diff --git "a/data/TableBench/corpus.json" "b/data/TableBench/corpus.json" new file mode 100644--- /dev/null +++ "b/data/TableBench/corpus.json" @@ -0,0 +1,91863 @@ +[ + { + "_id": "3a899e363ecc3c434605c0c4513b9408", + "header": [ + "season", + "tropical lows", + "tropical cyclones", + "severe tropical cyclones", + "strongest storm" + ], + "rows": [ + [ + "1990 - 91", + "10", + "10", + "7", + "marian" + ], + [ + "1991 - 92", + "11", + "10", + "9", + "jane - irna" + ], + [ + "1992 - 93", + "6", + "3", + "1", + "oliver" + ], + [ + "1993 - 94", + "12", + "11", + "7", + "theodore" + ], + [ + "1994 - 95", + "19", + "9", + "6", + "chloe" + ], + [ + "1995 - 96", + "19", + "14", + "9", + "olivia" + ], + [ + "1996 - 97", + "15", + "14", + "3", + "pancho" + ], + [ + "1997 - 98", + "10", + "9", + "3", + "tiffany" + ], + [ + "1998 - 99", + "21", + "14", + "9", + "gwenda" + ], + [ + "1999 - 00", + "13", + "12", + "5", + "john / paul" + ] + ], + "title": "", + "original_id": "29ba53ce7ca43a979263ed36798f62a3" + }, + { + "_id": "9e7f4648bfb107b55e191d8b5e73cc0e", + "header": [ + "rank", + "route", + "avg daily flts", + "of airlines", + "distance (km)", + "market share leader" + ], + "rows": [ + [ + "1", + "seoul ( gmp ) - jeju ( cju )", + "159", + "7", + "451", + "korean air" + ], + [ + "2", + "rio de janeiro ( sdu ) - são paulo ( cgh )", + "125", + "4", + "359", + "tam" + ], + [ + "3", + "mumbai ( bom ) - new delhi ( del )", + "123", + "8", + "1138", + "jet airways" + ], + [ + "4", + "tokyo ( hnd ) - sapporo ( cts )", + "119", + "4", + "822", + "all nippon airways" + ], + [ + "5", + "monte carlo ( mcm ) - nice ( nce )", + "117", + "2", + "18", + "heli air monaco" + ], + [ + "6t", + "madrid ( mad ) - barcelona ( bcn )", + "116", + "4", + "484", + "iberia" + ], + [ + "6t", + "melbourne ( mel ) - sydney ( syd )", + "116", + "8", + "705", + "qantas" + ], + [ + "8", + "kahului ( ogg ) - honolulu ( hnl )", + "98", + "4", + "163", + "hawaiian airlines" + ], + [ + "9t", + "johannesburg ( jnb ) - cape town ( cpt )", + "92", + "6", + "1270", + "south african airways" + ], + [ + "9t", + "fukuoka ( fuk ) - tokyo ( hnd )", + "92", + "3", + "881", + "japan airlines" + ] + ], + "title": "", + "original_id": "1aba704991b72a8107475d7fea800b42" + }, + { + "_id": "cd341c61d3c27c8b2430bb5f8db897dd", + "header": [ + "country", + "un budget", + "international trade (millions of usd) 2011", + "gdp (nominal) (millions of usd) 2011", + "gdp (ppp) (millions of usd) 2011", + "population" + ], + "rows": [ + [ + "italy", + "4.999%", + "1050100", + "2198730", + "1846950", + "60849247" + ], + [ + "canada", + "3.207%", + "910200", + "1736869", + "1396131", + "34953100" + ], + [ + "spain", + "3.177%", + "715200", + "1493513", + "1413468", + "46163116" + ], + [ + "mexico", + "2.356%", + "678200", + "1154784", + "1661640", + "112336538" + ], + [ + "south korea", + "2.260%", + "1084000", + "1116247", + "1554149", + "50004441" + ], + [ + "turkey", + "0.617%", + "373800", + "778089", + "1073565", + "74724269" + ], + [ + "argentina", + "0.287%", + "136300", + "447644", + "716419", + "40117096" + ], + [ + "indonesia", + "0.238%", + "335100", + "845680", + "1124649", + "237641326" + ], + [ + "colombia", + "0.144%", + "92760", + "327626", + "471890", + "46748000" + ], + [ + "pakistan", + "0.082%", + "58000", + "210566", + "488580", + "180991000" + ], + [ + "costa rica", + "0.034%", + "24460", + "40947", + "55020", + "4301712" + ], + [ + "malta", + "0.017%", + "9200", + "8896", + "10757", + "417617" + ], + [ + "san marino", + "0.003%", + "6201", + "2048", + "1136", + "32404" + ] + ], + "title": "", + "original_id": "39c3b24be6bcb3e279ecccea6b641efc" + }, + { + "_id": "0fd34a0fb2f14722cdcd704f35f9726f", + "header": [ + "Row Header", + "Position", + "Age", + "Air Group or Subsidiary Officer Since" + ], + "rows": [ + [ + "Bradley D. Tilden", + "Chairman and Chief Executive Officer of Alaska Air Group, Inc., Chairman of Alaska Airlines, Inc., Chairman of Horizon Air Industries, Inc.", + "58", + "1994" + ], + [ + "Brandon S. Pedersen", + "Executive Vice President/Finance and Chief Financial Officer of Alaska Air Group, Inc. and Alaska Airlines, Inc., and Treasurer of Alaska Air Group, Inc. and Alaska Airlines, Inc.", + "52", + "2003" + ], + [ + "Kyle B. Levine", + "Vice President Legal, General Counsel and Corporate Secretary of Alaska Air Group, Inc. and Alaska Airlines, Inc. and Chief Ethics and Compliance Officer of Alaska Air Group, Inc.", + "47", + "2016" + ], + [ + "Benito Minicucci", + "President and Chief Operating Officer of Alaska Airlines, Inc.", + "52", + "2004" + ], + [ + "Gary L. Beck", + "President and Chief Executive Officer of Horizon Air Industries, Inc.", + "71", + "2018" + ], + [ + "Andrew R. Harrison", + "Executive Vice President and Chief Commercial Officer of Alaska Airlines, Inc.", + "49", + "2008" + ], + [ + "Shane R. Tackett", + "Executive Vice President, Planning and Strategy of Alaska Airlines, Inc.", + "40", + "2011" + ], + [ + "Andrea L. Schneider", + "Vice President People of Alaska Airlines, Inc.", + "53", + "1998" + ], + [ + "Diana Birkett-Rakow", + "Vice President External Relations of Alaska Airlines, Inc.", + "41", + "2017" + ] + ], + "title": "", + "original_id": "e067a40ab6736ac5a004d9dc69f2d5c0" + }, + { + "_id": "5764357c431875dc08cb39fe9b3f1d03", + "header": [ + "Club", + "Season", + "League", + "League", + "League", + "National Cup", + "National Cup", + "League Cup", + "League Cup", + "Europe", + "Europe", + "Total", + "Total" + ], + "rows": [ + [ + "Club", + "Season", + "Division", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals" + ], + [ + "Liverpool", + "1990–91", + "First Division", + "2", + "0", + "1", + "0", + "0", + "0", + "0", + "0", + "3", + "0" + ], + [ + "Liverpool", + "1991–92", + "First Division", + "30", + "5", + "8", + "3", + "5", + "3", + "8", + "0", + "51", + "11" + ], + [ + "Liverpool", + "1992–93", + "Premier League", + "31", + "4", + "1", + "0", + "5", + "2", + "3", + "1", + "40", + "7" + ], + [ + "Liverpool", + "1993–94", + "Premier League", + "30", + "2", + "2", + "0", + "2", + "0", + "0", + "0", + "34", + "2" + ], + [ + "Liverpool", + "1994–95", + "Premier League", + "40", + "7", + "7", + "0", + "8", + "2", + "0", + "0", + "55", + "9" + ], + [ + "Liverpool", + "1995–96", + "Premier League", + "38", + "6", + "7", + "2", + "4", + "1", + "4", + "1", + "53", + "10" + ], + [ + "Liverpool", + "1996–97", + "Premier League", + "37", + "7", + "2", + "0", + "4", + "2", + "8", + "1", + "51", + "10" + ], + [ + "Liverpool", + "1997–98", + "Premier League", + "36", + "11", + "1", + "0", + "5", + "0", + "4", + "1", + "46", + "12" + ], + [ + "Liverpool", + "1998–99", + "Premier League", + "28", + "4", + "0", + "0", + "0", + "0", + "3", + "1", + "31", + "5" + ], + [ + "Liverpool", + "Liverpool Total", + "Liverpool Total", + "272", + "46", + "29", + "5", + "33", + "10", + "30", + "5", + "364", + "66" + ], + [ + "Real Madrid", + "1999–2000", + "La Liga", + "30", + "3", + "10", + "0", + "0", + "0", + "7", + "1", + "47", + "4" + ], + [ + "Real Madrid", + "2000–01", + "La Liga", + "26", + "2", + "6", + "0", + "0", + "0", + "10", + "0", + "42", + "2" + ], + [ + "Real Madrid", + "2001–02", + "La Liga", + "23", + "2", + "2", + "0", + "0", + "0", + "13", + "2", + "38", + "4" + ], + [ + "Real Madrid", + "2002–03", + "La Liga", + "15", + "1", + "4", + "1", + "0", + "0", + "6", + "2", + "25", + "4" + ], + [ + "Real Madrid", + "Real Madrid Total", + "Real Madrid Total", + "94", + "8", + "22", + "1", + "0", + "0", + "36", + "5", + "152", + "14" + ], + [ + "Manchester City", + "2003–04", + "Premier League", + "22", + "0", + "3", + "0", + "1", + "0", + "4", + "0", + "30", + "0" + ], + [ + "Manchester City", + "2004–05", + "Premier League", + "13", + "0", + "1", + "0", + "0", + "0", + "0", + "0", + "14", + "0" + ], + [ + "Manchester City", + "Manchester City Total", + "Manchester City Total", + "35", + "0", + "4", + "0", + "1", + "0", + "4", + "0", + "44", + "0" + ], + [ + "Career Total", + "Career Total", + "Career Total", + "401", + "54", + "52", + "6", + "37", + "10", + "70", + "10", + "560", + "80" + ] + ], + "title": "", + "original_id": "b71bb2ae2d5e19e17c816355f55ec3d8" + }, + { + "_id": "88df92949481d5ca24d8a8c77109978f", + "header": [ + "Unnamed: 0", + "1994 general", + "1995 regional", + "1996 general", + "1999 european", + "2000 regional", + "2001 general", + "2004 european", + "2005 regional", + "2006 general", + "2008 general", + "2009 european", + "2010 regional", + "2013 general" + ], + "rows": [ + [ + "piedmont", + "with fi", + "3.0", + "4.4", + "3.3", + "4.5", + "3.5", + "5.0", + "4.6", + "6.2", + "5.2", + "6.1", + "3.9", + "1.2" + ], + [ + "lombardy", + "with fi", + "2.2", + "4.6", + "3.5", + "4.1", + "3.4", + "3.6", + "3.8", + "5.9", + "4.3", + "5.0", + "3.8", + "1.1" + ], + [ + "veneto", + "with fi", + "3.6", + "5.4", + "5.4", + "6.8", + "5.0", + "5.0", + "6.4", + "7.8", + "5.6", + "6.4", + "4.9", + "1.7" + ], + [ + "emilia - romagna", + "with fi", + "4.8", + "4.8", + "2.7", + "3.7", + "3.4", + "2.8", + "3.9", + "5.8", + "4.3", + "4.7", + "3.8", + "1.1" + ], + [ + "tuscany", + "with fi", + "2.5", + "4.8", + "3.2", + "4.2", + "3.3", + "3.3", + "3.7", + "5.9", + "4.2", + "4.6", + "4.8", + "1.1" + ], + [ + "lazio", + "with fi", + "4.2", + "4.7", + "4.8", + "6.7", + "4.8", + "7.1", + "7.8", + "6.9", + "4.8", + "5.5", + "6.1", + "1.5" + ], + [ + "campania", + "with fi", + "9.7", + "8.0", + "6.8", + "8.5", + "7.5", + "7.0", + "6.7", + "6.8", + "6.5", + "8.7", + "9.4", + "3.6" + ], + [ + "apulia", + "with fi", + "5.6", + "7.6", + "6.0", + "6.2", + "6.8", + "8.1", + "7.8", + "7.8", + "7.9", + "9.1", + "6.5", + "2.0" + ], + [ + "calabria", + "with fi", + "9.0", + "9.0", + "9.4", + "13.3", + "9.5", + "9.6", + "10.4", + "7.7", + "8.2", + "9.3", + "9.4", + "4.1" + ], + [ + "sicily", + "with fi", + "19.0 (1996)", + "8.1", + "7.9", + "24.3 (2001)", + "14.4", + "14.0", + "18.7 (2006)", + "10.0", + "9.4", + "11.9", + "12.5 (2008)", + "2.8" + ] + ], + "title": "", + "original_id": "f19e3c32d88171eb59e66dc31967bf2d" + }, + { + "_id": "1df5376e585ac01f2f4b45ce50af5281", + "header": [ + "#", + "Mayor", + "Taking Office", + "Leaving" + ], + "rows": [ + [ + "1", + "Vivian Burrill", + "1901", + "1902" + ], + [ + "2", + "Arthur Dufresne", + "1902", + "1902" + ], + [ + "3", + "Beaudry Leman", + "1902", + "1908" + ], + [ + "1", + "Vivian Burrill", + "1908", + "1913" + ], + [ + "4", + "Joseph-Auguste Frigon", + "1913", + "1915" + ], + [ + "5", + "Edmond Thibaudeau", + "1915", + "1917" + ], + [ + "4", + "Joseph-Auguste Frigon", + "1917", + "1918" + ], + [ + "6", + "Napoléon Désaulniers", + "1918", + "1920" + ], + [ + "7", + "Joseph-Alexis Dufresne", + "1920", + "1928" + ], + [ + "6", + "Napoléon Désaulniers", + "1928", + "1930" + ], + [ + "8", + "Albert Gigaire", + "1930", + "1936" + ], + [ + "9", + "Lucien Bourassa", + "1936", + "1937" + ], + [ + "10", + "Alexandre Gélinas", + "1937", + "1938" + ], + [ + "11", + "J.A. Bilodeau", + "1938", + "1946" + ], + [ + "12", + "François Roy", + "1946", + "1954" + ], + [ + "13", + "Gaston Hardy", + "1954", + "1957" + ], + [ + "14", + "Armand Foucher", + "1957", + "1963" + ], + [ + "15", + "Gérard Dufresne", + "1963", + "1966" + ], + [ + "16", + "Maurice Bruneau", + "1966", + "1970" + ], + [ + "17", + "Dominique Grenier", + "1970", + "1986" + ], + [ + "18", + "Roland Désaulniers", + "1986", + "1994" + ], + [ + "19", + "Lise Landry", + "1994", + "2009" + ], + [ + "20", + "Michel Angers", + "2009", + "Current" + ] + ], + "title": "", + "original_id": "06cf0ed5987ea6984c584de1d8eda280" + }, + { + "_id": "53298410d7d3058ba8cf9077048cc8ba", + "header": [ + "Name", + "Position", + "Length\n[km]", + "Drainage basin area\n[km2]", + "Confluence\n[by Lahn-km]", + "Mouth elevation\n[m above MSL]" + ], + "rows": [ + [ + "Feudinge (Rüppersbach)", + "left", + "6.3", + "21.2", + "9.8", + "388" + ], + [ + "Ilse", + "right", + "8.4", + "11.8", + "10.5", + "382" + ], + [ + "Banfe", + "right", + "11.5", + "38.9", + "18.5", + "326" + ], + [ + "Laasphe", + "left", + "8.3", + "19.6", + "19.4", + "324" + ], + [ + "Perf", + "right", + "20.0", + "113.1", + "24.7", + "285" + ], + [ + "Dautphe", + "left", + "8.8", + "41.8", + "37.5", + "245" + ], + [ + "Wetschaft", + "left", + "29.0", + "196.2", + "56.3", + "192" + ], + [ + "Ohm", + "left", + "59.7", + "983.8", + "58.7", + "188" + ], + [ + "Allna", + "right", + "19.1", + "92.0", + "77.1", + "172" + ], + [ + "Zwester Ohm", + "left", + "20.0", + "69.5", + "84.0", + "165" + ], + [ + "Salzböde", + "right", + "27.6", + "137.8", + "87.4", + "164" + ], + [ + "Lumda", + "left", + "30.0", + "131.5", + "93.6", + "160" + ], + [ + "Wieseck", + "left", + "24.3", + "119.6", + "102.2", + "155" + ], + [ + "Bieber", + "right", + "13.6", + "34.7", + "105.1", + "151" + ], + [ + "Kleebach", + "left", + "26.9", + "164.6", + "106.2", + "150" + ], + [ + "Wetzbach", + "left", + "11.7", + "32.9", + "119.6", + "147" + ], + [ + "Dill", + "right", + "55.0", + "717.7", + "120.4", + "147" + ], + [ + "Solmsbach", + "left", + "24.6", + "112.5", + "128.1", + "141" + ], + [ + "Iserbach (Möttbach)", + "left", + "19.2", + "31.2", + "131.4", + "139" + ], + [ + "Ulmbach", + "right", + "22.9", + "60.9", + "138.2", + "135" + ], + [ + "Kallenbach", + "right", + "14.6", + "84.7", + "141.3", + "132" + ], + [ + "Weil", + "left", + "46.6", + "247.9", + "149.4", + "130" + ], + [ + "Kerkerbach", + "right", + "20.7", + "70.2", + "176.0", + "112" + ], + [ + "Emsbach", + "left", + "39.1", + "321.8", + "181.0", + "110" + ], + [ + "Elbbach", + "right", + "40.7", + "323.7", + null, + "109" + ], + [ + "Aar", + "left", + "49.7", + "312.6", + null, + "103" + ], + [ + "Dörsbach", + "left", + "32.0", + "114.0", + null, + "94" + ], + [ + "Gelbach (Aubach)", + "right", + "39.7", + "221.2", + null, + "93" + ], + [ + "Mühlbach", + "left", + "32.1", + "171.9", + null, + "85" + ], + [ + "Emsbach", + "right", + "11.5", + "29.4", + null, + "75" + ] + ], + "title": "", + "original_id": "9a6f45b58f3230e8a11f4f7cd5afa465" + }, + { + "_id": "650821059ba289f10b7849e521df4010", + "header": [ + "election", + "leader", + "of seats won", + "of national votes", + "% of national vote", + "of prefectural votes", + "% of prefectural vote" + ], + "rows": [ + [ + "1956", + "ichirō hatoyama", + "61", + "11356874", + "39.7%", + "14353960", + "48.4%" + ], + [ + "1959", + "nobusuke kishi", + "71", + "12120598", + "41.2%", + "15667022", + "52.0%" + ], + [ + "1962", + "hayato ikeda", + "69", + "16581637", + "46.4%", + "17112986", + "47.1%" + ], + [ + "1965", + "eisaku satō", + "71", + "17583490", + "47.2%", + "16651284", + "44.2%" + ], + [ + "1968", + "eisaku satō", + "69", + "20120089", + "46.7%", + "19405546", + "44.9%" + ], + [ + "1971", + "eisaku satō", + "62", + "17759395", + "44.5%", + "17727263", + "44.0%" + ], + [ + "1974", + "kakuei tanaka", + "62", + "23332773", + "44.3%", + "21132372", + "39.5%" + ], + [ + "1977", + "takeo fukuda", + "63", + "18160061", + "35.8%", + "20440157", + "39.5%" + ], + [ + "1980", + "masayoshi ōhira", + "69", + "23778190", + "43.3%", + "24533083", + "42.5%" + ], + [ + "1983", + "yasuhiro nakasone", + "68", + "16441437", + "35.3%", + "19975034", + "43.2%" + ], + [ + "1986", + "yasuhiro nakasone", + "72", + "22132573", + "38.58%", + "26111258", + "45.07%" + ], + [ + "1989", + "sōsuke uno", + "36", + "17466406", + "30.70%", + "15343455", + "27.32%" + ], + [ + "1992", + "kiichi miyazawa", + "68", + "20528293", + "45.23%", + "14961199", + "33.29%" + ], + [ + "1995", + "yōhei kōno", + "46", + "10557547", + "25.40%", + "11096972", + "27.29%" + ], + [ + "1998", + "keizō obuchi", + "44", + "17033851", + "30.45%", + "14128719", + "25.17%" + ], + [ + "2001", + "junichiro koizumi", + "64", + "22299825", + "41.04%", + "21114727", + "38.57%" + ], + [ + "2004", + "junichiro koizumi", + "49", + "16797686", + "30.03%", + "19687954", + "35.08%" + ], + [ + "2007", + "shinzō abe", + "37", + "16544696", + "28.1%", + "18606193", + "31.35%" + ], + [ + "2010", + "sadakazu tanigaki", + "51", + "14071671", + "24.07%", + "19496083", + "33.38%" + ], + [ + "2013", + "shinzō abe", + "65", + "18460404", + "34.7%", + "22681192", + "42.7%" + ] + ], + "title": "", + "original_id": "463ca07b585e49a35a8e1e657c4b9cf2" + }, + { + "_id": "b3b254dd52a414c4103c1c63cf19554f", + "header": [ + "season", + "series", + "team", + "races", + "wins", + "poles", + "flaps", + "podiums", + "points", + "position" + ], + "rows": [ + [ + "2008", + "formula bmw europe", + "räikkönen robertson racing", + "15", + "0", + "0", + "1", + "1", + "158", + "6th" + ], + [ + "2008", + "formula bmw pacific", + "motaworld racing", + "1", + "0", + "0", + "0", + "1", + "0", + "nc" + ], + [ + "2008", + "formula bmw world final", + "josef kaufmann racing", + "1", + "0", + "0", + "0", + "1", + "0", + "2nd" + ], + [ + "2009", + "formula bmw europe", + "mücke motorsport", + "16", + "4", + "5", + "4", + "6", + "233", + "4th" + ], + [ + "2010", + "gp3 series", + "mw arden", + "16", + "0", + "0", + "0", + "0", + "0", + "31st" + ], + [ + "2011", + "gp3 series", + "rsc mücke motorsport", + "16", + "0", + "0", + "1", + "2", + "19", + "11th" + ], + [ + "2011", + "adac gt masters", + "vulcan racing - mintgen motorsport", + "6", + "0", + "0", + "0", + "0", + "0", + "nc" + ] + ], + "title": "", + "original_id": "1feeafc0b774633c4b7070d7295d0b2a" + }, + { + "_id": "845482366ba4bac92ea34feeba688f0e", + "header": [ + "test", + "subject", + "mean score", + "standard deviation", + "number of students" + ], + "rows": [ + [ + "sat subject test in literature", + "literature", + "576", + "111", + "120004" + ], + [ + "sat subject test in united states history", + "us history", + "608", + "113", + "126681" + ], + [ + "sat subject test in world history", + "world history", + "607", + "118", + "19688" + ], + [ + "sat subject test in mathematics level 1", + "mathematics", + "610", + "100", + "82827" + ], + [ + "sat subject test in mathematics level 2", + "mathematics", + "654", + "107", + "176472" + ], + [ + "sat subject test in biology e / m", + "biology", + "e - 605 m - 635", + "110 108", + "86206 in total , 40076 (e) 46130 (m)" + ], + [ + "sat subject test in chemistry", + "chemistry", + "648", + "110", + "76077" + ], + [ + "sat subject test in physics", + "physics", + "656", + "105", + "49608" + ], + [ + "sat subject test in chinese with listening", + "chinese", + "758", + "67", + "7294" + ], + [ + "sat subject test in french", + "french", + "622", + "123", + "10391" + ], + [ + "sat subject test in french with listening", + "french", + "646", + "117", + "2370" + ], + [ + "sat subject test in german", + "german", + "622", + "135", + "777" + ], + [ + "sat subject test in german with listening", + "german", + "611", + "122", + "770" + ], + [ + "sat subject test in modern hebrew", + "modern hebrew", + "623", + "140", + "491" + ], + [ + "sat subject test in italian", + "italian", + "666", + "122", + "737" + ], + [ + "sat subject test in japanese with listening", + "japanese", + "684", + "113", + "1966" + ], + [ + "sat subject test in korean with listening", + "korean", + "767", + "57", + "4273" + ], + [ + "sat subject test in latin", + "latin", + "611", + "107", + "3010" + ], + [ + "sat subject test in spanish", + "spanish", + "647", + "117", + "37762" + ], + [ + "sat subject test in spanish with listening", + "spanish", + "663", + "107", + "6399" + ] + ], + "title": "", + "original_id": "d4089b01cb0b1550e4df597512eb8eea" + }, + { + "_id": "93fe4a560a112116321e93d709fca347", + "header": [ + "rank", + "name", + "city", + "region", + "height (m)", + "height (ft)", + "floors", + "estimated completion" + ], + "rows": [ + [ + "1", + "leadenhall building", + "london", + "greater london", + "225", + "737", + "48", + "2014" + ], + [ + "2", + "52 - 54 lime street", + "london", + "greater london", + "190", + "623", + "38", + "2017" + ], + [ + "3", + "100 bishopsgate", + "london", + "greater london", + "172", + "564", + "40", + "2015" + ], + [ + "4", + "1 blackfriars", + "london", + "greater london", + "163", + "535", + "52", + "2018" + ], + [ + "5", + "20 fenchurch street", + "london", + "greater london", + "160", + "525", + "36", + "2014" + ], + [ + "6", + "baltimore tower", + "london", + "greater london", + "150", + "495", + "45", + "2016" + ], + [ + "7", + "providence tower", + "london", + "greater london", + "136", + "446", + "44", + "2015" + ], + [ + "8", + "one the elephant", + "london", + "greater london", + "133", + "436", + "37", + "2016" + ], + [ + "9", + "25 churchill place", + "london", + "greater london", + "130", + "427", + "23", + "2014" + ], + [ + "10", + "lots road tower 1", + "london", + "greater london", + "122", + "400", + "37", + "2015" + ], + [ + "11", + "lexicon tower", + "london", + "greater london", + "115", + "377", + "35", + "2016" + ] + ], + "title": "", + "original_id": "b6ce5ae3244350599a7403a76a1f1c69" + }, + { + "_id": "f95435f1c13e957ec422fae63190de40", + "header": [ + "Unnamed: 0", + "airdate", + "episode", + "rating", + "share", + "rating / share (1849)", + "viewers (millions)", + "rank (timeslot)", + "rank (night)" + ], + "rows": [ + [ + "1", + "february 14 , 2010", + "nanna is kickin' your butt", + "5.1", + "8", + "2.8 / 7", + "9.07", + "1", + "1" + ], + [ + "2", + "february 21 , 2010", + "when the cow kicked me in the head", + "5.2", + "8", + "2.9 / 7", + "9.11", + "1", + "1" + ], + [ + "3", + "february 28 , 2010", + "run like scalded dogs!", + "5.8", + "9", + "3.2 / 8", + "10.24", + "2", + "4" + ], + [ + "4", + "march 7 , 2010", + "we are no longer in the bible belt", + "4.5", + "7", + "2.6 / 7", + "8.05", + "2", + "4" + ], + [ + "5", + "march 14 , 2010", + "i think we 're fighting the germans , right", + "5.8", + "10", + "3.0 / 9", + "10.1", + "1", + "3" + ], + [ + "6", + "march 21 , 2010", + "cathy drone", + "6.9", + "11", + "3.8 / 9", + "11.99", + "1", + "4" + ], + [ + "7", + "march 28 , 2010", + "anonymous", + "7.2", + "11", + "3.9 / 10", + "12.73", + "1", + "3" + ], + [ + "8", + "april 4 , 2010", + "you 're like jason bourne , right", + "5.2", + "9", + "2.7 / 8", + "9.14", + "1", + "3" + ], + [ + "9", + "april 11 , 2010", + "dumb did us in", + "6.9", + "11", + "3.4 / 10", + "11.88", + "1", + "3" + ], + [ + "10", + "april 25 , 2010", + "i feel like i'm in , like , sicily", + "6.3", + "10", + "3.2 / 9", + "10.69", + "1", + "3" + ], + [ + "11", + "may 2 , 2010", + "they don't even understand their own language", + "6.0", + "10", + "3.0 / 9", + "10.29", + "1", + "3" + ] + ], + "title": "", + "original_id": "8e11fccdc147a157e7d7e9471759e877" + }, + { + "_id": "4950fa7cbc0b68c3fce3c8be226e070c", + "header": [ + "inegi code", + "municipality", + "municipal seat", + "area (km 2 )", + "population (2005)", + "population density ( / km 2 )", + "human development index (2000)" + ], + "rows": [ + [ + "1", + "amealco de bonfil", + "amealco", + "682.1", + "56457", + "82.8", + "0.6803" + ], + [ + "2", + "pinal de amoles", + "pinal de amoles", + "705.37", + "25325", + "35.9", + "0.6659" + ], + [ + "3", + "arroyo seco", + "arroyo seco", + "731.17", + "12493", + "17.1", + "0.7029" + ], + [ + "4", + "cadereyta de montes", + "cadereyta", + "1131.0", + "57204", + "50.6", + "0.7074" + ], + [ + "5", + "colón", + "colón", + "807.15", + "51625", + "64.0", + "0.7036" + ], + [ + "6", + "corregidora", + "el pueblito", + "245.8", + "104218", + "424.0", + "0.8535" + ], + [ + "7", + "ezequiel montes", + "ezequiel montes", + "298.28", + "34729", + "116.4", + "0.7534" + ], + [ + "8", + "huimilpan", + "huimilpan", + "388.4", + "32728", + "84.3", + "0.6824" + ], + [ + "9", + "jalpan de serra", + "jalpan", + "1185.1", + "22025", + "18.6", + "0.7178" + ], + [ + "10", + "landa de matamoros", + "landa de matamoros", + "840.1", + "18905", + "22.5", + "0.6606" + ], + [ + "11", + "el marqués", + "la cañada", + "787.4", + "79743", + "101.3", + "0.7295" + ], + [ + "12", + "pedro escobedo", + "pedro escobedo", + "290.9", + "17007", + "58.5", + "0.7598" + ], + [ + "13", + "peñamiller", + "peñamiller", + "694.9", + "56553", + "81.4", + "0.7023" + ], + [ + "14", + "querétaro", + "santiago de querétaro", + "759.9", + "734139", + "966.1", + "0.856" + ], + [ + "15", + "san joaquín", + "san joaquín", + "499.0", + "7634", + "15.3", + "0.6593" + ], + [ + "16", + "san juan del río", + "san juan del río", + "799.9", + "208462", + "260.6", + "0.8035" + ], + [ + "17", + "tequisquiapan", + "tequisquiapan", + "343.6", + "54929", + "159.9", + "0.7827" + ] + ], + "title": "", + "original_id": "767d183aa02457793092c2e983eeb612" + }, + { + "_id": "1c3be4cbea489e57e8f1d8b0f8247b84", + "header": [ + "rank", + "peak", + "country", + "island", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "1", + "puncak jaya (carstensz pyramid)", + "indonesia", + "new guinea", + "4884", + "4884", + "0" + ], + [ + "2", + "mount arfak", + "indonesia", + "new guinea", + "2940", + "2761", + "179" + ], + [ + "3", + "puncak mandala", + "indonesia", + "new guinea", + "4760", + "2760", + "2000" + ], + [ + "4", + "mount kobowre", + "indonesia", + "new guinea", + "3750", + "2217", + "1533" + ], + [ + "5", + "mount gauttier", + "indonesia", + "new guinea", + "2230", + "2007", + "223" + ], + [ + "6", + "mount wondiwoi", + "indonesia", + "new guinea", + "2180", + "1985", + "195" + ], + [ + "7", + "bon irau", + "indonesia", + "new guinea", + "2500", + "1900", + "600" + ], + [ + "8", + "mount cycloop", + "indonesia", + "new guinea", + "2000", + "1876", + "124" + ], + [ + "9", + "undundi - wandandi", + "indonesia", + "new guinea", + "3640", + "1740", + "1900" + ], + [ + "10", + "mount kumawa", + "indonesia", + "new guinea", + "1680", + "1636", + "44" + ], + [ + "11", + "angemuk", + "indonesia", + "new guinea", + "3949", + "1565", + "2384" + ] + ], + "title": "", + "original_id": "2438086f1b3d0cb3f63d46f4c9eb8dbf" + }, + { + "_id": "d8c72aead83246984f406579eb7be4de", + "header": [ + "Color", + "Pin (Tip)", + "Pin (Ring)", + "Color.1" + ], + "rows": [ + [ + "White/Blue", + "26", + "1", + "Blue/White" + ], + [ + "White/Orange", + "27", + "2", + "Orange/White" + ], + [ + "White/Green", + "28", + "3", + "Green/White" + ], + [ + "White/Brown", + "29", + "4", + "Brown/White" + ], + [ + "White/Slate", + "30", + "5", + "Slate/White" + ], + [ + "Red/Blue", + "31", + "6", + "Blue/Red" + ], + [ + "Red/Orange", + "32", + "7", + "Orange/Red" + ], + [ + "Red/Green", + "33", + "8", + "Green/Red" + ], + [ + "Red/Brown", + "34", + "9", + "Brown/Red" + ], + [ + "Red/Slate", + "35", + "10", + "Slate/Red" + ], + [ + "Black/Blue", + "36", + "11", + "Blue/Black" + ], + [ + "Black/Orange", + "37", + "12", + "Orange/Black" + ], + [ + "Black/Green", + "38", + "13", + "Green/Black" + ], + [ + "Black/Brown", + "39", + "14", + "Brown/Black" + ], + [ + "Black/Slate", + "40", + "15", + "Slate/Black" + ], + [ + "Yellow/Blue", + "41", + "16", + "Blue/Yellow" + ], + [ + "Yellow/Orange", + "42", + "17", + "Orange/Yellow" + ], + [ + "Yellow/Green", + "43", + "18", + "Green/Yellow" + ], + [ + "Yellow/Brown", + "44", + "19", + "Brown/Yellow" + ], + [ + "Yellow/Slate", + "45", + "20", + "Slate/Yellow" + ], + [ + "Violet/Blue", + "46", + "21", + "Blue/Violet" + ], + [ + "Violet/Orange", + "47", + "22", + "Orange/Violet" + ], + [ + "Violet/Green", + "48", + "23", + "Green/Violet" + ], + [ + "Violet/Brown", + "49", + "24", + "Brown/Violet" + ], + [ + "Violet/Slate", + "50", + "25", + "Slate/Violet" + ] + ], + "title": "", + "original_id": "1e0891ff9db2d97d00d2b1f5d12142cd" + }, + { + "_id": "40a5d87e10b3e61f7cb3383e343344dd", + "header": [ + "Year", + "Single", + "US Chart position", + "Label", + "Catalogue No." + ], + "rows": [ + [ + "1942", + "\"Cow-Cow Boogie\"", + "9", + "Capitol", + "102" + ], + [ + "1942", + "\"Mr. Five by Five\"", + "10", + "Capitol", + "115" + ], + [ + "1943", + "\"Get On Board Little Chillun\"", + "17 (R&B)", + "Capitol", + "133" + ], + [ + "1943", + "\"Shoo Shoo Baby\"", + "4", + "Capitol", + "143" + ], + [ + "1944", + "\"No Love, No Nothin’\"", + "4", + "Capitol", + "143" + ], + [ + "1944", + "\"Tess' Torch Song\"", + "11", + "Capitol", + "151" + ], + [ + "1944", + "\"Milkman, Keep Those Bottles Quiet\"", + "7", + "Capitol", + "151" + ], + [ + "1944", + "\"The Patty Cake Man\"", + "10", + "Capitol", + "163" + ], + [ + "1945", + "\"Captain Kidd\"", + "17", + "Capitol", + "193" + ], + [ + "1946", + "\"Buzz Me\"", + "15", + "Capitol", + "226" + ], + [ + "1946", + "\"The House of Blue Lights\"", + "8 (R&B)", + "Capitol", + "251" + ], + [ + "1952", + "\"The Blacksmith Blues\"", + "3", + "Capitol", + "1922" + ], + [ + "1952", + "\"Oakie Boogie\"", + "23", + "Capitol", + "2072" + ], + [ + "1953", + "\"40 Cups of Coffee\"", + "26", + "Capitol", + "2539" + ] + ], + "title": "", + "original_id": "60effd85ac81cca8bbca69134e0b73a5" + }, + { + "_id": "7f44733802c769610d2d5322e681352a", + "header": [ + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "germany", + "7", + "4", + "5", + "16" + ], + [ + "france", + "1", + "4", + "1", + "6" + ], + [ + "united states", + "1", + "2", + "1", + "4" + ], + [ + "netherlands", + "1", + "1", + "3", + "5" + ], + [ + "united kingdom", + "1", + "1", + "1", + "3" + ], + [ + "switzerland", + "1", + "-", + "1", + "2" + ], + [ + "denmark", + "1", + "-", + "-", + "1" + ], + [ + "new zealand", + "1", + "-", + "-", + "1" + ], + [ + "belgium", + "-", + "1", + "-", + "1" + ], + [ + "spain", + "-", + "1", + "-", + "1" + ], + [ + "australia", + "-", + "-", + "1", + "1" + ], + [ + "sweden", + "-", + "-", + "1", + "1" + ] + ], + "title": "", + "original_id": "d36f751dac69318f27f101ed13b4710a" + }, + { + "_id": "7511b8a0bc286bbed5e31d3e7877a09b", + "header": [ + "region", + "total population", + "manchu", + "percentage in manchu population", + "regional percentage of population" + ], + "rows": [ + [ + "total", + "1335110869", + "10410585", + "100", + "0.77" + ], + [ + "total (in all 31 provincial regions)", + "1332810869", + "10387958", + "99.83", + "0.78" + ], + [ + "northeast", + "109513129", + "6951280", + "66.77", + "6.35" + ], + [ + "north", + "164823663", + "3002873", + "28.84", + "1.82" + ], + [ + "east", + "392862229", + "122861", + "1.18", + "0.03" + ], + [ + "south central", + "375984133", + "120424", + "1.16", + "0.03" + ], + [ + "northwest", + "96646530", + "82135", + "0.79", + "0.08" + ], + [ + "southwest", + "192981185", + "57785", + "0.56", + "0.03" + ], + [ + "liaoning", + "43746323", + "5336895", + "51.26", + "12.2" + ], + [ + "hebei", + "71854210", + "2118711", + "20.35", + "2.95" + ], + [ + "jilin", + "27452815", + "866365", + "8.32", + "3.16" + ], + [ + "heilongjiang", + "38313991", + "748020", + "7.19", + "1.95" + ], + [ + "inner mongolia", + "24706291", + "452765", + "4.35", + "2.14" + ], + [ + "beijing", + "19612368", + "336032", + "3.23", + "1.71" + ], + [ + "tianjin", + "12938693", + "83624", + "0.80", + "0.65" + ], + [ + "henan", + "94029939", + "55493", + "0.53", + "0.06" + ], + [ + "shandong", + "95792719", + "46521", + "0.45", + "0.05" + ], + [ + "guangdong", + "104320459", + "29557", + "0.28", + "0.03" + ], + [ + "shanghai", + "23019196", + "25165", + "0.24", + "0.11" + ], + [ + "ningxia", + "6301350", + "24902", + "0.24", + "0.4" + ], + [ + "guizhou", + "34748556", + "23086", + "0.22", + "0.07" + ], + [ + "xinjiang", + "21815815", + "18707", + "0.18", + "0.09" + ], + [ + "jiangsu", + "78660941", + "18074", + "0.17", + "0.02" + ], + [ + "shaanxi", + "37327379", + "16291", + "0.16", + "0.04" + ], + [ + "sichuan", + "80417528", + "15920", + "0.15", + "0.02" + ], + [ + "gansu", + "25575263", + "14206", + "0.14", + "0.06" + ], + [ + "yunnan", + "45966766", + "13490", + "0.13", + "0.03" + ], + [ + "hubei", + "57237727", + "12899", + "0.12", + "0.02" + ], + [ + "shanxi", + "25712101", + "11741", + "0.11", + "0.05" + ], + [ + "zhejiang", + "54426891", + "11271", + "0.11", + "0.02" + ], + [ + "guangxi", + "46023761", + "11159", + "0.11", + "0.02" + ], + [ + "anhui", + "59500468", + "8516", + "0.08", + "0.01" + ], + [ + "fujian", + "36894217", + "8372", + "0.08", + "0.02" + ], + [ + "qinghai", + "5626723", + "8029", + "0.08", + "0.14" + ], + [ + "hunan", + "65700762", + "7566", + "0.07", + "0.01" + ], + [ + "jiangxi", + "44567797", + "4942", + "0.05", + "0.01" + ], + [ + "chongqing", + "28846170", + "4571", + "0.04", + "0.02" + ], + [ + "hainan", + "8671485", + "3750", + "0.04", + "0.04" + ], + [ + "tibet", + "3002165", + "718", + "<0.01", + "0.02" + ], + [ + "active servicemen", + "2300000", + "22627", + "0.24", + "1.05" + ] + ], + "title": "", + "original_id": "3ba617b11797d522d5c51bdb6d6cd313" + }, + { + "_id": "0bafc43820077767aab46745b3d89eb0", + "header": [ + "rank", + "rank fortune 500", + "name", + "headquarters", + "revenue (millions)", + "profit (millions)", + "employees", + "industry" + ], + "rows": [ + [ + "1", + "17", + "sinopec", + "beijing", + "131636.0", + "3703.1", + "681900", + "oil" + ], + [ + "2", + "24", + "china national petroleum", + "beijing", + "110520.2", + "13265.3", + "1086966", + "oil" + ], + [ + "3", + "29", + "state grid corporation", + "beijing", + "107185.5", + "2237.7", + "1504000", + "utilities" + ], + [ + "4", + "170", + "industrial and commercial bank of china", + "beijing", + "36832.9", + "6179.2", + "351448", + "banking" + ], + [ + "5", + "180", + "china mobile limited", + "beijing", + "35913.7", + "6259.7", + "130637", + "telecommunications" + ], + [ + "6", + "192", + "china life insurance", + "beijing", + "33711.5", + "173.9", + "77660", + "insurance" + ], + [ + "7", + "215", + "bank of china", + "beijing", + "30750.8", + "5372.3", + "232632", + "banking" + ], + [ + "8", + "230", + "china construction bank", + "beijing", + "28532.3", + "5810.3", + "297506", + "banking" + ], + [ + "9", + "237", + "china southern power grid", + "guangzhou", + "27966.1", + "1074.1", + "178053", + "utilities" + ], + [ + "10", + "275", + "china telecom", + "beijing", + "24791.3", + "2279.7", + "400299", + "telecommunications" + ], + [ + "11", + "277", + "agricultural bank of china", + "beijing", + "24475.5", + "728.4", + "452464", + "banking" + ], + [ + "12", + "290", + "hutchison whampoa", + "hong kong", + "23661.0", + "2578.3", + "220000", + "various sectors" + ], + [ + "13", + "299", + "sinochem corporation", + "beijing", + "23109.2", + "344.7", + "20343", + "various sectors" + ], + [ + "14", + "307", + "baosteel", + "shanghai", + "22663.4", + "1622.2", + "91308", + "steel" + ], + [ + "15", + "342", + "china railway engineering", + "beijing", + "20520.4", + "142.6", + "275866", + "railway" + ], + [ + "16", + "384", + "china railway construction", + "beijing", + "18735.7", + "70.2", + "245540", + "railway" + ], + [ + "17", + "385", + "first automotive works", + "changchun", + "18710.7", + "70.0", + "136010", + "automobile" + ], + [ + "18", + "396", + "china state construction", + "beijing", + "18163.2", + "281.3", + "294309", + "construction" + ], + [ + "19", + "402", + "saic motor", + "shanghai", + "18010.1", + "89.7", + "72416", + "automobile" + ], + [ + "20", + "405", + "cofco limited", + "beijing", + "17953.2", + "281.0", + "82481", + "various sectors" + ], + [ + "21", + "435", + "china minmetals", + "beijing", + "16902.2", + "154.4", + "32594", + "metal trading" + ], + [ + "22", + "457", + "jardine matheson", + "hong kong / hamilton", + "16281.0", + "1348.0", + "240000", + "various sectors" + ], + [ + "23", + "469", + "china national offshore oil", + "beijing", + "16038.9", + "3007.1", + "44000", + "oil" + ], + [ + "24", + "488", + "china ocean shipping", + "beijing", + "15413.5", + "1092.9", + "79616", + "shipping" + ] + ], + "title": "", + "original_id": "e64c2ddce62c76ba41e5c576b72b1ac4" + }, + { + "_id": "49aab8952a096ac2b5fdfdfe7287bca6", + "header": [ + "rank by average", + "place", + "couple", + "total points", + "number of dances", + "average" + ], + "rows": [ + [ + "1", + "1", + "brooke & derek", + "433", + "16", + "27.1" + ], + [ + "2", + "2", + "warren & kym", + "397", + "16", + "24.8" + ], + [ + "3", + "3", + "lance & lacey", + "392", + "16", + "24.5" + ], + [ + "4", + "5", + "maurice & cheryl", + "252", + "11", + "22.9" + ], + [ + "5", + "4", + "cody & julianne", + "292", + "13", + "22.5" + ], + [ + "6", + "8", + "toni b & alec", + "134", + "6", + "22.3" + ], + [ + "7", + "6", + "susan & tony d", + "192", + "9", + "21.3" + ], + [ + "8", + "10", + "misty & maksim", + "63", + "3", + "21.0" + ], + [ + "9", + "12", + "ted & inna", + "37", + "2", + "18.5" + ], + [ + "10", + "11", + "kim k & mark", + "54", + "3", + "18.0" + ], + [ + "11", + "9", + "rocco & karina", + "89", + "5", + "17.8" + ], + [ + "12", + "7", + "cloris & corky", + "121", + "7", + "17.3" + ] + ], + "title": "", + "original_id": "521d1b7034109e2055b6a1c236319eb3" + }, + { + "_id": "a7d4bfc6aa0179a57447a059ae3d06e7", + "header": [ + "rank", + "city", + "population", + "area (km 2 )", + "density (inhabitants / km 2 )", + "altitude (mslm)" + ], + "rows": [ + [ + "1st", + "alessandria", + "94191", + "203.97", + "461.8", + "95" + ], + [ + "2nd", + "casale monferrato", + "36039", + "86.32", + "417.5", + "116" + ], + [ + "3rd", + "novi ligure", + "28581", + "54.22", + "527.1", + "197" + ], + [ + "4th", + "tortona", + "27476", + "99.29", + "276.7", + "122" + ], + [ + "5th", + "acqui terme", + "20426", + "33.42", + "611.2", + "156" + ], + [ + "6th", + "valenza", + "20282", + "50.05", + "405.2", + "125" + ], + [ + "7th", + "ovada", + "11912", + "35.33", + "337.2", + "186" + ], + [ + "8th", + "serravalle scrivia", + "6445", + "16.02", + "402.3", + "225" + ], + [ + "9th", + "arquata scrivia", + "6260", + "30.36", + "206.2", + "248" + ], + [ + "10th", + "castelnuovo scrivia", + "5473", + "45.42", + "120.5", + "85" + ] + ], + "title": "", + "original_id": "1274eebbc02e9c74547f94c43fbd5cdb" + }, + { + "_id": "dfc463b445679f6a3bccf5a573602c53", + "header": [ + "region of ussr", + "number of families", + "number of people", + "average family size", + "% of total deportees" + ], + "rows": [ + [ + "amur oblast", + "2028", + "5451", + "2.7", + "5.8" + ], + [ + "irkutsk oblast", + "8475", + "25834", + "3.0", + "27.3" + ], + [ + "krasnoyarsk krai", + "3671", + "13823", + "3.8", + "14.6" + ], + [ + "novosibirsk oblast", + "3152", + "10064", + "3.2", + "10.6" + ], + [ + "omsk oblast", + "7944", + "22542", + "2.8", + "23.8" + ], + [ + "tomsk oblast", + "5360", + "16065", + "3.0", + "16.9" + ] + ], + "title": "", + "original_id": "dd391b7413df643849f40644296aab34" + }, + { + "_id": "27c21efdb35cc2a37c60eacba8cc72a4", + "header": [ + "index", + "organization", + "year", + "rank", + "out of" + ], + "rows": [ + [ + "bribe payers index", + "transparency international", + "2011", + "19", + "28" + ], + [ + "corruption perceptions index", + "transparency international", + "2012", + "37", + "176" + ], + [ + "democracy index", + "economist intelligence unit", + "2010", + "36", + "167" + ], + [ + "ease of doing business index", + "world bank", + "2012", + "16", + "185" + ], + [ + "economic freedom index", + "fraser institute", + "2010", + "15", + "144" + ], + [ + "economic freedom index", + "the heritage foundation", + "2013", + "20", + "177" + ], + [ + "global competitiveness report", + "world economic forum", + "20122013", + "13", + "144" + ], + [ + "global peace index", + "institute for economics and peace", + "2011", + "27", + "153" + ], + [ + "globalization index", + "at kearney / foreign policy magazine", + "2006", + "35", + "62" + ], + [ + "press freedom index", + "reporters without borders", + "2013", + "47", + "179" + ], + [ + "property rights index", + "property rights alliance", + "2008", + "28", + "115" + ] + ], + "title": "", + "original_id": "9f6acb3e258123c6d0841b052d95505f" + }, + { + "_id": "aa2b4321fcb97aaa6b241da874ae2f49", + "header": [ + "year", + "indians admitted", + "pakistanis admitted", + "sri lankans admitted", + "bangladeshis admitted", + "nepalis admitted" + ], + "rows": [ + [ + "2000", + "26122", + "14201", + "5849", + "2715", + "247" + ], + [ + "2001", + "27901", + "15353", + "5520", + "3393", + "273" + ], + [ + "2002", + "28838", + "14173", + "4968", + "2615", + "418" + ], + [ + "2003", + "24595", + "12351", + "4448", + "1896", + "440" + ], + [ + "2004", + "25573", + "12793", + "4134", + "3374", + "594" + ], + [ + "2005", + "22141", + "13575", + "4690", + "3940", + "714" + ], + [ + "2006", + "30746", + "12329", + "4490", + "3838", + "640" + ], + [ + "2007", + "26047", + "9545", + "3934", + "2735", + "564" + ], + [ + "2008", + "24548", + "8051", + "4508", + "2716", + "639" + ], + [ + "2009", + "26117", + "6213", + "4270", + "4270", + "627" + ], + [ + "2010", + "30252", + "4986", + "4181", + "4364", + "1502" + ], + [ + "2011", + "24965", + "6073", + "3104", + "2449", + "1249" + ], + [ + "2012", + "28943", + "9931", + "3152", + "2449", + "1311" + ] + ], + "title": "", + "original_id": "651dfed1dce61e46914adf0a239b0c9a" + }, + { + "_id": "03fbc7be5d0984924abcd6660b3a1e05", + "header": [ + "states", + "males (%)", + "males rank", + "females (%)", + "females rank" + ], + "rows": [ + [ + "india", + "12.1", + "14", + "16.0", + "15" + ], + [ + "punjab", + "30.3", + "1", + "37.5", + "1" + ], + [ + "kerala", + "24.3", + "2", + "34.0", + "2" + ], + [ + "goa", + "20.8", + "3", + "27.0", + "3" + ], + [ + "tamil nadu", + "19.8", + "4", + "24.4", + "4" + ], + [ + "andhra pradesh", + "17.6", + "5", + "22.7", + "10" + ], + [ + "sikkim", + "17.3", + "6", + "21.0", + "8" + ], + [ + "mizoram", + "16.9", + "7", + "20.3", + "17" + ], + [ + "himachal pradesh", + "16.0", + "8", + "19.5", + "12" + ], + [ + "maharashtra", + "15.9", + "9", + "18.1", + "13" + ], + [ + "gujarat", + "15.4", + "10", + "17.7", + "7" + ], + [ + "haryana", + "14.4", + "11", + "17.6", + "6" + ], + [ + "karnataka", + "14.0", + "12", + "17.3", + "9" + ], + [ + "manipur", + "13.4", + "13", + "17.1", + "11" + ], + [ + "uttarakhand", + "11.4", + "15", + "14.8", + "14" + ], + [ + "arunachal pradesh", + "10.6", + "16", + "12.5", + "19" + ], + [ + "uttar pradesh", + "9.9", + "17", + "12.0", + "18" + ], + [ + "jammu and kashmir", + "8.7", + "18", + "11.1", + "5" + ], + [ + "bihar", + "8.5", + "19", + "10.5", + "29" + ], + [ + "nagaland", + "8.4", + "20", + "10.2", + "22" + ], + [ + "rajasthan", + "8.4", + "20", + "9.0", + "20" + ], + [ + "meghalaya", + "8.2", + "22", + "8.9", + "26" + ], + [ + "orissa", + "6.9", + "23", + "8.6", + "25" + ], + [ + "assam", + "6.7", + "24", + "7.8", + "21" + ], + [ + "chattisgarh", + "6.5", + "25", + "7.6", + "27" + ], + [ + "west bengal", + "6.1", + "26", + "7.1", + "16" + ], + [ + "madhya pradesh", + "5.4", + "27", + "6.7", + "23" + ], + [ + "jharkhand", + "5.3", + "28", + "5.9", + "28" + ] + ], + "title": "", + "original_id": "b6219d257925aa2abc3e4511e5a2ac16" + }, + { + "_id": "ae75b33db4efba6c307e1e829e429595", + "header": [ + "Age Group", + "Both Gender", + "%", + "Male", + "%", + "Female", + "%" + ], + "rows": [ + [ + "All Ages", + "32,512", + "100.00", + "16,390", + "50.41", + "16, 122", + "49.59" + ], + [ + "Under 1", + "1,053", + "3.24", + "531", + "3.24", + "522", + "3.24" + ], + [ + "1 - 2", + "1,281", + "3.94", + "654", + "3.99", + "627", + "3.89" + ], + [ + "3 - 4", + "1,889", + "5.81", + "970", + "5.92", + "919", + "5.70" + ], + [ + "5 - 6", + "1,892", + "5.82", + "990", + "6.04", + "902", + "5.60" + ], + [ + "7 - 9", + "2,877", + "8.85", + "1,480", + "9.03", + "1,397", + "8.67" + ], + [ + "10 - 14", + "4,428", + "13.62", + "2,293", + "13.99", + "2,135", + "13.24" + ], + [ + "15 - 17", + "2,396", + "7.37", + "1,260", + "7.69", + "1,136", + "7.04" + ], + [ + "18 - 21", + "2,656", + "8.17", + "1,287", + "7.85", + "1,370", + "8.50" + ], + [ + "22 - 35", + "5,673", + "17.45", + "2,840", + "17.33", + "2,833", + "17.57" + ], + [ + "36 - 45", + "3,352", + "10.31", + "1,660", + "10.13", + "1,692", + "10.49" + ], + [ + "46 - 59", + "2,923", + "8.99", + "1,442", + "8.80", + "1,481", + "9.18" + ], + [ + "60 & above", + "2,091", + "6.43", + "982", + "5.99", + "1,109", + "6.88" + ], + [ + "TOTAL", + "32,512", + "100.00", + "16,390", + "100.00", + "16,122", + "100.00" + ] + ], + "title": "", + "original_id": "b24100d2cb5ed9ab25a7fdadf8258089" + }, + { + "_id": "4d9509c8294a9d2ed84fcf4dfbe622b7", + "header": [ + "driver", + "car", + "make", + "points", + "laps", + "winnings" + ], + "rows": [ + [ + "kasey kahne", + "9", + "dodge", + "185", + "334", + "530164" + ], + [ + "matt kenseth", + "17", + "ford", + "175", + "334", + "362491" + ], + [ + "tony stewart", + "20", + "chevrolet", + "175", + "334", + "286386" + ], + [ + "denny hamlin", + "11", + "chevrolet", + "165", + "334", + "208500" + ], + [ + "kevin harvick", + "29", + "chevrolet", + "160", + "334", + "204511" + ], + [ + "jeff burton", + "31", + "chevrolet", + "150", + "334", + "172220" + ], + [ + "scott riggs", + "10", + "dodge", + "146", + "334", + "133850" + ], + [ + "martin truex jr", + "1", + "chevrolet", + "147", + "334", + "156608" + ], + [ + "mark martin", + "6", + "ford", + "143", + "334", + "151850" + ], + [ + "bobby labonte", + "43", + "dodge", + "134", + "334", + "164211" + ], + [ + "jimmie johnson", + "48", + "chevrolet", + "130", + "334", + "165161" + ], + [ + "dale earnhardt jr", + "8", + "chevrolet", + "127", + "334", + "154816" + ], + [ + "reed sorenson", + "41", + "dodge", + "124", + "334", + "126675" + ], + [ + "casey mears", + "42", + "dodge", + "121", + "334", + "150233" + ], + [ + "kyle busch", + "5", + "chevrolet", + "118", + "334", + "129725" + ], + [ + "ken schrader", + "21", + "ford", + "115", + "334", + "140089" + ], + [ + "dale jarrett", + "88", + "ford", + "112", + "334", + "143350" + ], + [ + "jeff green", + "66", + "chevrolet", + "114", + "334", + "133833" + ], + [ + "clint bowyer", + "7", + "chevrolet", + "106", + "333", + "116075" + ], + [ + "robby gordon", + "7", + "chevrolet", + "103", + "333", + "109275" + ], + [ + "david stremme", + "40", + "dodge", + "100", + "333", + "127033" + ], + [ + "jeff gordon", + "24", + "chevrolet", + "97", + "332", + "148411" + ], + [ + "joe nemechek", + "1", + "chevrolet", + "94", + "332", + "129070" + ], + [ + "tony raines", + "96", + "chevrolet", + "91", + "332", + "97075" + ], + [ + "terry labonte", + "44", + "chevrolet", + "88", + "332", + "95975" + ], + [ + "michael waltrip", + "55", + "dodge", + "85", + "331", + "108833" + ], + [ + "travis kvapil", + "32", + "chevrolet", + "82", + "331", + "105122" + ], + [ + "scott wimmer", + "4", + "chevrolet", + "79", + "330", + "94075" + ], + [ + "dave blaney", + "22", + "dodge", + "76", + "330", + "92475" + ], + [ + "sterling marlin", + "14", + "chevrolet", + "73", + "329", + "89325" + ], + [ + "jeremy mayfield", + "19", + "dodge", + "70", + "328", + "116891" + ], + [ + "kevin lepage", + "61", + "ford", + "67", + "328", + "85800" + ], + [ + "elliott sadler", + "38", + "ford", + "69", + "286", + "113558" + ], + [ + "kurt busch", + "2", + "dodge", + "61", + "286", + "124633" + ], + [ + "jj yeley", + "18", + "chevrolet", + "63", + "270", + "118075" + ], + [ + "carl edwards", + "99", + "ford", + "60", + "256", + "101175" + ], + [ + "jamie mcmurray", + "26", + "ford", + "52", + "254", + "127100" + ], + [ + "mike garvey", + "151", + "chevrolet", + "49", + "251", + "79125" + ], + [ + "kyle petty", + "45", + "dodge", + "46", + "248", + "87000" + ], + [ + "ryan newman", + "12", + "dodge", + "43", + "200", + "124283" + ], + [ + "derrike cope", + "74", + "dodge", + "pe", + "169", + "78760" + ], + [ + "greg biffle", + "16", + "ford", + "42", + "81", + "98860" + ], + [ + "brian vickers", + "25", + "chevrolet", + "34", + "24", + "86847" + ] + ], + "title": "", + "original_id": "1307e6264752997dde75a6bd237b9e28" + }, + { + "_id": "6b542652fc6f945ef14213675f0526c8", + "header": [ + "# in office", + "Governor", + "Days", + "Rank" + ], + "rows": [ + [ + "11", + "Calvin L. Rampton", + "4,382", + "1" + ], + [ + "14", + "Mike Leavitt", + "3,957", + "2" + ], + [ + "17", + "Gary Herbert", + "3,544", + "3" + ], + [ + "1", + "Heber Manning Wells", + "3,283", + "4" + ], + [ + "7", + "Henry H. Blood", + "2,926", + "5" + ], + [ + "9", + "J. Bracken Lee", + "2,926", + "5" + ], + [ + "12", + "Scott M. Matheson", + "2,926", + "5" + ], + [ + "3", + "William Spry", + "2,919", + "8" + ], + [ + "6", + "George Dern", + "2,919", + "8" + ], + [ + "8", + "Herbert B. Maw", + "2,919", + "8" + ], + [ + "10", + "George Dewey Clyde", + "2,919", + "8" + ], + [ + "13", + "Norman H. Bangerter", + "2,919", + "8" + ], + [ + "16", + "Jon Huntsman, Jr.", + "1,681", + "13" + ], + [ + "2", + "John Christopher Cutler", + "1,463", + "14" + ], + [ + "4", + "Simon Bamberger", + "1,463", + "14" + ], + [ + "5", + "Charles R. Mabey", + "1,463", + "14" + ], + [ + "15", + "Olene S. Walker", + "425", + "17" + ] + ], + "title": "", + "original_id": "c5e88a53c5cf14366e0d42de7eb6ab13" + }, + { + "_id": "acb071f988c7614978818a7021575eda", + "header": [ + "-", + "Theme", + "Films", + "Participants", + "Cities", + "Countries", + "Jury" + ], + "rows": [ + [ + "2011", + "Small things in life", + "86", + "620", + "14", + "1", + "Sanjay Gadhvi, Ashish Kakkad" + ], + [ + "2012", + "Ingredients of good living", + "121", + "1,510", + "22", + "1", + "Shoojit Sircar, Vikramaditya Motwane, Komal Nahta, Rajesh Mapuskar" + ], + [ + "2013", + "India can change", + "322", + "4,270", + "44", + "3", + "Tigmanshu Dhulia, Nikhil Advani, Bejoy Nambiar" + ], + [ + "2014", + "Progress has many meanings", + "619", + "10,600", + "122", + "11", + "Shyam Benegal, Hansal Mehta, Omung Kumar, Umesh Shukla" + ], + [ + "2015", + "There is a twist in the end", + "700+", + "14,400", + "184", + "18", + "Ketan Mehta, Onir, Raja Sen, Guneet Monga" + ], + [ + "2016", + "Top of the world", + "1,220", + "23,600", + "242", + "20", + "Madhur Bhandarkar, Sriram Raghavan, Nagesh Kukunoor, Vetrimaaran" + ], + [ + "2017", + "Everything is connected", + "1,503", + "29,000", + "262", + "18", + "Ram Madhvani, Aniruddha Roy Chowdhury, Vipul Amrutlal Shah" + ], + [ + "2018", + "Professional Category - A story of Change Amateur Category - Experience Change Mobile Category - Precaution is better than Cure", + "1,550", + "32,000", + "300", + "30", + "Sudhir Mishra, Milan Luthria, RS Prasanna" + ] + ], + "title": "", + "original_id": "4ee382645d542fe6e3f05e71925c5cb8" + }, + { + "_id": "cf3dd648ee072f0feb478f7861bb8fc1", + "header": [ + "year", + "theme", + "artist", + "mintage", + "issue price" + ], + "rows": [ + [ + "2002", + "15th anniversary loonie", + "dora de pãdery - hunt", + "67672", + "39.95" + ], + [ + "2004", + "jack miner bird sanctuary", + "susan taylor", + "46493", + "39.95" + ], + [ + "2005", + "tufted puffin", + "n / a", + "39818", + "39.95" + ], + [ + "2006", + "snowy owl", + "glen loates", + "39935", + "44.95" + ], + [ + "2007", + "trumpeter swan", + "kerri burnett", + "40000", + "45.95" + ], + [ + "2008", + "common eider", + "mark hobson", + "40000", + "47.95" + ], + [ + "2009", + "great blue heron", + "chris jordison", + "40000", + "47.95" + ], + [ + "2010", + "northern harrier", + "arnold nogy", + "35000", + "49.95" + ], + [ + "2011", + "great gray owl", + "arnold nogy", + "35000", + "49.95" + ], + [ + "2012", + "25th anniversary loonie", + "arnold nogy", + "35000", + "49.95" + ] + ], + "title": "", + "original_id": "f05eecdcb6b316d67cfcdee33a48b838" + }, + { + "_id": "6e87572a6fa85b9b02c8cd32a2d859b9", + "header": [ + "election", + "of candidates nominated", + "of seats won", + "of total votes", + "% of popular vote" + ], + "rows": [ + [ + "1945", + "203", + "65", + "1448744", + "27.62%" + ], + [ + "1949", + "249", + "41", + "1734261", + "29.62%" + ], + [ + "1953", + "248", + "50", + "1749579", + "31.01%" + ], + [ + "1957", + "256", + "109", + "2564732", + "38.81%" + ], + [ + "1958", + "265", + "208", + "3908633", + "53.56%" + ], + [ + "1962", + "265", + "114", + "2865542", + "37.22%" + ], + [ + "1963", + "265", + "93", + "2582322", + "32.72%" + ], + [ + "1965", + "265", + "95", + "2500113", + "32.41%" + ], + [ + "1968", + "262", + "72", + "2548949", + "31.36%" + ], + [ + "1972", + "265", + "107", + "3388980", + "35.02%" + ], + [ + "1974", + "264", + "95", + "3371319", + "35.46%" + ], + [ + "1979", + "282", + "136", + "4111606", + "35.89%" + ], + [ + "1980", + "282", + "103", + "3552994", + "32.49%" + ], + [ + "1984", + "282", + "211", + "6278818", + "50.03%" + ], + [ + "1988", + "295", + "169", + "5667543", + "43.02%" + ], + [ + "1993", + "295", + "2", + "2178303", + "16.04%" + ], + [ + "1997", + "301", + "20", + "2446705", + "18.84%" + ], + [ + "2000", + "291", + "12", + "1566994", + "12.19%" + ] + ], + "title": "", + "original_id": "c2d0e0b5e2f5835d65687912d1ad3d7c" + }, + { + "_id": "39cf9fb5c3b815418e803f9968f51d8b", + "header": [ + "south american rank", + "world rank", + "nation", + "2011 (imf)", + "2008 (cia factbook)" + ], + "rows": [ + [ + "1", + "51", + "argentina", + "17376", + "14500" + ], + [ + "2", + "55", + "chile", + "16171", + "15400" + ], + [ + "3", + "59", + "uruguay", + "15469", + "12300" + ], + [ + "4", + "71", + "venezuela", + "12407", + "13500" + ], + [ + "5", + "74", + "brazil", + "11845", + "10513" + ], + [ + "6", + "82", + "colombia", + "10155", + "9000" + ], + [ + "7", + "83", + "peru", + "10000", + "8500" + ], + [ + "8", + "86", + "suriname", + "9492", + "8900" + ], + [ + "9", + "91", + "ecuador", + "8335", + "7700" + ], + [ + "10", + "96", + "guyana", + "7541", + "4000" + ], + [ + "11", + "110", + "paraguay", + "5548", + "4400" + ] + ], + "title": "", + "original_id": "e3cdc02ff933ead57a5ddd0f4dc189c2" + }, + { + "_id": "7e5213dfe3efb175704186d794f87439", + "header": [ + "country", + "area km square", + "population", + "population density per km square", + "hdi (2011)", + "capital" + ], + "rows": [ + [ + "china (prc)", + "9640011", + "1339724852", + "138", + "0.699", + "beijing" + ], + [ + "hong kong (prc)", + "1104", + "7061200", + "6390", + "0.898", + "hong kong" + ], + [ + "japan", + "377930", + "127950000", + "337", + "0.901", + "tokyo" + ], + [ + "macau (prc)", + "30", + "556800", + "18662", + "no data", + "macau" + ], + [ + "mongolia", + "1564100", + "2809600", + "2", + "0.653", + "ulaanbaatar" + ], + [ + "north korea", + "120538", + "24346000", + "198", + "no data", + "pyongyang" + ], + [ + "south korea", + "100210", + "48988833", + "500", + "0.897", + "seoul" + ] + ], + "title": "", + "original_id": "fd3ba4c9889705553735f6144bc72739" + }, + { + "_id": "0743ed491d311559a4f7c0689e959351", + "header": [ + "rank", + "heat", + "lane", + "name", + "nationality", + "time" + ], + "rows": [ + [ + "1", + "2", + "4", + "jason lezak", + "united states", + "48.51" + ], + [ + "2", + "1", + "4", + "filippo magnini", + "italy", + "48.6" + ], + [ + "3", + "2", + "5", + "pieter van den hoogenband", + "netherlands", + "48.72" + ], + [ + "4", + "2", + "3", + "brent hayden", + "canada", + "48.79" + ], + [ + "5", + "2", + "6", + "eamon sullivan", + "australia", + "48.86" + ], + [ + "6", + "1", + "6", + "ryk neethling", + "south africa", + "48.87" + ], + [ + "6", + "2", + "2", + "cãsar cielo filho", + "brazil", + "48.87" + ], + [ + "6", + "2", + "8", + "roland schoeman", + "south africa", + "48.87" + ], + [ + "9", + "1", + "5", + "alain bernard", + "france", + "48.89" + ], + [ + "10", + "1", + "2", + "stefan nystrand", + "sweden", + "48.92" + ], + [ + "11", + "2", + "7", + "albert subirats altes", + "venezuela", + "49.17" + ], + [ + "12", + "1", + "3", + "simon burnett", + "great britain", + "49.22" + ], + [ + "13", + "1", + "7", + "dominik meichtry", + "switzerland", + "49.27" + ], + [ + "14", + "1", + "8", + "christian galenda", + "italy", + "49.31" + ], + [ + "15", + "1", + "1", + "mitja zastrow", + "netherlands", + "49.41" + ], + [ + "16", + "2", + "1", + "ashley callus", + "australia", + "49.45" + ] + ], + "title": "", + "original_id": "c195eb7689321829b33cdc40c5931ad3" + }, + { + "_id": "685f73872de9ece8922a6820b0ead0b6", + "header": [ + "nbr class", + "type", + "introduced", + "driving wheel", + "total", + "extinct" + ], + "rows": [ + [ + "141", + "2 - 4 - 0", + "1869", + "ft6in (mm)", + "2", + "1915" + ], + [ + "38", + "2 - 4 - 0", + "1869", + "ft0in (mm)", + "1", + "1912" + ], + [ + "418", + "2 - 4 - 0", + "1873", + "ft0in (mm)", + "8", + "1927" + ], + [ + "40", + "2 - 4 - 0", + "1873", + "ft0in (mm)", + "2", + "1903" + ], + [ + "224", + "4 - 4 - 0", + "1871", + "ft6in (mm)", + "2", + "1919" + ], + [ + "420", + "4 - 4 - 0", + "1873", + "ft6in (mm)", + "4", + "1918" + ], + [ + "251", + "0 - 6 - 0", + "1867", + "ft3in (mm)", + "38", + "1924" + ], + [ + "56", + "0 - 6 - 0", + "1868", + "ft0in (mm)", + "8", + "1914" + ], + [ + "17", + "0 - 6 - 0", + "1869", + "ft6in (mm)", + "1", + "1914" + ], + [ + "396", + "0 - 6 - 0", + "1867", + "ft0in (mm)", + "88", + "1937" + ], + [ + "293", + "0 - 6 - 0", + "1872", + "ft0in (mm)", + "1", + "1907" + ], + [ + "357", + "0 - 4 - 0", + "1868", + "ft3in (mm)", + "2", + "1925" + ], + [ + "226", + "0 - 6 - 0st", + "1870", + "ft0in (mm)", + "2", + "1924" + ], + [ + "229", + "0 - 6 - 0st", + "1871", + "ft0in (mm)", + "15", + "1924" + ], + [ + "112", + "0 - 6 - 0st", + "1870", + "ft6in (mm)", + "3", + "1910" + ], + [ + "282", + "0 - 6 - 0st", + "1866", + "ft1in (mm)", + "3", + "1921" + ], + [ + "130", + "0 - 6 - 0st", + "1870", + "ft3in (mm)", + "10", + "1924" + ], + [ + "32", + "0 - 6 - 0st", + "1874", + "ft6in (mm)", + "6", + "1907" + ], + [ + "18", + "0 - 4 - 0st", + "1872", + "ft0in (mm)", + "2", + "1906" + ] + ], + "title": "", + "original_id": "68abb88ce95a7853db80f4df14284e88" + }, + { + "_id": "eec5ad9962ccb889e28f9c0b4404fbe2", + "header": [ + "rank", + "team name", + "basic elements", + "tumbling", + "stunts", + "tosses / pyramids", + "deductions", + "total" + ], + "rows": [ + [ + "1", + "school of saint anthony ssa seagulls", + "61.5", + "66.5", + "67.5", + "69.5", + "(13)", + "252.0" + ], + [ + "2", + "school of the holy spirit shs pep squad", + "64.5", + "63.0", + "66.0", + "64.5", + "(15)", + "243.0" + ], + [ + "5", + "pcc pep squad", + "55.0", + "49.0", + "65.0", + "64.0", + "(26)", + "207.0" + ], + [ + "6", + "assumption college ac hardcourt", + "59.0", + "53.0", + "62.0", + "48.5", + "(37)", + "185.5" + ], + [ + "8", + "the cmic fighting vanguards", + "47.0", + "36.5", + "57.5", + "56.5", + "(35)", + "162.5" + ], + [ + "9", + "de la salle zobel dlsz pep squad and cheerdancers", + "46.5", + "44.5", + "54.0", + "44.0", + "(27)", + "162.0" + ] + ], + "title": "", + "original_id": "accf35669852e1aaaf42099aaeb188bb" + }, + { + "_id": "65d1f1fe9023c68a2715459026950ccc", + "header": [ + "rank", + "english title", + "chinese title", + "average", + "peak", + "premiere", + "finale", + "hk viewers" + ], + "rows": [ + [ + "1", + "la femme desperado", + "女人唔易做", + "33", + "41", + "31", + "34", + "2.14 million" + ], + [ + "2", + "forensic heroes", + "法證先鋒", + "33", + "43", + "28", + "37", + "2.11 million" + ], + [ + "3", + "the saviour of the soul", + "神鵰俠侶", + "32", + "40", + "32", + "35", + "2.07 million" + ], + [ + "4", + "love guaranteed", + "愛情全保", + "32", + "36", + "30", + "34", + "2.07 million" + ], + [ + "5", + "bar bender", + "潮爆大狀", + "32", + "38", + "31", + "34", + "2.06 million" + ], + [ + "6", + "the dance of passion", + "火舞黃沙", + "32", + "38", + "34", + "35", + "2.05 million" + ], + [ + "7", + "maiden 's vow", + "鳳凰四重奏", + "32", + "37", + "32", + "29", + "2.05 million" + ], + [ + "8", + "to grow with love", + "肥田囍事", + "32", + "35", + "32", + "32", + "2.04 million" + ], + [ + "9", + "men in pain", + "男人之苦", + "32", + "39", + "28", + "33", + "2.03 million" + ], + [ + "10", + "under the canopy of love", + "天幕下的戀人", + "31", + "37", + "28", + "33", + "2.02 million" + ] + ], + "title": "", + "original_id": "552dcdcf1bd1de6d19d74f2ecab53af8" + }, + { + "_id": "23414d8bf1e06ae55b4f42b911e5cf30", + "header": [ + "series", + "season", + "title", + "directed by", + "written by", + "original air date", + "production code", + "us viewers (million)" + ], + "rows": [ + [ + "118", + "1", + "my mirror image (part 2)", + "john inwood", + "tim hobert", + "november 30 , 2006", + "601", + "8.45" + ], + [ + "119", + "2", + "my best friend 's baby 's baby and my baby 's baby", + "gail mancuso", + "neil goldman & garrett donovan", + "december 7 , 2006", + "603", + "8.43" + ], + [ + "120", + "3", + "my coffee", + "rick blue", + "tad quill", + "december 14 , 2006", + "602", + "7.78" + ], + [ + "121", + "4", + "my house", + "john putch", + "bill callahan", + "january 4 , 2007", + "604", + "7.33" + ], + [ + "122", + "5", + "my friend with money", + "john michel", + "gabrielle allan", + "january 11 , 2007", + "605", + "7.33" + ], + [ + "123", + "6", + "my musical", + "will mackenzie", + "debra fordham", + "january 18 , 2007", + "607", + "6.57" + ], + [ + "124", + "7", + "his story iv", + "linda mendoza", + "mike schwartz", + "february 1 , 2007", + "606", + "6.88" + ], + [ + "125", + "8", + "my road to nowhere", + "mark stegemann", + "mark stegemann", + "february 8 , 2007", + "608", + "6.22" + ], + [ + "126", + "9", + "my perspective", + "john putch", + "angela nissel", + "february 15 , 2007", + "609", + "6.26" + ], + [ + "127", + "10", + "my therapeutic month", + "ken whittingham", + "aseem batra", + "february 22 , 2007", + "610", + "5.69" + ], + [ + "128", + "11", + "my night to remember", + "richard davis", + "debra fordham", + "march 1 , 2007", + "614", + "6.8" + ], + [ + "129", + "12", + "my fishbowl", + "chris koch", + "kevin biegel", + "march 8 , 2007", + "611", + "5.89" + ], + [ + "130", + "13", + "my scrubs", + "john putch", + "clarence livingston", + "march 15 , 2007", + "612", + "6.37" + ], + [ + "131", + "14", + "my no good reason (part 1)", + "zach braff", + "janae bakken", + "march 22 , 2007", + "613", + "6.48" + ], + [ + "132", + "15", + "my long goodbye (part 2)", + "victor nelli , jr", + "dave tennant", + "april 5 , 2007", + "615", + "4.89" + ], + [ + "133", + "16", + "my words of wisdom", + "victor nelli , jr", + "eric weinberg", + "april 12 , 2007", + "616", + "5.02" + ], + [ + "134", + "17", + "their story", + "richard alexander wells", + "andy schwartz", + "april 19 , 2007", + "617", + "5.56" + ], + [ + "135", + "18", + "my turf war", + "bill lawrence", + "sean russell", + "april 26 , 2007", + "618", + "4.65" + ], + [ + "136", + "19", + "my cold shower", + "john inwood", + "janae bakken", + "may 3 , 2007", + "619", + "4.95" + ], + [ + "137", + "20", + "my conventional wisdom", + "michael mcdonald", + "bill callahan", + "may 10 , 2007", + "620", + "5.31" + ], + [ + "138", + "21", + "my rabbit (part 1)", + "john putch", + "kevin biegel & aseem batra", + "may 17 , 2007", + "621", + "5.21" + ] + ], + "title": "", + "original_id": "a4f6d7cb86e12d536c41b2a9a6bab3d2" + }, + { + "_id": "96e5153c3f93c29850e839163d010983", + "header": [ + "series", + "presenters", + "start date", + "end date", + "days in camp", + "camp mates", + "winner", + "highest viewers (millions)", + "lowest viewers (millions)", + "average viewers (millions)" + ], + "rows": [ + [ + "one", + "ant & dec", + "25 august 2002", + "8 september 2002", + "15", + "8", + "tony blackburn", + "10.95", + "6.14", + "7.58" + ], + [ + "two", + "ant & dec", + "28 april 2003", + "12 may 2003", + "15", + "10", + "phil tufnell", + "12.75", + "5.15", + "8.55" + ], + [ + "three", + "ant & dec", + "26 january 2004", + "9 february 2004", + "16", + "10", + "kerry katona", + "14.99", + "8.96", + "11.02" + ], + [ + "four", + "ant & dec", + "21 november 2004", + "6 december 2004", + "18", + "11", + "joe pasquale", + "11.43", + "7.04", + "8.66" + ], + [ + "five", + "ant & dec", + "20 november 2005", + "5 december 2005", + "18", + "12", + "carol thatcher", + "12.35", + "7.69", + "9.42" + ], + [ + "six", + "ant & dec", + "13 november 2006", + "1 december 2006", + "19", + "12", + "matt willis", + "10.05", + "6.97", + "8.01" + ], + [ + "seven", + "ant & dec", + "12 november 2007", + "30 november 2007", + "20", + "11", + "christopher biggins", + "8.84", + "5.0", + "7.34" + ], + [ + "eight", + "ant & dec", + "16 november 2008", + "5 december 2008", + "21", + "12", + "joe swash", + "10.19", + "7.91", + "8.78" + ], + [ + "nine", + "ant & dec", + "15 november 2009", + "4 december 2009", + "21", + "13", + "gino d'acampo", + "10.86", + "7.86", + "9.37" + ], + [ + "ten", + "ant & dec", + "14 november 2010", + "4 december 2010", + "21", + "13", + "stacey solomon", + "13.48", + "6.68", + "9.7" + ], + [ + "eleven", + "ant & dec", + "13 november 2011", + "3 december 2011", + "21", + "13", + "dougie poynter", + "11.8", + "6.8", + "9.74" + ], + [ + "twelve", + "ant & dec", + "11 november 2012", + "1 december 2012", + "21", + "12", + "charlie brooks", + "11.51", + "7.81", + "9.81" + ] + ], + "title": "", + "original_id": "c83997f5fbd697a85059649fdfb3293d" + }, + { + "_id": "1ede6f32a9759542203ac96c626de14b", + "header": [ + "district", + "s barangay", + "population (2010 census)", + "area ( has )", + "pop density (per km2)" + ], + "rows": [ + [ + "binondo", + "10", + "12985", + "66.11", + "19641.5" + ], + [ + "ermita", + "13", + "7143", + "158.91", + "4495.0" + ], + [ + "intramuros", + "5", + "4925", + "67.26", + "7322.3" + ], + [ + "malate", + "57", + "77513", + "259.58", + "29860.9" + ], + [ + "paco", + "43", + "70978", + "278.69", + "25468.4" + ], + [ + "pandacan", + "38", + "73895", + "166.0", + "44515.1" + ], + [ + "port area", + "5", + "57405", + "315.28", + "18207.6" + ], + [ + "quiapo", + "16", + "24886", + "84.69", + "29384.8" + ], + [ + "sampaloc", + "192", + "241528", + "513.71", + "47016.4" + ], + [ + "san andrãs", + "65", + "115942", + "168.02", + "69004.9" + ], + [ + "san miguel", + "12", + "15992", + "91.37", + "17502.5" + ], + [ + "san nicolas", + "15", + "44241", + "163.85", + "27000.9" + ], + [ + "santa ana", + "34", + "60952", + "169.42", + "35976.9" + ], + [ + "santa cruz", + "82", + "115747", + "309.01", + "37457.4" + ], + [ + "santa mesa", + "51", + "99933", + "261.01", + "38287.0" + ], + [ + "tondo", + "259", + "628106", + "865.13", + "72602.5" + ] + ], + "title": "", + "original_id": "be0223bd4b1d4dcfcb9bf7d3351329b3" + }, + { + "_id": "c135787d7b84d1a072be1bdb883e93bc", + "header": [ + "School", + "Location", + "Outright Titles", + "Shared Titles", + "Runners-Up", + "Total Finals", + "Last Title", + "Last Final" + ], + "rows": [ + [ + "Methodist College Belfast", + "Belfast", + "35", + "2", + "25", + "62", + "2014.0", + "2014" + ], + [ + "Royal Belfast Academical Institution", + "Belfast", + "29", + "4", + "21", + "54", + "2007.0", + "2013" + ], + [ + "Campbell College", + "Belfast", + "23", + "4", + "12", + "39", + "2011.0", + "2011" + ], + [ + "Coleraine Academical Institution", + "Coleraine", + "9", + "0", + "24", + "33", + "1992.0", + "1998" + ], + [ + "The Royal School, Armagh", + "Armagh", + "9", + "0", + "3", + "12", + "2004.0", + "2004" + ], + [ + "Portora Royal School", + "Enniskillen", + "6", + "1", + "5", + "12", + "1942.0", + "1942" + ], + [ + "Bangor Grammar School", + "Bangor", + "5", + "0", + "4", + "9", + "1988.0", + "1995" + ], + [ + "Ballymena Academy", + "Ballymena", + "3", + "0", + "6", + "9", + "2010.0", + "2010" + ], + [ + "Rainey Endowed School", + "Magherafelt", + "2", + "1", + "2", + "5", + "1982.0", + "1982" + ], + [ + "Foyle College", + "Londonderry", + "2", + "0", + "4", + "6", + "1915.0", + "1915" + ], + [ + "Belfast Royal Academy", + "Belfast", + "1", + "3", + "5", + "9", + "1997.0", + "2010" + ], + [ + "Regent House Grammar School", + "Newtownards", + "1", + "1", + "2", + "4", + "1996.0", + "2008" + ], + [ + "Royal School Dungannon", + "Dungannon", + "1", + "0", + "4", + "5", + "1907.0", + "1975" + ], + [ + "Annadale Grammar School (now Wellington College)", + "Belfast", + "1", + "0", + "1", + "2", + "1958.0", + "1978" + ], + [ + "Ballyclare High School", + "Ballyclare", + "1", + "0", + "1", + "2", + "1973.0", + "2012" + ], + [ + "Belfast Boys' Model School", + "Belfast", + "1", + "0", + "0", + "1", + "1971.0", + "1971" + ], + [ + "Grosvenor High School", + "Belfast", + "1", + "0", + "0", + "1", + "1983.0", + "1983" + ], + [ + "Wallace High School", + "Lisburn", + "0", + "0", + "4", + "4", + null, + "2007" + ], + [ + "Derry Academy", + "Derry", + "0", + "0", + "2", + "2", + null, + "1896" + ], + [ + "Dalriada School", + "Ballymoney", + "0", + "0", + "1", + "1", + null, + "1993" + ], + [ + "Galway Grammar School", + "Galway", + "0", + "0", + "1", + "1", + null, + "1887" + ], + [ + "Lurgan College", + "Lurgan", + "0", + "0", + "1", + "1", + null, + "1934" + ], + [ + "Omagh Academy", + "Omagh", + "0", + "0", + "1", + "1", + null, + "1985" + ], + [ + "Sullivan Upper School", + "Holywood", + "0", + "0", + "1", + "1", + null, + "2014" + ] + ], + "title": "", + "original_id": "ffe5d38c4973ddc4bd3ca6d9c2d34406" + }, + { + "_id": "fd3ce583185bf40e79b3cd873488f502", + "header": [ + "commodity", + "2001 - 02", + "2002 - 03", + "2003 - 04", + "2004 - 05", + "2005 - 06", + "2006 - 07" + ], + "rows": [ + [ + "cattle and calves", + "6617", + "5849", + "6345", + "7331", + "7082", + "6517" + ], + [ + "wheat", + "6356", + "2692", + "5636", + "4320", + "5905", + "6026" + ], + [ + "milk", + "3717", + "2795", + "2808", + "3194", + "3268", + "3245" + ], + [ + "fruit and nuts", + "2333", + "2408", + "2350", + "2640", + "2795", + "2915" + ], + [ + "s vegetable", + "2269", + "2126", + "2356", + "2490", + "2601", + "2715" + ], + [ + "wool", + "2713", + "3318", + "2397", + "2196", + "2187", + "2138" + ], + [ + "barley", + "1725", + "984", + "1750", + "1240", + "1744", + "1624" + ], + [ + "poultry", + "1175", + "1273", + "1264", + "1358", + "1416", + "1461" + ], + [ + "s lamb", + "1181", + "1161", + "1318", + "1327", + "1425", + "1348" + ], + [ + "sugar cane", + "989", + "1019", + "854", + "968", + "1037", + "1208" + ] + ], + "title": "", + "original_id": "8b7282ee8b62b7081c34cb52912ccc40" + }, + { + "_id": "5a65f6d8c0f14a41cdb2d12b29cc51d4", + "header": [ + "sno", + "power plant", + "state", + "commissioned capacity (mw)", + "year of commission" + ], + "rows": [ + [ + "1", + "baira siul", + "himachal pradesh", + "180", + "1981" + ], + [ + "2", + "loktak", + "manipur", + "105", + "1983" + ], + [ + "3", + "salal - i", + "jammu & kashmir", + "345", + "1987" + ], + [ + "4", + "tanakpur", + "uttarakhand", + "120", + "1992" + ], + [ + "5", + "chamera - i", + "himachal pradesh", + "540", + "1994" + ], + [ + "6", + "salal - ii", + "jammu & kashmir", + "345", + "1996" + ], + [ + "7", + "uri - i", + "jammu & kashmir", + "480", + "1997" + ], + [ + "8", + "rangit", + "sikkim", + "60", + "1999" + ], + [ + "9", + "chamera - ii", + "himachal pradesh", + "300", + "2004" + ], + [ + "10", + "indira sagar", + "madhya pradesh", + "1000", + "2005" + ], + [ + "11", + "dhauliganga - i", + "uttarakhand", + "280", + "2005" + ], + [ + "12", + "dul hasti", + "jammu & kashmir", + "390", + "2007" + ], + [ + "13", + "omkareshwar", + "madhya pradesh", + "520", + "2007" + ], + [ + "14", + "teesta - v", + "sikkim", + "510", + "2008" + ], + [ + "15", + "sewa - ii", + "jammu & kashmir", + "120", + "2010" + ], + [ + "16", + "chamera - iii", + "himachal pradesh", + "231", + "2012" + ] + ], + "title": "", + "original_id": "ac4ea376af826244678bb8ef6a0e024b" + }, + { + "_id": "63c16af56b3d709395dffa88cf4ab9d7", + "header": [ + "region", + "start datum", + "target datum", + "c_x ( metre )", + "c_y (metre)", + "c_z (metre)", + "s ( ppm )", + "r x ( arcsecond )", + "r y ( arcsecond )", + "r z ( arcsecond )" + ], + "rows": [ + [ + "slovenia etrs89", + "d48", + "d96", + "409.545", + "72.164", + "486.872", + "17.919665", + "3.085957", + "5.46911", + "11.020289" + ], + [ + "england , scotland , wales", + "wgs84", + "osgb36", + "446.448", + "125.157", + "542.06", + "20.4894", + "0.1502", + "0.247", + "0.8421" + ], + [ + "ireland", + "wgs84", + "ireland 1965", + "482.53", + "130.596", + "564.557", + "8.15", + "1.042", + "0.214", + "0.631" + ], + [ + "germany", + "wgs84", + "dhdn", + "591.28", + "81.35", + "396.39", + "9.82", + "1.477", + "0.0736", + "1.458" + ], + [ + "germany", + "wgs84", + "bessel 1841", + "582.0", + "105.0", + "414.0", + "8.3", + "1.04", + "0.35", + "3.08" + ], + [ + "germany", + "wgs84", + "krassovski 1940", + "24.0", + "123.0", + "94.0", + "1.1", + "0.02", + "0.26", + "0.13" + ], + [ + "austria (bev)", + "wgs84", + "mgi", + "577.326", + "90.129", + "463.92", + "2.423", + "5.137", + "1.474", + "5.297" + ] + ], + "title": "", + "original_id": "0150c6f2c5f3a2b3ea7326b41446cbf3" + }, + { + "_id": "636b65c0daa4444c3680548c6170e113", + "header": [ + "Name", + "Title", + "Start", + "End" + ], + "rows": [ + [ + "William J. Porter", + "Chargé d'Affaires", + "1956", + "1956" + ], + [ + "Cavendish W. Cannon", + "Ambassador", + "1956", + "1958" + ], + [ + "Charles Yost", + "Ambassador", + "1958", + "1961" + ], + [ + "Philip W. Bonsal", + "Ambassador", + "1961", + "1962" + ], + [ + "John H. Ferguson", + "Ambassador", + "1962", + "1964" + ], + [ + "Henry J. Tasca", + "Ambassador", + "1965", + "1969" + ], + [ + "Stuart W. Rockwell", + "Ambassador", + "1970", + "1973" + ], + [ + "Robert G. Neumann", + "Ambassador", + "1973", + "1976" + ], + [ + "Robert Anderson", + "Ambassador", + "1976", + "1978" + ], + [ + "Richard B. Parker", + "Ambassador", + "1978", + "1979" + ], + [ + "Angier Biddle Duke", + "Ambassador", + "1979", + "1981" + ], + [ + "Joseph Verner Reed, Jr.", + "Ambassador", + "1981", + "1985" + ], + [ + "Thomas Anthony Nassif", + "Ambassador", + "1985", + "1988" + ], + [ + "Michael Ussery", + "Ambassador", + "1988", + "1991" + ], + [ + "Frederick Vreeland", + "Ambassador", + "1991", + "1993" + ], + [ + "Marc Charles Ginsberg", + "Ambassador", + "1994", + "1997" + ], + [ + "Gary S. Usrey", + "Chargé d'Affaires", + "1997", + "1998" + ], + [ + "Edward M. Gabriel", + "Ambassador", + "1998", + "2001" + ], + [ + "Margaret D. Tutwiler", + "Ambassador", + "2001", + "2003" + ], + [ + "Thomas Riley", + "Ambassador", + "2004", + "2009" + ], + [ + "Samuel L. Kaplan", + "Ambassador", + "2009", + "2013" + ], + [ + "Matthew Lussenhop", + "Chargé d'Affaires", + "2013", + "2014" + ], + [ + "Dwight L. Bush Sr.", + "Ambassador", + "2014", + "2017" + ] + ], + "title": "", + "original_id": "70d9755a3802ad91ea099532f8465915" + }, + { + "_id": "7b8344c6a1edd4a9ebfe522b88058701", + "header": [ + "party", + "pr seats", + "district seats", + "total elected 2001", + "total seats" + ], + "rows": [ + [ + "liberal democratic party", + "20", + "45", + "65", + "111" + ], + [ + "democratic party", + "8", + "18", + "26", + "59" + ], + [ + "new komeito party", + "8", + "5", + "13", + "23" + ], + [ + "liberal party", + "4", + "2", + "6", + "8" + ], + [ + "communist party", + "4", + "1", + "5", + "20" + ], + [ + "social democratic party", + "3", + "0", + "3", + "8" + ], + [ + "new conservative party", + "1", + "0", + "1", + "5" + ], + [ + "others", + "0", + "2", + "2", + "2" + ], + [ + "independents", + "0", + "0", + "0", + "4" + ], + [ + "total", + "48", + "73", + "121", + "247" + ] + ], + "title": "", + "original_id": "e7b71d1c7427df2a8dd74f7b599ff66e" + }, + { + "_id": "bce9ccee41e9adcf156e7dc16133c22b", + "header": [ + "type", + "beam height (mm)", + "flange width (mm)", + "web thickness (mm)", + "flange thickness (mm)", + "weight (kg / m)", + "cross - section area (cm 2 )", + "moment of inertia in torsion (j) (cm 4 )" + ], + "rows": [ + [ + "ismb 80", + "80", + "46", + "3.8", + "5.2", + "6.0", + "7.64", + "0.7" + ], + [ + "ismb 100", + "100", + "55", + "4.1", + "5.7", + "8.1", + "10.3", + "1.1" + ], + [ + "ismb 120", + "120", + "70", + "4.4", + "6.3", + "10.4", + "13.2", + "1.71" + ], + [ + "ismb 140", + "140", + "73", + "4.7", + "6.9", + "12.9", + "16.4", + "2.54" + ], + [ + "ismb 750 137", + "753", + "263", + "11.5", + "17.0", + "137.0", + "175.0", + "137.1" + ], + [ + "ismb 750 147", + "753", + "265", + "13.2", + "17.0", + "147.0", + "188.0", + "161.5" + ], + [ + "ismb 750 173", + "762", + "267", + "14.4", + "21.6", + "173.0", + "221.0", + "273.6" + ] + ], + "title": "", + "original_id": "7341c70da411447ef71639df09d1b994" + }, + { + "_id": "77fc281bd9c327b12cda36d32692030d", + "header": [ + "draw", + "singer", + "song", + "points", + "place" + ], + "rows": [ + [ + "1", + "manjola nallbani", + "kjo botë merr frymë nga dashuria", + "27", + "7" + ], + [ + "2", + "produkt 28", + "30 sekonda", + "3", + "15" + ], + [ + "3", + "eneida tarifa", + "e para letër", + "11", + "10" + ], + [ + "4", + "mariza ikonomi", + "mall i tretur", + "20", + "9" + ], + [ + "5", + "greta koçi", + "natën të kërkova", + "35", + "6" + ], + [ + "6", + "flaka krelani & doruntina disha", + "jeta kërkon dashuri", + "57", + "2" + ], + [ + "7", + "mira konçi & redon makashi", + "nën një qiell", + "37", + "5" + ], + [ + "8", + "kthjellu", + "dhoma", + "9", + "11" + ], + [ + "9", + "kozma dushi", + "tatuazh në kujtesë", + "1", + "16" + ], + [ + "10", + "devis xherahu", + "endacaku", + "0", + "17" + ], + [ + "11", + "teuta kurti", + "qyteti i dashurisë", + "3", + "14" + ], + [ + "12", + "samanta karavello", + "pse u harrua dashuria", + "23", + "8" + ], + [ + "13", + "juliana pasha", + "një qiell të ri", + "54", + "3" + ], + [ + "14", + "agim poshka", + "kujt i them të dua", + "8", + "12" + ], + [ + "15", + "jonida maliqi", + "s'ka fajtor në dashuri", + "36", + "4" + ], + [ + "16", + "olta boka", + "zemrën e lamë peng", + "67", + "1" + ], + [ + "17", + "rosela gjylbegu", + "po lind një yll", + "8", + "13" + ] + ], + "title": "", + "original_id": "3ca51f974a30120a84a22b6e72b818ba" + }, + { + "_id": "85eb3edf34d3c98f185ec1921f84eeaf", + "header": [ + "polling firm", + "date of polling", + "link", + "progressive conservative", + "liberal", + "new democratic" + ], + "rows": [ + [ + "corporate research associates", + "september 29 - october 3 , 2011", + "html", + "59", + "16", + "25" + ], + [ + "environics", + "september 29 - october 4 , 2011", + "html", + "54", + "13", + "33" + ], + [ + "marketquest omnifacts research", + "september 28 - 30 , 2011", + "html", + "54", + "13", + "33" + ], + [ + "marketquest omnifacts research", + "september 16 - 19 , 2011", + "html", + "53", + "18", + "29" + ], + [ + "corporate research associates", + "august 15 - 31 , 2011", + "pdf", + "54", + "22", + "24" + ], + [ + "corporate research associates", + "may 11 - 28 , 2011", + "pdf", + "57", + "22", + "20" + ], + [ + "corporate research associates", + "february 10 - 28 , 2011", + "pdf", + "73", + "18", + "8" + ], + [ + "corporate research associates", + "november 9 - 30 , 2010", + "pdf", + "75", + "16", + "8" + ], + [ + "corporate research associates", + "august 10 - 30 , 2010", + "pdf", + "76", + "17", + "7" + ], + [ + "corporate research associates", + "may 11 - 31 , 2010", + "pdf", + "75", + "16", + "8" + ], + [ + "corporate research associates", + "february 9 - 25 , 2010", + "pdf", + "80", + "15", + "5" + ], + [ + "corporate research associates", + "november 5 - 22 , 2009", + "pdf", + "77", + "16", + "7" + ], + [ + "corporate research associates", + "august 11 - 29 , 2009", + "pdf", + "77", + "15", + "8" + ], + [ + "corporate research associates", + "may 12 - 30 , 2009", + "pdf", + "72", + "19", + "8" + ], + [ + "corporate research associates", + "february 11 - 28 , 2009", + "pdf", + "71", + "22", + "7" + ], + [ + "corporate research associates", + "november 5 - december 2 , 2008", + "pdf", + "72", + "19", + "9" + ], + [ + "corporate research associates", + "august 12 - 30 , 2008", + "pdf", + "78", + "14", + "7" + ], + [ + "corporate research associates", + "may 8 - june 1 , 2008", + "pdf", + "77", + "13", + "8" + ], + [ + "corporate research associates", + "february 12 - march 4 , 2008", + "pdf", + "79", + "14", + "6" + ], + [ + "corporate research associates", + "november 9 - december 3 , 2007", + "pdf", + "82", + "12", + "7" + ] + ], + "title": "", + "original_id": "3e1a5d8854ccc78754eb3badc950a684" + }, + { + "_id": "ea12962d63f3eedbd9606781dcaf0479", + "header": [ + "club", + "played", + "drawn", + "lost", + "points for", + "points against", + "points difference", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + "rows": [ + [ + "club", + "played", + "drawn", + "lost", + "points for", + "points against", + "points difference", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + [ + "wattstown rfc", + "16", + "0", + "0", + "361", + "117", + "+ 244", + "39", + "14", + "5", + "0", + "69" + ], + [ + "bryncethin rfc", + "16", + "0", + "4", + "306", + "184", + "+ 122", + "41", + "26", + "6", + "2", + "56" + ], + [ + "crc caerdydd rfc", + "16", + "0", + "5", + "280", + "197", + "+ 83", + "39", + "23", + "4", + "1", + "49" + ], + [ + "cambrian welfare rfc", + "16", + "1", + "8", + "336", + "209", + "+ 127", + "49", + "20", + "5", + "6", + "41" + ], + [ + "glyncoch rfc", + "16", + "0", + "10", + "206", + "248", + "- 42", + "25", + "31", + "1", + "6", + "31" + ], + [ + "llanrumney rfc", + "16", + "1", + "10", + "277", + "304", + "- 27", + "36", + "38", + "3", + "3", + "28" + ], + [ + "ynysowen rfc", + "16", + "0", + "11", + "240", + "339", + "- 99", + "28", + "49", + "0", + "3", + "23" + ], + [ + "caerau ely rfc", + "16", + "0", + "12", + "163", + "273", + "- 110", + "21", + "33", + "2", + "4", + "22" + ], + [ + "llandrindod wells rfc", + "16", + "0", + "11", + "155", + "453", + "- 298", + "18", + "62", + "0", + "1", + "21" + ] + ], + "title": "", + "original_id": "2d94c83349915e453b125fdda0e30f95" + }, + { + "_id": "c17f809ee30b3b24aea2fc420d8f483f", + "header": [ + "Position", + "Club", + "Played", + "Points", + "Wins", + "Draws", + "Losses", + "Goals for", + "Goals against", + "Goal Difference" + ], + "rows": [ + [ + "1", + "UE Lleida", + "38", + "57+19", + "23", + "11", + "4", + "56", + "20", + "36" + ], + [ + "2", + "Real Valladolid", + "38", + "52+14", + "20", + "12", + "6", + "50", + "30", + "20" + ], + [ + "3", + "Racing de Santander", + "38", + "52+14", + "23", + "6", + "9", + "56", + "38", + "18" + ], + [ + "4", + "RCD Mallorca", + "38", + "50+12", + "21", + "8", + "9", + "57", + "34", + "23" + ], + [ + "5", + "Real Betis", + "38", + "43+5", + "16", + "11", + "11", + "49", + "33", + "16" + ], + [ + "6", + "Real Madrid B", + "38", + "42+4", + "15", + "12", + "11", + "57", + "41", + "16" + ], + [ + "7", + "Atlético Marbella", + "38", + "42+4", + "17", + "8", + "13", + "45", + "41", + "4" + ], + [ + "8", + "Barcelona B", + "38", + "39+1", + "15", + "9", + "14", + "59", + "55", + "4" + ], + [ + "9", + "CP Mérida", + "38", + "39+1", + "13", + "13", + "12", + "43", + "42", + "1" + ], + [ + "10", + "CD Castellón", + "38", + "36-2", + "13", + "10", + "15", + "40", + "45", + "-5" + ], + [ + "11", + "CD Badajoz", + "38", + "36-2", + "14", + "8", + "16", + "37", + "36", + "1" + ], + [ + "12", + "SD Compostela", + "38", + "35-3", + "10", + "15", + "13", + "35", + "39", + "-4" + ], + [ + "13", + "Villarreal CF", + "38", + "34-4", + "13", + "8", + "17", + "38", + "51", + "-14" + ], + [ + "14", + "Palamós CF", + "38", + "33-5", + "12", + "9", + "17", + "33", + "50", + "-17" + ], + [ + "15", + "Athletic de Bilbao B", + "38", + "33-5", + "9", + "15", + "14", + "33", + "34", + "-1" + ], + [ + "16", + "SD Eibar", + "38", + "32-6", + "10", + "12", + "16", + "33", + "44", + "-11" + ], + [ + "17", + "UE Figueres", + "38", + "32-6", + "11", + "10", + "17", + "41", + "59", + "-18" + ], + [ + "18", + "CD Lugo", + "38", + "25-13", + "7", + "11", + "20", + "23", + "41", + "-18" + ], + [ + "19", + "Sestao", + "38", + "24-14", + "7", + "10", + "21", + "29", + "54", + "-25" + ], + [ + "20", + "CE Sabadell FC 1", + "38", + "24-14", + "8", + "8", + "22", + "30", + "57", + "-27" + ] + ], + "title": "", + "original_id": "1c7c310b185c9507faa6e8b0f38a1213" + }, + { + "_id": "172ac017587b75be4bcbff56b96df602", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1", + "Russia", + "17", + "5", + "5", + "27" + ], + [ + "2", + "Bulgaria", + "5", + "2", + "3", + "10" + ], + [ + "3", + "Belarus", + "2", + "4", + "2", + "8" + ], + [ + "4", + "Ukraine", + "1", + "2", + "11", + "14" + ], + [ + "5", + "Kazakhstan", + "1", + "1", + "3", + "5" + ], + [ + "6", + "Latvia", + "1", + "0", + "0", + "1" + ], + [ + "7", + "Uzbekistan", + "0", + "3", + "4", + "7" + ], + [ + "8", + "Lithuania", + "0", + "1", + "6", + "7" + ], + [ + "8", + "Venezuela", + "0", + "3", + "3", + "6" + ], + [ + "9", + "Mongolia", + "0", + "2", + "4", + "6" + ], + [ + "10", + "Armenia", + "0", + "1", + "3", + "4" + ], + [ + "11", + "Japan", + "0", + "0", + "3", + "3" + ], + [ + "12", + "Estonia", + "0", + "0", + "2", + "2" + ], + [ + "13", + "Azerbaijan", + "0", + "1", + "0", + "1" + ], + [ + "13", + "France", + "0", + "1", + "0", + "1" + ], + [ + "13", + "Germany", + "0", + "1", + "0", + "1" + ], + [ + "13", + "Romania", + "0", + "1", + "0", + "1" + ], + [ + "17", + "Serbia", + "0", + "0", + "1", + "1" + ], + [ + "17", + "Spain", + "0", + "0", + "1", + "1" + ], + [ + "17", + "Tajikistan", + "0", + "0", + "1", + "1" + ], + [ + "17", + "Turkmenistan", + "0", + "0", + "1", + "1" + ], + [ + "21", + "Algeria", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Austria", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Belgium", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Cameroon", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Canada", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Colombia", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Czech Republic", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Cyprus", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Ecuador", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Finland", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Great Britain", + "0", + "0", + "0", + "0" + ], + [ + "21", + "India", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Indonesia", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Ireland", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Israel", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Italy", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Jordan", + "0", + "0", + "0", + "0" + ], + [ + "21", + "South Korea", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Kyrgyzstan", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Lebanon", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Malaysia", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Morocco", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Moldova", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Nepal", + "0", + "0", + "0", + "0" + ], + [ + "21", + "New Zealand", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Pakistan", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Panama", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Peru", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Poland", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Syria", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Slovenia", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Slovakia", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Thailand", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Tunisia", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Turkey", + "0", + "0", + "0", + "0" + ], + [ + "21", + "United States", + "0", + "0", + "0", + "0" + ], + [ + "21", + "Yemen", + "0", + "0", + "0", + "0" + ], + [ + "Total", + "Total", + "27", + "27", + "54", + "108" + ] + ], + "title": "", + "original_id": "c2f777e603e02e71156416f9065b55f5" + }, + { + "_id": "6d46f3235c2a39767f6b9b721cfb742c", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "south korea", + "11", + "1", + "1", + "13" + ], + [ + "2", + "spain", + "3", + "1", + "2", + "6" + ], + [ + "3", + "chinese taipei", + "1", + "1", + "2", + "4" + ], + [ + "4", + "france", + "1", + "0", + "1", + "2" + ], + [ + "5", + "turkey", + "0", + "2", + "3", + "5" + ], + [ + "6", + "mexico", + "0", + "2", + "2", + "4" + ], + [ + "7", + "canada", + "0", + "2", + "1", + "3" + ], + [ + "7", + "greece", + "0", + "2", + "1", + "3" + ], + [ + "9", + "brazil", + "0", + "2", + "0", + "2" + ], + [ + "10", + "venezuela", + "0", + "1", + "1", + "2" + ], + [ + "11", + "denmark", + "0", + "1", + "0", + "1" + ], + [ + "11", + "indonesia", + "0", + "1", + "0", + "1" + ], + [ + "13", + "united states", + "0", + "0", + "4", + "4" + ], + [ + "14", + "egypt", + "0", + "0", + "2", + "2" + ], + [ + "14", + "germany", + "0", + "0", + "2", + "2" + ], + [ + "16", + "argentina", + "0", + "0", + "1", + "1" + ], + [ + "16", + "colombia", + "0", + "0", + "1", + "1" + ], + [ + "16", + "cyprus", + "0", + "0", + "1", + "1" + ], + [ + "16", + "finland", + "0", + "0", + "1", + "1" + ], + [ + "16", + "malaysia", + "0", + "0", + "1", + "1" + ], + [ + "16", + "netherlands", + "0", + "0", + "1", + "1" + ], + [ + "16", + "nigeria", + "0", + "0", + "1", + "1" + ], + [ + "16", + "philippines", + "0", + "0", + "1", + "1" + ], + [ + "16", + "puerto rico", + "0", + "0", + "1", + "1" + ], + [ + "16", + "sweden", + "0", + "0", + "1", + "1" + ], + [ + "total", + "total", + "16", + "16", + "32", + "64" + ] + ], + "title": "", + "original_id": "78f1a1ec29ac20f339fbc3fb396b02d1" + }, + { + "_id": "ea149d1de2e24a191ced6d9cf9856484", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "germany", + "45", + "33", + "28", + "106" + ], + [ + "2", + "switzerland", + "39", + "35", + "32", + "106" + ], + [ + "3", + "italy", + "18", + "18", + "6", + "42" + ], + [ + "4", + "united states", + "12", + "20", + "31", + "63" + ], + [ + "5", + "west germany", + "11", + "13", + "12", + "36" + ], + [ + "6", + "canada", + "11", + "11", + "12", + "34" + ], + [ + "7", + "east germany", + "8", + "9", + "8", + "25" + ], + [ + "8", + "great britain", + "7", + "6", + "4", + "17" + ], + [ + "9", + "austria", + "6", + "11", + "14", + "31" + ], + [ + "10", + "russia", + "2", + "5", + "4", + "11" + ], + [ + "11", + "romania", + "2", + "2", + "2", + "6" + ], + [ + "12", + "latvia", + "2", + "1", + "1", + "4" + ], + [ + "13", + "belgium", + "1", + "1", + "1", + "3" + ], + [ + "14", + "france", + "1", + "0", + "4", + "5" + ], + [ + "15", + "new zealand", + "1", + "0", + "1", + "2" + ], + [ + "16", + "czechoslovakia", + "0", + "2", + "0", + "2" + ], + [ + "17", + "sweden", + "0", + "0", + "2", + "2" + ], + [ + "17", + "soviet union", + "0", + "0", + "2", + "2" + ], + [ + "19", + "spain", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "56af57cfe3097874ce49535911e9f039" + }, + { + "_id": "8cbfb25294dbe450ef71bad2d6871168", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "italy", + "5", + "4", + "2", + "11" + ], + [ + "2", + "france", + "3", + "3", + "5", + "11" + ], + [ + "3", + "egypt", + "2", + "0", + "2", + "4" + ], + [ + "4", + "algeria", + "1", + "4", + "4", + "9" + ], + [ + "5", + "tunisia", + "1", + "1", + "5", + "7" + ], + [ + "6", + "turkey", + "1", + "1", + "0", + "2" + ], + [ + "7", + "slovenia", + "1", + "0", + "1", + "2" + ], + [ + "8", + "serbia and montenegro", + "0", + "1", + "2", + "3" + ], + [ + "9", + "spain", + "0", + "0", + "5", + "5" + ], + [ + "10 =", + "greece", + "0", + "0", + "1", + "1" + ], + [ + "10 =", + "morocco", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "0024501faeb895ca098242a0af2f822a" + }, + { + "_id": "0aefaea311e276834b8a2feb8b83fce0", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "united states", + "50", + "41", + "32", + "123" + ], + [ + "2", + "great britain", + "18", + "23", + "20", + "61" + ], + [ + "3", + "italy", + "14", + "15", + "16", + "45" + ], + [ + "4", + "australia", + "12", + "11", + "7", + "30" + ], + [ + "5", + "rhodesia", + "10", + "5", + "2", + "17" + ], + [ + "6", + "south africa", + "8", + "8", + "3", + "19" + ], + [ + "7", + "israel", + "7", + "3", + "11", + "21" + ], + [ + "8", + "argentina", + "6", + "15", + "16", + "37" + ], + [ + "9", + "west germany", + "5", + "2", + "5", + "12" + ], + [ + "10", + "netherlands", + "4", + "6", + "4", + "14" + ] + ], + "title": "", + "original_id": "3e8c9ae6880c285746e8344707583b81" + }, + { + "_id": "9cc840450f05ae843c204d94dba19c02", + "header": [ + "club", + "played", + "drawn", + "lost", + "points for", + "points against", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + "rows": [ + [ + "club", + "played", + "drawn", + "lost", + "points for", + "points against", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + [ + "llandeilo rfc", + "22", + "1", + "0", + "917", + "119", + "136", + "14", + "19", + "0", + "105" + ], + [ + "brynamman rfc", + "22", + "1", + "2", + "821", + "210", + "116", + "27", + "16", + "2", + "96" + ], + [ + "tenby united rfc", + "22", + "0", + "8", + "562", + "461", + "78", + "61", + "10", + "1", + "67" + ], + [ + "pembroke dock harlequins rfc", + "22", + "0", + "8", + "423", + "351", + "56", + "40", + "7", + "3", + "66" + ], + [ + "pontarddulais rfc", + "22", + "1", + "9", + "550", + "503", + "79", + "68", + "11", + "5", + "66" + ], + [ + "betws rfc", + "22", + "1", + "9", + "528", + "440", + "72", + "63", + "9", + "0", + "59" + ], + [ + "trimsaran rfc", + "22", + "0", + "12", + "471", + "540", + "68", + "77", + "7", + "1", + "48" + ], + [ + "pembroke rfc", + "22", + "0", + "13", + "467", + "500", + "69", + "66", + "8", + "4", + "48" + ], + [ + "burry port rfc", + "22", + "1", + "14", + "373", + "688", + "47", + "99", + "3", + "2", + "31" + ], + [ + "hendy rfc", + "22", + "0", + "17", + "292", + "707", + "38", + "109", + "1", + "6", + "27" + ], + [ + "tycroes rfc", + "22", + "0", + "18", + "267", + "645", + "35", + "89", + "3", + "3", + "18" + ], + [ + "cwmgors rfc", + "22", + "1", + "19", + "211", + "718", + "28", + "109", + "2", + "3", + "15" + ] + ], + "title": "", + "original_id": "d7b545735f844944b02b05fe0343cb44" + }, + { + "_id": "e5c305305240101dfdb0493fbb4004dc", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1", + "China", + "63", + "46", + "32", + "141" + ], + [ + "2", + "Great Britain", + "35", + "30", + "29", + "94" + ], + [ + "3", + "Canada", + "28", + "19", + "25", + "72" + ], + [ + "4", + "United States", + "27", + "22", + "39", + "88" + ], + [ + "5", + "Australia", + "26", + "38", + "36", + "100" + ], + [ + "6", + "Ukraine", + "24", + "12", + "19", + "55" + ], + [ + "7", + "Spain", + "20", + "27", + "24", + "71" + ], + [ + "8", + "Germany", + "19", + "28", + "31", + "78" + ], + [ + "9", + "France", + "18", + "26", + "30", + "74" + ], + [ + "10", + "Japan", + "17", + "16", + "20", + "53" + ] + ], + "title": "", + "original_id": "6197fb264f5bffbbaadd753cde55c2e5" + }, + { + "_id": "dfcb133d13839c18df15ebaa338a7918", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1", + "Venezuela", + "9", + "8", + "6", + "23" + ], + [ + "2", + "Guatemala", + "6", + "6", + "6", + "18" + ], + [ + "3", + "Peru", + "5", + "8", + "9", + "22" + ], + [ + "4", + "Chile", + "4", + "4", + "1", + "9" + ], + [ + "5", + "El Salvador", + "4", + "0", + "2", + "6" + ], + [ + "6", + "Ecuador", + "2", + "5", + "1", + "8" + ], + [ + "7", + "Bolivia", + "2", + "1", + "2", + "5" + ], + [ + "8", + "Dominican Republic", + "1", + "0", + "2", + "3" + ], + [ + "9", + "Colombia", + "0", + "1", + "3", + "4" + ], + [ + "Total", + "Total", + "33", + "33", + "32", + "98" + ] + ], + "title": "", + "original_id": "04b30155112a315590a58ffe5fcd4a0b" + }, + { + "_id": "a51a16fd045d8c94feba814c64300a8e", + "header": [ + "season", + "series", + "races", + "wins", + "poles", + "f / laps", + "podiums", + "points", + "position" + ], + "rows": [ + [ + "2007", + "formula first manfeild winter series", + "3", + "0", + "0", + "1", + "1", + "170", + "14th" + ], + [ + "2007 - 08", + "oem supply nz formula first championship", + "24", + "4", + "1", + "5", + "18", + "1368", + "3rd" + ], + [ + "2008", + "formula ford manfeild winter series", + "9", + "5", + "1", + "3", + "7", + "610", + "3rd" + ], + [ + "2008", + "australian formula ford championship", + "2", + "0", + "0", + "0", + "0", + "0", + "nc" + ], + [ + "2008 - 09", + "mta formula ford championship", + "21", + "11", + "3", + "4", + "15", + "1215", + "1st" + ], + [ + "2009", + "australian formula ford championship", + "16", + "1", + "0", + "2", + "6", + "164", + "6th" + ], + [ + "2009", + "adac formel masters", + "6", + "0", + "1", + "0", + "2", + "52", + "8th" + ], + [ + "2009", + "toyota racing series - hamilton 400 trophy", + "2", + "2", + "2", + "1", + "2", + "150", + "1st" + ], + [ + "2010", + "adac formel masters", + "18", + "12", + "2", + "9", + "17", + "315", + "1st" + ], + [ + "2010", + "michelin formula renault winter cup", + "6", + "1", + "0", + "1", + "3", + "99", + "5th" + ], + [ + "2010", + "toyota racing series", + "6", + "1", + "0", + "2", + "3", + "362", + "10th" + ], + [ + "2011", + "german formula three championship", + "18", + "13", + "10", + "8", + "16", + "181", + "1st" + ], + [ + "2011", + "gp3 series", + "4", + "1", + "0", + "0", + "1", + "7", + "20th" + ], + [ + "2012", + "formula renault 3.5 series", + "5", + "0", + "0", + "0", + "0", + "8", + "22nd" + ] + ], + "title": "", + "original_id": "c73a6bab38248ecb331733bcd07ebde8" + }, + { + "_id": "e1fc3c8a16aef1606c9fc167b3995d23", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1", + "Puerto Rico", + "17", + "27", + "13", + "57" + ], + [ + "2", + "Bahamas", + "17", + "15", + "19", + "51" + ], + [ + "3", + "México", + "9", + "9", + "5", + "23" + ], + [ + "4", + "Jamaica", + "8", + "6", + "4", + "18" + ], + [ + "5", + "Barbados", + "7", + "3", + "6", + "16" + ], + [ + "6", + "Trinidad and Tobago", + "7", + "2", + "2", + "11" + ], + [ + "7", + "Venezuela", + "3", + "3", + "8", + "14" + ], + [ + "8", + "Colombia", + "3", + "1", + "2", + "6" + ], + [ + "9", + "U.S. Virgin Islands", + "1", + "1", + "3", + "5" + ], + [ + "10", + "Martinique", + "1", + "1", + "0", + "2" + ], + [ + "11", + "Antigua and Barbuda", + "1", + "0", + "1", + "2" + ], + [ + "12", + "Suriname", + "1", + "0", + "0", + "1" + ], + [ + "13", + "Bermuda", + "0", + "4", + "2", + "6" + ], + [ + "14", + "Dominican Republic", + "0", + "2", + "4", + "6" + ], + [ + "15", + "Panamá", + "0", + "1", + "2", + "3" + ], + [ + "16", + "Cayman Islands", + "0", + "0", + "2", + "2" + ], + [ + "16", + "Saint Kitts and Nevis", + "0", + "0", + "2", + "2" + ] + ], + "title": "", + "original_id": "a1e8eb2edd205ca85ff3310d4a0ad0eb" + }, + { + "_id": "9a75b6be6fbf1ee44bde75c1a1e3c58d", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "cuba", + "7", + "4", + "3", + "14" + ], + [ + "2", + "venezuela", + "6", + "6", + "4", + "16" + ], + [ + "3", + "jamaica", + "5", + "3", + "5", + "13" + ], + [ + "4", + "mexico", + "3", + "4", + "5", + "12" + ], + [ + "5", + "colombia", + "3", + "0", + "4", + "7" + ], + [ + "6", + "puerto rico", + "1", + "4", + "4", + "9" + ], + [ + "7", + "netherlands antilles", + "1", + "1", + "0", + "2" + ], + [ + "8", + "bahamas", + "1", + "0", + "1", + "2" + ], + [ + "9", + "guyana", + "1", + "1", + "0", + "2" + ], + [ + "10", + "guatemala", + "1", + "0", + "0", + "1" + ], + [ + "11", + "panama", + "0", + "3", + "1", + "4" + ], + [ + "12", + "trinidad and tobago", + "0", + "2", + "2", + "4" + ], + [ + "13", + "barbados", + "0", + "1", + "0", + "1" + ] + ], + "title": "", + "original_id": "b991baa4ea3f9da3acf4bea043fd5b4d" + }, + { + "_id": "36692a3457bb6dd0e93d0a909c129c2e", + "header": [ + "player", + "matches", + "innings", + "runs", + "average", + "highest score", + "100s", + "50s" + ], + "rows": [ + [ + "lionel palairet", + "10", + "19", + "560", + "31.11", + "100", + "1", + "5" + ], + [ + "john challen", + "9", + "16", + "354", + "25.28", + "89", + "0", + "2" + ], + [ + "richard palairet", + "10", + "17", + "266", + "19.0", + "74", + "0", + "1" + ], + [ + "herbie hewett", + "12", + "22", + "388", + "18.47", + "65", + "0", + "2" + ], + [ + "sammy woods", + "11", + "19", + "330", + "18.33", + "50", + "0", + "1" + ], + [ + "bill roe", + "7", + "12", + "168", + "15.27", + "36", + "0", + "0" + ], + [ + "crescens robinson", + "11", + "17", + "196", + "14.0", + "55", + "0", + "1" + ], + [ + "vernon hill", + "9", + "15", + "184", + "12.26", + "31", + "0", + "0" + ], + [ + "george nichols", + "12", + "21", + "216", + "10.28", + "37", + "0", + "0" + ], + [ + "ted tyler", + "12", + "20", + "168", + "9.88", + "62", + "0", + "1" + ] + ], + "title": "", + "original_id": "9280930f516f9e7e740df6336b2c327a" + }, + { + "_id": "49c899ca783137eb905a89d5d7492de2", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "canada", + "1", + "1", + "2", + "4" + ], + [ + "2", + "lebanon", + "1", + "1", + "0", + "2" + ], + [ + "3", + "bulgaria", + "1", + "0", + "1", + "2" + ], + [ + "4", + "benin", + "1", + "0", + "0", + "1" + ], + [ + "4", + "quebec", + "1", + "0", + "0", + "1" + ], + [ + "4", + "cape verde", + "1", + "0", + "0", + "1" + ], + [ + "4", + "ivory coast", + "1", + "0", + "0", + "1" + ], + [ + "8", + "vietnam", + "0", + "2", + "0", + "2" + ], + [ + "9", + "central african republic", + "0", + "1", + "0", + "1" + ], + [ + "9", + "french community of belgium", + "0", + "1", + "0", + "1" + ], + [ + "9", + "niger", + "0", + "1", + "0", + "1" + ], + [ + "9", + "democratic republic of the congo", + "0", + "1", + "0", + "1" + ], + [ + "9", + "republic of the congo", + "0", + "1", + "0", + "1" + ], + [ + "14", + "cameroon", + "0", + "0", + "1", + "1" + ], + [ + "14", + "madagascar", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "daa1e132c435be7e111cbe2363bb2c23" + }, + { + "_id": "a751632a695262f1c230b6108b7a9712", + "header": [ + "Unnamed: 0", + "1948", + "1952", + "1956", + "1960", + "1964" + ], + "rows": [ + [ + "all voters", + "50.0", + "45.0", + "42", + "50", + "61" + ], + [ + "White", + "50.0", + "43.0", + "41", + "49", + "59" + ], + [ + "Black", + "50.0", + "79.0", + "61", + "68", + "94" + ], + [ + "College educated", + "22.0", + "34.0", + "31", + "39", + "52" + ], + [ + "High School educated", + "51.0", + "45.0", + "42", + "52", + "62" + ], + [ + "Grade School educated", + "64.0", + "52.0", + "50", + "55", + "66" + ], + [ + "Professional & Business", + "19.0", + "36.0", + "32", + "42", + "54" + ], + [ + "White Collar", + "47.0", + "40.0", + "37", + "48", + "57" + ], + [ + "Manual worker", + "66.0", + "55.0", + "50", + "60", + "71" + ], + [ + "Farmer", + "60.0", + "33.0", + "46", + "48", + "53" + ], + [ + "Union member", + "76.0", + null, + "51", + "62", + "77" + ], + [ + "Not union", + "42.0", + null, + "35", + "44", + "56" + ], + [ + "Protestant", + "43.0", + "37.0", + "37", + "38", + "55" + ], + [ + "Catholic", + "62.0", + "56.0", + "51", + "78", + "76" + ], + [ + "Republican", + null, + "8.0", + "4", + "5", + "20" + ], + [ + "Independent", + null, + "35.0", + "30", + "43", + "56" + ], + [ + "Democrat", + null, + "77.0", + "85", + "84", + "87" + ], + [ + "East", + "48.0", + "45.0", + "40", + "53", + "68" + ], + [ + "Midwest", + "50.0", + "42.0", + "41", + "48", + "61" + ], + [ + "West", + "49.0", + "42.0", + "43", + "49", + "60" + ], + [ + "South", + "53.0", + "51.0", + "49", + "51", + "52" + ] + ], + "title": "", + "original_id": "1b9e6880bae6250d652f23b7ae3c9102" + }, + { + "_id": "09b76abab984f6b85b66e98a3561eea8", + "header": [ + "shirt number", + "player name", + "games played", + "total points", + "2 - points", + "3 - points", + "free throw" + ], + "rows": [ + [ + "11", + "alpha ibrahim koroma", + "5", + "31", + "30", + "0", + "1" + ], + [ + "12", + "alpha jalloh", + "5", + "17", + "16", + "0", + "1" + ], + [ + "13", + "samuel juah", + "3", + "7", + "6", + "0", + "1" + ], + [ + "14", + "abdulai bangura", + "2", + "4", + "4", + "0", + "0" + ], + [ + "15", + "ibrahim jalloh", + "5", + "6", + "6", + "0", + "0" + ], + [ + "17", + "ibrahim kallon", + "4", + "6", + "2", + "3", + "1" + ], + [ + "18", + "ibrahim bakarr kamara", + "3", + "2", + "2", + "0", + "0" + ], + [ + "22", + "alpha ambrose kargbo", + "5", + "60", + "42", + "15", + "3" + ], + [ + "33", + "amadu kargbo", + "4", + "14", + "12", + "0", + "2" + ] + ], + "title": "", + "original_id": "d2db16edd343270475522cf1f70b86c6" + }, + { + "_id": "3dccdeae4aee2d2aeb7d095b70b1725e", + "header": [ + "club", + "played", + "drawn", + "lost", + "points for", + "points against", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + "rows": [ + [ + "club", + "played", + "drawn", + "lost", + "points for", + "points against", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + [ + "maesteg rfc", + "22", + "2", + "1", + "615", + "271", + "78", + "24", + "12", + "0", + "92" + ], + [ + "waunarlwydd rfc", + "22", + "1", + "7", + "594", + "359", + "73", + "38", + "10", + "5", + "73" + ], + [ + "bp llandarcy rfc", + "22", + "1", + "7", + "376", + "320", + "43", + "36", + "3", + "5", + "66" + ], + [ + "kidwelly rfc", + "22", + "0", + "9", + "558", + "393", + "68", + "39", + "6", + "6", + "64" + ], + [ + "aberavon quins rfc", + "22", + "0", + "9", + "449", + "424", + "56", + "45", + "6", + "3", + "61" + ], + [ + "ammanford rfc", + "22", + "1", + "10", + "409", + "348", + "45", + "33", + "4", + "8", + "58" + ], + [ + "loughor rfc", + "22", + "1", + "11", + "427", + "479", + "47", + "60", + "5", + "4", + "51" + ], + [ + "aberystwyth rfc", + "22", + "0", + "12", + "390", + "509", + "46", + "71", + "5", + "4", + "49" + ], + [ + "pontyberem rfc", + "22", + "0", + "12", + "353", + "520", + "35", + "67", + "4", + "3", + "47" + ], + [ + "mumbles rfc", + "22", + "1", + "14", + "372", + "471", + "51", + "55", + "5", + "4", + "39" + ], + [ + "pencoed rfc", + "22", + "0", + "19", + "321", + "505", + "34", + "62", + "0", + "10", + "22" + ], + [ + "dunvant rfc", + "22", + "1", + "17", + "324", + "589", + "33", + "79", + "0", + "2", + "20" + ] + ], + "title": "", + "original_id": "8784e31776b33c2a8c9988602a50dabc" + }, + { + "_id": "bec0e2bb45a20a7286686456e1f8df3c", + "header": [ + "year", + "starts", + "wins", + "top 5", + "top 10", + "poles", + "avg start", + "avg finish", + "winnings", + "position", + "team (s)" + ], + "rows": [ + [ + "1983", + "5", + "0", + "0", + "0", + "0", + "25.6", + "30.4", + "8060", + "47th", + "5 sacks & sons" + ], + [ + "1984", + "29", + "0", + "0", + "1", + "0", + "24.3", + "25.1", + "75183", + "19th", + "51 sacks & sons" + ], + [ + "1986", + "8", + "0", + "0", + "1", + "0", + "22.4", + "30.4", + "64810", + "41st", + "10 digard motorsports" + ], + [ + "1987", + "16", + "0", + "0", + "0", + "0", + "23.6", + "29.8", + "54815", + "33rd", + "50 dingman brothers racing" + ], + [ + "1990", + "16", + "0", + "2", + "4", + "1", + "18.6", + "20.8", + "216148", + "32nd", + "17 / 18 / 46 hendrick motorsports" + ], + [ + "1991", + "11", + "0", + "0", + "0", + "0", + "27.5", + "30.4", + "84215", + "39th", + "18 daytona speed inc 47 close racing" + ], + [ + "1992", + "20", + "0", + "0", + "0", + "0", + "23.5", + "25.1", + "178120", + "30th", + "41 larry hedrick motorsports" + ], + [ + "1993", + "19", + "0", + "0", + "1", + "0", + "24.3", + "24.2", + "168055", + "35th", + "9 melling racing 68 tristar motorsports" + ], + [ + "1994", + "31", + "0", + "0", + "3", + "1", + "19.7", + "27.0", + "411728", + "31st", + "77 us motorsports inc" + ], + [ + "1998", + "7", + "0", + "0", + "0", + "0", + "23.6", + "35.3", + "296880", + "53rd", + "98 yarborough - burdette motorsports" + ], + [ + "2004", + "3", + "0", + "0", + "0", + "0", + "36.3", + "41.7", + "154100", + "71st", + "13 daytona speed inc" + ] + ], + "title": "", + "original_id": "3cebc683797d8ddec38b47f86d1c2eb0" + }, + { + "_id": "463041e0bff9d6305e976ac70abfaa87", + "header": [ + "country", + "preliminary", + "interview", + "swimsuit", + "evening gown", + "average" + ], + "rows": [ + [ + "california", + "8.435", + "8.861", + "9.211", + "9.2", + "9.09" + ], + [ + "texas", + "8.671", + "9.322", + "9.177", + "9.3", + "9.266" + ], + [ + "south carolina", + "8.075", + "8.733", + "8.65", + "8.744", + "8.709" + ], + [ + "louisiana", + "8.147", + "8.644", + "8.8", + "8.9", + "8.781" + ], + [ + "north dakota", + "7.949", + "8.955", + "8.3", + "8.422", + "8.559" + ], + [ + "oklahoma", + "7.844", + "8.688", + "8.266", + "8.566", + "8.506" + ], + [ + "nevada", + "8.147", + "8.011", + "8.866", + "8.322", + "8.399" + ], + [ + "washington", + "8.207", + "7.977", + "8.577", + "8.633", + "8.395" + ], + [ + "michigan", + "7.864", + "8.525", + "8.366", + "8.272", + "8.387" + ], + [ + "pennsylvania", + "8.035", + "8.166", + "8.555", + "8.377", + "8.366" + ], + [ + "georgia", + "7.903", + "7.655", + "8.588", + "8.755", + "8.332" + ] + ], + "title": "", + "original_id": "b4f1cccbee7620602901988934f47abf" + }, + { + "_id": "90fb8eccc50c9a24dc0475c2aa657617", + "header": [ + "year", + "indians admitted", + "pakistanis admitted", + "sri lankans admitted", + "bangladeshis admitted", + "nepalis admitted" + ], + "rows": [ + [ + "2000", + "26122", + "14201", + "5849", + "2715", + "247" + ], + [ + "2001", + "27901", + "15353", + "5520", + "3393", + "273" + ], + [ + "2002", + "28838", + "14173", + "4968", + "2615", + "418" + ], + [ + "2003", + "24595", + "12351", + "4448", + "1896", + "440" + ], + [ + "2004", + "25573", + "12793", + "4134", + "3374", + "594" + ], + [ + "2005", + "22141", + "13575", + "4690", + "3940", + "714" + ], + [ + "2006", + "30746", + "12329", + "4490", + "3838", + "640" + ], + [ + "2007", + "26047", + "9545", + "3934", + "2735", + "564" + ], + [ + "2008", + "24548", + "8051", + "4508", + "2716", + "639" + ], + [ + "2009", + "26117", + "6213", + "4270", + "4270", + "627" + ], + [ + "2010", + "30252", + "4986", + "4181", + "4364", + "1502" + ], + [ + "2011", + "24965", + "6073", + "3104", + "2449", + "1249" + ], + [ + "2012", + "28943", + "9931", + "3152", + "2449", + "1311" + ], + [ + "total", + "346788", + "139574", + "57248", + "35856", + "9218" + ] + ], + "title": "", + "original_id": "993a7fd34ef053762ab118cd5ae0a3c0" + }, + { + "_id": "ee595d664aa2e4e1a342514c75adf9dc", + "header": [ + "country / territory", + "area (km square)", + "population", + "pop density ( / km square)", + "gdp millions of usd (2009)", + "gdp per capita usd (2009 - 2011)", + "capital" + ], + "rows": [ + [ + "american samoa", + "199", + "55519", + "326", + "537", + "7874", + "pago pago" + ], + [ + "australia", + "7617930", + "23154782", + "3", + "1515468", + "41500", + "canberra" + ], + [ + "brunei", + "5765", + "407000", + "70", + "14700", + "36700", + "bandar seri begawan" + ], + [ + "cambodia", + "181035", + "14805000", + "82", + "10900", + "800", + "phnom penh" + ], + [ + "china", + "9671018", + "1339530000", + "138", + "7203784", + "6076", + "beijing" + ], + [ + "hong kong", + "1104", + "7055071", + "6390", + "210730", + "30000", + "hong kong" + ], + [ + "indonesia", + "1904569", + "237556363", + "126", + "514900", + "2200", + "jakarta" + ], + [ + "japan", + "377944", + "127470000", + "337", + "5870357", + "39700", + "tokyo" + ], + [ + "north korea", + "120540", + "23906000", + "198", + "27820", + "1200", + "pyongyang" + ], + [ + "south korea", + "100140", + "50062000", + "500", + "800300", + "20000", + "seoul" + ], + [ + "laos", + "236800", + "6320000", + "27", + "5721", + "900", + "vientiane" + ], + [ + "macau", + "29", + "541200", + "18662", + "36428", + "39800", + "macau" + ], + [ + "malaysia", + "329847", + "28318000", + "86", + "191399", + "7525", + "kuala lumpur" + ], + [ + "mongolia", + "1564116", + "2736800", + "2", + "4212", + "1500", + "ulan bator" + ], + [ + "burma", + "676578", + "50496000", + "74", + "26820", + "500", + "naypyidaw" + ], + [ + "new zealand", + "268021", + "4357437", + "16", + "109600", + "25500", + "wellington" + ], + [ + "papua new guinea", + "462840", + "6732000", + "15", + "8200", + "1200", + "port moresby" + ], + [ + "philippines", + "299764", + "91983000", + "307", + "158700", + "1700", + "manila" + ], + [ + "singapore", + "710", + "5183700", + "7023", + "177133", + "35500", + "city of singapore" + ], + [ + "taiwan", + "36191", + "23119772", + "639", + "466054", + "20328", + "taipei" + ], + [ + "thailand", + "513120", + "67764000", + "132", + "263510", + "3900", + "bangkok" + ], + [ + "timor - leste", + "14874", + "1171000", + "76", + "599", + "500", + "dili" + ] + ], + "title": "", + "original_id": "285c59f7f980d49b638f546b5d11d7ef" + }, + { + "_id": "219336322eaf9747d55a0aee4abe2efe", + "header": [ + "ward", + "bello", + "ben - tahir", + "doucet", + "furtenbacher", + "gauthier", + "haydon", + "larter", + "lawrance", + "libweshya", + "liscumb" + ], + "rows": [ + [ + "orlãans", + "51", + "27", + "1918", + "14", + "132", + "939", + "18", + "27", + "6", + "6" + ], + [ + "innes", + "41", + "11", + "1466", + "11", + "105", + "638", + "10", + "7", + "7", + "5" + ], + [ + "barrhaven", + "36", + "32", + "1267", + "6", + "26", + "1305", + "10", + "15", + "4", + "3" + ], + [ + "kanata north", + "23", + "23", + "1222", + "14", + "14", + "704", + "12", + "9", + "3", + "2" + ], + [ + "west carleton - march", + "6", + "5", + "958", + "2", + "10", + "909", + "3", + "8", + "2", + "1" + ], + [ + "stittsville", + "9", + "7", + "771", + "1", + "9", + "664", + "2", + "8", + "2", + "1" + ], + [ + "bay", + "37", + "68", + "2009", + "20", + "38", + "1226", + "20", + "21", + "8", + "8" + ], + [ + "college", + "40", + "32", + "2112", + "13", + "22", + "1632", + "7", + "15", + "6", + "10" + ], + [ + "knoxdale - merivale", + "33", + "47", + "1583", + "17", + "17", + "1281", + "11", + "12", + "4", + "3" + ], + [ + "gloucester - southgate", + "84", + "62", + "1378", + "25", + "39", + "726", + "15", + "20", + "12", + "8" + ], + [ + "beacon hill - cyrville", + "70", + "24", + "1297", + "7", + "143", + "592", + "7", + "10", + "1", + "6" + ], + [ + "rideau - vanier", + "66", + "24", + "2148", + "15", + "261", + "423", + "11", + "14", + "11", + "4" + ], + [ + "rideau - rockcliffe", + "68", + "48", + "1975", + "15", + "179", + "481", + "11", + "19", + "8", + "6" + ], + [ + "somerset", + "47", + "33", + "2455", + "17", + "45", + "326", + "15", + "18", + "12", + "1" + ], + [ + "kitchissippi", + "39", + "21", + "3556", + "12", + "21", + "603", + "10", + "10", + "3", + "6" + ], + [ + "river", + "52", + "57", + "1917", + "16", + "31", + "798", + "11", + "13", + "6", + "4" + ], + [ + "capital", + "40", + "20", + "4430", + "18", + "34", + "369", + "8", + "7", + "7", + "5" + ], + [ + "alta vista", + "58", + "89", + "2114", + "12", + "74", + "801", + "8", + "15", + "5", + "2" + ], + [ + "cumberland", + "39", + "32", + "1282", + "12", + "135", + "634", + "8", + "8", + "5", + "5" + ], + [ + "osgoode", + "15", + "2", + "769", + "8", + "22", + "768", + "5", + "11", + "1", + "4" + ], + [ + "rideau - goulbourn", + "7", + "4", + "898", + "11", + "15", + "1010", + "1", + "7", + "1", + "4" + ], + [ + "gloucester - south nepean", + "36", + "35", + "976", + "9", + "23", + "721", + "10", + "6", + "5", + "5" + ], + [ + "kanata south", + "29", + "26", + "1646", + "24", + "18", + "1354", + "6", + "20", + "3", + "5" + ], + [ + "ward", + "lyrette", + "maguire", + "o'brien", + "pita", + "ryan", + "st arnaud", + "scharf", + "taylor", + "watson", + "wright" + ], + [ + "orlãans", + "14", + "332", + "3937", + "8", + "27", + "17", + "84", + "52", + "8685", + "14" + ], + [ + "innes", + "5", + "229", + "2952", + "9", + "26", + "11", + "44", + "35", + "6746", + "11" + ], + [ + "barrhaven", + "3", + "394", + "3335", + "14", + "20", + "4", + "46", + "46", + "5943", + "19" + ], + [ + "kanata north", + "3", + "209", + "2612", + "10", + "8", + "3", + "35", + "44", + "4516", + "15" + ], + [ + "west carleton - march", + "1", + "297", + "3072", + "2", + "13", + "3", + "28", + "28", + "2746", + "88" + ], + [ + "stittsville", + "2", + "265", + "2884", + "10", + "7", + "6", + "33", + "15", + "3195", + "8" + ], + [ + "bay", + "9", + "299", + "3221", + "8", + "16", + "9", + "82", + "96", + "7220", + "19" + ], + [ + "college", + "4", + "378", + "4249", + "14", + "28", + "8", + "68", + "83", + "7668", + "21" + ], + [ + "knoxdale - merivale", + "8", + "301", + "3269", + "14", + "20", + "1", + "43", + "47", + "5540", + "18" + ], + [ + "gloucester - southgate", + "7", + "288", + "3006", + "16", + "24", + "17", + "46", + "39", + "6107", + "13" + ], + [ + "beacon hill - cyrville", + "9", + "239", + "2329", + "20", + "11", + "15", + "59", + "39", + "5484", + "7" + ], + [ + "rideau - vanier", + "17", + "129", + "1503", + "10", + "11", + "17", + "58", + "58", + "5784", + "21" + ], + [ + "rideau - rockcliffe", + "18", + "139", + "1729", + "16", + "13", + "17", + "55", + "42", + "5850", + "27" + ], + [ + "somerset", + "8", + "126", + "1393", + "12", + "16", + "12", + "59", + "80", + "5164", + "21" + ], + [ + "kitchissippi", + "6", + "211", + "2389", + "13", + "10", + "9", + "56", + "80", + "7034", + "22" + ], + [ + "river", + "9", + "312", + "2875", + "20", + "13", + "8", + "53", + "69", + "6539", + "27" + ], + [ + "capital", + "5", + "140", + "1436", + "12", + "6", + "10", + "35", + "52", + "6543", + "14" + ], + [ + "alta vista", + "9", + "265", + "2672", + "13", + "15", + "8", + "52", + "60", + "6666", + "22" + ], + [ + "cumberland", + "11", + "296", + "3203", + "6", + "25", + "7", + "53", + "40", + "6371", + "12" + ], + [ + "osgoode", + "6", + "441", + "3039", + "6", + "9", + "1", + "48", + "27", + "2844", + "11" + ], + [ + "rideau - goulbourn", + "2", + "649", + "3556", + "6", + "10", + "3", + "36", + "19", + "3359", + "8" + ], + [ + "gloucester - south nepean", + "8", + "247", + "2372", + "12", + "13", + "4", + "33", + "36", + "4759", + "11" + ] + ], + "title": "", + "original_id": "132684d63673e37ed6c5beabaa2d5a43" + }, + { + "_id": "4d1b5f4db902a834810bab29c270d9d7", + "header": [ + "seed", + "rank", + "player", + "points", + "points defending", + "points won", + "new points", + "status" + ], + "rows": [ + [ + "1", + "1", + "rafael nadal", + "12070", + "2000", + "1200", + "11270", + "runner - up , lost to novak djokovic" + ], + [ + "2", + "2", + "novak djokovic", + "12005", + "720", + "2000", + "13285", + "champion , defeated rafael nadal" + ], + [ + "3", + "3", + "roger federer", + "9230", + "360", + "360", + "9230", + "quarterfinals lost to jo - wilfried tsonga" + ], + [ + "4", + "4", + "andy murray", + "6855", + "720", + "720", + "6855", + "semifinals lost to rafael nadal" + ], + [ + "5", + "5", + "robin söderling", + "4595", + "360", + "90", + "4325", + "third round lost to bernard tomic (q)" + ], + [ + "6", + "7", + "tomáš berdych", + "3490", + "1200", + "180", + "2470", + "fourth round lost to mardy fish" + ], + [ + "7", + "6", + "david ferrer", + "4150", + "180", + "180", + "4150", + "fourth round lost to jo - wilfried tsonga" + ], + [ + "8", + "10", + "andy roddick", + "2200", + "180", + "90", + "2110", + "third round lost to feliciano lópez" + ], + [ + "9", + "8", + "gaël monfils", + "2780", + "90", + "90", + "2780", + "third round lost to łukasz kubot (q)" + ], + [ + "10", + "9", + "mardy fish", + "2335", + "45", + "360", + "2650", + "quarterfinals lost rafael nadal" + ], + [ + "11", + "11", + "jürgen melzer", + "2175", + "180", + "90", + "2085", + "third round lost to xavier malisse" + ], + [ + "12", + "19", + "jo - wilfried tsonga", + "1585", + "360", + "720", + "1945", + "semifinals lost to novak djokovic" + ], + [ + "13", + "12", + "viktor troicki", + "1930", + "45", + "45", + "1930", + "second round lost to lu yen - hsun" + ], + [ + "14", + "14", + "stanislas wawrinka", + "1900", + "10", + "45", + "1935", + "second round lost to simone bolelli (ll)" + ], + [ + "15", + "16", + "gilles simon", + "1745", + "90", + "90", + "1745", + "third round lost to juan martín del potro" + ], + [ + "16", + "15", + "nicolás almagro", + "1875", + "10", + "90", + "1955", + "third round lost to mikhail youzhny" + ], + [ + "17", + "13", + "richard gasquet", + "1925", + "0", + "180", + "2105", + "fourth round lost to andy murray" + ], + [ + "18", + "17", + "mikhail youzhny", + "1740", + "45", + "180", + "1875", + "fourth round lost to roger federer" + ], + [ + "19", + "35", + "michaël llodra", + "1195", + "45", + "180", + "1330", + "fourth round lost vs novak djokovic" + ], + [ + "20", + "18", + "florian mayer", + "1600", + "90", + "45", + "1555", + "second round lost to xavier malisse" + ], + [ + "21", + "23", + "fernando verdasco", + "1425", + "10", + "45", + "1460", + "second round lost to robin haase" + ], + [ + "22", + "21", + "alexandr dolgopolov", + "1405", + "45", + "10", + "1370", + "first round lost to fernando gonzález (pr)" + ], + [ + "23", + "29", + "janko tipsarević", + "1305", + "10", + "10", + "1305", + "first round lost to ivo karlović" + ], + [ + "24", + "22", + "juan martín del potro", + "1445", + "0", + "180", + "1625", + "fourth round lost to rafael nadal" + ], + [ + "25", + "20", + "juan ignacio chela", + "1475", + "10", + "45", + "1505", + "second round lost to alex bogomolov , jr" + ], + [ + "26", + "31", + "guillermo garcía - lópez", + "1120", + "10", + "45", + "1155", + "second round lost to karol beck (q)" + ], + [ + "27", + "26", + "marin čilić", + "1345", + "10", + "10", + "1345", + "first round lost to ivan ljubičić" + ], + [ + "28", + "24", + "david nalbandian", + "1425", + "0", + "90", + "1515", + "third round lost to roger federer" + ], + [ + "29", + "27", + "nikolay davydenko", + "1330", + "45", + "10", + "1295", + "first round lost to bernard tomic (q)" + ], + [ + "30", + "28", + "thomaz bellucci", + "1305", + "90", + "10", + "1225", + "first round lost to rainer schüttler" + ], + [ + "31", + "25", + "milos raonic", + "1354", + "0", + "45", + "1399", + "second round lost to gilles müller (wc)" + ] + ], + "title": "", + "original_id": "01029e3c959b99916ea9d73a107a87bf" + }, + { + "_id": "f05438f31426c74c3bff1122635c5e1f", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1.", + "United States", + "8", + "7", + "1", + "16" + ], + [ + "2.", + "Russia", + "7", + "7", + "5", + "19" + ], + [ + "3.", + "France", + "3", + "3", + "2", + "8" + ], + [ + "4.", + "Ethiopia", + "3", + "2", + "2", + "7" + ], + [ + "5.", + "Belarus", + "3", + "1", + "3", + "7" + ], + [ + "6.", + "Sweden", + "2", + "1", + "2", + "5" + ], + [ + "7.", + "Kenya", + "2", + "1", + "1", + "4" + ], + [ + "7=", + "South Africa", + "2", + "1", + "1", + "4" + ], + [ + "9.", + "Morocco", + "2", + "1", + "0", + "3" + ], + [ + "10.", + "Greece", + "1", + "1", + "2", + "4" + ], + [ + "11.", + "Cuba", + "1", + "1", + "0", + "2" + ], + [ + "12.", + "Italy", + "1", + "0", + "2", + "3" + ], + [ + "13.", + "Canada", + "1", + "0", + "1", + "2" + ], + [ + "14.", + "Algeria", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Australia", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Dominican Republic", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Ecuador", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Lithuania", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Mexico", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Mozambique", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Poland", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Qatar", + "1", + "0", + "0", + "1" + ], + [ + "14=", + "Saint Kitts and Nevis", + "1", + "0", + "0", + "1" + ], + [ + "24.", + "Jamaica", + "0", + "4", + "2", + "6" + ], + [ + "25.", + "Spain", + "0", + "3", + "2", + "5" + ], + [ + "26.", + "Hungary", + "0", + "2", + "0", + "2" + ], + [ + "27.", + "Germany", + "0", + "1", + "3", + "4" + ], + [ + "27=", + "Japan", + "0", + "1", + "3", + "4" + ], + [ + "27=", + "Ukraine", + "0", + "1", + "3", + "4" + ], + [ + "30.", + "Great Britain", + "0", + "1", + "2", + "3" + ], + [ + "31.", + "Brazil", + "0", + "1", + "0", + "1" + ], + [ + "31=", + "Cameroon", + "0", + "1", + "0", + "1" + ], + [ + "31=", + "Czech Republic", + "0", + "1", + "0", + "1" + ], + [ + "31=", + "Estonia", + "0", + "1", + "0", + "1" + ], + [ + "31=", + "Ireland", + "0", + "1", + "0", + "1" + ], + [ + "31=", + "Trinidad and Tobago", + "0", + "1", + "0", + "1" + ], + [ + "31=", + "Turkey", + "0", + "1", + "0", + "1" + ], + [ + "38.", + "Bahamas", + "0", + "0", + "3", + "3" + ], + [ + "39.", + "China", + "0", + "0", + "2", + "2" + ], + [ + "40.", + "India", + "0", + "0", + "1", + "1" + ], + [ + "40=", + "Kazakhstan", + "0", + "0", + "1", + "1" + ], + [ + "40=", + "Netherlands", + "0", + "0", + "1", + "1" + ], + [ + "40=", + "Senegal", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "df326b71a2a4177210d685c8bbd6cbf2" + }, + { + "_id": "7ae88a2e90b1abcdae1edb32607ca1ac", + "header": [ + "Unnamed: 0", + "Average population (x 1000)", + "Live births", + "Deaths", + "Natural change", + "Crude birth rate (per 1000)", + "Crude death rate (per 1000)", + "Natural change (per 1000)" + ], + "rows": [ + [ + "1970", + "38", + "761", + "299", + "462", + "20.0", + "7.9", + "12.2" + ], + [ + "1975", + "42", + "857", + "317", + "540", + "20.4", + "7.5", + "12.9" + ], + [ + "1980", + "46", + "996", + "333", + "663", + "21.7", + "7.2", + "14.4" + ], + [ + "1985", + "51", + "1 104", + "370", + "734", + "21.6", + "7.3", + "14.4" + ], + [ + "1990", + "51", + "842", + "360", + "482", + "16.4", + "7.0", + "9.4" + ], + [ + "1991", + "50", + "789", + "335", + "454", + "15.8", + "6.7", + "9.1" + ], + [ + "1992", + "48", + "692", + "401", + "291", + "14.4", + "8.3", + "6.0" + ], + [ + "1993", + "46", + "617", + "448", + "169", + "13.4", + "9.7", + "3.7" + ], + [ + "1994", + "44", + "585", + "518", + "67", + "13.3", + "11.8", + "1.5" + ], + [ + "1995", + "43", + "537", + "501", + "36", + "12.6", + "11.8", + "0.8" + ], + [ + "1996", + "42", + "486", + "441", + "45", + "11.7", + "10.6", + "1.1" + ], + [ + "1997", + "41", + "483", + "374", + "109", + "11.9", + "9.2", + "2.7" + ], + [ + "1998", + "40", + "498", + "368", + "130", + "12.6", + "9.3", + "3.3" + ], + [ + "1999", + "39", + "448", + "376", + "72", + "11.6", + "9.7", + "1.9" + ], + [ + "2000", + "38", + "460", + "438", + "22", + "12.0", + "11.4", + "0.6" + ], + [ + "2001", + "39", + "562", + "438", + "124", + "14.5", + "11.3", + "3.2" + ], + [ + "2002", + "39", + "608", + "397", + "211", + "15.5", + "10.1", + "5.4" + ], + [ + "2003", + "39", + "625", + "386", + "239", + "15.9", + "9.8", + "6.1" + ], + [ + "2004", + "39", + "637", + "345", + "292", + "16.5", + "8.9", + "7.6" + ], + [ + "2005", + "38", + "548", + "369", + "179", + "14.5", + "9.7", + "4.7" + ], + [ + "2006", + "37", + "540", + "347", + "193", + "14.5", + "9.3", + "5.2" + ] + ], + "title": "", + "original_id": "615fe8039d2c84220b9f383b5e287a50" + }, + { + "_id": "b8a6b75aa2ef64973e4d9b662fa6d97f", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1", + "United States (USA)", + "25", + "16", + "7", + "48" + ], + [ + "2", + "Canada (CAN)", + "5", + "4", + "7", + "16" + ], + [ + "3", + "Jamaica (JAM)", + "4", + "3", + "4", + "11" + ], + [ + "4", + "Cuba (CUB)", + "3", + "8", + "4", + "15" + ], + [ + "5", + "Mexico (MEX)", + "0", + "3", + "3", + "6" + ], + [ + "6", + "Brazil (BRA)", + "0", + "2", + "1", + "3" + ], + [ + "7", + "Puerto Rico (PUR)", + "0", + "1", + "1", + "2" + ], + [ + "8", + "Colombia (COL)", + "0", + "0", + "3", + "3" + ], + [ + "9", + "Peru (PER)", + "0", + "0", + "2", + "2" + ], + [ + "9", + "Trinidad and Tobago (TRI)", + "0", + "0", + "2", + "2" + ], + [ + "11", + "Chile (CHI)", + "0", + "0", + "1", + "1" + ], + [ + "11", + "Uruguay (URU)", + "0", + "0", + "1", + "1" + ], + [ + "11", + "Venezuela (VEN)", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "db5d51a82497e56cdd5c4b55ba02f07b" + }, + { + "_id": "e1f95370c65d4c5f3868b7af6359626e", + "header": [ + "season", + "series", + "team", + "races", + "wins", + "poles", + "podiums" + ], + "rows": [ + [ + "2006", + "star of silverstone", + "silverstone motorsport academy", + "2", + "1", + "0", + "2" + ], + [ + "2006", + "formula renault 2.0 uk winter series", + "aka lemac", + "4", + "0", + "0", + "0" + ], + [ + "2007", + "eurocup formula renault 2.0", + "sg drivers project", + "14", + "5", + "4", + "6" + ], + [ + "2007", + "french formula renault 2.0", + "sg formula", + "10", + "2", + "1", + "3" + ], + [ + "2007", + "formula renault 2.0 uk winter series", + "hitech junior team", + "4", + "0", + "0", + "0" + ], + [ + "2008", + "formula 3 euro series", + "art grand prix", + "19", + "1", + "0", + "2" + ], + [ + "2008", + "masters of formula 3", + "art grand prix", + "1", + "0", + "0", + "1" + ], + [ + "2008", + "macau grand prix", + "manor motorsport", + "1", + "0", + "0", + "0" + ], + [ + "2009", + "formula renault 3.5 series", + "comtec racing", + "12", + "1", + "1", + "2" + ], + [ + "2010", + "formula renault 3.5 series", + "fortec motorsport", + "17", + "0", + "1", + "1" + ], + [ + "2011", + "fia formula two championship", + "motorsport vision", + "2", + "0", + "0", + "0" + ], + [ + "2011", + "auto gp", + "super nova racing", + "4", + "1", + "0", + "1" + ], + [ + "2012", + "gp2 series", + "ocean racing technology", + "2", + "0", + "0", + "0" + ], + [ + "2013", + "gp2 series", + "hilmer motorsport", + "6", + "1", + "0", + "2" + ] + ], + "title": "", + "original_id": "991bb7236167d5557333f1dc881d2110" + }, + { + "_id": "47f9359a052cb2dbd9810a17a3f6a5ba", + "header": [ + "rank", + "country (or dependent territory)", + "july 1 , 2013 projection", + "% of pop", + "average relative annual growth (%)", + "average absolute annual growth" + ], + "rows": [ + [ + "1", + "egypt", + "84605000.0", + "22.81", + "2.29", + "1893000" + ], + [ + "2", + "algeria", + "38295000.0", + "10.32", + "2.11", + "792000" + ], + [ + "3", + "iraq", + "35404000.0", + "9.54", + "3.06", + "1051000" + ], + [ + "4", + "sudan", + "35150000.0", + "9.47", + "2.52", + "863000" + ], + [ + "5", + "morocco", + "32950000.0", + "8.88", + "1.08", + "353000" + ], + [ + "6", + "saudi arabia", + "30193000.0", + "8.14", + "3.41", + "997000" + ], + [ + "7", + "yemen", + "25252000.0", + "6.81", + "2.96", + "725000" + ], + [ + "8", + "syria", + "22169000.0", + "5.98", + "2.45", + "531000" + ], + [ + "9", + "tunisia", + "10889000.0", + "2.94", + "1.03", + "111000" + ], + [ + "10", + "somalia", + "9662000.0", + "2.6", + "1.17", + "112000" + ], + [ + "11", + "united arab emirates", + "8659000.0", + "2.33", + "1.56", + "133000" + ], + [ + "12", + "jordan", + "6517000.0", + "1.76", + "2.84", + "180000" + ], + [ + "13", + "libya", + "6323000.0", + "1.7", + "1.56", + "97000" + ], + [ + "14", + "palestine", + "4421000.0", + "1.19", + "2.91", + "125000" + ], + [ + "15", + "lebanon", + "4127000.0", + "1.11", + "1.58", + "64000" + ], + [ + "16", + "oman", + "3942000.0", + "1.06", + "8.8", + "319000" + ], + [ + "17", + "kuwait", + "3852000.0", + "1.04", + "2.94", + "110000" + ], + [ + "18", + "mauritania", + "3461000.0", + "0.93", + "2.58", + "87000" + ], + [ + "19", + "qatar", + "1917000.0", + "0.52", + "3.85", + "71000" + ], + [ + "20", + "bahrain", + "1546000.0", + "0.42", + "7.36", + "106000" + ], + [ + "21", + "djibouti", + "912000.0", + "0.25", + "2.7", + "24000" + ], + [ + "22", + "comoros", + "743000.0", + "0.2", + "2.62", + "19000" + ], + [ + "align = left|total", + "370989000", + "100.0", + "2.42", + "8763000.0", + "29" + ] + ], + "title": "", + "original_id": "29915db5c65f536063c9f0a89349a75b" + }, + { + "_id": "00110373865130e75eb1441a7b250c72", + "header": [ + "position", + "team", + "played", + "wins", + "draws", + "losses", + "scored", + "conceded", + "points" + ], + "rows": [ + [ + "1", + "cerro porteño", + "9", + "5", + "2", + "2", + "14", + "7", + "17" + ], + [ + "2", + "libertad", + "9", + "4", + "4", + "1", + "12", + "4", + "16" + ], + [ + "3", + "12 de octubre", + "9", + "5", + "1", + "3", + "15", + "10", + "16" + ], + [ + "4", + "cerro corá", + "9", + "4", + "2", + "3", + "15", + "14", + "14" + ], + [ + "5", + "san lorenzo", + "9", + "4", + "1", + "4", + "11", + "11", + "13" + ], + [ + "6", + "sportivo luqueño", + "9", + "3", + "4", + "2", + "11", + "12", + "13" + ], + [ + "7", + "guaraní", + "9", + "3", + "1", + "5", + "6", + "9", + "10" + ], + [ + "8", + "sol de américa", + "9", + "2", + "3", + "4", + "11", + "16", + "9" + ], + [ + "9", + "atl colegiales", + "9", + "2", + "3", + "4", + "6", + "11", + "9" + ] + ], + "title": "", + "original_id": "b706776a23c7b8fc4d8036047a48890e" + }, + { + "_id": "7d49fe013eb36603a635956f3fde3e30", + "header": [ + "Year", + "Numer of Jamaicans\ngranted British\ncitizenship", + "Naturalisation\nby residence", + "Naturalisation\nby marriage", + "Registration\nof a minor child", + "Registration\nby other means" + ], + "rows": [ + [ + "1997", + "732", + "327", + "279", + "114", + "12" + ], + [ + "1998", + "1,370", + "571", + "564", + "221", + "14" + ], + [ + "1999", + "1,437", + "678", + "526", + "226", + "7" + ], + [ + "2000", + "1,882", + "927", + "664", + "281", + "10" + ], + [ + "2001", + "2,070", + "1,025", + "710", + "330", + "0" + ], + [ + "2002", + "2,025", + "1,035", + "705", + "285", + "0" + ], + [ + "2003", + "2,795", + "1,285", + "985", + "520", + "5" + ], + [ + "2004", + "3,180", + "1,415", + "1,060", + "640", + "65" + ], + [ + "2005", + "3,515", + "1,585", + "1,080", + "770", + "80" + ], + [ + "2006", + "2,525", + "1,110", + "710", + "655", + "55" + ], + [ + "2007", + "3,165", + "1,575", + "825", + "725", + "45" + ], + [ + "2008", + "2,715", + "1,275", + "695", + "700", + "45" + ] + ], + "title": "", + "original_id": "410a163d2c0672ff88d17cab3cecc0c6" + }, + { + "_id": "cd1c1e4d2fcce4a5257736873da11399", + "header": [ + "position", + "team", + "points", + "played", + "drawn", + "lost", + "against", + "difference" + ], + "rows": [ + [ + "1", + "palestra itália - sp", + "18", + "9", + "0", + "0", + "8", + "25" + ], + [ + "2", + "auto", + "14", + "9", + "0", + "2", + "14", + "11" + ], + [ + "3", + "corinthians", + "13", + "9", + "1", + "2", + "9", + "17" + ], + [ + "4", + "santos", + "11", + "9", + "1", + "3", + "17", + "7" + ], + [ + "5", + "sílex", + "8", + "9", + "2", + "4", + "26", + "- 9" + ], + [ + "6", + "sírio", + "7", + "9", + "1", + "5", + "20", + "1" + ], + [ + "7", + "ypiranga - sp", + "7", + "9", + "1", + "5", + "22", + "- 6" + ], + [ + "8", + "portuguesa", + "7", + "9", + "3", + "4", + "26", + "- 9" + ], + [ + "9", + "aa são bento", + "4", + "9", + "0", + "7", + "31", + "- 22" + ], + [ + "10", + "sc internacional de são paulo", + "1", + "9", + "1", + "8", + "24", + "- 15" + ] + ], + "title": "", + "original_id": "9a37bff1bac90eb54cc51e99d4abef15" + }, + { + "_id": "597384a0e201856e6ffcf1b27cf3af04", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "germany", + "3", + "5", + "4", + "12" + ], + [ + "2", + "hungary", + "6", + "1", + "4", + "11" + ], + [ + "3", + "poland", + "3", + "4", + "3", + "10" + ], + [ + "4", + "spain", + "2", + "2", + "3", + "7" + ], + [ + "5", + "russia", + "3", + "2", + "1", + "6" + ], + [ + "6", + "canada", + "0", + "3", + "2", + "5" + ], + [ + "7", + "romania", + "1", + "1", + "2", + "4" + ], + [ + "8", + "slovakia", + "3", + "0", + "0", + "3" + ], + [ + "9", + "cuba", + "2", + "1", + "0", + "3" + ], + [ + "10", + "bulgaria", + "0", + "1", + "2", + "3" + ], + [ + "11", + "norway", + "1", + "1", + "0", + "2" + ], + [ + "12", + "lithuania", + "1", + "0", + "1", + "2" + ], + [ + "13", + "czech republic", + "0", + "2", + "0", + "2" + ], + [ + "14", + "belarus", + "0", + "1", + "1", + "2" + ], + [ + "15", + "uzbekistan", + "0", + "1", + "1", + "2" + ], + [ + "16", + "italy", + "0", + "0", + "2", + "2" + ], + [ + "17", + "australia", + "1", + "0", + "0", + "1" + ], + [ + "18", + "sweden", + "1", + "0", + "0", + "1" + ], + [ + "19", + "argentina", + "0", + "1", + "0", + "1" + ], + [ + "20", + "china", + "0", + "1", + "0", + "1" + ], + [ + "21", + "ukraine", + "0", + "1", + "0", + "1" + ], + [ + "22", + "israel", + "0", + "0", + "1", + "1" + ], + [ + "total", + "total", + "27", + "27", + "27", + "81" + ] + ], + "title": "", + "original_id": "73cc123cf088d1762671001ecd08190f" + }, + { + "_id": "8e44ca4de88e4f11ef10dd822de486d3", + "header": [ + "season", + "races", + "wins", + "podiums", + "poles", + "fastest laps" + ], + "rows": [ + [ + "2003", + "10", + "0", + "0", + "0", + "0" + ], + [ + "2003", + "5", + "0", + "0", + "0", + "0" + ], + [ + "2004", + "14", + "0", + "0", + "0", + "0" + ], + [ + "2005", + "16", + "1", + "2", + "0", + "0" + ], + [ + "2006", + "14", + "0", + "0", + "0", + "0" + ], + [ + "2007", + "15", + "0", + "0", + "0", + "0" + ], + [ + "2008", + "17", + "4", + "9", + "2", + "4" + ], + [ + "2009", + "16", + "0", + "2", + "1", + "0" + ], + [ + "2010", + "16", + "0", + "0", + "0", + "0" + ], + [ + "2011", + "17", + "0", + "0", + "0", + "0" + ], + [ + "2012", + "16", + "0", + "0", + "0", + "0" + ], + [ + "2013", + "10", + "0", + "0", + "0", + "0" + ], + [ + "total", + "166", + "5", + "13", + "3", + "4" + ] + ], + "title": "", + "original_id": "10d49252c00b82016f0d0b8bfabae105" + }, + { + "_id": "6a5e8a6ec4f7537211b6f2dfeb5c029c", + "header": [ + "hand", + "1 credit", + "2 credits", + "3 credits", + "4 credits", + "5 credits" + ], + "rows": [ + [ + "royal flush", + "250", + "500", + "750", + "1000", + "4000" + ], + [ + "straight flush", + "60", + "120", + "180", + "240", + "400" + ], + [ + "four aces", + "400", + "800", + "1200", + "1600", + "2000" + ], + [ + "four of a kind , 2 - 4", + "100", + "200", + "300", + "400", + "500" + ], + [ + "four of a kind , 5 - k", + "50", + "100", + "150", + "200", + "250" + ], + [ + "full house", + "8", + "16", + "24", + "32", + "40" + ], + [ + "flush", + "5", + "10", + "15", + "20", + "25" + ], + [ + "straight", + "4", + "8", + "12", + "16", + "20" + ], + [ + "three of a kind", + "3", + "6", + "9", + "12", + "15" + ], + [ + "two pair", + "1", + "2", + "3", + "4", + "5" + ], + [ + "jacks or better", + "1", + "2", + "3", + "4", + "5" + ], + [ + "theoretical return", + "98.68%", + "98.68%", + "98.68%", + "98.68%", + "99.92%" + ] + ], + "title": "", + "original_id": "0bf3ab8f74244dfca72c5290d44e6f3e" + }, + { + "_id": "a6f86e8dd171258bb4ade5169e486b7c", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "east germany", + "17", + "4", + "3", + "24" + ], + [ + "2", + "austria", + "12", + "13", + "10", + "35" + ], + [ + "3", + "russia", + "10", + "8", + "7", + "25" + ], + [ + "4", + "great britain", + "6", + "11", + "11", + "28" + ], + [ + "5", + "netherlands", + "6", + "3", + "3", + "12" + ], + [ + "6", + "norway", + "6", + "0", + "0", + "6" + ], + [ + "7", + "france", + "5", + "4", + "4", + "13" + ], + [ + "8", + "italy", + "5", + "2", + "4", + "11" + ], + [ + "9", + "germany", + "2", + "8", + "8", + "18" + ], + [ + "10", + "czechoslovakia", + "2", + "3", + "3", + "8" + ], + [ + "11", + "switzerland", + "2", + "2", + "2", + "6" + ], + [ + "12", + "canada", + "2", + "0", + "0", + "2" + ], + [ + "13", + "finland", + "1", + "2", + "4", + "7" + ], + [ + "14", + "hungary", + "1", + "2", + "3", + "6" + ], + [ + "15", + "soviet union", + "0", + "7", + "6", + "13" + ], + [ + "16", + "ukraine", + "0", + "3", + "3", + "6" + ], + [ + "17", + "united states", + "0", + "1", + "1", + "2" + ], + [ + "18", + "yugoslavia", + "0", + "1", + "0", + "1" + ], + [ + "19", + "sweden", + "0", + "0", + "2", + "2" + ], + [ + "20", + "georgia", + "0", + "0", + "2", + "2" + ] + ], + "title": "", + "original_id": "6d38c7ec1308824230451156f31f1f00" + }, + { + "_id": "9846b582c0cad59386869e785110ada0", + "header": [ + "Player", + "Rec.", + "Yards", + "Avg.", + "TD's", + "Long" + ], + "rows": [ + [ + "Charles Frederick", + "115", + "1385", + "12", + "27", + "42" + ], + [ + "Jerel Myers", + "104", + "1183", + "11.4", + "21", + "38" + ], + [ + "Anthony Hines", + "58", + "822", + "14.2", + "12", + "39" + ], + [ + "Boo Williams", + "45", + "474", + "10.5", + "17", + "35" + ], + [ + "Ira Gooch", + "24", + "339", + "14.1", + "6", + "32" + ], + [ + "Sam Simmons", + "15", + "197", + "13.1", + "2", + "30" + ], + [ + "Kevin Beard", + "10", + "87", + "8.7", + "0", + "21" + ], + [ + "Dawan Moss", + "7", + "39", + "5.6", + "1", + "12" + ], + [ + "Cyron Brown", + "3", + "17", + "5.7", + "1", + "8" + ], + [ + "Larrell Johnson", + "3", + "14", + "4.7", + "0", + "6" + ], + [ + "Jamarr Wood", + "1", + "13", + "13", + "0", + "13" + ], + [ + "Cecil Moore", + "2", + "9", + "4.5", + "2", + "8" + ], + [ + "Raymond Philyaw", + "1", + "−6", + "−6", + "0", + "−6" + ] + ], + "title": "", + "original_id": "78ccc4fb07ce60975392c8b42aa454ea" + }, + { + "_id": "da587e3a91e628bd5cfa8cf42cbdb6fc", + "header": [ + "year", + "2010", + "2009", + "2008", + "2005", + "2000" + ], + "rows": [ + [ + "shanghai", + "1", + "2", + "1", + "1", + "1" + ], + [ + "beijing", + "2", + "1", + "2", + "2", + "2" + ], + [ + "tianjin", + "3", + "3", + "3", + "3", + "3" + ], + [ + "jiangsu", + "4", + "4", + "5", + "6", + "6" + ], + [ + "zhejiang", + "5", + "5", + "4", + "4", + "4" + ], + [ + "inner mongolia", + "6", + "6", + "7", + "10", + "15" + ], + [ + "guangdong", + "7", + "7", + "6", + "5", + "5" + ], + [ + "liaoning", + "8", + "9", + "9", + "8", + "8" + ], + [ + "shandong", + "9", + "8", + "8", + "7", + "9" + ], + [ + "fujian", + "10", + "10", + "10", + "9", + "7" + ], + [ + "jilin", + "11", + "11", + "11", + "13", + "13" + ], + [ + "hebei", + "12", + "12", + "12", + "11", + "11" + ], + [ + "hubei", + "13", + "14", + "16", + "17", + "16" + ], + [ + "chongqing", + "14", + "13", + "15", + "16", + "17" + ], + [ + "shaanxi", + "15", + "16", + "18", + "20", + "23" + ], + [ + "heilongjiang", + "16", + "15", + "13", + "12", + "10" + ], + [ + "ningxia", + "17", + "17", + "19", + "22", + "21" + ], + [ + "shanxi", + "18", + "18", + "14", + "15", + "18" + ], + [ + "xinjiang", + "19", + "21", + "17", + "14", + "12" + ], + [ + "hunan", + "20", + "20", + "22", + "21", + "20" + ], + [ + "henan", + "21", + "19", + "20", + "18", + "19" + ], + [ + "qinghai", + "22", + "22", + "21", + "23", + "22" + ], + [ + "hainan", + "23", + "23", + "23", + "19", + "14" + ], + [ + "jiangxi", + "24", + "25", + "24", + "24", + "25" + ], + [ + "sichuan", + "25", + "24", + "25", + "25", + "24" + ], + [ + "anhui", + "26", + "26", + "27", + "27", + "26" + ], + [ + "guangxi", + "27", + "27", + "26", + "28", + "28" + ], + [ + "tibet", + "28", + "28", + "28", + "26", + "29" + ], + [ + "gansu", + "29", + "30", + "30", + "30", + "30" + ], + [ + "yunnan", + "30", + "29", + "29", + "29", + "27" + ], + [ + "guizhou", + "31", + "31", + "31", + "31", + "31" + ] + ], + "title": "", + "original_id": "ee38d1e26018264f906e82e45b85e4d8" + }, + { + "_id": "82bf863049cb67acb2b46023a9fb5a05", + "header": [ + "draw", + "artist", + "song", + "rank", + "points", + "a krajka", + "gj leka", + "b haxhia", + "d tukiqi", + "r magjistari", + "gj xhuvani", + "a skënderaj" + ], + "rows": [ + [ + "1", + "manjola nallbani", + "kjo botë merr frymë nga dashuria", + "7", + "27", + "3", + "4", + "4", + "7", + "8", + "1", + "0" + ], + [ + "2", + "produkt 28", + "30 sekonda", + "15", + "3", + "0", + "0", + "0", + "1", + "1", + "0", + "1" + ], + [ + "3", + "eneida tarifa", + "e para letër", + "10", + "11", + "0", + "1", + "0", + "0", + "0", + "7", + "3" + ], + [ + "4", + "mariza ikonomi", + "mall i tretur", + "9", + "20", + "2", + "3", + "0", + "3", + "3", + "3", + "6" + ], + [ + "5", + "greta koçi", + "natën të kërkova", + "5", + "35", + "5", + "5", + "3", + "6", + "4", + "8", + "4" + ], + [ + "6", + "flaka krelani & doruntina disha", + "jeta kërkon dashuri", + "2", + "57", + "12", + "12", + "12", + "12", + "9", + "0", + "0" + ], + [ + "7", + "mira konçi & redon makashi", + "nën një qiell", + "6", + "35", + "6", + "6", + "6", + "9", + "6", + "2", + "0" + ], + [ + "8", + "kthjellu", + "dhoma", + "11", + "9", + "0", + "0", + "1", + "0", + "0", + "0", + "8" + ], + [ + "9", + "kozma dushi", + "tatuazh në kujtesë", + "16", + "1", + "1", + "0", + "0", + "0", + "0", + "0", + "0" + ], + [ + "10", + "devis xherahu", + "endacaku", + "17", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + "0" + ], + [ + "11", + "teuta kurti", + "qyteti i dashurisë", + "14", + "5", + "0", + "0", + "5", + "0", + "0", + "0", + "0" + ], + [ + "12", + "samanta karavello", + "pse u harrua dashuria", + "8", + "23", + "4", + "2", + "2", + "5", + "0", + "5", + "5" + ], + [ + "13", + "juliana pasha", + "një qiell të ri", + "3", + "54", + "9", + "9", + "9", + "4", + "5", + "9", + "9" + ], + [ + "14", + "agim poshka", + "kujt i them të dua", + "12", + "8", + "0", + "0", + "0", + "0", + "2", + "4", + "2" + ], + [ + "15", + "jonida maliqi", + "s'ka fajtor në dashuri", + "4", + "36", + "0", + "7", + "7", + "2", + "7", + "6", + "7" + ], + [ + "16", + "olta boka", + "zemrën e lamë peng", + "1", + "67", + "7", + "8", + "8", + "8", + "12", + "12", + "12" + ], + [ + "17", + "rosela gjylbegu", + "po lind një yll", + "13", + "8", + "8", + "0", + "0", + "0", + "0", + "0", + "0" + ] + ], + "title": "", + "original_id": "a91f81d1472de78a9c78cef99cf9e92c" + }, + { + "_id": "c35f24887c4d6d7a66fa65189719346c", + "header": [ + "team", + "points", + "played", + "drawn", + "lost", + "against", + "diff" + ], + "rows": [ + [ + "ua maracaibo", + "41", + "18", + "5", + "1", + "11", + "+ 17" + ], + [ + "deportivo tã¡chira fc", + "31", + "18", + "4", + "5", + "23", + "+ 9" + ], + [ + "mineros de guayana", + "27", + "18", + "6", + "5", + "19", + "+ 5" + ], + [ + "carabobo fc", + "27", + "18", + "6", + "5", + "24", + "+ 4" + ], + [ + "caracas fc", + "24", + "18", + "3", + "8", + "25", + "+ 3" + ], + [ + "cd italmaracaibo", + "24", + "18", + "6", + "6", + "22", + "+ 1" + ], + [ + "aragua fc", + "22", + "18", + "4", + "8", + "27", + "- 11" + ], + [ + "trujillanos fc", + "18", + "18", + "6", + "8", + "24", + "- 10" + ], + [ + "estudiantes de mãrida fc", + "15", + "18", + "6", + "9", + "30", + "- 9" + ], + [ + "monagas sc", + "15", + "18", + "6", + "9", + "28", + "- 9" + ] + ], + "title": "", + "original_id": "b1750bbee8884677e5b289413c44f99a" + }, + { + "_id": "6672305c8f131415e15bdff68648d909", + "header": [ + "season", + "overall", + "slalom", + "giant slalom", + "super g", + "downhill", + "combined" + ], + "rows": [ + [ + "1990", + "44", + "-", + "39", + "12", + "-", + "21" + ], + [ + "1991", + "15", + "-", + "29", + "3", + "13", + "12" + ], + [ + "1992", + "3", + "-", + "10", + "4", + "1", + "-" + ], + [ + "1993", + "2", + "58", + "7", + "1", + "1", + "7" + ], + [ + "1994", + "3", + "49", + "6", + "1", + "1", + "19" + ], + [ + "1995", + "2", + "19", + "9", + "1", + "3", + "4" + ], + [ + "1996", + "1", + "39", + "2", + "1", + "2", + "-" + ], + [ + "1997", + "2", + "19", + "2", + "2", + "5", + "-" + ], + [ + "1998", + "1", + "12", + "6", + "1", + "1", + "2" + ] + ], + "title": "", + "original_id": "8b3679190263b8ff21f47df999a55756" + }, + { + "_id": "d4837db1e5300b89e443332df85de6e6", + "header": [ + "name", + "league goals", + "fa cup goals", + "fl cup goals", + "other goals", + "total", + "career" + ], + "rows": [ + [ + "george brown", + "142", + "17", + "0", + "0", + "159", + "1921 - 1929" + ], + [ + "jimmy glazzard", + "142", + "12", + "0", + "0", + "154", + "1946 - 1956" + ], + [ + "andy booth", + "133", + "5", + "4", + "8", + "150", + "1991 - 1996 and 2001 - 2009" + ], + [ + "billy smith", + "114", + "12", + "0", + "0", + "126", + "1913 - 1934" + ], + [ + "les massie", + "100", + "6", + "2", + "0", + "108", + "1956 - 1966" + ], + [ + "vic metcalfe", + "87", + "3", + "0", + "0", + "90", + "1946 - 1958" + ], + [ + "alex jackson", + "70", + "19", + "0", + "0", + "89", + "1925 - 1930" + ], + [ + "jordan rhodes", + "73", + "2", + "6", + "6", + "87", + "2009 - 2012" + ], + [ + "frank mann", + "68", + "7", + "0", + "0", + "75", + "1912 - 1923" + ], + [ + "dave mangnall", + "61", + "12", + "0", + "0", + "73", + "1929 - 1934" + ], + [ + "derek stokes", + "65", + "2", + "2", + "0", + "69", + "1960 - 1965" + ], + [ + "kevin mchale", + "60", + "5", + "3", + "0", + "68", + "1956 - 1967" + ], + [ + "iwan roberts", + "50", + "4", + "6", + "8", + "68", + "1990 - 1993" + ], + [ + "ian robins", + "59", + "5", + "3", + "0", + "67", + "1978 - 1982" + ], + [ + "marcus stewart", + "58", + "2", + "7", + "0", + "67", + "1996 - 2000" + ], + [ + "mark lillis", + "56", + "4", + "3", + "0", + "63", + "1978 - 1985" + ], + [ + "charlie wilson", + "57", + "5", + "0", + "0", + "62", + "1922 - 1925" + ], + [ + "alan gowling", + "58", + "1", + "2", + "0", + "61", + "1972 - 1975" + ], + [ + "craig maskell", + "43", + "3", + "4", + "4", + "55", + "1988 - 1990" + ], + [ + "brian stanton", + "45", + "6", + "3", + "0", + "54", + "1979 - 1986" + ], + [ + "colin dobson", + "50", + "0", + "2", + "0", + "52", + "1966 - 1970" + ], + [ + "ernie islip", + "44", + "8", + "0", + "0", + "52", + "1913 - 1923" + ], + [ + "paweł abbott", + "48", + "1", + "2", + "0", + "51", + "2004 - 2007" + ], + [ + "clem stephenson", + "42", + "8", + "0", + "0", + "50", + "1921 - 1929" + ], + [ + "david cowling", + "43", + "2", + "3", + "0", + "48", + "1978 - 1987" + ], + [ + "duncan shearer", + "38", + "3", + "6", + "1", + "48", + "1986 - 1988" + ], + [ + "frank worthington", + "41", + "5", + "2", + "0", + "48", + "1967 - 1972" + ], + [ + "charlie luke", + "40", + "7", + "0", + "0", + "47", + "1931 - 1936" + ], + [ + "phil starbuck", + "36", + "4", + "2", + "5", + "47", + "1991 - 1995" + ], + [ + "jimmy lawson", + "42", + "4", + "0", + "0", + "46", + "1968 - 1976" + ], + [ + "alf lythgoe", + "42", + "4", + "0", + "0", + "46", + "1934 - 1938" + ], + [ + "george mclean", + "43", + "3", + "0", + "0", + "46", + "1930 - 1934" + ], + [ + "danny schofield", + "39", + "1", + "0", + "6", + "46", + "1998 - 2008" + ], + [ + "peter fletcher", + "36", + "4", + "5", + "0", + "45", + "1978 - 1982" + ], + [ + "sammy taylor", + "39", + "6", + "0", + "0", + "45", + "1919 - 1921" + ], + [ + "tony leighton", + "40", + "2", + "2", + "0", + "44", + "1965 - 1968" + ], + [ + "ronnie jepson", + "36", + "3", + "2", + "1", + "42", + "1993 - 1996" + ], + [ + "bob kelly", + "39", + "3", + "0", + "0", + "42", + "1927 - 1932" + ], + [ + "lee novak", + "34", + "5", + "2", + "1", + "42", + "2009 - 2013" + ], + [ + "terry gray", + "36", + "2", + "3", + "0", + "41", + "1973 - 1979" + ] + ], + "title": "", + "original_id": "f10d21dbe9cca173c388760beaa75c80" + }, + { + "_id": "5c2940fee5196bea80d1d682db43694e", + "header": [ + "club", + "played", + "drawn", + "lost", + "points for", + "points against", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + "rows": [ + [ + "club", + "played", + "drawn", + "lost", + "points for", + "points against", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + [ + "oakdale rfc", + "22", + "2", + "0", + "614", + "226", + "88", + "23", + "13", + "0", + "97" + ], + [ + "blaenavon rfc", + "22", + "1", + "5", + "444", + "271", + "61", + "33", + "5", + "2", + "73" + ], + [ + "brynithel rfc", + "22", + "3", + "4", + "398", + "292", + "41", + "24", + "4", + "1", + "71" + ], + [ + "caldicot rfc", + "22", + "0", + "8", + "500", + "330", + "69", + "44", + "8", + "3", + "67" + ], + [ + "usk rfc", + "22", + "2", + "8", + "484", + "431", + "71", + "58", + "11", + "1", + "64" + ], + [ + "hartridge rfc", + "22", + "1", + "11", + "424", + "345", + "52", + "45", + "5", + "5", + "52" + ], + [ + "bettws rfc", + "22", + "3", + "11", + "476", + "438", + "59", + "53", + "6", + "7", + "51" + ], + [ + "rtb (ebbw vale) rfc", + "22", + "3", + "12", + "317", + "371", + "38", + "50", + "5", + "4", + "43" + ], + [ + "ynysddu rfc", + "22", + "1", + "14", + "315", + "376", + "35", + "44", + "3", + "9", + "42" + ], + [ + "llanhilleth rfc", + "22", + "3", + "13", + "357", + "475", + "42", + "61", + "3", + "4", + "37" + ], + [ + "trinant rfc", + "22", + "1", + "15", + "261", + "487", + "29", + "65", + "1", + "4", + "31" + ], + [ + "pontllanfraith rfc", + "22", + "0", + "21", + "160", + "708", + "17", + "102", + "2", + "1", + "7" + ] + ], + "title": "", + "original_id": "fb233753896ca878c04484eeb4f019b9" + }, + { + "_id": "50c802cb7b5fb28d5e88fca8750cd183", + "header": [ + "Month", + "Jan", + "Feb", + "Mar", + "Apr", + "May", + "Jun", + "Jul", + "Aug", + "Sep", + "Oct", + "Nov", + "Dec", + "Year" + ], + "rows": [ + [ + "Record high °F (°C)", + "76\n(24)", + "86\n(30)", + "96\n(36)", + "96\n(36)", + "95\n(35)", + "104\n(40)", + "111\n(44)", + "109\n(43)", + "105\n(41)", + "96\n(36)", + "90\n(32)", + "78\n(26)", + "111\n(44)" + ], + [ + "Average high °F (°C)", + "46.2\n(7.9)", + "50.4\n(10.2)", + "59.1\n(15.1)", + "68.7\n(20.4)", + "75.5\n(24.2)", + "83.5\n(28.6)", + "88.7\n(31.5)", + "89.4\n(31.9)", + "80.8\n(27.1)", + "70.3\n(21.3)", + "59.2\n(15.1)", + "48.0\n(8.9)", + "68.3\n(20.2)" + ], + [ + "Average low °F (°C)", + "26.1\n(−3.3)", + "29.0\n(−1.7)", + "37.8\n(3.2)", + "46.9\n(8.3)", + "55.7\n(13.2)", + "64.1\n(17.8)", + "68.7\n(20.4)", + "67.7\n(19.8)", + "58.9\n(14.9)", + "47.6\n(8.7)", + "39.2\n(4)", + "28.1\n(−2.2)", + "47.5\n(8.6)" + ], + [ + "Record low °F (°C)", + "−23\n(−31)", + "−24\n(−31)", + "−11\n(−24)", + "18\n(−8)", + "28\n(−2)", + "41\n(5)", + "48\n(9)", + "44\n(7)", + "29\n(−2)", + "17\n(−8)", + "5\n(−15)", + "−12\n(−24)", + "−24\n(−31)" + ], + [ + "Precipitation inches (mm)", + "1.99\n(50.5)", + "2.43\n(61.7)", + "3.54\n(89.9)", + "4.05\n(102.9)", + "4.99\n(126.7)", + "4.59\n(116.6)", + "3.18\n(80.8)", + "2.75\n(69.9)", + "4.43\n(112.5)", + "3.83\n(97.3)", + "4.19\n(106.4)", + "2.73\n(69.3)", + "42.7\n(1,084.6)" + ], + [ + "Snowfall inches (cm)", + "1.6\n(4.1)", + "2.0\n(5.1)", + "0\n(0)", + "0\n(0)", + "0\n(0)", + "0\n(0)", + "0\n(0)", + "0\n(0)", + "0\n(0)", + "0\n(0)", + "0\n(0)", + ".7\n(1.8)", + "4.4\n(11.2)" + ], + [ + "Avg. precipitation days (≥ 0.01 in)", + "5.4", + "6.6", + "8.2", + "9.0", + "11.2", + "8.9", + "7.0", + "6.4", + "7.6", + "7.9", + "7.0", + "6.3", + "91.4" + ], + [ + "Avg. snowy days (≥ 0.1 in)", + ".7", + ".9", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + ".5", + "2.3" + ] + ], + "title": "", + "original_id": "77f8372afde69977a62eda34f4cae760" + }, + { + "_id": "d04c9e45bd6464470e71de1e8cfc2336", + "header": [ + "Unnamed: 0", + "Club", + "Played", + "Won", + "Drawn", + "Lost", + "Points For", + "Points Against", + "Points Difference", + "Tries For", + "Tries Against", + "Try Bonus", + "Losing Bonus", + "Points" + ], + "rows": [ + [ + "1", + "Saracens (RU)", + "22", + "19", + "0", + "3", + "629", + "353", + "276", + "68", + "39", + "10", + "1", + "87" + ], + [ + "2", + "Northampton Saints (CH)", + "22", + "16", + "2", + "4", + "604", + "350", + "254", + "72", + "31", + "7", + "3", + "78" + ], + [ + "3", + "Leicester Tigers (SF)", + "22", + "15", + "2", + "5", + "542", + "430", + "112", + "59", + "41", + "7", + "3", + "74" + ], + [ + "4", + "Harlequins (SF)", + "22", + "15", + "0", + "7", + "437", + "365", + "72", + "43", + "33", + "4", + "3", + "67" + ], + [ + "5", + "Bath", + "22", + "14", + "2", + "6", + "495", + "388", + "107", + "48", + "38", + "4", + "3", + "67" + ], + [ + "6", + "Sale Sharks", + "22", + "12", + "0", + "10", + "432", + "399", + "33", + "46", + "40", + "3", + "6", + "57" + ], + [ + "7", + "London Wasps", + "22", + "9", + "0", + "13", + "451", + "533", + "-82", + "48", + "56", + "4", + "9", + "49" + ], + [ + "8", + "Exeter Chiefs", + "22", + "9", + "0", + "13", + "426", + "480", + "-54", + "40", + "51", + "2", + "7", + "45" + ], + [ + "9", + "Gloucester", + "22", + "8", + "0", + "14", + "440", + "539", + "-99", + "46", + "60", + "4", + "8", + "44" + ], + [ + "10", + "London Irish", + "22", + "7", + "0", + "15", + "396", + "496", + "-100", + "40", + "49", + "2", + "6", + "36" + ], + [ + "11", + "Newcastle Falcons", + "22", + "3", + "0", + "19", + "281", + "544", + "-263", + "23", + "62", + "2", + "8", + "22" + ], + [ + "12", + "Worcester Warriors (R)", + "22", + "2", + "0", + "20", + "325", + "581", + "-256", + "31", + "64", + "1", + "7", + "16" + ] + ], + "title": "", + "original_id": "908fe4eba12fbc8328b6ca83eaf617fb" + }, + { + "_id": "9c5563871561e6e9b80a48c1e1d3de40", + "header": [ + "Month", + "Jan", + "Feb", + "Mar", + "Apr", + "May", + "Jun", + "Jul", + "Aug", + "Sep", + "Oct", + "Nov", + "Dec", + "Year" + ], + "rows": [ + [ + "Record high °C (°F)", + "10.8\n(51.4)", + "10.7\n(51.3)", + "25.7\n(78.3)", + "29.2\n(84.6)", + "35.4\n(95.7)", + "38.3\n(100.9)", + "36.7\n(98.1)", + "40.0\n(104)", + "35.1\n(95.2)", + "27.8\n(82)", + "21.0\n(69.8)", + "12.9\n(55.2)", + "40.0\n(104)" + ], + [ + "Average high °C (°F)", + "−8.5\n(16.7)", + "−6.2\n(20.8)", + "1.6\n(34.9)", + "11.6\n(52.9)", + "18.1\n(64.6)", + "22.1\n(71.8)", + "25.2\n(77.4)", + "24.6\n(76.3)", + "18.6\n(65.5)", + "10.8\n(51.4)", + "−0.2\n(31.6)", + "−6.6\n(20.1)", + "9.3\n(48.7)" + ], + [ + "Daily mean °C (°F)", + "−14.5\n(5.9)", + "−11.6\n(11.1)", + "−4.1\n(24.6)", + "4.8\n(40.6)", + "11.0\n(51.8)", + "15.5\n(59.9)", + "18.1\n(64.6)", + "17.3\n(63.1)", + "11.6\n(52.9)", + "4.1\n(39.4)", + "−5.2\n(22.6)", + "−11.9\n(10.6)", + "4.9\n(40.8)" + ], + [ + "Average low °C (°F)", + "−19.0\n(−2.2)", + "−16.9\n(1.6)", + "−9.4\n(15.1)", + "−2.1\n(28.2)", + "3.8\n(38.8)", + "8.8\n(47.8)", + "11.0\n(51.8)", + "10.0\n(50)", + "4.4\n(39.9)", + "−2.5\n(27.5)", + "−10.4\n(13.3)", + "−17.1\n(1.2)", + "−3.3\n(26.1)" + ], + [ + "Record low °C (°F)", + "−40.4\n(−40.7)", + "−43.4\n(−46.1)", + "−34.7\n(−30.5)", + "−17.4\n(0.7)", + "−11.4\n(11.5)", + "−2.3\n(27.9)", + "3.4\n(38.1)", + "-0.0\n(32)", + "−10.7\n(12.7)", + "−26.3\n(−15.3)", + "−36.1\n(−33)", + "−40.4\n(−40.7)", + "−43.4\n(−46.1)" + ], + [ + "Precipitation mm (inches)", + "10.9\n(0.429)", + "6.7\n(0.264)", + "11.7\n(0.461)", + "23.5\n(0.925)", + "40.3\n(1.587)", + "67.0\n(2.638)", + "58.4\n(2.299)", + "43.8\n(1.724)", + "28.8\n(1.134)", + "13.2\n(0.52)", + "10.6\n(0.417)", + "12.7\n(0.5)", + "327.6\n(12.898)" + ], + [ + "Rainfall mm (inches)", + "0.3\n(0.012)", + "0.3\n(0.012)", + "1.7\n(0.067)", + "15.6\n(0.614)", + "38.3\n(1.508)", + "67.0\n(2.638)", + "58.7\n(2.311)", + "43.8\n(1.724)", + "28.5\n(1.122)", + "8.3\n(0.327)", + "1.9\n(0.075)", + "0.2\n(0.008)", + "264.6\n(10.417)" + ], + [ + "Snowfall cm (inches)", + "15.6\n(6.14)", + "9.6\n(3.78)", + "12.9\n(5.08)", + "9.5\n(3.74)", + "2.1\n(0.83)", + "0.04\n(0.016)", + "0\n(0)", + "0\n(0)", + "0.8\n(0.31)", + "6.5\n(2.56)", + "12.0\n(4.72)", + "17.5\n(6.89)", + "86.5\n(34.06)" + ] + ], + "title": "", + "original_id": "e5be717f4811ecea5e824a40a0675c39" + }, + { + "_id": "766cd4510c6e3359b643883c5a6ecd47", + "header": [ + "Country", + "Amphibians", + "Birds", + "Mammals", + "Reptile", + "Total terrestrial vertebrates", + "Vascular plants", + "Biodiversity" + ], + "rows": [ + [ + "Belize", + "46", + "544", + "147", + "140", + "877", + "2894", + "3771" + ], + [ + "Costa Rica", + "183", + "838", + "232", + "258", + "1511", + "12119", + "13630" + ], + [ + "El Salvador", + "30", + "434", + "137", + "106", + "707", + "2911", + "3618" + ], + [ + "Guatemala", + "133", + "684", + "193", + "236", + "1246", + "8681", + "9927" + ], + [ + "Honduras", + "101", + "699", + "201", + "213", + "1214", + "5680", + "6894" + ], + [ + "Nicaragua", + "61", + "632", + "181", + "178", + "1052", + "7590", + "8642" + ], + [ + "Panama", + "182", + "904", + "241", + "242", + "1569", + "9915", + "11484" + ] + ], + "title": "", + "original_id": "485b450b0ede043ce95109c0e9057578" + }, + { + "_id": "cd2c0ee7c17268898ea913d229cfe67d", + "header": [ + "Party", + "Candidate", + "Votes", + "%", + "∆%" + ], + "rows": [ + [ + "Conservative", + "Joe Daniel", + "14,422", + "36.78", + "+5.78" + ], + [ + "Liberal", + "Yasmin Ratansi", + "13,552", + "34.56", + "-13.51" + ], + [ + "New Democratic", + "Mary Trapani Hynes", + "9,878", + "25.19", + "+11.87" + ], + [ + "Green", + "Akil Sadikali", + "1,114", + "2.84", + "-4.05" + ], + [ + "Christian Heritage", + "Ryan Kidd", + "246", + "0.63", + "-0.07" + ], + [ + "Total valid votes", + "Total valid votes", + "39,212", + "100.00", + null + ], + [ + "Total rejected ballots", + "Total rejected ballots", + "218", + "0.55", + "–" + ], + [ + "Turnout", + "Turnout", + "39,430", + "57.24", + "–" + ], + [ + "Eligible voters", + "Eligible voters", + "68,890", + "–", + "–" + ] + ], + "title": "", + "original_id": "64664032a7a369ee8b22f988514f1107" + }, + { + "_id": "4845dc728710185107f808a6ec834bf3", + "header": [ + "Period", + "Live births per year", + "Deaths per year", + "Natural change per year", + "CBR1", + "CDR1", + "NC1", + "TFR1", + "IMR1" + ], + "rows": [ + [ + "1950-1955", + "9 000", + "5 000", + "4 000", + "47.9", + "27.1", + "20.8", + "6.67", + "184.8" + ], + [ + "1955-1960", + "10 000", + "6 000", + "5 000", + "49.0", + "26.8", + "22.3", + "6.67", + "181.4" + ], + [ + "1960-1965", + "12 000", + "6 000", + "6 000", + "48.5", + "25.7", + "22.8", + "6.67", + "174.1" + ], + [ + "1965-1970", + "13 000", + "7 000", + "7 000", + "47.8", + "24.1", + "23.8", + "6.67", + "163.1" + ], + [ + "1970-1975", + "16 000", + "7 000", + "8 000", + "47.0", + "22.0", + "25.1", + "6.67", + "149.3" + ], + [ + "1975-1980", + "18 000", + "8 000", + "10 000", + "45.8", + "19.6", + "26.2", + "6.67", + "133.2" + ], + [ + "1980-1985", + "20 000", + "8 000", + "12 000", + "42.7", + "17.1", + "25.6", + "6.39", + "117.1" + ], + [ + "1985-1990", + "21 000", + "8 000", + "13 000", + "40.4", + "15.0", + "25.3", + "6.11", + "104.0" + ], + [ + "1990-1995", + "19 000", + "7 000", + "12 000", + "35.2", + "12.5", + "22.7", + "5.27", + "87.5" + ], + [ + "1995-2000", + "16 000", + "5 000", + "11 000", + "29.2", + "9.9", + "19.3", + "4.13", + "69.7" + ], + [ + "2000-2005", + "15 000", + "5 000", + "11 000", + "25.2", + "7.9", + "17.2", + "3.3", + "52.8" + ], + [ + "2005-2010", + "15 000", + "5 000", + "10 000", + "21.5", + "7.2", + "14.4", + "2.61", + "44.4" + ] + ], + "title": "", + "original_id": "4119f4674c16142eed9eef4730b2c75f" + }, + { + "_id": "675794ec972eb1e612281e0e27ebd5d2", + "header": [ + "Ethnicity", + "1880", + "1899", + "1913", + "19301", + "1956", + "1966", + "1977", + "1992", + "2002" + ], + "rows": [ + [ + "All", + "139,671", + "258,242", + "380,430", + "437,131", + "593,659", + "702,461", + "863,348", + "1,019,766", + "971,643" + ], + [ + "Romanian", + "43,671 (31%)", + "118,919 (46%)", + "216,425 (56.8%)", + "282,844 (64.7%)", + "514,331 (86.6%)", + "622,996 (88.7%)", + "784,934 (90.9%)", + "926,608 (90.8%)", + "883,620 (90.9%)" + ], + [ + "Bulgarian", + "24,915 (17%)", + "38,439 (14%)", + "51,149 (13.4%)", + "42,070 (9.6%)", + "749 (0.13%)", + "524 (0.07%)", + "415 (0.05%)", + "311 (0.03%)", + "135 (0.01%)" + ], + [ + "Turkish", + "18,624 (13%)", + "12,146 (4%)", + "20,092 (5.3%)", + "21,748 (5%)", + "11,994 (2%)", + "16,209 (2.3%)", + "21,666 (2.5%)", + "27,685 (2.7%)", + "27,580 (2.8%)" + ], + [ + "Tatar", + "29,476 (21%)", + "28,670 (11%)", + "21,350 (5.6%)", + "15,546 (3.6%)", + "20,239 (3.4%)", + "21,939 (3.1%)", + "22,875 (2.65%)", + "24,185 (2.4%)", + "23,409 (2.4%)" + ], + [ + "Russian-Lipovan", + "8,250 (6%)", + "12,801 (5%)", + "35,859 (9.4%)", + "26,210 (6%)²", + "29,944 (5%)", + "30,509 (4.35%)", + "24,098 (2.8%)", + "26,154 (2.6%)", + "21,623 (2.2%)" + ], + [ + "Ruthenian\n(Ukrainian from 1956)", + "455 (0.3%)", + "13,680 (5%)", + "35,859 (9.4%)", + "33 (0.01%)", + "7,025 (1.18%)", + "5,154 (0.73%)", + "2,639 (0.3%)", + "4,101 (0.4%)", + "1,465 (0.1%)" + ], + [ + "Dobrujan Germans", + "2,461 (1.7%)", + "8,566 (3%)", + "7,697 (2%)", + "12,023 (2.75%)", + "735 (0.12%)", + "599 (0.09%)", + "648 (0.08%)", + "677 (0.07%)", + "398 (0.04%)" + ], + [ + "Greek", + "4,015 (2.8%)", + "8,445 (3%)", + "9,999 (2.6%)", + "7,743 (1.8%)", + "1,399 (0.24%)", + "908 (0.13%)", + "635 (0.07%)", + "1,230 (0.12%)", + "2,270 (0.23%)" + ], + [ + "Roma", + "702 (0.5%)", + "2,252 (0.87%)", + "3,263 (0.9%)", + "3,831 (0.88%)", + "1,176 (0.2%)", + "378 (0.05%)", + "2,565 (0.3%)", + "5,983 (0.59%)", + "8,295 (0.85%)" + ] + ], + "title": "", + "original_id": "b1ea3f96d887432df9bb3aa3bcf800d6" + }, + { + "_id": "ffe3097bbe884c33f76c43cc63068316", + "header": [ + "Pos", + "No", + "Driver", + "Constructor", + "Lap", + "Gap" + ], + "rows": [ + [ + "1", + "98", + "Walt Faulkner", + "Kurtis Kraft-Offenhauser", + "4:27.97", + "–" + ], + [ + "2", + "28", + "Fred Agabashian", + "Kurtis Kraft-Offenhauser", + "4:31.10", + "+ 3.13" + ], + [ + "3", + "31", + "Mauri Rose", + "Deidt-Offenhauser", + "4:32.07", + "+ 4.10" + ], + [ + "4", + "5", + "George Connor", + "Lesovsky-Offenhauser", + "4:32.39", + "+ 4.42" + ], + [ + "5", + "1", + "Johnnie Parsons", + "Kurtis Kraft-Offenhauser", + "4:32.43", + "+ 4.46" + ], + [ + "6", + "49", + "Jack McGrath", + "Kurtis Kraft-Offenhauser", + "4:33.00", + "+ 5.03" + ], + [ + "7", + "69", + "Duke Dinsmore", + "Kurtis Kraft-Offenhauser", + "4:34.67", + "+ 6.70" + ], + [ + "8", + "14", + "Tony Bettenhausen", + "Deidt-Offenhauser", + "4:34.92", + "+ 6.95" + ], + [ + "9", + "17", + "Joie Chitwood", + "Kurtis Kraft-Offenhauser", + "4:35.32", + "+ 7.35" + ], + [ + "10", + "3", + "Bill Holland", + "Deidt-Offenhauser", + "4:35.90", + "+ 7.93" + ], + [ + "11", + "59", + "Pat Flaherty", + "Kurtis Kraft-Offenhauser", + "4:37.76", + "+ 9.79" + ], + [ + "12", + "54", + "Cecil Green", + "Kurtis Kraft-Offenhauser", + "4:30.86", + "+ 2.89" + ], + [ + "13", + "18", + "Duane Carter", + "Stevens-Offenhauser", + "4:33.42", + "+ 5.45" + ], + [ + "14", + "21", + "Spider Webb", + "Maserati-Offenhauser", + "4:37.46", + "+ 9.49" + ], + [ + "15", + "81", + "Jerry Hoyt", + "Kurtis Kraft-Offenhauser", + "4:37.95", + "+ 9.98" + ], + [ + "16", + "2", + "Myron Fohr", + "Marchese-Offenhauser", + "4:33.32", + "+ 5.35" + ], + [ + "17", + "24", + "Bayliss Levrett", + "Adams-Offenhauser", + "4:34.43", + "+ 6.46" + ], + [ + "18", + "45", + "Dick Rathmann", + "Watson-Offenhauser", + "4:34.96", + "+ 6.99" + ], + [ + "19", + "7", + "Paul Russo", + "Nichels-Offenhauser", + "4:35.25", + "+ 7.28" + ], + [ + "20", + "4", + "Walt Brown", + "Kurtis Kraft-Offenhauser", + "4:35.96", + "+ 7.99" + ], + [ + "21", + "12", + "Henry Banks", + "Maserati-Offenhauser", + "4:37.68", + "+ 9.71" + ], + [ + "22", + "67", + "Bill Schindler", + "Snowberger-Offenhauser", + "4:31.31", + "+ 3.34" + ], + [ + "23", + "8", + "Lee Wallard", + "Moore-Offenhauser", + "4:31.83", + "+ 3.86" + ], + [ + "24", + "55", + "Troy Ruttman", + "Lesovsky-Offenhauser", + "4:32.91", + "+ 4.94" + ], + [ + "25", + "23", + "Sam Hanks", + "Kurtis Kraft-Offenhauser", + "4:33.57", + "+ 5.60" + ], + [ + "26", + "15", + "Mack Hellings", + "Kurtis Kraft-Offenhauser", + "4:35.32", + "+ 7.35" + ], + [ + "27", + "22", + "Jimmy Davies", + "Ewing-Offenhauser", + "4:36.07", + "+ 8.10" + ], + [ + "28", + "76", + "Jim Rathmann", + "Wetteroth-Offenhauser", + "4:37.01", + "+ 9.04" + ], + [ + "29", + "27", + "Walt Ader", + "Rae-Offenhauser", + "4:37.05", + "+ 9.08" + ], + [ + "30", + "77", + "Jackie Holmes", + "Olson-Offenhauser", + "4:37.57", + "+ 9.60" + ], + [ + "31", + "75", + "Gene Hartley", + "Langley-Offenhauser", + "4:38.61", + "+ 10.64" + ], + [ + "32", + "61", + "Jimmy Jackson", + "Kurtis Kraft-Cummins", + "4:38.62", + "+ 10.65" + ], + [ + "33", + "62", + "Johnny McDowell", + "Kurtis Kraft-Offenhauser", + "4:37.58", + "+ 9.61" + ] + ], + "title": "", + "original_id": "b0bce3c8708c147f9d7b85cac2fb8549" + }, + { + "_id": "db0eca2addbd8d93e213d289ae3a3d34", + "header": [ + "Institution", + "Location", + "Established", + "Gained university status", + "Vice-chancellor", + "Total number of students", + "Research funding (£,000)" + ], + "rows": [ + [ + "Birkbeck, University of London", + "London", + "1823", + "1920", + "Professor David Latchman", + "19,020", + "9,985" + ], + [ + "University of East Anglia", + "Norwich", + "1963", + "1963", + "Professor Edward Acton", + "19,585", + "16,482" + ], + [ + "University of Essex", + "Colchester", + "1964", + "1964", + "Professor Anthony Forster", + "11,690", + "9,967" + ], + [ + "Goldsmiths, University of London", + "London", + "1891", + "1904", + "Dr Pat Loughrey", + "7,615", + "8,539" + ], + [ + "Institute of Education, University of London", + "London", + "1902", + "1932", + "Professor Chris Husbands", + "7,215", + "7,734" + ], + [ + "University of Lancaster", + "Lancaster", + "1964", + "1964", + "Professor Mark Smith", + "12,695", + "18,640" + ], + [ + "University of Leicester", + "Leicester", + "1921", + "1957", + "Professor Robert Burgess", + "16,160", + "22,225" + ], + [ + "Loughborough University", + "Loughborough", + "1909", + "1966", + "Professor Robert Allison", + "17,825", + "22,398" + ], + [ + "Royal Holloway, University of London", + "Egham", + "1849", + "1900", + "Professor Paul Layzell (Principal)", + "7,620", + "13,699" + ], + [ + "SOAS, University of London", + "London", + "1916", + "1916", + "Professor Paul Webley", + "4,525", + "7,238" + ], + [ + "University of Sussex", + "Brighton", + "1961", + "1961", + "Professor Michael Farthing", + "12,415", + "16,196" + ] + ], + "title": "", + "original_id": "a7b1009dbaec71cea179c8bc90230152" + }, + { + "_id": "3560be2ffcb66508bbaa9105b6a69433", + "header": [ + "Unnamed: 0", + "agglutination", + "synthesis", + "compounding", + "derivation", + "inflection", + "prefixing", + "suffixing" + ], + "rows": [ + [ + "Swahili", + "0.67", + "2.56", + "1.0", + "0.03", + "0.31", + "0.45", + "0.16" + ], + [ + "spoken Turkish", + "0.67", + "1.75", + "1.04", + "0.06", + "0.38", + "0.0", + "0.44" + ], + [ + "written Turkish", + "0.6", + "2.33", + "1.0", + "0.11", + "0.43", + "0.0", + "0.54" + ], + [ + "Yakut", + "0.51", + "2.17", + "1.02", + "0.16", + "0.38", + "0.0", + "0.53" + ], + [ + "Greek", + "0.4", + "1.82", + "1.02", + "0.07", + "0.37", + "0.02", + "0.42" + ], + [ + "English", + "0.3", + "1.67", + "1.0", + "0.09", + "0.32", + "0.02", + "0.38" + ], + [ + "Eskimo", + "0.03", + "3.7", + "1.0", + "0.34", + "0.47", + "0.0", + "0.73" + ] + ], + "title": "", + "original_id": "193c026fe2590582330b4506df2091bc" + }, + { + "_id": "51fab6743838fef6232aa5803949fd57", + "header": [ + "Team", + "Year", + "Regular Season\nWon", + "Regular Season\nLost", + "Regular Season\nTies", + "Regular Season\nWin %", + "Regular Season\nFinish", + "Post Season\nWon", + "Post Season\nLost", + "Post Season\nWin %", + "Post Season\nResult" + ], + "rows": [ + [ + "DEN", + "1981", + "10", + "6", + "0", + "0.625", + "2nd in AFC West", + "-", + "-", + "-", + "-" + ], + [ + "DEN", + "1982", + "2", + "7", + "0", + "0.222", + "5th in AFC West", + "-", + "-", + "-", + "-" + ], + [ + "DEN", + "1983", + "9", + "7", + "0", + "0.563", + "2nd in AFC West", + "0", + "1", + ".000", + "Lost to Seattle Seahawks in AFC Wild Card Game." + ], + [ + "DEN", + "1984", + "13", + "3", + "0", + "0.813", + "1st in AFC West", + "0", + "1", + ".000", + "Lost to Pittsburgh Steelers in AFC Divisional Game." + ], + [ + "DEN", + "1985", + "11", + "5", + "0", + "0.688", + "2nd in AFC West", + "-", + "-", + "-", + "-" + ], + [ + "DEN", + "1986", + "11", + "5", + "0", + "0.688", + "1st in AFC West", + "2", + "1", + ".667", + "Lost to New York Giants in Super Bowl XXI." + ], + [ + "DEN", + "1987", + "10", + "4", + "1", + "0.714", + "1st in AFC West", + "2", + "1", + ".667", + "Lost to Washington Redskins in Super Bowl XXII." + ], + [ + "DEN", + "1988", + "8", + "8", + "0", + "0.5", + "2nd in AFC West", + "-", + "-", + "-", + "-" + ], + [ + "DEN", + "1989", + "11", + "5", + "0", + "0.688", + "1st in AFC West", + "2", + "1", + ".667", + "Lost to San Francisco 49ers in Super Bowl XXIV." + ], + [ + "DEN", + "1990", + "5", + "11", + "0", + "0.313", + "5th in AFC West", + "-", + "-", + "-", + "-" + ], + [ + "DEN", + "1991", + "12", + "4", + "0", + "0.75", + "1st in AFC West", + "1", + "1", + ".500", + "Lost to Buffalo Bills in AFC Championship Game." + ], + [ + "DEN", + "1992", + "8", + "8", + "0", + "0.5", + "3rd in AFC West", + "-", + "-", + "-", + "-" + ], + [ + "DEN Total", + "DEN Total", + "110", + "73", + "1", + "0.601", + null, + "7", + "6", + ".538", + null + ], + [ + "NYG", + "1993", + "11", + "5", + "0", + "0.688", + "2nd in NFC East", + "1", + "1", + ".500", + "Lost to San Francisco 49ers in NFC Divisional Game." + ], + [ + "NYG", + "1994", + "9", + "7", + "0", + "0.563", + "2nd in NFC East", + "-", + "-", + "-", + "-" + ], + [ + "NYG", + "1995", + "5", + "11", + "0", + "0.313", + "4th in NFC East", + "-", + "-", + "-", + "-" + ], + [ + "NYG", + "1996", + "6", + "10", + "0", + "0.375", + "5th in NFC East", + "-", + "-", + "-", + "-" + ], + [ + "NYG Total", + "NYG Total", + "31", + "33", + "0", + "0.484", + null, + "1", + "1", + ".500", + null + ], + [ + "ATL", + "1997", + "7", + "9", + "0", + "0.438", + "2nd in NFC West", + "-", + "-", + "-", + "-" + ], + [ + "ATL", + "1998", + "14", + "2", + "0", + "0.875", + "1st in NFC West", + "2", + "1", + ".667", + "Lost to Denver Broncos in Super Bowl XXXIII." + ], + [ + "ATL", + "1999", + "5", + "11", + "0", + "0.313", + "3rd in NFC West", + "-", + "-", + "-", + "-" + ], + [ + "ATL", + "2000", + "4", + "12", + "0", + "0.25", + "5th in NFC West", + "-", + "-", + "-", + "-" + ], + [ + "ATL", + "2001", + "7", + "9", + "0", + "0.438", + "3rd in NFC South", + "-", + "-", + "-", + "-" + ], + [ + "ATL", + "2002", + "9", + "6", + "1", + "0.594", + "2nd in NFC South", + "1", + "1", + ".500", + "Lost to Philadelphia Eagles in NFC Divisional Game." + ], + [ + "ATL", + "2003", + "3", + "10", + "0", + "0.231", + "4th in NFC South", + "-", + "-", + "-", + "-" + ], + [ + "ATL Total", + "ATL Total", + "49", + "59", + "1", + "0.454", + null, + "3", + "2", + ".600", + null + ], + [ + "Total", + "Total", + "190", + "165", + "2", + "0.535", + null, + "11", + "9", + ".550", + null + ] + ], + "title": "", + "original_id": "76bd1c55217e71d2dad443c1499400dc" + }, + { + "_id": "e3731c392955ab1d78df183f6cde86b8", + "header": [ + "Rank", + "Title", + "Studio", + "Actors", + "Gross" + ], + "rows": [ + [ + "1.0", + "Star Wars*", + "Lucasfilm/20th Century Fox", + "Mark Hamill, Harrison Ford, Carrie Fisher, Peter Cushing, Alec Guinness, David Prowse, James Earl Jones, Anthony Daniels, Kenny Baker and Peter Mayhew", + "$460,998,007" + ], + [ + "2.0", + "Smokey and the Bandit", + "Universal/Rastar", + "Burt Reynolds, Sally Field, Jackie Gleason, Jerry Reed and Mike Henry", + "$300,000,000" + ], + [ + "3.0", + "Close Encounters of the Third Kind*", + "Columbia", + "Richard Dreyfuss, Teri Garr, Melinda Dillon and François Truffaut", + "$166,000,000" + ], + [ + "4.0", + "Saturday Night Fever", + "Paramount", + "John Travolta and Karen Lynn Gorney", + "$139,486,124" + ], + [ + "5.0", + "The Goodbye Girl", + "MGM/Warner Bros./Rastar", + "Richard Dreyfuss, Marsha Mason and Quinn Cummings", + "$102,000,000" + ], + [ + "6.0", + "The Rescuers*", + "Disney", + "voices of Eva Gabor, Bob Newhart and Geraldine Page", + "$71,215,869" + ], + [ + "7.0", + "Oh, God!", + "Warner Bros.", + "George Burns, John Denver and Teri Garr", + "$51,061,196" + ], + [ + "8.0", + "A Bridge Too Far", + "United Artists", + "Dirk Bogarde, James Caan, Sean Connery, Elliott Gould, Laurence Olivier, Ryan O'Neal, Robert Redford, Liv Ullmann, Michael Caine, Edward Fox, Anthony Hopkins, Gene Hackman, Hardy Krüger and Maximilian Schell", + "$50,800,000" + ], + [ + "9.0", + "The Deep", + "Columbia", + "Robert Shaw, Nick Nolte and Jacqueline Bisset", + "$50,681,884" + ], + [ + "10.0", + "The Spy Who Loved Me", + "United Artists", + "Roger Moore, Barbara Bach, Curd Jürgens and Richard Kiel", + "$46,838,673" + ], + [ + "11.0", + "Annie Hall", + "United Artists", + "Woody Allen and Diane Keaton", + "$38,251,425" + ], + [ + "12.0", + "Semi-Tough", + "United Artists", + "Burt Reynolds, Kris Kristofferson and Jill Clayburgh", + "$37,187,139" + ], + [ + "13.0", + "Pete's Dragon", + "Disney", + "Helen Reddy, Mickey Rooney and Shelley Winters", + "$36,000,000" + ], + [ + "14.0", + "The Gauntlet", + "Warner Bros.", + "Clint Eastwood and Sondra Locke", + "$35,400,000" + ], + [ + "15.0", + "The Turning Point", + "20th Century Fox", + "Shirley MacLaine, Anne Bancroft, Tom Skerritt, Mikhail Baryshnikov and Leslie Browne", + "$33,600,000" + ], + [ + "16.0", + "Heroes", + "Universal", + "Henry Winkler, Sally Field, and Harrison Ford", + "$33,500,000" + ], + [ + "17.0", + "High Anxiety", + "20th Century Fox", + "Mel Brooks, Madeline Kahn, Cloris Leachman, Harvey Korman, Ron Carey, Howard Morris and Dick Van Patten", + "$31,063,038" + ], + [ + "18.0", + "Exorcist II: The Heretic", + "Warner Bros.", + "Linda Blair, Richard Burton, Louise Fletcher, Max von Sydow and James Earl Jones", + "$30,749,142" + ], + [ + "19.0", + "Airport '77", + "Universal", + "Jack Lemmon, Lee Grant and James Stewart", + "$30,000,000" + ], + [ + "20.0", + "Herbie Goes to Monte Carlo", + "Disney", + "Dean Jones, Don Knotts and Julie Sommars", + "$29,000,000" + ], + [ + "21.0", + "Slap Shot", + "Universal", + "Paul Newman and Strother Martin", + "$28,000,000" + ], + [ + "22.0", + "The Other Side of Midnight", + "20th Century Fox", + "Marie-France Pisier, John Beck and Susan Sarandon", + "$24,652,021" + ], + [ + "23.0", + "Looking for Mr. Goodbar", + "Paramount", + "Diane Keaton, Tuesday Weld and Richard Gere", + "$22,512,655" + ], + [ + "24.0", + "For the Love of Benji", + "Mulberry Square", + "Benjean, Patsy Garrett and Ed Nelson", + "$22,257,624" + ], + [ + "25.0", + "The World's Greatest Lover", + "20th Century Fox", + "Gene Wilder, Carol Kane and Dom DeLuise", + "$21,000,000" + ], + [ + "26.0", + "Julia", + "20th Century Fox", + "Jane Fonda, Vanessa Redgrave, Jason Robards, Hal Holbrook, Rosemary Murphy and Maximilian Schell", + "$20,714,400" + ] + ], + "title": "", + "original_id": "f4d60e32414319753c3f708a4b9664ea" + }, + { + "_id": "44b72363ea3361db1ebaeef822a74099", + "header": [ + "#", + "Name", + "Hanzi", + "Hanyu Pinyin", + "Population (2003 est.)", + "Area (km²)", + "Density (/km²)" + ], + "rows": [ + [ + "1", + "Aimin District", + "爱民区", + "Àimín Qū", + "230,000", + "359", + "641" + ], + [ + "2", + "Dong'an District", + "东安区", + "Dōng'ān Qū", + "180,000", + "566", + "318" + ], + [ + "3", + "Yangming District", + "阳明区", + "Yángmíng Qū", + "160,000", + "358", + "447" + ], + [ + "4", + "Xi'an District", + "西安区", + "Xī'ān Qū", + "210,000", + "325", + "646" + ], + [ + "5", + "Muling City", + "穆棱市", + "Mùlíng Shì", + "330,000", + "6,094", + "54" + ], + [ + "6", + "Suifenhe City", + "绥芬河市", + "Suífēnhé Shi", + "60,000", + "427", + "141" + ], + [ + "7", + "Hailin City", + "海林市", + "Hǎilín Shì", + "440,000", + "9,877", + "45" + ], + [ + "8", + "Ning'an City", + "宁安市", + "Níng'ān Shì", + "440,000", + "7,870", + "56" + ], + [ + "9", + "Dongning County", + "东宁县", + "Dōngníng Xiàn", + "210,000", + "7,368", + "29" + ], + [ + "10", + "Linkou County", + "林口县", + "Línkǒu Xiàn", + "450,000", + "7,191", + "63" + ] + ], + "title": "", + "original_id": "8d2f95dcfcff9966314745491802b50c" + }, + { + "_id": "8a00b0da870bb5746f4637ab64456fa1", + "header": [ + "Event", + "Gold", + "Gold.1", + "Silver", + "Silver.1", + "Bronze", + "Bronze.1" + ], + "rows": [ + [ + "60 metres", + "Nelli Cooman (NED)", + "7.17", + "Melanie Paschke (GER)", + "7.19", + "Patricia Girard (FRA)", + "7.19" + ], + [ + "200 metres", + "Galina Malchugina (RUS)", + "22.41", + "Silke Knoll (GER)", + "22.96", + "Jacqueline Poelman (NED)", + "23.43" + ], + [ + "400 metres", + "Svetlana Goncharenko (RUS)", + "51.62", + "Tatyana Alekseyeva (RUS)", + "51.77", + "Viviane Dorsile (FRA)", + "51.92" + ], + [ + "800 metres", + "Natalya Dukhnova (BLR)", + "2:00.42", + "Ella Kovacs (ROM)", + "2:00.49", + "Carla Sacramento (POR)", + "2:01.12" + ], + [ + "1500 metres", + "Yekaterina Podkopayeva (RUS)", + "4:06.46", + "Lyudmila Rogachova (RUS)", + "4:06.60", + "Małgorzata Rydz (POL)", + "4:06.98" + ], + [ + "3000 metres", + "Fernanda Ribeiro (POR)", + "8:50.47", + "Margareta Keszeg (ROM)", + "8:55.61", + "Anna Brzezińska (POL)", + "8:56.90" + ], + [ + "60 metres hurdles", + "Yordanka Donkova (BUL)", + "7.85", + "Eva Sokolova (RUS)", + "7.89", + "Anne Piquereau (FRA)", + "7.91" + ], + [ + "3000 metres walk", + "Annarita Sidoti (ITA)", + "11:54.32", + "Beate Gummelt (GER)", + "11:56.01", + "Yelena Arshintseva (RUS)", + "11:57.48" + ], + [ + "High jump", + "Stefka Kostadinova (BUL)", + "1.98", + "Desislava Aleksandrova (BUL)", + "1.96", + "Sigrid Kirchmann (AUT)", + "1.94 NR" + ], + [ + "Long jump", + "Heike Drechsler (GER)", + "7.06", + "Ljudmila Ninova (AUT)", + "6.78", + "Inessa Kravets (UKR)", + "6.72" + ], + [ + "Triple jump", + "Inna Lasovskaya (RUS)", + "14.88", + "Anna Biryukova (RUS)", + "14.72", + "Sofiya Bozhanova (BUL)", + "14.52" + ], + [ + "Shot put", + "Astrid Kumbernuss (GER)", + "19.44", + "Larisa Peleshenko (RUS)", + "19.16", + "Svetla Mitkova (BUL)", + "19.09" + ], + [ + "Pentathlon", + "Larisa Turchinskaya (RUS)", + "4801", + "Rita Ináncsi (HUN)", + "4775 NR", + "Urszula Włodarczyk (POL)", + "4668" + ] + ], + "title": "", + "original_id": "7b4151479725d585c4b0be8c8ae4f9ed" + }, + { + "_id": "ab812d5edf572e5558925573119c9bb0", + "header": [ + "Date", + "Time (EDT)", + "Team #1", + "Res.", + "Team #2", + "Round", + "Spectators" + ], + "rows": [ + [ + "1994-06-18", + "16.0", + "Italy", + "0–1", + "Republic of Ireland", + "Group E", + "75,338" + ], + [ + "1994-06-23", + "16.0", + "Italy", + "1–0", + "Norway", + "Group E", + "74,624" + ], + [ + "1994-06-25", + "12.3", + "Saudi Arabia", + "2–1", + "Morocco", + "Group F", + "76,322" + ], + [ + "1994-06-28", + "12.3", + "Republic of Ireland", + "0–0", + "Norway", + "Group E", + "72,404" + ], + [ + "1994-07-05", + "16.3", + "Mexico", + "1–1 (1–3 on pen.)", + "Bulgaria", + "Round of 16", + "71,030" + ], + [ + "1994-07-10", + "12.0", + "Bulgaria", + "2–1", + "Germany", + "Quarterfinals", + "72,000" + ], + [ + "1994-07-13", + "16.0", + "Bulgaria", + "1–2", + "Italy", + "Semifinals", + "74,110" + ] + ], + "title": "", + "original_id": "d460758d99ecaaf80409bcf5c8918b8a" + }, + { + "_id": "978740c2d0e5fbcdef1e4ce13aae9254", + "header": [ + "Year", + "Team", + "GP", + "Att", + "Yds", + "Avg", + "Long", + "Rush TD", + "Rec", + "Yds.1", + "Avg.1", + "Long.1", + "Rec TD" + ], + "rows": [ + [ + "1981", + "San Diego Chargers", + "14", + "109", + "525", + "4.8", + "28", + "3", + "46", + "329", + "7.2", + "29", + "3" + ], + [ + "1982", + "San Digeo Chargers", + "9", + "87", + "430", + "4.9", + "48", + "6", + "13", + "66", + "5.1", + "12", + "0" + ], + [ + "1983", + "San Diego Chargers", + "15", + "127", + "516", + "4.1", + "61", + "3", + "25", + "215", + "8.6", + "36", + "0" + ], + [ + "1984", + "Cincinnati Bengals", + "15", + "103", + "396", + "3.8", + "33", + "2", + "34", + "268", + "7.9", + "27", + "2" + ], + [ + "1985", + "Cincinnati Bengals", + "16", + "192", + "929", + "4.8", + "39", + "7", + "55", + "576", + "10.5", + "57", + "5" + ], + [ + "1986", + "Cincinnati Bengals", + "16", + "205", + "1,087", + "5.3", + "56", + "5", + "54", + "686", + "12.7", + "54", + "4" + ], + [ + "1987", + "Cincinnati Bengals", + "9", + "94", + "280", + "3.1", + "18", + "1", + "22", + "272", + "12.4", + "46", + "2" + ], + [ + "1988", + "Cincinnati Bengals", + "15", + "182", + "931", + "5.1", + "51", + "8", + "29", + "287", + "9.9", + "28", + "6" + ], + [ + "1989", + "Cincinnati Bengals", + "16", + "221", + "1,239", + "5.6", + "65", + "7", + "37", + "306", + "8.3", + "25", + "2" + ], + [ + "1990", + "Cincinnati Bengals", + "16", + "195", + "1,004", + "5.1", + "56", + "5", + "26", + "269", + "10.3", + "35", + "4" + ], + [ + "1991", + "Cincinnati Bengals", + "15", + "152", + "571", + "3.8", + "25", + "2", + "40", + "348", + "8.7", + "40", + "2" + ], + [ + "1992", + "Tampa Bay Buccaneers", + "2", + "5", + "6", + "1.2", + "4", + "0", + "0", + "0", + "0.0", + "0", + "0" + ], + [ + "1992", + "Cleveland Browns", + "4", + "13", + "38", + "2.9", + "13", + "0", + "2", + "-1", + "-0.5", + "4", + "0" + ], + [ + "Career Totals", + null, + "162", + "1,685", + "7,962", + "4.7", + "65", + "49", + "383", + "3,621", + "9.5", + "57", + "30" + ] + ], + "title": "", + "original_id": "3bba76d2d41024fde7d3061dc3e4c230" + }, + { + "_id": "db2370e4447adf197a80b98ee278bb0b", + "header": [ + "Value", + "Diameter", + "Composition", + "1979–1989\nObverse", + "1979–1989\nReverse" + ], + "rows": [ + [ + "1 cent", + "18 mm", + "Bronze", + "State arms", + "Frigate Birds" + ], + [ + "2 cents", + "21 mm", + "Bronze", + "State arms", + "B'abal plant" + ], + [ + "5 cents", + "19 mm", + "Cupronickel", + "State arms", + "Tokay gecko" + ], + [ + "10 cents", + "24 mm", + "Cupronickel", + "State arms", + "Breadfruit" + ], + [ + "20 cents", + "29 mm", + "Cupronickel", + "State arms", + "Dolphins" + ], + [ + "50 cents", + "32 mm", + "Cupronickel", + "State arms", + "Panda nut plant" + ], + [ + "1 dollar", + "30 mm", + "Cupronickel", + "State arms", + "Outrigger canoe" + ], + [ + "2 dollars", + "29 mm", + "Nickel-Brass", + "State arms", + "Meeting lodge/\\Tenth Anniversary of Independence\\\"\"" + ] + ], + "title": "", + "original_id": "fcec735ee13d0a97869221546baacd18" + }, + { + "_id": "1669132fb55f14e8e8ba66e63b680a8b", + "header": [ + "Year", + "Team", + "GP", + "GS", + "MPG", + "FG%", + "3P%", + "FT%", + "RPG", + "APG", + "SPG", + "BPG", + "PPG" + ], + "rows": [ + [ + "1993–94", + "Golden State", + "76", + "76", + "32.1", + "0.552", + "0.0", + "0.532", + "9.1", + "3.6", + "1.2", + "2.2", + "17.5" + ], + [ + "1994–95", + "Washington", + "54", + "52", + "38.3", + "0.495", + "0.276", + "0.502", + "9.6", + "4.7", + "1.5", + "1.6", + "20.1" + ], + [ + "1995–96", + "Washington", + "15", + "15", + "37.2", + "0.543", + "0.441", + "0.594", + "7.6", + "5.0", + "1.8", + ".6", + "23.7" + ], + [ + "1996–97", + "Washington", + "72", + "72", + "39.0", + "0.518", + "0.397", + "0.565", + "10.3", + "4.6", + "1.7", + "1.9", + "20.1" + ], + [ + "1997–98", + "Washington", + "71", + "71", + "39.6", + "0.482", + "0.317", + "0.589", + "9.5", + "3.8", + "1.6", + "1.7", + "21.9" + ], + [ + "1998–99", + "Sacramento", + "42", + "42", + "40.9", + "0.486", + "0.118", + "0.454", + "13.0", + "4.1", + "1.4", + "2.1", + "20.0" + ], + [ + "1999–00", + "Sacramento", + "75", + "75", + "38.4", + "0.483", + "0.284", + "0.751", + "10.5", + "4.6", + "1.6", + "1.7", + "24.5" + ], + [ + "2000–01", + "Sacramento", + "70", + "70", + "40.5", + "0.481", + "0.071", + "0.703", + "11.1", + "4.2", + "1.3", + "1.7", + "27.1" + ], + [ + "2001–02", + "Sacramento", + "54", + "54", + "38.4", + "0.495", + "0.263", + "0.749", + "10.1", + "4.8", + "1.7", + "1.4", + "24.5" + ], + [ + "2002–03", + "Sacramento", + "67", + "67", + "39.1", + "0.461", + "0.238", + "0.607", + "10.5", + "5.4", + "1.6", + "1.3", + "23.0" + ], + [ + "2003–04", + "Sacramento", + "23", + "23", + "36.1", + "0.413", + "0.2", + "0.711", + "8.7", + "4.6", + "1.3", + ".9", + "18.7" + ], + [ + "2004–05", + "Sacramento", + "46", + "46", + "36.3", + "0.449", + "0.379", + "0.799", + "9.7", + "5.5", + "1.5", + ".7", + "21.3" + ], + [ + "2004–05", + "Philadelphia", + "21", + "21", + "33.4", + "0.391", + "0.267", + "0.776", + "7.9", + "3.1", + "1.2", + ".9", + "15.6" + ], + [ + "2005–06", + "Philadelphia", + "75", + "75", + "38.6", + "0.434", + "0.273", + "0.756", + "9.9", + "3.4", + "1.4", + ".8", + "20.2" + ], + [ + "2006–07", + "Philadelphia", + "18", + "18", + "30.2", + "0.387", + "0.4", + "0.643", + "8.3", + "3.4", + "1.0", + ".8", + "11.0" + ], + [ + "2006–07", + "Detroit", + "43", + "42", + "29.7", + "0.489", + "0.333", + "0.636", + "6.7", + "3.0", + "1.0", + ".6", + "11.3" + ], + [ + "2007–08", + "Golden State", + "9", + "8", + "14.0", + "0.484", + "0.0", + "0.417", + "3.6", + "2.0", + "0.4", + ".7", + "3.9" + ], + [ + "Career", + null, + "831", + "827", + "37.1", + "0.479", + "0.299", + "0.649", + "9.8", + "4.2", + "1.4", + "1.4", + "20.7" + ], + [ + "All-Star", + null, + "4", + "4", + "19.0", + "0.371", + "0.333", + "0.375", + "6.0", + "3.3", + "1.0", + "-", + "7.5" + ] + ], + "title": "", + "original_id": "7b87f70bc3d95922c6b3335e7a737fe2" + }, + { + "_id": "79e97fe56c64b71242c75f96b95b6630", + "header": [ + "Name", + "County", + "Population\n(2012 est.)", + "Population\n(2010)", + "Land area" + ], + "rows": [ + [ + "Aberdeen", + "Grays Harbor", + "16,529", + "16,896", + "10.65 sq mi (27.6 km2)" + ], + [ + "Airway Heights", + "Spokane", + "6,363", + "6,114", + "5.63 sq mi (14.6 km2)" + ], + [ + "Algona", + "King", + "3,074", + "3,015", + "1.29 sq mi (3.3 km2)" + ], + [ + "Anacortes", + "Skagit", + "15,928", + "15,778", + "11.75 sq mi (30.4 km2)" + ], + [ + "Arlington", + "Snohomish", + "18,317", + "17,926", + "9.25 sq mi (24.0 km2)" + ], + [ + "Asotin", + "Asotin", + "1,270", + "1,251", + "1.05 sq mi (2.7 km2)" + ], + [ + "Auburn", + "King\nPierce", + "73,505", + "70,180", + "29.62 sq mi (76.7 km2)" + ], + [ + "Bainbridge Island", + "Kitsap", + "23,263", + "23,025", + "27.61 sq mi (71.5 km2)" + ], + [ + "Battle Ground", + "Clark", + "18,044", + "17,571", + "7.16 sq mi (18.5 km2)" + ], + [ + "Bellevue", + "King", + "126,439", + "122,363", + "31.97 sq mi (82.8 km2)" + ], + [ + "Bellingham", + "Whatcom", + "82,234", + "80,885", + "27.08 sq mi (70.1 km2)" + ], + [ + "Benton City", + "Benton", + "3,134", + "3,038", + "2.46 sq mi (6.4 km2)" + ], + [ + "Bingen", + "Klickitat", + "724", + "712", + "0.62 sq mi (1.6 km2)" + ], + [ + "Black Diamond", + "King", + "4,237", + "4,151", + "6.01 sq mi (15.6 km2)" + ], + [ + "Blaine", + "Whatcom", + "4,744", + "4,684", + "5.63 sq mi (14.6 km2)" + ], + [ + "Bonney Lake", + "Pierce", + "17,964", + "17,374", + "7.94 sq mi (20.6 km2)" + ], + [ + "Bothell", + "King\nSnohomish", + "34,651", + "33,505", + "12.11 sq mi (31.4 km2)" + ], + [ + "Bremerton", + "Kitsap", + "39,251", + "37,729", + "28.41 sq mi (73.6 km2)" + ], + [ + "Brewster", + "Okanogan", + "2,386", + "2,370", + "1.19 sq mi (3.1 km2)" + ], + [ + "Bridgeport", + "Douglas", + "2,444", + "2,409", + "1.05 sq mi (2.7 km2)" + ], + [ + "Brier", + "Snohomish", + "6,251", + "6,087", + "2.13 sq mi (5.5 km2)" + ], + [ + "Buckley", + "Pierce", + "4,402", + "4,354", + "3.87 sq mi (10.0 km2)" + ], + [ + "Burien", + "King", + "49,410", + "33,313", + "7.42 sq mi (19.2 km2)" + ], + [ + "Burlington", + "Skagit", + "8,470", + "8,388", + "4.26 sq mi (11.0 km2)" + ], + [ + "Camas", + "Clark", + "20,490", + "19,355", + "13.49 sq mi (34.9 km2)" + ], + [ + "Carnation", + "King", + "1,823", + "1,786", + "1.16 sq mi (3.0 km2)" + ], + [ + "Cashmere", + "Chelan", + "3,104", + "3,063", + "1.03 sq mi (2.7 km2)" + ], + [ + "Castle Rock", + "Cowlitz", + "1,983", + "1,982", + "1.59 sq mi (4.1 km2)" + ], + [ + "Centralia", + "Lewis", + "16,505", + "16,336", + "7.42 sq mi (19.2 km2)" + ], + [ + "Chehalis", + "Lewis", + "7,298", + "7,259", + "5.53 sq mi (14.3 km2)" + ], + [ + "Chelan", + "Chelan", + "3,945", + "3,890", + "6.29 sq mi (16.3 km2)" + ], + [ + "Cheney", + "Spokane", + "11,018", + "10,590", + "4.27 sq mi (11.1 km2)" + ], + [ + "Chewelah", + "Stevens", + "2,606", + "2,607", + "2.98 sq mi (7.7 km2)" + ], + [ + "Clarkston", + "Asotin", + "7,283", + "7,229", + "2.01 sq mi (5.2 km2)" + ], + [ + "Cle Elum", + "Kittitas", + "1,907", + "1,872", + "3.82 sq mi (9.9 km2)" + ], + [ + "Clyde Hill", + "King", + "3,047", + "2,984", + "1.06 sq mi (2.7 km2)" + ], + [ + "Colfax", + "Whitman", + "2,839", + "2,805", + "3.79 sq mi (9.8 km2)" + ], + [ + "College Place", + "Walla Walla", + "8,884", + "8,765", + "2.66 sq mi (6.9 km2)" + ], + [ + "Colville", + "Stevens", + "4,669", + "4,673", + "2.93 sq mi (7.6 km2)" + ], + [ + "Connell", + "Franklin", + "5,421", + "4,209", + "7.87 sq mi (20.4 km2)" + ], + [ + "Cosmopolis", + "Grays Harbor", + "1,643", + "1,649", + "1.33 sq mi (3.4 km2)" + ], + [ + "Covington", + "King", + "18,298", + "17,575", + "5.86 sq mi (15.2 km2)" + ], + [ + "Davenport", + "Lincoln", + "1,718", + "1,734", + "1.82 sq mi (4.7 km2)" + ], + [ + "Dayton", + "Columbia", + "2,509", + "2,526", + "1.43 sq mi (3.7 km2)" + ], + [ + "Deer Park", + "Spokane", + "3,673", + "3,652", + "6.88 sq mi (17.8 km2)" + ], + [ + "Des Moines", + "King", + "30,449", + "29,673", + "6.50 sq mi (16.8 km2)" + ], + [ + "DuPont", + "Pierce", + "8,808", + "8,199", + "5.86 sq mi (15.2 km2)" + ], + [ + "Duvall", + "King", + "7,183", + "6,695", + "2.47 sq mi (6.4 km2)" + ], + [ + "East Wenatchee", + "Douglas", + "13,439", + "13,190", + "3.80 sq mi (9.8 km2)" + ], + [ + "Edgewood", + "Pierce", + "9,501", + "9,387", + "8.41 sq mi (21.8 km2)" + ], + [ + "Edmonds", + "Snohomish", + "40,400", + "39,709", + "8.91 sq mi (23.1 km2)" + ], + [ + "Electric City", + "Grant", + "1,004", + "968", + "1.70 sq mi (4.4 km2)" + ], + [ + "Ellensburg", + "Kittitas", + "18,348", + "18,174", + "6.92 sq mi (17.9 km2)" + ], + [ + "Elma", + "Grays Harbor", + "3,095", + "3,107", + "1.89 sq mi (4.9 km2)" + ], + [ + "Entiat", + "Chelan", + "1,129", + "1,112", + "2.11 sq mi (5.5 km2)" + ], + [ + "Enumclaw", + "King\nPierce", + "11,327", + "10,669", + "4.26 sq mi (11.0 km2)" + ], + [ + "Ephrata", + "Grant", + "7,916", + "7,664", + "10.09 sq mi (26.1 km2)" + ], + [ + "Everett", + "Snohomish", + "104,655", + "103,019", + "33.45 sq mi (86.6 km2)" + ], + [ + "Everson", + "Whatcom", + "2,513", + "2,481", + "1.24 sq mi (3.2 km2)" + ], + [ + "Federal Way", + "King", + "91,933", + "89,306", + "22.26 sq mi (57.7 km2)" + ], + [ + "Ferndale", + "Whatcom", + "11,998", + "11,415", + "6.61 sq mi (17.1 km2)" + ], + [ + "Fife", + "Pierce", + "9,333", + "9,173", + "5.68 sq mi (14.7 km2)" + ], + [ + "Fircrest", + "Pierce", + "6,579", + "6,497", + "1.58 sq mi (4.1 km2)" + ], + [ + "Forks", + "Clallam", + "3,552", + "3,532", + "3.65 sq mi (9.5 km2)" + ], + [ + "George", + "Grant", + "514", + "501", + "1.33 sq mi (3.4 km2)" + ], + [ + "Gig Harbor", + "Pierce", + "7,549", + "7,126", + "5.95 sq mi (15.4 km2)" + ], + [ + "Gold Bar", + "Snohomish", + "2,101", + "2,075", + "1.03 sq mi (2.7 km2)" + ], + [ + "Goldendale", + "Klickitat", + "3,471", + "3,407", + "2.52 sq mi (6.5 km2)" + ], + [ + "Grand Coulee", + "Grant", + "1,044", + "988", + "1.19 sq mi (3.1 km2)" + ], + [ + "Grandview", + "Yakima", + "11,012", + "10,862", + "6.23 sq mi (16.1 km2)" + ], + [ + "Granger", + "Yakima", + "3,298", + "3,246", + "1.79 sq mi (4.6 km2)" + ], + [ + "Granite Falls", + "Snohomish", + "3,416", + "3,364", + "2.18 sq mi (5.6 km2)" + ], + [ + "Harrington", + "Lincoln", + "420", + "424", + "0.38 sq mi (0.98 km2)" + ], + [ + "Hoquiam", + "Grays Harbor", + "8,535", + "8,726", + "9.02 sq mi (23.4 km2)" + ], + [ + "Ilwaco", + "Pacific", + "936", + "936", + "2.10 sq mi (5.4 km2)" + ], + [ + "Issaquah", + "King", + "32,633", + "30,434", + "11.38 sq mi (29.5 km2)" + ], + [ + "Kahlotus", + "Franklin", + "204", + "193", + "0.47 sq mi (1.2 km2)" + ], + [ + "Kalama", + "Cowlitz", + "2,346", + "2,344", + "2.77 sq mi (7.2 km2)" + ], + [ + "Kelso", + "Cowlitz", + "11,832", + "11,925", + "8.14 sq mi (21.1 km2)" + ], + [ + "Kenmore", + "King", + "21,280", + "20,460", + "6.15 sq mi (15.9 km2)" + ], + [ + "Kennewick", + "Benton", + "75,971", + "73,917", + "26.93 sq mi (69.7 km2)" + ], + [ + "Kent", + "King", + "122,999", + "92,411", + "28.63 sq mi (74.2 km2)" + ], + [ + "Kettle Falls", + "Stevens", + "1,593", + "1,595", + "1.07 sq mi (2.8 km2)" + ], + [ + "Kirkland", + "King", + "50,697", + "48,787", + "10.79 sq mi (27.9 km2)" + ], + [ + "Kittitas", + "Kittitas", + "1,405", + "1,381", + "0.76 sq mi (2.0 km2)" + ], + [ + "La Center", + "Clark", + "2,852", + "2,800", + "1.27 sq mi (3.3 km2)" + ], + [ + "Lacey", + "Thurston", + "43,860", + "42,393", + "16.06 sq mi (41.6 km2)" + ], + [ + "Lake Forest Park", + "King", + "12,972", + "12,598", + "3.53 sq mi (9.1 km2)" + ], + [ + "Lake Stevens", + "Snohomish", + "29,104", + "28,069", + "8.88 sq mi (23.0 km2)" + ], + [ + "Lakewood", + "Pierce", + "58,852", + "58,163", + "17.17 sq mi (44.5 km2)" + ], + [ + "Langley", + "Island", + "1,041", + "1,035", + "1.08 sq mi (2.8 km2)" + ], + [ + "Leavenworth", + "Chelan", + "1,993", + "1,965", + "1.23 sq mi (3.2 km2)" + ], + [ + "Liberty Lake", + "Spokane", + "7,889", + "7,591", + "6.14 sq mi (15.9 km2)" + ], + [ + "Long Beach", + "Pacific", + "1,393", + "1,392", + "1.35 sq mi (3.5 km2)" + ], + [ + "Longview", + "Cowlitz", + "36,458", + "36,648", + "14.48 sq mi (37.5 km2)" + ], + [ + "Lynden", + "Whatcom", + "12,605", + "11,951", + "5.17 sq mi (13.4 km2)" + ], + [ + "Lynnwood", + "Snohomish", + "36,275", + "35,836", + "7.84 sq mi (20.3 km2)" + ], + [ + "Mabton", + "Yakima", + "2,324", + "2,286", + "0.80 sq mi (2.1 km2)" + ], + [ + "Maple Valley", + "King", + "24,171", + "22,684", + "5.72 sq mi (14.8 km2)" + ], + [ + "Marysville", + "Snohomish", + "62,402", + "60,020", + "20.68 sq mi (53.6 km2)" + ], + [ + "Mattawa", + "Grant", + "4,543", + "4,437", + "0.74 sq mi (1.9 km2)" + ], + [ + "McCleary", + "Grays Harbor", + "1,647", + "1,653", + "2.05 sq mi (5.3 km2)" + ], + [ + "Medical Lake", + "Spokane", + "4,940", + "5,060", + "3.40 sq mi (8.8 km2)" + ], + [ + "Medina", + "King", + "3,029", + "2,969", + "1.44 sq mi (3.7 km2)" + ], + [ + "Mercer Island", + "King", + "23,661", + "22,699", + "6.32 sq mi (16.4 km2)" + ], + [ + "Mesa", + "Franklin", + "518", + "489", + "1.64 sq mi (4.2 km2)" + ], + [ + "Mill Creek", + "Snohomish", + "18,671", + "18,244", + "4.67 sq mi (12.1 km2)" + ], + [ + "Millwood", + "Spokane", + "1,797", + "1,786", + "0.70 sq mi (1.8 km2)" + ], + [ + "Milton", + "Pierce\nKing", + "7,048", + "6,968", + "2.51 sq mi (6.5 km2)" + ], + [ + "Monroe", + "Snohomish", + "17,503", + "17,304", + "6.05 sq mi (15.7 km2)" + ], + [ + "Montesano", + "Grays Harbor", + "3,962", + "3,976", + "10.41 sq mi (27.0 km2)" + ], + [ + "Morton", + "Lewis", + "1,132", + "1,126", + "0.82 sq mi (2.1 km2)" + ], + [ + "Moses Lake", + "Grant", + "21,182", + "20,366", + "15.75 sq mi (40.8 km2)" + ], + [ + "Mossyrock", + "Lewis", + "764", + "759", + "0.68 sq mi (1.8 km2)" + ], + [ + "Mount Vernon", + "Skagit", + "32,287", + "31,743", + "12.30 sq mi (31.9 km2)" + ], + [ + "Mountlake Terrace", + "Snohomish", + "20,198", + "19,909", + "4.06 sq mi (10.5 km2)" + ], + [ + "Moxee", + "Yakima", + "3,361", + "3,308", + "1.69 sq mi (4.4 km2)" + ], + [ + "Mukilteo", + "Snohomish", + "20,605", + "20,254", + "6.40 sq mi (16.6 km2)" + ], + [ + "Napavine", + "Lewis", + "1,778", + "1,766", + "2.38 sq mi (6.2 km2)" + ], + [ + "Newcastle", + "King", + "10,792", + "10,380", + "4.45 sq mi (11.5 km2)" + ], + [ + "Newport", + "Pend Oreille", + "2,116", + "2,126", + "1.07 sq mi (2.8 km2)" + ], + [ + "Nooksack", + "Whatcom", + "1,355", + "1,338", + "0.70 sq mi (1.8 km2)" + ], + [ + "Normandy Park", + "King", + "6,504", + "6,335", + "2.52 sq mi (6.5 km2)" + ], + [ + "North Bend", + "King", + "6,030", + "5,731", + "4.27 sq mi (11.1 km2)" + ], + [ + "North Bonneville", + "Skamania", + "963", + "956", + "2.41 sq mi (6.2 km2)" + ], + [ + "Oak Harbor", + "Island", + "22,260", + "22,075", + "9.42 sq mi (24.4 km2)" + ], + [ + "Oakville", + "Grays Harbor", + "682", + "684", + "0.50 sq mi (1.3 km2)" + ], + [ + "Ocean Shores", + "Grays Harbor", + "5,622", + "5,569", + "8.51 sq mi (22.0 km2)" + ], + [ + "Okanogan", + "Okanogan", + "2,568", + "2,552", + "1.95 sq mi (5.1 km2)" + ], + [ + "Olympia", + "Thurston", + "47,698", + "46,478", + "17.82 sq mi (46.2 km2)" + ], + [ + "Omak", + "Okanogan", + "4,881", + "4,845", + "3.50 sq mi (9.1 km2)" + ], + [ + "Oroville", + "Okanogan", + "1,698", + "1,686", + "1.64 sq mi (4.2 km2)" + ], + [ + "Orting", + "Pierce", + "6,872", + "6,746", + "2.73 sq mi (7.1 km2)" + ], + [ + "Othello", + "Adams", + "7,532", + "7,364", + "3.81 sq mi (9.9 km2)" + ], + [ + "Pacific", + "King\nPierce", + "6,838", + "6,606", + "2.42 sq mi (6.3 km2)" + ], + [ + "Palouse", + "Whitman", + "1,011", + "998", + "1.08 sq mi (2.8 km2)" + ], + [ + "Pasco", + "Franklin", + "65,398", + "59,781", + "30.50 sq mi (79.0 km2)" + ], + [ + "Pateros", + "Okanogan", + "673", + "667", + "0.49 sq mi (1.3 km2)" + ], + [ + "Pomeroy", + "Garfield", + "1,422", + "1,425", + "1.78 sq mi (4.6 km2)" + ], + [ + "Port Angeles", + "Clallam", + "19,056", + "19,038", + "10.70 sq mi (27.7 km2)" + ], + [ + "Port Orchard", + "Kitsap", + "11,680", + "11,144", + "7.24 sq mi (18.8 km2)" + ], + [ + "Port Townsend", + "Jefferson", + "9,117", + "9,113", + "6.98 sq mi (18.1 km2)" + ], + [ + "Poulsbo", + "Kitsap", + "9,393", + "9,200", + "4.67 sq mi (12.1 km2)" + ], + [ + "Prescott", + "Walla Walla", + "323", + "318", + "0.40 sq mi (1.0 km2)" + ], + [ + "Prosser", + "Benton", + "5,799", + "5,714", + "4.49 sq mi (11.6 km2)" + ], + [ + "Pullman", + "Whitman", + "31,359", + "29,799", + "9.88 sq mi (25.6 km2)" + ], + [ + "Puyallup", + "Pierce", + "38,147", + "37,022", + "13.93 sq mi (36.1 km2)" + ], + [ + "Quincy", + "Grant", + "7,013", + "6,750", + "4.96 sq mi (12.8 km2)" + ], + [ + "Rainier", + "Thurston", + "1,826", + "1,794", + "1.73 sq mi (4.5 km2)" + ], + [ + "Raymond", + "Pacific", + "2,883", + "2,882", + "4.06 sq mi (10.5 km2)" + ], + [ + "Redmond", + "King", + "56,561", + "54,144", + "16.28 sq mi (42.2 km2)" + ], + [ + "Renton", + "King", + "95,448", + "90,927", + "23.12 sq mi (59.9 km2)" + ], + [ + "Republic", + "Ferry", + "1,093", + "1,073", + "1.59 sq mi (4.1 km2)" + ], + [ + "Richland", + "Benton", + "51,440", + "48,058", + "35.72 sq mi (92.5 km2)" + ], + [ + "Ridgefield", + "Clark", + "5,260", + "4,763", + "7.08 sq mi (18.3 km2)" + ], + [ + "Ritzville", + "Adams", + "1,699", + "1,673", + "1.70 sq mi (4.4 km2)" + ], + [ + "Rock Island", + "Douglas", + "799", + "788", + "0.61 sq mi (1.6 km2)" + ], + [ + "Roslyn", + "Kittitas", + "910", + "893", + "4.37 sq mi (11.3 km2)" + ], + [ + "Roy", + "Pierce", + "803", + "793", + "0.49 sq mi (1.3 km2)" + ], + [ + "Royal City", + "Grant", + "2,193", + "2,140", + "1.35 sq mi (3.5 km2)" + ], + [ + "Ruston", + "Pierce", + "759", + "749", + "0.26 sq mi (0.67 km2)" + ], + [ + "Sammamish", + "King", + "49,069", + "45,780", + "18.22 sq mi (47.2 km2)" + ], + [ + "SeaTac", + "King", + "27,667", + "26,909", + "10.03 sq mi (26.0 km2)" + ], + [ + "Seattle", + "King", + "634,535", + "608,660", + "83.94 sq mi (217.4 km2)" + ], + [ + "Sedro-Woolley", + "Skagit", + "10,636", + "10,540", + "3.81 sq mi (9.9 km2)" + ], + [ + "Selah", + "Yakima", + "7,333", + "7,147", + "4.44 sq mi (11.5 km2)" + ], + [ + "Sequim", + "Clallam", + "6,624", + "6,606", + "6.31 sq mi (16.3 km2)" + ], + [ + "Shelton", + "Mason", + "9,800", + "9,834", + "5.76 sq mi (14.9 km2)" + ], + [ + "Shoreline", + "King", + "54,352", + "53,007", + "11.67 sq mi (30.2 km2)" + ], + [ + "Snohomish", + "Snohomish", + "9,275", + "9,098", + "3.44 sq mi (8.9 km2)" + ], + [ + "Snoqualmie", + "King", + "11,594", + "10,670", + "6.40 sq mi (16.6 km2)" + ], + [ + "Soap Lake", + "Grant", + "1,550", + "1,514", + "1.25 sq mi (3.2 km2)" + ], + [ + "South Bend", + "Pacific", + "1,631", + "1,637", + "1.62 sq mi (4.2 km2)" + ], + [ + "Spangle", + "Spokane", + "280", + "278", + "0.36 sq mi (0.93 km2)" + ], + [ + "Spokane", + "Spokane", + "209,525", + "208,916", + "59.25 sq mi (153.5 km2)" + ], + [ + "Spokane Valley", + "Spokane", + "90,641", + "89,755", + "37.77 sq mi (97.8 km2)" + ], + [ + "Sprague", + "Lincoln", + "441", + "446", + "0.63 sq mi (1.6 km2)" + ], + [ + "Stanwood", + "Snohomish", + "6,422", + "6,231", + "2.82 sq mi (7.3 km2)" + ], + [ + "Stevenson", + "Skamania", + "1,473", + "1,465", + "1.64 sq mi (4.2 km2)" + ], + [ + "Sultan", + "Snohomish", + "4,710", + "4,651", + "3.15 sq mi (8.2 km2)" + ], + [ + "Sumas", + "Whatcom", + "1,325", + "1,307", + "1.48 sq mi (3.8 km2)" + ], + [ + "Sumner", + "Pierce", + "9,541", + "9,451", + "7.51 sq mi (19.5 km2)" + ], + [ + "Sunnyside", + "Yakima", + "16,054", + "15,858", + "6.63 sq mi (17.2 km2)" + ], + [ + "Tacoma", + "Pierce", + "202,010", + "198,397", + "49.72 sq mi (128.8 km2)" + ], + [ + "Tekoa", + "Whitman", + "787", + "778", + "1.14 sq mi (3.0 km2)" + ], + [ + "Tenino", + "Thurston", + "1,724", + "1,695", + "1.44 sq mi (3.7 km2)" + ], + [ + "Tieton", + "Yakima", + "1,211", + "1,191", + "0.82 sq mi (2.1 km2)" + ], + [ + "Toledo", + "Lewis", + "729", + "725", + "0.40 sq mi (1.0 km2)" + ], + [ + "Tonasket", + "Okanogan", + "1,038", + "1,032", + "0.80 sq mi (2.1 km2)" + ], + [ + "Toppenish", + "Yakima", + "9,017", + "8,949", + "2.09 sq mi (5.4 km2)" + ], + [ + "Tukwila", + "King", + "19,611", + "19,107", + "9.17 sq mi (23.8 km2)" + ], + [ + "Tumwater", + "Thurston", + "18,102", + "17,371", + "14.32 sq mi (37.1 km2)" + ], + [ + "Union Gap", + "Yakima", + "6,060", + "6,047", + "5.05 sq mi (13.1 km2)" + ], + [ + "University Place", + "Pierce", + "31,562", + "31,144", + "8.42 sq mi (21.8 km2)" + ], + [ + "Vader", + "Lewis", + "626", + "621", + "0.93 sq mi (2.4 km2)" + ], + [ + "Vancouver", + "Clark", + "165,489", + "161,791", + "46.46 sq mi (120.3 km2)" + ], + [ + "Waitsburg", + "Walla Walla", + "1,235", + "1,217", + "1.11 sq mi (2.9 km2)" + ], + [ + "Walla Walla", + "Walla Walla", + "31,864", + "31,731", + "12.80 sq mi (33.2 km2)" + ], + [ + "Wapato", + "Yakima", + "5,065", + "4,997", + "1.17 sq mi (3.0 km2)" + ], + [ + "Warden", + "Grant", + "2,758", + "2,692", + "2.58 sq mi (6.7 km2)" + ], + [ + "Washougal", + "Clark", + "14,584", + "14,095", + "5.42 sq mi (14.0 km2)" + ], + [ + "Wenatchee", + "Chelan", + "32,562", + "31,925", + "7.77 sq mi (20.1 km2)" + ], + [ + "West Richland", + "Benton", + "12,663", + "11,811", + "21.92 sq mi (56.8 km2)" + ], + [ + "Westport", + "Grays Harbor", + "2,092", + "2,099", + "3.70 sq mi (9.6 km2)" + ], + [ + "White Salmon", + "Klickitat", + "2,266", + "2,224", + "1.22 sq mi (3.2 km2)" + ], + [ + "Winlock", + "Lewis", + "1,346", + "1,339", + "1.29 sq mi (3.3 km2)" + ], + [ + "Woodinville", + "King", + "11,234", + "10,938", + "5.60 sq mi (14.5 km2)" + ], + [ + "Woodland", + "Cowlitz\nClark", + "5,540", + "5,509", + "3.37 sq mi (8.7 km2)" + ], + [ + "Woodway", + "Snohomish", + "1,324", + "1,307", + "1.11 sq mi (2.9 km2)" + ], + [ + "Yakima", + "Yakima", + "93,101", + "91,067", + "27.18 sq mi (70.4 km2)" + ], + [ + "Yelm", + "Thurston", + "7,121", + "6,848", + "5.68 sq mi (14.7 km2)" + ], + [ + "Zillah", + "Yakima", + "3,011", + "2,964", + "1.78 sq mi (4.6 km2)" + ] + ], + "title": "", + "original_id": "0e5d24e99ce2be597d1da273d8d0ed83" + }, + { + "_id": "99a2e362a7713f5048f5bf509995e01e", + "header": [ + "Name", + "Street address", + "Years as tallest", + "Height\nft (m)", + "Floors" + ], + "rows": [ + [ + "Globe Building", + "4th Street South", + "1882–1886", + "157 (48)", + "8" + ], + [ + "Lumber Exchange Building", + "10 5th Street South", + "1886–1887", + "165 (50)", + "12" + ], + [ + "Industrial Exposition Building", + "Central Avenue Southeast and Main Street Southeast", + "1887–1890", + "240 (73)", + "8" + ], + [ + "Metropolitan Building", + "308 2nd Avenue South", + "1890–1895", + "258 (79)", + "12" + ], + [ + "Minneapolis City Hall", + "350 5th Street South", + "1895–1929", + "341 (104)", + "14" + ], + [ + "Foshay Tower", + "821 Marquette Avenue", + "1929–1973", + "448 (137)", + "32" + ], + [ + "IDS Tower", + "80 8th Street South", + "1973–present", + "792 (241)", + "55" + ] + ], + "title": "", + "original_id": "0f41d5fef6881d303cee5f6a37993555" + }, + { + "_id": "16815a351b4e75a7da635bad706119d3", + "header": [ + "Year", + "Total\npassengers", + "Passenger\nChange", + "Domestic", + "International\n(total)", + "International\n(non-CIS)", + "CIS", + "Aircraft\nLandings", + "Cargo\n(tonnes)" + ], + "rows": [ + [ + "2000", + "930 251", + "+2%", + "698 957", + "231 294", + "155 898", + "75 396", + "8 619", + "18 344" + ], + [ + "2001", + "1 028 295", + "+10,5%", + "733 022", + "295 273", + "186 861", + "108 412", + "9 062", + "22 178" + ], + [ + "2002", + "1 182 815", + "+15,0%", + "793 295", + "389 520", + "239 461", + "150 059", + "10 162", + "20 153" + ], + [ + "2003", + "1 335 757", + "+12,9%", + "879 665", + "456 092", + "297 421", + "158 671", + "10 092", + "18 054" + ], + [ + "2004", + "1 553 628", + "+16,3%", + "972 287", + "581 341", + "429 049", + "152 292", + "11 816", + "20 457" + ], + [ + "2005", + "1 566 792", + "+0,8%", + "1 006 422", + "560 370", + "429 790", + "130 580", + "11 877", + "11 545" + ], + [ + "2006", + "1 764 948", + "+12,7%", + "1 128 489", + "636 459", + "488 954", + "147 505", + "13 289", + "15 519" + ], + [ + "2007", + "2 345 097", + "+32,9%", + "1 486 888", + "858 209", + "683 092", + "175 117", + "16 767", + "16 965" + ], + [ + "2008", + "2 529 395", + "+7,8%", + "1 523 102", + "1 006 293", + "815 124", + "191 169", + "16 407", + "17 142" + ], + [ + "2009", + "2 169 136", + "−14,2%", + "1 290 639", + "878 497", + "727 718", + "150 779", + "13 798", + "13 585" + ], + [ + "2010", + "2 748 919", + "+26,7%", + "1 529 245", + "1 219 674", + "1 017 509", + "202 165", + "15 989", + "22 946" + ], + [ + "2011", + "3 355 883", + "+22,1%", + "1 856 948", + "1 498 935", + "1 184 771", + "314 164", + "20 142", + "24 890" + ], + [ + "2012", + "3 783 069", + "+12.7%", + "1 934 016", + "1 849 053", + "1 448 765", + "439 668", + "21 728", + "25 866" + ], + [ + "2013", + "4 293 002", + "+13.5%", + "2 180 227", + "2 112 775", + null, + null, + "25 728", + "27 800" + ] + ], + "title": "", + "original_id": "bf75201c615c8bb7f27ad1b146d5c447" + }, + { + "_id": "3e7251a170b1325ea356c08e96b50669", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1", + "Soviet Union (URS)", + "4", + "1", + "6", + "11" + ], + [ + "2", + "Yugoslavia (YUG)", + "2", + "0", + "1", + "3" + ], + [ + "3", + "West Germany (FRG)", + "1", + "1", + "1", + "3" + ], + [ + "4", + "Bulgaria (BUL)", + "1", + "1", + "0", + "2" + ], + [ + "4", + "Czechoslovakia (TCH)", + "1", + "1", + "0", + "2" + ], + [ + "4", + "East Germany (GDR)", + "1", + "1", + "0", + "2" + ], + [ + "4", + "Great Britain (GBR)", + "1", + "1", + "0", + "2" + ], + [ + "8", + "Norway (NOR)", + "1", + "0", + "0", + "1" + ], + [ + "8", + "Romania (ROU)", + "1", + "0", + "0", + "1" + ], + [ + "10", + "China (CHN)", + "0", + "1", + "1", + "2" + ], + [ + "11", + "Chile (CHI)", + "0", + "1", + "0", + "1" + ], + [ + "11", + "France (FRA)", + "0", + "1", + "0", + "1" + ], + [ + "11", + "Japan (JPN)", + "0", + "1", + "0", + "1" + ], + [ + "11", + "South Korea (KOR)", + "0", + "1", + "0", + "1" + ], + [ + "11", + "Sweden (SWE)", + "0", + "1", + "0", + "1" + ], + [ + "11", + "United States (USA)", + "0", + "1", + "0", + "1" + ], + [ + "17", + "Hungary (HUN)", + "0", + "0", + "2", + "2" + ], + [ + "18", + "Belgium (BEL)", + "0", + "0", + "1", + "1" + ], + [ + "18", + "Spain (ESP)", + "0", + "0", + "1", + "1" + ], + [ + "Total", + "Total", + "13", + "13", + "13", + "39" + ] + ], + "title": "", + "original_id": "a7f2932c5e2c34ae2d673fa9c9bb3e5c" + }, + { + "_id": "ee1f2b3d96c295e9d59d5276e5ebf279", + "header": [ + "Game", + "Date", + "Opponent", + "Location", + "Score", + "OT", + "Attendance", + "Record" + ], + "rows": [ + [ + "1", + "January 8, 2005", + "Philadelphia Wings", + "Arrowhead Pond", + "W 13–10", + null, + "5,732", + "1–0" + ], + [ + "2", + "January 22, 2005", + "Rochester Knighthawks", + "Arrowhead Pond", + "L 11–15", + null, + "4,053", + "1–1" + ], + [ + "3", + "January 28, 2005", + "@ Minnesota Swarm", + "Xcel Energy Center", + "W 8–7", + null, + "12,514", + "2–1" + ], + [ + "4", + "January 29, 2005", + "Calgary Roughnecks", + "Arrowhead Pond", + "L 12–13", + null, + "4,159", + "2–2" + ], + [ + "5", + "February 4, 2005", + "@ Arizona Sting", + "Jobing.com Arena", + "L 10–17", + null, + "6,313", + "2–3" + ], + [ + "6", + "February 11, 2005", + "@ Buffalo Bandits", + "HSBC Arena", + "L 9–20", + null, + "8,805", + "2–4" + ], + [ + "7", + "February 18, 2005", + "@ Calgary Roughnecks", + "Pengrowth Saddledome", + "L 15–18", + null, + "9,550", + "2–5" + ], + [ + "8", + "March 4, 2005", + "Colorado Mammoth", + "Arrowhead Pond", + "L 12–13", + null, + "4,500", + "2–6" + ], + [ + "9", + "March 13, 2005", + "Toronto Rock", + "Arrowhead Pond", + "L 6–14", + null, + "4,499", + "2–7" + ], + [ + "10", + "March 19, 2005", + "@ Colorado Mammoth", + "Pepsi Center", + "L 8–16", + null, + "16,270", + "2–8" + ], + [ + "11", + "March 25, 2005", + "@ San Jose Stealth", + "HP Pavilion at San Jose", + "L 14–15", + null, + "5,022", + "2–9" + ], + [ + "12", + "March 26, 2005", + "San Jose Stealth", + "Arrowhead Pond", + "W 13–12", + "OT", + "4,834", + "3–9" + ], + [ + "13", + "April 2, 2005", + "@ Colorado Mammoth", + "Pepsi Center", + "W 10–6", + null, + "18,326", + "4–9" + ], + [ + "14", + "April 9, 2005", + "Minnesota Swarm", + "Arrowhead Pond", + "L 11–12", + "OT", + "4,967", + "4–10" + ], + [ + "15", + "April 15, 2005", + "Arizona Sting", + "Arrowhead Pond", + "L 12–14", + null, + "5,891", + "4–11" + ], + [ + "16", + "April 16, 2005", + "@ Arizona Sting", + "Jobing.com Arena", + "W 11–10", + null, + "7,731", + "5–11" + ] + ], + "title": "", + "original_id": "d6d1f7594c6772b9f7a3b8f4ae21d647" + }, + { + "_id": "fb34f174327a8b2b21bd7ee09184aac8", + "header": [ + "Year", + "Network", + "NASCAR\nCountdown", + "Lap-by-lap", + "Color commentator(s)", + "Pit reporters", + "Ratings", + "Viewers" + ], + "rows": [ + [ + "2007", + "ESPN", + "Brent Musburger\nSuzy Kolber\nBrad Daugherty", + "Jerry Punch", + "Rusty Wallace\nAndy Petree", + "Dave Burns\nJamie Little\nAllen Bestwick\nMike Massaro", + "4.2 (4.9 cable)", + "6.574 million" + ], + [ + "2008", + "ESPN", + "Allen Bestwick\nRusty Wallace\nBrad Daugherty", + "Jerry Punch", + "Dale Jarrett\nAndy Petree", + "Dave Burns\nJamie Little\nShannon Spake\nMike Massaro", + "4.3 (5.1 cable)", + "6.668 million" + ], + [ + "2009", + "ESPN", + "Allen Bestwick\nRusty Wallace\nBrad Daugherty\nRay Evernham", + "Jerry Punch", + "Dale Jarrett\nAndy Petree", + "Dave Burns\nJamie Little\nShannon Spake\nVince Welch", + "4.1 (4.8 cable)", + "6.487 million" + ], + [ + "2010", + "ESPN", + "Allen Bestwick\nRusty Wallace\nBrad Daugherty\nRay Evernham", + "Marty Reid", + "Dale Jarrett\nAndy Petree", + "Dave Burns\nJamie Little\nJerry Punch\nVince Welch", + "3.6 (4.2 cable)", + "5.709 million" + ], + [ + "2011", + "ESPN", + "Nicole Briscoe\nRusty Wallace\nBrad Daugherty", + "Allen Bestwick", + "Dale Jarrett\nAndy Petree", + "Dave Burns\nJamie Little\nJerry Punch\nVince Welch", + "4.0 (4.6 cable)", + "6.337 million" + ], + [ + "2012", + "ESPN", + "Nicole Briscoe\nRusty Wallace\nBrad Daugherty\nRay Evernham", + "Allen Bestwick", + "Dale Jarrett\nAndy Petree", + "Dave Burns\nJamie Little\nJerry Punch\nVince Welch", + "3.3", + "5.1 million" + ], + [ + "2013", + "ESPN", + "Nicole Briscoe\nRusty Wallace\nBrad Daugherty\nRay Evernham", + "Allen Bestwick", + "Dale Jarrett\nAndy Petree", + "Dave Burns\nJamie Little\nJerry Punch\nVince Welch", + "3.6", + "5.5 million" + ], + [ + "2014", + "ESPN", + null, + null, + null, + null, + null, + null + ] + ], + "title": "", + "original_id": "981a69b6740520bc07087f0d51cbd353" + }, + { + "_id": "06d2d58b097954f97c107fc8e113f159", + "header": [ + "Club", + "Winners", + "Runner-ups", + "Winning Years", + "Runner-up Years" + ], + "rows": [ + [ + "FK Austria Wien", + "6", + "2", + "1990, 1991, 1992, 1994, 2003, 2004", + "1986, 1994" + ], + [ + "SK Rapid Wien", + "4", + "1", + "1986, 1987, 1988, 2008", + "1995, 1996" + ], + [ + "SK Sturm Graz", + "3", + "2", + "1996, 1998, 1999", + "1997, 2002" + ], + [ + "SV Austria Salzburg", + "3", + "0", + "1994, 1995, 1997", + "–" + ], + [ + "Grazer AK", + "2", + "1", + "2000, 2002", + "2004" + ], + [ + "VfB Admira Wacker Mödling", + "1", + "1", + "1989", + "1992" + ], + [ + "FC Kärnten", + "1", + "1", + "2001", + "2003" + ], + [ + "FC Swarovski Tirol / FC Tirol Innsbruck", + "0*", + "6", + "–", + "1987, 1989, 1990, 1993, 2000, 2001" + ], + [ + "Kremser SC", + "0", + "1", + "–", + "1988" + ], + [ + "SV Stockerau", + "0", + "1", + "–", + "1991" + ], + [ + "SV Ried", + "0", + "1", + "–", + "1998" + ], + [ + "LASK Linz", + "0", + "1", + "–", + "1999" + ], + [ + "SV Horn", + "0", + "1", + "–", + "2008" + ] + ], + "title": "", + "original_id": "498ad888af0138fb83a16a69d424fde5" + }, + { + "_id": "3e06f5f7df7c1dfd5ff2b02c00c6834f", + "header": [ + "#", + "Date", + "Venue", + "Opponent", + "Score", + "Result", + "Competition" + ], + "rows": [ + [ + "1.0", + "24 December 2005", + "Phang Nga, Thailand", + "Latvia", + "1–1", + "Draw", + "2005 King's Cup" + ], + [ + "2.0", + "26 March 2006", + "Chonburi, Thailand", + "Philippines", + "5–0", + "Win", + "Friendly" + ], + [ + "3.0", + "26 March 2006", + "Chonburi, Thailand", + "Philippines", + "5–0", + "Win", + "Friendly" + ], + [ + "4.0", + "8 October 2007", + "Bangkok, Thailand", + "Macau", + "6–1", + "Win", + "2010 FIFA World Cup Qualification" + ], + [ + "5.0", + "6 February 2008", + "Saitama, Japan", + "Japan", + "4–1", + "Loss", + "2010 FIFA World Cup Qualification" + ], + [ + "6.0", + "15 March 2008", + "Kunming, China", + "China PR", + "3–3", + "Draw", + "Friendly" + ], + [ + "7.0", + "15 March 2008", + "Kunming, China", + "China PR", + "3–3", + "Draw", + "Friendly" + ], + [ + "8.0", + "20 May 2008", + "Bangkok, Thailand", + "Nepal", + "7–0", + "Win", + "Friendly" + ], + [ + "9.0", + "20 May 2008", + "Bangkok, Thailand", + "Nepal", + "7–0", + "Win", + "Friendly" + ], + [ + "10.0", + "25 May 2008", + "Bangkok, Thailand", + "Iraq", + "2–1", + "Win", + "Friendly" + ], + [ + "11.0", + "2 June 2008", + "Bangkok, Thailand", + "Bahrain", + "2–3", + "Loss", + "2010 FIFA World Cup Qualification" + ], + [ + "12.0", + "20 December 2008", + "Bangkok, Thailand", + "Indonesia", + "2–1", + "Win", + "2008 AFF Suzuki Cup" + ], + [ + "13.0", + "18 July 2009", + "Bangkok, Thailand", + "Pakistan", + "4–0", + "Win", + "Friendly" + ], + [ + "14.0", + "8 November 2009", + "Bangkok, Thailand", + "Syria", + "1–1", + "Draw", + "Friendly" + ], + [ + "15.0", + "8 September 2010", + "New Delhi, India", + "India", + "2–1", + "Win", + "Friendly" + ], + [ + "16.0", + "15 January 2012", + "Bangkok, Thailand", + "South Korea", + "1–3", + "Loss", + "2012 King's Cup" + ], + [ + "17.0", + "26 January 2013", + "Chiangmai, Thailand", + "North Korea", + "2–2", + "Draw", + "2013 King's Cup" + ], + [ + "18.0", + "5 March 2014", + "Bangkok, Thailand", + "Lebanon", + "2–5", + "Loss", + "2015 AFC Asian Cup qualification" + ] + ], + "title": "", + "original_id": "148dedc65365084819c4c9faddbe9be8" + }, + { + "_id": "f634197399f4f0130f567573f6bded49", + "header": [ + "Date", + "Name", + "Nationality", + "Tonnage\n(GRT)", + "Fate" + ], + "rows": [ + [ + "18 January 1940", + "Flandria", + "Sweden", + "1,179", + "Sunk" + ], + [ + "19 January 1940", + "Patria", + "Sweden", + "1,188", + "Sunk" + ], + [ + "11 February 1940", + "Linda", + "Estonia", + "1,213", + "Sunk" + ], + [ + "4 May 1940", + "San Tiburcio", + "United Kingdom", + "5,995", + "Sunk (mine)" + ], + [ + "9 May 1940", + "Doris", + "French Navy", + "552", + "Sunk" + ], + [ + "11 May 1940", + "Tringa", + "United Kingdom", + "1,930", + "Sunk" + ], + [ + "11 May 1940", + "Viiu", + "Estonia", + "1,908", + "Sunk" + ], + [ + "23 May 1940", + "Sigurd Faulbaum", + "Belgium", + "3,256", + "Sunk" + ], + [ + "11 May 1944", + "Shtorm", + "Soviet Union", + "412", + "Damaged" + ] + ], + "title": "", + "original_id": "c6efb6d1181b8e94551ca81c9073a942" + }, + { + "_id": "a24a1f632f5eb1382891ad1eb3abaca8", + "header": [ + "Rank", + "Heat", + "Nation", + "Competitors", + "Time", + "Notes" + ], + "rows": [ + [ + "1.0", + "2", + "United States", + "Kelly Willie, Derrick Brew, Andrew Rock, Darold Williamson", + "2:59.30", + "Q" + ], + [ + "2.0", + "2", + "Nigeria", + "James Godday, Musa Audu, Saul Weigopwa, Enefiok Udo-Obong", + "3:01.60", + "Q, SB" + ], + [ + "3.0", + "2", + "Bahamas", + "Andrae Williams, Dennis Darling, Nathaniel McKinney, Christopher Brown", + "3:01.74", + "Q, SB" + ], + [ + "4.0", + "1", + "Great Britain", + "Timothy Benjamin, Sean Baldock, Malachi Davis, Matthew Elias", + "3:02.40", + "Q, SB" + ], + [ + "5.0", + "1", + "Japan", + "Yuki Yamaguchi, Jun Osakada, Tomohiro Ito, Mitsuhiro Sato", + "3:02.71", + "Q" + ], + [ + "6.0", + "1", + "Germany", + "Ingo Schultz, Kamghe Gaba, Ruwen Faller, Bastian Swillims", + "3:02.77", + "Q" + ], + [ + "7.0", + "1", + "Australia", + "John Steffensen, Clinton Hill, Patrick Dwyer, Mark Ormrod", + "3:03.06", + "q" + ], + [ + "8.0", + "1", + "Botswana", + "Oganeditse Moseki, Johnson Kubisa, California Molefe, Kagiso Kilego", + "3:03.32", + "q, SB" + ], + [ + "9.0", + "2", + "Russia", + "Aleksandr Larin, Andrey Rudnitskiy, Oleg Mishukov, Ruslan Mashchenko", + "3:03.35", + null + ], + [ + "10.0", + "2", + "Poland", + "Piotr Rysiukiewicz, Piotr Klimczak, Marcin Marciniszyn, Marek Plawgo", + "3:03.69", + null + ], + [ + "11.0", + "2", + "Ukraine", + "Volodymyr Demchenko, Yevgeniy Zyukov, Myhaylo Knysh, Andriy Tverdostup", + "3:04.01", + null + ], + [ + "12.0", + "1", + "Greece", + "Stilianos Dimotsios, Anastasios Gousis, Panagiotis Sarris, Periklis Iakovakis", + "3:04.27", + "SB" + ], + [ + "13.0", + "1", + "France", + "Ahmed Douhou, Ibrahima Wade, Abderrahim El Haouzy, Leslie Djhone", + "3:04.39", + null + ], + [ + "14.0", + "2", + "Spain", + "Eduardo Ivan Rodriguez, David Canal, Luis Flores, Antonio Manuel Reina", + "3:05.03", + "SB" + ], + [ + null, + "2", + "South Africa", + "Marcus la Grange, Hendrick Mokganyetsi, Ockert Cilliers, Arnaud Malherbe", + "DNF", + null + ], + [ + null, + "1", + "Jamaica", + "Michael Campbell, Michael Blackwood, Jermaine Gonzales, Davian Clarke", + "DSQ", + null + ] + ], + "title": "", + "original_id": "a6b59f9af78c3d51a9219fe299c43ca2" + }, + { + "_id": "e6068fc4f49d3ee5f48ae44afb24e9d7", + "header": [ + "Year", + "Total", + "Serbs", + "Hungarians", + "Germans", + "Romanians", + "Slovaks" + ], + "rows": [ + [ + "1910", + "566,400", + "229,568 (40.5%)", + "108,622 (19.2%)", + "125,374 (22.1%)", + "73,303 (12.9%)", + "16,223 (2,9%)" + ], + [ + "1921", + "559,096", + "235,148 (42.1%)", + "98,463 (17.6%)", + "126,519 (22.6%)", + "66,433 (11,9%)", + "17,595 (3,2%)" + ], + [ + "1931", + "585,579", + "261,123 (44,6%)", + "95,867 (16,4%)", + "120,541 (20,6%)", + "62,365 (10,7%)", + "17,900 (2,1%)" + ], + [ + "1948", + "601,626", + "358,067 (59,6%)", + "110,446 (18,4%)", + "17,522 (2,9%)", + "55,678 (9,3%)", + "20,685 (2,4%)" + ], + [ + "1953", + "617,163", + "374,258 (60,6%)", + "112,683 (18,4%)", + null, + "55,094 (8,9%)", + "21,299 (3,4%)" + ], + [ + "1961", + "655,868", + "423,837 (64,6%)", + "111,944 (17,1%)", + null, + "54,447 (8,3%)", + "22,306 (3,4%)" + ], + [ + "1971", + "666,559", + "434,810 (65,2%)", + "103,090 (15.5%)", + null, + "49,455 (7,4%)", + "22,173 (3,3%)" + ], + [ + "1981", + "672,884", + "424,765 (65,7%)", + "90,445 (14,0%)", + null, + "43,474 (6,7%)", + "21,392 (3,3%)" + ], + [ + "1991", + "648,390", + "423,475 (65,1%)", + "76,153 (11.7%)", + null, + "35,935 (5,5%)", + "19,903 (3.1%)" + ], + [ + "2002", + "665,397", + "477,890 (71.8%)", + "63,047 (9.5%)", + "908 (0,1%)", + "27,661 (4,1%)", + "17,994 (2,7%)" + ] + ], + "title": "", + "original_id": "de91298e29cf142ece5d370e2687c1fc" + }, + { + "_id": "552915f9e063dcfe34d140d6400622c6", + "header": [ + "Rank", + "City", + "Passengers", + "Ranking", + "Airline" + ], + "rows": [ + [ + "1", + "Quintana Roo, Cancún", + "132,046", + null, + "Aeroméxico Connect, Interjet, Volaris" + ], + [ + "2", + "Nuevo León, Monterrey", + "106,513", + null, + "Aeroméxico Connect, Interjet" + ], + [ + "3", + "Guerrero, Acapulco", + "56,069", + null, + "Aeroméxico Connect, Interjet" + ], + [ + "4", + "Jalisco, Guadalajara", + "52,584", + null, + "Aeroméxico Connect, Volaris" + ], + [ + "5", + "Jalisco, Puerto Vallarta", + "43,419", + "1.0", + "Interjet" + ], + [ + "6", + "Baja California Sur, Los Cabos", + "37,526", + "1.0", + "Interjet" + ], + [ + "7", + "Guerrero, Ixtapa/Zihuatanejo", + "35,507", + null, + "Interjet" + ], + [ + "8", + "Baja California, Tijuana", + "14,906", + null, + "Interjet" + ], + [ + "9", + "Tabasco, Villahermosa", + "6,928", + "1.0", + "VivaAerobus" + ], + [ + "10", + "Tamaulipas, Tampico", + "3,619", + "1.0", + "VivaAerobus" + ] + ], + "title": "", + "original_id": "7cfdc47e6cfdc865ffb5d0a9ddd1d380" + }, + { + "_id": "d72604ef234fe3dee907507769107263", + "header": [ + "Painter", + "Composition", + "Drawing", + "Color", + "Expression" + ], + "rows": [ + [ + "Andrea del Sarto", + "12", + "16", + "9", + "8" + ], + [ + "Federico Barocci", + "14", + "15", + "6", + "10" + ], + [ + "Jacopo Bassano", + "6", + "8", + "17", + "0" + ], + [ + "Giovanni Bellini", + "4", + "6", + "14", + "O" + ], + [ + "Sebastian Bourdon", + "10", + "8", + "8", + "4" + ], + [ + "Charles Le Brun", + "16", + "16", + "8", + "16" + ], + [ + "I Carracci", + "15", + "17", + "13", + "13" + ], + [ + "Cavalier D'Arpino", + "10", + "10", + "6", + "2" + ], + [ + "Correggio", + "13", + "13", + "15", + "12" + ], + [ + "Daniele da Volterra", + "12", + "15", + "5", + "8" + ], + [ + "Abraham van Diepenbeeck", + "11", + "10", + "14", + "6" + ], + [ + "Il Domenichino", + "15", + "17", + "9", + "17" + ], + [ + "Albrecht Dürer", + "8", + "10", + "10", + "8" + ], + [ + "Giorgione", + "8", + "9", + "18", + "4" + ], + [ + "Giovanni da Udine", + "10", + "8", + "16", + "3" + ], + [ + "Giulio Romano", + "15", + "16", + "4", + "14" + ], + [ + "Guercino", + "18", + "10", + "10", + "4" + ], + [ + "Guido Reni", + "x", + "13", + "9", + "12" + ], + [ + "Holbein", + "9", + "10", + "16", + "3" + ], + [ + "Jacob Jordaens", + "10", + "8", + "16", + "6" + ], + [ + "Lucas Jordaens", + "13", + "12", + "9", + "6" + ], + [ + "Giovanni Lanfranco", + "14", + "13", + "10", + "5" + ], + [ + "Leonardo da Vinci", + "15", + "16", + "4", + "14" + ], + [ + "Lucas van Leyden", + "8", + "6", + "6", + "4" + ], + [ + "Michelangelo", + "8", + "17", + "4", + "8" + ], + [ + "Caravaggio", + "6", + "6", + "16", + "O" + ], + [ + "Murillo", + "6", + "8", + "15", + "4" + ], + [ + "Otho Venius", + "13", + "14", + "10", + "10" + ], + [ + "Palma il Vecchio", + "5", + "6", + "16", + "0" + ], + [ + "Palma il Giovane", + "12", + "9", + "14", + "6" + ], + [ + "Il Parmigianino", + "10", + "15", + "6", + "6" + ], + [ + "Gianfrancesco Penni", + "O", + "15", + "8", + "0" + ], + [ + "Perin del Vaga", + "15", + "16", + "7", + "6" + ], + [ + "Sebastiano del Piombo", + "8", + "13", + "16", + "7" + ], + [ + "Primaticcio", + "15", + "14", + "7", + "10" + ], + [ + "Raphael", + "17", + "18", + "12", + "18" + ], + [ + "Rembrandt", + "15", + "6", + "17", + "12" + ], + [ + "Rubens", + "18", + "13", + "17", + "17" + ], + [ + "Francesco Salviati", + "13", + "15", + "8", + "8" + ], + [ + "Eustache Le Sueur", + "15", + "15", + "4", + "15" + ], + [ + "Teniers", + "15", + "12", + "13", + "6" + ], + [ + "Pietro Testa", + "11", + "15", + "0", + "6" + ], + [ + "Tintoretto", + "15", + "14", + "16", + "4" + ], + [ + "Titian", + "12", + "15", + "18", + "6" + ], + [ + "Van Dyck", + "15", + "10", + "17", + "13" + ], + [ + "Vanius", + "15", + "15", + "12", + "13" + ], + [ + "Veronese", + "15", + "10", + "16", + "3" + ], + [ + "Taddeo Zuccari", + "13", + "14", + "10", + "9" + ], + [ + "Federico Zuccari", + "10", + "10", + "8", + "8" + ] + ], + "title": "", + "original_id": "186b646cdd698ceabbb2738e0e5e9e6b" + }, + { + "_id": "4dd6c3e8e1e5733c6a31aab9c0438b47", + "header": [ + "Year", + "Majors", + "ATP wins", + "Total wins", + "Earnings (US$)", + "Money list rank" + ], + "rows": [ + [ + "2002", + "0", + "0", + "0", + "101,122", + "165.0" + ], + [ + "2003", + "0", + "0", + "0", + "277,743", + "79.0" + ], + [ + "2004", + "0", + "0", + "0", + "579,375", + "38.0" + ], + [ + "2005", + "0", + "1", + "1", + "702,670", + "27.0" + ], + [ + "2006", + "0", + "2", + "2", + "1,276,265", + "9.0" + ], + [ + "2007", + "0", + "0", + "0", + "209,610", + "146.0" + ], + [ + "2008", + "0", + "0", + "0", + "600,326", + "44.0" + ], + [ + "2009", + "0", + "0", + "0", + "197,818", + "133.0" + ], + [ + "2010", + "0", + "0", + "0", + "52,464", + "284.0" + ], + [ + "Career", + "0", + "3", + "3", + "4,024,686", + null + ] + ], + "title": "", + "original_id": "3f2df3c4c7b0a42c92cd2ee6ef61ac49" + }, + { + "_id": "64d149c36f83dcf7d409856b1d99f750", + "header": [ + "Leg", + "Stage", + "Time", + "Name", + "Length", + "Winner", + "Time.1", + "Avg. spd.", + "Rally leader" + ], + "rows": [ + [ + "1\n(16 Feb)", + "SS1", + "07:43", + "Loten 1", + "30.30 km", + "M. Hirvonen", + "16:14.1", + "111.98 km/h", + "M. Hirvonen" + ], + [ + "1\n(16 Feb)", + "SS2", + "08:34", + "Haslemoen", + "11.92 km", + "S. Loeb", + "8:08.4", + "87.86 km/h", + "M. Hirvonen" + ], + [ + "1\n(16 Feb)", + "SS3", + "11:24", + "Loten 2", + "30.30 km", + "M. Hirvonen", + "16:09.9", + "112.47 km/h", + "M. Hirvonen" + ], + [ + "1\n(16 Feb)", + "SS4", + "12:30", + "Grue", + "14.36 km", + "S. Loeb", + "7:31.8", + "114.42 km/h", + "M. Hirvonen" + ], + [ + "1\n(16 Feb)", + "SS5", + "13:52", + "Opaker", + "14.64 km", + "J. Latvala", + "7:59.8", + "109.85 km/h", + "M. Hirvonen" + ], + [ + "1\n(16 Feb)", + "SS6", + "14:36", + "Kongsvinger", + "14.60 km", + "S. Loeb", + "9:44.5", + "89.92 km/h", + "M. Hirvonen" + ], + [ + "1\n(16 Feb)", + "SS7", + "15:30", + "Finnskogen", + "21.29 km", + "S. Loeb", + "12:42.3", + "100.54 km/h", + "M. Hirvonen" + ], + [ + "1\n(16 Feb)", + "SS8", + "16:33", + "Kirkanaer", + "6.75 km", + "S. Loeb", + "5:48.9", + "69.65 km/h", + "M. Hirvonen" + ], + [ + "2\n(17 Feb)", + "SS9", + "08:09", + "Eleverum 1", + "44.27 km", + "M. Hirvonen", + "24:40.3", + "107.66 km/h", + "M. Hirvonen" + ], + [ + "2\n(17 Feb)", + "SS10", + "09:23", + "Terningmoen", + "12.71 km", + "D. Sordo", + "7:59.1", + "95.5 km/h", + "M. Hirvonen" + ], + [ + "2\n(17 Feb)", + "SS11", + "12:05", + "Mountain 1", + "24.36 km", + "M. Hirvonen", + "14:01.8", + "104.18 km/h", + "M. Hirvonen" + ], + [ + "2\n(17 Feb)", + "SS12", + "13:06", + "Lillehammar", + "5.98 km", + "M. Grönholm", + "4:33.9", + "78.6 km/h", + "M. Hirvonen" + ], + [ + "2\n(17 Feb)", + "SS13", + "14:00", + "Ringsaker 1", + "27.30 km", + "M. Grönholm", + "16:29.7", + "99.3 km/h", + "M. Hirvonen" + ], + [ + "2\n(17 Feb)", + "SS14", + "15:10", + "Hamar 1", + "1.14 km", + "M. Grönholm", + "1:13.8", + "55.61 km/h", + "M. Hirvonen" + ], + [ + "3\n(18 Feb)", + "SS15", + "08:08", + "Mountain 2", + "24.36 km", + "S. Loeb", + "13:18.2", + "109.87 km/h", + "M. Hirvonen" + ], + [ + "3\n(18 Feb)", + "SS16", + "08:55", + "Ringsaker 2", + "27.30 km", + "H. Solberg", + "15:28.6", + "105.84 km/h", + "M. Hirvonen" + ], + [ + "3\n(18 Feb)", + "SS17", + "10:05", + "Hamar 2", + "1.14 km", + "X. Pons\n S. Loeb\n P. Solberg", + "1:11.8", + "57.16 km/h", + "M. Hirvonen" + ], + [ + "3\n(18 Feb)", + "SS18", + "12:14", + "Eleverum 2", + "44.27 km", + "M. Grönholm", + "24:10.3", + "109.89 km/h", + "M. Hirvonen" + ] + ], + "title": "", + "original_id": "83152b654dce2311e6036b3d951bfc77" + }, + { + "_id": "5401058c154fe0ddb1b2deecac708a83", + "header": [ + "League", + "League.1", + "Position", + "Teams", + "Matches", + "Win", + "Lose" + ], + "rows": [ + [ + "V.League", + "7th (2000-01)", + "4th", + "10", + "18", + "9", + "9" + ], + [ + "V.League", + "8th (2001-02)", + "4th", + "9", + "16", + "14", + "2" + ], + [ + "V.League", + "9th (2002-03)", + "3rd", + "8", + "21", + "12", + "9" + ], + [ + "V.League", + "10th (2003-04)", + "Runner-up", + "10", + "18", + "13", + "5" + ], + [ + "V.League", + "11th (2004-05)", + "8th", + "10", + "27", + "11", + "16" + ], + [ + "V.League", + "12th (2005-06)", + "4th", + "10", + "27", + "20", + "7" + ], + [ + "V・Premier", + "2006-07", + "6th", + "10", + "27", + "11", + "16" + ], + [ + "V・Premier", + "2007-08", + "Champion", + "10", + "27", + "23", + "4" + ], + [ + "V・Premier", + "2008-09", + "Champion", + "10", + "27", + "20", + "7" + ], + [ + "V・Premier", + "2009-10", + "Champion", + "8", + "28", + "21", + "7" + ], + [ + "V・Premier", + "2010-11", + "Runner-up", + "8", + "26", + "19", + "7" + ], + [ + "V・Premier", + "2011-12", + "Champion", + "8", + "21", + "18", + "3" + ], + [ + "V・Premier", + "2012-13", + "Runner-up", + "8", + "28", + "20", + "8" + ] + ], + "title": "", + "original_id": "b4eb57e9a160eb8d608dd549f1d97112" + }, + { + "_id": "e9e25283d34e5a97f5a038d5a44233c4", + "header": [ + "Position", + "Team", + "Points", + "Played", + "Won", + "Drawn", + "Lost", + "For", + "Against", + "Difference" + ], + "rows": [ + [ + "1", + "Paulistano", + "30", + "18", + "14", + "2", + "2", + "62", + "19", + "43" + ], + [ + "2", + "Palestra Itália-SP", + "29", + "18", + "14", + "1", + "3", + "59", + "21", + "38" + ], + [ + "3", + "Corinthians", + "26", + "18", + "12", + "2", + "4", + "51", + "16", + "35" + ], + [ + "4", + "Ypiranga-SP", + "25", + "18", + "11", + "3", + "4", + "56", + "34", + "22" + ], + [ + "5", + "AA São Bento", + "16", + "18", + "7", + "2", + "9", + "38", + "44", + "-6" + ], + [ + "6", + "Santos", + "13", + "18", + "6", + "1", + "11", + "36", + "43", + "-7" + ], + [ + "7", + "SC Internacional de São Paulo", + "11", + "15", + "3", + "5", + "7", + "26", + "44", + "-18" + ], + [ + "8", + "Minas Gerais", + "10", + "15", + "4", + "2", + "9", + "18", + "49", + "-31" + ], + [ + "9", + "AA das Palmeiras", + "6", + "15", + "3", + "0", + "12", + "27", + "57", + "-30" + ], + [ + "10", + "Mackenzie", + "2", + "15", + "1", + "0", + "14", + "11", + "57", + "-46" + ] + ], + "title": "", + "original_id": "10374c30d690bc6605ca2037c06541ef" + }, + { + "_id": "ec90ba87bd325b684657c1d8e546f52a", + "header": [ + "Interferometer and observing mode\tWaveband\tLimiting magnitude\tMinimum baseline (m)\\n(un-projected)\tMaximum baseline (m)\tApprox. no. visibility measurements per year\\n(measurements per night x nights used per year)\tMax ratio of no. phase / no. amplitude measurements\\n(measure of imaging performance", + " 0 = none)\tAccuracy of amplitude2 measurements\tAccuracy of phase measurements\\n(milli-radians)\tNumber of spectral channels\\n(max in use simultaneously)\tComments" + ], + "rows": [ + [ + " H", + " K\t8\t34\t330\t7500\t0.7\t1%\t10\t30000\tYes... 30000 in the visible band; maxiumum baseline 330-m" + ], + [ + " No imaging on a single baseline instrument. CLOSED 2009.", + null + ] + ], + "title": "", + "original_id": "ac9369e40bb0b3a23bbb92a0bae9b678" + }, + { + "_id": "21223de9850aaebdfae5dda2e0d2e265", + "header": [ + "year", + "typhus", + "typhoid fever", + "relapsing fever", + "smallpox", + "malaria" + ], + "rows": [ + [ + "1913", + "120", + "424", + "30", + "67", + "3600" + ], + [ + "191822", + "1300", + "293", + "639", + "106", + "2940 (avg)" + ], + [ + "1929", + "40", + "170", + "6", + "8", + "3000" + ], + [ + "1930", + "60", + "190", + "5", + "10", + "2700" + ], + [ + "1931", + "80", + "260", + "4", + "30", + "3200" + ], + [ + "1932", + "220", + "300", + "12", + "80", + "4500" + ], + [ + "1933", + "800", + "210", + "12", + "38", + "6500" + ], + [ + "1934", + "410", + "200", + "10", + "16", + "9477" + ], + [ + "1935", + "120", + "140", + "6", + "4", + "9924" + ] + ], + "title": "", + "original_id": "a289c37617f27573e8568ede1ef81561" + }, + { + "_id": "40899c93f8ce71f696618d14d61b20b9", + "header": [ + "song", + "mobiles", + "northern ireland", + "northern england", + "scotland", + "southern england", + "wales", + "total" + ], + "rows": [ + [ + "groovy chick", + "10", + "3", + "2", + "3", + "2", + "3", + "23" + ], + [ + "clear the air", + "5", + "5", + "10", + "8", + "3", + "4", + "35" + ], + [ + "devil in a hood", + "4", + "1", + "3", + "4", + "4", + "1", + "17" + ], + [ + "in my life", + "2", + "6", + "8", + "5", + "5", + "10", + "36" + ], + [ + "how does it feel", + "8", + "8", + "4", + "10", + "8", + "5", + "43" + ], + [ + "the girl", + "1", + "2", + "1", + "1", + "6", + "2", + "13" + ], + [ + "about you", + "3", + "4", + "6", + "6", + "1", + "6", + "26" + ] + ], + "title": "", + "original_id": "effc38cfdbb5023b3a88c474e66e3f83" + }, + { + "_id": "e9a6175904be7ad9f9cbb1e2fa5fbd7c", + "header": [ + "Row Header", + "Quarter Ended March 31 ", + "Quarter Ended June 30 ", + "Quarter Ended September 30 ", + "Quarter Ended December 31 " + ], + "rows": [ + [ + "Operating revenue", + "$9,589", + "$11,402", + "$11,380", + "$10,888" + ], + [ + "Income from operations", + "495", + "1,472", + "1,473", + "861" + ], + [ + "Net income", + "292", + "1,052", + "1,024", + "641" + ], + [ + "Basic earnings per share", + "1.09", + "4.03", + "4.01", + "2.54" + ], + [ + "Diluted earnings per share", + "1.09", + "4.02", + "3.99", + "2.53" + ], + [ + "2018 Operating revenue", + "$9,032", + "$10,777", + "$11,003", + "$10,491" + ], + [ + "2018 Income from operations (a)", + "262", + "1,145", + "1,187", + "635" + ], + [ + "2018 Net income (a)", + "145", + "683", + "833", + "461" + ], + [ + "2018 Basic earnings per share (a)", + "0.51", + "2.48", + "3.06", + "1.70" + ], + [ + "2018 Diluted earnings per share (a)", + "0.51", + "2.48", + "3.05", + "1.69" + ] + ], + "title": "", + "original_id": "82f9c9423754f76241ef44ad06504164" + }, + { + "_id": "973f8c87936ce6ab0c21a90e717b95da", + "header": [ + "county", + "obama%", + "obama", + "mccain%", + "mccain", + "total" + ], + "rows": [ + [ + "bernalillo", + "60.66%", + "168406", + "39.34%", + "109212", + "277618" + ], + [ + "catron", + "32.07%", + "659", + "67.93%", + "1396", + "2055" + ], + [ + "chaves", + "37.45%", + "8160", + "62.55%", + "13630", + "21790" + ], + [ + "cibola", + "64.91%", + "3176", + "35.09%", + "1717", + "4893" + ], + [ + "colfax", + "55.31%", + "3465", + "44.69%", + "2800", + "6265" + ], + [ + "curry", + "32.69%", + "4655", + "67.31%", + "9585", + "14240" + ], + [ + "debaca", + "34.62%", + "358", + "65.38%", + "676", + "1034" + ], + [ + "doã±a ana", + "58.64%", + "38574", + "41.36%", + "27211", + "65785" + ], + [ + "eddy", + "36.89%", + "7289", + "63.11%", + "12468", + "19757" + ], + [ + "grant", + "60.06%", + "8092", + "39.94%", + "5381", + "13473" + ], + [ + "guadalupe", + "71.47%", + "1541", + "28.53%", + "615", + "2156" + ], + [ + "harding", + "41.76%", + "256", + "58.24%", + "357", + "613" + ], + [ + "hidalgo", + "51.46%", + "990", + "48.54%", + "934", + "1924" + ], + [ + "lea", + "27.65%", + "5084", + "72.35%", + "13301", + "18385" + ], + [ + "lincoln", + "37.09%", + "3482", + "62.91%", + "5906", + "9388" + ], + [ + "los alamos", + "53.38%", + "5709", + "46.62%", + "4986", + "10695" + ], + [ + "luna", + "52.65%", + "4289", + "47.35%", + "3857", + "8146" + ], + [ + "mckinley", + "72.12%", + "15993", + "27.88%", + "6183", + "22176" + ], + [ + "mora", + "79.24%", + "2156", + "20.76%", + "565", + "2721" + ], + [ + "otero", + "40.21%", + "8602", + "59.79%", + "12791", + "21393" + ], + [ + "quay", + "39.55%", + "1546", + "60.45%", + "2363", + "3909" + ], + [ + "rio arriba", + "75.51%", + "11245", + "24.49%", + "3648", + "14893" + ], + [ + "roosevelt", + "34.63%", + "2270", + "65.37%", + "4285", + "6555" + ], + [ + "san juan", + "39.16%", + "17645", + "60.84%", + "27418", + "45063" + ], + [ + "san miguel", + "80.71%", + "10128", + "19.29%", + "2421", + "12549" + ], + [ + "sandoval", + "56.33%", + "32102", + "43.67%", + "24887", + "56989" + ], + [ + "santa fe", + "77.70%", + "53802", + "22.30%", + "15443", + "69245" + ], + [ + "sierra", + "43.85%", + "2351", + "56.15%", + "3011", + "5362" + ], + [ + "socorro", + "60.66%", + "4643", + "39.34%", + "3011", + "7654" + ], + [ + "taos", + "82.56%", + "13384", + "17.44%", + "2827", + "16211" + ], + [ + "torrance", + "45.19%", + "3068", + "54.81%", + "3721", + "6789" + ], + [ + "union", + "28.77%", + "492", + "71.23%", + "1218", + "1710" + ] + ], + "title": "", + "original_id": "1c5c0e7e18b6e11f8c7b9ef00ef8b137" + }, + { + "_id": "9271af3f840b1b645d48aa9920987a53", + "header": [ + "township", + "county", + "pop (2010)", + "land ( sqmi )", + "water (sqmi)", + "latitude", + "longitude", + "geo id", + "ansi code" + ], + "rows": [ + [ + "tacoma", + "bottineau", + "61", + "39.385", + "2.644", + "48.668771", + "- 100.852516", + "3800977740", + "1759300" + ], + [ + "taft", + "burleigh", + "32", + "35.809", + "0.142", + "46.771542", + "- 100.258025", + "3801577780", + "1037068" + ], + [ + "talbot", + "bowman", + "104", + "35.822", + "0.03", + "46.166803", + "- 103.304095", + "3801177900", + "1037226" + ], + [ + "tanner", + "kidder", + "26", + "34.098", + "2.246", + "46.758863", + "- 99.506850", + "3804377940", + "1037057" + ], + [ + "tappen", + "kidder", + "91", + "34.677", + "0.237", + "46.841224", + "- 99.647480", + "3804378020", + "2397881" + ], + [ + "tatman", + "ward", + "2992", + "35.922", + "0.155", + "48.418099", + "- 101.249373", + "3810178100", + "1759694" + ], + [ + "taylor", + "sargent", + "39", + "36.03", + "0.196", + "45.979191", + "- 97.696346", + "3808178140", + "1036786" + ], + [ + "taylor butte", + "adams", + "14", + "35.893", + "0.006", + "46.169023", + "- 102.559886", + "3800178220", + "1037209" + ], + [ + "teddy", + "towner", + "36", + "35.847", + "0.241", + "48.747117", + "- 99.077078", + "3809578260", + "1759667" + ], + [ + "telfer", + "burleigh", + "74", + "36.016", + "0.062", + "46.685192", + "- 100.500785", + "3801578300", + "1759348" + ], + [ + "tepee butte", + "hettinger", + "39", + "35.799", + "0.008", + "46.415037", + "- 102.735539", + "3804178460", + "1037233" + ], + [ + "tewaukon", + "sargent", + "54", + "37.499", + "1.536", + "45.976518", + "- 97.426205", + "3808178500", + "1036784" + ], + [ + "thelma", + "burleigh", + "17", + "34.163", + "1.942", + "46.74648", + "- 100.111760", + "3801578580", + "1037070" + ], + [ + "thingvalla", + "pembina", + "101", + "36.032", + "0.009", + "48.677597", + "- 97.848487", + "3806778620", + "1036722" + ], + [ + "thordenskjold", + "barnes", + "67", + "35.623", + "0.005", + "46.668028", + "- 97.874181", + "3800378700", + "1036401" + ], + [ + "thorson", + "burke", + "26", + "35.552", + "0.355", + "48.691017", + "- 102.790846", + "3801378780", + "1037112" + ], + [ + "tiber", + "walsh", + "72", + "35.805", + "0.093", + "48.503371", + "- 97.981576", + "3809978820", + "1036549" + ], + [ + "tiffany", + "eddy", + "31", + "35.94", + "0.185", + "47.715191", + "- 98.848133", + "3802778860", + "1759415" + ], + [ + "tioga", + "williams", + "104", + "34.437", + "0.151", + "48.423224", + "- 102.961858", + "3810578980", + "1037030" + ], + [ + "tolgen", + "ward", + "29", + "33.679", + "2.213", + "48.149479", + "- 101.724985", + "3810179100", + "1036984" + ], + [ + "torgerson", + "pierce", + "62", + "33.181", + "2.255", + "48.425558", + "- 99.924452", + "3806979220", + "1759561" + ], + [ + "torning", + "ward", + "64", + "34.401", + "1.783", + "48.071326", + "- 101.482912", + "3810179260", + "1036955" + ], + [ + "tower", + "cass", + "54", + "34.556", + "0.003", + "46.941938", + "- 97.608616", + "3801779300", + "1036378" + ], + [ + "trenton", + "williams", + "541", + "30.527", + "1.956", + "48.071095", + "- 103.805216", + "3810579500", + "1036977" + ], + [ + "tri", + "mckenzie", + "104", + "113.817", + "10.99", + "48.016174", + "- 103.665710", + "3805379520", + "1954181" + ], + [ + "trier", + "cavalier", + "50", + "30.346", + "1.924", + "48.681579", + "- 98.895032", + "3801979540", + "1759383" + ], + [ + "triumph", + "ramsey", + "38", + "36.106", + "0.493", + "48.332618", + "- 98.497709", + "3807179580", + "1759597" + ], + [ + "troy", + "divide", + "45", + "34.379", + "1.584", + "48.858036", + "- 103.388573", + "3802379660", + "1036927" + ], + [ + "truax", + "williams", + "190", + "49.301", + "7.797", + "48.12222", + "- 103.283768", + "3810579740", + "1036979" + ], + [ + "truman", + "pierce", + "54", + "35.36", + "0.457", + "47.898085", + "- 99.994799", + "3806979780", + "1759562" + ], + [ + "trygg", + "burleigh", + "40", + "36.028", + "0.0", + "47.025735", + "- 100.431786", + "3801579820", + "1037132" + ], + [ + "tuller", + "ransom", + "107", + "36.008", + "0.01", + "46.50733", + "- 97.710566", + "3807379860", + "1036872" + ], + [ + "turtle lake", + "mclean", + "43", + "33.978", + "1.982", + "47.548602", + "- 100.985957", + "3805579980", + "2397883" + ], + [ + "turtle river", + "grand forks", + "174", + "33.291", + "0.272", + "48.142938", + "- 97.202245", + "3803580060", + "1036622" + ], + [ + "tuscarora", + "pierce", + "62", + "34.634", + "1.241", + "48.239469", + "- 100.031162", + "3806980100", + "1759563" + ], + [ + "tuttle", + "kidder", + "39", + "34.48", + "1.013", + "47.1052", + "- 100.051684", + "3804380180", + "1037159" + ], + [ + "twelve mile", + "williams", + "74", + "62.235", + "7.737", + "48.121003", + "- 103.422014", + "3810580220", + "1036998" + ], + [ + "twin butte", + "divide", + "18", + "34.69", + "1.361", + "48.851599", + "- 103.530568", + "3802380260", + "1759398" + ], + [ + "twin hill", + "towner", + "39", + "34.908", + "0.901", + "48.681853", + "- 99.032808", + "3809580340", + "1759668" + ], + [ + "twin lake", + "benson", + "39", + "33.869", + "2.113", + "48.239127", + "- 99.663851", + "3800580380", + "1759260" + ], + [ + "twin tree", + "benson", + "143", + "36.341", + "0.213", + "47.8974", + "- 98.979574", + "3800580420", + "1759261" + ], + [ + "twin valley", + "mckenzie", + "114", + "79.127", + "19.604", + "48.045233", + "- 103.184756", + "3805380460", + "1036972" + ], + [ + "tyrol", + "griggs", + "116", + "36.673", + "0.191", + "47.530487", + "- 98.186907", + "3803980580", + "1036650" + ] + ], + "title": "", + "original_id": "4f6dce1f412de0aafbf367e0f8b8bbb7" + }, + { + "_id": "bc5b42c87ff559468fdc5876ac8f06aa", + "header": [ + "MGWR No.", + "Name", + "Builder", + "Introduced", + "D-bogie", + "GSR No.", + "Withdrawn" + ], + "rows": [ + [ + "2", + "Jupiter", + "Beyer-Peacock", + "1880", + "1900", + "534", + "1949" + ], + [ + "3", + "Juno", + "Beyer-Peacock", + "1880", + "1901", + "535", + "1949" + ], + [ + "25→4", + "Cyclops", + "Beyer-Peacock", + "1880", + "1901", + "531", + "1945" + ], + [ + "26→5", + "Britania", + "Beyer-Peacock", + "1880", + "1900", + "532", + "1949" + ], + [ + "36→1", + "Empress of Austria", + "Beyer-Peacock", + "1881", + "1900", + "530", + "1949" + ], + [ + "37→35→6", + "Wolfdog", + "Beyer-Peacock", + "1881", + "1900", + "533", + "1953" + ] + ], + "title": "", + "original_id": "1c37b8e9a57afaa04e2549ddc058b08c" + }, + { + "_id": "0003513246ece2818a7e51111afe6658", + "header": [ + "rank", + "surname", + "number of bearers 1971", + "number of bearers 2009", + "type", + "etymology" + ], + "rows": [ + [ + "1", + "jensen", + "368.631", + "278.782", + "patronymic", + "son of jens" + ], + [ + "2", + "nielsen", + "349.126", + "275.744", + "patronymic", + "son of niels" + ], + [ + "3", + "hansen", + "297.937", + "231.221", + "patronymic", + "son of hans" + ], + [ + "4", + "pedersen", + "203.426", + "173.639", + "patronymic", + "son of peder" + ], + [ + "5", + "andersen", + "188.359", + "165.871", + "patronymic", + "son of anders" + ], + [ + "6", + "christensen", + "159.943", + "125.192", + "patronymic", + "son of christen" + ], + [ + "7", + "larsen", + "148.214", + "122.712", + "patronymic", + "son of lars" + ], + [ + "8", + "sørensen", + "139.111", + "117.3", + "patronymic", + "son of søren" + ], + [ + "9", + "rasmussen", + "117.355", + "99.238", + "patronymic", + "son of rasmus" + ], + [ + "10", + "jørgensen", + "110.132", + "93.182", + "patronymic", + "son of jørgen" + ], + [ + "11", + "petersen", + "130.236", + "85.268", + "patronymic", + "son of peter" + ], + [ + "12", + "madsen", + "76.441", + "67.075", + "patronymic", + "son of mads" + ], + [ + "13", + "kristensen", + "58.99", + "62.549", + "patronymic", + "son of kristen" + ], + [ + "14", + "olsen", + "65.194", + "50.904", + "patronymic", + "son of ole" + ], + [ + "15", + "thomsen", + "40.18", + "39.86", + "patronymic", + "son of thomas" + ], + [ + "16", + "christiansen", + "45.984", + "38.528", + "patronymic", + "son of christian" + ], + [ + "17", + "poulsen", + "36.544", + "33.106", + "patronymic", + "son of poul" + ], + [ + "18", + "johansen", + "36.47", + "32.166", + "patronymic", + "son of johan" + ], + [ + "19", + "knudsen", + "34.66", + "30.634", + "patronymic", + "son of knud" + ], + [ + "20", + "møller", + "31.645", + "30.516", + "occupational", + "miller" + ] + ], + "title": "", + "original_id": "d4d6a955f12c1e81e21bcb9aebb17f0c" + }, + { + "_id": "613e0212b6e50376be8a166a12e61dc6", + "header": [ + "specimen weight / size", + "calculated activity ( bq )", + "calculated activity ( ci )", + "estimated activity gr (api)", + "estimated exposure ( mrem ) / hr" + ], + "rows": [ + [ + "1000 g / 8.79 cm", + "183355", + "4.9610 6", + "8449.31", + "2.78" + ], + [ + "100 g / 4.08 cm", + "18336", + "4.9610 7", + "844.93", + "0.28" + ], + [ + "10 g / 1.89 cm", + "1834", + "4.9610 8", + "84.49", + "0.03" + ], + [ + "1 g / 8.79 mm", + "183", + "4.9610 9", + "8.45", + "0.0" + ], + [ + "0.1 g / 4.08 mm", + "18", + "4.9610 10", + "0.84", + "0.0" + ], + [ + "0.01 g / 1.89 mm", + "2", + "4.9610 11", + "0.08", + "0.0" + ] + ], + "title": "", + "original_id": "bbda9a858ef116f491529e0fe820e1a9" + }, + { + "_id": "333f44070b8013f68b25e3d09cfb95b2", + "header": [ + "position", + "club", + "played", + "points", + "wins", + "draws", + "losses", + "goals for", + "goals against", + "goal difference" + ], + "rows": [ + [ + "1", + "rcd español", + "38", + "52", + "20", + "12", + "6", + "59", + "25", + "+ 34" + ], + [ + "2", + "real betis", + "38", + "51", + "22", + "7", + "9", + "66", + "38", + "+ 28" + ], + [ + "3", + "sd compostela", + "38", + "49", + "21", + "7", + "10", + "56", + "36", + "+ 20" + ], + [ + "4", + "cd toledo", + "38", + "47", + "18", + "11", + "9", + "50", + "32", + "+ 18" + ], + [ + "5", + "rcd mallorca", + "38", + "47", + "20", + "7", + "11", + "66", + "39", + "+ 27" + ], + [ + "6", + "real madrid b", + "38", + "46", + "19", + "8", + "11", + "57", + "41", + "+ 16" + ], + [ + "7", + "hércules cf", + "38", + "44", + "16", + "12", + "10", + "41", + "35", + "+ 6" + ], + [ + "8", + "barcelona b", + "38", + "39", + "11", + "17", + "10", + "59", + "51", + "+ 8" + ], + [ + "9", + "cp mérida", + "38", + "37", + "12", + "13", + "13", + "47", + "41", + "+ 6" + ], + [ + "10", + "sd eibar", + "38", + "35", + "10", + "15", + "13", + "30", + "40", + "- 10" + ], + [ + "11", + "cd badajoz", + "38", + "35", + "12", + "11", + "15", + "45", + "46", + "- 1" + ], + [ + "12", + "atlético marbella", + "38", + "35", + "10", + "15", + "13", + "40", + "41", + "- 1" + ], + [ + "13", + "palamós cf", + "38", + "34", + "11", + "12", + "15", + "40", + "49", + "- 9" + ], + [ + "14", + "athletic de bilbao b", + "38", + "34", + "10", + "14", + "14", + "46", + "52", + "- 6" + ], + [ + "15", + "cd leganés", + "38", + "34", + "11", + "12", + "15", + "53", + "59", + "- 6" + ], + [ + "16", + "villarreal cf", + "38", + "34", + "14", + "6", + "18", + "29", + "48", + "- 19" + ], + [ + "17", + "cd castellón", + "38", + "32", + "9", + "14", + "15", + "30", + "48", + "- 18" + ], + [ + "18", + "real murcia", + "38", + "31", + "10", + "11", + "17", + "40", + "64", + "- 24" + ], + [ + "19", + "real burgos 1", + "38", + "26", + "10", + "6", + "22", + "38", + "68", + "- 30" + ], + [ + "20", + "cádiz cf", + "38", + "18", + "4", + "10", + "24", + "28", + "67", + "- 39" + ] + ], + "title": "", + "original_id": "92dd1f500ae353c8d3cb4561626c578f" + }, + { + "_id": "5e61bdf43fa4a276c2ebbc51106a9a53", + "header": [ + "epoch (utc)", + "periselene (km)", + "aposelene (km)", + "eccentricity", + "inclination (deg) (to moon equator)", + "period (h)" + ], + "rows": [ + [ + "november 15 , 2004 , 17:47:12.1", + "6700.72", + "53215.151", + "0.776329", + "81.085", + "129.247777" + ], + [ + "december 4 , 2004 10:37:47.3", + "5454.925", + "20713.095", + "0.583085", + "83.035", + "37.304959" + ], + [ + "january 9 , 2005 , 15:24:55.0", + "2751.511", + "6941.359", + "0.432261", + "87.892", + "8.409861" + ], + [ + "february 28 , 2005 , 05:18:39.9", + "2208.659", + "4618.22", + "0.352952", + "90.063603", + "4.970998" + ], + [ + "april 25 , 2005 , 08:19:05.4", + "2283.738", + "4523.111", + "0.328988", + "90.141407", + "4.949137" + ], + [ + "may 16 , 2005 , 09:08:52.9", + "2291.25", + "4515.857", + "0.326807", + "89.734929", + "4.949919" + ], + [ + "june 20 , 2005 , 10:21:37.1", + "2256.09", + "4549.196", + "0.33696", + "90.232619", + "4.947432" + ] + ], + "title": "", + "original_id": "a28aa98e66b222fe527ad474b890709b" + }, + { + "_id": "02421fec8ead5657c34019abe248c181", + "header": [ + "rank", + "company", + "headquarters", + "industry", + "sales (billion )", + "profits (billion )", + "assets (billion )", + "market value (billion )" + ], + "rows": [ + [ + "1", + "jpmorgan chase", + "usa", + "banking", + "115.5", + "17.4", + "2117.6", + "182.2" + ], + [ + "2", + "hsbc", + "uk", + "banking", + "103.3", + "13.3", + "2467.9", + "186.5" + ], + [ + "3", + "general electric", + "usa", + "conglomerate", + "156.2", + "11.6", + "751.2", + "216.2" + ], + [ + "4", + "exxonmobil", + "usa", + "oil and gas", + "341.6", + "30.5", + "302.5", + "407.2" + ], + [ + "5", + "royal dutch shell", + "netherlands", + "oil and gas", + "369.1", + "20.1", + "317.2", + "212.9" + ], + [ + "6", + "petrochina", + "china", + "oil and gas", + "222.3", + "21.2", + "251.3", + "320.8" + ], + [ + "7", + "industrial and commercial bank of china", + "china", + "banking", + "69.2", + "18.8", + "1723.5", + "239.5" + ], + [ + "8", + "berkshire hathaway", + "usa", + "conglomerate", + "136.2", + "13.0", + "372.2", + "211.0" + ], + [ + "8", + "petrobras", + "brazil", + "oil and gas", + "121.3", + "21.2", + "313.2", + "238.8" + ], + [ + "10", + "citigroup", + "usa", + "banking", + "111.5", + "10.6", + "1913.9", + "132.8" + ], + [ + "11", + "bnp paribas", + "france", + "banking", + "130.4", + "10.5", + "2680.7", + "88.0" + ], + [ + "11", + "wells fargo", + "usa", + "banking", + "93.2", + "12.4", + "1258.1", + "170.6" + ], + [ + "13", + "santander group", + "spain", + "banking", + "109.7", + "12.8", + "1570.6", + "94.7" + ], + [ + "14", + "at&t inc", + "usa", + "telecommunications", + "124.3", + "19.9", + "268.5", + "168.2" + ], + [ + "15", + "gazprom", + "russia", + "oil and gas", + "98.7", + "25.7", + "275.9", + "172.9" + ], + [ + "16", + "chevron", + "usa", + "oil and gas", + "189.6", + "19.0", + "184.8", + "200.6" + ], + [ + "17", + "china construction bank", + "china", + "banking", + "58.2", + "15.6", + "1408.0", + "224.8" + ], + [ + "18", + "walmart", + "usa", + "retailing", + "421.8", + "16.4", + "180.7", + "187.3" + ], + [ + "19", + "total", + "france", + "oil and gas", + "188.1", + "14.2", + "192.8", + "138.0" + ], + [ + "20", + "allianz", + "germany", + "insurance", + "142.9", + "6.7", + "838.4", + "62.7" + ] + ], + "title": "", + "original_id": "93ba281742f9dcacc81800f11074ddcc" + }, + { + "_id": "2d18837de425d14c8c9e54a1f3ef975e", + "header": [ + "Model", + "Fuel Type", + "mpg (US gallons)", + "L/100 km", + "NZ Rating\n(Stars)" + ], + "rows": [ + [ + "Volkswagen Polo 1.4 TDI BLUEMOTION", + "diesel", + "62.0", + "3.8", + "5.5" + ], + [ + "Volkswagen Polo 1.4 TDI 5M", + "diesel", + "52.0", + "4.5", + "5.5" + ], + [ + "Volkswagen Polo 1.4 MAN", + "petrol", + "36.7", + "6.4", + "4.5" + ], + [ + "Volkswagen Polo 1.4 6A", + "petrol", + "34.0", + "6.9", + "4.5" + ], + [ + "Fiat 500 1.3 JTD POP", + "diesel", + "56.0", + "4.2", + "5.5" + ], + [ + "Fiat 500 1.2 POP", + "petrol", + "46.0", + "5.1", + "5.0" + ], + [ + "Fiat 500 1.4 LOUNGE 3D", + "petrol", + "37.3", + "6.3", + "4.5" + ], + [ + "Fiat 500 1.4 POP", + "petrol", + "37.3", + "6.3", + "4.5" + ], + [ + "Fiat 500 1.4 SPORT", + "petrol", + "37.3", + "6.3", + "4.5" + ], + [ + "Mini Cooper HATCH 6M 2DR 1.5L Diesel", + "diesel", + "53.0", + "4.4", + "5.5" + ], + [ + "Mini Cooper COUPE 6M 3DR 1.6L Diesel", + "diesel", + "52.0", + "4.5", + "5.5" + ], + [ + "Mini Cooper COUPE 6A 3DR 1.6L Diesel", + "diesel", + "43.5", + "5.4", + "5.0" + ], + [ + "Mini Cooper HATCH 6M 2DR 1.6I", + "petrol", + "40.5", + "5.8", + "5.0" + ], + [ + "Mini Cooper COUPE 6M 3DR 1.6L", + "petrol", + "39.2", + "6.0", + "5.0" + ], + [ + "Mini Cooper HATCH 6M 2DR 1.5L", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Mini Cooper COUPE 6A 3DR 1.6L", + "petrol", + "34.6", + "6.8", + "4.5" + ], + [ + "Citroen C4 1.6 HDI 6A EGS 5DR", + "diesel", + "52.0", + "4.5", + "5.5" + ], + [ + "Citroen C4 1.6 SX 5DR 5SP M D", + "diesel", + "50.0", + "4.7", + "5.0" + ], + [ + "Citroen C4 2.0 SX 5DR 6SP A D", + "diesel", + "37.3", + "6.3", + "4.5" + ], + [ + "Hyundai Getz 1.5D CRDI 5D M5", + "diesel", + "52.0", + "4.5", + "5.5" + ], + [ + "Hyundai Getz 1.4 5D M5", + "petrol", + "38.5", + "6.1", + "4.5" + ], + [ + "Kia Rio 1.5 DIESEL HATCH MAN", + "diesel", + "52.0", + "4.5", + "5.5" + ], + [ + "Kia Rio 1.5 DIESEL SEDAN MAN", + "diesel", + "52.0", + "4.5", + "5.5" + ], + [ + "Kia Rio 1.6 HATCH MANUAL", + "petrol", + "34.6", + "6.8", + "4.5" + ], + [ + "Volkswagen Golf 1.9 TDI BLUEMOTION", + "diesel", + "52.0", + "4.5", + "5.5" + ], + [ + "Volkswagen Golf 1.9 TDI 7DSG", + "diesel", + "44.3", + "5.3", + "5.0" + ], + [ + "Volkswagen Golf 90KW TSI 7DSG", + "petrol", + "39.8", + "5.9", + "5.0" + ], + [ + "Volkswagen Golf 1.9 TDI 6DSG", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Volkswagen Golf 2.0 TDI 4 MOTION MAN", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Volkswagen Golf 2.0 TDI DSG", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Volkswagen Golf TDI 103KW 6DSG", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Volkswagen Golf TDI 103KW 4MOTION", + "diesel", + "37.3", + "6.3", + "4.5" + ], + [ + "Fiat Grande Punto 1.3 JTD 5D 6SP", + "diesel", + "51.0", + "4.6", + "5.0" + ], + [ + "Fiat Grande Punto 1.3 JTD 5D DUALOGIC", + "diesel", + "51.0", + "4.6", + "5.0" + ], + [ + "Fiat Grande Punto 1.3 JTD DUAL LOGIC", + "diesel", + "46.0", + "5.1", + "5.0" + ], + [ + "Fiat Grande Punto 1.9 JTD SPORT 3D 6SP", + "diesel", + "42.0", + "5.6", + "5.0" + ], + [ + "Fiat Grande Punto 1.9 EMOTION 5DR 6SPD", + "diesel", + "42.0", + "5.6", + "5.0" + ], + [ + "Fiat Grande Punto 1.9 JTD 5D 6SPEED", + "diesel", + "42.0", + "5.6", + "5.0" + ], + [ + "Fiat Grande Punto 1.4 DYNAMIC 5 SPEED", + "petrol", + "38.5", + "6.1", + "4.5" + ], + [ + "Fiat Grande Punto 1.4 5D DUAL LOGIC", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Honda Civic Hybrid", + "petrol", + "51.0", + "4.6", + "5.0" + ], + [ + "Hyundai Accent 1.5 CRDI 4D M5 SEDAN", + "diesel", + "51.0", + "4.6", + "5.0" + ], + [ + "Hyundai Accent 1.6 GLS 4D M5", + "petrol", + "36.7", + "6.4", + "4.5" + ], + [ + "Peugeot 308 HDI AT 1.6", + "diesel", + "51.0", + "4.6", + "5.0" + ], + [ + "Peugeot 308 XS MANUAL", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Peugeot 308 HDI AUTO", + "diesel", + "34.6", + "6.8", + "4.5" + ], + [ + "Skoda Fabia 1.4 TDI", + "diesel", + "51.0", + "4.6", + "5.0" + ], + [ + "Skoda Fabia 1.9 TDI COMBI", + "diesel", + "48.0", + "4.9", + "5.0" + ], + [ + "Volkswagen Jetta 1.9 TDI 7DSG", + "diesel", + "51.0", + "4.6", + "5.0" + ], + [ + "Volkswagen Jetta 2.0 TDI DSG", + "diesel", + "43.5", + "5.4", + "5.0" + ], + [ + "Volkswagen Jetta TDI 103KW 6DSG", + "diesel", + "37.9", + "6.2", + "4.5" + ], + [ + "Hyundai i30 1.6 CRDI ELITE M5", + "diesel", + "50.0", + "4.7", + "5.0" + ], + [ + "Hyundai i30 1.6 CRDI 5D M5", + "diesel", + "50.0", + "4.7", + "5.0" + ], + [ + "Hyundai i30 1.6 CRDI ELITE A4", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Hyundai i30 1.6 5D M5", + "petrol", + "37.9", + "6.2", + "4.5" + ], + [ + "Peugeot 207 HDI 1.6 5DR 5 SP M D", + "diesel", + "49.0", + "4.8", + "5.0" + ], + [ + "Peugeot 207 XS 1.4 5DR 5SPD M P", + "petrol", + "37.3", + "6.3", + "4.5" + ], + [ + "Citroen C3 1.6 HDI 5DR 5SPD", + "diesel", + "48.0", + "4.9", + "5.0" + ], + [ + "Citroen C3 1.6 5DR 5SPD", + "petrol", + "36.2", + "6.5", + "4.5" + ], + [ + "Kia Cerato 1.6 DIESEL 5M SEDAN", + "diesel", + "48.0", + "4.9", + "5.0" + ], + [ + "Daihatsu Sirion 1.0 HATCH 5MT", + "petrol", + "47.0", + "5.0", + "5.0" + ], + [ + "Daihatsu Sirion 1.3P HATCH 5M", + "petrol", + "40.5", + "5.8", + "5.0" + ], + [ + "Daihatsu Sirion 1.3P HATCH 4A", + "petrol", + "36.2", + "6.5", + "4.5" + ], + [ + "Daihatsu Sirion 1.5P SX HATCH 4AT", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Smart Fortwo CAB", + "petrol", + "47.0", + "5.0", + "5.0" + ], + [ + "Smart Fortwo COUPE", + "petrol", + "47.0", + "5.0", + "5.0" + ], + [ + "Toyota Corolla 1.4D HATCH5 5M", + "diesel", + "47.0", + "5.0", + "5.0" + ], + [ + "Toyota Corolla 2.0D HATCH5 6M", + "diesel", + "43.5", + "5.4", + "5.0" + ], + [ + "Toyota Corolla 1.5P WAGON 5DR 5M", + "petrol", + "40.5", + "5.8", + "5.0" + ], + [ + "Volkswagen Passat TDI BLUEMOTION SED", + "diesel", + "46.0", + "5.1", + "5.0" + ], + [ + "Volkswagen Passat TDI BLUEMOTION VAR", + "diesel", + "44.3", + "5.3", + "5.0" + ], + [ + "Volkswagen Passat 2.0 TDI DSG SEDAN", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Volkswagen Passat 2.0 TDI DSG VARIANT", + "diesel", + "37.9", + "6.2", + "4.5" + ], + [ + "Volkswagen Passat TDI 125KW 6DSG SED", + "diesel", + "36.2", + "6.5", + "4.5" + ], + [ + "Volkswagen Passat TDI 125KW 6DSG VAR", + "diesel", + "35.6", + "6.6", + "4.5" + ], + [ + "Volkswagen Passat TDI 103KW 4M VAR", + "diesel", + "35.0", + "6.7", + "4.5" + ], + [ + "Kia Picanto 1.1 MANUAL", + "petrol", + "45.2", + "5.2", + "5.0" + ], + [ + "Kia Picanto 1.1 AUTO", + "petrol", + "40.5", + "5.8", + "5.0" + ], + [ + "Skoda Octavia 1.9 TDI MAN COMBI", + "diesel", + "45.2", + "5.2", + "5.0" + ], + [ + "Skoda Octavia RS 2.0 TDI SEDAN MAN", + "diesel", + "41.2", + "5.7", + "5.0" + ], + [ + "Skoda Octavia RS 2.0 TDI COMBI MAN", + "diesel", + "40.5", + "5.8", + "5.0" + ], + [ + "Skoda Octavia 1.9 TDI AUTO", + "diesel", + "40.5", + "5.8", + "5.0" + ], + [ + "Skoda Octavia 1.9 TDI COMBI AUTO", + "diesel", + "40.5", + "5.8", + "5.0" + ], + [ + "Skoda Octavia 4X4 2.0 TDI COMBI M", + "diesel", + "37.9", + "6.2", + "4.5" + ], + [ + "Skoda Octavia SCOUT 2.0 TDI", + "diesel", + "36.7", + "6.4", + "4.5" + ], + [ + "BMW 118D HATCH 6M 5DR 1.8L", + "diesel", + "44.3", + "5.3", + "5.0" + ], + [ + "BMW 118D HATCH 6A 5DR 1.8L", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Ford Focus 1.8TD WAGON", + "diesel", + "44.3", + "5.3", + "5.0" + ], + [ + "Ford Focus 1.6 M HATCH", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Ford Focus WAG 1.6 MAN", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Mercedes Benz A 180 CDI CLASSIC", + "diesel", + "44.3", + "5.3", + "5.0" + ], + [ + "Mercedes Benz A 180 CDI ELEGANCE", + "diesel", + "44.3", + "5.3", + "5.0" + ], + [ + "Mercedes Benz A 180 CDI AVANTGARDE", + "diesel", + "44.3", + "5.3", + "5.0" + ], + [ + "Mercedes Benz A 200 CDI AVANTGARDE", + "diesel", + "43.5", + "5.4", + "5.0" + ], + [ + "Skoda Roomster 1.9 TDI COMFORT", + "diesel", + "43.5", + "5.4", + "5.0" + ], + [ + "Skoda Roomster 1.9 TDI STYLE", + "diesel", + "43.5", + "5.4", + "5.0" + ], + [ + "Audi