeutic agents that utilize immune cells to recognize and destroy malignant cells has markedly expanded the frontiers of cancer therapy in the past decade (Rusch et al., 2018). One class of these agents, Immune Checkpoint Inhibitors (ICIs), target tumor antigens via monoclonal antibody-mediated activation of T cells. ICIs have demonstrated durable responses and increased long-term survival in advanced malignancies such as metastatic melanoma (Rusch et al., 2018, Simsek et al., 2018) However, ICIs are also associated with immune-related adverse events (irAEs) caused by the systemic activation of cytotoxic lymphocytes aberrantly targeting healthy tissues (Harris et al., 2016).\n\nWe report the case of a patient with metastatic vaginal melanoma with three consecutive high-grade irAEs and discuss the importance of prompt identification and management to prevent serious immunotherapy-related sequelae. The patient gave written informed consent to publish the following case.\n\n2 Case\nA 54-year-old, G2P0 female with locoregional metastatic melanoma of the vagina who had received three doses of combination ICI immunotherapy presented for admission at our tertiary care center in February of 2019 for severe colitis. Past medical history was significant for morbid obesity, hypertension, type 2 diabetes mellitus, hyperlipidemia, a remote history of smoking with no history of abnormal pap smears. Family oncological history was significant for ovarian cancer in her maternal grandmother. No further risk factors nor environmental exposures were noted.\n\nThe patient was diagnosed in 2016 with vaginal melanoma via an in-office biopsy by her primary gynecologist (Table 1). She was then referred to our institution for evaluation by gynecologic oncology. Pathology from a 2-centimeter vaginal wall mass resected by our team confirmed metastatic melanoma with tumor-free margins. The patient was referred to a melanoma specialty clinic for further evaluation, after which we decided to co-manage care and monitor with regular clinic visits and serial imaging.Table 1 Timeline of irAEs for six months after initiation of combination ICI therapy for vaginal melanoma after initiation demonstrating severe and varied diagnoses.\n\nDate\tEvent\tTrigger\tToxicity Grade*\tInitial Diagnosis\tAssociated irAE\tWork-Up/Treatment\tResponse to Treatment\t\nDecember 5, 2018\tipi/nivo #1**\n- ipi: 450 mg;250 mL NS\n- nivo:140 mg;50 mL NS\n\tRash\tGrade III\tir Rash\tir Rash\tTopical Cream/PO Hydroxyzine\tComplete\t\nDecember 26, 2018\tipi/nivo #2\n- ipi: 450 mg;250 mL NS\n- nivo:140 mg;50 mL NS\n\tHeadache\tGrade II\tComplicated Migraine\tir Hypophysitis\tFioricet\tModerate\t\nJanuary\n16, 2019\tipi/nivo #3\n- ipi: 450 mg;250 mL NS\n- nivo:140 mg;50 mL NS\n\tHyponatremia\tGrade II\tIsolated Hyponatremia 2/2 Dehydration\tir Hypophysitis\t1 L NS; Salt Tabs\tMinimal\t\nJanuary\n16, 2019\tipi/nivo #3\n- ipi: 450 mg;250 mL NS\n- nivo:140 mg;50 mL NS\n\tPersistent Hyponatremia/Possible Hypophysitis\tGrade II\tir Abnormality\tir Hypophysitis\tLaboratory Values;\nSteroid Taper\tModerate\t\nFebruary\n6, 2019\tHospital Admission\tColitis #1\tGrade II\tir Colitis\tir Colitis\tSteroid Taper\tMinimal\t\nFebruary 15, 2019\tHospital Re-Admission\tColitis #2\tGrade II\tCommunity-Acquired vs. Nosocomial Gastroenteritis\tir Colitis\tC. Diff panel, Steroid Taper\tComplete;\nHyperglycemia 2/2 Steroid Treatments\t\nCommon Terminology Criteria for Adverse Events (CTCAE): (Accessed on September 26, 2019).\n\nSERVICES., U.S.D.O.H.A.H., Common Terminology Criteria for Adverse Events (CTCAE) Version 5. 2010. https://ctep.cancer.gov/protocoldevelopment/electronic_applications/docs/CTCAE_v5_Quick_Reference_8.5x11.pdf.\n\n* Toxicity Grade: The toxicities were graded utilizing the National Institute of Health’s Common Terminology Criteria for Adverse Events (CTCAE) system for grading AE. These were graded retrospectively as only the toxicity grade of the rash was documented in the electronic medical record charts for the patient. Grade II headache is for headaches with moderate pain that limit instrumental ADLs. Grade II hyponatremia (if graded as isolated hyponatremia alone) for Na between 125 and 129 with no symptoms. Grade II Hypophysitis for local or noninvasive intervention indicating limits only to age-appropriate instrumental ADLs. Grade II colitis for colitis associated with abdominal pain and/or blood or mucus in the stool.\n\n** Ipilimumab was dosed with weight-based dosing at 3 mg/kg and Nivolumab was dosed at 1 mg/kg\n\n\n\nOver the next two years, the patient denied new symptoms and imaging had no evidence of new disease. However, in September of 2018, three days of vaginal bleeding prompted further investigation. Though serial CT scans had not demonstrated evidence of new disease, pelvic exam revealed a new right vaginal sidewall mass. A biopsy from the succeeding exam under anesthesia confirmed melanoma recurrence.\n\nCombination ICI therapy with programmed cell death 1 (PD-1) inhibitor, nivolumab (nivo), and cytotoxic T-lymphocyte-associated protein 4 (CTLA4) inhibitor, ipilimumab (ipi), was initiated for systemic control. Throughout the treatment course, the patient received two doses of ipi/nivo in December 2018 and one dose in January 2019.\n\n2.1 Rash\nThe day after first dose of ipi/nivo, the patient developed a tender erythematous maculopapular rash on the lower extremities that spread to the upper extremities and face. This rash mildly improved with topical triamcinolone 0.1% and oral hydroxyzine but persisted; upon re-evaluation prior to immunotherapy dose 3, it was retrospectively diagnosed as a grade III dermatitis likely secondary to ICI therapy. She was initiated on an 80 mg prednisone taper with a 20 mg/week reduction in dosage for 4 weeks and referred to dermatology for further evaluation.\n\n2.2 Headache\nFollowing her second dose of ipi/nivo, the patient experience new-onset frontal headaches and fatigue. Initially, headaches were an 8/10 on a subjective pain scale; after initiating Fioricet (Acetaminophen-Butalbital-Caffeine) every four hours as needed for severe headaches, her pain decreased to a 3–4/10. She simultaneously endorsed intermittent fatigue, but denied any visual changes, nausea or vomiting.\n\n2.3 Hyponatremia\nPrior to receiving the third dose of ipi/nivo, reconsideration of the dermatitis as an irAE prompted further work up, including a basic metabolic panel revealing a sodium level of 129 mEq/L. Conservative management with daily supplementation of 2 g of oral sodium tablets was initiated with plan for repeating serum sodium levels one week later in clinic. The patient was, however, subsequently admitted to the hospital.\n\n2.4 Colitis\nFollowing the third dose of ipi/nivo, the patient experienced two-weeks of profuse diarrhea refractory to over-the-counter antidiarrheals and was admitted for further work up and management. The patient described 5–10 daily episodes of watery, non-bloody diarrhea with mild abdominal cramping. She denied fever, chills, nausea, exposure to sick contacts or recent antibiotic use. At the time of admission, the patient was completing the last week of her dermatitis-related steroid taper; she was re-initiated on a prednisone dosage of 80 mg (planned taper by 20 mg/week) to treat presumed immunotherapy-related colitis (irC). Following treatment initiation, the patient had three loose stools before resolution of diarrhea.\n\n2.5 Hypophysitis\nDuring the first hospital admission, the patient’s refractory hyponatremia was further investigated. Laboratory work-up demonstrated persistent hyponatremia (sodium, 128mEQ/L) despite sodium supplementation, hypothyroidism with a low thyroid stimulating hormone level of 0.087 mU/l and low thyroxine of 0.82 mU/l, and hypogonadism with both follicle-stimulating hormone (8.3 IU/L) and luteinizing hormone (2.4 IU/L) at significantly low levels for a post-menopausal woman. These laboratory findings paired with clinical symptoms of headache and fatigue strongly suggested immune-related hypophysitis (irH). As irC and irH are managed with similar steroid courses, we made no adjustments to her planned steroid taper (Nagai and Muto, 2018).\n\n2.6 Recurrence of colitis\nNine days following discharge from her initial admission, the patient presented to an outside hospital reporting one week of copious diarrhea. The patient was transferred to our institution, where she continued to have diarrhea with severe crampy abdominal pain and intermittent frank bright red blood per rectum as well as nausea, dizziness, decreased appetite and intake. After admission, diarrhea decreased to 4–5 episodes daily, but fatigue and discomfort persisted. A stool sample was negative for Clostridium difficile. Initiation of IV methylprednisolone (2 mg/kg) lead to resolution of symptoms, and on hospital day four, patient was deemed stable for discharge home with a prednisone taper (initial dose 120 mg with 20 mg/week reduction in dosage). Follow-up was scheduled with her primary care physician to review a blood glucose log as the patient developed hyperglycemia.\n\n2.7 Therapy adjustment\nAt her most recent follow-up appointment, the patient reported persistent mild vaginal bleeding and discharge, but noted resolution of symptoms suggesting irAEs. Imaging and physical exams since hospital discharge has demonstrated stable disease with no evidence of new metastases. The amended treatment plan at time of publication was to discontinue ipilimumab and continue with biweekly nivolumab monotherapy.\n\n3 Discussion\nThis patient initially presented to our institution for inpatient admission for the work-up and treatment of colitis. Hospital admission allowed for ample opportunity to consider the full cohort of clinical symptoms since the initiation of ipi/nivo therapy. Synthesizing the symptoms of headache, fatigue, and salt supplementation-refractory hyponatremia (previously documented and treated as isolated non-immune events) with new confirmatory laboratory findings, we diagnosed and treated our patient for irC and irH. This case demonstrates the importance of educating providers about distinct toxicity profiles of immunotherapy treatments; despite unassuming initial clinical presentations, irAEs can have potentially serious irreversible downstream sequelae (Harris et al., 2016, Nagai and Muto, 2018).\n\nDespite increased efficacy with combination nivolumab and ipilimumab compared to monotherapy, studies have consistently correlated ICIs with high rates of irAEs in patients receiving anti-PD1 (10–20%), anti- CTLA4 monotherapy (30%), and combination therapy (55–60%) (Harris et al., 2016, Zhou et al., 2019). Such adverse events can manifest as dermatitis, colitis, hypophysitis, hepatitis, pneumonitis, nephritis and myocarditis (Harris et al., 2016, Zhou et al., 2019, Solinas et al., 2018). Of the many possible immune-related adverse events, often the most insidious are endocrine irAEs as they can be a sign of irreversible immune toxicity that may require long-term hormone supplementation (Solinas et al., 2018, Weber et al., 2012). IrH and other endocrine irAEs are often asymptomatic or present with nonspecific, mild-grade symptoms (Solinas et al., 2018). The most commonly reported clinical symptoms associated with irH are headache, fatigue, confusion, weakness and hyponatremia (Solinas et al., 2018). These symptoms can result from non-immune etiologies such as disease burden, prior chemotherapy treatments, benign tension headaches, or simple dehydration.\n\nAlthough irAE therapy recommendations have not been strictly established, ICI therapy is typically held and patients are admitted for high-dose intravenous steroid treatment with a subsequent oral steroid taper (Harris et al., 2016, Weber et al., 2012, Puzanov et al., 2017). Providers can consider treatment with biologic monoclonal antibody (infliximab) for steroid non-responsive adverse events (Puzanov et al., 2017). Further management and resumption of ICI therapy should be determined by the nature of the irAE (i.e pituitary hormone replacement for hypophysitis) and response to treatment. Patients should also be monitored for irAE symptom relapses with regular outpatient follow-up (Weber et al., 2012).\n\nAs symptoms of irAEs often masquerade as common illnesses and patients receiving ICI therapy may not always present directly to their specialists for evaluation, irAEs may be unknowingly written off and treated symptomatically with minimal work-up. The recognition and management of irAEs in patients receiving ICI therapy hinges on the ability of healthcare providers to identify at-risk patients (Harris et al., 2016, Weber et al., 2012). Historically, gynecologists and gynecologic oncologists have had limited exposure to ICIs as primary mucosal melanomas of gynecologic origin are rare (Shiavone et al., 2016). However, multiple current clinical trials are elucidating the role of ICI as they continue to be approved as valid options for treating a multitude of malignancies (Castellano et al., 2018). Increasing education about clinical triggers for the work-up of irAEs is thus critically important for all providers who could be the first clinical touchpoint for patients (Weber et al., 2012).\n\n4 Conclusion\nFor patients for whom ICI therapy may be indicated, we recommend that both patients and healthcare providers be educated prior to initiation on the breadth of presentation of immune-toxicities and common treatment recommendations of irAEs.\n\nAuthor contributions\n\nT. Graham Norwood contributed to the clinical management of the patient, the gathering of data, the review of existing literature and the writing and editing of the manuscript.\n\nMichelle J. Wang contributed to the clinical management of the patient, the gathering of data, the review of existing literature and the writing and editing of the manuscript.\n\nWarner K. Huh contributed to the clinical management of the patient, the gathering of data, the review of existing literature and the writing and editing of the manuscript.\n\nDeclaration of Competing Interest\nThe authors have no conflicts of interest to declare.\n==== Refs\nReferences\nCastellano T. Moore K.N. Holman L.L. An overview of immune checkpoint inhibitors in gynecologic cancers Clin. Therap. 40 3 2018 372 388 29530456 \nHarris S.J. Brown J. Lopez J. Yap T.A. Immuno-oncology combinations: raising the tail of the survival curve Cancer Biol. Med. 13 2 2016 171 193 27458526 \nNagai H. Muto Manabu Optimal management of immune-related adverse events resulting from treatment with immune checkpoint inhibitors: a review and update Int. J. Clin. Oncol. 23 2018 410 420 29516216 \nPuzanov I. Diab A. Abdallah K. Managing toxicities associated with immune checkpoint inhibitors: consensus recommendations from the Society for Immunotherapy of Cancer (SITC) Toxicity Management Working Group J. Immunother. Cancer 5 1 2017 95 29162153 \nRusch T. Bayry J. Werner J. Shevchenko I. Bazhin A. Immunotherapy as an Option for Cancer Treatment Arch. Immunol. Ther. Exp. 66 2018 89 96 \nShiavone M.B. Broach V. Shoushtari A.N. Carvajal R.D. Alektiar K. Kollmeier M.A. Abu-Rustum N.R. Leitao M.M. Combined immunotherapy and radiation for treatment of mucosal melanomas of the lower genital tract Gynecol. Oncol. Reports 16 2016 42 46 \nSimsek M. Tekin S.B. Bilici M. Immunological agents used in cancer treatment Eurasian J. Med. 51 1 2018 90 94 30911265 \nSolinas C. Porcu M. De Silva P. Musi M. Aspeslagh S. Scartozzi M. Willard-Gallo K. Mariotti S. Saba L. Cancer immunotherapy-associated hypophysitis Seminars Oncol. 45 2018 181 186 \nWeber J.S. Kahler K.C. Hauschild A. Management of immune-related adverse events and kinetics of response with ipilimumab J. Clin. Oncol. 21 2012 2691 2697 \nZhou S. Khanal S. Zhang H. Risk of immune-related adverse events associated with ipilimumab-plus-nivolumab and nivolumab therapy in cancer patients Ther. Clin. Risk Manag. 15 2019 211 221 30774357\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2352-5789", "issue": "30()", "journal": "Gynecologic oncology reports", "keywords": "Immune toxicity; Immune-related adverse events; Immunotherapy; Melanoma", "medline_ta": "Gynecol Oncol Rep", "mesh_terms": null, "nlm_unique_id": "101652231", "other_id": null, "pages": "100508", "pmc": null, "pmid": "31737773", "pubdate": "2019-11", "publication_types": "D002363:Case Reports", "references": "30774357;30911265;29026920;27458526;27331137;29516216;29530456;30352754;29162153;22614989", "title": "Combination checkpoint inhibitor therapy induces multiple immune major related adverse events in the treatment of vaginal melanoma: A cautionary case report.", "title_normalized": "combination checkpoint inhibitor therapy induces multiple immune major related adverse events in the treatment of vaginal melanoma a cautionary case report" }
[ { "companynumb": "US-BRISTOL-MYERS SQUIBB COMPANY-BMS-2019-113574", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "NIVOLUMAB" }, "drugaddi...
{ "abstract": "A 55-year-old Caucasian woman with lung adenocarcinoma stage IV presented with repeated relapse after treatment with cytotoxic chemotherapy (carboplatin, gemcitabine, docetaxel, pemetrexed) and targeted agents (erlotinib, cetuximab, sunitinib). Comprehensive molecular diagnostics (EGFR-, ALK-, RAS-, BRAF-, PIK3CA-, HER2- and DDR2-aberrations) were performed and failed initially to detect any driver mutation. While the patient suffered from rapid deterioration of her general condition, in particular from progressive dyspnea due to lung metastases, we implemented screening for RET- and ROS1 translocations into our molecular diagnostic program based on recent reports of these new molecular subgroups in lung adenocarcinoma. On retesting the patient's tumor sample was found to harbor a ROS1-translocation. The patient was subsequently treated with crizotinib and experienced a pronounced clinical improvement corresponding to a complete metabolic response in (18)F-FDG-PET and a good and confirmed partial response in CT (RECIST 1.1). Our case exemplifies the need for rapid implementation of newly discovered rare genetic lung cancer subtypes in routine molecular diagnostics.", "affiliations": "Department I of Internal Medicine, Center for Integrated Oncology Köln-Bonn, University Hospital Cologne, Cologne, Germany.", "authors": "Bos|M|M|;Gardizi|M|M|;Schildhaus|H U|HU|;Heukamp|L C|LC|;Geist|T|T|;Kaminsky|B|B|;Zander|T|T|;Nogova|L|L|;Scheffler|M|M|;Dietlein|M|M|;Kobe|C|C|;Holstein|A|A|;Maintz|D|D|;Büttner|R|R|;Wolf|J|J|", "chemical_list": "D047428:Protein Kinase Inhibitors; D011518:Proto-Oncogene Proteins; D011720:Pyrazoles; D011725:Pyridines; D000077547:Crizotinib; D011505:Protein-Tyrosine Kinases; C062333:ROS1 protein, human", "country": "Ireland", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0169-5002", "issue": "81(1)", "journal": "Lung cancer (Amsterdam, Netherlands)", "keywords": null, "medline_ta": "Lung Cancer", "mesh_terms": "D000230:Adenocarcinoma; D000077192:Adenocarcinoma of Lung; D000971:Antineoplastic Combined Chemotherapy Protocols; D002289:Carcinoma, Non-Small-Cell Lung; D000077547:Crizotinib; D005260:Female; D015321:Gene Rearrangement; D016161:Genes, Retinoblastoma; D006801:Humans; D008175:Lung Neoplasms; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D047428:Protein Kinase Inhibitors; D011505:Protein-Tyrosine Kinases; D011518:Proto-Oncogene Proteins; D011720:Pyrazoles; D011725:Pyridines; D016896:Treatment Outcome", "nlm_unique_id": "8800805", "other_id": null, "pages": "142-3", "pmc": null, "pmid": "23558310", "pubdate": "2013-07", "publication_types": "D002363:Case Reports; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Complete metabolic response in a patient with repeatedly relapsed non-small cell lung cancer harboring ROS1 gene rearrangement after treatment with crizotinib.", "title_normalized": "complete metabolic response in a patient with repeatedly relapsed non small cell lung cancer harboring ros1 gene rearrangement after treatment with crizotinib" }
[ { "companynumb": "DE-CIPLA LTD.-2018DE10156", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CETUXIMAB" }, "drugadditional": "3", ...
{ "abstract": "BACKGROUND\nNatalizumab, a treatment used in multiple sclerosis (MS), is associated with cases of progressive multifocal leukoencephalopathy (PML).\n\n\nOBJECTIVE\nWe describe two cases of PML in related but not genetically apparented natalizumab-treated MS patients who are stepsisters. Reported cases/outcomes: While Patient 1 developed PML, Patient 2 was on natalizumab and had contacts with Patient 1. Patient 2 was diagnosed with PML 5 months after Patient 1.\n\n\nCONCLUSIONS\nThe clinical and temporal data highly suggest that there was JC virus (JCV) transmission from one patient to the other with development of PML as primo-infection in Patient 2.", "affiliations": "Laboratory of Neuroimmunology, Service of Neurology, Department of Clinical Neurosciences, CHUV, Lausanne, Switzerland.;Laboratory of Neuroimmunology, Service of Neurology, Department of Clinical Neurosciences, CHUV, Lausanne, Switzerland.;Laboratory of Neuroimmunology, Service of Neurology, Department of Clinical Neurosciences, CHUV, Lausanne, Switzerland.;Laboratory of Neuroimmunology, Service of Neurology, Department of Clinical Neurosciences, CHUV, Lausanne, Switzerland.", "authors": "Bacchetta|Frédéric|F|;Mathias|Amandine|A|;Schluep|Myriam|M|;Du Pasquier|Renaud|R|", "chemical_list": "D061067:Antibodies, Monoclonal, Humanized; D000914:Antibodies, Viral; D000069442:Natalizumab", "country": "England", "delete": false, "doi": "10.1177/1352458516670734", "fulltext": null, "fulltext_license": null, "issn_linking": "1352-4585", "issue": "23(2)", "journal": "Multiple sclerosis (Houndmills, Basingstoke, England)", "keywords": "JC virus; Natalizumab; multiple sclerosis; progressive multifocal leukoencephalopathy; transmission", "medline_ta": "Mult Scler", "mesh_terms": "D061067:Antibodies, Monoclonal, Humanized; D000914:Antibodies, Viral; D001921:Brain; D005260:Female; D006801:Humans; D007577:JC Virus; D007968:Leukoencephalopathy, Progressive Multifocal; D008875:Middle Aged; D009103:Multiple Sclerosis; D000069442:Natalizumab", "nlm_unique_id": "9509185", "other_id": null, "pages": "300-303", "pmc": null, "pmid": "28165319", "pubdate": "2017-02", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Progressive multifocal leukoencephalopathy in two natalizumab-treated stepsisters: An intriguing coincidence.", "title_normalized": "progressive multifocal leukoencephalopathy in two natalizumab treated stepsisters an intriguing coincidence" }
[ { "companynumb": "CH-BIOGEN-2010BI001833", "fulfillexpeditecriteria": "1", "occurcountry": "CH", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "NATALIZUMAB" }, "drugadditional": "1", ...
{ "abstract": "OBJECTIVE\nGastrointestinal (GI) adverse effects have been reported with oral bisphosphonate formulations and are the primary adverse effects influencing their tolerability. New intermittent formulations, including intravenous (IV) ibandronate, may increase compliance and decrease the rate of GI adverse effects. We describe a 67-year-old woman with a 2-day history of hematemesis and melena 1 week after administration of IV ibandronate.\n\n\nCONCLUSIONS\nThe patient was initially stable but began to develop a small bowel obstruction for which a nasogastric (NG) tube was placed. During placement of the NG tube, the patient vomited and aspirated. Due to continued nausea and vomiting with the NG tube and shortness of breath, the patient was intubated and an orogastric tube was placed. Despite the use of a ventilator, the patient's blood pressure and oxygen saturation began to fall. Even with the use of mechanical ventilation and 3 pressors, her condition deteriorated, she was made DNR/DNI (do not resuscitate or intubate) and subsequently expired. The Naranjo adverse drug reaction score was 2, indicating a possible association between GI bleed and IV ibandronate. The exact mechanism of this is not known.\n\n\nCONCLUSIONS\nClinicians should be aware of this possible adverse effect and monitor high-risk patients for bleeding when administering IV bisphosphonates.", "affiliations": "Buffalo General Hospital, Buffalo, New York, NY, USA. necieri@yahoo.com", "authors": "Cieri|Nicole E|NE|;Seyse|Stephanie J|SJ|", "chemical_list": "D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D000077557:Ibandronic Acid", "country": "United States", "delete": false, "doi": "10.1177/0897190012442224", "fulltext": null, "fulltext_license": null, "issn_linking": "0897-1900", "issue": "25(3)", "journal": "Journal of pharmacy practice", "keywords": null, "medline_ta": "J Pharm Pract", "mesh_terms": "D000368:Aged; D050071:Bone Density Conservation Agents; D004164:Diphosphonates; D017809:Fatal Outcome; D005260:Female; D006471:Gastrointestinal Hemorrhage; D006801:Humans; D000077557:Ibandronic Acid; D007262:Infusions, Intravenous", "nlm_unique_id": "8900945", "other_id": null, "pages": "396-9", "pmc": null, "pmid": "22544618", "pubdate": "2012-06", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Gastrointestinal bleeding following intravenous ibandronate administration.", "title_normalized": "gastrointestinal bleeding following intravenous ibandronate administration" }
[ { "companynumb": "US-BAYER-2020-013627", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ASPIRIN" }, "drugadditional": null, "dr...
{ "abstract": "Olaparib combined with paclitaxel has previously shown a significant improvement in overall survival versus placebo plus paclitaxel as second-line therapy in a phase 2 study in Asian patients with advanced gastric cancer, especially in those with ataxia-telangiectasia mutated protein (ATM)-negative tumours. Here, we report the primary efficacy and safety analyses from a subsequent phase 3 trial.\n\n\n\nThis double-blind, randomised, placebo-controlled, phase 3 study (GOLD) recruited Asian patients aged 18 years or older (≥20 years if Japanese) with advanced gastric cancer that had progressed following, or during, first-line chemotherapy. Patients were randomly assigned (1:1) to receive oral olaparib (100 mg twice daily) plus paclitaxel (80 mg/m2 intravenously) or matching placebo plus paclitaxel. Randomisation was done through an interactive voice response system and no stratification factors were used. Patients and investigators were masked to treatment allocation. Two co-primary populations were assessed: the overall population of all patients and patients whose tumours were ATM-negative (identified after randomisation, before the data cutoff date, March 28, 2016). The primary endpoint in both populations was overall survival (defined as the time from the date of randomisation until death from any cause before data cutoff); a significant difference was defined as p<0·025. Efficacy was assessed in the intention-to-treat populations and safety in patients who received at least one dose of treatment. This trial is registered with ClinicalTrials.gov, number NCT01924533 (study ID, D081BC00004), and is ongoing but no longer recruiting participants.\n\n\n\nBetween Sept 3, 2013, and March 28, 2016, 643 patients were enrolled from 58 study sites in hospitals and medical centres in China, Japan, South Korea, and Taiwan. 525 eligible patients were randomly assigned: 263 to receive olaparib plus paclitaxel and 262 to receive placebo plus paclitaxel. 94 patients were determined to have ATM-negative tumours before unmasking for the primary analysis (48 in the olaparib plus paclitaxel group and 46 in the placebo plus paclitaxel group). Overall survival did not differ between treatment groups in the overall patient population (median overall survival 8·8 months [95% CI 7·4-9·6] in the olaparib group vs 6·9 months [6·3-7·9] in the placebo group; HR 0·79 [97·5% CI 0·63-1·00]; p=0·026) or in the ATM-negative population (12·0 months [7·8-18·1] vs 10·0 months [6·4-13·3]; 0·73 [0·40-1·34]; p=0·25). In the overall patient population, the most common grade 3 or worse adverse events in the olaparib plus paclitaxel group were neutropenia (78 [30%] of 262 patients), leucopenia (42 [16%]), and decreased neutrophil count (40 [15%]); in the placebo plus paclitaxel group, they were neutropenia (59 [23%] of 259 patients), leucopenia (27 [10%]), and decreased white blood cell count (21 [8%]). Adverse events with an outcome of death causally related to study treatment (according to investigator assessment) were reported in two patients: liver injury in one patient (<1%) in the olaparib plus paclitaxel group and cardiac failure in one patient (<1%) in the placebo plus paclitaxel group.\n\n\n\nThe GOLD study did not meet its primary objective of showing a significant improvement in overall survival with olaparib in the overall or ATM-negative population of Asian patients with advanced gastric cancer. The study generated informative efficacy and safety data regarding the use of olaparib in combination with a chemotherapeutic agent and provides a foundation for future studies in this difficult-to-treat patient population.\n\n\n\nAstraZeneca.", "affiliations": "Department of Internal Medicine, Cancer Research Institute, Seoul National University College of Medicine, Seoul, South Korea. Electronic address: bangyj@snu.ac.kr.;Sun Yat-sen University Cancer Center, Guangzhou, China.;The Cancer Institute Hospital of the Japanese Foundation for Cancer Research, Tokyo, Japan.;Department of Internal Medicine, Seoul National University Bundang Hospital, Seoul National University College of Medicine, Gyeonggi-do, South Korea.;Samsung Medical Center, Sungkyunkwan University, Seoul, South Korea.;Yonsei Cancer Center, Yonsei University College of Medicine, Seoul, South Korea.;Department of Gastrointestinal Oncology, Key Laboratory of Carcinogenesis and Translational Research (Ministry of Education), Peking University Cancer Hospital and Institute, Beijing, China.;Nanjing Bayi Hospital, Nanjing, China.;The First Affiliated Hospital, Zhejiang University School of Medicine, Hangzhou, China.;Department of Internal Medicine, Cancer Research Institute, Seoul National University College of Medicine, Seoul, South Korea.;AstraZeneca, Gaithersburg, MD, USA.;AstraZeneca, Macclesfield, UK.;AstraZeneca, Shanghai, China.;AstraZeneca, Macclesfield, UK.;AstraZeneca, Cambridge, UK.;National Cancer Center Hospital, Tokyo, Japan.", "authors": "Bang|Yung-Jue|YJ|;Xu|Rui-Hua|RH|;Chin|Keisho|K|;Lee|Keun-Wook|KW|;Park|Se Hoon|SH|;Rha|Sun Young|SY|;Shen|Lin|L|;Qin|Shukui|S|;Xu|Nong|N|;Im|Seock-Ah|SA|;Locker|Gershon|G|;Rowe|Phil|P|;Shi|Xiaojin|X|;Hodgson|Darren|D|;Liu|Yu-Zhen|YZ|;Boku|Narikazu|N|", "chemical_list": "D010793:Phthalazines; D010879:Piperazines; D017239:Paclitaxel; C531550:olaparib", "country": "England", "delete": false, "doi": "10.1016/S1470-2045(17)30682-4", "fulltext": null, "fulltext_license": null, "issn_linking": "1470-2045", "issue": "18(12)", "journal": "The Lancet. Oncology", "keywords": null, "medline_ta": "Lancet Oncol", "mesh_terms": "D000328:Adult; D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D001208:Asia; D018450:Disease Progression; D018572:Disease-Free Survival; D004305:Dose-Response Relationship, Drug; D004311:Double-Blind Method; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D053208:Kaplan-Meier Estimate; D008297:Male; D020714:Maximum Tolerated Dose; D008875:Middle Aged; D009361:Neoplasm Invasiveness; D009367:Neoplasm Staging; D017239:Paclitaxel; D010793:Phthalazines; D010879:Piperazines; D016016:Proportional Hazards Models; D012074:Remission Induction; D013274:Stomach Neoplasms; D016019:Survival Analysis; D016896:Treatment Outcome", "nlm_unique_id": "100957246", "other_id": null, "pages": "1637-1651", "pmc": null, "pmid": "29103871", "pubdate": "2017-12", "publication_types": "D017428:Clinical Trial, Phase III; D003160:Comparative Study; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Olaparib in combination with paclitaxel in patients with advanced gastric cancer who have progressed following first-line therapy (GOLD): a double-blind, randomised, placebo-controlled, phase 3 trial.", "title_normalized": "olaparib in combination with paclitaxel in patients with advanced gastric cancer who have progressed following first line therapy gold a double blind randomised placebo controlled phase 3 trial" }
[ { "companynumb": "KR-MYLANLABS-2017M1082955", "fulfillexpeditecriteria": "1", "occurcountry": "KR", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "OLAPARIB" }, "drugadditional": null, ...
{ "abstract": "OBJECTIVE\nTo present a case of retinal and uveal necrosis caused by expanding gas tamponade after pars plana vitrectomy.\n\n\nMETHODS\nSingle case report.\n\n\nRESULTS\nAn otherwise healthy 66-year-old woman underwent pars plana vitrectomy with intended 20% sulfur hexafluoride (SF6) tamponade for macular hole repair of her pseudophakic left eye. She developed intractable nausea, emesis and increasing left eye pain in association with gas expanded to totally fill the left eye, just hours after surgery. Extremely elevated intraocular pressure was lowered with a successful paracentesis but recurred within a few hours. She then underwent vitrectomy evacuation of all vitreous cavity gas, reformation of the anterior chamber, and silicone oil placement, normalizing intraocular pressure. Three weeks later, the left eye had no light perception, and devitalization of the retina, choroid, and iris was evident.\n\n\nCONCLUSIONS\nWe present a case of blindness and intraocular tissue dissolution/disorganization after vitrectomy with intended 20% SF6. To our knowledge, this is the most detailed report of the under-recognized complication of expanding gas tamponade. Institutions hosting vitrectomy surgery should consider enacting a formal \"Time Out\" that requires all team members to witness accurate fractionation of potentially expansile gas. In the event of acute postoperative glaucoma in such eyes, a single small volume paracentesis cannot be relied upon to protect against continued gas expansion.", "affiliations": "Department of Ophthalmology, William Beaumont Hospital, Royal Oak, Michigan.;Retina Specialists of Alabama, Birmingham, Alabama.;Retina Specialists of Alabama, Birmingham, Alabama.;Retina Specialists of Alabama, Birmingham, Alabama.", "authors": "Rooney|David M|DM|;Oltmanns|Matthew H|MH|;Sapp|Mathew R|MR|;Morris|Robert E|RE|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1097/ICB.0000000000000841", "fulltext": null, "fulltext_license": null, "issn_linking": "1935-1089", "issue": "15(5)", "journal": "Retinal cases & brief reports", "keywords": null, "medline_ta": "Retin Cases Brief Rep", "mesh_terms": null, "nlm_unique_id": "101298744", "other_id": null, "pages": "523-526", "pmc": null, "pmid": "30601459", "pubdate": "2021-09-01", "publication_types": "D016428:Journal Article", "references": null, "title": "NECROSIS OF THE RETINA AND UVEAL TRACT SECONDARY TO EXPANDING GAS TAMPONADE.", "title_normalized": "necrosis of the retina and uveal tract secondary to expanding gas tamponade" }
[ { "companynumb": "US-MYLANLABS-2022M1000331", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "ACETAZOLAMIDE" }, "drugadditional": "4", ...
{ "abstract": "BACKGROUND\nWe report a case of pulmonary edema induced by tocolytic agents that was successfully managed with noninvasive positive-pressure ventilation (NPPV) and resulted in extended gestation.\n\n\nMETHODS\nA 36-year-old Japanese pregnant woman received tocolytic therapy with ritodrine hydrochloride, magnesium sulfate, nifedipine, and betamethasone from 28 weeks of gestation. She developed respiratory failure. and her chest X-ray showed enlarged pulmonary vascular shadows. At 29 weeks and 1 day of gestation, she was diagnosed with pulmonary edema induced by tocolytic agents. Because respiratory failure worsened 2 days after ritodrine hydrochloride and magnesium sulfate were stopped, NPPV was initiated. Her respiratory status improved and she was weaned off of NPPV after 3 days. She underwent cesarean section because of breech presentation at 30 weeks and 0 days of gestation due to initiation of labor pains.\n\n\nCONCLUSIONS\nNPPV can be safely administered in cases of tocolytic agent-induced pulmonary edema during pregnancy.", "affiliations": "Department of Obstetrics and Gynecology, Niigata University Medical and Dental Hospital, 1-757 Asahimachi-dori, Chuo-ku, Niigata, 951-8510, Japan. ktakahashi2727@gmail.com.;Department of Obstetrics and Gynecology, Niigata University Medical and Dental Hospital, 1-757 Asahimachi-dori, Chuo-ku, Niigata, 951-8510, Japan.;Department of Obstetrics and Gynecology, Niigata University Medical and Dental Hospital, 1-757 Asahimachi-dori, Chuo-ku, Niigata, 951-8510, Japan.;Department of Obstetrics and Gynecology, Niigata University Medical and Dental Hospital, 1-757 Asahimachi-dori, Chuo-ku, Niigata, 951-8510, Japan.;Department of Obstetrics and Gynecology, Niigata University Medical and Dental Hospital, 1-757 Asahimachi-dori, Chuo-ku, Niigata, 951-8510, Japan.;Department of Obstetrics and Gynecology, Niigata University Medical and Dental Hospital, 1-757 Asahimachi-dori, Chuo-ku, Niigata, 951-8510, Japan.", "authors": "Takahashi|Kotaro|K|http://orcid.org/0000-0002-6270-0753;Nishijima|Koji|K|;Yamaguchi|Masayuki|M|;Matsumoto|Kensuke|K|;Sugai|Shunya|S|;Enomoto|Takayuki|T|", "chemical_list": "D015149:Tocolytic Agents; D012312:Ritodrine", "country": "England", "delete": false, "doi": "10.1186/s13256-021-02704-w", "fulltext": "\n==== Front\nJ Med Case Rep\nJ Med Case Rep\nJournal of Medical Case Reports\n1752-1947\nBioMed Central London\n\n2704\n10.1186/s13256-021-02704-w\nCase Report\nNoninvasive positive-pressure ventilation in pregnancy to treat acute pulmonary edema induced by tocolytic agents: a case report\nhttp://orcid.org/0000-0002-6270-0753\nTakahashi Kotaro ktakahashi2727@gmail.com\n\nNishijima Koji\nYamaguchi Masayuki\nMatsumoto Kensuke\nSugai Shunya\nEnomoto Takayuki\ngrid.412181.f 0000 0004 0639 8670 Department of Obstetrics and Gynecology, Niigata University Medical and Dental Hospital, 1-757 Asahimachi-dori, Chuo-ku, Niigata, 951-8510 Japan\n21 3 2021\n21 3 2021\n2021\n15 12614 7 2020\n28 1 2021\n© The Author(s) 2021\nOpen AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.\nBackground\n\nWe report a case of pulmonary edema induced by tocolytic agents that was successfully managed with noninvasive positive-pressure ventilation (NPPV) and resulted in extended gestation.\n\nCase presentation\n\nA 36-year-old Japanese pregnant woman received tocolytic therapy with ritodrine hydrochloride, magnesium sulfate, nifedipine, and betamethasone from 28 weeks of gestation. She developed respiratory failure. and her chest X-ray showed enlarged pulmonary vascular shadows. At 29 weeks and 1 day of gestation, she was diagnosed with pulmonary edema induced by tocolytic agents. Because respiratory failure worsened 2 days after ritodrine hydrochloride and magnesium sulfate were stopped, NPPV was initiated. Her respiratory status improved and she was weaned off of NPPV after 3 days. She underwent cesarean section because of breech presentation at 30 weeks and 0 days of gestation due to initiation of labor pains.\n\nConclusions\n\nNPPV can be safely administered in cases of tocolytic agent-induced pulmonary edema during pregnancy.\n\nKeywords\n\nNoninvasive ventilation\nPulmonary edema\nTocolytic agents\nPreterm labor\nPregnancy\nissue-copyright-statement© The Author(s) 2021\n==== Body\nBackground\n\nAcute pulmonary edema in pregnant women is an uncommon but life-threatening event that requires emergency care [1]. One cause of acute pulmonary edema is administration of tocolytic agents such as β-adrenergic receptor agonists and magnesium sulfate [2]. Therefore, in treatment of threatened preterm labor, development of acute pulmonary edema should be monitored.\n\nNoninvasive positive-pressure ventilation (NPPV) is a form of noninvasive ventilation (NIV) that can be utilized for treatment of pulmonary edema, even in pregnancy [1]. However, few studies have investigated the efficacy of NPPV during pregnancy, and reports describing NPPV management for pulmonary edema due to tocolytic agents are scarce.\n\nWe report a case of hypoxemic respiratory failure due to pulmonary edema induced by tocolytic agents that was successfully and safely managed with NPPV and resulted in extended gestation.\n\nCase presentation\n\nA 36-year-old Japanese pregnant woman (gravida 3, para 1) at 28 weeks and 6 days of gestation was admitted to a hospital for threatened preterm labor. Her past medical history was unremarkable. The patient received tocolytic therapy with intravenous ritodrine hydrochloride. Her uterine contractions increased and she was referred to our hospital at 29 weeks and 1 day of gestation. We administered intravenous magnesium sulfate and oral nifedipine as tocolytic therapy and betamethasone for fetal maturation. Twelve hours after arrival at our hospital, she developed dyspnea and her oxygen saturation (SpO2) fell to 88% on room air; therefore, oxygen administration was initiated. A chest X-ray revealed enlarged pulmonary vascular shadows (Fig. 1), diagnosed as pulmonary edema induced by tocolytic agents. The patient’s blood pressure did not increase; therefore, pulmonary edema associated with preeclampsia was negative. On the other hand, the volume of infusion was approximately 1000 ml per day due to the administration of ritodrine hydrochloride and magnesium sulfate, and thus overhydration was a possibility. Consequently, administration of ritodrine hydrochloride and magnesium sulfate was stopped. After 2 days on 80% oxygen via a non-rebreather mask, the patient’s arterial blood gas results revealed oxygen tension (PO2) of 57 mmHg, pH of 7.46, and carbon dioxide tension (PCO2) of 20 mmHg, and she was diagnosed with type 1 respiratory failure. An echocardiogram showed a normal ejection fraction and a D-dimer test was negative; thus, we excluded cardiac insufficiency and pulmonary embolism. Fetal heart rate monitoring was reassuring, and the fetal biophysical profile score was 8 out of 10 points, indicating normal amniotic fluid volume. Therefore, we decided to continue her pregnancy. She was transferred to the intensive care unit (ICU) for advanced respiratory management. NPPV and furosemide were initiated to treat pulmonary edema. During the next 3 days, her respiratory status dramatically improved; before the introduction of NPPV, the SpO2 level was 93% or less even with oxygen, but after the introduction of NPPV, the SpO2 level was maintained at 97% or more. In addition, her dyspnea was alleviated, and then, even with a reduced oxygen supply, the SpO2 level maintained at 97% or more, and the pulmonary vascular shadows observed by chest X-ray also shrank. Eventually, she was weaned off of NPPV, requiring only nasal cannulation. We monitored her fetal heart rate every day for reassurance while she was in the ICU. She left the ICU at 29 weeks and 6 days of gestation, but the next day her uterine contractions were difficult to control. Finally, she underwent a cesarean section due to breech presentation at 30 weeks and 0 days of gestation. She delivered a healthy, 1292 g female infant whose APGAR score was 7 at 1 minute and 8 at 5 minutes. The patient’s chest X-ray was improved (Fig. 2), and she was discharged on day 7 after delivery. The infant needed continuous positive airway pressure for 4 days. The infant’s development was satisfactory and she was discharged on day 55.Fig. 1 The chest X-ray taken in a sitting position after the patient developed dyspnea. Enlarged pulmonary vascular shadows indicated pulmonary edema\n\nFig. 2 The chest X-ray taken in a standing position 5 days after leaving the intensive care unit. The enlarged pulmonary vascular shadows were improved\n\nDiscussion\n\nTo the best of our knowledge, this case is the first report of acute pulmonary edema due to tocolytic agents during pregnancy that was successfully managed with NPPV. In addition, by initiating NPPV before parturition, we succeeded in extending gestation by 5 days. This increase in gestational duration may contribute to better neonatal health outcomes in cases of threatened preterm labor [3, 4].\n\nThere are numerous causes of acute pulmonary edema: cardiogenic hydrostatic edema, preeclampsia, acute hemorrhage, sepsis syndrome, pneumonitis, vigorous intravenous fluid therapy, pancreatitis, and tocolytic agents [2]. In addition, diabetes mellitus is a synergistic risk factor with hypertension that can lead to acute heart failure, which may manifest as acute pulmonary edema during pregnancy [5]. Although less commonly utilized worldwide today, tocolytic therapy with β-mimetic drugs was at one time the cause of up to 40% of pulmonary edema [6, 7]. Long-term tocolysis with ritodrine hydrochloride has been implemented in patients and is associated with pulmonary edema [8]. Combination therapy with magnesium sulfate or simultaneous administration of corticosteroids to induce fetal maturation are even more causative of pulmonary edema [2]. A report of pulmonary edema caused by calcium blockers such as nicardipine has also been published [9]. In our case, ritodrine hydrochloride and magnesium sulfate administration increased fluid volume, which may have caused overhydration. Physicians should consider the risk of acute pulmonary edema during treatment for threatened preterm labor.\n\nSeveral case reports and small series have shown favorable outcomes of NPPV for hypoxemic respiratory failure in pregnancy. In some cases, NPPV during pregnancy improved hypoxemic respiratory failure before delivery, and the baby was delivered at term [10–12]. However, the etiologies were not pulmonary edema induced by tocolytic agents, but severe pneumonia [10], acute respiratory distress syndrome (ARDS) induced by transfusion-related acute lung injury [11], and ARDS induced by all-trans retinoic acid syndrome [12]. Another case series demonstrated that NPPV was effective in delaying delivery for patients with preeclampsia-induced pulmonary edema [13].\n\nTwo case reports describe pulmonary edema induced by tocolytic agents, and in those cases, NPPV was initiated during vaginal delivery [14] or after cesarean section [15]. In both cases, NPPV was initiated during or after delivery, such that prolongation of gestational duration was not a goal.\n\nIn the present case of acute pulmonary edema induced by tocolytic agents, the risk of pulmonary edema was high because ritodrine hydrochloride, magnesium sulfate, and betamethasone were used. NPPV was initiated because respiratory failure worsened even after ritodrine hydrochloride and magnesium sulfate administration was stopped. NPPV improved respiratory status before delivery. Although the patient delivered prematurely because uterine contractions were difficult to control after she left the ICU, we were able to increase gestational duration by 5 days.\n\nAfter the initiation of NPPV, physicians should pay attention to the timing of intubation or termination. Pregnancy should be terminated when respiratory failure worsens despite NPPV management or fetal well-being deteriorates.\n\nIn conclusion, NPPV can be safely administered to pregnant women with hypoxemic respiratory failure due to tocolytic agent-induced pulmonary edema. NPPV may result in increased gestational duration by stabilizing the respiratory condition, thereby delaying delivery.\n\nAbbreviations\n\nNPPV Noninvasive positive-pressure ventilation\n\nNIV Noninvasive ventilation\n\nSpO2 Oxygen saturation\n\nICU Intensive care unit\n\nARDS Acute respiratory distress syndrome\n\nAcknowledgements\n\nWe would like to thank Enago (www.enago.com) for English language editing and publication support.\n\nAuthors’ contributions\n\nKT and KN contributed substantially to the conception or design of the work and the acquisition, analysis, or interpretation of data. KT, KN, MY, KM, and SS were involved in the clinical diagnosis and treatment. MY, KM, and SS critically reviewed the manuscript. TE supervised the writing of the report. All authors read and approved the final manuscript.\n\nFunding\n\nNone.\n\nAvailability of data and materials\n\nThe data that support the findings of this study are available from the medical records. Data are also available from the authors upon reasonable request.\n\nEthics approval and consent to participate\n\nInformed consent was obtained in comprehensive agreement.\n\nConsent for publication\n\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the consent is available for review by the Editor-in-Chief of this journal.\n\nCompeting interests\n\nThe authors declare that they have no competing interests.\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Dennis AT Solnordal CB Acute pulmonary oedema in pregnant women Anaesthesia 2012 67 646 659 10.1111/j.1365-2044.2012.07055.x 22420683\n2. Cunningham FG Leveno KJ Bloom SL Dashe JS Hoffman BL Casey BM Williams obstetrics 2018 25 New York McGraw-Hill Education\n3. Fanaroff AA Stoll BJ Wright LL Carlo WA Ehrenkranz RA Stark AR Trends in neonatal morbidity and mortality for very low birthweight infants Am J Obstet Gynecol 2007 196 147.e1 147.e8 10.1016/j.ajog.2006.09.014 17306659\n4. Stoll BJ Hansen NI Bell EF Shankaran S Laptook AR Walsh MC Neonatal outcomes of extremely preterm infants from the NICHD neonatal research network Pediatrics 2010 126 443 456 10.1542/peds.2009-2959 20732945\n5. Lee KW Ching SM Hoo FK Ramachandran V Chong SC Tusimin M Factors associated with poor-to-moderate quality of life among pregnant women with gestational diabetes mellitus: a cross-sectional study in Malaysia Qual Life Res 2020 29 2725 2736 10.1007/s11136-020-02532-3 32430781\n6. DiFederico EM Burlingame JM Kilpatrick SJ Harrison M Matthay MA Pulmonary edema in obstetric patients is rapidly resolved except in the presence of infection or of nitroglycerin tocolysis after open fetal surgery Am J Obstet Gynecol 1998 179 925 933 10.1016/S0002-9378(98)70190-5 9790372\n7. Jenkins TM Troiano NH Graves CR Baird SM Boehm FH Mechanical ventilation in an obstetric population: characteristics and delivery rates Am J Obstet Gynecol 2003 188 549 552 10.1067/mob.2003.68 12592270\n8. Shigemi D Aso S Yasunaga H Inappropriate use of ritodrine hydrochloride for threatened preterm birth in Japan: a retrospective cohort study using a national inpatient database BMC Preg Childbirth 2019 10.1186/s12884-019-2352-1\n9. Serena C Begot E Cros J Hodler C Fedou AL Nathan-Denizot N Nicardipine-induced acute pulmonary edema: a rare but severe complication of tocolysis Case Rep Crit Care 2014 10.1155/2014/242703 25215245\n10. Mazlan MZ Ali S Abidin HZ Mokhtar AM Mukmin LA Ayub ZN Non-invasive ventilation in a pregnancy with severe pneumonia Respir Med Case Rep 2017 21 161 163 28560149\n11. Gibbs J Bridges F Trivedi K Vullo J Spontaneous rectus sheath hematoma in pregnancy complicated by the development of transfusion related acute lung injury: a case report and review of the literature AJP Rep 2016 6 e325 10.1055/s-0036-1593353 27651980\n12. Bassani MA de Oliveira AB Oliveira Neto AF Noninvasive ventilation in a pregnant patient with respiratory failure from all-trans-retinoic-acid (ATRA) syndrome Respir Care 2009 54 969 972 10.4187/002013209793800466 19558746\n13. Hamada K Chigusa Y Kondoh E Ueda Y Kawahara S Mogami H Noninvasive positive-pressure ventilation for preeclampsia-induced pulmonary edema: 3 case reports and a literature review Case Rep Obstet Gynecol 2018 10.1155/2018/7274597 30186649\n14. Perbet S Constantin JM Bolandard F Vignaud M Gallot D Chanseaume S Non-invasive ventilation for pulmonary edema associated with tocolytic agents during labour for a twin pregnancy Can J Anesth 2008 55 769 773 10.1007/BF03016350 19138917\n15. Fujita N Tachibana K Takeuchi M Kinouchi K Successful perioperative use of noninvasive positive pressure ventilation in a pregnant woman with acute pulmonary edema Masui 2014 63 557 560 24864580\n\n", "fulltext_license": "CC BY", "issn_linking": "1752-1947", "issue": "15(1)", "journal": "Journal of medical case reports", "keywords": "Noninvasive ventilation; Pregnancy; Preterm labor; Pulmonary edema; Tocolytic agents", "medline_ta": "J Med Case Rep", "mesh_terms": "D000328:Adult; D002585:Cesarean Section; D005260:Female; D006801:Humans; D011175:Positive-Pressure Respiration; D011247:Pregnancy; D011654:Pulmonary Edema; D012312:Ritodrine; D015149:Tocolytic Agents", "nlm_unique_id": "101293382", "other_id": null, "pages": "126", "pmc": null, "pmid": "33743806", "pubdate": "2021-03-21", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "28560149;19138917;20732945;30186649;27651980;31215479;12592270;9790372;32430781;22420683;17306659;25215245;19558746;24864580", "title": "Noninvasive positive-pressure ventilation in pregnancy to treat acute pulmonary edema induced by tocolytic agents: a case report.", "title_normalized": "noninvasive positive pressure ventilation in pregnancy to treat acute pulmonary edema induced by tocolytic agents a case report" }
[ { "companynumb": "JP-ALVOGEN-2021-ALVOGEN-116852", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "BETAMETHASONE" }, "drugadditional": nul...
{ "abstract": "BACKGROUND\nFluorouracil-based preoperative chemoradiotherapy has become the standard treatment for stage II/III rectal cancer. In order to improve the overall survival (OS) and disease-free survival (DFS), we added oxaliplatin to the standard treatment, and compared the effectiveness of these two treatment patterns.\n\n\nMETHODS\nA total of 206 patients enrolled in the prospective study had histologically confirmed rectal cancer of clinical stage II/III during July 2007 to July 2010. They were randomized into the experimental group received oxaliplatin and capecitabine in combination with radiotherapy, and the control group received capecitabine in combination with radiotherapy. All patients received surgery in 6-10 weeks after chemoradiotherapy and adjuvant chemotherapy with mFOLFOX6. The primary endpoints were DFS and OS, and the secondary endpoints included toxicity, compliance, and histopathological response.\n\n\nRESULTS\nThe 3-year OS in the experimental group and the control group was 90.29% vs. 86.41% (P>0.05), and the 3-year DFS was 80.58% vs. 69.90% (P>0.05). The pathological complete remission (pCR) rates were 23.30% and 19.42%, respectively (P=0.497). The 3-year local recurrence rates were 4.85% vs. 5.83% (P=0.694), and the 3-year distant metastasis rates were 16.50% and 28.16%, respectively (P=0.045). There were no significant differences in most grade 3-4 toxicities between two groups, however, grade 3-4 diarrhea occurred in 16.50% (17/103) of the experimental group, compared with 6.80% (7/103) of the control group (P=0.030). Also, the total grade 3-4 acute toxicity showed a significant difference (10.68% vs. 21.36%, P=0.037).\n\n\nCONCLUSIONS\nThe experimental treatment did not lead significantly improved OS and DFS, and thus longer follow-up is warranted for our patient cohort. Adding oxaliplatin to capecitabine-based preoperative chemoradiotherapy can significantly reduce metastasis, but has only minimal impact on local recurrence. Although grade 3-4 toxicity rate increased (primarily gastrointestinal toxicity), patients can stand to be followed up with allopathic treatment.", "affiliations": "1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.;1 Department of Radiotherapy, 2 Department of Colorectal Surgery, Liaoning Cancer Hospital & Institute, Shenyang 110042, China.", "authors": "Jiao|Dexin|D|;Zhang|Rui|R|;Gong|Zhiqiang|Z|;Liu|Fang|F|;Chen|Yue|Y|;Yu|Qinrui|Q|;Sun|Liping|L|;Duan|Hongyan|H|;Zhu|Shendong|S|;Liu|Fei|F|;Wang|Jian|J|;Jia|Jianhui|J|", "chemical_list": null, "country": "China", "delete": false, "doi": "10.3978/j.issn.1000-9604.2015.12.05", "fulltext": null, "fulltext_license": null, "issn_linking": "1000-9604", "issue": "27(6)", "journal": "Chinese journal of cancer research = Chung-kuo yen cheng yen chiu", "keywords": "Oxaliplatin; capecitabine; preoperative chemoradiotherapy; rectal adenocarcinoma", "medline_ta": "Chin J Cancer Res", "mesh_terms": null, "nlm_unique_id": "9315242", "other_id": null, "pages": "588-96", "pmc": null, "pmid": "26752933", "pubdate": "2015-12", "publication_types": "D016428:Journal Article", "references": "22529255;20406942;23739201;24385689;23089949;24403010;23109696;12905554;22433756;25232218;24799484;24028546;12925071;15987918;23268010;17470851;21606427;22627104;22915656;23207926;22503032;21755378", "title": "Fluorouracil-based preoperative chemoradiotherapy with or without oxaliplatin for stage II/III rectal cancer: a 3-year follow-up study.", "title_normalized": "fluorouracil based preoperative chemoradiotherapy with or without oxaliplatin for stage ii iii rectal cancer a 3 year follow up study" }
[ { "companynumb": "CN-ROCHE-1693020", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "FLUOROURACIL" }, "drugadditional": null, "dr...
{ "abstract": "Achieving complete remission (CR) in childhood relapsed/refractory acute lymphoblastic leukaemia (ALL) is a difficult task. Bortezomib, a proteasome inhibitor, has in vitro activity against ALL blasts. A phase I-II trial, reported by the Therapeutic Advances in Childhood Leukaemia and Lymphoma (TACL) consortium, demonstrated that bortezomib with chemotherapy has acceptable toxicity and remarkable activity in patients with relapsed ALL failing 2-3 previous regimens. We evaluated bortezomib in combination with chemotherapy in 30 and 7 children with B-cell precursor (BCP) and T-cell ALL, respectively. Bortezomib (1·3 mg/m2 /dose) was administered intravenously on days 1, 4, 8, and 11. Chemotherapy agents were the same as those used in the TACL trial, consisting of dexamethasone, doxorubicin, vincristine and pegylated asparaginase. Three patients (8·1%) died due to infections. Twenty-seven patients (72·9%) achieved CR or CR with incomplete platelet recovery (CRp). Fourteen had minimal residual disease (MRD) lower than 0·1%. Twenty-two of 30 BCP-ALL patients (73·3%) and 5/7 patients (71%) with T-cell ALL achieved CR/CRp. The 2-year overall survival (OS) is 31·3%; CR/CRp patients with an MRD response had a remarkable 2-year OS of 68·4%. These data confirm that the combination of bortezomib with chemotherapy is a suitable/effective option for childhood relapsed/refractory ALL.", "affiliations": "Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.;Department of Paediatric Haematology-Oncology, IRCCS Ospedale Pediatrico Bambino Gesù, Rome, Italy.", "authors": "Bertaina|Alice|A|;Vinti|Luciana|L|;Strocchio|Luisa|L|;Gaspari|Stefania|S|;Caruso|Roberta|R|;Algeri|Mattia|M|;Coletti|Valentina|V|;Gurnari|Carmelo|C|;Romano|Mariateresa|M|;Cefalo|Maria Giuseppina|MG|;Girardi|Katia|K|;Trevisan|Valentina|V|;Bertaina|Valentina|V|;Merli|Pietro|P|;Locatelli|Franco|F|", "chemical_list": "D061988:Proteasome Inhibitors; D011092:Polyethylene Glycols; D014750:Vincristine; D000069286:Bortezomib; C042705:pegaspargase; D003907:Dexamethasone; D004317:Doxorubicin; D001215:Asparaginase", "country": "England", "delete": false, "doi": "10.1111/bjh.14505", "fulltext": null, "fulltext_license": null, "issn_linking": "0007-1048", "issue": "176(4)", "journal": "British journal of haematology", "keywords": "acute lymphoblastic leukaemia; bortezomib; childhood leukaemia; minimal residual disease; relapsed/refractory disease", "medline_ta": "Br J Haematol", "mesh_terms": "D000293:Adolescent; D000971:Antineoplastic Combined Chemotherapy Protocols; D001215:Asparaginase; D000069286:Bortezomib; D002648:Child; D002675:Child, Preschool; D003907:Dexamethasone; D004317:Doxorubicin; D005260:Female; D006801:Humans; D007223:Infant; D008297:Male; D018365:Neoplasm, Residual; D011092:Polyethylene Glycols; D015452:Precursor B-Cell Lymphoblastic Leukemia-Lymphoma; D054198:Precursor Cell Lymphoblastic Leukemia-Lymphoma; D054218:Precursor T-Cell Lymphoblastic Leukemia-Lymphoma; D061988:Proteasome Inhibitors; D012074:Remission Induction; D016879:Salvage Therapy; D016019:Survival Analysis; D014750:Vincristine; D055815:Young Adult", "nlm_unique_id": "0372544", "other_id": null, "pages": "629-636", "pmc": null, "pmid": "28116786", "pubdate": "2017-02", "publication_types": "D016428:Journal Article", "references": null, "title": "The combination of bortezomib with chemotherapy to treat relapsed/refractory acute lymphoblastic leukaemia of childhood.", "title_normalized": "the combination of bortezomib with chemotherapy to treat relapsed refractory acute lymphoblastic leukaemia of childhood" }
[ { "companynumb": "IT-JNJFOC-20170217429", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "DOXORUBICIN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nSafe, effective and convenient antiemetic regimens that preserve benefit over repeated cycles are needed for optimal supportive care during cancer treatment. NEPA, an oral fixed-dose combination of netupitant, a highly selective NK1 receptor antagonist (RA), and palonosetron (PALO), a distinct 5-HT3 RA, was shown to be superior to PALO in preventing chemotherapy-induced nausea and vomiting after a single cycle of highly (HEC) or moderately (MEC) emetogenic chemotherapy in recent trials. This study was designed primarily to assess the safety but also to evaluate the efficacy of NEPA over multiple cycles of HEC and MEC.\n\n\nMETHODS\nThis multinational, double-blind, randomized phase III study (NCT01376297) in 413 chemotherapy-naïve patients evaluated a single oral dose of NEPA (NETU 300 mg + PALO 0.50 mg) given on day 1 with oral dexamethasone (DEX). An oral 3-day aprepitant (APR) regimen + PALO + DEX was included as a control (3:1 NEPA:APR randomization). In HEC, DEX was administered on days 1-4 and in MEC on day 1. Safety was assessed primarily by adverse events (AEs), including cardiac AEs; efficacy by complete response (CR: no emesis, no rescue).\n\n\nRESULTS\nPatients completed 1961 total chemotherapy cycles (76% MEC, 24% HEC) with 75% completing ≥4 cycles. The incidence/type of AEs was comparable for both groups. Most frequent NEPA-related AEs included constipation (3.6%) and headache (1.0%); there was no indication of increasing AEs over multiple cycles. The majority of AEs were mild/moderate and there were no cardiac safety concerns based on AEs and electrocardiograms. The overall (0-120 h) CR rates in cycle 1 were 81% and 76% for NEPA and APR + PALO, respectively, and antiemetic efficacy was maintained over repeated cycles.\n\n\nCONCLUSIONS\nNEPA, a convenient single oral dose antiemetic targeting dual pathways, was safe, well tolerated and highly effective over multiple cycles of HEC/MEC.", "affiliations": "Department of Medical Oncology, Albert Einstein College of Medicine, Jacobi Medical Center, Bronx, USA. Electronic address: richard.gralla@nbhn.net.;Department of Supportive Oncology, Institute for Oncology and Radiology of Serbia, Belgrade, Serbia.;Chernivtsi Regional Cancer Hospital, Chernivtsi, Ukraine.;OnkoNet Marburg GmbH, Marburg, Germany.;Department of Statistics and Data Management.;Department of Corporate Clinical Development, Helsinn Healthcare SA, Lugano, Switzerland.;Department of Corporate Clinical Development, Helsinn Healthcare SA, Lugano, Switzerland.;Department of Hematology and Oncology, University of Halle-Wittenberg, Halle, Germany.", "authors": "Gralla|R J|RJ|;Bosnjak|S M|SM|;Hontsa|A|A|;Balser|C|C|;Rizzi|G|G|;Rossi|G|G|;Borroni|M E|ME|;Jordan|K|K|", "chemical_list": "D000970:Antineoplastic Agents; D004338:Drug Combinations; D007546:Isoquinolines; D011725:Pyridines; D011812:Quinuclidines; D000077924:Palonosetron; C508854:netupitant", "country": "England", "delete": false, "doi": "10.1093/annonc/mdu096", "fulltext": "\n==== Front\nAnn OncolAnn. OncolannoncannoncAnnals of Oncology0923-75341569-8041Oxford University Press 10.1093/annonc/mdu096mdu096Original ArticlesSupportive CareA phase III study evaluating the safety and efficacy of NEPA, a fixed-dose combination of netupitant and palonosetron, for prevention of chemotherapy-induced nausea and vomiting over repeated cycles of chemotherapy Gralla R. J. 1*Bosnjak S. M. 2Hontsa A. 3Balser C. 4Rizzi G. 5Rossi G. 6Borroni M. E. 6Jordan K. 71 Department of Medical Oncology, Albert Einstein College of Medicine, Jacobi Medical Center, Bronx, USA2 Department of Supportive Oncology, Institute for Oncology and Radiology of Serbia, Belgrade, Serbia3 Chernivtsi Regional Cancer Hospital, Chernivtsi, Ukraine4 OnkoNet Marburg GmbH, Marburg, Germany5 Department of Statistics and Data Management6 Department of Corporate Clinical Development, Helsinn Healthcare SA, Lugano, Switzerland7 Department of Hematology and Oncology, University of Halle-Wittenberg, Halle, Germany* Correspondence to: Dr Richard J. Gralla, Albert Einstein College of Medicine, Jacobi Medical Center, Bronx, NY 10461 USA. Tel: +1 718 918-6235; E-mail: richard.gralla@nbhn.net7 2014 14 3 2014 14 3 2014 25 7 1333 1339 13 12 2013 21 2 2014 © The Author 2014. Published by Oxford University Press on behalf of the European Society for Medical Oncology.2014This is an Open Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/3.0/), which permits non-commercial re-use, distribution, and reproduction in any medium, provided the original work is properly cited. For commercial re-use, please contact journals.permissions@oup.comIn this multinational, phase III study, the safety and efficacy of NEPA, a convenient, fixed-dose antiemetic combination of netupitant, a highly selective NK1 receptor antagonist (RA), and palonosetron, a distinct 5-HT3 RA, were evaluated over multiple cycles of highly and moderately emetogenic chemotherapy. NEPA was shown to be safe, well tolerated and highly effective over 1961 chemotherapy cycles.\n\nBackground\nSafe, effective and convenient antiemetic regimens that preserve benefit over repeated cycles are needed for optimal supportive care during cancer treatment. NEPA, an oral fixed-dose combination of netupitant, a highly selective NK1 receptor antagonist (RA), and palonosetron (PALO), a distinct 5-HT3 RA, was shown to be superior to PALO in preventing chemotherapy-induced nausea and vomiting after a single cycle of highly (HEC) or moderately (MEC) emetogenic chemotherapy in recent trials. This study was designed primarily to assess the safety but also to evaluate the efficacy of NEPA over multiple cycles of HEC and MEC.\n\nPatients and methods\nThis multinational, double-blind, randomized phase III study (NCT01376297) in 413 chemotherapy-naïve patients evaluated a single oral dose of NEPA (NETU 300 mg + PALO 0.50 mg) given on day 1 with oral dexamethasone (DEX). An oral 3-day aprepitant (APR) regimen + PALO + DEX was included as a control (3:1 NEPA:APR randomization). In HEC, DEX was administered on days 1–4 and in MEC on day 1. Safety was assessed primarily by adverse events (AEs), including cardiac AEs; efficacy by complete response (CR: no emesis, no rescue).\n\nResults\nPatients completed 1961 total chemotherapy cycles (76% MEC, 24% HEC) with 75% completing ≥4 cycles. The incidence/type of AEs was comparable for both groups. Most frequent NEPA-related AEs included constipation (3.6%) and headache (1.0%); there was no indication of increasing AEs over multiple cycles. The majority of AEs were mild/moderate and there were no cardiac safety concerns based on AEs and electrocardiograms. The overall (0–120 h) CR rates in cycle 1 were 81% and 76% for NEPA and APR + PALO, respectively, and antiemetic efficacy was maintained over repeated cycles.\n\nConclusions\nNEPA, a convenient single oral dose antiemetic targeting dual pathways, was safe, well tolerated and highly effective over multiple cycles of HEC/MEC.\n\nneurokinin-1 receptor antagonistNEPAnetupitantpalonosetronCINVmultiple chemotherapy cycles\n==== Body\nintroduction\nEffective, safe and convenient antiemetic regimens that preserve benefit over repeated chemotherapy cycles are essential for optimal supportive care of patients receiving emetogenic chemotherapy. Unfortunately, most antiemetic trials assess chemotherapy-induced nausea and vomiting (CINV) only in a single cycle of treatment [1]. In the few trials evaluating efficacy over multiple cycles, methodologic problems are often found as the number of patients evaluated in subsequent cycles diminishes rapidly in most studies. When few patients remain with continuing treatment cycles, one is unsure of whether or not apparent preserved emetic efficacy is due to patient dropout from lack of control or from side-effects of the antiemetics [1, 2].\n\nThe current study was designed to investigate the safety and efficacy of a new antiemetic combination when given in multiple treatment cycles. NEPA is a single oral fixed-dose combination of netupitant (NETU), a new NK1 receptor antagonist (RA) with a long half-life of 90 h, and palonosetron (PALO), a pharmacologically distinct [3] and clinically superior [4] 5-HT3 RA. This combination is being developed to enhance the convenience of administering guideline-based antiemetic prophylaxis targeted at two critical molecular pathways involved in the neuropharmacology of CINV. Large-scale studies with NEPA have just been completed which establish the basis of usage with this all-oral combination [5, 6]. The trials have shown superior CINV prevention and similar safety with NEPA when compared with PALO during a single cycle of either highly (HEC) [5] or moderately emetic chemotherapy (MEC) [6]. In addition, one of the trials confirmed that a 300 mg dose of oral netupitant gave the highest degree of antiemetic activity, without any increase in toxicity, when combined with oral PALO at 0.50 mg [5].\n\nThe current phase III study assessed the safety and described the efficacy of NEPA over multiple cycles in patients receiving HEC or MEC. The inclusion of aprepitant (APR) plus PALO as a control was intended to help interpret any unexpected safety finding in the NEPA group.\n\npatients and methods\nstudy design\nThis was a phase III, multinational, multicenter, randomized, double-blind, double-dummy, parallel group study conducted at 59 enrolling sites in 10 countries (Bulgaria, Czech Republic, Germany, Hungary, India, Poland, Russia, Serbia, Ukraine and the United States) between July 2011 and September 2012. The protocol was approved by ethical review committees for each center, all patients provided written informed consent and all investigators and site personnel followed GCP, ICH E6, Declaration of Helsinki (2008) ethical principles, local laws and regulations.\n\npatients\nEligible patients were ≥18 years, diagnosed with a malignant tumor, naïve to chemotherapy and scheduled to receive repeated consecutive courses of chemotherapy. A single intravenous (i.v.) dose of one or more of the following agents administered on day 1 was necessary for inclusion:\n\nHEC: cisplatin, mechlorethamine, streptozocin, cyclophosphamide ≥1500 mg/m2, carmustine, dacarbazine; MEC: oxaliplatin, carboplatin, epirubicin, idarubicin, ifosfamide, irinotecan, daunorubicin, doxorubicin, cyclophosphamide (<1500 mg/m2), cytarabine (>1 g/m2), azacitidine, alemtuzumab, bendamustine or clofarabine.\n\nPatients with breast cancer scheduled to receive anthracycline–cyclophosphamide (AC) chemotherapy were not eligible. Patients were required to have an Eastern Cooperative Oncology Group (ECOG) performance status of 0, 1 or 2. Patients were not eligible if they were scheduled to receive MEC or HEC from day 2 to day 5, a bone marrow transplant or stem cell rescue therapy. They were also ineligible if they had previously received an NK1 RA, or if they had known hypersensitivity or contraindication to 5-HT3 RAs or dexamethasone (DEX).\n\nExclusions included patients with a history or predisposition to cardiac conduction abnormalities, torsade de point or severe cardiovascular diseases. Since netupitant is a moderate inhibitor of CYP3A4, it was prohibited to use any CYP3A4 inducer within 4 weeks, a strong/moderate inhibitor within 1 week, certain substrates or scheduled to receive CYP3A4 inhibitors/inducers as concomitant medication.\n\ntreatment\nPatients were randomly allocated (stratified by HEC/MEC and gender) in a 3:1 ratio to receive one of the following treatments:Oral NEPA (NETU 300 mg + PALO 0.50 mg) + DEX\n\nOral APR (125 mg day 1, 80 mg days 2–3) + oral PALO 0.50 mg day 1 + DEX\n\n\n\nOral DEX was open label and identical in both groups; the dose/schedule was based on the emetogenicity of the chemotherapeutic regimen and according to antiemetic guidelines (HEC: 12 mg day 1 and 8 mg days 2–4; MEC: 12 mg day 1). NEPA, APR and PALO were administered 60 min and DEX 30 min before chemotherapy on day 1. APR and DEX were administered in the morning on subsequent days. Blinding was maintained in all groups with the use of matching identical placebos.\n\nThe 0.50 mg PALO dose was chosen based on an efficacy trial evaluating the noninferiority of three oral PALO doses, 0.25, 0.50 and 0.75 mg, compared with i.v. PALO 0.25 mg [7].\n\nRescue medication was permitted for treatment of established, refractory or persistent nausea and vomiting; however, its use was considered treatment failure. Metoclopramide tablets were provided, although the investigator was allowed the discretion to use alternative rescue medications (excluding 5-HT3 or NK1 RAs). There was no prespecified limit to the number of consecutive chemotherapy cycles for patients.\n\nassessments\nSafety was assessed primarily by treatment-emergent adverse events (TEAEs: defined as those occurring after the first dose of study drug), but also by clinical laboratory evaluations, physical examinations and vital signs. Cardiac safety was assessed by 12-lead electrocardiograms (ECGs) (screening, predose, 5, 24 and 120 h post-dose each cycle), cardiac troponin (cTnl) levels (screening, 24 and 120 h post-dose each cycle) and left ventricular ejection fraction (LVEF) (screening and between day 14 and 21 of last cycle). The ECGs were digitally recorded and read by a cardiologist blind to study treatment, cTnl levels were analyzed by a central laboratory as exact values, and LVEF was assessed using either the multiple gated acquisition scan or echocardiography, but the same tool at both times for each patient.\n\nTo evaluate the efficacy of NEPA, each patient completed a diary from the start of chemotherapy on day 1 through the morning of day 6 (0–120 h) of each cycle, documenting the time of onset and duration of each emetic episode, severity of nausea and rescue medications taken. An emetic episode was defined as a single vomiting episode, a single retching or any retching combined with vomiting. Severity of nausea was evaluated on a daily basis (for the preceding 24 h) using a 100-mm horizontal visual analog scale (VAS). The left end (0 mm) was labeled as ‘no nausea,’ and the right end (100 mm) was labeled as ‘nausea as bad as it could be’. Efficacy endpoints were complete response (CR: no emesis, no rescue medication) and no significant nausea (VAS score of <25 mm) during the acute (0–24 h), delayed (25–120 h) and overall (0–120 h) phase after the start of chemotherapy.\n\nstatistical analysis\nThe goal of this multiple cycle registration trial was to characterize the safety profile of NEPA over a duration of at least six cycles. It was expected that 300 patients treated with NEPA during cycle 1 would allow more than 100 patients to be treated for six cycles. If a given AE was not observed in 100 NEPA-treated patients, an incidence of ≥3% could be excluded with 95% confidence. As the study's focus was on the safety of NEPA, the APR + PALO group provided context although no formal comparison was planned.\n\nPALO was selected to be used in conjunction with APR to standardize the 5-HT3 RA component of the regimens and decrease the variability among the treatments. Four hundred patients were to be randomized at a 3:1 ratio; 300 (225 MEC, 75 HEC) to NEPA and 100 (75 MEC, 25 HEC) to APR + PALO.\n\nThe safety analysis population consisted of all patients who received study treatment and had at least one safety assessment after treatment administration. The full analysis set (FAS) population used for the efficacy analyses was defined as all patients randomized who received the MEC/HEC regimen and study treatment.\n\nThe number of patients who experienced TEAEs was listed and summarized by treatment arm. AEs were considered treatment-related if the relationship to study drug was assessed as definite, probable, possible, unassessable or missing.\n\nObserved values, changes from baseline and outliers were summarized for ECGs. A potential safety signal included a change from baseline in the heart-rate corrected QT interval by the Fredericia formula (QTcF) to >500 ms in more than 5% of patients or to >60 ms in more than 15% of patients. CTnls and LVEF values were summarized and changes from baseline calculated; a threshold of 0.12 ng/ml was considered an ‘alert value’.\n\nOnly descriptive statistics were provided for safety assessments and no formal testing was done for between group comparisons. The proportion (including 95% confidence intervals) of patients with CR and with no significant nausea was summarized for each cycle by treatment and by treatment and chemotherapy emetogenicity.\n\nresults\nA total of 413 patients were randomized (Figure 1); 412 patients were treated for a total of 1961 cycles (1446 NEPA, 515 APR + PALO); 98% of patients completed cycle 1, 75% completed at least four cycles and 40% completed six cycles.Figure 1. Consort diagram of the disposition of patients. One patient randomized/allocated to NEPA received APR + PALO throughout the study. Following the intent-to-treat principle, this patient was analyzed in the NEPA group for the full analysis set (FAS; N = 309) and the APR + PALO group for the safety population (N = 104). One patient randomized/allocated to APR + PALO did not receive any treatment and was therefore excluded from both the FAS (N = 103) and safety population. *The vast majority discontinued due to the study closure which occurred when the last patient enrolled had completed his/her final chemotherapy cycle; these patients were allowed to complete their current cycle but not enter any further cycles.\n\n\n\nThe patients' baseline and disease characteristics are reported in Table 1; these remained consistent across cycles. The study was not designed to control for type of cancer in each randomization arm. It should be noted that poorer cancer prognostic variables were found in the NEPA-treated patients with a greater proportion with lung/respiratory tract cancers (40% versus 31%), with metastatic cancer (52% versus 43%), and with concomitant disease (78% versus 62%) when compared with those patients who were randomly assigned to the APR + PALO study arm.Table 1. Patient baseline and disease characteristics\n\nCharacteristic\tNEPA (N = 308)\tAPR + PALO (N = 104)\tOverall (N = 412)\t\nGender\t\n Male (%)\t49.7\t51.0\t50.0\t\n Female (%)\t50.3\t49.0\t50.0\t\nMedian age (years)\t57.0\t58.5\t58.0\t\nCancer type (%)\t\n Lung/respiratory\t39.6\t30.8\t37.4\t\n Othera\t23.4\t15.4\t21.4\t\n Ovarian\t10.7\t17.3\t12.4\t\n Colon\t7.8\t12.5\t9.0\t\n Head and neck\t6.5\t10.6\t7.5\t\n Colorectal\t5.5\t4.8\t5.3\t\n Rectal\t2.9\t4.8\t3.4\t\n Gastric\t2.3\t1.0\t1.9\t\n Bladder\t1.3\t2.9\t1.7\t\nExtent of cancer at entry (%)\t\n Primary\t43.8\t51.9\t45.9\t\n Metastatic\t51.9\t43.3\t49.8\t\n Local recurrence\t4.2\t4.8\t4.4\t\nSite of metastasis (%)\t\n Lymph nodes\t33.1\t21.2\t30.1\t\n Other\t15.6\t19.2\t16.5\t\n Lung\t14.0\t13.5\t13.8\t\n Liver\t12.0\t12.5\t12.1\t\n Bone\t5.8\t4.8\t5.6\t\n Brain\t1.6\t2.9\t1.9\t\nECOG Performance Status (%)\t\n 0\t47.4\t48.1\t47.6\t\n 1\t51.0\t50.0\t50.7\t\n 2\t1.6\t1.9\t1.7\t\nChemotherapyb (%)\t\n MECc\t75.7\t75.7\t75.7\t\n Carboplatin\t60.3\t61.5\t60.6\t\n Oxaliplatin\t20.1\t24.4\t21.2\t\n Doxorubicin\t11.1\t6.4\t9.9\t\n Cyclophosphamide\t3.4\t2.6\t3.2\t\n Irinotecan\t3.0\t3.8\t3.2\t\n Epirubicin\t1.7\t1.3\t1.6\t\n Daunorubicin\t0.4\t0\t0.3\t\n HECc\t24.3\t24.3\t24.3\t\n Cisplatin\t96.0\t92.0\t95.0\t\n Dacarbazine\t4.0\t4.0\t4.0\t\n Carmustine\t0\t4.0\t1.0\t\naOther as a category included any other type of cancer not listed in the prespecified categories, including, but not limited to those of the uterus, breast, larynx and endometrium.\n\nbBased on efficacy (full analysis set) population, while all others based on safety population.\n\ncCycle 1 chemotherapy.\n\n\n\nsafety\nThe overall incidence, type and frequency of TEAEs were comparable for both treatment groups throughout the study (Table 2). Similar proportions of patients reported AEs regardless of chemotherapy emetogenicity or gender. There were no notable differences between the groups in overall percentages of patients who experienced severe or serious AEs or events leading to discontinuation.Table 2. Overview of adverse events\n\nType of adverse event number of patients (%)\tNEPA (N = 308)\tAPR + PALO (N = 104)\tNEPA (N = 308)\tAPR + PALO (N = 104)\t\nCycle 1\tEntire multiple cycle study perioda\t\nAny ‘treatment-emergent’ adverse event\t199 (64.6%)\t64 (61.5%)\t265 (86.0%)\t95 (91.3%)\t\n‘Treatment-related’ adverse event\t16 (5.2%)\t3 (2.9%)\t31 (10.1%)\t6 (5.8%)\t\n‘Severe’ treatment-related adverse event\t1 (0.3%)\t0\t1 (0.3%)\t0\t\n‘Serious’ treatment-related adverse event\t1 (0.3%)\t0\t2 (0.6%)\t0\t\nTreatment-related adverse event ‘leading to discontinuation’\t1 (0.3%)\t0\t1 (0.3%)\t0\t\n‘Total deaths’ (all unrelated to study drug)\t7 (2.3%)\t0\t16 (5.2%)\t1 (1.0%)\t\nTreatment-emergent adverse event: any AE reported after first study drug intake.\n\nTreatment-related adverse event: AEs deemed definitely, probably or possibly related to study drug.\n\nSafety population.\n\naIncludes cycle 1 through all cycles.\n\n\n\nThe majority of TEAEs reported were of mild/moderate intensity; 25.0% and 32.7% of patients experienced severe TEAEs with NEPA and APR + PALO, respectively. The most commonly reported severe TEAEs were neutropenia (11.7% NEPA, 10.6% APR + PALO) and leukopenia (4.5% NEPA, 4.8% APR + PALO). Only one AE was considered severe and possibly antiemetic treatment-related and was the only one leading to discontinuation (acute psychosis in a NEPA patient in cycle 1; also considered to be possibly related to DEX).\n\nThere was no indication of increasing AEs over multiple cycles (Table 3). The proportion of patients with AEs considered study drug-related was relatively low in both treatment groups (10.1% NEPA, 5.8% APR + PALO). The most frequent treatment-related AEs for NEPA included constipation (3.6%) and headache (1.0%) (Table 4).Table 3. Patients with any treatment-related adverse events across cycles\n\n% of patients with adverse event\tTreatment-emergent adverse event\tTreatment-related adverse event\t\nCycle (N = NEPA/APR)\tNEPA (N = 308)\tAPR + PALO (N = 104)\tNEPA (N = 308)\tAPR + PALO (N = 104)\t\nCycle 1 (N = 308/104)\t64.6%\t61.5%\t5.2%\t2.9%\t\nCycle 2 (N = 279/96)\t54.8%\t57.3%\t4.3%\t1.0%\t\nCycle 3 (N = 258/91)\t50.4%\t58.2%\t1.9%\t2.2%\t\nCycle 4 (N = 232/81)\t43.5%\t48.1%\t1.3%\t1.2%\t\nCycle 5 (N = 156/57)\t45.5%\t57.9%\t0.6%\t1.8%\t\nCycle 6 (N = 124/43)\t34.7%\t32.6%\t1.6%\t0.0%\t\nSafety population.\n\nTable 4. Summary of most common treatment-related adverse events\n\nAdverse event\tNEPA (N = 308)\tAPR + PALO (N = 104)\tNEPA (N = 308)\tAPR + PALO (N = 104)\t\nCycle 1\tEntire Multiple Cycle Study Perioda\t\nConstipation\t7 (2.3%)\t0\t11 (3.6%)\t1 (1.0%)\t\nDyspepsia\t0\t1 (1.0%)\t1 (0.3%)\t1 (1.0%)\t\nEructation\t1 (0.3%)\t1 (1.0%)\t1 (0.3%)\t1 (1.0%)\t\nHeadache\t3 (1.0%)\t1 (1.0%)\t3 (1.0%)\t1 (1.0%)\t\naIncludes cycle 1 through all cycles; Safety population.\n\n\n\nA similar proportion of patients experienced serious TEAEs (N = 50/16.2% NEPA, N = 19/18.3% APR + PALO); two of these in the NEPA group (0.6%) were deemed treatment-related (probably related ventricular systoles in cycle 6 and acute psychosis mentioned above). Seventeen patients (4.1%) died during the study or the follow-up period with 5.2% in the NEPA assigned treatment arm and 1.0% in the APR + PALO arm. The most common cause of death was disease progression; none of these events was attributed to study drug. As noted above, several poorer disease prognostic characteristics differences, including proportion with metastatic or concomitant disease, occurred according to randomized treatment arm assignment.\n\ncardiac safety\nChanges from baseline in 12-lead ECGs at 5 and 24 h after dose were similar between the groups, with any corrected QT (QTc) interval prolongation being transient and returning to predose measurements within 120 h after dose across all cycles. The percentage of patients with a >60 ms increase in QTcF was low in both groups [1 NEPA patient (0.3%) in each of cycles 1, 3, 4 and 5; 1 APR + PALO patient (1.0%) in each of cycles 1 and 4]. A >500 ms change in QTcF was observed for a NEPA patient in cycles 1, 3 and 4 and an APR + PALO patient in cycle 6. The percentage of patients who developed ECG abnormalities was comparable for the treatment groups throughout the study. The most frequently reported abnormalities were flat T waves (16.9% and 13.5% NEPA and APR + PALO, respectively) and ST depression (11.7% and 16.3%, respectively). Only two (0.6%) NEPA-treated and one (1.0%) APR-treated patients experienced abnormal U waves.\n\nThroughout the study, there were seven (2.3%) NEPA-treated patients and three (2.9%) APR-treated patients with high postdose troponin values. Mean LVEF was comparable at screening and at the end of the study with small changes in both groups.\n\nefficacy\nAntiemetic efficacy (CR rates) during the overall phase across six cycles of chemotherapy is summarized in Figure 2. Overall CR rates were high and were maintained across cycles for both treatment groups, with NEPA showing a small but consistent numerical advantage (2%–7%) over APR + PALO during each cycle. CR rates were similar between the two antiemetic treatment groups in the acute phase while rates during the delayed phase of each cycle mimicked the overall phase with differences ranging from 2% to 6%.Figure 2. Primary analysis: complete response (no emesis, no rescue medication) (overall 0–120 h). Full analysis population.\n\n\n\nThe proportions of patients with no significant nausea were high in both treatment groups, with overall rates ranging from 84% to 92% across cycles for NEPA and from 81% to 87% for APR + PALO. A similar numerical advantage over APR + PALO was shown in the delayed phase.\n\nIn the NEPA group, the percentage of patients with an overall CR across cycles was similar for the patients receiving HEC (79%–91%) and MEC (80%–93%). Observed CR rates were modestly lower in the HEC (58%–86%) subgroup when compared with the MEC (82%–89%) subgroup for APR + PALO. Overall CR rates in the NEPA group were generally similar for males and females across cycles.\n\ndiscussion\nThis study including 413 patients receiving 1961 chemotherapy cycles offers compelling evidence of the continuous safety of NEPA and support for its efficacy in patients receiving multiple cycles of either MEC or HEC.\n\nIn general, the AE profile seen is typical for a diverse cancer population receiving chemotherapy. As demonstrated in the single cycle trials [5, 6], NEPA was well tolerated with a comparable and low AE profile, as was seen with APR + PALO. The majority of AEs were mild/moderate in intensity and only two patients experienced serious treatment-related AEs. While the proportion of patients reporting treatment-related AEs was greater in the NEPA group compared with APR + PALO, the incidence was relatively low in both groups (10.1% versus 5.8%), with constipation being the only AE exceeding 1% (3.6% versus 1.0%). Reassuringly, there was no indication of increasing AEs, whether treatment-related or not, over multiple cycles.\n\nNone of the deaths occurring in either treatment arm in this trial, largely in patients with advanced stages of cancer, was attributed to or related to study drug. The difference between groups in number of deaths is potentially due to the combination of a greater number of patients randomly assigned to the NEPA treatment arm together with poorer prognostic variables (lung/respiratory cancer, metastatic disease and concomitant disease) compared with APR-treated patients.\n\nThere were no cardiac safety concerns for NEPA based on cardiac AEs and ECGs. This was supported by the very low proportions of patients with a change in QTcF of >60 ms or to a value >500 ms, combined with the low proportion of patients with abnormal U waves.\n\nThese efficacy results provide evidence of the benefits of the preservation of excellent emetic control over multiple chemotherapy cycles with the new antiemetic combination, NEPA. Not only were the CR rates high, exceeding 90% in the acute phase and 80% in the delayed/overall phases in the first cycle, but these rates for NEPA were maintained throughout six cycles. Having over 75% of patients in the efficacy evaluation after four cycles provides confidence in the preservation of antiemetic effect over multiple cycles. As in all trials, the control rates for nausea were less than the rates for vomiting; however, the reported control of nausea was high as well. Although the differences were small, the numerically better control in the NEPA group compared with APR + PALO is important in the development of a new antiemetic agent, demonstrating that there is no suggestion of loss of efficacy in exchange for a regimen of potentially greater convenience. Further studies should be carried out to determine whether the highly convenient concept of NEPA will result in greater adherence, fostering improved emetic control.\n\nIn conclusion, NEPA, a convenient single-dose oral antiemetic targeting two critical antiemetic pathways, was safe, well tolerated and highly effective over multiple cycles of HEC or MEC. NEPA offers an opportunity to provide effective antiemetic care which is consistent with guideline recommendations in a maximally convenient combination.\n\nfunding\nThis work was supported by Helsinn Healthcare, SA who provided the study drugs and the funding for this study.\n\ndisclosure\nThe authors have the following conflicts of interest to disclose: RG: advisor for Merck, Helsinn Healthcare and Eisai. KJ: speakers bureau for Merck and Helsinn Healthcare. GR, GR and MEB: employees of Helsinn Healthcare. All remaining authors have declared no conflicts of interest.\n\nacknowledgements\nThe authors express our sincere appreciation to the late Steven Grunberg, our esteemed colleague whose contributions to supportive care and to this study were of great significance. They thank the clinical investigators, patients and site personnel who participated in the study. They acknowledge the editorial support of Jennifer Vanden Burgt during the writing of this manuscript, Silvia Olivari, Silvia Sebastiani and Marco Palmas from Helsinn Healthcare SA and Norman Nagl from Eisai, Inc., for critically reviewing the manuscript, and the NEPA Publication Steering Committee (Paul Hesketh, Richard Gralla, Matti Aapro, Karin Jordan, and Steven Grunberg) for their leadership and guidance.\n==== Refs\nreferences\n1 De Wit R Herrstedt J Rapoport B Addition of the oral NK1 antagonist aprepitant to standard antiemetics provides protection against nausea and vomiting during multiple cycles of cisplatin-based chemotherapy J Clin Oncol 2003 22 4105 4111 14559891 \n2 De Wit R Schmitz PIM Verweij J Analysis of cumulative probabilities shows that the efficacy of 5-HT3 antagonist prophylaxis is not maintained J Clin Oncol 1996 14 644 651 8636782 \n3 Rojas C Slusher BS Pharmacological mechanism of 5-HT3 and tachykinin NK-1 receptor antagonism to prevent chemotherapy-induced nausea and vomiting Eur J Pharmacol 2012 684 1–3 1 7 22425650 \n4 Feyer P Jordan K Update and new trends in antiemetic therapy: the continuing need for novel therapies Ann Oncol 2011 22 1 30 38 20947707 \n5 Hesketh P Rossi G Rizzi G Efficacy and safety of NEPA, an oral combination of netupitant and palonosetron, for prevention of chemotherapy-induced nausea and vomiting following highly emetogenic chemotherapy: a randomized dose-ranging pivotal study Ann Oncol 2014 25 1340 1346 \n6 Aapro M Rugo H Rossi G A randomized phase 3 study evaluating the efficacy and safety of NEPA, a fixed-dose combination of netupitant and palonosetron, for prevention of chemotherapy-induced nausea and vomiting following moderately emetogenic chemotherapy Ann Oncol 2014 25 1328 1333 \n7 Boccia R Grunberg S Franco-Gonzales E Efficacy of oral palonosetron compared to intravenous palonosetron for prevention of chemotherapy-induced nausea and vomiting associated with moderately emetogenic chemotherapy: a phase 3 trial Support Care Cancer 2013 21 5 1453 1460 23354552\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "0923-7534", "issue": "25(7)", "journal": "Annals of oncology : official journal of the European Society for Medical Oncology", "keywords": "CINV; NEPA; multiple chemotherapy cycles; netupitant; neurokinin-1 receptor antagonist; palonosetron", "medline_ta": "Ann Oncol", "mesh_terms": "D000970:Antineoplastic Agents; D004311:Double-Blind Method; D004338:Drug Combinations; D006801:Humans; D007546:Isoquinolines; D009325:Nausea; D009369:Neoplasms; D000077924:Palonosetron; D011725:Pyridines; D011812:Quinuclidines; D014839:Vomiting", "nlm_unique_id": "9007735", "other_id": null, "pages": "1333-1339", "pmc": null, "pmid": "24631949", "pubdate": "2014-07", "publication_types": "D017428:Clinical Trial, Phase III; D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't", "references": "14559891;22425650;24608196;23354552;8636782;20947707;24603643", "title": "A phase III study evaluating the safety and efficacy of NEPA, a fixed-dose combination of netupitant and palonosetron, for prevention of chemotherapy-induced nausea and vomiting over repeated cycles of chemotherapy.", "title_normalized": "a phase iii study evaluating the safety and efficacy of nepa a fixed dose combination of netupitant and palonosetron for prevention of chemotherapy induced nausea and vomiting over repeated cycles of chemotherapy" }
[ { "companynumb": "US-JNJFOC-20140716378", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CISPLATIN" }, "drugadditional": null, "...
