index
int64
0
1,000k
blob_id
stringlengths
40
40
code
stringlengths
7
10.4M
997,900
98b5b340249219200457eb0d55f1c6d67775f5b1
#! /usr/bin/env python from tensorflow.contrib import learn import tensorflow as tf import numpy as np def tokenizer(iterator): """Tokenizer generator. Args: iterator: Input iterator with strings. Yields: array of tokens per each value in the input. """ for value in iterator: yield value def loadGloVe(filename): vocab = [] embd = [] file = open(filename,'r', encoding='utf8') for line in file.readlines(): row = line.strip().split(' ') if len(row) != 101: continue vocab.append(row[0].split('_')) embd.append(row[1:]) print('Loaded words vectors!') file.close() return vocab,embd def generateData(embiddingsFile, embeddingsDim, x_text, y, max_document_length): print("Loading words vectors!") embedding_dim = embeddingsDim filename = embiddingsFile vocab,embd = loadGloVe(filename) vocab_size = len(vocab) embedding_dim = len(embd[0]) #embedding = np.asarray(embd) embedding = np.asarray([np.asarray(xi, dtype=np.float32) for xi in embd]) W = tf.Variable(tf.constant(0.0, shape=[vocab_size, embedding_dim]), trainable=False, name="W") embedding_placeholder = tf.placeholder(tf.float32, [vocab_size, embedding_dim]) embedding_init = W.assign(embedding_placeholder) session_conf = tf.ConfigProto(allow_soft_placement=True, log_device_placement=False) sess = tf.Session(config=session_conf) feedDict = {embedding_placeholder: embedding} sess.run(embedding_init, feed_dict=feedDict)#[list(feedDict.keys())[0]]) #init vocab processor vocab_processor = learn.preprocessing.VocabularyProcessor(max_document_length, tokenizer_fn=tokenizer) #fit the vocab from glove pretrain = vocab_processor.fit(vocab) #transform inputs x = np.array(list(vocab_processor.transform(x_text))) return x, y, vocab_processor
997,901
02ff5bb01e006b5a0e9993ec7c2a8faf138ca06a
import random import names from itertools import cycle, islice, chain import time initial_decks = 3 initial_players = 4 initial_hand = 7 game_suits = ["Spades", "Hearts", "Clubs", "Diamonds"] special_values = { "A": 15, "2": 20, "8": 30, "J": 10, "Q": 10, "K": 10, "Joker": 50 } class Card: def __init__(self, rank, suit): self.rank = rank self.suit = suit self.card = (rank, suit) if self.rank in special_values: self.points = special_values[rank] else: self.points = int(rank) def __repr__(self): if self.rank == "Joker": return f"|{self.rank}|" else: return f"|{self.rank} of {self.suit}|" def __add__(self, p): return self.points + p.points class Player: def __init__(self, name): self.name = name self.hand = [] def __repr__(self): return self.name def play_card(self, card): if not is_valid(card): print("The play is not valid. JODETE! --> You draw 3 cards.") self.draw(3) return else: self.hand.remove(card) table.append(card) return card def draw(self, x): if len(deck) - 6 < x: shuffle() drawn = draw_from_deck(x) self.hand.extend(drawn) return drawn def calculate_points(self): points = 0 for card in self.hand: points = points + card.points return points def next_play(self): """ Automation of plays by CP.""" for card in self.hand: if is_valid(card): self.play_card(card) return card global forced_rank if forced_rank == "2": global two_multiplier self.draw(two_multiplier) print(f"{self.name} draws {str(two_multiplier)} cards.") two_multiplier = 0 forced_rank = False return None card = self.draw(1)[0] print(self.name + " draws a card.") if is_valid(card): self.play_card(card) return card print(self.name + " passes the turn.") def shuffle(): tabletop = table[-1] deck.extend(table[0:-1]) random.shuffle(deck) table.clear() table.append(tabletop) print("--> The table has been shuffled into de the deck. <--") def choose_suit(): return random.choice(game_suits) def create_players(n): players = list() for i in range(n): players.append(Player(names.get_full_name())) return players def create_deck(boxes, suits): a_deck = [] special = {1: "A", 11: "J", 12: "Q", 13: "K"} for a in range(boxes): for i in range(1, 14): for suit in suits: if i in special: i = special[i] card = Card(str(i), suit) a_deck.append(card) jokers = [Card("Joker", "Joker")] * 2 a_deck.extend(jokers) return a_deck def draw_from_deck(y): cards_drawn = [] for i in range(1, y+1): cards_drawn.append(deck.pop(random.randrange(len(deck)-1))) return cards_drawn def start_game(): players = create_players(initial_players - 1) user = input("What's your name? \n") players.append(Player(user)) random.shuffle(players) for player in players: player.draw(initial_hand) table.extend(draw_from_deck(1)) print("The game is starting. Players are, in order of the round:") time.sleep(2) for player in players: time.sleep(1) print("-- " + player.name) time.sleep(1) print("The top card of the deck is revealed:") time.sleep(1) print(table[-1]) time.sleep(2) print(f"{players[0]} will begin.") return players, user def is_valid(card): top = table[-1] valid_ranks = [top.rank, "8", "Joker"] if forced_rank: if card.rank != forced_rank: return False if card.rank in valid_ranks: return True if forced_suit: if card.suit == forced_suit: return True else: return False elif top.suit == card.suit: return True elif top.rank == card.rank: return True return False def user_turn(user): print("It's your turn. what card will you play?") time.sleep(1) print("Tabletop:" + str(table[-1])) time.sleep(1) print("Your hand:") print(user.hand) global forced_rank global two_multiplier while True: user_play = input('Type the card as shown in your hand, or "pass" to draw a card. \n') if user_play.lower() == "pass": if forced_rank == "2": draw = user.draw(two_multiplier) print(f"You drew {str(two_multiplier)} cards: {draw}.") forced_rank = False two_multiplier = 0 return else: draw = user.draw(1)[0] play_last_draw = input(f"You drew a {draw}. Want to play it? Y or N. \n") if play_last_draw.lower() == "y": print(f"You play a {draw}") play = user.play_card(draw) return play else: return else: card_input = user_play.split(" ") if len(card_input) == 3 or card_input[0].lower() == "joker": for card in user.hand: is_correct = card_input[0].lower() == "joker" and card.rank == "Joker" if not is_correct: is_correct = card_input[0].lower() == card.rank.lower() and card_input[2].lower() == card.suit.lower() if is_correct: print(f"You play a {card}") play = user.play_card(card) if forced_rank == "2" and not play: draw = user.draw(two_multiplier) print(f"You drew {str(two_multiplier)} cards: {draw}.") forced_rank = False two_multiplier = 0 return return play print("Input not valid! Try again.") def cp_turn(player): play = player.next_play() if play is not None: print(f"-- {player.name} plays a {play}.") return play def end_of_game(winner, players): print(f" {winner.name} has no more cards in hand. The game ended!") print("The final points are:") for player in players: print(player.name + ": " + str(player.calculate_points())) exit() def reverse_round(current_player): '''Returns a reversed cycle object starting with current player.''' players.reverse() reverse_players = cycle(players) while True: if next(reverse_players) == current_player: return reverse_players def main(players_, user_): players_cycle = cycle(players_) global forced_suit global forced_rank current_player = next(players_cycle) while True: print("The length of the deck is " + str(len(deck))) if user_ == current_player.name: played = user_turn(current_player) if len(current_player.hand) == 0: end_of_game(current_player, players_) if played: if played.rank == "8" or played.rank == "Joker": suit = input("--> Choose a suit. \n") while True: lower_suits = [i.lower() for i in game_suits] if suit.lower() in lower_suits: forced_suit = game_suits[lower_suits.index(suit.lower())] break else: suit = input("Suit is not valid. Type a valid suit.\n") else: forced_suit = False else: played = cp_turn(current_player) time.sleep(1) if len(current_player.hand) == 0: end_of_game(current_player, players_) if played: if played.rank == "8" or played.rank == "Joker": forced_suit = choose_suit() print(f"-- {current_player.name} chose {forced_suit}.") else: forced_suit = False if played: if played.rank == "2": global forced_rank forced_rank = "2" global two_multiplier two_multiplier += 2 if played.rank == "K": players_cycle = reverse_round(current_player) if played.rank == "J": next(players_cycle) if played.rank == "Q": next(players_cycle) next(players_cycle) if played.rank == "Joker": current_player = next(players_cycle) current_player.draw(4) print(f"{current_player} draws 4 cards.") continue current_player = next(players_cycle) deck = create_deck(initial_decks, game_suits) table = [] forced_rank = False forced_suit = False two_multiplier = 0 players, user = start_game() main(players, user) # todo shuffle deck
997,902
06791723f14d09a0b40ca6789b419e6a19669e82
# Given an array nums of n integers where n > 1, return an array output such that # output[i] is equal to the product of all the elements of nums except nums[i]. # # Example: # # Input: [1,2,3,4] # Output: [24,12,8,6] # Constraint: It's guaranteed that the product of the elements of # any prefix or suffix of the array (including the whole array) fits # in a 32 bit integer. # # Note: Please solve it without division and in O(n). # # Follow up: # Could you solve it with constant space complexity? (The output array does # not count as extra space for the purpose of space complexity analysis.) class Solution: def productExpectSelf(self, nums): res = [1] * len(nums) for i in range(1, len(nums)): res[i] = res[i - 1] * nums[i - 1] right = 1 for i in range(len(nums) - 2, -1, -1): right *= nums[i + 1] res[i] *= right return res
997,903
927edb138e5a55ba0f1bf8a3386aceb77c6d9153
class ContextSplitterStatus: NotStarted = 1 Started = 2 Ended = 3 class ContextSplitter: def __init__(self, context): self.status = ContextSplitterStatus.NotStarted self.context = context def start(self): self.status = ContextSplitterStatus.Started return self.context.__enter__() def end(self, exc): if exc is None: exc_type = None else: exc_type = type(exc) r = self.context.__exit__(exc_type, exc, None) self.status = ContextSplitterStatus.Ended return r def is_started(self)->bool: return self.status >= ContextSplitterStatus.Started def is_ended(self)->bool: return self.status == ContextSplitterStatus.Ended
997,904
e31d9ed50c35902d66be2cb39f91803ea9454963
# -*- coding: utf-8 -*- """ The Epilepsy Ecosystem's data has dropout; intervals in which the sensors failed to pick up signals. They are identified by all sensors reading 0 (which was numerically mapped to 0.034). This script extracts uninterrupted segments which we can draw images from safely @author: Bananin """ import numpy as np import pandas as pd import os # an interval's minimum duration in seconds min_duration = 5 F = 400 # Hz CHANNELS = np.array(["ch0","ch1","ch2","ch3","ch4","ch5","ch6","ch7","ch8","ch9", "ch10","ch11", "ch12","ch13","ch14","ch15"]) # directories containing the observations for each patient patient_dirs = [dir_pat for dir_pat in os.listdir("dataset") if dir_pat.startswith("Pat")] try: os.makedirs("intervals") except: pass for patient_dir in patient_dirs: print("Processing intervals in directory "+patient_dir) # list of uninterrupted intervals for this patient intervals = [] # this patient's .csv eeg files EEGs = [filename for filename in os.listdir("dataset/"+patient_dir)] for EEG in EEGs: # list all uninterrupted intervals for this segment (.csv file) segment = pd.read_csv("dataset/"+patient_dir+"/"+EEG) # dropout value is actually 0.034 segment.loc[:,CHANNELS] = segment.loc[:,CHANNELS].replace(0.034,0) sum_channels = np.sum(np.abs(segment.loc[:,CHANNELS]), axis=1) # look for uninterrupted intervals interval_start = 0 for i in range(len(segment)): if sum_channels[i] == 0 or i == len(segment)-1: # interruption due to dropout or file end if i-interval_start >= min_duration*F: # consolidate an interval (end tick not included) intervals.append({"start":interval_start,"end":i,"file":patient_dir+"/"+EEG}) interval_start = i+1 # store all discovered intervals for this patient intervals = pd.DataFrame(intervals) intervals.to_csv("intervals/"+patient_dir+".csv", index=False)
997,905
fccb6c7b9a9d4211d4e69aa1ebecbdc63e3fa5db
from django.urls import path from .import views app_name = "lists" urlpatterns = [ path('', views.lists, name='lists'), path('create/', views.list_create, name='create'), path('<slug:slug>/', views.list_detail, name='list_detail'), ]
997,906
3f59271ddf5bb5ca7210debe63aae261a7f4c199
""" You've built an inflight entertainment system with on-demand movie streaming. Users on longer flights like to start a second movie right when their first one ends, but they complain that the plane usually lands before they can see the ending. So you're building a feature for choosing two movies whose total runtimes will equal the exact flight length. Write a function that takes an integer flight_length (in minutes) and a list of integers movie_lengths (in minutes) and returns a boolean indicating whether there are two numbers in movie_lengths whose sum equals flight_length. When building your function: Assume your users will watch exactly two movies Don't make your users watch the same movie twice Optimize for runtime over memory. """ # Start coding from here
997,907
2f1a830e83c80bcb5e57a46890aa07638305f91d
""" class Phone: def __init__(self, height, display, camera, version): self.height = height self.display = display self.camera = camera self.version = version oppo = Phone(6, 5.7, 13, 7) vivo = Phone(5.5, 5.8, 20, 8) print(f"This is vivo display =>",vivo.display) print(f"this is my oppo camera {oppo.camera} mp lense") """ """ class ok: name = "lol" def __init__(self): self.name= "GabbAr" a = ok() print(a.name) print(ok.name) """ """ class hero: def __init__(self, name, age, power): self.name = name self.age = age self.power = power def compare_power(self, other): # to compare two diffrent objects if self.power == other.power: return True else: return False ironman = hero('ironman', 35, 99) captain = hero('captain', 28, 85) if captain.compare_power(ironman): print("Both have same power") else: print("Both have diffrent power") """ """ class Student: school = ("S.T. Xaviers High School") # class variable def __init__(self, maths, english, gujrati): # instance variable self.maths = maths self.english = english self.gujrati = gujrati def set_marks_maths(self, marks): self.maths = marks def get_marks_maths(self): print(self.maths) def set_marks_english(self, marks): self.english = marks def get_marks_english(self): print(self.english) def set_marks_gujrati(self, marks): self.gujrati = marks def get_marks_gujrati(self): print(self.gujrati) def info(cls): # this is example of class method print(Student.school) def ok(): # This is example of static method print("yes okay") raj = Student(85, 45, 56) raj.get_marks_gujrati() raj.set_marks_gujrati(58) raj.get_marks_gujrati() raj.info() # to call class method Student.ok() # to call static mathod """ ''' class A: def f1(self): print("f1 is working") def f2(self): print("f2 is working") class B(A): # Example of inheritance def f3(self): print("f3 is working") def f4(self): print("f4 is working") a = A() b = B() b.f1() # Example of inheritance ''' ''' class A: def f1(self): print("f1 is working") def f2(self): print("f2 is working") class B(A): def f3(self): print("f3 is working") def f4(self): print("f4 is working") class C(B): # multi lvl inheritance bcs class c taking all features from class a and class b def f5(self): print("f5 is working") a = A() b = B() c = C() c.f1() # Multi lvl inheritance ''' ''' class A: def f1(self): print("f1 is working") def f2(self): print("f2 is working") class B: def f3(self): print("f3 is working") def f4(self): print("f4 is working") class C(A,B): # Multiple inheritance def f5(self): print("f5 is working") a = A() b = B() c = C() c.f1() ''' class A: def __init__(self): print("A is initiated") def f1(self): print("f1 is working") def f2(self): print("f2 is working") class B: def __init__(self): print("B is initiated") def f3(self): print("f3 is working") def f4(self): print("f4 is working") class C(A,B): def __init__(self): super().__init__() # we can use super() method to tell to excute from super classes but remember if class has multiple classes than it will select from left to right , it's call Method Resolution Order (MRO) print("C is inititated") a = C() # so in this case , it will first look for in own class even if it's inheritance the other classes but if it's found same method in own class , it will excute it first for example here __init__ method
997,908
d6232c22f119b8c6edfcc7747f13c5999944a8cb
import datetime import random import uuid from locust import HttpUser, task, between from locust.contrib.fasthttp import FastHttpUser class RealityTubeUser(FastHttpUser): wait_time = lambda *args, **kwargs: 0 userId = None email = '' headers = None host = 'https://reality-tube.net/' def _index_page(self): self.client.get("/api/v1/config/") self.client.get("/api/v1/oauth-clients/local") self.client.get('/api/v1/videos/languages') self.client.get('/api/v1/plugins/peertube-plugin-simplelogo/public-settings') self.client.get('/api/v1/plugins/peertube-plugin-matomo/public-settings') self.client.get('/api/v1/plugins/peertube-plugin-custom-links/public-settings') self.client.get('/api/v1/plugins/peertube-plugin-custom-links/public-settings') self.client.get('/api/v1/videos/?start=0&count=25&sort=-publishedAt&skipCount=true') self.client.get('/api/v1/plugins/peertube-plugin-topmenu/public-settings') self.client.get('/api/v1/plugins/peertube-plugin-topmenu/public-settings') @task(1) def performance_test(self): self._index_page()
997,909
71eb2555faf009114c984c2cfc92bb407170fb42
"""Fixtures for testing mip app""" import string from typing import List import pytest from cg.apps.mip import MipAPI @pytest.fixture def valid_fastq_filename_pattern(): """the pattern MIP file names should match""" # 'xxx_R_1.fastq.gz and xxx_R_2.fastq.gz' return r"^.+_R_[1-2]{1}\.fastq.gz$" def _full_content(): """The content the files are made of""" return string.ascii_letters @pytest.fixture def files_content(tmpdir): """The content the files are made of""" return _full_content()[0 : len(_simple_files(tmpdir))] def simple(tmpdir): """Creates a dict with the data to use in the tests""" flowcells = [1, 2, 3, 4, 5, 6, 7, 8] lanes = [1, 2, 3] reads = [1, 2] _simple = {"files": [], "data": []} i = 0 for read in reads: for flowcell in flowcells: for lane in lanes: content = _full_content()[i] file_path = create_file(tmpdir, flowcell, lane, read, content) _simple["files"].append(file_path) data = create_file_data(file_path, flowcell, lane, read) _simple["data"].append(data) i += 1 return _simple def _simple_files(tmpdir): """"Some files to test with""" return simple(tmpdir)["files"] @pytest.fixture def simple_files(tmpdir): """"Some files to test with""" return _simple_files(tmpdir) @pytest.fixture def simple_files_data(tmpdir): """Data for link method""" return simple(tmpdir)["data"] def create_file(tmpdir, flowcell, lane, read, file_content): """actual file on disk""" file_name = f"S1_FC000{flowcell}_L00{lane}_R_{read}.fastq.gz" file_path = tmpdir / file_name file_path.write(file_content) return file_path def create_file_data(file_path, flowcell, lane, read): """meta data about a file on disk""" data = { "path": file_path, "lane": lane, "flowcell": flowcell, "read": read, "undetermined": False, } return data @pytest.fixture def cg_config(): """mock relevant parts of a cg-config""" return {} @pytest.fixture def link_family(): """mock family name""" return "family" @pytest.fixture def link_sample(): """mock sample name""" return "sample" class MockTB: """Trailblazer mock fixture""" def __init__(self): self._link_was_called = False def link(self, family: str, sample: str, analysis_type: str, files: List[str]): """Link files mock""" del family, sample, analysis_type, files self._link_was_called = True def link_was_called(self): """Check if link has been called""" return self._link_was_called @pytest.fixture def tb_api(): """Trailblazer API fixture""" return MockTB() @pytest.fixture(scope="session") def mip_api(): """MipAPI fixture""" _mip_api = MipAPI(script="test/fake_mip.pl", pipeline="analyse rd_dna") return _mip_api @pytest.fixture def mip_config_path(): """path to a mip config""" return "tests/fixtures/global_config.yaml" @pytest.fixture def case_id(): """the name of a case""" return "angrybird"
997,910
1592f15714eafd518c2944b7b32abc795c47aadb
import re import enchant dictio = enchant.Dict("en_US") def get_binary(mystring): out = [] foo = len(mystring) num = "" for i in range(0,foo): num += "0" out.append(num) while "0" in num: num = bin(int(num,2) + 1)[2:] while len(num) < foo: num = "0" + num out.append(num) return out def get_countries(): output = [] with open ("C:/Users/cdobb/Desktop/Python_stuff/sunday_puzzle/07_14_2019/countries.csv", "r") as BigFile: data=BigFile.readlines() for i in range(len(data)): mylist = re.split('"', data[i]) output.append(mylist[1].lower()) return output foo = get_countries() #ignore ones with spaces for now bar = [] for x in foo: if " " not in x: bar.append(x) #print(bar) #1. get all binary numbers in strings for length of name #print(bar[3]) #print(get_binary(bar[3])) #2. check if 2 real words for 1's part and 0's part for each country for x in bar: tempbin = get_binary(x) for bins in tempbin: i = 0 thing1 = "" thing2 = "" for zerone in bins: if zerone == "0": thing1 += x[i] i+=1 if zerone == "1": thing2 += x[i] i+=1 if thing1 != "" and thing2 != "" and dictio.check(thing1) and dictio.check(thing2): print(x + ", " + thing1 + ", " + thing2)
997,911
835b67ffb0534a463b18ffcc01affb6434903cd8
#takes a list of words and returns numbers corresponding to the words' lengths def idk(lst): numbers = [] for x in lst: f = len(x) numbers.append(f) return numbers i = ["hi", "westside", "just", "later", "opposite"] print(idk(i))
997,912
599e9f50e2805cb123265cd1caadc27117096252
APP_ENV = 'local' DEBUG = True SQLALCHEMY_DATABASE_URI = 'postgresql://localhost/food' SQLALCHEMY_TRACK_MODIFICATIONS = False APP_NAME = 'NUTRITION_CHECK' APP_SECRET = 'fghjkl23456fcgvhbjnkmlrtyuio456723456'
997,913
c2a7661f5a1888930192a1ceb916ba01cfb6a29f
from swampy.TurtleWorld import * from polygon import * def flower(turtle, petals, radius, angle): for i in range(petals): petal(t, radius, angle) lt(t, 360.0/petals) def petal(turtle, radius, angle): for i in range(2): arc(turtle, radius, angle) lt(turtle, 180-angle) world = TurtleWorld() t = Turtle() t.delay = 0.01 petals = 5 arc_radius = 120 angle = 60 flower(t, petals, arc_radius, angle) die(t) wait_for_user()
997,914
5451b0059d7cfb6ce31e017b3be2947cf083513d
# streamlit app demo # from collections import namedtuple import streamlit as st import pandas as pd import numpy as np import tensorflow as tf from googletrans import Translator st.title("IChiba Category Wizard") DATA_URL = "data/ichiba_test_strict_100316_more.tsv.gz" LABEL_CSV = "data/labels.csv" Lab_name = namedtuple("lab_name", ["jpn", "eng"]) @st.cache def load_data(nrows): data = pd.read_csv( DATA_URL, nrows=nrows, compression="gzip", header=None, # no header in tsv sep="\t", quotechar='"', ) selected = data.iloc[:, [0, 1, 8]] # title, label-path, img_url selected.columns = ["title", "label", "image_url"] labels = pd.read_csv( LABEL_CSV, header=None, ) labels.columns = ["row", "lab", "jpn", "eng"] lab_dict = { lab: Lab_name(labels["jpn"][row], labels["eng"][row]) for row, lab in enumerate(labels["lab"]) } return selected, lab_dict data_load_state = st.text("Loading data...") data, labels = load_data(1000) data_load_state.text("Done! (using st.cache)") @st.cache def load_model(): clf_model = tf.keras.models.load_model("data/100316") match_model = tf.keras.models.load_model("data/100316_matcher") return clf_model, match_model model_load_state = st.text("Loading model...") clf_model, match_model = load_model() model_load_state.text("Done! (using st.cache)") if st.checkbox("Show raw data"): st.subheader("Raw data") st.write(data) st.subheader("Choose one product to show") @st.cache def gen_trans(t_): translator = Translator() t_zh = translator.translate(t_, dest="zh-CN").text t_en = translator.translate(t_, dest="en").text return t_zh, t_en item_idx = st.slider("item_idx", 0, 999, 10) item_data = data.iloc[item_idx, :] t_, l_ = item_data["title"], item_data["label"] t_zh, t_en = gen_trans(t_) st.markdown(f'- *Title*:{t_}\n- *中文*:{t_zh}\n- *English*:{t_en}\n- *Label*:{labels[l_]}') st.image(item_data["image_url"], width=None) st.subheader("IC predicts category based on product title") label_pred = clf_model(tf.constant([t_])) st.write(labels[label_pred.numpy()[0].decode()]) st.subheader("Check merchant category selection") inv_labels = {v: k for k, v in labels.items()} label_merchant = st.selectbox("Merchant chooses a category", list(labels.values())) st.write("Chosen:", label_merchant) match_pred = match_model([tf.constant([t_]), tf.constant([inv_labels[label_merchant]])]) st.write(match_pred)
997,915
1ef29d08abef2ecf246cd6bfbbab0077f4a55e08
import math def func(n, arr): delta = 0 for i in range(len(arr)): for j in range(len(arr)): if i == j: continue sum_before = arr[i] + arr[j] d2 = (arr[i] + arr[j]) * (arr[i] + arr[j]) - 4 * arr[i] * arr[j] # print(f"d2 = {d2}") if d2 < 0: continue d = math.sqrt(d2) x1 = (arr[i] + arr[j] - d) / 2 / arr[j] x2 = (arr[i] + arr[j] + d) / 2 / arr[j] x = round(x1 + (x2 - x1) / 2) # print(f"ai = {arr[i]}; aj = {arr[j]}; x_i = {x_i}; x1 = {x1}; x2 = {x2}") if (arr[i] / x).is_integer(): sum_after = arr[j] * x + arr[i] / x new_delta = sum_before - sum_after if new_delta > 0 and new_delta > delta: delta = new_delta return int(sum(arr) - delta) print(f"{func(5, [1, 2, 3, 4, 5])} = 14") print(f"{func(4, [4, 2, 4, 4])} = 14") print(f"{func(5, [2, 4, 2, 3, 7])} = 18") # n = int(input()) # arr = list(map(lambda _: int(_), input().split(' '))) # print(func(n, arr))
997,916
16061d2153892f72e010cc99ed5c30f464ddbb59
import random import string import time def random_string_generator(size=10, chars=string.ascii_lowercase + string.digits): return ''.join(random.choice(chars) for _ in range(size)) current_time_milli = lambda : int(round(time.time() * 1000))
997,917
b6c94c34952b4d3595d5de032a3d58b0aa3f3afd
import pandas as pd import numpy as np import matplotlib.pyplot as plt import operator df = pd.read_csv('http://web.mta.info/developers/data/nyct/turnstile/turnstile_180630.txt') df.columns = df.columns.str.strip() df['real_entries'] = df['ENTRIES'].diff() df['real_exits'] = df['EXITS'].diff() df.loc[df['real_entries'] < 0] = np.nan df.loc[df['real_exits'] < 0] = np.nan df.loc[df['real_entries'] > 100000] = np.nan df.loc[df['real_exits'] > 100000] = np.nan print(df.columns) station_1_av = df[df['STATION'] == '1 AV'] print(df.sort_values(by='real_entries', ascending=False).head(100)) print(df.groupby(['STATION'])['real_entries', 'real_exits'].median()) new_df = df.groupby(['STATION'])['real_entries', 'real_exits'].median() totals = {} for index, row in new_df.iterrows(): totals[index] = row['real_entries'] + row['real_exits'] sorted_totals = sorted(totals.items(), key=operator.itemgetter(1), reverse=True) print(sorted_totals)
997,918
75d421d04b665eb92406d486d214c25bd76d4834
import re import numpy as np import gensim import requests import json from scipy import spatial data = [] with open('./avas_list.txt') as inputfile: for line in inputfile: data.append(line) print("Loaded function data") model = gensim.models.KeyedVectors.load_word2vec_format('./GoogleNews-vectors-negative300.bin', binary=True, limit=500000) print("Loaded model") index2word_set = set(model.wv.index2word) def avg_feature_vector(sentence, model, num_features, index2word_set): words = sentence.split() feature_vec = np.zeros((num_features, ), dtype='float32') n_words = 0 for word in words: if word in index2word_set: n_words += 1 feature_vec = np.add(feature_vec, model[word]) if (n_words > 0): feature_vec = np.divide(feature_vec, n_words) return feature_vec def make_list(name): words = [] if('_' in name): #if snake case name = name.lower() words = name.split('_') else: #identify if camel case word = "" for c in name: if(c.islower()): word +=c else: words.append(word) word = "" word += c.lower() words.append(word) return words def make_sentence(words): sentence = "" for w in words: sentence += w sentence += " " return sentence[:-1] def similarity_sentences(s1, s2): s1_afv = avg_feature_vector(s1, model=model, num_features=300, index2word_set=index2word_set) s2_afv = avg_feature_vector(s2, model=model, num_features=300, index2word_set=index2word_set) sim = 1 - spatial.distance.cosine(s1_afv, s2_afv) return sim #s1 = make_sentence(make_list('remove')) #s2 = make_sentence(make_list('delete')) #print(similarity_sentences(s1,s2)) def camel_to_snake(name): list = make_list(name) new_name = "" for w in list: new_name += w new_name += "_" return new_name[:-1] def snake_to_camel(name): list = make_list(name) new_name = "" pp = False for w in list: c = w[0].upper() if pp else w[0].lower() pp = True new_name += c new_name += w[1:] return new_name def change_case(name): if('_' in name): #this is snake return snake_to_camel(name) return camel_to_snake(name) def find_synonyms(word): #dev return ["sum","total","append"] p = make_sentence(make_list(word)) s_list = [] #r = requests.get('https://wordsapiv1.p.mashape.com/words/'+word+'/synonyms' # , headers={"x-rapidapi-host": "wordsapiv1.p.rapidapi.com", # "x-rapidapi-key": ""} ) #print(json.loads(r.content)) #synonym_list = json.loads(r.content)['synonyms'] r = requests.get('https://words.bighugelabs.com/api/2/3d61b2dab0e22df66fd693006de7a367/'+word+'/json') j = json.loads(r.content) synonym_list = [] for (key,val) in j.items(): if('syn' in val.keys()): synonym_list += val['syn'] #synonym_list = j['noun']['syn'] + j['verb']['syn'] for s in synonym_list: if(s.count(' ')>0): continue p1 = make_sentence(make_list(s)) sim = similarity_sentences(p,p1) obj = ( s, sim) if(not np.isnan(sim)): s_list.append(obj) #print(s_list) s_list.sort(key = lambda synonym: synonym[1] ) firsts = [t[0] for t in s_list] return firsts[-3:] def getReplacementsName(name): #for each word in the name, get the replacements words = make_list(name) replace_dict = [] for w in words: w_replacements = find_synonyms(w) w_replacements.append(w) w_replacements = list(set(w_replacements)) replace_dict.append(w_replacements) a = replace_dict[0] for b in replace_dict[1:]: o = [] for ia in a: for ib in b: o.append(ia+"_"+ib) a = o ca = a.copy() for poss in a: ca.append(change_case(poss)) return ca def extractName(regex): i = regex.find("def") before = regex[:(i+4)] i += 4 name = "" while True: name+=regex[i] i+=1 if(i>=len(regex)): break if(i<len(regex) and not regex[i].isalpha() and not regex[i].isnumeric() and not regex[i]=='_'): break after = regex[i:] return before, name, after def replaceFunctionNames(regex): if(regex.find("def") == -1): #has no function def return regex before,name,after = extractName(regex) names = getReplacementsName(name) final_regex = regex for n in names: r = before + n r = r + after final_regex += '|('+r+')' return final_regex def lookup(regex): #nothing to do if(regex.find("def") == -1): return regex #fast search fast_regex = regex found = False r_before,r_def,r_after = extractName(regex) if not re.match(r'^[A-Za-z0-9_]+$', r_def): return regex r = make_sentence(make_list(r_def)) for d in data: d_before,d_def,d_after = extractName(d) d_s = make_sentence(make_list(d_def)) score = similarity_sentences(d_s,r) #print(r, d_s,score,d) if(score > 0.7): fast_regex += '|('+d_before+d_def+d_after+')' found = True #if(not found): # print("Nothing good and fast") #else: # print("GOOD:",fast_regex) #look for the synonyms r = replaceFunctionNames(regex) + '|'+fast_regex return r #print(extractName("def delete_selected")) print(lookup('def removeSelected')) #print(lookup('somestuff def base64ToInt\([a-z]*\): func')) #print(lookup('somestuff def checkErr: func')) #print(lookup('somestuff def add_one[a-z]*: func')) #print(replaceFunctionNames('somestuff def addOne\(\): func'))