A4 2.0 TDI MULTI SEDAN", + "diesel", + "42.7", + "5.5", + "5.0" + ], + [ + "Audi A4 2.0 TDI MULTI", + "diesel", + "37.9", + "6.2", + "4.5" + ], + [ + "Audi A4 2.0 TDI MULTI AVANT", + "diesel", + "37.9", + "6.2", + "4.5" + ], + [ + "Audi A4 2.7 TDI MULTI SEDAN", + "diesel", + "35.6", + "6.6", + "4.5" + ], + [ + "BMW 120D 5 DOOR M E87", + "diesel", + "42.7", + "5.5", + "5.0" + ], + [ + "BMW 120D 5 DOOR A E87", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Fiat Bravo SPORT JTD 16V 5DR", + "diesel", + "42.0", + "5.6", + "5.0" + ], + [ + "Mitsubishi Colt 1.5P LS 5DR HATCH A", + "petrol", + "42.0", + "5.6", + "5.0" + ], + [ + "Mitsubishi Colt 1.5P VRX 5DR HATCH", + "petrol", + "42.0", + "5.6", + "5.0" + ], + [ + "Mitsubishi Colt 1.5P VRX 5DR HATCH A", + "petrol", + "42.0", + "5.6", + "5.0" + ], + [ + "Mitsubishi Colt 1.5P VRX 5DR HATCHA", + "petrol", + "42.0", + "5.6", + "5.0" + ], + [ + "Mitsubishi Colt 1.5P LS 5DR HATCH M", + "petrol", + "39.8", + "5.9", + "5.0" + ], + [ + "BMW 520D SEDAN 6A 4DR 2.0L", + "diesel", + "41.2", + "5.7", + "5.0" + ], + [ + "Holden Astra MY8.5 CDTI WAGON MAN", + "diesel", + "41.2", + "5.7", + "5.0" + ], + [ + "Holden Astra MY8.5 CDTI HATCH MAN", + "diesel", + "41.2", + "5.7", + "5.0" + ], + [ + "Holden Astra CDTI 5DR HATCH MT", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Holden Astra CDTI 5DR MAN", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Mini One HATCH 6M 2DR 1.4I", + "petrol", + "41.2", + "5.7", + "5.0" + ], + [ + "Mini One HATCH 6A 2DR 1.4I", + "petrol", + "35.6", + "6.6", + "4.5" + ], + [ + "Subaru Legacy WAGON 2.0 TD MANUAL", + "diesel", + "41.2", + "5.7", + "5.0" + ], + [ + "Audi A3 2.0 TDI S TRONIC", + "diesel", + "40.5", + "5.8", + "5.0" + ], + [ + "Audi A3 SPORTBACK 1.4T FSI", + "petrol", + "40.5", + "5.8", + "5.0" + ], + [ + "Audi A3 2.0 TDI SP A TRONIC", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Subaru Outback WAGON 2.0 TD MANUAL", + "diesel", + "40.5", + "5.8", + "5.0" + ], + [ + "BMW 123D COUPE 6M 3DR 2.0L", + "diesel", + "39.8", + "5.9", + "5.0" + ], + [ + "BMW 123D Saloon 6M 5DR 2.3L", + "diesel", + "39.8", + "5.9", + "5.0" + ], + [ + "BMW 123D HATCH 6M 5DR 2.3L", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "BMW 123D 2.3L 6A 3DR COUPE", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Daihatsu Charade 1.0P HATCH5 4A", + "petrol", + "39.8", + "5.9", + "5.0" + ], + [ + "Saab 9-3 Linear SPCOMBI1.9MT", + "diesel", + "39.8", + "5.9", + "5.0" + ], + [ + "Saab 9-3 Linear CONVERTIBLE 1.9TID M", + "diesel", + "37.3", + "6.3", + "4.5" + ], + [ + "Volkswagen Caddy DELIVERY 1.9TDI DSG", + "diesel", + "39.8", + "5.9", + "5.0" + ], + [ + "Volkswagen Caddy DELIVERY 1.9TDI MAN", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Volkswagen Caddy LIFE 1.9 TDI DSG", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Volkswagen Caddy LIFE 1.9 TDI MAN", + "diesel", + "37.9", + "6.2", + "4.5" + ], + [ + "Alfa Romeo 147 1.9 JTD 16V 5DR 6 SP", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Alfa Romeo 159 1.9 JTD 4D 6SP SEDAN", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Alfa Romeo 159 2.4 JTD 4D 6SP SEDAN", + "diesel", + "34.6", + "6.8", + "4.5" + ], + [ + "BMW 320D SEDAN 6A 4DR 2.0L", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "BMW 320D TOURING 6A 5DR 2.0L", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Daihatsu Copen 1.3P COUPE CONV 5M", + "petrol", + "39.2", + "6.0", + "5.0" + ], + [ + "Hyundai Sonata 2.0 CRDI M6", + "diesel", + "39.2", + "6.0", + "5.0" + ], + [ + "Dodge Caliber SXT CRD", + "diesel", + "38.5", + "6.1", + "4.5" + ], + [ + "Honda Jazz SPORT", + "petrol", + "38.5", + "6.1", + "4.5" + ], + [ + "Holden Combo XC 1.4 MANUAL", + "petrol", + "37.9", + "6.2", + "4.5" + ], + [ + "Mercedes Benz B 200 CDI", + "diesel", + "37.9", + "6.2", + "4.5" + ], + [ + "Suzuki Swift GLX 1.5 5DR", + "petrol", + "37.3", + "6.3", + "4.5" + ], + [ + "Suzuki Swift GLXH 1.5 5DR", + "petrol", + "37.3", + "6.3", + "4.5" + ], + [ + "Suzuki Swift GLXH2 1.5 5DR", + "petrol", + "37.3", + "6.3", + "4.5" + ], + [ + "Suzuki Swift GLXA 1.5 5DR", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Suzuki Swift GLXHA 1.5 5DR", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Suzuki Swift GLXHA2 1.5 5DR", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Fiat Multipla DYNAMIC 1.9 JTD 5D", + "diesel", + "36.7", + "6.4", + "4.5" + ], + [ + "Mazda Mazda2 CLASSIC 5DR 1.5 M5", + "petrol", + "36.7", + "6.4", + "4.5" + ], + [ + "Mazda Mazda2 SPORT 5 DR 1.5 M 5", + "petrol", + "36.7", + "6.4", + "4.5" + ], + [ + "Mazda Mazda2 SPORT 5 DR 1.5 4AT", + "petrol", + "34.6", + "6.8", + "4.5" + ], + [ + "Mazda Mazda2 CLASSIC 5DR 1.5 4AT", + "petrol", + "34.6", + "6.8", + "4.5" + ], + [ + "Mitsubishi Colt Plus 1.5P RALLIART TURBO", + "petrol", + "36.7", + "6.4", + "4.5" + ], + [ + "Peugeot 307 XS 1.6 5DR 4SPD A P", + "petrol", + "36.7", + "6.4", + "4.5" + ], + [ + "Peugeot 307 XSP 2.0 5DR 5SPD M P", + "petrol", + "36.2", + "6.5", + "4.5" + ], + [ + "Peugeot 307 HDI 2.0 5DR 6SPD A D", + "diesel", + "35.0", + "6.7", + "4.5" + ], + [ + "Peugeot 307 HDI 2.0 5DR 6SPD M D", + "diesel", + "35.0", + "6.7", + "4.5" + ], + [ + "Peugeot 607 HDI 2.2 5DR 6SPM P", + "diesel", + "36.7", + "6.4", + "4.5" + ], + [ + "BMW 330D SEDAN 6M 4DR 3.0L", + "diesel", + "36.2", + "6.5", + "4.5" + ], + [ + "Jeep Compass LTD 2.0L CRD", + "diesel", + "36.2", + "6.5", + "4.5" + ], + [ + "Ford Fiesta 5DR 1.6 M", + "petrol", + "35.6", + "6.6", + "4.5" + ], + [ + "Mitsubishi I-car 660P 5DR A", + "petrol", + "39.8", + "5.9", + "4.5" + ], + [ + "Toyota RAV4 2.2D WAGON 6M L1", + "diesel", + "35.6", + "6.6", + "4.5" + ], + [ + "BMW 118I 5 DOOR M E87", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Jeep Patriot 2.0L CRD HIGH LINE", + "diesel", + "35.0", + "6.7", + "4.5" + ], + [ + "Renault Clio 1.6 3DR 4SP A P", + "petrol", + "35.0", + "6.7", + "4.5" + ], + [ + "Alfa Romeo Brera 2.4 JTD 3D 6 SPEED", + "diesel", + "34.6", + "6.8", + "4.5" + ], + [ + "Audi A6 2.7 TDI QUATTRO TIP", + "diesel", + "34.6", + "6.8", + "4.5" + ], + [ + "BMW 535D SEDAN 6A 4D 3.0L", + "diesel", + "34.6", + "6.8", + "4.5" + ], + [ + "Suzuki SX4 GLXF 1.6 5DR", + "petrol", + "34.6", + "6.8", + "4.5" + ], + [ + "Suzuki SX4 GLXH2 1.6 5DR", + "petrol", + "34.6", + "6.8", + "4.5" + ], + [ + "Volkswagen Crosstouran 103KW TDI 6DSG", + "diesel", + "34.6", + "6.8", + "4.5" + ], + [ + "Volkswagen Touran 103KW TDI 6DSG", + "diesel", + "34.6", + "6.8", + "4.5" + ], + [ + "Holden Barina 3DR HATCH MANUAL", + "petrol", + "34.0", + "6.9", + "4.5" + ], + [ + "Holden Barina 5DR HATCH MANUAL", + "petrol", + "34.0", + "6.9", + "4.5" + ] + ], + "title": "", + "original_id": "62115c3dde92e599d85003e61d7debf3" + }, + { + "_id": "be1deadcd3707d3743725bcfd5e958d3", + "header": [ + "year", + "number of examinees", + "number of passed students", + "pass percentage", + "obtained gpa - 5" + ], + "rows": [ + [ + "2005", + "314", + "239", + "67.75%", + "31" + ], + [ + "2006", + "331", + "278", + "72.37%", + "54" + ], + [ + "2007", + "336", + "260", + "68.62%", + "63" + ], + [ + "2008", + "346", + "274", + "75.54%", + "79" + ], + [ + "2009", + "360", + "297", + "78.35%", + "83" + ], + [ + "2010", + "364", + "322", + "79.68%", + "85" + ] + ], + "title": "", + "original_id": "efaf118e6555dca460aef7313b577960" + }, + { + "_id": "9d9999816fde80641419d3f569d33b22", + "header": [ + "year", + "candidates", + "total votes", + "average votes per candidate", + "% of total vote", + "average % of vote per candidate", + "saved deposits", + "number of mps" + ], + "rows": [ + [ + "1974 - 02", + "6", + "4576", + "763", + "0.01", + "1.67", + "0", + "0" + ], + [ + "1974 - 10", + "5", + "1996", + "399", + "0.0", + "0.91", + "0", + "0" + ], + [ + "1979", + "53", + "39918", + "753", + "0.13", + "1.46", + "0", + "0" + ], + [ + "1983", + "109", + "54299", + "498", + "0.17", + "1.04", + "0", + "0" + ], + [ + "1987", + "133", + "89753", + "675", + "0.28", + "1.35", + "0", + "0" + ], + [ + "1992", + "253", + "170037", + "672", + "0.51", + "1.27", + "0", + "0" + ], + [ + "1997", + "89", + "61731", + "694", + "0.21", + "1.34", + "0", + "0" + ], + [ + "2001", + "145", + "166477", + "1148", + "0.63", + "2.75", + "10", + "0" + ], + [ + "2005", + "182", + "257758", + "1416", + "1.04", + "3.29", + "22", + "0" + ] + ], + "title": "", + "original_id": "72e6ff55259803f7c3bcd7d3c4f49c58" + }, + { + "_id": "507b1ff39985057ea31e574e51621ff0", + "header": [ + "township", + "county", + "pop (2010)", + "land ( sqmi )", + "water (sqmi)", + "latitude", + "longitude", + "geo id", + "ansi code" + ], + "rows": [ + [ + "oak creek", + "bottineau", + "24", + "35.445", + "0.0", + "48.675399", + "- 100.471642", + "3800958700", + "1759286" + ], + [ + "oak valley", + "bottineau", + "52", + "36.016", + "0.087", + "48.777318", + "- 100.511814", + "3800958860", + "1759287" + ], + [ + "oakhill", + "barnes", + "51", + "35.414", + "0.081", + "46.679076", + "- 98.017963", + "3800358780", + "1036402" + ], + [ + "oakland", + "mountrail", + "26", + "35.167", + "0.785", + "48.157497", + "- 102.109269", + "3806158820", + "1036997" + ], + [ + "oakville", + "grand forks", + "200", + "35.059", + "0.047", + "47.883391", + "- 97.305536", + "3803558900", + "1036604" + ], + [ + "oakwood", + "walsh", + "228", + "33.526", + "0.0", + "48.412107", + "- 97.339101", + "3809958980", + "1036534" + ], + [ + "oberon", + "benson", + "67", + "57.388", + "0.522", + "47.925443", + "- 99.244476", + "3800559060", + "2397849" + ], + [ + "odessa", + "hettinger", + "16", + "35.766", + "0.06", + "46.583226", + "- 102.104455", + "3804159100", + "1759459" + ], + [ + "odessa", + "ramsey", + "49", + "37.897", + "8.314", + "47.968754", + "- 98.587529", + "3807159140", + "1759587" + ], + [ + "odin", + "mchenry", + "46", + "34.424", + "1.722", + "47.986751", + "- 100.637016", + "3804959180", + "1759507" + ], + [ + "oliver", + "williams", + "8", + "35.987", + "0.024", + "48.423293", + "- 103.320183", + "3810559260", + "1037033" + ], + [ + "olivia", + "mchenry", + "40", + "35.874", + "0.035", + "47.900358", + "- 100.769959", + "3804959300", + "1759508" + ], + [ + "olson", + "towner", + "19", + "35.033", + "0.954", + "48.505811", + "- 99.287008", + "3809559380", + "1759659" + ], + [ + "ontario", + "ramsey", + "72", + "33.923", + "1.99", + "48.163172", + "- 98.601321", + "3807159460", + "1759588" + ], + [ + "ops", + "walsh", + "63", + "36.015", + "0.0", + "48.238231", + "- 97.578927", + "3809959540", + "1036518" + ], + [ + "ora", + "nelson", + "69", + "34.414", + "0.697", + "47.722982", + "- 97.946877", + "3806359580", + "1036557" + ], + [ + "orange", + "adams", + "22", + "35.802", + "0.133", + "46.012558", + "- 102.053893", + "3800159620", + "1037214" + ], + [ + "oriska", + "barnes", + "65", + "35.082", + "0.087", + "46.935397", + "- 97.752733", + "3800359700", + "1036418" + ], + [ + "orlien", + "ward", + "47", + "35.645", + "0.72", + "47.985154", + "- 101.796936", + "3810159740", + "1036954" + ], + [ + "orthell", + "williams", + "12", + "35.894", + "0.034", + "48.495353", + "- 103.728983", + "3810559860", + "1759732" + ], + [ + "osago", + "nelson", + "31", + "35.4", + "0.198", + "47.800898", + "- 98.328474", + "3806359900", + "1036565" + ], + [ + "osborn", + "mountrail", + "285", + "30.296", + "4.988", + "47.987208", + "- 102.429987", + "3806159940", + "1034001" + ], + [ + "osford", + "cavalier", + "47", + "35.803", + "0.052", + "48.585234", + "- 98.115821", + "3801959980", + "1759377" + ], + [ + "oshkosh", + "wells", + "56", + "34.747", + "0.065", + "47.623026", + "- 99.576942", + "3810360020", + "1759708" + ], + [ + "osloe", + "mountrail", + "41", + "35.077", + "0.903", + "48.146259", + "- 101.976499", + "3806160060", + "1036937" + ], + [ + "osnabrock", + "cavalier", + "36", + "35.505", + "0.439", + "48.594234", + "- 98.241946", + "3801960140", + "2397851" + ], + [ + "ostby", + "bottineau", + "45", + "35.452", + "0.027", + "48.581052", + "- 100.352948", + "3800960180", + "1759288" + ], + [ + "otis", + "mclean", + "41", + "35.152", + "0.656", + "47.799001", + "- 100.896513", + "3805560260", + "1759541" + ], + [ + "overland", + "ramsey", + "14", + "35.602", + "0.4", + "48.406215", + "- 98.644574", + "3807160340", + "1759589" + ], + [ + "ovid", + "lamoure", + "46", + "35.328", + "0.505", + "46.318992", + "- 98.107769", + "3804560420", + "1036886" + ], + [ + "owego", + "ransom", + "21", + "36.034", + "0.029", + "46.50933", + "- 97.319286", + "3807360460", + "1036866" + ] + ], + "title": "", + "original_id": "37125493373f4dba45a76bf2ae812a57" + }, + { + "_id": "cf3d3ce5ae6d1086e26367d0d7b3dd4e", + "header": [ + "year (january)", + "population (000)", + "rural , %", + "urban , %", + "source" + ], + "rows": [ + [ + "1939", + "6081", + "72", + "28", + "census" + ], + [ + "1959", + "9295", + "56", + "44", + "census" + ], + [ + "1970", + "13001", + "50", + "50", + "census" + ], + [ + "1979", + "14685", + "46", + "54", + "census" + ], + [ + "1989", + "16537", + "43", + "57", + "census" + ], + [ + "1999", + "14953", + "43", + "57", + "census" + ], + [ + "2002", + "14851", + "43", + "57", + "estimate" + ], + [ + "2005", + "15075", + "43", + "57", + "estimate" + ], + [ + "2008", + "15572", + "47", + "53", + "estimate" + ] + ], + "title": "", + "original_id": "68f293a5fcdbc2dea70732f53710cb68" + }, + { + "_id": "36411d9c5d9190d5266879b11cc5ca6b", + "header": [ + "place", + "code", + "area (km 2 )", + "population", + "most spoken language" + ], + "rows": [ + [ + "boipatong", + "70401", + "1.62", + "16867", + "sotho" + ], + [ + "bophelong", + "70402", + "5.97", + "37782", + "sotho" + ], + [ + "evaton", + "70404", + "35.2", + "143157", + "sotho" + ], + [ + "orange farm", + "70405", + "3.79", + "16720", + "zulu" + ], + [ + "sebokeng", + "70406", + "32.8", + "222045", + "sotho" + ], + [ + "sharpeville", + "70407", + "5.04", + "41032", + "sotho" + ], + [ + "tshepiso", + "70408", + "5.26", + "22952", + "sotho" + ], + [ + "vanderbijlpark", + "70409", + "207.69", + "80205", + "afrikaans" + ], + [ + "vereeniging", + "70410", + "191.33", + "73283", + "afrikaans" + ], + [ + "remainder of the municipality", + "70403", + "498.77", + "4378", + "sotho" + ] + ], + "title": "", + "original_id": "01f66b6eca74f5c74f00158de9c93e86" + }, + { + "_id": "131eee900e79ba1797c8cbdf9912d308", + "header": [ + "rank", + "couple", + "judges", + "public", + "total", + "vote percentage", + "result" + ], + "rows": [ + [ + "1", + "hayley and daniel", + "7", + "6", + "13", + "25.1%", + "safe" + ], + [ + "2", + "mikey and melanie", + "3", + "7", + "10", + "35.7%", + "safe" + ], + [ + "3", + "gary and maria", + "5", + "5", + "10", + "13.5%", + "safe" + ], + [ + "4", + "danny and frankie", + "6", + "3", + "9", + "6.2%", + "safe" + ], + [ + "5", + "kieron and brianne", + "4", + "4", + "8", + "9.0%", + "safe" + ], + [ + "6", + "danniella and matthew", + "6", + "1", + "7", + "4.2%", + "bottom two" + ] + ], + "title": "", + "original_id": "faaef2c1a2e22fbcb12eb4f7176d0493" + }, + { + "_id": "fdbfb2e55fb31d802ef856062d82cb70", + "header": [ + "2nd component", + "bp 2nd comp (˚c)", + "3rd component", + "bp 3rd comp (˚c)", + "bp azeo (˚c)", + "% wt 1st", + "% wt 2nd", + "% wt 3rd" + ], + "rows": [ + [ + "ethanol", + "78.4", + "ethyl acetate", + "77.1", + "70.3degree", + "7.8", + "9.0", + "83.2" + ], + [ + "ethanol", + "78.4", + "cyclohexane", + "80.8", + "62.1", + "7", + "17", + "76" + ], + [ + "ethanol", + "78.4", + "benzene", + "80.2", + "64.9", + "7.4 u 1.3 l 43.1", + "18.5 u 12.7 l 52.1", + "74.1 u 86.0 l 4.8" + ], + [ + "ethanol", + "78.4", + "chloroform", + "61.2", + "55.5", + "3.5 u 80.8 l 0.5", + "4.0 u 18.2 l 3.7", + "92.5 u 1.0 l 95.8" + ], + [ + "ethanol", + "78.4", + "carbon tetrachloride", + "86.8", + "61.8", + "4.3", + "9.7", + "86.0" + ], + [ + "ethanol", + "78.4", + "carbon tetrachloride", + "86.8", + "61.8", + "3.4 u 44.5 l<0.1", + "10.3 u 48.5 l 5.2", + "86.3 u 7.0 l 94.8" + ], + [ + "ethanol", + "78.4", + "ethylene chloride", + "83.7", + "66.7", + "5", + "17", + "78" + ], + [ + "ethanol", + "78.4", + "acetonitrile", + "82.0", + "72.9", + "1.0", + "55.0", + "44.0" + ], + [ + "ethanol", + "78.4", + "toluene", + "110.6", + "74.4", + "12.0 u 3.1 l 20.7", + "37.0 u 15.6 l 54.8", + "51.0 u 81.3 l 24.5" + ], + [ + "ethanol", + "78.4", + "methyl ethyl ketone", + "79.6", + "73.2", + "11.0", + "14.0", + "75.0" + ], + [ + "ethanol", + "78.4", + "n - hexane", + "69.0", + "56.0", + "3.0 u 0.5 l 19.0", + "12.0 u 3.0 l 75.0", + "85.0 u 96.5 l 6.0" + ], + [ + "ethanol", + "78.4", + "n - heptane", + "98.4", + "68.8", + "6.1 u 0.2 l 15.0", + "33.0 u 5.0 l 75.9", + "60.9 u 94.8 l 9.1" + ], + [ + "ethanol", + "78.4", + "carbon disulfide", + "46.2", + "41.3", + "1.6", + "5.0", + "93.4" + ], + [ + "n - propanol", + "97.2", + "cyclohexane", + "80.8", + "66.6", + "8.5", + "10.0", + "81.5" + ], + [ + "n - propanol", + "97.2", + "benzene", + "80.2", + "68.5", + "8.6", + "9.0", + "82.4" + ], + [ + "n - propanol", + "97.2", + "carbon tetrachloride", + "76.8", + "65.4", + "5 u 84.9 l 1.0", + "11 u 15.0 l 11.0", + "84 u 0.1 l 88.0" + ], + [ + "n - propanol", + "97.2", + "diethyl ketone", + "102.2", + "81.2", + "20", + "20", + "60" + ], + [ + "n - propanol", + "97.2", + "n - propyl acetate", + "101.6", + "82.2", + "21.0", + "19.5", + "59.5" + ], + [ + "isopropanol", + "82.5", + "cyclohexane", + "80.8", + "64.3", + "7.5", + "18.5", + "74.0" + ], + [ + "isopropanol", + "82.5", + "cyclohexane", + "80.8", + "66.1", + "7.5", + "21.5", + "71.0" + ], + [ + "isopropanol", + "82.5", + "benzene", + "80.2degree", + "66.5", + "7.5", + "18.7", + "73.8" + ], + [ + "isopropanol", + "82.5", + "benzene", + "80.2degree", + "65.7degree", + "8.2 u 2.3 l 85.1", + "19.8 u 20.2 l 14.4", + "72.0 u 77.5 l 0.5" + ], + [ + "isopropanol", + "82.5", + "methyl ethyl ketone", + "79.6", + "73.4", + "11.0", + "1.0", + "88.0" + ], + [ + "isopropanol", + "82.5", + "toluene", + "110.6", + "76.3", + "13.1 u 8.5 l 61.0", + "38.2 u 38.2 l 38.0", + "48.7 u 53.3 l 1.0" + ], + [ + "allyl alcohol", + "97.0", + "n - hexane", + "69.0", + "59.7", + "5 u 0.5 l 64.4", + "5 u 3.6 l 34.8", + "90 u 95.9 l 0.8" + ], + [ + "allyl alcohol", + "97.0", + "benzene", + "80.2", + "68.2", + "8.6 u 0.6 l 80.9", + "9.2 u 8.7 l 17.7", + "82.2 u 90.7 l 0.4" + ], + [ + "allyl alcohol", + "97.0", + "cyclohexane", + "80.8", + "66.2", + "8", + "11", + "81" + ], + [ + "allyl alcohol", + "97.0", + "carbon tetrachloride", + "76.8", + "65.2", + "5 u 71.7 l 0.8", + "11 u 25.6 l 10.1", + "84 u 2.7 l 89.1" + ], + [ + "benzene", + "80.1", + "acetonitrile", + "82.0", + "66.0", + "8.2", + "68.5", + "23.3" + ], + [ + "benzene", + "80.1", + "methyl ethyl ketone", + "79.6", + "68.2", + "8.8 u 0.6 l 94.7", + "65.1 u 71.3 l 0.1", + "26.1 u 28.1 l 5.2" + ], + [ + "methyl ethyl ketone", + "79.6", + "carbon tetrachloride", + "76.8", + "65.7", + "3.0 u 94.4 l 0.1", + "22.2 u 5.5 l 22.6", + "74.8 u 0.1 l 77.3" + ], + [ + "methyl ethyl ketone", + "79.6", + "cyclohexane", + "81.0", + "63.6", + "5.0 u 0.6 l 89.9", + "60.0 u 37.0 l 10.0", + "35.0 u 62.4 l 0.1" + ], + [ + "chloroform", + "61.2", + "methanol", + "64.65", + "52.6", + "4.0 u 27.0 l 3.0", + "81.0 u 32.0 l 83.0", + "15.0 u 41.0 l 14.0" + ], + [ + "chloroform", + "61.2", + "acetone", + "56.5", + "60.4", + "4.0", + "57.6", + "38.4" + ] + ], + "title": "", + "original_id": "2dbe1ffb001a27eda365ca2ed0808141" + }, + { + "_id": "a76db1503ef0a25aa6816d98890686cf", + "header": [ + "country", + "preliminaries", + "interview", + "swimsuit", + "evening gown", + "average" + ], + "rows": [ + [ + "missouri", + "9.26", + "9.84", + "9.76", + "9.77", + "9.79" + ], + [ + "california", + "9.18", + "9.76", + "9.64", + "9.66", + "9.69" + ], + [ + "pennsylvania", + "9.32", + "9.75", + "9.63", + "9.54", + "9.64" + ], + [ + "texas", + "9.27", + "9.39", + "9.74", + "9.72", + "9.62" + ], + [ + "arizona", + "9.25", + "9.56", + "9.59", + "9.7", + "9.62" + ], + [ + "maryland", + "9.25", + "9.4", + "9.73", + "9.55", + "9.56" + ], + [ + "oklahoma", + "9.31", + "9.44", + "9.57", + "9.63", + "9.54" + ], + [ + "michigan", + "9.13", + "9.37", + "9.51", + "9.4", + "9.42" + ], + [ + "north dakota", + "9.4", + "9.15", + "9.3", + "9.38", + "9.27" + ], + [ + "new york", + "9.21", + "9.19", + "9.18", + "9.32", + "9.23" + ] + ], + "title": "", + "original_id": "508fe9a2f4bd075bc49909fb8e4743b6" + }, + { + "_id": "9caa8c90d5ddcdad2d41fa0a5f656c3d", + "header": [ + "scorer", + "club", + "league goals", + "fa cup goals", + "league cup goals", + "total" + ], + "rows": [ + [ + "albert kinsey", + "wrexham", + "27", + "1", + "1", + "29" + ], + [ + "jim hall", + "peterborough united", + "24", + "3", + "1", + "28" + ], + [ + "jack howarth", + "aldershot", + "19", + "7", + "0", + "26" + ], + [ + "stuart brace", + "grimsby town", + "25", + "0", + "0", + "25" + ], + [ + "john fairbrother", + "northampton town", + "23", + "2", + "0", + "25" + ], + [ + "nigel cassidy", + "scunthorpe & lindsey", + "21", + "4", + "0", + "25" + ], + [ + "billy best", + "southend", + "23", + "1", + "0", + "24" + ], + [ + "don masson", + "notts county", + "23", + "0", + "0", + "23" + ], + [ + "dave gwyther", + "swansea city", + "16", + "5", + "1", + "22" + ], + [ + "dennis brown", + "aldershot", + "17", + "4", + "0", + "21" + ], + [ + "ernie moss", + "chesterfield", + "20", + "0", + "0", + "20" + ], + [ + "richie barker", + "notts county", + "19", + "1", + "0", + "20" + ], + [ + "peter price", + "peterborough united", + "16", + "3", + "1", + "20" + ], + [ + "kevin randall", + "chesterfield", + "18", + "0", + "0", + "18" + ], + [ + "arfon griffiths", + "wrexham", + "16", + "2", + "0", + "18" + ], + [ + "rod fletcher", + "lincoln city", + "16", + "1", + "0", + "17" + ], + [ + "smith", + "wrexham", + "15", + "2", + "0", + "17" + ], + [ + "john james", + "port vale", + "14", + "3", + "0", + "17" + ], + [ + "ken jones", + "colchester united", + "15", + "0", + "0", + "15" + ], + [ + "terry heath", + "scunthorpe & lindsey", + "13", + "2", + "0", + "15" + ], + [ + "herbie williams", + "swansea city", + "13", + "2", + "0", + "15" + ], + [ + "bill dearden", + "chester", + "11", + "3", + "1", + "15" + ], + [ + "brian gibbs", + "colchester united", + "14", + "0", + "0", + "14" + ], + [ + "ray mabbutt", + "newport county", + "14", + "0", + "0", + "14" + ], + [ + "tommy robson", + "peterborough united", + "12", + "1", + "1", + "14" + ], + [ + "bobby ross", + "brentford", + "13", + "0", + "0", + "13" + ], + [ + "mike hickman", + "grimsby town", + "13", + "0", + "0", + "13" + ], + [ + "jim fryatt", + "oldham / blackburn rovers", + "2 + 11", + "0", + "0", + "13" + ], + [ + "frank large", + "northampton town", + "10", + "2", + "1", + "13" + ], + [ + "derek draper", + "chester", + "12", + "0", + "0", + "12" + ], + [ + "david shaw", + "oldham", + "12", + "0", + "0", + "12" + ], + [ + "geoffrey thomas", + "swansea city", + "11", + "0", + "1", + "12" + ], + [ + "alan banks", + "exeter city", + "10", + "1", + "1", + "12" + ], + [ + "phil boyer", + "york city", + "9", + "3", + "0", + "12" + ], + [ + "ronnie walton", + "aldershot", + "11", + "0", + "0", + "11" + ], + [ + "alan bradshaw", + "crewe alexandra", + "11", + "0", + "0", + "11" + ], + [ + "john archer", + "chesterfield", + "10", + "1", + "0", + "11" + ], + [ + "fred binney", + "exeter city / torquay united", + "1 + 9", + "0", + "1", + "11" + ], + [ + "jim beardall", + "oldham", + "10", + "0", + "1", + "11" + ], + [ + "alan tarbuck", + "chester", + "8", + "3", + "0", + "11" + ], + [ + "roy massey", + "colchester united / crewe alexandra", + "5 + 2", + "0", + "4", + "11" + ], + [ + "jimmy melia", + "aldershot", + "10", + "0", + "0", + "10" + ], + [ + "lance robson", + "hartlepool / darlington", + "2 + 8", + "0", + "0", + "10" + ], + [ + "kevin mcmahon", + "york city", + "10", + "0", + "0", + "10" + ], + [ + "john mitten", + "exeter city", + "9", + "1", + "0", + "10" + ], + [ + "roy young", + "hartlepool", + "8", + "2", + "0", + "10" + ], + [ + "gary moore", + "southend", + "8", + "0", + "2", + "10" + ] + ], + "title": "", + "original_id": "b0d1c123cc2d1124e9ef5faf9b110b34" + }, + { + "_id": "0f5d7b460d09fcb2577bed808ce86972", + "header": [ + "member state", + "population in millions", + "population % of eu", + "area km 2", + "area % of eu", + "pop density people / km 2" + ], + "rows": [ + [ + "european union", + "494.8", + "100%", + "4422773", + "100%", + "112.0" + ], + [ + "austria", + "8.3", + "1.7%", + "83858", + "1.9%", + "99.0" + ], + [ + "belgium", + "10.5", + "2.1%", + "30510", + "0.7%", + "344.0" + ], + [ + "bulgaria", + "7.7", + "1.6%", + "110912", + "2.5%", + "70.0" + ], + [ + "croatia", + "4.3", + "0.9%", + "56594", + "1.3%", + "75.8" + ], + [ + "cyprus", + "0.8", + "0.2%", + "9250", + "0.2%", + "84.0" + ], + [ + "czech republic", + "10.3", + "2.1%", + "78866", + "1.8%", + "131.0" + ], + [ + "denmark", + "5.4", + "1.1%", + "43094", + "1.0%", + "126.0" + ], + [ + "estonia", + "1.4", + "0.3%", + "45226", + "1.0%", + "29.0" + ], + [ + "finland", + "5.3", + "1.1%", + "337030", + "7.6%", + "16.0" + ], + [ + "france", + "65.03", + "13.%", + "643548", + "14.6%", + "111.0" + ], + [ + "germany", + "80.4", + "16.6%", + "357021", + "8.1%", + "225.0" + ], + [ + "greece", + "11.1", + "2.2%", + "131940", + "3.0%", + "84.0" + ], + [ + "hungary", + "10.1", + "2.0%", + "93030", + "2.1%", + "108.0" + ], + [ + "ireland", + "4.2", + "0.8%", + "70280", + "1.6%", + "60.0" + ], + [ + "italy", + "58.8", + "11.9%", + "301320", + "6.8%", + "195.0" + ], + [ + "latvia", + "2.3", + "0.5%", + "64589", + "1.5%", + "35.0" + ], + [ + "lithuania", + "3.4", + "0.7%", + "65200", + "1.5%", + "52.0" + ], + [ + "luxembourg", + "0.5", + "0.1%", + "2586", + "0.1%", + "181.0" + ], + [ + "malta", + "0.4", + "0.1%", + "316", + "0.0%", + "1261.0" + ], + [ + "netherlands", + "16.4", + "3.3%", + "41526", + "0.9%", + "394.0" + ], + [ + "poland", + "38.1", + "7.7%", + "312685", + "7.1%", + "122.0" + ], + [ + "portugal", + "10.6", + "2.1%", + "92931", + "2.1%", + "114.0" + ], + [ + "romania", + "21.6", + "4.4%", + "238391", + "5.4%", + "91.0" + ], + [ + "spain", + "44.7", + "9.0%", + "504782", + "11.4%", + "87.0" + ], + [ + "slovakia", + "5.4", + "1.1%", + "48845", + "1.1%", + "111.0" + ], + [ + "slovenia", + "2.0", + "0.4%", + "20253", + "0.5%", + "99.0" + ], + [ + "sweden", + "9.1", + "1.8%", + "449964", + "10.2%", + "20.0" + ] + ], + "title": "", + "original_id": "3d4a4379fab0e72179a4a20199c27a18" + }, + { + "_id": "c7c0c13003d69473d24255bd7e33f0b8", + "header": [ + "rank", + "location", + "total passengers", + "annual change", + "capacity", + "capacity in use" + ], + "rows": [ + [ + "1", + "são paulo", + "32777330", + "9.24%", + "26000000", + "126 , 06%" + ], + [ + "2", + "rio de janeiro", + "17495737", + "17.00%", + "18000000", + "97 , 19%" + ], + [ + "3", + "são paulo", + "16775770", + "0.11%", + "12000000", + "139 , 79%" + ], + [ + "4", + "brasília", + "15891530", + "3.20%", + "10000000", + "158 , 91%" + ], + [ + "5", + "belo horizonte", + "10398296", + "9.05%", + "5000000", + "207 , 96%" + ], + [ + "6", + "rio de janeiro", + "9002863", + "5.73%", + "6000000", + "150 , 04%" + ], + [ + "7", + "campinas", + "8858380", + "17.04%", + "3500000", + "253 , 09%" + ], + [ + "8", + "salvador", + "8811540", + "4.96%", + "6000000", + "146 , 85%" + ], + [ + "9", + "porto alegre", + "8261355", + "5.45%", + "6100000", + "135 , 43%" + ], + [ + "10", + "curitiba", + "6828334", + "2.03%", + "6000000", + "113 , 80%" + ], + [ + "11", + "recife", + "6433410", + "0.78%", + "9000000", + "71 , 48%" + ], + [ + "12", + "fortaleza", + "5964308", + "5.61%", + "3000000", + "198 , 80%" + ], + [ + "13", + "vitória", + "3642842", + "14.46%", + "560000", + "650 , 50%" + ], + [ + "14", + "belém", + "3342771", + "11.56%", + "2700000", + "123 , 80%" + ], + [ + "15", + "florianópolis", + "3395256", + "8.75%", + "1100000", + "308 , 65%" + ], + [ + "16", + "manaus", + "3131150", + "3.70%", + "1800000", + "173 , 95%" + ], + [ + "17", + "goinia", + "3076858", + "9.80%", + "600000", + "512 , 80%" + ], + [ + "18", + "cuiabá", + "2761588", + "8.25%", + "1600000", + "172 , 59%" + ], + [ + "19", + "natal", + "2660864", + "2.88%", + "1500000", + "177 , 39%" + ], + [ + "20", + "são luís", + "1991099", + "8.01%", + "1010000", + "197 , 13%" + ], + [ + "21", + "foz do iguaçu", + "1741526", + "2.96%", + "1500000", + "116 , 10%" + ], + [ + "22", + "maceió", + "1719979", + "11.02%", + "1200000", + "143 , 31%" + ], + [ + "23", + "campo grande", + "1655073", + "9.20%", + "900000", + "183 , 89%" + ], + [ + "24", + "aracaju", + "1373401", + "25.63%", + "1300000", + "105 , 64%" + ], + [ + "25", + "navegantes", + "1277486", + "9.38%", + "600000", + "212 , 91%" + ], + [ + "26", + "joão pessoa", + "1252559", + "9.64%", + "860000", + "145 , 62%" + ], + [ + "27", + "londrina", + "1098848", + "14.23%", + "800000", + "137 , 35%" + ], + [ + "28", + "ribeirão preto", + "1077010", + "3.35%", + "480000", + "224 , 37%" + ], + [ + "29", + "porto velho", + "1050682", + "6.79%", + "920000", + "114 , 20%" + ], + [ + "30", + "teresina", + "1044865", + "2.86%", + "450000", + "232 , 19%" + ], + [ + "31", + "uberlndia", + "1011490", + "11.48%", + "600000", + "168 , 58%" + ], + [ + "32", + "são josé do rio preto", + "770569", + "15.13%", + "270000", + "285 , 39%" + ], + [ + "33", + "belo horizonte", + "774881", + "2.33%", + "1200000", + "64 , 57%" + ], + [ + "34", + "maringá", + "757719", + "13.61%", + "430000", + "176 , 21%" + ], + [ + "35", + "palmas", + "579395", + "15.09%", + "370000", + "156 , 59%" + ], + [ + "36", + "macapá", + "573560", + "2.36%", + "170000", + "337 , 38%" + ], + [ + "37", + "ilhéus", + "532130", + "3.70%", + "300000", + "177 , 37%" + ], + [ + "38", + "santarém", + "487168", + "5.62%", + "225000", + "216 , 51%" + ], + [ + "39", + "petrolina", + "458588", + "23.25%", + "150000", + "305 , 72%" + ], + [ + "40", + "juazeiro do norte", + "451087", + "31.51%", + "100000", + "451 , 08%" + ] + ], + "title": "", + "original_id": "671f211ea1ceee8e6abf1907bbe3afb7" + }, + { + "_id": "d827f31162e3d8da5a6c9ed939457823", + "header": [ + "subject", + "no sat", + "no passed", + "% pass", + "highest mark", + "lowest mark", + "mean" + ], + "rows": [ + [ + "english", + "55", + "46", + "84", + "100", + "37", + "59" + ], + [ + "mathematics", + "55", + "39", + "71", + "83", + "36", + "58" + ], + [ + "biology", + "17", + "17", + "100", + "85", + "54", + "72" + ], + [ + "chemistry", + "20", + "16", + "80", + "84", + "43", + "64" + ], + [ + "physics", + "10", + "8", + "80", + "79", + "47", + "63" + ], + [ + "accounting", + "35", + "27", + "77", + "75", + "31", + "58" + ], + [ + "economics", + "35", + "33", + "94", + "88", + "33", + "63" + ], + [ + "computer studies", + "25", + "19", + "76", + "78", + "35", + "56" + ], + [ + "geography", + "8", + "7", + "88", + "76", + "45", + "64" + ], + [ + "introduction to technology", + "3", + "3", + "100", + "69", + "50", + "61" + ], + [ + "food technology", + "9", + "9", + "100", + "80", + "50", + "64" + ] + ], + "title": "", + "original_id": "fde54f80bfc55153ce8d62c818c381df" + }, + { + "_id": "d44d3f9b6575ab0c6122d0ef9dff3db2", + "header": [ + "episode no", + "airdate", + "total viewers", + "share", + "bbc one weekly ranking" + ], + "rows": [ + [ + "1", + "8 april 2010", + "6700000", + "24.8%", + "6" + ], + [ + "2", + "15 april 2010", + "5820000", + "20.8%", + "11" + ], + [ + "3", + "22 april 2010", + "6367000", + "23.7%", + "7" + ], + [ + "4", + "6 may 2010", + "5901000", + "22.6%", + "10" + ], + [ + "5", + "13 may 2010", + "6751000", + "26.6%", + "7" + ], + [ + "6", + "20 may 2010", + "6507000", + "26.2%", + "7" + ] + ], + "title": "", + "original_id": "dc21011c28cb6d8b786c04c5a531dbfb" + }, + { + "_id": "c650e7a9045d9181d06f954e7d5e8165", + "header": [ + "Bank", + "Foundation", + "# of Branches\nAs of 30 September 2012", + "Total Assets (million TL)\nAs of 30 September 2012" + ], + "rows": [ + [ + "Türkiye İş Bankası", + "1924", + "1,294", + "210,535" + ], + [ + "Ziraat Bankası", + "1863", + "1,510", + "207,871" + ], + [ + "Garanti Bank", + "1946", + "947", + "154,550" + ], + [ + "Akbank", + "1948", + "963", + "150,241" + ], + [ + "Yapı ve Kredi Bankası", + "1944", + "949", + "160,309" + ], + [ + "Halk Bankası", + "1938", + "807", + "116,372" + ], + [ + "VakıfBank", + "1954", + "741", + "135,578" + ], + [ + "Finansbank", + "1987", + "530", + "49,902" + ], + [ + "Türk Ekonomi Bankası", + "1927", + "510", + "42,505" + ], + [ + "Denizbank", + "1997", + "624", + "40,457" + ], + [ + "HSBC Bank", + "1990", + "331", + "25,797" + ], + [ + "ING Bank", + "1984", + "320", + "23,184" + ], + [ + "Türk Eximbank", + "1987", + "2", + "14,724" + ], + [ + "Şekerbank", + "1953", + "272", + "14,656" + ], + [ + "İller Bankası", + "1933", + "19", + "12,309" + ], + [ + "Türkiye Sınai Kalkınma Bankası", + "1950", + "4", + "9,929" + ], + [ + "Alternatif Bank", + "1992", + "63", + "7,904" + ], + [ + "Citibank", + "1980", + "37", + "7,884" + ], + [ + "Anadolubank", + "1996", + "88", + "7,218" + ], + [ + "Burgan Bank", + "1992", + "60", + "4,275" + ], + [ + "İMKB Takas ve Saklama Bankası", + "1995", + "1", + "3,587" + ], + [ + "Tekstilbank", + "1986", + "44", + "3,502" + ], + [ + "Deutsche Bank", + "1988", + "1", + "3,426" + ], + [ + "Fibabanka", + "1984", + "27", + "3,120" + ], + [ + "Aktif Yatırım Bankası", + "1999", + "7", + "2,997" + ], + [ + "The Royal Bank of Scotland", + "1921", + "3", + "2,750" + ], + [ + "Türkiye Kalkınma Bankası", + "1975", + "1", + "2,651" + ], + [ + "Turkland Bank", + "1991", + "27", + "2,649" + ], + [ + "Arap Türk Bankası", + "1977", + "7", + "2,147" + ], + [ + "Merrill Lynch", + "1992", + "1", + "1,898" + ], + [ + "BankPozitif", + "1999", + "1", + "1,788" + ], + [ + "Société Générale", + "1989", + "16", + "1,457" + ], + [ + "Turkish Bank", + "1982", + "20", + "837" + ], + [ + "JPMorgan Chase", + "1984", + "1", + "830" + ], + [ + "Birleşik Fon Bankası", + "1958", + "1", + "801" + ], + [ + "Bank Mellat", + "1982", + "3", + "729" + ], + [ + "Portigon", + "1985", + "1", + "279" + ], + [ + "Nurol Yatırım Bankası", + "1999", + "2", + "227" + ], + [ + "Diler Yatırım Bankası", + "1998", + "1", + "108" + ], + [ + "GSD Yatırım Bankası", + "1998", + "1", + "108" + ], + [ + "Habib Bank Limited", + "1983", + "1", + "80" + ], + [ + "Credit Agricole", + "1990", + "1", + "72" + ], + [ + "Adabank", + "1985", + "1", + "51" + ], + [ + "Taib Yatırım Bank", + "1987", + "1", + "18" + ] + ], + "title": "", + "original_id": "084783c5325f5e96c17f174c4bf121d9" + }, + { + "_id": "e7ec6cce9b307aafea0f84f7d5b98993", + "header": [ + "rank", + "company", + "headquarters", + "industry", + "sales (billion )", + "profits (billion )", + "assets (billion )", + "market value (billion )" + ], + "rows": [ + [ + "1", + "citigroup", + "usa", + "banking", + "146.56", + "21.54", + "1884.32", + "247.42" + ], + [ + "2", + "bank of america", + "usa", + "banking", + "116.57", + "21.13", + "1459.74", + "226.61" + ], + [ + "3", + "hsbc", + "uk", + "banking", + "121.51", + "16.63", + "1860.76", + "202.29" + ], + [ + "4", + "general electric", + "usa", + "conglomerate", + "163.39", + "20.83", + "697.24", + "358.98" + ], + [ + "5", + "jpmorgan chase", + "usa", + "banking", + "99.3", + "14.44", + "1351.52", + "170.97" + ], + [ + "6", + "american international group", + "usa", + "insurance", + "113.19", + "14.01", + "979.41", + "174.47" + ], + [ + "7", + "exxonmobil", + "usa", + "oil and gas", + "335.09", + "39.5", + "223.95", + "410.65" + ], + [ + "8", + "royal dutch shell", + "netherlands", + "oil and gas", + "318.85", + "25.44", + "232.31", + "208.25" + ], + [ + "9", + "ubs", + "switzerland", + "diversified financials", + "105.59", + "9.78", + "1776.89", + "116.84" + ], + [ + "10", + "ing group", + "netherlands", + "diversified financials", + "153.44", + "9.65", + "1615.05", + "93.99" + ], + [ + "11", + "bp", + "uk", + "oil and gas", + "265.91", + "22.29", + "217.6", + "198.14" + ], + [ + "12", + "toyota", + "japan", + "automotive", + "179.02", + "11.68", + "243.6", + "217.69" + ], + [ + "13", + "the royal bank of scotland", + "uk", + "banking", + "77.41", + "12.51", + "1705.35", + "124.13" + ], + [ + "14", + "bnp paribas", + "france", + "banking", + "89.16", + "9.64", + "1898.19", + "97.03" + ], + [ + "15", + "allianz", + "germany", + "insurance", + "125.33", + "8.81", + "1380.88", + "87.22" + ], + [ + "16", + "berkshire hathaway", + "usa", + "diversified financials", + "98.54", + "11.02", + "248.44", + "163.79" + ], + [ + "17", + "walmart", + "usa", + "retailing", + "348.65", + "11.29", + "151.19", + "201.36" + ], + [ + "18", + "barclays", + "uk", + "banking", + "67.71", + "8.95", + "1949.17", + "94.79" + ], + [ + "19", + "chevron", + "usa", + "oil and gas", + "195.34", + "17.14", + "132.63", + "149.37" + ], + [ + "19", + "total sa", + "france", + "oil and gas", + "175.05", + "15.53", + "138.82", + "152.62" + ] + ], + "title": "", + "original_id": "20e1c96525644ffc2d2b4f807f0c8901" + }, + { + "_id": "68de1e224ae93322a888d33f4ae1b9d6", + "header": [ + "Year", + "Conservative\ncouncillors", + "Labour\ncouncillors", + "Independent\ncouncillors", + "Liberal\ncouncillors" + ], + "rows": [ + [ + "1947", + "3", + "2", + "18", + "1" + ], + [ + "1951", + "5", + "2", + "17", + "0" + ], + [ + "1952", + "3", + "3", + "18", + "0" + ], + [ + "1953", + "4", + "3", + "17", + "0" + ], + [ + "1954", + "3", + "4", + "17", + "0" + ], + [ + "1955", + "2", + "5", + "17", + "0" + ], + [ + "1956", + "2", + "6", + "16", + "0" + ], + [ + "1957", + "2", + "5", + "17", + "0" + ], + [ + "1958", + "2", + "6", + "16", + "0" + ], + [ + "1960", + "2", + "5", + "16", + "1" + ], + [ + "1961", + "2", + "5", + "15", + "2" + ], + [ + "1963", + "2", + "6", + "12", + "4" + ], + [ + "1964", + "3", + "6", + "11", + "4" + ], + [ + "1965", + "4", + "5", + "11", + "3" + ], + [ + "1966", + "9", + "4", + "6", + "5" + ], + [ + "1967", + "9", + "4", + "9", + "2" + ], + [ + "1972", + "10", + "10", + "3", + "1" + ] + ], + "title": "", + "original_id": "cec848df4b55e22fe694af2b6fcb7632" + }, + { + "_id": "edc3ee5fb109c03b6bbe7e7b1574c833", + "header": [ + "group", + "half - life (s)", + "decay constant (s 1 )", + "yield , neutrons per fission", + "fraction" + ], + "rows": [ + [ + "1", + "55.72", + "0.0124", + "0.00052", + "0.000215" + ], + [ + "2", + "22.72", + "0.0305", + "0.00546", + "0.001424" + ], + [ + "3", + "6.22", + "0.111", + "0.0031", + "0.001274" + ], + [ + "4", + "2.3", + "0.301", + "0.00624", + "0.002568" + ], + [ + "5", + "0.614", + "1.14", + "0.00182", + "0.000748" + ], + [ + "6", + "0.23", + "3.01", + "0.00066", + "0.000273" + ] + ], + "title": "", + "original_id": "9fdf969b7c66712da4f22c788a31c120" + }, + { + "_id": "336c12b29a70ee82c6d268d96a715b29", + "header": [ + "rocket", + "country", + "type", + "launches", + "successes", + "failures", + "partial failures" + ], + "rows": [ + [ + "ariane 5eca", + "europe", + "ariane 5", + "6", + "6", + "0", + "0" + ], + [ + "atlas v 401", + "united states", + "atlas v", + "1", + "1", + "0", + "0" + ], + [ + "atlas v 501", + "united states", + "atlas v", + "2", + "2", + "0", + "0" + ], + [ + "atlas v 531", + "united states", + "atlas v", + "1", + "1", + "0", + "0" + ], + [ + "delta ii 7420", + "united states", + "delta ii", + "1", + "1", + "0", + "0" + ], + [ + "delta iv - m + (4 , 2)", + "united states", + "delta iv", + "2", + "2", + "0", + "0" + ], + [ + "delta iv - h", + "united states", + "delta iv", + "1", + "1", + "0", + "0" + ], + [ + "dnepr - 1", + "ukraine", + "dnepr", + "3", + "3", + "0", + "0" + ], + [ + "falcon 9", + "united states", + "falcon 9", + "2", + "2", + "0", + "0" + ], + [ + "gslv mk i (c)", + "india", + "gslv", + "1", + "0", + "1", + "0" + ], + [ + "gslv mk ii", + "india", + "gslv", + "1", + "0", + "1", + "0" + ], + [ + "h - iia 202", + "japan", + "h - iia", + "2", + "2", + "0", + "0" + ], + [ + "kosmos - 3 m", + "russia", + "kosmos", + "1", + "1", + "0", + "0" + ], + [ + "long march 2d", + "china", + "long march 2", + "3", + "3", + "0", + "0" + ], + [ + "long march 3a", + "china", + "long march 3", + "3", + "3", + "0", + "0" + ], + [ + "long march 3b", + "china", + "long march 3", + "1", + "1", + "0", + "0" + ], + [ + "long march 3c", + "china", + "long march 3", + "4", + "4", + "0", + "0" + ], + [ + "long march 4b", + "china", + "long march 4", + "1", + "1", + "0", + "0" + ], + [ + "long march 4c", + "china", + "long march 4", + "3", + "3", + "0", + "0" + ], + [ + "minotaur iv", + "united states", + "minotaur iv", + "1", + "1", + "0", + "0" + ], + [ + "minotaur iv / haps", + "united states", + "minotaur iv", + "1", + "1", + "0", + "0" + ], + [ + "molniya - m / 2bl", + "russia", + "molniya", + "1", + "1", + "0", + "0" + ], + [ + "naro - 1", + "russia south korea", + "naro", + "1", + "0", + "1", + "0" + ], + [ + "proton - m / dm - 2", + "russia", + "proton", + "2", + "2", + "0", + "0" + ], + [ + "proton - m / dm - 03", + "russia", + "proton", + "1", + "0", + "1", + "0" + ], + [ + "proton - m / briz - m", + "russia", + "proton", + "9", + "9", + "0", + "0" + ], + [ + "pslv - ca", + "india", + "pslv", + "1", + "1", + "0", + "0" + ], + [ + "rokot / briz - km", + "russia", + "ur - 100", + "2", + "2", + "0", + "0" + ], + [ + "shavit - 2", + "israel", + "shavit", + "1", + "1", + "0", + "0" + ], + [ + "soyuz - 2.1a / fregat", + "russia", + "soyuz", + "2", + "2", + "0", + "0" + ], + [ + "soyuz - u", + "russia", + "soyuz", + "6", + "6", + "0", + "0" + ], + [ + "soyuz - fg", + "russia", + "soyuz", + "4", + "4", + "0", + "0" + ], + [ + "space shuttle", + "united states", + "space shuttle", + "3", + "3", + "0", + "0" + ] + ], + "title": "", + "original_id": "d5edf188f93efcfec0bcbc664b3b8445" + }, + { + "_id": "8ac9929fd0baa37756444a74da8fcb1b", + "header": [ + "rank", + "airport", + "total passengers", + "% change 2007 / 2008", + "international passengers", + "domestic passengers", + "transit passengers", + "aircraft movements", + "freight ( metric tonnes )" + ], + "rows": [ + [ + "1", + "london heathrow", + "67054745", + "1.5%", + "61344438", + "5562516", + "147791", + "478693", + "1397054" + ], + [ + "2", + "london gatwick", + "34205887", + "2.9%", + "30431051", + "3730963", + "43873", + "263653", + "107702" + ], + [ + "3", + "london stansted", + "22360364", + "6.0%", + "19996947", + "2343428", + "19989", + "193282", + "197738" + ], + [ + "4", + "manchester", + "21219195", + "4.0%", + "18119230", + "2943719", + "156246", + "204610", + "141781" + ], + [ + "5", + "london luton", + "10180734", + "2.6%", + "8853224", + "1320678", + "6832", + "117859", + "40518" + ], + [ + "6", + "birmingham airport", + "9627589", + "4.3%", + "8105162", + "1471538", + "50889", + "112227", + "12192" + ], + [ + "7", + "edinburgh", + "9006702", + "0.5%", + "3711140", + "5281038", + "14524", + "125550", + "12418" + ], + [ + "8", + "glasgow international", + "8178891", + "7.0%", + "3943139", + "4192121", + "43631", + "100087", + "3546" + ], + [ + "9", + "bristol", + "6267114", + "5.7%", + "5057051", + "1171605", + "38458", + "76517", + "3" + ], + [ + "10", + "east midlands", + "5620673", + "3.8%", + "4870184", + "746094", + "4395", + "93038", + "261507" + ], + [ + "11", + "liverpool", + "5334152", + "2.5%", + "4514926", + "814900", + "4326", + "84890", + "3740" + ], + [ + "12", + "belfast international", + "5262354", + "0.2%", + "2122844", + "3099995", + "39515", + "77943", + "36115" + ], + [ + "13", + "newcastle", + "5039993", + "10.8%", + "3506681", + "1509959", + "23353", + "72904", + "1938" + ], + [ + "14", + "aberdeen", + "3290920", + "3.6%", + "1470099", + "1820137", + "684", + "119831", + "4006" + ], + [ + "15", + "london city", + "3260236", + "12.0%", + "2600731", + "659494", + "11", + "94516", + "0" + ], + [ + "16", + "leeds bradford", + "2873321", + "0.3%", + "2282358", + "578089", + "12874", + "61699", + "334" + ], + [ + "17", + "belfast city", + "2570742", + "17.5%", + "70516", + "2500225", + "1", + "42990", + "168" + ], + [ + "18", + "glasgow prestwick", + "2415755", + "0.3%", + "1728020", + "685999", + "1736", + "42708", + "22966" + ], + [ + "19", + "cardiff", + "1994892", + "5.5%", + "1565991", + "412728", + "16173", + "37123", + "1334" + ] + ], + "title": "", + "original_id": "502645e77ad3f4a83adb38da6c6168b7" + }, + { + "_id": "055fca74fa773081880677d245347536", + "header": [ + "year ended", + "revenue (million)", + "profit / (loss) before tax (m)", + "net profit (m)", + "earnings per share (p)" + ], + "rows": [ + [ + "2011", + "5110", + "193.7", + "123.8", + "38.2" + ], + [ + "2010", + "4830", + "225.2", + "159.0", + "49.1" + ], + [ + "2009", + "4649", + "257.8", + "148.9", + "46.4" + ], + [ + "2008", + "4177", + "206.9", + "142.2", + "44.5" + ], + [ + "2007", + "3582", + "191.1", + "130.1", + "39.8" + ], + [ + "2006", + "3333", + "189.7", + "129.4", + "37.8" + ], + [ + "2005", + "2924", + "176.7", + "124.2", + "35.4" + ], + [ + "2004", + "2438", + "158.2", + "141.4", + "30.7" + ], + [ + "2004", + "2438", + "200.9", + "127.4", + "28.7" + ], + [ + "2003", + "2276", + "194.6", + "124.6", + "27.4" + ] + ], + "title": "", + "original_id": "f3e0cdd74f999348fb59a6fabee6691e" + }, + { + "_id": "d766a1d3b8a893ce87d2880399e83b1d", + "header": [ + "Unnamed: 0", + "Average population (x 1000)", + "Live births", + "Deaths", + "Natural change", + "Crude birth rate (per 1000)", + "Crude death rate (per 1000)", + "Natural change (per 1000)" + ], + "rows": [ + [ + "1970", + "31", + "683", + "356", + "327", + "22.0", + "11.5", + "10.5" + ], + [ + "1975", + "33", + "706", + "374", + "332", + "21.4", + "11.3", + "10.1" + ], + [ + "1980", + "35", + "701", + "351", + "350", + "20.0", + "10.0", + "10.0" + ], + [ + "1985", + "37", + "793", + "289", + "504", + "21.4", + "7.8", + "13.6" + ], + [ + "1990", + "38", + "635", + "342", + "293", + "16.9", + "9.1", + "7.8" + ], + [ + "1991", + "38", + "623", + "350", + "273", + "16.6", + "9.3", + "7.3" + ], + [ + "1992", + "37", + "611", + "369", + "242", + "16.7", + "10.1", + "6.6" + ], + [ + "1993", + "34", + "459", + "433", + "26", + "13.3", + "12.6", + "0.8" + ], + [ + "1994", + "32", + "433", + "460", + "- 27", + "13.5", + "14.3", + "-0.8" + ], + [ + "1995", + "31", + "382", + "481", + "- 99", + "12.5", + "15.8", + "-3.2" + ], + [ + "1996", + "29", + "374", + "436", + "- 62", + "12.7", + "14.8", + "-2.1" + ], + [ + "1997", + "29", + "373", + "400", + "- 27", + "13.0", + "13.9", + "-0.9" + ], + [ + "1998", + "28", + "396", + "355", + "41", + "14.2", + "12.7", + "1.5" + ], + [ + "1999", + "27", + "319", + "397", + "- 78", + "11.8", + "14.7", + "-2.9" + ], + [ + "2000", + "26", + "289", + "391", + "- 102", + "11.0", + "14.9", + "-3.9" + ], + [ + "2001", + "26", + "298", + "390", + "- 92", + "11.6", + "15.1", + "-3.6" + ], + [ + "2002", + "25", + "310", + "376", + "- 66", + "12.3", + "14.9", + "-2.6" + ], + [ + "2003", + "24", + "268", + "462", + "- 194", + "11.0", + "19.0", + "-8.0" + ], + [ + "2004", + "24", + "339", + "463", + "- 124", + "14.4", + "19.7", + "-5.3" + ], + [ + "2005", + "23", + "294", + "466", + "- 172", + "12.9", + "20.5", + "-7.6" + ], + [ + "2006", + "22", + "270", + "366", + "- 96", + "12.3", + "16.7", + "-4.4" + ], + [ + "2007", + "21", + "280", + "351", + "- 71", + "13.2", + "16.5", + "-3.3" + ], + [ + "2008", + "20", + "267", + "368", + "- 101", + "13.0", + "18.0", + "-4.9" + ], + [ + "2009", + "20", + "268", + "365", + "- 97", + "13.6", + "18.5", + "-4.9" + ], + [ + "2010", + "19", + "233", + "397", + "- 164", + "12.3", + "20.9", + "-8.7" + ] + ], + "title": "", + "original_id": "ea9cf61bd99a190e303a617ba0abb869" + }, + { + "_id": "5d5d877c6bc389d51f3dfc6b2e4c15ba", + "header": [ + "commune", + "area (km 2 )", + "2002 population", + "pop density (km 2 )", + "municipality website" + ], + "rows": [ + [ + "santiago (capital)", + "22.4", + "200792", + "8963.9", + "link" + ], + [ + "vitacura", + "28.3", + "81499", + "2879.8", + "link" + ], + [ + "san ramón", + "6.5", + "94906", + "14600.9", + "link" + ], + [ + "san miguel", + "9.5", + "78872", + "8302.3", + "link" + ], + [ + "san joaquín", + "9.7", + "97625", + "10064.4", + "link" + ], + [ + "renca", + "24.2", + "133518", + "5517.3", + "link" + ], + [ + "recoleta", + "16.2", + "148220", + "9149.4", + "link" + ], + [ + "quinta normal", + "12.4", + "104012", + "8388.1", + "link" + ], + [ + "quilicura", + "57.5", + "126518", + "2200.3", + "link" + ], + [ + "pudahuel", + "197.4", + "195653", + "991.1", + "link" + ], + [ + "providencia", + "14.4", + "120874", + "8394.0", + "link" + ], + [ + "peñalolén", + "54.2", + "216060", + "3986.3", + "link" + ], + [ + "pedro aguirre cerda", + "9.7", + "114560", + "11810.3", + "link" + ], + [ + "ñuñoa", + "16.9", + "163511", + "9675.2", + "link" + ], + [ + "maipú", + "133.0", + "468390", + "3521.7", + "link" + ], + [ + "macul", + "12.9", + "112535", + "8723.6", + "link" + ], + [ + "lo prado", + "6.7", + "104316", + "15569.6", + "link" + ], + [ + "lo espejo", + "7.2", + "112800", + "15666.7", + "link" + ], + [ + "lo barnechea", + "1023.7", + "74749", + "73.0", + "link" + ], + [ + "las condes", + "99.4", + "249893", + "2514.0", + "link" + ], + [ + "la reina", + "23.4", + "96762", + "4135.1", + "link" + ], + [ + "la pintana", + "30.6", + "190085", + "6211.9", + "link" + ], + [ + "la granja", + "10.1", + "132520", + "13120.8", + "link" + ], + [ + "la florida", + "70.8", + "365674", + "5164.9", + "link" + ], + [ + "la cisterna", + "10.0", + "85118", + "8511.8", + "link" + ], + [ + "independencia", + "7.4", + "65479", + "8848.5", + "link" + ], + [ + "huechuraba", + "44.8", + "74070", + "1653.3", + "link" + ], + [ + "estación central", + "14.1", + "130394", + "9247.8", + "link" + ], + [ + "el bosque", + "14.1", + "175594", + "12453.5", + "link" + ], + [ + "conchalí", + "70.7", + "133256", + "1884.8", + "link" + ], + [ + "cerro navia", + "11.1", + "148312", + "13361.4", + "link" + ] + ], + "title": "", + "original_id": "2c1aa2f249ca6fdf4a7fe2f47b3bd53c" + }, + { + "_id": "0bf74c06a629e346db7d2de3a73d149b", + "header": [ + "country", + "tourist arrivals (2011) (millions)", + "tourism receipts (2011) (millions of us)", + "tourism receipts (2011) (us per arrival)", + "tourism receipts (2011) (us per capita)", + "tourism receipts (2003) (as % of gdp)", + "tourism receipts (2003) (as % of exports)", + "tourism competitiveness (2011) (ttci)" + ], + "rows": [ + [ + "argentina", + "5.663", + "5353", + "945", + "133", + "7.4", + "1.8", + "4.20" + ], + [ + "bolivia", + "0.807", + "310", + "384", + "31", + "9.4", + "2.2", + "3.35" + ], + [ + "brazil", + "5.433", + "6555", + "1207", + "34", + "3.2", + "0.5", + "4.36" + ], + [ + "chile", + "3.07", + "1831", + "596", + "107", + "5.3", + "1.9", + "4.27" + ], + [ + "colombia", + "4.356", + "4061", + "873", + "45", + "6.6", + "1.4", + "3.94" + ], + [ + "costa rica", + "2.196", + "2156", + "982", + "459", + "17.5", + "8.1", + "4.43" + ], + [ + "cuba", + "2.507", + "2187", + "872", + "194", + "n / a", + "n / a", + "n / a" + ], + [ + "dominican republic", + "4.306", + "4353", + "1011", + "440", + "36.2", + "18.8", + "3.99" + ], + [ + "ecuador", + "1.141", + "837", + "734", + "58", + "6.3", + "1.5", + "3.79" + ], + [ + "el salvador", + "1.184", + "415", + "351", + "67", + "12.9", + "3.4", + "3.68" + ], + [ + "guatemala", + "1.225", + "1350", + "1102", + "94", + "16.0", + "2.6", + "3.82" + ], + [ + "haiti", + "0.255", + "167", + "655", + "17", + "19.4", + "3.2", + "n / a" + ], + [ + "honduras", + "0.931", + "701", + "753", + "92", + "13.5", + "5.0", + "3.79" + ], + [ + "mexico", + "23.403", + "11869", + "507", + "105", + "5.7", + "1.6", + "4.43" + ], + [ + "nicaragua", + "1.06", + "377", + "356", + "65", + "15.5", + "3.7", + "3.56" + ], + [ + "panama", + "2.06", + "1926", + "1308", + "550", + "10.6", + "6.3", + "4.30" + ], + [ + "paraguay", + "0.524", + "241", + "460", + "37", + "4.2", + "1.3", + "3.26" + ], + [ + "peru", + "2.598", + "2360", + "908", + "81", + "9.0", + "1.6", + "4.04" + ], + [ + "uruguay", + "2.857", + "2187", + "765", + "643", + "14.2", + "3.6", + "4.24" + ], + [ + "venezuela", + "0.51", + "739", + "1449", + "25", + "1.3", + "0.4", + "3.46" + ] + ], + "title": "", + "original_id": "af979ad2c02be83e2c8dd7babeec312d" + }, + { + "_id": "7624274d56083ae7c99730321ff9deb3", + "header": [ + "name", + "municipal status", + "census division", + "population (2011)", + "population (2006)", + "change (%)", + "area (km square)", + "population density" + ], + "rows": [ + [ + "barrie", + "single - tier", + "simcoe", + "136063", + "128430", + "5.9", + "77.39", + "1758.1" + ], + [ + "belleville", + "single - tier", + "hastings", + "49454", + "48821", + "1.3", + "247.21", + "200.0" + ], + [ + "brampton brampton is canada 's ninth - largest city", + "lower - tier", + "peel", + "523911", + "433806", + "20.8", + "266.34", + "1967.1" + ], + [ + "brant", + "single - tier", + "brant", + "35638", + "34415", + "3.6", + "843.29", + "42.3" + ], + [ + "brockville", + "single - tier", + "leeds and grenville", + "21870", + "21957", + "- 0.4", + "20.9", + "1046.2" + ], + [ + "burlington", + "lower - tier", + "halton", + "175779", + "164415", + "6.9", + "185.66", + "946.8" + ], + [ + "clarence - rockland", + "lower - tier", + "prescott and russell", + "23185", + "20790", + "11.5", + "297.86", + "77.8" + ], + [ + "cornwall", + "single - tier", + "stormont , dundas and glengarry", + "46340", + "45965", + "0.8", + "61.52", + "753.2" + ], + [ + "elliot lake", + "single - tier", + "algoma", + "11348", + "11549", + "- 1.7", + "714.56", + "15.9" + ], + [ + "haldimand county", + "single - tier", + "haldimand", + "44876", + "45212", + "- 0.7", + "1251.57", + "35.9" + ], + [ + "kawartha lakes", + "single - tier", + "kawartha lakes", + "73214", + "74561", + "- 1.8", + "3083.06", + "23.7" + ], + [ + "kenora", + "single - tier", + "kenora", + "15348", + "15177", + "1.1", + "211.75", + "72.5" + ], + [ + "norfolk county", + "single - tier", + "norfolk", + "63175", + "62563", + "1", + "1607.6", + "39.3" + ], + [ + "north bay", + "single - tier", + "nipissing", + "53651", + "53966", + "- 0.6", + "319.05", + "168.2" + ], + [ + "orillia", + "single - tier", + "simcoe", + "30586", + "30259", + "1.1", + "28.61", + "1069.2" + ], + [ + "owen sound", + "lower - tier", + "grey", + "21688", + "21753", + "- 0.3", + "24.22", + "895.5" + ], + [ + "pickering", + "lower - tier", + "durham", + "88721", + "87838", + "1", + "231.59", + "383.1" + ], + [ + "port colborne", + "lower - tier", + "niagara", + "18424", + "18599", + "- 0.9", + "121.97", + "151.1" + ], + [ + "prince edward county", + "single - tier", + "prince edward", + "25258", + "25496", + "- 0.9", + "1050.45", + "24.0" + ], + [ + "quinte west", + "single - tier", + "hastings", + "43086", + "42697", + "0.9", + "494.15", + "87.2" + ], + [ + "sarnia", + "lower - tier", + "lambton", + "72366", + "71419", + "1.3", + "164.71", + "439.4" + ], + [ + "sault ste marie", + "single - tier", + "algoma", + "75141", + "74948", + "0.3", + "223.26", + "336.6" + ], + [ + "st thomas", + "single - tier", + "elgin", + "37905", + "36110", + "5", + "35.52", + "1067.3" + ], + [ + "stratford", + "single - tier", + "perth", + "30886", + "30516", + "1.2", + "26.95", + "1146.0" + ], + [ + "temiskaming shores", + "single - tier", + "timiskaming", + "10400", + "10442", + "- 0.4", + "177.91", + "58.5" + ], + [ + "thorold", + "lower - tier", + "niagara", + "17931", + "18224", + "- 1.6", + "83.0", + "216.0" + ], + [ + "timmins", + "single - tier", + "cochrane", + "43165", + "42997", + "0.4", + "2979.15", + "14.5" + ], + [ + "vaughan", + "lower - tier", + "york", + "288301", + "238866", + "20.7", + "273.52", + "1054.0" + ], + [ + "welland", + "lower - tier", + "niagara", + "50631", + "50331", + "0.6", + "81.09", + "624.4" + ], + [ + "woodstock", + "lower - tier", + "oxford", + "37754", + "35822", + "5.4", + "49.0", + "770.5" + ] + ], + "title": "", + "original_id": "f039bcce7051c77924a8e9b2775e23c4" + }, + { + "_id": "602595cf88b2a12fa6c6b9cc3a566a44", + "header": [ + "region", + "land area (km 2 )", + "rainfall by depth (mm / year)", + "rainfall by volume (km 3 / year)", + "surface run off (km 3 / year)", + "infiltration (km 3 / year)", + "evapotranspiration (km 3 / year)" + ], + "rows": [ + [ + "chorotega", + "9552.4", + "2006", + "19.2", + "5.7", + "3.5", + "10.3" + ], + [ + "huetar norte", + "9001.5", + "3527", + "31.8", + "14.9", + "9.6", + "7.5" + ], + [ + "huetar atlántico", + "9688.5", + "3933", + "38.1", + "17.6", + "9.3", + "11.1" + ], + [ + "pacífico central", + "4722.9", + "2801", + "13.2", + "5.2", + "2.2", + "4.9" + ], + [ + "central", + "8543.2", + "3461", + "29.6", + "13.0", + "7.0", + "8.6" + ], + [ + "brunca", + "9294.5", + "3809", + "35.4", + "18.6", + "5.6", + "12.2" + ] + ], + "title": "", + "original_id": "4a9ffbf9e8babf2558133ff3ffa87d19" + }, + { + "_id": "bbfb01739f742b3008669ff46c05468b", + "header": [ + "season", + "season premiere", + "season finale", + "tv season", + "rank", + "viewers (in millions)" + ], + "rows": [ + [ + "1", + "september 23 , 1995", + "may 22 , 1996", + "1995 - 1996", + "79", + "11.56" + ], + [ + "2", + "january 3 , 1997", + "april 18 , 1997", + "1996 - 1997", + "68", + "11.8" + ], + [ + "3", + "september 23 , 1997", + "may 19 , 1998", + "1997 - 1998", + "36", + "12.9" + ], + [ + "4", + "september 22 , 1998", + "may 25 , 1999", + "1998 - 1999", + "17", + "14.2" + ], + [ + "5", + "september 21 , 1999", + "may 23 , 2000", + "1999 - 2000", + "25", + "14.07" + ], + [ + "6", + "october 3 , 2000", + "may 22 , 2001", + "2000 - 2001", + "26", + "14.6" + ], + [ + "7", + "september 25 , 2001", + "may 21 , 2002", + "2001 - 2002", + "15", + "14.8" + ], + [ + "8", + "september 24 , 2002", + "may 20 , 2003", + "2002 - 2003", + "26", + "12.97" + ], + [ + "9", + "september 26 , 2003", + "may 21 , 2004", + "2003 - 2004", + "37", + "10.8" + ] + ], + "title": "", + "original_id": "7cc8b2834fad4efc63736b5d45f4617d" + }, + { + "_id": "467e6439489065bc3ede668faf623099", + "header": [ + "annual ridership (2012)", + "rider per mile", + "opened", + "stations", + "lines" + ], + "rows": [ + [ + "2544892400", + "37613", + "1904", + "468", + "24" + ], + [ + "280904200", + "9227", + "1976", + "86", + "5" + ], + [ + "231154300", + "7095", + "1892", + "145", + "8" + ], + [ + "165028800", + "13982", + "1897", + "53", + "3" + ], + [ + "123219300", + "4056", + "1972", + "44", + "5" + ], + [ + "98171300", + "9172", + "1907", + "74", + "3" + ], + [ + "70548400", + "18123", + "1908", + "13", + "4" + ], + [ + "70506800", + "4594", + "1979", + "38", + "4" + ], + [ + "48703700", + "9115", + "1993", + "16", + "2" + ], + [ + "19242800", + "2904", + "1984", + "23", + "2" + ], + [ + "15399400", + "3871", + "1983", + "14", + "1" + ], + [ + "11023500", + "3794", + "2004", + "16", + "1" + ], + [ + "10619900", + "2606", + "1936", + "13", + "1" + ], + [ + "6239900", + "881", + "1955", + "18", + "1" + ], + [ + "4445100", + "1071", + "1860", + "22", + "1" + ] + ], + "title": "", + "original_id": "b068e116439a5805a7d328e24829a00e" + }, + { + "_id": "46b0f529103809ad08a3bc5a1bf2f704", + "header": [ + "type", + "numbers", + "year built", + "quantity built", + "power (horsepower)", + "max speed (km / h)" + ], + "rows": [ + [ + "rhn", + "1011 - 1048 (power cars) 11 - 48 (trailer cars)", + "1967", + "38 + 38", + "220", + "90" + ], + [ + "rts", + "d9 - d16 (power cars) ts4 - ts7 (center / trailer cars)", + "1971", + "8 + 4", + "220", + "70" + ], + [ + "thn", + "1101 - 1140", + "1983", + "40", + "235", + "105" + ], + [ + "nkf", + "1201 - 1264 , (center) 2101 - 2112", + "1985", + "64 + 12", + "235", + "105" + ], + [ + "asr ( class 158 express sprinter )", + "2501 - 2512 , (center) 2113 - 2120", + "1991", + "12 + 8", + "285", + "120" + ], + [ + "apd 20", + "2513 - 2524 (center) 2121 - 2128", + "1995", + "10 + 8", + "298", + "120" + ], + [ + "apd 60", + "2525 - 2544", + "1996", + "20 + 40", + "298", + "120" + ] + ], + "title": "", + "original_id": "e41eb9209114381d9de98dc4c249ed76" + }, + { + "_id": "3cc8273ccf0a4f15c573cd0294425731", + "header": [ + "season", + "series", + "team", + "races", + "wins", + "poles", + "laps", + "podiums", + "points", + "position" + ], + "rows": [ + [ + "2008", + "adac formel masters", + "team abt sportsline", + "16", + "0", + "1", + "1", + "3", + "91.0", + "8th" + ], + [ + "2009", + "adac formel masters", + "team abt sportsline", + "16", + "8", + "7", + "3", + "10", + "224.0", + "1st" + ], + [ + "2010", + "german formula three", + "van amersfoort racing", + "18", + "2", + "6", + "5", + "10", + "112.0", + "2nd" + ], + [ + "2011", + "formula 3 euro series", + "signature", + "27", + "0", + "0", + "1", + "4", + "150.0", + "7th" + ], + [ + "2012", + "gp3 series", + "lotus gp", + "16", + "2", + "1", + "0", + "7", + "149.5", + "2nd" + ], + [ + "2012", + "formula renault 3.5 series", + "tech 1 racing", + "4", + "0", + "0", + "0", + "0", + "0.0", + "34th" + ] + ], + "title": "", + "original_id": "f34a3a13b56566338cc4338ae502c668" + }, + { + "_id": "c812df0f82d991b5e640047cfda6b089", + "header": [ + "Province", + "DC", + "PSDI", + "PSI", + "PCI" + ], + "rows": [ + [ + "Verona", + "53.4", + "4.7", + "18.2", + "10.8" + ], + [ + "Vicenza", + "62.2", + "4.4", + "9.2", + "9.4" + ], + [ + "Padua", + "59.6", + "4.0", + "11.1", + "14.2" + ], + [ + "Treviso", + "59.9", + "8.0", + "11.9", + "8.6" + ], + [ + "Belluno", + "53.7", + "12.3", + "11.3", + "11.6" + ], + [ + "Venice", + "43.2", + "6.0", + "21.6", + "19.7" + ], + [ + "Rovigo", + "39.6", + "4.6", + "19.8", + "28.2" + ], + [ + "Veneto", + "53.4", + "5.6", + "14.6", + "14.2" + ] + ], + "title": "", + "original_id": "a728f926b6fe622a13dedab334d8c0ed" + }, + { + "_id": "2992664cb93ee94d79e17b8cb3d509de", + "header": [ + "State", + "Swimsuit", + "Interview", + "Evening Gown", + "Average", + "Finalists" + ], + "rows": [ + [ + "Iowa", + "9.267", + "9.651", + "9.62", + "9.513", + "9.8" + ], + [ + "Oklahoma", + "9.226", + "9.309", + "9.487", + "9.341", + "9.586" + ], + [ + "Kansas", + "9.221", + "9.6", + "9.6", + "9.474", + "9.486" + ], + [ + "Alabama", + "9.01", + "9.326", + "9.449", + "9.262", + "9.471" + ], + [ + "North Carolina", + "9.079", + "9.207", + "9.5", + "9.262", + "9.414" + ], + [ + "California", + "9.34", + "9.514", + "9.486", + "9.447", + "9.4" + ], + [ + "Rhode Island", + "9.087", + "9.279", + "9.341", + "9.235", + null + ], + [ + "Maryland", + "9.021", + "9.206", + "9.271", + "9.166", + null + ], + [ + "Indiana", + "8.966", + "9.103", + "9.37", + "9.146", + null + ], + [ + "Virginia", + "8.984", + "9.112", + "9.279", + "9.125", + null + ], + [ + "Mississippi", + "8.917", + "9.2", + "9.247", + "9.121", + null + ], + [ + "Illinois", + "8.897", + "8.969", + "9.286", + "9.05", + null + ] + ], + "title": "", + "original_id": "0bee2233eca7e83249d4dc7f850f47f8" + }, + { + "_id": "044ad1f01d197812af7d2338fdb04e46", + "header": [ + "lga name", + "area (km 2 )", + "census 2006 population", + "administrative capital", + "postal code" + ], + "rows": [ + [ + "port harcourt", + "109", + "541115", + "port harcourt", + "500" + ], + [ + "obio - akpor", + "260", + "464789", + "rumuodumaya", + "500" + ], + [ + "okrika", + "222", + "222026", + "okrika", + "500" + ], + [ + "ogu / bolo", + "89", + "74683", + "ogu", + "500" + ], + [ + "eleme", + "138", + "190884", + "eleme", + "501" + ], + [ + "tai", + "159", + "117797", + "sakpenwa", + "501" + ], + [ + "gokana", + "126", + "228828", + "kpor", + "501" + ], + [ + "khana", + "560", + "294217", + "bori", + "502" + ], + [ + "oyigbo", + "248", + "122687", + "afam", + "502" + ], + [ + "opobo / nkoro", + "130", + "151511", + "opobo town", + "503" + ], + [ + "andoni", + "233", + "211009", + "ngo", + "503" + ], + [ + "bonny", + "642", + "215358", + "bonny", + "503" + ], + [ + "degema", + "1011", + "249773", + "degema", + "504" + ], + [ + "asari - toru", + "113", + "220100", + "buguma", + "504" + ], + [ + "akuku - toru", + "1443", + "156006", + "abonnema", + "504" + ], + [ + "abua / odual", + "704", + "282988", + "abua", + "510" + ], + [ + "ahoada west", + "403", + "249425", + "akinima", + "510" + ], + [ + "ahoada east", + "341", + "166747", + "ahoada", + "510" + ], + [ + "ogba / egbema / ndoni", + "969", + "284010", + "omuku", + "510" + ], + [ + "emohua", + "831", + "201901", + "emohua", + "511" + ], + [ + "ikwerre", + "655", + "189726", + "isiokpo", + "511" + ], + [ + "etche", + "805", + "249454", + "okehi", + "512" + ] + ], + "title": "", + "original_id": "ebfb7f83b151375b826603749c259ed6" + }, + { + "_id": "e9781e88e087675f7a5f33e643512a4e", + "header": [ + "year ended", + "passengers flown", + "employees (average / year)", + "net profit / loss (sek)", + "basic eps (sek)" + ], + "rows": [ + [ + "2010", + "25200000", + "14801", + "- 2218000000", + "- 7.79" + ], + [ + "2009", + "24900000", + "18786", + "- 2947000000", + "- 18.20" + ], + [ + "2008", + "29000000", + "24635", + "- 6360000000", + "- 6.29" + ], + [ + "2007", + "29200000", + "26538", + "1234000000", + "3.87" + ], + [ + "2006", + "38609000", + "26554", + "4936000000", + "28.10" + ], + [ + "2005", + "36312000", + "32363", + "418000000", + "1.06" + ], + [ + "2004", + "32400000", + "32481", + "- 1813000000", + "- 11.38" + ], + [ + "2003", + "31004000", + "34544", + "- 2221000000", + "- 8.60" + ], + [ + "2002", + "33254000", + "35506", + "- 736000000", + "- 0.81" + ], + [ + "2001", + "35640000", + "31035", + "- 1140000000", + "- 6.58" + ], + [ + "2000", + "23240000", + "30939", + "2273000000", + "11.79" + ], + [ + "1999", + "21991000", + "30310", + "1846000000", + "8.41" + ] + ], + "title": "", + "original_id": "42d1e8631647f00f264fa84a37b4e899" + }, + { + "_id": "4b7598ebaa178b56fcad4550545c72be", + "header": [ + "year", + "competition", + "location", + "event", + "final - rank", + "final - score", + "qualifying rank", + "qualifying score" + ], + "rows": [ + [ + "2008", + "2008 summer olympics", + "beijing", + "team", + "2", + "186.525", + "2", + "246.8" + ], + [ + "2008", + "2008 summer olympics", + "beijing", + "uneven bars", + "dnq", + "n / a", + "23", + "14.8" + ], + [ + "2008", + "olympic trials", + "philadelphia", + "all around", + "4", + "61.850", + "4", + "61.4" + ], + [ + "2008", + "olympic trials", + "philadelphia", + "balance beam", + "4", + "15.550", + "4", + "15.8" + ], + [ + "2008", + "olympic trials", + "philadelphia", + "floor exercise", + "2", + "15.500", + "3", + "15.65" + ], + [ + "2008", + "olympic trials", + "philadelphia", + "uneven bars", + "6", + "15.200", + "5", + "15.3" + ], + [ + "2008", + "olympic trials", + "philadelphia", + "vault", + "4", + "15.150", + "3", + "15.1" + ], + [ + "2008", + "us championships", + "boston", + "all around", + "4", + "61.250", + "4", + "60.75" + ], + [ + "2008", + "us championships", + "boston", + "balance beam", + "5", + "16.000", + "5", + "15.4" + ], + [ + "2008", + "us championships", + "boston", + "floor exercise", + "10", + "14.750", + "4", + "15.2" + ], + [ + "2008", + "us championships", + "boston", + "uneven bars", + "6", + "15.550", + "6", + "15.15" + ] + ], + "title": "", + "original_id": "485cc8d1dba2799b064e4b40e6294bd8" + }, + { + "_id": "4005f2e626bfb4915e4147160c038818", + "header": [ + "region", + "capital", + "area (km square)", + "area (sq mi)", + "population" + ], + "rows": [ + [ + "abruzzo", + "l'aquila", + "10763", + "4156", + "1342177" + ], + [ + "aosta valley", + "aosta", + "3263", + "1260", + "128129" + ], + [ + "apulia", + "bari", + "19358", + "7474", + "4090577" + ], + [ + "basilicata", + "potenza", + "9995", + "3859", + "587680" + ], + [ + "calabria", + "catanzaro", + "15080", + "5822", + "2011537" + ], + [ + "campania", + "naples", + "13590", + "5247", + "5833131" + ], + [ + "emilia - romagna", + "bologna", + "22446", + "8666", + "4429766" + ], + [ + "friuli - venezia giulia", + "trieste", + "7858", + "3034", + "1235761" + ], + [ + "lazio", + "rome", + "17236", + "6655", + "5724365" + ], + [ + "liguria", + "genoa", + "5422", + "2093", + "1616993" + ], + [ + "lombardy", + "milan", + "23844", + "9206", + "9909348" + ], + [ + "marche", + "ancona", + "9366", + "3616", + "1564886" + ], + [ + "molise", + "campobasso", + "4438", + "1713", + "319834" + ], + [ + "piedmont", + "turin", + "25402", + "9808", + "4456532" + ], + [ + "sardinia", + "cagliari", + "24090", + "9301", + "1675286" + ], + [ + "sicily", + "palermo", + "25711", + "9927", + "5050486" + ], + [ + "tuscany", + "florence", + "22993", + "8878", + "3749074" + ], + [ + "trentino - alto adige / südtirol", + "trento", + "13607", + "5254", + "1036639" + ], + [ + "umbria", + "perugia", + "8456", + "3265", + "906675" + ] + ], + "title": "", + "original_id": "25f235b2c12daacbafcf8299558bb29f" + }, + { + "_id": "432439ecc56369fc3342c1cebe820281", + "header": [ + "election", + "of candidates nominated", + "of seats won", + "of total votes", + "% of popular vote" + ], + "rows": [ + [ + "1984", + "60", + "0", + "26921", + "0.21%" + ], + [ + "1988", + "68", + "0", + "47228", + "0.36%" + ], + [ + "1993", + "79", + "0", + "32979", + "0.24%" + ], + [ + "1997", + "79", + "0", + "55583", + "0.43%" + ], + [ + "2000", + "111", + "0", + "104402", + "0.81%" + ], + [ + "2004", + "308", + "0", + "582247", + "4.32%" + ], + [ + "2006", + "308", + "0", + "665940", + "4.48%" + ], + [ + "2008", + "303", + "0", + "941097", + "6.80%" + ] + ], + "title": "", + "original_id": "82326e0b5694b7754ab781cca80298e4" + }, + { + "_id": "b0af1a8f390273fa1efb6393c7401dbc", + "header": [ + "position", + "team", + "played", + "wins", + "draws", + "losses", + "scored", + "conceded", + "points" + ], + "rows": [ + [ + "1", + "olimpia", + "9", + "4", + "4", + "1", + "14", + "6", + "16" + ], + [ + "2", + "12 de octubre", + "9", + "3", + "6", + "0", + "14", + "8", + "15" + ], + [ + "3", + "cerro porteño", + "9", + "3", + "5", + "1", + "16", + "10", + "14" + ], + [ + "4", + "guaraní", + "9", + "3", + "5", + "1", + "8", + "6", + "14" + ], + [ + "5", + "cerro corá", + "9", + "3", + "4", + "2", + "9", + "8", + "13" + ], + [ + "6", + "atl colegiales", + "9", + "3", + "4", + "2", + "9", + "9", + "13" + ], + [ + "7", + "sol de américa", + "9", + "2", + "5", + "2", + "11", + "10", + "11" + ], + [ + "8", + "san lorenzo", + "9", + "3", + "1", + "5", + "13", + "18", + "10" + ], + [ + "9", + "universal", + "9", + "1", + "3", + "5", + "9", + "17", + "6" + ] + ], + "title": "", + "original_id": "afe4150d5541286e91c8fabe0b055b73" + }, + { + "_id": "9fe7646cdb5fa16db06aa5a7c8e4a6d4", + "header": [ + "rank", + "railway station", + "annual entry / exit (millions) 2011 - 12", + "annual interchanges (millions) 2011 - 12", + "total passengers (millions) 2011 - 12", + "location", + "number of platforms" + ], + "rows": [ + [ + "1", + "london waterloo", + "94.046", + "9.489", + "103.534", + "london", + "19" + ], + [ + "2", + "london victoria", + "76.231", + "9.157", + "85.38", + "london", + "19" + ], + [ + "3", + "london bridge", + "52.634", + "8.742", + "61.376", + "london", + "12" + ], + [ + "4", + "london liverpool street", + "57.107", + "2.353", + "59.46", + "london", + "18" + ], + [ + "5", + "clapham junction", + "21.918", + "21.61", + "43.528", + "london", + "17" + ], + [ + "6", + "london euston", + "36.609", + "3.832", + "40.44", + "london", + "18" + ], + [ + "7", + "london charing cross", + "38.005", + "1.99", + "39.995", + "london", + "6" + ], + [ + "8", + "london paddington", + "33.737", + "2.678", + "36.414", + "london", + "14" + ], + [ + "9", + "birmingham new street", + "31.214", + "5.118", + "36.331", + "birmingham", + "13" + ], + [ + "10", + "london king 's cross", + "27.875", + "3.022", + "30.896", + "london", + "12" + ], + [ + "11", + "glasgow central", + "26.639", + "3.018", + "29.658", + "glasgow", + "17" + ], + [ + "12", + "leeds", + "25.02", + "2.639", + "27.659", + "leeds", + "17" + ], + [ + "13", + "east croydon", + "20.551", + "6.341", + "26.892", + "london", + "6" + ], + [ + "14", + "london st pancras", + "22.996", + "3.676", + "26.672", + "london", + "15" + ], + [ + "15", + "stratford", + "21.797", + "2.064", + "23.862", + "london", + "15" + ], + [ + "16", + "edinburgh waverley", + "22.585", + "1.143", + "23.728", + "edinburgh", + "18" + ], + [ + "17", + "glasgow queen street", + "20.93", + "1.56", + "22.489", + "glasgow", + "9" + ], + [ + "18", + "manchester piccadilly", + "18.585", + "3.796", + "22.381", + "manchester", + "14" + ], + [ + "19", + "london cannon street", + "20.152", + "0.441", + "20.593", + "london", + "7" + ], + [ + "20", + "wimbledon", + "18.246", + "1.591", + "19.836", + "london", + "10" + ], + [ + "21", + "reading", + "15.276", + "3.794", + "19.07", + "reading", + "15" + ], + [ + "22", + "vauxhall", + "18.158", + "0.0", + "18.158", + "london", + "8" + ], + [ + "23", + "brighton", + "16.051", + "1.859", + "17.91", + "brighton", + "8" + ], + [ + "24", + "london fenchurch street", + "17.021", + "0.345", + "17.366", + "london", + "4" + ], + [ + "25", + "gatwick airport", + "14.758", + "1.115", + "15.873", + "gatwick airport", + "6" + ], + [ + "26", + "london marylebone", + "14.41", + "0.439", + "14.849", + "london", + "6" + ], + [ + "27", + "liverpool central", + "14.209", + "0.412", + "14.622", + "liverpool", + "3" + ], + [ + "28", + "liverpool lime street", + "13.835", + "0.778", + "14.613", + "liverpool", + "10" + ], + [ + "29", + "london blackfriars", + "12.79", + "1.059", + "13.85", + "london", + "4" + ], + [ + "30", + "highbury and islington", + "11.801", + "1.971", + "13.772", + "london", + "8" + ] + ], + "title": "", + "original_id": "ad74d81ab4aa956a6be905809321e014" + }, + { + "_id": "fc17b66219dfa477635a3453c66ac047", + "header": [ + "name", + "innings", + "runs scored", + "balls faced", + "average", + "sr" + ], + "rows": [ + [ + "adam gilchrist (wk)", + "8", + "313", + "318", + "39.13", + "98.43" + ], + [ + "matthew hayden", + "6", + "161", + "231", + "26.83", + "69.7" + ], + [ + "ricky ponting (c)", + "8", + "189", + "256", + "23.63", + "73.83" + ], + [ + "michael clarke", + "7", + "293", + "416", + "48.83", + "70.43" + ], + [ + "andrew symonds", + "8", + "100", + "125", + "14.29", + "80.0" + ], + [ + "michael hussey", + "7", + "189", + "283", + "47.25", + "66.78" + ], + [ + "james hopes", + "7", + "115", + "125", + "16.43", + "92.0" + ], + [ + "brett lee", + "5", + "49", + "102", + "12.25", + "48.04" + ], + [ + "mitchell johnson", + "5", + "21", + "44", + "7.0", + "47.73" + ], + [ + "nathan bracken", + "4", + "16", + "43", + "5.33", + "37.21" + ], + [ + "stuart clark", + "2", + "8", + "10", + "8.0", + "80.0" + ], + [ + "brad haddin", + "2", + "12", + "44", + "6.0", + "27.27" + ], + [ + "brad hogg", + "4", + "62", + "100", + "15.5", + "62.0" + ] + ], + "title": "", + "original_id": "b6117222265436180797b4690779708c" + }, + { + "_id": "6127207cab8109307eaf0a5294fa3b67", + "header": [ + "member countries", + "population", + "area (km square)", + "gdp (billion us)", + "gdp per capita (us)" + ], + "rows": [ + [ + "denmark", + "5021861", + "43094", + "70.032", + "59928" + ], + [ + "ireland", + "3073200", + "70273", + "21.103", + "39638" + ], + [ + "united kingdom", + "56210000", + "244820", + "675.941", + "36728" + ], + [ + "accession countries", + "64305061", + "358187", + "767.076", + "11929" + ], + [ + "existing members (1973)", + "192457106", + "1299536", + "2381396", + "12374" + ], + [ + "ec9 (1973)", + "256762167 ( + 33.41%)", + "1657723 ( + 25.44%)", + "3148.472 ( + 32.21%)", + "12262 (0.91%)" + ] + ], + "title": "", + "original_id": "3c41ec8ccc63a0ad8bac5638db8b4721" + }, + { + "_id": "2ebe5b2394d98693af8bb4342c0d0f21", + "header": [ + "Fiscal Year", + "Total External Debt in Million of US Dollars ($)", + "Total Debt Service in Million of US Dollars ($)", + "External Debt to GDP Ratio (%)", + "Debt Service Ratio (%)" + ], + "rows": [ + [ + "1999", + "51,157", + "6,583", + "61.6", + "14.6" + ], + [ + "2000", + "51,358", + "6,268", + "63.4", + "13.0" + ], + [ + "2001", + "52,047", + "6,536", + "68.2", + "15.7" + ], + [ + "2002", + "53,802", + "7,765", + "66.1", + "17.1" + ], + [ + "2003", + "57,567", + "7,951", + "68.6", + "16.9" + ], + [ + "2004", + "55,027", + "7,220", + "60.2", + "13.8" + ], + [ + "2005", + "61,555", + "7,499", + "59.7", + "16.2" + ], + [ + "2006", + "61,372", + "7,530", + "50.2", + "13.0" + ], + [ + "2007", + "66,508", + "6,993", + "44.5", + "10.7" + ], + [ + "2008", + "65,228", + "7,042", + "37.6", + "10.5" + ], + [ + "2009", + "64,738", + "6,880", + "38.4", + "11.0" + ], + [ + "2010", + "73,594", + "7,402", + "36.9", + "9.9" + ], + [ + "2011", + "75,569", + "7,793", + "33.7", + "9.9" + ], + [ + "2012", + "79,949", + "6,604", + "32.0", + "7.3" + ], + [ + "2013", + "78,489", + "7,535", + "28.9", + "8.2" + ], + [ + "2014", + "77,674", + "6,318", + "27.3", + "6.2" + ], + [ + "2015", + "77,474", + "5,584", + "26.5", + "-" + ], + [ + "2016", + "74,763", + "7,188", + "24.5", + "-" + ], + [ + "2017", + "73,098", + "7,323", + "23.3", + "-" + ], + [ + "2018", + "76,415", + "5,884", + "23.5", + "-" + ] + ], + "title": "", + "original_id": "8b7423e214d1e60f3bb63d2a0328faf6" + }, + { + "_id": "a86edb7acbd9025ef7523bcfd63c722f", + "header": [ + "autonomous community", + "hydroelectric power", + "wind power", + "solar power", + "biomass power", + "solid waste power", + "total renewable generation", + "total electricity demand", + "% renewable of total electricity demand" + ], + "rows": [ + [ + "castile and leã cubicn", + "6960", + "3840", + "14", + "274", + "87", + "11175", + "15793", + "70.8%" + ], + [ + "galicia", + "7561", + "5970", + "1", + "242", + "317", + "14091", + "20279", + "69.5%" + ], + [ + "la rioja", + "124", + "897", + "1", + "3", + "2", + "1027", + "1860", + "55.2%" + ], + [ + "aragã cubicn", + "3073", + "3342", + "1", + "63", + "8", + "6487", + "11885", + "54.6%" + ], + [ + "navarre", + "379", + "2248", + "28", + "269", + "0", + "2924", + "5401", + "54.1%" + ], + [ + "extremadura", + "2244", + "0", + "1", + "0", + "0", + "2245", + "5076", + "44.2%" + ], + [ + "castile - la mancha", + "710", + "3935", + "8", + "99", + "34", + "4786", + "12686", + "37.7%" + ], + [ + "asturias", + "1680", + "357", + "0", + "221", + "400", + "2658", + "12391", + "21.5%" + ], + [ + "cantabria", + "875", + "0", + "0", + "11", + "41", + "927", + "5693", + "16.3%" + ], + [ + "catalonia", + "3223", + "301", + "7", + "77", + "241", + "3849", + "48498", + "7.9%" + ], + [ + "andalusia", + "946", + "1042", + "5", + "728", + "0", + "2721", + "40737", + "6.7%" + ], + [ + "basque country", + "336", + "339", + "3", + "55", + "326", + "1059", + "20934", + "5.1%" + ], + [ + "valencia", + "1041", + "266", + "13", + "55", + "0", + "1375", + "27668", + "5.0%" + ], + [ + "canary islands", + "0", + "288", + "0", + "0", + "0", + "288", + "9372", + "3.1%" + ], + [ + "balearic islands", + "0", + "5", + "0", + "0", + "133", + "138", + "6235", + "2.2%" + ], + [ + "murcia", + "65", + "93", + "6", + "12", + "0", + "176", + "8334", + "2.1%" + ], + [ + "madrid", + "83", + "0", + "8", + "58", + "330", + "479", + "30598", + "1.6%" + ], + [ + "ceuta & melilla", + "0", + "0", + "0", + "0", + "2", + "2", + "391", + "0.5%" + ] + ], + "title": "", + "original_id": "17d8fd87a89dd0f3f9d6a827bc20df42" + }, + { + "_id": "ba8527fd64c864468fd258456bec5da6", + "header": [ + "player", + "tackles", + "solo", + "assisted", + "sack", + "yards", + "td 's" + ], + "rows": [ + [ + "rex motes", + "26.0", + "24", + "4", + "0", + "0", + "0" + ], + [ + "nathan creer", + "25.5", + "24", + "3", + "0", + "0", + "0" + ], + [ + "walter holman", + "21.0", + "17", + "8", + "2", + "3", + "0" + ], + [ + "pete stubbs", + "19.5", + "18", + "3", + "3", + "0", + "0" + ], + [ + "michael witteck", + "16.0", + "14", + "4", + "2", + "0", + "0" + ], + [ + "jon roehlk", + "15.0", + "11", + "8", + "6", + "0", + "0" + ], + [ + "dwayne dixon", + "13.0", + "12", + "2", + "0", + "0", + "0" + ], + [ + "sean mcinerney", + "9.0", + "8", + "2", + "3", + "0", + "0" + ], + [ + "robert goins", + "9.0", + "9", + "0", + "0", + "0", + "0" + ], + [ + "richard dupree", + "8.5", + "6", + "5", + "0", + "0", + "0" + ], + [ + "brett wilson", + "8.0", + "7", + "2", + "0", + "0", + "0" + ], + [ + "wes walton", + "7.0", + "4", + "6", + "2", + "0", + "0" + ], + [ + "fernando mcwherter", + "5.0", + "5", + "0", + "0", + "0", + "0" + ], + [ + "mike calhoun", + "3.0", + "2", + "2", + "3", + "0", + "0" + ], + [ + "kendall walls", + "2.0", + "2", + "0", + "0", + "0", + "0" + ], + [ + "steve griffin", + "1.0", + "1", + "0", + "0", + "0", + "0" + ] + ], + "title": "", + "original_id": "73cb636df01548c38396262253f15f4f" + }, + { + "_id": "5c036b98095d07d528f24cfaa8dd6c09", + "header": [ + "name", + "team", + "laps", + "grid", + "points" + ], + "rows": [ + [ + "lee holdsworth", + "garry rogers motorsport", + "46", + "4", + "24" + ], + [ + "garth tander", + "toll hsv dealer team", + "46", + "19", + "20" + ], + [ + "russell ingall", + "stone brothers racing", + "46", + "9", + "17" + ], + [ + "jamie whincup", + "teamvodafone", + "46", + "30", + "15" + ], + [ + "steven richards", + "ford performance racing", + "46", + "6", + "13" + ], + [ + "jason richards", + "tasman motorsport", + "46", + "5", + "12" + ], + [ + "andrew jones", + "team boc", + "46", + "17", + "11" + ], + [ + "steve owen", + "autobarn racing", + "46", + "21", + "10" + ], + [ + "max wilson", + "wps racing", + "46", + "11", + "9" + ], + [ + "paul dumbrell", + "supercheap auto racing", + "46", + "25", + "8" + ], + [ + "todd kelly", + "holden racing team", + "46", + "2", + "6" + ], + [ + "steven johnson", + "jim beam racing", + "46", + "12", + "5" + ], + [ + "jason bargwanna", + "wps racing", + "45", + "27", + "4" + ], + [ + "craig lowndes", + "teamvodafone", + "45", + "1", + "3" + ], + [ + "rick kelly", + "toll hsv dealer team", + "45", + "15", + "2" + ], + [ + "will davison", + "jim beam racing", + "45", + "8", + "0" + ], + [ + "simon wills", + "team boc", + "45", + "10", + "0" + ], + [ + "jack perkins", + "jack daniel 's racing", + "45", + "26", + "0" + ], + [ + "john bowe", + "paul cruickshank racing", + "45", + "24", + "0" + ], + [ + "shane price", + "jack daniel 's racing", + "45", + "18", + "0" + ], + [ + "paul morris", + "team sirromet wines", + "45", + "29", + "0" + ], + [ + "greg murphy", + "tasman motorsport", + "45", + "31", + "0" + ], + [ + "shane van gisbergen", + "team kiwi racing", + "45", + "13", + "0" + ], + [ + "mark winterbottom", + "ford performance racing", + "43", + "3", + "0" + ], + [ + "cameron mcconville", + "supercheap auto racing", + "43", + "22", + "0" + ], + [ + "fabian coulthard", + "team sirromet wines", + "34", + "14", + "0" + ], + [ + "mark skaife", + "holden racing team", + "31", + "20", + "0" + ], + [ + "alan gurr", + "britek motorsport", + "29", + "28", + "0" + ], + [ + "dean canto", + "garry rogers motorsport", + "27", + "23", + "0" + ], + [ + "jason bright", + "britek motosport", + "22", + "16", + "0" + ], + [ + "james courtney", + "stone brothers racing", + "17", + "7", + "0" + ] + ], + "title": "", + "original_id": "40ae3a1a5040527ccb57ea9a6b89ca2d" + }, + { + "_id": "3216d4d36b3a57e206866c4207240e13", + "header": [ + "sno", + "power plant", + "state", + "total capacity (mw)", + "completion schedule" + ], + "rows": [ + [ + "1", + "kishenganga", + "jammu & kashmir", + "330", + "2016" + ], + [ + "2", + "parbati - ii", + "himachal pradesh", + "800", + "2013" + ], + [ + "3", + "subansiri (lower)", + "assam", + "2000", + "2014" + ], + [ + "4", + "teesta low dam - iv", + "west bengal", + "160", + "2011" + ], + [ + "5", + "parbati - iii", + "himachal pradesh", + "520", + "2012" + ], + [ + "6", + "nimmo - bazgo", + "jammu & kashmir", + "45", + "2011" + ], + [ + "7", + "chutak", + "jammu & kashmir", + "44", + "2011" + ], + [ + "8", + "uri - ii", + "jammu & kashmir", + "240", + "2011" + ] + ], + "title": "", + "original_id": "d4a5c36f72e87f2eeac0751416cafcb4" + }, + { + "_id": "250a5440def821ac84029722054acbde", + "header": [ + "selected caribbean and n latin america countries", + "internl tourist arrivals 2011 (x1000)", + "internl tourism receipts 2011 (million usd )", + "receipts per arrival 2010 (col 2) / (col 1) ( usd )", + "receipts per capita 2005 usd", + "revenues as % of exports goods and services 2011" + ], + "rows": [ + [ + "bahamas (1)", + "1368", + "2059", + "1505", + "6288", + "74.6" + ], + [ + "barbados", + "568", + "974", + "1715", + "2749", + "58.5" + ], + [ + "brazil", + "5433", + "6555", + "1207", + "18", + "3.2" + ], + [ + "chile", + "3070", + "1831", + "596", + "73", + "5.3" + ], + [ + "costa rica", + "2196", + "2156", + "982", + "343", + "17.5" + ], + [ + "colombia (1)", + "2385", + "2083", + "873", + "25", + "6.6" + ], + [ + "cuba", + "2688", + "n / d", + "n / d", + "169", + "n / d" + ], + [ + "dominican republic", + "4306", + "4353", + "1011", + "353", + "36.2" + ], + [ + "guatemala", + "1225", + "1350", + "1102", + "66", + "16.0" + ], + [ + "jamaica", + "1952", + "2012", + "1031", + "530", + "49.2" + ], + [ + "mexico", + "23403", + "11869", + "507", + "103", + "5.7" + ], + [ + "panama", + "1473", + "1926", + "1308", + "211", + "10.6" + ], + [ + "peru", + "2598", + "2360", + "908", + "41", + "9.0" + ] + ], + "title": "", + "original_id": "00793dacf25441e231d6efb276f73d52" + }, + { + "_id": "c87610ad2f6fe61a7b907e80c14d5a36", + "header": [ + "year", + "number of tropical storms", + "number of hurricanes", + "number of major hurricanes", + "deaths", + "strongest storm" + ], + "rows": [ + [ + "1850", + "0", + "3", + "0", + "not known", + "one" + ], + [ + "1851", + "6", + "3", + "1", + "24", + "four" + ], + [ + "1852", + "5", + "5", + "1", + "100 +", + "one" + ], + [ + "1853", + "8", + "4", + "2", + "40", + "three" + ], + [ + "1854", + "5", + "3", + "1", + "30 +", + "three" + ], + [ + "1855", + "5", + "4", + "1", + "not known", + "five" + ], + [ + "1856", + "6", + "4", + "2", + "200 +", + "one" + ], + [ + "1857", + "4", + "3", + "0", + "424", + "two & four" + ], + [ + "1858", + "6", + "6", + "0", + "none", + "three & six" + ] + ], + "title": "", + "original_id": "01ebe5f7371f583d215d73cd4266b44c" + }, + { + "_id": "2a1e327516015eafed163c8d278c642a", + "header": [ + "peak", + "metres", + "feet", + "latitude (n)", + "longitude (e)", + "prominence (m)" + ], + "rows": [ + [ + "gasherbrum i", + "8080", + "26509", + "35 degree43′27″", + "76 degree41′48″", + "2155" + ], + [ + "broad peak", + "8047", + "26400", + "35 degree48′35″", + "76 degree34′06″", + "1701" + ], + [ + "gasherbrum ii", + "8035", + "26360", + "35 degree45′27″", + "76 degree39′15″", + "1523" + ], + [ + "gasherbrum iii", + "7952", + "26089", + "35 degree45′34″", + "76 degree38′31″", + "355" + ], + [ + "gasherbrum iv", + "7925", + "26001", + "35 degree45′39″", + "76 degree37′00″", + "725" + ], + [ + "gasherbrum v", + "7147", + "23448", + "35 degree43′45″", + "76 degree36′48″", + "654" + ], + [ + "gasherbrum vi", + "6979", + "22897", + "35 degree42′30″", + "76 degree37′54″", + "520" + ] + ], + "title": "", + "original_id": "5220eb200c2770c0628f7f45f794fbc2" + }, + { + "_id": "3438e8196d0fe5d3ef4d1280e9d26c43", + "header": [ + "2nd component", + "bp 2nd comp (˚c)", + "3rd component", + "bp 3rd comp (˚c)", + "bp azeo (˚c)" + ], + "rows": [ + [ + "acetone", + "56.5", + "chloroform", + "61.2", + "57.5" + ], + [ + "acetone", + "56.5", + "methyl acetate", + "57.0", + "53.7" + ], + [ + "acetone", + "56.5", + "cyclohexane", + "81.4", + "51.5" + ], + [ + "methyl acetate", + "57.1", + "carbon disulfide", + "46.2", + "37.0" + ], + [ + "methyl acetate", + "57.1", + "cyclohexane", + "81.4", + "50.8" + ], + [ + "methyl acetate", + "57.1", + "n - hexane", + "69.0", + "45.0" + ] + ], + "title": "", + "original_id": "a47d987b05bf1b6dd1441a073679477c" + }, + { + "_id": "f1131ab164f863e12ee7c94d6bb88517", + "header": [ + "episode", + "18 - 49", + "viewers (m)", + "rating", + "share" + ], + "rows": [ + [ + "hero", + "3.2 / 8", + "12.16", + "7.2", + "11" + ], + [ + "project run away", + "2.8 / 7", + "10.69", + "6.3", + "10" + ], + [ + "dmv", + "2.6 / 6", + "10.86", + "6.6", + "10" + ], + [ + "40 days", + "2.4 / 6", + "9.91", + "6.0", + "9" + ], + [ + "burn , bougainvillea , burn", + "1.0 / 3", + "2.83", + "1.9", + "4" + ], + [ + "if the shoe fits , steal it", + "0.6 / 3", + "2.87", + "1.3", + "3" + ], + [ + "dirty stevie", + "0.6 / 3", + "2.59", + "1.8", + "4" + ], + [ + "the game of life", + "0.7 / 3", + "2.76", + "1.7", + "4" + ], + [ + "nothing for money", + "0.5 / 2", + "2.23", + "1.8", + "4" + ], + [ + "school council", + "0.7 / 3", + "2.62", + "1.7", + "4" + ], + [ + "three end tables", + "0.6 / 3", + "2.42", + "tba", + "tba" + ], + [ + "desperate housewife", + "0.6 / 3", + "2.6", + "1.6", + "4" + ], + [ + "no reception", + "0.7 / 3", + "2.73", + "1.8", + "4" + ] + ], + "title": "", + "original_id": "2a81093974f2cc5cb278ad23d0b23d74" + }, + { + "_id": "e119c4fc5eba785ee69da8bab16d4a00", + "header": [ + "county", + "per capita income", + "median household income", + "median family income", + "population", + "number of households" + ], + "rows": [ + [ + "los alamos", + "49474", + "103643", + "118993", + "17950", + "7663" + ], + [ + "santa fe", + "32188", + "52696", + "64041", + "144170", + "61963" + ], + [ + "united states", + "27334", + "51914", + "62982", + "308745538", + "116716292" + ], + [ + "bernalillo", + "26143", + "47481", + "59809", + "662564", + "266000" + ], + [ + "sandoval", + "25979", + "57158", + "65906", + "131561", + "47602" + ], + [ + "eddy", + "24587", + "46583", + "56646", + "53829", + "20411" + ], + [ + "lincoln", + "24290", + "43750", + "53871", + "20497", + "9219" + ], + [ + "new mexico", + "22966", + "43820", + "52565", + "2059179", + "791395" + ], + [ + "taos", + "22145", + "35441", + "43236", + "32937", + "14806" + ], + [ + "mora", + "22035", + "37784", + "42122", + "4881", + "2114" + ], + [ + "grant", + "21164", + "36591", + "44360", + "29514", + "12586" + ], + [ + "colfax", + "21047", + "39216", + "48450", + "13750", + "6011" + ], + [ + "catron", + "20895", + "31914", + "40906", + "3725", + "1787" + ], + [ + "de baca", + "20769", + "30643", + "36618", + "2022", + "912" + ], + [ + "san juan", + "20725", + "46189", + "53540", + "130044", + "44404" + ], + [ + "valencia", + "19955", + "42044", + "48767", + "76569", + "27500" + ], + [ + "curry", + "19925", + "38090", + "48933", + "48376", + "18015" + ], + [ + "rio arriba", + "19913", + "41437", + "47840", + "40246", + "15768" + ], + [ + "lea", + "19637", + "43910", + "48980", + "64727", + "22236" + ], + [ + "otero", + "19255", + "39615", + "46210", + "63797", + "24464" + ], + [ + "union", + "19228", + "39975", + "41687", + "4549", + "1695" + ], + [ + "san miguel", + "18508", + "32213", + "42888", + "29393", + "11978" + ], + [ + "chaves", + "18504", + "37524", + "43464", + "65645", + "23691" + ], + [ + "doã±a ana", + "18315", + "36657", + "43184", + "209233", + "75532" + ], + [ + "quay", + "18234", + "28773", + "41766", + "9041", + "4072" + ], + [ + "socorro", + "17801", + "33284", + "41964", + "17866", + "7014" + ], + [ + "hidalgo", + "17451", + "36733", + "41594", + "4894", + "1936" + ], + [ + "torrance", + "17278", + "37117", + "43914", + "16383", + "6264" + ], + [ + "roosevelt", + "16933", + "37762", + "43536", + "19846", + "7299" + ], + [ + "sierra", + "16667", + "25583", + "38641", + "11988", + "5917" + ], + [ + "luna", + "15687", + "27997", + "33312", + "25095", + "9593" + ], + [ + "cibola", + "14712", + "37361", + "41187", + "27213", + "8860" + ], + [ + "harding", + "14684", + "33750", + "56563", + "695", + "349" + ], + [ + "guadalupe", + "13710", + "28488", + "37535", + "4687", + "1766" + ], + [ + "mckinley", + "12932", + "31335", + "37345", + "71492", + "21968" + ] + ], + "title": "", + "original_id": "91d8eb2652379f81c62a5eaa91ef1545" + }, + { + "_id": "5603c47b6c23347727dfb95297a5738e", + "header": [ + "Temperature T (°C)", + "Speed of sound c (m/s)", + "Density of air ρ (kg/m3)", + "Characteristic specific acoustic impedance z0 (Pa·s/m)" + ], + "rows": [ + [ + "35", + "351.88", + "1.1455", + "403.2" + ], + [ + "30", + "349.02", + "1.1644", + "406.5" + ], + [ + "25", + "346.13", + "1.1839", + "409.4" + ], + [ + "20", + "343.21", + "1.2041", + "413.3" + ], + [ + "15", + "340.27", + "1.2250", + "416.9" + ], + [ + "10", + "337.31", + "1.2466", + "420.5" + ], + [ + "5", + "334.32", + "1.2690", + "424.3" + ], + [ + "0", + "331.30", + "1.2922", + "428.0" + ], + [ + "−5", + "328.25", + "1.3163", + "432.1" + ], + [ + "−10", + "325.18", + "1.3413", + "436.1" + ], + [ + "−15", + "322.07", + "1.3673", + "440.3" + ], + [ + "−20", + "318.94", + "1.3943", + "444.6" + ], + [ + "−25", + "315.77", + "1.4224", + "449.1" + ] + ], + "title": "", + "original_id": "766afe58ffd3cac9bbdec711f8b9b2ef" + }, + { + "_id": "ad30fbe40e238f185d9673362de9a4fe", + "header": [ + "aircraft", + "1990", + "destroyed", + "damaged", + "to iran", + "survived" + ], + "rows": [ + [ + "france mirage f1 eq", + "76", + "23", + "6", + "24", + "23" + ], + [ + "france mirage f1 k (kuwaiti)", + "8", + "2", + "2", + "0", + "4" + ], + [ + "ussr mig - 23bn", + "38", + "17", + "0", + "4", + "18" + ], + [ + "ussr su - 20", + "18", + "4", + "2", + "4", + "8" + ], + [ + "ussr su - 22 r", + "10", + "1", + "0", + "0", + "9" + ], + [ + "ussr su - 22 m2", + "24", + "2", + "6", + "5", + "11" + ], + [ + "ussr su - 22 m3", + "16", + "7", + "0", + "9", + "0" + ], + [ + "ussr su - 22 m4", + "28", + "7", + "0", + "15", + "6" + ], + [ + "ussr su - 24 mk", + "30", + "5", + "0", + "24", + "1" + ], + [ + "ussr su - 25", + "66", + "31", + "8", + "7", + "20" + ], + [ + "ussr mig - 21 / china f7", + "236", + "65", + "46", + "0", + "115" + ], + [ + "ussr mig - 23 ml", + "39", + "14", + "1", + "7", + "17" + ], + [ + "ussr mig - 23 mf", + "14", + "2", + "5", + "0", + "7" + ], + [ + "ussr mig - 23 ms", + "15", + "2", + "4", + "0", + "9" + ], + [ + "ussr mig - 25 rb", + "9", + "3", + "3", + "0", + "3" + ], + [ + "ussr mig - 25 pds", + "19", + "13", + "1", + "0", + "5" + ], + [ + "ussr mig - 29", + "37", + "17", + "4", + "4", + "12" + ], + [ + "ussr mig - 23 um", + "21", + "8", + "0", + "1", + "12" + ], + [ + "ussr tu - 16", + "3", + "3", + "0", + "0", + "0" + ], + [ + "china xian h - 6", + "4", + "4", + "0", + "0", + "0" + ], + [ + "ussr an - 26", + "5", + "0", + "3", + "0", + "2" + ], + [ + "ussr il - 76", + "19", + "3", + "1", + "15", + "0" + ], + [ + "france dassault falcon 20", + "2", + "0", + "0", + "2", + "0" + ], + [ + "france dassault falcon 50", + "3", + "0", + "0", + "3", + "0" + ], + [ + "usa lockheed jetstar", + "6", + "4", + "0", + "1", + "1" + ], + [ + "ussr mig - 25 u", + "7", + "3", + "2", + "0", + "2" + ], + [ + "ussr su - 22 - um3", + "25", + "3", + "1", + "0", + "21" + ], + [ + "czechoslovakia l - 39", + "67", + "0", + "1", + "0", + "66" + ], + [ + "brazil tucano", + "78", + "1", + "6", + "0", + "64" + ], + [ + "switzerland ffa as - 202 bravo", + "34", + "5", + "5", + "0", + "17" + ], + [ + "eloris trainer", + "12", + "0", + "0", + "0", + "12" + ], + [ + "united kingdom jet provost", + "15", + "0", + "0", + "0", + "15" + ], + [ + "bk - 117", + "14", + "1", + "6", + "0", + "6" + ], + [ + "france mirage f1 bq", + "10", + "0", + "0", + "0", + "10" + ], + [ + "ussr mig - 29ub", + "4", + "0", + "0", + "0", + "4" + ] + ], + "title": "", + "original_id": "197880d573a4d526da262e794d318af6" + }, + { + "_id": "9b1bb7c6c63c66d78d5484566d05d083", + "header": [ + "frequency (hz)", + "r (î / km)", + "l (mh / km)", + "g (î¼s / km)", + "c (nf / km)" + ], + "rows": [ + [ + "1", + "172.24", + "0.6129", + "0.0", + "51.57" + ], + [ + "1k", + "172.28", + "0.6125", + "0.072", + "51.57" + ], + [ + "10k", + "172.7", + "0.6099", + "0.531", + "51.57" + ], + [ + "100k", + "191.63", + "0.5807", + "3.327", + "51.57" + ], + [ + "1 m", + "463.59", + "0.5062", + "29.111", + "51.57" + ], + [ + "2 m", + "643.14", + "0.4862", + "53.205", + "51.57" + ] + ], + "title": "", + "original_id": "fc48b080b4db6a50c2dc1b6b0cfa678c" + }, + { + "_id": "39c67458a69012e466d092d08577fa46", + "header": [ + "rank", + "peak", + "country", + "island", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "1", + "finisterre range high point", + "papua new guinea", + "new guinea", + "4175", + "3734", + "441" + ], + [ + "2", + "mount suckling", + "papua new guinea", + "new guinea", + "3676", + "2976", + "700" + ], + [ + "3", + "mount wilhelm", + "papua new guinea", + "new guinea", + "4509", + "2969", + "1540" + ], + [ + "4", + "mount victoria", + "papua new guinea", + "new guinea", + "4038", + "2738", + "1300" + ], + [ + "5", + "mount balbi", + "papua new guinea", + "bougainville island", + "2715", + "2715", + "0" + ], + [ + "6", + "mount oiautukekea", + "papua new guinea", + "goodenough island", + "2536", + "2536", + "0" + ], + [ + "7", + "mount giluwe", + "papua new guinea", + "new guinea", + "4367", + "2507", + "1860" + ], + [ + "8", + "new ireland high point", + "papua new guinea", + "new ireland", + "2340", + "2340", + "0" + ], + [ + "9", + "mount ulawun", + "papua new guinea", + "new britain", + "2334", + "2334", + "0" + ], + [ + "10", + "mount kabangama", + "papua new guinea", + "new guinea", + "4104", + "2284", + "1820" + ], + [ + "11", + "nakanai mountains high point", + "papua new guinea", + "new britain", + "2316", + "2056", + "260" + ], + [ + "12", + "mount kilkerran", + "papua new guinea", + "fergusson island", + "1947", + "1947", + "0" + ], + [ + "13", + "mount piora", + "papua new guinea", + "new guinea", + "3557", + "1897", + "1660" + ], + [ + "14", + "mount bosavi", + "papua new guinea", + "new guinea", + "2507", + "1887", + "620" + ], + [ + "15", + "mount karoma", + "papua new guinea", + "new guinea", + "3623", + "1883", + "1740" + ], + [ + "16", + "mount simpson", + "papua new guinea", + "new guinea", + "2883", + "1863", + "1020" + ], + [ + "17", + "mount kunugui", + "papua new guinea", + "karkar island", + "1833", + "1833", + "0" + ], + [ + "18", + "mount victory", + "papua new guinea", + "new guinea", + "1891", + "1831", + "60" + ], + [ + "19", + "manam high point", + "papua new guinea", + "manam", + "1807", + "1807", + "0" + ], + [ + "20", + "mount michael", + "papua new guinea", + "new guinea", + "3647", + "1787", + "1860" + ], + [ + "21", + "mount talawe", + "papua new guinea", + "new britain", + "1824", + "1773", + "51" + ], + [ + "22", + "barurumea ridge", + "papua new guinea", + "new britain", + "2063", + "1723", + "340" + ], + [ + "23", + "mount sarawaget", + "papua new guinea", + "new guinea", + "4121", + "1701", + "2420" + ], + [ + "24", + "bewani mountains high point", + "papua new guinea", + "new guinea", + "1980", + "1664", + "316" + ], + [ + "25", + "mount bel", + "papua new guinea", + "umboi island", + "1658", + "1658", + "0" + ], + [ + "26", + "unnamed summit", + "papua new guinea", + "new britain", + "1951", + "1651", + "300" + ], + [ + "27", + "mount maybole", + "papua new guinea", + "fergusson island", + "1665", + "1597", + "68" + ], + [ + "28", + "adelbert range high point", + "papua new guinea", + "new guinea", + "1716", + "1576", + "140" + ], + [ + "29", + "sibium mountains high point", + "papua new guinea", + "new guinea", + "2295", + "1555", + "740" + ], + [ + "30", + "mount shungol", + "papua new guinea", + "new guinea", + "2752", + "1518", + "1234" + ] + ], + "title": "", + "original_id": "15bffb7b518116bf353c08583e80a77a" + }, + { + "_id": "0fee7d42f3c898d7442b2bd047fbf6d3", + "header": [ + "metropolitan ring", + "localities", + "total", + "jews and others 1", + "thereof : jews", + "arabs", + "population density (per km square)", + "annual population growth rate" + ], + "rows": [ + [ + "core 2", + "1", + "187200", + "184100", + "164600", + "3100", + "2220.6", + "0.6%" + ], + [ + "inner ring 3", + "32", + "151000", + "55900", + "53900", + "95100", + "145.2", + "3.9%" + ], + [ + "northern section", + "11", + "69100", + "9200", + "9000", + "59900", + "195.3", + "3.8%" + ], + [ + "western section", + "13", + "32400", + "32300", + "30600", + "100", + "65.2", + "1.0%" + ], + [ + "middle ring 4", + "83", + "210700", + "140400", + "128500", + "70300", + "61.7", + "1.6%" + ], + [ + "eastern section", + "8", + "126100", + "57900", + "50100", + "68200", + "149.6", + "1.6%" + ], + [ + "southern section", + "10", + "13000", + "11100", + "9700", + "1900", + "9.5", + "0.9%" + ], + [ + "western section", + "65", + "71600", + "71400", + "68600", + "200", + "59.3", + "1.7%" + ], + [ + "outer ring 5", + "13", + "10800", + "9500", + "9000", + "1300", + "2.5", + "1.8%" + ], + [ + "eastern section", + "5", + "2300", + "1100", + "1100", + "1100", + "1.5", + "- 1.7%" + ], + [ + "southern section", + "8", + "8500", + "8400", + "8000", + "100", + "3.0", + "2.7%" + ] + ], + "title": "", + "original_id": "72886da909eefe9863c211e4747e3e07" + }, + { + "_id": "4d1e553b8fe64221af6a1fa9d2b00513", + "header": [ + "interval name", + "size (steps)", + "size (cents)", + "just ratio", + "just (cents)", + "error", + "audio" + ], + "rows": [ + [ + "perfect fifth", + "9", + "720", + "3:2", + "701.96", + "+ 18.04", + "play category : articles with haudio microformats" + ], + [ + "septimal tritone", + "7", + "560", + "7:5", + "582.51", + "22.51", + "play category : articles with haudio microformats" + ], + [ + "11:8 wide fourth", + "7", + "560", + "11:8", + "551.32", + "+ 8.68", + "play category : articles with haudio microformats" + ], + [ + "15:11 wide fourth", + "7", + "560", + "15:11", + "536.95", + "+ 23.05", + "play category : articles with haudio microformats" + ], + [ + "perfect fourth", + "6", + "480", + "4:3", + "498.04", + "18.04", + "play category : articles with haudio microformats" + ], + [ + "septimal major third", + "5", + "400", + "9:7", + "435.08", + "35.08", + "play category : articles with haudio microformats" + ], + [ + "undecimal major third", + "5", + "400", + "14:11", + "417.51", + "17.51", + "play category : articles with haudio microformats" + ], + [ + "major third", + "5", + "400", + "5:4", + "386.31", + "+ 13.69", + "play category : articles with haudio microformats" + ], + [ + "minor third", + "4", + "320", + "6:5", + "315.64", + "+ 4.36", + "play category : articles with haudio microformats" + ], + [ + "septimal minor third", + "3", + "240", + "7:6", + "266.87", + "26.87", + "play category : articles with haudio microformats" + ], + [ + "septimal whole tone", + "3", + "240", + "8:7", + "231.17", + "+ 8.83", + "play category : articles with haudio microformats" + ], + [ + "major tone", + "3", + "240", + "9:8", + "203.91", + "+ 36.09", + "play category : articles with haudio microformats" + ], + [ + "minor tone", + "2", + "160", + "10:9", + "182.4", + "22.40", + "play category : articles with haudio microformats" + ], + [ + "greater undecimal neutral second", + "2", + "160", + "11:10", + "165.0", + "5.00", + "play category : articles with haudio microformats" + ], + [ + "lesser undecimal neutral second", + "2", + "160", + "12:11", + "150.63", + "+ 9.36", + "play category : articles with haudio microformats" + ], + [ + "just diatonic semitone", + "1", + "80", + "16:15", + "111.73", + "31.73", + "play category : articles with haudio microformats" + ], + [ + "septimal chromatic semitone", + "1", + "80", + "21:20", + "84.46", + "4.47", + "play category : articles with haudio microformats" + ] + ], + "title": "", + "original_id": "1b234165005ad86450164ddaec89aee3" + }, + { + "_id": "72daff4fd44678397ade4768122a070f", + "header": [ + "season", + "episodes", + "timeslot (et)", + "season premiere", + "season finale", + "tv season", + "rank", + "viewers (in millions)" + ], + "rows": [ + [ + "1", + "10", + "saturday 8:00 pm", + "february 21 , 2004", + "august 14 , 2004", + "2003 - 2004", + "123", + "6.21" + ], + [ + "2", + "17", + "saturday 8:00 pm", + "september 25 , 2004", + "august 27 , 2005", + "2004 - 2005", + "107", + "6.41" + ], + [ + "3", + "25", + "saturday 8:00 pm", + "september 17 , 2005", + "august 12 , 2006", + "2005 - 2006", + "126", + "5.74" + ], + [ + "4", + "25", + "saturday 8:00 pm", + "october 21 , 2006", + "august 25 , 2007", + "2006 - 2007", + "180", + "5.12" + ], + [ + "5", + "23", + "saturday 8:00 pm", + "december 8 , 2007", + "august 23 , 2008", + "2007 - 2008", + "160", + "4.69" + ], + [ + "6", + "21", + "saturday 8:00 pm", + "december 13 , 2008", + "august 29 , 2009", + "2008 - 2009", + "149", + "3.8" + ], + [ + "7", + "18", + "saturday 8:00 pm", + "december 12 , 2009", + "august 28 , 2010", + "2009 - 2010", + "119", + "3.55" + ], + [ + "8", + "22", + "saturday 8:00 pm", + "december 11 , 2010", + "august 20 , 2011", + "2010 - 2011", + "170", + "3.53" + ], + [ + "9", + "14", + "saturday 8:00 pm", + "december 24 , 2011", + "august 18 , 2012", + "2011 - 2012", + "156", + "3.46" + ] + ], + "title": "", + "original_id": "46be461d6cbfbb137a063587f8aaeef6" + }, + { + "_id": "e2099829a9308a753ff4145f2c01f7e5", + "header": [ + "year of marriage", + "name", + "her age", + "his age", + "of children" + ], + "rows": [ + [ + "1835", + "louisa maria tanner", + "17", + "22", + "8" + ], + [ + "1843", + "diontha walker", + "27", + "30", + "0" + ], + [ + "1844", + "caroline partridge", + "17", + "31", + "6" + ], + [ + "1846", + "eliza maria partridge", + "23", + "33", + "5" + ], + [ + "1846", + "paulina eliza phelps", + "19", + "33", + "7" + ], + [ + "1846", + "priscilla turley", + "17", + "33", + "6" + ], + [ + "1846", + "cornelia leavitt", + "21", + "33", + "2" + ], + [ + "1853", + "lydia partridge", + "23", + "40", + "4" + ] + ], + "title": "", + "original_id": "e617dfb780c7add548b0874e476724e6" + }, + { + "_id": "ac2e4f0e452392491a4e08914876f827", + "header": [ + "STAPLE:", + "Maize / Corn", + "Rice", + "Wheat", + "Potato", + "Cassava", + "Soybean (Green)", + "Sweet potato", + "Sorghum", + "Yam", + "Plantain" + ], + "rows": [ + [ + "Component (per 100g portion)", + "Amount", + "Amount", + "Amount", + "Amount", + "Amount", + "Amount", + "Amount", + "Amount", + "Amount", + "Amount" + ], + [ + "Water (g)", + "10", + "12", + "13", + "79", + "60", + "68", + "77", + "9", + "70", + "65" + ], + [ + "Energy (kJ)", + "1528", + "1528", + "1369", + "322", + "670", + "615", + "360", + "1419", + "494", + "511" + ], + [ + "Protein (g)", + "9.4", + "7.1", + "12.6", + "2.0", + "1.4", + "13.0", + "1.6", + "11.3", + "1.5", + "1.3" + ], + [ + "Fat (g)", + "4.74", + "0.66", + "1.54", + "0.09", + "0.28", + "6.8", + "0.05", + "3.3", + "0.17", + "0.37" + ], + [ + "Carbohydrates (g)", + "74", + "80", + "71", + "17", + "38", + "11", + "20", + "75", + "28", + "32" + ], + [ + "Fiber (g)", + "7.3", + "1.3", + "12.2", + "2.2", + "1.8", + "4.2", + "3", + "6.3", + "4.1", + "2.3" + ], + [ + "Sugar (g)", + "0.64", + "0.12", + "0.41", + "0.78", + "1.7", + "0", + "4.18", + "0", + "0.5", + "15" + ], + [ + "Calcium (mg)", + "7", + "28", + "29", + "12", + "16", + "197", + "30", + "28", + "17", + "3" + ], + [ + "Iron (mg)", + "2.71", + "0.8", + "3.19", + "0.78", + "0.27", + "3.55", + "0.61", + "4.4", + "0.54", + "0.6" + ], + [ + "Magnesium (mg)", + "127", + "25", + "126", + "23", + "21", + "65", + "25", + "0", + "21", + "37" + ], + [ + "Phosphorus (mg)", + "210", + "115", + "288", + "57", + "27", + "194", + "47", + "287", + "55", + "34" + ], + [ + "Potassium (mg)", + "287", + "115", + "363", + "421", + "271", + "620", + "337", + "350", + "816", + "499" + ], + [ + "Sodium (mg)", + "35", + "5", + "2", + "6", + "14", + "15", + "55", + "6", + "9", + "4" + ], + [ + "Zinc (mg)", + "2.21", + "1.09", + "2.65", + "0.29", + "0.34", + "0.99", + "0.3", + "0", + "0.24", + "0.14" + ], + [ + "Copper (mg)", + "0.31", + "0.22", + "0.43", + "0.11", + "0.10", + "0.13", + "0.15", + "-", + "0.18", + "0.08" + ], + [ + "Manganese (mg)", + "0.49", + "1.09", + "3.99", + "0.15", + "0.38", + "0.55", + "0.26", + "-", + "0.40", + "-" + ], + [ + "Selenium (μg)", + "15.5", + "15.1", + "70.7", + "0.3", + "0.7", + "1.5", + "0.6", + "0", + "0.7", + "1.5" + ], + [ + "Vitamin C (mg)", + "0", + "0", + "0", + "19.7", + "20.6", + "29", + "2.4", + "0", + "17.1", + "18.4" + ], + [ + "Thiamin (mg)", + "0.39", + "0.07", + "0.30", + "0.08", + "0.09", + "0.44", + "0.08", + "0.24", + "0.11", + "0.05" + ], + [ + "Riboflavin (mg)", + "0.20", + "0.05", + "0.12", + "0.03", + "0.05", + "0.18", + "0.06", + "0.14", + "0.03", + "0.05" + ], + [ + "Niacin (mg)", + "3.63", + "1.6", + "5.46", + "1.05", + "0.85", + "1.65", + "0.56", + "2.93", + "0.55", + "0.69" + ], + [ + "Pantothenic acid (mg)", + "0.42", + "1.01", + "0.95", + "0.30", + "0.11", + "0.15", + "0.80", + "-", + "0.31", + "0.26" + ], + [ + "Vitamin B6 (mg)", + "0.62", + "0.16", + "0.3", + "0.30", + "0.09", + "0.07", + "0.21", + "-", + "0.29", + "0.30" + ], + [ + "Folate Total (μg)", + "19", + "8", + "38", + "16", + "27", + "165", + "11", + "0", + "23", + "22" + ], + [ + "Vitamin A (IU)", + "214", + "0", + "9", + "2", + "13", + "180", + "14187", + "0", + "138", + "1127" + ], + [ + "Vitamin E, alpha-tocopherol (mg)", + "0.49", + "0.11", + "1.01", + "0.01", + "0.19", + "0", + "0.26", + "0", + "0.39", + "0.14" + ], + [ + "Vitamin K1 (μg)", + "0.3", + "0.1", + "1.9", + "1.9", + "1.9", + "0", + "1.8", + "0", + "2.6", + "0.7" + ], + [ + "Beta-carotene (μg)", + "97", + "0", + "5", + "1", + "8", + "0", + "8509", + "0", + "83", + "457" + ], + [ + "Lutein+zeaxanthin (μg)", + "1355", + "0", + "220", + "8", + "0", + "0", + "0", + "0", + "0", + "30" + ], + [ + "Saturated fatty acids (g)", + "0.67", + "0.18", + "0.26", + "0.03", + "0.07", + "0.79", + "0.02", + "0.46", + "0.04", + "0.14" + ], + [ + "Monounsaturated fatty acids (g)", + "1.25", + "0.21", + "0.2", + "0.00", + "0.08", + "1.28", + "0.00", + "0.99", + "0.01", + "0.03" + ], + [ + "Polyunsaturated fatty acids (g)", + "2.16", + "0.18", + "0.63", + "0.04", + "0.05", + "3.20", + "0.01", + "1.37", + "0.08", + "0.07" + ] + ], + "title": "", + "original_id": "f613a13c80d7b38191513c4bbbb12399" + }, + { + "_id": "4aa86768302fc49154d12e1675ce4a86", + "header": [ + "Rank", + "Date", + "Level at Trent Bridge\nm", + "Level at Trent Bridge\nft", + "Peak Flow\nm3/s", + "Peak Flow\ncfs" + ], + "rows": [ + [ + "1.0", + "February 1795", + "24.55", + "80.5", + "1,416", + "50,000" + ], + [ + "2.0", + "October 1875", + "24.38", + "80.0", + "1,274", + "45,000" + ], + [ + "3.0", + "March 1947", + "24.3", + "79.7", + "1,107", + "39,100" + ], + [ + "4.0", + "November 1852", + "24.26", + "79.6", + "1,082", + "38,200" + ], + [ + "5.0", + "November 2000", + "23.8", + "78.1", + "1,019", + "36,000" + ], + [ + null, + "Normal / Avg flow", + "20.7", + "68.0", + "84", + "3,000" + ] + ], + "title": "", + "original_id": "05d552ca0b57ae7642215bd020e5a998" + }, + { + "_id": "21803e35e4d5238a003dba6a2e432b1b", + "header": [ + "date", + "total usaaf", + "tot officers", + "tot enlisted", + "overseas", + "officers o / s", + "enlisted o / s" + ], + "rows": [ + [ + "31 july 1939", + "24724", + "2636", + "22088", + "3991", + "272", + "3719" + ], + [ + "31 december 1939", + "43118", + "3006", + "40112", + "7007", + "351", + "6656" + ], + [ + "31 december 1940", + "101227", + "6437", + "94790", + "16070", + "612", + "15458" + ], + [ + "31 december 1941", + "354161", + "24521", + "329640", + "25884", + "2479", + "23405" + ], + [ + "31 december 1942", + "1597049", + "127267", + "1469782", + "242021", + "26792", + "215229" + ], + [ + "31 december 1943", + "2373882", + "274347", + "2099535", + "735666", + "81072", + "654594" + ], + [ + "31 march 1944 (peak size)", + "2411294", + "306889", + "2104405", + "906335", + "104864", + "801471" + ], + [ + "31 december 1944", + "2359456", + "375973", + "1983483", + "1164136", + "153545", + "1010591" + ], + [ + "30 april 1945 (peak overseas)", + "2329534", + "388278", + "1941256", + "1224006", + "163886", + "1060120" + ] + ], + "title": "", + "original_id": "f59574b7c105caabd689074d79b03f51" + }, + { + "_id": "77293ee7b061d3c25fd426cfdae0493b", + "header": [ + "school year", + "95 - 96", + "99 - 00", + "00 - 01", + "01 - 02", + "02 - 03", + "03 - 04", + "04 - 05", + "05 - 06", + "06 - 07" + ], + "rows": [ + [ + "school year", + "95 - 96", + "99 - 00", + "00 - 01", + "01 - 02", + "02 - 03", + "03 - 04", + "04 - 05", + "05 - 06", + "06 - 07" + ], + [ + "latvian", + "203607", + "239163", + "242475", + "242183", + "237425", + "230212", + "214855", + "205189", + "194230" + ], + [ + "russian", + "132540", + "120925", + "116009", + "108454", + "101486", + "95841", + "84559", + "77471", + "70683" + ], + [ + "others", + "1513", + "1344", + "1344", + "1352", + "1397", + "1305", + "1253", + "1287", + "1198" + ], + [ + "total", + "337660", + "361432", + "359818", + "351989", + "340308", + "327358", + "300667", + "283947", + "266111" + ], + [ + "% learning in latvian", + "60.3", + "66.2", + "67.4", + "68.8", + "69.8", + "70.3", + "71.5", + "72.3", + "73.0" + ] + ], + "title": "", + "original_id": "cb3925b6aac9fe33756c8d068e84fe1c" + }, + { + "_id": "44ee2ac030046b877aa73d3ffc3c73a4", + "header": [ + "county", + "starky", + "starky %", + "hancock", + "hancock %", + "mccain", + "mccain %", + "total" + ], + "rows": [ + [ + "apache", + "9588", + "40.95%", + "905", + "3.86%", + "12923", + "55.19%", + "23416" + ], + [ + "cochise", + "9555", + "21.80%", + "1394", + "3.18%", + "32879", + "75.02%", + "43828" + ], + [ + "coconino", + "13520", + "26.58%", + "1504", + "2.96%", + "35849", + "70.47%", + "50873" + ], + [ + "gila", + "4291", + "20.96%", + "632", + "3.09%", + "15551", + "75.95%", + "20474" + ], + [ + "graham", + "2000", + "19.06%", + "322", + "3.07%", + "8171", + "77.87%", + "10493" + ], + [ + "greenlee", + "746", + "25.03%", + "68", + "2.28%", + "2166", + "72.68%", + "2980" + ], + [ + "la paz", + "965", + "19.51%", + "156", + "3.15%", + "3826", + "77.34%", + "4947" + ], + [ + "maricopa", + "216124", + "18.58%", + "29769", + "2.56%", + "917527", + "78.86%", + "1163420" + ], + [ + "mohave", + "10423", + "18.44%", + "1686", + "2.98%", + "44402", + "78.57%", + "56511" + ], + [ + "navajo", + "7434", + "23.42%", + "1222", + "3.85%", + "23091", + "72.73%", + "31747" + ], + [ + "pima", + "89483", + "25.17%", + "7980", + "2.24%", + "258010", + "72.58%", + "355473" + ], + [ + "pinal", + "13595", + "21.45%", + "1692", + "2.67%", + "48094", + "75.88%", + "63381" + ], + [ + "santa cruz", + "3583", + "31.60%", + "252", + "2.22%", + "7502", + "66.17%", + "11337" + ], + [ + "yavapai", + "14852", + "17.41%", + "3160", + "3.70%", + "67312", + "78.89%", + "85324" + ], + [ + "yuma", + "8348", + "22.28%", + "1056", + "2.82%", + "28069", + "74.90%", + "37473" + ] + ], + "title": "", + "original_id": "e50db28add493534433a98cb3ccfcdbf" + }, + { + "_id": "e73d5c7b83844c3d752ef1aed7174d89", + "header": [ + "chambering", + "p1 diameter (mm)", + "a external (cm 2 )", + "p max ( bar )", + "f bolt ( kgf )", + "f bolt" + ], + "rows": [ + [ + "5.45x39 mm", + "10.0", + "0.7854", + "3800", + "2985", + "n ( lbf )" + ], + [ + ".223 remington", + "9.58", + "0.7208", + "4300", + "3099", + "n (lbf)" + ], + [ + "7.62x39 mm", + "11.35", + "1.0118", + "3550", + "3592", + "n (lbf)" + ], + [ + ".308 winchester", + "11.96", + "1.1234", + "4150", + "4662", + "n (lbf)" + ], + [ + ".300 winchester magnum", + "13.03", + "1.3335", + "4300", + "5734", + "n (lbf)" + ], + [ + ".300 wsm", + "14.12", + "1.5659", + "4450", + "6968", + "n (lbf)" + ], + [ + ".300 remington ultra magnum", + "13.97", + "1.5328", + "4480", + "6876", + "n (lbf)" + ], + [ + ".338 lapua magnum", + "14.91", + "1.746", + "4200", + "7333", + "n (lbf)" + ], + [ + ".300 lapua magnum", + "14.91", + "1.746", + "4700", + "8339", + "n (lbf)" + ], + [ + ".50 bmg", + "20.42", + "3.2749", + "3700", + "12117", + "n (lbf)" + ] + ], + "title": "", + "original_id": "3b35d95ee257a5d59d6b3eb9d15c73ae" + }, + { + "_id": "98ea8a624030bcbe12bc6aac7aab597d", + "header": [ + "pilot", + "organization", + "total flights", + "usaf space flights", + "fai space flights", + "max mach", + "max speed (mph)", + "max altitude (miles)" + ], + "rows": [ + [ + "michael j adams", + "us air force", + "7", + "1", + "0", + "5.59", + "3822", + "50.3" + ], + [ + "neil armstrong", + "nasa", + "7", + "0", + "0", + "5.74", + "3989", + "39.2" + ], + [ + "scott crossfield", + "north american aviation", + "14", + "0", + "0", + "2.97", + "1959", + "15.3" + ], + [ + "william h dana", + "nasa", + "16", + "2", + "0", + "5.53", + "3897", + "58.1" + ], + [ + "joseph h engle", + "us air force", + "16", + "3", + "0", + "5.71", + "3887", + "53.1" + ], + [ + "william j pete knight", + "us air force", + "16", + "1", + "0", + "6.7", + "4519", + "53.1" + ], + [ + "john b mckay", + "nasa", + "29", + "1", + "0", + "5.65", + "3863", + "55.9" + ], + [ + "forrest s petersen", + "us navy", + "5", + "0", + "0", + "5.3", + "3600", + "19.2" + ], + [ + "robert a rushworth", + "us air force", + "34", + "1", + "0", + "6.06", + "4017", + "53.9" + ], + [ + "milton o thompson", + "nasa", + "14", + "0", + "0", + "5.48", + "3723", + "40.5" + ], + [ + "joseph a walker", + "nasa", + "25", + "3", + "2", + "5.92", + "4104", + "67.0" + ] + ], + "title": "", + "original_id": "909198221c6530a86885112b88cf997d" + }, + { + "_id": "994ac1d127c56f09c033f7630167dab1", + "header": [ + "period", + "live births per year", + "deaths per year", + "natural change per year", + "cbr", + "cdr", + "nc", + "tfr", + "imr", + "life expectancy total", + "life expectancy males", + "life expectancy females" + ], + "rows": [ + [ + "1950 - 1955", + "2 572 000", + "900 000", + "1 672 000", + "44.1", + "15.5", + "28.6", + "6.15", + "135", + "50.9", + "49.2", + "52.6" + ], + [ + "1955 - 1960", + "2 918 000", + "947 000", + "1 971 000", + "43.2", + "14.0", + "29.1", + "6.15", + "122", + "53.3", + "51.5", + "55.2" + ], + [ + "1960 - 1965", + "3 303 000", + "986 000", + "2 317 000", + "42.2", + "12.6", + "29.6", + "6.15", + "109", + "55.7", + "53.8", + "57.6" + ], + [ + "1965 - 1970", + "3 330 000", + "998 000", + "2 332 000", + "37.0", + "11.1", + "25.9", + "5.38", + "100", + "57.6", + "55.7", + "59.6" + ], + [ + "1970 - 1975", + "3 441 000", + "1 014 000", + "2 427 000", + "33.7", + "9.9", + "23.8", + "4.72", + "91", + "59.5", + "57.3", + "61.8" + ], + [ + "1975 - 1980", + "3 741 000", + "1 043 000", + "2 698 000", + "32.5", + "9.0", + "23.5", + "4.31", + "79", + "61.5", + "59.2", + "63.9" + ], + [ + "1980 - 1985", + "3 974 000", + "1 064 000", + "2 910 000", + "30.8", + "8.2", + "22.6", + "3.8", + "63", + "63.4", + "60.4", + "66.8" + ], + [ + "1985 - 1990", + "3 757 000", + "1 055 000", + "2 702 000", + "26.3", + "7.4", + "18.9", + "3.1", + "52", + "65.3", + "61.9", + "69.1" + ], + [ + "1990 - 1995", + "3 519 000", + "1 058 000", + "2 461 000", + "22.6", + "6.8", + "15.8", + "2.6", + "43", + "67.3", + "63.6", + "71.2" + ], + [ + "1995 - 2000", + "3 624 000", + "1 086 000", + "2 538 000", + "21.5", + "6.5", + "15.1", + "2.45", + "34", + "69.3", + "65.5", + "73.3" + ], + [ + "2000 - 2005", + "3 572 000", + "1 147 000", + "2 425 000", + "19.8", + "6.4", + "13.4", + "2.25", + "27", + "70.9", + "67.2", + "74.8" + ] + ], + "title": "", + "original_id": "941de41a89c72f457a53e9f5ffd87bc9" + }, + { + "_id": "c08e9c6eae01811037ae6b19fae3c0f7", + "header": [ + "Township", + "FIPS", + "Population\ncenter", + "Population", + "Population\ndensity\n(/mi²)", + "Population\ndensity\n(/km²)", + "Land area\n(mi²)", + "Land area\n(km²)", + "Water area\n(mi²)", + "Water area\n(km²)", + "Geographic coordinates" + ], + "rows": [ + [ + "Bayliss", + "90159", + null, + "708", + "24.6", + "9.5", + "28.81", + "74.62", + "0.0979", + "0.2536", + "35°24′10″N 93°14′06″W / 35.40278°N 93.23500°W" + ], + [ + "Burnett", + "90558", + null, + "452", + "20.9", + "8.1", + "21.65", + "56.07", + "0.1051", + "0.2722", + "35°19′10″N 92°52′33″W / 35.31944°N 92.87583°W" + ], + [ + "Center", + "90735", + null, + "515", + "36.8", + "14.2", + "13.99", + "36.23", + "0.0339", + "0.0878", + "35°24′20″N 92°57′16″W / 35.40556°N 92.95444°W" + ], + [ + "Clark", + "90813", + "London", + "2969", + "115.3", + "44.6", + "25.73", + "66.64", + "6.0444", + "15.6549", + "35°19′45″N 93°14′46″W / 35.32917°N 93.24611°W" + ], + [ + "Convenience", + "90921", + null, + "933", + "50.4", + "19.4", + "18.53", + "47.99", + "0.0942", + "0.244", + "35°20′00″N 92°56′41″W / 35.33333°N 92.94472°W" + ], + [ + "Dover", + "91134", + "Dover", + "5277", + "119.1", + "46.0", + "44.29", + "114.7", + "0.3637", + "0.942", + "35°23′30″N 93°07′01″W / 35.39167°N 93.11694°W" + ], + [ + "Freeman", + "91377", + null, + "98", + "0.8", + "0.3", + "119.78", + "310.2", + "0.0", + "0.0", + "35°39′10″N 93°04′06″W / 35.65278°N 93.06833°W" + ], + [ + "Galla", + "91407", + "Pottsville", + "3523", + "88.7", + "34.3", + "39.71", + "102.8", + "1.841", + "4.7682", + "35°13′15″N 93°02′46″W / 35.22083°N 93.04611°W" + ], + [ + "Griffin", + "91536", + null, + "901", + "26.5", + "10.2", + "33.96", + "87.96", + "0.1106", + "0.2865", + "35°25′30″N 92°52′36″W / 35.42500°N 92.87667°W" + ], + [ + "Gum Log", + "91560", + null, + "1420", + "71.6", + "27.6", + "19.84", + "51.39", + "0.0142", + "0.0368", + "35°16′30″N 92°59′51″W / 35.27500°N 92.99750°W" + ], + [ + "Illinois", + "91812", + "Russellville", + "25841", + "540.9", + "208.9", + "47.77", + "123.7", + "6.6022", + "17.0996", + "35°17′00″N 93°07′46″W / 35.28333°N 93.12944°W" + ], + [ + "Jackson", + "91875", + "Hector", + "1191", + "11.5", + "4.4", + "103.72", + "268.6", + "0.0505", + "0.1308", + "35°29′20″N 92°57′01″W / 35.48889°N 92.95028°W" + ], + [ + "Liberty", + "92181", + null, + "805", + "14.2", + "5.5", + "56.64", + "146.7", + "0.0028", + "0.0073", + "35°29′40″N 93°03′16″W / 35.49444°N 93.05444°W" + ], + [ + "Martin", + "92415", + null, + "1482", + "23.7", + "9.2", + "62.46", + "161.8", + "0.3931", + "1.0181", + "35°28′25″N 93°10′06″W / 35.47361°N 93.16833°W" + ], + [ + "Moreland", + "92553", + null, + "700", + "52.2", + "20.2", + "13.4", + "34.71", + "0.0683", + "0.1769", + "35°21′30″N 92°59′46″W / 35.35833°N 92.99611°W" + ], + [ + "Phoenix", + "92871", + null, + "334", + "26.7", + "10.3", + "12.51", + "32.4", + "0.0", + "0.0", + "35°24′30″N 93°00′31″W / 35.40833°N 93.00861°W" + ], + [ + "Smyrna", + "93420", + null, + "173", + "2.4", + "0.9", + "70.69", + "183.1", + "0.0218", + "0.0565", + "35°38′10″N 92°53′46″W / 35.63611°N 92.89611°W" + ], + [ + "Valley", + "93765", + null, + "2776", + "125.7", + "48.5", + "22.09", + "57.21", + "0.0144", + "0.0373", + "35°20′05″N 93°02′46″W / 35.33472°N 93.04611°W" + ], + [ + "Wilson", + "94089", + "Atkins", + "4371", + "77.6", + "30.0", + "56.32", + "145.9", + "3.0305", + "7.849", + "35°13′30″N 92°55′01″W / 35.22500°N 92.91694°W" + ] + ], + "title": "", + "original_id": "42588bff012a6959cc80a02fbdb8ea8b" + }, + { + "_id": "7788d29b42260c6febf4c29ba8df9b68", + "header": [ + "institution", + "location", + "established", + "gained university status", + "vice - chancellor", + "total number of students", + "research funding (000)" + ], + "rows": [ + [ + "birkbeck , university of london", + "london", + "1823", + "1920", + "professor david latchman", + "19020", + "9985" + ], + [ + "university of east anglia", + "norwich", + "1963", + "1963", + "professor edward acton", + "19585", + "16482" + ], + [ + "university of essex", + "colchester", + "1964", + "1964", + "professor anthony forster", + "11690", + "9967" + ], + [ + "goldsmiths , university of london", + "london", + "1891", + "1904", + "dr pat loughrey", + "7615", + "8539" + ], + [ + "institute of education , university of london", + "london", + "1902", + "1932", + "professor chris husbands", + "7215", + "7734" + ], + [ + "university of lancaster", + "lancaster", + "1964", + "1964", + "professor mark smith", + "12695", + "18640" + ], + [ + "university of leicester", + "leicester", + "1921", + "1957", + "professor robert burgess", + "16160", + "22225" + ], + [ + "loughborough university", + "loughborough", + "1909", + "1966", + "professor robert allison", + "17825", + "22398" + ], + [ + "royal holloway , university of london", + "egham", + "1849", + "1900", + "professor paul layzell (principal)", + "7620", + "13699" + ], + [ + "soas , university of london", + "london", + "1916", + "1916", + "professor paul webley", + "4525", + "7238" + ] + ], + "title": "", + "original_id": "86d237da79f5e78933cafbcf861599b6" + }, + { + "_id": "e67c5ef31a4f0e61c85d3e96608cbbd4", + "header": [ + "rank", + "metropolitan area", + "country", + "gdp (ppp) (2008) billions of us", + "metropolitan population (2006) millions", + "gdp (ppp) us per capita" + ], + "rows": [ + [ + "1", + "mexico city", + "mexico", + "390", + "21.2", + "20300" + ], + [ + "2", + "são paulo", + "brazil", + "388", + "18.61", + "20800" + ], + [ + "3", + "buenos aires", + "argentina", + "362", + "13.52", + "28000" + ], + [ + "4", + "rio de janeiro", + "brazil", + "201", + "11.62", + "17300" + ], + [ + "5", + "bogotá", + "colombia", + "180", + "8.55", + "21050" + ], + [ + "6", + "santiago", + "chile", + "120", + "5.7", + "21050" + ], + [ + "7", + "brasilia", + "brazil", + "110", + "3.48", + "31600" + ], + [ + "8", + "lima", + "peru", + "109", + "8.35", + "13100" + ], + [ + "9", + "medellín", + "colombia", + "102", + "3.58", + "28500" + ], + [ + "10", + "guadalajara", + "mexico", + "81", + "3.95", + "20500" + ] + ], + "title": "", + "original_id": "13d88bef442eaf8c1a03ae3aebbbe620" + }, + { + "_id": "f032c9372c209f7c63485568619c8781", + "header": [ + "sunshine (hrs / year)", + "rain (mm / year)", + "snow (days / year)", + "storms (days / year)", + "fog (days / year)" + ], + "rows": [ + [ + "1973", + "770", + "14", + "22", + "40" + ], + [ + "1650", + "657", + "17", + "18", + "54" + ], + [ + "1 630", + "642", + "15", + "19", + "13" + ], + [ + "2 668", + "767", + "1", + "31", + "1" + ], + [ + "1 633", + "610", + "30", + "29", + "65" + ], + [ + "1 492", + "1 109", + "9", + "11", + "74" + ] + ], + "title": "", + "original_id": "ee98550f2f9e19f521b3c953c7c476a2" + }, + { + "_id": "4d284692b879c143b75429912916814b", + "header": [ + "Rank", + "Region", + "GDP (€, billions)", + "GDP (% of national total)", + "GDP per capita (€)", + "GDP per capita (PPS)", + "GDP per capita (PPS, EU28=100)" + ], + "rows": [ + [ + "0", + "a", + "0", + "0", + "0", + "0", + "0" + ], + [ + "1", + "Attica", + "85.285", + "47.3", + "22,700", + "27,300", + "91" + ], + [ + "2", + "Central Macedonia", + "24.953", + "13.8", + "13,300", + "16,000", + "53" + ], + [ + "3", + "Thessaly", + "9.437", + "5.2", + "13,000", + "15,700", + "52" + ], + [ + "4", + "Crete", + "8.962", + "5.0", + "14,200", + "17,000", + "57" + ], + [ + "5", + "Central Greece", + "8.552", + "4.7", + "15,400", + "18,500", + "62" + ], + [ + "6", + "Western Greece", + "8.164", + "4.5", + "12,300", + "14,900", + "49" + ], + [ + "7", + "Peloponnese", + "8.144", + "4.5", + "14,100", + "17,000", + "56" + ], + [ + "8", + "Eastern Macedonia and Thrace", + "6.939", + "3.9", + "11,500", + "13,900", + "46" + ], + [ + "9", + "South Aegean", + "6.114", + "3.4", + "18,000", + "21,700", + "72" + ], + [ + "10", + "Western Macedonia", + "4.010", + "2.2", + "14,800", + "17,900", + "59" + ], + [ + "11", + "Epirus", + "4.001", + "2.2", + "12,000", + "14,400", + "48" + ], + [ + "12", + "Ionian Islands", + "3.159", + "1.8", + "15,400", + "18,600", + "62" + ], + [ + "13", + "North Aegean", + "2.498", + "1.4", + "12,000", + "14,500", + "48" + ], + [ + "-", + "-", + "-", + "-", + "-", + "-", + "-" + ], + [ + "–", + "Greece", + "180.218", + "100", + "16,800", + "20,200", + "67" + ], + [ + "-", + "-", + "-", + "-", + "-", + "-", + "-" + ], + [ + "–", + "European Union", + "15,383.066", + "8535.8", + "30,000", + "30,000", + "100" + ], + [ + "100", + "z", + "1000000000000000", + "1000", + "100", + "1000000000", + "1000" + ] + ], + "title": "", + "original_id": "466d38cce925e5567977bc108dffbcc4" + }, + { + "_id": "49338491cc80bc31c70537f052dd779b", + "header": [ + "drug", + "mean", + "pleasure", + "psychological dependence", + "physical dependence" + ], + "rows": [ + [ + "heroin", + "3.0", + "3.0", + "3.0", + "3.0" + ], + [ + "cocaine", + "2.37", + "3.0", + "2.8", + "1.3" + ], + [ + "alcohol", + "1.93", + "2.3", + "1.9", + "1.6" + ], + [ + "barbiturates", + "2.01", + "2.0", + "2.2", + "1.8" + ], + [ + "benzodiazepines", + "1.83", + "1.7", + "2.1", + "1.8" + ], + [ + "amphetamine", + "1.67", + "2.0", + "1.9", + "1.1" + ], + [ + "cannabis", + "1.51", + "1.9", + "1.7", + "0.8" + ], + [ + "ecstasy", + "1.13", + "1.5", + "1.2", + "0.7" + ], + [ + "lsd", + "0.9", + "1.3", + "1.1", + "0.3" + ] + ], + "title": "", + "original_id": "6423fac749dc4e40ed398068f69b433d" + }, + { + "_id": "6013b9d705b701d6ac84b242c5f7a914", + "header": [ + "fuel gas", + "upper index kcal / nm 3", + "lower index kcal / nm 3", + "upper index mj / nm 3", + "lower index mj / nm 3" + ], + "rows": [ + [ + "hydrogen", + "11528", + "9715", + "48.23", + "40.65" + ], + [ + "methane", + "12735", + "11452", + "53.28", + "47.91" + ], + [ + "ethane", + "16298", + "14931", + "68.19", + "62.47" + ], + [ + "ethylene", + "15253", + "14344", + "63.82", + "60.01" + ], + [ + "natural gas", + "12837", + "11597", + "53.71", + "48.52" + ], + [ + "propane", + "19376", + "17817", + "81.07", + "74.54" + ], + [ + "propylene", + "18413", + "17180", + "77.04", + "71.88" + ], + [ + "n - butane", + "22066", + "20336", + "92.32", + "85.08" + ], + [ + "iso - butane", + "21980", + "20247", + "91.96", + "84.71" + ], + [ + "butylene - 1", + "21142", + "19728", + "88.46", + "82.54" + ], + [ + "lpg", + "20755", + "19106", + "86.84", + "79.94" + ], + [ + "acetylene", + "14655", + "14141", + "61.32", + "59.16" + ] + ], + "title": "", + "original_id": "491f762a5e6a62788dbefb887cacdde6" + }, + { + "_id": "346cf7a36dd406e89de1398099a64e16", + "header": [ + "School Name", + "Low grade", + "High grade", + "Students (K-12)", + "FTE Teachers", + "Student/teacher ratio" + ], + "rows": [ + [ + "Bethany Lutheran School", + "PK", + "8", + "28.0", + "3.6", + "7.78" + ], + [ + "Bethlehem Lutheran School", + "PK", + "8", + "182.0", + "10.0", + "18.2" + ], + [ + "Christ Lutheran School", + "K", + "8", + "12.0", + "2.0", + "6.0" + ], + [ + "Community Baptist Christian School", + "PK", + "12", + "120.0", + "9.8", + "12.24" + ], + [ + "Good Shepherd Early Childhood", + "PK", + "K", + "20.0", + "1.0", + "20.0" + ], + [ + "Grace Christian School", + "PK", + "12", + "117.0", + "13.0", + "9.0" + ], + [ + "Holy Cross Lutheran School", + "PK", + "8", + "135.0", + "7.9", + "17.09" + ], + [ + "Immanuel Lutheran School", + "PK", + "8", + "82.0", + "5.6", + "14.64" + ], + [ + "Michigan Lutheran Seminary", + "9", + "12", + "313.0", + "31.0", + "10.1" + ], + [ + "Nouvel Catholic Central High School", + "9", + "12", + "505.0", + "37.0", + "13.65" + ], + [ + "Peace Lutheran School", + "PK", + "8", + "229.0", + null, + null + ], + [ + "Sheridan Road Christian School", + "K", + "12", + "42.0", + "5.9", + "7.12" + ], + [ + "St Helen Elementary School", + "K", + "8", + "182.0", + "10.9", + "16.7" + ], + [ + "St John's Evangelical Lutheran School", + "K", + "8", + "32.0", + "3.0", + "10.67" + ], + [ + "St