{ "abstract": "Tufted angioma (TA) is a rare benign vascular neoplasm characterized histopathologically by the proliferation of endothelial cells arranged in lobules in the dermis and subcutaneous fat. To date, about 200 cases have been reported, most of which are of Japanese ethnicity. TA predominantly affects children and young adults, developing in 80% of patients younger than 10 years. A white 72-year-old renal transplant recipient presented with 2 asymptomatic dusky red papules on his right leg. The lesions appeared 5 years after the start of immunosuppressive treatment. Histopathologic examination showed a proliferation of poorly canalized capillary-sized vascular structures with typical \"cannonball\" pattern in the dermis and subcutaneous fat. Eccrine glands were also evident focally in the stroma of capillary lobules. On immunohistochemistry, endothelial cells in the vascular tufts stained positive for CD31 and CD34 but were negative for factor VIII-related antigen, human herpes virus 8, and podoplanin (clone D2-40); α-smooth muscle actin stained pericytes disposed in a single layer in capillary-sized vessels and in 2-3 or more layers in vessels of larger size, respectively. The microscopic findings were suggestive of TA. In the deep dermis, venules with smooth muscle wall and arterioles, as shown by Van Gieson staining, normally not found at that level, were present and appeared surrounded by capillary lobules. Onset of TA in adulthood is rare and may be associated with pregnancy, varicella zoster virus infection, and pharmacological immunosuppression. A case of acquired adult-onset TA associated with an arteriovenous malformation in an elderly transplanted patient is described.", "affiliations": "*Dermatology, Department of Clinical-Surgical, Diagnostic and Pediatric Sciences, University of Pavia, Pavia, Italy; †Dermatology, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; ‡Department of Molecular Medicine, University of Pavia, Pavia, Italy; §Pathology, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy; and ¶Centre for Inherited Cardiovascular Diseases, Fondazione IRCCS Policlinico San Matteo, Pavia, Italy.", "authors": "Grassi|Sara|S|;Carugno|Andrea|A|;Vignini|Mariadelaide|M|;Rosso|Renato|R|;Borroni|Riccardo G|RG|", "chemical_list": "D014408:Biomarkers, Tumor; D007166:Immunosuppressive Agents", "country": "United States", "delete": false, "doi": "10.1097/DAD.0000000000000221", "fulltext": null, "fulltext_license": null, "issn_linking": "0193-1091", "issue": "37(2)", "journal": "The American Journal of dermatopathology", "keywords": null, "medline_ta": "Am J Dermatopathol", "mesh_terms": "D000368:Aged; D001165:Arteriovenous Malformations; D014408:Biomarkers, Tumor; D001706:Biopsy; D003937:Diagnosis, Differential; D006391:Hemangioma; D006801:Humans; D016867:Immunocompromised Host; D007150:Immunohistochemistry; D007166:Immunosuppressive Agents; D016030:Kidney Transplantation; D008297:Male; D011237:Predictive Value of Tests; D012307:Risk Factors; D012878:Skin Neoplasms; D013997:Time Factors", "nlm_unique_id": "7911005", "other_id": null, "pages": "162-5", "pmc": null, "pmid": "25365496", "pubdate": "2015-02", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Adult-onset tufted angiomas associated with an arteriovenous malformation in a renal transplant recipient: case report and review of the literature.", "title_normalized": "adult onset tufted angiomas associated with an arteriovenous malformation in a renal transplant recipient case report and review of the literature" }
[ { "companynumb": "IT-ACCORD-033395", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MYCOPHENOLIC ACID" }, "drugadditional": null, ...
{ "abstract": "To assess the efficacy and safety of maraviroc (MVC) administered once-daily in routine clinical practice. A retrospective multicenter study (27 centers in Spain) was conducted. Data were collected from the records of patients starting a regimen with MVC. Laboratory and clinical data were recorded every 3 months the first year and every 6 months thereafter. Data are presented as median and interquartile range. Among 667 patients treated with MVC, 142 (21.3%) received MVC once-daily: 108 (76.1%), 150 mg and 34 (23.9%), and 300 mg. Age was 47 (42-45) years, there were 76.1% men, and 81 (57%) patients had baseline HIV-RNA <50 copies/mL. Viral tropism was R5 in 118 (83.1%) patients. Reasons for prescribing MVC: salvage therapy (36.6%), drug toxicity (31.2%), simplification (16.9%), and immunodiscordant response (7.1%). Median follow-up was 13 (9-16) months. In 95.8%, a PI/r was part of the regimen (67% on dual therapy). At months 12 and 24, 73.3% and 68.2% of patients had HIV-RNA <50 copies/mL, respectively (p = .041 and p < .001 vs. baseline). CD4+ cell count increased by a median of 52 (-36,135) and 84 (-9.5,180) cells/mm3 at 12 and 24 months, respectively (p < .001 and p = .039 vs. baseline). Twenty-five (17.6%) patients discontinued MVC: virologic failure (6), medical decision (5), and other reasons (14). Two patients presented grade 3 adverse events (hypertransaminasemia, hypertriglyceridemia) without the need for MVC withdrawal, whereas MVC was discontinued in two patients due to gastrointestinal toxicity. In routine clinical practice, MVC once-daily combined with at least PI/r was virologically effective and well tolerated in a high percentage of pretreated patients.", "affiliations": "1 HIV and STD Unit, Infectious Diseases Service, Bellvitge University Hospital , Bellvitge Biomedical Research Institute, Hospitalet de Llobregat, Spain .;2 Hospital Universitari Germans Trias i Pujol , Badalona, Spain .;4 Infectious Diseases Unit, Hospital SAS , Jerez de la Frontera, Spain .;5 Infectious Diseases Department, Hospital del Mar , Barcelona, Spain .;6 Internal Medice Services, Hospital Universitario La Paz-IdiPAZ , Madrid, Spain .;7 Infectious Diseases Unit, Hospital de la Santa Creu i Sant Pau , Barcelona, Spain .;8 Clinical Biostatistics Unit, Instituto Ramón y Cajal de Investigación Sanitaria (IRYCIS) , Madrid, Spain .;9 Hospital Reina Sofía-IMIBIC , Córdoba, Spain .;10 Hospital Ramón y Cajal-IRYCIS , Madrid, Spain .;1 HIV and STD Unit, Infectious Diseases Service, Bellvitge University Hospital , Bellvitge Biomedical Research Institute, Hospitalet de Llobregat, Spain .", "authors": "Saumoy|Maria|M|;Llibre|Josep M|JM|;Terrón|Alberto|A|;Knobel|Hernando|H|;Arribas|José Ramón|JR|;Domingo|Pere|P|;Arroyo-Manzano|David|D|;Rivero|Antonio|A|;Moreno|Santiago|S|;Podzamczer|Daniel|D|", "chemical_list": "D065100:CCR5 Receptor Antagonists; D003510:Cyclohexanes; D012367:RNA, Viral; D014230:Triazoles; D000077592:Maraviroc", "country": "United States", "delete": false, "doi": "10.1089/AID.2015.0386", "fulltext": null, "fulltext_license": null, "issn_linking": "0889-2229", "issue": "33(1)", "journal": "AIDS research and human retroviruses", "keywords": "efficacy; maraviroc once-daily; routine clinical practice; safety", "medline_ta": "AIDS Res Hum Retroviruses", "mesh_terms": "D000328:Adult; D065100:CCR5 Receptor Antagonists; D018791:CD4 Lymphocyte Count; D003510:Cyclohexanes; D064420:Drug-Related Side Effects and Adverse Reactions; D005260:Female; D015658:HIV Infections; D006801:Humans; D008137:Longitudinal Studies; D008297:Male; D000077592:Maraviroc; D008875:Middle Aged; D012367:RNA, Viral; D012189:Retrospective Studies; D013030:Spain; D016896:Treatment Outcome; D014230:Triazoles; D019562:Viral Load", "nlm_unique_id": "8709376", "other_id": null, "pages": "29-32", "pmc": null, "pmid": "27250802", "pubdate": "2017-01", "publication_types": "D016428:Journal Article; D016448:Multicenter Study", "references": null, "title": "Short Communication: Maraviroc Once-Daily: Experience in Routine Clinical Practice.", "title_normalized": "short communication maraviroc once daily experience in routine clinical practice" }
[ { "companynumb": "ES-VIIV HEALTHCARE LIMITED-ES2017GSK202204", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MARAVIROC" }, "drugadditiona...
{ "abstract": "The impact of iso-osmolar versus low-osmolar iodinated contrast on diagnostic accuracy for coronary computed tomography angiography (CCTA), against the reference standard of invasive coronary angiography (ICA), has not been determined. We sought to compare in an international multicenter randomized controlled trial the impact of iso-osmolar iodixanol versus low-osmolar iopamidol on diagnostic accuracy, image quality, patient symptoms, and heart rate variability.\n\n\n\nAdult patients who were clinically referred for ICA were randomly assigned to receive either iodixanol (n = 133) or iopamidol (n = 133) with an investigational CCTA. CCTA stenosis and image quality were scored by consensus of independent blinded core laboratory readers. Degree of stenosis by ICA was evaluated using quantitative coronary angiography and used to calculate diagnostic accuracy. Heart rate variability and patient-reported symptom questionnaires were compared between the two groups.\n\n\n\nA total of 266 subjects underwent both CCTA and ICA (57 ± 11 years, 58% male). The sensitivity, specificity, positive predictive value, negative predictive value, and accuracy for detecting coronary artery disease were 86.8%, 93.7%, 84.6%, 94.7%, and 91.7% for iodixanol and 94.7%, 88.4%, 76.6%, 97.7%, and 90.2% for iopamidol, respectively, on a per-patient level. These values were not significantly different between the two groups. There was no significant difference in image quality and heart rate increase or variability. The majority of patients reported symptoms (59.4%), with no differences in the overall or individual rate of any or moderate to severe symptoms between the two groups. Patients receiving iodixanol reported lower incidence of moderate to severe flushing (3.0% vs. 12.8%, P = .005). Lower rates of moderate to severe symptoms were particularly evident for patients with ≥55 years receiving iodixanol versus iopamidol (8.5% vs. 24.6%, P = .01).\n\n\n\nDiagnostic performance and image quality were similar for CCTA performed with iso-osmolar versus low-osmolar iodinated contrast. Indices of patient comfort were improved with iso-osmolar iodinated contrast.", "affiliations": "Department of Radiology, Weill Cornell Medical College, New York, New York; St. Luke's International Hospital, Tokyo, Japan.;Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, California.;Department of Radiology, Weill Cornell Medical College, New York, New York; Soroka University Medical Center, Be'er Sheva, Israel.;St. Paul's Hospital, University of British Columbia, Vancouver, British Columbia, Canada.;Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, California.;Department of Radiology, Weill Cornell Medical College, New York, New York.;Department of Radiology, Weill Cornell Medical College, New York, New York.;Department of Imaging, Cedars-Sinai Medical Center, Los Angeles, California.;Department of Radiology, Weill Cornell Medical College, New York, New York; Department of Medicine, Weill Cornell Medical College, New York, New York; Dalio Institute of Cardiovascular Imaging, New York-Presbyterian Hospital, New York, New York. Electronic address: jkm2001@med.cornell.edu.", "authors": "Nakazato|Ryo|R|;Arsanjani|Reza|R|;Shalev|Aryeh|A|;Leipsic|Jonathon A|JA|;Gransar|Heidi|H|;Lin|Fay Y|FY|;Gomez|Millie|M|;Berman|Daniel S|DS|;Min|James K|JK|", "chemical_list": "D003287:Contrast Media; D014283:Triiodobenzoic Acids; C044834:iodixanol; D007479:Iopamidol", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1076-6332", "issue": "23(6)", "journal": "Academic radiology", "keywords": "Iso-osmolar contrast agent; coronary CT; diagnostic accuracy; image quality", "medline_ta": "Acad Radiol", "mesh_terms": "D000072226:Computed Tomography Angiography; D003287:Contrast Media; D017023:Coronary Angiography; D003324:Coronary Artery Disease; D005260:Female; D006801:Humans; D007089:Image Enhancement; D007479:Iopamidol; D008297:Male; D008875:Middle Aged; D009994:Osmolar Concentration; D000070659:Patient Comfort; D011446:Prospective Studies; D012680:Sensitivity and Specificity; D014283:Triiodobenzoic Acids", "nlm_unique_id": "9440159", "other_id": null, "pages": "743-51", "pmc": null, "pmid": "27178781", "pubdate": "2016-06", "publication_types": "D016428:Journal Article; D016448:Multicenter Study; D016449:Randomized Controlled Trial", "references": null, "title": "Diagnostic Accuracy, Image Quality, and Patient Comfort for Coronary CT Angiography Performed Using Iso-Osmolar versus Low-Osmolar Iodinated Contrast: A Prospective International Multicenter Randomized Controlled Trial.", "title_normalized": "diagnostic accuracy image quality and patient comfort for coronary ct angiography performed using iso osmolar versus low osmolar iodinated contrast a prospective international multicenter randomized controlled trial" }
[ { "companynumb": "US-GE HEALTHCARE MEDICAL DIAGNOSTICS-VISP-PR-1605L-0316", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "IODIXANOL" }, ...
{ "abstract": "Although radiofrequency ablation is the first line therapy in some children with supraventricular tachycardia, its application in small children is still limited. Herein, we presented a premature newborn diagnosed as multidrug-resistant permanent junctional reciprocal tachycardia, and treated by radiofrequency ablation via the jugular vein approach because of bilateral femoral vein thrombosis. We think that when there is limited vascular access, the transjugular route for radiofrequency ablation might be considered as an alternative treatment in newborns with multidrug-resistant supraventricular tachycardia.", "affiliations": "Department of Pediatric Cardiology, Hacettepe University Faculty of Medicine, Ankara, Turkey. mustafagulgun@yahoo.com.;Department of Pediatric Cardiology, Hacettepe University Faculty of Medicine, Ankara, Turkey.;Department of Pediatric Cardiology, Hacettepe University Faculty of Medicine, Ankara, Turkey.;Department of Pediatric Cardiology, Hacettepe University Faculty of Medicine, Ankara, Turkey.", "authors": "Gülgün|Mustafa|M|;Karagöz|Tevfik|T|;Aykan|Hakan Hayrettin|HH|;Ertuğrul|İlker|İ|", "chemical_list": null, "country": "Turkey", "delete": false, "doi": "10.5543/tkda.2015.76301", "fulltext": null, "fulltext_license": null, "issn_linking": "1016-5169", "issue": "43(2)", "journal": "Turk Kardiyoloji Dernegi arsivi : Turk Kardiyoloji Derneginin yayin organidir", "keywords": null, "medline_ta": "Turk Kardiyol Dern Ars", "mesh_terms": "D017115:Catheter Ablation; D005260:Female; D005268:Femoral Vein; D006801:Humans; D007231:Infant, Newborn; D007601:Jugular Veins; D047928:Premature Birth; D054139:Tachycardia, Reciprocating; D013927:Thrombosis", "nlm_unique_id": "9426239", "other_id": null, "pages": "182-4", "pmc": null, "pmid": "25782124", "pubdate": "2015-03", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Transjugular approach for radiofrequency ablation of permanent junctional reciprocal tachycardia in a newborn with bilateral femoral vein thrombosis.", "title_normalized": "transjugular approach for radiofrequency ablation of permanent junctional reciprocal tachycardia in a newborn with bilateral femoral vein thrombosis" }
[ { "companynumb": "PHHY2015TR038019", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "SOTALOL" }, "drugadditional": null, "drugadm...
{ "abstract": "The use of tenofovir disoproxil fumarate (TDF) in combination with emtricitabine, prescribed for pre-exposure prophylaxis (PrEP), is highly effective at reducing incident sexually transmissible HIV infection among those at risk. TDF is associated with proteinuria, Fanconi syndrome and chronic kidney disease, and is not recommended for use in patients with an estimated creatinine clearance <60 mL min-1. There are currently no Pharmaceutical Benefits Scheme (PBS)-funded PrEP options for patients at risk of HIV infection with moderate renal impairment in Australia. This report describes the case of a patient who acquired HIV soon after PrEP was suspended due to moderate renal impairment. The various clinical and regulatory issues this case raises are discussed.", "affiliations": "Department of Renal Medicine, Royal Prince Alfred Hospital, Camperdown, NSW 2050, Australia; and Corresponding author. Email: Jack.Heron@health.nsw.gov.au.;Sydney Sexual Health Centre, South Eastern Sydney Local Health District, Sydney, NSW 2000, Australia.;Sydney Sexual Health Centre, South Eastern Sydney Local Health District, Sydney, NSW 2000, Australia.;Department of Renal Medicine, Royal Prince Alfred Hospital, Camperdown, NSW 2050, Australia; and Central Clinical School, The University of Sydney, Sydney, NSW 2006, Australia.", "authors": "Heron|Jack E|JE|;Rix|Suzanne|S|;Varma|Rick|R|;Gracey|David M|DM|", "chemical_list": "D000069480:Emtricitabine, Tenofovir Disoproxil Fumarate Drug Combination", "country": "Australia", "delete": false, "doi": "10.1071/SH20037", "fulltext": null, "fulltext_license": null, "issn_linking": "1448-5028", "issue": "17(3)", "journal": "Sexual health", "keywords": null, "medline_ta": "Sex Health", "mesh_terms": "D000328:Adult; D001315:Australia; D000069480:Emtricitabine, Tenofovir Disoproxil Fumarate Drug Combination; D005919:Glomerular Filtration Rate; D015658:HIV Infections; D006801:Humans; D007356:Insurance, Pharmaceutical Services; D008297:Male; D065129:Pre-Exposure Prophylaxis; D051437:Renal Insufficiency", "nlm_unique_id": "101242667", "other_id": null, "pages": "299-300", "pmc": null, "pmid": "32576363", "pubdate": "2020-06", "publication_types": "D002363:Case Reports", "references": null, "title": "Renal impairment: an unnecessary barrier to HIV prevention.", "title_normalized": "renal impairment an unnecessary barrier to hiv prevention" }
[ { "companynumb": "AU-GILEAD-2020-0477808", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "EMTRICITABINE\\TENOFOVIR DISOPROXIL FUMARATE" }, ...
{ "abstract": "Secondary myelodysplastic syndrome (MDS)/acute myeloid leukemia (AML) is a rare but devastating complication of solid tumor treatment involving high-dose topoisomerase II inhibitor and alkylator chemotherapy. For relapsed or elderly MDS and AML patients ineligible for hematopoietic stem cell transplantation, epigenetic therapies, including DNA methyltransferase inhibitors and histone deacetylase inhibitors, have been utilized as palliative therapy, offering a well-tolerated approach to disease stabilization, prolonged survival, and quality of life. Literature on the use of epigenetic therapies for both primary and relapsed disease is scarce in the pediatric population. Here, we report 2 pediatric patients with secondary AML and MDS, respectively, due to prior therapy for metastatic solid tumors. Both patients were ineligible for hematopoietic stem cell transplantation due to concurrent solid tumor relapse, but were treated with the epigenetic combination therapy, decitabine and vorinostat, and achieved stabilization of marrow disease, outpatient palliation, and family-reported reasonable quality of life.", "affiliations": "*Department of Pediatric Hematology/Oncology, Winthrop University Medical Center, Mineola †Department of Pediatric Hematology/Oncology/Stem Cell Transplantation, Columbia University Medical Center, New York Presbyterian Hospital §Department of Pediatrics, Memorial Sloan Kettering Cancer Center, New York, NY ‡Department of Pediatric Hematology/Oncology, Arnold Palmer Hospital for Children, Orlando, FL.", "authors": "Glasser|Chana L|CL|;Lee|Alice|A|;Eslin|Don|D|;Marks|Lianna|L|;Modak|Shakeel|S|;Glade Bender|Julia L|JL|", "chemical_list": "D000970:Antineoplastic Agents; D056572:Histone Deacetylase Inhibitors; D006877:Hydroxamic Acids; D000077337:Vorinostat; D000077209:Decitabine; D001374:Azacitidine", "country": "United States", "delete": false, "doi": "10.1097/MPH.0000000000000868", "fulltext": null, "fulltext_license": null, "issn_linking": "1077-4114", "issue": "39(7)", "journal": "Journal of pediatric hematology/oncology", "keywords": null, "medline_ta": "J Pediatr Hematol Oncol", "mesh_terms": "D000293:Adolescent; D000970:Antineoplastic Agents; D001374:Azacitidine; D000077209:Decitabine; D004359:Drug Therapy, Combination; D044127:Epigenesis, Genetic; D005260:Female; D056572:Histone Deacetylase Inhibitors; D006801:Humans; D006877:Hydroxamic Acids; D015470:Leukemia, Myeloid, Acute; D009190:Myelodysplastic Syndromes; D016609:Neoplasms, Second Primary; D010166:Palliative Care; D011788:Quality of Life; D000077337:Vorinostat", "nlm_unique_id": "9505928", "other_id": null, "pages": "560-564", "pmc": null, "pmid": "28562519", "pubdate": "2017-10", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "16778214;20026803;23890779;16985182;21278245;19148951;10802708;22689805;23233562;8202048;25336333;18549473;14654560;24891274;17322921;9850034;17962510;16882711;11245427;17623797;26692909;12120280;12637473;20564411;10866323;21115869;24663049;23706636;25040094;19279403;20606092;26766110;17694093;20589651;9916800", "title": "Epigenetic Combination Therapy for Children With Secondary Myelodysplastic Syndrome (MDS)/Acute Myeloid Leukemia (AML) and Concurrent Solid Tumor Relapse.", "title_normalized": "epigenetic combination therapy for children with secondary myelodysplastic syndrome mds acute myeloid leukemia aml and concurrent solid tumor relapse" }
[ { "companynumb": "US-DRREDDYS-USA/USA/17/0093360", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "DECITABINE" }, "drugadditional": null, ...
{ "abstract": "To investigate the impact of medications on outcomes after tonsillectomy, a retrospective review using the MarketScan database was performed. A total of 306,536 privately insured children and adolescents (1 to 17 years old) who underwent tonsillectomy/adenoidectomy were identified from 2008 to 2012. Pharmaceutical claims identified patients who received outpatient prescriptions for ibuprofen, steroids, or topical anesthetics until discharge and for medications for the treatment of attention deficit hyperactivity disorder (ADHD) or montelukast up to 14 days postoperatively. Logistic regression compared prescription claims to outcomes, including postoperative bleeding, dehydration, emergency department visits, and readmissions. Ibuprofen was the only medication associated with increased odds of postoperative bleeding (odds ratio [OR]: 1.45, 95% confidence interval [CI]: 1.07 to 1.95). Patients receiving steroids had lower odds of dehydration (OR: 0.74, 95% CI: 0.65 to 0.84) and emergency department visits (OR: 0.82, 95% CI: 0.76 to 0.88). Odds of dehydration were highest in patients taking ADHD medications (OR: 1.38, 95% CI: 1.15 to 1.66) and topical anesthetics (OR: 1.32, 95% CI: 1.10 to 1.59). Although causality cannot be assumed in observational studies, steroids and ibuprofen should be used judiciously.", "affiliations": "Department of Surgery, Division of Otolaryngology-Head and Neck Surgery, The Pennsylvania State University College of Medicine, 500 University Dr., PO Box 850, Hershey, PA 17033-0850, USA. aoconnell2@hmc.psu.edu.", "authors": "O'Connell Ferster|Ashley P|AP|;Schaefer|Eric|E|;Schubart|Jane R|JR|;Carr|Michele M|MM|", "chemical_list": "D000085:Acetates; D000697:Central Nervous System Stimulants; D003521:Cyclopropanes; D011804:Quinolines; D013440:Sulfides; C093875:montelukast", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0145-5613", "issue": "97(8)", "journal": "Ear, nose, & throat journal", "keywords": null, "medline_ta": "Ear Nose Throat J", "mesh_terms": "D000085:Acetates; D000233:Adenoidectomy; D000293:Adolescent; D001289:Attention Deficit Disorder with Hyperactivity; D000697:Central Nervous System Stimulants; D002648:Child; D002675:Child, Preschool; D003521:Cyclopropanes; D003681:Dehydration; D005260:Female; D006801:Humans; D007223:Infant; D008297:Male; D017063:Outcome Assessment, Health Care; D010149:Pain, Postoperative; D019106:Postoperative Hemorrhage; D011804:Quinolines; D012307:Risk Factors; D013440:Sulfides; D014068:Tonsillectomy", "nlm_unique_id": "7701817", "other_id": null, "pages": "E19-E24", "pmc": null, "pmid": "30138521", "pubdate": "2018-08", "publication_types": "D016428:Journal Article", "references": null, "title": "Ancillary medications and outcomes in post-tonsillectomy patients.", "title_normalized": "ancillary medications and outcomes in post tonsillectomy patients" }
[ { "companynumb": "US-JNJFOC-20180916153", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "IBUPROFEN" }, "drugadditional": "3", "d...
{ "abstract": "Embryonal tumor with multilayered rosettes (ETMR) are rare pediatric brain tumors with increased malignant potential. Despite the advances in multimodal treatment schemes the overall 5-year event free survival rates for ETMR are not favorable. Further, therapeutic regimes are limited to a case by case basis due to the limited amount of literature and guidelines available for treating childhood ETMR. We report one patient with refractory ETMR who was successfully treated by implementing a molecular profiling approach which identified the tyrosine kinase inhibitor dasatinib as a viable therapy. Our results suggest that utilizing this precision medicine approach might prove useful in treating patients with refractory ETMR.", "affiliations": "Texas Tech University Health Sciences Center at El Paso, El Paso, Texas, USA.;Texas Tech University Health Sciences Center at El Paso, El Paso, Texas, USA.;Texas Tech University Health Sciences Center at El Paso, El Paso, Texas, USA.;Texas Tech University Health Sciences Center at El Paso, El Paso, Texas, USA.;Department of Biological Sciences, The University of Texas at El Paso, El Paso, Texas, USA.;Department of Biological Sciences, The University of Texas at El Paso, El Paso, Texas, USA.;Department of Biological Sciences, The University of Texas at El Paso, El Paso, Texas, USA.", "authors": "Hartman|Lisa L R|LLR|;Oaxaca|Derrick M|DM|;Carcamo|Benjamin|B|;Wilson|Harry L|HL|;Ross|Jeremy A|JA|;Robles-Escajeda|Elisa|E|;Kirken|Robert A|RA|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.1159/000497380", "fulltext": "\n==== Front\nCase Rep OncolCase Rep OncolCROCase Reports in Oncology1662-6575S. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH–4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.ch 10.1159/000497380cro-0012-0211Case ReportIntegration of a Personalized Molecular Targeted Therapy into the Multimodal Treatment of Refractory Childhood Embryonal Tumor with Multilayered Rosettes (ETMR) Hartman Lisa L.R. abOaxaca Derrick M. acCarcamo Benjamin abWilson Harry L. abRoss Jeremy A. cRobles-Escajeda Elisa cKirken Robert A. c*aTexas Tech University Health Sciences Center at El Paso, El Paso, Texas, USAbEl Paso Children's Hospital, El Paso, Texas, USAcDepartment of Biological Sciences, The University of Texas at El Paso, El Paso, Texas, USA*Robert A. Kirken, Department of Biological Sciences, The University of Texas at El Paso, 500 West University Avenue, El Paso, TX 79968 (USA), E-Mail rkirken@utep.eduJan-Apr 2019 28 2 2019 28 2 2019 12 1 211 217 31 1 2019 31 1 2019 2019 Copyright © 2019 by S. Karger AG, Basel2019This article is licensed under the Creative Commons Attribution-NonCommercial-4.0 International License (CC BY-NC) (http://www.karger.com/Services/OpenAccessLicense). Usage and distribution for commercial purposes requires written permission.Embryonal tumor with multilayered rosettes (ETMR) are rare pediatric brain tumors with increased malignant potential. Despite the advances in multimodal treatment schemes the overall 5-year event free survival rates for ETMR are not favorable. Further, therapeutic regimes are limited to a case by case basis due to the limited amount of literature and guidelines available for treating childhood ETMR. We report one patient with refractory ETMR who was successfully treated by implementing a molecular profiling approach which identified the tyrosine kinase inhibitor dasatinib as a viable therapy. Our results suggest that utilizing this precision medicine approach might prove useful in treating patients with refractory ETMR.\n\nKey Words\nBrain tumorPediatricTargeted therapyTyrosine-kinase inhibitor\n==== Body\nIntroduction\nETMR (2016 WHO classification) are highly-malignant, and rare, brain tumors that primarily affect young children [1, 2]. Despite multimodal treatments that include surgery, radiotherapy, and chemotherapy, 3- and 5-year event free survival rates are approximately 34–57% and 19–38%, respectively [3, 4]. Moreover, neurocognitive impairment with current radiotherapy treatment strategies is a significant complication for survivors [5]. Implementing molecular biomarkers in the modulation of treatment strategies has proven promising for selectively treating ETMR. Further, utilizing an early multimodal treatment approach has demonstrated improved outcomes for patients with ETMR [4]. Currently, the treatment of ETMR is approached by utilizing a non-selective high dose chemotherapy in combination with a radiotherapy regimen, and in select cases, an autologous stem cell transplantation [6]. Due to the rare occurrences of pediatric cancers, clinical trials involving precision or personalized medicine in this unique population is limited. However, results taken from clinical trials utilizing a precision medicine approach in adult cancer patient populations can be used as examples for how precision medicine is transforming the field of oncology. Schwaederle et al. performed a meta-analysis of 570 phase II studies involving various cancers comparing the outcome end points and overall survival rates between trials that adopted a precision medicine approach. The results from this study highlighted better outcomes for patients who received treatment regimens based upon molecular profiling [7].\n\nRecently, the Children's Oncology Group (COG), in partnership with the National Cancer Institute (NCI), has launched the Pediatric Molecular Analysis for Therapeutic Choice (MATCH) protocol. This protocol entails the implementation of biomarker profiling coupled with single-arm phase II trials of targeted therapies. This initiative represents an important transition for Pediatric Oncology into the field of precision medicine [8].\n\nDevelopment of precision medicine regimens relies heavily on selecting therapeutics based upon the molecular profile of the tumor. Here we report the successful use of molecular profiling and dasatinib therapy with informed parental consent in the multimodal treatment of a 32-month-old patient with ETMR for whom standard therapy had failed.\n\nCase Report\nA 32-month-old, ex-29-week twin B female with no family history of cancer or congenital disease presented to the emergency department with complaints of recurrent headaches. Initial brain computerized tomography (CT) demonstrated a large solid and cystic intra axial tumor with coarse calcifications within the left parietal lobe resulting in significant midline shift. The tumor cyst was treated surgically by placing an Ommaya reservoir to drain cyst volume and relieve symptoms. Biopsy of tumor and cystic fluid allowed for the diagnosis of ETMR-NOS, WHO Grade IV, with extensive necrosis and calcification. The patient was placed on standard induction chemotherapy with each cycle consisting of vincristine (0.5 mg/kg/day, weekly), etoposide (2.5 mg/kg, days 1 through 3), cyclophosphomaide (60 mg/kg, days 1 and 2), cisplatin (3.5 mg/kg, day 3). During the third cycle of induction chemotherapy, the patient displayed symptoms consistent with chemotherapy toxicity. Brain magnetic resonance imaging (MRI), with and without contrast, demonstrated an increase in the bulk of the peripheral gyriform enhancing tumor mantel with reaccumulation of the large cystic cavity and progressive disease was noted. Subsequently, induction chemotherapy was discontinued, the solid tumor component was partially resected, and tumor cells studied.\n\nChromosome and FISH analysis presented a normal female karyotype with the exception of reported natural variants identified within chromosomes 14, 16, and 22 (data not shown). Patient tumor cells were obtained from excess diagnostic material through an approved study by the Institutional Review Board. Target proteins were subsequently analyzed using xMAP multiplex technology on the Luminex 200 platform coupled with xPONENT 3.1 software according to the manufacturer's suggested protocol. Cell signaling analysis was performed on the partially biopsied tumor which revealed an extensively activated tyrosine kinase signaling molecular profile. Additionally, this tumor was sectioned and imaged by transmission electron microscopy (TEM), as previously described [9]. The signaling profile of the ETMR tumor suggested dasatinib as a potentially viable therapy based upon observed SRC and PDGFR activity (see below). Irradiation therapy was not considered a viable option due to the unwanted side effects of radiation on the developing brain.\n\nA four-month therapy of dasatinib (one 20 mg tablet twice daily) was well-tolerated by the patient. MRI, multiplanar T1, FLAIR, T2, gradient echo and postcontrast diffusion imaging was performed pre- and post-dasatinib treatment to quantitate clinical response. As shown (Fig. 1a, b), the anterior to posterior cystic component was markedly decreased by a 3.46 cm reduction which also coincided with a 0.3 cm reduction in size for the solid tumor component. The MRI images of the post operation and 2-year follow up were also found to be clear of visible tumor component (Fig. 1B). The analysis of pre- and post-dasatinib was observed to be molecularly effective in the treatment of this progressive refractory ETMR based on Ki67 proliferation index staining, which displayed decreased proliferation activity (Fig. 2A). Analysis of tumor cell signaling molecules revealed that dasatinib treatment decreased activation of receptor tyrosine kinases PDGFRa and PDGFRb (Fig. 2Bi). Analysis of the activated forms of Src family kinases including SRC, FYN, and LYN were all observed to be significantly reduced (Fig. 2Bii). In addition, activated forms of downstream molecules including STAT1, STAT3, and ERK1/2 were also markedly reduced in response to dasatinib treatment (Fig. 2Biii). Transmission electron microscopy (TEM) of pre- (Fig. 2Ci, Cii) and post dasatinib therapy (Fig. 2Ciii, Civ) illustrated the impact by allowing visualization of increased changes with tumor ultrastructure suggestive of induced cellular autophagy of the ETMR.\n\nIn summary of this case, implementing a molecular guided approach in pediatric ETMR allowed for the effective utilization of dasatinib therapy. Dasatinib therapy significantly reduced the brain tumor size allowing for a total resection of the residual tumor (Fig. 1B). An EEG at four months post-surgery demonstrated an unremarkable symmetric profile. Five years post resection, the patient remains disease free, with no evidence of recurrent tumor.\n\nDiscussion\nMolecularly targeted therapies have transformed the treatment of cancer [10]; however successful application of pathway-specific inhibitors remains a challenge. The off-label usage of chemotherapeutic agents based on tumor biomarker expression is being heavily investigated. The COG and NCI Pediatric MATCH trial is highly anticipated to advance precision medicine treatment schemes forward in relapsed and refractory pediatric cancer [8]. Currently, at the adult cancer patient level multiple studies have demonstrated the benefit of precision medicine. For example, Tsimberidou et al., investigated the benefit of utilizing molecular profiling to match targeted agents with tumor molecular aberrations in a Phase I Clinical Trials Program. Their study involved the analysis of 1,144 patients, from which 175 were given therapies based upon results identified through molecular profiling. The patients that received a precision medicine treatment regimen demonstrated higher overall response rates compared to their counterparts who were given therapies based on standard protocols [11]. More recent success was reported by Kris et al., who demonstrated the potential of multiplex assays in aiding physicians in selecting therapies for treating 275 of 1,007 patients with metastatic lung adenocarcinomas. The results from this study revealed increased survival rates for patients receiving therapies based on multiplex assays [12]. A meta-analysis performed by Fontes Jardim et al. systematically reviewed the results of 112 clinical trials conducted over a ten-year period and compared the efficacy of trials that incorporated a molecular profiling approach. This comprehensive analysis suggested that molecular profiling can be safe and have improved efficacy outcomes with FDA-approved anticancer agents [13]. With the Pediatric MATCH trial underway, it is expected that similar results will be identified in the pediatric cancer population.\n\nIt is estimated that 8.2 million individuals die from cancer worldwide and such trends are expected to increase over the next decade [14]. Most patients with metastatic or refractory cancer will exhaust all conventional therapy options. Better understanding of aberrantly regulated signaling networks, at an individualized level, will be critical for developing rational targeted therapies to overcome drug resistance in tumors such as those present in ETMR patients with refractory disease. The results presented herein could aid future ETMR patient stratification schemes that recruit similar molecular activation pathway strategies. Thus, larger clinical studies employing this approach are perhaps warranted.\n\nStatement of Ethics\nThe authors have no ethical conflicts to disclose.\n\nDisclosure Statement\nThe authors declare that there is no conflict of interest.\n\nAcknowledgement\nThis work was supported by grants and gifts from the Lizanell and Colbert Coldwell Foundation, Edward N. and Margaret G. Marsh Foundation, The Shiloff Family Foundation, and Grant 5G12MD007592 from the National Institute on Minority Health and Health Disparities, National Institutes of Health.\n\nFig. 1. Brain MRI Demonstrating ETMR Response to Dasatinib Treatment. (A) Cystic component and tumor component measurements demonstrating increased ETMR tumor response to dasatinib treatment. Marked reductions in both cystic and tumor components was noted. (B) Treatment time course demonstrating overall clinical time course. Baseline MRI and Post Induction Treatment (Rx) MRI demonstrated interval increase in bulk of peripheral gyriform enhancing tumor mantle with re-accumulation of the large cystic cavity. Post dasatinib Rx MRI displayed an overall volume reduction of tumor, cystic cavity, and mantle involvement within the parieto-occipital region. Tumor volume reduced from 1.66 cm to 1.36 cm. (AP: Anterior-Posterior; SI: Superior-Inferior). * Tumor Component measured at widest margin.\n\nFig. 2. Patient tumor molecular response and ultrastructural changes to dasatinib treatment. (A) Ki-67 immunopositivity decreased from (i) 50–60% to (ii) 5% post-dasatinib treatment. (B) Aberrant activation of (i) RTKs: PDGFRa/b, (ii) SFKs: SRC, FYN, and LYN, and (iii) downstream ERK1/2 and STAT1/3 effectors were significantly reduced in the post-dasatinib Rx tumor. Student's t-tests were employed using SigmaStat3.1 software. p values < 0.05 (*) and < 0.01 (**) were considered statistically significant. (C) Ultrastructural examination of ETMR tumor pre- (i, ii) and post-dasatinib Rx (iii, iv). Autophagocytic vacuoles (green arrows) and predominance of nuclear heterochromatin (red arrows) compared to euchromatin (blue arrows) are indicated.\n==== Refs\nReferences\n1 Louis DN Perry A Reifenberger G von Deimling A Figarella-Branger D Cavenee WK The 2016 World Health Organization Classification of Tumors of the Central Nervous System: a summary Acta Neuropathol 2016 6 131 (6) 803 20 27157931 \n2 Pickles JC Hawkins C Pietsch T Jacques TS CNS embryonal tumours: WHO 2016 and beyond Neuropathol Appl Neurobiol 2018 2 44 (2) 151 62 28949028 \n3 Geyer JR Sposto R Jennings M Boyett JM Axtell RA Breiger D Children's Cancer Group Multiagent chemotherapy and deferred radiotherapy in infants with malignant brain tumors: a report from the Children's Cancer Group J Clin Oncol 2005 10 23 (30) 7621 31 16234523 \n4 Choi SH Kim SH Shim KW Han JW Choi J Kim DS Treatment Outcome and Prognostic Molecular Markers of Supratentorial Primitive Neuroectodermal Tumors PLoS One 2016 4 11 (4) e0153443 27074032 \n5 Padovani L André N Constine LS Muracciole X Neurocognitive function after radiotherapy for paediatric brain tumours Nat Rev Neurol 2012 10 8 (10) 578 88 22964509 \n6 Sung KW Lim DH Yi ES Choi YB Lee JW Yoo KH Tandem High-Dose Chemotherapy and Autologous Stem Cell Transplantation for Atypical Teratoid/Rhabdoid Tumor Cancer Res Treat 2016 10 48 (4) 1408 19 27034140 \n7 Schwaederle M Zhao M Lee JJ Eggermont AM Schilsky RL Mendelsohn J Impact of Precision Medicine in Diverse Cancers: A Meta-Analysis of Phase II Clinical Trials J Clin Oncol 2015 11 33 (32) 3817 25 26304871 \n8 Allen CE Laetsch TW Mody R Irwin MS Lim MS Adamson PC Pediatric MATCH Target and Agent Prioritization Committee Target and Agent Prioritization for the Children's Oncology Group-National Cancer Institute Pediatric MATCH Trial J Natl Cancer Inst 2017 5 109 (5) \n9 Ross JA Nagy ZS Kirken RA The PHB1/2 phosphocomplex is required for mitochondrial homeostasis and survival of human T cells J Biol Chem 2008 2 283 (8) 4699 713 18086671 \n10 Arora A Scholar EM Role of tyrosine kinase inhibitors in cancer therapy J Pharmacol Exp Ther 2005 12 315 (3) 971 9 16002463 \n11 Tsimberidou AM Iskander NG Hong DS Wheler JJ Falchook GS Fu S Personalized medicine in a phase I clinical trials program: the MD Anderson Cancer Center initiative Clin Cancer Res 2012 11 18 (22) 6373 83 22966018 \n12 Kris MG Johnson BE Berry LD Kwiatkowski DJ Iafrate AJ Wistuba II Using multiplexed assays of oncogenic drivers in lung cancers to select targeted drugs JAMA 2014 5 311 (19) 1998 2006 24846037 \n13 Jardim DL Schwaederle M Wei C Lee JJ Hong DS Eggermont AM Impact of a Biomarker-Based Strategy on Oncology Drug Development: A Meta-analysis of Clinical Trials Leading to FDA Approval J Natl Cancer Inst 2015 9 107 (11) djv253 26378224 \n14 Ferlay J Soerjomataram I Dikshit R Eser S Mathers C Rebelo M Cancer incidence and mortality worldwide: sourcesmethods and major patterns in GLOBOCAN 2012 Int J Cancer 2015 3 136 (5) E359 86 25220842\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1662-6575", "issue": "12(1)", "journal": "Case reports in oncology", "keywords": "Brain tumor; Pediatric; Targeted therapy; Tyrosine-kinase inhibitor", "medline_ta": "Case Rep Oncol", "mesh_terms": null, "nlm_unique_id": "101517601", "other_id": null, "pages": "211-217", "pmc": null, "pmid": "31011318", "pubdate": "2019", "publication_types": "D002363:Case Reports", "references": "16002463;16234523;18086671;22964509;22966018;24846037;25220842;26304871;26378224;27034140;27074032;27157931;28376230;28949028", "title": "Integration of a Personalized Molecular Targeted Therapy into the Multimodal Treatment of Refractory Childhood Embryonal Tumor with Multilayered Rosettes (ETMR).", "title_normalized": "integration of a personalized molecular targeted therapy into the multimodal treatment of refractory childhood embryonal tumor with multilayered rosettes etmr" }
[ { "companynumb": "US-PFIZER INC-2019232397", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "VINCRISTINE SULFATE" }, "drugadditional": null...
{ "abstract": "We present a rare cause of iridocyclitis in a patient with vitiligo and type 1 diabetes who showed poor metabolic control, and suffered from remitting fever, weight loss, fatigue, diffuse arthralgias and reduced visual acuity. Mild systemic symptoms coupled with increased cholestasis enzymes, insulin resistance, mild inflammation and a functioning adrenal gland focused our clinical work-up on granulomatous causes of iridocyclitis. Specific tests confirmed syphilis, with no involvement of the central nervous system. Ocular syphilis, despite being unusual, can be the only manifestation of the disease. The work-up of any unexplained ocular inflammation should include testing for syphilis so as to not delay the diagnosis.", "affiliations": "Department of Clinical and Experimental Medicine, University of Pisa, Pisa, Italy.;Department of Clinical and Experimental Medicine, University of Pisa, Pisa, Italy.;Department of Clinical and Experimental Medicine, University of Pisa, Pisa, Italy.", "authors": "Comassi|Mario|M|;Natali|Andrea|A|;Solini|Anna|A|", "chemical_list": null, "country": "Japan", "delete": false, "doi": "10.1111/jdi.12447", "fulltext": "\n==== Front\nJ Diabetes InvestigJ Diabetes Investig10.1111/(ISSN)2040-1124JDIJournal of Diabetes Investigation2040-11162040-1124John Wiley and Sons Inc. Hoboken 10.1111/jdi.12447JDI12447Case ReportArticlesClinical Science and CareSyphilis iridocyclitis in a patient with type 1 diabetes Comassi et al.Comassi Mario \n1\nNatali Andrea \n1\nSolini Anna \n1\n1 Department of Clinical and Experimental MedicineUniversity of PisaPisaItaly* Correspondence\n\nAnna Solini\n\nTel.: +39‐050993482\n\nFax: +39‐050553235\n\nE‐mail address: anna.solini@med.unipi.it\n25 12 2015 7 2016 7 4 10.1111/jdi.2016.7.issue-4641 644 19 6 2015 28 10 2015 08 11 2015 © 2015 The Authors. Journal of Diabetes Investigation published by Asian Association for the Study of Diabetes (AASD) and John Wiley & Sons Australia, LtdThis is an open access article under the terms of the Creative Commons Attribution‐NonCommercial‐NoDerivs License, which permits use and distribution in any medium, provided the original work is properly cited, the use is non‐commercial and no modifications or adaptations are made.Abstract\nWe present a rare cause of iridocyclitis in a patient with vitiligo and type 1 diabetes who showed poor metabolic control, and suffered from remitting fever, weight loss, fatigue, diffuse arthralgias and reduced visual acuity. Mild systemic symptoms coupled with increased cholestasis enzymes, insulin resistance, mild inflammation and a functioning adrenal gland focused our clinical work‐up on granulomatous causes of iridocyclitis. Specific tests confirmed syphilis, with no involvement of the central nervous system. Ocular syphilis, despite being unusual, can be the only manifestation of the disease. The work‐up of any unexplained ocular inflammation should include testing for syphilis so as to not delay the diagnosis.\n\nIridocyclitisSyphilisType 1 diabetes source-schema-version-number2.0component-idjdi12447cover-dateJuly 2016details-of-publishers-convertorConverter:WILEY_ML3GV2_TO_NLMPMC version:4.9.1 mode:remove_FC converted:04.07.2016\n\nJ Diabetes Investig \n2016 ; 7 : 641 –644\n==== Body\nIntroduction\nOcular involvement is common in autoimmune disorders; conversely, patients with autoimmune polyglandular syndrome (APS) frequently show vitiligo, alopecia, pernicious anemia, chronic hepatitis and uveitis1, 2. Transgenic mice deficient for the autoimmune regulator gene develop type 1 APS and uveitis3. Therefore, searching for other autoimmunity diseases is mandatory in the clinical suspect of APS.\n\nThe combination of type 1 diabetes, vitiligo, thyroid disorders and adrenal insufficiency suggests the presence of type 2 APS4; other combinations of organ‐specific autoimmune disease are compatible with type 3 or type 4 APS; however, the autoimmune disease might occur progressively within a wide age span, making the diagnosis difficult. With all this in mind, we suspected an autoimmune origin of iridocyclitis that developed in a patient with vitiligo, type 1 diabetes, alopecia and thyroid disease.\n\nCase Report\nA 61‐year‐old man with type 1 diabetes and long‐lasting poor metabolic control (glycated hemoglobin 100 mmol/mol, 11.3%) despite a 96‐IU basal–bolus insulin regimen was referred to our clinic at the Department of Clinical and Experimental Medicine University of Pisa, Pisa, Italy. His clinical history showed vitiligo, a previous hyperthyroidism corrected with methimazole, a cholecystectomy for gall bladder stones and a prior diagnosis of chronic obstructive pulmonary disease.\n\nAt the age of 43 years, after a sudden retinal detachment in the left eye, diabetes was diagnosed; insulin therapy was started without further characterization of the disease.\n\nFour months before coming to our attention, the patient suffered for 2 months from a remittent fever (38.5°C), not associated with shivering, and weight loss (−10%); routine blood tests were normal except for mild abnormalities in aspartate aminotransferase, alanine aminotransferase, γ‐glutamyl transferase and alkaline phosphatase. Then he developed a progressive reduction of visual acuity in the right eye; an iridocyclitis was diagnosed, whose etiology was not investigated. He also reported unstable glycemic control, requiring a significant increase in total daily insulin dose, associated with weight loss, fatigue, diffuse arthralgias persisting throughout the day and declining during the night, and sporadic recurrence of mild fever (37–37.5°C).\n\nClinical examination\nThe patient was hemodynamically stable. His skin showed signs of segmental vitiligo. His head showed sparse alopecia. An eye examination found bilateral mild miosis with a turbid right iris, and depigmented redness around the cornea and conjunctiva. His thyroid was palpable, with small nodules. Cardiac action was eurhythmic, with no murmurs. A chest examination found kyphosis with sounds of bronchoconstriction. His abdomen was not painful; there was no appreciable liver and spleen enlargement. His genitourinary system showed nothing remarkable. There was no peripheral edema. A neurological examination was normal, apart from a reduction of visual acuity in the right eye.\n\nBiochemical parameters\nComplete blood count, C‐reactive protein, international normalized ratio, activated partial thromboplastin time, blood urea nitrogen, creatinine, uric acid, total protein, bilirubin, lipid profile, creatine kinase, pancreatic amylase and lipase showed normal values. The patient was negative for hepatitis B virus, hepatitis C virus and HIV. Anti‐mitochondrial antibodies, anti‐smooth muscle antibodies, anti‐neutrophil cytoplasmic antibodies, extractable nuclear antigens, anti‐liver kidney microsomal antibodies, scleroderma‐70 kD extractable immunoreactive fragment antibodies, rheumatoid arthritis test, anti‐tissue transglutaminase antibodies, endomysial antibodies, deamidated gliadin peptide antibodies and hormones (thyroid‐stimulating hormone, free tri‐iodothyronine, free thyroxine, adrenocorticotrophic hormone, cortisol, luteinizing hormone, follicle‐stimulating hormone, free testosterone, growth hormone, prolactin, parathyroid hormone) were all normal, as well as thyroid autoantibodies (anti‐thyroglobulin autoantibodies and anti‐thyroid peroxidase autoantibodies: <1 IU/mL for both). A slight positivity of anti‐surrenal gland antibodies was evident. Gamma‐glutamyl transferase (115 U/L; normal value <60), alkaline phosphatase (194 U/L; <115) and erythrocytes sedimentation rate (38 mm/h) showed altered values.\n\nThe presence of glutamic acid decarboxylase and tyrosine phosphatase‐like protein IA2 antibodies with undetectable C‐peptide confirmed type 1 diabetes. Despite insulin uptitration, glucose values were extremely variable, with mild hypoglycemic episodes and frequent, severe hyperglycemia. Common causes of poor glycemic control, including neoplasms, were excluded. The combination of vitiligo, alopecia, type 1 diabetes, previous hyperthyroidism and the presence of positive adrenal antibodies allowed the suspicion of type 2 APS, but adrenal function was normal. Therefore, low‐grade fever, fatigue and weight loss, increased cholestasis enzymes, insulin resistance, and mild inflammation focused our clinical work‐up on the granulomatous causes of iridocyclitis: the sexual habits of the patient were investigated; treponemal screening was 40.95 S/CO (normal value <1.0) and a treponemal test found: Treponema pallidum hemoagglutination assay >1:40960, immunoglobulin G and immunoglobulin M positivity for Treponema pallidum, and fluorescent treponemal antibody absorption positive 3+/4+.\n\nAlthough international guidelines for treatment suggest penicillin‐G as the first‐choice drug for the treatment of all stages of syphilis5, we started with ceftriaxone and doxycycline, continuing at home with benzathine penicillin (four intramuscular doses of 2.4 MU each at 1‐week interval). Immediately after the first dose of ceftriaxone and doxycycline, the patient developed a Jarish–Herxheimer reaction (as a result of a massive release of treponemal antigens); however, in the light of such a reaction and in order to prevent a possible worsening of the ocular manifestations, i.v. methylprednisolone had been administered before starting antimicrobial therapy.\n\nTo investigate central nervous system involvement, brain magnetic resonance imaging was carried out (signs of a previous optic neuritis). Lumbar puncture was postponed, as the patient was HIV‐negative and iridocyclitis was the only neurological manifestation of the disease.\n\nDuring the follow up, the patient reported subjective well‐being with rapid improvement of visual acuity and eye inflammation (Figure 1). Glycemic control, though still suboptimal, was obtained with a total of 58 IU of insulin. Six months after the diagnosis, Treponema pallidum hemoagglutination assay was 1:10240 and venereal disease research laboratory 1:16.\n\nFigure 1 The (a) eyes status and (b) vitiligo (detail of the hands) 4 months after the diagnosis.\n\nDiscussion\nDespite the presence of a clinical phenotype suggestive of APS, the nature of this iridocyclitis was not related to the autoimmune disorder. Acute anterior uveitis can be idiopathic, sometimes HLA‐B27‐linked or granulomatous, the latter either associated with systemic infectious processes, such syphilis, Lyme disease, tuberculosis or herpetic viral infections, or sarcoidosis. In this perspective, specific serology tests should be arranged in case of intractable uveitis of uncertain origin, especially in HIV patients, where macular palcoid chorioretinitis can occur6.\n\nIn Italy, 720 cases of syphilis were recorded in the National Health Registry in 2007; 78% occurred in male subjects. According to 2011 World Health Organization data, the estimated number of new cases of curable sexually transmitted diseases in adults, in Europe, is 20 million, of which, in 2010, 17,884 were cases of syphilis7. In the post‐war period, a relationship between syphilis and diabetes was described; recently, an increased prevalence of type 2 diabetes has been reported among patients with neurosyphilis; these patients were also characterized by a worse metabolic pattern, with higher fasting glucose and glycated hemoglobin levels8.\n\nOcular manifestation of syphilis can occur at any stage of the disease, mimic a wide range of ocular disorders, and lead to misdiagnoses and delay in the administration of appropriate antimicrobial therapy. Syphilis is a rare cause of uveitis; it might occur 6 weeks after primary infection, sometimes being the only systemic sign of secondary syphilis, often characterized by optic neuropathy.\n\nThe diagnosis of syphilis in the present patient was, in fact, delayed; a meditated interpretation of the clinical history and a critically‐oriented analysis of laboratory tests would have allowed us to rapidly formulate a correct diagnosis. In fact, as early as 4 months before coming to our attention, the patient started to report symptoms not clearly related to a rise in the hepatobiliary indices in a long term‐cholecystectomized individual. Therefore, a screening for hepatotropic viruses, syphilis and HIV should had been carried out even at that time, because of the presence of risk behaviors. When iridocyclitis developed, it was considered an autoimmune epiphenomenon of a coexisting APS, with this view being supported by the low‐grade inflammation and the worsening glycemic control. Such a hypothesis allowed us to also explain flu‐like symptoms and fever; on the same basis, the suspicion of syphilitic etiology could have been made previously. We attributed the modest rise in liver enzymes to hepatosteatosis, likely worsened by the metabolic and inflammatory derangement. However, it is good practice, when there is an increase in transaminases or cholestasis indexes in the absence of hepatitis or hepatobiliary disease, to carry out screening tests for syphilis, given that various degrees of hepatobiliary involvement are reported in early and late stages of syphilis9, 10. An attempt to correctly define the patient's phenotype, even in the presence of an atypical presentation of the disease (Figure 2), is of particular relevance in a perspective of prevention and early treatment aiming at reducing severe complications and improving the prognosis.\n\nFigure 2 The natural history of syphilis in the patient. CNS, central nervous system.\n\nDisclosure\nThe authors declare no conflict of interest.\n\nAcknowledgments\nThis study did not receive any financial support.\n==== Refs\nReferences\n1 \n\nMohsenin \nA \n, \nHuang \nJJ \n. Ocular manifestations of systemic inflammatory diseases . Conn Med \n2012 ; 76 : 533 –544 .23155672 \n2 \n\nDavies \nJB \n, \nRao \nPK \n. Ocular manifestations of systemic lupus erythematosus . Curr Opin Ophthalmol \n2008 ; 19 : 512 –518 .18998618 \n3 \n\nDeVoss \nJJ \n, \nShum \nAK \n, \nJohannes \nKPA \n, et al\nEffector mechanisms of the autoimmune syndrome in the murine model of Autoimmune Polyglandular Syndrome Type 1 . J Immunol \n2008 ; 181 : 4072 –4079 .18768863 \n4 \n\nEisenbarth \nGS \n, \nGottlieb \nPA \n. Autoimmune polyendocrine syndromes . N Engl J Med \n2004 ; 350 : 2068 –2079 .15141045 \n5 \n\nJanier \nM \n, \nHegyi \nV \n, \nDupin \nN \n, et al\n2014 European guideline on the management of syphilis . J Eur Acad Dermatol Venereol \n2014 ; 28 : 1581 –1593 .25348878 \n6 \n\nOkada \nAA \n, \nJabs \nDA \n. The standardization of uveitis nomenclature project: the future is here . JAMA Ophthalmol \n2013 ; 131 : 787 –789 .23764704 \n7 \nWorld Health Organization \n. Prevalence and incidence of selected sexually transmitted infections, Chlamydia trachomatis, Neisseria gonorrhoeae, syphilis and Trichomonas vaginalis . Geneva , World Health Organization , 2011 Available at http://whqlibdoc.who.int/publications/2011/9789241502450_eng.pdf\n\n8 \n\nYang \nT \n, \nTong \nM \n, \nXi \nY \n, et al\nAssociation between neurosyphilis and diabetes mellitus: resurgence of an old problem . J Diabetes \n2014 ; 6 : 403 –408 .24393446 \n9 \n\nLee \nRV \n, \nThornton \nGF \n, \nConn \nHO \n. Liver disease associated with secondary syphilis . N Engl J Med \n1971 ; 284 : 1423 –1425 .4931102 \n10 \n\nIshikawa \nM \n, \nShimizu \nI \n, \nUehara \nK \n, et al\nA patient with early syphilis complicated by fatty liver who showed an alleviation of hepatopathy accompanied by jaundice after receiving anti‐syphilitic therapy . Intern Med \n2006 ; 45 : 953 –956 .16974057\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2040-1116", "issue": "7(4)", "journal": "Journal of diabetes investigation", "keywords": "Iridocyclitis; Syphilis; Type 1 diabetes", "medline_ta": "J Diabetes Investig", "mesh_terms": null, "nlm_unique_id": "101520702", "other_id": null, "pages": "641-644", "pmc": null, "pmid": "27180731", "pubdate": "2016-07", "publication_types": "D002363:Case Reports", "references": "18998618;15141045;18768863;4931102;23155672;27180731;16974057;25348878;23764704;24393446", "title": "Syphilis iridocyclitis in a patient with type 1 diabetes.", "title_normalized": "syphilis iridocyclitis in a patient with type 1 diabetes" }
[ { "companynumb": "IT-BAUSCH-BL-2016-019072", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": null, "activesubstance": null, "drugadditional": null, "drugadministrationroute": "030", "drugauth...