997,919
a4fd04facdc2e0bef0d84215724b4f393d919b03
import copy import torch import pytest from transformers import AutoModel from allennlp.common import Params from allennlp.modules.transformer.attention_module import T5Attention from transformers.models.t5.configuration_t5 import T5Config from transformers.models.t5.modeling_t5 import T5Attention as HFT5Attention from allennlp.nn.util import min_value_of_dtype PARAMS_DICT = { "hidden_size": 6, "num_heads": 2, "key_value_proj_dim": 3, "dropout": 0.0, "relative_attention_num_buckets": 2, } @pytest.fixture def params_dict(): return copy.deepcopy(PARAMS_DICT) @pytest.fixture def params(params_dict): return Params(params_dict) @pytest.fixture def t5_attention(params): return T5Attention.from_params(params.duplicate()) def test_can_construct_from_params(t5_attention, params_dict): assert t5_attention.num_attention_heads == params_dict["num_heads"] assert t5_attention.attention_head_size == params_dict["key_value_proj_dim"] assert ( t5_attention.all_head_size == params_dict["num_heads"] * params_dict["key_value_proj_dim"] ) assert t5_attention.query.in_features == params_dict["hidden_size"] assert t5_attention.key.in_features == params_dict["hidden_size"] assert t5_attention.value.in_features == params_dict["hidden_size"] assert t5_attention.output.in_features == params_dict["hidden_size"] assert t5_attention.dropout == params_dict["dropout"] def test_forward_against_huggingface_output(params_dict): hidden_states = torch.randn(2, 3, 6) attention_mask = torch.tensor([[0, 1, 0], [1, 1, 0]]) hf_kwargs = { "d_model": params_dict["hidden_size"], "d_kv": params_dict["key_value_proj_dim"], "num_heads": params_dict["num_heads"], "relative_attention_num_buckets": params_dict["relative_attention_num_buckets"], "dropout_rate": params_dict["dropout"], } torch.manual_seed(1234) hf_module = HFT5Attention(T5Config(**hf_kwargs), has_relative_attention_bias=False) torch.manual_seed(1234) params = copy.deepcopy(params_dict) params["normalize"] = False # only for this test, as HF does not normalize. t5_attention = T5Attention(**params) # setting to eval mode to avoid non-deterministic dropout. t5_attention = t5_attention.eval() hf_module = hf_module.eval() output = t5_attention.forward(hidden_states, mask=attention_mask) attention_mask_hf = (attention_mask == 0).view((2, 1, 1, 3)).expand( 2, 2, 3, 3 ) * min_value_of_dtype(hidden_states.dtype) hf_output = hf_module.forward(hidden_states, mask=attention_mask_hf) hs = output.hidden_states assert torch.allclose(hs, hf_output[0]) @pytest.mark.parametrize( "pretrained_name, relevant_module", [ ("t5-small", "encoder.block.0.layer.0.SelfAttention"), ], ) def test_loading_from_pretrained_weights_using_model_name(pretrained_name, relevant_module): torch.manual_seed(1234) module = T5Attention.from_pretrained_module(pretrained_name, relevant_module=relevant_module) torch.manual_seed(1234) pretrained_module = dict(AutoModel.from_pretrained(pretrained_name).named_modules())[ relevant_module ] batch_size = 2 seq_len = 3 dim = module.query.in_features hidden_states = torch.randn(batch_size, seq_len, dim) attention_mask = torch.tensor([[1, 1, 0], [1, 0, 1]])[:, None, None, :] # setting to eval mode to avoid non-deterministic dropout. module = module.eval() pretrained_module = pretrained_module.eval() torch.manual_seed(1234) output = module(hidden_states, mask=attention_mask.squeeze()).hidden_states # The attn_mask is processed outside the self attention module in HF bert models. attention_mask = (~(attention_mask == 1)) * min_value_of_dtype(hidden_states.dtype) torch.manual_seed(1234) hf_output = pretrained_module(hidden_states, mask=attention_mask)[0] assert torch.allclose(output, hf_output)
997,920
5cbb3bf73b4f83885b6c5e22369680c7e5eaa815
import hdf_pull import netCDF_build as netcdf from mpl_toolkits.basemap import Basemap import numpy as np import matplotlib.pyplot as plt import matplotlib as mpl import csv files = hdf_pull.file_path("\Aqua") #print files """plotting frp with frp intensity colour for single hdf file""" def plot_fire(FP_data,i,date_time): # FP_data is a array with lat,long,FRP and Confidane latitude = FP_data[0,:] longitude = FP_data[1,:] FRP=FP_data[2,:] # llcrnrlat,llcrnrlon,urcrnrlat,urcrnrlon # are the lat/lon values of the lower left and upper right corners # of the map. # resolution = 'i' means use intermediate resolution coastlines. # lon_0, lat_0 are the central longitude and latitude of the projection. m = Basemap(llcrnrlon=124,llcrnrlat=-17,urcrnrlon=129,urcrnrlat=-14, resolution='i',projection='tmerc',lon_0=126,lat_0=-15) m.drawcoastlines() m.drawmapboundary()#(color='lightgray',fill_color='aqua') m.fillcontinents(lake_color='aqua',zorder=0) # draw parallels and meridians. m.drawparallels(np.arange(-40,61.,0.5), labels = [True]) m.drawmeridians(np.arange(100.,140.,0.5), labels = [True]) #m.drawmapboundary(fill_color='aqua') #FRP.max() x, y = m(longitude, latitude) m.scatter(x, y, c=FRP, s = 150, marker ='^', zorder=10,norm=mpl.colors.SymLogNorm(linthresh=10, vmin=0, vmax=(1000))) m.shadedrelief() cb = m.colorbar() cb.set_ticks([0,10,100,500,1000]) plt.title(date_time) plt.show() plt.savefig('C:\Users\Hannah.N\Documents\Data\Sept_Oct2016_data\images\MODIS_'+ str(i) +'.png') plt.close() file_info = netcdf.file_info() #print file_info i=1 for x in file_info: try: #print x[0] data = hdf_pull.read_in(x[0]) FP_data = hdf_pull.FP_data_pull(data) date_time = x[2] plot_fire(FP_data,i,date_time) i = i+1 except ValueError as error: bad_files = [] bad_files.append(x) with open('bad_files', 'wb') as myfile: wr = csv.writer(myfile, quoting=csv.QUOTE_ALL) wr.writerow(bad_files) """ file = files[1] data = hdf_pull.read_in(file[0]) hdf_pull.list_sds(data) FP_data = hdf_pull.FP_data_pull(data) FRP_map_plot.plot_fire(FP_data) """
997,921
e68fccf24607b81344e350c18565fe43e4f364fe
## Randy: This run took about 4 hours, as it is set up now. """ Module to set up run time parameters for Clawpack. The values set in the function setrun are then written out to data files that will be read in by the Fortran code. """ import os from pyclaw import data import numpy as np #------------------------------ def setrun(claw_pkg='geoclaw'): #------------------------------ """ Define the parameters used for running Clawpack. INPUT: claw_pkg expected to be "geoclaw" for this setrun. OUTPUT: rundata - object of class ClawRunData """ assert claw_pkg.lower() == 'geoclaw', "Expected claw_pkg = 'geoclaw'" ndim = 2 rundata = data.ClawRunData(claw_pkg, ndim) #------------------------------------------------------------------ # Problem-specific parameters to be written to setprob.data: #------------------------------------------------------------------ #probdata = rundata.new_UserData(name='probdata',fname='setprob.data') #------------------------------------------------------------------ # GeoClaw specific parameters: #------------------------------------------------------------------ rundata = setgeo(rundata) # Defined below #------------------------------------------------------------------ # Standard Clawpack parameters to be written to claw.data: # (or to amr2ez.data for AMR) #------------------------------------------------------------------ clawdata = rundata.clawdata # initialized when rundata instantiated clawdata.restart = False # Turn restart switch on or off # Set single grid parameters first. # See below for AMR parameters. # --------------- # Spatial domain: # --------------- # Number of space dimensions: clawdata.ndim = ndim # Lower and upper edge of computational domain: # clawdata.xlower = 137.57 ## # clawdata.xupper = 141.41 ## # clawdata.ylower = 39.67 ## # clawdata.yupper = 44.15 ## # For OK08 grid: # clawdata.xlower = 138.5015 ## # clawdata.xupper = 140.541 ## # clawdata.ylower = 40.5215 ## # clawdata.yupper = 43.2988 ## clawdata.xlower = 139.05 ## clawdata.xupper = 140. ## clawdata.ylower = 41.6 ## clawdata.yupper = 42.55 ## # # Number of grid cells: # clawdata.mx = 36 ## 3.84 deg/36 cells = 384 sec/cell = 16*24 sec/cell # clawdata.my = 42 ## 4.48 deg/42 cells = 384 sec/cell = 16*24 sec/cell # clawdata.mx = 576 ## 3.84 deg/576 cells = 24 sec/cell # clawdata.my = 672 ## 4.48 deg/672 cells = 24 sec/cell # clawdata.mx = 84 ## 8*24 sec/cell # clawdata.my = 72 ## 8*24 sec/cell clawdata.mx = 60 clawdata.my = 60 # --------------- # Size of system: # --------------- # Number of equations in the system: clawdata.meqn = 3 # Number of auxiliary variables in the aux array (initialized in setaux) clawdata.maux = 3 # Index of aux array corresponding to capacity function, if there is one: clawdata.mcapa = 2 # ------------- # Initial time: # ------------- clawdata.t0 = 0.0 # ------------- # Output times: #-------------- # Specify at what times the results should be written to fort.q files. # Note that the time integration stops after the final output time. # The solution at initial time t0 is always written in addition. clawdata.outstyle = 1 ## if clawdata.outstyle==1: # Output nout frames at equally spaced times up to tfinal: # Note: Frame time intervals = (tfinal-t0)/nout clawdata.nout = 10 ## Number of frames (plus the t = 0.0 frame) clawdata.tfinal = 6.5*60 ## End run time in Seconds elif clawdata.outstyle == 2: # Specify a list of output times. from numpy import arange,linspace #clawdata.tout = list(arange(0,3600,360)) + list(3600*arange(0,21,0.5)) # clawdata.tout = list(linspace(0,32000,9)) + \ # list(linspace(32500,40000,16)) clawdata.tout = list(linspace(0,4,2)) clawdata.nout = len(clawdata.tout) elif clawdata.outstyle == 3: # Output every iout timesteps with a total of ntot time steps: iout = 1 ntot = 1 clawdata.iout = [iout, ntot] # --------------------------------------------------- # Verbosity of messages to screen during integration: # --------------------------------------------------- # The current t, dt, and cfl will be printed every time step # at AMR levels <= verbosity. Set verbosity = 0 for no printing. # (E.g. verbosity == 2 means print only on levels 1 and 2.) clawdata.verbosity = 1 # -------------- # Time stepping: # -------------- # if dt_variable==1: variable time steps used based on cfl_desired, # if dt_variable==0: fixed time steps dt = dt_initial will always be used. clawdata.dt_variable = 1 # Initial time step for variable dt. # If dt_variable==0 then dt=dt_initial for all steps: clawdata.dt_initial = 0.016 # Max time step to be allowed if variable dt used: clawdata.dt_max = 1e+99 # Desired Courant number if variable dt used, and max to allow without # retaking step with a smaller dt: clawdata.cfl_desired = 0.75 clawdata.cfl_max = 1.0 # Maximum number of time steps to allow between output times: clawdata.max_steps = 50000 # ------------------ # Method to be used: # ------------------ # Order of accuracy: 1 => Godunov, 2 => Lax-Wendroff plus limiters clawdata.order = 2 # Transverse order for 2d or 3d (not used in 1d): clawdata.order_trans = 2 # Number of waves in the Riemann solution: clawdata.mwaves = 3 # List of limiters to use for each wave family: # Required: len(mthlim) == mwaves clawdata.mthlim = [3,3,3] # Source terms splitting: # src_split == 0 => no source term (src routine never called) # src_split == 1 => Godunov (1st order) splitting used, # src_split == 2 => Strang (2nd order) splitting used, not recommended. clawdata.src_split = 1 # -------------------- # Boundary conditions: # -------------------- # Number of ghost cells (usually 2) clawdata.mbc = 2 # Choice of BCs at xlower and xupper: # 0 => user specified (must modify bcN.f to use this option) # 1 => extrapolation (non-reflecting outflow) # 2 => periodic (must specify this at both boundaries) # 3 => solid wall for systems where q(2) is normal velocity clawdata.mthbc_xlower = 1 # Open Left BC clawdata.mthbc_xupper = 1 # Open Right BC clawdata.mthbc_ylower = 1 # Open Bottom BC clawdata.mthbc_yupper = 1 # Open Top BC # --------------- # AMR parameters: # --------------- # max number of refinement levels: mxnest = 5 ## clawdata.mxnest = -mxnest # negative ==> anisotropic refinement in x,y,t # List of refinement ratios at each level (length at least mxnest-1) ## Levels 2 3 4 5 clawdata.inratx = [2,4,4,6] ## clawdata.inraty = [2,4,4,6] ## clawdata.inratt = [2,4,4,2] ## # Specify type of each aux variable in clawdata.auxtype. # This must be a list of length maux, each element of which is one of: # 'center', 'capacity', 'xleft', or 'yleft' (see documentation). clawdata.auxtype = ['center','capacity','yleft'] clawdata.tol = -1.0 # negative ==> don't use Richardson estimator clawdata.tolsp = 0.5 # used in default flag2refine subroutine # (Not used in geoclaw!) clawdata.kcheck = 3 # how often to regrid (every kcheck steps) clawdata.ibuff = 2 # width of buffer zone around flagged points clawdata.tchk = [33000., 35000.] # when to checkpoint # More AMR parameters can be set -- see the defaults in pyclaw/data.py return rundata # end of function setrun # ---------------------- #------------------- def setgeo(rundata): #------------------- """ Set GeoClaw specific runtime parameters. For documentation see .... """ try: geodata = rundata.geodata except: print "*** Error, this rundata has no geodata attribute" raise AttributeError("Missing geodata attribute") # == setgeo.data values == geodata.variable_dt_refinement_ratios = True ## Overrides clawdata.inratt, above geodata.igravity = 1 geodata.gravity = 9.81 geodata.icoordsys = 2 geodata.Rearth = 6367.5e3 geodata.icoriolis = 0 # == settsunami.data values == geodata.sealevel = 0. geodata.drytolerance = 1.e-2 geodata.wavetolerance = 1.e-1 ## geodata.depthdeep = 1.e6 ## Definition of "deep" water geodata.maxleveldeep = 10 ## Restriction on the number of deep water levels geodata.ifriction = 1 ## Friction switch. 0=off, 1=on # geodata.coeffmanning =0.0 geodata.coeffmanning =.025 geodata.frictiondepth = 10. #okushiri_dir = '/Users/FrankGonzalez/daily/modeling/tsunami-benchmarks/github/' \ #+ 'FrankGonzalez/geoclaw-group/benchmarks/bp09' ## okushiri_dir = '..' ## this directory # == settopo.data values == geodata.topofiles = [] # for topography, append lines of the form # [topotype, minlevel, maxlevel, t1, t2, fname] # geodata.topofiles.append([1, 1, 1, 0, 1.e10, \ # okushiri_dir + '/OK24.tt1']) ## 24-s, ~550-740 m Entire Domain (Dmitry's version of Kansai U.) geodata.topofiles.append([1, 1, 1, 0, 1.e10, \ okushiri_dir + '/OK08.tt1']) ## 8-s, ~184-247 m Okushiri (Dmitry's version of Kansai U.) geodata.topofiles.append([1, 1, 1, 0, 1.e10, \ okushiri_dir + '/OK03.tt1']) ## 2.67 s (8/3s), ~61-82 m Okushiri (Dmitry's version of Kansai U.) geodata.topofiles.append([1, 1, 1, 0., 1.e10, \ okushiri_dir + '/AO15.tt1']) ## 0.53-0.89 s, ~16.5-20.4 m, Aonae (Dmitry's version of Kansai U.) # geodata.topofiles.append([1, 1, 1, 0, 1.e10, \ # okushiri_dir + '/MO01.tt1']) ## 0.89 s, ~20-27 m, Monai (Dmitry's version of Kansai U.) # geodata.topofiles.append([1, 1, 1, 0., 1.e10, \ # okushiri_dir + '/MB05.tt1']) ## 0.13-0.18 s, ~4 m Monai (Dmitry's version of Kansai U.) # geodata.topofiles.append([-3, 1, 1, 0, 1.e10, \ # okushiri_dir + '/depth40_138.txt']) ## JODC 500 m # geodata.topofiles.append([-3, 1, 1, 0, 1.e10, \ # okushiri_dir + '/depth40_140.txt']) ## JODC 500 m # geodata.topofiles.append([-3, 1, 1, 0, 1.e10, \ # okushiri_dir + '/depth42_138.txt']) ## JODC 500 m # geodata.topofiles.append([-3, 1, 1, 0, 1.e10, \ # okushiri_dir + '/depth42_140.txt']) ## JODC 500 m # == setdtopo.data values == geodata.dtopofiles = [] # for moving topography, append lines of the form: (<= 1 allowed for now!) # [topotype, minlevel,maxlevel,fname] geodata.dtopofiles.append([1,2,3, okushiri_dir + '/HNO1993.txyz']) ## Dmitry N.'s version of Kansai U. # == setqinit.data values == geodata.iqinit = 0 geodata.qinitfiles = [] # for qinit perturbations, append lines of the form: (<= 1 allowed for now!) # [minlev, maxlev, fname] #geodata.qinitfiles.append([1, 1, 'hump.xyz']) # == setregions.data values == geodata.regions = [] # to specify regions of refinement append lines of the form # [minlevel,maxlevel,t1,t2,x1,x2,y1,y2] # Note: Level 1 = 24 s & Levels [2,3,4,5] = RF [3,3,3,8] => Res of 8 sec to 8/3 sec to 8/9 to 1/9 sec/cell # Grid Limits # Name x1 x2 y1 y2 # OK24 137.53666670 141.53000000 39.53666670 44.26333330 # HNO 138.50000000 140.55000000 40.51666670 43.30000000 # OK08 138.50111110 140.55222220 40.52111110 43.29888890 # OK03 139.38925930 139.66407410 41.99592590 42.27074070 # AO15 139.43419750 139.49987650 42.03118520 42.07251850 # MO01 139.41123460 139.43320990 42.07790120 42.14580250 # MB05 139.41385190 139.42639510 42.09458550 42.10343920 #geodata.regions.append([1, 1, 0., 1e9, 0.0, 360.0, -90.0, 90.0]) ## OK24: 24-s, ~550-740 m Entire Domain geodata.regions.append([1, 2, 0., 1e9, 138.5, 139.7, 41.4, 43.3]) ## OK08: 8-s, ~184-247 m Okushiri geodata.regions.append([1, 3, 0., 1e9, 139.39, 139.6, 42.0, 42.25]) ## OK03: 2.67 s (8/3s), ~61-82 m Okushiri # geodata.regions.append([1, 4, 0., 1e9, 139.42, 139.57, 42.03, 42.23]) ## AO15: 0.53-8/9 s, ~16.5-20.4 m, Aonae #geodata.regions.append([1, 4, 0., 1e9, 139.40, 139.46, 42.03, 42.22]) ## West coast Okushiri geodata.regions.append([4, 4, 90., 1e9, 139.42, 139.431, 42.07, 42.12]) # == setgauges.data values == geodata.gauges = [] # for gauges append lines of the form [gaugeno, x, y, t1, t2] # geodata.gauges.append([1,139.429211710298,42.188181491811,0.0,1e9]) ## Tsuji Obs # geodata.gauges.append([3,139.411185686023,42.162762869034,0.0,1e9]) ## Tsuji Obs # geodata.gauges.append([5,139.418261206409,42.137404393442,0.0,1e9]) ## Tsuji Obs geodata.gauges.append([6,139.428035766149,42.093012384481,0.0,1e9]) ## Tsuji Obs geodata.gauges.append([7,139.426244998662,42.116554785296,0.0,1e9]) ## Tsuji Obs geodata.gauges.append([8,139.423714744650,42.100414145210,0.0,1e9]) ## Tsuji Obs geodata.gauges.append([9,139.428901803617,42.076636582137,0.0,1e9]) ## Tsuji Obs # geodata.gauges.append([10,139.427853421935,42.065461519438,0.0,1e9]) ## Tsuji Obs # geodata.gauges.append([11,139.451539852594,42.044696547058,0.0,1e9]) ## Tsuji Obs # geodata.gauges.append([12,139.456528443496,42.051692262353,0.0,1e9]) ## Tsuji Obs # geodata.gauges.append([13,139.456528443496,42.051692262353,0.0,1e9]) ## Tsuji Obs # # == setfixedgrids.data values == geodata.fixedgrids = [] for g in geodata.gauges: xg = g[1] yg = g[2] xg1 = xg - 0.001 xg2 = xg + 0.002 yg1 = yg - 0.001 yg2 = yg + 0.002 nx = 31 ny = 31 gaugeno = g[0] if gaugeno == 9: xg2 = xg + 0.003 nx = 41 if gaugeno == 8: xg1 = xg - 0.002 xg2 = xg + 0.001 yg1 = yg - 0.002 yg2 = yg + 0.001 geodata.fixedgrids.append([210.0,360.0,11,xg1,xg2,yg1,yg2,nx,ny,0,1]) geodata.regions.append([5, 5, 180., 1e9, xg1,xg2,yg1,yg2]) return rundata # end of function setgeo # ---------------------- if __name__ == '__main__': # Set up run-time parameters and write all data files. import sys if len(sys.argv) == 2: rundata = setrun(sys.argv[1]) else: rundata = setrun() rundata.write()
997,922
f465bcc50bd3cb5bfc28b1d3466c52f4a13d7761
#!/usr/bin/python # -*- coding: UTF-8 -*- import ConfigParser import os import datetime import random def gen_dates(base_date, days): """ Generate days list :param base_date: start date :param days: how many days to generate the list :return: days list """ day = datetime.timedelta(days = 1) for i in range(days): yield base_date + day * i def generate_log(dir, start_date, end_date, ip_addr, http_verb_uri_collect, http_verb_uri_other, per_200, resp_time_90, resp_time_95, resp_time_99): """ Generate logs :param dir: the directory to generate logs :param start_date: start date :param end_date: end date :param ip_addr: ip address :param http_verb_uri_collect: the http verb uri to collect :param http_verb_uri_other: the interferential http verb uri :param per_200: the percentage of success response :param resp_time_90: the response time in milliseconds to generate in 90% of requests :param resp_time_95: the response time in milliseconds to generate in 95% of requests :param resp_time_99: the response time in milliseconds to generate in 99% of requests :return: """ for date in gen_dates(start_date, (end_date - start_date).days + 1): filename = date.strftime(dir + "%Y-%m-%d" + ".log") next_day = start_date + datetime.timedelta(days = 1) log_time = start_date with open(filename, "w") as log_file: log_time = log_time + datetime.timedelta(milliseconds = random.randint(100, 200)) while log_time < next_day: log_ip_addr = ip_addr.replace("*", str(random.randint(2, 5))) if random.randint(1, 10) <=9: http_verb_uri = http_verb_uri_collect.replace("%d", str(random.randint(1, 99))) else: http_verb_uri = http_verb_uri_other if random.randint(1, 100) <= per_200: response_status = "200" else: response_status = "404" randnum = random.randint(1, 100) if randnum <= 90: response_time = str(random.randint(1, resp_time_90)) elif randnum > 90 and randnum <= 95: response_time = str(random.randint(resp_time_90 + 1, resp_time_95)) elif randnum > 95 and randnum <= 99: response_time = str(random.randint(resp_time_95 + 1, resp_time_99)) else: response_time = str(random.randint(resp_time_99 + 1, resp_time_99 * 2)) #10.2.3.4 [2018/13/10:14:02:39] "GET /api/playeritems?playerId=3" 200 1230 #10.3.4.5 [2018/13/10:14:02:41] "GET /api/playeritems?playerId=2" 200 4630 log = "{} [{}] {} {} {}\n".format(log_ip_addr, log_time.strftime('%Y-%m-%d %H:%M:%S:%f')[:-3], http_verb_uri, response_status, response_time) log_file.write(log) log_time = log_time + datetime.timedelta(milliseconds = random.randint(100, 200)) log_file.close() return def main(): #get config from config file config = ConfigParser.ConfigParser() with open("logper.cfg", "r") as cfg_file: config.readfp(cfg_file) for section in config.sections(): #config is in Generator section if section == "Generator": dir = config.get(section, "dir") start_date = datetime.datetime.strptime(config.get(section, "start_date"), '%Y-%m-%d') end_date = datetime.datetime.strptime(config.get(section, "end_date"), '%Y-%m-%d') ip_addr = config.get(section, "ip_address") http_verb_uri_collect = config.get(section, "http_verb_uri_collect") http_verb_uri_other = config.get(section, "http_verb_uri_other") per_200 = int(config.get(section, "per_200")) resp_time_90 = int(config.get(section, "resp_time_90")) resp_time_95 = int(config.get(section, "resp_time_95")) resp_time_99 =int(config.get(section, "resp_time_99")) #create directory if not exist if not os.path.exists(dir): os.makedirs(dir) #generate log according to config generate_log(dir, start_date, end_date, ip_addr, http_verb_uri_collect, http_verb_uri_other, per_200, resp_time_90, resp_time_95, resp_time_99) if __name__ == '__main__': main()
997,923
b6984e396ee93d1afb8dceb9c2e7397ca1217c76
################## ### original author: Parashar Dhapola ### modified by Rintu Kutum ################## import numpy as np import sys import os import matplotlib.pyplot as plt import matplotlib as mpl from scipy import ndimage import math ######################### chrom_indices = {} chrom_lens = [] bin_size = 1000 with open('./data/hg19/hg19-chrom-sizes.txt') as h: for n, l in enumerate(h): c = l.rstrip('\n').split('\t') chrom_indices[c[0]] = n chrom_lens.append(int(c[1])) ########## ## create chrom for TRF2 trf2_chrom_array_c = [np.zeros(int(x / bin_size) + 1) for x in chrom_lens] h = open('./data/TRF2/all_common_peaks_pankaj_sorted.bed','r') for l in h: c = l.rstrip('\n').split('\t') s = int(c[1]) // 1000 e = int(c[2]) // 1000 if s == e: e+=1 trf2_chrom_array_c[chrom_indices[c[0]]][s:e] += 1 if not os.path.exists('./data/TRF2/trf2_binned_array_count/'): os.makedirs('./data/TRF2/trf2_binned_array_count/') for n, i in enumerate(trf2_chrom_array_c): for k, v in chrom_indices.items(): if v == n: fn1 = './data/TRF2/trf2_binned_array_count/%s.npy' % k print "Saving to file %s" % fn1 sys.stdout.flush() np.save(fn1, i) def get_binned_array(a, b): remainder = len(a) % b if remainder > 0: binned = a[:-remainder] else: binned = a.copy() binned = binned.reshape(len(a) // b, b).mean(axis=1) if remainder > 0: return np.append(binned, a[-remainder:].mean()) return binned all_chrom_subtracted = np.array([]) points = [] bin_size = 400 np.random.seed(1261) for chrom in [x for x in range(1,23)]+['X', 'Y']: #print '\r%s' % chrom, end='', print '\r%s' % chrom trf2_peaks = np.load('./data/TRF2/trf2_binned_array_count/chr%s.npy' % chrom) trf2_peaks = get_binned_array(trf2_peaks, bin_size) dnase = np.load('./data/DES/chr%s.npy' % chrom) dnase = get_binned_array(dnase, bin_size) dnase = np.log2(dnase+1) #################### specific = dnase.copy() specific[trf2_peaks == 0] = 0 #################### chrom_len = len(trf2_peaks) random_peaks = [] for i in range(1): got_nums = [] rand_p= np.zeros(chrom_len) for j in range(len(np.nonzero(trf2_peaks)[0])): while True: rand_num = np.random.randint(chrom_len) if rand_num not in got_nums: got_nums.append(rand_num) break rand_p[rand_num] = 1 random_peaks.append(rand_p) background = dnase.copy() idx = random_peaks[0] == 0 background[idx] = 0 if len(all_chrom_subtracted) == 0: all_chrom_subtracted = specific.copy() all_chrom_background = background.copy() else: all_chrom_subtracted = np.hstack((all_chrom_subtracted, specific)) all_chrom_background = np.hstack((all_chrom_background, background)) points.append(len(dnase)) ref_subtract = all_chrom_subtracted - all_chrom_background ############################# ############################# ######################### breaks_pos = np.cumsum([0.0] + points) breaks_pos = np.radians((breaks_pos/breaks_pos[-1])*360) xticks = [] for i in range(len(breaks_pos)-1): xticks.append(((breaks_pos[i+1]-breaks_pos[i])/2)+breaks_pos[i]) polar_pos = np.radians(np.linspace(0,360,len(ref_subtract))) ################## pos = ref_subtract.copy() pos[pos < 0] = 0 pos[pos > 10] = 10 neg = ref_subtract.copy() neg[neg > 0] = 0 neg[neg < -10] = -10 ######################### fig = plt.figure(figsize=(7, 7)) gs = mpl.gridspec.GridSpec(6, 6, hspace=0.5) ax = fig.add_subplot(gs[:, :], projection='polar') ####### smoothen_factor = 5 a = ndimage.gaussian_filter1d(pos, smoothen_factor) b = ndimage.gaussian_filter1d(neg, smoothen_factor) ####### track_pos = 7 ax.fill_between(polar_pos, track_pos, a + track_pos, color='crimson', alpha=0.7, edgecolor='none', label='DES in TRF2\npeaks only') ax.fill_between(polar_pos, track_pos, b + track_pos, color='grey', alpha=0.7, edgecolor='none', label='DES in random\npeaks only') for i in breaks_pos: ax.axvline(i, ymin=0.4, ymax=0.9, ls='-.', c='k', lw=1) for i,j in zip([x for x in range(1,23)]+['X', 'Y'], xticks): rotation = math.degrees(j) if 270 > rotation > 90: rotation-=180 ax.text(j, track_pos + 3, 'chr'+str(i), fontsize=10, color='grey', alpha=0.7, horizontalalignment='center', verticalalignment='center', rotation=rotation) ax.set_xticks(xticks) ax.xaxis.grid(False) ax.yaxis.grid(False) ax.set_xticklabels([]) ax.set_yticklabels([]) ax.set_ylim((0,11)) ax.spines['polar'].set_visible(False) ax.legend(loc='center', frameon=False, fontsize=11) plt.savefig('./figures/Figure-2B-dnase_TRF2_vs_Random.png', dpi=300)
997,924
e6e73ef7f06588ab788a0e17deb9676564519012
#!/usr/bin/env python3 import argparse, sys, numpy, os import matplotlib.pyplot import datetimelib import photometrylib import generallib import astropy import subprocess if __name__ == "__main__": parser = argparse.ArgumentParser(description='Loads a FITS file bins it.') parser.add_argument('inputfile', type=str, nargs='+', help='File(s) to rebin.') parser.add_argument('-b', '--bin', type=int, default=2, help="New binning factor.") parser.add_argument('-o', '--output', type=str, default="auto", help="Name of the output file. By default it will add an _nxn suffix to the input filename.") arg = parser.parse_args() print(arg) for FITSfile in arg.inputfile: hdul = astropy.io.fits.open(FITSfile) header = hdul[0].header binning = "unknown" try: binning = header['CCDSUM'] except KeyError: pass imageData = hdul[0].data print("Image dimensions:", numpy.shape(imageData)) width = numpy.shape(imageData)[1] height = numpy.shape(imageData)[1] binningStrings = binning.split() binning = [ int(b) for b in binningStrings] print("Binning of original image: ", binning) hdul.close() rebin = arg.bin a = numpy.array(imageData) width = numpy.shape(a)[1] height = numpy.shape(a)[0] new_height = int(height/rebin) new_width = int(width/rebin) b = a.reshape(new_height, rebin, new_width, rebin) c = rebin*rebin * b.mean(axis=3).mean(axis=1) d = numpy.clip(c, 0, 65535) print(a) print(d) print("Old shape:", numpy.shape(a), " New shape:",numpy.shape(d)) hdr = astropy.io.fits.Header() hdu = astropy.io.fits.PrimaryHDU(d) header['CCDSUM'] = "%d %d"%(rebin, rebin) header['CCDXBIN'] = rebin header['CCDYBIN'] = rebin hdu.header = header if arg.output=="auto": filename = os.path.splitext(FITSfile)[0] + "_%dx%d"%(rebin,rebin) + os.path.splitext(FITSfile)[1] else: filename = arg.output hdul = astropy.io.fits.HDUList([hdu]) hdul.writeto(filename, overwrite=True) print("Written rebinned image to: %s"%filename) sys.exit()
997,925
5703b52b97e054c50e5561188bf815367434807b