Pauls Lutheran School", + "PK", + "8", + "155.0", + "9.6", + "16.15" + ], + [ + "St Stephen Elementary School", + "PK", + "8", + "364.0", + "23.1", + "15.76" + ], + [ + "St Thomas Aquinas Elementary School", + "K", + "8", + "403.0", + "25.0", + "16.12" + ], + [ + "Tri-City Seventh-Day Adventist School", + "1", + "8", + "18.0", + "2.1", + "8.57" + ], + [ + "Valley Lutheran High School", + "9", + "12", + "344.0", + "21.0", + "16.38" + ], + [ + "Notes", + null, + null, + null, + null, + null + ] + ], + "title": "", + "original_id": "a99c268eb398a0062284bc4d59ab2d89" + }, + { + "_id": "355473703ad8f153f802ae01c12c87d5", + "header": [ + "Province", + "DC", + "LV*", + "PSI", + "PCI" + ], + "rows": [ + [ + "Verona", + "44.3", + "10.8", + "14.2", + "11.5" + ], + [ + "Vicenza", + "49.1", + "11.4", + "10.1", + "8.6" + ], + [ + "Padua", + "46.1", + "6.4", + "10.7", + "16.3" + ], + [ + "Treviso", + "44.5", + "7.8", + "14.1", + "12.1" + ], + [ + "Belluno", + "39.3", + "7.0", + "23.8", + "13.1" + ], + [ + "Venice", + "31.7", + "4.9", + "15.9", + "24.2" + ], + [ + "Rovigo", + "35.2", + "3.3", + "15.5", + "29.0" + ], + [ + "Veneto", + "42.3", + "7.8", + "13.7", + "15.5" + ] + ], + "title": "", + "original_id": "f006cbc7a735f7755e32dde42be5b50b" + }, + { + "_id": "93cba3453de56e6f01a7ea0967c244c5", + "header": [ + "height (m)", + "no of times visited", + "no of hc climbs", + "first time as hc climb", + "most recent" + ], + "rows": [ + [ + "2744", + "2", + "2", + "2008", + "2011" + ], + [ + "1850 / 1860", + "29", + "25", + "1979", + "2013" + ], + [ + "2240", + "2", + "2", + "1997", + "2009" + ], + [ + "1655", + "2", + "1", + "2013", + "2013" + ], + [ + "1709", + "48", + "14", + "1980", + "2012" + ], + [ + "1755", + "3", + "3", + "2007", + "2012" + ], + [ + "1780", + "5", + "5", + "1998", + "2011" + ], + [ + "2715", + "4", + "2", + "1993", + "2008" + ], + [ + "1730", + "1", + "1", + "2001", + "2001" + ], + [ + "2067", + "16", + "8", + "1989", + "2012" + ], + [ + "2556 / 2645", + "56", + "19", + "1979", + "2011" + ], + [ + "1924", + "12", + "4", + "1981", + "2013" + ], + [ + "1501", + "1", + "1", + "2012", + "2012" + ], + [ + "2465", + "5", + "1", + "2009", + "2009" + ], + [ + "2413", + "1", + "1", + "1986", + "1986" + ], + [ + "1560", + "4", + "4", + "1994", + "2008" + ], + [ + "2770", + "5", + "2", + "1992", + "2007" + ], + [ + "1900", + "1", + "1", + "1993", + "1993" + ], + [ + "2360", + "32", + "6", + "1986", + "2011" + ], + [ + "1691", + "11", + "6", + "1981", + "2006" + ], + [ + "1980", + "4", + "4", + "1984", + "2002" + ], + [ + "1573", + "2", + "2", + "1996", + "2007" + ], + [ + "1160", + "1", + "1", + "1984", + "1984" + ], + [ + "2351", + "1", + "1", + "2008", + "2008" + ], + [ + "1715", + "8", + "8", + "1985", + "2011" + ], + [ + "1993", + "25", + "17", + "1980", + "2013" + ], + [ + "2083", + "5", + "1", + "1999", + "1999" + ], + [ + "2001", + "5", + "4", + "2005", + "2013" + ], + [ + "1669", + "9", + "4", + "1981", + "2005" + ], + [ + "1630", + "2", + "1", + "1980", + "1980" + ], + [ + "1415", + "13", + "2", + "1983", + "1986" + ], + [ + "1540", + "6", + "2", + "1987", + "2006" + ], + [ + "1474", + "22", + "1", + "1982", + "1982" + ], + [ + "1770", + "6", + "1", + "1986", + "1986" + ], + [ + "2115", + "82", + "23", + "1980", + "2012" + ], + [ + "2275", + "1", + "1", + "1994", + "1994" + ], + [ + "1909", + "15", + "5", + "1987", + "2013" + ] + ], + "title": "", + "original_id": "1632f38bd3383a3944a46d77fb466963" + }, + { + "_id": "f8b582ee8ec287a82d6811e4034a302f", + "header": [ + "squad no", + "name", + "position", + "league apps", + "league goals", + "fa cup apps", + "fa cup goals", + "league cup apps", + "league cup goals", + "flt apps", + "flt goals", + "total apps", + "total goals" + ], + "rows": [ + [ + "2", + "andy holdsworth", + "df", + "43 (1)", + "3", + "5", + "0", + "0", + "0", + "1", + "0", + "49 (1)", + "3" + ], + [ + "3", + "joe skarz", + "df", + "22 (5)", + "0", + "2 (1)", + "0", + "1", + "0", + "1", + "0", + "26 (6)", + "0" + ], + [ + "4", + "michael collins", + "mf", + "35 (6)", + "2", + "3 (2)", + "1", + "1", + "0", + "1", + "1", + "40 (8)", + "4" + ], + [ + "5", + "david mirfin", + "df", + "23 (6)", + "1", + "3 (1)", + "0", + "1", + "0", + "0", + "0", + "27 (7)", + "1" + ], + [ + "6", + "nathan clarke", + "df", + "44", + "2", + "4", + "0", + "1", + "0", + "1", + "0", + "50", + "2" + ], + [ + "7", + "chris brandon", + "mf", + "25 (3)", + "2", + "2", + "1", + "1", + "0", + "1", + "0", + "29 (3)", + "3" + ], + [ + "8", + "jon worthington", + "mf", + "19 (6)", + "0", + "1", + "0", + "1", + "0", + "0", + "0", + "21 (6)", + "0" + ], + [ + "9", + "danny cadamarteri", + "fw", + "10 (2)", + "3", + "1 (1)", + "0", + "0", + "0", + "0", + "0", + "11 (3)", + "3" + ], + [ + "10", + "robbie williams", + "df", + "24 (1)", + "2", + "3", + "0", + "0", + "0", + "0", + "0", + "27 (1)", + "2" + ], + [ + "11", + "danny schofield", + "mf", + "19 (6)", + "2", + "4 (1)", + "0", + "1", + "0", + "1", + "0", + "25 (7)", + "2" + ], + [ + "12", + "tom clarke", + "df", + "2 (1)", + "0", + "0", + "0", + "0", + "0", + "0 (1)", + "0", + "2 (2)", + "0" + ], + [ + "13", + "frank sinclair", + "df", + "28 (1)", + "0", + "5", + "0", + "1", + "0", + "0", + "0", + "34 (1)", + "0" + ], + [ + "14", + "phil jevons", + "fw", + "17 (4)", + "7", + "3 (1)", + "2", + "0", + "0", + "0", + "0", + "20 (5)", + "9" + ], + [ + "14", + "richard keogh", + "df", + "9", + "1", + "0", + "0", + "0", + "0", + "1", + "0", + "10", + "1" + ], + [ + "15", + "malvin kamara", + "mf", + "33 (10)", + "3", + "3 (2)", + "2", + "1", + "0", + "1", + "0", + "38 (12)", + "5" + ], + [ + "16", + "ronnie wallwork", + "mf", + "16", + "3", + "2", + "0", + "0", + "0", + "0", + "0", + "18", + "3" + ], + [ + "17", + "matty young", + "mf", + "4 (4)", + "0", + "0", + "0", + "0", + "0", + "0 (1)", + "0", + "4 (5)", + "0" + ], + [ + "18", + "luke beckett", + "fw", + "25 (11)", + "8", + "3 (2)", + "4", + "1", + "0", + "1", + "0", + "30 (13)", + "12" + ], + [ + "19", + "aaron hardy", + "df", + "5 (1)", + "0", + "0", + "0", + "0 (1)", + "0", + "1", + "0", + "6 (2)", + "0" + ], + [ + "20", + "danny racchi", + "df", + "0 (3)", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + "0 (3)", + "0" + ], + [ + "21", + "lucas akins", + "fw", + "0 (3)", + "0", + "0", + "0", + "0", + "0", + "0 (1)", + "0", + "0 (4)", + "0" + ], + [ + "22", + "james berrett", + "mf", + "10 (5)", + "1", + "2", + "0", + "0", + "0", + "0", + "0", + "12 (5)", + "1" + ], + [ + "23", + "andy booth", + "fw", + "28 (10)", + "9", + "2 (1)", + "0", + "0 (1)", + "0", + "0", + "0", + "30 (12)", + "9" + ], + [ + "27", + "matt glennon", + "gk", + "45", + "0", + "5", + "0", + "1", + "0", + "1", + "0", + "52", + "0" + ], + [ + "28", + "alex smithies", + "gk", + "1 (1)", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + "1 (1)", + "0" + ], + [ + "29", + "robert page", + "df", + "18", + "1", + "2", + "0", + "0", + "0", + "0", + "0", + "20", + "1" + ], + [ + "31", + "shane killock", + "df", + "1", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + "1", + "0" + ], + [ + "32", + "daniel broadbent", + "fw", + "0 (5)", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + "0 (5)", + "0" + ] + ], + "title": "", + "original_id": "8bbcb834cd1f78b5fdea62a28c9746d5" + }, + { + "_id": "619e17e815e00993801849fe0207ccda", + "header": [ + "-", + "Soviet Union", + "Poland and Danzig", + "Finland", + "Estonia", + "Latvia", + "Lithuania" + ], + "rows": [ + [ + "1934", + "223.0", + "78.1", + "42.3", + "8.2", + "21.1", + "15.1" + ], + [ + "1935", + "201.7", + "75.5", + "41.4", + "13.0", + "31.1", + "2.0" + ], + [ + "1936", + "93.2", + "74.0", + "46.1", + "13.8", + "33.2", + "9.1" + ], + [ + "1937", + "63.1", + "80.7", + "70.1", + "23.7", + "45.7", + "17.2" + ], + [ + "1938", + "47.4", + "109.4", + "88.6", + "24.0", + "43.5", + "27.6" + ], + [ + "1939", + "52.8", + "140.8", + "88.9", + "24.3", + "43.6", + "27.8" + ], + [ + "*German Imports in millions of Reichsmarks", + "*German Imports in millions of Reichsmarks", + "*German Imports in millions of Reichsmarks", + "*German Imports in millions of Reichsmarks", + "*German Imports in millions of Reichsmarks", + "*German Imports in millions of Reichsmarks", + "*German Imports in millions of Reichsmarks" + ] + ], + "title": "", + "original_id": "e1c02ab4252451db510a47d2d9f7f227" + }, + { + "_id": "d444a2de371afcd6f9f13802dc129915", + "header": [ + "rank", + "building", + "address", + "height", + "storeys", + "completed" + ], + "rows": [ + [ + "1", + "la renaissance apartments", + "424 spadina crescent e", + "-", + "24", + "1983" + ], + [ + "2", + "hallmark place", + "311 6th ave n", + "-", + "27", + "1984" + ], + [ + "3", + "saskatoon square", + "410 22nd st e", + "-", + "17", + "1979" + ], + [ + "4", + "the terrace apartments", + "315 5th ave n", + "-", + "22", + "1980" + ], + [ + "5", + "radisson hotel", + "405 20th st e", + "-", + "20", + "1983" + ], + [ + "6", + "the view on fifth (formerly milroy apartments)", + "320 5th ave n", + "-", + "22", + "1968" + ], + [ + "7", + "the luther", + "1223 temperance st", + "-", + "22", + "1978" + ], + [ + "8", + "marquis towers", + "241 5th ave n", + "-", + "21", + "1966" + ], + [ + "9", + "carlton towers", + "325 5th ave n", + "-", + "21", + "1968" + ], + [ + "10", + "delta bessborough", + "601 spadina crescent e", + "-", + "10", + "1932" + ], + [ + "11", + "the tower at midtown (formerly cn tower)", + "201 1st avenue south", + "-", + "12", + "1970" + ], + [ + "12", + "saskatoon towers", + "125 5th avenue north", + "-", + "19", + "1972" + ], + [ + "13", + "avord towers", + "606 spadina crescent east", + "-", + "14", + "1964" + ] + ], + "title": "", + "original_id": "7ee09fe1d48c37e52e56c6ac5615fb80" + }, + { + "_id": "5fa1431c33770d601142fa4890f9a6d8", + "header": [ + "contestant", + "starting weight (kg)", + "final weight (kg)", + "weight lost (kg)", + "percentage lost", + "position (out of eliminated contestants)" + ], + "rows": [ + [ + "rick", + "172.6", + "97.2", + "75.4", + "43.68%", + "1st" + ], + [ + "david", + "165.6", + "99.2", + "66.4", + "40.10%", + "2nd" + ], + [ + "teneale", + "97.4", + "58.8", + "38.6", + "39.63%", + "3rd" + ], + [ + "phil", + "146.9", + "93.0", + "53.9", + "36.69%", + "4th" + ], + [ + "jarna", + "118.8", + "75.5", + "43.3", + "36.45%", + "5th" + ], + [ + "elise", + "104.6", + "66.7", + "37.9", + "36.23%", + "6th" + ], + [ + "jenni", + "130.6", + "84.3", + "46.3", + "35.45%", + "7th" + ], + [ + "phoebe", + "116.0", + "76.9", + "39.1", + "33.71%", + "8th" + ], + [ + "caitlin", + "179.4", + "124.8", + "54.6", + "30.43%", + "9th" + ], + [ + "geoff", + "161.6", + "117.8", + "43.8", + "27.10%", + "10th" + ], + [ + "daina", + "105.2", + "77.8", + "27.4", + "26.05%", + "11th" + ], + [ + "chris", + "128.9", + "104.2", + "24.7", + "19.16%", + "12th" + ], + [ + "allan", + "155.8", + "131.5", + "24.3", + "15.60%", + "13th" + ] + ], + "title": "", + "original_id": "c804d4f121627a594222775cc3091419" + }, + { + "_id": "04de564ecdf2b472c1e19f75bfd2ed13", + "header": [ + "rank", + "company", + "headquarters", + "industry", + "sales (billion )", + "profits (billion )", + "assets (billion )", + "market value (billion )" + ], + "rows": [ + [ + "1", + "exxonmobil", + "usa", + "oil and gas", + "433.5", + "41.1", + "331.1", + "407.4" + ], + [ + "2", + "jpmorgan chase", + "usa", + "banking", + "110.8", + "19.0", + "2265.8", + "170.1" + ], + [ + "3", + "general electric", + "usa", + "conglomerate", + "147.3", + "14.2", + "717.2", + "213.7" + ], + [ + "4", + "royal dutch shell", + "netherlands", + "oil and gas", + "470.2", + "30.9", + "340.5", + "227.6" + ], + [ + "5", + "industrial and commercial bank of china", + "china", + "banking", + "82.6", + "25.1", + "2039.1", + "237.4" + ], + [ + "6", + "hsbc", + "uk", + "banking", + "102.0", + "16.2", + "2550.0", + "164.3" + ], + [ + "7", + "petrochina", + "china", + "oil and gas", + "310.1", + "20.6", + "304.7", + "294.7" + ], + [ + "8", + "berkshire hathaway", + "usa", + "conglomerate", + "143.7", + "10.3", + "392.6", + "202.2" + ], + [ + "9", + "wells fargo", + "usa", + "banking", + "87.6", + "15.9", + "1313.9", + "178.7" + ], + [ + "10", + "petrobras", + "brazil", + "oil and gas", + "145.9", + "20.1", + "319.4", + "180.0" + ], + [ + "11", + "bp", + "uk", + "oil and gas", + "375.5", + "25.7", + "292.5", + "147.4" + ], + [ + "12", + "chevron", + "usa", + "oil and gas", + "236.3", + "26.9", + "209.5", + "218.0" + ], + [ + "13", + "china construction bank", + "china", + "banking", + "68.7", + "20.5", + "1637.8", + "201.9" + ], + [ + "14", + "citigroup", + "usa", + "banking", + "102.6", + "11.1", + "1873.9", + "107.5" + ], + [ + "15", + "gazprom", + "russia", + "oil and gas", + "117.6", + "31.7", + "302.6", + "159.8" + ], + [ + "16", + "walmart", + "usa", + "retailing", + "447.0", + "15.7", + "193.4", + "208.4" + ], + [ + "17", + "volkswagen group", + "germany", + "automotive", + "221.9", + "21.5", + "328.7", + "79.5" + ], + [ + "18", + "total", + "france", + "oil and gas", + "216.2", + "15.9", + "213.0", + "132.4" + ], + [ + "19", + "agricultural bank of china", + "china", + "banking", + "62.4", + "14.4", + "1563.9", + "154.8" + ], + [ + "20", + "bnp paribas", + "france", + "banking", + "119.0", + "7.9", + "2539.1", + "61.5" + ] + ], + "title": "", + "original_id": "d0a1f61b05fa1d4c1cada744578f10e0" + }, + { + "_id": "854523aaee26f738c9a4f41f12912ed2", + "header": [ + "Club", + "Season", + "Division", + "League", + "League", + "FA Cup", + "FA Cup", + "Total", + "Total" + ], + "rows": [ + [ + "Club", + "Season", + "Division", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals" + ], + [ + "Sheffield United", + "1945–46", + "-", + "0", + "0", + "1", + "0", + "1", + "0" + ], + [ + "Bournemouth & Boscombe Athletic", + "1946–47", + "Third Division South", + "8", + "3", + "0", + "0", + "8", + "3" + ], + [ + "Lincoln City", + "1946–47", + "Third Division North", + "25", + "15", + "5", + "2", + "30", + "17" + ], + [ + "Lincoln City", + "1947–48", + "Third Division North", + "41", + "32", + "1", + "0", + "42", + "32" + ], + [ + "Lincoln City", + "1948–49", + "Second Division", + "19", + "8", + "0", + "0", + "19", + "8" + ], + [ + "Lincoln City", + "Total", + "Total", + "85", + "55", + "6", + "2", + "91", + "57" + ], + [ + "Oldham Athletic", + "1948–49", + "Third Division North", + "7", + "3", + "0", + "0", + "7", + "3" + ], + [ + "Oldham Athletic", + "1949–50", + "Third Division North", + "7", + "0", + "0", + "0", + "7", + "0" + ], + [ + "Oldham Athletic", + "Total", + "Total", + "14", + "3", + "0", + "0", + "14", + "3" + ], + [ + "Career Total", + "Career Total", + "Career Total", + "107", + "61", + "7", + "2", + "114", + "63" + ] + ], + "title": "", + "original_id": "3df36d0c0c2a1cb5306ad1457893f64a" + }, + { + "_id": "e01c2b0e800538d2d6850f1a4c12c943", + "header": [ + "draw", + "artist", + "song", + "points", + "place" + ], + "rows": [ + [ + "1", + "niamh kavanagh", + "in your eyes", + "118", + "1" + ], + [ + "2", + "suzanne bushnell", + "long gone", + "54", + "7" + ], + [ + "3", + "patricia roe", + "if you changed your mind", + "75", + "3" + ], + [ + "4", + "róisín ní haodha", + "mo mhúirnín óg", + "34", + "8" + ], + [ + "5", + "champ", + "2nd time around", + "79", + "2" + ], + [ + "6", + "off the record", + "hold out", + "61", + "6" + ], + [ + "7", + "dav mcnamara", + "stay", + "67", + "4" + ], + [ + "8", + "perfect timing", + "why aren't we talking anyway", + "62", + "5" + ] + ], + "title": "", + "original_id": "7a156d05e2c0428c864472f280530e0e" + }, + { + "_id": "f2380a5dc70efc21299c4aa9794b56f8", + "header": [ + "Province", + "DC", + "LV", + "Ven.", + "PSI", + "PDS" + ], + "rows": [ + [ + "Verona", + "34.0", + "20.6", + "6.6", + "11.1", + "7.1" + ], + [ + "Vicenza", + "34.3", + "19.5", + "12.3", + "7.9", + "5.6" + ], + [ + "Padua", + "34.5", + "14.8", + "8.1", + "9.3", + "10.5" + ], + [ + "Treviso", + "32.9", + "21.5", + "7.8", + "9.7", + "7.5" + ], + [ + "Belluno", + "27.4", + "27.8", + "-", + "14.3", + "8.0" + ], + [ + "Venice", + "23.8", + "13.4", + "6.6", + "13.0", + "16.2" + ], + [ + "Rovigo", + "29.5", + "8.5", + "6.1", + "14.1", + "18.1" + ], + [ + "Veneto", + "31.5", + "17.8", + "7.7", + "10.6", + "9.9" + ] + ], + "title": "", + "original_id": "9294abdf58d2fa73160b9131f16ec61d" + }, + { + "_id": "2b54fc4848539562474908fb89065d82", + "header": [ + "Unnamed: 0", + "district", + "province", + "region", + "ubigeo", + "elevation (m)" + ], + "rows": [ + [ + "1", + "suykutambo", + "espinar", + "cusco", + "80807", + "4801" + ], + [ + "2", + "condoroma", + "espinar", + "cusco", + "80802", + "4737" + ], + [ + "3", + "san antonio", + "puno", + "puno", + "210113", + "4700" + ], + [ + "4", + "ananea", + "san antonio de putina", + "puno", + "211002", + "4660" + ], + [ + "5", + "morococha", + "yauli", + "junín", + "120805", + "4550" + ], + [ + "6", + "san antonio de chuca", + "caylloma", + "arequipa", + "40514", + "4525" + ], + [ + "7", + "santa ana", + "castrovirreyna", + "huancavelica", + "90411", + "4473" + ], + [ + "8", + "marcapomacocha", + "yauli", + "junín", + "120804", + "4415" + ], + [ + "9", + "capazo", + "el collao", + "puno", + "210502", + "4400" + ], + [ + "10", + "paratia", + "lampa", + "puno", + "210707", + "4390" + ], + [ + "11", + "cojata", + "huancané", + "puno", + "210602", + "4355" + ], + [ + "12", + "yanacancha", + "pasco", + "pasco", + "190113", + "4350" + ], + [ + "13", + "chaupimarca", + "pasco", + "pasco", + "190101", + "4338" + ], + [ + "14", + "macusani", + "carabaya", + "puno", + "210301", + "4315" + ], + [ + "15", + "huayllay", + "pasco", + "pasco", + "190104", + "4310" + ], + [ + "16", + "caylloma", + "caylloma", + "arequipa", + "40505", + "4310" + ], + [ + "17", + "vilavila", + "lampa", + "puno", + "210710", + "4300" + ], + [ + "18", + "tanta", + "yauyos", + "lima", + "151028", + "4278" + ], + [ + "19", + "tinyahuarco", + "pasco", + "pasco", + "190111", + "4275" + ] + ], + "title": "", + "original_id": "ea29c3703787096422647ea08ceb19f9" + }, + { + "_id": "a6baf1305e7eb9b25409e2c8a11485f0", + "header": [ + "rank", + "province", + "population", + "area", + "density" + ], + "rows": [ + [ + "1", + "san juan", + "232333", + "3363.8", + "69.07" + ], + [ + "2", + "la altagracia", + "273210", + "2998.4", + "91.12" + ], + [ + "3", + "santiago", + "963422", + "2806.3", + "343.31" + ], + [ + "4", + "azua", + "214311", + "2682.5", + "79.89" + ], + [ + "5", + "monte plata", + "185956", + "2601.6", + "71.48" + ], + [ + "6", + "la vega", + "394205", + "2292.5", + "171.95" + ], + [ + "7", + "pedernales", + "31587", + "2080.5", + "15.18" + ], + [ + "8", + "independencia", + "52589", + "2007.4", + "26.2" + ], + [ + "9", + "monte cristi", + "109607", + "1885.8", + "58.12" + ], + [ + "10", + "puerto plata", + "321597", + "1805.6", + "178.11" + ], + [ + "11", + "el seibo", + "87680", + "1788.4", + "49.03" + ], + [ + "12", + "barahona", + "187105", + "1660.2", + "112.7" + ], + [ + "13", + "duarte", + "289574", + "1649.5", + "175.55" + ], + [ + "14", + "elías piña", + "63029", + "1395.5", + "45.17" + ], + [ + "15", + "hato mayor", + "85017", + "1319.3", + "64.44" + ], + [ + "16", + "santo domingo", + "2374370", + "1302.2", + "1823.35" + ], + [ + "17", + "baoruco", + "97313", + "1284.9", + "75.74" + ], + [ + "18", + "san pedro de macorís", + "290458", + "1254.3", + "231.57" + ], + [ + "19", + "san cristóbal", + "569930", + "1240.6", + "459.4" + ], + [ + "20", + "maría trinidad sánchez", + "140925", + "1206.5", + "116.8" + ], + [ + "21", + "sánchez ramírez", + "151392", + "1185.8", + "127.67" + ], + [ + "22", + "santiago rodríguez", + "57476", + "1147.5", + "50.09" + ], + [ + "23", + "dajabón", + "63955", + "1021.3", + "62.62" + ], + [ + "24", + "monseñor nouel", + "165224", + "992.0", + "166.56" + ], + [ + "25", + "samaná", + "101494", + "862.8", + "117.63" + ], + [ + "26", + "san josé de ocoa", + "59544", + "853.4", + "69.77" + ], + [ + "27", + "espaillat", + "231938", + "843.0", + "275.13" + ], + [ + "28", + "valverde", + "163030", + "823.0", + "198.09" + ], + [ + "29", + "peravia", + "184344", + "785.2", + "234.77" + ], + [ + "30", + "la romana", + "245433", + "652.1", + "376.37" + ], + [ + "31", + "hermanas mirabal", + "92193", + "427.4", + "215.71" + ], + [ + "32", + "distrito nacional", + "965040", + "91.6", + "10535.37" + ] + ], + "title": "", + "original_id": "43c234d2ebb2952c9539118b2183165c" + }, + { + "_id": "132a16f0b8f208ede4ff098eeac2bc85", + "header": [ + "Country", + "Primary", + "Middle", + "Diploma", + "Career-related", + "Schools" + ], + "rows": [ + [ + "United States", + "500", + "618", + "893", + "77", + "1,725" + ], + [ + "Canada", + "82", + "169", + "171", + "2", + "366" + ], + [ + "Australia", + "119", + "45", + "67", + "1", + "176" + ], + [ + "Ecuador", + "9", + "9", + "253", + "0", + "253" + ], + [ + "United Kingdom", + "14", + "13", + "125", + "13", + "132" + ], + [ + "India", + "63", + "21", + "108", + "0", + "128" + ], + [ + "Mexico", + "55", + "35", + "66", + "1", + "106" + ], + [ + "China", + "37", + "27", + "83", + "1", + "101" + ], + [ + "Spain", + "11", + "14", + "93", + "0", + "95" + ], + [ + "Germany", + "23", + "11", + "67", + "2", + "71" + ], + [ + "Hong Kong", + "32", + "9", + "29", + "1", + "56" + ], + [ + "Turkey", + "25", + "10", + "43", + "0", + "60" + ], + [ + "Argentina", + "7", + "3", + "56", + "0", + "57" + ], + [ + "Switzerland", + "18", + "11", + "42", + "1", + "49" + ], + [ + "Indonesia", + "32", + "14", + "29", + "0", + "48" + ], + [ + "Poland", + "6", + "8", + "40", + "0", + "45" + ], + [ + "-", + "Primary", + "Middle", + "Diploma", + "Career-related", + "Schools" + ], + [ + "Total Schools Globally", + "1,375", + "1,264", + "2,997", + "118", + "4,460" + ], + [ + "Countries & Territories", + "104", + "97", + "140", + "18", + "151" + ] + ], + "title": "", + "original_id": "5111df4c8ab0075f11805502915ebcf7" + }, + { + "_id": "0433a5cfa320e133f0a92411cf5c4845", + "header": [ + "SR No.", + "BR No.", + "Date Built", + "Date Withdrawn" + ], + "rows": [ + [ + "950", + "30950", + "March 1929", + "October 1962" + ], + [ + "951", + "30951", + "April 1929", + "November 1962" + ], + [ + "952", + "30952", + "May 1929", + "November 1962" + ], + [ + "953", + "30953", + "May 1929", + "December 1962" + ], + [ + "954", + "30954", + "June 1929", + "December 1962" + ], + [ + "955", + "30955", + "July 1929", + "December 1962" + ], + [ + "956", + "30956", + "August 1929", + "December 1962" + ], + [ + "957", + "30957", + "September 1929", + "November 1962" + ] + ], + "title": "", + "original_id": "7905cb93ae282659886179a302c00327" + }, + { + "_id": "b26705cba62b6fc0be4ea9638029021b", + "header": [ + "Unnamed: 0", + "total freshwater withdrawal", + "per capita withdrawal", + "domestic use", + "industrial use", + "agricultural use" + ], + "rows": [ + [ + "turkmenistan", + "24.65", + "5104", + "2", + "1", + "98" + ], + [ + "kazakhstan", + "35.0", + "2360", + "2", + "17", + "82" + ], + [ + "uzbekistan", + "58.34", + "2194", + "5", + "2", + "93" + ], + [ + "guyana", + "1.64", + "2187", + "2", + "1", + "98" + ], + [ + "hungary", + "21.03", + "2082", + "9", + "59", + "32" + ], + [ + "azerbaijan", + "17.25", + "2051", + "5", + "28", + "68" + ], + [ + "kyrgyzstan", + "10.08", + "1916", + "3", + "3", + "94" + ], + [ + "tajikistan", + "11.96", + "1837", + "4", + "5", + "92" + ], + [ + "usa", + "477.0", + "1600", + "13", + "46", + "41" + ], + [ + "suriname", + "0.67", + "1489", + "4", + "3", + "93" + ], + [ + "iraq", + "42.7", + "1482", + "3", + "5", + "92" + ], + [ + "canada", + "44.72", + "1386", + "20", + "69", + "12" + ], + [ + "thailand", + "82.75", + "1288", + "2", + "2", + "95" + ], + [ + "ecuador", + "16.98", + "1283", + "12", + "5", + "82" + ] + ], + "title": "", + "original_id": "3d4ce757ccae9604c0351525427960e7" + }, + { + "_id": "d4f32ec4dbbe875f09613dcb039fbd3e", + "header": [ + "SR No.", + "BR No.", + "Date Built", + "Date Withdrawn" + ], + "rows": [ + [ + "530", + "30530", + "January 1938", + "December 1964" + ], + [ + "531", + "30531", + "June 1938", + "July 1964" + ], + [ + "532", + "30532", + "June 1938", + "January 1964" + ], + [ + "533", + "30533", + "July 1938", + "March 1963" + ], + [ + "534", + "30534", + "August 1938", + "December 1962" + ], + [ + "535", + "30535", + "September 1938", + "April 1965" + ], + [ + "536", + "30536", + "October 1938", + "January 1964" + ], + [ + "537", + "30537", + "October 1938", + "December 1962" + ], + [ + "538", + "30538", + "November 1938", + "July 1963" + ], + [ + "539", + "30539", + "December 1938", + "January 1963" + ], + [ + "540", + "30540", + "December 1938", + "November 1962" + ], + [ + "541", + "30541", + "January 1939", + "November 1964" + ], + [ + "542", + "30542", + "February 1939", + "December 1964" + ], + [ + "543", + "30543", + "March 1939", + "December 1964" + ], + [ + "544", + "30544", + "April 1939", + "January 1964" + ], + [ + "545", + "30545", + "June 1939", + "May 1965" + ], + [ + "546", + "30546", + "June 1939", + "May 1964" + ], + [ + "547", + "30547", + "July 1939", + "January 1964" + ], + [ + "548", + "30548", + "August 1939", + "March 1965" + ], + [ + "549", + "30549", + "September 1939", + "July 1963" + ] + ], + "title": "", + "original_id": "b68a92a9b123ed32ddae96e5ab1e3428" + }, + { + "_id": "dbe9516049a0bbd02f0887e4449a262e", + "header": [ + "region", + "enrolled men", + "enrolled women", + "enrolled total", + "men of voting age", + "women of voting age", + "voting age population", + "e / vap ratio men", + "e / vap ratio women", + "e / vap ratio total" + ], + "rows": [ + [ + "arica and parinacota", + "86777", + "83744", + "170521", + "61482", + "69090", + "130572", + "141.1%", + "121.2%", + "130.6%" + ], + [ + "tarapacá", + "110862", + "105991", + "216853", + "123726", + "112390", + "236116", + "89.6%", + "94.3%", + "91.8%" + ], + [ + "antofagasta", + "207865", + "204518", + "412383", + "220600", + "199989", + "420590", + "94.2%", + "102.3%", + "98.0%" + ], + [ + "atacama", + "110406", + "108717", + "219123", + "103866", + "99277", + "203143", + "106.3%", + "109.5%", + "107.9%" + ], + [ + "coquimbo", + "257793", + "270799", + "528592", + "264626", + "275644", + "540270", + "97.4%", + "98.2%", + "97.8%" + ], + [ + "valparaíso", + "703110", + "752801", + "1455911", + "655608", + "693352", + "1348960", + "107.2%", + "108.6%", + "107.9%" + ], + [ + "santiago", + "2508422", + "2743434", + "5251856", + "2503209", + "2700807", + "5204016", + "100.2%", + "101.6%", + "100.9%" + ], + [ + "o'higgins", + "341873", + "348904", + "690777", + "333154", + "329673", + "662826", + "102.6%", + "105.8%", + "104.2%" + ], + [ + "maule", + "393346", + "407300", + "800646", + "371827", + "382371", + "754199", + "105.8%", + "106.5%", + "106.2%" + ], + [ + "biobío", + "789249", + "837039", + "1626288", + "740687", + "780951", + "1521638", + "106.6%", + "107.2%", + "106.9%" + ], + [ + "araucanía", + "396403", + "409163", + "805566", + "349552", + "364606", + "714158", + "113.4%", + "112.2%", + "112.8%" + ], + [ + "los ríos", + "158554", + "162596", + "321150", + "138550", + "142148", + "280698", + "114.4%", + "114.4%", + "114.4%" + ], + [ + "los lagos", + "327881", + "333800", + "661681", + "316363", + "306929", + "623292", + "103.6%", + "108.8%", + "106.2%" + ], + [ + "aisén", + "47425", + "42583", + "90008", + "40412", + "35537", + "75950", + "117.4%", + "119.8%", + "118.5%" + ], + [ + "magallanes", + "81474", + "71255", + "152729", + "63257", + "56295", + "119552", + "128.8%", + "126.6%", + "127.8%" + ] + ], + "title": "", + "original_id": "a8f73d171ce1a708942eea5752a1eb05" + }, + { + "_id": "3e613a61878bd55cbd32ba3a9d921cfd", + "header": [ + "name", + "faith", + "type", + "intake", + "dcsf number", + "ofsted number" + ], + "rows": [ + [ + "boxmoor", + "-", + "primary", + "30", + "2041", + "117107" + ], + [ + "chaulden", + "-", + "infants", + "50", + "2193", + "117202" + ], + [ + "chaulden", + "-", + "junior", + "60", + "2185", + "117198" + ], + [ + "gade valley", + "-", + "jmi", + "30", + "2274", + "117249" + ], + [ + "galley hill", + "-", + "primary", + "45", + "3990", + "135224" + ], + [ + "heath lane", + "-", + "nursery", + "80", + "1009", + "117070" + ], + [ + "micklem", + "-", + "primary", + "30", + "2243", + "117231" + ], + [ + "pixies hill", + "-", + "primary", + "30", + "2293", + "117256" + ], + [ + "st cuthbert mayne", + "rc", + "junior", + "60", + "3386", + "117468" + ], + [ + "st rose 's", + "rc", + "infants", + "60", + "3409", + "117484" + ], + [ + "south hill", + "-", + "primary", + "30", + "2047", + "117110" + ] + ], + "title": "", + "original_id": "566c9200cea18c995a6c5cfb3ef59f71" + }, + { + "_id": "fdb401c840777ab5319938dc83ffabf7", + "header": [ + "place", + "code", + "area (km 2 )", + "population", + "most spoken language" + ], + "rows": [ + [ + "addo elephant national park", + "20602", + "1.08", + "90", + "xhosa" + ], + [ + "addo", + "20601", + "3.21", + "1752", + "afrikaans" + ], + [ + "barsheba", + "20603", + "0.61", + "517", + "xhosa" + ], + [ + "bontrug", + "20604", + "2.33", + "6806", + "xhosa" + ], + [ + "enon", + "20605", + "0.4", + "782", + "afrikaans" + ], + [ + "kirkwood", + "20606", + "3.07", + "2749", + "afrikaans" + ], + [ + "kwazenzele", + "20607", + "3.62", + "3733", + "xhosa" + ], + [ + "nomathamsanqa", + "20608", + "1.53", + "9266", + "xhosa" + ], + [ + "paterson", + "20609", + "0.22", + "671", + "afrikaans" + ], + [ + "remainder of the municipality", + "20610", + "3491.83", + "15218", + "xhosa" + ] + ], + "title": "", + "original_id": "6e909081b29bd08e4a7c528b6b5e1d84" + }, + { + "_id": "e6027c98b7153eec4722e2ca1dd5ab5b", + "header": [ + "years covered", + "all bills sponsored", + "all amendments sponsored", + "all bills cosponsored", + "all amendments cosponsored", + "bills originally cosponsored", + "amendments originally cosponsored" + ], + "rows": [ + [ + "2007 - 08", + "22", + "16", + "133", + "74", + "101", + "57" + ], + [ + "2005 - 06", + "75", + "68", + "152", + "42", + "113", + "36" + ], + [ + "2003 - 04", + "77", + "112", + "181", + "47", + "116", + "39" + ], + [ + "2001 - 02", + "54", + "178", + "121", + "55", + "97", + "53" + ], + [ + "1999 - 00", + "102", + "65", + "175", + "37", + "110", + "33" + ], + [ + "1997 - 98", + "74", + "150", + "147", + "59", + "79", + "50" + ], + [ + "1995 - 96", + "80", + "137", + "118", + "61", + "66", + "56" + ], + [ + "1993 - 94", + "53", + "91", + "201", + "89", + "98", + "82" + ], + [ + "1991 - 92", + "159", + "52", + "353", + "66", + "175", + "63" + ], + [ + "1989 - 90", + "39", + "24", + "247", + "86", + "150", + "81" + ], + [ + "1987 - 88", + "24", + "15", + "342", + "79", + "171", + "76" + ], + [ + "1985 - 86", + "12", + "10", + "335", + "0", + "117", + "0" + ], + [ + "1983 - 84", + "6", + "1", + "286", + "0", + "107", + "0" + ] + ], + "title": "", + "original_id": "7dcf69b8604e3dd7f98f12ad742452c4" + }, + { + "_id": "d9add5665185412c2901c73a4fdce659", + "header": [ + "Month", + "M36", + "M36B1", + "M36B2" + ], + "rows": [ + [ + "April 1944", + "25", + "0", + "0" + ], + [ + "May 1944", + "100", + "0", + "0" + ], + [ + "June 1944", + "120", + "0", + "0" + ], + [ + "July 1944", + "155", + "0", + "0" + ], + [ + "August 1944", + "100", + "0", + "0" + ], + [ + "October 1944", + "75", + "50", + "0" + ], + [ + "November 1944", + "290", + "93", + "0" + ], + [ + "December 1944", + "348", + "44", + "0" + ], + [ + "May 1945", + "10", + "0", + "50" + ], + [ + "Post-war", + "190", + "0", + "674" + ], + [ + "Total", + "1,413", + "187", + "724" + ] + ], + "title": "", + "original_id": "50e30b3aec81d556db90cb2055da773b" + }, + { + "_id": "ef18503df7d17b7b9c8ac1f56e0ff474", + "header": [ + "peak", + "country", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "jbel toubkal", + "morocco", + "4167", + "3755", + "412" + ], + [ + "m'goun", + "morocco", + "4071", + "1904", + "2167" + ], + [ + "koudiet tirbirhine", + "morocco", + "2456", + "1901", + "555" + ], + [ + "lalla khedidja", + "algeria", + "2308", + "1720", + "588" + ], + [ + "adrar bou nasser", + "morocco", + "3340", + "1642", + "1698" + ], + [ + "djebel chãlia", + "algeria", + "2328", + "1612", + "716" + ], + [ + "jbel igdet", + "morocco", + "3615", + "1609", + "2006" + ] + ], + "title": "", + "original_id": "85e54c4224379fa75e8bb916f8014b3c" + }, + { + "_id": "dbfe6e083b20387bdb8ff758f18162bc", + "header": [ + "Unnamed: 0", + "episode", + "air date", + "rating", + "share", + "rating / share 1849", + "viewers (m)", + "timeslot rank", + "night rank", + "overall rank" + ], + "rows": [ + [ + "1", + "pilot", + "tuesday , march 4 , 2008", + "8.2", + "12", + "4.5 / 11", + "13.47", + "1", + "2", + "6" + ], + [ + "2", + "golden boy", + "thursday , march 6 , 2008", + "6.2", + "10", + "3.5 / 8", + "10.12", + "2", + "4", + "15" + ], + [ + "3", + "soldier 's heart", + "monday , march 10 , 2008", + "5.5", + "8", + "2.5 / 6", + "8.78", + "3", + "6", + "20" + ], + [ + "4", + "honor", + "monday , march 17 , 2008", + "4.5", + "7", + "2.3 / 6", + "7.3", + "4", + "10", + "37" + ], + [ + "5", + "keep the change", + "monday , march 24 , 2008", + "3.8", + "6", + "2.0 / 5", + "6.19", + "4", + "11", + "52" + ], + [ + "6", + "legacy", + "monday , march 31 , 2008", + "4.3", + "6", + "2.1 / 5", + "6.63", + "4", + "10", + "43" + ], + [ + "7", + "reclassified", + "monday , april 7 , 2008", + "4.6", + "7", + "2.2 / 5", + "7.44", + "4", + "n / a", + "37" + ] + ], + "title": "", + "original_id": "0595618d0746974966d38bb82fc99faf" + }, + { + "_id": "51e0dabf094c698d28e08c7bb2ce393f", + "header": [ + "draw", + "artist", + "song", + "jury votes", + "televotes", + "total votes", + "result" + ], + "rows": [ + [ + "1", + "diqesi", + "subiré", + "5", + "4", + "9", + "out" + ], + [ + "2", + "roel", + "y ahora dices", + "6", + "3", + "9", + "out" + ], + [ + "3", + "salva ortega", + "lujuria", + "7", + "7", + "14", + "second chance >final" + ], + [ + "4", + "soraya", + "la noche es para mí", + "12", + "12", + "24", + "final" + ], + [ + "5", + "virginia", + "true love", + "10", + "10", + "20", + "final" + ], + [ + "6", + "calipop", + "burbuja", + "2", + "2", + "4", + "out" + ], + [ + "7", + "ángeles vela", + "vístete de primavera", + "4", + "5", + "9", + "out" + ], + [ + "8", + "jorge gonzález", + "si yo vengo a enamorarte", + "8", + "8", + "16", + "final" + ], + [ + "9", + "electronikboy", + "mon petit oiseau", + "1", + "1", + "2", + "out" + ] + ], + "title": "", + "original_id": "a79cd8ec27af6973720047fe8cd8e217" + }, + { + "_id": "6de538c2086cfcd1de65451d56888048", + "header": [ + "Season", + "Episodes", + "Season Premiere", + "Season Finale" + ], + "rows": [ + [ + "1", + "20", + "March 4, 2006", + "May 13, 2006" + ], + [ + "2", + "52", + "October 7, 2006", + "July 16, 2007" + ], + [ + "3", + "44", + "October 15, 2007", + "June 2, 2008" + ], + [ + "4", + "48", + "October 13, 2008", + "May 11, 2009" + ], + [ + "5", + "40", + "October 12, 2009", + "June 14, 2010" + ], + [ + "6", + "20", + "September 6, 2010", + "December 6, 2010" + ], + [ + "7", + "8", + "October 29, 2013", + "December 17, 2013" + ] + ], + "title": "", + "original_id": "42761f0622ad3513894ab3472e8982bf" + }, + { + "_id": "e938b6bbc8e4035eaeb1fc53ed1fe0d0", + "header": [ + "party", + "administrative panel", + "agricultural panel", + "cultural and educational panel", + "industrial and commercial panel", + "labour panel", + "national university of ireland", + "university of dublin", + "nominated by the taoiseach", + "total" + ], + "rows": [ + [ + "fianna fáil", + "2", + "4", + "2", + "3", + "5", + "0", + "0", + "9", + "25" + ], + [ + "fine gael", + "3", + "4", + "3", + "3", + "2", + "1", + "0", + "0", + "16" + ], + [ + "labour party", + "1", + "1", + "0", + "1", + "2", + "0", + "0", + "0", + "5" + ], + [ + "clann na talmhan", + "0", + "1", + "0", + "0", + "0", + "0", + "0", + "0", + "1" + ], + [ + "independent", + "1", + "0", + "0", + "1", + "1", + "2", + "3", + "1", + "9" + ], + [ + "total", + "7", + "11", + "5", + "9", + "11", + "3", + "3", + "11", + "60" + ] + ], + "title": "", + "original_id": "4c01f2bd62606606466e3bb1cb304423" + }, + { + "_id": "2a21701bc5a848960dbe85e34af4492d", + "header": [ + "peak", + "country", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "mount stanley", + "democratic republic of the congo / uganda", + "5109", + "3951", + "1158" + ], + [ + "mount karisimbi", + "rwanda / democratic republic of the congo", + "4507", + "3312", + "1195" + ], + [ + "kinyeti", + "south sudan", + "3187", + "2120", + "1067" + ], + [ + "emogadong", + "south sudan", + "2623", + "1730", + "893" + ], + [ + "kabobo", + "democratic republic of the congo", + "2725", + "1604", + "1121" + ], + [ + "mont mohi", + "democratic republic of the congo", + "3480", + "1592", + "1888" + ], + [ + "wuhevi", + "democratic republic of the congo", + "3095", + "1570", + "1525" + ], + [ + "mount muhabura", + "rwanda / uganda", + "4127", + "1530", + "2597" + ] + ], + "title": "", + "original_id": "c8a0829ce6f11dd2af255ba6d1e54552" + }, + { + "_id": "df4d1d05e6bd35298b23c288ff0c4f2f", + "header": [ + "cost", + "2400 kwh / kwp y", + "2200 kwh / kwp y", + "2000 kwh / kwp y", + "1800 kwh / kwp y", + "1600 kwh / kwp y", + "1400 kwh / kwp y", + "1200 kwh / kwp y", + "1000 kwh / kwp y", + "800 kwh / kwp y" + ], + "rows": [ + [ + "200 / kwp", + "0.8", + "0.9", + "1.0", + "1.1", + "1.3", + "1.4", + "1.7", + "2.0", + "2.5" + ], + [ + "600 / kwp", + "2.5", + "2.7", + "3.0", + "3.3", + "3.8", + "4.3", + "5.0", + "6.0", + "7.5" + ], + [ + "1000 / kwp", + "4.2", + "4.5", + "5.0", + "5.6", + "6.3", + "7.1", + "8.3", + "10.0", + "12.5" + ], + [ + "1400 / kwp", + "5.8", + "6.4", + "7.0", + "7.8", + "8.8", + "10.0", + "11.7", + "14.0", + "17.5" + ], + [ + "1800 / kwp", + "7.5", + "8.2", + "9.0", + "10.0", + "11.3", + "12.9", + "15.0", + "18.0", + "22.5" + ], + [ + "2200 / kwp", + "9.2", + "10.0", + "11.0", + "12.2", + "13.8", + "15.7", + "18.3", + "22.0", + "27.5" + ], + [ + "2600 / kwp", + "10.8", + "11.8", + "13.0", + "14.4", + "16.3", + "18.6", + "21.7", + "26.0", + "32.5" + ], + [ + "3000 / kwp", + "12.5", + "13.6", + "15.0", + "16.7", + "18.8", + "21.4", + "25.0", + "30.0", + "37.5" + ], + [ + "3400 / kwp", + "14.2", + "15.5", + "17.0", + "18.9", + "21.3", + "24.3", + "28.3", + "34.0", + "42.5" + ], + [ + "3800 / kwp", + "15.8", + "17.3", + "19.0", + "21.1", + "23.8", + "27.1", + "31.7", + "38.0", + "47.5" + ], + [ + "4200 / kwp", + "17.5", + "19.1", + "21.0", + "23.3", + "26.3", + "30.0", + "35.0", + "42.0", + "52.5" + ], + [ + "4600 / kwp", + "19.2", + "20.9", + "23.0", + "25.6", + "28.8", + "32.9", + "38.3", + "46.0", + "57.5" + ] + ], + "title": "", + "original_id": "73a06f4dbbb1534fa4a19027c6802804" + }, + { + "_id": "12d2a27f8f2c820ca6626be6b70ab5e9", + "header": [ + "rank", + "country", + "2009", + "2010", + "2011" + ], + "rows": [ + [ + "1.0", + "china", + "8038703", + "8651831", + "9174280" + ], + [ + "2.0", + "italy", + "8242500", + "7787800", + "7115500" + ], + [ + "3.0", + "united states", + "6629198", + "6777731", + "6756449" + ], + [ + "4.0", + "france", + "6101525", + "5794433", + "6588904" + ], + [ + "5.0", + "spain", + "5535333", + "6107617", + "5809315" + ], + [ + "6.0", + "turkey", + "4264720", + "4255000", + "4296351" + ], + [ + "7.0", + "chile", + "2600000", + "2903000", + "3149380" + ], + [ + "8.0", + "argentina", + "2181567", + "2616613", + "2750000" + ], + [ + "9.0", + "iran", + "2305000", + "2225000", + "2240000" + ], + [ + "10.0", + "australia", + "1797012", + "1684345", + "1715717" + ], + [ + null, + "world", + "58521410", + "58292101", + "58500118" + ] + ], + "title": "", + "original_id": "78701cee63f205291b864544107432ef" + }, + { + "_id": "de319d05bfe79146ba016a50a6111ed1", + "header": [ + "member countries", + "population", + "area (km square)", + "gdp (billion us)", + "gdp per capita (us)" + ], + "rows": [ + [ + "belgium", + "9052707", + "30528", + "58.316", + "46878" + ], + [ + "france", + "44788852", + "674843", + "312.966", + "40690" + ], + [ + "west germany", + "54292038", + "248717", + "400.554", + "41168" + ], + [ + "italy", + "49476000", + "301336", + "265.192", + "30116" + ], + [ + "luxembourg", + "310291", + "2586", + "2.938", + "113533" + ], + [ + "netherlands", + "11186847", + "41526", + "83.351", + "50355" + ], + [ + "ec6 (1958)", + "169106736", + "1299536", + "1123.317", + "6643" + ] + ], + "title": "", + "original_id": "8869ae21589a1ab50a40faf5d85d8eaf" + }, + { + "_id": "86e838cab7ad80f58d8a11ffdd12231b", + "header": [ + "draw", + "language", + "song", + "english translation", + "place", + "points" + ], + "rows": [ + [ + "1", + "english", + "wait until the weekend comes", + "-", + "6", + "91" + ], + [ + "2", + "finnish", + "eläköön elämä", + "long live life", + "9", + "58" + ], + [ + "3", + "greek", + "to katalava arga (το κατάλαβα αργά)", + "i realised it too late", + "16", + "15" + ], + [ + "4", + "danish", + "sku' du spørg' fra no'en", + "what business is it of yours", + "11", + "41" + ], + [ + "5", + "spanish", + "la fiesta terminó", + "the party 's over", + "14", + "36" + ], + [ + "6", + "french", + "femme dans ses rêves aussi", + "woman in her dreams too", + "10", + "56" + ], + [ + "7", + "turkish", + "didai didai dai", + "-", + "14", + "36" + ], + [ + "8", + "dutch", + "laat me nu gaan", + "let me go now", + "19", + "7" + ], + [ + "9", + "portuguese", + "penso em ti , eu sei", + "thinking of you , i know", + "18", + "9" + ], + [ + "10", + "german", + "für alle", + "for everyone", + "2", + "105" + ], + [ + "11", + "hebrew", + "olé , olé (עולה , עולה)", + "going up and up", + "5", + "93" + ], + [ + "12", + "italian", + "magic oh magic", + "-", + "7", + "78" + ], + [ + "13", + "norwegian", + "la det swinge", + "let it swing", + "1", + "123" + ], + [ + "14", + "english", + "love is", + "-", + "4", + "100" + ], + [ + "15", + "german", + "piano , piano", + "slowly , slowly", + "12", + "39" + ], + [ + "16", + "swedish", + "bra vibrationer", + "good vibrations", + "3", + "103" + ], + [ + "17", + "german", + "kinder dieser welt", + "children of this world", + "8", + "60" + ], + [ + "18", + "french", + "children , kinder , enfants", + "children", + "13", + "37" + ], + [ + "19", + "greek", + "miazoume (μοιάζουμε)", + "we are alike", + "16", + "15" + ] + ], + "title": "", + "original_id": "1882bbbc5b4f7879c02b463929d39f67" + }, + { + "_id": "3a9954cb3c847ed889eb655db9e0ccbc", + "header": [ + "Rank", + "Death toll", + "Magnitude", + "Location", + "Depth (km)", + "Date" + ], + "rows": [ + [ + "1", + "60,000", + "7.5", + "Pakistan Baluchistan, Pakistan", + "25.0", + "May 30" + ], + [ + "2", + "3,276", + "7.0", + "Taiwan Taichung City, Taiwan", + "15.0", + "April 20" + ], + [ + "3", + "2,746", + "6.5", + "Taiwan Miaoli County, Taiwan", + "30.0", + "July 16" + ], + [ + "4", + "690", + "6.4", + "Iran Mazandaran Province, Iran", + "15.0", + "April 11" + ], + [ + "5", + "540", + "6.0", + "Turkey Agri Province, Turkey", + "35.0", + "May 1" + ], + [ + "6", + "100", + "6.0", + "China Sichuan Province, China", + "35.0", + "December 18" + ], + [ + "7", + "60", + "6.0", + "Iran Mazandaran Province, Iran", + "35.0", + "March 5" + ], + [ + "8", + "51", + "6.8", + "Greece southern Aegean Sea, Greece", + "80.0", + "February 25" + ] + ], + "title": "", + "original_id": "dd778956ba0b5266e7a32a45bf8ab123" + }, + { + "_id": "0dac20fe5f692925af23de60b0a85b80", + "header": [ + "rank (2012)", + "rank (2010)", + "employer", + "industry", + "2012 employees (total)", + "2010 employees (total)", + "2007 employees (total)", + "head office" + ], + "rows": [ + [ + "1", + "1", + "alberta health services", + "healthcare", + "99400", + "92200", + "see note", + "edmonton" + ], + [ + "2", + "2", + "canada safeway limited", + "wholesale and retail trade", + "30000", + "30000", + "34318", + "calgary" + ], + [ + "3", + "6", + "agrium inc", + "agri - business", + "14800", + "11153", + "n / a", + "calgary" + ], + [ + "4", + "7", + "university of alberta", + "education", + "14500", + "10800", + "11000", + "edmonton" + ], + [ + "5", + "4", + "canadian pacific railway", + "transportation", + "14169", + "14970", + "15232", + "calgary" + ], + [ + "6", + "5", + "suncor energy", + "petroleum resource industry", + "13026", + "12978", + "5800", + "calgary" + ], + [ + "7", + "9", + "shaw communications", + "communications", + "12500", + "10000", + "8985", + "calgary" + ], + [ + "8", + "8", + "flint energy services ltd", + "energy", + "11211", + "10280", + "6169", + "calgary" + ], + [ + "9", + "11", + "stantec inc", + "professional services", + "11100", + "9300", + "n / a", + "edmonton" + ], + [ + "10", + "12", + "calgary board of education", + "public education", + "9106", + "9278", + "10972", + "calgary" + ] + ], + "title": "", + "original_id": "251b26a4fad061d606ee5854eae48f42" + }, + { + "_id": "7633b65a5e25fc45e2f9264f08c96990", + "header": [ + "team", + "wins", + "losses", + "ties", + "win pct" + ], + "rows": [ + [ + "arizona cardinals", + "2", + "1", + "0", + "0.667" + ], + [ + "atlanta falcons", + "3", + "1", + "1", + "0.7" + ], + [ + "baltimore ravens", + "13", + "9", + "0", + "0.591" + ], + [ + "buffalo bills", + "5", + "2", + "0", + "0.714" + ], + [ + "carolina panthers", + "3", + "1", + "0", + "0.75" + ], + [ + "chicago bears", + "3", + "1", + "0", + "0.75" + ], + [ + "cincinnati bengals", + "21", + "9", + "0", + "0.7" + ], + [ + "cleveland browns", + "19", + "5", + "0", + "0.792" + ], + [ + "dallas cowboys", + "1", + "2", + "0", + "0.333" + ], + [ + "denver broncos", + "1", + "3", + "0", + "0.25" + ], + [ + "detroit lions", + "4", + "1", + "0", + "0.8" + ], + [ + "green bay packers", + "2", + "2", + "0", + "0.5" + ], + [ + "houston texans", + "1", + "1", + "0", + "0.5" + ], + [ + "indianapolis colts", + "4", + "1", + "0", + "0.8" + ], + [ + "jacksonville jaguars", + "8", + "10", + "0", + "0.444" + ], + [ + "kansas city chiefs", + "5", + "3", + "0", + "0.625" + ], + [ + "miami dolphins", + "5", + "2", + "0", + "0.714" + ], + [ + "minnesota vikings", + "2", + "2", + "0", + "0.5" + ], + [ + "new england patriots", + "4", + "3", + "0", + "0.571" + ], + [ + "new orleans saints", + "2", + "1", + "0", + "0.667" + ], + [ + "new york giants", + "2", + "1", + "0", + "0.667" + ], + [ + "new york jets", + "4", + "1", + "0", + "0.8" + ], + [ + "oakland raiders", + "5", + "2", + "0", + "0.714" + ], + [ + "philadelphia eagles", + "2", + "2", + "0", + "0.5" + ], + [ + "st louis rams", + "1", + "2", + "0", + "0.333" + ], + [ + "san diego chargers", + "7", + "2", + "0", + "0.778" + ], + [ + "san francisco 49ers", + "1", + "3", + "0", + "0.25" + ], + [ + "seattle seahawks", + "2", + "4", + "0", + "0.333" + ], + [ + "tampa bay buccaneers", + "3", + "1", + "0", + "0.75" + ], + [ + "tennessee titans", + "11", + "12", + "0", + "0.478" + ], + [ + "washington redskins", + "3", + "0", + "0", + "1.0" + ], + [ + "totals :", + "149", + "90", + "1", + "0.623" + ] + ], + "title": "", + "original_id": "4b4ff8f17963fa7ba3edd5cae2c32abb" + }, + { + "_id": "b5a1abdd82e581122fe1f9dca66ec875", + "header": [ + "event", + "date", + "dp / da", + "np / nnp", + "cope", + "acdp", + "others" + ], + "rows": [ + [ + "1994 election", + "27 april 1994", + "3", + "23", + "-", + "1", + "1" + ], + [ + "1999 election", + "2 june 1999", + "5", + "17", + "-", + "1", + "1" + ], + [ + "2003 floor - crossing", + "4 april 2003", + "7", + "10", + "-", + "2", + "1" + ], + [ + "2004 election", + "14 april 2004", + "12", + "5", + "-", + "2", + "1" + ], + [ + "2005 floor - crossing", + "15 september 2005", + "13", + "-", + "-", + "2", + "2" + ], + [ + "2007 floor - crossing", + "15 september 2007", + "11", + "-", + "-", + "2", + "1" + ], + [ + "2009 election", + "22 april 2009", + "22", + "-", + "3", + "1", + "0" + ] + ], + "title": "", + "original_id": "c04b6beeac5ae498a58265f212f78fbb" + }, + { + "_id": "587710d0e896ea5870bd307fd6cdcd31", + "header": [ + "year", + "theme", + "artist", + "finish", + "issue price", + "total mintage" + ], + "rows": [ + [ + "2002", + "golden tulip", + "anthony testa", + "proof (selectively gold plated)", + "24.95", + "19986" + ], + [ + "2003", + "golden daffodil", + "christie paquet", + "proof (selectively gold plated)", + "34.95", + "36293" + ], + [ + "2004", + "golden easter lily", + "christie paquet", + "proof (selectively gold plated)", + "34.95", + "23486" + ], + [ + "2005", + "golden rose", + "christie paquet", + "proof (selectively gold plated)", + "34.95", + "23000" + ], + [ + "2006", + "golden daisy", + "christie paquet", + "proof (selectively gold plated)", + "34.95", + "23000" + ], + [ + "2007", + "golden forget - me - not", + "christie paquet", + "proof (selectively gold plated)", + "38.95", + "20000" + ] + ], + "title": "", + "original_id": "5eb7d24afce65f474b46fe270f680c2e" + }, + { + "_id": "977ac6ed4e8f11fd3afae71c9787c1e2", + "header": [ + "date of sterilization", + "age 10 - 19", + "age 20 - 29", + "age 30 - 39", + "age 40 - 49", + "age 50 - 59", + "age unknown", + "total" + ], + "rows": [ + [ + "jan 1929 - jun 1935", + "87", + "87", + "42", + "4", + "2", + "1", + "223" + ], + [ + "jul 1935 - jun 1940", + "380", + "205", + "112", + "11", + "1", + "0", + "709" + ], + [ + "jul 1940 - jun 1950", + "727", + "593", + "249", + "36", + "0", + "1", + "1606" + ], + [ + "jul 1950 - jun 1960", + "936", + "1201", + "745", + "93", + "8", + "0", + "2983" + ], + [ + "jul 1960 - dec 1968", + "686", + "717", + "260", + "23", + "1", + "0", + "1687" + ], + [ + "jan 1969 - dec 1974", + "174", + "118", + "26", + "2", + "0", + "0", + "320" + ] + ], + "title": "", + "original_id": "ca00171fdb93e37efc302c26a7d0ec28" + }, + { + "_id": "73ddb356678fa535ff2ef1da3930db6b", + "header": [ + "code", + "type", + "name", + "area (km 2 )", + "population", + "regional county municipality", + "region" + ], + "rows": [ + [ + "95005", + "vl", + "tadoussac", + "74.59", + "832", + "la haute - côte - nord", + "9" + ], + [ + "95010", + "m", + "sacré - cur", + "341.74", + "2093", + "la haute - côte - nord", + "9" + ], + [ + "95018", + "m", + "les bergeronnes", + "291.89", + "660", + "la haute - côte - nord", + "9" + ], + [ + "95025", + "m", + "les escoumins", + "267.33", + "2031", + "la haute - côte - nord", + "9" + ], + [ + "95032", + "m", + "longue - rive", + "295.35", + "1317", + "la haute - côte - nord", + "9" + ], + [ + "95040", + "m", + "portneuf - sur - mer", + "241.23", + "885", + "la haute - côte - nord", + "9" + ], + [ + "95045", + "v", + "forestville", + "241.73", + "3637", + "la haute - côte - nord", + "9" + ], + [ + "95050", + "m", + "colombier", + "313.2", + "868", + "la haute - côte - nord", + "9" + ], + [ + "96005", + "vl", + "baie - trinité", + "536.33", + "569", + "manicouagan", + "9" + ], + [ + "96010", + "vl", + "godbout", + "204.34", + "318", + "manicouagan", + "9" + ], + [ + "96015", + "m", + "franquelin", + "529.84", + "341", + "manicouagan", + "9" + ], + [ + "96020", + "v", + "baie - comeau", + "371.69", + "22613", + "manicouagan", + "9" + ], + [ + "96025", + "vl", + "pointe - lebel", + "91.16", + "1943", + "manicouagan", + "9" + ], + [ + "96030", + "vl", + "pointe - aux - outardes", + "71.56", + "1389", + "manicouagan", + "9" + ], + [ + "96035", + "vl", + "chute - aux - outardes", + "8.31", + "1882", + "manicouagan", + "9" + ], + [ + "96040", + "p", + "ragueneau", + "215.92", + "1529", + "manicouagan", + "9" + ], + [ + "97007", + "v", + "sept - îles", + "1969.42", + "25276", + "sept - rivières", + "9" + ], + [ + "97022", + "v", + "port - cartier", + "1073.7", + "6865", + "sept - rivières", + "9" + ], + [ + "97035", + "v", + "fermont", + "497.45", + "2487", + "caniapiscau", + "9" + ], + [ + "97040", + "v", + "schefferville", + "39.02", + "249", + "caniapiscau", + "9" + ], + [ + "98005", + "m", + "blanc - sablon", + "254.49", + "1293", + "le golfe - du - saint - laurent", + "9" + ], + [ + "98010", + "m", + "bonne - espérance", + "721.28", + "839", + "le golfe - du - saint - laurent", + "9" + ], + [ + "98012", + "m", + "saint - augustin", + "1435.82", + "853", + "le golfe - du - saint - laurent", + "9" + ], + [ + "98014", + "m", + "gros - mécatina", + "961.46", + "538", + "le golfe - du - saint - laurent", + "9" + ], + [ + "98015", + "m", + "côte - nord - du - golfe - du - saint - laurent", + "2783.59", + "1155", + "le golfe - du - saint - laurent", + "9" + ], + [ + "98020", + "m", + "l'île - d'anticosti", + "7923.16", + "263", + "minganie", + "9" + ], + [ + "98025", + "ct", + "natashquan", + "193.2", + "374", + "minganie", + "9" + ], + [ + "98030", + "m", + "aguanish", + "594.4", + "312", + "minganie", + "9" + ], + [ + "98035", + "m", + "baie - johan - beetz", + "425.31", + "85", + "minganie", + "9" + ], + [ + "98040", + "m", + "havre - saint - pierre", + "3779.89", + "3240", + "minganie", + "9" + ], + [ + "98045", + "m", + "longue - pointe - de - mingan", + "417.6", + "501", + "minganie", + "9" + ], + [ + "98050", + "m", + "rivière - saint - jean", + "652.54", + "284", + "minganie", + "9" + ], + [ + "98055", + "m", + "rivière - au - tonnerre", + "1331.17", + "365", + "minganie", + "9" + ] + ], + "title": "", + "original_id": "092c7277b67f6da76a00a049f8ede3b9" + }, + { + "_id": "fc048e1cd7a7f48d16a64e9bb9eb042f", + "header": [ + "Rank", + "Magnitude", + "Death toll", + "Location", + "Depth (km)", + "MMI", + "Date" + ], + "rows": [ + [ + "1", + "8.3", + "0", + "Russia Russia", + "608.9", + "V", + "May 24" + ], + [ + "2", + "8.0", + "13", + "Solomon Islands Solomon Islands", + "29", + "VIII", + "February 7" + ], + [ + "3", + "7.7", + "35", + "Iran Iran", + "82", + "VII", + "April 16" + ], + [ + "3", + "7.7", + "825", + "Pakistan Pakistan", + "20.0", + "IX", + "September 24" + ], + [ + "3", + "7.7", + "0", + "Antarctica Coronation Island, Antarctica", + "10", + "VII", + "November 17" + ], + [ + "6", + "7.5", + "0", + "United States United States", + "9.9", + "VI", + "January 5" + ], + [ + "7", + "7.4", + "0", + "Tonga Tonga", + "171.4", + "V", + "May 23" + ], + [ + "8", + "7.3", + "0", + "Papua New Guinea Papua New Guinea", + "386.3", + "IV", + "July 7" + ], + [ + "8", + "7.3", + "0", + "South Georgia and the South Sandwich Islands South Georgia and the South Sandwich Islands", + "31.3", + "VI", + "July 15" + ], + [ + "10", + "7.2", + "0", + "Russia Russia", + "123.3", + "VII", + "April 19" + ], + [ + "11", + "7.1", + "0", + "Solomon Islands Solomon Islands", + "10.1", + "VI", + "February 6" + ], + [ + "11", + "7.1", + "0", + "Solomon Islands Santa Cruz Islands", + "21", + "VII", + "February 8" + ], + [ + "11", + "7.1", + "3", + "Peru Peru", + "40", + "VIII", + "September 25" + ], + [ + "11", + "7.1", + "222", + "Philippines Philippines", + "20.0", + "IX", + "October 15" + ], + [ + "11", + "7.1", + "0", + "Japan Japan", + "26.1", + "III", + "October 25" + ], + [ + "16", + "7.0", + "0", + "Solomon Islands Solomon Islands", + "10.1", + "VII", + "February 6" + ], + [ + "16", + "7.0", + "0", + "Indonesia Indonesia", + "66", + "VI", + "April 6" + ], + [ + "16", + "7.0", + "0", + "United States United States", + "33.5", + "VI", + "August 30" + ], + [ + "16", + "7.0", + "0", + "Falkland Islands Falkland Islands", + "10", + "I", + "November 25" + ] + ], + "title": "", + "original_id": "3e5bae52d54ea5a02750c0f0bb794736" + }, + { + "_id": "cadada2b3d6f45b1f75b542ab5bca024", + "header": [ + "Year", + "Award", + "Category", + "Nominated Work", + "Result", + "Notes" + ], + "rows": [ + [ + "2017", + "Global Music Awards", + "Jazz Music Album", + "Bein' Green", + "Silver Medal", + "-" + ], + [ + "2017", + "Global Music Awards", + "Album", + "Bein' Green", + "Silver Medal", + "-" + ], + [ + "2017", + "Hollywood Music in Media Awards", + "Jazz", + "Sunny Morning", + "Nominated", + "edition #8 (2017)" + ], + [ + "2017", + "Radio Music Awards", + "Jazz", + "Sunny Morning", + "Won", + "-" + ], + [ + "2017", + "Radio Music Awards", + "Jazz", + "Flying Away", + "Won", + "-" + ], + [ + "2018", + "16th Independent Music Awards", + "Jazz", + "Funky Party", + "Won", + "Vox Populi Award" + ], + [ + "2018", + "Indie Music Channel Awards", + "Jazz Song", + "Flying Away", + "Won", + "-" + ], + [ + "2018", + "Indie Music Channel Awards", + "Jazz Recording", + "Tears For Niro", + "Won", + "-" + ], + [ + "2018", + "Indie Music Channel Awards", + "Jazz Instrumentalist", + "Funky Party", + "Won", + "-" + ], + [ + "2018", + "Indie Music Channel Awards", + "Jazz Producer", + "Cabriolet", + "Won", + "-" + ], + [ + "2018", + "Indie Music Channel Awards", + "Jazz Video", + "Sunny Morning", + "Won", + "Natalia Vlaskina co-winner" + ], + [ + "2018", + "Indie Music Channel Awards", + "Best New Male Artist of the Year", + "-", + "Won", + "-" + ], + [ + "2018", + "Indie Music Channel Awards", + "Recording of the Year", + "Tears For Niro", + "-", + "-" + ], + [ + "2018", + "Hollywood Music in Media Awards", + "Jazz", + "Funky Party", + "Nominated", + "edition #9 (2018)" + ], + [ + "2018", + "Annual TheMothFM Jazz Awards (GMFM -DB Radio Group)", + "Best Overall Artist 2018", + "-", + "Winner", + "-" + ], + [ + "2018", + "UK Songwriting Contest 2018", + "Jazz/Blues", + "Flying Away", + "Finalist", + "-" + ], + [ + "2018", + "UK Songwriting Contest 2018", + "Jazz/Blues", + "Funky Party", + "Finalist", + "-" + ], + [ + "2018", + "UK Songwriting Contest 2018", + "Jazz/Blues", + "Tears For Niro", + "Finalist", + "-" + ], + [ + "2018", + "UK Songwriting Contest 2018", + "Jazz/Blues", + "With You All The Clouds Go Away", + "Finalist", + "-" + ], + [ + "2019", + "17th Independent Music Awards 2019", + "Instrumental", + "Lullaby of Christmas", + "nominee", + "Winner TBA in June 2019" + ] + ], + "title": "", + "original_id": "b19bad70a2dd3e356e8c6d038fa2bfd3" + }, + { + "_id": "35d97569c1d80746eff0b638b32b9623", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "1981", + "Maghreb Championships", + "Algiers, Algeria", + "2nd", + "20,000 m walk", + "1:34:07.4" + ], + [ + "1981", + "Arab Championships", + "Tunis, Tunisia", + "2nd", + "20 km walk", + "1:41:40" + ], + [ + "1983", + "Maghreb Championships", + "Casablanca, Morocco", + "2nd", + "20,000 m walk", + "1:32:38.1" + ], + [ + "1983", + "World Championships", + "Helsinki, Finland", + "35th", + "20 km walk", + "1:29:53" + ], + [ + "1984", + "Olympic Games", + "Los Angeles, United States", + "26th", + "20 km walk", + "1:31:24" + ], + [ + "1984", + "African Championships", + "Rabat, Morocco", + "1st", + "20 km walk", + "1:30:02" + ], + [ + "1985", + "World Race Walking Cup", + "St John's, Isle of Man", + "37th", + "20 km walk", + "1:32:51" + ], + [ + "1985", + "African Championships", + "Cairo, Egypt", + "1st", + "20 km walk", + "1:33:28" + ], + [ + "1985", + "Pan Arab Games", + "Casablanca, Morocco", + "1st", + "20 km walk", + "1:32:31" + ], + [ + "1986", + "Maghreb Championships", + "Tunis, Tunisia", + "1st", + "20 km walk", + "1:36:19" + ], + [ + "1987", + "World Race Walking Cup", + "New York City, United States", + "40th", + "20 km walk", + "1:26:17" + ], + [ + "1987", + "Arab Championships", + "Algiers, Algeria", + "1st", + "20 km walk", + "1:30:39" + ], + [ + "1987", + "World Championships", + "Rome, Italy", + "35th", + "20 km walk", + "1:34:26" + ], + [ + "1988", + "African Championships", + "Annaba, Algeria", + "2nd", + "20 km walk", + "1:34:07" + ], + [ + "1988", + "Olympic Games", + "Seoul, South Korea", + "32nd", + "20 km walk", + "1:26:33" + ], + [ + "1989", + "World Race Walking Cup", + "Barcelona, Spain", + "34th", + "20 km walk", + "1:26:04" + ], + [ + "1989", + "African Championships", + "Lagos, Nigeria", + "2nd", + "20 km walk", + "1:36:49" + ], + [ + "1989", + "Arab Championships", + "Cairo, Egypt", + "2nd", + "20 km walk", + "1:51:52" + ], + [ + "1990", + "African Championships", + "Cairo, Egypt", + "2nd", + "20 km walk", + "1:31:00" + ], + [ + "1991", + "World Race Walking Cup", + "San Jose, United States", + "62nd", + "20 km walk", + "1:29:51" + ], + [ + "1991", + "Mediterranean Games", + "Athens, Greece", + "7th", + "20 km walk", + "1:33:27" + ], + [ + "1991", + "All-Africa Games", + "Cairo, Egypt", + "2nd", + "20 km walk", + "1:35:21" + ], + [ + "1992", + "Pan Arab Games", + "Latakia, Syria", + "1st", + "20 km walk", + "1:32:31" + ], + [ + "1993", + "World Championships", + "Stuttgart, Germany", + "34th", + "20 km walk", + "1:35:48" + ] + ], + "title": "", + "original_id": "ddd1519eb6a5c5ff75883d73e61f6704" + }, + { + "_id": "ccd8044ce52b715704b7c4848dbe3b82", + "header": [ + "year", + "competition", + "venue", + "position", + "event", + "notes" + ], + "rows": [ + [ + "2006", + "nacac u23 championships", + "santo domingo , dominican republic", + "3rd", + "4100 m relay", + "39.98" + ], + [ + "2007", + "nacac championships", + "san salvador , el salvador", + "1st", + "100 m", + "10.32" + ], + [ + "2007", + "nacac championships", + "san salvador , el salvador", + "3rd", + "4100 m relay", + "39.92" + ], + [ + "2007", + "pan american games", + "rio de janeiro , brazil", + "4th (h)", + "4100 m relay", + "39.02" + ], + [ + "2007", + "world championships", + "osaka , japan", + "31st (h)", + "100 m", + "10.44" + ], + [ + "2008", + "central american and caribbean championships", + "cali , colombia", + "1st", + "4100 m relay", + "38.54" + ], + [ + "2008", + "olympic games", + "beijing , china", + "2nd", + "100 m", + "9.89" + ], + [ + "2008", + "olympic games", + "beijing , china", + "2nd", + "4100 m relay", + "38.06" + ], + [ + "2009", + "world championships", + "berlin , germany", + "5th", + "100 m", + "9.93" + ], + [ + "2009", + "world championships", + "berlin , germany", + "2nd", + "4100 m relay", + "37.62" + ], + [ + "2011", + "world championships", + "daegu , south korea", + "10th (sf)", + "100 m", + "10.2" + ], + [ + "2011", + "world championships", + "daegu , south korea", + "6th", + "4100 m relay", + "39.01" + ], + [ + "2012", + "olympic games", + "london , united kingdom", + "7th", + "100 m", + "9.98" + ], + [ + "2012", + "olympic games", + "london , united kingdom", + "3rd", + "4100 m relay", + "38.12" + ] + ], + "title": "", + "original_id": "2188238068289d7a4408ca02a059bc48" + }, + { + "_id": "133c8e77ae9610616c74eeacc93b7bc9", + "header": [ + "year", + "men 's singles", + "women 's singles", + "men 's doubles", + "women 's doubles", + "mixed doubles" + ], + "rows": [ + [ + "1975", + "victor yusim", + "no competition", + "victor yusim michael schneidman", + "no competition", + "no competition" + ], + [ + "1976", + "michael schneidman", + "tineke hof", + "victor yusim michael schneidman", + "tineke hof devora geffen", + "no competition" + ], + [ + "1977", + "victor yusim", + "eva unglick", + "victor yusim michael schneidman", + "eva unglick chaya grunstein", + "no competition" + ], + [ + "1978", + "victor yusim", + "chaya grunstein", + "victor yusim michael schneidman", + "chaya grunstein carole silman", + "michael rappaport carole silman" + ], + [ + "1979", + "victor yusim", + "eva unglick", + "victor yusim michael schneidman", + "eva unglick chaya grunstein", + "nissim duk eva unglick" + ], + [ + "1980", + "yitzhak serrouya", + "elka kalb", + "nissim duk yitzhak serrouya", + "elka kalb irit ben shushan", + "michael rappaport eva unglick" + ], + [ + "1981", + "johann ratheyser", + "adelhid losek", + "johann rathyser gerard hofegger", + "eva unglick irit ben shushan", + "johann ratheyser adelheid losek" + ], + [ + "1982", + "andrew downes", + "lisa salmon", + "david spurling stuart spurling", + "lisa salmon j downes", + "david spurling h blake" + ], + [ + "1983 1989", + "no competition", + "no competition", + "no competition", + "no competition", + "no competition" + ], + [ + "1990", + "stephane renault", + "christelle mol", + "ricardo fernandes marco vasconcelos", + "christelle mol virginie delvingt", + "stephane renault elodie mansuy" + ], + [ + "1991 1997", + "no competition", + "no competition", + "no competition", + "no competition", + "no competition" + ], + [ + "1998", + "aivaras kvedarauskas", + "svetlana zilberman", + "aivaras kvedarauskas nir yusim", + "svetlana zilberman diana koleva", + "leon pugatch svetlana zilberrman" + ], + [ + "1999 2005", + "no competition", + "no competition", + "no competition", + "no competition", + "no competition" + ], + [ + "2006", + "petr koukal", + "maja tvrdy", + "luka petric mateuz srekl", + "no competition", + "luka petric maja tvrdy" + ], + [ + "2007", + "sho sasaki", + "tracey hallam", + "jochen cassel thomas tesche", + "no competition", + "valeriy atrashenkov elena prus" + ] + ], + "title": "", + "original_id": "95f0dcfec48507cc665cc640daf4fe9d" + }, + { + "_id": "b367d3a279cb4b10b3e9286983c41637", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Great Britain", + "Representing Great Britain", + "Representing Great Britain", + "Representing Great Britain", + "Representing Great Britain", + "Representing Great Britain" + ], + [ + "2009", + "World Youth Championships", + "Brixen, Italy", + "1st", + "100 m", + "11.39" + ], + [ + "2009", + "World Youth Championships", + "Brixen, Italy", + "1st", + "200 m", + "23.08" + ], + [ + "2010", + "World Junior Championships", + "Moncton, New Brunswick, Canada", + "1st", + "100m", + "11.40 (wind: -0.7 m/s)" + ], + [ + "2010", + "World Junior Championships", + "Moncton, New Brunswick, Canada", + "2nd", + "200m", + "23.19 (wind: -0.5 m/s)" + ], + [ + "2010", + "World Junior Championships", + "Moncton, New Brunswick, Canada", + "—", + "4 × 100 m relay", + "DNF" + ], + [ + "2011", + "European