{ "abstract": "BACKGROUND\nMucormycosis is a rare fungal infection, but can cause substantial morbidity and mortality in both immunocompromised and immunocompetent patients. Apophysomyces is a mucormycetes species ubiquitous in nature, particularly in soil, decaying wood and other organic matter. Apophysomyces is known to cause cutaneous fungal infections, particularly after penetrating trauma. Septic arthritis is a rare clinical manifestation.\n\n\nMETHODS\nWe describe a case of Apophysomyces trapeziformis causing septic arthritis of the knee of a patient with multiple myeloma. He was treated multiple times for bacterial septic arthritis with minimal improvement. Surgical tissue specimens finally grew mucoraceous mould, and DNA sequencing and morphological assessment of spores identified the mould as A. trapeziformis. The patient was treated with amphotericin B and posaconazole, but ultimately required an above-the-knee amputation for definitive treatment.\n\n\nCONCLUSIONS\nThis case illustrates the need to evaluate for fungal infection in a persistent septic arthritis that is culture negative and refractory to empiric antibiotics, particularly in an immunocompromised individual. It also shows the importance of a thorough social history and adequate tissue specimens for culture.", "affiliations": "Duke University Medical Center, 2100 Erwin Road, Durham, NC 27710, USA; Durham VA Medical Center, 508 Fulton Street, Durham, NC 27705, USA.;Duke University Medical Center , 2100 Erwin Road, Durham, NC 27710 , USA.;Durham VA Medical Center , 508 Fulton Street, Durham, NC 27705 , USA.;Durham VA Medical Center , 508 Fulton Street, Durham, NC 27705 , USA.;Duke University Medical Center, 2100 Erwin Road, Durham, NC 27710, USA; Durham VA Medical Center, 508 Fulton Street, Durham, NC 27705, USA.", "authors": "Bertumen|J Bradford|JB|;Schell|Wiley A|WA|;Joyce|Maria|M|;Alley|Christopher|C|;Woods|Christopher W|CW|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1099/jmmcr.0.005075", "fulltext": "\n==== Front\nJMM Case RepJMM Case RepJMMCRJMM Case Reports2053-3721Microbiology Society jmmcr00507510.1099/jmmcr.0.005075Case ReportBoneClinical MycologyFungal InfectionsHuman Pathogenic FungiMedical MycologyMycologyDiagnostic difficulty identifying Apophysomyces trapeziformis septic arthritis in a patient with multiple myeloma http://jmmcr.microbiologyresearch.orgApophysomyces trapeziformis septic arthritisJ. Bradford Bertumen and othersBertumen J. Bradford 12Schell Wiley A. 1Joyce Maria 2Alley Christopher 2Woods Christopher W. 121​ Duke University Medical Center, 2100 Erwin Road, Durham, NC 27710, USA2​ Durham VA Medical Center, 508 Fulton Street, Durham, NC 27705, USACorrespondence J. Bradford Bertumen jabejeebs@verizon.net12 2016 19 12 2016 3 6 e00507510 8 2016 28 11 2016 © 2016 The Authors2016This is an open access article under the terms of the Creative Commons Attribution 4.0 International License, which permits unrestricted use, distribution and reproduction in any medium, provided the original author and source are credited.Introduction:\nMucormycosis is a rare fungal infection, but can cause substantial morbidity and mortality in both immunocompromised and immunocompetent patients. Apophysomyces is a mucormycetes species ubiquitous in nature, particularly in soil, decaying wood and other organic matter. Apophysomyces is known to cause cutaneous fungal infections, particularly after penetrating trauma. Septic arthritis is a rare clinical manifestation.\n\nCase presentation:\nWe describe a case of Apophysomyces trapeziformis causing septic arthritis of the knee of a patient with multiple myeloma. He was treated multiple times for bacterial septic arthritis with minimal improvement. Surgical tissue specimens finally grew mucoraceous mould, and DNA sequencing and morphological assessment of spores identified the mould as A. trapeziformis. The patient was treated with amphotericin B and posaconazole, but ultimately required an above-the-knee amputation for definitive treatment.\n\nConclusion:\nThis case illustrates the need to evaluate for fungal infection in a persistent septic arthritis that is culture negative and refractory to empiric antibiotics, particularly in an immunocompromised individual. It also shows the importance of a thorough social history and adequate tissue specimens for culture.\n\nmucormycosisApophysomycesmouldmethenamine silver stainingseptic arthritisamputationOpenAccessEmbargo0Abbreviations:\nI&Dincision and drainage\n\nVAVeterans' Affairs\n\nWBCwhite blood cell\n==== Body\nIntroduction\nMucormycosis (zygomycosis) is a rare fungal infection caused by moulds in the order Mucorales. These moulds are ubiquitous in nature and can be found in soil, decaying wood and other organic matter (Neblett Fanfair et al., 2012). They can cause a variety of infections, with skin and soft tissue infections being a common clinical manifestation. These infections can be quite devastating, causing complications such as tissue necrosis and necrotizing fasciitis, especially in immunocompromised individuals (Neblett Fanfair et al., 2012). There is substantial morbidity and mortality associated with these infections (Vaezi et al., 2016).\n\nApophysomyces species are an unusual cause of mucormycosis, accounting for 3 % of cases reported in the literature (Echaiz et al., 2013). Cases involving this mould are usually associated with penetrating trauma, particularly after natural disasters. The species Apophysomyces trapeziformis was implicated in cases of necrotizing soft tissue infections following the tornado that ravaged Joplin, Missouri, in 2011 and the Indian Ocean tsunami in 2004 (Gomes et al., 2011; Neblett Fanfair et al., 2012).\n\nMucoraceous moulds rarely cause septic arthritis, with only a few case reports described (Mostaza et al., 1989; Parra-Ruiz et al., 2008). In this report, we present a patient with multiple myeloma who presented with persistent septic arthritis of the left knee, who ultimately was found to have A. trapeziformis growing from his synovial cultures. This case illustrates the importance of obtaining a thorough social history and adequate tissue samples for culture, as well as considering fungal infection in cases of septic arthritis where cultures are negative for bacterial growth and empiric antibiotic therapy is ineffective.\n\nCase report\nA 62-year-old African American male with a history of multiple myeloma previously treated with pamalidomide presented to a Veterans’ Affairs (VA) hospital with a 3 day history of progressive pain and swelling in the left knee as well as fever. X-ray of the left knee showed joint effusion. He underwent an arthroscopic incision and drainage (I&D) of the left knee, which revealed a cell count of 50 250 white blood cells (WBCs) cm−². Routine synovial cultures were negative for bacteria, and there were no crystals present in the fluid. The patient was started on vancomycin 1 g daily, pipercillin-tazobactam 3.375 g every 6 h and clindamycin 600 mg every 8 h prior to the procedure, and was continued on them while in the hospital. He was discharged on oral ciprofloxacin 500 mg twice a day and doxycycline 100 mg twice a day.\n\nFive days after discharge, he presented back to the same VA hospital with recurrence of left knee pain and swelling. Repeat I&D again showed purulent fluid with a cell count of 74 663 WBCs cm−². Again, the synovial cultures were negative for bacteria (of note, he was started on vancomycin 1 g daily and pipercillin-tazobactam 3.375 g every 6 h prior to the procedure once again). Synovial fungal and acid fast bacilli cultures were also sent at this time, and those were negative as well. The rheumatologist also evaluated the patient, and determined that the patient did not have rheumatoid arthritis (serum rheumatoid factor and serum cyclic citrullinated peptide antibody were both negative). The patient was treated empirically for septic arthritis again, first with vancomycin and pipercillin-tazobactam, and then was discharged on intravenous antibiotics with vancomycin 1 g daily and ertapenem 1 g daily for a total of 6 weeks of therapy. The patient was also treated empirically for gout, despite no crystals, first with colchicine 0.6 mg daily for 7 days, and then with a prednisone taper (40 mg daily for 5 days, 20 mg daily for 5 days and 10 mg daily for 4 days). He followed up in an orthopaedics clinic twice, and was noted to have mild improvement in his knee pain and swelling. He reported that his symptoms mildly improved after each procedure.\n\nApproximately 6 weeks after his discharge, the patient presented again to the VA hospital with 1 week of recurrent knee pain and swelling. Repeat I&D again revealed purulent fluid in the knee with a cell count of 155 200 WBCs cm−². There were atypical birefringent crystals in the fluid, with an appearance that was consistent with monosodium urate crystals.\n\nDiagnosis\nFollowing surgical I&D, joint tissue and synovial fluid were submitted for culture on routine microbiology media (sheep blood and chocolate agar). Overnight, the cultures revealed growth of a mould (Fig. 1). The isolate was referred to mycology for identification. Fungal synovial tissue cultures revealed moderate aseptate hyphae consistent with mucoraceous mould. The isolate was grown on potato dextrose agar (PDA) for 7 days and no sporulation was present. Approximately 0.5 cm2 of mycelium was bead milled for 2 min using 0.3 g of glass beads (710–1180 µm) in 700 µl of 200 mM Tris-HCl (pH 7.5), 250 mM NaCl, 25 mM EDTA and 1 % SDS. DNA was extracted using a phenol/chloroform/isoamyl alcohol procedure incorporating two 70 % ethanol wash steps. The internal transcribed spacer (ITS) region of the nuclear ribosomal DNA was amplified via PCR with the following steps: (1) 3 min at 95 °C; (2) 35 cycles of 30 s at 95 °C, 3 min at 58 °C and 1 min at 72 °C; and (3) 7 min extension at 72 °C using primer pair ITS1/ITS4. Sequencing of the amplicon (2× and 3× coverage) was performed by Eton Biosciences using primers ITS1, ITS2, ITS3, ITS4 and ApophyITS4b (5ʹ→3ʹ CTTGCTATAAACCTCGCCAAGA) (White et al., 1990). The isolate was deposited with GenBank under accession no. KF 463335.1. The 777 bp sequence, corresponding to the 18S rRNA gene, ITS1, 5.8S rRNA gene, ITS2 and 28S rRNA gene, showed a 99 % match to the sequence of the ex-typus Apophysomyces trapeziformis isolate (GenBank accession no. NR 137034.1) over the entire 777 bp sequence.\n\nFig. 1. (a) Growth of Apophysomyces trapeziformis on synovial culture plate (sheep blood). (b) Methenamine silver stain of mucoraceous mould in tibial bone surgical specimen.\n\nBecause no spores were produced after 1 week of incubation at 25 °C on PDA, an agar block containing the hyphae of the isolate was transferred to a plate containing 20 ml of sterile deionized water supplemented with 0.2 ml of 10 % filter-sterilized yeast extract solution, and incubated at 35 °C to induce sporulation (Padhye & Ajello, 1988). Sporulation occurred by day 7, and morphological assessment of the sporangiophores and sporangiospores also confirmed the isolate as A. trapeziformis. Antifungal susceptibilities were not performed.\n\nRepeat X-ray showed worsening changes in the left knee, including joint space loss as well as osseous involvement with permeative appearance of the proximal tibia with aggressive periostitis. Magnetic resonance imaging of the left knee was consistent with septic arthritis complicated by multiple extra-articular and intramuscular abscesses, as well as air in the proximal tibia.\n\nWe obtained further history on the patient to determine the portal of entry for this mould. The patient noted that he had stepped on a nail with his left foot while living on a farm approximately 1 year before this admission. The wound healed after a few weeks.\n\nTreatment\nThe patient was started on liposomal amphotericin B (Ambisome) 300 mg daily when his synovial fungal cultures came back positive for mould. In addition to the antifungal treatment, we discussed surgical options with the patient along with the orthopaedics team. The patient was presented the choice between prolonged antifungal therapy plus extensive debridement of the left knee joint and the adjacent infected bone vs. left above-the-knee amputation followed by 2 weeks of Ambisome, then 6 weeks of posaconazole 400 mg twice a day for step-down therapy. He ultimately chose the above-the-knee amputation surgery as he did not want to deal with the subsequent debilitation of the debridement option, and tolerated the surgery well. Pathology, including methenamine silver staining, was performed on the tibial bone, which showed dense necrosis and inflammation of the tibial bone at the knee and surrounding soft tissue. There were numerous thick ribbon-like fungal forms with uncommon branching but no septa, confirming the presence of invasive mucorales osteomyelitis (Fig. 1). He was treated with the antifungal regimen previously outlined.\n\nOutcome and follow-up\nThe patient was seen twice in the infectious disease clinic. He tolerated the posaconazole therapy well and, other than phantom pain, denied any further issues with the left lower extremity. Despite recovery from his fungal septic arthritis, the patient still had progressive multiple myeloma, and he died from his disease 2 years after the mucormycosis infection.\n\nDiscussion\nApophysomyces species were first isolated in 1979 from soil in northern India, and subsequently found in the United States, Australia, Central America and South America. The first case of human infection with this mould was in Arizona in 1985 (Gomes et al., 2011). Penetrating trauma is a common route of infection. Despite occurring 1 year prior to presentation, we believe that it is possible our patient was infected when he stepped on a nail while living in a rural part of the country. If this history was known during his first or second presentation, the differential could have been broadened to fungal infections, and perhaps his leg could have been saved.\n\nThe most common risk factors other than penetrating trauma for Apophysomyces include diabetes mellitus, iron-rich states, acidaemia, immunosuppressive conditions such as organ transplantation, alcoholic cirrhosis and myelofibrosis (Gomes et al., 2011; Neblett Fanfair et al., 2012). Its main mechanism of pathogenesis is vascular invasion which causes thrombosis, which can lead to tissue necrosis. This can happen within days of inoculation (Gomes et al., 2011).\n\nSeptic arthritis caused by mucormycetes is very unusual. In a 10 year retrospective study at a comprehensive cancer centre, there were 28 cases of fungal osteoarticular infection in patients, with 24 of those cases caused by moulds. Only five of those cases were caused by mucoraceous moulds. Of the 28 cases, only two were classified as septic arthritis (Kumashi et al., 2006). There have been a few case reports of mucoraceous mould causing septic arthritis. There is one case of Absidia corymbifera causing septic arthritis in a patient with AIDS. The exact mechanism of inoculation was not determined (Parra-Ruiz et al., 2008). There was also a case of Cunninghamella bertholletiae articular mucormycosis, also in a patient with AIDS. This was caused by cutaneous infection in the left thigh that infected the left knee joint via contiguous spread (Mostaza et al., 1989).\n\nAlthough Apophysomyces species are capable of infecting immunocompetent patients, immunocompromised patients like our patient are certainly at greater risk for mucormycosis infections. In a review of 929 reported cases of mucormycosis between 1940 and 2003, 154 (16.6 %) of those cases had a malignancy, and of those cases, 147 of them (95 %) had a haematological malignancy (Roden et al., 2005). Furthermore, the patient’s synovial WBC count increased after his steroid taper for presumptive gout. Corticosteroid use is a risk factor for mucormycosis, and it is possible that this patient’s steroid use led to this laboratory finding (Gomes et al., 2011).\n\nThe absence of growth on his two earlier synovial cultures is consistent with mucormycosis as it is tissue-invasive and difficult to recover without an adequate tissue specimen. When mould grows, it usually appears within 12–24 h. Apophysomyces species are frequently slow to sporulate on primary isolation media used for cultivation of filamentous fungi (Echaiz et al., 2013). In addition, the hyphae of mucoraceous moulds are very delicate and the lack of septated hyphae prevents compartmentalization of the cytoplasm into cells. Therefore, agitation of tissue specimens or fluid samples, such as grinding or homogenization, may rupture the hyphae and render them non-viable, causing a false negative (Walsh et al., 2012).\n\nAt the time of the case, there were only two antifungal therapies approved by the Food and Drug Administration (FDA) for treatment of mucormycosis: amphotericin B and posaconazole (Neblett Fanfair et al., 2012). In this patient’s case, antifungal susceptibilities were not automatically tested, and his antifungal therapy was chosen based on previously published data on mucormycosis infections. Amphotericin B usually has the best in vitro activity against mucor species, although strains of Apophysomyces elegans have been shown to be more resistant to amphotericin, with MIC50 and MIC90 values of 2 and 4 µg ml−1, respectively (Chakrabarti et al., 2010). Posaconazole is the first azole drug to demonstrate good mucor activity, with MICs ≤1 µg ml−1 (Chakrabarti et al., 2010). As with most cutaneous and osteoarticular fungal infections, therapy is a combination of antifungal therapy as well as surgical debridement (Roden et al., 2005). He opted for an amputation, which provided definitive source control, so ultimately antifungal susceptibilities were not requested for his isolate.\n\nOutcomes have improved with mucormycosis infection with the advent of effective antifungal therapies and earlier diagnosis. If no therapy (antifungal or surgical) is administered, the outcome is nearly universally fatal. In a review of 929 mucormycosis cases, there was a 62.4 % survival rate among patients who received antifungal therapy alone, and a 57 % survival rate for patients who received surgery alone. Dual treatment with antifungal therapy and surgery resulted in a 70 % survival rate (Roden et al., 2005). In a systematic review performed in Iran, overall mortality in 98 mucormycosis patients over 25 years was 40.8 %. Those patients who received any antifungal therapy had a survival rate of 61.0 % and those who received only surgery had a rate of 71.4 %. Those patients who received dual therapy of antifungals and surgery had a survival rate of 66.7 %. There were only four patients who received no therapy at all, and none of them survived. No patient with subcutaneous mucormycosis died (Vaezi et al., 2016). These data demonstrate the important of both medical therapy and surgical debridement, but also show that even with aggressive therapy, mortality can still be high.\n\nIn conclusion, septic arthritis caused by mucormycetes is extremely rare, and we have presented here a case of A. trapeziformis septic arthritis. This case illustrates that clinicians should have fungal infection on their differential diagnosis if a septic arthritis patient fails to respond to empiric antibacterial treatment, especially if the patient is immunocompromised. It also shows the importance of prompt diagnosis; submission of adequate surgical tissue to recover the mould; initiation of both antifungal and surgical therapy; and a thorough social history in these patients.\n==== Refs\nReferences\nChakrabarti A. Shivaprakash M. R. Curfs-Breuker I. Baghela A. Klaassen C. H. Meis J. F. (2010 ). Apophysomyces\nelegans: epidemiology, amplified fragment length polymorphism typing, and in vitro antifungal susceptibility pattern . J Clin Microbiol 48 4580 –4585 .10.1128/JCM.01420-10 20881165 \nEchaiz J. F. Burnham C. A. Bailey T. C. (2013 ). A case of Apophysomyces trapeziformis necrotizing soft tissue infection . Int J Infect Dis 17 e1240–e1242 .10.1016/j.ijid.2013.06.008 23891642 \nGomes M. Z. Lewis R. E. Kontoyiannis D. P. (2011 ). Mucormycosis caused by unusual mucormycetes, non-Rhizopus, -Mucor, and -Lichtheimia species . Clin Microbiol Rev 24 411 –445 .10.1128/CMR.00056-10 21482731 \nKumashi P. R. Safdar A. Chamilos G. Chemaly R. F. Raad I. I. Kontoyiannis D. P. (2006 ). Fungal osteoarticular infections in patients treated at a comprehensive cancer centre: a 10-year retrospective review . Clin Microbiol Infect 12 621 –626 .10.1111/j.1469-0691.2006.01471.x 16774557 \nMostaza J. M. Barbado F. J. Fernandez-Martin J. Peña-Yañez J. Vazquez-Rodriguez J. J. (1989 ). Cutaneoarticular mucormycosis due to Cunninghamella bertholletiae in a patient with AIDS . Rev Infect Dis 11 316 –318 .10.1093/clinids/11.2.316 2704928 \nNeblett Fanfair R. Benedict K. Bos J. Bennett S. D. Lo Y. C. Adebanjo T. Etienne K. Deak E. Derado G. (2012 ). Necrotizing cutaneous mucormycosis after a Tornado in Joplin, Missouri, in 2011 . N Engl J Med 367 2214 –2225 .10.1056/NEJMoa1204781 23215557 \nPadhye A. A. Ajello L. (1988 ). Simple method of inducing sporulation by Apophysomyces elegans and Saksenaea vasiformis . J Clin Microbiol 26 1861 –1863 .3183029 \nParra-Ruiz J. Peña-Monje A. Tomas-Jimenez C. Antelo-Lorenzo R. Escobar-Lara T. Hernández-Quero J. (2008 ). Septic arthritis due to Absidia corymbifera in a patient with HIV-1 infection . Infection 36 279 –281 .10.1007/s15010-007-6297-3 18084717 \nRoden M. M. Zaoutis T. E. Buchanan W. L. Knudsen T. A. Sarkisova T. A. Schaufele R. L. Sein M. Sein T. Chiou C. C. (2005 ). Epidemiology and outcome of zygomycosis: a review of 929 reported cases . Clin Infect Dis 41 634 –653 .10.1086/432579 16080086 \nVaezi A. Moazeni M. Rahimi M. T. de Hoog S. Badali H. (2016 ). Mucormycosis in Iran: a systematic review . Mycoses 59 402 –415 .10.1111/myc.12474 26906121 \nWalsh T. J. Gamaletsou M. N. McGinnis M. R. Hayden R. T. Kontoyiannis D. P. (2012 ). Early clinical and laboratory diagnosis of invasive pulmonary, extrapulmonary, and disseminated mucormycosis (zygomycosis) . Clin Infect Dis 54 S55 –60 .10.1093/cid/cir868 22247446 \nWhite T. J. Bruns T. Lee S. Taylor J. W. (1990 ). Amplification and direct sequencing of fungal ribosomal RNA genes for phylogenetics . PCR Protocols-a Guide to Methods and Applications , 315 –322 . Edited by Innis M. A. Gelfand D. H. Sninsky J. J. White T. J. New York, NY : Academic Press, Inc .\n\n", "fulltext_license": "CC BY", "issn_linking": "2053-3721", "issue": "3(6)", "journal": "JMM case reports", "keywords": "Apophysomyces; amputation; methenamine silver staining; mould; mucormycosis; septic arthritis", "medline_ta": "JMM Case Rep", "mesh_terms": null, "nlm_unique_id": "101639133", "other_id": null, "pages": "e005075", "pmc": null, "pmid": "28348796", "pubdate": "2016-12", "publication_types": "D002363:Case Reports", "references": "16774557;22247446;21482731;26906121;20881165;18084717;23891642;3183029;16080086;23215557;2704928", "title": "Diagnostic difficulty identifying Apophysomyces trapeziformis septic arthritis in a patient with multiple myeloma.", "title_normalized": "diagnostic difficulty identifying apophysomyces trapeziformis septic arthritis in a patient with multiple myeloma" }
[ { "companynumb": "US-CELGENEUS-USA-2017024848", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "PREDNISONE" }, "drugadditional": null, ...
{ "abstract": "Accidental injection into the digit from an epinephrine autoinjection device can cause discoloration, pain, and paresthesias. Although loss of digit is rare, treatment in the emergency department is commonly aimed at vasodilation of the affected tissue. We report two cases of accidental injection of epinephrine into the digits that were successfully treated with subcutaneous phentolamine injection with no adverse events.", "affiliations": "Department of Emergency Medicine, University of Rochester Medical Center, 601 Elmwood Avenue, Box 655, Rochester, NY 14642, USA.", "authors": "Bodkin|Ryan P|RP|;Acquisto|Nicole M|NM|;Gunyan|Holly|H|;Wiegand|Timothy J|TJ|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2013/586207", "fulltext": "\n==== Front\nCase Rep Emerg MedCase Rep Emerg MedCRIM.EMCase Reports in Emergency Medicine2090-648X2090-6498Hindawi Publishing Corporation 10.1155/2013/586207Case ReportTwo Cases of Accidental Injection of Epinephrine into a Digit Treated with Subcutaneous Phentolamine Injections Bodkin Ryan P. \n1\nAcquisto Nicole M. \n1\n\n2\n*http://orcid.org/0000-0002-9672-741XGunyan Holly \n1\nWiegand Timothy J. \n1\n1Department of Emergency Medicine, University of Rochester Medical Center, 601 Elmwood Avenue, Box 655, Rochester, NY 14642, USA2Department of Pharmacy, University of Rochester Medical Center, 601 Elmwood Avenue, Box 638, Rochester, NY 14642, USA*Nicole M. Acquisto: nicole_acquisto@urmc.rochester.eduAcademic Editors: L. Bojić, N. Kikuchi, and O. A. Sowande\n\n2013 5 8 2013 2013 58620710 6 2013 15 7 2013 Copyright © 2013 Ryan P. Bodkin et al.2013This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Accidental injection into the digit from an epinephrine autoinjection device can cause discoloration, pain, and paresthesias. Although loss of digit is rare, treatment in the emergency department is commonly aimed at vasodilation of the affected tissue. We report two cases of accidental injection of epinephrine into the digits that were successfully treated with subcutaneous phentolamine injection with no adverse events.\n==== Body\n1. Introduction\nAn intramuscular injection of epinephrine is currently the gold standard of treatment for severe anaphylaxis reactions. Autoinjection devices (i.e., EpiPen and Twinject) have been commercially available for the treatment of self-diagnosed anaphylaxis in the outpatient setting for over 30 years. Although education is provided to patients on the proper administration of these devices, the anxiety of the acuity of an anaphylaxis event compounded by the infrequency of use leads to accidental digital injections during administration. It is reported that this occurs in approximately one in 50,000 attempts at injection [1]. The Ruth Lawrence Poison and Drug Information Center covering the Finger Lakes Upstate Region of New York (14 counties) reports 27 cases of accidental injection over the past 10 years, and the Upstate New York Poison Center (54 counties) reports a total of 48 cases in 2011 making this a rare presentation. The prescribing information advises patients to go to the emergency department immediately for treatment directed at vasodilation if there is inadvertent administration to the digits, hands, or feet [2]. \n\nEpinephrine causes severe vasoconstriction through agonism of alpha1 and alpha2 receptors on the vascular smooth muscle. Based on this mechanism, it is believed that a direct injection of concentrated epinephrine 1 : 1,000 into the digit could lead to ischemic necrosis of the area. However, there is a lack of available reports showing that this in fact occurs [3–5]. Since symptoms including digital pain and paresthesias are reported to last as long as 10 weeks in those left untreated, vasodilatory treatment is commonly used [4].\n\n2. Case Presentations\n\nCase 1\nA 29-year-old female presented to the emergency department approximately 30 minutes after an accidental injection of epinephrine (0.3 mg/0.3 mL, 1 : 1,000 concentration) into the pad of her right thumb. She complained of pain and numbness and noted pale coloration tracking up the palmar and dorsal surface of her right thumb. Initial therapy in the emergency department consisted of nitroglycerin ointment 2%, applied with a transparent dressing, after warm water bath soaks for approximately 20 minutes. These treatments did not change the coloration or stop the progression of symptoms (Figure 1). Phentolamine was prepared using the 10 mg/mL solution and mixing 1.5 mg (0.15 mL) with NS to a concentration of 1 mg/1 mL. Small subcutaneous injections of phentolamine were administered to each of the three locations of the thumb that included the pad and midshaft bilaterally, totaling 0.5 mg for this series of injections. This administration process was repeated for 20 and 40 minutes to a total of 1.5 mg of phentolamine. Following each series of phentolamine subcutaneous injections, thumb recoloration and some resolution of symptoms occurred within five minutes. Complete resolution of color and symptoms was noted following the third series of phentolamine injections (Figure 2). The patient was observed on telemetry for one hour following the last dose of phentolamine and was discharged home. \n\n\n\n\n\nCase 2\nA 41-year-old male presented to the emergency department 30 minutes after accidental injection of epinephrine (0.3 mg/0.3 mL, 1 : 1000 concentration) into the pad of his right thumb. He had numbness and blanching of his entire thumb, extending to below the metacarpal phalangeal joint, and pain with movement. Preparation of phentolamine was the same as in Case 1. Phentolamine was injected subcutaneously into the site of epinephrine injection (0.5 mg) and bilaterally at the base of the thumb (0.25 mg/injection), for a total dose of 1 mg. There was immediate improvement in color, but the digit remained cool to touch. Reassessment at 15 minutes indicated further improvement in symptoms with return of color and warmth, although numbness persisted. No further phentolamine was administered. Sensation returned 3.5 hours after phentolamine administration and the patient was discharged home.\n\n\n\n\n3. Case Discussion\nAccidental digital injection of epinephrine is uncommon. The notion that this event can cause ischemic necrosis is largely theoretical based on the mechanism of action. A review of the literature found that no cases of subcutaneous injection of epinephrine caused ischemic necrosis in those who did not receive treatment aimed at vasodilation [3–5]. Specifically, a systematic review of 59 cases of accidental injection of concentrated epinephrine (0.3 mg/0.3 mL, 1 : 1,000 concentration) into a digit reported that those without treatment (n = 32) had resolution of symptoms without long-term negative sequelae [4]. However pain, paresthesias, and discoloration were reported to persist in the digit for days to weeks. Due to these persistent symptoms, treatment with vasodilatory agents is commonly utilized in the emergency department. Several modalities of treatment are described and include external warming, nitroglycerin ointment, and phentolamine injection [5]. \n\nSince epinephrine causes vasoconstriction through agonism of alpha1 and alpha2 receptors, phentolamine is an obvious choice. Phentolamine is a competitive nonselective alpha1 and alpha2 adrenergic receptor-antagonist that is commonly used subcutaneously for the treatment of extravasation following infiltration of intravenous alpha1 agonist agents [6]. Extravasation from intravenous infiltration and subcutaneous injection into the digit with epinephrine presents similarly in regard to discoloration and painful symptoms. \n\nThe current literature supports the safety and efficacy of phentolamine for use in accidental subcutaneous epinephrine injections into the digit [1, 3–5]. One case series reports 14 patients with subcutaneous epinephrine injection into a digit that received subcutaneous phentolamine at a total dose ranging from 0.5 mg to 2 mg. All patients experienced resolution of symptoms within 5 to 30 minutes [4]. Similarly, in a systematic review, 15 patients received local subcutaneous phentolamine following epinephrine injection and had complete resolution of symptoms [5]. There were no reported adverse effects from phentolamine treatment in these cases.\n\n4. Conclusion\nOur cases support the use of phentolamine for the treatment of subcutaneous injection of epinephrine for the rapid resolution of pain, paresthesias, and discoloration and prevention of prolonged symptoms.\n\nDisclosures\nR. P. Bodkin, N. M. Acquisto, H. Gunyan, and T. J. Wiegand have nothing to disclose.\n\nFigure 1 \nCase 1—right thumb 20 minutes after topical application of nitroglycerin ointment and warm water bath emersion. \n\nFigure 2 \nCase 1—right thumb 5 minutes after subcutaneous injections of a total of 1.5 mg of phentolamine.\n==== Refs\n1 McGovern SJ Treatment of accidental digital injection of adrenaline from an auto-injector device Emergency Medicine Journal 1997 14 6 379 380 2-s2.0-0030842196 \n2 Epinephrine (EpiPen) prescribing information Meridian Medical Technologies, 2008, http://files.epipen.gethifi.com/Prescribing-Information.pdf \n3 Muck AE Bebarta VS Borys DJ Morgan DL Six years of epinephrine digital injections: absence of significant local or systemic effects Annals of Emergency Medicine 2010 56 3 270 274 2-s2.0-77956058975 20346537 \n4 Fitzcharles-Bowe C Denkler K Lalonde D Finger injection with high-dose (1:1,000) epinephrine: does it cause finger necrosis and should it be treated? Hand 2007 2 1 5 11 2-s2.0-33947721061 18780041 \n5 Simons FER Lieberman PL Read EJ Jr. Edwards ES Hazards of unintentional injection of epinephrine from autoinjectors: a systematic review Annals of Allergy, Asthma and Immunology 2009 102 4 282 287 2-s2.0-65249188740 \n6 Phentolamine (Rogitine) prescribing information Paladin Labs, 2009, http://paladin.lateshowlabs.com/wp-content/uploads/PM_approved_Rogitine_26Jun2009_CN130902_V3.0_EN.pdf\n\n", "fulltext_license": "CC BY", "issn_linking": "2090-6498", "issue": "2013()", "journal": "Case reports in emergency medicine", "keywords": null, "medline_ta": "Case Rep Emerg Med", "mesh_terms": null, "nlm_unique_id": "101591814", "other_id": null, "pages": "586207", "pmc": null, "pmid": "24024046", "pubdate": "2013", "publication_types": "D016428:Journal Article", "references": "18780041;19441598;20346537;9413778", "title": "Two cases of accidental injection of epinephrine into a digit treated with subcutaneous phentolamine injections.", "title_normalized": "two cases of accidental injection of epinephrine into a digit treated with subcutaneous phentolamine injections" }
[ { "companynumb": "US-KALEO, INC.-2021KL000068", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "EPINEPHRINE" }, "drugadditional": "4", ...
{ "abstract": "Spontaneous pneumomediastinum is an infrequent complication of COVID-19. The mechanism is still unknown and thought to be related to patient self-inflicted lung injury. Our patient is a 49-year-old male who presented with shortness of breath and cough. A COVID-19 Polymerase Chain Reaction was positive. He required a high-flow nasal cannula, but he did not demand mechanical ventilation. Computed tomography angiography scan of the chest revealed pneumomediastinum. He was managed conservatively, and a complete recovery was achieved. This case highlights the emerging association of COVID-19, patient self-inflicted lung injury, and pneumomediastinum. Furthermore, spontaneous pneumomediastinum should be suspected even in patients who were not mechanically ventilated.", "affiliations": "St. Vincent Charity Medical Center, Cleveland, OH, USA.;St. Vincent Charity Medical Center, Cleveland, OH, USA.;St. Vincent Charity Medical Center, Cleveland, OH, USA.;St. Vincent Charity Medical Center, Cleveland, OH, USA.;Yale University School of Medicine, New Haven, CT, USA.;Baptist Health North Little Rock North Little Rock, North Little Rock, AR, USA.;St. Vincent Charity Medical Center, Cleveland, OH, USA.;St. Vincent Charity Medical Center, Cleveland, OH, USA.", "authors": "Al Armashi|Abdul Rahman|AR|;Somoza-Cano|Francisco J|FJ|;Patell|Kanchi|K|;Homeida|Mohamed|M|;Desai|Omkar|O|;Zubaidi|Anas Al|AA|;Altaqi|Basel|B|;Ravakhah|Keyvan|K|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.radcr.2021.08.076", "fulltext": "\n==== Front\nRadiol Case Rep\nRadiol Case Rep\nRadiology Case Reports\n1930-0433\nElsevier\n\nS1930-0433(21)00645-2\n10.1016/j.radcr.2021.08.076\nCase Report\nSpontaneous pneumomediastinum: A collaborative sequelae between COVID‐19 and self‐inflicted lung injury ‐ A case report and literature review\nAl Armashi Abdul Rahman MD Abd.armashi@gmail.com\na⁎\nSomoza-Cano Francisco J. MD a\nPatell Kanchi MD a\nHomeida Mohamed MD a\nDesai Omkar MD b\nZubaidi Anas Al MD c\nAltaqi Basel MD a\nRavakhah Keyvan MD a\na St. Vincent Charity Medical Center, Cleveland, OH, USA\nb Yale University School of Medicine, New Haven, CT, USA\nc Baptist Health North Little Rock North Little Rock, North Little Rock, AR, USA\n⁎ Corresponding author. Abd.armashi@gmail.com\n04 10 2021\n12 2021\n04 10 2021\n16 12 36553658\n23 8 2021\n30 8 2021\n© 2021 The Authors. Published by Elsevier Inc. on behalf of University of Washington.\n2021\n\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nSpontaneous pneumomediastinum is an infrequent complication of COVID-19. The mechanism is still unknown and thought to be related to patient self-inflicted lung injury. Our patient is a 49-year-old male who presented with shortness of breath and cough. A COVID-19 Polymerase Chain Reaction was positive. He required a high-flow nasal cannula, but he did not demand mechanical ventilation. Computed tomography angiography scan of the chest revealed pneumomediastinum. He was managed conservatively, and a complete recovery was achieved. This case highlights the emerging association of COVID-19, patient self-inflicted lung injury, and pneumomediastinum. Furthermore, spontaneous pneumomediastinum should be suspected even in patients who were not mechanically ventilated.\n\nKeywords\n\nCOVID-19\nSars-cov-2\nSpontaneous Pneumomediastinum\nPatient Self-Inflicted Lung Injury\n(PSILI)\nPneumomediastinum\n==== Body\npmcIntroduction\n\nCoronavirus Disease 2019 (COVID-19) has an extensive array of pulmonary complications due to the aggressive damage to the lung parenchyma and pulmonary vessels. These manifestations range from mild pneumonia to severe acute respiratory distress syndrome (ARDS), venous thromboembolism, and rarely, pneumothoraces [1,2]. Pneumomediastinum is an infrequent condition in which gas is present within the mediastinal space. In COVID-19, Zantah et al. reported an incidence rate of 0.66% in a retrospective review when unrelated to mechanical ventilation (MV) [3]. However, the specific mechanism is still unclear. It is deemed to be related to patient self-inflicted lung injury (P-SILI), where the lung damage is caused by increased intra-alveolar pressure [4]. We are presenting a 49-year-old male with COVID-19 pneumonia complicated by a spontaneous pneumomediastinum.\n\nCase presentation\n\nOur patient is a 49-year-old male with a past medical history of childhood asthma, hypertension, morbid obesity, and prostate cancer in remission. He visited his primary care physician for shortness of breath, cough, and chills, where a COVID-19 Polymerase Chain Reaction (PCR) test was positive. He was initially managed as an outpatient with oral prednisone and azithromycin, but his symptoms worsened after a few days of treatment. His home pulse oximetry showed an oxygen saturation of 86% on room air. On admission, the review of systems was positive for pleuritic chest pain, and change in the mouth taste. On physical examination, he was tachycardic, and saturating 87% on room air. Lung exam was remarkable for decreased air entry bilaterally. Further examination revealed an unremarkable cardiovascular exam and extremities with no edema or calf tenderness. Laboratory work showed lymphopenia of 1 K/uL (reference range 1.2 - 3.5), creatinine of 1.4 mg/dL, with a baseline of 1 mg/dL (reference range 0.7 - 1.3), and troponin I within normal limits. C-reactive protein of 47 mg/L (reference range 0 - 0.3), ferritin of 1230 ng/mL (reference range 26 - 388), lactate dehydrogenase of 1121 U/L (reference range 84 - 246), procalcitonin of 0.08 ng/ml (reference range <0.5), and a D-dimer of 1689 ng/mLFEU (reference range <500). Chest x-ray showed diffuse interstitial infiltrates bilaterally. Duplex ultrasound of lower extremities was negative for deep vein thrombosis. He was admitted to the Respiratory Care Unit and managed with supplemental oxygen, dexamethasone, and intravenous (IV) ceftriaxone. Nevertheless, due to high suspicion of pulmonary embolism, a continuous heparin infusion was started empirically as computed tomography angiography (CTA) of the chest could not be done due to the ongoing acute kidney injury. On day 2 of admission, his oxygen requirements continued to increase, for which he was started on a high-flow nasal cannula (HFNC) of 25 L with 60% FiO2 and remdesivir. On day 3 of admission, he had increasing oxygen demands requiring HFNC 50 L with 60% FiO2. Tocilizumab was given by the infectious disease team. His kidney function returned to baseline level at day 4. A CTA scan of the chest revealed pneumomediastinum (Fig. 1, Fig. 2) and multiple bilateral acute pulmonary embolisms with diffuse ground-glass opacities at the bases (Fig. 3). The following day, a repeat chest x-ray showed a stable pneumomediastinum, which tracked to the lower neck, and supraclavicular regions with no associated pneumothorax (Fig. 4). The patient finished a 10-day course of dexamethasone and remdesivir with the improvement of his clinical status. His oxygen requirements continued to decrease; therefore, he was switched to a 2 L nasal cannula. His follow-up chest x-ray images showed a stable pneumomediastinum with no progression of the disease. He was transferred to a long-term acute care facility, where he achieved a complete recovery, and was discharged home.Fig. 1 Computed tomography angiography (CTA) scan of the chest in axial view revealing pneumomediastinum and ground glass opacities at the bases.\n\nFig 1 –\n\nFig. 2 Computed tomography angiography (CTA) scan of the chest in coronal view revealing air that outlines multiple mediastinal structures including the aortic arch and extending to the lower neck.\n\nFig 2 –\n\nFig. 3 Computed tomography angiography (CTA) scan of the chest in axial view revealing multiple bilateral filling defects of the pulmonary artery in the lobar branches consistent with acute pulmonary embolisms (white arrows). Also revealing diffuse ground-glass opacities at the bases.\n\nFig 3 –\n\nFig. 4 Chest x-ray revealing a crescent of air that outlines the ascending aorta and also the left border of the heart consistent with pneumomediastinum (white arrow), that is tracking to the lower neck, and supraclavicular regions.\n\nFig 4 –\n\nDiscussion\n\nCOVID-19 has a broad spectrum of clinical manifestations, affecting multiple organs in the human body. The lungs are frequently compromised, given the high expression of the angiotensin-converting enzyme 2 (ACE2) receptor complex in the alveolar cells, which the SARS-CoV-2 uses to enter the cell, making the lungs a target for dysregulated inflammation, and its acute consequences. Rarely, pneumothorax or spontaneous pneumomediastinum may occur with an incidence of 0.66% [1,2,5,6].\n\nPneumomediastinum (PM) is described as the presence of air or gas in the mediastinum. It is classified as spontaneous (SPM) or traumatic. SPM can be primary, where no underlying lung disease is identified, or secondary to lung or airway disease like asthma or cystic fibrosis [7]. On the other hand, traumatic pneumomediastinum can be caused by physical trauma or barotrauma produced by MV. Moreover, PM can also be categorized into benign or malignant. The malignant form can lead to fatal consequences as the accumulation of a significant amount of air in the mediastinum can lead to mechanical obstruction of the vessels and trachea [8].\n\nSPM was first reported in 1819 by Laennec [9]. Its pathophysiology was described by Macklin et al. to be related to the pressure gradient between the alveoli and the lung interstitium. Additionally, it was documented how an acute increase in the intrathoracic pressure can produce alveolar rupture [6,10]. The exact correlation between COVID-19 and SPM is still not well understood. It is believed to be related to the increased alveolar pressure and diffuse alveolar injury, making the alveoli more prone to rupture [11].\n\nFurthermore, the pathophysiology of P-SILI is also similar to COVID-19, where tachypnea, and progressive cough can result in acute lung injury. This pulmonary damage is produced when an intense inspiratory effort induces pulmonary damage through an increase in transpulmonary pressure in a reduced aerated compartment. Conditions like acute hypoxemic respiratory failure, COVID-19, and ARDS may present with this abnormality. The accompanying lung damage and pulmonary edema caused by these conditions prompt an augmentation in the respiratory drive, ensuing a damaging, and repetitive series of events. The most acceptable strategy to break this vicious circle is invasive mechanical ventilation (IMV) [4,12,13].\n\nRisk factors of SPM include smoking (tobacco and marijuana), asthma, chronic lung disease, infections, illicit drug use (heroin and cocaine), and MV [9,14,15]. Our patient had a history of childhood asthma, but he did not have a history of smoking, illicit drug use, or emphysematous changes due to chronic lung disease on his previous imaging studies. Furthermore, he did not require non–invasive or IMV during his stay. Uncomplicated SPM is usually managed conservatively since it is primarily self-limited [16].\n\nUpon literature review, we recognized 8 cases of SPM developing in patients with COVID-19 (Table 1). The incidence was higher in males when compared to females. Our patient was similar to 5 patients with no MV use and 3 other patients where the CT scan showed SPM with subcutaneous emphysema. One patient expired with the mortality rate being up to 12.5% [7,11,12,17,18,19,20]. Our patient was fortunate to recover upon discharge completely.Table 1 Literature review of spontaneous pneumomediastinum cases in patients with COVID-19. \n\nTable 1–Case\tAge\tGender\tComorbidities\tInvasive ventilation\tDiagnosis\tTreatment\tOutcome\t\nElhakim TS et al. [7]\t63\tM\thypertension type II diabetes mellitus (DM)\tNo\tSpontaneous pneumomediastinum\tConservative\tRecovered\t\nMohan V et al. [11]\t49\tM\thypertension and type II DM\tNo\tSpontaneous pneumomediastinum with subcutaneous emphysema\tConservative\tRecovered\t\nOye M et al. [12]\t32\tM\tNone\tNo\tSpontaneous pneumomediastinum Pneumothorax and subcutaneous emphysema\tChest tube for the pneumothorax\tRecovered\t\nOye M et al. [12]\t56\tF\thypertension and type II DM\tNo\tSpontaneous pneumomediastinum And bilateral Pneumothorax\tthoracostomy tube\tRecovered\t\nKolani S et al. [17]\t23\tF\tNone\tNo\tPneumomediastinum\tConservative\tRecovered\t\nLacroix M et al. [18]\t57\tM\tNone\tYes\tPneumomediastinum with subcutaneous emphysema\tConservative\tUnknow\t\nLei P et al. [19]\t64\tM\tNone\tUnknown\tSpontaneous pneumomediastinum\tConservative\tRecovered\t\nWang J et al. [20]\t36\tF\tNone\tYes\tSpontaneous pneumomediastinum\tConservative\tExpired\t\n\nConclusion\n\nThis case highlights the emerging association of COVID-19, P-SILI, and pneumomediastinum. SPM should be suspected even in patients who did not receive IMV, non–invasive positive pressure ventilation or in the absence of chronic lung diseases and smoking. Early detection and continuous monitoring for progression can prevent life-threatening consequences.\n\nDisclaimer\n\nThe authors received no financial support for the research or publication of this article. The authors whose names are listed above certify that formal consents were not required as we used entirely anonymized images from which the individual cannot be identified.\n\nPatient consent\n\nThe authors whose names are listed above certify that formal consents was not required as we used entirely anonymized images from which the individual cannot be identified. Additionally, the patient’s names, initials, hospital or social security numbers, dates of birth or other personal or identifying information was not used or mentioned anywhere in the manuscript.\n==== Refs\nReferences\n\n1 Batah SS Fabro AT Pulmonary pathology of ARDS in COVID-19: a pathological review for clinicians Respir Med 176 2021 106239 10.1016/j.rmed.2020.106239\n2 Martinelli AW Ingle T Newman J Nadeem I Jackson K Lane ND COVID-19 and pneumothorax: a multicentre retrospective case series Eur Respir J 56 5 2020 2002697 10.1183/13993003.02697-2020\n3 Zantah M Castillo ED Townsend R Dikengil F Criner GJ Pneumothorax in COVID-19 disease- incidence and clinical characteristics Respir Res 21 1 2020 10.1186/s12931-020-01504-y\n4 Oujidi Y Bkiyar H Housni B. Self-inflicted injury by the patient himself: P-Sili in acute covid deseas, case and literature review Ijirr.com. Accessed July 7, 2021 https://www.ijirr.com/sites/default/files/issues-pdf/3724.pdf\n5 Ni W Yang X Yang D Bao J Li R Xiao Y Role of angiotensin-converting enzyme 2 (ACE2) in COVID-19 Crit Care 24 1 2020 422 32660650\n6 Mason R Pneumomediastinum and mediastinitis Murray and Nadel’s Textbook of Respiratory Medicine 4th ed 2005 Elsevier Health Sciences Chapter 72\n7 Elhakim TS Abdul HS Pelaez Romero C Rodriguez-Fuentes Y Spontaneous pneumomediastinum, pneumothorax and subcutaneous emphysema in COVID-19 pneumonia: a rare case and literature review BMJ Case Rep 13 12 2020 e239489\n8 Kouritas VK Papagiannopoulos K Lazaridis G Baka S Mpoukovinas I Karavasilis V Pneumomediastinum J Thorac Dis 7 Suppl 1 2015 S44 S49 25774307\n9 Roguin A Rene Theophile Hyacinthe Laënnec The man behind the stethoscope Clin Med Res 4 3 2006 230 235 10.3121/cmr.4.3.230 17048358\n10 Macklin MT Macklin CC Malignant interstitial emphysema of the lungs and mediastinum as an important occult complication in many respiratory diseases and other conditions: an interpretation of the clinical literature in the light of laboratory experiment Medicine 23 1944 281 358\n11 Mohan V Tauseen RA Spontaneous pneumomediastinum in COVID-19 BMJ Case Rep 13 5 2020 e236519\n12 Oye M Ali A Kandah F Chowdhury N Two cases of spontaneous pneumomediastinum with pneumothorax in patients with COVID-19 associated pneumonia Respir Med Case Rep 31 101308 2020 101308\n13 Weaver L, Das A, Saffaran S, Yehya N, Scott TE, Chikhani M, et al. High risk ofpatient self-inflicted lung injury in COVID-19 with frequently encountered spontaneous breathing patterns: acomputational modelling study. bioRxiv. doi:10.1101/2021.03.17.21253788.\n14 Mattox KL Pneumomediastinum in heroin and marijuana users JACEP 5 1 1976 26 28 933384\n15 Macrae C Brown C Aiken C Jamdar R Pneumomediastinum as a complication of cocaine abuse Clin Med 19 4 2019 321 324\n16 Ebina M Inoue A Takaba A Ariyoshi K Management of spontaneous pneumomediastinum: are hospitalization and prophylactic antibiotics needed? Am J Emerg Med 35 8 2017 1150 1153 28330688\n17 Kolani S Houari N Haloua M Lamrani YA Meryem Boubbou M Serraj M Spontaneous pneumomediastinum occurring in the SARS-COV-2 infection IDCases 21 e00806 2020 e00806 32395425\n18 Lacroix M Graiess F Monnier-Cholley L Arrivé L SARS-CoV-2 pulmonary infection revealed by subcutaneous emphysema and pneumomediastinum Intensive Care Med 46 8 2020 1620 1621 10.1007/s00134-020-06078-3 32430514\n19 Lei P Mao J Wang P Spontaneous pneumomediastinum in a patient with coronavirus disease 2019 pneumonia and the possible underlying mechanism Korean J Radiol 21 7 2020 929 930 10.3348/kjr.2020.0426 32524794\n20 Wang J Su X Zhang T Zheng C Spontaneous pneumomediastinum: a probable unusual complication of coronavirus disease 2019 (COVID-19) pneumonia Korean J Radiol 21 5 2020 627 628 10.3348/kjr.2020.0281 32323507\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "1930-0433", "issue": "16(12)", "journal": "Radiology case reports", "keywords": "(PSILI); COVID-19; Patient Self-Inflicted Lung Injury; Pneumomediastinum; Sars-cov-2; Spontaneous Pneumomediastinum", "medline_ta": "Radiol Case Rep", "mesh_terms": null, "nlm_unique_id": "101467888", "other_id": null, "pages": "3655-3658", "pmc": null, "pmid": "34630794", "pubdate": "2021-12", "publication_types": "D002363:Case Reports", "references": "32938445;32524794;33246294;25774307;34255207;28330688;17048358;32395425;33262929;32457032;32323507;32660650;933384;32430514;32907891;31308113;33310838", "title": "Spontaneous pneumomediastinum: A collaborative sequelae between COVID-19 and self-inflicted lung injury - A case report and literature review.", "title_normalized": "spontaneous pneumomediastinum a collaborative sequelae between covid 19 and self inflicted lung injury a case report and literature review" }
[ { "companynumb": "US-SUN PHARMACEUTICAL INDUSTRIES LTD-2022R1-326761", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "CEFTRIAXONE" }, "dru...
{ "abstract": "Antisynthetase syndrome (anti-SS) is a rare systemic autoimmune disease characterised by autoantibodies against aminoacyl-tRNA synthetases manifesting as one or more components of the classic triad: interstitial lung disease, arthritis and myositis. While it is well-recognised that autoimmune rheumatological disorders in general can contribute to multiple pregnancy complications, very little is known about how anti-SS itself affects pregnancy outcomes. Described here is the case of a 26-year-old pregnant woman with anti-SS whose pregnancy course was complicated by placental dysfunction and subsequent extremely premature delivery at 24 weeks' gestation. This report presents a review of the literature to date and discusses potential pregnancy complications associated with anti-SS and their subsequent targeted management.", "affiliations": "Department of Internal Medicine, Queensland Health, Herston, Queensland, Australia monique.kowitz@health.qld.gov.au.;Department of Rheumatology, Royal Brisbane and Women's Hospital, Herston, Queensland, Australia.;Department of Rheumatology, Royal Brisbane and Women's Hospital, Herston, Queensland, Australia.;Department of Obstetric Medicine, Royal Brisbane and Women's Hospital, Herston, Queensland, Australia.", "authors": "Kowitz|Monique|M|;Chakradeo|Katrina|K|;Hennessey|Ashleigh|A|;Wolski|Penny|P|", "chemical_list": "D001323:Autoantibodies; D000604:Amino Acyl-tRNA Synthetases", "country": "England", "delete": false, "doi": "10.1136/bcr-2020-240929", "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "14(5)", "journal": "BMJ case reports", "keywords": "pregnancy; rheumatology", "medline_ta": "BMJ Case Rep", "mesh_terms": "D000026:Abortion, Habitual; D000328:Adult; D000604:Amino Acyl-tRNA Synthetases; D001323:Autoantibodies; D005260:Female; D006801:Humans; D050498:Live Birth; D009220:Myositis; D011247:Pregnancy", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "33975837", "pubdate": "2021-05-11", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Premature live birth in a woman with antisynthetase syndrome following recurrent miscarriages.", "title_normalized": "premature live birth in a woman with antisynthetase syndrome following recurrent miscarriages" }
[ { "companynumb": "AU-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-305661", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ASPIRIN" }, "drugadd...
{ "abstract": "Drug desensitization can be achieved successfully by gradual drug dose increases in different protocols. Most protocols are designed to obtain temporal tolerance. The data on long-term maintenance of drug tolerance is scarce. Based on an IgE-mediated colomycin allergy we describe the maintenance of drug tolerance to nebulized drug for the period of 10 years in a 15-year-old cystic fibrosis patient, proceeded by successful rush intravenous desensitization protocol. The mechanism of drug tolerance is largely speculative; however, long-term maintenance of it seems achievable by continuous local drug application.", "affiliations": "Division of Pediatric Pulmonology, Allergy and Endocrinology, Departement of Pediatrics and Adolescent Medicine, Comprehensive Center of Pediatrics, Medical University of Vienna, Vienna, Austria.;Division of Pediatric Pulmonology, Allergy and Endocrinology, Departement of Pediatrics and Adolescent Medicine, Comprehensive Center of Pediatrics, Medical University of Vienna, Vienna, Austria.;Department of Pulmonology, Klinik Hietzing, Vienna, Austria.;Division of Pediatric Pulmonology, Allergy and Endocrinology, Departement of Pediatrics and Adolescent Medicine, Comprehensive Center of Pediatrics, Medical University of Vienna, Vienna, Austria.", "authors": "Sieber|Justyna|J|;Renner|Sabine|S|;Lakatos-Krepcik|Andrea|A|;Szépfalusi|Zsolt|Z|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3389/fped.2021.663228", "fulltext": "\n==== Front\nFront Pediatr\nFront Pediatr\nFront. Pediatr.\nFrontiers in Pediatrics\n2296-2360\nFrontiers Media S.A.\n\n10.3389/fped.2021.663228\nPediatrics\nOriginal Research\nCase Report: Maintenance of Desensitization to Nebulized Colomycin Over 10 Years\nSieber Justyna 12\n\nRenner Sabine 1\nLakatos-Krepcik Andrea 3\n\nSzépfalusi Zsolt 1*\n\n1Division of Pediatric Pulmonology, Allergy and Endocrinology, Departement of Pediatrics and Adolescent Medicine, Comprehensive Center of Pediatrics, Medical University of Vienna, Vienna, Austria\n2Department of Clinical Immunology, Wroclaw Medical University, Wroclaw, Poland\n3Department of Pulmonology, Klinik Hietzing, Vienna, Austria\nEdited by: Ron Rubenstein, Washington University in St. Louis, United States\n\nReviewed by: Alysa Ellis, Washington University in St. Louis, United States; Kelvin D. MacDonald, Oregon Health and Science University, United States\n\n*Correspondence: Zsolt Szépfalusi zsolt.szepfalusi@meduniwien.ac.at\nThis article was submitted to Pediatric Pulmonology, a section of the journal Frontiers in Pediatrics\n\n01 4 2021\n2021\n9 66322802 2 2021\n05 3 2021\nCopyright © 2021 Sieber, Renner, Lakatos-Krepcik and Szépfalusi.\n2021\nSieber, Renner, Lakatos-Krepcik and Szépfalusi\nhttps://creativecommons.org/licenses/by/4.0/ This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY). The use, distribution or reproduction in other forums is permitted, provided the original author(s) and the copyright owner(s) are credited and that the original publication in this journal is cited, in accordance with accepted academic practice. No use, distribution or reproduction is permitted which does not comply with these terms.\nDrug desensitization can be achieved successfully by gradual drug dose increases in different protocols. Most protocols are designed to obtain temporal tolerance. The data on long-term maintenance of drug tolerance is scarce. Based on an IgE-mediated colomycin allergy we describe the maintenance of drug tolerance to nebulized drug for the period of 10 years in a 15-year-old cystic fibrosis patient, proceeded by successful rush intravenous desensitization protocol. The mechanism of drug tolerance is largely speculative; however, long-term maintenance of it seems achievable by continuous local drug application.\n\nhypersensitivity\ndesensitization\ncystic fibrosis\ncase report\ncolomycin\ndrug tolerance\ndrug allergy\n==== Body\nIntroduction\n\nAdverse drug reactions can be considered as important public health problem (1). Patients with Cystic Fibrosis represent a defined risk group for drug allergies (2–4). Desensitization protocols have been successfully developed to prevent from withholding of first line therapy in allergic patients. The principle of this approach is to administrate fractional aliquots of the total therapeutic dose and alter the patient's immune response to a drug. Most of described protocols achieve that goal through oral, intravenous or subcutaneous routes. Thus, many routes seem to be feasible. Starting dose, number of steps and dosing frequency differ between available protocols (5–7). A 12-step standardized intravenous (IV) protocol has been developed and used successfully for immediate hypersensitivity reactions to a variety of drugs (5) In fact, more rush or more prolonged protocols can be successfully used. Nevertheless, drug tolerance used to be temporary and the tolerant state can be lost as soon as after 24 h after discontinuation of the therapy. With recurrent need of antibiotic treatments desensitization procedures have to be repeated. These can be a relevant clinical problem in the management of Cystic Fibrosis, as recurrent antibiotic and continuous or alternate inhaled antibiotic therapy became standard of care, mostly due to chronic Pseudomonas aeruginosa colonization (8). In addition, these pathogens may develop resistances to the narrow group of antibiotic sources. Alternative drugs are rare and the new treatment approaches are warranted. Thus, we describe the successful maintenance of drug tolerance state to colomycin for the period of 10 years in a Cystic Fibrosis allergic patient. This was achieved by daily inhalation of nebulized drug after a successful IV desensitization procedure.\n\nCase Description\n\nWe report the case of a 15-year-old girl with Cystic Fibrosis (dF508/dF508), with first Pseudomonas aeruginosa infection at 1 year of age, and chronic colonization at the age of 5 years. The standard first line therapy and in consequence eradication of the bacteria was impeded by a hyperresponsiveness of the bronchial airway to nebulized tobramycin and colomycin, regardless of pre-medication with bronchodilator and corticosteroids. The patient was treated regularly with oral antibiotic courses (ciprofloxacin) and the attempts for aerosol administration of anti-pseudomonas antibiotics were repeated. The initial clinical course was stable, with no acute exacerbation. However, the lung function was deteriorating continuously with time. At the age of 12 years the girl was experiencing deterioration of clinical condition with increased need for oral antimicrobials and acute exacerbation resulting in hospital admissions for I.V. treatment. During one of the hospitalizations, intravenous antibiotic therapy with tobramycin and ceftazidime was initiated. Due to new microbiological findings revealing resistance of Pseudomonas aeruginosa to tobramycin, the antibiotic therapy was switched to ceftazidime, flucloxacillin and colomycin, all given intravenously. Minutes after the initiation of the colomycin infusion the girl reacted with generalized urticaria, dyspnea, tachycardia and hypotension. The infusion was stopped and steroids and antihistamines were applied. The patient recovered and the antibiotic therapy was changed and well-tolerated. The colomycin hypersensitivity was confirmed with positive prick-test (7 mm) and clinical significant FEV1 deterioration (>20 %) after inhalation with colomycin. Since then, colomycin was avoided. Further clinical course showed progressive lung deterioration. The microbiological findings revealed repeated detection of Pseudomonas aeruginosa up to 108 cells/ml. The patient was treated regularly with oral antibiotics. Attempts for nebulized tobramycin therapy were tried again, but was not tolerated by the patient. Repeated IV therapies were resulting only in temporary clinical improvement. At the age of 15 years, due to clinical signs of pulmonary exacerbation, the girl was again hospitalized. The lung function revealed FEV1 54% predicted, FVC 75% predicted, the microbiological findings showed two strains of Pseudomonas aeruginosa with resistance to tobramycin and sensitive to colomycin. Due to lack of alternative therapy, colomycin desensitization was initiated. The patient and her legal representatives gave an informed consent for desensitization procedure. At first, a 4-step intravenous desensitization protocol established in our center was applied (Table 1). The target dose of colomycin was 1,000,000 U. Pre-medication with methylprednisolone 1 mg/kg was used. During the desensitization procedure mild symptoms of a rush and restlessness were observed. The symptoms improved without medication and the procedure was continued without modification. After successful desensitization, the intravenous course of colomycin 3 × 1,000,000 IU/day was continued for 14 days without any adverse events. The clinical condition of the patient and the lung function improved significantly. On day 15 the therapy was switched to nebulized colomycin 2 × 1,000,000 IU and was continued for the next 2 days in inpatient setting. The inhalation treatment was well-tolerated, and thus the girl was discharged with the recommendation for long-term nebulized therapy in home care (Table 2). The patient and her parents were instructed on the necessity of strict and regular administration of the inhaled drug and the possible consequences of discontinuation. Anaphylaxis-rescue medication was prescribed and management training was performed. This therapy was successfully continued for a period of 10 years without any relevant complication. The clinical condition improved significantly, the lung function trend was stable, the microbiological findings of Pseudomonas aeruginosa were reduced to 103 cells/ml, also the number of oral and intravenous antibiotic courses could be reduced as well as the number of hospital admissions due to pulmonary exacerbations (Figure 1).\n\nTable 1 Protocol for intravenous desensitization with colomycin.\n\nMedication\tDilution\tUnits\tTime of infusion\tWay of administration\t\nColomycin\t1/1000\t1,000 U\t60 min\tintravenous\t\nColomycin\t1/100\t10,000 U\t60 min\tintravenous\t\nColomycin\t1/10\t100,000 U\t60 min\tintravenous\t\nColomycin\t9/10\t900,000 U\t60 min\tintravenous\t\n\nTable 2 Protocol for long-term desensitization to nebulized colomycin.\n\nStep\tTherapy\tDuration\tUnits\tWay of administration\tSettings\t\n1.\tColomycin–desensitization\t1 day\tCumulative 1,000,000U\tintravenous\tinpatient\t\n2.\tColomycin–treatment course\t14 days\t3 × 1,000,000 U/day\tintravenous\tinpatient\t\n3.\tColomycin–nebulized therapy\t2 days\t2 × 1,000,000 U/day\tinhalation\tinpatient\t\n4.\tColomycin–nebulized long-term therapy\t10 years\t2 × 1,000,000 U/day\tinhalation\toutpatient\t\n\nFigure 1 Clinical course of the patient before desensitization and under long-term therapy with colomycin. (A) FEV1 trend before desensitization with colomycin, years 2006–2010. (B) FEV1 trend after desensitization with colomycin and under regular, twice daily nebulized colomycin therapy, years 2010–2015. (C) Concentration of Pseudomonas strains in years 2008–2015–before and after desensitization. (D) Number of antibiotic courses in years 2002–2019-before and after desensitization. D–Desensitization: 06.2010.\n\nDiscussion\n\nAdverse drug reactions are considered important public health problems, because of their frequent occurrence, occasional severity and impact on the use of medications (1). The prevalence of adverse drug reaction in Cystic Fibrosis (CF) is higher than in general population and is predicted to increase (2, 3). This is due to increased use of high dose intravenous antibiotics, frequent antibiotic courses and improving survival in patients with CF (4). Drug desensitization is a procedure which alters the immune response to the drug and results in temporary tolerance (5–7). The exact mechanisms which allowed that tolerance are not fully elucidated. Actually proposed mechanisms are: alteration in expression of surface receptors on mast cells and basophils (9, 10), generation of IgG blocking immunoglobulins (11) and reduction in cellular signaling in mast cells and basophils (12, 13) and presence of inhibitory receptors (14). The indications for desensitization are limited to these cases, in which no acceptable alternative drugs are available and when the benefits of such procedure outweigh the potential harm (15). Many protocols with different escalation steps for various antibiotics have been described so far (16). Most of published desensitization protocols are designed to obtain temporary desensitization. In case of recurrent need for therapy the desensitization procedure need to be repeated as well. Nevertheless, the potential to maintain the drug-tolerant state after drug desensitization upon chronic daily administration has been suggested especially for oral drugs (penicillin) (11).\n\nThe present case is due to an IgE-mediated allergy to colomycin. The clinical history with immediate reaction and generalized symptoms, positive SPT and clinical significant lung function deterioration after inhalation of nebulized colomycin reveal an IgE-mediated origin. Additionally, the patient presented airways hyperreactivity to nebulized tobramycin. At that time, as alternative, nebulized therapy with aztreonam was not available yet.\n\nAntipseudomonal treatment in CF patients is challenging. Eradication upon chronic infection is virtually impossible. No consensus has been reached concerning route, choice of the antibiotic, the dosage and duration of the treatment against Pseudomonas aeruginosa in CF patients. In accordance to European consensus for antibiotic therapy against Pseudomonas aeruginosa the patients can be treated with intravenous, oral, nebulized and combined therapy, using different antibiotics (8). The presented patient was treated regularly with oral antipseudomonal antibiotics, which allowed avoiding frequent hospital admission for IV therapies. Unfortunately, nebulized therapy was impeded due to hyperresponsiveness of the airways. For obvious reason, CF patient prefer oral treatment to intravenous ones. Additionally, there are evidences that oral ciprofloxacin can be as effective against Pseudomonas aeruginosa as an intravenous application (17). Nebulized antimicrobial therapy can increase this effectiveness significantly (18, 19). Thus, upon deteriorating clinical condition, presence of high Pseudomonas concentrations and repeated resistance against alternative drugs, colomycin desensitization was performed. Based on the need of a long-term treatment with an effective medication, a strategy to maintain the drug desensitization by nebulized colomycin was attempted. In fact, there are evidences for susceptibility testing being not predictive for clinical success in the treatment of pulmonary exacerbations in Pseudomonas aeruginosa infection (20). The significance of antibiotic resistance in prolonged nebulized therapy remains unclear at present. Taking into account all clinical data, the choice of colomycin over tobramycin seemed reasonable. Desensitization with colomycin is uncommon. However, there is some evidence for successful IV desensitization with that drug (21). The first evidence for desensitization with nebulized antibiotics (tobramycin) has been described in 1995 (22). Since then, there is sparse evidence of desensitization to nebulized antibiotics, such as tobramycin or aztreonam (23–25). The first evidence of desensitization to nebulized colomycin using incremental doses of nebulized drug was described in 2007 (26). Long-term nebulized therapy with colomycin upon IgE-mediated allergy has not been described so far.\n\nThus, we report for the first time a successful maintenance of a desensitization state to nebulized colomycin over the period of 10 years. The strength of the reported case is the proven IgE-mechanism of a drug adverse event, the length of drug desensitization state and the co-association of a clinical improvement of the patient under this treatment. Data concerning desensitization to nebulized antibiotic is scarce, just like evidence of long-term maintenance of drug tolerance. The biggest limitation of the presented case is the fact, that the mechanisms of drug tolerance remain unknown. Additionally, the described clinical approach needs very compliant patients, since the time of loss of tolerance after discontinuation of the therapy remains unknown, but is thought to occur rapidly.\n\nConclusion\n\nLong-term drug tolerance seems to be achievable by repeated/continuous local drug application. The mechanism of drug desensitization is largely speculative and need to be further elucidated. Combined intravenous desensitization procedure followed by an inhaled long-term maintenance treatment appears feasible and may provide a possible treatment approach in particular cystic fibrosis patients needing many antibiotic treatment courses. As inhaled antibiotic are being increasingly used, standardized desensitization protocols with these drugs might be developed.\n\nData Availability Statement\n\nThe original contributions generated for the study are included in the article/supplementary material, further inquiries can be directed to the corresponding author.\n\nEthics Statement\n\nEthical review and approval was not required for the study on human participants in accordance with the local legislation and institutional requirements. Written informed consent to participate in this study was provided by the participants' legal guardian/next of kin.\n\nAuthor Contributions\n\nAll authors contributing to the writing of the manuscript, critical review, and accepted the final version.\n\nConflict of Interest\n\nThe authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.\n\nWe thank the cystic fibrosis team at Division of Pediatric Pulmonology, Allergy and Endocrinology of Medical University of Vienna and Department of Pulmonology, Klinik Hietzing, in particular: Nachbaur Edith, Dehlink Eleonora, Gruber Saskia, Gona-Höpler Livia Mia, Bannert Christina, Gaupmann René, Schmidthaler Klara, Mersi Brigitte and Böhm Bianca.\n==== Refs\nReferences\n\n1. Edwards IR Aronson JK . Adverse drug reactions: definitions, diagnosis, and management. Lancet. (2000) 356 :1255–9. 10.1016/S0140-6736(00)02799-9 11072960\n2. Moss RB . Drug allergy in cystic fibrosis. Clin Rev Allergy. (1991) 9 :211–29. 10.1007/978-1-4612-0475-6_12 1884325\n3. Parmar JS Nasser S . Antibiotic allergy in cystic fibrosis. Thorax. (2005) 60 :517–20. 10.1136/thx.2004.027953 15923254\n4. Parkins MD Parkins VM Rendall JC Elborn S . Changing epidemiology and clinical issues arising in an ageing cystic fibrosis population. Ther Adv Respir Dis. (2011) 5 :105–19. 10.1177/1753465810386051 21078692\n5. Castells M . Rapid desensitization for hypersensitivity reactions to medications. Immunol Allergy Clin North Am. (2009) 29 :585–606. 10.1016/j.iac.2009.04.012 19563999\n6. de Las Vecillas Sánchez L Alenazy LA Garcia-Neuer M Castells MC . Drug hypersensitivity and desensitizations: mechanisms and new approaches. Int J Mol Sci. (2017) 18 :1316. 10.3390/ijms18061316 28632196\n7. Campos L Hamadi SA Lynch D-M Marquis K Castells MC . Update on desensitization. Cur Treat Options Allergy. (2019) 6 :519–37. 10.1007/s40521-019-00231-0\n8. Döring G Conway SP Heijerman HG Hodson ME Høiby N Smyth A . Antibiotic therapy against Pseudomonas aeruginosa in cystic fibrosis: a European consensus. Eur Respir J. (2000) 16 :749–67. 10.1034/j.1399-3003.2000.16d30.x 11106223\n9. Pruzansky JJ Patterson R . Desensitization of human basophils with suboptimal concentrations of agonist. Evidence for reversible and irreversible desensitization. Immunology. (1988) 65 :443–7. 2463224\n10. MacGlashan D Jr Lichtenstein LM . Basic characteristics of human lung mast cell desensitization. J Immunol. (1987) 139 :501–5. 2439588\n11. Naclerio R Mizrahi EA Adkinson NF Jr . Immunologic observations during desensitization and maintenance of clinical tolerance to penicillin. J Allergy Clin Immunol. (1983) 71 :294–301. 10.1016/0091-6749(83)90083-0 6826989\n12. Macglashan D Miura K . Loss of syk kinase during IgE-mediated stimulation of human basophils. J Allergy Clin Immunol. (2004) 114 :1317–24. 10.1016/j.jaci.2004.08.037 15577829\n13. Odom S Gomez G Kovarova M Furumoto Y Ryal JJ Wright HV . Negative regulation of immunoglobulin E-dependent allergic responses by Lyn kinase. J Exp Med. (2004) 199 :1491–502. 10.1084/jem.20040382 15173205\n14. Mahajan A Barua D Cutler P Lidke DS Espinoza FA Pehlke C . Optimal aggregation of FcεRI with a structurally defined trivalent ligand overrides negative regulation driven by phosphatases. ACS Chem Biol. (2014) 9 :1508–19. 10.1021/cb500134t 24784318\n15. Drug allergy: an updated practice parameter. Ann Allergy Asthma Immunol. (2010) 105 :259–73. 10.1016/j.anai.2010.08.002 20934625\n16. Chastain DB Hutzley VJ Parekh J Alegro JVG . Antimicrobial desensitization: a review of published protocols. Pharmacy (Basel). (2019) 7 :112. 10.3390/pharmacy7030112 31405062\n17. Hodson ME Roberts CM Butland RJ Smith MJ Batten JC . Oral ciprofloxacin compared with conventional intravenous treatment for Pseudomonas aeruginosa infection in adults with cystic fibrosis. Lancet. (1987) 1 :235–7. 10.1016/S0140-6736(87)90062-6 2880066\n18. Mukhopadhyay S Singh M Cater JI Ogston S Franklin M Olver RE . Nebulised antipseudomonal antibiotic therapy in cystic fibrosis: a meta-analysis of benefits and risks. Thorax. (1996) 51 :364–8. 10.1136/thx.51.4.364 8733486\n19. Frederiksen B Koch C Høiby N . Antibiotic treatment of initial colonization with Pseudomonas aeruginosa postpones chronic infection and prevents deterioration of pulmonary function in cystic fibrosis. Pediatr Pulmonol. (1997) 23 :330–5. 10.1002/(SICI)1099-0496(199705)23:5<330::AID-PPUL4>3.0.CO;2-O 9168506\n20. Smith AL Fiel SB Mayer-Hamblett N Ramsey B Burns JL . Susceptibility testing of Pseudomonas aeruginosa isolates and clinical response to parenteral antibiotic administration: lack of association in cystic fibrosis. Chest. (2003) 123 :1495–502. 10.1378/chest.123.5.1495 12740266\n21. Rigg L Wu SS Hull D Hostoffer RW . A revision of rapid colistin desensitization. Ann Allergy Asthma Immunol. (2019) 123 :607–8. 10.1016/j.anai.2019.09.012 31542505\n22. Schretlen-Doherty JS Troutman WG . Tobramycin-induced hypersensitivity reaction. Ann Pharmacother. (1995) 29 :704–6. 10.1177/106002809502907-810 8520085\n23. Spigarelli MG Hurwitz ME Nasr SZ . Hypersensitivity to inhaled TOBI following reaction to gentamicin. Pediatr Pulmonol. (2002) 33 :311–4. 10.1002/ppul.10049 11921461\n24. Guglani L Abdulhamid I Ditouras J Montejo J . Desensitization to inhaled aztreonam lysine in an allergic patient with cystic fibrosis using a novel approach. Ann Pharmacother. (2012) 46 :e25. 10.1345/aph.1R293 23012384\n25. Kwak E Mainardi TR Canfield SM Miller RL Dimango EA . A novel desensitization protocol for inhaled aztreonam. J Allergy Clin Immunol. (2013) 131 :AB174. 10.1016/j.jaci.2012.12.1284\n26. Domínguez-Ortega J Manteiga E Abad-Schilling C Juretzcke MA Sánchez-Rubio J Kindelan C . Induced tolerance to nebulized colistin after severe reaction to the drug. J Investig Allergol Clin Immunol. (2007) 17 :59–61. 17323867\n\n", "fulltext_license": "CC BY", "issn_linking": "2296-2360", "issue": "9()", "journal": "Frontiers in pediatrics", "keywords": "case report; colomycin; cystic fibrosis; desensitization; drug allergy; drug tolerance; hypersensitivity", "medline_ta": "Front Pediatr", "mesh_terms": null, "nlm_unique_id": "101615492", "other_id": null, "pages": "663228", "pmc": null, "pmid": "33869120", "pubdate": "2021", "publication_types": "D016428:Journal Article", "references": "28632196;9168506;23012384;2463224;2439588;11921461;8520085;11106223;2880066;12740266;6826989;19563999;24784318;31405062;1884325;15173205;20934625;31542505;21078692;17323867;15923254;11072960;8733486;15577829", "title": "Case Report: Maintenance of Desensitization to Nebulized Colomycin Over 10 Years.", "title_normalized": "case report maintenance of desensitization to nebulized colomycin over 10 years" }
[ { "companynumb": "AT-LUPIN PHARMACEUTICALS INC.-2021-13524", "fulfillexpeditecriteria": "1", "occurcountry": "AT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "TOBRAMYCIN" }, "drugadditional...