from curtain import Curtain, frame_length import sys from plugin import Plugin import time, os, math import midi plugins = [] for filename in os.listdir('plugins'): name, extension = os.path.splitext(filename) if extension == '.py' and name != '__init__': module = __import__('plugins.' + name).__dict__[name] for var in module.__dict__.values(): if isinstance(var, type) and Plugin in var.__bases__: plugins.append(var) curtain = Curtain() from plugins.strobe import Strobe from plugins.rainbow import Rainbow from plugins.snakes import Snakes from plugins.ec import EC from plugins.fancyrainbow import FancyRainbow plugins = [Strobe(),Snakes(), FancyRainbow(), EC(),Strobe()] input = midi.MidiInput(9) class Constants(): p = 3 def do_strobe(lol): print "strobe" Constants.p = 0 def do_strobe_2(lol): print "strobe" Constants.p = 4 def do_rainbow(lol): global p Constants.p=2 def do_snakes(lol): global p Constants.p=1 def do_ec(lol): global p Constants.p = 3 def set_period(rate): rate = int((127*3)/(rate+1)) plugins[0].period = rate def set_period_2(rate): rate = int((127*3)/(rate+1)) plugins[4].period = rate/5+2 input.attach_callback(102,do_strobe) input.attach_callback(106,do_strobe_2) input.attach_callback(103,do_rainbow) input.attach_callback(104,do_snakes) input.attach_callback(105,do_ec) input.attach_callback(16,set_period) input.attach_callback(20,set_period_2) input.start() def weighted_average(a, b, f): average = {} for k in set(a.keys() + b.keys()): r1, g1, b1 = a.get(k, (0, 0, 0)) r2, g2, b2 = b.get(k, (0, 0, 0)) average[k] = (f*r1 + (1-f)*r2, f*g1 + (1-f)*g2, f*b1 + (1-f)*b2) return average frame = 0 try: while True: start = time.clock() frame += 1 for plugin in plugins: plugin.step() plugin =plugins[Constants.p] # plugins[(int(frame / 600) + 2) % len(plugins)] curtain.send_color_dict(plugin.canvas) end = time.clock() sleep_length = frame_length - (end - start) if sleep_length > 0: time.sleep(sleep_length) except Exception: input.stop() sys.exit(0)
997,926
8a2fec0cf510431b7b6a4cb7f9916452ec64ecbc
import Tkinter import tkMessageBox import gridbutton top = Tkinter.Tk() top.withdraw() class Run(): def _init_(self,fona): self.fona = fona self.screen_lock = False def make_call(self): if Entry.get() > (1+1+1+1+1+1+1+1+1+1): self.valid_call=True if self.valid_call: self.fona.transmit('ATD' + (Entry.get())+ ';') self.ongoing_call = True else: self.ongoing_call = False #self.screen_lock = False tkMessageBox.showinfo("Call Failed", "FAILED") else: self.valid_call=False def end_call(self): self.fona.transmit('ATH') #self.screen_lock = False self.ongoing_call = False def ongoing_call(self): #self.screen_lock = True tkMessageBox.showinfo("Headset", Tkinter.Button(top, text="ON", command = self.headset_on),Tkinter.Button(top, text="OFF", command = self.headset_off)) # def screen_lock(self): # Entry.get() = 0 # def new_contact(self): # print "contacts dont do anything right now" # def find_contact(self): # print "find a contact" def headset_on(self): #self.headset: self.headset = False self.fona.transmit('AT+CHFA=1') def headset_off(self): self.headset = True self.fona.transmit('AT+CHFA=0') top.mainloop()
997,927
db9b5e89312b3b3ac8875c431046aea5d947c424
import sys """ This function take the sequence input and output the complementary sequence in 5' to 3' fashion. output[complementary] = wcc[input_sequence] Example: wcc('TAGCTACTCAGACGACCAGTAGATAAAAG') will give "CTTTTATCTACTGGTCGTCTGAGTAGCTA" """ def comp(base): if base == 'A': baseC = 'T' if base == 'G': baseC = 'C' if base == 'C': baseC = 'G' if base == 'T': baseC = 'A' return baseC def wcc(s): c = [] for i in range(len(s.strip())): c.append(comp(s[i])) sys.stdout.write(" Note that the output sequence is from 5' to 3' \n") c = c[::-1] #invert the sequence i.e. make it 5' to 3' for element in c: sys.stdout.write(str(element)) sys.stdout.write("\n")
997,928
b292ff349c00b8de5db9e8a4fa485669ff32c750
from bs4 import BeautifulSoup import requests import re from django.db import models class ScrapeLinkdin(models.Model): location = None fieldToSearch = None url = None jobPosting = [] def __init__(self,searchTerm): # This is just a variable I set to test it, however the website should have a drop down menu or an input field to get this location = "Ontario Canada" # This just breaks up the location to have it fit the URL format for char in location: if char in " ": location = location.replace(char, '%2C') # This is just a variable I set to test it out. In this case this is the search field fieldToSearch = searchTerm # This just adds the %20 inbetween spaces to make it a proper url for char in fieldToSearch: if char in " ": fieldToSearch = fieldToSearch.replace(char, '%20') # This adds the fields to generate the proper URL self.url = "https://www.linkedin.com/jobs/search/?keywords=" + fieldToSearch + "&location=" + location # Finds all the information for each job posting self.jobPosting = [] def scrapeSite(self): # Getting the webpage response = requests.get(self.url) # Getting source code data = response.text # Pass source code to BeautifulSoup soup = BeautifulSoup(data, features="lxml") # Finds all the urls of the job postings and puts it in a list links=[] for link in soup.findAll(attrs={ 'class': "result-card__full-card-link"}): links.append(link['href']) for link in links: # Creates the webpages data for each individual job posting indivResponse = requests.get(link) indivData = indivResponse.text indivSoup = BeautifulSoup(indivData, features="lxml") jobInfo = { # The postings URL 'URL':link, # The postings title 'Title':(indivSoup.find(attrs={ 'class': "topcard__title"})).getText(), # The postings Company 'Company':(indivSoup.find(attrs={ 'class': "topcard__flavor"})).getText(), 'Location':(indivSoup.find(attrs={ 'class': "topcard__flavor topcard__flavor--bullet"})).getText() } # The postings Date posted (for some reason just using find wont work for the specific class, however findAll in a loop only looping once works) count = 0 for date in indivSoup.findAll(attrs={ 'class': "topcard__flavor--metadata posted-time-ago__text"}): if count == 0: jobInfo['Date Posted'] = date.getText() break # This gets the whole Description of the post including the requirments that may be listed descrip = '' for li in indivSoup.findAll(attrs={ 'class': "show-more-less-html__markup"}): descrip = descrip +" " + li.getText() jobInfo['Description'] = descrip # Criteria section have the same class, so by getting the first 2 we can get the Seniority level (ex Entry) and the Employment type (ex fulltime) for critList in indivSoup.findAll(attrs={ 'class': "job-criteria__text job-criteria__text--criteria"}): if count == 0: jobInfo['Seniority'] = critList.getText() elif count == 1: jobInfo['Employment'] = critList.getText() break count+=1 self.jobPosting.append(jobInfo)
997,929
e754829a029427a0e65ab21e55f6dc8bce76b282
import numpy as np import matplotlib.pyplot as plt from fkpp_vect1D import main_FD_Solver N = 1000 # resolution L = 1000 # box size units (m) dt = .001 # time step size gamma = 1.0 # growth rate tend = 1000 # tending time in (s) t_trans = 50 saves = False verbose = False save_freq = 1000 D_arr = np.linspace(0.01, 2.5, 25) # diffusion array v_arr = np.zeros([D_arr.shape[0], 3]) # record velocity for i, D in enumerate(D_arr): print(i, ': d = ', round(D, 4)) vel_values = main_FD_Solver(N, L, dt, D, gamma, tend, save_freq, verbose, saves, t_trans) assert vel_values[0] - vel_values[1] < 0.010 vel_numeric = vel_values[0] vel_predict = vel_values[2] CFL_ = vel_values[-1] v_arr[i, :] = vel_predict, vel_numeric, CFL_ print('Done vel iterations') fig, ax = plt.subplots() ax.plot(D_arr, v_arr[:, 0], label=r"Predicted: $2\sqrt{D}$") ax.plot(D_arr, v_arr[:, 1], label="Numeric FTCD") ax.set_title('Numeric FTCD vs Analytical velocity 1D') ax.set_xlabel('Diffusion constant') ax.set_ylabel('Velocity') ax.grid(alpha=0.50) plt.legend() plt.savefig('numeric_Vs_analytical_fkpp1D') plt.show() plt.plot(D_arr, v_arr[:, 2]) plt.show()
997,930
44c3a86c579a0637cdceb16537d535b7971b609a
import math def solution(progresses, speeds): answer = [] N = len(progresses) now_day = -1 cnt = 1 for i in range(N): progress = progresses[i] speed = speeds[i] DONE = 100 remain = math.ceil((DONE - progress) / speed) if now_day == -1: now_day = remain continue if now_day >= remain: cnt += 1 else: answer.append(cnt) now_day = remain cnt = 1 return answer + [cnt] print(solution([93, 99, 92, 93], [1, 1, 1, 1]))
997,931
0ffb656967a1c903ca2289973f35cc0245a09368
def main(): import csv from itertools import islice reptotal=0 demtotal=0 demlist=(1961,1962,1963,1964,1965,1966,1967,1968,1977,1978,1979,1980,1993,1994,1995,1996,1997,1998,1999,2000,2009,2010,2011,2012,2013) replist=(1969,1970,1971,1972,1973,1974,1975,1976,1981,1982,1983,1984,1985,1986,1987,1988,1989,1990,1991,1992,2001,2002,2003,2004,2005,2006,2007,2008) p = open('presidents.txt', 'w') with open('BLS_private.csv') as d: for line in islice(csv.reader(d), 6, None): yeartotal=0 year=float(line[0]) yeartotal+=float(line[1]) yeartotal+=float(line[2]) yeartotal+=float(line[3]) yeartotal+=float(line[4]) yeartotal+=float(line[5]) yeartotal+=float(line[6]) yeartotal+=float(line[7]) yeartotal+=float(line[8]) yeartotal+=float(line[9]) yeartotal+=float(line[10]) if line[11]<str(10): line[11]=0 line[12]=0 yeartotal+=float(line[11]) yeartotal+=float(line[12]) for i in demlist: if i==year: demtotal+=yeartotal for i in replist: if i==year: reptotal+=yeartotal p.write('\n%s: %s\n'%("Democrat",demtotal)) p.write('\n%s: %s\n'%("Republican",reptotal)) if __name__ == "__main__": main()
997,932
9b8328094fd054eb4f989e976d7a70d1e02d05a8
import random from bottle import Bottle, template, static_file, request, redirect, HTTPError import model import session app = Bottle() # get the css file and apply to all the html @app.route('/static/<filename:path>') def static(filename): return static_file(filename=filename, root='static') # this is for index.html @app.route('/') def index(db): # session session.get_or_create_session(db) # create a string lis = [] # get the product_list dict and name it as productList productList = model.product_list(db,None) # use for loop an for productList and get the id, name, url and so on for each dict for row in productList: info = { 'id': row['id'], 'name': row['name'], 'url': row['image_url'], 'inventory': row['inventory'], 'cost': row['unit_cost'] } # append those data into the lis lis.append(info) # return the title and a lis that contain all the data for each product. and use the for loop in html return template('index', title='The WT Store', lis=lis) # product/id @app.route('/product/<id>', method='GET') def product(db, id): # just the product data base on id product = model.product_get(db, id) # if no such product, 404 error and print 'No such Item' if not product: return HTTPError(404,'No such Item ') else: # get the data and insert to the product.html info = { 'title': product['name'], 'id': product['id'], 'name': product['name'], 'url': product['image_url'], 'inventory': product['inventory'], 'cost': product['unit_cost'], 'description': product['description'] } # return the template with the product data return template('product', info) # create a Method that handle the Product Post # if 'quantity' in request.query: # @app.post('/product/<id>') # def add_to_cart(db,id): # session.get_cart_contents(db) # # #the quantity will be request and name as quantity # quantity = request.forms.get['quantity'] # # # the data use the method of session.add_to_cart with the data # # id from the product/<id> # session.add_to_cart(db, id, quantity=quantity) # # # once it works, it redirect to cart # return redirect('/cart') # create a cart page @app.route('/cart') def cart(db): # session get the content from the from the db session.get_cart_contents(db) return template('cart') if __name__ == '__main__': from bottle.ext import sqlite from dbschema import DATABASE_NAME # install the database plugin app.install(sqlite.Plugin(dbfile=DATABASE_NAME)) app.run(debug=True, port=8010)
997,933
a4b2f0dd236722c61b37dde913d05573e6d635d4
import pandas as pd import numpy as np import math import copy import QSTK.qstkutil.qsdateutil as du import datetime as dt import QSTK.qstkutil.DataAccess as da import QSTK.qstkutil.tsutil as tsu import QSTK.qstkstudy.EventProfiler as ep import sys import csv def bollinger_value(price_array, ldt_timestamps, bollinger_date): d= {'price': price_array, 'time': ldt_timestamps} data=pd.DataFrame(d) data['roll_mean']=pd.rolling_mean(data['price'],20) data['roll_std']=pd.rolling_std(data['price'],20) data['boll_low']=data['roll_mean']-data['roll_std'] data['boll_high']=data['roll_mean']+data['roll_std'] data['boll_val']= (data['price']-data['roll_mean']) / data['roll_std'] result_array=[] for i in range(0, len(ldt_timestamps)): if data['time'][i]==bollinger_date: for j in keys: result_array.append(data[j][i]) return result_array, data def getdata(dt_start,dt_end,ls_symbols): #dt_start=dt.datetime(na_dates[0,0],na_dates[0,1],na_dates[0,2]) #dt_end=dt.datetime(na_dates[len(na_dates)-1,0],na_dates[len(na_dates)-1,1],na_dates[len(na_dates)-1,2]+1) dt_timeofday = dt.timedelta(hours=16) ldt_timestamps = du.getNYSEdays(dt_start, dt_end, dt_timeofday) c_dataobj = da.DataAccess('Yahoo') ls_keys = ['open', 'high', 'low', 'close', 'volume', 'actual_close'] ldf_data = c_dataobj.get_data(ldt_timestamps, ls_symbols, ls_keys) d_data = dict(zip(ls_keys, ldf_data)) na_price = d_data['close'].values return na_price, ldt_timestamps def printresults(result_array,keys): for i in range(0,len(keys)): print str(keys[i]) + " : " + str(result_array[i]) if __name__ == '__main__': '''def get_data(symlist,filename):''' print 'Number of arguments:', len(sys.argv), 'arguments.' print 'Argument List:', str(sys.argv) days=252 k=math.sqrt(days) ls_symbols=sys.argv[1] lookback=int(sys.argv[2]) #date1=[] #date1.append(sys.argv[3]) #print date1 year=int(sys.argv[3]) month=int(sys.argv[4]) day=int(sys.argv[5]) date=dt.datetime(year,month,day) dt_start = dt.datetime(2008, 1, 1) dt_end = dt.datetime(2010, 12, 31) keys= ['time', 'roll_mean', 'roll_std', 'boll_low', 'boll_high', 'boll_val'] na_price, ldt_timestamps=getdata(dt_start,dt_end,ls_symbols) price_array=[] for i in range(0, len(na_price)): price_array.append(na_price[i][0]) #d= {'price': price_array, 'time': ldt_timestamps} #data-pd.DataFrame(d) #price_data=pd.Series(price_array,index=ldt_timestamps) #timestamps bollinger_date=pd.tslib.Timestamp(dt.datetime(date.year, date.month, date.day, 16)) result_array, all_data=bollinger_value(price_array, ldt_timestamps, bollinger_date) printresults(result_array,keys)
997,934
36719a627701d3baeedf29460088f2835acdeecc
# Generated by Django 3.1 on 2021-08-12 06:32 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('dataapp', '0013_auto_20210812_0848'), ] operations = [ migrations.AlterField( model_name='delivery', name='year', field=models.IntegerField(default=2021, editable=False), ), migrations.AlterField( model_name='farmer', name='join_year', field=models.IntegerField(default=2021, editable=False), ), migrations.AlterField( model_name='payfarmer', name='year', field=models.IntegerField(default=2021, editable=False), ), ]
997,935
fb93cb9321c4536ab8d2cfa5a6b0f044247c4d6e
from difflib import * class Op(object): def __init__(self, delete=False, insert=[]): self.delete=delete self.insert=insert def rep(self): return (self.delete, tuple(self.insert)) def __repr__(self): return "Op({0})".format({'delete':self.delete, 'insert': self.insert }) def __hash__(self): return hash(self.rep()) def __cmp__(self, other): return cmp(self.rep(), other) def align(a_, b_): '''Align edit operations to each position in the source sequence. The sequence of edit operations transforms source sequence a to target sequence b.''' a = list(a_) b = list(b_) codes = SequenceMatcher(a=a, b=b, autojunk=False).get_opcodes() T = {} for code in codes: tag, a_i, a_j, b_i, b_j = code if tag in ['insert', 'replace']: op = T.get(a_i, Op()) op.insert = op.insert + b[b_i:b_j] T[a_i] = op if tag in ['delete', 'replace']: for i in range(a_i, a_j): op = T.get(i, Op()) op.delete = True T[i] = op for i in range(0, len(a)+1): if not i in T: T[i] = Op() return [ op for _, op in sorted(T.iteritems()) ] def apply(ops, a_): '''Apply edit operations ops to source sequence a and return a generator for the resulting target sequence.''' a = list(a_) for i, op in enumerate(ops): for x in op.insert + (a[i:i+1] if not op.delete else []): yield x
997,936
77e1de7e2eb393dfcb6bd14c708faab6c9086ef2
# vim: tabstop=4 shiftwidth=4 softtabstop=4 # Copyright 2013 VMware Inc. # All Rights Reserved # # Licensed under the Apache License, Version 2.0 (the "License"); you may # not use this file except in compliance with the License. You may obtain # a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, WITHOUT # WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the # License for the specific language governing permissions and limitations # under the License. from neutron.openstack.common import log from neutron.plugins.nicira.dbexts import nicira_db from neutron.plugins.nicira import nvplib LOG = log.getLogger(__name__) def get_nsx_switch_and_port_id(session, cluster, neutron_port_id): """Return the NSX switch and port uuids for a given neutron port. First, look up the Neutron database. If not found, execute a query on NSX platform as the mapping might be missing because the port was created before upgrading to grizzly. This routine also retrieves the identifier of the logical switch in the backend where the port is plugged. Prior to Icehouse this information was not available in the Neutron Database. For dealing with pre-existing records, this routine will query the backend for retrieving the correct switch identifier. As of Icehouse release it is not indeed anymore possible to assume the backend logical switch identifier is equal to the neutron network identifier. """ nvp_switch_id, nvp_port_id = nicira_db.get_nsx_switch_and_port_id( session, neutron_port_id) if not nvp_switch_id: # Find logical switch for port from backend # This is a rather expensive query, but it won't be executed # more than once for each port in Neutron's lifetime nvp_ports = nvplib.query_lswitch_lports( cluster, '*', relations='LogicalSwitchConfig', filters={'tag': neutron_port_id, 'tag_scope': 'q_port_id'}) # Only one result expected # NOTE(salv-orlando): Not handling the case where more than one # port is found with the same neutron port tag if not nvp_ports: LOG.warn(_("Unable to find NVP port for Neutron port %s"), neutron_port_id) # This method is supposed to return a tuple return None, None nvp_port = nvp_ports[0] nvp_switch_id = (nvp_port['_relations'] ['LogicalSwitchConfig']['uuid']) with session.begin(subtransactions=True): if nvp_port_id: # Mapping already exists. Delete before recreating nicira_db.delete_neutron_nsx_port_mapping( session, neutron_port_id) else: nvp_port_id = nvp_port['uuid'] # (re)Create DB mapping nicira_db.add_neutron_nsx_port_mapping( session, neutron_port_id, nvp_switch_id, nvp_port_id) return nvp_switch_id, nvp_port_id
997,937
504e061bcd80fcbd66d098f8966587c4d957dc51
import re, string import sys, math, operator from collections import defaultdict from decimal import Decimal import numpy as np import mixem import matplotlib.pyplot as plt import itertools alphabet = "qwertyuiopasdfghjklzxcvbnm0. #" all_trigram = [''.join(i) for i in itertools.product(alphabet, repeat = 3)] #Remove non-ASCII characters def strip_non_ascii(string): ''' Returns the string without non ASCII characters''' stripped = (c for c in string if 0 < ord(c) < 127 and c is not "\n") return ''.join(stripped) #Count the number of lines in a file def file_len(fname): for i, l in enumerate(fname): pass return i + 1 #split a list in n chunks def split(a, n): k, m = divmod(len(a), n) return (a[i * k + min(i, m):(i + 1) * k + min(i + 1, m)] for i in range(n)) #Converts a dictionary into a list of tuple sorted by the second element and return the list splitted in n chunks def sort_and_chunk(dictionary, n): return list(split(sorted(dictionary.items(), key=operator.itemgetter(1)), n)) #Lowecase all character, remove non ascii characters, then punctiations (except full stop), converts all digits to 0 and add the initials and final marks def preprocess_line(line): line = "##" + re.sub("\d", "0",strip_non_ascii(line.lower()).translate(str.maketrans('', '', string.punctuation.replace(".", "")))) + "#" return line #Returns two dictionaries containing the counts of the n-grams, one for calculating the likelihood and one for train the lambdas def n_gram_count(n, file, length): counts = [defaultdict(int), defaultdict(int)] held_out_index = int(length*0.7) index_flag = 0 line_count=0 for line in file: line = preprocess_line(line) index_flag = 1 if line_count > held_out_index else 0 for j in range(len(line)-(n-1)): gram = line[j:j+n] counts[index_flag][gram] += 1 line_count += 1 return counts #Load the training file and return 3-2-1 counts dictionaries def generate_count_dict(): if len(sys.argv) != 2: print("Usage: ", sys.argv[0], "<training_file>") sys.exit(1) infile = sys.argv[1] #get input argument: the training file with open(infile) as f: result_1 = [] result_2 = [] length = file_len(f) for i in range(1,4): f.seek(0) #reset the file read dicts =n_gram_count(i,f, length) result_1.append(dicts[0]) result_2.append(dicts[1]) return result_1, result_2 def get_likelihood(trigram, bigram, unigram, count): return tuple((trigram/bigram, bigram/unigram, unigram/count)) #Apply EM Algorithm to calculate the optimal lambdas def train_lambda(data): # plt.scatter(np.array(range(data.shape[0])), data) # plt.show(); weights, distributions, ll = mixem.em(np.sort(np.array(data)), [mixem.distribution.NormalDistribution(0,1),mixem.distribution.NormalDistribution(0.3,5),mixem.distribution.NormalDistribution(1,9)]) return weights def J_M_interpolation(dicts): uni_counts, bi_counts, tri_counts = dicts[0] uni_counts_lamda, bi_counts_lamda, tri_counts_lamda = dicts[1] probabilities = [] lambdas = [] v1 = sum(uni_counts.values()) v2 = sum(uni_counts_lamda.values()) #bucketing -> Train the lambda for chunk in sort_and_chunk(tri_counts_lamda, 10): data = [] #Create the input vector for train the lambdas for trigram in chunk: key=trigram[0] likelihood = get_likelihood(tri_counts_lamda[key],bi_counts_lamda[key[:-1]], uni_counts_lamda[key[:-2]], v2) data.append(likelihood[0]) data.append(likelihood[1]) data.append(likelihood[2]) lambdas.append(train_lambda(np.array(data))) index = 0 #Interpolate! for chunk in sort_and_chunk(tri_counts, 10): for trigram in chunk: key=trigram[0] likelihood = get_likelihood(tri_counts[key],bi_counts[key[:-1]], uni_counts[key[:-2]], v1) probabilities.append([key,lambdas[index][0]*likelihood[0] + lambdas[index][1]*likelihood[1] + lambdas[index][2]*likelihood[2] ]) #calculate probability for all unseen trigram for trigram in all_trigram: if trigram not in tri_counts.keys(): if bi_counts_lamda[trigram[:-1]] == 0: probability = [trigram, 0.05*uni_counts[trigram[:-2]]/v1] else: probability = [trigram, 0.05*uni_counts[trigram[:-2]]/v1 + 0.07*bi_counts_lamda[trigram[:-1]]/uni_counts[trigram[:-2]]] probabilities.append(probability) print (lambdas) #break return probabilities def generate_JM_model(model_name): probabilities = J_M_interpolation(generate_count_dict()) with open(model_name, "w") as f: for couple in probabilities: f.write(couple[0]+"\t"+ ('%.2E' % Decimal(couple[1]) +"\n")) def generate_MLE_model(): tri_counts, bi_counts, s_counts = generate_count_dict() with open("my_model_MLE.en", "w") as f: for key in sorted(tri_counts.keys()): #Write key ,tab> likelihood in the file f.write(key+"\t"+ ('%.2E' % Decimal( tri_counts[key] / bi_counts[key[:-1]]) +"\n"))
997,938
058e8c63290a4c4d029971b03c36422030b9ec32
from django.contrib.auth.backends import ModelBackend from .models import CashierProfile from django.contrib.auth.models import User class PasswordlessAuthBackend(ModelBackend): """Log in to Django without providing a password, just a cashier code/login number """ def authenticate(self, request, rest_id, login): try: cashier = CashierProfile.objects.filter(restaurant = rest_id).filter(login_number = login).first() return cashier except CashierProfile.DoesNotExist: return None # def get_user(self, user_id): # try: # return User.objects.get(pk=user_id) # except CashierProfile.DoesNotExist: # return None
997,939
b4407e499f9583f1e0a5dd118d465fe18fe7e38a
import os import torch import numpy as np from scipy.spatial import distance_matrix dataset = 'diab' model_info = 'lstm+tanh' dirname = '../outputs/' + dataset + '/' + model_info dirs = [d for d in os.listdir(dirname) if 'enc.th' in os.listdir(os.path.join(dirname, d))] # print(dirs) distance_matrices = [] for dir in dirs: pth = os.path.join(dirname, dir, 'enc.th') enc = torch.load(pth) enc = enc['embedding.weight'].cpu().numpy() print(enc.shape) distance_matrices.append( distance_matrix(enc, enc)) # Minkowski distance with p-norm=2 import pickle file_name = dataset + model_info + "-distance-matrices.pkl" pkl_file = open(file_name, 'wb') pickle.dump(distance_matrices, pkl_file) pkl_file.close()
997,940
05943fdff745512181fdcf90ac271b5d56a6697a
# -*- coding: utf-8 -*- """ Created on Fri Jul 19 10:50:22 2019 @author: Manuel """ def calcular_mochila(peso_maximo, *monton): numobj=0 numobjquedarse=0 valpess=[] mochila=[] quedarse=[] descartes=[] dejar=[] for objeto in monton: valpes=objeto["valor"]/objeto["peso"] #valpes calcula la relación entre el valor y el peso. objeto["valpes"]=valpes valpess.append(valpes) numobj+=1 valpess.sort() #Esto permitirá empezar por los objetos más valiosos. while numobj != 0: obj_prueba=valpess.pop() for objeto in monton: if obj_prueba==objeto["valpes"]: objeto["valpes"]=-1 #Esto evita problemas cuando hay más de un objeto con el mismo valor de valpes. if peso_maximo>=objeto["peso"]: quedarse.append(objeto) numobjquedarse+=1 peso_maximo-=objeto["peso"] else: #Para, cuando esté casi llena, comparar el valor de los últimos objetos a meter. if numobjquedarse!=0: #Esto es por si el objeto más valioso es muy grande y no se puede llevar, que no se saque de una lista vacía. comparar=quedarse.pop() peso_maximo+=comparar["peso"] if peso_maximo >= objeto["peso"]: if comparar["valor"] > objeto["valor"]: quedarse.append(comparar) numobjquedarse+=1 peso_maximo-=comparar["peso"] dejar.append(objeto) else: quedarse.append(objeto) numobjquedarse+=1 peso_maximo-=objeto["peso"] dejar.append(comparar) else: quedarse.append(comparar) numobjquedarse+=1 peso_maximo-=comparar["peso"] dejar.append(objeto) else: dejar.append(objeto) numobj-=1 valor_llevo=0 peso_llevo=0 valor_dejo=0 peso_dejo=0 for objeto in quedarse: mochila.append(objeto["nombre"]) valor_llevo+=objeto["valor"] peso_llevo+=objeto["peso"] for objeto in dejar: descartes.append(objeto["nombre"]) valor_dejo+=objeto["valor"] peso_dejo+=objeto["peso"] print("En la mochila me llevo los siguientes objetos: ",mochila, ",con un valor total de",valor_llevo,"y un peso de",peso_llevo) print("Dejo los siguientes objetos: ",descartes, ",con un valor total de",valor_dejo,"y un peso de",peso_dejo) #Ahora una prueba con diferentes objetos moneda={"nombre":"moneda","peso":1,"valor":3} piedra={"nombre":"piedra","peso":5,"valor":1} anillo={"nombre":"anillo","peso":1,"valor":10} talisman={"nombre":"talismán","peso":4,"valor":10} estatua={"nombre":"estatua","peso":10,"valor":100} corona={"nombre":"corona","peso":3,"valor":100} amuleto={"nombre":"amuleto","peso":1,"valor":1} calcular_mochila(5,moneda, piedra, anillo, talisman, estatua,corona,amuleto)
997,941
cf5975dd2e67a00515c1256c2bf277ae67fd8802
import logging from dataclasses import dataclass, field, asdict from datetime import datetime from typing import Callable, Optional, Dict, Tuple, Any, Type, List, Union import yaml import torch import torch.nn as nn import torchvision from action_recognition import models # Initiate Logger logger = logging.getLogger(__name__) def transform_dict(config_dict: Dict, expand: bool = True): """ General function to transform any dictionary into wandb config acceptable format (This is mostly due to datatypes that are not able to fit into YAML format which makes wandb angry) The expand argument is used to expand iterables into dictionaries So the configs can be used when comparing results across runs """ ret: Dict[str, Any] = {} for k, v in config_dict.items(): if v is None or isinstance(v, (int, float, str)): ret[k] = v elif isinstance(v, (list, tuple, set)): # Need to check if item in iterable is YAML-friendly t = transform_dict(dict(enumerate(v)), expand) # Transform back to iterable if expand is False ret[k] = t if expand else [t[i] for i in range(len(v))] elif isinstance(v, dict): ret[k] = transform_dict(v, expand) else: # Transform to YAML-friendly (str) format # Need to handle both Classes, Callables, Object Instances # Custom Classes might not have great __repr__ so __name__ might be better in these cases vname = v.__name__ if hasattr(v, '__name__') else v.__class__.__name__ ret[k] = f"{v.__module__}:{vname}" return ret def dfac_cur_time(): return datetime.now().strftime("%Y%m%d-%H%M%S") def update_dict_by_key_value(argdict, key, value): now_dict = argdict *dict_keys, last_key = key.split('.') for k in dict_keys: now_dict.setdefault(k, {}) if now_dict[k] is None: now_dict[k] = {} now_dict = now_dict[k] now_dict[last_key] = value return argdict ARGS_TYPE = Dict[str, Any] @dataclass class WandbConfig: # Logging Related cur_time: str = field(default_factory=dfac_cur_time) # WandB setting wandb_repo: str = "donny" wandb_project: str = "video_classification" wandb_group: str = "test" wandb_name: str = '' wandb_dir: str = "./output/wandb/" @dataclass # pylint: disable=too-many-instance-attributes class ExperimentConfig(WandbConfig): # GPU Device Setting gpu_device_id: Union[None, int, List[int]] = None tensorboard_log_root: str = "./output/tensorboard/" # Set random seed. Set to None to create new Seed random_seed: Optional[int] = None # Dataset Config dataset_root: str = "./data/clipped_database/preprocessed" dataset_artifact: str = "" output_type: str = "random_frame" split_by: str = "random" frames_per_clip: int = 1 step_between_clips: int = 1 frame_rate: Optional[int] = None metadata_path: Optional[str] = None num_sample_per_clip: int = 1 # mouse dataset args mix_clip: int = 0 no_valid: bool = False extract_groom: bool = True exclude_5min: bool = False exclude_2_mouse: bool = False exclude_fpvid: bool = True exclude_2_mouse_valid: bool = False # Over-write arguments for valid set and test set valid_set_args: ARGS_TYPE = field(default_factory=dict) test_set_args: ARGS_TYPE = field(default_factory=dict) # sampler train_sampler_config: ARGS_TYPE = field(default_factory=dict) valid_sampler_config: ARGS_TYPE = field(default_factory=dict) test_sampler_config: ARGS_TYPE = field(default_factory=dict) # Transform Function transform_size: int = 224 train_transform: Optional[Tuple[Callable, ...]] = None valid_transform: Optional[Tuple[Callable, ...]] = None test_transform: Optional[Tuple[Callable, ...]] = None # Increase dataloader worker to increase throughput num_worker: int = 16 # Training Related batch_size: int = 64 # Default Don't Select Model model: Optional[Union[Type[torch.nn.Module], Callable[..., torch.nn.Module]]] = None model_args: ARGS_TYPE = field(default_factory=dict) xavier_init: bool = False # Default Cross Entropy loss loss_function: nn.Module = field(default_factory=lambda: nn.CrossEntropyLoss(reduction='sum')) # Default Select Adam as Optimizer optimizer: Type[torch.optim.Optimizer] = torch.optim.Adam # type: ignore optimizer_args: ARGS_TYPE = field(default_factory=lambda: {"lr": 1e-2}) # Default adjust learning rate lr_scheduler: Optional[Type[torch.optim.lr_scheduler._LRScheduler]] = None # pylint: disable=protected-access lr_scheduler_args: ARGS_TYPE = field(default_factory=dict) # Set number of epochs to train num_epochs: int = 20 samples_per_epoch: Optional[int] = None valid_every_epoch: int = 1 save_path: Optional[str] = None best_metric: str = 'Accuracy' def to_dict(self, expand: bool = True): return transform_dict(asdict(self), expand) def update_value(self, key, value): first_key, *rest = key.split('.') if key in ["model", "model.class"]: self.model = getattr(models, value, None) \ or getattr(torchvision.models, value, None) \ or getattr(torchvision.models.video, value) elif key.startswith('model.'): self.model_args = update_dict_by_key_value(self.model_args, key[len('model.'):], value) elif key.startswith('train_sampler_config.'): self.train_sampler_config = update_dict_by_key_value( self.train_sampler_config, key[len('train_sampler_config.'):], value) elif key in ["optimizer", "optimizer.class"]: assert hasattr(torch.optim, value) self.optimizer = getattr(torch.optim, value) elif key.startswith('optimizer.'): self.optimizer_args = update_dict_by_key_value(self.optimizer_args, key[len('optimizer.'):], value) elif key in ["lr_scheduler", "lr_scheduler.class"]: assert hasattr(torch.optim.lr_scheduler, value) self.lr_scheduler = getattr(torch.optim.lr_scheduler, value) elif key == "lr_scheduler.step": self.lr_scheduler_args['milestones'] = list(range(value, self.num_epochs, value)) elif key.startswith('lr_scheduler.'): self.lr_scheduler_args = update_dict_by_key_value(self.lr_scheduler_args, key[len('lr_scheduler.'):], value) elif key == 'frames_per_clip': self.frames_per_clip = value self.batch_size = 16 * 16 // value elif hasattr(self, key): assert getattr(self, key) is None or isinstance(getattr(self, key), type(value)), (key, value) setattr(self, key, value) elif hasattr(self, first_key) and len(rest) > 0: assert isinstance(getattr(self, first_key), dict) setattr( self, first_key, update_dict_by_key_value( getattr(self, first_key), key[len(first_key) + 1:], value) ) else: raise NotImplementedError(f"Unknown key={key}") def update_sweep_dict(self, wandb_config: Dict[str, Any]): SWEEP_ARG_PREFIX = "WS_" for k, v in wandb_config.items(): if k.startswith("WS_BASE"): sp_value = v['value'] if isinstance(sp_value, list): for item in sp_value: self.merge_with_yaml(item) elif sp_value: self.merge_with_yaml(sp_value) elif k.startswith(SWEEP_ARG_PREFIX): sp_name = k[len(SWEEP_ARG_PREFIX):] # wandb.config.as_dict() returns Dict[k, Dict[str, v]] # https://github.com/wandb/client/blob/master/wandb/wandb_config.py#L321 sp_value = v['value'] self.update_value(sp_name, sp_value) def update_dict_value(self, dictionary, prefix=''): for k, v in dictionary.items(): if isinstance(v, dict): self.update_dict_value(v, prefix=prefix + k + '.') else: self.update_value(prefix + k, v) def merge_with_yaml(self, yaml_path): with open(yaml_path, 'r') as f: cfg_dict = yaml.safe_load(f) if "__BASE__" in cfg_dict: if isinstance(cfg_dict['__BASE__'], list): for path in cfg_dict['__BASE__']: self.merge_with_yaml(path) else: assert isinstance(cfg_dict['__BASE__'], str) self.merge_with_yaml(cfg_dict['__BASE__']) cfg_dict.pop("__BASE__") self.update_dict_value(cfg_dict)
997,942
691ceb833dd3f0d6591a9773820d261052276553
DATABASES = { 'default': { 'ENGINE': 'django.db.backends.sqlite3', 'NAME': ':memory:', }, } SECRET_KEY = 'ishalltellyouonlyonce' INSTALLED_APPS = ( 'django.contrib.auth', 'django.contrib.contenttypes', 'django.contrib.sessions', 'django.contrib.sites', 'django.contrib.messages', 'django.contrib.staticfiles', 'fa', ) TEMPLATES = [ { 'BACKEND': 'django.template.backends.django.DjangoTemplates', }, ]
997,943
25f13848f9f55c6114521dcca043d43e2fe233f7
from datetime import datetime from flask import render_template, redirect, url_for, flash, abort, request, jsonify from flask_login import logout_user, login_required, login_user from autoP.models import User, load_user, query_results from forms import LoginForm, RegistrationForm, SearchForm from . import app @app.route('/') @app.route('/home') def home(): """Renders the home page.""" return render_template( 'index.html', title='Automation Center', year=datetime.now().year, message='Welcome to the Automation Center' ) @app.route('/contact') def contact(): """Renders the contact page.""" return render_template( 'contact.html', title='Contact', message='Contact me if you have any questions.' ) @app.route('/about') def about(): """Renders the about page.""" return render_template( 'about.html', title='About', message='Project Brief.' ) @app.route('/show') def show(): """Renders the listUsers page.""" return render_template( 'listUsers.html', title='List Users', message='These are the users in our system' ) @app.route('/dash_board') def dash_board(): return render_template( 'dash_board.html', title = 'Dash Board', message='Welcome to the Automation Center' ) @app.route('/search', methods=['GET', 'POST']) @login_required def search(): form = SearchForm() if form.validate_on_submit(): # input some search here search_string = form.search.data flash(search_string) app.logger.info(form.search.data) return redirect(url_for('search_result', query=search_string)) # redirect(url_for('search')) return render_template('search.html', form=form) @app.route('/search_result/<string:query>') @login_required def search_result(query): results = query_results(query) return render_template('_results.html', query=query, results=results) @app.route('/login', methods=['GET', 'POST']) def login(): # Here we use a class of some kind to represent and validate our # client-side form data. For example, WTForms is a library that will # handle this for us, and we use a custom LoginForm to validate. form = LoginForm() if form.validate_on_submit(): # Login and validate the user. # user should be an instance of your `User` class users = load_user(form.email.data) if users is None: flash(message='We don\'t know you', category='error') return render_template('login.html', form=form) user = users if user.verify_password(form.password.data): login_user(user) flash(message='Logged in successfully.', category='message') return redirect(url_for('dash_board')) else: flash(message='wrong password', category='error') return render_template('login.html', form=form) return render_template('login.html', form=form) @app.route('/logout') @login_required def logout(): logout_user() flash('You have been logged out.') return redirect(url_for('home')) @app.route('/register', methods=['GET', 'POST']) def register(): form = RegistrationForm() if form.validate_on_submit(): if User.get_by(email=form.email.data): flash(message='User already existing.', category='error') return redirect(url_for('register')) user = User(email=form.email.data, password=form.password.data) user.save() flash('User is registered!') return redirect(url_for('login')) return render_template('register.html', form=form) @app.route('/shutdown') def server_shutdown(): if app.testing: return 'Cannot shutdown testing......' shutdown = request.environ.get('werkzeug.server.shutdown') if not shutdown: abort(500) shutdown() return 'Shutting down the server......' @app.errorhandler(403) def forbidden(error): return handle_error(error, 'Forbidden', 403) @app.errorhandler(404) def not_found(error): return handle_error(error, 'Page Not Found', 404) @app.errorhandler(500) def internal_server_error(error): return handle_error(error, 'Internal Server Error', 500) def handle_error(error, server_error, error_code): if request.accept_mimetypes.accept_json and not request.accept_mimetypes.accept_html: response = jsonify({'error': server_error}) response.status_code = error_code return response return render_template('error.html', message='Internal Server Error:'), error_code
997,944
18d25718ec8d10097b4c9d0a54a03b783d240270
# set up relays from gpiozero import OutputDevice import time import sys # devices specified by GPIO number # gpiozero.OutputDevice(pin, *, active_high=True, initial_value=False, pin_factory=None) air_pump = OutputDevice(18, False) nutrient_pump = OutputDevice(23, False) solenoid = OutputDevice(24, False) l_board = OutputDevice(25, False) motors = OutputDevice(4, False) #function to toggle relay power def TogglePower(relay): relay.toggle() #TogglePower(air_pump) #time.sleep(1) #TogglePower(motors) #time.sleep(1) #TogglePower(l_board) #time.sleep(1) #TogglePower(nutrient_pump) #TogglePower(solenoid) #time.sleep(1) #TogglePower(solenoid)
997,945
a6bbf5eb88d39c1519d258ce16f0af99236f162f
from django.db.models.signals import post_save from djblets.extensions.hooks import SignalHook from djblets.integrations.integration import Integration from djblets.integrations.manager import IntegrationManager from djblets.integrations.tests.models import IntegrationConfig from djblets.integrations.tests.testcases import IntegrationsTestCase class DummyIntegration1(Integration): def initialize(self) -> None: self.dummy_initted = True self.hook = SignalHook(self, post_save, self._on_callback) def shutdown(self) -> None: self.dummy_initted = False def _on_callback(self, **kwargs) -> None: pass class DummyIntegration2(Integration): def initialize(self) -> None: pass class IntegrationTests(IntegrationsTestCase): """Unit tests for djblets.integrations.integration.Integration.""" def setUp(self) -> None: super().setUp() self.manager = IntegrationManager(IntegrationConfig) self.integration = \ self.manager.register_integration_class(DummyIntegration1) def test_init(self) -> None: """Testing Integration initialization""" self.assertEqual(self.integration.hooks, set()) self.assertFalse(self.integration.enabled) self.assertFalse(hasattr(self.integration, 'dummy_initted')) def test_id(self) -> None: """Testing Integration.id""" self.assertEqual(self.integration.id, self.integration.integration_id) def test_enable_integration(self) -> None: """Testing Integration.enable_integration""" self.integration.enable_integration() self.assertTrue(self.integration.enabled) self.assertTrue(hasattr(self.integration, 'dummy_initted')) self.assertTrue(getattr(self.integration, 'dummy_initted')) self.assertEqual(self.integration.hooks, { getattr(self.integration, 'hook'), }) def test_disable_integration(self) -> None: """Testing Integration.disable_integration""" self.integration.enable_integration() self.integration.disable_integration() self.assertFalse(self.integration.enabled) self.assertTrue(hasattr(self.integration, 'dummy_initted')) self.assertFalse(getattr(self.integration, 'dummy_initted')) self.assertEqual(self.integration.hooks, set()) def test_get_configs(self) -> None: """Testing Integration.get_configs""" config1 = self.integration.create_config(name='Config 1', enabled=True, save=True) config2 = self.integration.create_config(name='Config 2', enabled=True, save=True) # Add some configs that shouldn't be returned. integration2 = \ self.manager.register_integration_class(DummyIntegration2) self.integration.create_config(name='Config 3', save=True) integration2.create_config(name='Config 4', save=True) self.assertEqual(self.integration.get_configs(), [config1, config2]) def test_get_configs_with_filter(self) -> None: """Testing Integration.get_configs with filter""" config1 = self.integration.create_config(name='Config 1', enabled=True, save=True) self.integration.create_config(name='Config 2', enabled=True, save=True) # Add some configs that shouldn't be returned. integration2 = \ self.manager.register_integration_class(DummyIntegration2) self.integration.create_config(name='Config 3', save=True) integration2.create_config(name='Config 4', save=True) self.assertEqual(self.integration.get_configs(name='Config 1'), [config1]) def test_create_config(self) -> None: """Testing Integration.create_config""" config = self.integration.create_config(name='Config 1') self.assertFalse(config.enabled) self.assertIsNone(config.pk) def test_create_config_with_save(self) -> None: """Testing Integration.create_config with save=True""" config = self.integration.create_config(name='Config 1', save=True) self.assertFalse(config.enabled) self.assertIsNotNone(config.pk)
997,946
e2bd5a633e4a63b23968441999cf1599f754a3e0
from chunk import make_all_sentences_chunks_list import pydot_ng as pydot F_NAME = "neko.txt.cabocha" """ びにおもちろいわと 名詞,一般,*,*,*,*,* 云う 動詞,自立,*,*,五段・ワ行促音便,基本形,云う,イウ,イウ のようなものもちゃんと管理する """ def _45(): contents = make_all_sentences_chunks_list(F_NAME) verb_case_patterns = [] for sentence in contents: for chunk in sentence: case_pattern = [] verb_base = None for chunk_morph in chunk.morphs: if chunk_morph.pos == "動詞": verb_base = chunk_morph.base break if verb_base: for i in chunk.srcs: for src_morph in sentence[i].morphs: if src_morph.pos == "助詞": case_pattern.append(src_morph.surface) if case_pattern: verb_case_patterns.append(verb_base+"\t"+" ".join(sorted(case_pattern))) for verb_case_pattern in verb_case_patterns: print(verb_case_pattern) if __name__ == "__main__": _45() """ sort 45 | uniq -c | sort -r | head -10 565 云う と 442 する を 249 思う と 199 ある が 189 なる に 174 する に 173 見る て 127 する と 117 する が 105 する に を """ """ grep -E "^する" 45 | sort | uniq -c | sort -r | head -10 442 する を 174 する に 127 する と 117 する が 105 する に を 86 する て を 59 する は 58 する て 57 する が を 48 する から """ """ grep -E "^見る" 45 | sort | uniq -c | sort -r | head -10 173 見る て 94 見る を 21 見る て て 20 見る から 18 見る て を 14 見る と 12 見る から て 12 見る で 11 見る て は 8 見る に """ """ grep -E "^与える" 45 | sort | uniq -c | sort -r | head -10 3 与える に を 2 与える て に は を 1 与える ば を 1 与える に に対して のみ は は も 1 与える て も を 1 与える て に を 1 与える て に に は を 1 与える だけ で に を 1 与える たり て に を 1 与える けれども に は を """
997,947
eb536f14768417698ae24195bbf1684852dc7299
special.gdtr(a,b,x)
997,948
55497f19f059c7a12b13501ceb1afe5b05f08df0
# Isabella Gomez A15305555 # ECE143 HW5 # imports: import re def get_average_word_length(words): ''' This function takes in a list of words and computes the average length of the words in the list. :param words: list of words :return: average length of the words in the list ''' # check that words is a list of strings assert type(words) == list for word in range(len(words)): assert type(words[word]) == str average_length = 0 # get average length of all words in list for word in range(len(words)): average_length = average_length + len(words[word]) average_length = average_length / len(words) return average_length def get_longest_word(words): ''' Gets the longest word in the list :param words: list of words :return: returns the string of the longest word ''' # check that words is a list of strings assert type(words) == list for word in range(len(words)): assert type(words[word]) == str list_of_lenghts = [] # make a list with all the word lengths for word in range(len(words)): list_of_lenghts.append(len(words[word])) longest_word_length = max(list_of_lenghts) for l in range(len(list_of_lenghts)): if list_of_lenghts[l] == longest_word_length: longest_word = words[l] return longest_word def get_longest_words_startswith(words,start): ''' This function finds the longest word that begins with the letter "start" :param words: list with all words :param start: the letter with which the longest word will start :return: the longest word that begins with the given letter ''' # check that words is a list of strings assert type(words) == list for word in range(len(words)): assert type(words[word]) == str # check that start is a single letter and str assert type(start) == str assert len(start) == 1 # make start lowercase if start.isupper() == True: start = start.lower() words_with_start_letter = [] for word in range(len(words)): first_letter = words[word][0] # make a list with all words that begin with "start" if start == first_letter: words_with_start_letter.append(words[word]) list_of_lenghts = [] # make a list with all the word lengths for word in range(len(words_with_start_letter)): list_of_lenghts.append(len(words_with_start_letter[word])) longest_word_length = max(list_of_lenghts) for l in range(len(list_of_lenghts)): if list_of_lenghts[l] == longest_word_length: longest_word = words_with_start_letter[l] return longest_word def get_most_common_start(words): ''' This function checks what beginning letter is most common amongst the list of words :param words: list of words :return: string of most common letter ''' # check that words is a list of strings assert type(words) == list for word in range(len(words)): assert type(words[word]) == str first_letter_list = [] # make a list of first letters for word in range(len(words)): first_letter_list.append(words[word][0]) # finding most common letter most_common = max(set(first_letter_list), key=first_letter_list.count) return most_common def get_most_common_end(words): ''' This function checks what beginning letter is most common amongst the list of words :param words: list of words :return: string of most common letter ''' # check that words is a list of strings assert type(words) == list for word in range(len(words)): assert type(words[word]) == str last_letter_list = [] # make a list of last letters for word in range(len(words)): last_letter_list.append(words[word][-1]) # finding most common letter most_common = max(set(last_letter_list), key=last_letter_list.count) return most_common
997,949
502fe5eebd8e47ddc93500420a165e1117782882
#!/usr/bin/python3 class MyInt(int): def __eq__(self, val2): return self - val2 is not 0 def __ne__(self, val2): return self - val2 is 0
997,950
3ed6dc7fc0b4136e4f1aa5f8d999f11b8c85d00c
import json import traceback from db_utils import DB from kafka import KafkaConsumer, TopicPartition from random import randint from time import time, sleep from field_validations import apply_field_validations from chained_rules import run_chained_rules from producer import produce from business_rules_api import apply_business_rules, update_table, initialize_rules, get_tables_data try: from app.da_bizRul_factory import DABizRulFactory from app.ace_logger import Logging except: from da_bizRul_factory import DABizRulFactory from ace_logger import Logging DAO = DABizRulFactory.get_dao_bizRul() logging = Logging() import BusinessRules import json def get_chain_rules(data_base): """ Getting the rule_string, next_if_sucess and next_if_failure data from the database """ business_rule_db = DB(data_base, host='business_rules_db') df = business_rule_db.execute(f"SELECT `id`, `rule_id`,`rule_string`, `next_if_sucess`, `next_if_failure`, `group`, `description`, `data_source` from `sequence_rule_data`") chained_rules = [[e['rule_id'], e['rule_string'], e['next_if_sucess'], e['next_if_failure'], e['group'],e['description'], e['data_source']] for e in df.to_dict(orient='records') ] return chained_rules database = 'business_rules' rules = get_chain_rules(database) # print (rules[0]) # rules = [rules[0]] rules_id_mapping = {rule.pop(0):rule for i,rule in enumerate(rules)} data = {'id': 1, 'case_id': '2000441939', 'highlight': '{"Document Heading": {"height": 12, "width": 63, "y": 38, "x": 297, "right": 364, "word": "Tax Invoice", "page": 0}, "Vendor GSTIN": {"height": 7, "width": 101, "y": 117, "x": 102, "right": 203, "word": "37AAUFA4486C1Z5", "page": 0}, "Billed To (DRL Name)": {"height": 9, "width": 197, "y": 159, "x": 39, "right": 252, "word": "Dr. Reddys Laboratories Limited CTO-6", "page": 0}, "DRL GSTIN": {"height": 10, "width": 105, "y": 205, "x": 128, "right": 239, "word": "37AAACD7999Q1ZJ", "page": 0}, "Invoice Number": {"height": 9, "width": 24, "y": 79, "x": 364, "right": 389, "word": "6106", "page": 0}, "Vendor Name": {"height": 7, "width": 93, "y": 816, "x": 529, "right": 628, "word": "Akshaya Lab Products", "page": 0}, "Invoice Date": {"height": 9, "width": 60, "y": 79, "x": 498, "right": 559, "word": "4-May-2019", "page": 0}, "PO Number": {"height": 10, "width": 61, "y": 157, "x": 364, "right": 426, "word": "5800438872", "page": 0}, "Invoice Total": {"height": 7, "width": 163, "y": 708, "x": 325, "right": 629, "word": "50,000.00 4,500.00 4,500.00 9,000.00", "page": 0}}', 'PO Number': '5800438872', 'Invoice Number': '6106', 'Invoice Category': None, 'Invoice Date': '2019-05-04', 'Invoice Total': '59000', 'Invoice Base Amount': '50000', 'GST Percentage': '', 'IGST Amount': '0', 'DRL GSTIN': '37AAACD7999Q1ZJ', 'Vendor GSTIN': '37AAUFA4486C1Z5', 'Billed To (DRL Name)': 'Dr. Reddys Laboratories Limited CTO-6', 'Vendor Name': 'Akshaya Lab Products', 'Special Instructions': '', 'Digital Signature': 'Yes', 'Document Heading': 'Tax Invoice', 'HSN/SAC': '', 'DC Number': '', 'SGST/CGST Amount': '', 'GRN Number': '', 'Service Entry Number': '', 'Comments': None, 'Table': '[[[[[["<b>Product description</b>",1,1],["<b>HSN/SAC</b>",1,1],["<b>Quantity</b>",1,1],["<b>Rate</b>",1,1],["<b>Gross Amount</b>",1,1]],[[" Headspace Vials 20ml - Pk/100 Cat No: FULV21 Make: Saint-Gobain Material Code: 940003734",1,1],[" Rate 70179090 18 %",1,1],[" 50 Pack",1,1],[" 1,000.00",1,1],[" 50,000.00",1,1]],[[" SGST Output @ 9%",1,1],["",1,1],["",1,1],[" 9",1,1],[" 4,500.00",1,1]],[[" CGST Output @ 9%",1,1],["",1,1],["",1,1],[" 9",1,1],[" 4,500.00",1,1]]]]]]'} # data['PO Number'] = "4" record = { 'Name': ['Ankit', 'Amit', 'Aishwarya', 'Priyanka', 'Priya', 'Shaurya' ], 'Age': [21, 19, 20, 18, 17, 21], 'Stream': ['Math', 'Commerce', 'Science', 'Math', 'Math', 'Science'], 'Percentage': [88, 92, 95, 70, 65, 78] } def evaluate_chained_rules(start=None, fax_unique_id=None): """Evaluate the chained rules""" # this means we are just starting.. if start == None: start = '1' rule_id = start # dangerous...might end in infinite loop..take care while rule_id != "END": rule_string, next_ruleid_if_success, next_ruleid_if_fail,stage, description, data_source = rules_id_mapping[rule_id] rule_to_evaluate = json.loads(rule_string) # get the data_source according to the case_id...and..the stage... data_source = {"ocr":data, "validation": data.copy(), "master":record} BR = BusinessRules.BusinessRules(fax_unique_id,[rule_to_evaluate], data_source) decision = BR.evaluate_rule(rule_to_evaluate) print ("HEREEE", decision) if decision: rule_id = next_ruleid_if_success else: rule_id = next_ruleid_if_fail if rule_id == "BOT": # send to the microservices # parameters- case_id, start, stage, table_name that bot should update return result = {} result['flag'] = True return result def run_business_rule_consumer_(data, function_params): print ("GOT THE PARAMTERTES", data, function_params) print (f"\n the data got is \n {data} \n") # evaluate the field validation case_id = data['case_id'] start_rule_id = data.get('next_rule_id', None) bot_message = data.get('bot_message', False) bot_status = data.get('bot_status', None) stage = None try: for func in data['functions']: try: if func['route'] == 'run_business_rule': stage = func['parameters']['stage'][0] except Exception as e: print (f"No stage is got {e}") stage = None except Exception as e: print (e) # stage = data.get('stage', None) print (f"\n GOT THE STAGE {stage} \n") if stage == 'default': db_tables = { "alorica_data": ['screen_shots'], "extraction" : ["ocr"], } apply_field_validations(case_id, stage, db_tables) return {'flag': True, 'message': 'Completed runninig default business rules.', 'updates': updates} if stage == 'validation': db_tables = { "extraction" : ["ocr"], "queues":["process_queue"] } updates = apply_field_validations(case_id, stage, db_tables) return {'flag': True, 'message': 'Completed runninig validation business rules.', 'updates': updates} if not bot_message: # updates = apply_field_validations(case_id) updates = None else: print ("CALLED BY BOT") print (case_id, start_rule_id, bot_message) updates = None # run all the chained rules print ("RUNNING CHAINED RULES ", start_rule_id,bot_message ) run_chained_rules(case_id,data, start_rule_id=start_rule_id, bot_finished=bot_message, bot_status=bot_status) return {'flag': True, 'message': 'Completed runninig business rules.', 'updates': updates} def run_business_rule_consumer(data): queue_db_config = { 'host': '172.31.45.112', 'user': 'root', 'password': 'AlgoTeam123', 'port': '3306' } queue_db = DB('queues', **queue_db_config) print("Submit data", data) if 'case_id' not in data: message = f'`case_id` key not provided.' print(message) return {'flag': False, 'message': message} case_id = data['case_id'] initialize_rules() tables = { "extraction" : ["business_rule","ocr","sap","validation"], "queues" : ["ocr_info", "process_queue"] } table_data = get_tables_data(tables, case_id) table_data['update'] = {} if 'stage' not in data: message = f'`{case_id}` key not provided. Running all stages...' print(message) stages = ['One'] for stage in stages: starting_time = time() data = apply_business_rules(api=True, table_data= table_data,stage=stage, case_id=case_id) print("time taken - ",time() - starting_time) if not data['flag'] and stage == 'One': DAO.update_error_msg(data['message'], case_id) update_values = update_table(table_data, case_id, tables) if data['flag']: return {'flag': data['flag'], 'message': 'Applied all business rules.', 'updates': update_values} else: return {'flag': data['flag'], 'message': 'Something failed.', 'updates': update_values} stages = data['stage'] starting_time = time() if type(stages) is str: data = apply_business_rules(api=True, table_data = table_data,**data) time_taken = time() - starting_time data['time_taken'] = time_taken # print("time takne - ",time_taken) update_values = update_table(table_data, case_id, tables) data['updates'] = update_values if not data['flag'] and stages == 'One': DAO.update_error_msg(data['message'], case_id) return data elif type(stages) is list: for stage in stages: # starting_time = time() rule_response = apply_business_rules(api=True, table_data= table_data,stage=stage, case_id=case_id) if not rule_response['flag'] and stage == 'One': try: messsage = rule_response['message'] except: messsage = 'Validation Failed due to execution error in business rules.' DAO.update_error_msg(message, case_id) if not rule_response['flag']: message = f'Something went wrong running stage at `{stage}`. Skipping other rules.' print(message) update_values = update_table(table_data, case_id, tables) return {'flag': False, 'message': message, 'updates':update_values} update_values = update_table(table_data, case_id, tables) print("time takne - ",time() - starting_time) if rule_response['flag']: return {'flag': rule_response['flag'], 'message': 'Completed runninig business rules.', 'updates': update_values} else: return {'flag': rule_response['flag'], 'message': 'Something wrong happened.', 'updates': update_values} def consume(broker_url='broker:9092'): try: route = 'run_business_rule' common_db_config = { 'host': 'common_db', 'port': '3306', 'user': 'root', 'password': 'root' } kafka_db = DB('kafka', **common_db_config) # kafka_db = DB('kafka') queue_db_config = { 'host': 'queue_db', 'port': '3306', 'user': 'root', 'password': '' } queue_db = DB('queues', **queue_db_config) # queue_db = DB('queues') message_flow = kafka_db.get_all('grouped_message_flow') print(f'Listening to topic `{route}`...') consumer = KafkaConsumer( bootstrap_servers=broker_url, value_deserializer=lambda value: json.loads(value.decode()), auto_offset_reset='earliest', group_id='run_business_rule', api_version=(0,10,1), enable_auto_commit=False, session_timeout_ms=800001, request_timeout_ms=800002 ) print('Consumer object created.') parts = consumer.partitions_for_topic(route) if parts is None: logging.warning(f'No partitions for topic `{route}`') logging.debug(f'Creating Topic: {route}') produce(route, {}) print(f'Listening to topic `{route}`...') while parts is None: consumer = KafkaConsumer( bootstrap_servers=broker_url, value_deserializer=lambda value: json.loads(value.decode()), auto_offset_reset='earliest', group_id='sap_portal', api_version=(0,10,1), enable_auto_commit=False, session_timeout_ms=800001, request_timeout_ms=800002 ) parts = consumer.partitions_for_topic(route) logging.warning("No partition. In while loop. Make it stop") partitions = [TopicPartition(route, p) for p in parts] consumer.assign(partitions) query = 'SELECT * FROM `button_functions` WHERE `route`=%s' function_info = queue_db.execute(query, params=[route]) in_progress_message = list(function_info['in_progress_message'])[0] failure_message = list(function_info['failure_message'])[0] success_message = list(function_info['success_message'])[0] for message in consumer: data = message.value try: case_id = data['case_id'] functions = data['functions'] except Exception as e: print(f'Recieved unknown data. [{data}] [{e}]') consumer.commit() continue function_params = {} # coming from bot_watcher .... not button function print ("CHECKING FOR THE IS BUTTON", data.get('is_button', True)) if not data.get('is_button', False): try: result = run_business_rule_consumer_(data, function_params) except Exception as e: print (f"Error runnign the business_rules {e}") print (str(e)) query = 'UPDATE `process_queue` SET `queue`=%s, `status`=%s, `case_lock`=0, `failure_status`=1 WHERE `case_id`=%s' queue_db.execute(query, params=['GHI678', failure_message, case_id]) consumer.commit() continue # Get which button (group in kafka table) this function was called from group = data['group'] # Get message group functions group_messages = message_flow.loc[message_flow['message_group'] == group] # If its the first function the update the progress count first_flow = group_messages.head(1) first_topic = first_flow.loc[first_flow['listen_to_topic'] == route] query = 'UPDATE `process_queue` SET `status`=%s, `total_processes`=%s WHERE `case_id`=%s' if not first_topic.empty: if list(first_flow['send_to_topic'])[0] is None: queue_db.execute(query, params=[in_progress_message, len(group_messages), case_id]) else: queue_db.execute(query, params=[in_progress_message, len(group_messages) + 1, case_id]) # Getting the correct data for the functions. This data will be passed through # rest of the chained functions. function_params = {} for function in functions: if function['route'] == route: function_params = function['parameters'] break # Call save changes function try: print (f"\n the data got is \n {data} \n") result = run_business_rule_consumer_(data, function_params) # return {'flag': True, 'message': 'Completed runninig business rules.', 'updates': None} except Exception as e: # Unlock the case. logging.error(e) query = 'UPDATE `process_queue` SET `queue`=%s, `status`=%s, `case_lock`=0, `failure_status`=1 WHERE `case_id`=%s' queue_db.execute(query, params=['Maker', failure_message, case_id]) consumer.commit() continue # Check if function was succesfully executed if result['flag']: # If there is only function for the group, unlock case. if not first_topic.empty: if list(first_flow['send_to_topic'])[0] is None: # It is the last message. So update file status to completed. query = 'UPDATE `process_queue` SET `status`=%s, `case_lock`=0, `completed_processes`=`completed_processes`+1 WHERE `case_id`=%s' queue_db.execute(query, params=[success_message, case_id]) consumer.commit() continue last_topic = group_messages.tail( 1).loc[group_messages['send_to_topic'] == route] # If it is not the last message, then produce to next function else just unlock case. if last_topic.empty: # Get next function name print ("\n CHECKING FOR THE DATA \n") print (data) next_topic = list( group_messages.loc[group_messages['listen_to_topic'] == route]['send_to_topic'])[0] if next_topic is not None: produce(next_topic, data) # Update the progress count by 1 query = 'UPDATE `process_queue` SET `status`=%s, `completed_processes`=`completed_processes`+1 WHERE `case_id`=%s' queue_db.execute(query, params=[success_message, case_id]) consumer.commit() else: # It is the last message. So update file status to completed. query = 'UPDATE `process_queue` SET `status`=%s, `case_lock`=0, `completed_processes`=`completed_processes`+1 WHERE `case_id`=%s' queue_db.execute(query, params=[success_message, case_id]) consumer.commit() else: # Unlock the case. query = 'UPDATE `process_queue` SET `status`=%s, `case_lock`=0, `failure_status`=1 WHERE `case_id`=%s' queue_db.execute(query, params=[failure_message, case_id]) consumer.commit() except: logging.exception('Something went wrong in consumer. Check trace.') if __name__ == '__main__': consume()