{ "abstract": "Programmed cell death 1 (PD-1) receptor inhibitors, such as nivolumab, are used in the treatment of non-small cell lung cancers, melanoma, and other cancers. Cutaneous adverse events (AEs) associated with anti-PD-1 therapy have been widely documented. Although cutaneous AEs often are mild, some patients can develop notable morbidity. We report an 87-year-old woman with stage IV non-small cell lung cancer who developed a bullous eruption on the trunk and extremities. Biopsy of the lesions revealed a subepidermal bullous lichenoid eruption with positive immunofluorescence in a linear pattern at the basement membrane zone, consistent with lichen planus pemphigoides (LPP). The patient improved with oral prednisone and cessation of nivolumab therapy.", "affiliations": "Department of Medicine, University of Louisville School of Medicine, Kentucky, USA.;Division of Dermatology, University of Louisville School of Medicine, Kentucky, USA.;Division of Dermatology, University of Louisville School of Medicine, Kentucky, USA.;Division of Dermatology, University of Louisville School of Medicine, Kentucky, USA.", "authors": "Strickley|John D|JD|;Vence|Lacey M|LM|;Burton|Sonya K|SK|;Callen|Jeffrey P|JP|", "chemical_list": "D000074322:Antineoplastic Agents, Immunological; D000077594:Nivolumab", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0011-4162", "issue": "103(4)", "journal": "Cutis", "keywords": null, "medline_ta": "Cutis", "mesh_terms": "D000369:Aged, 80 and over; D000074322:Antineoplastic Agents, Immunological; D002289:Carcinoma, Non-Small-Cell Lung; D003937:Diagnosis, Differential; D005260:Female; D006801:Humans; D008010:Lichen Planus; D008175:Lung Neoplasms; D000077594:Nivolumab; D010392:Pemphigus", "nlm_unique_id": "0006440", "other_id": null, "pages": "224-226", "pmc": null, "pmid": "31116807", "pubdate": "2019-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Nivolumab-induced lichen planus pemphigoides.", "title_normalized": "nivolumab induced lichen planus pemphigoides" }
[ { "companynumb": "US-APOTEX-2019AP017008", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ALBUTEROL\\IPRATROPIUM" }, "drugadditional": "3"...
{ "abstract": "Lumateperone (Caplyta®) is a drug recently approved by the U.S. Food and Drug Administration for the treatment of schizophrenia. But is it a new drug with promise, or a similar drug with new wrappings? This drug, similar to other second- and third-generation serotonin dopamine antagonists, is a potent antagonist at higher serotonin 2A receptors as well as brief binding to dopamine 1 and dopamine 2 (D2) receptors, but also has partial agonism at presynaptic D2 and indirect modulation of N-Methyl-D-aspartic acid (NMDA) and alpha-amino-3-hydroxy-5-methyl-isoxazolepropionic acid (AMPA) of the glutamine receptors. The current article reviews the putative effects of this novel mechanism of action on symptoms of schizophrenia as discussed in Phase II and III trials. A case study applies the information to a clinical situation. [Journal of Psychosocial Nursing and Mental Health Services, 58(6), 9-12.].", "affiliations": null, "authors": "Limandri|Barbara J|BJ|", "chemical_list": "D014150:Antipsychotic Agents; D065127:Dopamine D2 Receptor Antagonists; D006576:Heterocyclic Compounds, 4 or More Rings; D017448:Receptors, Dopamine D2; C000705749:lumateperone; D018967:Risperidone", "country": "United States", "delete": false, "doi": "10.3928/02793695-20200513-01", "fulltext": null, "fulltext_license": null, "issn_linking": "0279-3695", "issue": "58(6)", "journal": "Journal of psychosocial nursing and mental health services", "keywords": null, "medline_ta": "J Psychosoc Nurs Ment Health Serv", "mesh_terms": "D014150:Antipsychotic Agents; D002986:Clinical Trials as Topic; D065127:Dopamine D2 Receptor Antagonists; D006576:Heterocyclic Compounds, 4 or More Rings; D006801:Humans; D008297:Male; D008875:Middle Aged; D011568:Psychiatric Nursing; D017448:Receptors, Dopamine D2; D018967:Risperidone; D012559:Schizophrenia", "nlm_unique_id": "8200911", "other_id": null, "pages": "9-12", "pmc": null, "pmid": "32463907", "pubdate": "2020-06-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Lumateperone: New Drug or Same Old Drug With a New Dress?", "title_normalized": "lumateperone new drug or same old drug with a new dress" }
[ { "companynumb": "US-MYLANLABS-2021M1013061", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "RISPERIDONE" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nAlthough the randomized mycophenolate mofetil- (MMF) azathioprine (AZA) trial is likely applicable to cardiac transplantation in general, it was limited to select and usually larger cardiac transplant centers and suffered from substantial cross-over and failure of many patients to receive assigned treatment drug.\n\n\nMETHODS\nThe Joint ISHLT/UNOS Thoracic Registry was analyzed for the effects of MMF versus AZA in patients 1) on a cyclosporine- (CsA) based immunosuppression protocol; 2) having survived long enough to be discharged from the transplant hospitalization.\n\n\nRESULTS\nA total of 5599 patients (4942 CsA/AZA and 657 CsA/MMF) were included with no significant differences between the MMF and AZA groups in baseline characteristics with the exception of recipient age (50 vs. 47 years), donor age (29 vs. 28 years), ischemic time (3.0 vs. 2.9 hr), and pretransplant medical condition (more AZA patients in ICU, more MMF patients on VAD). Actuarial survival was greater in the MMF group compared to the AZA group in patients surviving the initial transplant hospitalization (1 year 96 vs. 93%, 3 years 91 vs. 86%, P=0.0012). This difference was confirmed in the logistic regression analysis of 3-year mortality showing a relative risk of 0.62 (P=0.011).\n\n\nCONCLUSIONS\nThese data provide independent support for the broad applicability of the positive results from the randomized MMF-AZA clinical trial in a substantially larger patient population and confirm improved survival in patients using mycophenolate mofetil compared to azathioprine late after cardiac transplantation.", "affiliations": "St. Lukes's Transpant Program, Milwaukee, WI 53215, USA.", "authors": "Hosenpud|J D|JD|;Bennett|L E|LE|", "chemical_list": "D007166:Immunosuppressive Agents; D009173:Mycophenolic Acid; D001379:Azathioprine", "country": "United States", "delete": false, "doi": "10.1097/00007890-200111270-00015", "fulltext": null, "fulltext_license": null, "issn_linking": "0041-1337", "issue": "72(10)", "journal": "Transplantation", "keywords": null, "medline_ta": "Transplantation", "mesh_terms": "D000328:Adult; D000368:Aged; D001379:Azathioprine; D005260:Female; D016027:Heart Transplantation; D006760:Hospitalization; D006801:Humans; D007166:Immunosuppressive Agents; D008297:Male; D008875:Middle Aged; D009173:Mycophenolic Acid; D012042:Registries", "nlm_unique_id": "0132144", "other_id": null, "pages": "1662-5", "pmc": null, "pmid": "11726828", "pubdate": "2001-11-27", "publication_types": "D016430:Clinical Trial; D003160:Comparative Study; D016428:Journal Article; D016449:Randomized Controlled Trial", "references": null, "title": "Mycophenolate mofetil versus azathioprine in patients surviving the initial cardiac transplant hospitalization: an analysis of the Joint UNOS/ISHLT Thoracic Registry.", "title_normalized": "mycophenolate mofetil versus azathioprine in patients surviving the initial cardiac transplant hospitalization an analysis of the joint unos ishlt thoracic registry" }
[ { "companynumb": "US-ROCHE-1945590", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CYCLOSPORINE" }, "drugadditional": null, "dr...
{ "abstract": "We present the case of a 50-year-old gravida with a chronic Stanford type B aortic dissection with false lumen aneurysm and discuss a literature-based treatment strategy. She underwent oocyte donation in the United States and was seen in week 15 of gestation. We chose a strategy of \"watchful waiting\" at a constant aortic diameter of 52 mm on magnetic resonance imaging. In week 32 + 6 days, cesarean delivery was induced in a hybrid operating room with subsequent thoracic endovascular aortic repair to reduce the risk of early dilation and rupture during the nursing period. One year later, she cared for her healthy baby with stable aortic diameters.", "affiliations": "Department of Vascular Medicine, University Heart Center, University Hospital Eppendorf, Hamburg, Germany.;Department of Vascular Medicine, University Heart Center, University Hospital Eppendorf, Hamburg, Germany.;Department of Vascular Medicine, University Heart Center, University Hospital Eppendorf, Hamburg, Germany.;Department of Vascular Medicine, University Heart Center, University Hospital Eppendorf, Hamburg, Germany.;Department of Vascular Medicine, University Heart Center, University Hospital Eppendorf, Hamburg, Germany.;Department of Vascular Medicine, University Heart Center, University Hospital Eppendorf, Hamburg, Germany.", "authors": "Stoberock|Konstanze|K|;Wipper|Sabine|S|;Debus|Eike Sebastian|ES|;Somville|Thierry|T|;Rybczynski|Meike|M|;Kölbel|Tilo|T|", "chemical_list": null, "country": "Netherlands", "delete": false, "doi": "10.1016/j.jvsc.2016.02.002", "fulltext": "\n==== Front\nJ Vasc Surg CasesJ Vasc Surg CasesJournal of Vascular Surgery Cases2352-667XElsevier S2352-667X(16)00011-410.1016/j.jvsc.2016.02.002ArticleChronic type B aortic dissection in a pregnant patient managed by simultaneous thoracic endovascular aortic repair and cesarean section in the hybrid operating room Stoberock Konstanze MDk.stoberock@uke.de∗Wipper Sabine MDDebus Eike Sebastian MDSomville Thierry MDRybczynski Meike MDKölbel Tilo MDDepartment of Vascular Medicine, University Heart Center, University Hospital Eppendorf, Hamburg, Germany∗ Correspondence: Konstanze Stoberock, MD, Department of Vascular Medicine, University Heart Center, University Hospital Hamburg-Eppendorf, Martinistr. 52, 20246 Hamburg, Germany. k.stoberock@uke.de24 2 2016 3 2016 24 2 2016 2 1 25 27 24 8 2015 2 2 2016 © 2016 The Authors2016This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).We present the case of a 50-year-old gravida with a chronic Stanford type B aortic dissection with false lumen aneurysm and discuss a literature-based treatment strategy. She underwent oocyte donation in the United States and was seen in week 15 of gestation. We chose a strategy of “watchful waiting” at a constant aortic diameter of 52 mm on magnetic resonance imaging. In week 32 + 6 days, cesarean delivery was induced in a hybrid operating room with subsequent thoracic endovascular aortic repair to reduce the risk of early dilation and rupture during the nursing period. One year later, she cared for her healthy baby with stable aortic diameters.\n==== Body\nStanford type B aortic dissection (TBAD) in pregnant women is rare; 50% of aortic dissections afflicting women younger than 40 years are pregnancy associated.1, 2, 3, 4 The International Registry of Acute Aortic Dissection reported a 0.2% risk of TBAD during pregnancy and the peripartum period, particularly in the third trimester and post partum. In general, aortic dissection is more common in connective tissue disease or as the result of trauma. TBAD accounts for a minority of these cases (11%-21%).2 Chronic aortic dissection in pregnant women has not yet been reported, and current guidelines for the treatment of aortic dissection do not provide recommendations for this challenging clinical situation.5 According to these guidelines, thoracic endovascular aortic repair (TEVAR) is indicated for false lumen aneurysm with a maximum diameter of 55 mm or more. Increased risks of aneurysmal dilation and arterial rupture during pregnancy are well known.6 We therefore anticipated an increase of these risks in chronic TBAD and pregnancy because of the hemodynamic and endocrine changes during pregnancy and the lactation period. The patient consented to publication of the report.\n\nCase report\nWe saw the 50-year-old gravida (3, para: 2) in week 15 of her gestation with a known chronic TBAD of hypertensive origin from the left subclavian artery to the common iliac artery with a false lumen aneurysm of 52 mm (Figs 1 and 2). A connective tissue disorder (Marfan syndrome, Loeys-Dietz syndrome, and familial aortic aneurysm) had been excluded through genetic testing. The medical history included arterial hypertension, obesity (body mass index, 38.3), and stent grafting of the right renal artery for dissection-related renal malperfusion. On that occasion in 2008, the TBAD was first identified. In 2013, 6 months before delivery, false lumen dilation was noted with aneurysmal dilation of 4.9 cm. Because of the high risk of pregnancy-related complications, the regional ethics committee had advised against pregnancy. After unsuccessful attempts of in vitro fertilization and intracytoplasmic sperm injection, the patient became pregnant as a result of oocyte donation despite this recommendation.Fig 1 a, Volume rendering of preoperative magnetic resonance image showing the aortic dissection from the left subclavian artery to the common iliac artery with a false lumen aneurysm. b, Multiplanar reconstruction of preoperative magnetic resonance image showing the aortic dissection with a false lumen aneurysm with a maximum diameter of 52 mm.\n\nFig 2 Preoperative magnetic resonance image showing the aortic dissection and pregnancy.\n\n\n\nAn interdisciplinary team of vascular surgeons, obstetricians, neonatologists, and anesthesiologists discussed the case, and to best balance and reduce the risks of mother and child, they recommended “watchful waiting” under optimized antihypertensive therapy and repeated native magnetic resonance imaging until a gestational state of safe delivery. Further, an accompanying emergency plan was established. It included preparations for an emergency cesarean section and TEVAR in our hybrid operating room in case of a rupture. After delivery of the child, TEVAR was planned to meet the risks of further dilation and rupture during the lactation period.\n\nThe patient was treated with a quadruple antihypertensive therapy (α-methyldopa, enalapril, metoprolol, amlodipine). She developed gestational diabetes with insulin substitution with fetal macrosomia. Repeated magnetic resonance scans showed an unchanged diameter of 52 mm (20, 25, 27, and 30 weeks of gestation). From week 23 on, inpatient observation was chosen.\n\nIn week 32 + 6 days, elective early cesarean section was performed with peridural anesthesia in a hybrid operating room with a fixed imaging system. The delivery was uneventful and followed by TEVAR performed with a Cook Zenith thoracic endograft (Cook Medical, Bloomington, Ind) covering the large proximal entry tear. The left subclavian artery was covered without revascularization according to in-house guidelines (Fig 3), which recommend carotid subclavian artery revascularization only if two or more vascular territories are covered according to Czerny et al.7Fig 3 a, Postoperative angiography of thoracic endovascular aortic repair (TEVAR) with overstenting of the left subclavian artery. b, Postoperative magnetic resonance image of TEVAR without endoleaks and successful exclusion of the aneurysm.\n\n\n\nPostoperatively, the patient was monitored for 24 hours in the intensive care unit. She recovered well without complications, was transferred to a peripheral ward on the third day, and was discharged on postoperative day 6. An antiplatelet agent (acetylsalicylic acid, 100 mg) was used. Follow-up examinations (by ultrasound at 1 month and computed tomography at 3 months and 1 year after TEVAR) revealed a patent aortic stent graft with complete false lumen thrombosis throughout the stented segment of the aorta (Fig 3).\n\nDiscussion\nDuring pregnancy, the risk for acute dissection increases in the last trimester and during the postpartum period. However, published records of TBAD in pregnant women are scarce, and current guidelines of TBAD do not refer to this rare condition.1, 2, 3, 4 The median age for TBAD is 63 years for men and 67 years for women.8 Therefore, chronic TBAD as reported here is extremely rare and has not been reported yet. Only a few case reports refer to acute TBAD in pregnancy.1, 2, 3 Studies on the treatment of pregnancy-associated TBAD with best medical treatment or open surgery reported high mortality rates of 30.8% to 42.8% for both.2 With the increasing age of motherhood, more cases of this constellation may be expected in the future.\n\nThe etiology of acute pregnancy-associated dissection is marked by multiple factors. Physiologic, cardiovascular, and hormonal influences during pregnancy lead to a weakening of the aortic wall and increased shear stress, which predispose the aortic media to dissection.1 The physiologic and cardiovascular effects of TBAD in pregnancy are increased plasma volume, increased heart rate, and inotropy with ventricular hypertrophy, whereas hormonal influences are reduced mucopolysaccharides with fragmentation of the reticulum and reduction of elastic fibers.1, 2\n\nThe aortic rupture risk of chronic TBAD during pregnancy and in the postpartum period is unknown but probably increases in the last trimester and postpartum period because of endocrine and hemodynamic changes. Although our patient was not symptomatic and had an aortic diameter <55 mm, we assumed a significant risk of rupture and chose the described strategy of watchful waiting, optimized antihypertensive therapy, early hospitalization, premature delivery, and prophylactic TEVAR. The patient did well and remains asymptomatic for the chronic TBAD with false lumen thrombosis and stable aortic diameters.\n\nConclusions\nThe strategy of watchful waiting, optimized antihypertensive therapy, early hospitalization, premature delivery, and prophylactic TEVAR in chronic TBAD proved feasible in this first reported case.\n\nAuthor conflict of interest: none.\n\nThe editors and reviewers of this article have no relevant financial relationships to disclose per the Journal policy that requires reviewers to decline review of any manuscript for which they may have a conflict of interest.\n==== Refs\nReferences\n1 Stout C.L. Scott E.C. Stokes G.K. Panneton J.M. Successful repair of a ruptured Stanford type B aortic dissection during pregnancy J Vasc Surg 51 2010 990 992 20045616 \n2 Shu C. Fang K. Dardik A. Li X. Li M. Pregnancy-associated type B aortic dissection treated with thoracic endovascular aneurysm repair Ann Thorac Surg 97 2014 582 587 24200396 \n3 Yuan S.M. Aortic dissection during pregnancy: a difficult clinical scenario Clin Cardiol 36 2013 576 584 23843107 \n4 Smok D.A. Aortopathy in pregnancy Semin Perinatol 38 2014 295 303 25037520 \n5 Fattori R. Montgomery D. Lovato L. Kische S. Di Eusanio M. Ince H. Survival after endovascular therapy in patients with type B aortic dissection: a report from the International Registry of Acute Aortic Dissection (IRAD) JACC Cardiovasc Interv 6 2013 876 882 23968705 \n6 Barrett J.M. Van Hooydonk J.E. Boehm F.H. Pregnancy-related rupture of arterial aneurysms Obstet Gynecol Surv 37 1982 557 566 6752786 \n7 Czerny M. Eggebrecht H. Sodeck G. Verzini F. Cao P. Maritati G. Mechanisms of symptomatic spinal cord ischemia after TEVAR: insights from the European Registry of Endovascular Aortic Repair Complications (EuREC) J Endovasc Ther 19 2012 37 43 22313200 \n8 Tsai T.T. Nienaber C.A. Eagle K.A. Acute aortic syndromes Circulation 112 2005 3802 3813 16344407\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2352-667X", "issue": "2(1)", "journal": "Journal of vascular surgery cases", "keywords": null, "medline_ta": "J Vasc Surg Cases", "mesh_terms": null, "nlm_unique_id": "101665940", "other_id": null, "pages": "25-27", "pmc": null, "pmid": "31724638", "pubdate": "2016-03", "publication_types": "D002363:Case Reports", "references": "16344407;6752786;24200396;25037520;23843107;20045616;22313200;23968705", "title": "Chronic type B aortic dissection in a pregnant patient managed by simultaneous thoracic endovascular aortic repair and cesarean section in the hybrid operating room.", "title_normalized": "chronic type b aortic dissection in a pregnant patient managed by simultaneous thoracic endovascular aortic repair and cesarean section in the hybrid operating room" }
[ { "companynumb": "DE-VALIDUS PHARMACEUTICALS LLC-DE-2016VAL000924", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "METHYLDOPA" }, "drugad...
{ "abstract": "BACKGROUND\nTo define the maximum tolerated dose (MTD) tolerability and efficacy of intra-arterial chemotherapy with irinotecan in patients with liver metastases of colorectal carcinoma (CRC).\n\n\nMETHODS\nSuperselective intra-arterial irinotecan was applied on days 1, 14, 28 and 42. The initial dose was 140 mg/m² with escalation in the subsequent patient group to 160 mg/m². The final protocol toxicity evaluation was 260 mg/m². Patients required histologically proven disease and adequate bone marrow, liver and renal function, no extrahepatic metastasis and a life expectancy >12 weeks. results: Thirty-three patients were enrolled (median age 65, range 49-78 years). On dose level VI (240 mg/m²), 1 case of dose-limiting toxicity (DLT) (granulocytopenia) was observed, leading to an enlarged cohort of 6 patients. As no additional DLT was detected on this level, an escalation to level VII was performed. On the dose level of 260 mg/m², irinotecan DLTs were observed, resulting in the termination of escalation and the declaration of dose level VI as MTD. Imaging follow-up with Response Evaluation Criteria in Solid Tumors (RECIST) criteria revealed a complete response in 1 patient, stable disease in 31 patients, and progressed disease in 1 patient. The median time to progression was 4.7 months, the median overall survival 15.6 months.\n\n\nCONCLUSIONS\nThe method of intra-arterial chemotherapy with irinotecan is well tolerated and shows promising local response rates in liver metastases of CRC.", "affiliations": "Department of Diagnostic and Interventional Radiology, University Hospital Frankfurt, Johann Wolfgang Goethe University, Frankfurt am Main, Germany. k.eichler@em.uni-frankfurt.de", "authors": "Eichler|K|K|;Dufas|T|T|;Hammerstingl|R|R|;Gruber-Rouh|T|T|;Vogl|T J|TJ|;Zangos|S|S|", "chemical_list": "D000972:Antineoplastic Agents, Phytogenic; D000077146:Irinotecan; D002166:Camptothecin", "country": "Switzerland", "delete": false, "doi": "10.1159/000348579", "fulltext": null, "fulltext_license": null, "issn_linking": "0009-3157", "issue": "59(1)", "journal": "Chemotherapy", "keywords": null, "medline_ta": "Chemotherapy", "mesh_terms": "D000368:Aged; D000380:Agranulocytosis; D000972:Antineoplastic Agents, Phytogenic; D002166:Camptothecin; D015331:Cohort Studies; D015179:Colorectal Neoplasms; D004305:Dose-Response Relationship, Drug; D004334:Drug Administration Schedule; D005260:Female; D006801:Humans; D007269:Injections, Intra-Arterial; D000077146:Irinotecan; D008113:Liver Neoplasms; D008279:Magnetic Resonance Imaging; D008297:Male; D008875:Middle Aged; D016019:Survival Analysis; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "0144731", "other_id": null, "pages": "66-73", "pmc": null, "pmid": "23839050", "pubdate": "2013", "publication_types": "D017426:Clinical Trial, Phase I; D016428:Journal Article; D016449:Randomized Controlled Trial", "references": null, "title": "Hepatic arterial infusion with irinotecan in patients with liver metastases of colorectal cancer: results of an extended phase I study.", "title_normalized": "hepatic arterial infusion with irinotecan in patients with liver metastases of colorectal cancer results of an extended phase i study" }
[ { "companynumb": "DE-CIPLA LTD.-2015DE04000", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "IRINOTECAN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nPulmonary thromboembolism (PTE) is a life-threatening disease. In this study, we aimed to evaluate long-term outcomes of the use of 50 mg recombinant tissue-type plasminogen activator (rt-PA) in the management of PTE in terms of relapse, pulmonary hypertension (PH), mortality and hemorrhage and to compare with the use of 100 mg rt-PA.\n\n\nMETHODS\nThe study was designed as a retrospective cohort. Patients who were diagnosed as acute PTE and received either 50 or 100 mg rt-PA in a tertiary care hospital between 2010 and 2015 were included in the study. Rates of relapse, PH, mortality (in-hospital and long-term) and hemorrhage (major and minor) were calculated for each treatment group.\n\n\nRESULTS\nA total 117 patients, 73 females and 44 males, were evaluated. Eighty-three patients were administered 100 mg rt-PA, and 34 were administered 50 mg rt-PA. The mean age was lower in the 100 mg group compared to the 50 mg group (61 ± 15 vs 69 ± 14 years). There was a significant decrease in PH in each group at 3 months follow-up (P < .001). Although statistically nonsignificant, the relapse rate was lower in the 50 mg rt-PA group, but the 5-year mortality rate was higher in 50 mg rt-PA group (35.2% vs 27.7%, P = .50). Mortality was associated with older age and presence of malignancy.\n\n\nCONCLUSIONS\nOur results suggest that both doses of rt-PA have similar efficacy. The high mortality rate in the 50 mg group may have resulted from patient selection.", "affiliations": "Department of Pulmonary Diseases, Ataturk University School of Medicine, Yakutiye, 25240 Erzurum, Turkey.;Department of Pulmonary Diseases, Ataturk University School of Medicine, Yakutiye, 25240 Erzurum, Turkey.;Department of Pulmonary Diseases, Ataturk University School of Medicine, Yakutiye, 25240 Erzurum, Turkey.;Department of Pulmonary Diseases, Ataturk University School of Medicine, Yakutiye, 25240 Erzurum, Turkey.;Department of Pulmonary Diseases, Ataturk University School of Medicine, Yakutiye, 25240 Erzurum, Turkey.;Department of Pulmonary Diseases, Ataturk University School of Medicine, Yakutiye, 25240 Erzurum, Turkey.", "authors": "Yilmazel Ucar|Elif|E|http://orcid.org/0000-0001-8284-1038;Araz|Omer|O|http://orcid.org/0000-0002-3476-4506;Kerget|Bugra|B|;Yilmaz|Nafiye|N|http://orcid.org/0000-0001-9404-0393;Akgun|Metin|M|;Saglam|Leyla|L|", "chemical_list": "D005343:Fibrinolytic Agents; D011994:Recombinant Proteins; D010959:Tissue Plasminogen Activator", "country": "England", "delete": false, "doi": "10.1111/crj.12721", "fulltext": null, "fulltext_license": null, "issn_linking": "1752-6981", "issue": "12(4)", "journal": "The clinical respiratory journal", "keywords": "long-term outcomes; pulmonary thromboembolism; thrombolytic therapy", "medline_ta": "Clin Respir J", "mesh_terms": "D000208:Acute Disease; D000368:Aged; D004305:Dose-Response Relationship, Drug; D005260:Female; D005343:Fibrinolytic Agents; D005500:Follow-Up Studies; D017052:Hospital Mortality; D006801:Humans; D008297:Male; D008875:Middle Aged; D011655:Pulmonary Embolism; D011994:Recombinant Proteins; D012189:Retrospective Studies; D015996:Survival Rate; D015912:Thrombolytic Therapy; D013997:Time Factors; D010959:Tissue Plasminogen Activator; D016896:Treatment Outcome; D014421:Turkey", "nlm_unique_id": "101315570", "other_id": null, "pages": "1628-1634", "pmc": null, "pmid": "29044967", "pubdate": "2018-04", "publication_types": "D003160:Comparative Study; D016428:Journal Article", "references": null, "title": "Comparison of long-term outcomes of 50 and 100 mg rt-PA in the management of acute pulmonary thromboembolism.", "title_normalized": "comparison of long term outcomes of 50 and 100 mg rt pa in the management of acute pulmonary thromboembolism" }
[ { "companynumb": "TR-SHENZHEN TECHDOW PHARMACEUTICAL CO. LTD-TR-2018TEC0000026", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "HEPARIN SODIUM" }, ...
{ "abstract": "Dolutegravir is a preferred antiretroviral drug for human immunodeficiency virus (HIV)-infected patients following solid organ transplantation. It has potent antiretroviral activity and does not interact with calcineurin inhibitors. We describe a case of an HIV-infected kidney transplant patient, who was noted to have a rising serum creatinine following initiation of dolutegravir. At first, an acute rejection episode was suspected, but this finding was later attributed to inhibition of creatinine secretion by dolutegravir. We suggest that an awareness of this potential effect of dolutegravir is important for providers who take care of HIV-positive kidney transplant recipients, in order to prevent potentially unnecessary testing.", "affiliations": "Division of Infectious Diseases and HIV Medicine, Drexel University, Philadelphia, Pennsylvania, USA.;Department of Surgery, Drexel University, Philadelphia, Pennsylvania, USA.;Division of Infectious Diseases and HIV Medicine, Drexel University, Philadelphia, Pennsylvania, USA.;Division of Nephrology, Drexel University, Philadelphia, Pennsylvania, USA.;Division of Nephrology, Drexel University, Philadelphia, Pennsylvania, USA.;Division of Nephrology, Drexel University, Philadelphia, Pennsylvania, USA.", "authors": "Lee|D H|DH|;Malat|G E|GE|;Bias|T E|TE|;Harhay|M N|MN|;Ranganna|K|K|;Doyle|A M|AM|", "chemical_list": "D044966:Anti-Retroviral Agents; D065095:Calcineurin Inhibitors; D006575:Heterocyclic Compounds, 3-Ring; D007166:Immunosuppressive Agents; D010078:Oxazines; D010879:Piperazines; D011728:Pyridones; D003404:Creatinine; C562325:dolutegravir", "country": "Denmark", "delete": false, "doi": "10.1111/tid.12545", "fulltext": null, "fulltext_license": null, "issn_linking": "1398-2273", "issue": "18(4)", "journal": "Transplant infectious disease : an official journal of the Transplantation Society", "keywords": "antiretroviral; creatinine; dolutegravir; human immunodeficiency virus; kidney transplant", "medline_ta": "Transpl Infect Dis", "mesh_terms": "D044966:Anti-Retroviral Agents; D065095:Calcineurin Inhibitors; D003404:Creatinine; D004347:Drug Interactions; D057915:Drug Substitution; D004359:Drug Therapy, Combination; D006084:Graft Rejection; D006678:HIV; D006679:HIV Seropositivity; D006575:Heterocyclic Compounds, 3-Ring; D006801:Humans; D007165:Immunosuppression Therapy; D007166:Immunosuppressive Agents; D007676:Kidney Failure, Chronic; D016030:Kidney Transplantation; D008297:Male; D008875:Middle Aged; D010078:Oxazines; D010879:Piperazines; D011728:Pyridones", "nlm_unique_id": "100883688", "other_id": null, "pages": "625-7", "pmc": null, "pmid": "27159656", "pubdate": "2016-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "23876341;25791727;25393999;24646860;23807273;26080612;20477995;23250333;25773499;22905856;24074642;19141712;22732469;19656133;24195548", "title": "Serum creatinine elevation after switch to dolutegravir in a human immunodeficiency virus-positive kidney transplant recipient.", "title_normalized": "serum creatinine elevation after switch to dolutegravir in a human immunodeficiency virus positive kidney transplant recipient" }
[ { "companynumb": "US-ASTELLAS-2016US036450", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DARUNAVIR" }, "drugadditional": "3", ...
{ "abstract": "A 36-year-old woman who had received long-term treatment with chloroquine for systemic lupus erythematosus developed a third degree atrioventricular block and required a permanent pacemaker. Notably, left ventricular thickening and mild systolic dysfunction were noticed on echocardiography as well as on cardiac MRI. As there was no clear explanation for myocardial findings, the patient underwent an endomyocardial biopsy that demonstrated vacuolar degeneration of myocytes on light microscopy and curvilinear bodies on electron microscopy, both findings consistent with chloroquine toxicity. The drug was withheld and treatment with candesartan and carvedilol was prescribed. At 2-year follow-up, the patient remained asymptomatic and left ventricular systolic function had improved. Physicians who prescribe antimalarial drugs for rheumatic diseases should be aware of the potentially life-threatening effects of chloroquine on the heart.", "affiliations": "Division of Cardiology, Hospital Pablo Tobon Uribe, Medellin, Antioquia, Colombia.;Department of Invasive Cardiology, Clinica CardioVID, Medellin, Colombia.", "authors": "Lopez-Ruiz|Nilson|N|http://orcid.org/0000-0001-5770-2773;Uribe|Carlos Esteban|CE|", "chemical_list": "D000962:Antimalarials; D002738:Chloroquine", "country": "England", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "2014()", "journal": "BMJ case reports", "keywords": null, "medline_ta": "BMJ Case Rep", "mesh_terms": "D000328:Adult; D000962:Antimalarials; D054537:Atrioventricular Block; D009202:Cardiomyopathies; D002738:Chloroquine; D005260:Female; D006352:Heart Ventricles; D006801:Humans; D008180:Lupus Erythematosus, Systemic; D018487:Ventricular Dysfunction, Left", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "25225192", "pubdate": "2014-09-15", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "12163948;22801982;15846170;26838110;16923761;16030080;16096334;16631007;19955054;19784824;7627632;9893568;12093666;24446690;12361838;23741058;19103632;23635029", "title": "Chloroquine cardiomyopathy: beyond ocular adverse effects.", "title_normalized": "chloroquine cardiomyopathy beyond ocular adverse effects" }
[ { "companynumb": "CO-WATSON-2015-13762", "fulfillexpeditecriteria": "1", "occurcountry": "CO", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PREDNISOLONE" }, "drugadditional": null, ...
{ "abstract": "Recent research showed an increased risk of high-grade cervical dysplasia and cervical cancer associated with rheumatoid arthritis (RA). The purpose of this study was to examine whether this risk was associated with the use of biologic versus nonbiologic disease-modifying antirheumatic drugs (DMARDs).\n\n\n\nWe identified RA patients in the US Medicaid and commercial insurance databases (for the years 2000-2012) who were starting treatment with either a biologic or a nonbiologic DMARD. High-grade cervical dysplasia or cervical cancer was identified with a validated claims-based algorithm, and we assessed utilization of gynecologic procedures. To control for potential confounders, those starting therapy with a biologic DMARD were matched 1:1 to those starting therapy with a nonbiologic DMARD according to the propensity score (PS). Hazard ratios (HRs) and rate ratios (RRs) in the PS-matched Medicaid and commercial insurance cohorts were pooled by an inverse variance-weighted fixed-effects model.\n\n\n\nWe included 14,729 pairs of patients initiating biologic and nonbiologic DMARDs from the Medicaid cohort and 7,538 pairs from the commercial insurance cohort. During 73,389 person-years of active treatment with either biologic or nonbiologic DMARDs, 95 cases of high-grade cervical dysplasia or cervical cancer occurred in the 2 cohorts. The HR for high-grade cervical dysplasia or cervical cancer associated with biologic DMARD use was 1.25 (95% confidence interval [95% CI] 0.78-2.01) in the Medicaid cohort and 1.63 (95% CI 0.62-4.27) in the commercial insurance cohort, with a pooled HR of 1.32 (95% CI 0.86-2.01). The rate of gynecologic procedures involving the uterine cervix was not different between the 2 groups (pooled RR 0.96 [95% CI 0.90-1.02]).\n\n\n\nAmong women with RA, initiation of therapy with a biologic DMARD was associated with a numerically significant, but not statistically significant, increase in the risk of high-grade cervical dysplasia or cervical cancer as compared to initiation of a nonbiologic DMARD.", "affiliations": "Brigham and Women's Hospital, Boston, Massachusetts.;Brigham and Women's Hospital, Boston, Massachusetts.;Brigham and Women's Hospital, Boston, Massachusetts.;Brigham and Women's Hospital, Boston, Massachusetts.;Brigham and Women's Hospital, Boston, Massachusetts.;Brigham and Women's Hospital, Boston, Massachusetts.;Brigham and Women's Hospital, Boston, Massachusetts.", "authors": "Kim|Seoyoung C|SC|;Schneeweiss|Sebastian|S|;Liu|Jun|J|;Karlson|Elizabeth W|EW|;Katz|Jeffrey N|JN|;Feldman|Sarah|S|;Solomon|Daniel H|DH|", "chemical_list": "D018501:Antirheumatic Agents", "country": "United States", "delete": false, "doi": "10.1002/art.39689", "fulltext": null, "fulltext_license": null, "issn_linking": "2326-5191", "issue": "68(9)", "journal": "Arthritis & rheumatology (Hoboken, N.J.)", "keywords": null, "medline_ta": "Arthritis Rheumatol", "mesh_terms": "D018501:Antirheumatic Agents; D001172:Arthritis, Rheumatoid; D015331:Cohort Studies; D005260:Female; D006801:Humans; D008875:Middle Aged; D018570:Risk Assessment; D002578:Uterine Cervical Dysplasia; D002583:Uterine Cervical Neoplasms", "nlm_unique_id": "101623795", "other_id": null, "pages": "2106-13", "pmc": null, "pmid": "27015113", "pubdate": "2016-09", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't; D013487:Research Support, U.S. Gov't, P.H.S.", "references": "21208778;22782529;14585769;21072553;26271620;18798391;22491770;17941962;25811679;25692470;17036389;20890985;25800216;21345216;9382394;17187347;24618265;23403598;24027140;12845680;19197955;22020266;17108147;19061814;15840880;23117294;11074851;20142812", "title": "Biologic Disease-Modifying Antirheumatic Drugs and Risk of High-Grade Cervical Dysplasia and Cervical Cancer in Rheumatoid Arthritis: A Cohort Study.", "title_normalized": "biologic disease modifying antirheumatic drugs and risk of high grade cervical dysplasia and cervical cancer in rheumatoid arthritis a cohort study" }
[ { "companynumb": "US-JNJFOC-20160913863", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "INFLIXIMAB" }, "drugadditional": "3", "...
{ "abstract": "This report describes a suicide by self-administration of propofol in a 29-year-old female radiographer. This is the first published report of death by overdosage with propofol. Propofol was detected in tissues using high performance liquid chromatography. Post mortem femoral blood and liver concentrations of propofol were 0.22 mg/L and 1.4 mg/kg, respectively. The scene suggested that a dose of 400 mg was used.", "affiliations": "(Scientific Services), Victorian Institute of Forensic Pathology, South Melbourne, Australia.", "authors": "Drummer|O H|OH|", "chemical_list": "D015742:Propofol", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0022-1198", "issue": "37(4)", "journal": "Journal of forensic sciences", "keywords": null, "medline_ta": "J Forensic Sci", "mesh_terms": "D000059:Accidents; D000328:Adult; D002851:Chromatography, High Pressure Liquid; D062787:Drug Overdose; D005260:Female; D008401:Gas Chromatography-Mass Spectrometry; D006801:Humans; D009132:Muscles; D015742:Propofol; D013405:Suicide; D014781:Viscera", "nlm_unique_id": "0375370", "other_id": null, "pages": "1186-9", "pmc": null, "pmid": "1506835", "pubdate": "1992-07", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "A fatality due to propofol poisoning.", "title_normalized": "a fatality due to propofol poisoning" }
[ { "companynumb": "US-PFIZER INC-2017437659", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "PROPOFOL" }, "drugadditional": null, ...
{ "abstract": "Sturge-Weber syndrome (SWS) is a very rare condition characterized by abnormal vascular formations that encompass several manifestations: cutaneous, neurologic, ocular, and oral. Neurologic conditions are the most important factor, especially epilepsy, which frequently leads patients to make use of anticonvulsants. These drugs are capable of inducing abnormal tissue growth in the oral cavity that can be situated over areas with vascular malformation, requiring special attention by the clinician. This report describes 1 case of SWS and performs a literature review of treatments for this condition, providing a protocol of treatment for these clinical situations.", "affiliations": "From the João de Barros Barreto University Hospital, UFPA-Federal University of Pará, Belém, Brazil.", "authors": "Pontes|Flávia Sirotheau Corrêa|FS|;Conte Neto|Nicolau|N|;da Costa|Rodrigo Moreira Bringel|RM|;Loureiro|Arlison Miranda|AM|;do Nascimento|Liliane Silva|LS|;Pontes|Hélder Antônio Rebelo|HA|", "chemical_list": "D000927:Anticonvulsants; D010672:Phenytoin", "country": "United States", "delete": false, "doi": "10.1097/SCS.0b013e3182a2eb1d", "fulltext": null, "fulltext_license": null, "issn_linking": "1049-2275", "issue": "25(1)", "journal": "The Journal of craniofacial surgery", "keywords": null, "medline_ta": "J Craniofac Surg", "mesh_terms": "D000328:Adult; D000927:Anticonvulsants; D004827:Epilepsy; D005260:Female; D005881:Gingiva; D005885:Gingival Hyperplasia; D005890:Gingivectomy; D006801:Humans; D008297:Male; D008334:Mandible; D010027:Osteotomy; D010519:Periodontium; D010672:Phenytoin; D013341:Sturge-Weber Syndrome; D013524:Surgical Flaps; D014081:Tooth Extraction; D054079:Vascular Malformations", "nlm_unique_id": "9010410", "other_id": null, "pages": "e1-3", "pmc": null, "pmid": "24240770", "pubdate": "2014-01", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Periodontal growth in areas of vascular malformation in patients with Sturge-Weber syndrome: a management protocol.", "title_normalized": "periodontal growth in areas of vascular malformation in patients with sturge weber syndrome a management protocol" }
[ { "companynumb": "BR-ACTAVIS-2015-18387", "fulfillexpeditecriteria": "1", "occurcountry": "BR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PHENYTOIN" }, "drugadditional": null, "...
{ "abstract": "The myeloid and lymphoid neoplasms with eosinophilia and PDGFRA gene rearrangements usually show a good response to Imatinib and are typically associated with a normal karyotype, occasionally exhibiting a secondary chromosomal abnormality associated with clonal evolution. Five variant translocations involving PDGFRA have been reported. Here, we report a rare case of therapy-related acute myeloid leukemia with PDGFRA rearrangement after chemotherapy for prior B lymphoblastic leukemia (B-ALL). The patient had a history of BCR-ABL negative, hypodiploid B-ALL in complete remission after chemotherapy. However, 15 months later the patient developed acute myeloid leukemia with rapidly increasing eosinophilia, basophilia and a complex karyotype that included a novel t(4;14)(q12;q24). FIP1L1 was not associated with the PDGFRA rearrangement. The patient had a very aggressive clinical course, and died from the disease shortly after diagnosis. This is the first case of a primary therapy-related myeloid neoplasm with secondary PDGFRA rearrangement. The t(4:14)(q12;q24) is joining the growing list of the variant translocations involving PDGFRA.", "affiliations": "Department of Hematopathology and Laboratory Medicine, H. Lee Moffitt Cancer Center and Research Institute 12902 Magnolia Drive, Tampa, FL, USA.;Cytogenetics Laboratory, Laboratory Corporation of America Research Triangle Park, NC, USA.;Department of Hematopathology and Laboratory Medicine, H. Lee Moffitt Cancer Center and Research Institute 12902 Magnolia Drive, Tampa, FL, USA.", "authors": "Zhou|Jun|J|;Papenhausen|Peter|P|;Shao|Haipeng|H|", "chemical_list": "D000970:Antineoplastic Agents; D014408:Biomarkers, Tumor; D020796:Receptor, Platelet-Derived Growth Factor alpha", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1936-2625", "issue": "8(5)", "journal": "International journal of clinical and experimental pathology", "keywords": "Acute myeloid leukemia (AML); PDGFRA; basophilia; eosinophilia; therapy-related myeloid neoplasm", "medline_ta": "Int J Clin Exp Pathol", "mesh_terms": "D000368:Aged; D000970:Antineoplastic Agents; D001491:Basophils; D014408:Biomarkers, Tumor; D001856:Bone Marrow Examination; D002883:Chromosomes, Human, Pair 14; D002894:Chromosomes, Human, Pair 4; D018450:Disease Progression; D004802:Eosinophilia; D017809:Fatal Outcome; D015321:Gene Rearrangement; D020022:Genetic Predisposition to Disease; D006801:Humans; D007621:Karyotyping; D015470:Leukemia, Myeloid, Acute; D008297:Male; D010641:Phenotype; D015452:Precursor B-Cell Lymphoblastic Leukemia-Lymphoma; D020796:Receptor, Platelet-Derived Growth Factor alpha; D013997:Time Factors; D014178:Translocation, Genetic", "nlm_unique_id": "101480565", "other_id": null, "pages": "5812-20", "pmc": null, "pmid": "26191303", "pubdate": "2015", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": "11886377;23550302;17628645;14973504;12660384;24764730;16845659;20442440;18976025;22742558;16787876;12023981;17889716;19187542;17555450;17508004;24460680;24763514;19901109;22204765", "title": "Therapy-related acute myeloid leukemia with eosinophilia, basophilia, t(4;14)(q12;q24) and PDGFRA rearrangement: a case report and review of the literature.", "title_normalized": "therapy related acute myeloid leukemia with eosinophilia basophilia t 4 14 q12 q24 and pdgfra rearrangement a case report and review of the literature" }
[ { "companynumb": "US-ACCORD-040227", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "CYCLOPHOSPHAMIDE" }, "drugadditional": null, ...
{ "abstract": "Oxycodone is one of the most abused prescription drugs. Iatrogenic factors that lead to oxycodone-related death, such as mis-prescribing, present an opportunity for death prevention if identified early. This study investigated deaths involving oxycodone in Australia to explore potentially inappropriate prescribing and the coroner's investigation. The National Coronial Information System identified cases from 2001 to 2011 where oxycodone was detected by toxicological analysis. There were 806 oxycodone-related deaths, with a significant increase in the 11-year period, from 21 deaths in 2001, up almost sevenfold in 2011 (139 deaths). Most deaths were caused by combined drug toxicity (63.4%) or oxycodone toxicity alone (11.8%). Most individuals were male (59.1%), aged 35-44 years (26.7%), who died unintentionally (56.4%), with mental illness (52.1%) and/or a history of acute or chronic pain (46.2%). 312 cases (39%) described a legitimate prescription for oxycodone, of which most involved non-cancer related chronic pain. About three quarters of the indications were deemed appropriate. There were at least 43 different indications treated with oxycodone that were inappropriate. The majority of oxycodone-related cases involved minor to no description of the drugs involved (n = 600; 74.4%). A moderate description of oxycodone involvement was given in 162 cases (20.1%), while only 44 cases (5.5%) involved a thorough examination and recommendations from the coroners on oxycodone and other drugs involved in death. This study emphasized the need for medical practitioners to exercise caution when prescribing oxycodone and for coroners to provide more consistent and detailed information regarding drug use, in order to identify and implement preventive strategies.", "affiliations": "Department of Forensic Medicine, Monash University, 57-83 Kavanagh Street, Southbank, VIC, 3006, Australia, jennifer.pilgrim@monash.edu.", "authors": "Pilgrim|Jennifer L|JL|;Yafistham|Sabrina Putrianita|SP|;Gaya|Sanjeev|S|;Saar|Eva|E|;Drummer|Olaf H|OH|", "chemical_list": "D000701:Analgesics, Opioid; D010098:Oxycodone", "country": "United States", "delete": false, "doi": "10.1007/s12024-014-9624-x", "fulltext": null, "fulltext_license": null, "issn_linking": "1547-769X", "issue": "11(1)", "journal": "Forensic science, medicine, and pathology", "keywords": null, "medline_ta": "Forensic Sci Med Pathol", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000367:Age Factors; D000368:Aged; D000701:Analgesics, Opioid; D001315:Australia; D001344:Autopsy; D002423:Cause of Death; D002648:Child; D002675:Child, Preschool; D015897:Comorbidity; D016208:Databases, Factual; D004347:Drug Interactions; D062787:Drug Overdose; D005260:Female; D053593:Forensic Toxicology; D006801:Humans; D057970:Inappropriate Prescribing; D007223:Infant; D007231:Infant, Newborn; D008297:Male; D008875:Middle Aged; D009293:Opioid-Related Disorders; D010098:Oxycodone; D010818:Practice Patterns, Physicians'; D018570:Risk Assessment; D012307:Risk Factors; D012737:Sex Factors; D013997:Time Factors; D055815:Young Adult", "nlm_unique_id": "101236111", "other_id": null, "pages": "3-12", "pmc": null, "pmid": "25403552", "pubdate": "2015-03", "publication_types": "D016428:Journal Article", "references": "17680738;18834042;15831018;21970125;19187889;19682021;10661675;19686524;24721614;16304755;21895598;22925507;24129447;17227967;21164159;20837827;23696768;17636553;22227792;17661857;24290448;21083382;21895579;21668762;21564365;22339505;12852312;16862603;23594290;17169712;18799767;21668753;18039433;19460051;21823370;16236466;23294765;19874648;23442164;24422612;22471532;21467284", "title": "An update on oxycodone: lessons for death investigators in Australia.", "title_normalized": "an update on oxycodone lessons for death investigators in australia" }
[ { "companynumb": "AU-COREPHARMA LLC-2015COR00185", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "OXYCODONE" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nPseudoaneurysm of the uterine artery (UPA) is a rare cause of potentially life-threatening hemorrhage during pregnancy and puerperium. It is an uncommon condition that mainly occurs after traumatic injury to a vessel following pelvic surgical intervention, but also has been reported based on underlying endometriosis. There is an increased risk of developing UPA during pregnancy. Diagnosis includes clinical symptoms, with severe abdominal pain and is confirmed by sonographic or magnetic resonance imaging (MRI). Due to its potential risk of rupture, with a subsequent hypovolemic maternal shock and high fetal mortality, an interdisciplinary treatment should be considered expeditiously.\n\n\nMETHODS\nWe present the case of a 34-year old pregnant symptomatic patient, where a large UPA was detected at 26 weeks, based on deep infiltrating endometriosis (DIE). The UPA was successfully treated by selective arterial embolization. After embolization, the pain decreased but the woman still required intravenous analgesics during follow-up. At 37 weeks she developed a sepsis from the intravenous catheter which led to a cesarean section and delivery of a healthy boy. She was discharged 10 days postpartum.\n\n\nCONCLUSIONS\nUPA should be considered in pregnant women with severe abdominal and pelvic pain, once other obstetrical factors have been excluded. DIE might be the underlying diagnosis. It is a rare but potentially life-threatening condition for mother and fetus.", "affiliations": "Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland. tibor.zwimpfer@unibas.ch.;Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland.;Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland.;Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland.;Department of Radiology and Nuclear Medicine, University Hospital of Basel, Basel, Switzerland.;Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland.;Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland.;Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland.", "authors": "Zwimpfer|Tibor Andrea|TA|http://orcid.org/0000-0002-1574-6572;Monod|Cécile|C|;Redling|Katharina|K|;Willi|Heike|H|;Takes|Martin|M|;Fellmann-Fischer|Bernhard|B|;Manegold-Brauer|Gwendolin|G|;Hösli|Irene|I|", "chemical_list": "D017135:Desogestrel", "country": "England", "delete": false, "doi": "10.1186/s12884-021-03753-1", "fulltext": "\n==== Front\nBMC Pregnancy Childbirth\nBMC Pregnancy Childbirth\nBMC Pregnancy and Childbirth\n1471-2393\nBioMed Central London\n\n3753\n10.1186/s12884-021-03753-1\nCase Report\nUterine pseudoaneurysm on the basis of deep infiltrating endometriosis during pregnancy-a case report\nhttp://orcid.org/0000-0002-1574-6572\nZwimpfer Tibor Andrea tibor.zwimpfer@unibas.ch\n\n12\nMonod Cécile 1\nRedling Katharina 1\nWilli Heike 1\nTakes Martin 3\nFellmann-Fischer Bernhard 1\nManegold-Brauer Gwendolin 1\nHösli Irene 1\n1 grid.410567.1 Department of Obstetrics and Gynecology, University Hospital of Basel, Basel, Switzerland\n2 grid.6612.3 0000 0004 1937 0642 Department of Biomedicine, University Hospital of Basel and University Basel, Basel, Switzerland\n3 grid.410567.1 Department of Radiology and Nuclear Medicine, University Hospital of Basel, Basel, Switzerland\n9 4 2021\n9 4 2021\n2021\n21 28215 12 2020\n24 3 2021\n© The Author(s) 2021\nhttps://creativecommons.org/licenses/by/4.0/ Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.\nBackground\n\nPseudoaneurysm of the uterine artery (UPA) is a rare cause of potentially life-threatening hemorrhage during pregnancy and puerperium. It is an uncommon condition that mainly occurs after traumatic injury to a vessel following pelvic surgical intervention, but also has been reported based on underlying endometriosis. There is an increased risk of developing UPA during pregnancy. Diagnosis includes clinical symptoms, with severe abdominal pain and is confirmed by sonographic or magnetic resonance imaging (MRI). Due to its potential risk of rupture, with a subsequent hypovolemic maternal shock and high fetal mortality, an interdisciplinary treatment should be considered expeditiously.\n\nCase presentation\n\nWe present the case of a 34-year old pregnant symptomatic patient, where a large UPA was detected at 26 weeks, based on deep infiltrating endometriosis (DIE). The UPA was successfully treated by selective arterial embolization. After embolization, the pain decreased but the woman still required intravenous analgesics during follow-up. At 37 weeks she developed a sepsis from the intravenous catheter which led to a cesarean section and delivery of a healthy boy. She was discharged 10 days postpartum.\n\nConclusions\n\nUPA should be considered in pregnant women with severe abdominal and pelvic pain, once other obstetrical factors have been excluded. DIE might be the underlying diagnosis. It is a rare but potentially life-threatening condition for mother and fetus.\n\nKeywords\n\nUterine pseudoaneurysm\nDeep infiltrating endometriosis\nPregnancy\nissue-copyright-statement© The Author(s) 2021\n==== Body\nBackground\n\nUterine pseudoaneurysm (UPA) is a condition in which the arterial vessel wall has lost intraluminal continuity and blood accumulates between the two outer layers of the artery. It can present with severe abdominal and pelvic pain, and sonographic imaging or magnet resonance imaging (MRI) can detect a pulsatile growing mass. UPA occurs mainly after a traumatic injury of the vessel following pelvic surgical intervention, but rarely, it is based on severe endometriosis as DIE (Deep infiltrating endometriosis) [1–5]. The main causes are gynecological interventions, such a myomectomy, treatment of endometriosis, ovarian puncture or cystectomies, and obstetrical interventions, such as cesarean section, curettage, and vacuum or forceps extraction [3–9]. Furthermore, there is an increased risk of developing UPA during pregnancy.\n\nDue to the potential risk of rupture, with subsequent hypovolemic shock of the mother and a high fetal mortality, the diagnosis of UPA in pregnancy requires urgent interdisciplinary treatment. The standard of care is a selective arterial embolization of the uterine artery by the interventional radiologist, which has a good risk-benefit profile [10, 11].\n\nHere, we present the observation of a pregnant patient with a successfully treated symptomatic UPA that occurred in the second trimester, on the basis of a DIE in the left uterine artery and cervix.\n\nCase presentation\n\nThe 34-year old, first gravida, was admitted to our obstetrical department by ambulance at 23 + 0 weeks of gestation (WG) with progressive severe pain over 24 h in the left lower abdomen irradiating to the rectum and the vagina. The previous day, she had an unremarkable clinical and sonographic examination and a normal laboratory investigation. Her past medical history included a conization due to cervical dysplasia, dysmenorrhea and dyspareunia with suspected endometriosis, and the use of a combined oral contraceptive for 16 years prior to the current pregnancy. The pregnancy occurred spontaneously, with a single fetus. The otherwise healthy patient showed pain on palpation in the two lower abdominal quadrants: speculum examination revealed cervical ectopy and two black dots were visible at six o’clock. The vital signs were normal with an unremarkable pulse, respiratory rate, body temperature, blood pressure, and the hemoglobin was stable at 129 g/l. The laboratory tests and urine analysis showed no signs of infection. The cardiotocogram (CTG) was normal without contractions. Cervical length was 34 mm, measured by transvaginal ultrasound. Fetal sonography and Doppler studies revealed normal biometry with a fetus appropriate for gestational age at 42nd percentile, normal amniotic fluid, a posterior wall placenta without signs of hematoma and a normal uteroplacental resistance. Caudal and adjacent to the left ovary, a solid, ill-defined adnexal mass of 40x45mm and moderate blood flow was detected (Fig. 1 a, b). On MRI, the adnexal mass was seen and was suggestive of endometriosis (Fig. 2 a and b). There were no signs of intraabdominal free fluid or kidney stones. Fig. 1 Development of the UPA over 2 weeks by ultrasound. Visit 1 with a. Ultrasound image of the ill-defined solid mass in the adnex at the initial presentation at 23 + 2 gestational weeks. The arrows mark the outer margins of the lesion. An endometrioma is not clearly visible. b. Corresponding Doppler image of the left adnexa showing moderate blood flow (Color Score 3) in the lesion. Visit 2 with c\n\nUltrasound Image of the same lesion on the follow up at 25 + 2 gestational weeks. On the lower right there is an unilocular mass suggestive of endometrioma. In the center there is a pulsating vessel (UPA) of about 2 cm with most likely haematoma surrounding the UPA and d. corresponding Doppler image confirming blood flow in the vessel.\n\nFig. 2 Timeline of the development of the endometriosis nodule and pseudoaneurysm of the uterine artery (UPA), from transvaginal ultrasound (TVUS) and magnetic resonance imaging (MRI). a: T1 weighted transverse MRI showing a lesion (2 cm × 2 cm) caudal adjacent to the left ovary, suspected to be an endometriosis nodule; b: Dynamic MR angiography (TWIST) showing a small process of the left uterine artery.; c.T1 weighted transverse MRI showing a progressing lesion (3.8 cm × 2 cm) with expansion to the rectovaginal space with d. a corresponding growing alteration of the left uterine artery in the TWIST.; e. T1 weighted transverse MRI with an identifiable UPA (2.5 cm × 1.5 cm) and the confirmation in the f. TWIST.; g. TVUS showing the UPA (left) (black arrow) and the endometriosis nodule (white arrow) one day after embolization; h: TVUS follow-up ultrasound a week after embolization, showing the UPA left (black arrow) and endometriois nodule (white arrow)\n\nThe patient was hospitalized for monitoring and analgesic therapy. The pelvic pain persisted despite intravenous (IV) opiate therapy. Additionally, the patient complained of newly occurring dyschezia and a single episode of brown vaginal discharge. A follow-up MRI after 6 days, at 24 + 1 WG showed progression of the lesion, with expansion into the rectovaginal space (Fig. 2 c and d). The patient remained hospitalized for maternal and fetal monitoring and received continuous analgesia and steroids for fetal lung maturation induction with tocolysis as a precautionary measure. Sixteen days after hospitalization (25 + 3 WG), a pseudoaneurysm of the left uterine artery (2.5 cm × 1.5 cm) was identified by ultrasound (Fig. 1 c and d) and confirmed by MRI. (Fig. 2 e and f). An interdisciplinary team of radiologist, fetomaternal specialists, gynecologists and neonatologists concluded that, based on the early gestational age, the progression of the lesion and in view to the persistent pain, a selective embolization of the left uterine artery would be the preferred management. The neonatologist team was prepared for an emergency cesarean section in case of any complications. The intervention was carried out under local anesthesia with a retrograde access over the left common femoral artery. No digital subtraction angiography was performed in order to minimize radiation exposition. Embolization was achieved by selective occlusion of the aneurysm-feeding branch of the left uterine artery over a microcatheter by injection of 0.2 ml liquid embolic material (histoacryl/lipiodol 1:3). The estimated radiation exposure for the uterus was 0.4 mSv. Subsequently the contrast media had suspended in the UPA as indication for a sufficient occlusion. Further sequential sonographic examinations confirmed normal fetal growth and Doppler flow. The embolized UPA showed no vascularization and decreased to 2 cm × 1 cm on sonography before hospital discharge (Fig. 2 g and h). The pelvic pain improved but did not resolve completely and the patient received a peripherally inserted central venous catheter (PICC) line and, temporarily, a patient-controlled analgesia pump. After 30 days (28 + 2 WG), she was discharged to outpatient care with oral morphine in reserve and the PICC line in situ. A primary cesarean at 38 weeks was planned because of the risk of the UPA rupturing during contractions. However, the patient presented herself at 37 weeks, with sepsis of unknown etiology, a fever of 39.0 °C, tachypnea, hypotension, maternal tachycardia, a C-reactive protein of 23.8 mg/l and fetal tachycardia (200 beats per minute). An emergency cesarean delivery was done under general anesthesia with antibiotic therapy (amoxicillin and clavulanic acid) and a healthy boy was born (2670 g) with Apgar 6/7/8 and pH 7.31. Postoperatively, the patient needed intensive care (IC) for 3 days. Blood cultures were positive for Serratia macescens and Streptococcus anginosus, and according to the resistance tests, treatment was changed to carbapenem IV. The patient was discharged, together with the newborn, 10 days after the cesarean section. The infection was most likely caused by an infected PICC line, even though the results of the smear tests and cultures were unremarkable.\n\nThe patient presented for follow-up at 6 weeks postpartum. She had lactation amenorrhea, persisting dyschezia and newly developed hematochezia. Rectovaginal sonography and palpation identified an unchanged endometriosis node. We started suppressive therapy with Desogestrel and scheduled a colonoscopy to exclude another origin for the hematochezia and an MRI for staging. The MRI showed an endometriosis node 3x2cm adjacent to the septum rectovaginale with expansion to the left ovary and in close proximity to the sigmoid without infiltration according to an Enzian score A2, B1, C1. (Fig. 3 a and b) The restructuring operation of the symptomatic DIE is planned for 4 months after her delivery. Fig. 3 Abdominal magnetic resonance imaging (MRI) two months after the delivery a. T2 weighted transverse MRI and b. T2 weighted coronal MRI showed an endometriosis node 3x2cm (white arrow) adjacent to the septum rectovaginale with expansion to the left ovary and in close proximity to the sigmoid without infiltration according to an Enzian score A2, B1, C1\n\nDiscussion\n\nThis case illustrates the difficulty to diagnose the rare entity of a UPA during pregnancy. In our case, the appearance of the lesion changed over time and finally led to the correct diagnosis with the combination of sonography and MRI. There is an increased risk of developing or diagnosing UPA during pregnancy. It is assumed that the physiological changes of the hormonal milieu and cardiovascular system, together with the pressure on the vessels promote the development of UPA [12]. Additionally, the improvement of imaging technology and the frequent ultrasounds during pregnancy increase the probability of diagnosing a UPA.\n\nEndometriosis further increases the risk of UPA during and after pregnancy, in particular DIE [13–15]. The endometrial implants demonstrate a non-location response to hormonal stimulation. Estrogens are a proliferating factor, and the hormone withdrawal results in abortive bleeding which is associated with pain. Additionally, inflammatory cell production is stimulated, resulting in pain and adhesions. Gestagen inhibits the inflammatory reaction. In menopause, the decline of ovarian stimulation turns active endometriosis lesions inactive. Since pregnancy has a similar effect, with a decline of ovarian stimulation and increasing gestagen levels, a common assumption is that pregnancy temporarily cures endometriosis [16–18]. Recently, conflicting data demonstrates preexisting endometriosis causes pregnancy complications due to adhesions, chronic inflammation and intrusion of decidualized endometriosis [19–21]. Chronic inflammation makes the vessels more vulnerable to lacerations [22] and adhesion can increase the stress on uterine-ovarian vessels [23]. The intrusion of decidualized endometriosis can result in a perforation of the uterine-ovarian vessels and, because of persistent progesterone levels, decidualization occurs with differentiation of mesenchymal cells [24, 25]. A decrease in progesterone at the end of the third trimester of pregnancy correlates with an increased expression of inflammatory cells, proteolytic degradation of the extracellular matrix, cell death, and, finally, bleeding of the peritoneum [26, 27].\n\nIn this patient, the combination of preexisting DIE and pregnancy probably caused the UPA. The close follow-up, with ultrasound and MRI, enabled us to detect the development of the UPA from the endometriosis node during the second trimester. Previously, ruptured or unruptured UPA have been detected in pregnant patients with a known history of endometriosis or previous surgery [13–15]. Van Coppenollea et al. summarized six cases of UPA, based on previous appendectomy, cesarean section or surgically treated endometriosis [9]. Feld et al. described even a case of a hemoperitoneum, caused by a ruptured UPA based on endometriosis, but the UPA was only detected postpartum [13]. Our patient was symptom-free apart from occasional dyspareunia and dysmenorrhea because of a suspected rectovaginal endometriosis before pregnancy, as she was on hormonal contraception for 16 years until 6 months before pregnancy. We presume that the pregnancy stimulated the decidualization of the endometriosis, in particular of the deep infiltrating rectovaginal node adjacent to the UPA. The chronic inflammation, in combination with the decidualization, might have increased the stress on the uterine artery resulting in the UPA. Fortunately, the UPA was diagnosed early, and the expedited treatment preserved the pregnancy and avoided preterm delivery.\n\nTranscatheter arterial embolization has been established as an effective technique for the management and prevention of obstetric and gynecologic hemorrhage [10, 11, 15, 28–30]. Complications of transcatheter arterial embolization are extremely uncommon when it is performed by expert interventional radiologists. Its advantages include prevention of surgical risks, high success rates, low complication rates, and no significant impact on future pregnancies and fertility [10, 11, 15, 28–30]. Three reported cases in literature [11, 14, 30] and our case suggest that successful unilateral uterine artery embolization is well tolerated by the fetus and therefore appears to be a safe and effective method to treat pseudoaneurysm during pregnancy without compromising uteroplacental perfusion. Moreover, in our case the estimated radiation exposure for the uterus was only 0.4 mSv, which is far below any critical exposure rate for the fetus.\n\nOur patient suffered long-term from severe immobilizing pain, which was difficult to control. Furthermore, the hospitalization and treatment were physically and emotionally very stressful. This raises the question regarding early diagnosis and treatment of such cases through monitoring pregnancies of patients with endometriosis. Currently, there is no evidence that endometriosis has a significant effect on pregnancy outcome [31, 32].; however, rare cases such as our case might be encountered in pregnancy and a data base of deep infiltrating endometriosis like that available at the Kepler University Clinic together with the Foundation Endometriosis Research (SEF), and with support of the Deutsche Gesellschaft für Gynäkologie und Geburtshilfe (DGGG) will be helpful in identifying patients at risk for such a complication and provide diagnostic and treatment guidelines.\n\nConclusions\n\nUPA should be considered in pregnant women with severe abdominal and pelvic pain, once other obstetrical factors have been excluded. Endometriosis can cause UPA during and after pregnancy, in particular DIE. It is a rare but potentially life-threatening condition for the mother and fetus, as a rupture of the UPA will result in hemoperitoneum and hypovolemic, hemorrhagic shock. The standard of care in a stable situation is selective arterial embolization, which has a good risk-benefit profile. There is currently no evidence that endometriosis has a harmful effect on the pregnancy outcome, therefore, no special monitoring of conventional pregnancies for patients with endometriosis is required. Nevertheless, awareness should be raised among physicians, and similar cases should be reported to establish treatment guidelines.\n\nAbbreviations\n\nCTG Cardiotocogram\n\nDIE Deep infiltrating endometriosis\n\nIC Intensive care\n\nIV Intravenous\n\nMRI Magnetic resonance imaging\n\nPICC Peripherally inserted central venous catheter\n\nTVUS Transvaginal ultrasound\n\nUPA Uterine pseudoaneurysm\n\nWG Weeks of gestation\n\nAcknowledgements\n\nNot applicable.\n\nAuthors’ contributions\n\n(I) Conception and design: TZ, KR, HW, GM. (II) Administrative support: IH, BF, GM, MT. (III) Collection and assembly of data: TZ, CM, MT. (IV) Data analysis and interpretation: TZ, CM, KR, HW. (V) Manuscript writing: all authors. (VI) Final approval of manuscript: all authors.\n\nFunding\n\nNot applicable.\n\nAvailability of data and materials\n\nThe data and materials analyzed during the current case report are presented within the manuscript and available from the corresponding author.\n\nDeclarations\n\nEthics approval and consent to participate\n\nAccording to the ethics committee of Northwest and Central Switzerland (EKNZ) the project does not fall under the remit of the cantonal or federal law Human Research Act (HRA) because the project is not defined as a research project as per HRA Art. 2; therefore, an Institutional Review Board approval is not needed. The patient gave her written consent to participate in this case report and waived any claims. The anonymization of personal data was guaranteed.\n\nConsent for publication\n\nWritten informed consent was obtained from the patient for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor of this journal.\n\nCompeting interests\n\nThe authors Tibor Andrea Zwimpfer, Cécile Monod, Katharina Redling, Heike Willi, Martin Takes, Bernhard Fellmann-Fischer, Gwendolin Manegold-Brauer and Irene Hösli have no competing interest to disclose.\n\nPublisher’s Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n==== Refs\nReferences\n\n1. Ferrero S Bogliolo S Rossi UG Baldi C Valenzano Menada M Ragni N Remorgida V Unusual complication of excision of pelvic endometriosis: pseudoaneurysm of the left uterine artery Fertil Steril 2010 93 1 264 266 10.1016/j.fertnstert.2009.02.002 19285669\n2. Boi L Savastano S Beghetto M Dall'Acqua J Montenegro GM Embolization of iatrogenic uterine pseudoaneurysm Gynecol Minim Invasive Ther 2017 6 2 85 88 10.1016/j.gmit.2017.02.004 30254884\n3. Baba Y Matsubara S Kuwata T Ohkuchi A Usui R Saruyama M Uterine artery pseudoaneurysm: not a rare condition occurring after non-traumatic delivery or non-traumatic abortion Arch Gynecol Obstet 2014 290 3 435 440 10.1007/s00404-014-3226-4 24691826\n4. Wald DA Postpartum hemorrhage resulting from uterine artery pseudoaneurysm J Emerg Med 2003 25 1 57 60 10.1016/S0736-4679(03)00098-2 12865110\n5. Bhatt A Odujebe O Bhatt S Houry D Uterine artery pseudoaneurysm rupture: a life-threatening presentation of vaginal bleeding Ann Emerg Med 2010 55 5 460 463 10.1016/j.annemergmed.2010.01.026 20172628\n6. Dohan A Soyer P Subhani A Hequet D Fargeaudou Y Morel O Boudiaf M Gayat E Barranger E le Dref O Sirol M Postpartum hemorrhage resulting from pelvic pseudoaneurysm: a retrospective analysis of 588 consecutive cases treated by arterial embolization Cardiovasc Intervent Radiol 2013 36 5 1247 1255 10.1007/s00270-013-0668-1 23756881\n7. Isono W Tsutsumi R Wada-Hiraike O Fujimoto A Osuga Y Yano T Taketani Y Uterine artery pseudoaneurysm after cesarean section: case report and literature review J Minim Invasive Gynecol 2010 17 6 687 691 10.1016/j.jmig.2010.06.004 20656567\n8. Matsubara S Uterine artery pseudoaneurysm after cesarean section: case report and literature review [Letter,author reply] J Minim Invasive Gynecol 2011 18 411 412 10.1016/j.jmig.2011.03.003 21545975\n9. Van Coppenolle C Jaillet L Gallot D Chabrot P Delabaere A Rupture d’un aneuvrisme de l’artere uterine en cours de grossesse traitée par embolisation Gynecol Obstet Fertil Senol 2019 47 10 761 764 10.1016/j.gofs.2019.08.006 31493560\n10. Kwon JH Kim GS Obstetric iatrogenic arterial injuries of the uterus: diagnosis with US and treatment with transcatheter arterial embolization Radiographics 2002 22 1 35 46 10.1148/radiographics.22.1.g02ja0735 11796896\n11. Ugwumadu L Hayes K Belli AM Heenan S Loftus I Uterine artery pseudoaneurysm requiring embolization in pregnancy: a case report and review of the literature CVIR Endovasc 2018 1 1 31 10.1186/s42155-018-0040-2 30652162\n12. Barrett JM Van Hooydonk JE Boehm FH Pregnancy-related rupture of arterial aneurysms Obstet Gynecol Surv 1982 37 9 557 566 10.1097/00006254-198209000-00001 6752786\n13. Feld Z Rowen T Callen A Goldstein R Poder L Uterine artery pseudoaneurysm in the setting of deep endometriosis: an uncommon cause of hemoperitoneum in pregnancy Emerg Radiol 2018 25 1 107 110 10.1007/s10140-017-1560-0 28986709\n14. Zilberman A Eisenberg V Yoeli R Soriano D Sivan E Golan G Mashiach R Uterine artery pseudoaneurysm in a pregnant patient with retrocervical endometriosis J Minim Invasive Gynecol 2020 27 5 1209 1213 10.1016/j.jmig.2020.03.010 32259651\n15. Laubach M Delahaye T Van Tussenbroek F Debing E De Catte L Foulon W Uterine artery pseudo-aneurysm: diagnosis and therapy during pregnancy J Perinat Med 2000 28 4 321 325 10.1515/JPM.2000.041 11031704\n16. Beecham CT Surgical treatment of endometriosis with special reference to conservative surgery in young women J Am Med Assoc 1949 139 15 971 10.1001/jama.1949.02900320001001 18113902\n17. Kistner RW Conservative management of endometriosis J Lancet 1959 79 5 179 183 13654930\n18. Kistner RW Endometriosis and infertility Clin Obstet Gynecol 1959 2 3 877 889 10.1097/00003081-195902030-00023 14409474\n19. Navarro R, Poder L, Sun D, Jha P. Endometriosis in pregnancy. Abdom Radiol 2020;45:1741–1753. https://doi.org/10.1007/s00261-020-02486-7, 6.\n20. Frühauf F Fanta M Burgetová A Fischerová D Endometriosis in pregnancy - diagnostics and management. Endometrióza v těhotenství - diagnostika a management Ceska Gynekol 2019 84 1 61 67 31213060\n21. Leeners B Damaso F Ochsenbein-Kölble N Farquhar C The effect of pregnancy on endometriosis-facts or fiction? Human Reprod Update 2018 24 3 290 299 10.1093/humupd/dmy004\n22. Manresa MC Godson C Taylor CT Hypoxia-sensitive pathways in inflammation driven fibrosis Am J Physiol Regul Integr Comp Physiol 2014 307 12 R1369 R1380 10.1152/ajpregu.00349.2014 25298511\n23. Rossman F D’Ablaing G III Marrs RP Pregnancy complicated by rupture endometrioma Obstet Gynecol 1983 62 4 519 521 6888830\n24. O’Leary SM Ectopic decidualization causing massive postpartum intraperitonea hemorrhage Obstet Gynecol 2006 108 776 779 10.1097/01.AOG.0000200596.98039.c5 17018499\n25. Plaisier M Decidualisation and angiogenesis Best Pract Res Clin Obstet Gynaecol 2011 25 3 259 271 10.1016/j.bpobgyn.2010.10.011 21144801\n26. Brosens IA Fusi L Brosens JJ Endometriosis is a risk factor for spontaneous hemoperitoneum during pregnancy Fertil Steril 2009 92 4 1243 1245 10.1016/j.fertnstert.2009.03.091 19439293\n27. Erikson DW Chen JC Piltonen TT Conti M Irwin JC Giudice LC Inhibition of epidermal growth factor receptor restores decidualization markers in stromal fibroblasts from women with endometriosis J Endometriosis 2014 6 4 196 211 10.5301/je.5000198\n28. Salazar GM Petrozza JC Walker TG Transcatheter endovascular techniques for management of obstetrical and gynecologic emergencies Tech Vasc Interv Radiol 2009 12 2 139 147 10.1053/j.tvir.2009.08.007 19853231\n29. Vedantham S Goodwin SC McLucas B Mohr G Uterine artery embolization: an underused method of controlling pelvic hemorrhage Am J Obstet Gynecol 1997 176 4 938 948 10.1016/S0002-9378(97)70624-0 9125624\n30. Cornette J van der Wilk E Janssen NM van der Weiden RMF Jenninkens SFM Pattynama P Duvekot JJ Uterine artery pseudoaneurysm requiring embolization during pregnancy Obstet Gynecol 2014 123 2 Pt 2 Suppl 2 453 456 10.1097/AOG.0000000000000002 24413233\n31. Inversetti A, Giorgione V, Viganò P, Candiani M, A systematic review on endometriosis during pregnancy: diagnosis, misdiagnosis, complications and outcomes. Hum Reprod Update. 2016 https://doi.org/10.1093/humupd/dmv045, 22, 1, 70, 103.\n32. Zullo F, Spagnolo E, Saccone G, Acunzo M, Xodo S, Ceccaroni M, et al. Endometriosis and obstetrics complications: a systematic review and meta-analysis. Fertil Steril https://doi.org/10.1016/j.fertnstert.2017.07.019, 2017.\n\n", "fulltext_license": "CC BY", "issn_linking": "1471-2393", "issue": "21(1)", "journal": "BMC pregnancy and childbirth", "keywords": "Deep infiltrating endometriosis; Pregnancy; Uterine pseudoaneurysm", "medline_ta": "BMC Pregnancy Childbirth", "mesh_terms": "D015746:Abdominal Pain; D000328:Adult; D017541:Aneurysm, False; D002585:Cesarean Section; D017135:Desogestrel; D004715:Endometriosis; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D050498:Live Birth; D018810:Magnetic Resonance Angiography; D008297:Male; D011247:Pregnancy; D011249:Pregnancy Complications, Cardiovascular; D016896:Treatment Outcome; D014463:Ultrasonography; D055988:Uterine Artery; D055357:Uterine Artery Embolization; D014599:Uterus", "nlm_unique_id": "100967799", "other_id": null, "pages": "282", "pmc": null, "pmid": "33836672", "pubdate": "2021-04-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "17018499;11796896;24691826;24413233;21144801;25298511;32259651;6888830;12865110;21545975;18113902;19285669;6752786;32206832;30652162;14409474;26450609;29471493;11031704;28874260;19853231;28986709;20172628;23756881;30254884;13654930;20656567;9125624;31213060;31493560;19439293", "title": "Uterine pseudoaneurysm on the basis of deep infiltrating endometriosis during pregnancy-a case report.", "title_normalized": "uterine pseudoaneurysm on the basis of deep infiltrating endometriosis during pregnancy a case report" }
[ { "companynumb": "CH-SUN PHARMACEUTICAL INDUSTRIES LTD-2021RR-297489", "fulfillexpeditecriteria": "1", "occurcountry": "CH", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "AMOXICILLIN\\CLAVULANIC ACID" ...