997,951
6103bfe71f3902e7aecf01904c4a375a20713a47
#syntax: num = 20 if num < 10: print("less than") elif num > 10: print("greater than") else: print("equal to") #None returns false #empty objects (string, etc) return false #Any non-empty object returns true string = "" if string: print("string is non-empty") else: print("string is empty") s = [] if string: print("list is non-empty") else: print("list is empty") #logical opertors #and #or #not #identity operators #is #is not #membership operators #in #not ink
997,952
c249104133c1defa2d08e44347762ed8d011890f
import time,threading """ 多线程 """ def loop(): thread_name = threading.current_thread().name print('Thread %s is running...' % thread_name) n = 0 while n < 5: n += 1 print('Thread %s >>> %d' % (thread_name, n)) print('Thread %s ends.' % thread_name) thread_name = threading.current_thread().name print('Thread %s is running...' % thread_name) t = threading.Thread(target= loop, name= 'loopThread') t.start() t.join() print('Thread %s ends.' % thread_name)
997,953
48adabe462019ee5c264a8450be820aa147ca697
# -*- coding: utf-8 -*- import time import pika def callback(channel, method, properties, body): print("****** received: %r" % body) time.sleep(body.count(b'.')) connection = pika.BlockingConnection(pika.ConnectionParameters(host="localhost")) channel = connection.channel() channel.queue_declare(queue="hello") channel.basic_consume(callback, queue="hello", no_ack=True) print("--- Waiting for message. To exit press ctrl + c. ---") channel.start_consuming()
997,954
f5e9503aa86286a887c1d0b137b9f05edbbce624
import player # required to make imports work properly import sys sys.path.append("../") from game import ChessGame def main(): play_game() def play_game(): p1 = player.RandomComputer() p2 = player.BasicMinimax() game = ChessGame(p1, p2) game.play() if __name__ == "__main__": main()
997,955
319a8a297bfcaf203c0b15af46a4d3376db93f4f
import pygame import constants import objects class Level(): entities = None enemy_list = None camerafocus = "" background = None def __init__(self, player, game): self.game = game game.entities = pygame.sprite.Group() game.enemygroup = pygame.sprite.Group() game.lives = pygame.sprite.Group() self.heart_list = pygame.sprite.Group() self.player = player def update(self): self.game.entities.update() self.game.enemygroup.update() self.game.enemygroup2.update(self.game.entities, self.game.projectilegroup, self.player) self.game.projectilegroup.update(self.game.entities, self.game.enemygroup2) #self.game.lives.update(self.player) def drawBackground(self, screen): screen.blit(self.background, (0, 0)) def setLives(self): heart_list = [[objects.HEART, 0, 0]] for hearts in heart_list: block = objects.Lives(hearts[0]) block.rect.x = hearts[1] block.rect.y = hearts[2] block.player = self.player self.game.lives.add(block) def setGroups(self, neutral, enemy): for enemy in enemy: block = objects.Harmful(enemy[0]) block.rect.x = enemy[1] block.rect.y = enemy[2] block.player = self.player self.game.enemygroup.add(block) for platform in neutral: block = objects.Platform(platform[0]) block.rect.x = platform[1] block.rect.y = platform[2] block.player = self.player self.game.entities.add(block) class Level1(Level): def __init__(self, player): Level.__init__(self, player, player.game) self.background = pygame.image.load("background1.png").convert() #Invisible obstacles stop the player from going out of bounds self.level = [[objects.INV_OBSTACLE, -50, -400], [objects.INV_OBSTACLE, -50, 0], [objects.INV_OBSTACLE, -50, 408]] self.harmful_objects = [[objects.SPIKES, 480, 768],[objects.SPIKES, 600, 768], [objects.SPIKES, 720, 768], [objects.SPIKES, 840, 768], [objects.SPIKES, 450, 185], [objects.SPIKES, 578, 185], [objects.SPIKES, 706, 185], [objects.SPIKES, 833, 185],] # Add the hearts and enemy/platform sprites to spritegroups in class Game self.setLives() self.setGroups(self.level, self.harmful_objects) block = objects.Bat(500, 600, 2) block.boundary_left = 300 block.player = self.player self.game.enemygroup2.add(block) block = objects.Bat(350, 285, 2) block.boundary_left = 200 block.boundary_right = 630 block.player = self.player self.game.enemygroup2.add(block) block = objects.Bat(300, 50, 2) block.boundary_left = 150 block.boundary_right = 780 block.player = self.player self.game.enemygroup2.add(block) block = objects.Bat(1300, 600, 2) block.boundary_left = 1100 block.boundary_right = 1500 block.player = self.player self.game.enemygroup2.add(block) block = objects.Bat(1300, 400, 2) block.boundary_left = 1000 block.boundary_right = 1500 block.player = self.player self.game.enemygroup2.add(block) block = objects.Bat(1100, 300, 2) block.boundary_left = 1000 block.boundary_right = 1500 block.player = self.player self.game.enemygroup2.add(block) block = objects.Bat(1100, 200, 2) block.boundary_left = 1000 block.boundary_right = 1500 block.player = self.player self.game.enemygroup2.add(block) ''' block = objects.Harmful(objects.SPIKES) block.rect.x = 330 block.rect.y = 550 block.player = self.player block.level = self self.game.entities.add(block) ''' block = objects.Platform(objects.FLOOR) block.rect.x = 0 block.rect.y = 750 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.FLOOR) block.rect.x = 480 block.rect.y = 783 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.FLOOR) block.rect.x = 960 block.rect.y = 750 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.FLOOR) block.rect.x = 1200 block.rect.y = 750 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.FLOOR) block.rect.x = 1350 block.rect.y = 750 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 960 block.rect.y = 141 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 960 block.rect.y = 237 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 960 block.rect.y = 333 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 960 block.rect.y = 429 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = 650 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = 650 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = 555 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = 460 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = 365 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = 270 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = 175 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = 80 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.CHAINS) block.rect.x = 1810 block.rect.y = -15 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.BOX_S_STRIPPED) block.rect.x = 960 block.rect.y = 686 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.BOX_S_STRIPPED) block.rect.x = 960 block.rect.y = 623 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.BOX_S_STRIPPED) block.rect.x = 960 block.rect.y = 560 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.BOX_S_STRIPPED) block.rect.x = 960 block.rect.y = 497 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.BOX_B_STRIPPED) block.rect.x = 1023 block.rect.y = 653 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_W_WINDOWS) block.rect.x = 270 block.rect.y = 520 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_W_WINDOWS) block.rect.x = 270 block.rect.y = 270 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_W_WINDOWS) block.rect.x = 843 block.rect.y = 520 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_W_WINDOWS) block.rect.x = 1227 block.rect.y = 520 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_W_WINDOWS) block.rect.x = -300 block.rect.y = 270 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_W_WINDOWS) block.rect.x = 843 block.rect.y = 270 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_W_WINDOWS) block.rect.x = 1227 block.rect.y = 270 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_BOXES) block.rect.x = 0 block.rect.y = 143 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_BOXES) block.rect.x = 764 block.rect.y = 143 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_BOXES) block.rect.x = 380 block.rect.y = 143 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_BOXES) block.rect.x = 0 block.rect.y = 0 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_BOXES) block.rect.x = 764 block.rect.y = 0 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Backgrounds(objects.BACKGROUND_BLACK_BOXES) block.rect.x = 380 block.rect.y = 0 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Platform(objects.FLOOR) block.rect.x = -125 block.rect.y = 526 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Backgrounds(objects.BACKGROUND_W_STAIRS) block.rect.x = 0 block.rect.y = 526 block.player = self.player block.level = self self.game.backgrounds.add(block) block = objects.Platform(objects.PLATFORM_DARK_GREY) block.rect.x = 500 block.rect.y = 200 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.PLATFORM_DARK_GREY) block.rect.x = 720 block.rect.y = 200 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.PLATFORM_DARK_GREY) block.rect.x = 256 block.rect.y = 200 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.PLATFORM_DARK_GREY) block.rect.x = 960 block.rect.y = 113 block.player = self.player block.level = self self.game.entities.add(block) block = objects.MovingPlatform(objects.SMALL_PLAT) block.rect.x = 770 block.rect.y = 400 block.boundary_bottom = 680 block.boundary_top = 350 block.boundary_left = -380 block.boundary_right = 1900 block.change_y = 1 block.player = self.player block.level = self self.game.entities.add(block) block = objects.MovingPlatform(objects.SMALL_PLAT) block.rect.x = 1300 block.rect.y = 400 block.boundary_bottom = 630 block.boundary_top = 150 block.boundary_left = -380 block.boundary_right = 1900 block.change_y = 1 block.player = self.player block.level = self self.game.entities.add(block) block = objects.MovingPlatform(objects.SMALL_PLAT) block.rect.x = 0 block.rect.y = 250 block.boundary_bottom = 450 block.boundary_top = 150 block.boundary_left = -380 block.boundary_right = 1900 block.change_y = 1 block.player = self.player block.level = self self.game.entities.add(block) block = objects.MovingPlatform(objects.PLATFORM_GREY_SMALL) block.rect.x = 700 block.rect.y = 150 block.boundary_bottom = 450 block.boundary_top = 150 block.boundary_left = 450 block.boundary_right = 900 block.change_x = 1 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.BOX_S_STRIPPED) block.rect.x = 200 block.rect.y = 463 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.PLATFORM_GREY_SMALL) block.rect.x = 550 block.rect.y = 700 block.player = self.player block.level = self self.game.entities.add(block) block = objects.Platform(objects.PLATFORM_GREY_SMALL) block.rect.x = 550 block.rect.y = 400 block.player = self.player block.level = self self.game.entities.add(block) ''' block = objects.MovingPlatform(objects.SMALL_PLAT) block.rect.x = 550 block.rect.y = 700 block.boundary_bottom = 700 block.boundary_top = 100 block.boundary_left = 550 block.boundary_right = 750 block.change_x = -1 block.player = self.player block.level = self self.game.entities.add(block) ''' ''' block = objects.MovingPlatform(objects.FLOOR) #add the moving platforms (direction: horizontal) block.rect.x = 0 block.rect.y = 750 block.boundary_left = -380 block.boundary_right = 2000 block.change_x = -2 block.player = self.player block.level = self self.game.entities.add(block) ''' class Level2(Level): #Level 2 Empty for now def __init__(self, player): Level.__init__(self,player, player.game) self.background = pygame.image.load("back4.png").convert() self.level = [[objects.FLOOR, 390,700], [objects.AIR_PLAT, 500, 400]] self.game.harmful_objects = [[objects.HOT_MAGMA, 0, 765], [objects.HOT_MAGMA, 295, 765], [objects.HOT_MAGMA, 2 * 295, 765], [objects.HOT_MAGMA, 3 * 295, 765], [objects.HOT_MAGMA, 4 * 295, 765],[objects.HOT_MAGMA, -250,765], [objects.HOT_MAGMA, -500,765]] self.setLives() self.setGroups(self.level, self.game.harmful_objects)
997,956
211b30794b165ac5728a5dbae3d1ef6838e82511
# Generated from visualg.g4 by ANTLR 4.8 from antlr4 import * from io import StringIO from typing.io import TextIO import sys def serializedATN(): with StringIO() as buf: buf.write("\3\u608b\ua72a\u8133\ub9ed\u417c\u3be7\u7786\u5964\2?") buf.write("\u0249\b\1\4\2\t\2\4\3\t\3\4\4\t\4\4\5\t\5\4\6\t\6\4\7") buf.write("\t\7\4\b\t\b\4\t\t\t\4\n\t\n\4\13\t\13\4\f\t\f\4\r\t\r") buf.write("\4\16\t\16\4\17\t\17\4\20\t\20\4\21\t\21\4\22\t\22\4\23") buf.write("\t\23\4\24\t\24\4\25\t\25\4\26\t\26\4\27\t\27\4\30\t\30") buf.write("\4\31\t\31\4\32\t\32\4\33\t\33\4\34\t\34\4\35\t\35\4\36") buf.write("\t\36\4\37\t\37\4 \t \4!\t!\4\"\t\"\4#\t#\4$\t$\4%\t%") buf.write("\4&\t&\4\'\t\'\4(\t(\4)\t)\4*\t*\4+\t+\4,\t,\4-\t-\4.") buf.write("\t.\4/\t/\4\60\t\60\4\61\t\61\4\62\t\62\4\63\t\63\4\64") buf.write("\t\64\4\65\t\65\4\66\t\66\4\67\t\67\48\t8\49\t9\4:\t:") buf.write("\4;\t;\4<\t<\4=\t=\4>\t>\4?\t?\3\2\3\2\3\3\3\3\3\3\3\3") buf.write("\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3") buf.write("\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\3\5\3\u009c\n\3\3\4\3") buf.write("\4\3\4\3\4\5\4\u00a2\n\4\3\5\3\5\3\5\3\5\3\5\3\5\3\5\3") buf.write("\5\5\5\u00ac\n\5\3\6\3\6\3\6\3\6\3\6\3\6\3\6\3\6\3\6\5") buf.write("\6\u00b7\n\6\3\7\3\7\3\b\3\b\3\b\3\b\3\b\3\b\3\b\3\t\3") buf.write("\t\3\t\3\t\3\t\3\t\3\t\3\t\3\t\3\t\3\t\3\t\3\t\3\n\3\n") buf.write("\3\n\3\n\3\n\3\n\3\n\3\n\3\n\3\n\3\13\6\13\u00da\n\13") buf.write("\r\13\16\13\u00db\3\13\7\13\u00df\n\13\f\13\16\13\u00e2") buf.write("\13\13\3\f\3\f\3\f\3\f\7\f\u00e8\n\f\f\f\16\f\u00eb\13") buf.write("\f\3\f\3\f\3\f\3\f\3\r\3\r\6\r\u00f3\n\r\r\r\16\r\u00f4") buf.write("\3\r\3\r\3\16\3\16\3\16\3\16\3\16\3\16\3\17\3\17\3\17") buf.write("\3\20\3\20\3\21\3\21\3\22\3\22\3\23\3\23\3\24\3\24\3\25") buf.write("\3\25\3\25\3\26\6\26\u0110\n\26\r\26\16\26\u0111\3\27") buf.write("\6\27\u0115\n\27\r\27\16\27\u0116\3\27\3\27\6\27\u011b") buf.write("\n\27\r\27\16\27\u011c\5\27\u011f\n\27\3\30\3\30\3\30") buf.write("\3\30\3\30\3\30\3\30\3\30\3\30\3\30\3\30\3\30\3\30\3\30") buf.write("\3\30\5\30\u0130\n\30\3\31\3\31\3\31\3\32\3\32\3\32\3") buf.write("\32\3\32\3\32\3\32\3\32\3\32\3\32\3\32\3\32\3\32\3\32") buf.write("\3\32\5\32\u0144\n\32\3\33\3\33\3\33\3\33\3\33\3\34\3") buf.write("\34\3\34\3\35\3\35\3\35\3\35\3\35\3\35\3\36\3\36\3\36") buf.write("\3\36\3\36\3\36\3\37\3\37\3\37\3\37\3\37\3\37\3 \3 \3") buf.write(" \3 \3 \3 \3 \3 \3!\3!\3!\3!\3!\3\"\3\"\3\"\3\"\3\"\3") buf.write("\"\3\"\3\"\3\"\3\"\3#\3#\3#\3#\3#\3#\3#\3#\3#\3#\3#\3") buf.write("$\3$\3%\3%\3%\3%\3%\3&\3&\3&\3&\3\'\3\'\3\'\3\'\3\'\3") buf.write("(\3(\3(\3(\3(\3(\3(\3(\3)\3)\3)\3)\3)\3)\3)\3*\3*\3*\3") buf.write("*\3*\3*\3*\3*\3*\3+\3+\3+\3+\3+\3+\3+\3+\3+\3+\3+\3+\3") buf.write(",\3,\3,\3,\3,\3,\3,\3,\3,\3,\3,\3-\3-\3-\3-\3-\3-\3-\3") buf.write("-\3-\3-\3-\3-\3-\3.\3.\3.\3.\3.\3.\3.\3.\3.\3.\3.\3.\3") buf.write(".\3.\3.\3.\3/\3/\3/\3/\3/\3/\3/\3\60\3\60\3\60\3\60\3") buf.write("\60\3\60\3\60\3\60\3\61\3\61\3\61\3\61\3\61\3\61\3\61") buf.write("\3\61\3\61\3\61\3\62\3\62\3\63\3\63\3\63\3\63\3\64\3\64") buf.write("\3\64\3\65\3\65\3\65\3\65\3\66\3\66\3\66\3\66\3\66\3\66") buf.write("\3\66\3\66\3\67\3\67\6\67\u020e\n\67\r\67\16\67\u020f") buf.write("\3\67\3\67\6\67\u0214\n\67\r\67\16\67\u0215\3\67\3\67") buf.write("\38\38\38\38\38\38\39\39\59\u0222\n9\3:\3:\5:\u0226\n") buf.write(":\3;\3;\3;\3;\3;\3;\3;\3;\3;\3;\3<\3<\3=\3=\3=\3=\3=\3") buf.write("=\3=\3=\3=\3=\3>\3>\3>\3>\3>\3>\3?\3?\3?\3?\3?\3?\3\u00e9") buf.write("\2@\3\2\5\3\7\4\t\5\13\6\r\7\17\b\21\t\23\n\25\13\27\f") buf.write("\31\r\33\16\35\17\37\20!\21#\22%\23\'\24)\25+\26-\27/") buf.write("\30\61\31\63\32\65\33\67\349\35;\36=\37? A!C\"E#G$I%K") buf.write("&M\'O(Q)S*U+W,Y-[.]/_\60a\61c\62e\63g\64i\65k\66m\67o") buf.write("8q9s:u;w<y={>}?\3\2\f\3\2\62;\5\2,-//\61\61\4\2>>@@\4") buf.write("\2--//\4\2C\\c|\6\2\62;C\\aac|\3\2$$\b\2\"\"%\60\62\\") buf.write("``c|~~\3\2\60\60\5\2\62;C\\c|\2\u0260\2\5\3\2\2\2\2\7") buf.write("\3\2\2\2\2\t\3\2\2\2\2\13\3\2\2\2\2\r\3\2\2\2\2\17\3\2") buf.write("\2\2\2\21\3\2\2\2\2\23\3\2\2\2\2\25\3\2\2\2\2\27\3\2\2") buf.write("\2\2\31\3\2\2\2\2\33\3\2\2\2\2\35\3\2\2\2\2\37\3\2\2\2") buf.write("\2!\3\2\2\2\2#\3\2\2\2\2%\3\2\2\2\2\'\3\2\2\2\2)\3\2\2") buf.write("\2\2+\3\2\2\2\2-\3\2\2\2\2/\3\2\2\2\2\61\3\2\2\2\2\63") buf.write("\3\2\2\2\2\65\3\2\2\2\2\67\3\2\2\2\29\3\2\2\2\2;\3\2\2") buf.write("\2\2=\3\2\2\2\2?\3\2\2\2\2A\3\2\2\2\2C\3\2\2\2\2E\3\2") buf.write("\2\2\2G\3\2\2\2\2I\3\2\2\2\2K\3\2\2\2\2M\3\2\2\2\2O\3") buf.write("\2\2\2\2Q\3\2\2\2\2S\3\2\2\2\2U\3\2\2\2\2W\3\2\2\2\2Y") buf.write("\3\2\2\2\2[\3\2\2\2\2]\3\2\2\2\2_\3\2\2\2\2a\3\2\2\2\2") buf.write("c\3\2\2\2\2e\3\2\2\2\2g\3\2\2\2\2i\3\2\2\2\2k\3\2\2\2") buf.write("\2m\3\2\2\2\2o\3\2\2\2\2q\3\2\2\2\2s\3\2\2\2\2u\3\2\2") buf.write("\2\2w\3\2\2\2\2y\3\2\2\2\2{\3\2\2\2\2}\3\2\2\2\3\177\3") buf.write("\2\2\2\5\u009b\3\2\2\2\7\u00a1\3\2\2\2\t\u00ab\3\2\2\2") buf.write("\13\u00b6\3\2\2\2\r\u00b8\3\2\2\2\17\u00ba\3\2\2\2\21") buf.write("\u00c1\3\2\2\2\23\u00ce\3\2\2\2\25\u00d9\3\2\2\2\27\u00e3") buf.write("\3\2\2\2\31\u00f0\3\2\2\2\33\u00f8\3\2\2\2\35\u00fe\3") buf.write("\2\2\2\37\u0101\3\2\2\2!\u0103\3\2\2\2#\u0105\3\2\2\2") buf.write("%\u0107\3\2\2\2\'\u0109\3\2\2\2)\u010b\3\2\2\2+\u010f") buf.write("\3\2\2\2-\u0114\3\2\2\2/\u012f\3\2\2\2\61\u0131\3\2\2") buf.write("\2\63\u0143\3\2\2\2\65\u0145\3\2\2\2\67\u014a\3\2\2\2") buf.write("9\u014d\3\2\2\2;\u0153\3\2\2\2=\u0159\3\2\2\2?\u015f\3") buf.write("\2\2\2A\u0167\3\2\2\2C\u016c\3\2\2\2E\u0176\3\2\2\2G\u0181") buf.write("\3\2\2\2I\u0183\3\2\2\2K\u0188\3\2\2\2M\u018c\3\2\2\2") buf.write("O\u0191\3\2\2\2Q\u0199\3\2\2\2S\u01a0\3\2\2\2U\u01a9\3") buf.write("\2\2\2W\u01b5\3\2\2\2Y\u01c0\3\2\2\2[\u01cd\3\2\2\2]\u01dd") buf.write("\3\2\2\2_\u01e4\3\2\2\2a\u01ec\3\2\2\2c\u01f6\3\2\2\2") buf.write("e\u01f8\3\2\2\2g\u01fc\3\2\2\2i\u01ff\3\2\2\2k\u0203\3") buf.write("\2\2\2m\u020b\3\2\2\2o\u0219\3\2\2\2q\u0221\3\2\2\2s\u0225") buf.write("\3\2\2\2u\u0227\3\2\2\2w\u0231\3\2\2\2y\u0233\3\2\2\2") buf.write("{\u023d\3\2\2\2}\u0243\3\2\2\2\177\u0080\t\2\2\2\u0080") buf.write("\4\3\2\2\2\u0081\u0082\7k\2\2\u0082\u0083\7p\2\2\u0083") buf.write("\u0084\7v\2\2\u0084\u0085\7g\2\2\u0085\u0086\7k\2\2\u0086") buf.write("\u0087\7t\2\2\u0087\u009c\7q\2\2\u0088\u0089\7t\2\2\u0089") buf.write("\u008a\7g\2\2\u008a\u008b\7c\2\2\u008b\u009c\7n\2\2\u008c") buf.write("\u008d\7e\2\2\u008d\u008e\7c\2\2\u008e\u008f\7t\2\2\u008f") buf.write("\u0090\7c\2\2\u0090\u0091\7e\2\2\u0091\u0092\7v\2\2\u0092") buf.write("\u0093\7g\2\2\u0093\u0094\7t\2\2\u0094\u009c\7g\2\2\u0095") buf.write("\u0096\7n\2\2\u0096\u0097\7q\2\2\u0097\u0098\7i\2\2\u0098") buf.write("\u0099\7k\2\2\u0099\u009a\7e\2\2\u009a\u009c\7q\2\2\u009b") buf.write("\u0081\3\2\2\2\u009b\u0088\3\2\2\2\u009b\u008c\3\2\2\2") buf.write("\u009b\u0095\3\2\2\2\u009c\6\3\2\2\2\u009d\u00a2\t\3\2") buf.write("\2\u009e\u009f\7o\2\2\u009f\u00a0\7q\2\2\u00a0\u00a2\7") buf.write("f\2\2\u00a1\u009d\3\2\2\2\u00a1\u009e\3\2\2\2\u00a2\b") buf.write("\3\2\2\2\u00a3\u00ac\t\4\2\2\u00a4\u00a5\7>\2\2\u00a5") buf.write("\u00ac\7?\2\2\u00a6\u00a7\7@\2\2\u00a7\u00ac\7?\2\2\u00a8") buf.write("\u00ac\7?\2\2\u00a9\u00aa\7>\2\2\u00aa\u00ac\7@\2\2\u00ab") buf.write("\u00a3\3\2\2\2\u00ab\u00a4\3\2\2\2\u00ab\u00a6\3\2\2\2") buf.write("\u00ab\u00a8\3\2\2\2\u00ab\u00a9\3\2\2\2\u00ac\n\3\2\2") buf.write("\2\u00ad\u00ae\7p\2\2\u00ae\u00af\7c\2\2\u00af\u00b7\7") buf.write("q\2\2\u00b0\u00b1\7q\2\2\u00b1\u00b7\7w\2\2\u00b2\u00b7") buf.write("\7g\2\2\u00b3\u00b4\7z\2\2\u00b4\u00b5\7q\2\2\u00b5\u00b7") buf.write("\7w\2\2\u00b6\u00ad\3\2\2\2\u00b6\u00b0\3\2\2\2\u00b6") buf.write("\u00b2\3\2\2\2\u00b6\u00b3\3\2\2\2\u00b7\f\3\2\2\2\u00b8") buf.write("\u00b9\t\5\2\2\u00b9\16\3\2\2\2\u00ba\u00bb\7k\2\2\u00bb") buf.write("\u00bc\7p\2\2\u00bc\u00bd\7k\2\2\u00bd\u00be\7e\2\2\u00be") buf.write("\u00bf\7k\2\2\u00bf\u00c0\7q\2\2\u00c0\20\3\2\2\2\u00c1") buf.write("\u00c2\7h\2\2\u00c2\u00c3\7k\2\2\u00c3\u00c4\7o\2\2\u00c4") buf.write("\u00c5\7C\2\2\u00c5\u00c6\7n\2\2\u00c6\u00c7\7i\2\2\u00c7") buf.write("\u00c8\7q\2\2\u00c8\u00c9\7t\2\2\u00c9\u00ca\7k\2\2\u00ca") buf.write("\u00cb\7v\2\2\u00cb\u00cc\7o\2\2\u00cc\u00cd\7q\2\2\u00cd") buf.write("\22\3\2\2\2\u00ce\u00cf\7c\2\2\u00cf\u00d0\7n\2\2\u00d0") buf.write("\u00d1\7i\2\2\u00d1\u00d2\7q\2\2\u00d2\u00d3\7t\2\2\u00d3") buf.write("\u00d4\7k\2\2\u00d4\u00d5\7v\2\2\u00d5\u00d6\7o\2\2\u00d6") buf.write("\u00d7\7q\2\2\u00d7\24\3\2\2\2\u00d8\u00da\t\6\2\2\u00d9") buf.write("\u00d8\3\2\2\2\u00da\u00db\3\2\2\2\u00db\u00d9\3\2\2\2") buf.write("\u00db\u00dc\3\2\2\2\u00dc\u00e0\3\2\2\2\u00dd\u00df\t") buf.write("\7\2\2\u00de\u00dd\3\2\2\2\u00df\u00e2\3\2\2\2\u00e0\u00de") buf.write("\3\2\2\2\u00e0\u00e1\3\2\2\2\u00e1\26\3\2\2\2\u00e2\u00e0") buf.write("\3\2\2\2\u00e3\u00e4\7\61\2\2\u00e4\u00e5\7\61\2\2\u00e5") buf.write("\u00e9\3\2\2\2\u00e6\u00e8\13\2\2\2\u00e7\u00e6\3\2\2") buf.write("\2\u00e8\u00eb\3\2\2\2\u00e9\u00ea\3\2\2\2\u00e9\u00e7") buf.write("\3\2\2\2\u00ea\u00ec\3\2\2\2\u00eb\u00e9\3\2\2\2\u00ec") buf.write("\u00ed\7\f\2\2\u00ed\u00ee\3\2\2\2\u00ee\u00ef\b\f\2\2") buf.write("\u00ef\30\3\2\2\2\u00f0\u00f2\t\b\2\2\u00f1\u00f3\t\t") buf.write("\2\2\u00f2\u00f1\3\2\2\2\u00f3\u00f4\3\2\2\2\u00f4\u00f2") buf.write("\3\2\2\2\u00f4\u00f5\3\2\2\2\u00f5\u00f6\3\2\2\2\u00f6") buf.write("\u00f7\t\b\2\2\u00f7\32\3\2\2\2\u00f8\u00f9\7x\2\2\u00f9") buf.write("\u00fa\7g\2\2\u00fa\u00fb\7v\2\2\u00fb\u00fc\7q\2\2\u00fc") buf.write("\u00fd\7t\2\2\u00fd\34\3\2\2\2\u00fe\u00ff\7f\2\2\u00ff") buf.write("\u0100\7g\2\2\u0100\36\3\2\2\2\u0101\u0102\7]\2\2\u0102") buf.write(" \3\2\2\2\u0103\u0104\7_\2\2\u0104\"\3\2\2\2\u0105\u0106") buf.write("\7*\2\2\u0106$\3\2\2\2\u0107\u0108\7+\2\2\u0108&\3\2\2") buf.write("\2\u0109\u010a\7.\2\2\u010a(\3\2\2\2\u010b\u010c\7>\2") buf.write("\2\u010c\u010d\7/\2\2\u010d*\3\2\2\2\u010e\u0110\5\3\2") buf.write("\2\u010f\u010e\3\2\2\2\u0110\u0111\3\2\2\2\u0111\u010f") buf.write("\3\2\2\2\u0111\u0112\3\2\2\2\u0112,\3\2\2\2\u0113\u0115") buf.write("\5\3\2\2\u0114\u0113\3\2\2\2\u0115\u0116\3\2\2\2\u0116") buf.write("\u0114\3\2\2\2\u0116\u0117\3\2\2\2\u0117\u011e\3\2\2\2") buf.write("\u0118\u011a\t\n\2\2\u0119\u011b\5\3\2\2\u011a\u0119\3") buf.write("\2\2\2\u011b\u011c\3\2\2\2\u011c\u011a\3\2\2\2\u011c\u011d") buf.write("\3\2\2\2\u011d\u011f\3\2\2\2\u011e\u0118\3\2\2\2\u011e") buf.write("\u011f\3\2\2\2\u011f.\3\2\2\2\u0120\u0121\7H\2\2\u0121") buf.write("\u0122\7C\2\2\u0122\u0123\7N\2\2\u0123\u0124\7U\2\2\u0124") buf.write("\u0130\7Q\2\2\u0125\u0126\7X\2\2\u0126\u0127\7G\2\2\u0127") buf.write("\u0128\7T\2\2\u0128\u0129\7F\2\2\u0129\u012a\7C\2\2\u012a") buf.write("\u012b\7F\2\2\u012b\u012c\7G\2\2\u012c\u012d\7K\2\2\u012d") buf.write("\u012e\7T\2\2\u012e\u0130\7Q\2\2\u012f\u0120\3\2\2\2\u012f") buf.write("\u0125\3\2\2\2\u0130\60\3\2\2\2\u0131\u0132\7\60\2\2\u0132") buf.write("\u0133\7\60\2\2\u0133\62\3\2\2\2\u0134\u0135\7g\2\2\u0135") buf.write("\u0136\7u\2\2\u0136\u0137\7e\2\2\u0137\u0138\7t\2\2\u0138") buf.write("\u0139\7g\2\2\u0139\u013a\7x\2\2\u013a\u0144\7c\2\2\u013b") buf.write("\u013c\7g\2\2\u013c\u013d\7u\2\2\u013d\u013e\7e\2\2\u013e") buf.write("\u013f\7t\2\2\u013f\u0140\7g\2\2\u0140\u0141\7x\2\2\u0141") buf.write("\u0142\7c\2\2\u0142\u0144\7n\2\2\u0143\u0134\3\2\2\2\u0143") buf.write("\u013b\3\2\2\2\u0144\64\3\2\2\2\u0145\u0146\7n\2\2\u0146") buf.write("\u0147\7g\2\2\u0147\u0148\7k\2\2\u0148\u0149\7c\2\2\u0149") buf.write("\66\3\2\2\2\u014a\u014b\7u\2\2\u014b\u014c\7g\2\2\u014c") buf.write("8\3\2\2\2\u014d\u014e\7g\2\2\u014e\u014f\7p\2\2\u014f") buf.write("\u0150\7v\2\2\u0150\u0151\7c\2\2\u0151\u0152\7q\2\2\u0152") buf.write(":\3\2\2\2\u0153\u0154\7u\2\2\u0154\u0155\7g\2\2\u0155") buf.write("\u0156\7p\2\2\u0156\u0157\7c\2\2\u0157\u0158\7q\2\2\u0158") buf.write("<\3\2\2\2\u0159\u015a\7h\2\2\u015a\u015b\7k\2\2\u015b") buf.write("\u015c\7o\2\2\u015c\u015d\7u\2\2\u015d\u015e\7g\2\2\u015e") buf.write(">\3\2\2\2\u015f\u0160\7g\2\2\u0160\u0161\7u\2\2\u0161") buf.write("\u0162\7e\2\2\u0162\u0163\7q\2\2\u0163\u0164\7n\2\2\u0164") buf.write("\u0165\7j\2\2\u0165\u0166\7c\2\2\u0166@\3\2\2\2\u0167") buf.write("\u0168\7e\2\2\u0168\u0169\7c\2\2\u0169\u016a\7u\2\2\u016a") buf.write("\u016b\7q\2\2\u016bB\3\2\2\2\u016c\u016d\7q\2\2\u016d") buf.write("\u016e\7w\2\2\u016e\u016f\7v\2\2\u016f\u0170\7t\2\2\u0170") buf.write("\u0171\7q\2\2\u0171\u0172\7e\2\2\u0172\u0173\7c\2\2\u0173") buf.write("\u0174\7u\2\2\u0174\u0175\7q\2\2\u0175D\3\2\2\2\u0176") buf.write("\u0177\7h\2\2\u0177\u0178\7k\2\2\u0178\u0179\7o\2\2\u0179") buf.write("\u017a\7g\2\2\u017a\u017b\7u\2\2\u017b\u017c\7e\2\2\u017c") buf.write("\u017d\7q\2\2\u017d\u017e\7n\2\2\u017e\u017f\7j\2\2\u017f") buf.write("\u0180\7c\2\2\u0180F\3\2\2\2\u0181\u0182\7/\2\2\u0182") buf.write("H\3\2\2\2\u0183\u0184\7r\2\2\u0184\u0185\7c\2\2\u0185") buf.write("\u0186\7t\2\2\u0186\u0187\7c\2\2\u0187J\3\2\2\2\u0188") buf.write("\u0189\7c\2\2\u0189\u018a\7v\2\2\u018a\u018b\7g\2\2\u018b") buf.write("L\3\2\2\2\u018c\u018d\7h\2\2\u018d\u018e\7c\2\2\u018e") buf.write("\u018f\7e\2\2\u018f\u0190\7c\2\2\u0190N\3\2\2\2\u0191") buf.write("\u0192\7h\2\2\u0192\u0193\7k\2\2\u0193\u0194\7o\2\2\u0194") buf.write("\u0195\7r\2\2\u0195\u0196\7c\2\2\u0196\u0197\7t\2\2\u0197") buf.write("\u0198\7c\2\2\u0198P\3\2\2\2\u0199\u019a\7t\2\2\u019a") buf.write("\u019b\7g\2\2\u019b\u019c\7r\2\2\u019c\u019d\7k\2\2\u019d") buf.write("\u019e\7v\2\2\u019e\u019f\7c\2\2\u019fR\3\2\2\2\u01a0") buf.write("\u01a1\7g\2\2\u01a1\u01a2\7p\2\2\u01a2\u01a3\7s\2\2\u01a3") buf.write("\u01a4\7w\2\2\u01a4\u01a5\7c\2\2\u01a5\u01a6\7p\2\2\u01a6") buf.write("\u01a7\7v\2\2\u01a7\u01a8\7q\2\2\u01a8T\3\2\2\2\u01a9") buf.write("\u01aa\7h\2\2\u01aa\u01ab\7k\2\2\u01ab\u01ac\7o\2\2\u01ac") buf.write("\u01ad\7g\2\2\u01ad\u01ae\7p\2\2\u01ae\u01af\7s\2\2\u01af") buf.write("\u01b0\7w\2\2\u01b0\u01b1\7c\2\2\u01b1\u01b2\7p\2\2\u01b2") buf.write("\u01b3\7v\2\2\u01b3\u01b4\7q\2\2\u01b4V\3\2\2\2\u01b5") buf.write("\u01b6\7k\2\2\u01b6\u01b7\7p\2\2\u01b7\u01b8\7v\2\2\u01b8") buf.write("\u01b9\7g\2\2\u01b9\u01ba\7t\2\2\u01ba\u01bb\7t\2\2\u01bb") buf.write("\u01bc\7q\2\2\u01bc\u01bd\7o\2\2\u01bd\u01be\7r\2\2\u01be") buf.write("\u01bf\7c\2\2\u01bfX\3\2\2\2\u01c0\u01c1\7r\2\2\u01c1") buf.write("\u01c2\7t\2\2\u01c2\u01c3\7q\2\2\u01c3\u01c4\7e\2\2\u01c4") buf.write("\u01c5\7g\2\2\u01c5\u01c6\7f\2\2\u01c6\u01c7\7k\2\2\u01c7") buf.write("\u01c8\7o\2\2\u01c8\u01c9\7g\2\2\u01c9\u01ca\7p\2\2\u01ca") buf.write("\u01cb\7v\2\2\u01cb\u01cc\7q\2\2\u01ccZ\3\2\2\2\u01cd") buf.write("\u01ce\7h\2\2\u01ce\u01cf\7k\2\2\u01cf\u01d0\7o\2\2\u01d0") buf.write("\u01d1\7r\2\2\u01d1\u01d2\7t\2\2\u01d2\u01d3\7q\2\2\u01d3") buf.write("\u01d4\7e\2\2\u01d4\u01d5\7g\2\2\u01d5\u01d6\7f\2\2\u01d6") buf.write("\u01d7\7k\2\2\u01d7\u01d8\7o\2\2\u01d8\u01d9\7g\2\2\u01d9") buf.write("\u01da\7p\2\2\u01da\u01db\7v\2\2\u01db\u01dc\7q\2\2\u01dc") buf.write("\\\3\2\2\2\u01dd\u01de\7h\2\2\u01de\u01df\7w\2\2\u01df") buf.write("\u01e0\7p\2\2\u01e0\u01e1\7e\2\2\u01e1\u01e2\7c\2\2\u01e2") buf.write("\u01e3\7q\2\2\u01e3^\3\2\2\2\u01e4\u01e5\7t\2\2\u01e5") buf.write("\u01e6\7g\2\2\u01e6\u01e7\7v\2\2\u01e7\u01e8\7q\2\2\u01e8") buf.write("\u01e9\7t\2\2\u01e9\u01ea\7p\2\2\u01ea\u01eb\7g\2\2\u01eb") buf.write("`\3\2\2\2\u01ec\u01ed\7h\2\2\u01ed\u01ee\7k\2\2\u01ee") buf.write("\u01ef\7o\2\2\u01ef\u01f0\7h\2\2\u01f0\u01f1\7w\2\2\u01f1") buf.write("\u01f2\7p\2\2\u01f2\u01f3\7e\2\2\u01f3\u01f4\7c\2\2\u01f4") buf.write("\u01f5\7q\2\2\u01f5b\3\2\2\2\u01f6\u01f7\7=\2\2\u01f7") buf.write("d\3\2\2\2\u01f8\u01f9\7x\2\2\u01f9\u01fa\7c\2\2\u01fa") buf.write("\u01fb\7t\2\2\u01fbf\3\2\2\2\u01fc\u01fd\7q\2\2\u01fd") buf.write("\u01fe\7p\2\2\u01feh\3\2\2\2\u01ff\u0200\7q\2\2\u0200") buf.write("\u0201\7h\2\2\u0201\u0202\7h\2\2\u0202j\3\2\2\2\u0203") buf.write("\u0204\7c\2\2\u0204\u0205\7t\2\2\u0205\u0206\7s\2\2\u0206") buf.write("\u0207\7w\2\2\u0207\u0208\7k\2\2\u0208\u0209\7x\2\2\u0209") buf.write("\u020a\7q\2\2\u020al\3\2\2\2\u020b\u020d\t\b\2\2\u020c") buf.write("\u020e\t\t\2\2\u020d\u020c\3\2\2\2\u020e\u020f\3\2\2\2") buf.write("\u020f\u020d\3\2\2\2\u020f\u0210\3\2\2\2\u0210\u0211\3") buf.write("\2\2\2\u0211\u0213\13\2\2\2\u0212\u0214\t\13\2\2\u0213") buf.write("\u0212\3\2\2\2\u0214\u0215\3\2\2\2\u0215\u0213\3\2\2\2") buf.write("\u0215\u0216\3\2\2\2\u0216\u0217\3\2\2\2\u0217\u0218\t") buf.write("\b\2\2\u0218n\3\2\2\2\u0219\u021a\7r\2\2\u021a\u021b\7") buf.write("c\2\2\u021b\u021c\7w\2\2\u021c\u021d\7u\2\2\u021d\u021e") buf.write("\7c\2\2\u021ep\3\2\2\2\u021f\u0222\5g\64\2\u0220\u0222") buf.write("\5i\65\2\u0221\u021f\3\2\2\2\u0221\u0220\3\2\2\2\u0222") buf.write("r\3\2\2\2\u0223\u0226\5g\64\2\u0224\u0226\5i\65\2\u0225") buf.write("\u0223\3\2\2\2\u0225\u0224\3\2\2\2\u0226t\3\2\2\2\u0227") buf.write("\u0228\7n\2\2\u0228\u0229\7k\2\2\u0229\u022a\7o\2\2\u022a") buf.write("\u022b\7r\2\2\u022b\u022c\7c\2\2\u022c\u022d\7v\2\2\u022d") buf.write("\u022e\7g\2\2\u022e\u022f\7n\2\2\u022f\u0230\7c\2\2\u0230") buf.write("v\3\2\2\2\u0231\u0232\7<\2\2\u0232x\3\2\2\2\u0233\u0234") buf.write("\7c\2\2\u0234\u0235\7n\2\2\u0235\u0236\7g\2\2\u0236\u0237") buf.write("\7c\2\2\u0237\u0238\7v\2\2\u0238\u0239\7q\2\2\u0239\u023a") buf.write("\7t\2\2\u023a\u023b\7k\2\2\u023b\u023c\7q\2\2\u023cz\3") buf.write("\2\2\2\u023d\u023e\7v\2\2\u023e\u023f\7k\2\2\u023f\u0240") buf.write("\7o\2\2\u0240\u0241\7g\2\2\u0241\u0242\7t\2\2\u0242|\3") buf.write("\2\2\2\u0243\u0244\7r\2\2\u0244\u0245\7c\2\2\u0245\u0246") buf.write("\7u\2\2\u0246\u0247\7u\2\2\u0247\u0248\7q\2\2\u0248~\3") buf.write("\2\2\2\25\2\u009b\u00a1\u00ab\u00b6\u00db\u00e0\u00e9") buf.write("\u00f4\u0111\u0116\u011c\u011e\u012f\u0143\u020f\u0215") buf.write("\u0221\u0225\3\b\2\2") return buf.getvalue() class visualgLexer(Lexer): atn = ATNDeserializer().deserialize(serializedATN()) decisionsToDFA = [ DFA(ds, i) for i, ds in enumerate(atn.decisionToState) ] TIPO_DE_DADO = 1 OPERADOR_BINARIO = 2 OPERADOR_RELACIONAL = 3 OPERADOR_LOGICO = 4 OPERADOR_UNARIO = 5 INICIO = 6 FIM_ALGORITMO = 7 ALGORITMO = 8 NOME_DA_VARIAVEL = 9 COMENTARIO = 10 STRING = 11 VETOR = 12 DE = 13 ABRE_COLCHETES = 14 FECHA_COLCHETES = 15 ABRE_PARENTESES = 16 FECHA_PARENTESES = 17 VIRGULA = 18 ATRIBUIR = 19 INTEIRO = 20 REAL = 21 BOOL = 22 PONTO_PONTO = 23 ESCREVA = 24 LEIA = 25 SE = 26 ENTAO = 27 SENAO = 28 FIM_SE = 29 ESCOLHA = 30 CASO = 31 OUTRO_CASO = 32 FIM_ESCOLHA = 33 MENOS = 34 PARA = 35 ATE = 36 FACA = 37 FIM_PARA = 38 REPITA = 39 ENQUANTO = 40 FIM_ENQUANTO = 41 INTERROMPA = 42 PROCEDIMENTO = 43 FIM_PROCEDIMENTO = 44 FUNCAO = 45 RETORNO = 46 FIM_FUNCAO = 47 PONTO_VIRGULA = 48 VAR = 49 ON = 50 OFF = 51 ARQUIVO = 52 NOME_ARQUIVO = 53 PAUSA = 54 ECO = 55 CRONOMETRO = 56 LIMPATELA = 57 DOIS_PONTOS = 58 ALEATORIO = 59 TIMER = 60 PASSO = 61 channelNames = [ u"DEFAULT_TOKEN_CHANNEL", u"HIDDEN" ] modeNames = [ "DEFAULT_MODE" ] literalNames = [ "<INVALID>", "'inicio'", "'fimAlgoritmo'", "'algoritmo'", "'vetor'", "'de'", "'['", "']'", "'('", "')'", "','", "'<-'", "'..'", "'leia'", "'se'", "'entao'", "'senao'", "'fimse'", "'escolha'", "'caso'", "'outrocaso'", "'fimescolha'", "'-'", "'para'", "'ate'", "'faca'", "'fimpara'", "'repita'", "'enquanto'", "'fimenquanto'", "'interrompa'", "'procedimento'", "'fimprocedimento'", "'funcao'", "'retorne'", "'fimfuncao'", "';'", "'var'", "'on'", "'off'", "'arquivo'", "'pausa'", "'limpatela'", "':'", "'aleatorio'", "'timer'", "'passo'" ] symbolicNames = [ "<INVALID>", "TIPO_DE_DADO", "OPERADOR_BINARIO", "OPERADOR_RELACIONAL", "OPERADOR_LOGICO", "OPERADOR_UNARIO", "INICIO", "FIM_ALGORITMO", "ALGORITMO", "NOME_DA_VARIAVEL", "COMENTARIO", "STRING", "VETOR", "DE", "ABRE_COLCHETES", "FECHA_COLCHETES", "ABRE_PARENTESES", "FECHA_PARENTESES", "VIRGULA", "ATRIBUIR", "INTEIRO", "REAL", "BOOL", "PONTO_PONTO", "ESCREVA", "LEIA", "SE", "ENTAO", "SENAO", "FIM_SE", "ESCOLHA", "CASO", "OUTRO_CASO", "FIM_ESCOLHA", "MENOS", "PARA", "ATE", "FACA", "FIM_PARA", "REPITA", "ENQUANTO", "FIM_ENQUANTO", "INTERROMPA", "PROCEDIMENTO", "FIM_PROCEDIMENTO", "FUNCAO", "RETORNO", "FIM_FUNCAO", "PONTO_VIRGULA", "VAR", "ON", "OFF", "ARQUIVO", "NOME_ARQUIVO", "PAUSA", "ECO", "CRONOMETRO", "LIMPATELA", "DOIS_PONTOS", "ALEATORIO", "TIMER", "PASSO" ] ruleNames = [ "DIGIT", "TIPO_DE_DADO", "OPERADOR_BINARIO", "OPERADOR_RELACIONAL", "OPERADOR_LOGICO", "OPERADOR_UNARIO", "INICIO", "FIM_ALGORITMO", "ALGORITMO", "NOME_DA_VARIAVEL", "COMENTARIO", "STRING", "VETOR", "DE", "ABRE_COLCHETES", "FECHA_COLCHETES", "ABRE_PARENTESES", "FECHA_PARENTESES", "VIRGULA", "ATRIBUIR", "INTEIRO", "REAL", "BOOL", "PONTO_PONTO", "ESCREVA", "LEIA", "SE", "ENTAO", "SENAO", "FIM_SE", "ESCOLHA", "CASO", "OUTRO_CASO", "FIM_ESCOLHA", "MENOS", "PARA", "ATE", "FACA", "FIM_PARA", "REPITA", "ENQUANTO", "FIM_ENQUANTO", "INTERROMPA", "PROCEDIMENTO", "FIM_PROCEDIMENTO", "FUNCAO", "RETORNO", "FIM_FUNCAO", "PONTO_VIRGULA", "VAR", "ON", "OFF", "ARQUIVO", "NOME_ARQUIVO", "PAUSA", "ECO", "CRONOMETRO", "LIMPATELA", "DOIS_PONTOS", "ALEATORIO", "TIMER", "PASSO" ] grammarFileName = "visualg.g4" def __init__(self, input=None, output:TextIO = sys.stdout): super().__init__(input, output) self.checkVersion("4.8") self._interp = LexerATNSimulator(self, self.atn, self.decisionsToDFA, PredictionContextCache()) self._actions = None self._predicates = None
997,957