{ "abstract": "Gabapentin, one of the antiepileptics, shows its effects via voltage-gated calcium channels. Sedation and mood elevation are among its side effects. The positive effects of antiepileptics such as valproate and carbamazepine as mood stabilizers have raised the hope that other antiepileptics may as well be efficacious in the treatment of mood disorders. However, relevant research data have not proven success of newer antiepileptics. This article presents the negative side effects of gabapentin such as psychotic and depressive symptoms, which occur shortly after its use. The use of gabapentin in mood disorders is discussed through these side effects.", "affiliations": "Üsküdar University, Istanbul, Turkey alperevrensel@gmail.com.;Üsküdar University, Istanbul, Turkey.", "authors": "Evrensel|Alper|A|;Ünsalver|Barış Önen|BÖ|", "chemical_list": "D000588:Amines; D003509:Cyclohexanecarboxylic Acids; D018691:Excitatory Amino Acid Antagonists; D005680:gamma-Aminobutyric Acid; D000077206:Gabapentin", "country": "United States", "delete": false, "doi": "10.1177/0091217415589295", "fulltext": null, "fulltext_license": null, "issn_linking": "0091-2174", "issue": "49(4)", "journal": "International journal of psychiatry in medicine", "keywords": "Gabapentin; depression; psychosis; side effects", "medline_ta": "Int J Psychiatry Med", "mesh_terms": "D000588:Amines; D003509:Cyclohexanecarboxylic Acids; D003863:Depression; D018691:Excitatory Amino Acid Antagonists; D005260:Female; D000077206:Gabapentin; D006801:Humans; D009437:Neuralgia; D011605:Psychoses, Substance-Induced; D005680:gamma-Aminobutyric Acid", "nlm_unique_id": "0365646", "other_id": null, "pages": "245-8", "pmc": null, "pmid": "26060258", "pubdate": "2015", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Psychotic and depressive symptoms after gabapentin treatment.", "title_normalized": "psychotic and depressive symptoms after gabapentin treatment" }
[ { "companynumb": "TR-ACI HEALTHCARE LIMITED-1053819", "fulfillexpeditecriteria": "1", "occurcountry": "TR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "GABAPENTIN" }, "drugadditional": null...
{ "abstract": "BACKGROUND\nTranslocation renal cell carcinoma (TRCC) is a rare form of RCC affecting mostly children and young adults with the occurrence of only 1-5% of all renal cell carcinomas. These carcinomas are associated with different translocations on a short arm of chromosome X in the region 11.2, which results in genetic modification of the p arm containing the transcription factor E3 gene.\n\n\nMETHODS\nHerein we report a case of a patient who was dia-gnosed with TRCC with c-Met overexpression and was treated with multiple targeted therapy agents and immunotherapy.\n\n\nMETHODS\nA 28-year old woman without a significant past medical history underwent left sided total nephrectomy for TRCC. Seven months later, she developed systemic relapse and was treated with multiple lines of targeted therapy including sunitinib, everolimus, sorafenib, crizotinib, and pazopanib as well as with anti-PD-L1 antibody nivolumab, with stable disease as a best response. The most pronounced disease stabilization was achieved with sorafenib, which lasted 18 months. The patient died 81 months after initial dia-gnosis and 74 months from the dia-gnosis of metastatic disease.\n\n\nCONCLUSIONS\nImproved survival observed in our patient could be related to the effectivity of tyrosine-kinase inhibitors, but notm-TOR inhibitors, even though disease stabilisation was observed as a best response. Identification of new treatment targets are warranted in this rare disease.", "affiliations": null, "authors": "Gomolčáková|J|J|;Brezinová|B|B|;Dubovan|P|P|;Jurišová|S|S|;Rejlekova|K|K|;Chovanec|M|M|;Mardiak|J|J|;Mego|M|M|", "chemical_list": "D000970:Antineoplastic Agents; D051778:Basic Helix-Loop-Helix Leucine Zipper Transcription Factors; D007191:Indazoles; D047428:Protein Kinase Inhibitors; D011743:Pyrimidines; D013449:Sulfonamides; C069203:TFE3 protein, human; D000077594:Nivolumab; D000077547:Crizotinib; C516667:pazopanib; D000068338:Everolimus; D000077157:Sorafenib; D019859:Proto-Oncogene Proteins c-met; D000077210:Sunitinib", "country": "Czech Republic", "delete": false, "doi": "10.48095/ccko2021137", "fulltext": null, "fulltext_license": null, "issn_linking": "0862-495X", "issue": "34(2)", "journal": "Klinicka onkologie : casopis Ceske a Slovenske onkologicke spolecnosti", "keywords": "Xp11.2 translocation; c-Met; crizotinib; immunotherapy; sorafenib; targeted therapy; translocation renal cell carcinoma", "medline_ta": "Klin Onkol", "mesh_terms": "D000328:Adult; D000970:Antineoplastic Agents; D051778:Basic Helix-Loop-Helix Leucine Zipper Transcription Factors; D002292:Carcinoma, Renal Cell; D041321:Chromosomes, Human, X; D000077547:Crizotinib; D018450:Disease Progression; D000068338:Everolimus; D017809:Fatal Outcome; D005260:Female; D006801:Humans; D007191:Indazoles; D007680:Kidney Neoplasms; D058990:Molecular Targeted Therapy; D000077594:Nivolumab; D047428:Protein Kinase Inhibitors; D019859:Proto-Oncogene Proteins c-met; D011743:Pyrimidines; D000077157:Sorafenib; D013449:Sulfonamides; D000077210:Sunitinib; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "9425213", "other_id": null, "pages": "137-140", "pmc": null, "pmid": "33906362", "pubdate": "2021", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Targeted therapy in Xp11 translocation renal cell carcinoma.", "title_normalized": "targeted therapy in xp11 translocation renal cell carcinoma" }
[ { "companynumb": "SK-BAYER-2021-141643", "fulfillexpeditecriteria": "1", "occurcountry": "SK", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "SORAFENIB" }, "drugadditional": null, "d...
{ "abstract": "The majority of patients treated with anti-tumor necrosis factor (TNF) therapy develop anti-drug antibodies (ADAs), which might result in loss of treatment efficacy. Strict guidelines on measuring trough levels (TLs) and ADA in clinical routine do not exist. To provide real-world data, we took advantage of our tertiary inflammatory bowel disease (IBD) center patient cohort and determined indicators for therapeutic drug monitoring (TDM) and actual consequences in patient care.\nWe retrospectively collected clinical data of 104 IBD patients treated with infliximab or adalimumab in our IBD clinic. Patients with TL and ADA measurements between June 2015 and February 2018 were included.\nThe main reason for determining TL was increased clinical disease. Subtherapeutic TLs were found in 33 patients, therapeutic TLs in 33 patients, and supratherapeutic TLs in 38 patients. Adjustments in anti-TNF therapy occurred more frequently (p = 0.01) in patients with subtherapeutic TL (24 of 33 patients; 73%) as compared to patients with therapeutic and supratherapeutic TLs (26 of 71 patients; 37%). No correlation could be found between TL and disease activity (p = 0.16). Presence of ADA was found in 16 patients, correlated with the development of infusion reactions (OR: 10.6, RR: 5.4, CI: 2.9-38.6), and was associated with subtherapeutic TL in 15 patients (93.8%). Treatment adaptations were based on TL and/or ADA presence in 36 of 63 patients.\nTDM showed significant treatment adaptations in patients with subtherapeutic TL. Conversely, in patients with therapeutic and supratherapeutic TLs, reasons for adaptations were based on considerations other than TL, such as clinical disease activity. Further studies should focus on decision-making in patients presenting with supratherapeutic TL in remission.", "affiliations": "Department of Gastroenterology and Hepatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland.;Department of Gastroenterology and Hepatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland.;Department of Immunology, University Hospital Zurich, Zurich, Switzerland.;Department of Immunology, University Hospital Zurich, Zurich, Switzerland.;Department of Gastroenterology and Hepatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland.;Department of Internal Medicine, University Hospital Zurich, University of Zurich, Zurich, Switzerland.;Department of Gastroenterology and Hepatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland.;Department of Gastroenterology and Hepatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland.;Department of Gastroenterology and Hepatology, University Hospital Zurich, University of Zurich, Zurich, Switzerland.", "authors": "Reinhold|Ilana|I|;Blümel|Sena|S|;Schreiner|Jens|J|;Boyman|Onur|O|;Bögeholz|Jan|J|;Cheetham|Marcus|M|;Rogler|Gerhard|G|;Biedermann|Luc|L|;Scharl|Michael|M|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.1159/000511296", "fulltext": null, "fulltext_license": null, "issn_linking": "2296-9365", "issue": "6(1)", "journal": "Inflammatory intestinal diseases", "keywords": "Adalimumab; Anti-drug antibodies; Anti-tumor necrosis factor; Crohn's disease; Inflammatory bowel disease; Infliximab; Trough level measurement; Ulcerative colitis", "medline_ta": "Inflamm Intest Dis", "mesh_terms": null, "nlm_unique_id": "101677990", "other_id": null, "pages": "38-47", "pmc": null, "pmid": "33850838", "pubdate": "2021-02", "publication_types": "D016428:Journal Article", "references": "25358062;26092578;26535480;25569569;24490595;15224278;24041539;22751454;21407183;22344964;13260656;25707962;27508512;23797343;26116557;24486408;16021319;28839870;27269903;6102236;22325168;29697810;26741065;28513805;24280879;30928454;25112605;12584368;28195852;25724455;23419382;21122530;26351388;19756557;29431871;29027257;23666424;24013361;28210077;24393836;20145610;26113313;21486979;18784655", "title": "Clinical Relevance of Anti-TNF Antibody Trough Levels and Anti-Drug Antibodies in Treating Inflammatory Bowel Disease Patients.", "title_normalized": "clinical relevance of anti tnf antibody trough levels and anti drug antibodies in treating inflammatory bowel disease patients" }
[ { "companynumb": "CH-JNJFOC-20201244142", "fulfillexpeditecriteria": "1", "occurcountry": "CH", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "INFLIXIMAB" }, "drugadditional": "3", "...
{ "abstract": "Panitumumab is a recombinant human IgG2 monoclonal antibody which is used for the treatment of patients with metastatic colorectal cancer (mCRC) with disease progression on or following FOLFIRI (fluoropyrimidine, oxaliplatin and irinotecan) containing chemotherapy regimen. We report a case of an 83-year-old Hispanic man, non-smoker, with KRAS/NRAS wild-type mCRC of the liver who was treated with 9 cycles of FOLFOX4 (fluorouracil, leucovorin and oxaliplatin) and cetuximab. Follow-up abdominal imaging showed progression of CRC, requiring initiation of panitumumab in addition to FOLFIRI. After 2 cycles of this combination chemotherapy, he presented with acute hypoxaemic respiratory failure. Pulmonary imaging showed new onset of interstitial lung disease (ILD). He was treated with systemic corticosteroids with marked improvement of ILD. We aim to highlight the risk of severe life-threatening ILD associated with panitumumab. Early recognition of this serious adverse event helps avoid unnecessary administration of systemic antibiotics and prevent mortality.", "affiliations": "Internal Medicine, Presence Saint Joseph Hospital Chicago, Chicago, Illinois, USA.;Internal Medicine, Presence Saint Joseph Hospital Chicago, Chicago, Illinois, USA.;Presence St Joseph Hospital, Chicago, Illinois, USA.;Department of Hematology/Oncology, Presence Saint Joseph Hospital Chicago, Chicago, Illinois, USA.", "authors": "Rezkallah|Kamal Naguib Makar|KNM|http://orcid.org/0000-0002-4121-9020;Ahmed|Adnan|A|;Patel|Sabah|S|;Kozma|Kelly|K|", "chemical_list": "D000305:Adrenal Cortex Hormones; D000074322:Antineoplastic Agents, Immunological; D000077544:Panitumumab; D002955:Leucovorin; D005472:Fluorouracil; D002166:Camptothecin", "country": "England", "delete": false, "doi": "10.1136/bcr-2018-227785", "fulltext": null, "fulltext_license": null, "issn_linking": "1757-790X", "issue": "12(2)", "journal": "BMJ case reports", "keywords": "cancer intervention; chemotherapy; haematology (drugs and medicines); interstitial Lung Disease", "medline_ta": "BMJ Case Rep", "mesh_terms": "D000230:Adenocarcinoma; D000305:Adrenal Cortex Hormones; D000369:Aged, 80 and over; D000074322:Antineoplastic Agents, Immunological; D000971:Antineoplastic Combined Chemotherapy Protocols; D002166:Camptothecin; D015179:Colorectal Neoplasms; D042241:Early Diagnosis; D061345:Early Medical Intervention; D005472:Fluorouracil; D006801:Humans; D002955:Leucovorin; D008113:Liver Neoplasms; D017563:Lung Diseases, Interstitial; D008297:Male; D000077544:Panitumumab; D013902:Radiography, Thoracic; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "101526291", "other_id": null, "pages": null, "pmc": null, "pmid": "30739089", "pubdate": "2019-02-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "17761974;12413012;15919344;10471616;10632484;15169807;17470858;17317857;22076388;19485873;18003886;16387947;11451841;20133293;15864276;15045042;21444868;26564810;20481659;17522246;11451840;10464862;11255078;18385198;25967287;15340374;20463821;26481343;10559072;21471066;15738299;16806903;15691221;30168753;17538086;20305036;18635345;15031564;30034518;18829672;9863989;24032382;19739274;16291774;17522249;18574290", "title": "A case of panitumumab containing chemotherapy causing interstitial lung disease: early recognition and treatment resulting in a good outcome.", "title_normalized": "a case of panitumumab containing chemotherapy causing interstitial lung disease early recognition and treatment resulting in a good outcome" }
[ { "companynumb": "US-SA-2019SA047450", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PANITUMUMAB" }, "drugadditional": "3", "dr...
{ "abstract": "This article provides an overview on the Institute for Safe Medication Practices (ISMP), the only independent nonprofit organization in the USA devoted to the prevention of medication errors. ISMP developed the national Medication Errors Reporting Program (MERP) and investigates and analyzes errors in order to formulate recommendations to prevent further occurrences. ISMP works closely with the US Food and Drug Administration (FDA), drug manufacturers, professional organizations, and others to promote changes in package design, practice standards, and healthcare practitioner and consumer education. By collaborating with ISMP to share and disseminate information, Poison Control centers, emergency departments, and toxicologists can help decrease unintentional and accidental poisonings.", "affiliations": "Institute for Safe Medication Practices, 200 Lakeside Drive, Suite 200, Horsham, PA, 19044, USA, avaida@ismp.org.", "authors": "Vaida|Allen J|AJ|", "chemical_list": "D018712:Analgesics, Non-Narcotic; D000082:Acetaminophen", "country": "United States", "delete": false, "doi": "10.1007/s13181-015-0475-y", "fulltext": null, "fulltext_license": null, "issn_linking": "1556-9039", "issue": "11(2)", "journal": "Journal of medical toxicology : official journal of the American College of Medical Toxicology", "keywords": null, "medline_ta": "J Med Toxicol", "mesh_terms": "D000047:Academies and Institutes; D000082:Acetaminophen; D016907:Adverse Drug Reaction Reporting Systems; D018712:Analgesics, Non-Narcotic; D002675:Child, Preschool; D003299:Cooperative Behavior; D004349:Drug Packaging; D006801:Humans; D019300:Medical Errors; D008508:Medication Errors; D011039:Poison Control Centers; D011041:Poisoning; D014481:United States; D014486:United States Food and Drug Administration", "nlm_unique_id": "101284598", "other_id": null, "pages": "262-4", "pmc": null, "pmid": "25840933", "pubdate": "2015-06", "publication_types": "D016428:Journal Article", "references": "24196095", "title": "The Institute for Safe Medication Practices and Poison Control Centers: Collaborating to Prevent Medication Errors and Unintentional Poisonings.", "title_normalized": "the institute for safe medication practices and poison control centers collaborating to prevent medication errors and unintentional poisonings" }
[ { "companynumb": "US-JNJFOC-20150701708", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ACETAMINOPHEN" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nPneumatosis intestinalis (PI) is a rare entity which refers to the presence of gas within the wall of the small bowel or colon which is a radiographic sign. The etiology and clinical presentation are variable. Patients with PI may present either with chronic mild non-specific symptoms or with acute abdominal pain with peritonitis. Some cases of intestinal pneumatosis have been reported as adverse events of new oncological treatments such as targeted therapies that are widely used in multiple tumors.\n\n\nMETHODS\nA 59-year-old caucasian female with radioactive iodine-refractory metastatic thyroid papillary carcinoma with BRAFV600E mutation was treated with dabrafenib and trametinib as a compassionate use. After 4 months treatment, positron emission tomography-computed tomography (PET-CT) showed PI. At the time of diagnosis, the patient was asymptomatic without signs of peritonitis. The initial treatment was conservative and no specific treatment for PI was needed. Unfortunately, after dabrafenib-trametinib withdrawal, the patient developed tumor progression with significant clinical worsening.\n\n\nCONCLUSIONS\nThis case report is, in our knowledge, the first description of PI in a patient treated with dabrafenib-trametinib. Conservative treatment is feasible if there are no abdominal symptoms.", "affiliations": "Medical Oncology Department, University Hospital 12 de Octubre, Madrid, Spain. mcms.207@gmail.com.;Nuclear Medicine Department, University Hospital 12 de Octubre, Madrid, Spain.;Medical Oncology Department, University Hospital 12 de Octubre, Madrid, Spain.;Medical Oncology Department, University Hospital 12 de Octubre, Madrid, Spain.;Medical Oncology Department, University Hospital 12 de Octubre, Madrid, Spain.;Medical Oncology Department, University Hospital 12 de Octubre, Madrid, Spain.;Medical Oncology Department, University Hospital 12 de Octubre, Madrid, Spain.", "authors": "Martín-Soberón|M C|MC|http://orcid.org/0000-0003-3095-9346;Ruiz|S|S|;De Velasco|G|G|;Yarza|R|R|;Carretero|A|A|;Castellano|D|D|;Sepúlveda-Sánchez|J M|JM|", "chemical_list": "D007093:Imidazoles; D007457:Iodine Radioisotopes; D010091:Oximes; D047428:Protein Kinase Inhibitors; D011728:Pyridones; D011744:Pyrimidinones; C560077:trametinib; C482119:BRAF protein, human; D048493:Proto-Oncogene Proteins B-raf; C561627:dabrafenib", "country": "England", "delete": false, "doi": "10.1186/s13256-020-02581-9", "fulltext": "\n==== Front\nJ Med Case Rep\nJ Med Case Rep\nJournal of Medical Case Reports\n1752-1947 BioMed Central London \n\n2581\n10.1186/s13256-020-02581-9\nCase Report\nPneumatosis intestinalis in a radioactive iodine-refractory metastasic thyroid papillary carcinoma with BRAFV600E mutation treated with dabrafenib–trametinib: a case report\nhttp://orcid.org/0000-0003-3095-9346Martín-Soberón M. C. mcms.207@gmail.com 1 Ruiz S. sebastian.ruiz@salud.madrid.org 2 De Velasco G. gdvelasco.gdv@gmail.com 1 Yarza R. r.y.barrio@gmail.com 1 Carretero A. carretero_88@hotmail.com 1 Castellano D. cdanicas@hotmail.com 1 Sepúlveda-Sánchez J. M. juanmanuel.sepulveda@salud.madrid.org 1 1 grid.144756.50000 0001 1945 5329Medical Oncology Department, University Hospital 12 de Octubre, Madrid, Spain \n2 grid.144756.50000 0001 1945 5329Nuclear Medicine Department, University Hospital 12 de Octubre, Madrid, Spain \n2 3 2021 \n2 3 2021 \n2021 \n15 10910 6 2019 11 11 2020 © The Author(s) 2021Open AccessThis article is licensed under a Creative Commons Attribution 4.0 International License, which permits use, sharing, adaptation, distribution and reproduction in any medium or format, as long as you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons licence, and indicate if changes were made. The images or other third party material in this article are included in the article's Creative Commons licence, unless indicated otherwise in a credit line to the material. If material is not included in the article's Creative Commons licence and your intended use is not permitted by statutory regulation or exceeds the permitted use, you will need to obtain permission directly from the copyright holder. To view a copy of this licence, visit http://creativecommons.org/licenses/by/4.0/. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated in a credit line to the data.Background\nPneumatosis intestinalis (PI) is a rare entity which refers to the presence of gas within the wall of the small bowel or colon which is a radiographic sign. The etiology and clinical presentation are variable. Patients with PI may present either with chronic mild non-specific symptoms or with acute abdominal pain with peritonitis. Some cases of intestinal pneumatosis have been reported as adverse events of new oncological treatments such as targeted therapies that are widely used in multiple tumors.\n\nCase presentation\nA 59-year-old caucasian female with radioactive iodine-refractory metastatic thyroid papillary carcinoma with BRAFV600E mutation was treated with dabrafenib and trametinib as a compassionate use. After 4 months treatment, positron emission tomography–computed tomography (PET–CT) showed PI. At the time of diagnosis, the patient was asymptomatic without signs of peritonitis. The initial treatment was conservative and no specific treatment for PI was needed. Unfortunately, after dabrafenib–trametinib withdrawal, the patient developed tumor progression with significant clinical worsening.\n\nConclusions\nThis case report is, in our knowledge, the first description of PI in a patient treated with dabrafenib–trametinib. Conservative treatment is feasible if there are no abdominal symptoms.\n\nKeywords\nCase reportPneumatosis intestinalis (PI)Targeted therapiesDabrafenibTrametinibThyroid cancerissue-copyright-statement© The Author(s) 2021\n==== Body\nBackground\nPneumatosis intestinalis is a rare condition characterized by the presence of subserosal and submucosal gas, with air-filled cysts occurring anywhere in the gastrointestinal tract [1]. PI often presents as an incidental finding on abdominal imaging in asymptomatic patients, but it may occur in the context of life-threatening intestinal pathology, such as acute intestinal ischemia [2]. The pathogenesis is poorly understood and PI is associated with a wide range of etiologies. Chemotherapy has been defined as a well-known predisposing factor by oncologists [3]. Nowadays, due to the increased use of targeted therapies, PI has also been described as a side effect of multiple targeted anticancer drugs [4]. This entity is one of the few conditions where a pneumoperitoneum has no mandatory indication for laparotomy [5]. Although the association of tyrosine kinase inhibitors with PI is rare, its knowledge and management are essential in the era of these targeted therapies.\n\nCase presentation\nA 59-year-old caucasian female was diagnosed with thyroid papillary carcinoma after total thyroidectomy in 2001. Diagnosed with postsurgical hypothyroidism under treatment with levothyroxine, 100 micrograms per day. There was no other previous medical history of interest. The patient did not consume tobacco or alcohol.\n\nIn 2008, a computerized tomography scan (CT) showed locoregional relapse and surgery was performed with resection of locoregional recurrence and left cervical lymphadenectomy. In November 2011, pulmonary relapse was treated with I-131 since November 2011 until March 2012 (total accumulated dose: 850 mCi). In October 2016, a CT scan showed a progression of the disease with cervical and pulmonary progression. The patient started sorafenib, 400 mg twice a day. Stable disease was maintained during 20 months. In June 2018, patient presented an episode of abrupt instability and cervical pain. The magnetic resonance imaging (MRI) (Fig. 1) showed a new metastatic lesion in the skull base with destruction of bony structures of the left occipital-petrous region. At this point, a molecular study of the cervical node was performed and a mutation in BRAFV600E was found.Fig. 1 Magnetic resonance imaging June 2018 showing metastatic lesion in the skull base with destruction of bony structures\n\n\n\nDue to the lack of alternative therapeutic options, treatment with vemurafenib–trametinib was requested as a compassionate use. In August 2018, patient was started on the combination of dabrafenib 150 mg twice a day and trametinib 2 mg once a day. MRI in October 2018 showed a slight decrease of the metastatic lesion in the skull base (Fig. 2). In addition, the patient showed evident clinical improvement with decreased initial headache and cervicalgia.Fig. 2 Magnetic resonance imaging October 2018 showing a slight decrease of the metastatic lesion at the base of the skull\n\n\n\nA follow-up PET–CT scan was performed in January 2019. Tumor was on radiological partial response. In addition, there was intestinal pneumatosis with mild sign of pneumoperitoneum (Fig. 3). Patient had no digestive symptoms and the abdominal medical examination was completely normal. Also normal neurological examination was verified. Routine physical examination showed blood pressure 110/60 mmHg, heart rate 80 bpm and 36.5 degree centigrade temperature. Blood test showed normal liver function: AST 21 U/L, ALT 16 U/L, bilirubin 0.19 mg/dL and normal renal function: creatinine 0.7 and glomerular filtrate > 90 mL/min. Blood count values were normal: leukocytes 7.6 × 1000/µL, hemoglobin 12 g/dL and platelets 417 × 1000/µL.Fig. 3 Positron emission tomography–computed tomography January 2019. (Images a and b show radiological signs of PI with mild sign of pneumoperitoneum showed in image c.)\n\n\n\nThe surgery department recommended conservative treatment unless new abdominal signs or symptoms were seen. Intravenous metoclopramide 10 mg/8 h and paracetamol 1000 mg/8 h were administrated. Both drugs, dabrafenib and trametinib, were discontinued after the PI diagnosis.\n\nOnly 10 days after the discontinuation of targeted therapy, tumor progression was shown with clinical deterioration due to intracranial hypertension and the patient died 4 weeks later because of intracranial disease progression. Because the cause of death was related with tumor progression, autopsy was not performed.\n\nDiscussion\nDespite PI being related to targeted therapies, we have not found any report in patients receiving dabrafenib–trametinib. Here, we presented a case of a 59-year-old woman who developed PI 5 months after starting the combination treatment with those drugs.\n\nPapillary thyroid cancer is the most common type among all thyroid tumors. Outcome of refractory radioactive iodine tumors is poor, the 10-year survival is 10% from the time of detection of metastasis [6]. About half of papillary thyroid cancers harbor the BRAFV600E mutation. Although the value of this mutation is still under investigation, thyroid cancer harboring BRAFV600E mutation have worse prognosis [7]. In the last decade, tyrosine kinase inhibitors have been approved and used for radioactive iodine-refractory patients.\n\nVemurafenib and dabrafenib potently inhibit BRAF proteins containing the V600E mutation and are indicated for patients with non-resectable or metastatic melanoma associated with this mutation [8]. Both drugs act in the RAS–RAF–MEK–ERK pathway which is overactivated by oncogenic mutation in the BRAF protein, triggering overactivation of this pathway and increasing cell proliferation, cell survival and angiogenesis [9]. Dabrafenib inhibits mutated BRAF proteins and trametinib inhibits MEK. Neither dabrafenib nor trametinib is currently approved for papillary thyroid cancer, however responses have been observed to those drugs in thyroid tumors carrying the BRAFV600 mutation.\n\nIn the last decade, the extended use of those targeted therapies has caused new types of toxicities. PI is a multifactorial entity with a wide range of etiologies: changes of the intestinal wall, peritonitis, bowel distention and corticosteroid therapy are some of the described etiologies [10].\n\nA wide study evaluating the association of targeted therapies with PI and bowel perforation was published by Shinagare AB et al. These authors retrospectively reviewed 48 patients with cancer who developed one of these abdominal complications. Twenty-four patients were receiving molecular targeted therapies and have no other risk factors for PI or bowel perforation. Investigators showed that bevacizumab (n = 14) and sunitinib (n = 6) were the most common drugs associated with PI. Other drugs included were sorafenib, cetuximab, erlotinib and ipilimumab [11]. In the context of those treatments, the precise mechanism that leads to the association between targeted therapies and PI is currently unknown. In the case of antiangiogenics, bevacizumab, an anti-VEGF monoclonal antibody, has been shown to compromise the bowel wall integrity, producing intestinal wall disruption due to necrosis of the serosa and PI [11].\n\nConclusion\nDespite the existence of other targeted therapies associated with PI, to our knowledge, this is the first report of PI in a patient receiving dabrafenib–trametinib. Conservative treatment is feasible if there are no abdominal signs or symptoms. However, the discontinuation of the cancer treatment led to a clinical deterioration and progression of the thyroid cancer. Understanding the toxicity of novel treatments is crucial in the management of our patients. In patients who are receiving targeted therapies it is possible that PI, if it appears, determines the vital prognosis and it should be considered a severe adverse event.\n\nAbbreviations\nPIPneumatosis intestinalis\n\nPET–CTPositron emission tomography–computed tomography\n\nCTComputed tomography\n\nMRIMagnetic resonance imaging\n\nVEGFVascular endothelial growth factor\n\nPublisher's Note\n\nSpringer Nature remains neutral with regard to jurisdictional claims in published maps and institutional affiliations.\n\nAcknowledgements\nNot applicable.\n\nAuthors’ contributions\nAll authors have approved the manuscript, including the conflict of interest statements, for submission for publication. All the authors have been involved in review of previous bibliography and review of successive drafts of the manuscript and have approved the manuscript.\n\nFunding\nThere was no funding received for this project\n\nEthics approval and consent to participate\nThis case report study was carried out respecting the Declaration of Helsinki in its current version. The study of a case report is exempt from ethical approval in our institution.\n\nConsent for publication\nWritten informed consent was obtained from the patient’s next of kin for publication of this case report and any accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nAvailability of data and materials\nThis case report corresponds to a real case diagnosed and treated in our clinical center. Clinical and radiological data presented correspond to real data. The datasets supporting this article are stored in Hospital 12 Octubre medical records.\n\nCompeting interests\nThe authors included in this case report declare that they have no conflict of interest.\n==== Refs\nReferences\n1. Yale CE Balish E Pneumatosis cystoides intestinalis Dis Colon Rectum 1976 10.1007/BF02590860 176016 \n2. Koss LG Abdominal gas cysts (pneumatosis cystoides intestinorum hominis); an analysis with a report of a case and a critical review of the literature AMA Arch Pathol. 1952 53 6 523 549 14923068 \n3. Vargas A Pagés M Buxó E Pneumatosis intestinalis due to 5-fluorouracil chemotherapy Gastroenterol Hepatol 2016 39 10 672 673 10.1016/j.gastrohep.2015.09.010 26547612 \n4. Shinagare AB Howard SA Krajewski KM Zukotynski KA Jagannathan JP Ramaiya NH Pneumatosis intestinalis and bowel perforation associated with molecular targeted therapy: an emerging problem and the role of radiologists in its management AJR Am J Roentgenol. 2012 199 6 1259 1265 10.2214/AJR.12.8782 23169717 \n5. Dhadlie S Mehanna D McCourtney J Pneumatosis intestinalis a trap for the unwary: case series and literature review Int J Surg Case Rep. 2018 53 214 217 10.1016/j.ijscr.2018.10.079 30428434 \n6. Durante C Haddy N Baudin E Leboulleux S Hartl D Travagli JP Caillou B Ricard M Lumbroso JD De Vathaire F Schlumberger M Long- term outcome of 444 patients with distant metastasis from papillary and folicular thyroid carcinoma: benefits and limits of radioiodine therapy J Clin Endocrinol Metab. 2006 91 8 2892 2899 10.1210/jc.2005-2838 16684830 \n7. Iva J Filip G Martin B Pavel Ž Jan Č The significance of BRAFV600E mutation in thyroid cancer terms of novel targeted therapies—overview of current knowledge and studies Klin Onkol. Fall 2018 31 5 339 344 10.14735/amko2018339 \n8. Robert C Karaszewska B Schachter J Rutkowski P Mackiewicz A Improved overall survival in melanoma with combined dabrafenib and trametinib N Engl J Med. 2015 372 1 30 39 10.1056/NEJMoa1412690 25399551 \n9. Rissmann R Hessel MH Cohen AF Vemurafenib/dabrafenib and trametinib Br J Clin Pharmacol. 2015 80 4 765 767 10.1111/bcp.12651 25847075 \n10. Sebastià C Quiroga S Espin E Boyé R Alvarez-Castells A Armengol M Portomesenteric vein gas: pathologic mechanisms, CT findings, and prognosis Radiographics. 2000 20 5 1213 1224 10.1148/radiographics.20.5.g00se011213 10992012 \n11. Shinagare AB Howard SA Krajewski KM Zukotynski KA Jagannathan JP Ramaiya NH Pneumatosis intestinalis and bowel perforation associated with molecular targeted therapy: an emerging problem and the role of radiologists in is management AJR Am J Roentgenol. 2012 199 6 1259 1265 10.2214/AJR.12.8782 23169717\n\n", "fulltext_license": "CC BY", "issn_linking": "1752-1947", "issue": "15(1)", "journal": "Journal of medical case reports", "keywords": "Case report; Dabrafenib; Pneumatosis intestinalis (PI); Targeted therapies; Thyroid cancer; Trametinib", "medline_ta": "J Med Case Rep", "mesh_terms": "D004646:Emphysema; D005260:Female; D006801:Humans; D007093:Imidazoles; D007410:Intestinal Diseases; D007457:Iodine Radioisotopes; D008875:Middle Aged; D010091:Oximes; D000072078:Positron Emission Tomography Computed Tomography; D047428:Protein Kinase Inhibitors; D048493:Proto-Oncogene Proteins B-raf; D011728:Pyridones; D011744:Pyrimidinones; D019292:Skull Base Neoplasms; D000077273:Thyroid Cancer, Papillary; D013964:Thyroid Neoplasms", "nlm_unique_id": "101293382", "other_id": null, "pages": "109", "pmc": null, "pmid": "33653337", "pubdate": "2021-03-02", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "30541319;30428434;25847075;14923068;26547612;25399551;176016;10992012;16684830;23169717", "title": "Pneumatosis intestinalis in a radioactive iodine-refractory metastasic thyroid papillary carcinoma with BRAFV600E mutation treated with dabrafenib-trametinib: a case report.", "title_normalized": "pneumatosis intestinalis in a radioactive iodine refractory metastasic thyroid papillary carcinoma with brafv600e mutation treated with dabrafenib trametinib a case report" }
[ { "companynumb": "NVSC2021ES073454", "fulfillexpeditecriteria": "1", "occurcountry": "ES", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "TRAMETINIB" }, "drugadditional": null, "drug...
{ "abstract": "BACKGROUND\nN-acetyl cysteine (NAC) was proposed as an adjuvant to clomiphene citrate for ovulation induction in patients with polycystic ovary syndrome (PCOS) without clomiphene citrate resistance.\n\n\nOBJECTIVE\nTo evaluate the effect of NAC on pregnancy rate in PCOS patients who were candidates for intrauterine insemination.\n\n\nMETHODS\nIn this randomized clinical trial, 97 PCOS women aged 18-38 years were enrolled in two groups, randomly. For the case group (n=49), NAC (1.2 gr)+ clomiphene citrate (100 mg) + letrozole (5mg) were prescribed daily from the third day of menstruation cycle for five days. The control group (n=48) had the same drug regimen without NAC. In order to follicular development, recombinant human follicle stimulating hormone (r-hFSH; Gonal-F®) was injected on days of 7-11 menstrual cycles in all participants. When the follicle size was 18mm or more, 10000 IU human chorionic gonadotropin was injected intramuscular and the intrauterine insemination was performed after 34-36 hr.\n\n\nRESULTS\nThere were not significant differences between study groups regarding mean endometrial thickness (p=0.14), the mean number of mature follicles (p=0.20), and the pregnancy rate (p=0.09).\n\n\nCONCLUSIONS\nNAC is ineffective in inducing or augmenting ovulation in PCOS patients who were candidates for intrauterine insemination and cannot be recommended as an adjuvant to CC in such patients.", "affiliations": "Department of Obstetrics and Gynecology, Urmia Reproductive Health Research Center, Urmia, Iran.;Department of Obstetrics and Gynecology, Urmia Reproductive Health Research Center, Urmia, Iran.;Department of Obstetrics and Gynecology, Urmia Reproductive Health Research Center, Urmia, Iran.;Department of Obstetrics and Gynecology, Urmia Reproductive Health Research Center, Urmia, Iran.", "authors": "Behrouzi Lak|Tahereh|T|;Hajshafiha|Masoomeh|M|;Nanbakhsh|Fariba|F|;Oshnouei|Sima|S|", "chemical_list": null, "country": "Iran", "delete": false, "doi": null, "fulltext": "\n==== Front\nInt J Reprod Biomed\nInt J Reprod Biomed\nIJRB\nInternational Journal of Reproductive Biomedicine\n2476-4108\n2476-3772\nResearch and Clinical Center for Infertility Yazd, Iran\n\n28835936\nijrb-15-203\nOriginal Article\nN-acetyl cysteine in ovulation induction of PCOS women underwent intrauterine insemination: An RCT\nBehrouzi Lak Tahereh M.D.\nHajshafiha Masoomeh M.D.\nNanbakhsh Fariba M.D.\nOshnouei Sima M.Sc.\nDepartment of Obstetrics and Gynecology, Urmia Reproductive Health Research Center, Urmia, Iran.\n4 2017\n15 4 203208\n16 6 2016\n8 12 2016\n5 2 2017\nThis is an Open Access article distributed under the terms of the Creative Commons Attribution License, (http://creativecommons.org/licenses/by/3.0/) which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.\nBackground:\n\nN-acetyl cysteine (NAC) was proposed as an adjuvant to clomiphene citrate for ovulation induction in patients with polycystic ovary syndrome (PCOS) without clomiphene citrate resistance.\n\nObjective:\n\nTo evaluate the effect of NAC on pregnancy rate in PCOS patients who were candidates for intrauterine insemination.\n\nMaterials and Methods:\n\nIn this randomized clinical trial, 97 PCOS women aged 18-38 years were enrolled in two groups, randomly. For the case group (n=49), NAC (1.2 gr)+ clomiphene citrate (100 mg) + letrozole (5mg) were prescribed daily from the third day of menstruation cycle for five days. The control group (n=48) had the same drug regimen without NAC. In order to follicular development, recombinant human follicle stimulating hormone (r-hFSH; Gonal-F®) was injected on days of 7-11 menstrual cycles in all participants. When the follicle size was 18mm or more, 10000 IU human chorionic gonadotropin was injected intramuscular and the intrauterine insemination was performed after 34-36 hr.\n\nResults:\n\nThere were not significant differences between study groups regarding mean endometrial thickness (p=0.14), the mean number of mature follicles (p=0.20), and the pregnancy rate (p=0.09).\n\nConclusion:\n\nNAC is ineffective in inducing or augmenting ovulation in PCOS patients who were candidates for intrauterine insemination and cannot be recommended as an adjuvant to CC in such patients.\n\nKey Words\n\nN-acetyl cysteine\nPolycystic ovary syndrome\nIntrauterine insemination\nOvulation induction\n==== Body\nIntroduction\n\nPolycystic ovary syndrome (PCOS) is the most common cause of anovulation among reproductive- age women (1, 2). It is characterized by hyperandrogenism, insulin resistance, and chronic anovulation and affects 5-10% of women in reproductive age (3-5). Clomiphene citrate (CC) is recommended as the first treatment strategy to induce ovulation in these patients (6). Patients who do not ovulate while receiving even 150 mg CC are classified as CC-resistant patients (7). In these cases, other treatment regimens are recommended such as the co-administration of metformin and CC (that its impact is questioned), Gonadotropin (which has high costs and side effects such as multiple pregnancies and ovarian hyperstimulation syndrome), and ovarian drilling by diathermy (8, 9). However, a recent Cochrane review revealed that whereas metformin was associated with improved clinical pregnancy and ovulation rate, it did not improve live birth rates when used alone or in combination with CC or when compared with CC (10).\n\nTherefore, there is a need for developing therapeutic selections for treating the women with PCOS. Aromatase is a cytochrome P450 enzyme which converts androstenedione and testosterone to estrone and estradiol by hydroxylation (11). Aromatase Inhibitors particularly letrozole have been prescribed for ovulation induction in patients who do not respond to CC (12). With respect to the performance of aromatase, the enzyme inhibitor medicines inhibit the estrogen production and consequently, the pituitary gland is stimulated to secrete follicle-stimulating hormone (FSH) and ovarian follicle grows larger followed by FSH (13).\n\nN-Acetyl Cysteine (NAC) with the chemical structure of sulfhydryl groups is derived from L- amino acid cysteine and the first time were used as a mucolytic drug in some respiratory diseases such as chronic bronchitis (14). NAC decreased blood levels of homocysteine by increasing glutathione synthesis which is an antioxidant (15). On the other hand, NAC significantly reduces the serum testosterone level, insulin resistance, and serum lipids (16). It was shown that the combination of NAC and CC enhance ovulation rate and pregnancy rate in CC-resistant PCOS patients (17). By administering NAC with CC in PCOS patients without CC resistance, a considerable improvement in the ovulation rate, serum estrogen and progesterone, endometrial thickness, and pregnancy rate were observed (15, 18). According to the results of Salehpour study, NAC is as a safe and well-tolerated adjuvant to CC for induction of ovulation can improve the ovulation and pregnancy rates in PCOS patients (19).\n\nWe aimed to evaluate the effect of NAC with a combination of two inductions of ovulation drugs in PCOS patients who were candidates for intrauterine insemination (IUI), to assess the pregnancy rate.\n\nMaterials and methods\n\nThis randomized clinical trial was performed on 100 PCOS women candidates intrauterine insemination (IUI) who referred to Kosar Department of Obstetrics and Gynecology, Shahid Motahhari Hospital, Urmia University of Medical Sciences, Urmia, Iran. After obtaining the informed constant, the participants were randomized using closed envelopes (A and B) in two groups: The case group (received NAC) and control group (without NAC). Inclusion criteria were PCOS women who were IUI candidate, age 18-38 years, having two out of three criteria of chronic oligo-or anovulation, clinical or laboratory signs of hyperandrogenism, PCOS sonographic findings (based on the Rotterdam criteria (20), also the presence of normal laboratory tests of thyroid, prolactin, and normal hysterosalpingography and a normal transvaginal ultrasound. Exclusion criteria included, the presence of ovarian cyst, FSH> 10 IU/L, and patients with ovarian hyperstimulation syndrome (OHSS) and male infertility.\n\nThe sample size was calculated based on a level error of 5% and a power of 80% to see a difference between two groups. The estimated sample size was 84 patients (42 patients in each group), but for reaffirmation 100 patients were selected by the simple random method. Three patients in the case group and six patients in controls because of discontinuation of treatments did not receive allocated intervention.\n\nThe case group were received 100 mg CC (Clomid©, Hoechest Marion Russel, Cairo, Egypt) and 5 mg letrozole (Novartis Pharma Services, Basel, Switzerland) plus 1.2 gr NAC (Sedico, Cairo, ARE) daily, from day 3 to 7 of the menstrual cycle for one cycle. NAC was given to the subjects in the form of powder inserted in small pockets to be diluted into one standard glass of water and taken orally in two daily divided doses.\n\nThen 75 IU of recombinant FSH (r-hFSH; Gonal-F, Merck, Serono, Germany) was injected subcutaneously from the 7th of menstrual cycles and continued to 11th of the cycle. On the 12th day of the menstrual cycle, patients were monitored by transvaginal ultrasound examination to evaluate the mean follicular diameter and the endometrial thickness. In the presence of at least one follicle with 18-20 mm in size, 10000 IU human chorionic gonadotropin (hCG; Profasi, Serono, Switzerland) was injected intramuscularly and 36-40 hr after hCG injection, IUI was performed. The serum β-hCG level was measured on the 16th day after hCG injection. In the control group, the process was same as above, but without the NAC.\n\nFinally, the treatment duration until the presence of mature follicle, number and size of mature follicles, endometrial thickness, the timing of hCG injection, and pregnancy, miscarriage, multiple pregnancies, and ectopic pregnancy were compared in two groups. Meanwhile, transvaginal ultrasound was performed using 7.3 MHz Probe/Fukuda Denshi. Clinical pregnancy was defined as the presence of a gestational sac on ultrasound, as confirmed by the presence of a fetal heart rate. Secondary outcomes were related to assessing of abortion, OHSS, and multiple pregnancies.\n\nEthical considerations\n\nThis study was approved by the ethics committee of Urmia University of Medical Sciences (Ref. number: Ir.UMSU.rec.1393.179). Subjects were informed that their participation was voluntary and written consent was obtained from all participants.\n\nStatistical analysis\n\nFor continuous variables, data were presented as means±SD and for categorical variables, as the number and frequency. The comparisons of variables between the two groups were made using the Fisher’s Exact test for categorical variables and independent samples t-test for continuous variables. Kolmogorov-Smirnov test for normality quantitative data was reviewed. Students’ t-test was used for normally distributed data. Statistical analysis was performed using -Statistical Package for the Social Sciences, version 17.0, SPSS Inc, Chicago, Illinois, USA (SPSS) version 17. All the cut-off for statistical significance presumed 0.05.\n\nResults\n\nTotally, there were 106 patients in both groups at the start of this study but three of whom from the case group and 6 women from controls were excluded due to the discontinue of intervention. Therefore, 97 patients continued our study: Case group (n=49) and control group (n=48) (Figure 1). Table I shows the demographic characteristic of study participants. There were no statistically significant differences in age, body mass index, duration of infertility, the mean of luteinizing hormone (LH) and FSH, type of infertility, the mean of mature follicles, and mean number of Gonal-F in two groups (Table I, II).\n\nThe mean number of mature follicles was 2.10±0.87 in the case group and 1.85±1.03 in the control group. There was no significant difference between two groups regarding the mean number of mature follicles (p=0.20), the mean endometrial thickness on the day of hCG administration by transvaginal sonography (p=0.25), the mean day of hCG administration (p=0.47), and the mean day of IUI performing (p=0.63) (Table II). In the case group (n=49) with 49 patients, pregnancy test was positive in 16 patients (32.7%), but pregnancy test was negative in 33 patients (67.3%). Also, in the control group with 48 patients; pregnancy test was positive for 9 (18.8%) women and negative among 39 (81.2%) women.\n\nAccording to Fisher test, there was no significant difference between two groups regarding pregnancy rate (p=0.09). Besides, one case of abortion, one ectopic pregnancy (EP), and one twin pregnancy have been reported in the experimental group (Table II). No manifestations of ovarian hyperstimulation syndrome (OHSS) were reported in two groups.\n\nTable I Demographic characteristic of study participants\n\nVariables\tCase group (n=49)\tControl group (n=48)\tp-value\t\nAge (years)*\t27.53 ± 4.16\t27.14 ± 4.49\t0.64\t\nBody mass index (kg/m2)*\t27.23 ± 2.90\t27.84 ± 2.89\t0.28\t\nDuration of infertility(year)*\t4.26 ± 3.27\t3.40 ± 2.20\t0.17\t\nSerum FSH level (mIU/mL) *\t6.51± 1.89\t6.68± 2\t0.66\t\nSerum LH level(mIU/mL) *\t9.19± 5.73\t8.60± 6.05\t0.67\t\nType of infertility n (%)\t\t\t\t\n\tPrimary\t39 (75%)\t43 (79.6%)\t0.36\t\n\tSecondary\t13 (25%)\t11 (20.4%)\t\nStudents’ t-Test, Chi-square Test\n\nFSH: Follicle-stimulating hormone\n\nLH: Luteinizing hormone\n\n* Data presented as Mean±SD\n\nTable II Assessed quantity variable after intervention among two group\n\nVariables\tCase group (n=49)\tControl group (n=48)\tp-value\t\nNo. of mature follicles*\t2.10±0.87\t1.85±1.3\t0.20\t\nNo. of GONAL-F injection*\t4.25±1.72\t4.33±2.27\t0.83\t\nEndometrial thickness (mm)*\t8.15±0.85\t8.04±1.4\t0.25\t\nDay of hCG administration*\t14.04±1.84\t14.29±1.82\t0.47\t\nDay of IUI performing*\t15.93±1.74\t15.87±2.68\t0.63\t\nPregnancy rate**\t16(32.7% )\t9(18.8% )\t0.09\t\nMiscarriage rate**\t1(6.2%)\t0(0.0%)\t0.62\t\nEP rate**\t1(6.2%)\t0(0.0%)\t0.62\t\nTwin pregnancy **\t1(6.6%)\t0(0.0%)\t0.62\t\nStudents’t-Test, Fisher’s Exact Test\n\nEP=Ectopic pregnancy\n\n* Data presented as Mean±SD.\n\n** Data presented as n (%).\n\nFigure 1 CONSORT Flow diagram\n\nDiscussion\n\nTo the best of our knowledge, this is the first published study comparing the effect of NAC in PCOS women who were candidates for IUI. The meta-analysis was conducted to assess clinical benefits of NAC among women with PCOS. A total of eight randomized controlled trials with 910 women compared the effects of NAC with placebo or metformin in women with PCOS. NAC significantly improved rates of live birth and spontaneous ovulation compared to placebo in women with PCOS (21). However, we found no evidence of effects of NAC on improving pregnancy rate and spontaneous ovulations.\n\nAlso, in the present study, the endometrial thickness on the day of hCG administration and pregnancy rate were not a significant difference in two groups. While in the study from Salehpour et al, the number of follicles larger than 18 mm and the mean of endometrial thickness in the group who received CC and NAC (for 6 wk) were significantly higher than those who only received CC. As well as the rate of ovulation and pregnancy in the study group who received CC and NAC was significantly greater than in the group receiving CC. Finally, they concluded that adding NAC to CC as a non-harmful adjuvant improve the ovulation rate and increases pregnancy rates (19).\n\nLike Salehpour et al study, Rizk et al have stated in patients who received NAC in combination with CC, ovulation and pregnancy rates were significantly increased and no cases of OHSS has been reported (22). Nasr studied the outcomes of NAC administration on CC-resistant PCOS patients who underwent unilateral laparoscopic ovarian drilling. In his study, the group receiving NAC had a significantly high rate of ovulation, pregnancy and live birth rate while the abortion rate was significantly low (23). Thakker et al showed that the pregnancy, ovulation and live birth rates were high in the received NAC group compared with the placebo group (21). Millea study stated that NAC administration with a dose of 1200 mg improves ovulation and pregnancy rates in PCOS patients which can be due to a decrease in insulin resistance (24).\n\nAlso, Oner et al performed a comparison study on the effects of metformin and NAC in PCOS patients, they concluded that both NAC and metformin leads to decrease in BMI, hirsutism, menstrual irregularities, levels of fasting insulin and free testosterone (25). A study on repeated failure of pregnancy concluded that the concurrent use of NAC with folic acid compared to taking folic acid alone, allow to progress further 20 wk of pregnancy and significantly increase live birth rate (26). Abu Hashim et al showed that co-administration of metformin and CC had better results compared with NAC and CC in increasing rates of ovulation and pregnancy and even in reducing the abortion rate. As well as in patients receiving metformin and CC, estrogen and progesterone levels and also endometrial thickness were at a high level on the day of hCG administration (27).\n\nA prospective randomized placebo-controlled pilot study on 60 Iranian women with PCOS (aged 25-35 yr) undergoing intracytoplasmic sperm injection showed that NAC (1800 mg) improves oocyte and embryo quality and could be administered as an alternative to metformin (28). Also, NAC as an adjuvant to CC for induction of ovulation improves ovulation and pregnancy rates in PCOS patients with beneficial impacts on endometrial thickness (29). A systematic review of clinical trials showed that antioxidants and vitamins have positive effects on the management of PCOS women. Although it seems more studies is necessary for this field (30).\n\nAccording to the results of this study and other research, we can conclude that administration of NAC in CC- resistant PCOS patients has no effect on follicles maturation, and endometrial thickness. Some studies have suggested that reduced insulin resistance is a mechanism for NAC performance. On the other hand, since metformin mechanism is similar with NAC, it seems that different results on the combined use of NAC with these two drugs CC and letrozole are affected by other factors such as genetic factors, dosage, and duration of drug use and the sample size.\n\nSo, further studies are needed to be done on NAC therapy effects with a larger sampling in the large geographical areas and assessment of NAC therapy effects on biomedical, hormonal and metabolic profiles, symptoms of hyperandrogenism, and cardiovascular risk factors. However, our study was limited to one treatment cycle, raising the dosage of NAC will further increase the cost, which is an important consideration in choosing the appropriate therapy.\n\nConclusion\n\nNAC is not effective in inducing or augmenting ovulation in PCOs patients who were candidates for IUI and cannot be recommended as an adjuvant to CC in such patients.\n\nAcknowledgments\n\nWe are grateful to the Kosar Department of Obstetrics and Gynecology of Shahid Motahhari Hospital affiliated to Urmia University of Medical Sciences for helping us. This work is granted by the Research Deputy of Urmia University of Medical Sciences, Urmia, Iran.\n\nNote\n\nRegistration ID in RCT: IRCT20160300826962N1\n\nConflict of interest\n\nIt should be noted that there was no association between the authors and any organization or institution. The Authors report no declarations of interest.\n==== Refs\nReferences\n\n1 Hendriks ML König T Soleman RS Korsen T Schats R Hompes PG Influence of ovarian manipulation on reproductive endocrinology in polycystic ovarian syndrome and regularly cycling women Eur J Endocrinol 2013 169 503 10 23904283\n2 Shi Y Wei D Liang X Sun Y Liu J Cao Y Live birth after fresh embryo transfer vs elective embryo cryopreservation/frozen embryo transfer in women with polycystic ovary syndrome undergoing IVF (FreFro-PCOS): study protocol for a multicenter, prospective, randomized controlled clinical trial Trials 2014 15 154 24885793\n3 Maharjan R Nagar PS Nampoothiri L Effect of Aloe barbadensis Mill formulation on Letrozole induced polycystic ovarian syndrome rat model J Ayurveda Integr Med 2010 1 273 279 21731374\n4 Nam H Kim CH Cha MY Kim JM Kang BM Yoo HW Polycystic ovary syndrome woman with heterozygous androgen receptor gene mutation who gave birth to a child with androgen insensitivity syndrome Obstet Gynecol Sci 2015 58 179 182 25798434\n5 Bagheri M Sohrabvand F Lankarani M Zandieh Z Haghollahi F Shariat M Comparison of Biomedical Variables in PCOS Patients with Normal Iranian Women J Family Reprod Health 2015 9 5 11 25904961\n6 Hendawy SF Samaha HE Elkholy MF Letrozole versus Clomiphene Citrate for Induction of Ovulation in Patients with Polycystic Ovarian Syndrome Undergoing Intrauterine Insemination Clin Med Insights Reprod Health 2011 5 11 16 24453507\n7 Kuang H Li Y Wu X Hou L Wu T Liu J Acupuncture and clomiphene citrate for live birth in polycystic ovary syndrome: study design of a randomized controlled trial Evid Based Complement Alternat Med 2013 2013 527303 24023577\n8 Tang T Lord JM Norman RJ Yasmin E Balen AH Insulin-sensitising drugs (metformin, rosiglitazone, pioglitazone, D-chiro-inositol) for women with polycystic ovary syndrome, oligo amenorrhoea and subfertility Cochrane Database Syst Rev 2010 1 CD003053\n9 Farquhar C Lilford RJ Marjoribanks J Vandekerckhove P Laparoscopic “drilling” by diathermy or laser for ovulation induction in anovulatory polycystic ovary syndrome Cochrane Database Syst Rev 2007 3 CD001122\n10 Tang T Lord JM Norman RJ Yasmin E Balen AH Insulin-sensitising drugs (metformin, rosiglitazone, pioglitazone, D-chiro-inositol) for women with polycystic ovary syndrome, oligo amenorrhoea and subfertility Cochrane Database Syst Rev 2012 5 CD003053\n11 El-Gharib MN Mahfouz AE Farahat MA Comparison of letrozole versus tamoxifen effects in clomiphen citrate resistant women with polycystic ovarian syndrome J Reprod Infertil 2015 16 30 35 25717433\n12 Holzer H Casper R Tulandi T A new era in ovulation induction Fertil Steril 2006 85 277 284 16595197\n13 Nik Hussain NK Ismail M Mohd M Yeu Cp Rmli R Wan Mohammad MW Randomized contralled trial of letrozole versus Chlomiphene citrate for induction of ovulation in polycystic ovarian syndrome (PCOS): A Malaysian experience Open J Obstet Gynecol 2013 3 11 17\n14 Dorota Magdalena Radomska-Leoeniewska Piotr Skopiñski N-acetylcysteine as an anti-oxidant and anti-inflammatory drug and its some clinical applications Centr Eur J Immunol 2012 37 57 66\n15 Salehpour S Tohidi M Akhound MR Amirzargar N N Acetyl Cysteine, A novel Remedy for Poly Cystic Ovarian Syndrome Int J Fertil Steril 2009 3 66 73\n16 Kilic-Okman T Kucuk M N-acetyl-cysteine treatment for polycystic ovary syndrome Int J Gynaecol Obstet 2004 85 296 297 15145276\n17 Roshanayee Y Comprehensive information official agents of Iran and the world 2014 3rd Ed. Tehran Roshan book 11\n18 Badawy A State O Abdelgawad S N-Acetyl cysteine and clomiphene citrate for induction of ovulation in polycystic ovary syndrome: A cross-over trial Acta Obstet Gynecol Scand 2007 86 218 222 17364286\n19 Salehpour S Sene AA Saharkhiz N Sohrabi MR Moghimian F N-Acetylcysteine as an adjuvant to clomiphene citrate for successful induction of ovulation in infertile patients with polycystic ovary syndrome J Obstet Gynaecol Res 2012 38 1182 1186 22540635\n20 Rotterdam ESHRE/ASRM-Sponsored PCOS Con-sensus Workshop Group Revised 2003 consensus on diagnostic criteria and long-term health risks related to polycystic ovary syndrome Fertil Steril 2004 81 19 25\n21 Thakker D Raval A Patel I Walia R N-acetylcysteine for polycystic ovary syndrome: a systematic review and meta-analysis of randomized controlled clinical trials Obstet Gynecol Int 2015 2015 817849 25653680\n22 Rizk AY Bedaiwy MA Al-Inany HG N-acetyl-cysteine is a novel adjuvant to clomiphene citrate in clomiphene citrate-resistant patients with polycystic ovary syndrome Fertil Steril 2005 83 367 370 15705376\n23 Nasr A Effect of N-acetyl-cysteine after ovarian drilling in clomiphene citrate-resistant PCOS women: a pilot study Reprod Biomed Online 2010 20 403 409 20089454\n24 Millea PJ N-acetylcysteine: multiple clinical applications Am Fam Physician 2009 80 265 269 19621836\n25 Oner G Muderris II Clinical, endocrine and metabolic effects of metformin vs N-acetyl-cysteine in women with polycystic ovary syndrome Eur J Obstet Gynecol Reprod Biol 2011 159 127 131 21831508\n26 Amin AF Shaaban OM Bediawy MA N-acetyl cysteine for treatment of recurrent unexplained pregnancy loss Reprod Biomed Online 2008 17 722 726 18983759\n27 Abu Hashim H Anwar K El-Fatah RA N-acetyl cysteine plus clomiphene citrate versus metformin and clomiphene citrate in treatment of clomiphene-resistant polycystic ovary syndrome: a randomized controlled trial J Womens Health (Larchmt) 2010 19 2043 2048 20939675\n28 Cheraghi E Mehranjani MS Shariatzadeh MA Esfahani MH Ebrahimi Z N-Acetylcysteine improves oocyte and embryo quality in polycystic ovary syndrome patients undergoing intracytoplasmic sperm injection: an alternative to metformin Reprod Fertil Dev 2016 28 723 731 25482371\n29 Maged AM Elsawah H Abdelhafez A Bakry A Mostafa WA The adjuvant effect of metformin and N-acetylcysteine to clomiphene citrate in induction of ovulation inpatients with Polycystic Ovary Syndrome Gynecol Endocrinol 2015 31 635 638 26291797\n30 Amini L Tehranian N Movahedin M Ramezani Tehrani F Ziaee S Antioxidantsand management of polycystic ovary syndrome in Iran: A systematic review ofclinical trials Iran J Reprod Med 2015 13 1 8 25653669\n\n", "fulltext_license": "CC BY", "issn_linking": "2476-3772", "issue": "15(4)", "journal": "International journal of reproductive biomedicine", "keywords": "Intrauterine insemination; N-acetyl cysteine; Ovulation induction; Polycystic ovary syndrome", "medline_ta": "Int J Reprod Biomed", "mesh_terms": null, "nlm_unique_id": "101679102", "other_id": null, "pages": "203-208", "pmc": null, "pmid": "28835936", "pubdate": "2017-04", "publication_types": "D016428:Journal Article", "references": "21831508;20089454;24453507;18983759;17636653;17364286;19621836;24023577;25482371;20091537;25798434;23904283;25717433;25653669;26291797;21731374;14711538;22540635;25653680;24885793;22592687;20939675;15145276;25904961;15705376;16595197", "title": "N-acetyl cysteine in ovulation induction of PCOS women underwent intrauterine insemination: An RCT.", "title_normalized": "n acetyl cysteine in ovulation induction of pcos women underwent intrauterine insemination an rct" }
[ { "companynumb": "PHHY2017IR113308", "fulfillexpeditecriteria": "1", "occurcountry": "IR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ACETYLCYSTEINE" }, "drugadditional": "3", "d...
{ "abstract": "We reported 2 cases of hepatic encephalopathy after chemotherapy for advanced colorectal cancer. Case 1: A 49-year-old male was diagnosed advanced sigmoid colon cancer with peritoneal dissemination, multiple liver metastasis and multiple osseous metastasis. After resection of primary lesion, we administered mFOLFOX6 plus bevacizumab combination therapy. He was in comatose(Japan coma scale 200)3 days after 2 courses of administration of this regimen. Case 2: A 57-year-old female was diagnosed advanced rectal cancer with multiple huge liver metastasis and multiple osseous metastasis. We administered mFOLFOX6 plus panitumumab combination therapy. She was in comatose(Japan coma scale 100)3 days after 10 courses of administration of this regimen. In both cases, radiographic imaging showed no abnormal sign and blood examination revealed a high level of serum ammonia. We diagnosed their disturbance of consciousness as a symptom of hepatic encephalopathy. Branched-chain amino acid infusion rapidly improved disturbance of consciousness. We must consider the symptom, hepatic encephalopathy in patients receiving chemotherapy for advanced colorectal cancer.", "affiliations": "Dept. of Surgery, Osaka Rosai Hospital.", "authors": "Matsumura|Tae|T|;Noura|Shingo|S|;Hirota|Masaki|M|;Ozato|Yuki|Y|;Marukawa|Daiki|D|;Shuto|Takashi|T|;Muratsu|Arisa|A|;Yasuyama|Akinobu|A|;Takata|Akihiro|A|;Koga|Chikato|C|;Kameda|Chizu|C|;Murakami|Masahiro|M|;Kawabata|Ryohei|R|;Shimizu|Junzo|J|;Hasegawa|Junichi|J|", "chemical_list": null, "country": "Japan", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0385-0684", "issue": "45(4)", "journal": "Gan to kagaku ryoho. Cancer & chemotherapy", "keywords": null, "medline_ta": "Gan To Kagaku Ryoho", "mesh_terms": "D000971:Antineoplastic Combined Chemotherapy Protocols; D005260:Female; D006501:Hepatic Encephalopathy; D006801:Humans; D008113:Liver Neoplasms; D008297:Male; D008875:Middle Aged; D012004:Rectal Neoplasms; D012811:Sigmoid Neoplasms", "nlm_unique_id": "7810034", "other_id": null, "pages": "694-696", "pmc": null, "pmid": "29650838", "pubdate": "2018-04", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review", "references": null, "title": "Two Cases of Hepatic Encephalopathy after Chemotherapy for Metastatic Colorectal Cancer.", "title_normalized": "two cases of hepatic encephalopathy after chemotherapy for metastatic colorectal cancer" }
[ { "companynumb": "JP-MYLANLABS-2018M1059690", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "FLUOROURACIL" }, "drugadditional": "1", ...
{ "abstract": "Maternal use of drugs during pregnancy may cause irreversible renal failure in the newborn. This report highlights the adverse effect of telmisartan during the last trimester of pregnancy. The neonate presented with oliguric renal failure and the renal histology showed proximal tubular dysgenesis.", "affiliations": "Department of Nephrology, Osmania General Hospital and Medical College, Hyderabad, Andhra Pradesh, India.;Department of Nephrology, Osmania General Hospital and Medical College, Hyderabad, Andhra Pradesh, India.;Department of Nephrology, Osmania General Hospital and Medical College, Hyderabad, Andhra Pradesh, India.;Department of Nephrology, Osmania General Hospital and Medical College, Hyderabad, Andhra Pradesh, India.", "authors": "Sahay|M|M|;Ismal|K|K|;Vali|P S|PS|;Saivani|D|D|", "chemical_list": null, "country": "India", "delete": false, "doi": "10.4103/0971-4065.133023", "fulltext": "\n==== Front\nIndian J NephrolIndian J NephrolIJNIndian Journal of Nephrology0971-40651998-3662Medknow Publications & Media Pvt Ltd India IJN-24-24910.4103/0971-4065.133023Case ReportMaternal drugs and neonatal renal failure Sahay M. Ismal K. Vali P. S. Saivani D. Department of Nephrology, Osmania General Hospital and Medical College, Hyderabad, Andhra Pradesh, IndiaAddress for correspondence: Dr. Manisha Sahay, 6-3-852/A, Ameerpet, Hyderabad - 500 016, Andhra Pradesh, India. E-mail: drmanishasahay@gmail.comJul-Aug 2014 24 4 249 251 Copyright: © Indian Journal of Nephrology2014This is an open-access article distributed under the terms of the Creative Commons Attribution-Noncommercial-Share Alike 3.0 Unported, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Maternal use of drugs during pregnancy may cause irreversible renal failure in the newborn. This report highlights the adverse effect of telmisartan during the last trimester of pregnancy. The neonate presented with oliguric renal failure and the renal histology showed proximal tubular dysgenesis.\n\nNeonatal renal failurepregnancyproximal tubular dysgenesisrenin angiotensin system blockade\n==== Body\nIntroduction\nInappropriate drug use during pregnancy may lead to fetal complications. Use of angiotensin receptor blockers (ARBs) in the third trimester may cause renal failure in the neonate which may be irreversible if associated with renal tubular dysgenesis. This case report highlights the importance of educating the practitioners about appropriate use of drugs in pregnancy.\n\nCase Report\nA 7-day-old male child was brought to our hospital with severe respiratory distress and anuria. Child was born to non-consanguineous parents and was 2nd in birth order. The older female sibling was normal. The mother had pregnancy induced hypertension diagnosed at 21st week of gestation and review of her pregnancy medications showed that she had been taking telmisartan for hypertension as prescribed by a local practitioner. Her blood pressure was well controlled. Proteinuria was 550 mg/d and serum creatinine was 0.8 mg/dl. Her antenatal scan showed oligohydramnios, no fetal anomalies were detected. She underwent caesarean section at 34 weeks. The birth weight of the newborn was 2.5 kg. The child had a progressive decline in urine output and was brought to the hospital for respiratory distress on 7th day of life.\n\nExamination showed no congenital abnormalities. The child has severe respiratory distress. Urine examination was normal, serum creatinine was 8 mg/dl, blood urea 148 mg/dl, serum potassium 6 meq/l, serum sodium 135 meq/l, serum bicarbonate 12 meq/l, blood sugar 120 mg/dl, hemoglobin 13 g/dl, total leucocyte count was 7800/mm3 with normal differential count and C-reactive protein was negative. Urine and blood cultures were sterile. Chest radiography and echocardiogram were normal. On ultrasound examination right kidney measured 3.8 cm × 2 cm and left kidney was 4 cm × 1.8 cm with grade 1 echotexture. The neonate was subjected to peritoneal dialysis. The parameters settled. However the child continued to be anuric. Another peritoneal dialysis was carried out. In view of non-recovery of renal functions a renal biopsy was performed at 21st day of life which revealed proximal tubular dysgenesis (PTD) characterized by glomerular overcrowding on hematoxylin and eosin stain with immunostaining demonstrating absence of proximal tubular antigens (CD 10 negative). There was normal staining for distal tubular antigens (epithelial membrane antigen) [Figures 1-3]. The child was initiated on continuous ambulatory peritoneal dialysis. This case highlights an important and preventable cause of neonatal renal failure.\n\nFigure 1 Proximal tubular dysgenesis with glomerular crowding (H and E, ×10)\n\nFigure 2 Immunostaining-absence of proximal tubules (CD 10 negative, ×40)\n\nFigure 3 Immunstaining-normal distal tubules (stain for epithelial membrane antigen positive, ×40)\n\nDiscussion\nThe first detailed description of this disorder was given by Schwartz et al.[1] It was later described by Voland et al.,[2] Allanson et al.[3] and Swinford et al.[4] The patient reported by Lorentz and Trillo with glomerular as well as tubular immaturity represents a different disorder.[5]\n\nPTD may occur due to congenital or acquired causes. Congenital defects result from mutations in genes of the renin angiotensin system (RAS) that encode genes for renin, angiotensinogen (AGT), angiotensin-converting enzyme (ACE) and Ang II receptor type 1 and are associated with autosomal recessive PTD.[23] These mutations result in absent or ineffective Ang II, leading to a loss of negative regulation of renin synthesis. Low Ang II action causes persistent hypotension during fetal development. Chronic under perfusion pressure in the kidney causes a defect in the proximal tubule development.\n\nAcquired causes of PTD include neonatal hemochromatosis (NH), substance abuse and RAS blockade and twin-twin transfusion syndrome (TTTS).\n\nThe fetal liver injury in NH impairs proximal renal tubular development through impaired hepatic AGT production. A linear relationship is seen between hepatic AGT expression and degree of renal tubular dysgenesis. Vascular impairment due to cocaine or alcohol intake in mother or maternal smoking may lead to PTD. Angiotensin-converting enzyme inhibitor (ACEi) intake by the mother is an important causative factor.[6] RAS system is critical for renal development. Maternal use of ACEi or ARBs leads to reduction in angiotensin or its’ action. Use of these drugs in the first trimester is associated with cardiovascular or central nervous system anomalies in 5%. Use in 2nd or 3rd trimester is absolutely contraindicated as it leads to fetal anuria, oligohydramnios, pulmonary hypoplasia, Potter's phenotype, hypocalvaria, refractory hypotension and even death. TTTS in monochorionic twins may be associated with PTD. There is a disparity in circulation with discordant fetal growth, urine output and amniotic fluid accumulation and hypoperfusion due to shunting of blood from donor to recipient twin leading to PTD in the donor twin.\n\nSome mothers have spontaneous abortions if the fetus is affected with PTD. PTD is characterized by oligohydramnios in mother.[46] However, normal amniotic fluid volume is seen even in affected pregnancies prior to the 20th or 22nd week of gestation hence early prenatal diagnosis is difficult. Late second trimester demonstration of oligohydramnios on ultrasound with normal sized fetal kidneys suggests this diagnosis. Severe oligohydramnios may be seen. The children may have Potter's phenotype (redundant skin, facial dysmorphism with large and flattened low-set ears, arthrogryposis and severe deformation of the head, chest, hips and limbs) and anuric renal failure leading to stillbirth or neonatal death from respiratory failure. There may be microcephaly, congenital heart defect, acidosis, joint contractures or fractures. Many are born preterm. Fetal chromosomes appear normal. Severe and refractory hypotension has been observed in children who survive the immediate neonatal period. Poor calvarial ossification, resulting in wide cranial sutures and large fontanels, is an additional feature.\n\nThe gross appearance of the kidneys is unremarkable. The cortex maybe slightly thinned and the medulla may be a little attenuated. The kidneys show normal fetal lobulation. There are no gross abnormalities in the cardiovascular, gastrointestinal, endocrine, reticuloendothelial, or central nervous systems. The renal cortices may be slightly pale, but the kidneys and the rest of the genitourinary system are otherwise grossly normal. Kidneys are normal in size, shape and echogenicity or may show mild hyperechogenicity and/or poor corticomedullary differentiation with enlargement.\n\nHistologically patients demonstrate a paucity of proximal tubules with crowding of glomeruli. There is a relative and an absolute increase in numbers of normal glomeruli. Kidney shows a lack of ‘mature proximal tubules on immunostaining with fumarylacetoacetate hydrolase, Leu-M1 and Lotus tetragonolobus which are used to identify proximal convoluted tubules. Monoclonal anti-CD10 antibody that recognizes the human membrane-associated neutral endopeptidase of podocytes and proximal tubular cells and a monoclonal anti-CD15 antibody that recognizes an early myeloid differentiation antigen and serves as a marker for proximal tubules show paucity of proximal tubules. There is a positive staining of distal convoluted and collecting tubules with epithelial membrane antigen. The kidneys show tubular immaturity with some increase in interstitial fibrous tissue. The immature tubules have hyperchromatic nuclei, prominent nucleoli; scant cytoplasm and their brush borders are negative to periodic acid-Schiff reagent. There is no evidence of renal dysplasia. In some cases, there is an arrest of glomerular maturation. The cortical and medullary capillary network can be identified by staining with anti-CD34 antibodies and is normal in PTD. Renal vein thrombosis has been reported in few cases.[7] ACE and AGT are absent or only very weakly expressed in kidney tubules.[8]\n\nAcknowledgments\nThe authors would like to thank Dr. Swarnalata Gowrishankar, Dr. Michelle de Padua and Dr. Meenakshi Swain, Pathology Department, Apollo Hospital, Hyderabad for the histopathology slides.\n\nSource of Support: Nil\n\nConflict of Interest: None declared.\n==== Refs\n1 Schwartz BR Lage JM Pober BR Driscoll SG Isolated congenital renal tubular immaturity in siblings Hum Pathol 1986 17 1259 63 3539761 \n2 Voland JR Hawkins EP Wells TR Saunders B Jones M Benirschke K Congenital hypernephronic nephromegaly with tubular dysgenesis: A distinctive inherited renal anomaly Pediatr Pathol 1985 4 231 45 3835549 \n3 Allanson JE Pantzar JT MacLeod PM Possible new autosomal recessive syndrome with unusual renal histopathological changes Am J Med Genet 1983 16 57 60 6638071 \n4 Swinford AE Bernstein J Toriello HV Higgins JV Renal tubular dysgenesis: Delayed onset of oligohydramnios Am J Med Genet 1989 32 127 32 2650547 \n5 Lorentz WB Jr Trillo AA Neonatal renal failure and glomerular immaturity Clin Nephrol 1983 19 154 9 6839566 \n6 Kriegsmann J Coerdt W Kommoss F Beetz R Hallermann C Müntefering H Renal tubular dysgenesis (RTD)-an important cause of the oligohydramnion-sequence. Report of 3 cases and review of the literature Pathol Res Pract 2000 196 861 5 11156331 \n7 Ortmann M Querfeld U Stollorz M Schröder R Renal tubular dysgenesis with fetal renal vein thrombosis Pathologe 1995 16 143 7 7761360 \n8 Lacoste M Cai Y Guicharnaud L Mounier F Dumez Y Bouvier R Renal tubular dysgenesis, a not uncommon autosomal recessive disorder leading to oligohydramnios: Role of the renin-angiotensin system J Am Soc Nephrol 2006 17 2253 63 16790508\n\n", "fulltext_license": "CC BY-NC-SA", "issn_linking": "0971-4065", "issue": "24(4)", "journal": "Indian journal of nephrology", "keywords": "Neonatal renal failure; pregnancy; proximal tubular dysgenesis; renin angiotensin system blockade", "medline_ta": "Indian J Nephrol", "mesh_terms": null, "nlm_unique_id": "8914356", "other_id": null, "pages": "249-51", "pmc": null, "pmid": "25097340", "pubdate": "2014-07", "publication_types": "D002363:Case Reports", "references": "3539761;3835549;6638071;16790508;7761360;11156331;6839566;2650547", "title": "Maternal drugs and neonatal renal failure.", "title_normalized": "maternal drugs and neonatal renal failure" }
[ { "companynumb": "IN-B.I. PHARMACEUTICALS,INC./RIDGEFIELD-2014-BI-39280GD", "fulfillexpeditecriteria": "1", "occurcountry": "IN", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "TELMISARTAN" }, ...
{ "abstract": "A woman in her 70s with fever and abdominal distension was referred to our hospital for investigation. She had just finished a course of pegylated interferon and ribavirin combination therapy for chronic hepatitis C. Abdominal computed tomography revealed peritoneal thickening and ascites. QuantiFERON(®)-TB Gold was positive, ascitic adenosine deaminase was high, and fluorine-18-fluorodeoxyglucose positron emission tomography (FDG-PET) showed diffuse accumulation in the peritoneum. Although these findings suggested tuberculous peritonitis, we did not detect Mycobacterium tuberculosis in any bacterial cultures, ascites, or other specimens. However, laparoscopic peritoneal biopsy demonstrated a large number of miliary white nodules in the parietal and visceral peritonea. Pathological examination of these nodules revealed epidermoid granuloma with giant Langhans' cells and caseous necrosis. Finally, the diagnosed of tuberculous peritonitis was established. It is important to consider tuberculosis in patients presenting with new symptoms while receiving interferon therapy.", "affiliations": "Center for Postgraduate Training, Nara Medical University.", "authors": "Fukuba|Ryohei|R|;Kawaratani|Hideto|H|;Kubo|Takuya|T|;Kaya|Daisuke|D|;Aihara|Yosuke|Y|;Morioka|Chie|C|;Noguchi|Ryuichi|R|;Mitoro|Akira|A|;Yoshiji|Hitoshi|H|;Fukui|Hiroshi|H|", "chemical_list": "D000995:Antitubercular Agents; D004338:Drug Combinations; D012254:Ribavirin; D007372:Interferons", "country": "Japan", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0446-6586", "issue": "111(12)", "journal": "Nihon Shokakibyo Gakkai zasshi = The Japanese journal of gastro-enterology", "keywords": null, "medline_ta": "Nihon Shokakibyo Gakkai Zasshi", "mesh_terms": "D000368:Aged; D000995:Antitubercular Agents; D004338:Drug Combinations; D005260:Female; D019698:Hepatitis C, Chronic; D006801:Humans; D007372:Interferons; D064847:Multimodal Imaging; D014395:Peritonitis, Tuberculous; D049268:Positron-Emission Tomography; D012254:Ribavirin; D014057:Tomography, X-Ray Computed", "nlm_unique_id": "2984683R", "other_id": null, "pages": "2337-45", "pmc": null, "pmid": "25482910", "pubdate": "2014-12", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Tuberculous peritonitis during pegylated interferon plus ribavirin combination therapy in a patient with chronic hepatitis C.", "title_normalized": "tuberculous peritonitis during pegylated interferon plus ribavirin combination therapy in a patient with chronic hepatitis c" }
[ { "companynumb": "JP-KADMON PHARMACEUTICALS, LLC-KAD201412-001759", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "RIBAVIRIN" }, "drugaddi...
{ "abstract": "Mixed germ cell tumors (GCT) with teratoma components can transform into somatic malignancies which can include histologies outside of traditional germ cell lineages. We describe a case of an 18-year-old man with a metastatic testicular GCT with both mature and immature teratoma components containing malignant transformation into multiple histologies including PNET in the primary testicular tumor and osteosarcoma in a separate pulmonary metastatic lesion. Management with targeted chemotherapy resulted in a durable remission. This is the first reported case that we know of a patient with primary PNET malignant transformation with subsequent metastatic transformation to osteosarcoma.", "affiliations": "Department of Pediatrics, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Pediatrics, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Surgical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.;Department of Pediatrics, The University of Texas MD Anderson Cancer Center, Houston, TX, USA.", "authors": "Shaw|Angela|A|;Morrell|Miriam|M|0000-0001-8183-5795;Weissferdt|Annikka|A|;Hayes-Jordan|Andrea|A|;Harrison|Douglas|D|0000-0002-6776-4852", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1155/2018/8460603", "fulltext": "\n==== Front\nCase Rep Oncol MedCase Rep Oncol MedCRIONMCase Reports in Oncological Medicine2090-67062090-6714Hindawi 10.1155/2018/8460603Case ReportMalignant Transformation of Testicular Teratoma to PNET, Adenocarcinoma, and Osteosarcoma with Complete Remission after Surgery and Combination Chemotherapy in a Young Adult Male Shaw Angela \n1\nhttp://orcid.org/0000-0001-8183-5795Morrell Miriam \n1\nWeissferdt Annikka \n2\nHayes-Jordan Andrea \n3\nhttp://orcid.org/0000-0002-6776-4852Harrison Douglas djharrison@mdanderson.org\n1\n\n1Department of Pediatrics, The University of Texas MD Anderson Cancer Center, Houston, TX, USA\n2Department of Pathology, The University of Texas MD Anderson Cancer Center, Houston, TX, USA\n3Department of Surgical Oncology, The University of Texas MD Anderson Cancer Center, Houston, TX, USAAcademic Editor: Ossama W. Tawfik\n\n2018 3 10 2018 2018 846060315 5 2018 12 9 2018 Copyright © 2018 Angela Shaw et al.2018This is an open access article distributed under the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.Mixed germ cell tumors (GCT) with teratoma components can transform into somatic malignancies which can include histologies outside of traditional germ cell lineages. We describe a case of an 18-year-old man with a metastatic testicular GCT with both mature and immature teratoma components containing malignant transformation into multiple histologies including PNET in the primary testicular tumor and osteosarcoma in a separate pulmonary metastatic lesion. Management with targeted chemotherapy resulted in a durable remission. This is the first reported case that we know of a patient with primary PNET malignant transformation with subsequent metastatic transformation to osteosarcoma.\n==== Body\n1. Introduction\nGerm cell tumors (GCT) of the testis are the most common solid tumors diagnosed in males between the ages of 15 and 40 years [1]. GCTs are typically divided into two major subtypes—seminomatous and nonseminomatous GCT. Nonseminomatous GCT subtype includes embryonal carcinoma, yolk sac tumor, choriocarcinoma, and teratoma. Initial management combines surgical exploration with orchiectomy and diagnostic evaluation of serum tumor markers followed by clinical staging and risk stratification according to the International Germ Cell Cancer Collaborative Group classification system. Depending on risk status, patients may receive systemic chemotherapy which typically incorporates bleomycin, etoposide, and cisplatin (BEP). Prognosis is excellent with a 5-year relative survival rate for males in late adolescence and early adulthood of approximately 96% [2].\n\nGCTs with malignant transformation into somatic histologies are rare, occurring in only 2.7–8.6% of all GCT cases [3]. Malignant transformations from GCT typically arise from mediastinal nonseminomatous GCTs rather than gonadal primary tumors [4]. The development of malignant transformation with sarcomatous components in GCTs tends to occur in nonseminomatous GCTs with teratoma histologies [5]. Primary malignant transformation to sarcoma is the most frequent histology [5, 6], with rhabdomyosarcoma being the most common subtype [4, 6]. Osteosarcoma subtype is rare and has been reported only once [6]. Following sarcoma, transformation to adenocarcinoma and primitive neuroectodermal tumor (PNET) are the next most common histologies [6]. Unlike teratoma, PNET transformation allows for metastatic potential [7] which may render tumors unresectable and difficult to treat.\n\n2. Case Report\nAn 18-year-old man with a past medical history significant for an osteochondroma of the right forearm presented with a three-month history of a slowly enlarging right testicle. At the time of his initial presentation, the testicle had reached 9–10 cm in diameter. The patient was asymptomatic aside from the enlarged testicle without any constitutional symptoms. Tumor markers, including alpha fetoprotein and beta human chorionic gonadotropin, were negative. Family history was significant for a maternal grandmother with uterine and colon cancer both diagnosed in her 60s, a paternal grandfather diagnosed with prostate cancer in his 60s, and a maternal great grandfather diagnosed with leukemia in his 30s.\n\nA unilateral orchiectomy was performed. Pathology was consistent with mature teratoma (90%) and PNET (10%). Chest and abdominal CT scan revealed multiple retroperitoneal lymph nodes matted into a mass. Retroperitoneal lymph node dissection (RPLND) was performed revealing mature and immature teratoma with 60–70% transformation to PNET. This positive lymph node spread prompted second opinion review of the pathology. Second opinion pathologic evaluation of the primary tumor revealed nonseminomatous mixed germ cell tumor composed of mature and immature teratoma (95%, of which 30–50% was PNET), yolk sac tumor (3%), and embryonal carcinoma (2%). Due to the PNET component, 18F-FDG-PET (PET) imaging was obtained which revealed a 1 cm PET avid left lower lobe lung nodule with a standard uptake value (SUV) of 2.8. A multidisciplinary team discussed treatment and planned for surgical resection of the lung nodule following initiation of therapy. There was concern that the patient was progressing when the FDG-PET avid nodule was discovered, and there had been considerable delay in confirming the diagnosis. As such, it was decided to proceed with chemotherapy and explore the pathology of the nodule if the patient did not experience adequate treatment response. Given the unusual nature of his case and the presence of several family members with a history of cancer, the patient was offered TP53 genetic testing but declined.\n\nCombination chemotherapy was initiated with an alternating regimen that included cycles of vincristine/doxorubicin/cyclophosphamide and ifosfamide/etoposide given in compressed two-week cycles. The patient tolerated chemotherapy well without any major toxicity aside from intermittent mild myelosuppression.\n\nReevaluation of the PET avid lung nodule occurred prior to cycle 5 and showed persistent avidity with an SUV of 2.92. A wedge resection of the left lower lung lobe nodule was completed following cycle 9 of chemotherapy. Pathology of this nodule revealed mature teratoma (40%), osteosarcoma (30%), and adenocarcinoma (30%) components (Figure 1).\n\nTreatment was subsequently amended to an osteosarcoma-based treatment regimen that contained four cycles of cisplatin with doxorubicin again alternating with 3 cycles of ifosfamide and etoposide. Total cumulative dose included doxorubicin 600 mg/m2, cisplatin 360 mg/m2, ifosfamide 54 g/m2, etoposide 3 g/m2, and cyclophosphamide 6 g/m2. He received dexrazoxane for cardioprotection prior to each doxorubicin infusion for a total cumulative dose of 6 g/m2. The patient's end of therapy evaluation was negative for any evidence of disease, and he is alive with no evidence of disease after 18 months.\n\n3. Discussion\nWhile germ cell tumors are a common malignancy in young men, it is rare for them to develop somatic malignant transformation. Malignant transformation more commonly arises in mediastinal nonseminomatous germ cell tumors than in gonadal germ cell tumors [4]. Sarcomas, typically rhabdomyosarcoma subtype, and PNET are among the most commonly reported histologic transformations [3–5, 7]. To our knowledge, primary malignant transformation to osteosarcoma has been reported only once [6]. Transformation to multiple distinct solid tumor histologies in the primary tumor has also been previously reported [6, 8]. Prevalence of transformation to multiple distinct histologies in metastases is unknown, with only two reports that included mature and immature teratoma, embryonal rhabdomyosarcoma, and non-Hodgkin's lymphoma components [6] and mature teratoma, choriocarcinoma, and embryonal carcinoma, respectively [8].\n\nBecause of the rarity of these tumors, prognostic factors and optimal management of germ cell tumors with somatic malignant transformation are poorly defined. Cisplatin-based chemotherapy regimens have good outcomes in nontransformed malignant germ cell tumors, with a cure rate of greater than 80% [5, 9]. Unfortunately, these regimens have proven to be ineffective in the treatment of malignantly transformed germ cell tumors [10]. In particular, germ cell tumors with PNET transformation are usually resistant to cisplatin-based chemotherapy regimens [7, 11, 12]. Surgical resection remains the mainstay of treatment for germ cell tumors with malignant transformation. However, systemic chemotherapy may be effective when the choice of treatment regimen is directed towards the transformed histology [4] and can improve surgical resectability. Germ cell tumors with somatic transformation into PNET have in certain cases been successfully treated with chemotherapy that includes cycles of vincristine, doxorubicin, and cyclophosphamide alternating with ifosfamide and etoposide. In one study, this resulted in a median survival of 32.7 months [13].\n\nFurther research is needed to adequately define treatment paradigms for patients with germ cell tumors transformed into multiple somatic histologies. It has been suggested that treatment for patients with unresectable malignant transformations be tailored towards the specific transformed histology [6]. We have demonstrated that thorough surgical resection and combination chemotherapy targeted towards the most aggressive found histology can lead to disease control and durable remission in patients with gonadal germ cell tumors containing transformation to multiple malignant somatic histologies.\n\nDisclosure\nAn earlier version of this work was presented as an abstract as shown in the following link https://onlinelibrary.wiley.com/doi/full/10.1002/pbc.26591.\n\nConflicts of Interest\nAll authors have no conflict of interest to disclose.\n\nAuthors' Contributions\nDr. Shaw and Dr. Morrell contributed equally to this work and are co-first authors.\n\nFigure 1 (a) Primitive neuroectodermal tumor component present in the testicular primary tumor and precaval mass. (b) Metastatic teratoma to the lung with transition to areas of osteosarcoma. (c) Metastatic teratoma to the lung with adjacent adenocarcinoma component.\n==== Refs\n1 Winter C. Albers P. Testicular germ cell tumors: pathogenesis, diagnosis and treatment Nature Reviews Endocrinology 2011 7 1 43 53 10.1038/nrendo.2010.196 2-s2.0-78650308345 21116298 \n2 Gilligan T. Quality of life among testis cancer survivors Urologic Oncology: Seminars and Original Investigations 2015 33 9 413 419 10.1016/j.urolonc.2015.05.018 2-s2.0-84940467352 26087970 \n3 Rice K. R. Magers M. J. Beck S. D. W. Management of germ cell tumors with somatic type malignancy: pathological features, prognostic factors and survival outcomes The Journal of Urology 2014 192 5 1403 1409 10.1016/j.juro.2014.05.118 2-s2.0-84908134885 24952240 \n4 Donadio A. C. Motzer R. J. Bajorin D. F. Chemotherapy for teratoma with malignant transformation Journal of Clinical Oncology 2003 21 23 4285 4291 10.1200/JCO.2003.01.019 2-s2.0-0642368575 14645417 \n5 Guo C. C. Punar M. Contreras A. L. Testicular germ cell tumors with sarcomatous components: an analysis of 33 cases The American Journal of Surgical Pathology 2009 33 8 1173 1178 10.1097/PAS.0b013e3181adb9d7 2-s2.0-68249093368 19561445 \n6 Motzer R. J. Amsterdam A. Prieto V. Tertatoma with malignant transformation: diverse malignant histologies arising in men with germ cell tumors The Journal of Urology 1998 159 1 133 138 10.1016/S0022-5347(01)64035-7 2-s2.0-0031986550 9400455 \n7 Ehrlich Y. Beck S. D. W. Ulbright T. M. Outcome analysis of patients with transformed teratoma to primitive neuroectodermal tumor Annals of Oncology 2010 21 9 1846 1850 10.1093/annonc/mdq045 2-s2.0-77956096193 20231305 \n8 Ahmed T. Bosl G. J. Hajdu S. I. Teratoma with malignant transformation in germ cell tumors in men Cancer 1985 56 4 860 863 10.1002/1097-0142(19850815)56:4<860::AID-CNCR2820560426>3.0.CO;2-3 2990657 \n9 Stephenson A. J. Sheinfeld J. The role of retroperitoneal lymph node dissection in the management of testicular cancer Urologic Oncology: Seminars and Original Investigations 2004 22 3 225 233 10.1016/j.urolonc.2004.04.029 2-s2.0-3242695249 15271322 \n10 El Mesbahi O. Terrier-Lacombe M.-J. Rebischung C. Theodore C. Vanel D. Fizazi K. Chemotherapy in patients with teratoma with malignant transformation European Urology 2007 51 5 1306 1312 10.1016/j.eururo.2006.10.021 2-s2.0-33947202102 17081678 \n11 Comiter C. Kibel A. Richie J. Nucci M. Renshaw A. Prognostic features of teratomas with malignant transformation: a clinicopathological study of 21 cases The Journal of Urology 1998 159 3 859 863 10.1016/S0022-5347(01)63754-6 2-s2.0-0031931448 9474169 \n12 Spiess P. E. Pisters L. L. Liu P. Malignant transformation of testicular teratoma: a chemoresistant phenotype Urologic Oncology: Seminars and Original Investigations 2008 26 6 595 599 10.1016/j.urolonc.2007.07.013 2-s2.0-55249110888 18367105 \n13 Al-Hader A. A. Jain A. Al-Nasrallah N. Einhorn L. H. Metastatic malignant transformation of teratoma to primitive neuroectodermal tumor (PNET): results with PNET-based chemotherapy American Journal of Clinical Oncology 2015 38 4 364 366 10.1097/COC.0b013e31829d1ed7 2-s2.0-84938743169 23799289\n\n", "fulltext_license": "CC BY", "issn_linking": null, "issue": "2018()", "journal": "Case reports in oncological medicine", "keywords": null, "medline_ta": "Case Rep Oncol Med", "mesh_terms": null, "nlm_unique_id": "101581035", "other_id": null, "pages": "8460603", "pmc": null, "pmid": "30402315", "pubdate": "2018", "publication_types": "D002363:Case Reports", "references": "15271322;17081678;21116298;20231305;24952240;26087970;23799289;9474169;14645417;9400455;18367105;2990657;19561445", "title": "Malignant Transformation of Testicular Teratoma to PNET, Adenocarcinoma, and Osteosarcoma with Complete Remission after Surgery and Combination Chemotherapy in a Young Adult Male.", "title_normalized": "malignant transformation of testicular teratoma to pnet adenocarcinoma and osteosarcoma with complete remission after surgery and combination chemotherapy in a young adult male" }
[ { "companynumb": "US-TEVA-2019-US-1041284", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DOXORUBICIN" }, "drugadditional": "3", ...
{ "abstract": "Immune checkpoint inhibitors (ICIs), such as programmed cell death 1 (PD-1) inhibitors, are used to treat multiple cancers. Limited data exist as to the use of ICIs in patients with coexistent interstitial lung disease (ILD). We conducted a retrospective case series to assess clinical and radiologic outcomes of patients with ILD treated with PD-1 inhibitors.\n\n\n\nEligible patients were 18 years of age or older, treated with pembrolizumab or nivolumab for oncologic indications, and had evidence of ILD on chest computed tomography scan not attributable to radiotherapy before initiation of ICI therapy. Outcomes of interest included mortality, hospitalizations for respiratory-related causes, development of pneumonitis, and radiologic change in ILD over a 1-year follow-up period.\n\n\n\nWe included 41 patients in the analysis. At 1 year, 17 patients (41.5%) were alive, 23 had died (56.1%), and 1 (2.4%) was lost to follow-up. Of 23 deaths, 16 (69.6%) were due to cancer, 4 (17.4%) to causes excluding cancer and ILD, and 3 (13.0%) to hypoxemic respiratory failure from ILD- or ICI-induced pneumonitis. Three patients (7.3%) required hospitalization owing to ILD, including drug-induced pneumonitis, and 3 (7.3%) developed pneumonitis attributable to anti-PD-1 therapy. On follow-up computed tomography scans, 32 patients (78.0%) had stable or improved ILD and 9 (22.0%) had progression.\n\n\n\nPatients with ILD receiving PD-1 inhibitors more frequently died of cancer-related causes than from ILD. Further research is needed to determine the safety of ICIs in patients with ILD and if ILD subtype may help to refine ICI-associated risks.", "affiliations": "Queen's University School of Medicine, Kingston, Ontario, Canada.;Division of Pulmonary & Critical Care Medicine, Massachusetts General Hospital, Boston, Massachusetts.;Division of Rheumatology, Allergy and Immunology, Massachusetts General Hospital, Boston, Massachusetts.;Division of Pulmonary & Critical Care Medicine, Massachusetts General Hospital, Boston, Massachusetts; Harvard T.H. Chan School of Public Health, Boston, Massachusetts.;Division of Pulmonary & Critical Care Medicine, Massachusetts General Hospital, Boston, Massachusetts.;Division of Thoracic Imaging and Intervention, Massachusetts General Hospital, Boston, Massachusetts.;Division of Pulmonary & Critical Care Medicine, Massachusetts General Hospital, Boston, Massachusetts. Electronic address: sbmontesi@partners.org.", "authors": "Dobre|Ioana A|IA|;Frank|Angela J|AJ|;D'Silva|Kristin M|KM|;Christiani|David C|DC|;Okin|Daniel|D|;Sharma|Amita|A|;Montesi|Sydney B|SB|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1016/j.cllc.2021.01.014", "fulltext": null, "fulltext_license": null, "issn_linking": "1525-7304", "issue": "22(5)", "journal": "Clinical lung cancer", "keywords": "Carcinomas; Idiopathic pulmonary fibrosis; Immunotherapy; Interstitial lung disease; X-Ray Computed tomography", "medline_ta": "Clin Lung Cancer", "mesh_terms": null, "nlm_unique_id": "100893225", "other_id": null, "pages": "e738-e744", "pmc": null, "pmid": "33663958", "pubdate": "2021-09", "publication_types": "D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Outcomes of Patients With Interstitial Lung Disease Receiving Programmed Cell Death 1 Inhibitors: A Retrospective Case Series.", "title_normalized": "outcomes of patients with interstitial lung disease receiving programmed cell death 1 inhibitors a retrospective case series" }
[ { "companynumb": "CA-SUN PHARMACEUTICAL INDUSTRIES LTD-2020R1-256519", "fulfillexpeditecriteria": "1", "occurcountry": "CA", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "DOCETAXEL" }, "druga...
{ "abstract": "BACKGROUND\nThe Management of postoperative pain after abdominal surgery is a major challenge to the anesthesiologist. The optimization of postoperative analgesia improves prognosis contributing also to patient satisfaction and reducing morbidity and mortality. The aim of this randomized control study is to perform the comparative analysis in terms of effectiveness of an unconventional and still poorly technique implemented, continuous wound infusion, and the currently most applied and gold standard technique, epidural analgesia, in the postoperative period after abdominal surgery.\n\n\nMETHODS\nFifty patients, previously subjected to abdominal surgery by median laparotomy with xifo-pubic incision were randomized to receive postoperative analgesia via epidural (n = 25) or via continuous wound infusion (n = 25) during 48 hours. The primary outcome was analysis of pain at rest (< 4/10 numerical pain scale) after 24 hours postoperatively. Scores of pain at six, 12 and 48 hours and three months after surgery were also evaluated, as well as the incidence of adverse effects 48 hours postoperatively.\n\n\nRESULTS\nThe proportion of patients with successful control of postoperative pain was 84% against 60% with epidural analgesia and continuous wound infusion, respectively. Within the continuous wound infusion group with uncontrolled pain, all patients rated the pain below 6/10 24 hours postoperatively. The incidence of nausea, vomiting, pruritus or íleus was lower in the continuous wound infusion group, with statistically significant results for recovery of intestinal function. There was one case of systemic local anesthetic toxicity with an episode of frequent ventricular extrasystoles without hemodynamic instability, which ceased after suspension of continuous epidural infusion of local anesthetic.\n\n\nCONCLUSIONS\nThis study suggests that continuous wound infusion is the technique with most efficacy and safety, being even better than epidural analgesia in postoperative pain control after major abdominal surgery. This technique is associated with better analgesia, lower incidence of side effects, high level of satisfaction and no residual pain, contributing to enhanced recovery.\n\n\nCONCLUSIONS\nContinuous wound infusion is an effective technique, which should be implemented for analgesia after major abdominal surgery, with advantages when compared with epidural analgesia, especially low incidence of adverse effects. Registration: Trial not registered.", "affiliations": "Serviço de Anestesiologia. Hospital de Santa Maria. Centro Hospitalar Lisboa Norte. Lisboa. Portugal.", "authors": "Araújo|Rita|R|;|||", "chemical_list": null, "country": "Portugal", "delete": false, "doi": "10.20344/amp.8600", "fulltext": null, "fulltext_license": null, "issn_linking": "0870-399X", "issue": "30(10)", "journal": "Acta medica portuguesa", "keywords": "Abdomen/surgery; Anesthesia, Epidural; Anesthetics, Local; Digestive System Surgical Procedures; Pain, Postoperative; Postoperative Complications; Postoperative Nausea and Vomiting", "medline_ta": "Acta Med Port", "mesh_terms": "D000368:Aged; D000698:Analgesia; D015360:Analgesia, Epidural; D005260:Female; D006801:Humans; D036502:Infusions, Intralesional; D008297:Male; D008875:Middle Aged; D059408:Pain Management; D010149:Pain, Postoperative; D017060:Patient Satisfaction; D011183:Postoperative Complications; D011446:Prospective Studies; D013530:Surgical Wound Infection", "nlm_unique_id": "7906803", "other_id": null, "pages": "683-690", "pmc": null, "pmid": "29268061", "pubdate": "2017-10-31", "publication_types": "D003160:Comparative Study; D016428:Journal Article; D016449:Randomized Controlled Trial", "references": null, "title": "Pain Management, Local Infection, Satisfaction, Adverse Effects and Residual Pain after Major Open Abdominal Surgery: Epidural versus Continuous Wound Infusion (PAMA Trial).", "title_normalized": "pain management local infection satisfaction adverse effects and residual pain after major open abdominal surgery epidural versus continuous wound infusion pama trial" }
[ { "companynumb": "PT-ABBVIE-17P-130-2160344-00", "fulfillexpeditecriteria": "1", "occurcountry": "PT", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "FENTANYL" }, "drugadditional": null, ...
{ "abstract": "Late-onset neutropenia after rituximab therapy (LONART) is defined as a fall in the absolute neutrophil count below 500/mm3 at least 3 weeks after rituximab infusion, in the absence of any other explanation. LONART is rare during dysimmune conditions but can be life-threatening. We report on two patients with LONART and associated neurological relapse occurring in myelin oligodendrocyte glycoprotein (MOG)-antibody spectrum disorders. Rituximab was reintroduced in one patient, while the second patient was switched to tocilizumab. LONART can occur during anti-MOG spectrum disorders. Neurologists should be aware of this rare and treatable complication. Regular monitoring of blood cell counts is needed, and patients should be informed of the need to consult their physician if symptoms of infection appear.", "affiliations": "Pole des Neurosciences, Unité de neurologie, Hôpital Pierre-Paul Riquet, CHU Purpan, Toulouse, France.;Pole des Neurosciences, Unité de neurologie, Hôpital Pierre-Paul Riquet, CHU Purpan, Toulouse, France.;Unité de neuroradiologie, Hôpital Pierre-Paul-Riquet, CHU Purpan, Toulouse, France.;Pole des Neurosciences, Unité de neurologie, Hôpital Pierre-Paul Riquet, CHU Purpan, Toulouse, France.;Pole des Neurosciences, Unité de neurologie, Hôpital Pierre-Paul Riquet, CHU Purpan, Toulouse, France; INSERM UMR 1043, Université Toulouse III, Toulouse, France.;Pole des Neurosciences, Unité de neurologie, Hôpital Pierre-Paul Riquet, CHU Purpan, Toulouse, France; INSERM UMR 1043, Université Toulouse III, Toulouse, France.", "authors": "Biotti|Damien|D|0000-0003-0569-629X;Lerebours|Fleur|F|;Bonneville|Fabrice|F|;Ciron|Jonathan|J|;Clanet|Michel|M|;Brassat|David|D|", "chemical_list": "D001323:Autoantibodies; D001324:Autoantigens; D007155:Immunologic Factors; C571326:MOG protein, human; D063308:Myelin-Oligodendrocyte Glycoprotein; D000069283:Rituximab", "country": "England", "delete": false, "doi": "10.1177/1352458518765677", "fulltext": null, "fulltext_license": null, "issn_linking": "1352-4585", "issue": "24(12)", "journal": "Multiple sclerosis (Houndmills, Basingstoke, England)", "keywords": "Rituximab; anti-myelin oligodendrocyte glycoprotein antibodies; late onset neutropenia; neuromyelitis optica spectrum disorders", "medline_ta": "Mult Scler", "mesh_terms": "D000328:Adult; D001323:Autoantibodies; D001324:Autoantigens; D005260:Female; D006801:Humans; D007155:Immunologic Factors; D008297:Male; D008875:Middle Aged; D063308:Myelin-Oligodendrocyte Glycoprotein; D009471:Neuromyelitis Optica; D009503:Neutropenia; D012008:Recurrence; D000069283:Rituximab", "nlm_unique_id": "9509185", "other_id": null, "pages": "1645-1647", "pmc": null, "pmid": "29741120", "pubdate": "2018-10", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Late-onset neutropenia and neurological relapse, during long-term rituximab therapy in myelin oligodendrocyte glycoprotein-antibody spectrum disorder.", "title_normalized": "late onset neutropenia and neurological relapse during long term rituximab therapy in myelin oligodendrocyte glycoprotein antibody spectrum disorder" }
[ { "companynumb": "FR-AMGEN-FRASP2018162581", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "RITUXIMAB" }, "drugadditional": null, ...
{ "abstract": "BACKGROUND\nRituximab is a chimeric anti-CD20 monoclonal antibody generally well tolerated. However, a severe but rare rituximab-related immune-toxic syndrome, associating fever, chills and thrombocytopenia can occur shortly after the infusion.\n\n\nMETHODS\nWe report a case of severe acute rituximab-induced thrombocytopenia with favorable outcome in a patient with chronic lymphocytic leukemia and discuss the possible underlying mechanisms.\n\n\nCONCLUSIONS\nDespite the potential initial severity of rituximab-induced thrombocytopenia in CLL, chemotherapy should not be discontinued; tolerance might increase as the hematologic disorder is controlled.", "affiliations": "Service de néphrologie, hôpital La-Conception, Assistance publique-Hôpitaux de Marseille, Aix-Marseille université, 147, boulevard Baille, 13005 Marseille, France. Electronic address: mickael.bobot@ap-hm.fr.;Service de dermatologie, hôpital Nord, Assistance publique-Hôpitaux de Marseille, Aix-Marseille université, chemin des Bourrely, 13015 Marseille, France.;Service de pharmacologie clinique et pharmacovigilance, centre régional de pharmacovigilance Marseille Provence Corse, hôpital Sainte-Marguerite, AP-HM, 270, boulevard de Sainte-Marguerite, 13009 Marseille, France.;Département de médecine interne, service de médecine interne générale, HUG, 4, rue Gabrielle-Perret-Gentil, 1211 Genève 14, Suisse.;Département de médecine interne, service de médecine interne générale, HUG, 4, rue Gabrielle-Perret-Gentil, 1211 Genève 14, Suisse.;Service de médecine interne, hôpital La Timone, Assistance publique-Hôpitaux de Marseille, Aix-Marseille université, 264, rue Saint-Pierre, 13005 Marseille, France.", "authors": "Bobot|M|M|;Benzaquen|M|M|;Rouby|F|F|;Lebowitz|D|D|;Serratrice|J|J|;Durand|J-M|JM|", "chemical_list": "D000970:Antineoplastic Agents; D000069283:Rituximab", "country": "France", "delete": false, "doi": "10.1016/j.revmed.2016.08.008", "fulltext": null, "fulltext_license": null, "issn_linking": "0248-8663", "issue": "38(5)", "journal": "La Revue de medecine interne", "keywords": "Chronic lymphocytic leukemia; Cytokine release syndrome; Leucémie lymphoïde chronique; Rituximab; Syndrome de relargage des cytokines; Thrombocytopenia; Thrombopénie", "medline_ta": "Rev Med Interne", "mesh_terms": "D000208:Acute Disease; D000368:Aged; D000970:Antineoplastic Agents; D006801:Humans; D015451:Leukemia, Lymphocytic, Chronic, B-Cell; D008297:Male; D000069283:Rituximab; D013921:Thrombocytopenia", "nlm_unique_id": "8101383", "other_id": null, "pages": "344-346", "pmc": null, "pmid": "27639907", "pubdate": "2017-05", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Rituximab-induced acute thrombocytopenia in a patient with chronic lymphocytic leukemia.", "title_normalized": "rituximab induced acute thrombocytopenia in a patient with chronic lymphocytic leukemia" }
[ { "companynumb": "FR-ROCHE-1863623", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "METHYLPREDNISOLONE SODIUM SUCCINATE" }, "drugaddition...
{ "abstract": "A male patient was born small for gestational age (SGA) at 33 weeks with a birth weight of 1,663 grams (< 10th percentile) and length 43 cm (10th percentile) to a 38-year-old G5P4 mother by cesarean section due to non-reassuring fetal heart tones. Prior to delivery, his mother experienced decreased fetal movement and decelerations. At birth, he was initially well-appearing and vigorous, with Apgar scores of 7 and 8 at 1 and 5 minutes, respectively. The physical examination was unremarkable--no skin findings, no facial anomalies, good tone, and the anterior fontanelle was soft and flat. The placenta, although noted to be healthy in appearance on prenatal ultrasounds, was atrophic and calcified by gross examination. The patient developed respiratory distress 1 hour after birth and was found to have a blood glucose level of 24 mg/dL. Following an intravenous (IV) bolus of 10% dextrose in water (D10W) of 2 mL/kg, his glucose was 20 mg/dL. He was started on IV fluids with a glucose infusion rate (GIR) of 7.3 mg/kg/minute, with a subsequent rise in blood glucose to 46 mg/dL. Due to prematurity, respiratory distress, and persistent hypoglycemia, a diagnostic evaluation was initiated for possible sepsis, including a complete blood count with differential and platelet count and blood cultures. The patient was started empirically on IV ampicillin and gentamicin. The patient was subsequently found to have thrombocytopenia, hypomagnesemia, and hyponatremia on laboratory evaluation and was transferred to our neonatal intensive care unit (NICU) for further care.", "affiliations": null, "authors": "Blanco|Michelle|M|;Khan|Owais|O|;Stanley|Katherine|K|;Hageman|Joseph R|JR|;Greeley|Siri Atma W|SA|", "chemical_list": "D001786:Blood Glucose; D003981:Diazoxide", "country": "United States", "delete": false, "doi": "10.3928/00904481-20140221-08", "fulltext": null, "fulltext_license": null, "issn_linking": "0090-4481", "issue": "43(3)", "journal": "Pediatric annals", "keywords": null, "medline_ta": "Pediatr Ann", "mesh_terms": "D001786:Blood Glucose; D003937:Diagnosis, Differential; D003981:Diazoxide; D006801:Humans; D006946:Hyperinsulinism; D007231:Infant, Newborn; D007235:Infant, Premature, Diseases; D007236:Infant, Small for Gestational Age; D015931:Intensive Care, Neonatal; D008297:Male; D047928:Premature Birth", "nlm_unique_id": "0356657", "other_id": null, "pages": "e56-60", "pmc": null, "pmid": "24605860", "pubdate": "2014-03", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "11697420;7351590;18156285;16492430;14586649;15922680;17179930;23032149;23362136;9290603", "title": "Hyperinsulinism in a neonate.", "title_normalized": "hyperinsulinism in a neonate" }
[ { "companynumb": "US-MYLANLABS-2016M1037502", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "GENTAMICIN" }, "drugadditional": "3", ...
{ "abstract": "OBJECTIVE\nTo provide psychiatrists with relevant, up to date information about sporadic Creutzfeldt-Jakob disease.\n\n\nCONCLUSIONS\nA 59-year-old bookkeeper presented with psychiatric symptoms in the context of stressors and past history of depression, for which her GP prescribed sertraline and olanzapine. Following a further deterioration in her mental state she was referred to acute psychiatric services, and there found to have dementia and myoclonus, and investigations supported a diagnosis of probable Creutzfeldt-Jakob disease, sporadic type (sCJD). This paper serves to outline the emerging literature challenging the notion that suggests psychiatric symptoms are uncommon in the presentation of sCJD.", "affiliations": "Centre for Clinical Research in Neuropsychiatry, The University of Western Australia, Claremont, Western Australia, Australia. brian.power@health.wa.gov.au", "authors": "Power|Brian|B|;Trivedi|Darshan|D|;Samuel|Mathew|M|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1177/1039856211430145", "fulltext": null, "fulltext_license": null, "issn_linking": "1039-8562", "issue": "20(1)", "journal": "Australasian psychiatry : bulletin of Royal Australian and New Zealand College of Psychiatrists", "keywords": null, "medline_ta": "Australas Psychiatry", "mesh_terms": "D007562:Creutzfeldt-Jakob Syndrome; D003937:Diagnosis, Differential; D005260:Female; D006801:Humans; D008279:Magnetic Resonance Imaging; D008875:Middle Aged; D009483:Neuropsychological Tests", "nlm_unique_id": "9613603", "other_id": null, "pages": "61-6", "pmc": null, "pmid": "22357679", "pubdate": "2012-02", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "What psychiatrists should know about sporadic Creutzfeldt-Jakob disease.", "title_normalized": "what psychiatrists should know about sporadic creutzfeldt jakob disease" }
[ { "companynumb": "AU-PFIZER INC-2019334629", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "SERTRALINE HYDROCHLORIDE" }, "drugadditional":...
{ "abstract": "OBJECTIVE\nConcerns exist about outcomes of liver transplantation (LT) from low volume centres, especially for hepatitis C (HCV) patients. The aim of the study was to assess patient outcomes as well as their predictors post LT for HCV in a small volume Australian unit (< 25 LTs/year), comparing these with the average outcomes obtained from national and international transplant registries. Patients transplanted for HCV at the South Australian Liver Transplant Unit between 1992 and 2012 were studied. Outcomes assessed were patient and graft survival at 1,3, and 5 years. Factors independently associated with the outcomes were assessed using Cox regression model.\n\n\nRESULTS\n1, 3, and 5-year patient survival for HCV patients was 95.2, 82.9, and 78.2%, graft survival were 93.7, 80.1, and 75.5% respectively. The total follow-up time observed was 299.9 years amongst 61 patients in which there were 16 deaths. The expected number of deaths was 40.4 and the standardized mortality ratio 0.40 (95% CI = 0.24, 0.65). These results compared favourably to those obtained from the SRTR registry. Variables independently associated with lower patient survival: donor age (HR = 1.06, 95% CI 1.02 - 1.11; P = 0.003), and post LT cytomegalovirus (CMV) disease requiring treatment (HR = 4.03, 95% CI 1.48 - 10.92;P = 0.06).\n\n\nCONCLUSIONS\nIn conclusion, high rates of patient and graft survival for HCV liver transplantation can be obtained in a small volume unit. Young donor age and lack of CMV disease post-transplant were associated with better outcomes. Institutional factors may be influential determinants of outcomes.", "affiliations": "Hepatology and Liver Transplant Medicine Unit, Flinders Medical Centre, Adelaide, South Australia; The South Australian Liver Transplant Unit, Flinders Medical Centre, Adelaide, South Australia.;Flinders Centre for Epidemiology and Biostatistics, School of Medicine, Flinders University of South Australia, Adelaide, South Australia.;The South Australian Liver Transplant Unit, Flinders Medical Centre, Adelaide, South Australia; LiverTransplant Unit, Irmandade Santa Casa de Misericordiade Porto Alegre, Brazil.;Hepatology and Liver Transplant Medicine Unit, Flinders Medical Centre, Adelaide, South Australia; The South Australian Liver Transplant Unit, Flinders Medical Centre, Adelaide, South Australia.;The South Australian Liver Transplant Unit, Flinders Medical Centre, Adelaide, South Australia.;The South Australian Liver Transplant Unit, Flinders Medical Centre, Adelaide, South Australia.;The South Australian Liver Transplant Unit, Flinders Medical Centre, Adelaide, South Australia.;Hepatology and Liver Transplant Medicine Unit, Flinders Medical Centre, Adelaide, South Australia; The South Australian Liver Transplant Unit, Flinders Medical Centre, Adelaide, South Australia.", "authors": "Su|Yin Lau|YL|;Woodman|Richard J|RJ|;Silva|Mauricio F|MF|;Muller|Kate|K|;Libby|John|J|;Chen|John W|JW|;Padbury|Robert|R|;Wigg|Alan J|AJ|", "chemical_list": "D007166:Immunosuppressive Agents; D011239:Prednisolone; D001379:Azathioprine; D016559:Tacrolimus", "country": "Mexico", "delete": false, "doi": "10.5604/16652681.1193713", "fulltext": null, "fulltext_license": null, "issn_linking": "1665-2681", "issue": "15(2)", "journal": "Annals of hepatology", "keywords": null, "medline_ta": "Ann Hepatol", "mesh_terms": "D000293:Adolescent; D000328:Adult; D000367:Age Factors; D000368:Aged; D001315:Australia; D001379:Azathioprine; D016022:Case-Control Studies; D015331:Cohort Studies; D003586:Cytomegalovirus Infections; D006084:Graft Rejection; D006085:Graft Survival; D019698:Hepatitis C, Chronic; D061846:Hospitals, Low-Volume; D006801:Humans; D007166:Immunosuppressive Agents; D008103:Liver Cirrhosis; D016031:Liver Transplantation; D008875:Middle Aged; D011239:Prednisolone; D012189:Retrospective Studies; D015996:Survival Rate; D016559:Tacrolimus; D016896:Treatment Outcome; D055815:Young Adult", "nlm_unique_id": "101155885", "other_id": null, "pages": "207-14", "pmc": null, "pmid": "26845598", "pubdate": "2016", "publication_types": "D016428:Journal Article", "references": null, "title": "Good outcomes of liver transplantation for hepatitis C at a low volume centre.", "title_normalized": "good outcomes of liver transplantation for hepatitis c at a low volume centre" }
[ { "companynumb": "AU-ROCHE-1716223", "fulfillexpeditecriteria": "1", "occurcountry": "AU", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PEGINTERFERON ALFA-2A" }, "drugadditional": null, ...
{ "abstract": "On November 29, 2011 Dr Conrad Murray was sentenced to four years in prison after being convicted of the involuntary manslaughter of Michael Jackson. Expert witness statements indicated that Murray's actions were an \"extreme departure from the standard of care\", particularly with regard to (1) inappropriately treating insomnia with a surgical anaesthetic (propofol); (2) failing to acquire sufficiently informed consent; (3) administering propofol without the necessary monitoring equipment; (4) delaying contacting the emergency services; and (5) making ineffective resuscitation efforts. Further medical evidence argued that Murray's care of Jackson contained \"17 egregious violations\", defined as acts that posed a foreseeable danger to the patient's life. These deficiencies, it was stated, constituted gross negligence. Such events might seem remote from daily medical practice in Ireland. However, medical errors resulting in patient death are reported to be unfortunately frequent, even if such fatalities are rarely as dramatic, or as public, as that of Michael Jackson. Medical care is not necessarily straightforward, and any treatment outcome is dependent on clinician skill, the nature of the intervention, and on the pathological condition of the patient. Regardless of these latter two factors, a poor outcome still may occur through physician omissions or the commission of errors or violations. Merry and McCall Smith distinguish between errors and violations on the following basis: (1) errors are not deliberate, and result in unintentional actions and consequences; (2) violations, on the other hand, entail a deliberate deviation from accepted rules or norms. It was alleged that much of Dr Murray's professional conduct in this case fell into the latter category.", "affiliations": null, "authors": "Lyons|B|B|", "chemical_list": "D006993:Hypnotics and Sedatives; D015742:Propofol", "country": "Ireland", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0332-3102", "issue": "106(1)", "journal": "Irish medical journal", "keywords": null, "medline_ta": "Ir Med J", "mesh_terms": "D002140:California; D005197:Famous Persons; D006708:Homicide; D006801:Humans; D006993:Hypnotics and Sedatives; D007494:Ireland; D008297:Male; D008318:Malpractice; D015742:Propofol", "nlm_unique_id": "0430275", "other_id": null, "pages": "26-7", "pmc": null, "pmid": "23472376", "pubdate": "2013-01", "publication_types": "D016422:Letter", "references": null, "title": "Medical manslaughter.", "title_normalized": "medical manslaughter" }
[ { "companynumb": "IE-BAUSCH-BL-2018-026483", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "ACETAMINOPHEN\\HYDROCODONE BITARTRATE" }, "dru...
{ "abstract": "We present a case of acute onset of bilateral choroidal effusions leading to angle closure glaucoma attributed to multiple mechanism of actions causing ciliary body and aqueous flow disruption in the setting of topical glaucoma therapy with latanoprost, brimonidine 0.2%, and Brinzolamide 0.1%.\nThe patient presented with ocular hypertension in the setting of bilateral choroidal effusions, leading to angle closure without pupillary block. After cessation of the glaucoma drops and starting steroids and cycloplegics, the patient's symptoms resolved.\nThis case report highlights the various physiological mechanisms of action that can induce angle closure glaucoma from commonly used topical medications for glaucoma treatment. Thus, a keen awareness is warranted of this idiosyncratic reaction in order to avoid morbidity and long term vision loss.", "affiliations": "William Beaumont Army Medical Center, El Paso, TX, USA.;Wilford Hall Ambulatory Surgical Center, San Antonio, TX, USA.", "authors": "Mehta|Aditya|A|;Lewis|Andrew|A|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1016/j.ajoc.2021.101152", "fulltext": "\n==== Front\nAm J Ophthalmol Case Rep\nAm J Ophthalmol Case Rep\nAmerican Journal of Ophthalmology Case Reports\n2451-9936\nElsevier\n\nS2451-9936(21)00161-4\n10.1016/j.ajoc.2021.101152\n101152\nCase Report\nMultimodal etiology of drug induced angle closure with topical glaucoma therapy\nMehta Aditya adimehta115@gmail.com\na∗\nLewis Andrew b\na William Beaumont Army Medical Center, El Paso, TX, USA\nb Wilford Hall Ambulatory Surgical Center, San Antonio, TX, USA\n∗ Corresponding author. William Beaumont Army Medical Center, 5005 N Piedras, St El Paso, TX, 79911, USA. adimehta115@gmail.com\n17 6 2021\n9 2021\n17 6 2021\n23 10115214 5 2020\n9 4 2021\n14 6 2021\n© 2021 Published by Elsevier Inc.\n2021\n\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/4.0/).\nPurpose\n\nWe present a case of acute onset of bilateral choroidal effusions leading to angle closure glaucoma attributed to multiple mechanism of actions causing ciliary body and aqueous flow disruption in the setting of topical glaucoma therapy with latanoprost, brimonidine 0.2%, and Brinzolamide 0.1%.\n\nObservation\n\nThe patient presented with ocular hypertension in the setting of bilateral choroidal effusions, leading to angle closure without pupillary block. After cessation of the glaucoma drops and starting steroids and cycloplegics, the patient's symptoms resolved.\n\nConclusions and importance\n\nThis case report highlights the various physiological mechanisms of action that can induce angle closure glaucoma from commonly used topical medications for glaucoma treatment. Thus, a keen awareness is warranted of this idiosyncratic reaction in order to avoid morbidity and long term vision loss.\n\nKeywords\n\nDrug-induced glaucoma\nAcute angle closure\nChoroidal effusions\nBrimonidine\nUveitis\n==== Body\nAbbreviations\n\nIOP Intraocular Pressure\n\nOU Oculus Uterque - Both eyes\n\nQHS Quaque hora somni - Every night\n\nCOPD Chronic Obstructive Pulmonary Disease\n\nOD Oculus Dexter\n\nOS Oculus Sinister\n\nUBM Ultrasound biomicroscopy\n\nVa Visual Acuity\n\nCF Count Fingers\n\nQID Four times a day\n\nTID Three times a day\n\nBID Two times a day\n\nVKH Vogt-Koyanagi-Harada Disease\n\n1 Introduction\n\nDrug induced bilateral angle closure is a well reported phenomenon, especially with sulphamate-substituted compounds, such as topiramate, hydrochlorothiazide, and acetazolamide .1 Topical brinzolamide, a carbonic anhydrase inhibitor, brimonidine, alpha 2 adrenergic receptor agonist, and latanaprost, a prostaglandin analog, are routinely used to for the treatment of glaucoma. This case presents a patient with bilateral angle closure, who improves rapidly after cessation of all glaucoma drop therapy. We seek to identify various mechanisms of action of each glaucoma drug taken by our patient that may have lead and compounded to the development of angle closure.\n\n2 Case presentation\n\nA 78 year old female presented to the ophthalmology clinic with acute vision loss and headache. Her past ocular history was significant for pseudophakia OU, dry macular degeneration and open angle glaucoma, for which she had chronically used latanaprost 0.005% QHS OU, and recently prescribed Simbrinza™ (Brimonidine 0.1%/Brinzolamide 0.1%) BID OU. Her medical history was significant for COPD. On examination, her visual acuity was 20/400 OD and 20/200 OS. Pupils were equally reactive and without a relative afferent pupillary defect. Her IOP was 24 OD and 23 OS. Slit lamp exam showed a quiet anterior chamber but shallow peripherally. Indentation gonioscopy revealed closed angles OU. UBM demonstrated irido-corneal apposition in the setting of 360° choroidal effusions OU (Fig. 1). A manifest refraction revealed a 3 diopter myopic shift. The diagnosis of bilateral secondary acute angle closure secondary to choroidal effusions from brinzolamide was made. As a result, Simbrinza™ was discontinued and brimonidine 0.15% TID OU was added to control her IOP, as well as topical homatropine BID OU.Fig. 1 UBM OD, demonstrating irido-corneal apposition in the setting of suprachoroidal fluid (white arrows) with resultant anterior rotation of ciliary processes and closed angle (arrowhead). The curved arrows indicate a shallow peripheral anterior chamber.\n\nFig. 1\n\nThe following day the patient's VA had worsened to CF OD and 20/400 OS although IOP improved to 9 OD and 7 OS. There was now 2+ anterior chamber cell OU. The choroidal effusions had enlarged and were now extending over the temporal macula OU (see Fig. 2). Brimonidine and latanoprost were discontinued and the patient was prescribed prednisolone 1% QID OU in addition to her cycloplegia. The patient continued to show improvement over five days as the choroidal effusions resolved and her vision returned to baseline. Examination revealed a deep and quiet anterior chamber with angles open to scleral spur 360° OU. Her latanoprost was restarted and the patient maintained an adequate IOP.Fig. 2 Optos fundus photo OD demonstrating temporal choroidal effusion extending into the macula and peripheral nasal choroidal effusions.\n\nFig. 2\n\n3 Discussion\n\nOur patient presented with acute angle closure, without pupillary block, in the setting of large choroidal effusions after recently starting a combination of brinzolamide and brimonidine. The differential diagnosis for bilateral choroidal effusions include melanoma, metastasis, hypertensive choroidopathy, chronic hypotony, VKH, aqueous misdirection, posterior scleritis, or posterior uveitis. However, none of these conditions were present in our patient.\n\nWe initially hypothesized the choroidal effusions were due to brinzolamide, as it is a carbonic anhydrase inhibitor that shares the same sulfamate moiety 2, as topiramate and acetazolamide, and therefore, has the potential to cause this idiosyncratic reaction. However, the patient had worsening choroidal effusions and subsequently developed anterior uveitis when brimonidine was continued alone. Nevertheless, brinzolamide may still have a residual effect on this idiosyncratic reaction since it had only been stopped for 24 hours, given it has a longer washout period.\n\nDrug-induced uveitis due to brimonidine has been well established but choroidal effusions have not been reported 3,.4 Previous reports have reported other non-sulfamate moiety containing drugs causing secondary bilateral angle closure 1,5,.6 Multiple hypothesis have been postulated as to the cause of this idiosyncratic reaction including dysregulation of aqueous flow and inflammation in the ciliary body 7, which could have been potentiated by the uveitis caused by brimonidine in our patient. Interestingly, the IOP dropped significantly prior to the resolution of choroidal effusions, thought likely due to ciliary body shutdown in the presence of uveitis.\n\nLastly, the concomitant use of latanoprost in our patient may also have compounded to the rapid enlargement of choroidal effusions. Latanoprost increases aqueous flow into uveo-scleral outflow pathway and could disrupt blood-aqueous barrier in pseudophakic eyes .8 Previous case report, have shown topical latanoprost as a culprit for choroidal effusions .9\n\nUltimately, the drugs causing this reaction lead to a similar clinical course - the development of choroidal effusions with forward rotation of ciliary processes-iris-lens complex, leading to angle closure without pupillary block and acute myopic shift.\n\nThe discontinuation of all glaucoma drops, with the addition of prednisolone and a cycloplegic, led to the rapid resolution of the anterior chamber cell and choroidal effusions. The use of brimonidine in our patient met 7 out of 7 criteria established by Naranjo et al. in order to determine causality of a drug to the reported adverse event .10 However, a re-challenge with Simbrinza, brimonide or brinzolamide alone was not performed, in order to avoid further morbidity to our patient. This case report highlights multiple mechanisms by which routine glaucoma drops (latanoprost, brinzolamide, and brimonidine) may compound and lead to drug induced bilateral acute angle closure. Physicians must be highly aware of this idiosyncratic reaction and stop all inciting medications to promptly treat the patient.\n\nPatient consent\n\nThis report does not contain any personal identifying information.\n\nFunding\n\nNo funding or grant support\n\nAuthorship\n\nAll authors attest that they meet the current ICMJE criteria for Authorship.\n\nDeclaration of competing interest\n\nNone of the authors have any financial disclosures.\n\nAcknowledgements\n\nNone.”\n==== Refs\nReferences\n\n1 Murphy R. Bakir B. O'Brien C. Drug induced bilateral secondary angle-closure glaucoma: a Literature Synthesis J Glaucoma 25 2016 e99–e105.\n2 Lester M. Brinzolamide ophthalmic suspension: a review of its pharmacology and use in the treatment of open angle glaucoma and ocular hypertension Clin Ophthalmol 2 3 2008 517 523 19668749\n3 Byles D. Frith P. Salmon J. Anterior uveitis as a side effect of topical brimonidine Am J Ophthalmol 130 3 2000 287 291 11020406\n4 Nguyen E. Azar F. Papalkar D. McCluskey P. Brimonidine-induced anterior uveitis and conjunctivitis: clinical and histologic features J Glaucoma 17 1 2008 40 42 18303383\n5 Hsu Cherng-Ru Chen Yi-Hao Tai Ming-Cheng Lu Da-Wen Sumatriptan-induced angle-closure glaucoma Medicine 96 2017 10.1097/MD.0000000000006953\n6 Chen E.L. Kang K.B. Acute onset of blurry vision in a young man JAMA Ophthalmol 2019 Aug 22 10.1001/jamaophthalmol.2019.3058\n7 Pirmohamed M. Naisbitt D.J. Gordon F. The danger hypothesis - potential role in idiosyncratic drug reactions Toxicology 181 2002 55 63 12505285\n8 Miyake Latanoprost accelerates disruption of blood-aqueous barrier and the incidence of angiographic cystoid macular edema in early postoperative psudophakias Arch Ophthalmol 117 1999 24 30 9930157\n9 Rowe Ciliochoroidal effusion induced by topical latanoprost in a patient with Sturge-Weber syndrome Am J Ophthalmol 124 1997 683 685 Sakai et al. Jpn J Ophthalmol 2002;46:553-555 9372723\n10 Naranjo C. Busto D. Sellers E. A method for estimating the probability of adverse drug reactions Clin Pharmacol Ther 30 1981 239 245 7249508\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "2451-9936", "issue": "23()", "journal": "American journal of ophthalmology case reports", "keywords": "Acute angle closure; Brimonidine; Choroidal effusions; Drug-induced glaucoma; Uveitis", "medline_ta": "Am J Ophthalmol Case Rep", "mesh_terms": null, "nlm_unique_id": "101679941", "other_id": null, "pages": "101152", "pmc": null, "pmid": "34307961", "pubdate": "2021-09", "publication_types": "D002363:Case Reports", "references": "7249508;31436821;18303383;12505285;19668749;28562545;11020406;25943730;9930158", "title": "Multimodal etiology of drug induced angle closure with topical glaucoma therapy.", "title_normalized": "multimodal etiology of drug induced angle closure with topical glaucoma therapy" }
[ { "companynumb": "US-DRREDDYS-SPO/USA/21/0138030", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "LATANOPROST" }, "drugadditional": "1", ...
{ "abstract": "We report a case of a 43 years old man who was intoxicated by a 25g vancomycin overload. An anuric acute renal failure rapidly occured. The vancomycinemia was measured as high as 360mg/L (normal range: 15-35mg/L). We started an intermittent hemodialysis program to clear out the vancomycin. The vancomycinemia decreased below the treshold of our laboratory after the eighth session. Three supplementary sessions were needed because of a persistant oliguria. The kidney function slowly improved and was back to normal (seric creatinin: 80micromol/L) 3 weeks after the patient had gone home. To our knowledge, it is the first success of this technic concerning vancomycin poisoning in adults with anuric kidney failure.", "affiliations": "Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France. Electronic address: jyzaworski@gmail.com.;Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France.;Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France.;Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France.;Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France.;Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France.;Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France.;Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France.;Service de néphrologie, transplantation rénale, hémodialyse et aphérèse, hôpital Claude-Huriez, CHRU de Lille, rue Michel-Polonowski, 59000 Lille, France.", "authors": "Zaworski|Jérémy|J|;Frimat|Marie|M|;Duval|Marion|M|;Saint-Jacques|Camille|C|;Bouderlique|Élise|É|;Glowacki|François|F|;Noël|Christian|C|;Hazzan|Marc|M|;Provôt|François|F|", "chemical_list": "D000900:Anti-Bacterial Agents; D014640:Vancomycin", "country": "France", "delete": false, "doi": "10.1016/j.nephro.2017.10.004", "fulltext": null, "fulltext_license": null, "issn_linking": "1769-7255", "issue": "14(2)", "journal": "Nephrologie & therapeutique", "keywords": "Hemodialysis; Hémodialyse; Intoxication; Vancomycin overload; Vancomycine", "medline_ta": "Nephrol Ther", "mesh_terms": "D058186:Acute Kidney Injury; D000328:Adult; D000900:Anti-Bacterial Agents; D006801:Humans; D008297:Male; D006435:Renal Dialysis; D014640:Vancomycin", "nlm_unique_id": "101248950", "other_id": null, "pages": "112-116", "pmc": null, "pmid": "29295766", "pubdate": "2018-04", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Vancomycin poisoning successfully treated with intermittent hemodialysis: A case report.", "title_normalized": "vancomycin poisoning successfully treated with intermittent hemodialysis a case report" }
[ { "companynumb": "FR-FRESENIUS KABI-FK201800434", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "VANCOMYCIN" }, "drugadditional": "1", ...
{ "abstract": "OBJECTIVE\nTo observe the clinical efficacy and safety of bevacizumab (BEV) combined with paclitaxel on recurrent ovarian cancer.\n\n\nMETHODS\nA total of 164 patients with recurrent ovarian cancer were selected and randomly divided into two groups: experimental group (n=82, BEV + paclitaxel + carboplatin) and control group (n=82, paclitaxel + carboplatin). The clinical therapeutic effects including objective response rate (ORR), complete response (CR) rate, partial response (PR) rate, stable disease (SD), progressive disease (PD), progression free survival (PFS) and overall survival (OS) were evaluated, together with the adverse clinical reactions and improvement of quality of life (QoL). Immunohistochemistry was used to detect the expression of phosphate and tension homology deleted on chromosome ten (PTEN).\n\n\nRESULTS\nThe PFS, OS and ORR of patients in the experimental group were significantly higher than those in the control group (p<0.05). In addition, the incidence rates of allergy, gastrointestinal reactions and leukopenia were significantly lower in the experimental group compared with those in the control group (p<0.05). There was no significant difference in QoL score between the two groups before treatment (p>0.05). However, after treatment, the QoL score in the experimental group was increased significantly compared with the control group (p<0.05). Moreover, the expression of PTEN in PR, SD and PD patients was lower, with significant difference between the two groups (p<0.05).\n\n\nCONCLUSIONS\nThe clinical therapeutic effect of BEV combined with paclitaxel in patients with recurrent ovarian cancer was improved, suggesting it might be beneficial for the treatment of ovarian cancer.", "affiliations": "Department of Obstetrics and Gynaecology, Yantai Yuhuangding Hospital affiliated to Qingdao University, Yantai, Shandong Province, China.", "authors": "Cong|Jianglin|J|;Liu|Riming|R|;Hou|Jianqing|J|;Wang|Xiuli|X|;Jiang|Haiyang|H|;Wang|Jing|J|", "chemical_list": "D000068258:Bevacizumab; D016190:Carboplatin; D017239:Paclitaxel", "country": "Cyprus", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1107-0625", "issue": "24(3)", "journal": "Journal of B.U.ON. : official journal of the Balkan Union of Oncology", "keywords": null, "medline_ta": "J BUON", "mesh_terms": "D000328:Adult; D000368:Aged; D000068258:Bevacizumab; D016190:Carboplatin; D005260:Female; D006801:Humans; D008875:Middle Aged; D009364:Neoplasm Recurrence, Local; D010051:Ovarian Neoplasms; D017239:Paclitaxel", "nlm_unique_id": "100883428", "other_id": null, "pages": "1003-1008", "pmc": null, "pmid": "31424654", "pubdate": "2019", "publication_types": "D016428:Journal Article", "references": null, "title": "Therapeutic effect of bevacizumab combined with paclitaxel and carboplatin on recurrent ovarian cancer.", "title_normalized": "therapeutic effect of bevacizumab combined with paclitaxel and carboplatin on recurrent ovarian cancer" }
[ { "companynumb": "CN-ROCHE-2358267", "fulfillexpeditecriteria": "1", "occurcountry": "CN", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "SODIUM CHLORIDE" }, "drugadditional": null, ...
{ "abstract": "Novel synthetic opioids and benzodiazepines are an emerging trend on the narcotic drugs market. We present a lethal case of U-47700 and flubromazepam poisoning. A 24-year-old man suffered apnoea after the consumption of the synthetic opioid U-47700 in combination with the benzodiazepine flubromazepam. After reanimation and hospital admission, hypoxic cerebral damage and severe brain oedema were stated. Six days after admission, mechanical ventilation was discontinued, and the patient died. Seven blood serum samples and one urine sample collected during the hospitalisation were analysed by liquid chromatography-tandem mass spectrometry. In the sample collected 42 minutes after admission, the concentrations of U-47700 and flubromazepam were 370 and 830 ng/mL, respectively. Three days later, the concentrations of U-47700 and flubromazepam dropped to 4.2 and 280 ng/mL, respectively. The resulting concentration-time-curves allowed calculating a U-47700 elimination half-life of approximately six hours and confirmed the previously reported flubromazepam elimination half-life of around 100 hours. In the presented case, intoxication by the synthetic opioid U-47700 with a contribution of flubromazepam can be assumed as the cause of death. The concentration-time curves allow an estimation of the clinical course of similar cases. Flubromazepam may lead to prolonged central-nervous depressant effects.", "affiliations": "ZLMT, MDI, Städtisches Klinikum Karlsruhe, Germany.;Department of Forensic Toxicology, Institute of Forensic Medicine, Medical Center - University of Freiburg, Faculty of Medicine, University of Freiburg, Germany.;Poisons Information Center, Departement of General Pediatrics, Adolescent Medicine and Neonatology, Center for Pediatrics, Medical Center - University of Freiburg, Faculty of Medicine, University of Freiburg, Germany.;Department of Forensic Toxicology, Institute of Forensic Medicine, Medical Center - University of Freiburg, Faculty of Medicine, University of Freiburg, Germany.;Department of Forensic Toxicology, Institute of Forensic Medicine, Medical Center - University of Freiburg, Faculty of Medicine, University of Freiburg, Germany.", "authors": "Koch|Katharina|K|http://orcid.org/0000-0002-5105-3220;Auwärter|Volker|V|http://orcid.org/0000-0002-1883-2804;Hermanns-Clausen|Maren|M|http://orcid.org/0000-0002-9803-7324;Wilde|Maurice|M|;Neukamm|Merja A|MA|http://orcid.org/0000-0002-3826-2327", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1002/dta.2391", "fulltext": null, "fulltext_license": null, "issn_linking": "1942-7603", "issue": null, "journal": "Drug testing and analysis", "keywords": "Designer benzodiazepines; U-47700; flubromazepam; new psychoactive substances; synthetic opioids", "medline_ta": "Drug Test Anal", "mesh_terms": null, "nlm_unique_id": "101483449", "other_id": null, "pages": null, "pmc": null, "pmid": "29637722", "pubdate": "2018-04-10", "publication_types": "D016428:Journal Article", "references": null, "title": "Mixed intoxication by the synthetic opioid U-47700 and the benzodiazepine flubromazepam with lethal outcome: Pharmacokinetic data.", "title_normalized": "mixed intoxication by the synthetic opioid u 47700 and the benzodiazepine flubromazepam with lethal outcome pharmacokinetic data" }
[ { "companynumb": "DE-MYLANLABS-2018M1065960", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "TRAMADOL" }, "drugadditional": "3", ...
{ "abstract": "A woman with a medical history of breast cancer presented with chronic pain of the right hemithorax. To alleviate pain, a continuous paravertebral block was performed using a pigtail end catheter, introduced using ultrasound visualization (transversal technique at the inferior articular process of T6). Complete pain relief was observed. A few hours later, urinary retention was diagnosed and discharge from the ambulatory setting was canceled. On the following day, a new injection of local anesthetics through the catheter triggered paresthesia in the contralateral leg and a new urinary retention was diagnosed. A CT scan confirmed the epidural misplacement of the catheter. The latter was withdrawn, and the patient was released to home after the complete disappearance of her neurological symptoms. This case report highlights the risk of inadvertently misplacing the catheter into the epidural space during thoracic paravertebral block, even with a \"pigtail\" distal end type of catheter.", "affiliations": "Department of Anesthesiology, Institut Claudius Regaud, University Institute of Cancer Toulouse Oncopole (IUCT-O), 1 Avenue Irène Joliot-Curie, 31059, Toulouse Cedex, France. fuzier.r@gmail.com.;Department of Anesthesiology, Institut Claudius Regaud, University Institute of Cancer Toulouse Oncopole (IUCT-O), 1 Avenue Irène Joliot-Curie, 31059, Toulouse Cedex, France.;Department of Radiology, Institut Claudius Regaud, IUCT-O, 31059, Toulouse, France.;Department of Anesthesiology, Institut Claudius Regaud, University Institute of Cancer Toulouse Oncopole (IUCT-O), 1 Avenue Irène Joliot-Curie, 31059, Toulouse Cedex, France.", "authors": "Fuzier|Régis|R|0000-0001-6298-7523;Izard|Philippe|P|;Aziza|Richard|R|;Pouymayou|Jacques|J|", "chemical_list": "D000779:Anesthetics, Local", "country": "Japan", "delete": false, "doi": "10.1007/s00540-016-2151-z", "fulltext": null, "fulltext_license": null, "issn_linking": "0913-8668", "issue": "30(3)", "journal": "Journal of anesthesia", "keywords": "Catheter; Epidural; Pain of cancer; Paravertebral block", "medline_ta": "J Anesth", "mesh_terms": "D000779:Anesthetics, Local; D057785:Catheters; D004824:Epidural Space; D005260:Female; D006801:Humans; D008875:Middle Aged; D009407:Nerve Block; D010146:Pain; D010149:Pain, Postoperative; D014057:Tomography, X-Ray Computed; D014463:Ultrasonography", "nlm_unique_id": "8905667", "other_id": null, "pages": "503-5", "pmc": null, "pmid": "26906035", "pubdate": "2016-06", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "22321080;21112880;21821511;26083767;1286056;20947592;20301827;20435949;12893391", "title": "Even a \"pigtail\" distal end catheter can enter the epidural space after continuous paravertebral block.", "title_normalized": "even a pigtail distal end catheter can enter the epidural space after continuous paravertebral block" }
[ { "companynumb": "FR-LUPIN PHARMACEUTICALS INC.-2016-03245", "fulfillexpeditecriteria": "2", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "PREGABALIN" }, "drugadditiona...