04a744b251db17927d1fe8bbf0f3a06d3f72d046
def pytest_configure(config): config.addinivalue_line( "markers", "profile_databricks_cluster" ) config.addinivalue_line( "markers", "profile_databricks_sql_endpoint" ) config.addinivalue_line( "markers", "profile_apache_spark" )
997,958
eec04b5a5ab371d5a12797031fb9bc4f37cf11b9
''' Created on Aug 3, 2016 @author: YLin2 ''' import sys import os from xml.dom import minidom def fix_class(class_node): valid_lines = 0 covered_lines = 0 for lines_node in class_node.getElementsByTagName('lines'): for line in lines_node.getElementsByTagName('line'): if not line.hasAttribute('hits'): continue valid_lines += 1 hit = line.getAttribute('hits') if hit == '1': covered_lines += 1 if valid_lines > 0: class_node.setAttribute('line-rate', repr(float(covered_lines)/float(valid_lines))) return valid_lines, covered_lines def fix_package(package_node): valid_lines = 0 covered_lines = 0 for classes_node in package_node.getElementsByTagName('classes'): for class_node in classes_node.getElementsByTagName('class'): current_valid_lines, current_covered_lines = fix_class(class_node) valid_lines += current_valid_lines covered_lines += current_covered_lines if valid_lines > 0: package_node.setAttribute('line-rate', repr(float(covered_lines)/float(valid_lines))) return valid_lines, covered_lines def fix(*args, **kargs): default_file_path = '' default_file_name = 'cobertura.xml' if len(args[0]) > 1: arg = args[0][1] else: arg = default_file_path if os.path.isdir(arg): file_name = os.path.join(arg, default_file_name) else: file_name = os.path.join(default_file_path, default_file_name) print 'processing: '+file_name xml_file = open(file_name, 'r') xml_doc = minidom.parse(xml_file) xml_file.close() xml_root = xml_doc.documentElement original_copy = open('coverage.original.xml', 'w') xml_root.writexml(original_copy) valid_lines = 0 covered_lines = 0 tag_valid_lines = 'lines-valid' tag_covered_lines = 'lines-covered' for package_node in xml_doc.getElementsByTagName('package'): current_valid_lines, current_covered_lines = fix_package(package_node) valid_lines += current_valid_lines covered_lines += current_covered_lines xml_root.setAttribute(tag_valid_lines, repr(valid_lines)) xml_root.setAttribute(tag_covered_lines, repr(covered_lines)) fixed_copy = open(os.path.basename(file_name), 'w') xml_root.writexml(fixed_copy) if __name__ == '__main__': fix(sys.argv)
997,959
899d859db131b32ea251b6a03cf7743f57e721f1
# -*- coding: utf-8 -*- # ridgeRegression.py import numpy as np import matplotlib.pyplot as plt def rssError(yArr, yHatArr): """ 函数说明:求平方误差 """ return ((yArr-yHatArr)**2).sum() def loadDataSet(fileName): ''' 函数说明:数据导入函数 参数:fileName: 数据存放的路径 返回:dataMat: 数据特征集 labelMat: 数据标签集 ''' dataMat = [] labelMat = [] with open(fileName) as fr: numFeat = len(fr.readline().split("\t")) - 1 for line in fr.readlines(): lineArr = [] curLine = line.strip().split('\t') for i in range(numFeat): lineArr.append(float(curLine[i])) dataMat.append(lineArr) labelMat.append(float(curLine[-1])) return dataMat, labelMat def ridgeRegre(xMat, yMat, lam=0.2): ''' 函数说明:岭回归 参数: xMat: x数据集 yMat: y数据集 lam: 缩减系数 返回: ws : 岭回归的回归系数 ''' xTx = xMat.T * xMat # 按公式进行求解系数 denom = xTx + np.eye(np.shape(xMat)[1]) * lam if np.linalg.det(denom) == 0.0: print("This matrix is singular, cannot do inverse") return ws = denom * (xMat.T * yMat) return ws def ridgeTest(xArr, yArr): ''' 函数说明:岭回归测试 参数: xArr: x数据集 yArr: y数据集 返回: wMat : 回归系数 ''' xMat = np.mat(xArr) yMat = np.mat(yArr).T yMean = np.mean(yMat, axis = 0) # axis=0,表示纵轴(列),1代表横轴(行),此处对列进行求平均 yMat = yMat - yMean xMeans = np.mean(xMat, axis = 0) xVar = np.var(xMat, axis = 0) # 求方差 xMat = (xMat - xMeans) / xVar # 进行归一化,使得变成标准化 numTestPst = 30 # 30个不同的lam进行测试 wMat = np.zeros((numTestPst, np.shape(xMat)[1])) # 初始化系数矩阵 for i in range(numTestPst): ws = ridgeRegre(xMat, yMat, lam=np.exp(i-10)) # 对不同的lam值进行求解回归系数,lam以指数级变化,从很小的数开始 wMat[i, :] = ws.T # 对每个lam得到的回归系数进行保存 return wMat def plotwMat(): ''' 函数说明:绘制岭回归系数矩阵 参数:无 返回:无 ''' abX, abY = loadDataSet("abalone.txt") ridgeWeights = ridgeTest(abX, abY) fig = plt.figure() ax = fig.add_subplot(111) ax.plot(ridgeWeights) ax_title_text = ax.set_title('gaun xi') ax_xlabel_text = ax.set_xlabel('log(lambada)') ax_ylabel_text = ax.set_ylabel('ws') plt.setp(ax_title_text, size=20, weight="bold", color = 'red') plt.setp(ax_xlabel_text, size=10, weight="bold", color = 'black') plt.setp(ax_ylabel_text, size=10, weight="bold", color = 'black') plt.show() if __name__ == "__main__": plotwMat()
997,960
0d52a5764b5f9bb3a04a48414f00c1ebc9c8fc5f
import pygame as pg import numpy as np import sys from SoundManager import SoundManager from MainMenuUI import MainMenuUI from SettingsUI import SettingsUI from GameUI import GameUI from GameController import GameController def main(): WIDTH = 1186 HEIGHT = 964 sm = SoundManager("sounds/") pg.init() pg.font.init() mui = MainMenuUI(WIDTH, HEIGHT) sui = SettingsUI(WIDTH, HEIGHT) gui = GameUI(WIDTH, HEIGHT) gc = GameController(60) clock = pg.time.Clock() while True: # The time it takes for a frame to complete. It is used to make the game frame independent. dt = clock.tick(gc.FPS) for event in pg.event.get(): if event.type == pg.QUIT: sys.exit() if gc.game_state == 0: if gc.starting_level != 0: gc.starting_level = 0 gc.set_speed(gc.starting_level) if pg.mouse.get_pressed()[0]: mouse = pg.mouse.get_pos() # If player clicks on play button then go to settings if WIDTH // 2 - 90 < mouse[0] < WIDTH // 2 + 90 and HEIGHT // 2 - 115 < mouse[1] < HEIGHT // 2 - 35: gc.game_state = 1 # If player clicks on quit button, exit if WIDTH // 2 - 90 < mouse[0] < WIDTH // 2 + 90 and HEIGHT // 2 + 35 < mouse[1] < HEIGHT // 2 + 115: sys.exit() # At game over the music stops. This ensures that the music will start again. if not gc.theme_playing: gc.theme_playing = True gc.track = "track1.wav" sm.play_sound(gc.track, 0, -1) mui.draw_main_menu() elif gc.game_state == 1: if pg.mouse.get_pressed()[0]: mouse = pg.mouse.get_pos() # Start button if WIDTH // 2 - 90 < mouse[0] < WIDTH // 2 + 90 and HEIGHT // 2 + 300 < mouse[1] < HEIGHT // 2 + 380: gc.game_state = 2 gc.level = gc.starting_level # Track buttons if WIDTH // 2 - 275 < mouse[0] < WIDTH // 2 - 125: for i in range(3): dy = (i+1)*70 if HEIGHT // 2 - 148 + dy < mouse[1] < HEIGHT // 2 - 148 + 50 + dy: gc.track = "track" + str(i+1) + ".wav" sm.play_sound(gc.track, 0, -1) # Even levels buttons if WIDTH // 2 + 240 < mouse[0] < WIDTH // 2 + 290: for i in range(5): dy = 50*(i+1) if HEIGHT // 2 - 140 + dy < mouse[1] < HEIGHT // 2 - 140 + 50 + dy: gc.starting_level = 2*i gc.set_speed(gc.starting_level) # Even levels buttons if WIDTH // 2 + 290 < mouse[0] < WIDTH // 2 + 340: for i in range(5): dy = 50*(i+1) if HEIGHT // 2 - 140 + dy < mouse[1] < HEIGHT // 2 - 140 + 50 + dy: gc.starting_level = 2*i+1 gc.set_speed(gc.starting_level) sui.draw_settings(gc.starting_level) elif gc.game_state == 2: gc.drop_counter += dt gc.move_counter += dt # Delay between player's side movement if gc.move_counter >= gc.h_speed: gc.can_h_move = True if not pg.key.get_pressed()[pg.K_UP]: gc.can_rotate = True if len(gc.next_pieces) <= 2: gc.create_piece_sequence() if not gc.piece_falling: gc.rotated = False gc.piece_falling = True pts = gc.next_pieces[:][0] del gc.next_pieces[0] next_piece = gc.next_pieces[:][0] index = pts[pts > 0][0] game_over = gc.spawn_piece(pts) if game_over: gc.game_state = 3 pf = pts[:] else: if pg.key.get_pressed()[pg.K_DOWN]: gc.drop_counter *= 3 if pg.key.get_pressed()[pg.K_LEFT] and gc.move_counter >= gc.h_speed and gc.can_h_move: gc.can_h_move = False gc.move_counter = 0 if gc.h_move(-1, index): sm.play_sound("piece-move.wav", 1, 0) if pg.key.get_pressed()[pg.K_RIGHT] and gc.move_counter >= gc.h_speed and gc.can_h_move: gc.can_h_move = False gc.move_counter = 0 if gc.h_move(1, index): sm.play_sound("piece-move.wav", 1, 0) if pg.key.get_pressed()[pg.K_UP] and gc.can_rotate: gc.can_rotate = False sm.play_sound("piece-rotate.wav", 3, 0) gc.rotated = gc.r_move(pf, index, gc.rotated) if gc.drop_counter >= gc.speed and gc.piece_falling: gc.drop_counter = 0 gc.piece_falling = gc.v_move(index, sm) gui.screen.fill(gui.BLACK) gui.draw_game_ui(gc, next_piece, np.array_equal(next_piece, gc.I)) elif gc.game_state == 3: if not gc.game_over_sound_played: gc.game_over_sound_played = gc.game_over(sm) if pg.key.get_pressed()[pg.K_SPACE]: gc.state_initializer(2, gui) sm.play_sound(gc.track, 0, -1) if pg.key.get_pressed()[pg.K_ESCAPE]: gc.state_initializer(0, gui) sm.play_sound(gc.track, 0, -1) pg.display.update() if __name__ == "__main__": main()
997,961
cc5aa39b0f2c6d2da5e25b08f812ce9d46ae34bd
import RPi.GPIO as GPIO import threading interval = 0.01 class Key: def __init__(self, eventCallback, shutdown): GPIO.setmode(GPIO.BCM) GPIO.setup(4,GPIO.IN,pull_up_down=GPIO.PUD_UP) self.timerStart(interval=interval) self.eventCallback = eventCallback self.shutdown = shutdown self.pressed = False self.event = 0 #0->not press 1->tap, 2->longpress self.times = 0 def timerStart(self, interval): self.scantimer = threading.Timer(interval, self.keyScan, (interval,)) self.scantimer.start() def keyScan(self, interval): if (GPIO.input(4) == GPIO.LOW): self.pressed = True self.times = self.times + 1 if self.times > 80: self.times = 0 self.event = 2 #longpress self.eventCallback(self.event, self.shutdown) self.event = 0 else: self.pressed = False if self.times > 5: self.event = 1 #tap self.eventCallback(self.event, self.shutdown) self.event = 0 self.times = 0 if interval != 0: self.scantimer = threading.Timer(interval, self.keyScan, (interval,)) self.scantimer.start() def keycallback(event): print(event) if __name__ == "__main__": key = Key(keycallback)
997,962
cc476955321c42bc083811469fc42858ac5cdda9
# coding=utf-8 # Copyright 2022 Meta Platforms authors and The HuggingFace Team. All rights reserved. # # Licensed under the Apache License, Version 2.0 (the "License"); # you may not use this file except in compliance with the License. # You may obtain a copy of the License at # # http://www.apache.org/licenses/LICENSE-2.0 # # Unless required by applicable law or agreed to in writing, software # distributed under the License is distributed on an "AS IS" BASIS, # WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. # See the License for the specific language governing permissions and # limitations under the License. import argparse import os import torch from transformers import FlavaConfig, FlavaForPreTraining from transformers.models.flava.convert_dalle_to_flava_codebook import convert_dalle_checkpoint def count_parameters(state_dict): # encoder.embeddings are double copied in original FLAVA return sum(param.float().sum() if "encoder.embeddings" not in key else 0 for key, param in state_dict.items()) def upgrade_state_dict(state_dict, codebook_state_dict): upgrade = {} for key, value in state_dict.items(): if "text_encoder.embeddings" in key or "image_encoder.embeddings" in key: continue key = key.replace("heads.cmd.mim_head.cls.predictions", "mmm_image_head") key = key.replace("heads.cmd.mlm_head.cls.predictions", "mmm_text_head") key = key.replace("heads.cmd.itm_head.cls", "itm_head") key = key.replace("heads.cmd.itm_head.pooler", "itm_head.pooler") key = key.replace("heads.cmd.clip_head.logit_scale", "flava.logit_scale") key = key.replace("heads.fairseq_mlm.cls.predictions", "mlm_head") key = key.replace("heads.imagenet.mim_head.cls.predictions", "mim_head") key = key.replace("mm_text_projection", "flava.text_to_mm_projection") key = key.replace("mm_image_projection", "flava.image_to_mm_projection") key = key.replace("image_encoder.module", "flava.image_model") key = key.replace("text_encoder.module", "flava.text_model") key = key.replace("mm_encoder.module.encoder.cls_token", "flava.multimodal_model.cls_token") key = key.replace("mm_encoder.module", "flava.multimodal_model") key = key.replace("text_projection", "flava.text_projection") key = key.replace("image_projection", "flava.image_projection") upgrade[key] = value.float() for key, value in codebook_state_dict.items(): upgrade[f"image_codebook.{key}"] = value return upgrade @torch.no_grad() def convert_flava_checkpoint(checkpoint_path, codebook_path, pytorch_dump_folder_path, config_path=None): """ Copy/paste/tweak model's weights to transformers design. """ if config_path is not None: config = FlavaConfig.from_pretrained(config_path) else: config = FlavaConfig() hf_model = FlavaForPreTraining(config).eval() codebook_state_dict = convert_dalle_checkpoint(codebook_path, None, save_checkpoint=False) if os.path.exists(checkpoint_path): state_dict = torch.load(checkpoint_path, map_location="cpu") else: state_dict = torch.hub.load_state_dict_from_url(checkpoint_path, map_location="cpu") hf_state_dict = upgrade_state_dict(state_dict, codebook_state_dict) hf_model.load_state_dict(hf_state_dict) hf_state_dict = hf_model.state_dict() hf_count = count_parameters(hf_state_dict) state_dict_count = count_parameters(state_dict) + count_parameters(codebook_state_dict) assert torch.allclose(hf_count, state_dict_count, atol=1e-3) hf_model.save_pretrained(pytorch_dump_folder_path) if __name__ == "__main__": parser = argparse.ArgumentParser() parser.add_argument("--pytorch_dump_folder_path", default=None, type=str, help="Path to the output PyTorch model.") parser.add_argument("--checkpoint_path", default=None, type=str, help="Path to flava checkpoint") parser.add_argument("--codebook_path", default=None, type=str, help="Path to flava codebook checkpoint") parser.add_argument("--config_path", default=None, type=str, help="Path to hf config.json of model to convert") args = parser.parse_args() convert_flava_checkpoint(args.checkpoint_path, args.codebook_path, args.pytorch_dump_folder_path, args.config_path)
997,963
c237f3aa5fe6051647480a1a4d5af2a8bc8801e5
from django.urls import path,re_path from .views import * urlpatterns = [ re_path('^register/',register_views), re_path('^logout/',logout_views), re_path('^login/',login_views), ]
997,964
5d36f91fa11951340e82e4f2d063bb1d6e703526
#This program looks at the string Repetition Operator (*) str1="Hello " print(str1*300)
997,965
7623b5dd5577bde6522289a45b857b13717c87cf
from numpy import * from collections import Counter import torch import pickle device = torch.device('cuda' if torch.cuda.is_available() else 'cpu') def build_vocab(texts, n=None): counter = Counter(''.join(texts)) # char level char2index = {w: i for i, (w, c) in enumerate(counter.most_common(n), start=4)} char2index['~'] = 0 # pad 不足长度的文本在后边填充0 char2index['^'] = 1 # sos 表示句子的开头 char2index['$'] = 2 # eos 表示句子的结尾 char2index['#'] = 3 # unk 表示句子中出现的字典中没有的未知词 index2char = {i: w for w, i in char2index.items()} return char2index, index2char def indexes_from_text(text, char2index): return [1] + [char2index[c] for c in text] + [2] # 手动添加开始结束标志 def pad_seq(seq, max_length): seq += [0 for _ in range(max_length - len(seq))] return seq def random_batch(batch_size, pairs, src_c2ix, trg_c2ix): input_seqs, target_seqs = [], [] for i in random.choice(len(pairs), batch_size): input_seqs.append(indexes_from_text(pairs[i][0], src_c2ix)) target_seqs.append(indexes_from_text(pairs[i][1], trg_c2ix)) seq_pairs = sorted(zip(input_seqs, target_seqs), key=lambda p: len(p[0]), reverse=True) input_seqs, target_seqs = zip(*seq_pairs) input_lengths = [len(s) for s in input_seqs] input_padded = [pad_seq(s, max(input_lengths)) for s in input_seqs] target_lengths = [len(s) for s in target_seqs] target_padded = [pad_seq(s, max(target_lengths)) for s in target_seqs] input_var = torch.LongTensor(input_padded).transpose(0, 1) # seq_len x batch_size target_var = torch.LongTensor(target_padded).transpose(0, 1) input_var = input_var.to(device) target_var = target_var.to(device) return input_var, input_lengths, target_var, target_lengths def save_model(model , index): fw = open('model.' + str(index) + '.m' , 'wb') pickle.dump(model , fw) fw.flush() fw.close()
997,966
c47f5485b92ce610ed5321025dae35b2074b6a8d
from clarifai.rest import ClarifaiApp import json # name, grade, 3 bullet points, source dictionary = {'Pepsi': {0: 'D', 1: 'PepsiCo has managed to decrease its total climate footprint from 2014 to 2017.' 'PepsiCo scores poorly because the brand remains secretive in its sustainability report' 'and refuses to disclose information. PepsiCo mentions target to reduce carbon emissions.', 2: 'https://rankabrand.org/soda/Pepsi'}, 'Coke': {0: 'D', 1: 'Coca-Cola Company implements measures to reduce emissions, but has still increased in overall climate footprint.' 'The company mentions using renewable energy, but is not clear about how much.' 'Coca-Cola Company implements measures to purchase its other products, such as coffee, tea and fruits, from sustainable sources', 2: 'https://rankabrand.org/soda/Coca-Cola'}, 'Yerba': {0: 'B', 1: 'Guayaki harvests yerba in an organic and ecologically friendly manner.' ' Guayaki actively contributes to environmental protection by working to restore 200,000 acres of rainforest. ' 'The company creates 1,000 living wage jobs for local workers.', 2: 'https://magazine.wellwallet.com/gold-indios-guayakis-yerba-mate-ushering-sustainable-economy'}, 'Kettle Brand': {0: 'B', 1: 'After cooking chips with vegetable oil, Kettle Brand converts excess oil to biodiesel to fuel their vehicles.' 'In 2019, Kettle Brand chips cut the amount of materials used in packaging by 43%,' 'reducing greenhouse gas emissions from packaging by 51% and waste from packaging by 2 million pounds.', 2: 'https://www.kettlebrand.com/sustainability/'}, 'Fiji': {0: 'A', 1: 'In 2007, Fiji Water has managed to keep their total annual carbon footprint low.' 'The company is taking measures to continue to lower their carbon emissions and packaging materials.' 'Fiji Water has goals to reduce the amount of fuel used in transporting their products.', 2: 'https://www.csrwire.com/press_releases/15107-FIJI-Water-Becomes-First-Bottled-Water-Company-to-Release-Carbon-Footprint-of-Its-Products'}, 'Smartwater': {0: 'D', 1: 'Coca-Cola Company implements measures to reduce emissions, but has still increased in overall climate footprint.' 'The company mentions using renewable energy, but is not clear about how much.' 'Coca-Cola Company implements measures to purchase its other products, such as coffee, tea and fruits, from sustainable sources' 2: 'https://rankabrand.org/soda/Coca-Cola'} } newArray = [] # Array that is returned. Stored as [name,grade,description,source] app = ClarifaiApp(api_key='a83ecce289b64338a8036f3603e8d551') # api call def main(url): model1 = app.models.get('Brand') #url = input("URL of image: ") output = model1.predict_by_url(url)['outputs'][0]['data']['concepts'] newJson = json.dumps(output[0]) # dumps json data into newJson completeJson = json.loads(newJson) # loads json data into completeJson for key in dictionary: # loops through dictionary isfound = False # boolean to determine if anything is found if key == completeJson['name']: # if dictionary key (name) equals the name in Json, executes code block if completeJson['value'] < .5: # Checks if API is over 50% sure of its prediction # print('None found, value was only:', completeJson['value'] * 100, "% accurate.") return None # returns null if api was too unsure newArray.append(key) # first element of array is the name (or key of dictionary for size in range(0, 3): # loops from 0-2 newArray.append(dictionary[key][size]) # appends the 0-2 key values of the original key isfound = True break if isfound: #checks if database name was found and matched #print(newArray) return newArray else: print('None found') return None if __name__ == '__main__': main()
997,967
01bb8d5af7d73c86604f15b33ec6f9e0eb692ce0
#!/bin/python3 import unittest2 as unittest from jumping_on_the_clouds import jumpingOnClouds """ https://www.hackerrank.com/challenges/jumping-on-the-clouds/problem Jump 1 or 2 steps on the cloud ( marked by 0). The thunder clouds (marked by 1) have to be avoided. """ class Test_jumping_on_clouds(unittest.TestCase): def test_case_0(self): self.assertEquals(jumpingOnClouds([0, 0, 1, 0, 0, 1, 0]), 4) def test_case_1(self): self.assertEquals(jumpingOnClouds([0, 0, 0, 1, 0, 0]), 3) def test_case_contain_only_0(self): self.assertEquals(jumpingOnClouds([0, 0, 0, 0, 0, 0]), 3) if __name__ == '__main__': unittest.main()
997,968
46e20fc640690c09ff6fb889ce1d43eb0bda0417
from pathlib import Path, PurePosixPath import fnmatch import hashlib from cw.directory_walk import directory_walk from io import StringIO import os import re from typing import Union class DirectoryChecksum: """ Class used to generate a file containing the sha256 hashes of all files in a directory and its subdirectories. The instance of the class is also used to validate a directory using a preexisting hash file. :param dir_path: String or :class:`os.PathLike` object with the path to the target directory. :param ignore_patterns: Iterable with unix shell-style patterns of file and directory names to ignore. :func:`fnmatch.fnmatch` is used to match the patterns. :param: Path relative to the directory to the checksum file. If None it will be """ def __init__(self, dir_path: Union[os.PathLike, str], ignore_patterns=None, checksum_file_path="./checksum"): self.dir_path = dir_path if isinstance(dir_path, Path) else Path(dir_path) """ :class:`os.PathLike` object pointing to the target directory, """ self.ignore_patterns = set(ignore_patterns or []) """ Set of the patterns to ignore. """ self.checksum_file_path = self.dir_path / checksum_file_path """ Path object to the checksum file. """ @property def has_checksum_file(self): """ True if the directory already has a checksum file. """ return self.checksum_file_path.is_file() def create_checksum_file(self, force=False): """ Generate a new checksum file in the directory. :class:`sim_common.directory_checksum.ChecksumFileAlreadyExistsError` will be raised if the checksum. :param force: If True the checksum file will be (re)created whether it exists or not. :returns: A bytestring with the sha256 hash of the contents of the checksum file. """ # Check if the checksum file has already been created and raise an error # if it has been, except if its forced. if self.has_checksum_file and not force: raise ChecksumFileAlreadyExistsError(self.dir_path) # Initialize dictionary containing the hashes of all files in the directory. dir_hashes = {} # Create hashing object and walk through all files in the directory and its # subdirectories. hash_generator = hashlib.sha256() for file_path in directory_walk(self.dir_path, self.ignore_pattern_filter): with open(file_path, "rb") as f: # Read the file chunk by chunk and update the hash generator. for chunk in iter(lambda: f.read(4096), b""): hash_generator.update(chunk) # Put the hash in the dictionary with the relative path of the file # w.r.t. the root directory as the key. The path will be a Posix path. dir_hashes[str(PurePosixPath(file_path.relative_to(self.dir_path)))] = hash_generator.hexdigest() # Create new hash generator. hash_generator = hashlib.sha256() # Initialize string io object used to generate the contents of the hash file. str_io = StringIO() # Write the file paths and hashes to the string io object. One # pair on each line separated by tabs. for file_path_str, file_hash in dir_hashes.items(): str_io.write(f"{file_path_str}\t{file_hash}\n") # Generate the hash of the hash_file contents. hash_generator.update(str_io.getvalue().encode('utf-8')) # Save the hashes to the hash file. with open(self.checksum_file_path, "w") as f: f.write(str_io.getvalue()) # Return the hash of the checksum file. return hash_generator.digest() def delete_checksum_file(self): if self.checksum_file_path.exists(): self.checksum_file_path.unlink() def ignore_pattern_filter(self, path): """ Checks whether a path doesn't match one of the ignore patterns. :param path: :class:`os.PathLike` object pointing a file or directory. :return: True if the path doesn't math any of the ignore patterns, otherwise False. """ # Return False for the checksum file. if self.checksum_file_path.exists(): if self.checksum_file_path.samefile(path): return False # Return True of no patterns where given. if self.ignore_patterns is None: return True # Loop through all patterns. for pattern in self.ignore_patterns: # Return False if the path matches an ignore pattern. if fnmatch.fnmatch(path.name, pattern): return False # If it reached this point, this means that it doesn't match any of the patterns, # so return True. return True def validate_directory(self, checksum_file_hash=None): """ Validates a directory by checking the hash of all the files listed in the checksum file. :param checksum_file_hash: Optional bytestring with the hash of the sha256 checksum file. :return: True if the directory content is valid. """ # If the directory doesn't have a checksum file, raise an error. if not self.has_checksum_file: return False # Load in all the text in the checksum file. with open(self.checksum_file_path, "r") as f: checksum_file_content = f.read() # If a hash was given for the checksum file, check the validity # of the checksum file. if checksum_file_hash is not None: hash_generator = hashlib.sha256() hash_generator.update(checksum_file_content.encode("utf-8")) if checksum_file_hash != hash_generator.digest(): return False # If we have reached this point and the checksum_file_hash was given, then we know that # the checksum file has not been corrupted. If the checksum_file_hash was not given then we # are not sure, so we need to check if there are any errors in the file. # This is done by adding and extra matching group to the regex "|(.)". This group will # match anything that has not been matched by the base regex. Meaning that # if something is matched by this group, there are syntax errors in the file. checksum_file_regex_pattern = \ r"(?:(.+)(?:\t)([a-fA-F0-9]{64}))|(.)" if checksum_file_hash is None else r"(?:(.+)(?:\t)([a-fA-F0-9]{64}))" # Loop through all matches found by the regex. for match in re.finditer(checksum_file_regex_pattern, checksum_file_content): # Check if syntax error was found in case no checksum_file_hash was given. if checksum_file_hash is None: if match.group(3) is not None: return False # Get the file path and file hash and convert these to the correct type. file_path = self.dir_path / match.group(1) file_hash = bytes.fromhex(match.group(2)) # Generate the sha256 hash of the contents of the file. hash_generator = hashlib.sha256() with open(file_path, "rb") as f: for chunk in iter(lambda: f.read(4096), b""): hash_generator.update(chunk) # Return false if the hash doesn't match. if file_hash != hash_generator.digest(): return False # If we have reached here, then all of the files have been checked and they are valid. # so return True. return True class ChecksumFileAlreadyExistsError(Exception): """ Raised when an attempt is being made to create a checksum file in a directory that already has one. If the intention is to recreate it, set the force parameter to True. """ def __init__(self, dir_path): super().__init__(f"'{str(dir_path)}' already has a checksum file.") class NoChecksumFileError(Exception): """ Raised when an attempt is being made to validate a directory that doesn't have a checksum file. """ def __init__(self, dir_path): super().__init__(f"'{str(dir_path)}' has no checksum file.") class InvalidChecksumFile(Exception): """ Raised when the directory has a invalid checksum file. """ def __init__(self, dir_path): super().__init__(f"'{str(dir_path)}' has an invalid checksum file.")