{ "abstract": "BACKGROUND\nAllergy to beta-lactam (βL) antibiotics is highly reported in children, but rarely confirmed. Risk factors for a positive diagnostic work-up are scarce. The primary aim was to characterize the cases of children with confirmed βL allergy, investigating potential risk factors. Secondary aims were to assess the prevalence of allergy to βL in this population and to confirm the safety of less extensive diagnostic protocols for milder reactions.\n\n\nMETHODS\nWe reviewed the clinical data from all children evaluated in our Department for suspected βL allergy, over a six-year period.\n\n\nRESULTS\nTwo hundred and twenty children (53% females) with a mean age of 6.5±4.2 years were evaluated. Cutaneous manifestations were the most frequently reported (96.9%), mainly maculopapular exanthema (MPE). The reactions were non-immediate in 59.5% of the cases. Only 23 children (10.5%) were diagnosed with allergy to βL. The likelihood of βL allergy was significantly higher in children with a family history of drug allergy (p<0.001) and in those with a smaller time period between the reaction and the study (p=0.046). The probability of not confirming βL allergy is greater in children reporting less severe reactions (p<0.001) and MPE (p<0.001). We found the less extensive diagnostic protocol in milder reactions safe, since only 4.2% of the children presented a positive provocation test (similar reaction as the index reaction).\n\n\nCONCLUSIONS\nThis study highlights family history of drug allergy as a risk factor for a positive diagnostic work-up. Larger series are required, particularly genetic studies to accurately determine future risk for βL allergy in children.", "affiliations": "Allergy and Clinical Immunology Department, Centro Hospitalar Universitário de S. João, Porto, Portugal; MedInUP - Center for Drug Discover and Innovative Medicines, Faculty of Medicine, University of Porto, Porto, Portugal. Electronic address: eunicediascastro@gmail.com.;Allergy and Clinical Immunology Department, Centro Hospitalar Universitário de S. João, Porto, Portugal.;Allergy and Clinical Immunology Department, Centro Hospitalar Universitário de S. João, Porto, Portugal.;Public Health and Forensic Sciences and Medical Education Department, Faculty of Medicine, University of Porto, Porto, Portugal; UNIC - Cardiovascular Research and Development Unit, University of Porto, Porto, Portugal.;Public Health and Forensic Sciences and Medical Education Department, Faculty of Medicine, University of Porto, Porto, Portugal; Biomedicine Department, Faculty of Medicine, University of Porto, Porto, Portugal; I3S - Instituto de Investigação e Inovação em Saúde, University of Porto, Porto, Portugal.;Allergy and Clinical Immunology Department, Centro Hospitalar Universitário de S. João, Porto, Portugal.", "authors": "Dias de Castro|E|E|;Carolino|F|F|;Carneiro-Leão|L|L|;Barbosa|J|J|;Ribeiro|L|L|;Cernadas|J R|JR|", "chemical_list": "D000900:Anti-Bacterial Agents; D047090:beta-Lactams", "country": "Singapore", "delete": false, "doi": "10.1016/j.aller.2020.01.005", "fulltext": null, "fulltext_license": null, "issn_linking": "0301-0546", "issue": "48(5)", "journal": "Allergologia et immunopathologia", "keywords": "Allergy diagnostic work-up; Beta-lactam antibiotics; Children; Drug allergy; Risk factors", "medline_ta": "Allergol Immunopathol (Madr)", "mesh_terms": "D000293:Adolescent; D000900:Anti-Bacterial Agents; D002648:Child; D002675:Child, Preschool; D004342:Drug Hypersensitivity; D005260:Female; D006801:Humans; D008297:Male; D015995:Prevalence; D012189:Retrospective Studies; D012307:Risk Factors; D012720:Severity of Illness Index; D012882:Skin Tests; D047090:beta-Lactams", "nlm_unique_id": "0370073", "other_id": null, "pages": "417-423", "pmc": null, "pmid": "32460994", "pubdate": "2020", "publication_types": "D016428:Journal Article", "references": null, "title": "Allergy to beta-lactam antibiotics in children: Risk factors for a positive diagnostic work-up.", "title_normalized": "allergy to beta lactam antibiotics in children risk factors for a positive diagnostic work up" }
[ { "companynumb": "PT-TEVA-2020-PT-1843806", "fulfillexpeditecriteria": "1", "occurcountry": "PT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "AMOXICILLIN\\CLAVULANIC ACID" }, "drugadditiona...
{ "abstract": "To compare the safety and efficacy of phenobarbital and levetiracetam in a cohort of neonates with seizures following cardiac surgery.\n\n\n\nWe performed a retrospective single-center study of consecutive neonates with electrographically confirmed seizures managed with antiseizure medication after cardiac surgery from June 15, 2012 to December 31, 2018. We compared the safety and efficacy of phenobarbital and levetiracetam as first-line therapy.\n\n\n\nFirst-line therapy was phenobarbital in 31 neonates and levetiracetam in 22 neonates. Phenobarbital was associated with more adverse events (P = .006). Eight neonates (14%) experienced an adverse event related to phenobarbital use, including seven with hypotension and one with respiratory depression. No adverse events were reported with levetiracetam use. The cessation of electrographic seizures was similar in both groups, including 18 neonates (58%) with seizure cessation after phenobarbital and 12 neonates (55%) with seizure cessation after levetiracetam (P = 1.0). The combined cessation rates of phenobarbital and levetiracetam when used as first- or second-line therapy were 58% and 47%, respectively (P = .47).\n\n\n\nPhenobarbital was associated with more adverse events than levetiracetam, and the two drugs were equally but incompletely effective in treating electrographically confirmed seizures in neonates following cardiac surgery. Given its more acceptable safety profile and potential noninferiority, levetiracetam may be a reasonable option for first-line therapy for treatment of seizures in this population. Further prospective studies are needed to confirm these results.", "affiliations": "Department of Anesthesiology and Critical Care Medicine, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;Department of Anesthesiology and Critical Care Medicine, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;Department of Anesthesiology and Critical Care Medicine, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;Departments of Neurology and Pediatrics, Children's Hospital of Philadelphia, University of Pennsylvania, Philadelphia, Pennsylvania.;Division of Cardiothoracic Surgery, Children's Hospital of Philadelphia, Philadelphia, Pennsylvania.;Department of Biostatistics, Epidemiology, and Informatics, University of Pennsylvania School of Medicine, Philadelphia, Pennsylvania.;Departments of Neurology and Pediatrics, Children's Hospital of Philadelphia, University of Pennsylvania, Philadelphia, Pennsylvania.", "authors": "Thibault|Céline|C|0000-0001-7612-2934;Naim|Maryam Y|MY|0000-0002-9127-0043;Abend|Nicholas S|NS|0000-0001-6166-2663;Licht|Daniel J|DJ|0000-0002-4080-843X;Gaynor|J William|JW|0000-0001-7955-5604;Xiao|Rui|R|;Massey|Shavonne L|SL|0000-0002-8496-221X", "chemical_list": "D000927:Anticonvulsants; D000077287:Levetiracetam; D010634:Phenobarbital", "country": "United States", "delete": false, "doi": "10.1111/epi.16469", "fulltext": null, "fulltext_license": null, "issn_linking": "0013-9580", "issue": "61(4)", "journal": "Epilepsia", "keywords": "cardiology; congenital; critical care; heart diseases; infant", "medline_ta": "Epilepsia", "mesh_terms": "D000927:Anticonvulsants; D006348:Cardiac Surgical Procedures; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D000077287:Levetiracetam; D008297:Male; D010634:Phenobarbital; D011183:Postoperative Complications; D012189:Retrospective Studies; D012640:Seizures", "nlm_unique_id": "2983306R", "other_id": null, "pages": "627-635", "pmc": null, "pmid": "32162678", "pubdate": "2020-04", "publication_types": "D003160:Comparative Study; D016428:Journal Article; D052061:Research Support, N.I.H., Extramural; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "A retrospective comparison of phenobarbital and levetiracetam for the treatment of seizures following cardiac surgery in neonates.", "title_normalized": "a retrospective comparison of phenobarbital and levetiracetam for the treatment of seizures following cardiac surgery in neonates" }
[ { "companynumb": "US-UCBSA-2020015238", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "LEVETIRACETAM" }, "drugadditional": "4", ...
{ "abstract": "We report a case of a 39-year-old woman with a psychiatric history of schizoaffective disorder with catatonia, dependent personality disorder and substance use disorder whose symptoms have been very difficult to control. During her most recent inpatient admission, she was treated with electroconvulsive therapy (ECT) for catatonia. Our treatment team was hopeful that ECT was making a difference for this patient. However, she was only able to receive two sessions of treatment due to new hospital protocols related to the coronavirus pandemic. Although the patient was not suspected to have the coronavirus, she could no longer undergo ventilation with a bag and mask during the procedure. Bag-mask ventilation is known to aerosolise the coronavirus and other diseases and potentially put healthcare workers at risk. Although orotracheal intubation also aerosolises the coronavirus, this was the only means of airway management still allowed by anaesthesia providers at this time. Our psychiatry team estimated that the risks of intubation outweighed the benefits of treatment, and ECT was cancelled. Without additional ECT treatments, the patient again decompensated for several weeks before being stabilised on clozapine, haloperidol and lorazepam. Although she eventually had a positive treatment outcome, her hospital course was likely prolonged due to unforeseen events related to the novel coronavirus. We feel that the current medical climate is unprecedented and is interfering with necessary psychiatric treatment in an unanticipated way. Anaesthesiologists will need to be flexible while working with psychiatrists and identify safe ways to provide this necessary psychiatric treatment for patients.", "affiliations": "Department of Psychiatry, LSU Health Sciences Center New Orleans, New Orleans, Louisiana, USA.;Psychiatry, LSU Health Sciences Center New Orleans, New Orleans, Louisiana, USA.", "authors": "Casano|Kelsey|K|0000-0002-1834-9185;Capone|Erin|E|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1136/gpsych-2020-100271", "fulltext": "\n==== Front\nGen Psychiatr\nGen Psychiatr\ngpsych\ngpsych\nGeneral Psychiatry\n2517-729X BMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR \n\ngpsych-2020-100271\n10.1136/gpsych-2020-100271\nCase Report\n1506\n2474\nUnexpected cancellation on a catatonic patient’s electroconvulsive therapy due to the coronavirus pandemic\nhttp://orcid.org/0000-0002-1834-9185Casano Kelsey 1* Capone Erin 2 \n1 \nDepartment of Psychiatry, LSU Health Sciences Center New Orleans, New Orleans, Louisiana, USA\n\n\n2 \nPsychiatry, LSU Health Sciences Center New Orleans, New Orleans, Louisiana, USA\n\nCorrespondence to Dr Erin Capone; ecapon@lsuhsc.edu\n2020 \n24 9 2020 \n24 9 2020 \n33 6 e10027122 6 2020 23 7 2020 01 8 2020 © Author(s) (or their employer(s)) 2020. Re-use permitted under CC BY-NC. No commercial re-use. See rights and permissions. Published by BMJ.2020http://creativecommons.org/licenses/by-nc/4.0/This is an open access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited, appropriate credit is given, any changes made indicated, and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/.We report a case of a 39-year-old woman with a psychiatric history of schizoaffective disorder with catatonia, dependent personality disorder and substance use disorder whose symptoms have been very difficult to control. During her most recent inpatient admission, she was treated with electroconvulsive therapy (ECT) for catatonia. Our treatment team was hopeful that ECT was making a difference for this patient. However, she was only able to receive two sessions of treatment due to new hospital protocols related to the coronavirus pandemic. Although the patient was not suspected to have the coronavirus, she could no longer undergo ventilation with a bag and mask during the procedure. Bag–mask ventilation is known to aerosolise the coronavirus and other diseases and potentially put healthcare workers at risk. Although orotracheal intubation also aerosolises the coronavirus, this was the only means of airway management still allowed by anaesthesia providers at this time. Our psychiatry team estimated that the risks of intubation outweighed the benefits of treatment, and ECT was cancelled.\n\nWithout additional ECT treatments, the patient again decompensated for several weeks before being stabilised on clozapine, haloperidol and lorazepam. Although she eventually had a positive treatment outcome, her hospital course was likely prolonged due to unforeseen events related to the novel coronavirus. We feel that the current medical climate is unprecedented and is interfering with necessary psychiatric treatment in an unanticipated way. Anaesthesiologists will need to be flexible while working with psychiatrists and identify safe ways to provide this necessary psychiatric treatment for patients.\n\nconvulsive therapyschizophreniacatatonicdependent personality disorderspecial-featureunlocked\n==== Body\nIntroduction\nElectroconvulsive therapy (ECT) was first described in the 1930s after several schizophrenic patients showed symptomatic improvement following spontaneous seizure activity.1 In modern practice, ECT is performed by placing electrodes on a patient’s scalp and delivering an electric pulse to induce seizure activity. It is an extremely effective therapy for treatment-resistant major depression, catatonia, mania and schizophrenia. ECT has proven particularly efficacious in the treatment of catatonia, regardless of the aetiology.2 Because of this, ECT is considered the preferred treatment for patients with catatonia who fail to respond to adequate dosages of benzodiazepines.2\n\n\nDuring ECT, a patient is placed under general anaesthesia and given muscle relaxants. The patient is oxygenated with a bag and face mask during the procedure. In rare instances, patients may require endotracheal intubation to secure the airway instead.3 4 This is generally avoided because it requires the patient to spend more time under anaesthesia.4 Also, intubation is not without risk and has the potential to cause severe airway trauma such as life-threatening tears of the trachea and larynx. Reports of such injuries, which sometimes result in death and significant litigation, are not uncommon.5 Additionally, there is one known report of a patient who was intubated during ECT and suffered a tracheal tear during the procedure. This resulted in life-threatening pneumomediastinum and pneumopericardium for the patient.6\n\n\nWe report a case of a 39-year-old woman with psychiatric history of schizoaffective disorder with catatonia, dependent personality disorder and substance use disorder whose symptoms have been very difficult to control with antipsychotics and benzodiazepines. During her most recent inpatient admission, she was treated with ECT for refractory catatonia. She underwent two sessions of ECT with the bag and mask and began to respond quite well to this therapy. However, due to new hospital protocols related to the coronavirus pandemic, bag–mask ventilation was no longer an option, and our treatment team was forced to choose whether to intubate the patient and proceed with therapy or to call off treatment altogether.\n\nCase history\nWe report a case of a 39-year-old Caucasian woman with a psychiatric history of schizoaffective disorder with catatonia, dependent personality disorder and substance use disorder. Her psychiatric history began at age 23 years with her first psychotic episode. Since then, she has been hospitalised multiple times with treatment-resistant symptoms coupled with low treatment adherence outside of the hospital. She was a victim of sex trafficking and domestic abuse and has attempted suicide by overdose. She has a history of alcohol, marijuana, cocaine and heroin use. She was able to graduate from high school and attended college for 1 year but has remained unemployed since then. She was last hospitalised 3 weeks prior to this current admission, at which time she was stabilised on oral aripiprazole before being discharged to live with her mother.\n\nDuring this current inpatient admission, the patient was brought to the hospital by her mother due to altered mental status and mutism. On presentation to the emergency room, there was a concern for catatonia and possible serotonin syndrome secondary to an oral aripiprazole overdose. Urine toxicology and alcohol levels were negative. She was subsequently admitted to inpatient medicine service for observation and supportive care, which included lorazepam. She was seen by psychiatry, and serotonin syndrome was deemed unlikely. She endorsed visual hallucinations, so lorazepam was discontinued, and she was started on low-dose haloperidol. On medical clearance, she was transferred to inpatient psychiatry. Haloperidol was increased and lorazepam was restarted due to concern for catatonia. She continued to exhibit severe psychomotor retardation and was unable to verbally respond to questions. These symptoms exhibited mild improvement with increasing doses of haloperidol and lorazepam over the next few weeks; however, due to a lack of significant progress, the decision was made to proceed with ECT in this patient.\n\nDuring the first ECT session, the patient experienced a seizure of 150 s, which was prolonged and required propofol to abort without incident. Afterwards, she showed improvement with a significant decrease in latency of response time in her speech. She underwent her second session 3 days later and experienced a seizure of 82 s. Once again, she seemed in brighter spirits after treatment with resolving catatonia and decreased response latency compared with previous days.\n\nOur treatment team was hopeful that ECT was helping this patient. However, before beginning the third session of ECT, coronavirus hit the USA. With the virus came a new series of hospital protocols, and although the patient was not suspected to have coronavirus, she could no longer undergo ventilation with a bag and mask during ECT. Bag–mask ventilation is known to aerosolise the coronavirus and potentially put healthcare workers at risk. Although orotracheal intubation is also known to aerosolise the coronavirus, this was the only means of airway management still allowed by anaesthesia providers. Our psychiatry team felt that the risks of intubation outweighed the benefits of treatment, and ECT was cancelled indefinitely.\n\nWithout additional ECT treatments, the patient decompensated. She displayed emotional lability, disorganised thoughts and behaviours, and eventually lapsed back into a state of catatonia with increased latency of response and severe psychomotor retardation. We started the patient on clozapine, a medication that she had previously responded to but had been non-compliant with in the past. We tapered the haloperidol. Lorazepam was continued at 1 mg three times per day due to repeated recurrence of catatonia on taper attempts. Clozapine was eventually increased to 200 mg per day, and haloperidol was tapered to 10 mg per day. The patient responded well to this treatment and had minimal side effects. With time, she gained more insight on her situation and showed resolving symptoms of catatonia. She became linear, cooperative, pleasant and able to speak about aspects of her life with a good memory. After 8 weeks in the hospital, she finally met criteria for discharge. She was discharged to live with her husband and father-in-law with the agreement to follow-up with the assertive community team on a frequent basis.\n\nDiscussion and conclusions\nAlthough this patient was eventually stabilised on medication and suitable for discharge, her hospital course was likely prolonged due to novel barriers to treatment during the coronavirus pandemic. We feel that the current medical climate is unprecedented and is interfering with necessary psychiatric treatment in unanticipated ways. Mentally ill persons comprise an extremely vulnerable patient population with many barriers to receiving appropriate care, and it is apparent that the coronavirus is introducing new barriers for these patients to receive treatment. Anaesthesiologists will need to be flexible while working with psychiatrists and identify safe ways to provide this necessary psychiatric treatment for patients. Bag–mask ventilation and intubation both aerosolise the coronavirus and potentially put healthcare workers’ lives at risk, but bag–mask airway management poses far fewer risks for the patient. New protocols such as preoperative coronavirus testing and more robust personal protective equipment are needed to ensure the safety of healthcare workers while delivering necessary medical treatment to patients.\n\nContributors: Both authors made substantial contributions to the conception of the work, and drafted and revised the work.\n\nFunding: The authors have not declared a specific grant for this research from any funding agency in the public, commercial or not-for-profit sectors.\n\nCompeting interests: None declared.\n\nPatient consent for publication: Not required.\n\nProvenance and peer review: Not commissioned; externally peer reviewed.\n\nKelsey Casano obtained a bachelor’s degree of Arts from Tulane University in 2015. After this, she attended Louisiana State University School of Medicine in New Orleans where she developed a passion for community-based healthcare and psychiatry. She graduated as a Doctor of Medicine in May 2020. She is currently spending the 2020-2021 academic year studying to acquire her Master of Public Health. She plans to pursue a career in psychiatry beginning next year. Her main research interest include health disparities among mentally ill populations and their families, and policy changes that could improve quality of life for these groups.\n==== Refs\nReferences\n1 \nEndler NS \nThe origins of electroconvulsive therapy (ECT)\n. Convuls Ther \n1988 ;4 :5 –23\n.\n11940939 \n2 \nWeiner RD , Reti IM \nKey updates in the clinical application of electroconvulsive therapy\n. Int Rev Psychiatry \n2017 ;29 :54 –62\n. 10.1080/09540261.2017.1309362 \n28406327 \n3 \nKellner CH , Bryson EO \nAnesthesia advances add to safety of ECT\n. Psychiatric Times \n2012 ;29 .\n4 \nChawla N \nAnesthesia for electroconvulsive therapy\n. Anesthesiol Clin \n2020 ;38 :183 –95\n. 10.1016/j.anclin.2019.10.007 \n32008651 \n5 \nCook TM , Scott S , Mihai R \nLitigation related to airway and respiratory complications of anaesthesia: an analysis of claims against the NHS in England 1995-2007\n. Anaesthesia \n2010 ;65 :556 –63\n. 10.1111/j.1365-2044.2010.06331.x \n20345420 \n6 \nHutchens M , Smith KR \nA case of tracheal injury with intubation during electroconvulsive therapy\n. J Ect \n2009 ;25 :67 –9\n. 10.1097/YCT.0b013e31816f75d5 \n18997634\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2517-729X", "issue": "33(6)", "journal": "General psychiatry", "keywords": "catatonic; convulsive therapy; dependent personality disorder; schizophrenia", "medline_ta": "Gen Psychiatr", "mesh_terms": null, "nlm_unique_id": "101735271", "other_id": null, "pages": "e100271", "pmc": null, "pmid": "33083693", "pubdate": "2020", "publication_types": "D002363:Case Reports", "references": "11940939;32008651;28406327;20345420;18997634", "title": "Unexpected cancellation on a catatonic patient's electroconvulsive therapy due to the coronavirus pandemic.", "title_normalized": "unexpected cancellation on a catatonic patient s electroconvulsive therapy due to the coronavirus pandemic" }
[ { "companynumb": "US-DRREDDYS-USA/USA/20/0128824", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "ARIPIPRAZOLE" }, "drugadditional": "3", ...
{ "abstract": "The occurrence of Leptospirosis and Escherichia coli coinfection in the post-partum period is a novel case. This report illustrated a previously well woman from a suburban area presented with acute neurological deterioration following a two days history of fever during her puerperal period. Early interventions with fluids, broad spectrum antibiotics and intensive supportive care were given. Despite that, she deteriorated rapidly and developed pulmonary hemorrhage, disseminated intravascular coagulopathy, and multi-organ failure. She succumbed within 12 hours of admission. The knowledge about such fatal co-infections should be disseminated to medical practitioners encountering Leptospirosis infection and general public.", "affiliations": "Hospital Seri Manjung, Department of Internal Medicine, Manjung, Perak Malaysia. tanthailun@gmail.com.;Hospital Seri Manjung, Department of Internal Medicine, Manjung, Perak Malaysia.;Hospital Seri Manjung, Department of Internal Medicine, Manjung, Perak Malaysia.", "authors": "Tan|T L|TL|;Lee|L Y|LY|;Lim|W C|WC|", "chemical_list": null, "country": "Malaysia", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0300-5283", "issue": "73(6)", "journal": "The Medical journal of Malaysia", "keywords": null, "medline_ta": "Med J Malaysia", "mesh_terms": "D000328:Adult; D060085:Coinfection; D004926:Escherichia coli; D004927:Escherichia coli Infections; D017809:Fatal Outcome; D005260:Female; D006801:Humans; D007919:Leptospira; D007922:Leptospirosis; D049590:Postpartum Period", "nlm_unique_id": "0361547", "other_id": null, "pages": "427-429", "pmc": null, "pmid": "30647223", "pubdate": "2018-12", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Fatal Leptospirosis and Escherichia coli co-infection in a post-partum woman.", "title_normalized": "fatal leptospirosis and escherichia coli co infection in a post partum woman" }
[ { "companynumb": "MY-MICRO LABS LIMITED-ML2019-00412", "fulfillexpeditecriteria": "1", "occurcountry": "MY", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "TRANEXAMIC ACID" }, "drugadditional"...
{ "abstract": "We describe the effect of interleukin 6 (IL-6) blockade using tocilizumab (TCZ) for inducing and maintaining remission of refractory polyarteritis nodosa (PAN). Three patients with refractory PAN defined according to the American College of Rheumatology criteria were treated with TCZ infusions (8 mg/kg) on a monthly basis. All of them had severe cutaneous and articular involvement with elevated biological inflammatory markers. One suffered from a neuritis multiplex and one from renal and digestive damage. All three patients were dependent on high doses of glucocorticoids (above 0.5 mg/kg) and two of them were resistant to immunosuppressive drugs. All patients achieved and maintained clinical response and normalisation of the inflammation acute-phase proteins after a few weeks of treatment with TCZ. Prednisolone could be reduced by an average of 41-13 mg/day. These first case reports suggest that IL-6 blockade using TCZ could be a therapeutic alternative to induce remission in patients with polyarteritis nodosa resistant or intolerant to the reference treatment.", "affiliations": "Service de Médecine Interne et Maladies Infectieuses, Hôpital Saint-André, CHU de Bordeaux, Bordeaux, France.;Service de Médecine Interne et Maladies Infectieuses, Hôpital Saint-André, CHU de Bordeaux, Bordeaux, France.;Service de Médecine Interne et Maladies Infectieuses, Hôpital Saint-André, CHU de Bordeaux, Bordeaux, France.;Service de Médecine Interne et Maladies Infectieuses, Hôpital Saint-André, CHU de Bordeaux, Bordeaux, France.;Service de Dermatologie, Hôpital Saint-André, CHU de Bordeaux, Bordeaux, France.;Service de Médecine Interne et Maladies Infectieuses, Hôpital Saint-André, CHU de Bordeaux, Bordeaux, France.", "authors": "Saunier|Aurélie|A|;Issa|Nahéma|N|;Vandenhende|Marie-Anne|MA|;Morlat|Philippe|P|;Doutre|Marie-Sylvie|MS|;Bonnet|Fabrice|F|", "chemical_list": null, "country": "England", "delete": false, "doi": "10.1136/rmdopen-2017-000446", "fulltext": "\n==== Front\nRMD OpenRMD OpenrmdopenrmdopenRMD Open2056-5933BMJ Publishing Group BMA House, Tavistock Square, London, WC1H 9JR 28879047rmdopen-2017-00044610.1136/rmdopen-2017-000446Vasculitis1506Clinical caseTreatment of polyarteritis nodosa with tocilizumab: a new therapeutic approach? Saunier Aurélie 1Issa Nahéma 1Vandenhende Marie-Anne 1Morlat Philippe 1Doutre Marie-Sylvie 2Bonnet Fabrice 1\n1 \nService de Médecine Interne et Maladies Infectieuses, Hôpital Saint-André, CHU de Bordeaux, Bordeaux, France\n\n2 \nService de Dermatologie, Hôpital Saint-André, CHU de Bordeaux, Bordeaux, France\nCorrespondence to Dr Fabrice Bonnet; fabrice.bonnet@chu-bordeaux.fr2017 29 6 2017 3 1 e00044614 2 2017 08 5 2017 16 5 2017 © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.2017This is an Open Access article distributed in accordance with the Creative Commons Attribution Non Commercial (CC BY-NC 4.0) license, which permits others to distribute, remix, adapt, build upon this work non-commercially, and license their derivative works on different terms, provided the original work is properly cited and the use is non-commercial. See: http://creativecommons.org/licenses/by-nc/4.0/We describe the effect of interleukin 6 (IL-6) blockade using tocilizumab (TCZ) for inducing and maintaining remission of refractory polyarteritis nodosa (PAN). Three patients with refractory PAN defined according to the American College of Rheumatology criteria were treated with TCZ infusions (8 mg/kg) on a monthly basis. All of them had severe cutaneous and articular involvement with elevated biological inflammatory markers. One suffered from a neuritis multiplex and one from renal and digestive damage. All three patients were dependent on high doses of glucocorticoids (above 0.5 mg/kg) and two of them were resistant to immunosuppressive drugs. All patients achieved and maintained clinical response and normalisation of the inflammation acute-phase proteins after a few weeks of treatment with TCZ. Prednisolone could be reduced by an average of 41–13 mg/day. These first case reports suggest that IL-6 blockade using TCZ could be a therapeutic alternative to induce remission in patients with polyarteritis nodosa resistant or intolerant to the reference treatment.\n\npolyarteritis nodosatocilizumabtreatmentspecial-featureunlocked\n==== Body\nKey messages\nWhat is already known about this subject?\nCorticosteroids and cyclophosphamide are the recomended treatments for polyarteritis nodosa (PAN) but they are not always effective or well tolerated.\n\nWhat does this study add?\nThree patients with PAN had a dramatic therapeutic response to tocilizumab.\n\nHow might this impact on clinical practice?\nTocilizumab could be a promising therapeutic appoach for patients with PAN.\n\nPolyarteritis nodosa (PAN) is a systemic necrotising vasculitis of the medium-sized and small-sized arteries. It has been associated with hepatitis B virus (HBV) infection in around 36% of cases and has become less common due to the discovery and widespread use of antiviral agents against HBV, HBV vaccines and the improved safety of blood transfusion. The annual incidence of PAN currently ranges from 0 to 1.6 cases per million inhabitants in Europe.1 The clinical presentation is most commonly associated with constitutional symptoms (eg, fever, weight loss, myalgia and arthralgia), and the disease spectrum ranges from involving one organ to polyvisceral failure.2 The thrombosis or rupture of the inflamed arteries induces ischaemia or haemorrhage in different organs with a risk of life-threatening complications. There is currently no biological test to facilitate diagnosis. Diagnosis is therefore primarily based on the results of histopathological samples showing vascular inflammatory lesions mixed with lymphocytes, macrophages, neutrophils, eosinophils with frequent fibrinoid necrosis.\n\nTreatment of primary PAN is currently based on glucocorticoids (GC) and cyclophosphamide (CYC) and is guided by the Five-Factor Score.3 The duration of treatment is at least 12 months, but relapses occur in between 20% and 50% of HBV-negative patients after 2 years.4 These traditional treatments are not always effective or well tolerated in the long run and new anti-inflammatory strategies required for these rare inflammatory diseases.\n\nHere, we present three case reports of patients with primary PAN, according to the American College of Rheumatology criteria, successfully treated with tocilizumab, an anti-interleukin 6 (IL-6) therapy.\n\nCase reports\nCase 1\nA 39-year-old woman was in care since 2006 for systemic PAN revealed by a necrotic purpura . The initial diagnosis was based on the presence of small and medium vessel vasculitis on the deep skin biopsy, an aneurysm on renal artery imaging, negative immunological tests (cryoglobulin, antiphospholipid, antineutrophil cytoplasmic, antinuclear antibodies, rheumatoid factor) and negative HBV serology (table 1). She was successively treated with methotrexate (MTX), then GC (1 mg/kg/day) and mycophenolate mofetil (2 g per day), nine intravenous bolus of CYC relayed by oral CYC (3 mg/kg/day) with partial efficacy on constitutional symptoms and biological inflammatory syndrome (C reactive protein (CRP) between 59 and 126 mg/L over the following months). CYC was replaced by infliximab 5 mg/kg every 6 weeks associated with low-dose GC and MTX (10 mg per week) over a period of 4 years, but infliximab was stopped because of a paradoxical psoriasis due to antitumour necrosis alpha (TNFα), resulting in a relapse of PAN. CYC pulse therapy and GC (1 mg/kg/day) were restarted, but the patient remained dependent on high levels of GC (>40 mg/day). Intravenous TCZ 8 mg/kg was initiated in December 2015 and repeated every 4 weeks. The patient described a dramatic improvement of her general health status with a progressive decrease of CRP to 1 mg/L which allowed for tapering GC from 50 mg to 10 mg/day after 4 months of TCZ (figure 1A). One year later, she is still asymptomatic with no signs of inflammatory syndrome. She is still receiving TCZ every 4 weeks and 5 mg of prednisolone per day.\n\nTable 1 Patient’s characteristics\n\n\tPatient 1\tPatient 2\tPatient 3\t\nAge at the beginning of the treatment\t39 years\t52 years\t35 years\t\nGenre\tFemale\tFemale\tMale\t\nMedical history\tOsteoporosis\tType 2 diabetes \nOverlap syndrome \nBipolar disorder \nOsteoporosis \nHypothyroidism\t\t\nDuration of illness until TCZ\t10 years\t8 years\t3 months\t\nOrgans concerned\tMuscle \nAneurysms kidney arteries\tMuscle \nNeuropathy \nSkin and soft tissue \nOcclusion and aneurysm of arm arteries\tMuscle \nNeuropathy\t\nACR diagnostic criteria\tWeight loss >4 kg \nMyalgias \nDiastolic pressure >90 mm Hg creatinine >1.5 mg/dL \nBiopsy of small-sized or medium-sized artery containing PNN aneurysms or occlusions of the visceral arteries\tWeight loss >4 kg \nLivedo reticularis \nMyalgias, polyneuropathy \nBiopsy of small-sized or medium-sized artery containing PNN aneurysms or occlusions of the visceral arteries\tWeight loss >4 kg \nMyalgias, polyneuropathy \nBiopsy of small-sized or medium-sized artery containing PNN\t\nPrevious immunosuppressive therapeutics\tCorticosteroids \nMethotrexate \nMycophenolate mofetil \nCyclophosphamide intravenous \nInfliximab\tCorticosteroids \nDapsone \nMethotrexate \nCyclophosphamide intravenous \nOral cyclophosphamide \nAzathioprine\tCorticosteroids\t\nACR, American College of Rheumatology; PNN, polynuclear neutrophils; TCZ, tocilizumab.\n\nFigure 1 Patients’ markers of disease activity and treatment. CRP (mg/L), dose of GC (mg per day) and PGA (0 to 10). AZT, azathioprine; CRP, C reactive protein; CYC, cyclophosphamide; GC, glucocorticoids; IGIV, intravenous immunoglobulin; MTX, methotrexate; PGA, physician global assessment; TCZ, tocilizumab.\n\nCase 2\nA 52-year-old woman in care since 2009 for a necrotic purpura and arthritis had a medical history involving obesity, diabetes and chronic obstructive pulmonary disease. Treatment in the early years was mainly based on colchicine with low-dose GCs and dapsone since 2010 (table 1).\n\nIn 2013, the patient’s skin condition degraded abruptly. She experienced a wide range of skin necrosis, livedo, bubbles and intraoral ulcerations. The deep subcutaneous biopsy found a vasculitis of small and medium vessels. HBV serology was negative. MR angiography of the right arm showed multiple aneurysms. The patient received MTX associated with GC (60 mg/day), which lacked efficacy. Extensive and destructive cutaneous and muscle lesions led to a more aggressive approach with pulse CYC and finally, oral CYC at 3 mg/kg/day with GC (0.7 mg/kg/day) followed by azathioprine and resulted in the remission of PAN. The haematological toxicity of immunosuppressive treatments hampered our ability to increase azathioprine to the target dose, and the patient relapsed as soon as GCs were decreased to below 25 mg/day. The patient was disabled by anaemia (8 g/dL) and osteoporosis with vertebral fractures.\n\nAs sparing corticosteroids and immunosuppressive drugs became crucial, TCZ 8 mg/kg intravenous was introduced and resulted in the clinical remission of PAN and the tapering of corticosteroids from 35 to 9 mg over 6 months (figure 1b). At 1 year of treatment, she remains asymptomatic receiving TCZ every 4 weeks and 5 mg of prednisolone per day.\n\nCase 3\nA 35-year-old man with no significant prior medical history presented suffering from multiple arthritis, myalgia, tenosynovitis, subcutaneous nodules, paraesthesia in the dominant hand, weight loss and biological inflammatory syndrome was referred to our institution (table 1). HBV serology and all the immunological tests were negative. CRP was elevated at 393 mg/L. He was initially successfully treated with prednisolone (80 mg/day) but reported a relapse when prednisolone was reduced to around 40 mg/day. 18 F-fluorodeoxyglucose positron emission combined with CT (FDG-PET/CT) revealed increased FDG uptake in the bone marrow and multiple subcutaneous and intramuscular nodules (maximum standardised uptake value at 5.6) (figure 2). A deep skin biopsy with necrosis inflammation of small-sized and medium-sized vessels led to the diagnosis of PAN.\n\nFigure 2 FDG-PET/CT of the third patient before treatment and 4 months later. FDG-PET, 18 F-fluorodeoxyglucose positron emission tomography.\n\nThe patient was treated by oral prednisolone (1 mg/kg/day) and intravenous immunoglobulin (2 g/kg) with a modest and a short-term (less than 1 week) effect on CRP and poor clinical benefit. Given the high levels of inflammation, general symptoms and the dependence of very high doses of GC, TCZ 8 mg/kg was introduced. Three days after the start of the treatment, the patient reported an improvement of his general health status with a decreasing CRP to 12 mg/L. The condition continued to improve despite the reduction of prednisolone from 60 to 30 mg over the following 3 months (figure 1c). The FDG-PET/CT, conducted 4 months after the beginning of TCZ, was normal (figure 2). Ten months after starting treatment, the patient no longer requires corticosteroids. We have, therefore, begun to space out the TCZ infusion to every 6 weeks.\n\nDiscussion\nWhile the physiopathology of idiopathic systemic PAN is less well-known, the fundamental role of proinflammatory cytokines is no longer questioned. General symptoms and elevation of CRP are frequent and significant in PAN. IL-6 levels are very elevated in large vessels vasculitis and associated with constitutional symptoms and CRP. The essential function of TNF alpha in the expression of major histocompatibility complex class II suggests a central role of T cells in this pathology, major macrophage activation and a release of proinflammatory cytokines such as IL-1 and IL-6.2\n\n\nTCZ is now a new therapeutic option for large vessel vasculitis (giant-cell arteritis or Takayasu disease) for patients resistant to or dependent on GCs.5–7 One case of amyloidosis secondary to PAN treated with tocilizumab, previously reported, also showed a good response of inflammatory markers including serum amyloid A protein.8 The role of proinflammatory IL-6, the data observed in patients with large vessel vasculitis and this other case of PAN treated by TCZ, argue the use of tocilizumab in our three patients suffering for refractory PAN. All patients have consented to receive TCZ and are still under treatment at this time.\n\nIf TCZ is known to artificially decrease CRP levels, all of our patients presented dramatic clinical improvement which allowed us to significantly reduce the doses of GCs. The tolerance of TCZ in our patients and generally in patients with other indications remains good.5–7\n\n\nA few patients with PAN have been treated with other biological agents such as anti-TNF agents infliximab and etanercept which, in the reported cases,9 10 has generally resulted in a good clinical response. However, vasculitis has also been described as a complication of anti-TNF agent infliximab and etanercept, making the choice of this agent difficult in the context of PAN.11 There are no data on the efficacy of rituximab in PAN. Thus, IL-6 may be the right target for PAN treatment like it has been recently shown for giant-cell arteritis.5\n\n\nMany uncertainties remain regarding duration of treatment, long-term side effects in this context and its place as first-line treatment, treatment for relapses or to spare GCs. However, regarding the low incidence of idiopathic PAN and the issue of therapeutic trials in rare diseases, it is inconceivable to wait for results of controlled trials to allow patients with PAN to benefit from the TCZ in case of refractory PAN or more frequently to prevent GC long-term side effects in a pathology with a very limited therapeutic arsenal.\n\nThe authors thank Diana Barger for the English revision of the manuscript.\n\nContributors: All authors have participated to the management of these patients, to the collection of the data and to the analyses of the results. All authors have approved the manuscript before submission.\n\nCompeting interests: None declared.\n\nProvenance and peer review: Not commissioned; externally peer reviewed.\n\nData sharing statement: Data can be obtained from the corresponding author.\n==== Refs\nReferences\n1. \nHernández-Rodríguez J , Alba MA , Prieto-González S , et al \nDiagnosis and classification of polyarteritis nodosa . J Autoimmun \n2014 \n48-49 :84 –9 .10.1016/j.jaut.2014.01.029 \n24485157 \n2. \nDe Virgilio A , Greco A , Magliulo G , et al \nPolyarteritis nodosa: a contemporary overview . Autoimmun Rev \n2016 ;15 :564 –70 .10.1016/j.autrev.2016.02.015 \n26884100 \n3. \nGuillevin L , Cohen P , Mahr A , et al \nTreatment of polyarteritis nodosa and microscopic polyangiitis with poor prognosis factors: a prospective trial comparing glucocorticoids and six or twelve cyclophosphamide pulses in sixty-five patients . Arthritis Rheum \n2003 ;49 :93 –100 .10.1002/art.10922 \n12579599 \n4. \nSamson M , Puéchal X , Devilliers H , et al \nLong-term follow-up of a randomized trial on 118 patients with polyarteritis nodosa or microscopic polyangiitis without poor-prognosis factors . Autoimmun Rev \n2014 ;13 :197 –205 .10.1016/j.autrev.2013.10.001 \n24161361 \n5. \nVilliger PM , Adler S , Kuchen S , et al \nTocilizumab for induction and maintenance of remission in giant cell arteritis: a phase 2, randomised, double-blind, placebo-controlled trial . Lancet \n2016 ;387 :1921 –7 .10.1016/S0140-6736(16)00560-2 \n26952547 \n6. \nNakaoka Y , Higuchi K , Arita Y , et al \nTocilizumab for the treatment of patients with refractory takayasu arteritis . Int Heart J \n2013 ;54 :405 –11 .10.1536/ihj.54.405 \n24309452 \n7. \nMekinian A , Comarmond C , Resche-Rigon M , et al \nEfficacy of biological-targeted treatments in Takayasu arteritis: multicenter, retrospective study of 49 patients . Circulation \n2015 ;132 :1693 –700 .10.1161/CIRCULATIONAHA.114.014321 \n26354797 \n8. \nHočevar A , Lestan B , Šemrl SS , et al \nAA amyloidosis in a polyarteritis nodosa patient treated with tocilizumab . Amyloid \n2013 ;20 :275 –6 .10.3109/13506129.2013.838947 \n24106820 \n9. \nAl-Bishri J , le Riche N , Pope JE \nRefractory polyarteritis nodosa successfully treated with infliximab. \nJ Rheumatol \n2005 ;32 :1371 –3 .15996083 \n10. \nFeinstein J , Arroyo R \nSuccessful treatment of childhood onset refractory polyarteritis nodosa with tumor necrosis factor alpha blockade . J Clin Rheumatol \n2005 ;11 :219 –22 .10.1097/01.rhu.0000173225.41933.83 \n16357761 \n11. \nMohan N , Edwards ET , Cupps TR , et al \nLeukocytoclastic vasculitis associated with tumor necrosis factor-alpha blocking agents . J Rheumatol \n2004 ;31 :1955 –8 .15468359\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "2056-5933", "issue": "3(1)", "journal": "RMD open", "keywords": "polyarteritis nodosa; tocilizumab; treatment", "medline_ta": "RMD Open", "mesh_terms": null, "nlm_unique_id": "101662038", "other_id": null, "pages": "e000446", "pmc": null, "pmid": "28879047", "pubdate": "2017", "publication_types": "D002363:Case Reports", "references": "26354797;26884100;12579599;26952547;15468359;24485157;24106820;24309452;24161361;15996083;16357761", "title": "Treatment of polyarteritis nodosa with tocilizumab: a new therapeutic approach?", "title_normalized": "treatment of polyarteritis nodosa with tocilizumab a new therapeutic approach" }
[ { "companynumb": "FR-ALVOGEN-2017-ALVOGEN-092877", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "DAPSONE" }, "drugadditional": "3", ...
{ "abstract": "Objective: To report the development of neuroleptic malignant syndrome (NMS) after donepezil was added to maintenance haloperidol. Case Summary: An East Asian female in her mid-50s with a 25-year history of schizophrenia was prescribed fluvoxamine 150 mg daily, haloperidol decanoate 200 mg intramuscularly every 4 weeks, and benztropine 0.5 mg twice daily. Donepezil 5 mg daily was initiated for the treatment of possible dementia and 2 days later she appeared pale, displayed malaise, reported emesis, but was afebrile. The following day she was notably changed in behavior, withdrawn with a blunted affect. Decreased appetite, hyperthermia (temperatures 99.2-101°F), tachycardia, drooling, and slow, stiff movements with a creatine phosphokinase level of 1413 units/L (normal 26-192 units/L) were noted, and the patient was transferred to a medical hospital for treatment of suspected NMS. Symptoms improved with antipsychotic discontinuation, intravenous fluids, bromocriptine, and dantrolene. Five days after the adverse reaction the creatine phosphokinase significantly improved and she was noted to be more alert and responsive. Discussion: A literature search revealed 9 case reports of cholinesterase inhibitors causing NMS reactions either alone or, more commonly, when used in combination with antipsychotics. In this case, it was probable (Drug Interaction Probability Scale Score 6) the interaction between donepezil and haloperidol decanoate contributed to NMS. Conclusions: Use of cholinesterase inhibitors with antipsychotic medications may create an imbalance in acetylcholine and dopamine, which can precipitate the onset of NMS in susceptible individuals. These agents should be used cautiously in combination with careful monitoring for NMS.", "affiliations": "Austin State Hospital, Austin, TX, USA.;The University of Texas at Austin, TX, USA.", "authors": "Mican|Lisa M|LM|;Schulenberg|Samantha|S|", "chemical_list": null, "country": "United States", "delete": false, "doi": "10.1177/8755122514544526", "fulltext": null, "fulltext_license": null, "issn_linking": "1549-4810", "issue": "30(6)", "journal": "The Journal of pharmacy technology : jPT : official publication of the Association of Pharmacy Technicians", "keywords": "adverse drug reactions; antipsychotics; cholinergics; drug interactions; drug safety; drug-related problems; interactions; neuroleptics; pharmacodynamics", "medline_ta": "J Pharm Technol", "mesh_terms": null, "nlm_unique_id": "8504643", "other_id": null, "pages": "235-239", "pmc": null, "pmid": "34860886", "pubdate": "2014-12", "publication_types": "D002363:Case Reports", "references": "23194104;16863495;22563571;11774731;17389673;12654986;18294120;18494081;16440373;12955290;18212788;14731314", "title": "In the Balance: A Case of Neuroleptic Malignant Syndrome When Donepezil Is Added to Maintenance Haloperidol Decanoate.", "title_normalized": "in the balance a case of neuroleptic malignant syndrome when donepezil is added to maintenance haloperidol decanoate" }
[ { "companynumb": "US-APOTEX-2015AP009427", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "DONEPEZIL HYDROCHLORIDE" }, "drugadditional": nu...
{ "abstract": "Pregnancy-associated diffuse large B-cell lymphoma (DLBCL) is a rare event. Experience regarding fetal effects of maternal treatment during pregnancy is limited. Cardiotoxicity is a known adverse effect of some antineoplastic agents especially of doxorubicin. We report a case of pregnancy-associated DLBCL, which was treated between gestational week 26 and 33 with three cycles of R-CHOP (cyclophosphamide, doxorubicin, vincristine and prednisolone combined with rituximab). At gestational age 34 2/7 she delivered a male infant who was admitted to neonatal care due to cardiomyopathy. In the absence of other explanations it was interpreted as a direct toxic effect of maternal chemotherapy. At age 6 months the boy's cardiac output had normalized. This case report is the first presenting congenital cardiomyopathy after maternal R-CHOP during pregnancy. Since especially anthracyclines are known to cause acute and chronic cardiotoxicity in treated patients, the most probable explanation for neonatal cardiomyopathy in this case is doxorubicin.", "affiliations": "Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy, Charité Universitätsmedizin, Berlin, Campus Virchow-Klinikum, Augustenburger Platz 1, 13353 Berlin, Germany. Electronic address: stephanie.padberg@charite.de.;Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy, Charité Universitätsmedizin, Berlin, Campus Virchow-Klinikum, Augustenburger Platz 1, 13353 Berlin, Germany. Electronic address: inge-maria.mick@charite.de.;Universitätsklinik für Kinder- und Jugendheilkunde, Landeskrankenhaus, Müllner Hauptstraße 48, 5020 Salzburg, Austria. Electronic address: c.frenzel@salk.at.;Universitätsklinik für Innere Medizin III, Landeskrankenhaus, Müllner Hauptstraße 48, 5020 Salzburg, Austria. Electronic address: r.greil@salk.at.;Universitätsklinik für Kinder- und Jugendheilkunde, Landeskrankenhaus, Müllner Hauptstraße 48, 5020 Salzburg, Austria; Universitätsklinik für Kinder- und Jugendmedizin, Hoppe-Seyler-Straße 1, 72076 Tübingen, Germany. Electronic address: johannes.hilberath@med.uni-tuebingen.de.;Institute for Clinical Teratology and Drug Risk Assessment in Pregnancy, Charité Universitätsmedizin, Berlin, Campus Virchow-Klinikum, Augustenburger Platz 1, 13353 Berlin, Germany. Electronic address: christof.schaefer@charite.de.", "authors": "Padberg|Stephanie|S|;Mick|Inge|I|;Frenzel|Cornelia|C|;Greil|Richard|R|;Hilberath|Johannes|J|;Schaefer|Christof|C|", "chemical_list": "D058846:Antibodies, Monoclonal, Murine-Derived; C571759:R-CHOP protocol; D000069283:Rituximab; D014750:Vincristine; D004317:Doxorubicin; D003520:Cyclophosphamide; D011241:Prednisone", "country": "United States", "delete": false, "doi": "10.1016/j.reprotox.2017.05.008", "fulltext": null, "fulltext_license": null, "issn_linking": "0890-6238", "issue": "71()", "journal": "Reproductive toxicology (Elmsford, N.Y.)", "keywords": "Anthracyclines; Cardiotoxicity; Case report; Diffuse large B-cell lymphoma; Pregnancy", "medline_ta": "Reprod Toxicol", "mesh_terms": "D000328:Adult; D058846:Antibodies, Monoclonal, Murine-Derived; D000971:Antineoplastic Combined Chemotherapy Protocols; D002311:Cardiomyopathy, Dilated; D003520:Cyclophosphamide; D004317:Doxorubicin; D004452:Echocardiography; D005260:Female; D006801:Humans; D007231:Infant, Newborn; D016403:Lymphoma, Large B-Cell, Diffuse; D008297:Male; D008431:Maternal-Fetal Exchange; D011241:Prednisone; D011247:Pregnancy; D011248:Pregnancy Complications; D011859:Radiography; D000069283:Rituximab; D014750:Vincristine", "nlm_unique_id": "8803591", "other_id": null, "pages": "146-149", "pmc": null, "pmid": "28552383", "pubdate": "2017-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Transient congenital dilated cardiomyopathy after maternal R-CHOP chemotherapy during pregnancy.", "title_normalized": "transient congenital dilated cardiomyopathy after maternal r chop chemotherapy during pregnancy" }
[ { "companynumb": "PHHY2017DE099452", "fulfillexpeditecriteria": "1", "occurcountry": "DE", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "VINCRISTINE" }, "drugadditional": null, "dru...
{ "abstract": "OBJECTIVE\nThis study reviewed the cumulative postmarketing and clinical safety experience with sodium oxybate (Xyrem), a treatment approved for cataplexy and excessive daytime sleepiness in narcolepsy. Study objectives were to investigate the occurrence of abuse/misuse of sodium oxybate since first market introduction in 2002, classify cases using DSM-IV criteria for substance abuse and dependence, and describe specific characteristics of these cases.\n\n\nMETHODS\nWe retrospectively reviewed postmarketing spontaneous adverse event (AE) reports from 15 countries for all cases containing reporting terminology related to abuse/misuse to determine its occurrence. All death cases independent of causality were reviewed to identify associated risk factors.\n\n\nRESULTS\nApproximately 26,000 patients worldwide received sodium oxybate from first market introduction in 2002 through March 2008. Of those 26,000 patients, 0.2% reported > or = 1 of the events studied. These included 10 cases (0.039%) meeting DSM-IV abuse criteria, 4 cases (0.016%) meeting DSM-IV dependence criteria, 8 cases (0.031%, including 3 of the previous 4) with withdrawal symptoms reported after discontinuation of sodium oxybate, 2 confirmed cases (0.008%) of sodium oxybate-facilitated sexual assault, 8 cases (0.031%) of overdose with suicidal intent, 21 deaths (0.08%) in patients receiving sodium oxybate treatment with 1 death known to be related to sodium oxybate, and 3 cases (0.01%) of traffic accidents involving drivers taking sodium oxybate. During this period, approximately 600,000 bottles of sodium oxybate were distributed, and 5 incidents (0.0009%) of diversion were reported.\n\n\nCONCLUSIONS\nCumulative postmarketing and clinical experience indicates a very low risk of abuse/misuse of sodium oxybate.", "affiliations": "Jazz Pharmaceuticals, Inc. Palo Alto, CA 94304, USA. Grace.Wang@jazzpharma.com", "authors": "Wang|Y Grace|YG|;Swick|Todd J|TJ|;Carter|Lawrence P|LP|;Thorpy|Michael J|MJ|;Benowitz|Neal L|NL|", "chemical_list": "D002492:Central Nervous System Depressants; D012978:Sodium Oxybate", "country": "United States", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1550-9389", "issue": "5(4)", "journal": "Journal of clinical sleep medicine : JCSM : official publication of the American Academy of Sleep Medicine", "keywords": null, "medline_ta": "J Clin Sleep Med", "mesh_terms": "D000063:Accidents, Traffic; D002492:Central Nervous System Depressants; D006970:Disorders of Excessive Somnolence; D062787:Drug Overdose; D004363:Drug Utilization; D064420:Drug-Related Side Effects and Adverse Reactions; D006801:Humans; D011358:Product Surveillance, Postmarketing; D011902:Rape; D012306:Risk; D012978:Sodium Oxybate; D019966:Substance-Related Disorders", "nlm_unique_id": "101231977", "other_id": null, "pages": "365-71", "pmc": null, "pmid": "19968016", "pubdate": "2009-08-15", "publication_types": "D016428:Journal Article; D016454:Review", "references": "12063892;3432862;18852348;15871147;19493637;18226949;19269893;15586785;18004131;12734908;11833860;14225980;18690919;9624312;11297827;9624311;11174231;19187456;15990433;16880774;11579621;19897413;11300509;10084097;18246980;2406848;10077458;1596007;12733850;12534425;16648309;19010351;16336040", "title": "Safety overview of postmarketing and clinical experience of sodium oxybate (Xyrem): abuse, misuse, dependence, and diversion.", "title_normalized": "safety overview of postmarketing and clinical experience of sodium oxybate xyrem abuse misuse dependence and diversion" }
[ { "companynumb": "US-APOTEX-2020AP016758", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "FLUOXETINE HYDROCHLORIDE" }, "drugadditional": n...
{ "abstract": "We present a case demonstrating the diagnostic work-up of a patient undergoing azathioprine treatment for inflammatory bowel disease (IBD), diagnosed with an acute cytomegalovirus (CMV) infection and CMV colitis. An 18F-FDG positron emission tomography/computed tomography (PET/CT) performed 2 weeks after debut of symptoms revealed pathological 18F-FDG uptake in the left side of the colon mucosa, mimicked activity of IBD. However, a diagnosis of CMV colitis was based on the presence of CMV IgM antibodies, a seroconversion of CMV IgG antibodies, presence of CMV DNA in plasma and the finding af CMV DNA in biopsies from the intestinal mucosa. The patient responded to treatment with ganciclovir. This case highlights that a positive 18F-FDG PET/CT scan of the colon can be due to CMV colitis.", "affiliations": "Department of Infectious diseases, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark. vqs488@alumni.ku.dk.;Department of Infectious diseases, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark. ibenribberholt@dadlnet.dk.;Department of Clinical microbiology, Copenhagen University Hospital Rigshospitalet, Blegdamsvej 9, DK-2100 Copenhagen Ø, Denmark. kim.thomsen@regionh.dk.;Department of Patology, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark. per.ibsen@regionh.dk.;Department of Radiology, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark. elena.markova.01@regionh.dk.;Department of Clinical Physiology & Nuclear Medicine, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark. jesper.graff@regionh.dk.", "authors": "Kjaer|Anna Sophie L|ASL|0000-0003-3623-7635;Ribberholt|Iben|I|;Thomsen|Kim|K|;Ibsen|Per H|PH|;Markova|Elena|E|;Graff|Jesper|J|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.3390/diagnostics9010003", "fulltext": "\n==== Front\nDiagnostics (Basel)Diagnostics (Basel)diagnosticsDiagnostics2075-4418MDPI 10.3390/diagnostics9010003diagnostics-09-00003Interesting Images18F-FDG PET/CT Findings in Cytomegalovirus Colitis https://orcid.org/0000-0003-3623-7635Kjaer Anna Sophie L. 1*Ribberholt Iben 1Thomsen Kim 2Ibsen Per H. 3Markova Elena 4Graff Jesper 51 Department of Infectious diseases, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark; ibenribberholt@dadlnet.dk2 Department of Clinical microbiology, Copenhagen University Hospital Rigshospitalet, Blegdamsvej 9, DK-2100 Copenhagen Ø, Denmark; kim.thomsen@regionh.dk3 Department of Patology, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark; per.ibsen@regionh.dk4 Department of Radiology, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark; elena.markova.01@regionh.dk5 Department of Clinical Physiology & Nuclear Medicine, Copenhagen University Hospital Hvidovre, Kettegaards Allé 30, DK-2650 Hvidovre, Denmark; jesper.graff@regionh.dk* Correspondence: vqs488@alumni.ku.dk; Tel.: +45-6166-791126 12 2018 3 2019 9 1 302 11 2018 21 12 2018 © 2018 by the authors.2018Licensee MDPI, Basel, Switzerland. This article is an open access article distributed under the terms and conditions of the Creative Commons Attribution (CC BY) license (http://creativecommons.org/licenses/by/4.0/).We present a case demonstrating the diagnostic work-up of a patient undergoing azathioprine treatment for inflammatory bowel disease (IBD), diagnosed with an acute cytomegalovirus (CMV) infection and CMV colitis. An 18F-FDG positron emission tomography/computed tomography (PET/CT) performed 2 weeks after debut of symptoms revealed pathological 18F-FDG uptake in the left side of the colon mucosa, mimicked activity of IBD. However, a diagnosis of CMV colitis was based on the presence of CMV IgM antibodies, a seroconversion of CMV IgG antibodies, presence of CMV DNA in plasma and the finding af CMV DNA in biopsies from the intestinal mucosa. The patient responded to treatment with ganciclovir. This case highlights that a positive 18F-FDG PET/CT scan of the colon can be due to CMV colitis.\n\n18F-FDG PET/CTcytomegalovirus colitisinflammatory bowel disease\n==== Body\nFigure 1 A 33 year-old man with known inflammatory bowel disease (IBD), on azathioprin (Imurel®) and mesalazin (Asacol®) treatment, presented with two weeks of hyperpyrexia up to 40.6 °C, dry cough, and water like diarrhoea which—unlike usual IBD—contained only a limited amount of blood. One month earlier, the patient had been travelling for 17 days in Jamaica. The patient was initially treated as an outpatient with roxithromycin for suspected pneumonia with no effect, and was admitted to the hospital after 10 days with symptoms. At admission, we found elevated C-Reactive Protein (CRP) 58 mg/L (normal range <10 mg/L), Alanine aminotransferase (ALAT) 217 U/L (normal range 10–70 U/L), Lactate dehydrogenase (LDH) 778 U/L (normal range 105–205 U/L), and Ferritin 2,560 µg/L (normal range 12–300 µg/L). Hemoglobin was low 6.5 mmol/L (normal range 8.3–9.5 mmol/L). White blood cell count was within normal range; 6.1 × 109/L (normal range 3.5–8.8 ×109/L). Blood cultures were negative. Human immunodeficiency (HIV) test was negative, hepatitis panels were either negative or consistent with previous vaccination. Dengue IgG and IgM, Zikavirus IgG and IgM and DNA, Chikungunya IgG and IgM and Malaria microscopy were all negative. A stool sample tested negative for bacteria, vira, and parasites. X-ray of the thorax was normal. CT of the abdomen revealed an enlarged descending colon with oedema of the colon mucosa and splenomegaly. The patient did not improve, and due to persistent pyrexia and watery diarrhoea, elevated ALAT and the finding of an enlarged spleen; Epstein Barr virus (EBV) and Cytomegalovirus (CMV) testing were ordered, especially as CMV reactivation have been found to be associated with IBD flare-up in patients on immunosupressive therapy. EBV serology was consistent with a previous infection; EBV DNA in the blood was negative. Specific CMV IgM antibodies were detected, and CMV IgG antibodies were borderline. However, only 3,000 copies/mL of CMV in the plasma were detected by PCR. At day 10 after admission, an 18F-FDG PET/CT scan was performed to identify the cause of fever of unknown origin (Figure 1). The scan revealed pathologically high 18F-FDG uptake in the left side of the colon, and mild diffuse increased activity in the bone marrow and in the enlarged spleen (16.5 cm). The intense 18F-FDG uptake in the left side of the colon was consistent with either flare-up in IBD or an infectious colitis. CMV testing was repeated on day 8 after admission, and this time both CMV IgG and IgM antibodies were detected, indicating a CMV IgG seroconversion consistent with a primary CMV infection. A sigmoidoscopy revealed inflammation with oedema and submucosal bleeding from 45 to 70 cm from the anus, which is not characteristic for IBD. The biopsy specimen from the colonic lesions did not reveal cells with CMV inclusion bodies, but PCR of the biopsies from the intestinal mucosa were positive for CMV DNA with 12,000 copies/mL suggesting compartmentalization of CMV manifestation. The patient was treated with ganciclovir 5 mg/kg twice daily for 14 days with good clinical response. Following treatment, CMV DNA in the blood was undetectable. CMV colitis is a known, but relatively rare complication to CMV infection that is observed in severely immunocompromised patients including those who have HIV and IBD, or have received an organ transplantation, chemotherapy, or other immunosuppressives [1,2,3]. CMV colitis as a complication in patients with IBD has been associated with active disease, immunosuppressive medication, steroid treatment, and especially steroid refractory disease progression [4]. Diagnosing CMV colitis is based on clinical symptoms, biochemical findings, typical endoscopic findings, histological examination of biopsies from colon mucosa, and detection of CMV DNA in the blood and biopsies from affected colon mucosa [1,2,3,4,5,6]. Discrimnation between activity in IBD and an acute CMV infectious colitis is difficult, but of great importance in order to initiate antiviral therapy. IBD patients with colitis and systemic signs of inflammation, steroid-refractory disease, pyrexia, splenomegaly, and a lack of leukocytosis have a high pre-test probability for CMV colitis [6] as was the case in our patient. 18F-FDG PET/CT has been shown to have a potential for a noninvasive whole-body assessment of IBD, with FDG accumulating along the intestinal tract including assessment of disease extent, activity, and treatment response [7]. In the present case, PET/CT scan revealed pathologically high 18F-FDG uptake in the left side of the colon, and mild diffuse increased activity in the bone marrow and in the enlarged spleen. The initial blood samples and the sigmoideoscopy did not indicate activity in the patients IBD, and the patient was diagnosed with a primary CMV colitis, based on CMV seroconversion and CMV DNA in the blood and the biopsy from the colon. The changes revealed by the PET/CT were consistent with an acute infectious colitis. Only one case of 18F-FDG uptake in acute CMV colitis has been previously reported [8]. This case highlights that a positive 18F-FDG PET/CT scan of the colon can be due to CMV colitis.\n\nConsent for Publication\nThe patient provided written informed consent for the publication of the paper.\n\nConflicts of Interest\nThe authors declare no conflicts of interest.\n==== Refs\nReferences\n1. Sager K. Alam S. Bond A. Chinnappan L. Probert C.S. Cytomegalovirus and inflammatory bowel disease Aliment. Pharmacol. Ther. 2015 41 725 733 10.1111/apt.13124 25684400 \n2. Umar S. Clarke K. Bilimoria F. Bilal M. Singh S. Silverman J. Diagnostic yield from colon biopsies in patients with inflammatory bowel disease and suspected cytomegalovirus infection: Is it worth it? Ann. Gastroenterol. 2017 30 429 432 10.20524/aog.2017.0153 28655979 \n3. Garrido E. Carrera E. Manzano R. Lopez-Sanroman A. Clinical significance of cytomegalovirus infection in patients with inflammatory bowel disease World J. Gastroenterol. 2013 19 17 25 10.3748/wjg.v19.i1.17 23326158 \n4. Kredel L.I. Mundt P. van Riesen L. Jöhrens K. Hofmann J. Loddenkemper C. Siegmund B. Preiß J.C. Accuracy of diagnostic tests and a new algorithm for diagnosing cytomegalovirus colitis in inflammatory bowel diseases: A diagnostic study Int. J. Colorectal. Dis. 2018 1 9 10.1007/s00384-018-3170-z 30276706 \n5. Lawlor G. Moss A.C. Cytomegalovirus in inflammatory bowel disease: Pathogen or innocent bystander? Inflamm. Bowel Dis. 2010 16 1620 1627 10.1002/ibd.21275 20232408 \n6. Lv Y.L. Han F.F. Jia Y.J. Wan Z.R. Gong L.L. Liu H. Liu L.H. Is cytomegalovirus infection related to inflammatory bowel disease, especially steroid-resistant inflammatory bowel disease? A meta-analysis Infect. Drug Resist. 2017 10 511 519 10.2147/IDR.S149784 29276397 \n7. Hess S. Hansson S.H. Pedersen K.T. Basu S. Høilund-Carlsen P.F. FDG-PET/CT in Infectious and Inflammatory Diseases PET Clin. 2014 9 497 519 10.1016/j.cpet.2014.07.002 26050949 \n8. Nihashi T. Ito K. Kato T. Kato R. Okuda M. Arima T. Bundo M. Kawatsu S. Hayasaka K. Ishigaki T. An abnormal accumulation of fluorine-18-FDG PET in cytomegalovirus enteritis—A case report Ann. Nucl. Med. 2006 20 75 78 10.1007/BF02985595 16485579\n\n", "fulltext_license": "CC BY", "issn_linking": "2075-4418", "issue": "9(1)", "journal": "Diagnostics (Basel, Switzerland)", "keywords": "18F-FDG PET/CT; cytomegalovirus colitis; inflammatory bowel disease", "medline_ta": "Diagnostics (Basel)", "mesh_terms": null, "nlm_unique_id": "101658402", "other_id": null, "pages": null, "pmc": null, "pmid": "30587768", "pubdate": "2018-12-26", "publication_types": "D016428:Journal Article", "references": "16485579;20232408;23326158;25684400;26050949;28655979;29276397;30276706", "title": "18F-FDG PET/CT Findings in Cytomegalovirus Colitis.", "title_normalized": "18f fdg pet ct findings in cytomegalovirus colitis" }
[ { "companynumb": "DK-ALLERGAN-1923198US", "fulfillexpeditecriteria": "1", "occurcountry": "DK", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MESALAMINE" }, "drugadditional": "3", "...
{ "abstract": "BACKGROUND\nModerate to severe psoriasis often requires treatment with systemic agents, many of which have immunosuppressive properties and could increase cancer risk, including nonmelanoma skin cancer (NMSC).\n\n\nOBJECTIVE\nWe sought to estimate the overall malignancy rate (excluding NMSC) and NMSC rate among 5889 patients with systemically treated psoriasis.\n\n\nMETHODS\nWe identified a cohort of adult Kaiser Permanente Northern California health plan members with psoriasis diagnosed from 1998 to 2011 and treated with at least 1 systemic antipsoriatic agent and categorized them into ever-biologic or nonbiologic users. Malignancy rates were calculated per 1000 person-years of follow-up with 95% confidence intervals (CI). Crude and confounder-adjusted hazard ratios (aHRs) were calculated using Cox regression.\n\n\nRESULTS\nMost biologic-exposed members were treated with TNF-alfa inhibitors (n = 2214, 97%). Overall incident cancer rates were comparable between ever-biologic as compared to nonbiologic users (aHR 0.86, 95% CI 0.66-1.13). NMSC rates were 42% higher among individuals ever exposed to a biologic (aHR 1.42, 95% CI 1.12-1.80), largely driven by increased cutaneous squamous cell carcinoma risk (aHR 1.81, 95% CI 1.23-2.67).\n\n\nCONCLUSIONS\nNo information was available on disease severity.\n\n\nCONCLUSIONS\nWe found increased incidence of cutaneous squamous cell carcinoma among patients with systemically treated psoriasis who were ever exposed to biologics, the majority of which were TNF-alfa inhibitors. Increased skin cancer surveillance in this population may be warranted.", "affiliations": "Division of Research, Kaiser Permanente Northern California, Oakland, California; Department of Dermatology, Massachusetts General Hospital, and Harvard Medical School, Boston, Massachusetts. Electronic address: harvardskinstudies@partners.org.;Division of Research, Kaiser Permanente Northern California, Oakland, California.;Pfizer Inc, New York, New York.;Division of Research, Kaiser Permanente Northern California, Oakland, California.", "authors": "Asgari|Maryam M|MM|;Ray|G Thomas|GT|;Geier|Jamie L|JL|;Quesenberry|Charles P|CP|", "chemical_list": "D000911:Antibodies, Monoclonal; D003879:Dermatologic Agents; D007166:Immunosuppressive Agents; D014409:Tumor Necrosis Factor-alpha", "country": "United States", "delete": false, "doi": "10.1016/j.jaad.2016.10.006", "fulltext": null, "fulltext_license": null, "issn_linking": "0190-9622", "issue": "76(4)", "journal": "Journal of the American Academy of Dermatology", "keywords": "basal cell carcinoma; biologics; cancer; cutaneous squamous cell carcinoma; epidemiology; nonmelanoma skin cancer; psoriasis; tumor necrosis factor-alfa", "medline_ta": "J Am Acad Dermatol", "mesh_terms": "D000328:Adult; D000367:Age Factors; D000368:Aged; D000911:Antibodies, Monoclonal; D002140:California; D002294:Carcinoma, Squamous Cell; D015897:Comorbidity; D015986:Confounding Factors, Epidemiologic; D003879:Dermatologic Agents; D005260:Female; D005500:Follow-Up Studies; D006801:Humans; D016867:Immunocompromised Host; D007166:Immunosuppressive Agents; D015994:Incidence; D008297:Male; D008329:Managed Care Programs; D008875:Middle Aged; D009369:Neoplasms; D009381:Neoplasms, Radiation-Induced; D016016:Proportional Hazards Models; D011565:Psoriasis; D012878:Skin Neoplasms; D014409:Tumor Necrosis Factor-alpha; D014467:Ultraviolet Therapy; D055815:Young Adult", "nlm_unique_id": "7907132", "other_id": null, "pages": "632-638", "pmc": null, "pmid": "28162854", "pubdate": "2017-04", "publication_types": "D016428:Journal Article", "references": null, "title": "Malignancy rates in a large cohort of patients with systemically treated psoriasis in a managed care population.", "title_normalized": "malignancy rates in a large cohort of patients with systemically treated psoriasis in a managed care population" }
[ { "companynumb": "US-JNJFOC-20170406735", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "INFLIXIMAB" }, "drugadditional": "3", "...
{ "abstract": "The use of liquid silicone for cosmetic procedures can yield serious sequelae including embolization and pneumonia. We describe a recent case of silicone embolism syndrome occurring together with systemic tuberculosis in a transgendered patient newly diagnosed with AIDS. She presented with fever, hematochezia, lymphadenopathies, purple nodular lesions and lower limb edema. HIV test was positive. A chest X-Ray showed interstitial infiltrates and a tomography showed necrotic lymph nodes and pulmonary nodules with blurred borders, suggesting Kaposi sarcoma. Psychomotor impairment then occurred in the absence of tomographic signs of acute neurological events. The Mycobacterium tuberculosis genome was isolated from stool and bronchial washing samples. Histological examination of a necrotic lymph node showed lymphoadenopathy due to silicone accumulation. Moreover, the patient presented fever and swelling of lower limbs; a tomography showed multiple foreign body granulomas. After starting antitubercular, antiretroviral and antibiotic treatment she reported symptomatic improvement including a mild recovery of motor-slowing. There are few reports about silicone-induced pulmonary disease in HIV-1 infected patients and, as far as we know, none of them describes an overlapping pulmonary involvement due to Mycobacterium tuberculosis infection. Even if extensive clinical and radiologic evidence is suggestive of Kaposi sarcoma (fever, severe immunodeficiency, multiple cutaneous nodules, hematochezia, diffuse lymphoadenopathies), it is possible to see Kaposi-like manifestations in patients with systemic silicone embolization. With this article we wish to stress the attention on the possible overlap of more than one concurrent disease in an immunocompromised host.", "affiliations": "Fondazione Policlinico Universitario A. Gemelli IRCCS, Institute of Clinical Infectious Diseases, Rome, Italy.;Fondazione Policlinico Universitario A. Gemelli IRCCS, Institute of Clinical Infectious Diseases, Rome, Italy.;Fondazione Policlinico Universitario A. Gemelli IRCCS, Institute of Clinical Infectious Diseases, Rome, Italy; Università Cattolica del Sacro Cuore, Institute of Clinical Infectious Diseases, Rome, Italy.", "authors": "Picarelli|Chiara|C|;Borghetti|Alberto|A|;Di Gianbenedetto|Simona|S|", "chemical_list": "D020034:Silicone Gels", "country": "Italy", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1124-9390", "issue": "27(2)", "journal": "Le infezioni in medicina", "keywords": null, "medline_ta": "Infez Med", "mesh_terms": "D000163:Acquired Immunodeficiency Syndrome; D000328:Adult; D004617:Embolism; D005260:Female; D015745:Granuloma, Foreign-Body; D006801:Humans; D008168:Lung; D000072281:Lymphadenopathy; D008297:Male; D009169:Mycobacterium tuberculosis; D009336:Necrosis; D012514:Sarcoma, Kaposi; D020034:Silicone Gels; D063106:Transgender Persons; D014391:Tuberculosis, Miliary", "nlm_unique_id": "9613961", "other_id": null, "pages": "190-193", "pmc": null, "pmid": "31205045", "pubdate": "2019-06-01", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Kaposi-like manifestations in a newly diagnosed AIDS transgendered patient with silicone embolism syndrome and disseminated tuberculosis.", "title_normalized": "kaposi like manifestations in a newly diagnosed aids transgendered patient with silicone embolism syndrome and disseminated tuberculosis" }
[ { "companynumb": "PHHY2019IT186043", "fulfillexpeditecriteria": "1", "occurcountry": "IT", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "BETAMETHASONE" }, "drugadditional": "3", "dr...
{ "abstract": "Allogeneic stem cell transplantation (HCT) is curative in patients with severe sickle cell disease (SCD), but a significant number of patients lack an HLA-identical sibling or matched unrelated donor. Mismatched related (haploidentical) HCT with post-transplant cyclophosphamide (PTCY) allows expansion of the donor pool but is complicated by high rates of graft failure. In this report we describe a favorable haploidentical HCT approach in a limited cohort of SCD patients with significant comorbidities. To reduce the risk of graft failure we administered the conditioning regimen of rabbit antithymocyte globulin, busulfan, and fludarabine preceded with 2 courses of pretransplant immunosuppressive therapy (PTIS) with fludarabine and dexamethasone. Graft-versus-host disease (GVHD) prophylaxis consisted of PTCY on days +3 and +4 followed by tacrolimus and mycophenolate mofetil starting on day +5. Four patients (ages 13, 19, 19, and 23 years) received T cell-replete haploidentical stem cell infusion. All patients engrafted with 99.9% to 100% donor chimerism, and all patients continued with stable engraftment at the last follow-up (5 to 11 months post-transplant). Time to neutrophil engraftment was 14 to 26 days. Two patients had high levels of donor-specific anti-HLA antibodies, which required the implementation of an antibody management protocol. This facilitated neutrophil engraftment on day +16 and day +26, respectively. One patient developed grade I acute GVHD, which resolved. Three patients developed mild, limited skin GVHD that responded to conventional immunosuppressive therapy. Human herpesvirus-6 viremia was detected in 3 patients but resolved without treatment. One patient developed asymptomatic cytomegalovirus viremia that responded appropriately to standard therapy with ganciclovir. The prompt, stable engraftment and low toxicity in the post-transplant period makes PTIS with haploidentical transplant a promising option for patients with SCD.", "affiliations": "Department of Pediatrics, City of Hope, Duarte, CA. Electronic address: apawlowska@coh.org.;Southern California Kaiser Permanente Medical Group, Los Angeles, CA.;Department of Pediatrics, City of Hope, Duarte, CA.;Department of Pediatrics, City of Hope, Duarte, CA.;Department of Pediatrics, City of Hope, Duarte, CA.;Department of Pediatrics, City of Hope, Duarte, CA.;Department of Pediatrics, City of Hope, Duarte, CA.;Department of Pediatrics, City of Hope, Duarte, CA.", "authors": "Pawlowska|Anna B|AB|;Cheng|Jerry C|JC|;Karras|Nicole A|NA|;Sun|Weili|W|;Wang|Leo D|LD|;Bell|Alison D|AD|;Gutierrez|Lisa|L|;Rosenthal|Joseph|J|", "chemical_list": "D000961:Antilymphocyte Serum; D007166:Immunosuppressive Agents; D003907:Dexamethasone; C512542:thymoglobulin; D014740:Vidarabine; D002066:Busulfan; C024352:fludarabine", "country": "United States", "delete": false, "doi": "10.1016/j.bbmt.2017.08.039", "fulltext": null, "fulltext_license": null, "issn_linking": "1083-8791", "issue": "24(1)", "journal": "Biology of blood and marrow transplantation : journal of the American Society for Blood and Marrow Transplantation", "keywords": "Haploidentical stem cell transplantation; Hematopoietic stem cell transplantation; Post-transplant cytoxan; Sickle cell disease", "medline_ta": "Biol Blood Marrow Transplant", "mesh_terms": "D000293:Adolescent; D000755:Anemia, Sickle Cell; D000961:Antilymphocyte Serum; D002066:Busulfan; D015331:Cohort Studies; D003907:Dexamethasone; D006085:Graft Survival; D006801:Humans; D007165:Immunosuppression Therapy; D007166:Immunosuppressive Agents; D000075442:Transplantation, Haploidentical; D014184:Transplantation, Homologous; D014740:Vidarabine; D055815:Young Adult", "nlm_unique_id": "9600628", "other_id": null, "pages": "185-189", "pmc": null, "pmid": "28939451", "pubdate": "2018-01", "publication_types": "D016428:Journal Article", "references": null, "title": "HLA Haploidentical Stem Cell Transplant with Pretransplant Immunosuppression for Patients with Sickle Cell Disease.", "title_normalized": "hla haploidentical stem cell transplant with pretransplant immunosuppression for patients with sickle cell disease" }
[ { "companynumb": "US-ALKEM LABORATORIES LIMITED-US-ALKEM-2018-00007", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "MYCOPHENOLATE MOFETIL" }, ...