997,969
fd1d33b3febc12d1a74421bd522b5d81483ccfa7
from xlutils.copy import copy import xlrd import xlwt import time class Excel_dx(): def du (self,h,l): #path = 'F:/untitled/我的坚果云/git/zentao/comm/case.xls' path = './comm/case.xls' workbook = xlrd.open_workbook(path) data_sheet = workbook.sheets()[0] ss =data_sheet.cell_value(h,l)#将字符串转为字典 return ss def bt(self,a): name = ['ID','用例名称','API地址','是否执行','请求类型','请求头','测试类型','是否需要登陆', '依赖caseid','请求参数','状态码','返回结果','执行结果','断言','执行时间'] line = [0,1,2,3,4,5,6,7,8,9,10,11,12,13,14] meter = dict(zip(name,line)) #print (meter) A = a return meter[A] def xg(self,h,l,vale): #style = xlwt.XFStyle() read_file = xlrd.open_workbook('./comm/case.xls', formatting_info=True) # 参数注释: # file_path:文件路径,包含文件的全名称 # formatting_info=True:保留Excel的原格式 # 将文件复制到内存 write_data = copy(read_file) # 读取复制后文件的sheet1 write_save = write_data.get_sheet(0) # 写入数据 style = xlwt.easyxf('align: wrap on')#自动换行 write_save.write(h,l,vale,style) # 参数注释: # x,y:写入目标格的位置坐标 # value:写入数据 # 保存写入数据后的文件到原文件路径 write_data.save('./comm/case.xls') if __name__=="__main__": a = Excel_dx() self = "pass" aa = a.bt(1) print (aa)
997,970
9a53f7d6601c42b0fe4216c202d5e0abeeefd993
""" Import the datas from the json dataset file and return the big array that contains it """ import simplejson as json datasetPath = '../../find\ relationships/dataset/yelp_academic_dataset_business.json' heatMapData= open("heatMapData.html", "w") with open(datasetPath) as fin: for business in fin: line_contents = json.loads(business) if line_contents["state"] == "AZ": latitude = str(line_contents['latitude']) longitude = str(line_contents['longitude']) data = 'new google.maps.LatLng(' + latitude + ', ' + longitude + '), \n' heatMapData.write(data) heatMapData.close()
997,971
d7557c330cf64c830e270314d5d0c21d02da9881
import tensorflow as tf from tensorflow.contrib import learn from tensorflow.contrib.learn.python.learn.estimators import model_fn as model_fn_lib class SampleArchitecture2(object): height = 32 width = 32 channels = 3 learning_rate = 0.002 @classmethod def get_model(cls, features, labels, mode): # Input Layer input_layer = tf.reshape(features, [ -1, SampleArchitecture2.height, SampleArchitecture2.width, SampleArchitecture2.channels ]) # Convolutional Layer #1 conv1 = tf.layers.conv2d( inputs=input_layer, filters=32, kernel_size=[5, 5], padding="same", activation=tf.nn.relu ) # Pooling Layer #1 pool1 = tf.layers.max_pooling2d(inputs=conv1, pool_size=[2, 2], strides=2) # Convolutional Layer #2 and Pooling Layer #2 conv2 = tf.layers.conv2d( inputs=pool1, filters=32, kernel_size=[5, 5], padding="same", activation=tf.nn.relu ) pool2 = tf.layers.max_pooling2d(inputs=conv2, pool_size=[2, 2], strides=2) # Convolutional Layer #3 (No Pooling) conv3 = tf.layers.conv2d( inputs=pool2, filters=64, kernel_size=[5, 5], padding="same", activation=tf.nn.relu ) pool3 = tf.layers.max_pooling2d(inputs=conv3, pool_size=[2, 2], strides=2) # Dense Layer pool3_flat = tf.reshape(pool3, [-1, 4 * 4 * 64]) # Flatten pool3 which has these dimensions dense = tf.layers.dense(inputs=pool3_flat, units=64) # Logits Layer logits = tf.layers.dense(inputs=dense, units=10) loss = None train_op = None # Calculate Loss (for both TRAIN and EVAL modes) if mode != learn.ModeKeys.INFER: onehot_labels = tf.one_hot(indices=tf.cast(labels, tf.int32), depth=10) loss = tf.losses.softmax_cross_entropy(onehot_labels=onehot_labels, logits=logits) # Configure the Training Op (for TRAIN mode) if mode == learn.ModeKeys.TRAIN: train_op = tf.contrib.layers.optimize_loss( loss=loss, global_step=tf.contrib.framework.get_global_step(), learning_rate=SampleArchitecture2.learning_rate, optimizer="SGD" ) # Generate Predictions predictions = { "classes": tf.argmax(input=logits, axis=1), "probabilities": tf.nn.softmax(logits, name="softmax_tensor") } # Return a ModelFnOps object return model_fn_lib.ModelFnOps(mode=mode, predictions=predictions, loss=loss, train_op=train_op)
997,972
cf4ab6bf374ca62c3356a4efff69683d890c7f62
class Employ: def __init__(self, empno, name, sal): self.empno = empno self.name = name self.sal = sal def __str__(self): return "Empno %d, Name %s, Salary %d " %(self.empno, self.name, self.sal) emp = Employ(1, "Satish", 88555) print(emp)
997,973
142a0b26fcc0a5a799f6b488c430c6f340060d0c
class Node: def __init__(self, data): self.data = data self.left = None self.right = None def leftLeavesSumRec(root, isLeft, summ): if root is None: return #Check whether this node is a leaf node and is left if root.left is None and root.right is None and isLeft == True: summ[0] += root.data leftLeavesSumRec(root.left, 1, summ) leftLeavesSumRec(root.right, 0, summ) def leftLeavesSum(root): summ = [0] leftLeavesSumRec(root, 0, summ) return summ[0] root = Node(20) root.left = Node(9) root.right = Node(49) root.right.left = Node(23) root.right.right = Node(52) root.right.right.left = Node(50) root.left.left = Node(5) root.left.right = Node(12) root.left.right.right = Node(12) print ("Sum of left leaves is") print(leftLeavesSum(root))
997,974
0576bb7bba6319c9ce6a1e5f8c8e83802a52e694
""" http ~~~~ A module to handle making HTTP requests. """ import requests # Exceptions. class AuthenticationError(RuntimeError): """The request received a 401 error from the server.""" class NotFoundError(RuntimeError): """The request received a 404 error from the server.""" class ServerError(RuntimeError): """The request received a 500 error from the server.""" # HTTP calls. def get(url:str, session: requests.Session = None): """Make an HTTP GET request.""" if session: resp = session.get(url) else: resp = requests.get(url) if resp.status_code == 401: raise AuthenticationError('Authentication failed.') if resp.status_code == 404: raise NotFoundError('Page not found.') if resp.status_code >= 500 and resp.status_code < 600: print(resp.text) raise ServerError('Encountered a server error.') return resp.text # Utility functions. def build_session(): """Provide a session object for use in tracking session.""" return requests.Session()
997,975
9e5c5809380697d4fb91d89c4875185934319a7b
#Create Cluster import sys import os sys.path.append(os.path.abspath(__file__ + '/../../')) from Utils.utils import Utils import pprint class CreateCluster: def __init__(self): print('Create Clusterr') self.utils = Utils(sys.argv) self.hostname = sys.argv[1] def create_cluster(self): data = self.utils.read_input(os.path.abspath(__file__ +'/../')+'/create_cluster_spec.json') validations_url = 'https://'+self.hostname+'/v1/clusters/validations/creations' print ('Validating the input....') response = self.utils.post_request(data,validations_url) if(response['resultStatus'] != 'SUCCEEDED'): print ('Validation Failed.') exit(1) create_cluster_url = 'https://'+ self.hostname + '/v1/clusters' response = self.utils.post_request(data,create_cluster_url) print ('Creating Cluster...') task_url = 'https://'+self.hostname+'/v1/tasks/' + response['id'] print('Create cluster eneded with status: ' + self.utils.poll_on_id(task_url,True)) if __name__== "__main__": CreateCluster().create_cluster()
997,976
d7547c21b0af5cb982c0ee22922d8872cede91af
# Generated by Django 3.1.7 on 2021-06-28 16:01 from django.db import migrations, models class Migration(migrations.Migration): dependencies = [ ('vdapp', '0001_initial'), ] operations = [ migrations.AlterField( model_name='index', name='thumbnail', field=models.FileField(upload_to='video/%y'), ), ]
997,977
5f48880739e6f88724874f34104a445f72aca9bc
## Create acceptance uncertainties for the ggH QCD uncertainties (i.e. the so called 9NP scheme) ## by renormalizing the default inputs by total-xsection variation: ## ## acc_variation = variation.Scale( sum_of_weights_nominal / sum_of_weights_variation ) ## ## where sum_of_weights_nominal and sum_of_weights_variation are sums of events weights ## of all generated events. ## ## We use the following assumptons: ## 1. ggH for the lep-lep channel consists only from the DSID 345120 ## 2. ggH for the had-had channel consists only from the DSID 345123 ## 3. ggH for the lep-had channel consists only from the DSIDs 345121 and 345121 ## 4. There is no difference in acceptance between positive and negative lepton channels in lep-had try: # command line agrument parser import argparse parser = argparse.ArgumentParser() parser.add_argument('-ws', '--wsInputFile', help='Name of the combined WS input root file') args = parser.parse_args() # have to import root after the parser from ROOT import TFile from wsPostProcess import * # open the WS inpt file f = TFile.Open(args.wsInputFile) print "Loading WS input folder tree..." tree = readFolderTree(f) print "...done" # sample sample = 'ggH' # normalization factors: ll_sum_of_weights_nominal = 53957603.57 ll_sum_of_weights = [ ('theory_sig_qcd_0_high', 56492715.88), ('theory_sig_qcd_1_high', 55185917.43), ('theory_sig_qcd_2_high', 54041298.10), ('theory_sig_qcd_3_high', 54047280.43), ('theory_sig_qcd_4_high', 54121620.68), ('theory_sig_qcd_5_high', 53956505.47), ('theory_sig_qcd_6_high', 54076640.70), ('theory_sig_qcd_7_high', 54182534.31), ('theory_sig_qcd_8_high', 54092313.60), ] lh_sum_of_weights_nominal = 42976109.88 lh_sum_of_weights = [ ('theory_sig_qcd_0_high', 44991163.54), ('theory_sig_qcd_1_high', 43941580.52), ('theory_sig_qcd_2_high', 43010396.20), ('theory_sig_qcd_3_high', 43060393.68), ('theory_sig_qcd_4_high', 43104010.47), ('theory_sig_qcd_5_high', 42974999.18), ('theory_sig_qcd_6_high', 43069327.90), ('theory_sig_qcd_7_high', 43171852.50), ('theory_sig_qcd_8_high', 43095802.77), ] hh_sum_of_weights_nominal = 53538670.72 hh_sum_of_weights = [ ('theory_sig_qcd_0_high', 56042603.54), ('theory_sig_qcd_1_high', 54729386.89), ('theory_sig_qcd_2_high', 53568183.13), ('theory_sig_qcd_3_high', 53620581.91), ('theory_sig_qcd_4_high', 53695584.28), ('theory_sig_qcd_5_high', 53540003.79), ('theory_sig_qcd_6_high', 53631218.96), ('theory_sig_qcd_7_high', 53751977.36), ('theory_sig_qcd_8_high', 53671009.16), ] # loop over regions for regionName,region in tree.iteritems(): if type(region) == dict and sample in region: # pull out the appropriate normalzation factors for this channels if 'llAll' in regionName: sum_of_weights_nominal = ll_sum_of_weights_nominal sum_of_weights = ll_sum_of_weights elif 'ehAll' in regionName or 'mhAll' in regionName: sum_of_weights_nominal = lh_sum_of_weights_nominal sum_of_weights = lh_sum_of_weights elif 'hhAll' in regionName: sum_of_weights_nominal = hh_sum_of_weights_nominal sum_of_weights = hh_sum_of_weights else: raise ValueError("Cannot determine channel for region {}".format(regionName)) print "{}/{}".format(regionName, sample) # modify the variations by a correction factor sum_of_weights_nominal / sum_of_weights_variation for histName, sum_of_weights_var in sum_of_weights: print " {}".format(histName) if histName not in region[sample] or region[sample][histName].Integral() == 0: print " not available or has 0 intergal" else: # create a renormalized variation histNameNew = histName.replace("_high", "_acceptance_high") new_var = region[sample][histName].Clone(histNameNew) new_var.Scale( sum_of_weights_nominal / sum_of_weights_var ) # store rescaled histograms in the tree: region[sample][new_var.GetName()] = new_var # debug printout print " original overall variation {}".format(region[sample][histName].Integral() / region[sample]['nominal'].Integral() ) print " rescaled overall variation {} (was rescaled by {})".format(region[sample][histNameNew].Integral() / region[sample]['nominal'].Integral(), sum_of_weights_nominal / sum_of_weights_var ) # save the updated tree if '.root' in args.wsInputFile: newFileName = args.wsInputFile.replace('.root','_accGGH9NP.root') else: newFileName = args.wsInputFile + '_accGGH9NP' print "Creating the processed WS input file {} ...".format(newFileName) fOut = TFile.Open(newFileName, 'recreate') save(tree, fOut) print "...done" except SystemExit as e: pass except Exception: raise # the end
997,978
f72c29d04287f930ac9c5163771c7d2ff9cbf9b7
import sys import os import shutil import re def delete_files(directory, file_type): regex = "[.]" + file_type for dir_name, folders, dir_files in os.walk(directory): for files in dir_files: if re.search(regex, files): print("directory: ", dir_name) print("Folder: ", folders) print("files: ", files) os.remove(dir_name + "/" + files) return None def delete_folders(directory, gen_folder_name): for dir_name, folders, dir_files in os.walk(directory, topdown = False): for folder in folders: if re.search(gen_folder_name, folder): folder_to_delete = dir_name + '/' + folder + '/' print(folder_to_delete) shutil.rmtree(folder_to_delete) return None
997,979
8b8242e8c578d62c4cef8dc410f721064c4d9224
import ROOT from ROOT import TGraph,TColor from array import array import CMS_lumi from operator import itemgetter ROOT.gROOT.SetBatch() hexcolor=["#1f77b4", "#ff7f0e", "#2ca02c", "#d62728", "#9467bd", "#8c564b", "#e377c2", "#7f7f7f", "#bcbd22", "#17becf"] intcolor=[TColor.GetColor(i) for i in hexcolor] x_13,y_th_13,y_13_obs,y_th = array( 'd' ), array( 'd' ), array( 'd' ), array( 'd' ) x_13.append(1.000) x_13.append(1.250) x_13.append(1.500) x_13.append(2.000) x_13.append(2.500) x_13.append(3.000) x_13.append(3.500) x_13.append(4.000) x_13.append(4.500) x_13.append(5.000) #x_th_13.append(6.000) y_th_13.append(1.3*20.05) y_th_13.append(1.3*7.92) y_th_13.append(1.3*3.519) y_th_13.append(1.3*0.9528) y_th_13.append(1.3*0.3136) y_th_13.append(1.3*0.1289) y_th_13.append(1.3*0.05452) y_th_13.append(1.3*0.02807) y_th_13.append(1.3*0.01603) y_th_13.append(1.3*0.009095) #y_th_13.append(0.00960796535494) y_13_obs.append(0.76) y_13_obs.append(0.82) y_13_obs.append(0.28) y_13_obs.append(0.091) y_13_obs.append(0.044) y_13_obs.append(0.021) y_13_obs.append(0.018) y_13_obs.append(0.021) y_13_obs.append(0.019) y_13_obs.append(0.024) y_th.append(1.3*1.153) y_th.append(1.3*1.556*0.1) y_th.append(1.3*3.585*0.01) y_th.append(1.3*1.174*0.01) y_th.append(1.3*4.939*0.001) masses=[2,3,4,5,6] x=array('d',[2.000,3.000,4.000,5.000,6.000]) theory = TGraph( 5, x, y_th ) theory.SetLineWidth(3) theory.SetLineColor(ROOT.kAzure) theory.SetMarkerColor(ROOT.kAzure) theory_13 = TGraph( 10, x_13, y_th_13 ) theory_13.SetLineWidth(3) theory_13.SetLineColor(ROOT.kRed) theory_13.SetMarkerColor(ROOT.kRed) obs_13 = TGraph( 10, x_13, y_13_obs ) obs_13.SetLineWidth(3) obs_13.SetLineColor(ROOT.kRed) obs_13.SetMarkerColor(ROOT.kRed) limits=[] sig3=[] sig5=[] def rounding(numero): return '%s' % float('%.2g' % float(numero)) for lumi in ['300','1000','3000','36']: #for lumi in ['36','new_36','double_36']: c=ROOT.TCanvas('unodlimit_'+lumi,'',1200,1000) c.SetLogy() margine=0.15 c.SetRightMargin(0.10) c.SetLeftMargin(margine) c.SetTopMargin(0.10) c.SetBottomMargin(margine) theta_exp_result = open('plots/theta_'+lumi+'.txt','r') theta_exp_lines=theta_exp_result.readlines() lines_exp=[filter(None, i.split(' ')) for i in theta_exp_lines[1:] ] y_exp=array('d',[float(lines_exp[i][1]) for i in range(len(lines_exp))]) y_err2down=array('d',[float(lines_exp[i][1])-float(lines_exp[i][2]) for i in range(len(lines_exp))]) y_err1down=array('d',[float(lines_exp[i][1])-float(lines_exp[i][4]) for i in range(len(lines_exp))]) y_err1up=array('d',[float(lines_exp[i][5])-float(lines_exp[i][1]) for i in range(len(lines_exp))]) y_err2up=array('d',[float(lines_exp[i][3])-float(lines_exp[i][1]) for i in range(len(lines_exp))]) zeros=array('d',[0]*len(lines_exp)) print lumi for i in range(len(lines_exp)): print masses[i],'&',rounding(lines_exp[i][2]),'&',rounding(lines_exp[i][4]),'&',rounding(lines_exp[i][1]),'&',rounding(lines_exp[i][5]),'&',rounding(lines_exp[i][3]),'\\\\' exp1sigma=ROOT.TGraphAsymmErrors(5,x,y_exp,zeros,zeros,y_err1down,y_err1up) exp2sigma=ROOT.TGraphAsymmErrors(5,x,y_exp,zeros,zeros,y_err2down,y_err2up) explim=TGraph(5,x,y_exp) explim.SetLineWidth(2) explim.SetLineStyle(2) explim.SetTitle('') limits.append(explim.Clone()) exp2sigma.SetTitle('') exp1sigma.SetTitle('') exp1sigma.SetFillColor(ROOT.kGreen+1) exp2sigma.SetFillColor(ROOT.kOrange) exp2sigma.SetMaximum(10000) exp2sigma.SetMinimum(0.0007) exp2sigma.Draw('a3lp') exp2sigma.GetXaxis().SetTitle("g_{KK} mass [TeV]") exp2sigma.GetXaxis().SetRangeUser(1500,6500) exp2sigma.GetYaxis().SetTitle("Upper cross section limit [pb]") sizefactor=1.5 exp2sigma.GetXaxis().SetTitleSize(sizefactor*exp2sigma.GetXaxis().GetTitleSize()) exp2sigma.GetYaxis().SetTitleSize(sizefactor*exp2sigma.GetYaxis().GetTitleSize()) exp2sigma.GetXaxis().SetLabelSize(sizefactor*exp2sigma.GetXaxis().GetLabelSize()) exp2sigma.GetYaxis().SetLabelSize(sizefactor*exp2sigma.GetYaxis().GetLabelSize()) #exp2sigma.GetYaxis().SetMoreLogLabels(1) offset=1.2 exp2sigma.GetXaxis().SetTitleOffset(offset*exp2sigma.GetXaxis().GetTitleOffset()) exp2sigma.GetYaxis().SetTitleOffset(offset*exp2sigma.GetYaxis().GetTitleOffset()) exp1sigma.Draw('3') explim.Draw('lp') theory.Draw('l') legend=ROOT.TLegend(0.335,0.55,0.9,0.9) legend.SetTextSize(0.030) legend.SetBorderSize(0) legend.SetTextFont(42) legend.SetLineColor(1) legend.SetLineStyle(1) legend.SetLineWidth(1) legend.SetFillColor(0) legend.SetFillStyle(0) legend.SetHeader('g_{KK}#rightarrow t#bar{t}') legend.AddEntry(explim,'Expected','l') legend.AddEntry(exp1sigma,'#pm 1 std. deviation','f') legend.AddEntry(exp2sigma,'#pm 2 std. deviation','f') legend.AddEntry(theory,"g_{KK}#rightarrow t#bar{t}",'l') legend.Draw() if '3000' in lumi: CMS_lumi.CMS_lumi(c, 3, 11) elif '1000' in lumi: CMS_lumi.CMS_lumi(c, 2, 11) elif '300' in lumi: CMS_lumi.CMS_lumi(c, 1, 11) elif '36' in lumi: CMS_lumi.CMS_lumi(c, 0, 11) c.SaveAs('pdf/unodlimit_'+lumi+'.pdf') c2=ROOT.TCanvas('sigma_'+lumi,'',1200,1000) c2.SetLogy() c2.SetRightMargin(0.10) c2.SetLeftMargin(margine) c2.SetTopMargin(0.10) c2.SetBottomMargin(margine) sigma3_file = open('plots/theta_'+lumi+'_3sigmaSignif.txt','r') sigma5_file = open('plots/theta_'+lumi+'_5sigmaSignif.txt','r') sigma3_lines=sigma3_file.readlines() sigma5_lines=sigma5_file.readlines() sigma3_list=[[float(j) for j in filter(None, i.split(' '))] for i in sigma3_lines[1:] ] sigma5_list=[[float(j) for j in filter(None, i.split(' '))] for i in sigma5_lines[1:] ] sigma3_list=sorted(sigma3_list, key=itemgetter(0)) sigma5_list=sorted(sigma5_list, key=itemgetter(0)) y_sigma3=array('d',[sigma3_list[i][1] for i in range(len(sigma3_list))]) y_sigma5=array('d',[sigma5_list[i][1] for i in range(len(sigma5_list))]) sigma3=TGraph(5,x,y_sigma3) sigma5=TGraph(5,x,y_sigma5) for i in range(len(sigma3_list)): print masses[i],'&',rounding(sigma3_list[i][1]),'&',rounding(sigma5_list[i][1]),'\\\\' sigma3.SetLineWidth(3) #sigma3.SetLineStyle(2) sigma3.SetTitle('') sigma3.SetLineColor(ROOT.kGreen+1) sigma5.SetLineWidth(3) #sigma5.SetLineStyle(2) sigma5.SetTitle('') sigma5.SetLineColor(ROOT.kRed+1) sigma3.SetMaximum(10000) sigma3.SetMinimum(0.0007) sig3.append(sigma3.Clone()) sig5.append(sigma5.Clone()) sigma3.Draw('al') sigma3.GetXaxis().SetTitle("g_{KK} mass [TeV]") sigma3.GetXaxis().SetRangeUser(1500,6500) sigma3.GetYaxis().SetTitle("Cross section [pb]") sigma3.GetXaxis().SetTitleSize(sizefactor*sigma3.GetXaxis().GetTitleSize()) sigma3.GetYaxis().SetTitleSize(sizefactor*sigma3.GetYaxis().GetTitleSize()) sigma3.GetXaxis().SetLabelSize(sizefactor*sigma3.GetXaxis().GetLabelSize()) sigma3.GetYaxis().SetLabelSize(sizefactor*sigma3.GetYaxis().GetLabelSize()) sigma3.GetXaxis().SetTitleOffset(offset*sigma3.GetXaxis().GetTitleOffset()) sigma3.GetYaxis().SetTitleOffset(offset*sigma3.GetYaxis().GetTitleOffset()) sigma5.Draw('l') theory.Draw('l') legend2=ROOT.TLegend(0.335,0.55,0.9,0.9) legend2.SetTextSize(0.030) legend2.SetBorderSize(0) legend2.SetTextFont(42) legend2.SetLineColor(1) legend2.SetLineStyle(1) legend2.SetLineWidth(1) legend2.SetFillColor(0) legend2.SetFillStyle(0) legend2.SetHeader('g_{KK}#rightarrow t#bar{t}') legend2.AddEntry(sigma3,'3#sigma significance','l') legend2.AddEntry(sigma5,'5#sigma significance','l') legend2.AddEntry(theory,"g_{KK}#rightarrow t#bar{t}",'l') legend2.Draw() if '3000' in lumi: CMS_lumi.CMS_lumi(c2, 3, 11) elif '1000' in lumi: CMS_lumi.CMS_lumi(c2, 2, 11) elif '300' in lumi: CMS_lumi.CMS_lumi(c2, 1, 11) elif '36' in lumi: CMS_lumi.CMS_lumi(c2, 0, 11) c2.SaveAs('pdf/sigma_'+lumi+'.pdf') y_comp = ["Upper cross section limit [pb]",'3#sigma significance','5#sigma significance'] legends_comp = ["300 fb^{-1} (14 TeV)","1000 fb^{-1} (14 TeV)","3000 fb^{-1} (14 TeV)","36 fb^{-1} (14 TeV)","g_{KK}#rightarrow t#bar{t} (14 TeV)","36 fb^{-1} (13 TeV) 0l+1l+2l","g_{KK}#rightarrow t#bar{t} (13 TeV)"] #legends_comp = ["36 fb^{-1} (14 TeV)","36 fb^{-1} (14 TeV) no systematics (only stat)","36 fb^{-1} (14 TeV) double systematics","g_{KK}#rightarrow t#bar{t} (14 TeV)","36 fb^{-1} (13 TeV) 0l+1l+2l","g_{KK}#rightarrow t#bar{t} (13 TeV)"] to_compare=[limits,sig3,sig5] #to_compare=[limits] comp_names=['limits','sig3','sig5'] for comparison in range(len(to_compare)): c3=ROOT.TCanvas(comp_names[comparison]+'_comp','',1200,1000) c3.SetLogy() c3.SetRightMargin(0.10) c3.SetLeftMargin(margine) c3.SetTopMargin(0.10) c3.SetBottomMargin(margine) legend3=ROOT.TLegend(0.335,0.55,0.9,0.9) legend3.SetTextSize(0.030) legend3.SetBorderSize(0) legend3.SetTextFont(42) legend3.SetLineColor(1) legend3.SetLineStyle(1) legend3.SetLineWidth(1) legend3.SetFillColor(0) legend3.SetFillStyle(0) legend3.SetHeader('g_{KK}#rightarrow t#bar{t}') for i in range(len(to_compare[comparison])): to_compare[comparison][i].SetLineColor(intcolor[i]) to_compare[comparison][i].SetLineWidth(3) to_compare[comparison][i].SetLineStyle(0) if i==0: to_compare[comparison][i].Draw('al') to_compare[comparison][i].GetXaxis().SetTitle("g_{KK} mass [TeV]") to_compare[comparison][i].GetXaxis().SetRangeUser(1500,6500) to_compare[comparison][i].GetYaxis().SetTitle(y_comp[comparison]) to_compare[comparison][i].SetMaximum(10000) to_compare[comparison][i].SetMinimum(0.0007) legend3.AddEntry(to_compare[comparison][i],legends_comp[i],'l') else: to_compare[comparison][i].Draw('l') legend3.AddEntry(to_compare[comparison][i],legends_comp[i],'l') theory.SetLineColor(ROOT.kBlack) theory.SetLineWidth(3) theory.SetLineStyle(0) theory.Draw('l') legend3.AddEntry(theory,legends_comp[-3],'l') if comparison==0: obs_13.SetLineColor(ROOT.kRed) obs_13.SetLineWidth(3) obs_13.SetLineStyle(2) obs_13.Draw('l') legend3.AddEntry(obs_13,legends_comp[-2],'l') theory_13.SetLineColor(ROOT.kBlack) theory_13.SetLineWidth(3) theory_13.SetLineStyle(2) theory_13.Draw('l') legend3.AddEntry(theory_13,legends_comp[-1],'l') legend3.Draw() c3.SaveAs('pdf/'+c3.GetName()+'.pdf')
997,980
65859cb79891dc1caf4dd0ac428569c4d94300d1
"""Tool used to generate a signal according to the model chosen. Also extracts measurements and parameters for the DCS-AMP framework to run with. """ from typing import List, Tuple import numpy class SignalGen: def __init__(self, **params): """Initialize a set of signal parameters for later generation.""" # Dimension of the true signal x self.N = params.get('N', 1024) # Dimension of the measurement vector y self.M = params.get('M', 256) # Number of timesteps self.T = params.get('T', 4) # Type of the random measurement matrix to generate # (1) : normalized Gaussian matrix self.A_type = params.get('A_type', 1) # Active support probability self.lambda_ = params.get('lambda_', 0.08) # high sparsity default # Amplitude mean self.zeta = params.get('zeta', 0) # Amplitude variance self.sigma2 = params.get('sigma2', 1) # Amplitude innovation rate self.alpha = params.get('alpha', 0.10) # Active-to-inactive transition probability self.p01 = params.get('p01', 0.10) # Desired signal-to-noise ratio, in dB self.desired_SNR = params.get('desired_SNR', 25) @property def rho(self): return (2 - self.alpha) * self.sigma2 / self.alpha @property def p10(self): return self.lambda_ * self.p01 / (1 - self.lambda_) def generate_signal(self) -> Tuple[numpy.ndarray]: s = numpy.zeros((self.N, self.T)) support = [None for _ in range(self.T)] n_active = [None for _ in range(self.T)] # Generate initial support n_active[0] = numpy.random.binomial(self.N, self.lambda_) support[0] = numpy.random.choice(range(self.N), size=n_active[0]) s[support[0], 0] = 1 # Evolve support over time for t in range(1, self.T): draws = numpy.random.random(self.N) active_mask, inactive_mask = s[:, t-1] == 0, s[:, t-1] == 1 deactivated = draws[active_mask] > self.p01 activated = draws[inactive_mask] < self.p10 s[active_mask, t] = 1 - deactivated.astype(int) s[inactive_mask, t] = activated.astype(int) support[t] = s[t] == 1 n_active[t] = len(support[t]) # Generate amplitude process (complex-valued) theta = numpy.zeros((self.N, self.T), dtype=numpy.complex) theta[:, 0] = self.zeta * numpy.ones(self.N) theta[:, 0] += numpy.sqrt(self.sigma2 / 2) * ( numpy.random.randn(self.N, 2).dot([1, 1j]) ) for t in range(1, self.T): noise = numpy.random.randn(self.N, 2).dot([1, 1j]) theta[:, t] = ( (1 - self.alpha) * (theta[:, t - 1] - self.zeta) + self.alpha * numpy.sqrt(self.rho / 2) * noise + self.zeta ) # True signal x = theta * s return x, theta, s def generate_measurements( self, x: numpy.ndarray ) -> Tuple[List[numpy.ndarray]]: """Generate measurement matrices and vectors from a given signal.""" # Generate A matrices signal_power = 0 A_list = [] for t in range(self.T): if self.A_type == 1: # IID Gausian with unit-norm colums A = ( numpy.random.randn(self.M, self.N) + 1j * numpy.random.randn(self.M, self.N) ) / numpy.sqrt(2 * self.M) for n in range(self.N): A[:, n] /= numpy.linalg.norm(A[:, n]) else: raise ValueError("Invalid A_type: {}".format(self.A_type)) A_list.append(A) signal_power += numpy.linalg.norm(A.dot(x[:, t])) ** 2 # Extract noise variance for desired SNR sig2e = signal_power / (self.M * self.T) * 10 ** (-self.desired_SNR/10) # Generate noisy measurements y_list = [] for t in range(self.T): e = numpy.sqrt(sig2e/2) * ( numpy.random.randn(self.M, 2).dot([1, 1j])) y_list.append( A[t].dot(x[:, t]) + e ) return y_list, A_list, sig2e
997,981
dc009dee1a4284bf16e96572971bda5157446677
# This is an auto-generated Django model module. # You'll have to do the following manually to clean this up: # * Rearrange models' order # * Make sure each model has one field with primary_key=True # * Remove `managed = False` lines for those models you wish to give write DB access # Feel free to rename the models, but don't rename db_table values or field names. # # Also note: You'll have to insert the output of 'django-admin.py sqlcustom [appname]' # into your database. from __future__ import unicode_literals from django.db import models from datetime import datetime class Fixture(models.Model): fixture_id = models.AutoField(db_column='Fixture_id', primary_key=True) # Field name made lowercase. tournament = models.ForeignKey('Tournament', db_column='Tournament_id') # Field name made lowercase. number = models.IntegerField(db_column='Number') # Field name made lowercase. info = models.TextField(db_column='Info', blank=True) # Field name made lowercase. last_updated = models.DateTimeField(db_column='Last_updated',default=datetime.now) # Field name made lowercase. Active = models.BooleanField(db_column='Status',default='true') # Field name made lowercase. class Meta: managed = False db_table = 'Fixture' def __unicode__(self): return str(self.fixture_id) class Match(models.Model): match_id = models.AutoField(db_column='Match_id', primary_key=True) # Field name made lowercase. fixture = models.ForeignKey(Fixture, db_column='Fixture_id') # Field name made lowercase. home = models.ForeignKey('Team', db_column='Home_id', related_name='match_home') # Field name made lowercase. away = models.ForeignKey('Team', db_column='Away_id') # Field name made lowercase. date = models.DateTimeField(db_column='Date', blank=True, null=True) # Field name made lowercase. info = models.TextField(db_column='Info', blank=True) # Field name made lowercase. last_updated = models.DateTimeField(db_column='Last_updated',default=datetime.now) # Field name made lowercase. active = models.BooleanField(db_column='Status', default='true') # Field name made lowercase. score_home = models.IntegerField(db_column='Score_home') # Field name made lowercase. score_away = models.IntegerField(db_column='Score_away') # Field name made lowercase. played = models.BooleanField(db_column='Played', default='false') # Field name made lowercase. class Meta: managed = False db_table = 'Match' permissions = ( ("usario_digitador", "Can change a match if it is a data entry user"), ) def __unicode__(self): return str(self.match_id) class Privilege(models.Model): privilege_id = models.IntegerField(db_column='Privilege_id', primary_key=True) # Field name made lowercase. description = models.CharField(db_column='Description', max_length=80) # Field name made lowercase. class Meta: managed = False db_table = 'Privilege' class Team(models.Model): team_id = models.AutoField(db_column='Team_id', primary_key=True) # Field name made lowercase. tournament = models.ForeignKey('Tournament', db_column='Tournament_id') # Field name made lowercase. name = models.CharField(db_column='Name', max_length=60) # Field name made lowercase. e_mail = models.CharField(db_column='E-mail', max_length=45, blank=True) # Field name made lowercase. Field renamed to remove unsuitable characters. info = models.TextField(db_column='Info', blank=True) # Field name made lowercase. last_updated = models.DateTimeField(db_column='Last_updated',default=datetime.now) # Field name made lowercase. active = models.BooleanField(db_column='Status',default='true') # Field name made lowercase. class Meta: managed = False db_table = 'Team' permissions = ( ("view_team", "Can view a team"), ) def __unicode__(self): return self.name class Tournament(models.Model): tournament_id = models.AutoField(db_column='Tournament_id', primary_key=True) # Field name made lowercase. name = models.CharField(db_column='Name', max_length=50) # Field name made lowercase. date_start = models.DateTimeField(db_column='Date_start') # Field name made lowercase. date_end = models.DateTimeField(db_column='Date_end', blank=True, null=True) # Field name made lowercase. home_and_away = models.BooleanField(db_column='Home_and_away') # Field name made lowercase. info = models.TextField(db_column='Info', blank=True) # Field name made lowercase. last_updated = models.DateTimeField(db_column='Last_updated',default=datetime.now) # Field name made lowercase. active = models.BooleanField(db_column='Status',default='True') # Field name made lowercase. public = models.BooleanField(db_column='Public',default='True') # Field name made lowercase. class Meta: managed = False db_table = 'Tournament' permissions = ( ("view_tournament", "Can view a tournament"), ) def __unicode__(self): return self.name class AuthGroup(models.Model): id = models.IntegerField(primary_key=True) name = models.CharField(unique=True, max_length=80) class Meta: managed = False db_table = 'auth_group' class AuthGroupPermissions(models.Model): id = models.IntegerField(primary_key=True) group = models.ForeignKey(AuthGroup) permission = models.ForeignKey('AuthPermission') class Meta: managed = False db_table = 'auth_group_permissions' class AuthPermission(models.Model): id = models.IntegerField(primary_key=True) name = models.CharField(max_length=50) content_type = models.ForeignKey('DjangoContentType') codename = models.CharField(max_length=100) class Meta: managed = False db_table = 'auth_permission' class AuthUser(models.Model): id = models.IntegerField(primary_key=True) password = models.CharField(max_length=128) last_login = models.DateTimeField() is_superuser = models.IntegerField() username = models.CharField(unique=True, max_length=30) first_name = models.CharField(max_length=30) last_name = models.CharField(max_length=30) email = models.CharField(max_length=75) is_staff = models.IntegerField() is_active = models.IntegerField() date_joined = models.DateTimeField() class Meta: managed = False db_table = 'auth_user' permissions = ( ("add_dataentry", "Can add a user for data entry"), ("add_usuario_rep", "Can add a user that represents a team"), ("is_rep", "Can view a tournament even if it is private"), ) class AuthUserGroups(models.Model): id = models.IntegerField(primary_key=True) user = models.ForeignKey(AuthUser) group = models.ForeignKey(AuthGroup) class Meta: managed = False db_table = 'auth_user_groups' class AuthUserUserPermissions(models.Model): id = models.IntegerField(primary_key=True) user = models.ForeignKey(AuthUser) permission = models.ForeignKey(AuthPermission) class Meta: managed = False db_table = 'auth_user_user_permissions' class DjangoAdminLog(models.Model): id = models.IntegerField(primary_key=True) action_time = models.DateTimeField() user = models.ForeignKey(AuthUser) content_type = models.ForeignKey('DjangoContentType', blank=True, null=True) object_id = models.TextField(blank=True) object_repr = models.CharField(max_length=200) action_flag = models.IntegerField() change_message = models.TextField() class Meta: managed = False db_table = 'django_admin_log' class DjangoContentType(models.Model): id = models.IntegerField(primary_key=True) name = models.CharField(max_length=100) app_label = models.CharField(max_length=100) model = models.CharField(max_length=100) class Meta: managed = False db_table = 'django_content_type' class DjangoSession(models.Model): session_key = models.CharField(primary_key=True, max_length=40) session_data = models.TextField() expire_date = models.DateTimeField() class Meta: managed = False db_table = 'django_session'
997,982
a9fb5c229e72d086f976c014a516d4de1f15d3a0
from urllib.request import quote from django.conf import settings from django.contrib.contenttypes.fields import GenericForeignKey, GenericRelation from django.contrib.contenttypes.models import ContentType from django.core.urlresolvers import reverse from django.db import models from django.db.models.signals import pre_save, post_save from django.utils.text import slugify from .utils import get_vid_for_direction class VideoQuerySet(models.query.QuerySet): def active(self): return self.filter(active=True) def featured(self): return self.filter(featured=True) def free_preview(self): return self.filter(free_preview=True) def embed_code(self): return self.filter(embed_code__isnull=False).exclude(embed_code__iexact="") def category(self, slug): cat = Category.objects.get(slug=slug) return self.filter(category=cat.id) class VideoManager(models.Manager): def get_queryset(self): return VideoQuerySet(self.model, using=self._db) def get_featured(self): return self.get_queryset().featured().active() def get_by_category(self, slug): return self.get_queryset().active().embed_code().category(slug=slug) def all(self): return self.get_queryset().active().embed_code() DEFAULT_MESSAGE = "Check this awesome video." class Video(models.Model): title = models.CharField(max_length=120) embed_code = models.CharField(max_length=500, null=True, blank=True) order = models.PositiveIntegerField(default=1) share_message = models.TextField(max_length=140, default=DEFAULT_MESSAGE) tags = GenericRelation("TaggedItem", null=True, blank=True) active = models.BooleanField(default=True) slug = models.SlugField(null=True, blank=True) featured = models.BooleanField(default=False) free_preview = models.BooleanField(default=False) category = models.ForeignKey("Category") timestamp = models.DateTimeField(auto_now_add=True, auto_now=False, null=True) updated = models.DateTimeField(auto_now_add=False, auto_now=True, null=True) objects = VideoManager() class Meta: ordering = ['order', 'timestamp'] unique_together = ('slug', 'category') def __str__(self): return self.title def get_absolute_url(self): return reverse("categories:video_detail", kwargs={"cat_slug": self.category.slug, "slug": self.slug}) def get_share_link(self): full_url = "{0}{1}".format(settings.FULL_DOMAIN_NAME, self.get_absolute_url()) return quote("{0} {1}".format(self.share_message, full_url)) def get_next_url(self): video = get_vid_for_direction(self, "next") if video: return video.get_absolute_url() return None def get_previous_url(self): video = get_vid_for_direction(self, "previous") if video: return video.get_absolute_url() return None def has_preview(self): if self.free_preview: return True return False def video_post_save_receiver(sender, instance, created, *args, **kwargs): slug_title = slugify(instance.title) if created: slug_exists = Video.objects.filter(slug=slug_title) if slug_exists: new_slug = "{0} {1}".format(instance.title, instance.id) instance.slug = slugify(new_slug) instance.save() else: instance.slug = slug_title instance.save() post_save.connect(video_post_save_receiver, sender=Video) class CategoryQuerySet(models.query.QuerySet): def active(self): return self.filter(active=True) def featured(self): return self.filter(featured=True) class CategoryManager(models.Manager): def get_queryset(self): return CategoryQuerySet(self.model, using=self._db) def get_featured(self): return self.get_queryset().featured().active() def all(self): return self.get_queryset().active() class Category(models.Model): title = models.CharField(max_length=120) description = models.TextField(null=True, blank=True) image = models.ImageField(upload_to='images/', null=True, blank=True) tags = GenericRelation("TaggedItem", null=True, blank=True) slug = models.SlugField(unique=True, default="abc") active = models.BooleanField(default=True) featured = models.BooleanField(default=False) timestamp = models.DateTimeField(auto_now_add=True, auto_now=False) updated = models.DateTimeField(auto_now_add=False, auto_now=True) objects = CategoryManager() class Meta: ordering = ['title', 'timestamp'] verbose_name = 'Category' verbose_name_plural = 'Categories' def __str__(self): return self.title def get_absolute_url(self): return reverse("categories:detail", kwargs={"slug": self.slug}) def get_image_url(self): return "{0}{1}".format(settings.MEDIA_URL, self.image) def category_post_save_receiver(sender, instance, created, *args, **kwargs): slug_title = slugify(instance.title) if created: slug_exists = Category.objects.filter(slug=slug_title) if slug_exists: new_slug = "{0} {1}".format(instance.title, instance.id) instance.slug = slugify(new_slug) instance.save() else: instance.slug = slug_title instance.save() post_save.connect(category_post_save_receiver, sender=Category) TAG_CHOICES = ( ("python", "python"), ("django", "django"), ("css", "css"), ("bootstrap", "bootstrap"), ) class TaggedItem(models.Model): tag = models.SlugField(choices=TAG_CHOICES) content_type = models.ForeignKey(ContentType) object_id = models.PositiveIntegerField() content_object = GenericForeignKey() def __str__(self): return self.tag