{ "abstract": "BACKGROUND\nRelapses upon corticosteroids tapering and immunosuppressive agents are frequent in Takayasu arteritis (TA). Interleukin-6 is highly involved in physiopathology of TA. Many reports showed efficacy of tocilizumab (TCZ) in refractory TA cases. We report four cases and an updated literature review on the TCZ efficacy and safety in patients with TA.\n\n\nMETHODS\nPatients with TA defined by ACR 1990 criteria were included. Clinical, biological and imaging data were retrospectively reported. Disease activity was analyzed before TCZ and during the follow-up. Medline database was searched for systematic literature review.\n\n\nRESULTS\nOne hundred and five patients (median age 28years [22-38]) were included, mostly refractory cases (76 patients, 72%). Median TCZ duration was 12months [6-20]. Among 105 patients, 90 patients (85.7%) had an initial clinical response within three months [3-6] and 43/66 patients (65.2%) had a radiological improvement. Only seven patients (9%) showed relapse on therapy. Corticosteroid dose reduction was obtained in 75/83 patients (90.4%). Relapse after TCZ discontinuation was observed in six patients (46%), with a median time of five months [2-9]. Twenty-four side-effects were noted in 18 patients (18%), with TCZ interruption in seven cases (7%): 10 infections, five cytopenia, six hepatitis, one pancreatitis, one cutaneous rash and one breast cancer.\n\n\nCONCLUSIONS\nThis review confirms that TCZ is safe and effective in refractory cases of TA and TCZ is a corticosteroid-sparing therapy in patients with or without previous TNFα blockers therapy. However relapses after TCZ discontinuation are frequent.", "affiliations": "Vascular Medicine Division and Regional Competence Centre for Rare Vascular and Systemic Autoimmune Diseases, Hôpitaux de Brabois, CHRU de Nancy, 5 rue du Morvan, 54500 Vandoeuvre-lès-Nancy, France.;University of Lorraine, Nancy, France; Department of Nuclear Medicine, Hôpitaux de Brabois, CHRU de Nancy, 5 rue du Morvan, 54500 Vandoeuvre-lès-Nancy, France.;Vascular Medicine Division and Regional Competence Centre for Rare Vascular and Systemic Autoimmune Diseases, Hôpitaux de Brabois, CHRU de Nancy, 5 rue du Morvan, 54500 Vandoeuvre-lès-Nancy, France.;Vascular Medicine Division and Regional Competence Centre for Rare Vascular and Systemic Autoimmune Diseases, Hôpitaux de Brabois, CHRU de Nancy, 5 rue du Morvan, 54500 Vandoeuvre-lès-Nancy, France; University of Lorraine, Nancy, France; INSERM UMR_S 1116, Vandoeuvre-lès-Nancy, France.;Vascular Medicine Division and Regional Competence Centre for Rare Vascular and Systemic Autoimmune Diseases, Hôpitaux de Brabois, CHRU de Nancy, 5 rue du Morvan, 54500 Vandoeuvre-lès-Nancy, France; University of Lorraine, Nancy, France; INSERM UMR_S 1116, Vandoeuvre-lès-Nancy, France. Electronic address: d.wahl@chru-nancy.fr.", "authors": "Decker|Paul|P|;Olivier|Pierre|P|;Risse|Jessie|J|;Zuily|Stéphane|S|;Wahl|Denis|D|", "chemical_list": "D061067:Antibodies, Monoclonal, Humanized; C502936:tocilizumab", "country": "Netherlands", "delete": false, "doi": "10.1016/j.autrev.2017.11.026", "fulltext": null, "fulltext_license": null, "issn_linking": "1568-9972", "issue": "17(4)", "journal": "Autoimmunity reviews", "keywords": "Anti-IL 6 antibody; Large vessel vasculitis; Systematic review; Takayasu arteritis; Therapy; Tocilizumab", "medline_ta": "Autoimmun Rev", "mesh_terms": "D000293:Adolescent; D000328:Adult; D061067:Antibodies, Monoclonal, Humanized; D005260:Female; D006801:Humans; D008875:Middle Aged; D012189:Retrospective Studies; D013625:Takayasu Arteritis; D016896:Treatment Outcome; D055815:Young Adult", "nlm_unique_id": "101128967", "other_id": null, "pages": "353-360", "pmc": null, "pmid": "29427826", "pubdate": "2018-04", "publication_types": "D002363:Case Reports; D016428:Journal Article; D016454:Review; D000078182:Systematic Review", "references": null, "title": "Tocilizumab and refractory Takayasu disease: Four case reports and systematic review.", "title_normalized": "tocilizumab and refractory takayasu disease four case reports and systematic review" }
[ { "companynumb": "FR-ACCORD-067992", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "1", "activesubstance": { "activesubstancename": "TOCILIZUMAB" }, "drugadditional": null, "dru...
{ "abstract": "Treatments for pancreatic cancer can have debilitating side effects including fatigue, weight loss, and cardiac toxicity, resulting in functional loss and psychological distress. Exercise has been proposed as a therapy to counteract physical and psychological detriments. The case: A 47-year-old male undergoing chemotherapy for stage 3 locally advanced pancreatic cancer. He was cycling during hospital chemotherapy infusions (6 fortnightly cycles of FOLFIRINOX: 5-FU 2, 400 mg/m2, over 48 h: irinotecan 180 mg/m2, oxaliplatin 85 mg/m2, no 5-FU bolus) plus 12 weeks of twice weekly aerobic and resistance exercise. Over 12 weeks, body composition was maintained, and physical function improved, with specific increases in muscular strength of up to 50% and aerobic capacity improving by 9%. Moreover, quality of life, fatigue, psychological distress, and sleep quality improved by 38, 113, 50, and 9%, respectively. Additionally, the participant experienced more severe side effects in week 6, when he did not cycle to a high intensity during hospital infusion and had less total weekly exercise. After cycle 6 (week 11), chemotherapy was halted, and a Whipple resection procedure was successfully performed. It can be concluded that regular aerobic and resistance exercise plus exercise during infusion can attenuate expected decline in physical and mental health with pancreatic cancer treatment and may reduce treatment side effects and have favourable effects on prognosis.", "affiliations": "Edinburgh Napier University, Edinburgh, United Kingdom.;Edinburgh Cancer Centre, Western General Hospital, Edinburgh, United Kingdom.;Edinburgh Napier University, Edinburgh, United Kingdom.", "authors": "McLaughlin|Marie|M|;Christie|Alan|A|;Campbell|Anna|A|", "chemical_list": null, "country": "Switzerland", "delete": false, "doi": "10.1159/000503815", "fulltext": "\n==== Front\nCase Rep OncolCase Rep OncolCROCase Reports in Oncology1662-6575S. Karger AG Allschwilerstrasse 10, P.O. Box · Postfach · Case postale, CH-4009, Basel, Switzerland · Schweiz · Suisse, Phone: +41 61 306 11 11, Fax: +41 61 306 12 34, karger@karger.com 10.1159/000503815cro-0012-0845Case ReportCase Report of Exercise to Attenuate Side Effects of Treatment for Pancreatic Cancer McLaughlin Marie aChristie Alan bCampbell Anna a*aEdinburgh Napier University, Edinburgh, United KingdombEdinburgh Cancer Centre, Western General Hospital, Edinburgh, United Kingdom*Prof. Anna Campbell, Department of Sport, Exercise and Health, School of Applied Science, Edinburgh Napier University, Edinburgh EH11 4BN (UK), E-Mail anna.campbell@napier.ac.ukSep-Dec 2019 1 11 2019 1 11 2019 12 3 845 854 30 9 2019 1 10 2019 2019 Copyright © 2019 by S. Karger AG, Basel2019This article is licensed under the Creative Commons Attribution-NonCommercial-4.0 International License (CC BY-NC) (http://www.karger.com/Services/OpenAccessLicense). Usage and distribution for commercial purposes requires written permission.Treatments for pancreatic cancer can have debilitating side effects including fatigue, weight loss, and cardiac toxicity, resulting in functional loss and psychological distress. Exercise has been proposed as a therapy to counteract physical and psychological detriments. The case: A 47-year-old male undergoing chemotherapy for stage 3 locally advanced pancreatic cancer. He was cycling during hospital chemotherapy infusions (6 fortnightly cycles of FOLFIRINOX: 5-FU 2, 400 mg/m2, over 48 h: irinotecan 180 mg/m2, oxaliplatin 85 mg/m2, no 5-FU bolus) plus 12 weeks of twice weekly aerobic and resistance exercise. Over 12 weeks, body composition was maintained, and physical function improved, with specific increases in muscular strength of up to 50% and aerobic capacity improving by 9%. Moreover, quality of life, fatigue, psychological distress, and sleep quality improved by 38, 113, 50, and 9%, respectively. Additionally, the participant experienced more severe side effects in week 6, when he did not cycle to a high intensity during hospital infusion and had less total weekly exercise. After cycle 6 (week 11), chemotherapy was halted, and a Whipple resection procedure was successfully performed. It can be concluded that regular aerobic and resistance exercise plus exercise during infusion can attenuate expected decline in physical and mental health with pancreatic cancer treatment and may reduce treatment side effects and have favourable effects on prognosis.\n\nKeywords\nPancreatic cancerExerciseChemotherapyCase report\n==== Body\nIntroduction\nThe prognosis for pancreatic cancer is poor, with <5% of those with the condition surviving for 5 years and only 1% surviving 10 years after diagnosis [1]. For resectable pancreatic cancer (stage 1 and 2) survival rates are 7–25% at 5 years. Locally advanced (stage 3) and advanced cancer (stage 4) have an average survival of 6–11 months and 2–6 months, respectively [1]. In addition to the poor prognosis, treatments for pancreatic cancer (primarily surgery, chemotherapy, and radiotherapy) can have debilitating side effects, including fatigue which affects 92% of patients receiving chemotherapy [2]. Further complications with pancreatic cancer include weight loss, cardiac toxicity, digestive problems, diarrhoea, nausea, vomiting, increased infection risk, alopecia, and pain due to chemotherapy treatment [3]. Additionally, psychological well-being decreases by 13% from pre- to post-treatment, with pancreatic cancer eliciting the highest rates of depression and anxiety compared to all other cancer types at 28.8 versus 18.5%, respectively [4]. Furthermore, disturbed sleep is also common in cancer survivors, with 43% of cancer patients having insomnia syndrome during chemotherapy treatment [5]. This translates to a decrease in quality of life (QOL) with FACT-Hep scores declining from pre- to post-treatment in pancreatic cancer patients [3]. Therefore, therapies that improve treatment tolerance, reduce the loss of physical functioning, and improve psychological well-being are essential to improve QOL.\n\nExercise has been proposed as such a therapy and has been investigated in other cancer types. As current, only one single case study exists which investigates the effects of exercise on physical and psychological well-being in pancreatic cancer [6]. This previous study investigated twice weekly aerobic and resistance training for 6 months in a 49-year-old male with stage 2b pancreatic cancer undergoing chemotherapy. The intervention was well-tolerated, with 73% attendance. At 12-weeks, exercise resulted in an improvement across all outcome measures, with an 8.2% increase in fat free mass, accompanied by a 31.6% increase in leg strength, and a decrease in time to complete 400 m walk, chair rise, stair climb, and 6 m walk (–5.9, −17.2, −9.9, and −23.5%, respectively). In addition to this, QOL improved by 40%, fatigue improved by 350%, sleep quality improved by 20%, and psychological distress improved by 21%. The current study was undertaken to expand these findings by investigating exercise during chemotherapy infusion in addition to twice weekly aerobic and strength exercise in a case of stage 3 pancreatic cancer.\n\nPresenting Concerns\nA 47-year old white male with diagnosis of stage 3 locally advanced pancreatic cancer was recruited following a self-referral to MoveMore cancer exercise classes. He is married, a non-smoker, and works in middle management. He initially presented with a 2–3 month history of epigastric pains, requiring hospital admission on one occasion. After symptoms failed to settle with analgesia and omeprazole, he underwent further investigation with an endoscopic ultrasound and CT scan of his abdomen.\n\nClinical Findings\nHe had no medical history of note, and was taking omeprazole, tramadol and ibuprofen for symptom relief. There were no relevant family history or examination findings and he was ECOG performance status 0.\n\nDiagnostic Focus and Assessment\nInvestigations confirmed the presence of a locally advanced pancreatic adenocarcinoma with invasion of the superior mesenteric vein, and proximity of the tumour to the hepatic artery and superior mesenteric artery. Baseline laboratory testing was unremarkable, with excellent liver and kidney function. As a consequence of the vascular involvement, he had an AJCC stage III pancreatic cancer which was considered inoperable.\n\nTherapeutic Focus\nThe case received FOLFIRINOX (5-FU 2,400 mg/m2 over 48 h, irinotecan 180 mg/m2, oxaliplatin 85 mg/m2 – no 5-FU bolus) via peripherally inserted catheter administered over 6 fortnightly cycles (12 weeks).\n\nDuring hospital chemotherapy infusions, the participant cycled for 40 min at 60% of heart rate maximum, using Polar Heart Rate Monitor. In addition, a 12-week exercise program, beginning on week 2 of chemotherapy, was delivered as one-on-one sessions on two non-consecutive days/week, supervised by the researcher based on the following exercise prescription:\n\n5-min warm-up and cool-down: light aerobic and flexibility exercises.\n\nResistance exercise: 8 exercises, performed for 3 sets of 12 repetitions at 60% of 1-repetition maximum (1-RM), based on 12-RM baseline strength testing (leg press, leg extension, leg curl, calf raise, hip abduction, rear kick, back extension and leg raises). The participant did not perform upper body exercises as peripherally inserted central catheter was present.\n\nAerobic exercise: 15 min of continuous cycling on ergometer at 70% of maximum heart rate, based on maximal heart rate during baseline testing. Heart rate monitor worn throughout all sessions.\n\nIntensity and duration attenuated based on the participant's health status. Therefore, adherence and compliance were recorded throughout.\n\nAdditional exercise out-with the program was advised, with the aim of accumulating 150-min/week moderate intensity or 75-min vigorous intensity exercise in bouts of 10-min or more.\n\nAssessments\n\nAerobic Capacity:The participant cycled on an ergometer at 100 watts for 6 min. Heart rate measured every minute, using Polar heart rate monitor, and the steady state heart rate determined. This was extrapolated to corresponding VO2max estimation on Astrand Ryhming nomogram.\n\n\nStrength Testing (12-Repitition Maximum [RM]): The maximum load that can be performed for 12-repetition was determined for leg press, leg extension, calf raise, leg curl, rear kick, hip abduction, and back extension.\n\n\nFlexibility:Seated toe-reach assessed flexibility of the hamstrings.\n\n\nPhysical Function: Repeated chair rise (time taken to rise five times from a chair) evaluated muscular power. Stair climb (time to ascend a flight of stairs) assessed ambulation. Usual pace, fast pace, and backwards 6-m walk evaluated ambulation and dynamic balance. Activities-Specific Balance Confidence scale evaluated falls self-efficacy.\n\n\nBody Composition:Bioelectrical impedance analysis assessed percentage body fat and lean mass.\n\n\nPhysical Activity (PA) Levels:Apple watch assessed average weekly PA.\n\n\nQuestionnaires:The Functional Assessment of Cancer Therapy–Hepatobiliary (FACT-Hep) questionnaire evaluated pancreatic cancer-specific quality of life.\n\nFunctional Assessment of Chronic Illness Therapy–Fatigue subscale assessed cancer-related fatigue.\n\nPittsburgh Sleep Quality Index assessed sleep quality.\n\nThe Brief Symptom Inventory-18 assessed psychological distress (depression, anxiety, somatization, and global distress severity).\n\n\nSemi-Structured Interview:Conducted at the end of the exercise program to elucidate if exercising during chemotherapy was truly meaningful. This consisted of 10 open-ended questions, delivered by the researcher, referring to the impact the intervention had on the participant's quality of life, using a social validity approach.\n\nFollow-up and Outcomes\nThe participant was assessed at baseline, 4, 8, and 12 weeks. Adherence to exercise during chemotherapy infusions was 100%, with compliance to exercise intensity reduced only during week 6 (100 bpm vs. usual 124 bpm). This was due to use of an unfamiliar bicycle. Adherence to the supervised exercise sessions was 94% (15/16 sessions). Reason for missed session: on holiday. Average compliance to the supervised sessions varied from non-chemotherapy to chemotherapy weeks at 100 and 68.67%, respectively. Performance intensity reductions during chemotherapy weeks were due to nausea. No adverse events from exercise. The participant experienced the following toxicities: grade 2 constipation, grade 2 nausea and vomiting, and grade 2 mucositis. These were managed successfully and did not result in treatment delays or dose attenuations.\n\nWith regards to exercise effects, there was a positive change in body composition from baseline to end of the training period, with a decrease in body fat percentage and increase in lean and total body mass (Table 1). In addition to altering body composition, exercise training also induced increases in strength (Fig. 1). Furthermore, physical performance and aerobic capacity improved considerably with exercise (Fig. 2).\n\nWith regards to psychological well-being, there were considerable improvements in quality of life, fatigue, and psychological distress, with sleep quality also showing a slight increase with exercise (Fig. 3). In addition to these results, qualitative feedback was obtained from the patient and is outlined in Table 2.\n\nAfter 6 weeks of chemotherapy (3 cycles), CT scan revealed partial tumour response, with further partial response on 12-week scan (after cycle 6), including improvement in previously noted vascular involvement of his locally advanced pancreatic cancer. Given the improvement, a successful Whipple's pancreatico-duodenectomy was performed without requirement for a vascular reconstruction in September (final pathology: T2 N1 R1). The participant recovered well post-operatively and completed a further 6 cycles post-operative modified FOLFIRINOX (with reduced dose of irinotecan to 150 mg/m2 as per the adjuvant PRODIGE-24 trial protocol [7]). Cycle 12 was delivered with a further 20% dose reduction of 5-FU, oxaliplatin and irinotecan due to grade 2 diarrhoea with cycle 11. He is now recovering well from his chemotherapy. His Ca19–9 tumour marker remains within normal range and he is planning his return to work.\n\nDiscussion\nExercise was safe during chemotherapy for stage 3 pancreatic cancer, with appropriate attenuation of program when feeling nauseas. Twelve weeks of exercise increased lean muscle mass by 4.4%, translating into increased strength of up to 50% from baseline to week 12. These are significant findings as cancer cachexia affects 83% of those with pancreatic cancer, responsible for ∼80% of advanced pancreatic cancer mortality [8]. Aerobic capacity also increased with training, similar to the previous case study in pancreatic cancer [6]. Improvements in both cardiovascular function and strength are translated into improved physical function, important for maintaining independence of activities of daily living. Usually, chemotherapy results in fatigue sub-scores on FACT-Hep reducing from 1.30 at baseline to 0.80 at 4 and 8 weeks in those with pancreatic cancer [3] due to cachexia, loss of physical function, and psychological distress due to treatment toxicity and tumour-specific cytokine release [9]. This case had large and progressive improvements in fatigue. This is an important finding as cancer-related fatigue upsets daily routines of 88% of sufferers, with 75% of those changing employment status [10]. Hence, exercise may be a therapy which can aid maintenance of normal lifestyle by counteracting the usual expected side effects of cachexia and declines in physical functioning.\n\nIt is important to discuss the finding from week 6 whereby the participant reported feeling physically and mentally poorly after exercising at a lesser intensity during chemotherapy infusion. It may be speculated that, due to increased side effects from his chemotherapy, the case was too fatigued to exercise to the same intensity. It could be equally speculated that exercise during infusion may have to be at a high intensity to reduce treatment-related side effects. The mechanism suggested for this is redirection of blood flow to muscle tissue during exercise, reducing the splanchnic organ contact with the chemotherapy treatment [11]. This enhances treatment tolerance and is likely to contribute to treatments being on time. Additionally, exercise may increase treatment efficacy by increasing tumour blood flow and subsequent chemotherapy delivery. The tumour vasculature does not respond to vasoconstrictive signals during exercise, allowing increased blood flow to the tumour [11], with a 140% increase in tumour perfusion in breast cancer mice, translating to reduced tumour hypoxia and decreased tumour development, compared with usual care [12]. This may be because hypoxia causes chemoresistance as low vascularization limits the delivery of chemotherapy to the tumor [13]. Therefore, decreased tumour development is postulated to be due to an exercise-induced increase in efficacy of chemotherapy by increasing tumour blood supply.\n\nAdditionally, sleep quality also improved by the end of the intervention; and psychological distress moved from ‘severe mental disorder’ to ‘mild mental disorder’ from baseline to 4 weeks, and ‘likely to be well’ by week 8. Overall, well-being improved, with increased strength, fitness, physical functioning, and improved ability to psychologically cope with treatment, translating to improved QOL. The inclusion of qualitative data adds social validity to the numerical findings, and from Table 2 it can be determined that exercise is truly meaningful to the participant's life. Additionally, exercise during infusion gives the participant ‘something to look forward to’ and a perception of control (Table 2). This is consistent with a previous study of exercise during infusion whereby it was found that cycling during infusion was “4% more comfortable, 15% less difficult, and 69% less boring” than usual care [14]. Hence, reduced side effects of treatment by cycling during infusion may be both psychological and physiological. However, it is important to note that he was also seeing a psychologist regularly throughout his chemotherapy, which will have undoubtedly contributed to improved psychological well-being.\n\nUnfortunately, cause-effect cannot be determined. The lack of reported treatment side effects may be due to high levels of exercise; or it may be the limited side effects which allows compliance to the intervention. Achieving high levels of exercise may not be possible for those experiencing severe side effects. Moreover, the case is relatively young, compared to the average age of 71 years for diagnosis of pancreatic cancer [15] and hence, results may not be applicable to all pancreatic cancer patients.\n\nConclusions\nExercise is safe and effective during treatment for locally advanced pancreatic cancer. This case study hasconfirmed findings that exercise attenuates expected declines in pancreatic cancer patients, adding to literature that exercising during infusions is also safe and may decrease side effects and aid efficacy of chemotherapy treatment. Findings have clinical implications, and it is recommended that a supervised exercise program and exercise during chemotherapy infusions should be included as an adjunct to usual treatment for pancreatic cancer. In the future, clinical trials of supervised exercise programs are required to expand these findings.\n\nStatement of Ethics\nEthical approval was granted from Edinburgh Napier University to undertake this study.\n\nThe patient gave their informed consent for the publication of this study.\n\nDisclosure Statement\nThe authors have no conflicts of interest to declare.\n\nFig. 1 Muscular strength endurance of leg press, extension and curl, calf raise, rear kick, hip abduction and back extension, measured by 12-repetition maximum (kg), at 0, 4, 8, and 12 weeks of the exercise intervention. Results were taken from a single test of each exercise.\n\nFig. 2 Physical performance and fitness, measured by a submaximal Astrand fitness test, stair climb time, 6 m walk test and 30 s chair rise test, reported as the improvement (%) from baseline to week 4, 8, and 12 of the exercise intervention. Measurements were taken on 3 consecutive attempts and the average score reported (except from Astrand test, which was performed once, and the result reported).\n\nFig. 3 Psychological well-being, measured by self-reported questionnaires for quality of life, fatigue, psychological distress and sleep quality, reported as the improvement (%) from baseline to week 4, 8, and 12 of the intervention.\n\nTable 1 Body composition at baseline and week 12\n\nMeasurement\tBaseline\tWeek 12\t\nBody mass, kg\t80.8\t82.7\t\nBody fat, %\t17.7\t13.3\t\nLean mass, %\t82.3\t86.7\t\nTable 2 Semi-structured interview results\n\nQuestion\tKey Words\t\nHow has exercise helped you cope with treatment?\tFeel different to other cancer patients In control Proud\t\n\t\nWhat are your main motivators for doing this exercise programme?\tFear of death\t\n\t\nHow would you describe your experience of this programme?\tHopeful Purposeful Team effort (social) Don ' t feel isolated\t\n\t\nHave any side effects of treatment been a problem for exercising?\tNausea a big problem in first week Frustrating\t\n\t\nWhat do you think are the benefits of cycling during infusion?\tSomething to look forward to Not easy but makes a big difference Helps to aid recovery from treatment: Felt awful for a full week when bike was stolen but all other times recovered after a few days\n==== Refs\nReferences\n1 Cancer Research UK Pancreatic cancer statistics | Cancer Research UK. Cancer Research UK https://www.cancerresearchuk.org/health-professional/cancer-statistics/statistics-by-cancer-type/pancreatic-cancer (2015, accessed 10 December 2018) \n2 Hartvig P Aulin J Hugerth M Wallenberg S Wagenius G Fatigue in cancer patients treated with cytotoxic drugs J Oncol Pharm Pract 2006 9 12 (3) 155 64 17022870 \n3 Sun V Ferrell B Juarez G Wagman LD Yen Y Chung V Symptom concerns and quality of life in hepatobiliary cancers Oncol Nurs Forum 2008 5 35 (3) E45 52 18467279 \n4 Clark KL Loscalzo M Trask PC Zabora J Philip EJ Psychological distress in patients with pancreatic cancer—an understudied group Psychooncology 2010 12 19 (12) 1313 20 20119937 \n5 Palesh OG Roscoe JA Mustian KM Roth T Savard J Ancoli-Israel S Prevalence, demographics, and psychological associations of sleep disruption in patients with cancer: University of Rochester Cancer Center-Community Clinical Oncology Program J Clin Oncol 2010 1 28 (2) 292 8 19933917 \n6 Cormie P Spry N Jasas K Johansson M Yusoff IF Newton RU Exercise as medicine in the management of pancreatic cancer: a case study Med Sci Sports Exerc 2014 4 46 (4) 664 70 24042308 \n7 Conroy T Hammel P Hebbar M Ben Abdelghani M Wei AC Raoul JL FOLFIRINOX or gemcitabine as adjuvant therapy for pancreatic cancer New England Journal of Medicine Massachusetts Medical Society pp. 2395 406 \n8 Bachmann J Heiligensetzer M Krakowski-Roosen H Büchler MW Friess H Martignoni ME Cachexia worsens prognosis in patients with resectable pancreatic cancer J Gastrointest Surg 2008 7 12 (7) 1193 201 18347879 \n9 Stewart GD Skipworth RJ Fearon KC Cancer cachexia and fatigue. Clinical Medicine J R Coll Physicians Lond 2006 6 140 3 \n10 Curt GA Breitbart W Cella D Groopman JE Horning SJ Itri LM Impact of cancer-related fatigue on the lives of patients: new findings from the Fatigue Coalition Oncologist 2000 5 (5) 353 60 11040270 \n11 Wiggins JM Opoku-Acheampong AB Baumfalk DR Siemann DW Behnke BJ Exercise and the Tumor Microenvironment: Potential Therapeutic Implications Exerc Sport Sci Rev 2018 1 46 (1) 56 64 29166299 \n12 Betof AS Lascola CD Weitzel D Landon C Scarbrough PM Devi GR Palmer G Jones LW Dewhirst MW Modulation of murine breast tumor vascularity, hypoxia, and chemotherapeutic response by exercise J Natl Cancer Inst 107 Epub ahead of print May 2015. DOI: \n13 Dewhirst MW Secomb TW Transport of drugs from blood vessels to tumour tissue Nat Rev Cancer 2017 12 17 (12) 738 50 29123246 \n14 Edwards KM Thomas V Seet-Lee C Cheema BS Boyer M Marthick M Piloting the Effect of Aerobic Exercise during Chemotherapy Infusion in Patients with Cancer: 1653 Board #3 May 31 315 PM - 515 PM Med Sci Sports Exerc 2018 50 383 4 \n15 Howlader N Noone AM Krapcho M Garshell J Neyman N Altekruse SF SEER Cancer Statistics Review, 1975-2010 http://seer.cancer.gov/csr/1975_2010/ (2014, date accessed: 10 December, 2018).\n\n", "fulltext_license": "CC BY-NC", "issn_linking": "1662-6575", "issue": "12(3)", "journal": "Case reports in oncology", "keywords": "Case report; Chemotherapy; Exercise; Pancreatic cancer", "medline_ta": "Case Rep Oncol", "mesh_terms": null, "nlm_unique_id": "101517601", "other_id": null, "pages": "845-854", "pmc": null, "pmid": "31762759", "pubdate": "2019", "publication_types": "D002363:Case Reports", "references": "16688969;19933917;17022870;20119937;29166299;18347879;11040270;30575490;25780062;24042308;18467279;29123246", "title": "Case Report of Exercise to Attenuate Side Effects of Treatment for Pancreatic Cancer.", "title_normalized": "case report of exercise to attenuate side effects of treatment for pancreatic cancer" }
[ { "companynumb": "GB-TEVA-2020-GB-1183055", "fulfillexpeditecriteria": "1", "occurcountry": "GB", "patient": { "drug": [ { "actiondrug": "4", "activesubstance": { "activesubstancename": "OXALIPLATIN" }, "drugadditional": null, ...
{ "abstract": "Ledipasvir-sofosbuvir has become the current standard of care for hepatitis C since its release in 2014. Therefore, potential adverse effects are important to identify.\n\n\n\nTo report findings of uveitis after treatment with ledipasvir-sofosbuvir for hepatitis C.\n\n\n\nThis case series includes patients treated in an urban academic setting with ledipasvir-sofosbuvir for hepatitis C from June 2015 to June 2017 who are known to have developed signs and symptoms of posterior uveitis.\n\n\n\nAll patients had been treated with ledipasvir-sofosbuvir for hepatitis C for a total of 12 weeks. All patients but 1 had finished treatment prior to presentation.\n\n\n\nSigns of posterior uveitis on ophthalmic testing.\n\n\n\nData were collected from 6 patients (median age, 64.5 [range, 54-72] years). Five patients were male; 4 were white, and 2 were African American. The mean (SD) time between beginning of treatment and presentation was 8.8 (5.5) months. Both eyes were affected in 3 of the 6 patients (total, 9 eyes). The median presenting visual acuity in affected eyes was 20/40 (range, 20/20-20/70). All patients had a negative systemic uveitis workup. Five patients presented with blurred vision, and 1 had a paracentral scotoma. The main ocular findings were peripheral vasculitis (in 8 of 9 eyes), papillitis (in 7 of 9 eyes), and cystoid macular edema (in 6 of 9 eyes). The median follow-up was 8 (range, 4-13) months. The median final visual acuity was 20/40 (range, 20/20-20/200).\n\n\n\nIn these patients, it appears that treatment with ledipasvir-sofosbuvir for hepatitis C was associated with a mild posterior uveitis different than interferon retinopathy. Given the large number of patients treated with ledipasvir-sofosbuvir, these findings cannot be considered causative, and an association cannot be quantified at this time.", "affiliations": "Kresge Eye Institute, Detroit, Michigan.;Kresge Eye Institute, Detroit, Michigan.;Kresge Eye Institute, Detroit, Michigan.;Kresge Eye Institute, Detroit, Michigan.;Kresge Eye Institute, Detroit, Michigan.", "authors": "Padidam|Sneha|S|;Burke|Marie T|MT|;Apple|Daniel B|DB|;Hu|Jonathan K|JK|;Lin|Xihui|X|", "chemical_list": "D000998:Antiviral Agents; D001562:Benzimidazoles; D005449:Fluorenes; C000595958:ledipasvir, sofosbuvir drug combination; D014542:Uridine Monophosphate; D000069474:Sofosbuvir", "country": "United States", "delete": false, "doi": "10.1001/jamaophthalmol.2019.0374", "fulltext": null, "fulltext_license": null, "issn_linking": "2168-6165", "issue": "137(5)", "journal": "JAMA ophthalmology", "keywords": null, "medline_ta": "JAMA Ophthalmol", "mesh_terms": "D000368:Aged; D000998:Antiviral Agents; D001562:Benzimidazoles; D005260:Female; D005449:Fluorenes; D005451:Fluorescein Angiography; D005500:Follow-Up Studies; D005654:Fundus Oculi; D019698:Hepatitis C, Chronic; D006801:Humans; D008297:Male; D008875:Middle Aged; D009898:Optic Disk; D012160:Retina; D012720:Severity of Illness Index; D000069474:Sofosbuvir; D013997:Time Factors; D041623:Tomography, Optical Coherence; D014542:Uridine Monophosphate; D015866:Uveitis, Posterior; D014792:Visual Acuity", "nlm_unique_id": "101589539", "other_id": null, "pages": "568-570", "pmc": null, "pmid": "30920588", "pubdate": "2019-05-01", "publication_types": "D016428:Journal Article", "references": "25837989;26764884;27335709;9602634", "title": "Association of Ledipasvir-Sofosbuvir Treatment With Uveitis in Patients Treated for Hepatitis C.", "title_normalized": "association of ledipasvir sofosbuvir treatment with uveitis in patients treated for hepatitis c" }
[ { "companynumb": "US-GILEAD-2019-0400805", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "LEDIPASVIR\\SOFOSBUVIR" }, "drugadditional": nul...
{ "abstract": "To describe the characteristics and severity of epistaxis in patients taking factor Xa inhibitors novel anticoagulants.\n\n\n\nRetrospective cohort study.\n\n\n\nA study of adult patients hospitalized due to spontaneous epistaxis under the treatment of warfarin, rivaroxaban, or apixaban between the years 2011 and 2017 was performed. A control group of patients under antiplatelet therapy (acetylsalicylic acid, clopidogrel) was included. The mean follow-up periods in the warfarin, rivaroxaban, apixaban, and antiplatelet groups were 18, 14.5, 13.5, and 18.2 months, respectively. We compared demographics, location and severity of bleeding, treatment methods, and outcome between the groups.\n\n\n\nThe study included 109 patients (35 under factor Xa inhibitors), the majority of whom presented with anterior epistaxis (68%). The antiplatelet group had more episodes of epistaxis prior to admission, and required endoscopic surgical control of bleeding more often, in comparison with anticoagulants (2.23 vs. 1.44, P < .05 and 23% vs. 6%, respectively, P < .05). Among anticoagulants, combined therapy (cauterization and packing) was required more frequently in the apixaban group compared to the rivaroxaban and warfarin groups (64% vs. 25% and 33%, respectively, P < .05). The rate of readmissions due to epistaxis, within 1 year of follow-up was lower in the factor Xa inhibitor groups compared with the warfarin and antiplatelet groups (16% vs. 9% and 4%, respectively, P < .05). Cessation of factor Xa inhibitor therapy was effective and uneventful with no further epistaxis events.\n\n\n\nEpistaxis under factor Xa inhibitors was effectively treated with no worse and perhaps even a better outcome when compared to other anticlotting medications.\n\n\n\n4 Laryngoscope, 129:119-123, 2019.", "affiliations": "Department of Otolaryngology-Head and Neck Surgery, Sheba Medical Center, Tel-Hashomer, Israel.;Sheba Medical Center, Tel-Hashomer, Israel.;Department of Otolaryngology-Head and Neck Surgery, Sheba Medical Center, Tel-Hashomer, Israel.;Department of Otolaryngology-Head and Neck Surgery, Sheba Medical Center, Tel-Hashomer, Israel.;Department of Otolaryngology-Head and Neck Surgery, Rabin Medical Center, Petach Tikva, Israel.;Department of Otolaryngology-Head and Neck Surgery, Sheba Medical Center, Tel-Hashomer, Israel.;Department of Otolaryngology-Head and Neck Surgery, Sheba Medical Center, Tel-Hashomer, Israel.;Department of Otolaryngology-Head and Neck Surgery, Sheba Medical Center, Tel-Hashomer, Israel.", "authors": "Glikson|Eran|E|0000-0001-8924-9811;Chavkin|Uri|U|;Madgar|Ory|O|;Sagiv|Doron|D|0000-0002-7151-838X;Nakache|Gabriel|G|0000-0002-6783-2165;Yakirevitch|Arkadi|A|;Wolf|Michael|M|;Alon|Eran E|EE|", "chemical_list": "D000925:Anticoagulants; D065427:Factor Xa Inhibitors; D010975:Platelet Aggregation Inhibitors; D011720:Pyrazoles; D011728:Pyridones; C522181:apixaban; D014859:Warfarin; D000069552:Rivaroxaban", "country": "United States", "delete": false, "doi": "10.1002/lary.27400", "fulltext": null, "fulltext_license": null, "issn_linking": "0023-852X", "issue": "129(1)", "journal": "The Laryngoscope", "keywords": "Epistaxis; anticoagulation; antiplatelet; novel anticoagulants", "medline_ta": "Laryngoscope", "mesh_terms": "D000368:Aged; D000925:Anticoagulants; D004844:Epistaxis; D065427:Factor Xa Inhibitors; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D010359:Patient Readmission; D010975:Platelet Aggregation Inhibitors; D011720:Pyrazoles; D011728:Pyridones; D012189:Retrospective Studies; D000069552:Rivaroxaban; D014859:Warfarin", "nlm_unique_id": "8607378", "other_id": null, "pages": "119-123", "pmc": null, "pmid": "30325496", "pubdate": "2019-01", "publication_types": "D003160:Comparative Study; D016428:Journal Article", "references": null, "title": "Epistaxis in the setting of antithrombotic therapy: A comparison between factor Xa inhibitors, warfarin, and antiplatelet agents.", "title_normalized": "epistaxis in the setting of antithrombotic therapy a comparison between factor xa inhibitors warfarin and antiplatelet agents" }
[ { "companynumb": "IL-BAYER-2018-231697", "fulfillexpeditecriteria": "1", "occurcountry": "IL", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "AMLODIPINE BESYLATE" }, "drugadditional": null, ...
{ "abstract": "Historically, the treatment of hepatitis C virus infection has been difficult, but therapeutic options have improved markedly recently because of the development of novel antiviral therapies. These therapies have been well tolerated. We describe a patient who was receiving such therapy and had development of temporally related and histologically confirmed severe pulmonary toxicity. Pulmonary toxicity should be considered a potential serious complication of novel antiviral therapy for hepatitis C virus infection.", "affiliations": "Department of Critical Care Medicine, Mayo Clinic, Phoenix, AZ. Electronic address: helmers.richard@mayo.edu.;Division of Gastroenterology and Hepatology, Mayo Clinic, Phoenix, AZ.;Division of Pulmonary Medicine, Mayo Clinic, Scottsdale, AZ.;Department of Laboratory Medicine and Pathology, Mayo Clinic, Scottsdale, AZ.", "authors": "Helmers|Richard A|RA|;Byrne|Thomas J|TJ|;Wesselius|Lewis J|LJ|;Leslie|Kevin O|KO|", "chemical_list": "D000998:Antiviral Agents; D000069616:Simeprevir; D000069474:Sofosbuvir", "country": "England", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "0025-6196", "issue": "90(9)", "journal": "Mayo Clinic proceedings", "keywords": null, "medline_ta": "Mayo Clin Proc", "mesh_terms": "D000998:Antiviral Agents; D005260:Female; D019698:Hepatitis C, Chronic; D006801:Humans; D016031:Liver Transplantation; D008297:Male; D011658:Pulmonary Fibrosis; D012307:Risk Factors; D000069616:Simeprevir; D000069474:Sofosbuvir; D016896:Treatment Outcome", "nlm_unique_id": "0405543", "other_id": null, "pages": "1294-7", "pmc": null, "pmid": "26231293", "pubdate": "2015-09", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": null, "title": "Serious Pulmonary Toxicity Secondary to Novel Hepatitis C Antiviral Therapy in a Liver Transplant Recipient.", "title_normalized": "serious pulmonary toxicity secondary to novel hepatitis c antiviral therapy in a liver transplant recipient" }
[ { "companynumb": "US-JNJFOC-20141111754", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": null, "activesubstance": { "activesubstancename": "ASPIRIN" }, "drugadditional": null, "d...
{ "abstract": "The use of contrast agent for magnetic resonance imaging improves the effectiveness of this diagnostic examination. Complexes of godolinium, which appear to be well tolerated, are used for this purpose. A few cases of anaphylactic shock have been attributed to these agents. We report a case of anaphylactic shock due to gadoterate meglumine (DOTAREM). While undergoing a magnetic resonance imaging examination, a 33-year-old nonatopic female patient became severely hypotensive, lost consciousness, and had generalized erythema immediately after the intravenous injection of this product. She recovered rapidly after she was given injection of epinephrine and her blood volume was restored with intravenous fluids. That DOTAREM had caused this immediate hypersensitivity reaction was proven by the positivity of prick-test and intradermal test at 10-3 (0.37 mg/ml) and in vitro leukocyte histamine release test. The results of these tests indicated that it was the gadoteric acid rather than the meglumine component of DOTAREM that was responsible: positivity of IDR at 10 mg/ml. Skin tests and leukocyte histamine release test to gadopentetate dimeglumine (MAGNEVIST) were negative. In addition of the exceptional character, this observation provides evidence for an immediate hypersensitivity without cross reactivity with gadopentetate dimeglumine.", "affiliations": "Department of Internal Medicine, Clinical Immunology and Allergology, University Hospital, Hôpital Central, 54035 Nancy, France.", "authors": "Beaudouin|E|E|;Kanny|G|G|;Blanloeil|Y|Y|;Guilloux|L|L|;Renaudin|J M|JM|;Moneret-Vautrin|D A|DA|", "chemical_list": "D003287:Contrast Media; D006571:Heterocyclic Compounds; D009942:Organometallic Compounds; D008536:Meglumine; C050823:gadolinium 1,4,7,10-tetraazacyclododecane-N,N',N'',N'''-tetraacetate; D019786:Gadolinium DTPA; C072417:gadoterate meglumine", "country": "Italy", "delete": false, "doi": null, "fulltext": null, "fulltext_license": null, "issn_linking": "1764-1489", "issue": "35(10)", "journal": "European annals of allergy and clinical immunology", "keywords": null, "medline_ta": "Eur Ann Allergy Clin Immunol", "mesh_terms": "D000328:Adult; D000707:Anaphylaxis; D003287:Contrast Media; D003429:Cross Reactions; D004342:Drug Hypersensitivity; D005260:Female; D019786:Gadolinium DTPA; D006571:Heterocyclic Compounds; D006636:Histamine Release; D006801:Humans; D007428:Intradermal Tests; D008279:Magnetic Resonance Imaging; D008536:Meglumine; D009942:Organometallic Compounds", "nlm_unique_id": "101466614", "other_id": null, "pages": "382-5", "pmc": null, "pmid": "14768523", "pubdate": "2003-12", "publication_types": "D002363:Case Reports; D003160:Comparative Study; D016428:Journal Article", "references": null, "title": "Anaphylactic shock induced by gadoterate meglumine (DOTAREM).", "title_normalized": "anaphylactic shock induced by gadoterate meglumine dotarem" }
[ { "companynumb": "FR-GUERBET-FR-20180204", "fulfillexpeditecriteria": "1", "occurcountry": "FR", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "GADOTERATE MEGLUMINE" }, "drugadditional": null,...
{ "abstract": "BACKGROUND Vancomycin is an antibiotic commonly used for management of severe gram-positive infections. It is infrequently associated with hematologic adverse effects, ranging from isolated thrombocytopenia or neutropenia to pancytopenia. Although the mechanism is poorly understood, it is considered an immune-mediated phenomenon. CASE REPORT A 46-year-old woman with a history of intravenous drug use presented having 2 months of lower back pain associated with new acute lower-extremity weakness, numbness, paresthesia, and urinary/fecal incontinence. Magnetic resonance imaging revealed L5-S1 osteomyelitis with an epidural phlegmon, and broad-spectrum antibiotic coverage, including vancomycin, was initiated. On day 33 of treatment, the patient was noted to have developed neutropenia, thrombocytopenia, and eosinophilia. Vancomycin was the suspected cause and was replaced with daptomycin; laboratory tests for alternative causes of the bicytopenia were negative. Resolution of the bicytopenia occurred 5 days after vancomycin was stopped, and the eosinophilia continued to improve. The Naranjo adverse drug reaction probability scale score was 6, deeming vancomycin as the \"probable\" cause. CONCLUSIONS Routine blood analysis during long-term vancomycin therapy is crucial to identifying hematologic suppression early. Prompt discontinuation of vancomycin is key to the management of the condition, with some case reports advocating for filgrastim adjuvant therapy to accelerate recovery. Cases of recurrence of the cytopenia with reexposure to vancomycin have been documented, and therefore inquiry into prior adverse reactions to vancomycin is recommended. Given the widespread use of vancomycin and the potential risks of bleeding and infection associated with thrombocytopenia and neutropenia, respectively, we caution physicians to be aware of this rare adverse effect in patients on long-term vancomycin therapy.", "affiliations": "School of Medicine, Saint Louis University, Saint Louis, MO, USA.;School of Medicine, Saint Louis University, Saint Louis, MO, USA.", "authors": "Lintel|Hendrik|H|;Saffaf|Mohammad|M|", "chemical_list": "D000900:Anti-Bacterial Agents; D014640:Vancomycin", "country": "United States", "delete": false, "doi": "10.12659/AJCR.931647", "fulltext": "\n==== Front\nAm J Case Rep\nAm J Case Rep\namjcaserep\nThe American Journal of Case Reports\n1941-5923\nInternational Scientific Literature, Inc.\n\n34101721\n10.12659/AJCR.931647\n931647\nArticles\nNeutropenia, Thrombocytopenia, and Eosinophilia: An Unusual Triad in a Patient on Long-Term Vancomycin Therapy\nLintel Hendrik ABDEF\nSaffaf Mohammad ABDEF\nSchool of Medicine, Saint Louis University, Saint Louis, MO, U.S.A.\nCorresponding Author: Hendrik Lintel, e-mail: hendrik.lintel@health.slu.edu\nAuthors’ Contribution:\n\nA Study Design\n\nB Data Collection\n\nC Statistical Analysis\n\nD Data Interpretation\n\nE Manuscript Preparation\n\nF Literature Search\n\nG Funds Collection\n\nConflict of interest: None declared\n\n2021\n08 6 2021\n22 e931647-1e931647-5\n16 2 2021\n23 4 2021\n06 5 2021\n© Am J Case Rep, 2021\n2021\nhttps://creativecommons.org/licenses/by-nc-nd/4.0/ This work is licensed under Creative Common Attribution-NonCommercial-NoDerivatives 4.0 International (CC BY-NC-ND 4.0)\nPatient: Female, 46-year-old\n\nFinal Diagnosis: Adverse drug reaction • epidural abscess\n\nSymptoms: Eosinophilia • neutropenia • thrombocytopenia\n\nMedication: —\n\nClinical Procedure: —\n\nSpecialty: General and Internal Medicine\n\nObjective:\n\nUnusual clinical course\n\nBackground:\n\nVancomycin is an antibiotic commonly used for management of severe gram-positive infections. It is infrequently associated with hematologic adverse effects, ranging from isolated thrombocytopenia or neutropenia to pancytopenia. Although the mechanism is poorly understood, it is considered an immune-mediated phenomenon.\n\nCase Report:\n\nA 46-year-old woman with a history of intravenous drug use presented having 2 months of lower back pain associated with new acute lower-extremity weakness, numbness, paresthesia, and urinary/fecal incontinence. Magnetic resonance imaging revealed L5-S1 osteomyelitis with an epidural phlegmon, and broad-spectrum antibiotic coverage, including vancomycin, was initiated. On day 33 of treatment, the patient was noted to have developed neutropenia, thrombocytopenia, and eosinophilia. Vancomycin was the suspected cause and was replaced with daptomycin; laboratory tests for alternative causes of the bicytopenia were negative. Resolution of the bicytopenia occurred 5 days after vancomycin was stopped, and the eosinophilia continued to improve. The Naranjo adverse drug reaction probability scale score was 6, deeming vancomycin as the “probable” cause.\n\nConclusions:\n\nRoutine blood analysis during long-term vancomycin therapy is crucial to identifying hematologic suppression early. Prompt discontinuation of vancomycin is key to the management of the condition, with some case reports advocating for filgrastim adjuvant therapy to accelerate recovery. Cases of recurrence of the cytopenia with reexposure to vancomycin have been documented, and therefore inquiry into prior adverse reactions to vancomycin is recommended. Given the widespread use of vancomycin and the potential risks of bleeding and infection associated with thrombocytopenia and neutropenia, respectively, we caution physicians to be aware of this rare adverse effect in patients on long-term vancomycin therapy.\n\nKeywords:\n\nEosinophilia\nNeutropenia\nThrombocytopenia\nVancomycin\n==== Body\nBackground\n\nVancomycin is a tricyclic glycopeptide, which is most often used in the treatment of severe gram-positive bacterial infections, in particular those caused by methicillin-resistant Staphylococcus aureus (MRSA). It is typically associated with adverse effects including hypersensitivity reactions, infusion reactions (eg, “red man syndrome”), thrombophlebitis, nephrotoxicity, and ototoxicity [1]. Less commonly, hematologic adverse effects have been noted to occur with vancomycin therapy, including reversible neutropenia (up to 8% event rate), thrombocytopenia, and pancytopenia [2]. Several published case reports have identified these hematologic adverse effects occurring in isolation. To the best of our knowledge, this is the first case report of bicytopenia consisting of neutropenia and thrombocytopenia with absolute eosinophilia.\n\nCase Report\n\nA 46-year-old woman with a past medical history of intravenous drug use and chronic anemia initially presented with a 2-month history of significant back pain. The day before presentation, the pain became unbearable, with acute onset of weakness in her left leg, bilateral lower-extremity numbness and tingling, and urinary and fecal incontinence. On examination, the patient had tenderness to palpation over the L3-S1 vertebrae as well as decreased rectal tone and weakness in both dorsiflexion and plantar flexion of the bilateral lower extremities. She was also noted to have a left anterior shin ulcer, which the patient reported to be chronic in nature. Magnetic resonance imaging (MRI) of the lumbar spine revealed L5-S1 osteomyelitis with associated paravertebral fluid collection, concerning for epidural abscess. The patient was given vancomycin and ceftriaxone for empiric coverage on day 1 of hospitalization. She subsequently underwent an L4-S1 laminectomy. Blood cultures and cultures from the epidural phlegmon were obtained and resulted in no growth after 5 days. Left shin wound cultures showed growth of Mycobacterium abscessus, and biopsy results showed granulomatous inflammation with intracellular and extracellular acid-fast bacilli. On day 5 of hospitalization, ceftriaxone was discontinued and replaced with cefepime; metronidazole was also started. On day 33 of vancomycin treatment, the patient was noted to have leukopenia, thrombocytopenia, and eosinophilia. Suspecting a drug-induced adverse reaction to vancomycin, we decided to discontinue vancomycin and start daptomycin. The rest of her medication regimen remained unchanged, including scheduled acetaminophen and oxycodone for pain, cyclobenzaprine and pregabalin for neuropathic pain, and enoxaparin for deep venous thrombosis prophylaxis. Over the subsequent days, the patient’s white blood cell (WBC) count and platelet count began to trend upward, and her eosinophil count started to trend downward. The platelet and WBC counts normalized by day 2 and day 5, respectively, after vancomycin cessation. Serum studies such as antineutrophil cytoplasmic antibody (ANCA) titers, an autoantibody associated with vancomycin-induced hematologic reactions, and platelet smears to evaluate for EDTA-induced pseudothrombocytopenia were not performed at that time. The time course of serum studies and antibiotic regimen are shown in Table 1. The patient completed her adjusted antibiotic regimen without further complications and was discharged home in stable condition without any further antibiotics. Two days after discharge, a follow-up MRI revealed significant resolution of her paravertebral soft tissue inflammation and L5-S1 abscess.\n\nOther differential diagnoses were considered for this patient’s hematologic findings. Hemophagocytic lymphohistiocytosis was considered unlikely owing to the patient’s normal ferritin level, absence of fever, and the fact that eosinophilia is not a common finding in this condition. Disseminated intravascular coagulation was also unlikely because this patient had a calculated score of 2 based on the International Society of Thrombosis and Hemostasis criteria [3]. Given the patient’s concomitant leg wound and eosinophilia, vasculitis was also considered but was ruled out based on the wound biopsy results. An autoimmune etiology was deemed less likely given the lack of personal and family autoimmune history as well as the better explanation of vancomycin-induced cytopenia, given the time course. The Naranjo adverse drug reaction probability for vancomycin was calculated as a 6, making vancomycin a “probable” cause since this adverse reaction has previous conclusive reports, appeared after the drug was given, improved when the drug was discontinued, and other causes were ruled out. Notably, daily metabolic panels revealed no concordant renal dysfunction, indicating vancomycin-induced nephrotoxicity was unlikely to be the cause of the eosinophilia, although it has been shown to be associated with elevated eosinophil counts [4].\n\nDiscussion\n\nGiven the time course of the bicytopenia in our patient, it is likely that the same pathophysiologic process was responsible for the neutropenia and thrombocytopenia. While the etiology of vancomycin-induced cytopenias has not yet been fully elucidated, most evidence supports immune-mediated peripheral destruction as the cause over alternative possibilities such as bone marrow suppression or sequestration. Antibodies to neutrophils and platelets have been detected in cases of both neutropenia and thrombocytopenia.\n\nIn cases of vancomycin-induced neutropenia, onset typically occurs after a minimum of 12 days of vancomycin administration [5]. Numerous studies have found an increase in serum ANCA during episodes of neutropenia, although a causal relationship has never been established; one case report found ANCA testing was negative following the withdrawal of vancomycin after previously being positive during an episode of vancomycin-induced neutropenia [6–8]. ANCA is thought to induce peripheral destruction via a complement-mediated mechanism, according to an in vitro cytotoxicity test done by Akamizu et al on the serum of a patient with propylthiouracil-induced neutropenia with elevated ANCA [9]. As an alternative explanation, bone marrow suppression is a more unlikely cause given the inconsistency across case reports on bone marrow microscopic findings, the time lag after initial vancomycin dose to the neutropenia, the absence of dose dependence, and the rapid restoration of neutrophil and platelet counts once vancomycin is discontinued, as was seen in our patient [8].\n\nThrombocytopenia induced by vancomycin is postulated to also occur via an immune-mediated mechanism and most often reaches a nadir 8 days after initiation of therapy, although later times of onset have been documented [10]. Von Drygalski et al identified the presence of vancomycin-dependent, platelet-reactive antibodies in 34 patients (20%) suspected of having vancomycin-induced thrombocytopenia; no antibodies were found in 25 patients taking vancomycin without thrombocytopenia [10]. In the presence of vancomycin, the antibody is thought to bind to glycoprotein IIb/IIIa and cause phagocytic clearance by peripheral macrophages [11].\n\nEosinophilia is also an adverse drug reaction commonly linked to vancomycin, although the mechanism of drug-induced eosinophilia has yet to be elucidated [12]. Blumenthal et al found that 30.25% (n=314) of patients treated with vancomycin developed peripheral eosinophilia when compared with control patients [13]. Isolated eosinophilia is commonly believed to be a benign finding and not a cause for alteration of management; however, some reports suggest further scrutiny may be required because an increased risk of rash, renal injury, and DRESS syndrome can be linked to drug-induced eosinophilia [12,13]. For example, some studies have found eosinophilia to be associated in particular with cases of vancomycin-induced nephrotoxicity; therefore, evaluation of renal function is prudent in patients on long-term therapy who develop eosinophilia [4].\n\nThe neutropenia and thrombocytopenia in our patient were significant and required changes in her clinical care. Our patient was placed on neutropenic precautions to avoid infection owing to her immunocompromised status. She was also regularly monitored for evidence of active bleeding owing to the thrombocytopenia. While drug-induced thrombocytopenia is not typically associated with ecchymoses and hemorrhage, one-third of the vancomycin-induced thrombocytopenia cases reviewed by Von Drygalski et al had evidence of significant bleeding at very low platelet counts [10].\n\nIn our patient, when the hematologic abnormalities were identified, vancomycin was promptly discontinued, and recovery of her cell counts was noted by the fifth day after stoppage. For continued MRSA coverage, we changed her medication to daptomycin, but other options, per the Infectious Disease Society of America guidelines, could have included linezolid or clindamycin [14]. Another option to consider in similar patients is teicoplanin, an alternative glycopeptide; however, a retrospective study by Wu et al showed evidence that patients with a history of vancomycin-induced neutropenia had an increased incidence of developing neutropenia during long-term teicoplanin exposure [15]. While some reported cases have used filgrastim to aid in restoring neutrophil counts, our patient and other reported cases demonstrate that neutrophil counts can recover spontaneously without adjuvant therapy [5,6,8].\n\nIt is important to note that reexposure to vancomycin can potentially induce a rapid reoccurrence of a previous cytopenia because of the presence of long-lasting antibodies. Cases of rapid development of thrombocytopenia with severe bleeding within 24 hours of vancomycin reexposure in patients with history of vancomycin-induced thrombocytopenia have been reported [16]. Similar observations of reoccurrence of neutropenia have been made in patients with a history of vancomycin-induced neutropenia [17].\n\nLastly, it is worth noting that hematologic adverse reactions to vancomycin are not isolated to adult cases. Occurrences of thrombocytopenia and pancytopenia in children as young as newborns have been reported [18,19].\n\nConclusions\n\nVancomycin is an antibiotic commonly used for gram-positive infections and is associated with various hematologic adverse effects. In our case of suspected vancomycin-induced neutropenia, thrombocytopenia, and eosinophilia, prompt discontinuation of vancomycin resulted in a rapid restoration of cell counts without adjuvant therapy. Regular monitoring of cell counts, regardless of patient age, and inquiring about prior adverse hematologic reactions to vancomycin are key in the management of patients in need of long-term vancomycin therapy.\n\nThe authors would like to thank Nora Porter, MD for her guidance and for editing the manuscript.\n\nTable 1. Complete blood count results with differentials and creatinine levels in the patient corresponding with antibiotic regimen.\n\nLaboratory test\tVancomycin\t\nDay 1\tDay 2\tDay 3\tDay 5\tDay 12\tDay 13\tDay 19\tDay 26\tDay 33\tDay 34\tDay 35\tDay 36\tDay 37\tDay 38\tDay 40\t\nWhite blood cells (103/uL)\t12.9\t18.5\t17.7\t13.9\t8.2\t8.3\t7.2\t4.8\t0.9\t1.2\t1.7\t2.3\t3.2\t3.7\t5\t\nHemoglobin (g/dL)\t12.5\t11.1\t12.3\t10.5\t10.2\t10.5\t11.1\t11.4\t11.2\t10.8\t11.1\t9.8\t10.2\t10.3\t11.2\t\nHematocrit (%)\t37.5\t32.9\t37.5\t32.1\t31.5\t32.1\t35\t35.5\t34.6\t33.6\t34.5\t30.8\t32.6\t31.5\t35.6\t\nPlatelets (103/uL)\t377\t335\t–\t333\t307\t–\t261\t189\t126\t135\t168\t172\t210\t215\t250\t\nNeutrophils (%)\t67%\t84%\t75%\t61%\t50%\t–\t–\t38%\t22%\t13%\t16%\t39%\t41%\t50%\t47%\t\nEosinophils (%)\t2%\t–\t0%\t7%\t12%\t–\t–\t13%\t38%\t20%\t29%\t20%\t17%\t16%\t12%\t\nNeutrophils absolute (103/uL)\t8.7\t15.54\t13.3\t8.5\t4.1\t–\t–\t1.8\t0.24\t0.16\t0.43\t0.94\t1.3\t1.85\t2.3\t\nEosinophils absolute (10/uL)\t0.24\t–\t0.07\t0.92\t0.94\t–\t–\t0.63\t0.34\t0.24\t0.49\t0.46\t0.56\t0.59\t0.6\t\nCreatinine (mg/dL)\t0.6\t0.6\t0.7\t0.7\t0.7\t0.6\t0.6\t0.7\t0.5\t–\t–\t–\t–\t–\t0.7\t\nVancomycin 1250 mg q12h\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\nDaptomycin 10 mg/kg q24h\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\nCeftriaxone 2 g q24h\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\nCefepime 2 g q8h\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\t\nMetronidazole 500 mg q8h\n==== Refs\nReferences:\n\n1. Bruniera FR Ferreira FM Saviolli LR The use of vancomycin with its therapeutic and adverse effects: A review Eur Rev Med Pharmacol Sci 2015 19 4 694 700 25753888\n2. Rocha JL Kondo W Baptista MI Uncommon vancomycin-induced side effects Braz J Infect Dis 2002 6 4 196 200 12204187\n3. Taylor FB Jr Toh CH Hoots WK , Scientific Subcommittee on Disseminated Intravascular Coagulation (DIC) of the International Society on Thrombosis and Haemostasis (ISTH). Towards definition, clinical and laboratory criteria, and a scoring system for disseminated intravascular coagulation Thromb Haemost 2001 86 5 1327 30 11816725\n4. Madigan LM Fox LP Vancomycin-associated drug-induced hypersensitivity syndrome J Am Acad Dermatol 2019 81 1 123 28 30738120\n5. Segarra-Newnham M Tagoff SS Probable vancomycin-induced neutropenia Ann Pharmacother 2004 38 11 1855 59 15466904\n6. di Fonzo H Villegas Gutsch M Castroagudin A Agranulocytosis induced by vancomycin. Case report and literature review Am J Case Rep 2018 19 1053 56 30174327\n7. Grayson PC Sloan JM Niles JL Antineutrophil cytoplasmic antibodies, autoimmune neutropenia, and vasculitis Semin Arthritis Rheum 2011 41 3 424 33 21507463\n8. Schwartz MD Vancomycin-induced neutropenia in a patient positive for an antineutrophil antibody Pharmacotherapy 2002 22 6 783 88 12066971\n9. Akamizu T Ozaki S Hiratani H Drug-induced neutropenia associated with anti-neutrophil cytoplasmic antibodies (ANCA): Possible involvement of complement in granulocyte cytotoxicity Clin Exp Immunol 2002 127 1 92 98 11882038\n10. Von Drygalski A Curtis BR Bougie DW Vancomycin-induced immune thrombocytopenia N Engl J Med 2007 356 9 904 10 17329697\n11. Warkentin TE Drug-induced immune-mediated thrombocytopenia – from purpura to thrombosis N Engl J Med 2007 356 9 891 93 17329695\n12. Ramírez E Medrano-Casique N Tong HY Eosinophilic drug reactions detected by a prospective pharmacovigilance programme in a tertiary hospital Br J Clin Pharmacol 2017 83 2 400 15 27543764\n13. Blumenthal KG Patil SU Long AA The importance of vancomycin in drug rash with eosinophilia and systemic symptoms (DRESS) syndrome Allergy Asthma Proc 2012 33 2 165 71 22525393\n14. Liu C Bayer A Cosgrove SE Clinical practice guidelines by the Infectious Diseases Society of America for the treatment of methicillin-resistant Staphylococcus aureus infections in adults and children children [published correction appears in Clin Infect Dis. 2011 Aug 1;53(3)319] Clin Infect Dis 2011 52 3 e18 55 21208910\n15. Hsiao SH Chou CH Lin WL High risk of cross-reactivity between vancomycin and sequential teicoplanin therapy J Clin Pharm Ther 2012 37 3 296 300 22017186\n16. Getz TM Packer CD Rapid-onset vancomycin-induced thrombocytopenia with reexposure Ann Pharmacother 2019 53 12 1259 61 31353923\n17. Duff JM Moreb JS Muwalla F Severe neutropenia following a prolonged course of vancomycin that progressed to agranulocytosis with drug reexposure Ann Pharmacother 2012 46 1 e1 22170976\n18. Kalra K Mittal HG Maria A Vancomycin-induced thrombocytopenia in a newborn Drug Metab Pers Ther 2016 31 4 235 37 27849621\n19. Leng B Yan G Li T Hou N Vancomycin-induced reversible pancytopenia and rash in a 16-month-old boy with osteomyelitis: A case report Int J Clin Pharmacol Ther 2020 58 4 242 46 32000885\n\n", "fulltext_license": "CC BY-NC-ND", "issn_linking": "1941-5923", "issue": "22()", "journal": "The American journal of case reports", "keywords": null, "medline_ta": "Am J Case Rep", "mesh_terms": "D000900:Anti-Bacterial Agents; D004802:Eosinophilia; D005260:Female; D006801:Humans; D008875:Middle Aged; D009503:Neutropenia; D013921:Thrombocytopenia; D014640:Vancomycin", "nlm_unique_id": "101489566", "other_id": null, "pages": "e931647", "pmc": null, "pmid": "34101721", "pubdate": "2021-06-08", "publication_types": "D002363:Case Reports; D016428:Journal Article", "references": "30738120;22017186;11882038;17329697;27543764;12066971;31353923;21208910;17329695;22525393;11816725;30174327;27849621;25753888;32000885;21507463;12204187;15466904;22170976", "title": "Neutropenia, Thrombocytopenia, and Eosinophilia: An Unusual Triad in a Patient on Long-Term Vancomycin Therapy.", "title_normalized": "neutropenia thrombocytopenia and eosinophilia an unusual triad in a patient on long term vancomycin therapy" }
[ { "companynumb": "US-SLATE RUN PHARMACEUTICALS-21US000537", "fulfillexpeditecriteria": "2", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "6", "activesubstance": { "activesubstancename": "CEFTRIAXONE" }, "drugadditional...
{ "abstract": "This phase I trial evaluated LY2603618, a selective inhibitor of the DNA damage checkpoint kinase 1, in combination with gemcitabine. Japanese patients with advanced solid tumors were enrolled. All patients received gemcitabine (1000 mg/m on days 1, 8, and 15 every 28 days) and either 170 mg (cohort 1) or 230 mg (cohort 2) of LY2603618. The primary objective was assessment of safety/tolerability. Pharmacokinetic/pharmacodynamic marker profiles were secondary objectives. Of the 17 patients enrolled, dose-limiting toxicities were observed in one patient in cohort 1 (n=7) and in two patients in cohort 2 (n=10). The most common grade 3 or more drug-related treatment-emergent adverse events were hematological. Three patients discontinued because of adverse events. Dose-dependent decreases in LY2603618 exposure were observed, but the LY2603618 pharmacokinetics at each dose were consistent within and between cycles and did not influence gemcitabine pharmacokinetics. Circulating plasma DNA decreased from baseline in all four patients who achieved a partial response. Administration of 170 or 230 mg of LY2603618 following a standard dose of gemcitabine showed acceptable safety and tolerability in Japanese patients with solid tumors.", "affiliations": "aDepartment of Gastrointestinal Oncology bDepartment of Breast and Medical Oncology, National Cancer Center Hospital East, Kashiwa, Chiba cEli Lilly Japan K.K., Kobe, Japan dEli Lilly and Company, Indianapolis, Indiana, USA.", "authors": "Doi|Toshihiko|T|;Yoshino|Takayuki|T|;Shitara|Kohei|K|;Matsubara|Nobuaki|N|;Fuse|Nozomu|N|;Naito|Yoichi|Y|;Uenaka|Kazunori|K|;Nakamura|Takashi|T|;Hynes|Scott M|SM|;Lin|Aimee Bence|AB|", "chemical_list": "C582547:LY2603618; D010671:Phenylurea Compounds; D047428:Protein Kinase Inhibitors; D011719:Pyrazines; D003841:Deoxycytidine; C056507:gemcitabine; D011494:Protein Kinases; C000605867:CHEK1 protein, human; D000071877:Checkpoint Kinase 1", "country": "England", "delete": false, "doi": "10.1097/CAD.0000000000000278", "fulltext": null, "fulltext_license": null, "issn_linking": "0959-4973", "issue": "26(10)", "journal": "Anti-cancer drugs", "keywords": null, "medline_ta": "Anticancer Drugs", "mesh_terms": "D000368:Aged; D000971:Antineoplastic Combined Chemotherapy Protocols; D000071877:Checkpoint Kinase 1; D003841:Deoxycytidine; D005260:Female; D006801:Humans; D008297:Male; D008875:Middle Aged; D009362:Neoplasm Metastasis; D009369:Neoplasms; D010671:Phenylurea Compounds; D047428:Protein Kinase Inhibitors; D011494:Protein Kinases; D011719:Pyrazines", "nlm_unique_id": "9100823", "other_id": null, "pages": "1043-53", "pmc": null, "pmid": "26288133", "pubdate": "2015-11", "publication_types": "D017426:Clinical Trial, Phase I; D016428:Journal Article; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "Phase I study of LY2603618, a CHK1 inhibitor, in combination with gemcitabine in Japanese patients with solid tumors.", "title_normalized": "phase i study of ly2603618 a chk1 inhibitor in combination with gemcitabine in japanese patients with solid tumors" }
[ { "companynumb": "JP-CIPLA LTD.-2015JP06876", "fulfillexpeditecriteria": "1", "occurcountry": "JP", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "GEMCITABINE\\GEMCITABINE HYDROCHLORIDE" }, "d...
{ "abstract": "Purpose Heat shock protein 27 (Hsp27) is implicated in prostate cancer progression. Apatorsen is a second generation phosphorothioate antisense inhibitor of Hsp27 expression. We evaluated apatorsen in patients with metastatic castration resistant prostate cancer (mCRPC). Experimental design Eligible patients were randomized 1:1 to receive intravenous apatorsen (3 loading doses of 600 mg within 5-9 days followed by weekly doses of 1000 mg) with oral prednisone 5 mg twice daily or prednisone alone. The primary endpoint was disease progression at 12 weeks. Crossover from prednisone alone was allowed after radiographic progression. Results 74 patients received apatorsen + prednisone (n = 36) or prednisone alone (n = 38). Twenty-five patients crossed-over to receive apatorsen + prednisone. Apatorsen treated patients received a median of 19 infusions. 50% of apatorsen + prednisone patients (95% CI: 32.9%, 67.1%) compared with 42% of prednisone patients (95% CI: 26.3%, 59.2%) did not have disease progression at week 12 (P = 0.33). A PSA decline of ≥50% was observed in 47% of apatorsen + prednisone and 24% of prednisone patients (P = 0.04), with a median duration of response of 24.1 weeks (95% CI: 12.0, 52) and 14.0 weeks (95% CI: 4.0, 44.4), respectively. A PSA decline of ≥50% was observed in 5 patients (20%) that received cross-over apatorsen. Infusion reactions were the most commonly reported adverse event occurring in 77% of apatorsen-treated patients. Conclusions Apatorsen + prednisone did not change the proportion of CRPC patients without disease progression at 12 weeks compared to prednisone but was associated with significant PSA declines. Further evaluation of Hsp27 targeting in prostate cancer is warranted.", "affiliations": "Division of Oncology, Department of Medicine, University of Washington School of Medicine, Seattle, WA, USA.;Division of Medical Oncology, Department of Medicine, University of British Columbia, Vancouver, BC, Canada.;Division of Medical Oncology, Department of Oncology, McMaster University, Hamilton, ON, Canada.;Division of Medical Oncology, Cancer Care Manitoba, University of Manitoba, Winnipeg, MB, Canada.;Kinghorn Cancer Center, St Vincents Hospital, Sydney, NSW, Australia.;Department of Urologic Sciences, Vancouver Prostate Centre, University of British Columbia, Vancouver, BC, Canada.;Division of Medical Oncology, Department of Medicine, University of British Columbia, Vancouver, BC, Canada. kchi@bccancer.bc.ca.", "authors": "Yu|Evan Y|EY|;Ellard|Susan L|SL|;Hotte|Sebastien J|SJ|;Gingerich|Joel R|JR|;Joshua|Anthony M|AM|;Gleave|Martin E|ME|;Chi|Kim N|KN|", "chemical_list": "D055551:HSP27 Heat-Shock Proteins; D009841:Oligonucleotides; D016376:Oligonucleotides, Antisense; D017430:Prostate-Specific Antigen; C000595177:apatorsen; D011241:Prednisone", "country": "United States", "delete": false, "doi": "10.1007/s10637-017-0553-x", "fulltext": null, "fulltext_license": null, "issn_linking": "0167-6997", "issue": "36(2)", "journal": "Investigational new drugs", "keywords": "Castration-resistant; Clinical trial; Heat shock protein 27; Prostate cancer; Randomized phase 2", "medline_ta": "Invest New Drugs", "mesh_terms": "D000328:Adult; D000368:Aged; D000369:Aged, 80 and over; D004305:Dose-Response Relationship, Drug; D023381:Endpoint Determination; D055551:HSP27 Heat-Shock Proteins; D006801:Humans; D008297:Male; D008875:Middle Aged; D009362:Neoplasm Metastasis; D009841:Oligonucleotides; D016376:Oligonucleotides, Antisense; D011241:Prednisone; D017430:Prostate-Specific Antigen; D064129:Prostatic Neoplasms, Castration-Resistant; D016896:Treatment Outcome", "nlm_unique_id": "8309330", "other_id": null, "pages": "278-287", "pmc": null, "pmid": "29250742", "pubdate": "2018-04", "publication_types": "D017427:Clinical Trial, Phase II; D003160:Comparative Study; D016428:Journal Article; D016449:Randomized Controlled Trial; D013485:Research Support, Non-U.S. Gov't", "references": null, "title": "A randomized phase 2 study of a HSP27 targeting antisense, apatorsen with prednisone versus prednisone alone, in patients with metastatic castration resistant prostate cancer.", "title_normalized": "a randomized phase 2 study of a hsp27 targeting antisense apatorsen with prednisone versus prednisone alone in patients with metastatic castration resistant prostate cancer" }
[ { "companynumb": "US-JUBILANT CADISTA PHARMACEUTICALS-2018JUB00018", "fulfillexpeditecriteria": "1", "occurcountry": "US", "patient": { "drug": [ { "actiondrug": "5", "activesubstance": { "activesubstancename": "PREDNISONE" }, "drugad...