997,983
7b1e2894c30e9bc9b7d74af96b404a563eb00989
# -*- coding: utf-8 -*- # Form implementation generated from reading ui file 'ui_sublayersdialog.ui' # # Created by: PyQt5 UI code generator 5.9.1 # # WARNING! All changes made in this file will be lost! from PyQt5 import QtCore, QtGui, QtWidgets class Ui_SublayersDialog(object): def setupUi(self, SublayersDialog): SublayersDialog.setObjectName("SublayersDialog") SublayersDialog.resize(400, 300) self.gridLayout = QtWidgets.QGridLayout(SublayersDialog) self.gridLayout.setObjectName("gridLayout") self.mSublayersTreeWidget = QtWidgets.QTreeWidget(SublayersDialog) self.mSublayersTreeWidget.setRootIsDecorated(False) self.mSublayersTreeWidget.setItemsExpandable(False) self.mSublayersTreeWidget.setObjectName("mSublayersTreeWidget") self.mSublayersTreeWidget.headerItem().setText(0, "1") self.gridLayout.addWidget(self.mSublayersTreeWidget, 0, 0, 1, 1) self.buttonBox = QtWidgets.QDialogButtonBox(SublayersDialog) self.buttonBox.setOrientation(QtCore.Qt.Horizontal) self.buttonBox.setStandardButtons(QtWidgets.QDialogButtonBox.Cancel|QtWidgets.QDialogButtonBox.Ok) self.buttonBox.setObjectName("buttonBox") self.gridLayout.addWidget(self.buttonBox, 1, 0, 1, 1) self.retranslateUi(SublayersDialog) self.buttonBox.accepted.connect(SublayersDialog.accept) self.buttonBox.rejected.connect(SublayersDialog.reject) QtCore.QMetaObject.connectSlotsByName(SublayersDialog) def retranslateUi(self, SublayersDialog): _translate = QtCore.QCoreApplication.translate SublayersDialog.setWindowTitle(_translate("SublayersDialog", "Interlis sublayers"))
997,984
aa62987f1ef2b3e511fc5e64673eb9d63017183e
import numpy as np from config_loader import config class Block: def __init__(self, spawn_point): self.FIELDWIDTH = config['FIELD-WIDTH'] self.FIELDHEIGHT = config['FIELD-HEIGHT'] p_shapes = self._possible_shapes() self.shape_id = np.random.randint(0, len(p_shapes)) self.shape = p_shapes[self.shape_id] #self.shape = p_shapes[-1] self.anchor = spawn_point self.WIDTH = np.max(self.shape, axis=0)[1] + 1 self.HEIGHT = np.max(self.shape, axis=0)[0] + 1 self.COLOR = self._get_color() def get_anchor(self): return self.anchor def get_shape(self): return self.shape def set_anchor(self, x, y): self.anchor = [x, y] def _possible_shapes(self): shapes = [ [[0, 0], [0, 1], [0, 2], [0, 3]], [[0, 0], [0, 1], [1, 1], [1, 2]], [[0, 0], [1, 0], [1, 1], [2, 1]], [[0, 0], [0, 1], [1, 0], [1, 1]], [[0, 0], [0, 1], [0, 2], [1, 1]], [[0, 0], [0, 1], [0, 2], [1, 2]], [[0, 0], [0, 1], [0, 2], [1, 0]], ] return shapes def get_coords(self): coords = [[self.anchor[0] + x, self.anchor[1] + y] for [x, y] in self.shape] return coords def remove_coord(self, coord): x = self.anchor[0] - coord[0] y = self.anchor[1] - coord[1] self.shape.remove([x, y]) def _get_color(self): pos_colors = ["red", "yellow", "green", "white", "grey", "magenta", "cyan"] return pos_colors[np.random.randint(0, len(pos_colors))] def set_shape(self, shape): self.shape = [] for [x, y] in shape: self.shape.append([x, y]) self.WIDTH = np.max(self.shape, axis=0)[1] + 1 self.HEIGHT = np.max(self.shape, axis=0)[0] + 1 def rotate(self): original = [] for i in range(self.HEIGHT): row = [] for j in range(self.WIDTH): if [i, j] in self.shape: row.append(1) else: row.append(0) original.append(row) rotated = list(zip(*original[::-1])) new_shape = [] for x, row in enumerate(rotated): for y, value in enumerate(row): if value == 1: new_shape.append([x, y]) return new_shape
997,985
4978e75295e4f0f545b6565ca73863ef80d259fe
#!/usr/bin/env python import re import sys import time import requests import logging import hookio.keys from six.moves.html_parser import HTMLParser from six.moves.html_entities import name2codepoint from six import unichr log = logging.getLogger(__name__) max_retries = 3 class RolesParser(HTMLParser): roles = newroles = states = savedata = None def handle_starttag(self, tag, attrs): if tag.lower() != 'div': return if attrs and any(n.lower() == 'class' and 'availableRoles' in v.split() for n, v in attrs): log.debug('Start processing roles') self.newroles = [] self.states = ['top'] return if self.newroles is not None: log.debug('Pushing div for role %d', len(self.newroles)) self.states.append('role') self.save_bgn() def handle_endtag(self, tag): if tag.lower() != 'div': return if self.states is None: return tp = self.states.pop() assert tp in ('role', 'top') if tp == 'role': role = self.save_end() log.debug('Found role %r', role) self.newroles.append(role) return if tp == 'top': assert not self.states self.roles = self.newroles log.debug('Processed roles: %r', self.roles) self.newroles = None self.states = None def handle_data(self, data): if self.savedata is None: return self.savedata = self.savedata + data def handle_entityref(self, name): if self.savedata is None: return c = unichr(name2codepoint[name]) log.debug("Named ent: &%s; = %r", name, c) self.handle_data(c) def handle_charref(self, name): if self.savedata is None: return if name[:1].lower() in ('x', 'u'): c = unichr(int(name[1:], 16)) else: c = unichr(int(name)) log.debug("Num ent: &%s; = %r", name, c) self.handle_data(c) def save_bgn(self): """Begins saving character data in a buffer. Retrieve the stored data via the save_end() method. Use of the save_bgn() / save_end() pair may not be nested. """ self.savedata = '' def save_end(self): """Ends buffering character data and returns all data saved since the preceding call to the save_bgn() method. """ data = self.savedata self.savedata = None return data def test_roles(cache): roles = cache.get('hook.io/roles', None) if roles is not None: t, roles = roles if time.time() - t > 86400: roles = None if roles is None: for i in range(max_retries): try: roles = request_roles() except Exception: if i == max_retries-1: raise continue cache.set('hook.io/roles', [time.time(), roles]) break assert roles == sorted(hookio.keys.roles) def request_roles(): r = requests.get('https://hook.io/roles') r.raise_for_status() text = r.text if False: p = RolesParser() p.feed(text) p.close() roles = sorted(p.roles) else: roles = sorted(set(re.findall('>\\s*(\\w+(?:::\\w+)+)\\s*<', text))) assert roles return roles if __name__=='__main__': roles = request_roles() print('\n'.join(roles)) sys.stderr.write('%s\n' % (hookio.keys.roles == roles,))
997,986
1eabe6a9b2439b90e81235744a5f50faf8d51be0
import functools import logging import os import pandas as pd import time from dotenv import load_dotenv from luigi import Target from pathlib import Path from pymongo import MongoClient, ASCENDING, DESCENDING from utils.constants import ENV_PATH, TRENDS_DIR load_dotenv(dotenv_path=ENV_PATH) MONGO_SERVER = os.environ['MONGO_SERVER'] MONGO_PORT = int(os.environ['MONGO_PORT']) MONGO_DATABASE = os.environ['MONGO_DATABASE'] # Mongo requires a server port of type int. # quick utility functions def connect_db(server=MONGO_SERVER, port=MONGO_PORT): client = MongoClient(server, port) return client def get_database(client, db=MONGO_DATABASE): return client[db] def get_collection(client, col, db=MONGO_DATABASE): return client[db][col] def post_document(data, col): assert isinstance(data, dict) result = col.insert_one(data) return result def retrieve_all_data(col, limit=3500): data = [x for x in col.find().sort('datestamp', DESCENDING).limit(limit)] return data def find_by_id(col, idx): return col.find_one({'_id': idx}) def find_by_luigi_at(col, dt): return col.find({'scope.luigi_at': dt}) def find_by_luigi_loc(col, loc): return col.find({'scope.luigi_loc': loc})
997,987
0af39d5277243cb274a959f2ccd3fec7ae374600
from nose.tools import assert_equal from pbfalcon import gen_config import pprint def test_get_falcon_overrides(): text = 'three=four; one = two;' overrides = gen_config.get_falcon_overrides(text, 'foo') got = pprint.pformat(overrides) expected = "{'one': 'two', 'three': 'four'}" assert_equal(expected, got) # It should work even if the text is not semicolon delimited, # just in case. text = '\n[General]\nthree=four\none = two\n' overrides = gen_config.get_falcon_overrides(text, 'foo') got = pprint.pformat(overrides) expected = "{'one': 'two', 'three': 'four'}" assert_equal(expected, got)
997,988
39b5a9b3786d9e263dccb10622850ad6165b398f
import os import argparse import utils.drive_utils as drive_utils def main(params) -> None: service = drive_utils.build_service("ro") if params.init: return if params.all: drive_utils.download_all(service, params.out_dir, verbose=not params.silent) return print(str(params.method)) drive_utils.download_checkpoint(service, str(params.dataset), params.noise_std, str(params.method), params.out_dir, verbose=not params.silent) if __name__ == '__main__': parent_parser = argparse.ArgumentParser(add_help=False) parent_parser = drive_utils.add_download_args(parent=parent_parser) args = parent_parser.parse_args() if args.method == drive_utils.PossibleMethods.lag and args.dataset != drive_utils.PossibleDatasets.ffhq: parent_parser.error("the LAG method is supported for the FFHQ dataset only.\nAborting") if args.init and (os.path.exists('token.json') or os.path.exists('token.pickle')): parent_parser.error("token.{pickle, json} detected. No need for additional init.\nAborting") main(args)
997,989
bce41a3d9031305c227db03b0a6be07943b9fa3e
#!/usr/bin/python import os print ("Hello Fuck") os.system('ipconfig')
997,990
5732c007daae78bb0b6e3103345ccd3c60331372
from flask import Flask, render_template, json, request, redirect from flaskext.mysql import MySQL from werkzeug import generate_password_hash, check_password_hash from flask import session app = Flask(__name__) mysql = MySQL() #MySql configurations app.config['MYSQL_DATABASE_USER']='root' app.config['MYSQL_DATABASE_PASSWORD']='fafhrd123' app.config['MYSQL_DATABASE_DB']='Iedapp1' app.config['MYSQL_DATABASE_HOST']='localhost' mysql.init_app(app) @app.route("/") def main(): return render_template('index.html') @app.route('/showSignUp') def showSignup(): return render_template('signup.html') @app.route('/signUp', methods = ['POST']) def signUp(): # read the posted values from the UI try: __userid = request.form['inputUserid'] __name = request.form['inputName'] __email = request.form['inputEmail'] __password = request.form['inputPassword'] if __name and __email and __password: conn = mysql.connect() cursor = conn.cursor() _hashed_password = generate_password_hash(__password) #print(_hashed_password) #cursor.callproc('sp_createUser',(__name,__email,_hashed_password)) cursor.callproc('sp_createUser',(__userid,__name,__email,__password)) data = cursor.fetchall() if len(data) is 0: conn.commit() return json.dumps({'message':'User created successfully !'}) else: return json.dumps({'error':str(data[0])}) else: return json.dumps({'html':'<span>Enter the required fields</span>'}) except Exception as e: return json.dumps({'error':str(e)}) finally: cursor.close() conn.close() @app.route('/validateLogin',methods=['POST']) def validateLogin(): try: _username = request.form['inputEmail'] _password = request.form['inputPassword'] # connect to mysql con = mysql.connect() cursor = con.cursor() cursor.callproc('sp_validateLogin',(_username,)) data = cursor.fetchall() if len(data) > 0: if (str(data[0][3])==_password): session['user'] = data[0][0] return redirect('/userHome') else: return render_template('error.html',error = 'Wrong Email address or Password.') else: return render_template('error.html',error = 'Wrong Email address or Password.') except Exception as e: print(str(e)) return render_template('error.html',error = str(e)) finally: cursor.close() con.close() @app.route('/showSignin') def showSignin(): return render_template('signin.html') @app.route('/userHome') def userHome(): if session.get('user'): return render_template('userHome.html') else: return render_template('error.html',error = 'Unauthorized Access') @app.route('/logout') def logout(): session.pop('user',None) return redirect('/') @app.route('/getWish') def getWish(): try: if session.get('user'): _user = session.get('user') print("HOOOOLAAAAAAAAAAAA") con = mysql.connect() cursor = con.cursor() cursor.callproc('sp_GetWishByUser',(_user,)) wishes = cursor.fetchall() print(wishes) wishes_dict = [] for wish in wishes: wish_dict = { 'Id': wish[0], 'nam': wish[1], 'usernam': wish[2], 'passwor': wish[3], 'money':wish[4], 'reward':wish[5]} wishes_dict.append(wish_dict) print(json.dumps(wishes_dict)) return json.dumps(wishes_dict) else: return render_template('error.html', error = 'Unauthorized Access') except Exception as e: return render_template('error.html', error = str(e)) @app.route('/Showadd') def showaddup(): return render_template('sysadd.html') @app.route('/add', methods = ['POST']) def addUp(): # read the posted values from the UI print("HOOOOLAAAAAAAAAAAA") try: __userid = request.form['inputUserid'] __password = request.form['inputPassword'] __monsub = request.form['submoney'] __reward = request.form['addpoints'] if __userid and __password: conn = mysql.connect() cursor = conn.cursor() _hashed_password = generate_password_hash(__password) #print(_hashed_password) #cursor.callproc('sp_createUser',(__name,__email,_hashed_password)) cursor.callproc('sp_add',(__monsub,__reward,__userid)) data = cursor.fetchall() if len(data) is 0: conn.commit() return json.dumps({'message':'Transaction Succesfull!'}) else: return json.dumps({'error':str(data[0])}) else: return json.dumps({'html':'<span>Enter the required fields</span>'}) except Exception as e: return json.dumps({'error':str(e)}) finally: cursor.close() conn.close() @app.route('/add2', methods = ['POST']) def addUp2(): # read the posted values from the UI print("GGGGGGGGGGGGGGGGGGGGGAAAAAAAAAAAA") try: _username = request.form['inputEmail'] __monsub = request.form['submoney'] print(__monsub) if _username: _user = session.get('user') print("Hello") conn = mysql.connect() cursor = conn.cursor() #_hashed_password = generate_password_hash(__password) #print(_hashed_password) #cursor.callproc('sp_createUser',(__name,__email,_hashed_password)) cursor.callproc('sp_addtoanother',(_user,__monsub,_username)) data = cursor.fetchall() if len(data) is 0: conn.commit() return json.dumps({'message':'Transfer Succesfull!'}) else: return json.dumps({'error':str(data[0])}) else: return json.dumps({'html':'<span>Enter the required fields</span>'}) except Exception as e: return json.dumps({'error':str(e)}) finally: cursor.close() conn.close() if __name__ == '__main__': app.secret_key = 'why would I tell you my secret key?' app.run(host='0.0.0.0', threaded=True, debug=True, port=5000)
997,991
bb5c574e9480773b787bbbd7a75416fa6cc1ba24
import numpy as np np.random.seed(2020) from multiprocessing import Pool from tqdm import tqdm import time from controller.Controller import * from settings import * from controller.ES_trainer import ES_abstract from scipy import stats class NES_trainer(ES_abstract): def __init__(self, loss_function, pop_size, learn_rate, args, theta_init=None): """ Natural Evolution Strategy algorithm :param loss_function (function) rollout of the Neurosmash environment, function to be optimized :param pop_size (float) population size :param p_theta (function) probability density function of theta :param learn_rate (float) learning rate :param args """ super().__init__(loss_function, pop_size, args) if theta_init is None: self.weights = np.random.normal(0, 1, self.dim) # weights = mu self.cov_matrix = np.eye(self.dim) sigma_values = np.triu(self.cov_matrix)[np.triu_indices(self.dim)] self.theta = np.append(self.weights, sigma_values) else: print(theta_init) self.theta = theta_init self.weights = self.get_mu(theta_init) self.cov_matrix = self.get_Sigma(theta_init) self.grad = self.grad_log_mvn_pdf self.learn_rate = learn_rate self.p_theta = lambda theta: stats.multivariate_normal(mean=self.get_mu(theta).flatten(), cov=self.get_Sigma(theta)@self.get_Sigma(theta).T) def train(self, n_iter, parallel=False, verbose=True): ''' Natural Evolution Strategy algorithm :param n_iter (int) number of iterations :param parallel (bool) If true, run the Neurosmash environment in parallel :return trained controller (Controller) trained controller object with trained weights :return fitness (matrix) fitness score for each member for each iteration ''' pop_size, learn_rate = self.pop_size, self.learn_rate p_theta, theta = self.p_theta, self.theta grad = self.grad reward = np.zeros((n_iter,4)) # score of i) mean weight ii) best performer iii) worst performer iv) sampled population average print('using NES trainer for controller') tic = time.perf_counter() for i in tqdm(range(n_iter)): # Reset gradient and Fisher matrix grad_J = np.zeros((self.dim+np.sum(np.arange(self.dim+1)), 1)) F = np.zeros((self.dim+np.sum(np.arange(self.dim+1)), self.dim+np.sum(np.arange(self.dim+1)))) # Ensure covariance matrix is positive-semidefinite # while not self.is_pos_def(self.get_Sigma(theta)): # Sigma = self.get_Sigma(theta) # Sigma += np.eye(self.dim) * 0.1 # theta = self.get_theta_from_cov(Sigma, theta) # print(f'{i} Matrix not positive semi-definite') # Plan B: Sample from A, where A=Sigma @ Sigma.T, therefore # Specify current pi( | theta) and current gradient cur_p_theta = p_theta(theta) cur_grad = grad(theta) # Gradient descent fitness = np.zeros(pop_size) for j in tqdm(range(pop_size)): x = np.reshape(cur_p_theta.rvs(), (self.dim, 1)) controller = Controller(self.args) controller.set_weight_array(x) fitness[j] = self.loss_func(controller, r_rounds=2) log_der = np.reshape(cur_grad(x), (len(theta), 1)) grad_J += fitness[j] * log_der / pop_size F += log_der @ log_der.T / pop_size theta += learn_rate * (np.linalg.inv(F) @ grad_J).flatten() reward[i] = self.get_reward_stats(theta[:self.dim], fitness) print(f'Mean reward: {reward[i,0]}') print(f'Best reward: {reward[i,1]}') print(f'Worst reward: {reward[i,2]}') print(f'Sampled population reward: {reward[i,3]}') # Save parameters np.save(self.args.path_to_ctrl_params+f"NES{i}", theta) toc = time.perf_counter() print(f'Duration of training the controller: {toc - tic:0.4f} seconds') self.theta = theta self.weights = self.get_mu(theta) self.cov_matrix = self.get_Sigma(theta) trained_controller = Controller(self.args) trained_controller.set_weight_array(self.weights) return trained_controller, reward def grad_log_mvn_pdf(self, theta): ''' theta is of the form: [mu1, mu2, sigma1 ^ 2, rho * sigma1 * sigma2, sigma2 ^ 2] ''' Sigma_inv = np.linalg.inv(self.get_Sigma(theta)) mu = self.get_mu(theta) mu_grad = lambda x: Sigma_inv @ (x - mu) Sigma_grad = lambda x: 0.5 * (Sigma_inv @ (x - mu) @ (x - mu).T @ Sigma_inv - Sigma_inv) idx_matrix = np.arange(1, (self.dim * self.dim) + 1).reshape((self.dim, self.dim)) idx = np.triu(idx_matrix).flatten() idx = idx[idx > 0] - 1 return lambda x: np.concatenate([mu_grad(x).flatten(), Sigma_grad(x).flatten()[idx]]) def get_mu(self, theta): return np.reshape(theta[:self.dim], (self.dim, 1)) def get_Sigma(self, theta): Sigma_values = theta[self.dim:] Sigma = np.zeros((self.dim,self.dim)) ind_u = np.triu_indices(self.dim) Sigma[ind_u] = Sigma_values Sigma = Sigma + Sigma.transpose() - np.diag(np.diag(Sigma)) return Sigma def get_theta_from_cov(self, Sigma, theta): """ Takes a full symetrical covariance matrix and returns it in array without symmetrical weights :param Sigma: covariance matrix :return: theta: array of all trainable parameters """ sigma_values = np.triu(Sigma) ind_u = np.triu_indices(self.dim) sigma_values= sigma_values[ind_u] return np.append(self.get_mu(theta), sigma_values) def is_pos_def(self, x): return np.all(np.linalg.eigvals(x) > 0)
997,992
b9ca62d26862f952dcf88d5b507485dad74434cc
import tensorflow as tf import pickle import numpy as np import datetime from Match_LSTM import MatchLSTM from Rnet import Rnet import json import os import DataUtils from nltk.tokenize import word_tokenize from tqdm import * from sklearn.metrics import accuracy_score import random tf.flags.DEFINE_string("mode", "pretrained", "pretrained/tranfer") # Training hyperparameter config tf.flags.DEFINE_integer("batch_size", 64, "batch size") tf.flags.DEFINE_integer("epochs", 160, "epochs") tf.flags.DEFINE_float("learning_rate", 1e-3, "learning rate") tf.flags.DEFINE_float("grad_clip", 5.0, "") # LSTM config tf.flags.DEFINE_integer("hidden_layer", 300, "") tf.flags.DEFINE_integer("pad", 610, "") tf.flags.DEFINE_float("dropout", 0.3, "") tf.flags.DEFINE_string("Ddim", "2", "") tf.flags.DEFINE_boolean("bidi", True, "") tf.flags.DEFINE_string("rnnact", "tanh", "") tf.flags.DEFINE_string("bidi_mode", "concatenate", "") tf.flags.DEFINE_boolean("use_cudnn", True, "") # word vector config tf.flags.DEFINE_string( "embedding_path", "glove.6B.300d.txt", "word embedding path") # Tensorflow config tf.flags.DEFINE_integer("num_checkpoints", 5, "Number of checkpoints to store (default: 5)") tf.flags.DEFINE_string("out_dir", "runs/", "path to save checkpoint") tf.flags.DEFINE_boolean("allow_soft_placement", True, "Allow device soft device placement") tf.flags.DEFINE_boolean("log_device_placement", False, "Log placement of ops on devices") FLAGS = tf.flags.FLAGS def convert_idx(text, tokens): current = 0 spans = [] for token in tokens: if token == "``" or token=="''": token = '"' current = text.find(token, current) if current < 0: print("Token {} cannot be found".format(token)) raise Exception() spans.append((current, current + len(token))) current += len(token) return spans def load_data_from_file(dsfile): q, q_l = [], [] # a set of questions sents, s_l = [], [] # a set of sentences labels = [] # a set of labels with open(dsfile) as f: for l in f: label = l.strip().split("\t")[2] qtext = l.strip().split("\t")[0] stext = l.strip().split("\t")[1] q_tok = word_tokenize(qtext.lower()) s_tok = word_tokenize(stext.lower()) q.append(q_tok) q_l.append(min(len(q_tok), FLAGS.pad)) sents.append(s_tok) s_l.append(min(len(s_tok), FLAGS.pad)) labels.append(int(label)) return q, sents def make_model_inputs(qi, si, q, sents, y): inp = {'qi': qi, 'si': si, 'q':q, 'sents':sents, 'y':y} return inp def load_set(fname, vocab=None, iseval=False): examples = load_data_SQUAD(fname) if not iseval: if vocab == None: q, sents = load_data_from_file("SemEval/train.txt") vocab = DataUtils.Vocabulary(q + sents) update = [] for e in examples: update += [e["context_tokens"], e["ques_tokens"]] vocab.update(update) else: update = [] for e in examples: update += [e["context_tokens"], e["ques_tokens"]] vocab.update(update) pad = FLAGS.pad qis, sis, q, sents, y = [], [], [], [], [] for e in examples: qi = e["ques_tokens"] si = e["context_tokens"] qis.append(qi) sis.append(si) q.append(e["ques_tokens"]) sents.append(e["context_tokens"]) y.append(e["y"]) qis = vocab.vectorize(qis, 50) sis = vocab.vectorize(sis, pad) inp = make_model_inputs(qis, sis, q, sents, y) if iseval: return (inp, y) else: return (inp, y, vocab) def load_data_SQUAD(filename): examples = [] total = 0 with open(filename, "r") as fh: source = json.load(fh) for article in tqdm(source["data"]): for para in article["paragraphs"]: context = para["context"].replace( "''", "' ").replace("``", "' ").lower() context_tokens = word_tokenize(context) spans = convert_idx(context, context_tokens) for qa in para["qas"]: total += 1 ques = qa["question"].replace( "''", '" ').replace("``", '" ').lower() ques_tokens = word_tokenize(ques) ques_chars = [list(token) for token in ques_tokens] answer = qa["answers"][0] answer_text = answer["text"] answer_start = answer['answer_start'] answer_end = answer_start + len(answer_text) answer_span = [] for idx, span in enumerate(spans): if not (answer_end <= span[0] or answer_start >= span[1]): answer_span.append(idx) y1, y2 = answer_span[0], answer_span[-1] y = [y1,y2] example = {"context_tokens": context_tokens, "ques_tokens": ques_tokens, "y":y,} if y2 >= 610: print(context) print(y2) print(len(context)) examples.append(example) random.shuffle(examples) print("{} questions in total".format(len(examples))) return examples def read_data(trainf, valf): global vocab, inp_tr, inp_val, inp_test, y_train, y_val, y_test inp_tr, y_train, vocab = load_set(trainf, iseval=False) inp_val, y_val = load_set(valf, vocab=vocab, iseval=True) def train_step(sess, model, data_batch): q_batch, s_batch, y_batch = data_batch feed_dict = { model.queries : q_batch, #model.queries_length : ql_batch, model.hypothesis : s_batch, #model.hypothesis_length : sl_batch, model.dropout : FLAGS.dropout, model.y_SQUAD : y_batch } _, loss = sess.run([model.train_op_SQUAD, model.loss_SQUAD], feed_dict=feed_dict) return loss def train_step(sess, model, data_batch): q_batch, s_batch, y_batch = data_batch feed_dict = { model.queries : q_batch, #model.queries_length : ql_batch, model.hypothesis : s_batch, #model.hypothesis_length : sl_batch, model.dropout : FLAGS.dropout, model.y_SQUAD : y_batch } _, loss = sess.run([model.train_op_SQUAD, model.loss_SQUAD], feed_dict=feed_dict) return loss def test_step(sess, model, test_data): q_test, s_test, y_test = test_data final_pred = [] final_loss = [] for i in range(0, len(y_test), FLAGS.batch_size): feed_dict = { model.queries : q_test[i:i+FLAGS.batch_size], #model.queries_length : ql_test[i:i+FLAGS.batch_size], model.hypothesis : s_test[i:i+FLAGS.batch_size], #model.hypothesis_length : sl_test[i:i+FLAGS.batch_size], model.y_SQUAD : y_test[i:i+FLAGS.batch_size], model.dropout : 1.0 } loss = sess.run([model.loss_SQUAD], feed_dict=feed_dict) final_loss.append(loss) print("loss in valid set :{}".format(np.mean(final_loss))) return np.mean(final_loss) if __name__ == "__main__": trainf = os.path.join('SQUAD/train-v1.1.json') valf = os.path.join('SQUAD/dev-v1.1.json') best_map = 100 best_epoch = 0 print("Load data") read_data(trainf, valf) pickle.dump(vocab, open("vocab.pkl","wb")) print("Load Glove") emb = DataUtils.GloVe(FLAGS.embedding_path) session_conf = tf.ConfigProto( allow_soft_placement=FLAGS.allow_soft_placement, log_device_placement=FLAGS.log_device_placement) sess = tf.Session(config=session_conf) model = MatchLSTM(FLAGS, vocab, emb) checkpoint_dir = os.path.abspath(os.path.join(FLAGS.out_dir, "checkpoints")) if not os.path.exists(checkpoint_dir): os.makedirs(checkpoint_dir) saver = tf.train.Saver(tf.global_variables(), max_to_keep=FLAGS.num_checkpoints) test_data = [ inp_val['qi'], inp_val['si'], y_val ] sess.run(tf.global_variables_initializer()) for e in range(FLAGS.epochs): t = tqdm(range(0, len(y_train), FLAGS.batch_size), desc='train loss: %.6f' %0.0, ncols=90) for i in t: data_batch = [ inp_tr['qi'][i:i+FLAGS.batch_size], inp_tr['si'][i:i+FLAGS.batch_size], y_train[i:i+FLAGS.batch_size] ] loss = train_step(sess, model, data_batch) t.set_description("epoch %d: train loss %.6f" % (e, loss)) t.refresh() curr_map = test_step(sess, model, test_data) print("best loss in dev: %.6f" %best_map) if curr_map < best_map: best_map = curr_map best_epoch = e save_path = saver.save(sess, os.path.join(checkpoint_dir, "checkpoint"), e) print("saved in %s" %save_path)
997,993
afb3d765608ea9cc654f6f0bfd516c01c0a4c2c5
#json模拟数据库 #在文本文件中保存json字符,通过文件读写来操作数据 import json #创建文本文件(数据库文件) # with open(r"user.txt","w") as f: # users='[{"uname":"zhangsan","upwd":"123"},{"uname":"lisi","upwd":"123"},{"uname":"wangwu","upwd":"123"}]' # f.write(users) #读数据(查询) def readData(): with open(r"user.txt","r") as f: jsonData=f.read() usersList=json.loads(jsonData) return usersList #写数据(修改) def writeData(usersList): jsonData=json.dumps(usersList,ensure_ascii=False) with open(r"user.txt","w") as f: f.write(jsonData) print("----数据写入成功!") #登录 def login(): name=input("请输入用户名:") password=input("请输入密码:") usersList=readData() #读取所有用户列表 msg="失败" for user in usersList: if name==user["uname"] and password==user["upwd"]: msg="成功" print("----恭喜登陆成功!") if msg=="失败": print("----登录失败!") return msg #注册(在数据库中增加用户) def reg(): name=input("请输入新用户名:") password=input("请输入密码:") newuser={"uname":name,"upwd":password} #新用户 usersList=readData() usersList.append(newuser) #将新用户添加到用户列表 writeData(usersList) print("-----新用户添加成功!") #------------------------- if __name__ == '__main__': login()
997,994
a01cbbbb7c1c0df31fb7abfe04731fa0debbc234
from math import sqrt, atan import numpy as np import matplotlib.pyplot as plt def mans_atan (x): count = 0 a = 1. sum = a while count < 500: count+=1 k = 1.*((2*count-1)**2)/(2*count*(2*count+1))*(x**2)/(1+(x**2)) a = a * k sum = sum + a z = (x/(np.sqrt(1+(x**2)))) y = z * sum return y a = -3. b = 3. x = np.arange(a,b,0.01) y = mans_atan(x) plt.plot(x,y) plt.grid() plt.show() delta_x = 1.e-3 # =0,001 funa = mans_atan (a) funb = mans_atan (b) if funa * funb > 0: print "[%.2f,%.2f] intervala saknu nav"%(a,b) print "vai saja intervala ir paru saknu skaits" exit() print "turpinajums, kad sakne ir:" print "vertibas intervala galapunktos - ", print "f(%.2f)=%.2f un f(%.2f)=%.2f"%(a,funa,b,funb) k=0 while b-a > delta_x: k = k + 1 x = (a+b)/2 funx = mans_atan(x) print "%3d. a=%.5f f(%.5f)=%8.5f b=%.5f"%(k,a,x,funx,b) if funa * funx > 0: a = x else: b = x print "rezultats: " print "a=%.9f f(%.9f)=%8.9f b=%.9f"%(a,x,funx,b) print "apreikins veikts ar %d iteraciju"%(k)
997,995
20711aee91f0832fdd080b9faa4f9c41f616fc52
''' Write a program that prints the numbers from 1 to 100. But for multiples of three print “Fizz” instead of the number and for the multiples of five print “Buzz” and for the multiples of both 5 and 3 print 'FizzBuzz' ''' # My Solution: for i in range(1,101): if i % 5 == 0 and i % 3 == 0: print('Fizzbuzz') elif i % 5 == 0: print('buzz') elif i % 3 == 0: print('Fizz') else: print(i)
997,996
7739a3cb19d1cf3fb597b7d763e3905c04ee5d10
import numpy as np from sklearn import datasets import matplotlib.pyplot as plt from sklearn.model_selection import train_test_split from 机器学习.逻辑回归.LogisticRegression import LogisticRegression iris = datasets.load_iris() x = iris.data y = iris.target x = x[y < 2, :2] y = y[y < 2] x_train, x_test, y_train, y_test = train_test_split(x, y, test_size=0.2, random_state=666) log_reg = LogisticRegression() log_reg.fit(x_train, y_train) score = log_reg.score(x_test, y_test) def x2(x1): return (-log_reg.coef_[0] * x1 - log_reg.interception_) / log_reg.coef_[1] x1_plot = np.linspace(4, 8, 1000) x2_plot = x2(x1_plot) plt.scatter(x[y == 0, 0], x[y == 0, 1], color='r') plt.scatter(x[y == 1, 0], x[y == 1, 1], color='b') plt.plot(x1_plot, x2_plot) plt.show() plt.scatter(x_test[y_test == 0, 0], x_test[y_test == 0, 1], color='r') plt.scatter(x_test[y_test == 1, 0], x_test[y_test == 1, 1], color='b') plt.plot(x1_plot, x2_plot) plt.show() # KNN的决策边界 from sklearn.neighbors import KNeighborsClassifier knn_clf = KNeighborsClassifier() knn_clf.fit(x_train, y_train)
997,997
f02553385cce3676ff5c63051a76f91acb6ab05f
from collections import Counter from typing import List class Solution: def isNStraightHand(self, hand: List[int], groupSize: int) -> bool: hand.sort() s = Counter(hand) for v in hand: if s[v] > 0: ck = 0 while ck < groupSize and s[v + ck] > 0: s[v + ck] -= 1 ck += 1 if ck < groupSize: return False return True
997,998
ca7c59c44c1e44fb614eb60d6a7ac243430ab7b8
# -*- coding: utf-8 -*- import datetime from south.db import db from south.v2 import SchemaMigration from django.db import models class Migration(SchemaMigration): def forwards(self, orm): # Deleting model 'Object' db.delete_table('core_object') # Adding model 'Miracle' db.create_table('core_miracle', ( ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('name', self.gf('django.db.models.fields.CharField')(max_length=250)), ('description', self.gf('django.db.models.fields.TextField')()), ('coord_x', self.gf('django.db.models.fields.CharField')(max_length=250)), ('coord_y', self.gf('django.db.models.fields.CharField')(max_length=250)), ('instag_tags', self.gf('django.db.models.fields.CharField')(max_length=250)), ('google_tags', self.gf('django.db.models.fields.CharField')(max_length=250)), ('slug', self.gf('django.db.models.fields.SlugField')(max_length=250)), )) db.send_create_signal('core', ['Miracle']) # Deleting field 'Image.object' db.delete_column('core_image', 'object_id') # Adding field 'Image.miracle' db.add_column('core_image', 'miracle', self.gf('django.db.models.fields.related.ForeignKey')(default=1, to=orm['core.Miracle']), keep_default=False) def backwards(self, orm): # Adding model 'Object' db.create_table('core_object', ( ('slug', self.gf('django.db.models.fields.SlugField')(max_length=250)), ('coord_y', self.gf('django.db.models.fields.CharField')(max_length=250)), ('coord_x', self.gf('django.db.models.fields.CharField')(max_length=250)), ('name', self.gf('django.db.models.fields.CharField')(max_length=250)), ('instag_tags', self.gf('django.db.models.fields.CharField')(max_length=250)), ('google_tags', self.gf('django.db.models.fields.CharField')(max_length=250)), ('id', self.gf('django.db.models.fields.AutoField')(primary_key=True)), ('description', self.gf('django.db.models.fields.TextField')()), )) db.send_create_signal('core', ['Object']) # Deleting model 'Miracle' db.delete_table('core_miracle') # Adding field 'Image.object' db.add_column('core_image', 'object', self.gf('django.db.models.fields.related.ForeignKey')(default=1, to=orm['core.Object']), keep_default=False) # Deleting field 'Image.miracle' db.delete_column('core_image', 'miracle_id') models = { 'core.image': { 'Meta': {'object_name': 'Image'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'miracle': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['core.Miracle']"}), 'rating': ('django.db.models.fields.IntegerField', [], {'default': '0'}), 'source': ('django.db.models.fields.CharField', [], {'unique': 'True', 'max_length': '250'}), 'type': ('django.db.models.fields.CharField', [], {'max_length': '20'}), 'url': ('django.db.models.fields.URLField', [], {'max_length': '250'}), 'year': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['core.Year']"}) }, 'core.miracle': { 'Meta': {'object_name': 'Miracle'}, 'coord_x': ('django.db.models.fields.CharField', [], {'max_length': '250'}), 'coord_y': ('django.db.models.fields.CharField', [], {'max_length': '250'}), 'description': ('django.db.models.fields.TextField', [], {}), 'google_tags': ('django.db.models.fields.CharField', [], {'max_length': '250'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'instag_tags': ('django.db.models.fields.CharField', [], {'max_length': '250'}), 'name': ('django.db.models.fields.CharField', [], {'max_length': '250'}), 'slug': ('django.db.models.fields.SlugField', [], {'max_length': '250'}) }, 'core.vote': { 'Meta': {'object_name': 'Vote'}, 'created': ('django.db.models.fields.DateTimeField', [], {'auto_now_add': 'True', 'blank': 'True'}), 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'image': ('django.db.models.fields.related.ForeignKey', [], {'to': "orm['core.Image']"}), 'user_ip': ('django.db.models.fields.CharField', [], {'max_length': '20'}), 'value': ('django.db.models.fields.DecimalField', [], {'default': '1', 'max_digits': '1', 'decimal_places': '0'}) }, 'core.year': { 'Meta': {'object_name': 'Year'}, 'id': ('django.db.models.fields.AutoField', [], {'primary_key': 'True'}), 'value': ('django.db.models.fields.IntegerField', [], {}) } } complete_apps = ['core']
997,999
83a9ff3168c7f5bb2c20122a9027dd3cb161dc34
#!/usr/bin/env python # -*- coding: utf-8 -*- from setuptools import setup, find_packages setup( name='selectel_cloud_api', version='1.2', packages=find_packages(), install_requires='selectel_cloud_api', url='https://github.com/RustoriaRu/SelectelCloudApi', license='MIT', author='vir-mir', keywords='selectel.ru selectel api, cloud', author_email='virmir49@gmail.com', description='api select cloud api', classifiers=[ 'Environment :: Web Environment', 'Intended Audience :: Developers', 'License :: OSI Approved :: MIT License', 'Programming Language :: Python :: 2.7', 'Programming Language :: Python :: 3.3', 'Programming Language :: Python :: 3.4', 'Topic :: Software Development :: Libraries :: Python Modules', ] )