Indoor Championships", + "Paris, France", + "4th", + "60 m", + "7.21" + ], + [ + "2011", + "European Junior Championships", + "Tallinn, Estonia", + "1st", + "100 m", + "11.18" + ], + [ + "2011", + "European Junior Championships", + "Tallinn, Estonia", + "1st", + "200 m", + "22.94" + ], + [ + "2011", + "European Junior Championships", + "Tallinn, Estonia", + "3rd", + "4 × 100 m", + "45.00" + ], + [ + "2012", + "World Indoor Championships", + "Istanbul, Turkey", + "16th (sf)", + "60 m", + "7.32" + ], + [ + "2013", + "European U23 Championships", + "Tampere, Finland", + "2nd", + "100 m", + "11.42 (wind: -0.7 m/s)" + ], + [ + "2013", + "European U23 Championships", + "Tampere, Finland", + "1st", + "200 m", + "22.92 (wind: -0.5 m/s)" + ], + [ + "2013", + "European U23 Championships", + "Tampere, Finland", + "2nd", + "4 × 100 m", + "43.83" + ], + [ + "2013", + "World Championships", + "Moscow, Russia", + "semi-final", + "200 m", + "23.21" + ], + [ + "2014", + "Commonwealth Games", + "Glasgow, Scotland", + "2nd", + "200 m", + "22.50" + ], + [ + "2014", + "Commonwealth Games", + "Glasgow, Scotland", + "3rd", + "4 × 100 m relay", + "43.10" + ], + [ + "2014", + "European Championships", + "Zurich, Switzerland", + "2nd", + "200 m", + "22.46" + ], + [ + "2014", + "European Championships", + "Zurich, Switzerland", + "1st", + "4 × 100 m relay", + "42.25 NR" + ], + [ + "2015", + "World Championships", + "Beijing, China", + "4th", + "4 × 100 m relay", + "42.10" + ], + [ + "2016", + "Olympic Games", + "Rio de Janeiro, Brazil", + "22nd (sf)", + "200 m", + "22.99" + ], + [ + "2018", + "European Championships", + "Berlin, Germany", + "13th (sf)", + "200 m", + "23.28" + ] + ], + "title": "", + "original_id": "676e45fc03dc0b9f312ff42d35bda0d1" + }, + { + "_id": "9249b9477ff85ae55d2e4a8f25140e72", + "header": [ + "year", + "points", + "rebounds", + "assists", + "steals", + "blocks" + ], + "rows": [ + [ + "1995", + "albert white (13)", + "kevin garnett (10)", + "stephon marbury (5)", + "3 tied (2)", + "kevin garnett (9)" + ], + [ + "1996", + "jermaine o'neal (21)", + "jermaine o'neal (10)", + "ed cota (4)", + "winfred walton (3)", + "jermaine o'neal (7)" + ], + [ + "1997", + "larry hughes (20)", + "ron artest (9)", + "baron davis (5)", + "ron artest (5)", + "shane battier (2)" + ], + [ + "1998", + "al harrington (26)", + "al harrington (9)", + "ronald curry (4)", + "2 tied (4)", + "2 tied (2)" + ], + [ + "1999", + "casey jacobsen (31)", + "travis watson (9)", + "jay williams (7)", + "3 tied (2)", + "jason parker (2)" + ], + [ + "2000", + "zach randolph (24)", + "2 tied (8)", + "chris duhon (6)", + "darius miles (3)", + "darius miles (2)" + ], + [ + "2004", + "josh smith (27)", + "al jefferson (7)", + "sebastian telfair (7)", + "3 tied (3)", + "josh smith (2)" + ], + [ + "2005", + "tyler hansbrough (31)", + "tyler hansbrough (10)", + "greg paulus (10)", + "monta ellis (4)", + "tyler hansbrough (3)" + ], + [ + "2006", + "wayne ellington (31)", + "2 tied (7)", + "2 tied (6)", + "wayne ellington (3)", + "gerald henderson (3)" + ], + [ + "2007", + "oj mayo (20)", + "michael beasley (9)", + "jonny flynn (10)", + "derrick rose (4)", + "2 tied (2)" + ], + [ + "2008", + "demar derozan (17)", + "tyreke evans (8)", + "jrue holiday (5)", + "4 tied (3)", + "drew gordon (4)" + ], + [ + "2009", + "xavier henry (22)", + "john henson (9)", + "john wall (11)", + "john wall (5)", + "2 tied (2)" + ], + [ + "2010", + "harrison barnes (27)", + "jared sullinger (8)", + "2 tied (5)", + "3 tied (2)", + "terrence jones (3)" + ], + [ + "2011", + "austin rivers (20)", + "anthony davis (10)", + "tony wroten (5)", + "tony wroten (2)", + "michael kidd - gilchrist (5)" + ], + [ + "2012", + "shabazz muhammad (35)", + "kyle anderson (10)", + "kyle anderson (4)", + "nerlens noel (4)", + "nerlens noel (4)" + ] + ], + "title": "", + "original_id": "a9c6bb106c8d9b69f6a9d3ca47f411ba" + }, + { + "_id": "406589d6fcb3b35aa7dbda1fd76778d1", + "header": [ + "Year", + "Award", + "Category", + "Nominee/Work", + "Result", + "Ref" + ], + "rows": [ + [ + "2014", + "BCCMA", + "Roots Canadiana of the Year", + "The Washboard Union", + "Nominated", + "-" + ], + [ + "2015", + "BCCMA", + "Album of the Year", + "In My Bones", + "Nominated", + "-" + ], + [ + "2015", + "BCCMA", + "Group Duo of the Year", + "The Washboard Union", + "Nominated", + "-" + ], + [ + "2015", + "BCCMA", + "Roots Canadiana of the Year", + "The Washboard Union", + "Won", + "-" + ], + [ + "2015", + "BCCMA", + "Songwriter of the Year", + "The Washboard Union", + "Nominated", + "-" + ], + [ + "2015", + "BCCMA", + "Single of the Year", + "\"Some Day\"", + "Nominated", + "-" + ], + [ + "2015", + "BCCMA", + "Video of the Year", + "\"Some Day\"", + "Nominated", + "-" + ], + [ + "2016", + "CCMA Awards", + "Roots Artist of the Year", + "The Washboard Union", + "Won", + "-" + ], + [ + "2016", + "CCMA Awards", + "Rising Star", + "The Washboard Union", + "Won", + "-" + ], + [ + "2016", + "CCMA Awards", + "Group or Duo of the Year", + "The Washboard Union", + "Nominated", + "-" + ], + [ + "2016", + "CCMA Awards", + "CMT Video of the Year", + "\"Maybe It’s the Moonshine\"", + "Nominated", + "-" + ], + [ + "2016", + "BCCMA", + "Group Duo of the Year", + "The Washboard Union", + "Won", + "-" + ], + [ + "2016", + "BCCMA", + "Roots Canadiana of the Year", + "The Washboard Union", + "Won", + "-" + ], + [ + "2016", + "BCCMA", + "Entertainer of the Year", + "The Washboard Union", + "Nominated", + "-" + ], + [ + "2016", + "BCCMA", + "Fans Choice Award", + "The Washboard Union", + "Nominated", + "-" + ], + [ + "2016", + "BCCMA", + "Songwriter of the Year", + "\"Maybe It’s the Moonshine\"", + "Won", + "-" + ], + [ + "2016", + "BCCMA", + "Single of the Year", + "\"Maybe It’s the Moonshine\"", + "Nominated", + "-" + ], + [ + "2016", + "BCCMA", + "Video of the Year", + "\"Maybe It’s the Moonshine\"", + "Nominated", + "-" + ], + [ + "2017", + "Canadian Radio Music Awards", + "Best New Group or Solo Artist: Country", + "\"Maybe It’s the Moonshine\"", + "Nominated", + "-" + ], + [ + "2017", + "BCCMA", + "SOCAN Songwriter of the Year", + "\"Head Over Heels\"", + "Won", + "-" + ], + [ + "2017", + "BCCMA", + "Single of the Year", + "\"Head Over Heels\"", + "Won", + "-" + ], + [ + "2017", + "BCCMA", + "Fan Choice", + "The Washboard Union", + "Won", + "-" + ], + [ + "2017", + "BCCMA", + "Website of the Year", + "The Washboard Union", + "Won", + "-" + ], + [ + "2017", + "BCCMA", + "Gaylord Wood Traditional Country Award/Roots Country Award", + "The Washboard Union", + "Won", + "-" + ], + [ + "2017", + "Western Canadian Music Awards", + "Country Artist of the Year", + "The Washboard Union", + "Won", + "-" + ], + [ + "2017", + "CCMA", + "Group Duo of the Year", + "The Washboard Union", + "Nominated", + "-" + ], + [ + "2017", + "CCMA", + "Roots Artist or Group of the Year", + "The Washboard Union", + "Won", + "-" + ], + [ + "2018", + "CCMA", + "Album of the Year", + "What We're Made Of", + "Nominated", + "-" + ], + [ + "2018", + "CCMA", + "Group or Duo of the Year", + "The Washboard Union", + "Won", + "-" + ], + [ + "2018", + "CCMA", + "Roots Artist or Group of the Year", + "The Washboard Union", + "Won", + "-" + ] + ], + "title": "", + "original_id": "2aa86e06de9f21b3e8dcf82b4372dcdc" + }, + { + "_id": "9bffe02a4a8c8f6127d297bc1b332e58", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Morocco", + "Representing Morocco", + "Representing Morocco", + "Representing Morocco", + "Representing Morocco", + "Representing Morocco" + ], + [ + "2003", + "World Youth Championships", + "Sherbrooke, Canada", + "21st (h)", + "800 m", + "2:12.66" + ], + [ + "2004", + "World Junior Championships", + "Grosseto, Italy", + "9th", + "800 m", + "2:09.26" + ], + [ + "2005", + "World Cross Country Championships", + "Saint-Galmier, France", + "31st", + "Junior race (6.153 km)", + "22:42" + ], + [ + "2005", + "World Youth Championships", + "Marrakech, Morocco", + "4th", + "800 m", + "2:08.61" + ], + [ + "2005", + "Francophonie Games", + "Niamey, Niger", + "4th", + "800 m", + "2:09.64" + ], + [ + "2005", + "Francophonie Games", + "Niamey, Niger", + "3rd", + "4 × 400 m relay", + "3:42.48" + ], + [ + "2006", + "World Junior Championships", + "Beijing, China", + "12th (sf)", + "800 m", + "2:07.07" + ], + [ + "2007", + "World Cross Country Championships", + "Mombasa, Kenya", + "46th", + "Junior race (6 km)", + "24:01" + ], + [ + "2007", + "African Junior Championships", + "Ouagadougou, Burkina Faso", + "2nd", + "800 m", + "2:06.13" + ], + [ + "2007", + "African Junior Championships", + "Ouagadougou, Burkina Faso", + "3rd", + "1500 m", + "4:20.91" + ], + [ + "2007", + "Pan Arab Games", + "Cairo, Egypt", + "3rd", + "800 m", + "2:09.50" + ], + [ + "2008", + "African Championships", + "Addis Ababa, Ethiopia", + "4th", + "800 m", + "2:04.74" + ], + [ + "2009", + "Mediterranean Games", + "Pescara, Italy", + "2nd", + "800 m", + "2:00.91" + ], + [ + "2009", + "World Championships", + "Berlin, Germany", + "23rd (sf)", + "800 m", + "DNF" + ], + [ + "2009", + "Francophonie Games", + "Beirut, Lebanon", + "2nd", + "800 metres", + "2:02.76" + ], + [ + "2009", + "Francophonie Games", + "Beirut, Lebanon", + "3rd", + "4 × 400 m relay", + "3:37.72" + ], + [ + "2010", + "World Indoor Championships", + "Doha, Qatar", + "8th (h)", + "800 m", + "2:03.81" + ], + [ + "2010", + "African Championships", + "Nairobi, Kenya", + "8th", + "800 m", + "DNF" + ], + [ + "2011", + "World Championships", + "Daegu, South Korea", + "24th (sf)", + "800 m", + "DNF" + ], + [ + "2012", + "Olympic Games", + "London, Great Britain", + "11th (sf)", + "800 m", + "11th" + ], + [ + "2013", + "World Championships", + "Moscow, Russia", + "11th (sf)", + "800 m", + "11th" + ] + ], + "title": "", + "original_id": "01b8f8e3ea00672844eb858c29324c9e" + }, + { + "_id": "373abce0a559ca0de9af8f5bad68fb92", + "header": [ + "year", + "delegate", + "hometown", + "pageant", + "result", + "other awards" + ], + "rows": [ + [ + "1971", + "nelia sancho", + "no information available", + "queen of the pacific", + "winner", + "none" + ], + [ + "1971", + "milagros gutierrez", + "no information available", + "miss charming international", + "second runner - up", + "none" + ], + [ + "1972", + "maria isabel seva", + "no information available", + "miss charming international", + "did not place", + "none" + ], + [ + "1989", + "maria rita apostol", + "no information available", + "miss flower queen", + "did not place", + "none" + ], + [ + "1992", + "sharmaine rama gutierrez", + "manila , metro manila", + "elite model look", + "did not place", + "none" + ], + [ + "1993", + "anna maria gonzalez", + "no information available", + "elite model look", + "did not place", + "none" + ], + [ + "1995", + "rollen richelle caralde", + "no information available", + "elite model look", + "did not place", + "none" + ], + [ + "1996", + "ailleen marfori damiles", + "las piñas , metro manila", + "international folklore beauty pageant", + "top 5 finalist", + "miss photogenic" + ], + [ + "1997", + "joanne zapanta santos", + "san fernando , pampanga", + "miss tourism international", + "winner", + "none" + ], + [ + "2000", + "rachel muyot soriano", + "no information available", + "miss tourism world", + "second runner - up", + "best in long gown" + ], + [ + "2001", + "maricar manalaysay balagtas", + "bulacan", + "miss globe international", + "winner", + "best national costume" + ], + [ + "2001", + "michelle cueva reyes", + "caloocan city , metro manila", + "miss tourism international", + "winner", + "best national costume" + ], + [ + "2001", + "zorayda ruth blanco andam", + "baguio city", + "miss tourism world", + "finalist", + "miss tourism world asia" + ], + [ + "2001", + "joanna maria mijares peñaloza", + "mandaluyong city , metro manila", + "miss internet www", + "did not place", + "face of the net" + ], + [ + "2002", + "kristine reyes alzar", + "lipa , batangas", + "miss tourism international", + "winner", + "best national costume" + ], + [ + "2002", + "karen loren medrano agustin", + "manila , metro manila", + "miss globe international", + "fifth runner - up", + "best in swimsuit" + ], + [ + "2002", + "michelle cueva reyes", + "caloocan city , metro manila", + "miss tourism world", + "winner", + "best national costume" + ], + [ + "2002", + "margaret - ann awitan bayot", + "antipolo , rizal", + "miss internet www", + "second runner - up", + "none" + ], + [ + "2003", + "noella mae evangelista", + "iligan city", + "queen of tourism international", + "winner", + "best national costume" + ], + [ + "2004", + "karen loren medrano agustin", + "manila , metro manila", + "world coffee queen", + "second runner - up", + "none" + ], + [ + "2004", + "margaret ann awitan bayot", + "antipolo , rizal", + "miss maja mundial", + "first runner - up / virreina", + "none" + ], + [ + "2005", + "jhezarie games javier", + "manila , metro manila", + "miss asean", + "winner", + "none" + ], + [ + "2006", + "carlene ang aguilar", + "quezon city , metro manila", + "miss internet www", + "winner", + "none" + ], + [ + "2009", + "april love antolo jordan", + "manila , metro manila", + "beauty of the world", + "winner", + "none" + ], + [ + "2010", + "mariella castillo", + "mabini , batangas", + "miss global teen", + "top 12 semi - finalist", + "teen queen of asia and oceania" + ], + [ + "2011", + "czarina catherine gatbonton", + "malolos , bulacan", + "miss humanity international", + "second runner - up", + "none" + ] + ], + "title": "", + "original_id": "5921991ef07b397dfd587a30c770faea" + }, + { + "_id": "944d22d21ab3c3a652329d280eade25e", + "header": [ + "year", + "mens singles", + "womens singles", + "mens doubles", + "womens doubles", + "mixed doubles" + ], + "rows": [ + [ + "1985", + "jeliazko valkov", + "diana koleva", + "ilko orechov nanko ertchopov", + "diana koleva zlatka valkanova", + "jeliazko valkov dobrinka peneva" + ], + [ + "1986", + "jeliazko valkov", + "diana koleva", + "jeliazko valkov dinko dukov", + "diana koleva petia borisova", + "ilko okreshkov elena velinova" + ], + [ + "1987", + "stanimir boitchinov", + "diana koleva", + "jeliazko valkov dinko dukov", + "diana koleva diana filipova", + "jeliazko valkov gabriela spasova" + ], + [ + "1988", + "jeliazko valkov", + "diana koleva", + "jeliazko valkov dinko dukov", + "diana koleva emilia dimitrova", + "jeliazko valkov irina dimitrova" + ], + [ + "1989", + "stanimir boitchinov", + "diana koleva", + "jeliazko valkov dinko dukov", + "diana koleva emilia dimitrova", + "jeliazko valkov diana filipova" + ], + [ + "1990", + "stoyan ivantchev", + "diana koleva", + "slantcezar tzankov anatoliy skripko", + "diana koleva emilia dimitrova", + "anatoliy skripko diana filipova" + ], + [ + "1991", + "stoyan ivantchev", + "victoria hristova", + "stoyan ivantchev anatoliy skripko", + "diana koleva emilia dimitrova", + "jeliazko valkov emilia dimitrova" + ], + [ + "1992", + "jassen borissov", + "diana koleva", + "jeliazko valkov sibin atanasov", + "diana koleva diana filipova", + "slantchezar tzankov diana filipova" + ], + [ + "1993", + "todor velkov", + "dimitrinka dimitrova", + "boris kesov anatoliy skripko", + "victoria hristova nelly nedjalkova", + "svetoslav stoyanov emilia dimitrova" + ], + [ + "1994", + "mihail popov", + "victoria hristova", + "svetoslav stoyanov mihail popov", + "raina tzvetkova emilia dimitrova", + "svetoslav stoyanov raina tzvetkova" + ], + [ + "1995", + "todor velkov", + "neli nedialkova", + "svetoslav stoyanov mihail popov", + "raina tzvetkoa victoria hristova", + "svetoslav stoyanov raina tzvetkova" + ], + [ + "1996", + "mihail popov", + "victoria hristova", + "svetoslav stoyanov mihail popov", + "victoria hristova neli nedialkova", + "svetoslav stoyanov raina tzvetkova" + ], + [ + "1997", + "boris kessov", + "raina tzvetkova", + "svetoslav stoyanov mihail popov", + "victoria hristova dobrinka smilianova", + "svetoslav stoyanov raina tzvetkova" + ], + [ + "1998", + "mihail popov", + "victoria hristova", + "svetoslav stoyanov mihail popov", + "victoria hristova raina tzvetkova", + "svetoslav stoyanov raina tzvetkova" + ], + [ + "1999", + "boris kessov", + "neli boteva", + "boris kessov tzvetozar kolev", + "raina tzvetkova petya nedelcheva", + "konstantin dobrev petya nedelcheva" + ], + [ + "2000", + "luben panov", + "petya nedelcheva", + "konstantin dobrev luben panov", + "petya nedelcheva neli boteva", + "konstantin dobrev petya nedelcheva" + ], + [ + "2001", + "konstantin dobrev", + "petya nedelcheva", + "konstantin dobrev luben panov", + "petya nedelcheva maya ivanova", + "konstantin dobrev petya nedelcheva" + ], + [ + "2002", + "boris kessov", + "petya nedelcheva", + "konstantin dobrev georgi petrov", + "petya nedelcheva nely boteva", + "boris kessov nely boteva" + ], + [ + "2003", + "georgi petrov", + "nely boteva", + "julian hristov boris kessov", + "petya nedelcheva diana koleva", + "julian hristov diana dimova" + ], + [ + "2004", + "yulian hristov", + "petya nedelcheva", + "stilian makarski bladimir metodiev", + "petya nedelcheva nely boteva", + "vladimir metodiev petya nedelcheva" + ], + [ + "2005", + "kostantin dobrev", + "petya nedelcheva", + "konstantin dobrev georgi petrov", + "petya nedelcheva maya lvanova", + "vladimir metodiev petya nedelcheva" + ], + [ + "2006", + "georgi petrov", + "petya nedelcheva", + "georgi petrov blagovest kisiov", + "petya nedelcheva diana dimova", + "vladimir metodiev petya nedelcheva" + ], + [ + "2007", + "georgi petrov", + "petya nedelcheva", + "vladimir metodiev stilian makarski", + "petya nedelcheva diana dimova", + "vladimir metodiev diana dimova" + ], + [ + "2008", + "stilian makarski", + "petya nedelcheva", + "vladimir metodiev krasimir yankov", + "petya nedelcheva diana dimova", + "stilian makarski diana dimova" + ], + [ + "2009", + "krasimir yankov", + "petya nedelcheva", + "vladimir metodiev krasimir yankov", + "petya nedelcheva dimitria popstoykova", + "stilian makarski diana dimova" + ], + [ + "2010", + "stilian makarski", + "petya nedelcheva", + "stilian makarski peyo boichinov", + "petya nedelcheva diana dimova", + "stilian makarski diana dimova" + ], + [ + "2011", + "peyo boichinov", + "petya nedelcheva", + "stilian makarski peyo boichinov", + "petya nedelcheva diana dimova", + "stilian makarski diana dimova" + ] + ], + "title": "", + "original_id": "d494234ecc77e5ad04517a99c500b01b" + }, + { + "_id": "bff2ff8050d1f4caafca1ce737e43b60", + "header": [ + "year", + "competition", + "date", + "location", + "score", + "result" + ], + "rows": [ + [ + "2000", + "euro / africa zone group iv , round robin", + "19 jan", + "kampala (uga)", + "3 - 0", + "win" + ], + [ + "2000", + "euro / africa zone group iv , round robin", + "20 jan", + "kampala (uga)", + "1 - 2", + "loss" + ], + [ + "2000", + "euro / africa zone group iv , round robin", + "22 jan", + "kampala (uga)", + "3 - 0", + "win" + ], + [ + "2000", + "euro / africa zone group iv , round robin", + "23 jan", + "kampala (uga)", + "2 - 1", + "win" + ], + [ + "2001", + "euro / africa zone group iv , round robin", + "16 may", + "nicosia (cyp)", + "3 - 0", + "win" + ], + [ + "2001", + "euro / africa zone group iv , round robin", + "17 may", + "nicosia (cyp)", + "2 - 1", + "win" + ], + [ + "2001", + "euro / africa zone group iv , round robin", + "18 may", + "nicosia (cyp)", + "3 - 0", + "win" + ], + [ + "2001", + "euro / africa zone group iv , round robin", + "19 may", + "nicosia (cyp)", + "3 - 0", + "win" + ], + [ + "2001", + "euro / africa zone group iv , round robin", + "20 may", + "nicosia (cyp)", + "3 - 0", + "win" + ], + [ + "2002", + "euro / africa zone group iii , round robin", + "8 may", + "gdynia (pol)", + "0 - 3", + "loss" + ], + [ + "2002", + "euro / africa zone group iii , round robin", + "9 may", + "gdynia (pol)", + "1 - 2", + "loss" + ], + [ + "2002", + "euro / africa zone group iii , round robin", + "10 may", + "gdynia (pol)", + "2 - 1", + "win" + ], + [ + "2002", + "euro / africa zone group iii , relegation playoff", + "12 may", + "gdynia (pol)", + "3 - 0", + "win" + ], + [ + "2003", + "euro / africa zone group iii , round robin", + "11 jun", + "jūrmala (lat)", + "3 - 0", + "win" + ], + [ + "2003", + "euro / africa zone group iii , round robin", + "12 jun", + "jūrmala (lat)", + "3 - 0", + "win" + ], + [ + "2003", + "euro / africa zone group iii , round robin", + "13 jun", + "jūrmala (lat)", + "1 - 2", + "loss" + ], + [ + "2003", + "euro / africa zone group iii , promotion playoff", + "14 jun", + "jūrmala (lat)", + "1 - 2", + "loss" + ], + [ + "2003", + "euro / africa zone group iii , 3rd to 4th playoff", + "15 jun", + "jūrmala (lat)", + "3 - 0", + "win" + ], + [ + "2004", + "euro / africa zone group iii , round robin", + "4 feb", + "kaunas (ltu)", + "1 - 2", + "loss" + ], + [ + "2004", + "euro / africa zone group iii , round robin", + "5 feb", + "kaunas (ltu)", + "2 - 1", + "win" + ], + [ + "2004", + "euro / africa zone group iii , 5th to 7th playoff", + "7 feb", + "kaunas (ltu)", + "2 - 1", + "win" + ], + [ + "2004", + "euro / africa zone group iii , 5th to 6th playoff", + "8 feb", + "kaunas (ltu)", + "1 - 2", + "loss" + ], + [ + "2005", + "euro / africa zone group iii , round robin", + "13 jul", + "dublin (irl)", + "2 - 1", + "win" + ], + [ + "2005", + "euro / africa zone group iii , round robin", + "14 jul", + "dublin (irl)", + "3 - 0", + "win" + ], + [ + "2005", + "euro / africa zone group iii , round robin", + "15 jul", + "dublin (irl)", + "3 - 0", + "win" + ], + [ + "2005", + "euro / africa zone group iii , 1st to 4th playoff", + "16 jul", + "dublin (irl)", + "2 - 1", + "win" + ], + [ + "2005", + "euro / africa zone group iii , 1st to 2nd playoff", + "17 jul", + "dublin (irl)", + "2 - 1", + "win" + ], + [ + "2006", + "euro / africa zone group ii , 1st round", + "7 - 9 apr", + "plovdiv (bul)", + "2 - 3", + "loss" + ], + [ + "2006", + "euro / africa zone group ii , relegation playoff", + "21 - 23 jul", + "cairo (egy)", + "3 - 2", + "win" + ], + [ + "2007", + "euro / africa zone group ii , 1st round", + "6 - 8 apr", + "nicosia (cyp)", + "2 - 3", + "loss" + ], + [ + "2007", + "euro / africa zone group ii , relegation playoff", + "20 - 22 jul", + "nicosia (cyp)", + "4 - 1", + "win" + ], + [ + "2008", + "euro / africa zone group ii , 1st round", + "11 - 13 apr", + "nicosia (cyp)", + "3 - 2", + "win" + ], + [ + "2008", + "euro / africa zone group ii , quarterfinal", + "20 - 22 jul", + "porto (por)", + "2 - 3", + "loss" + ], + [ + "2009", + "euro / africa zone group ii , 1st round", + "6 - 8 apr", + "nicosia (cyp)", + "3 - 2", + "win" + ], + [ + "2009", + "euro / africa zone group ii , quarterfinal", + "10 - 12 jul", + "nicosia (cyp)", + "3 - 2", + "win" + ], + [ + "2009", + "euro / africa zone group ii , semifinal", + "18 - 20 sep", + "salo (fin)", + "2 - 3", + "loss" + ] + ], + "title": "", + "original_id": "5f02d6b560d63b1cf6b30cd39d7a208c" + }, + { + "_id": "79187319a1c87ba843721165104f34ea", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Mexico", + "Representing Mexico", + "Representing Mexico", + "Representing Mexico", + "Representing Mexico", + "Representing Mexico" + ], + [ + "1978", + "Central American and Caribbean Junior Championships (U-17)", + "Xalapa, México", + "3rd", + "1000 m", + "2:38.8 A" + ], + [ + "1978", + "Central American and Caribbean Junior Championships (U-17)", + "Xalapa, México", + "1st", + "3000 m", + "9:04.4 A" + ], + [ + "1980", + "Central American and Caribbean Junior Championships (U-20)", + "Nassau, Bahamas", + "4th", + "1500 m", + "3:53.7" + ], + [ + "1980", + "Central American and Caribbean Junior Championships (U-20)", + "Nassau, Bahamas", + "2nd", + "5000 m", + "14:27.4" + ], + [ + "1980", + "Central American and Caribbean Junior Championships (U-20)", + "Nassau, Bahamas", + "1st", + "3000 m steeplechase", + "9:27.8" + ], + [ + "1984", + "Olympic Games", + "Los Angeles, United States", + "36th", + "Marathon", + "2:20:33" + ], + [ + "1988", + "Ibero-American Championships", + "Ciudad de México, México", + "1st", + "10,000m", + "29:51.09 A" + ], + [ + "1988", + "Olympic Games", + "Seoul, South Korea", + "11th", + "Marathon", + "2:13:58" + ] + ], + "title": "", + "original_id": "691ee4d04b744fd879670b1a0075aaf7" + }, + { + "_id": "83a792594d447f7ee35fbd0aa72accbf", + "header": [ + "year", + "winners", + "grand finalist", + "scores", + "venue", + "crowd", + "margin", + "season result" + ], + "rows": [ + [ + "1977", + "hawthorn", + "carlton", + "14.11 (95) - 11.5 (71)", + "waverley park", + "27407", + "24", + "preliminary finalist" + ], + [ + "1978", + "fitzroy", + "north melbourne", + "13.18 (96) - 2.8 (20)", + "waverley park", + "26420", + "76", + "9th" + ], + [ + "1979", + "collingwood", + "hawthorn", + "12.8 (80) - 7.10 (52)", + "waverley park", + "37753", + "28", + "grand finalist" + ], + [ + "1980", + "north melbourne", + "collingwood", + "8.9 (57) - 7.12 (54)", + "waverley park", + "50478", + "3", + "elimination finalist" + ], + [ + "1981", + "essendon", + "carlton", + "9.11 (65) - 6.5 (41)", + "waverley park", + "42269", + "24", + "elimination finalist" + ], + [ + "1982", + "sydney swans", + "north melbourne", + "13.12 (90) - 8.10 (58)", + "waverley park", + "20028", + "32", + "7th" + ], + [ + "1983", + "carlton", + "richmond", + "14.16 (100) - 10.6 (66)", + "waverley park", + "32927", + "34", + "elimination finalist" + ], + [ + "1984", + "essendon", + "sydney swans", + "13.11 (89) - 5.8 (38)", + "waverley park", + "30824", + "51", + "premier" + ], + [ + "1985", + "hawthorn", + "essendon", + "11.11 (77) - 10.8 (68)", + "waverley park", + "24812", + "9", + "grand finalist" + ], + [ + "1986", + "hawthorn", + "carlton", + "9.12 (66) - 5.6 (36)", + "waverley park", + "19627", + "30", + "premier" + ] + ], + "title": "", + "original_id": "71857abad22fe712e19123f175c8fa76" + }, + { + "_id": "d2ca426823c7e75b2680d430033556eb", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Sweden", + "Representing Sweden", + "Representing Sweden", + "Representing Sweden", + "Representing Sweden", + "Representing Sweden" + ], + [ + "2008", + "World Junior Championships", + "Bydgoszcz, Poland", + "11th (sf)", + "400m", + "54.12" + ], + [ + "2009", + "European Junior Championships", + "Novi Sad, Serbia", + "3rd", + "400 m", + "54.01" + ], + [ + "2010", + "European Championships", + "Barcelona, Spain", + "7th", + "4 × 100 m relay", + "43.75" + ], + [ + "2011", + "European U23 Championships", + "Ostrava, Czech Republic", + "2nd", + "200 m", + "23.24" + ], + [ + "2011", + "World Championships", + "Daegu, South Korea", + "24th (h)", + "200 m", + "23.31" + ], + [ + "2011", + "World Championships", + "Daegu, South Korea", + "18th (sf)", + "400 m", + "52.35" + ], + [ + "2012", + "World Indoor Championships", + "Istanbul, Turkey", + "6th (sf)", + "400 m", + "52.29" + ], + [ + "2012", + "European Championships", + "Helsinki, Finland", + "1st", + "400 m", + "51.13 (NR)" + ], + [ + "2013", + "World Championships", + "Moscow, Russia", + "31st (h)", + "200 m", + "23.33" + ], + [ + "2013", + "World Championships", + "Moscow, Russia", + "24th (h)", + "400 m", + "52.39" + ], + [ + "2018", + "European Championships", + "Berlin, Germany", + "9th (h)", + "4 × 400 m relay", + "3:32.61" + ] + ], + "title": "", + "original_id": "4d999e44a25d4d802cbb0ea178c847fe" + }, + { + "_id": "212adb2f4a88b85a43c34cd49f27e51c", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing China", + "Representing China", + "Representing China", + "Representing China", + "Representing China", + "Representing China" + ], + [ + "2013", + "Asian Championships", + "Pune, India", + "4th", + "Triple jump", + "13.57 m" + ], + [ + "2014", + "Asian Indoor Championships", + "Hangzhou, China", + "3rd", + "Triple jump", + "13.43 m" + ], + [ + "2014", + "Asian Junior Championships", + "Taipei City, Taiwan", + "1st", + "Long jump", + "6.27 m" + ], + [ + "2014", + "Asian Junior Championships", + "Taipei City, Taiwan", + "2nd", + "Triple jump", + "13.62 m" + ], + [ + "2014", + "World Junior Championships", + "Eugene, United States", + "25th (q)", + "Long jump", + "5.72 m" + ], + [ + "2014", + "World Junior Championships", + "Eugene, United States", + "3rd", + "Triple jump", + "14.03 m" + ], + [ + "2015", + "World Championships", + "Beijing, China", + "21st (q)", + "Triple jump", + "13.52 m" + ], + [ + "2016", + "Asian Indoor Championships", + "Hangzhou, China", + "5th", + "Triple jump", + "13.14 m" + ], + [ + "2016", + "Olympic Games", + "Rio de Janeiro, Brazil", + "34th (q)", + "Triple jump", + "13.30 m" + ] + ], + "title": "", + "original_id": "9c67f976517e940f4c621cc43685f9f1" + }, + { + "_id": "d9951099561edda303e2d1934a6b12b4", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing India", + "Representing India", + "Representing India", + "Representing India", + "Representing India", + "Representing India" + ], + [ + "2008", + "Asian Junior Championships", + "Jakarta, Indonesia", + "2nd", + "800 m", + "2:08.63" + ], + [ + "2008", + "World Junior Championships", + "Bydgoszcz, Poland", + "8th (sf)", + "800m", + "2:06.51" + ], + [ + "2008", + "World Junior Championships", + "Bydgoszcz, Poland", + "14th (h)", + "4 × 400 m relay", + "3:44.13" + ], + [ + "2009", + "Asian Championships", + "Guangzhou, China", + "6th", + "800 m", + "2:07.36" + ], + [ + "2010", + "Commonwealth Games", + "Delhi, India", + "6th", + "800 m", + "2:01.25" + ], + [ + "2010", + "Asian Games", + "Guangzhou, China", + "3rd", + "800 m", + "2:01.36" + ], + [ + "2011", + "Asian Championships", + "Kobe, Japan", + "3rd", + "800 m", + "2:02.55" + ], + [ + "2011", + "Asian Championships", + "Kobe, Japan", + "2nd", + "4 × 400 m relay", + "3:44.17" + ], + [ + "2011", + "World Championships", + "Daegu, South Korea", + "15th (sf)", + "800 m", + "2:00.95" + ], + [ + "2012", + "Olympic Games", + "London, United Kingdom", + "10th (sf)", + "800 m", + "1:59.61" + ], + [ + "2013", + "Asian Championships", + "Pune, India", + "3rd", + "800 m", + "2:04.48" + ], + [ + "2013", + "Asian Championships", + "Pune, India", + "1st", + "4 × 400 m relay", + "3:32.26" + ], + [ + "2013", + "World Championships", + "Moscow, Russia", + "15th (h)", + "4 × 400 m relay", + "3:38.81" + ], + [ + "2014", + "Commonwealth Games", + "Glasgow, United Kingdom", + "11th (sf)", + "800 m", + "2:03.35" + ], + [ + "2014", + "Asian Games", + "Incheon, South Korea", + "2nd", + "800 m", + "1:59.19" + ], + [ + "2014", + "Asian Games", + "Incheon, South Korea", + "1st", + "4 × 400 m relay", + "3:28.68 GR" + ], + [ + "2015", + "Asian Championships", + "Wuhan, China", + "1st", + "800 m", + "2:01.53" + ], + [ + "2015", + "Asian Championships", + "Wuhan, China", + "2nd", + "4 × 400 m relay", + "3:33.81" + ], + [ + "2015", + "World Championships", + "Beijing, China", + "19th (h)", + "800 metres", + "2:00.95" + ], + [ + "2015", + "World Championships", + "Beijing, China", + "14th (h)", + "4 × 400 m relay", + "3:29.08" + ], + [ + "2016", + "Olympic Games", + "Rio de Janeiro, Brazil", + "29th (h)", + "800 m", + "2:00.58" + ] + ], + "title": "", + "original_id": "9949f443a53a970598e8d3e4d400361b" + }, + { + "_id": "1121a93e2885f375290aac973a109084", + "header": [ + "Song", + "Year", + "Artist", + "Album", + "Role", + "Notes" + ], + "rows": [ + [ + "\"Leavin' Eyes\"", + "1984", + "Glen Campbell", + "Letter to Home", + "Writer, producer", + "-" + ], + [ + "\"Cruisin'\"", + "1986", + "Alabama", + "The Touch", + "Writer", + "-" + ], + [ + "\"No More Tears\"", + "1994", + "David Ball", + "David Ball", + "Writer", + "-" + ], + [ + "\"Love Lessons\"", + "1995", + "Tracy Byrd", + "Love Lessons", + "Writer", + "US Country #9" + ], + [ + "\"Wine into Water\"", + "1998", + "T. Graham Brown", + "Wine into Water", + "Writer", + "US Country #44" + ], + [ + "\"Don't Think I Won't\"", + "1998", + "Mark Wills", + "Wish You Were Here", + "Writer", + "-" + ], + [ + "\"She Rides Wild Horses\"", + "1999", + "Kenny Rogers", + "She Rides Wild Horses", + "Writer", + "-" + ], + [ + "\"He Rocks\"", + "2000", + "Wynonna Judd", + "New Day Dawning", + "Writer", + "-" + ], + [ + "\"Monkey in the Middle\"", + "2003", + "Rodney Atkins", + "Honesty", + "Writer, producer", + "-" + ], + [ + "\"Honesty (Write Me a List)\"", + "2003", + "Rodney Atkins", + "Honesty", + "Producer, vocals", + "US Country #4" + ], + [ + "\"Someone to Share it With\"", + "2003", + "Rodney Atkins", + "Honesty", + "Writer, producer", + "-" + ], + [ + "\"The Man I Am Today\"", + "2003", + "Rodney Atkins", + "Honesty", + "Writer, producer", + "-" + ], + [ + "\"My Old Man\"", + "2003", + "Rodney Atkins", + "Honesty", + "Writer, producer", + "US Country #36" + ], + [ + "\"Wasted Whiskey\"", + "2006", + "Rodney Atkins", + "If You're Going Through Hell", + "Writer, producer", + "-" + ], + [ + "\"Cleaning This Gun (Come On In Boy)\"", + "2006", + "Rodney Atkins", + "If You're Going Through Hell", + "Producer, vocals", + "US Country #1 US Gold" + ], + [ + "\"Watching You\"", + "2006", + "Rodney Atkins", + "If You're Going Through Hell", + "Producer, vocals", + "US Country #1 US Platinum" + ], + [ + "\"If You're Going Through Hell (Before the Devil Even Knows)\"", + "2006", + "Rodney Atkins", + "If You're Going Through Hell", + "Producer, vocals", + "US Country #1 US Platinum" + ], + [ + "\"These Are My People\"", + "2006", + "Rodney Atkins", + "If You're Going Through Hell", + "Producer, vocals", + "US Country #1 US Gold" + ], + [ + "\"Home Sweet Oklahoma\"", + "2008", + "Patti Page and Vince Gill", + "Best Country Songs", + "Writer, producer", + "-" + ], + [ + "\"Chasin' Girls\"", + "2009", + "Rodney Atkins", + "It's America", + "Writer, producer", + "-" + ], + [ + "\"It's America\"", + "2009", + "Rodney Atkins", + "It's America", + "Producer, vocals", + "US Country #1" + ], + [ + "\"15 Minutes\"", + "2009", + "Rodney Atkins", + "It's America", + "Producer, vocals", + "US Country #20" + ], + [ + "\"Farmer's Daughter\"", + "2010", + "Rodney Atkins", + "It's America", + "Producer, vocals", + "US Country #5 US Platinum" + ], + [ + "\"Growing Up Like That\"", + "2011", + "Rodney Atkins", + "Take a Back Road", + "Writer, producer", + "-" + ], + [ + "\"Take a Back Road\"", + "2011", + "Rodney Atkins", + "Take a Back Road", + "Producer", + "US Country #1 US Platinum" + ], + [ + "\"He's Mine\"", + "2011", + "Rodney Atkins", + "Take a Back Road", + "Producer, vocals", + "US Country #23" + ], + [ + "\"Tips\"", + "2011", + "Rodney Atkins", + "Take a Back Road", + "Writer, producer", + "-" + ], + [ + "\"Lifelines\"", + "2011", + "Rodney Atkins", + "Take a Back Road", + "Writer, producer", + "-" + ], + [ + "\"Cool with That\"", + "2015", + "Brett Kissel", + "Pick Me Up", + "Writer", + "-" + ], + [ + "\"Wine Into Water\"", + "2015", + "T. Graham Brown", + "Forever Changed", + "Writer", + "-" + ], + [ + "\"Wine Into Water\"", + "2016", + "Loretta Lynn", + "Full Circle", + "Writer", + "-" + ], + [ + "\"Nights in the Sun\"", + "2017", + "Brett Kissel", + "We Were That Song", + "Writer", + "-" + ] + ], + "title": "", + "original_id": "be18c465eb0851ea697b232017a9c7dc" + }, + { + "_id": "292fa6f06d0acc669ad42922fa85e1b8", + "header": [ + "year", + "mens singles", + "womens singles", + "mens doubles", + "womens doubles", + "mixed doubles" + ], + "rows": [ + [ + "1964", + "feliks glapka , poznań", + "teresa masłowska , warszawa", + "feliks glapka marian grys , poznań", + "no competition", + "bolesław suterski stanisława suterska , poznań" + ], + [ + "1965", + "aleksander koczur , kraków", + "teresa masłowska , warszawa", + "andrzej domagała krzysztof englander , wrocław", + "no competition", + "bolesław suterski stanisława suterska , poznań" + ], + [ + "1966", + "wiesław świątczak , łódź", + "teresa masłowska , warszawa", + "andrzej domagała krzysztof englander , wrocław", + "no competition", + "wiesław świątczak irena józefowicz , łódź" + ], + [ + "1967", + "wiesław świątczak , łódź", + "barbara rojewska , olsztyn", + "andrzej domagała krzysztof englander , wrocław", + "no competition", + "krzysztof englander bożena basińska , wrocław" + ], + [ + "1968", + "krzysztof englander , wrocław", + "irena karolczak , wrocław", + "jerzy przybylski lech woźny , poznań", + "no competition", + "krzysztof englander irena karolczak , wrocław" + ], + [ + "1969", + "andrzej domagała , wrocław", + "teresa masłowska , warszawa", + "andrzej domagała krzysztof englander , wrocław", + "no competition", + "bogusław żołądkowski teresa masłowska , warszawa" + ], + [ + "1970", + "wiesław świątczak , łódź", + "irena karolczak , wrocław", + "jerzy przybylski lech woźny , poznań", + "no competition", + "jan makarus jolanta proch , szczecin" + ], + [ + "1971", + "wiesław świątczak , łódź", + "lidia baczyńska , wrocław", + "andrzej domagała krzysztof englander , wrocław", + "no competition", + "wiesław świątczak ewa astasiewicz , łódź" + ], + [ + "1972", + "wiesław danielski", + "irena karolczak", + "wiesław danielski zygmunt skrzypczyński", + "lidia baczyńska irena karolczak", + "leszek nowakowski hana snochowska" + ], + [ + "1973", + "andrzej domagała", + "irena karolczak", + "wiesław danielski zygmunt skrzypczyński", + "no competition", + "sławomir wloszczynski irena karolczak" + ], + [ + "1974", + "stanisław rosko", + "irena karolczak", + "ryszard borek stanisław rosko", + "irena karolczak hana snochowska", + "leszek nowakowski hana snochowska" + ], + [ + "1975", + "zygmunt skrzypczyński", + "irena karolczak", + "andrzej domagała wiesław świątczak", + "irena karolczak hana snochowska", + "leslaw markowicz irena karolczak" + ], + [ + "1976", + "zygmunt skrzypczyński", + "elżbieta utecht", + "krzysztof englander janusz labisko", + "irena karolczak wanda czamańska", + "leslaw markowicz irena karolczak" + ], + [ + "1978", + "zygmunt skrzypczyński", + "elżbieta utecht", + "zygmunt skrzypczyński sławomir włoszyński", + "bożena wojtkowska elżbieta utecht", + "janusz labisko anna zyśk" + ], + [ + "1979", + "brunon rduch", + "elżbieta utecht", + "zygmunt skrzypczyński sławomir włoszyński", + "bożena wojtkowska maria bahryj", + "zygmunt skrzypczyński elżbieta utecht" + ], + [ + "1980", + "zygmunt skrzypczyński", + "bożena wojtkowska", + "zygmunt skrzypczyński janusz labisko", + "bożena wojtkowska ewa rusznica", + "zygmunt skrzypczyński elżbieta utecht" + ], + [ + "1981", + "brunon rduch", + "bożena wojtkowska", + "brunon rduch norbert węgrzyn", + "bożena wojtkowska zofia żółtańska", + "jerzy dołhan ewa rusznica" + ], + [ + "1982", + "stanisław rosko", + "bożena wojtkowska", + "stanisław rosko kazimierz ciurys", + "bożena wojtkowska ewa rusznica", + "jerzy dołhan bożena wojtkowska" + ], + [ + "1983", + "stanisław rosko", + "ewa rusznica", + "jerzy dołhan grzegorz olchowik", + "bożena wojtkowska bożena siemieniec", + "kazimierz ciurys bożena wojtkowska" + ], + [ + "1984", + "stanisław rosko", + "bożena wojtkowska", + "jerzy dołhan grzegorz olchowik", + "bożena wojtkowska ewa wilman", + "kazimierz ciurys bożena wojtkowska" + ], + [ + "1985", + "grzegorz olchowik", + "bożena wojtkowska", + "jerzy dołhan grzegorz olchowik", + "bożena siemieniec zofia żółtańska", + "jerzy dołhan ewa wilman" + ], + [ + "1986", + "grzegorz olchowik", + "bożena siemieniec", + "jerzy dołhan grzegorz olchowik", + "bożena siemieniec zofia żółtańska", + "jerzy dołhan ewa wilman" + ], + [ + "1987", + "jerzy dołhan", + "bożena haracz", + "jerzy dołhan grzegorz olchowik", + "bożena haracz bożena siemieniec", + "jerzy dołhan bożena haracz" + ], + [ + "1988", + "jerzy dołhan", + "bożena siemieniec", + "jerzy dołhan grzegorz olchowik", + "bożena haracz bożena siemieniec", + "jerzy dołhan bożena haracz" + ], + [ + "1989", + "jacek hankiewicz", + "bożena siemieniec", + "jerzy dołhan jacek hankiewicz", + "bożena haracz bożena siemieniec", + "jerzy dołhan bożena haracz" + ], + [ + "1990", + "jacek hankiewicz", + "beata syta", + "jerzy dołhan jacek hankiewicz", + "bożena haracz beata syta", + "jerzy dołhan bożena haracz" + ], + [ + "1991", + "jacek hankiewicz", + "katarzyna krasowska", + "jerzy dołhan jacek hankiewicz", + "bożena haracz bożena siemieniec", + "jerzy dołhan bożena haracz" + ], + [ + "1992", + "dariusz zięba", + "katarzyna krasowska", + "jerzy dołhan jacek hankiewicz", + "bożena haracz bożena bąk", + "jerzy dołhan bożena haracz" + ], + [ + "1993", + "jacek hankiewicz", + "katarzyna krasowska", + "dariusz zięba jacek hankiewicz", + "bożena haracz bożena bąk", + "jerzy dołhan bożena haracz" + ], + [ + "1994", + "dariusz zięba", + "katarzyna krasowska", + "jerzy dołhan damian pławecki", + "monika lipińska sylwia rutkiewicz", + "damian pławecki dorota borek" + ], + [ + "1995", + "dariusz zięba", + "katarzyna krasowska", + "jerzy dołhan damian pławecki", + "dorota borek katarzyna krasowska", + "jerzy dołhan bożena haracz" + ], + [ + "1996", + "dariusz zięba", + "katarzyna krasowska", + "dariusz zięba jacek hankiewicz", + "monika bienkowska katarzyna boczek", + "robert mateusiak sylwia rutkiewicz" + ], + [ + "1997", + "jacek niedźwiedzki", + "katarzyna krasowska", + "jerzy dołhan damian pławecki", + "dorota borek katarzyna krasowska", + "damian pławecki dorota borek" + ], + [ + "1998", + "jacek niedźwiedzki", + "katarzyna krasowska", + "michał łogosz damian pławecki", + "bożena haracz katarzyna krasowska", + "damian pławecki dorota grzejdak" + ], + [ + "1999", + "przemysław wacha", + "kamila augustyn", + "michał łogosz robert mateusiak", + "bożena haracz joanna szleszyńska", + "robert mateusiak monika bienkowska" + ], + [ + "2000", + "jacek niedźwiedzki", + "katarzyna krasowska", + "michał łogosz robert mateusiak", + "bożena haracz katarzyna krasowska", + "robert mateusiak barbara kulanty" + ], + [ + "2001", + "jacek niedźwiedzki", + "kamila augustyn", + "michał łogosz robert mateusiak", + "barbara kulanty joanna szleszyńska", + "robert mateusiak barbara kulanty" + ], + [ + "2002", + "przemysław wacha", + "kamila augustyn", + "michał łogosz robert mateusiak", + "kamila augustyn joanna szleszyńska", + "robert mateusiak barbara kulanty" + ], + [ + "2003", + "jacek niedźwiedzki", + "kamila augustyn", + "michał łogosz robert mateusiak", + "kamila augustyn paulina matusewicz", + "robert mateusiak barbara kulanty" + ], + [ + "2004", + "przemysław wacha", + "kamila augustyn", + "michał łogosz robert mateusiak", + "kamila augustyn nadieżda kostiuczyk", + "robert mateusiak barbara kulanty" + ], + [ + "2005", + "przemysław wacha", + "kamila augustyn", + "michał łogosz robert mateusiak", + "kamila augustyn nadieżda kostiuczyk", + "robert mateusiak barbara kulanty" + ], + [ + "2006", + "przemysław wacha", + "angelika węgrzyn", + "rafał hawel przemysław wacha", + "kamila augustyn nadieżda kostiuczyk", + "robert mateusiak nadieżda kostiuczyk" + ], + [ + "2007", + "przemysław wacha", + "kamila augustyn", + "michał łogosz robert mateusiak", + "kamila augustyn nadieżda kostiuczyk", + "robert mateusiak nadieżda kostiuczyk" + ], + [ + "2008", + "przemysław wacha", + "kamila augustyn", + "michał łogosz robert mateusiak", + "kamila augustyn nadieżda kostiuczyk", + "robert mateusiak nadieżda kostiuczyk" + ], + [ + "2009", + "przemysław wacha", + "kamila augustyn", + "michał łogosz robert mateusiak", + "małgorzata kurdelska agnieszka wojtkowska", + "robert mateusiak kamila augustyn" + ], + [ + "2010", + "przemysław wacha", + "kamila augustyn", + "michał łogosz robert mateusiak", + "kamila augustyn nadieżda kostiuczyk", + "robert mateusiak nadieżda kostiuczyk" + ] + ], + "title": "", + "original_id": "31d0f57a11ed01b643d02e560eee8c05" + }, + { + "_id": "3036b2b46efe509a669533933ff823bc", + "header": [ + "Year", + "Association", + "Category", + "Work", + "Result", + "Ref." + ], + "rows": [ + [ + "1938", + "Academy Awards", + "Best Actress in a Leading Role", + "Stella Dallas", + "Nominated", + "-" + ], + [ + "1942", + "Academy Awards", + "Best Actress in a Leading Role", + "Ball of Fire", + "Nominated", + "-" + ], + [ + "1945", + "Academy Awards", + "Best Actress in a Leading Role", + "Double Indemnity", + "Nominated", + "-" + ], + [ + "1949", + "Academy Awards", + "Best Actress in a Leading Role", + "Sorry, Wrong Number", + "Nominated", + "-" + ], + [ + "1960", + "Hollywood Walk of Fame", + "Motion Pictures, 1751 Vine Street", + "-", + "Won", + "-" + ], + [ + "1961", + "Emmy Awards", + "Outstanding Performance by an Actress in a Series", + "The Barbara Stanwyck Show", + "Won", + "-" + ], + [ + "1966", + "Emmy Awards", + "Outstanding Continued Performance by an Actress in a Leading Role", + "The Big Valley", + "Won", + "-" + ], + [ + "1966", + "Golden Globe Awards", + "Best TV Star – Female", + "The Big Valley", + "Nominated", + "-" + ], + [ + "1967", + "Emmy Awards", + "Outstanding Continued Performance by an Actress in a Leading Role", + "The Big Valley", + "Nominated", + "-" + ], + [ + "1967", + "Golden Globe Awards", + "Best TV Star – Female", + "The Big Valley", + "Nominated", + "-" + ], + [ + "1967", + "Screen Actors Guild", + "Life Achievement", + "-", + "Won", + "-" + ], + [ + "1968", + "Emmy Awards", + "Outstanding Continued Performance by an Actress in a Leading Role", + "The Big Valley", + "Nominated", + "-" + ], + [ + "1968", + "Golden Globe Awards", + "Best TV Star – Female", + "The Big Valley", + "Nominated", + "-" + ], + [ + "1973", + "Hall of Great Western Performers Cowboy Hall of Fame Oklahoma City", + "Lifetime Achievement Award Performer", + "-", + "Won", + "-" + ], + [ + "1981", + "Film Society of Lincoln Center Gala Tribute", + "-", + "-", + "Won", + "-" + ], + [ + "1981", + "Los Angeles Film Critics Association", + "Career Achievement", + "-", + "Won", + "-" + ], + [ + "1982", + "Academy Awards", + "Honorary Award", + "-", + "Won", + "-" + ], + [ + "1983", + "Emmy Awards", + "Outstanding Lead Actress in a Limited Series", + "The Thorn Birds", + "Won", + "-" + ], + [ + "1984", + "Golden Globe Awards", + "Best Performance by an Actress in a Supporting Role", + "The Thorn Birds", + "Won", + "-" + ], + [ + "1986", + "Golden Globe Awards", + "Cecil B. DeMille Award", + "-", + "Won", + "-" + ], + [ + "1987", + "American Film Institute", + "Life Achievement", + "-", + "Won", + "-" + ] + ], + "title": "", + "original_id": "28bf1ccc00e7ac7016bde04933ece3e4" + }, + { + "_id": "b2ea14633c7cdfd0fa1e93b2821d4889", + "header": [ + "year", + "men 's singles", + "women 's singles", + "men 's doubles", + "women 's doubles", + "mixed doubles" + ], + "rows": [ + [ + "1993", + "jim laugesen", + "mette sørensen", + "neil cottrill john quinn", + "nadezhda chervyakova marina yakusheva", + "john quinn nicola beck" + ], + [ + "1994", + "henrik sörensen", + "irina serova", + "henrik sörensen claus simonsen", + "lene sörensen mette sørensen", + "jürgen koch irina serova" + ], + [ + "1995", + "thomas soegaard", + "elena rybkina", + "thomas stavngaard janek roos", + "michelle rasmussen mette sørensen", + "janek roos pernille harder" + ], + [ + "1996", + "daniel ericsson", + "tanja berg", + "johan tholinsson henrik andersson", + "ann - lou jørgensen christina sörensen", + "jonas rasmussen ann - lou jørgensen" + ], + [ + "1997", + "martin hagberg", + "anne gibson", + "james anderson ian sullivan", + "rebeka pantaney gail emms", + "ian sulivan gail emms" + ], + [ + "1998", + "robert nock", + "ella karachkova", + "graham hurrell paul jeffrey", + "lorraine cole tracey dineen", + "anthony clark lorraine cole" + ], + [ + "1999", + "robert nock", + "katja michalowsky", + "svetoslav stojanov michal popov", + "liza parker suzanne rayappan", + "ola molin johanna persson" + ], + [ + "2000", + "gerben bruystens", + "christina b sörensen", + "thomas hovgaard jesper mikla", + "britta andersen lene mork", + "mathias boe britta andersen" + ], + [ + "2001", + "bobby milroy", + "rebecca panteney", + "michael popov manuel dubrulle", + "nadiezda kostiuczyk kamila augustyn", + "kristian roebuck natalie munt" + ], + [ + "2002", + "przemysław wacha", + "sara persson", + "svetoslav stoyanov vincent laigle", + "johanna persson elin berglom", + "andrey konakh nadiezda kostiuczyk" + ], + [ + "2003", + "michael christensen", + "petya nedelcheva", + "michael popov manuel dubrulle", + "petya nedelcheva nely boteva", + "mike beres jody patrick" + ], + [ + "2004", + "per - henrik croona", + "katja michalowsky", + "mike beres william milroy", + "britta andersen mie schjott kristensen", + "jesper thomsen britta andersen" + ], + [ + "2005", + "przemysław wacha", + "susan hughes", + "chris langridge chris tonks", + "nadiezda kostiuczyk kamila augustyn", + "henri hurskainen johanna persson" + ], + [ + "2006", + "jan o jorgensen", + "ragna ingolfsdottir", + "robert adcock robin middleton", + "mie schjott - kristensen christinna pedersen", + "liza parker robin middleton" + ], + [ + "2007", + "arvind bhat", + "rachel van cutsen", + "kasper henriksen rasmus bonde", + "mie schjott - kristensen christinna pedersen", + "rasmus bonde christinna pedersen" + ], + [ + "2008", + "chetan anand", + "ella diehl", + "kasper henriksen christian skovgaard", + "helle nielsen marie roepke", + "rasmus bonde helle nielsen" + ], + [ + "2009", + "petr koukal", + "trupti murgunde", + "mads conrad - petersen mads pieler kolding", + "maria helsbol anne skelbaek", + "viki indra okvana gustiani megawati" + ], + [ + "2010", + "ajay jayaram", + "karina jörgensen", + "chris langridge robin middleton", + "selena piek iris tabeling", + "anders skaarup rasmussen anne skelbaek" + ], + [ + "2011", + "przemyslaw wacha", + "kristina gavnholt", + "adam cwalina michal logosz", + "valeria sorokina nina vislova", + "alexandr nikolaenko nina vislova" + ], + [ + "2012", + "joachim persson", + "kirsty gilmour", + "chris langridge peter mills", + "heather olver kate robertshaw", + "chris langridge heather olver" + ] + ], + "title": "", + "original_id": "69837e67a1ab18c4f912f97bf9c714bd" + }, + { + "_id": "7b24a7989adac29045dbca13bfd4a8fd", + "header": [ + "year", + "winner", + "jockey", + "trainer", + "owner", + "distance (miles)", + "time" + ], + "rows": [ + [ + "2013", + "war dancer", + "alan garcia", + "kenneth g mcpeek", + "magdalena racing", + "1 - 1 / 4", + "2:03.57" + ], + [ + "2012", + "silver max", + "robby albarado", + "dale l romans", + "bacon / wells", + "1 - 1 / 4", + "2:04.05" + ], + [ + "2011", + "air support", + "alex solis", + "shug mcgaughey", + "stuart janney iii", + "1 - 1 / 4", + "2:00.80" + ], + [ + "2010", + "paddy o'prado", + "kent j desormeaux", + "dale l romans", + "winchell thoroughbreds", + "1 - 1 / 4", + "2:02.58" + ], + [ + "2009", + "battle of hastings", + "tyler baze", + "jeff mullins", + "michael house", + "1 - 1 / 4", + "2:03.29" + ], + [ + "2008", + "gio ponti", + "garrett gomez", + "christophe clement", + "castleton lyons", + "1 - 1 / 4", + "2:02.22" + ], + [ + "2007", + "red giant", + "horacio karamanos", + "todd a pletcher", + "peachtree stable", + "1 - 1 / 4", + "1:59.62" + ], + [ + "2006", + "go between", + "garrett k gomez", + "william i mott", + "peter vegso", + "1 - 1 / 4", + "1:59.74" + ], + [ + "2005", + "english channel", + "john r velazquez", + "todd a pletcher", + "james t scatuorchio", + "1 - 1 / 4", + "2:02.57" + ], + [ + "2004", + "kitten 's joy", + "edgar s prado", + "dale l romans", + "ken and sarah ramsey", + "1 - 1 / 4", + "2:01.22" + ], + [ + "2003", + "silver tree", + "edgar s prado", + "william i mott", + "peter vegso", + "1 - 1 / 4", + "2:01.11" + ], + [ + "2002", + "orchard park", + "edgar s prado", + "william i mott", + "peter vegso", + "1 - 1 / 4", + "2:03.10" + ], + [ + "2001", + "potaro", + "brent bartram", + "jonathan sheppard", + "augustin stable", + "1 - 1 / 4", + "2:02.18" + ], + [ + "2000", + "lightning paces", + "greg hutton", + "john j robb", + "tulip hill farm", + "1 - 1 / 4", + "2:02.18" + ], + [ + "1999", + "phi beta doc", + "ramon dominguez", + "robert w leonard", + "dennis foster / r leonard", + "1 - 1 / 4", + "1:59.97" + ], + [ + "1998", + "crowd pleaser", + "jean - luc samyn", + "jonathan sheppard", + "augustin stable", + "1 - 1 / 4", + "2:00.28" + ] + ], + "title": "", + "original_id": "afe452325ae2a67d28cd447dd37686d6" + }, + { + "_id": "48a8180daadb7db17ff59b5a3b04e89d", + "header": [ + "Year", + "Award", + "Category", + "Nominated work", + "Result", + "Ref." + ], + "rows": [ + [ + "2015", + "30th Golden Rooster Awards", + "Best Supporting Actor", + "Dearest", + "Won", + "-" + ], + [ + "2016", + "33rd Hundred Flowers Awards", + "Best Supporting Actor", + "Dearest", + "Nominated", + "-" + ], + [ + "2017", + "24th Beijing College Student Film Festival", + "Best Actor", + "Cock and Bull", + "Won", + "-" + ], + [ + "2017", + "8th China Film Director's Guild Awards", + "Best Actor", + "Cock and Bull", + "Won", + "-" + ], + [ + "2017", + "31st Golden Rooster Awards", + "Best Supporting Actor", + "Cock and Bull", + "Nominated", + "-" + ], + [ + "2017", + "23rd Shanghai Television Festival", + "Best Actor", + "Feather Flies to the Sky", + "Won", + "-" + ], + [ + "2018", + "31st Flying Apsaras Award", + "Outstanding Actor", + "Feather Flies to the Sky", + "Nominated", + "-" + ], + [ + "2018", + "29th China TV Golden Eagle Award", + "Best Actor", + "Feather Flies to the Sky", + "Won", + "-" + ], + [ + "2018", + "25th Beijing College Student Film Festival", + "Best Actor", + "Operation Red Sea", + "Nominated", + "-" + ], + [ + "2018", + "34th Hundred Flowers Awards", + "Best Actor", + "Operation Red Sea", + "Nominated", + "-" + ] + ], + "title": "", + "original_id": "f7ca4efbf662c36e751424be8b2f4d1f" + }, + { + "_id": "049d567592d768c550adb6e63f2b2e6b", + "header": [ + "Year", + "Association", + "Category", + "Nominated work", + "Result", + "Ref." + ], + "rows": [ + [ + "2008", + "ASCAP Pop Music Awards", + "ASCAP Vanguard Award", + "Herself", + "Won", + "-" + ], + [ + "2009", + "Grammy Awards", + "Song of the Year", + "\"Love Song\"", + "Nominated", + "-" + ], + [ + "2009", + "Grammy Awards", + "Best Female Pop Vocal Performance", + "\"Love Song\"", + "Nominated", + "-" + ], + [ + "2011", + "Grammy Awards", + "Best Female Pop Vocal Performance", + "\"King of Anything\"", + "Nominated", + "-" + ], + [ + "2011", + "BDSCertified Spin Awards", + "700,000 Spins", + "\"Love Song\"", + "Won", + "-" + ], + [ + "2012", + "MVPA Awards", + "Best Directional Debut", + "\"Gonna Get Over You\"", + "Nominated", + "-" + ], + [ + "2012", + "MVPA Awards", + "Best Choreography", + "\"Gonna Get Over You\"", + "Won", + "-" + ], + [ + "2014", + "World Music Awards", + "World's Best Song", + "\"Brave\"", + "Nominated", + "-" + ], + [ + "2014", + "MTV Video Music Awards Japan", + "Best Choreography", + "\"Brave\"", + "Nominated", + "-" + ], + [ + "2014", + "Grammy Awards", + "Best Pop Solo Performance", + "\"Brave\"", + "Nominated", + "-" + ], + [ + "2014", + "Grammy Awards", + "Album of the Year", + "The Blessed Unrest", + "Nominated", + "-" + ], + [ + "2014", + "American Music Award", + "Favorite Adult Contemporary Artist", + "Herself", + "Nominated", + "-" + ], + [ + "2016", + "Tony Award", + "Best Original Score", + "Waitress", + "Nominated", + "-" + ], + [ + "2016", + "Drama Desk Award", + "Outstanding Music", + "Waitress", + "Nominated", + "-" + ], + [ + "2016", + "Drama Desk Award", + "Outstanding Lyrics", + "Waitress", + "Nominated", + "-" + ], + [ + "2016", + "Outer Critics Circle Award", + "Outstanding New Score (Broadway or Off-Broadway)", + "Waitress", + "Nominated", + "-" + ], + [ + "2017", + "Grammy Awards", + "Best Musical Theater Album", + "Waitress", + "Nominated", + "-" + ], + [ + "2017", + "Broadway.com Audience Awards", + "Favorite Female Replacement", + "Waitress", + "Won", + "-" + ], + [ + "2017", + "Hollywood Music in Media Awards", + "Original Song - Featured Film", + "\"If I Dare\"", + "Nominated", + "-" + ], + [ + "2017", + "Women's Entrepreneurship Day Pioneer Awards", + "Music", + "Herself", + "Won", + "-" + ], + [ + "2018", + "Tony Award", + "Best Original Score", + "SpongeBob SquarePants", + "Nominated", + "-" + ], + [ + "2018", + "Emmy Award", + "Outstanding Supporting Actress in a Limited Series or Movie", + "Jesus Christ Superstar Live in Concert", + "Nominated", + "-" + ], + [ + "2019", + "Grammy Award", + "Best Musical Theater Album", + "Jesus Christ Superstar Live in Concert", + "Nominated", + "-" + ] + ], + "title": "", + "original_id": "21f6f7538ed226cc54b563131618e08f" + }, + { + "_id": "a307797ce0988da30363904793a8d04c", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Spain", + "Representing Spain", + "Representing Spain", + "Representing Spain", + "Representing Spain", + "Representing Spain" + ], + [ + "2000", + "World Junior Championships", + "Santiago, Chile", + "5th (heats)", + "800m", + "1:51.65" + ], + [ + "2002", + "European Indoor Championships", + "Vienna, Austria", + "19th (heats)", + "800m", + "1:51.95" + ], + [ + "2002", + "World Junior Championships", + "Kingston, Jamaica", + "8th", + "800m", + "1:56.73" + ], + [ + "2003", + "European Indoor Cup", + "Leipzig, Germany", + "5th", + "800m", + "1:49.55" + ], + [ + "2003", + "European U23 Championships", + "Bydgoszcz, Poland", + "3rd", + "800m", + "1:46.83" + ], + [ + "2003", + "World Championships", + "Paris, France", + "4th (heats)", + "800 m", + "1:47.98" + ], + [ + "2004", + "Olympic Games", + "Athens, Greece", + "4th (heats)", + "800 m", + "1:47.71" + ], + [ + "2005", + "European U23 Championships", + "Erfurt, Germany", + "2nd", + "800m", + "1:51.47" + ], + [ + "2006", + "European Championships", + "Gothenburg, Sweden", + "12th (semis)", + "800m", + "1:49.37" + ], + [ + "2007", + "European Indoor Championships", + "Birmingham, United Kingdom", + "12th (heats)", + "800m", + "1:54.54" + ], + [ + "2007", + "World Championships", + "Osaka, Japan", + "5th (semis)", + "800 m", + "1:45.61" + ], + [ + "2007", + "IAAF World Athletics Final", + "Stuttgart, Germany", + "6th", + "800m", + "1:47.06" + ], + [ + "2008", + "World Indoor Championships", + "Valencia, Spain", + "5th (semis)", + "800 m", + "1:48.90" + ], + [ + "2008", + "Olympic Games", + "Beijing, China", + "4th (semis)", + "800 m", + "1:45.91" + ], + [ + "2009", + "European Indoor Championships", + "Turin, Italy", + "5th", + "800 m", + "1:49.77" + ], + [ + "2009", + "World Championships", + "Berlin, Germany", + "—", + "800 m", + "DNF" + ], + [ + "2010", + "European Championships", + "Barcelona, Spain", + "3rd", + "1500 m", + "3:43.54" + ], + [ + "2011", + "European Indoor Championships", + "Paris, France", + "1st", + "1500 m", + "3:41.03" + ], + [ + "2011", + "European Team Championships", + "Stockholm, Sweden", + "1st", + "1500 m", + "3:38.63" + ] + ], + "title": "", + "original_id": "683bd6790af412784782f32319148ce8" + }, + { + "_id": "5dad570c18304377caf1c09879b9a92c", + "header": [ + "year", + "winner (number of titles)", + "runners - up", + "top team in regular season (points)", + "top scorer (points)", + "winning coach" + ], + "rows": [ + [ + "1968", + "atlanta chiefs (1)", + "san diego toros", + "san diego toros (186 points)", + "janusz kowalik", + "phil woosnam" + ], + [ + "1969", + "kansas city spurs (1)", + "atlanta chiefs", + "kansas city spurs (110 points)", + "kaizer motaung", + "janos bedl" + ], + [ + "1970", + "rochester lancers (1)", + "washington darts", + "washington darts (137 points)", + "kirk apostolidis", + "sal derosa" + ], + [ + "1971", + "dallas tornado (1)", + "atlanta chiefs", + "rochester lancers (141 points)", + "carlos metidieri", + "ron newman" + ], + [ + "1972", + "new york cosmos (1)", + "st louis stars", + "new york cosmos (77 points)", + "randy horton", + "gordon bradley" + ], + [ + "1973", + "philadelphia atoms (1)", + "dallas tornado", + "dallas tornado (111 points)", + "kyle rote , jr", + "al miller" + ], + [ + "1974", + "los angeles aztecs (1)", + "miami toros", + "los angeles aztecs (110 points)", + "paul child", + "alex perolli" + ], + [ + "1975", + "tampa bay rowdies (1)", + "portland timbers", + "portland timbers (138 points)", + "steve david", + "eddie firmani" + ], + [ + "1976", + "toronto metros - croatia (1)", + "minnesota kicks", + "tampa bay rowdies (154 points)", + "giorgio chinaglia", + "domagoj kapetanović" + ], + [ + "1977", + "new york cosmos (2)", + "seattle sounders", + "fort lauderdale strikers (161 points)", + "steve david", + "eddie firmani" + ], + [ + "1978", + "new york cosmos (3)", + "tampa bay rowdies", + "new york cosmos (212 points)", + "giorgio chinaglia", + "eddie firmani" + ], + [ + "1979", + "vancouver whitecaps (1)", + "tampa bay rowdies", + "new york cosmos (216 points)", + "oscar fabbiani", + "tony waiters" + ], + [ + "1980", + "new york cosmos (4)", + "fort lauderdale strikers", + "new york cosmos (213 points)", + "giorgio chinaglia", + "hennes weisweiler & yasin özdenak" + ], + [ + "1981", + "chicago sting (1)", + "new york cosmos", + "new york cosmos (200 points)", + "giorgio chinaglia", + "willy roy" + ], + [ + "1982", + "new york cosmos (5)", + "seattle sounders", + "new york cosmos (203 points)", + "giorgio chinaglia", + "julio mazzei" + ], + [ + "1983", + "tulsa roughnecks (1)", + "toronto blizzard", + "new york cosmos (194 points)", + "roberto cabañas", + "terry hennessey" + ] + ], + "title": "", + "original_id": "6f65e885bfa8dc52b0cd93679c9acca7" + }, + { + "_id": "6ada3857bbf5aa5d2d8813f4d8db225a", + "header": [ + "year", + "venue", + "location", + "winning team", + "score", + "us captain", + "international captain" + ], + "rows": [ + [ + "2013", + "muirfield village", + "dublin , ohio", + "united states", + "18½ - 15½", + "fred couples", + "nick price" + ], + [ + "2011", + "royal melbourne golf club", + "melbourne , australia", + "united states", + "19 - 15", + "fred couples", + "greg norman" + ], + [ + "2009", + "harding park golf club", + "san francisco , california", + "united states", + "19½ - 14½", + "fred couples", + "greg norman" + ], + [ + "2007", + "royal montreal golf club", + "montreal , canada", + "united states", + "19½ - 14½", + "jack nicklaus", + "gary player" + ], + [ + "2005", + "robert trent jones golf club", + "gainesville , virginia", + "united states", + "18½ - 15½", + "jack nicklaus", + "gary player" + ], + [ + "2003", + "fancourt hotel and country club", + "george , western cape , south africa", + "tied", + "17 - 17", + "jack nicklaus", + "gary player" + ], + [ + "2000", + "robert trent jones golf club", + "gainesville , virginia", + "united states", + "21½ - 10½", + "ken venturi", + "peter thomson" + ], + [ + "1998", + "royal melbourne golf club", + "melbourne , australia", + "international", + "20½ - 11½", + "jack nicklaus", + "peter thomson" + ], + [ + "1996", + "robert trent jones golf club", + "gainesville , virginia", + "united states", + "16½ - 15½", + "arnold palmer", + "peter thomson" + ], + [ + "1994", + "robert trent jones golf club", + "gainesville , virginia", + "united states", + "20 - 12", + "hale irwin", + "david graham" + ] + ], + "title": "", + "original_id": "04ee0f17194c6801d956b34508e32420" + }, + { + "_id": "690dbec079ff62d836d1a7d6a0815d91", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing France", + "Representing France", + "Representing France", + "Representing France", + "Representing France", + "Representing France" + ], + [ + "2011", + "World Youth Championships", + "Lille, France", + "7th", + "400 m", + "47.27" + ], + [ + "2011", + "World Youth Championships", + "Lille, France", + "3rd", + "Medley relay", + "1:51.81" + ], + [ + "2013", + "European Indoor Championships", + "Gothenburg, Sweden", + "–", + "400 m", + "DQ" + ], + [ + "2013", + "European Junior Championships", + "Rieti, Italy", + "3rd", + "400 m", + "46.21" + ], + [ + "2013", + "European Junior Championships", + "Rieti, Italy", + "4th", + "4x400 m relay", + "3:05.41" + ], + [ + "2014", + "IAAF World Relays", + "Nassau, Bahamas", + "10th (h)", + "4x400 m relay", + "3:03.74" + ], + [ + "2014", + "European Championships", + "Zürich, Switzerland", + "3rd", + "4x400 m relay", + "2:59.89" + ], + [ + "2015", + "IAAF World Relays", + "Nassau, Bahamas", + "10th (h)", + "4x400 m relay", + "3:03.88" + ], + [ + "2015", + "European U23 Championships", + "Tallinn, Estonia", + "1st", + "400 m", + "45.50" + ], + [ + "2015", + "European U23 Championships", + "Tallinn, Estonia", + "1st", + "4x400 m relay", + "3:04.92" + ], + [ + "2015", + "World Championships", + "Beijing, China", + "6th", + "4x400 m relay", + "3:00.65" + ], + [ + "2016", + "European Championships", + "Amsterdam, Netherlands", + "17th (sf)", + "400 m", + "46.24" + ], + [ + "2016", + "European Championships", + "Amsterdam, Netherlands", + "12th (h)", + "4x400 m relay", + "3:04.95" + ], + [ + "2016", + "Olympic Games", + "Rio de Janeiro, Brazil", + "9th (h)", + "4x400 m relay", + "3:00.82" + ], + [ + "2017", + "European Indoor Championships", + "Belgrade, Serbia", + "7th (h)", + "400 m", + "47.49" + ], + [ + "2017", + "European Indoor Championships", + "Belgrade, Serbia", + "4th", + "4x400 m relay", + "3:08.99" + ], + [ + "2017", + "IAAF World Relays", + "Nassau, Bahamas", + "8th", + "4x400 m relay", + "3:06.33" + ], + [ + "2017", + "World Championships", + "London, United Kingdom", + "8th", + "4x400 m relay", + "3:01.79" + ], + [ + "2018", + "European Championships", + "Berlin, Germany", + "4th", + "4 × 400 m relay", + "3:02.08" + ], + [ + "2019", + "European Indoor Championships", + "Glasgow, United Kingdom", + "3rd", + "4 × 400 m relay", + "3:07.71" + ] + ], + "title": "", + "original_id": "62a2796dac6e8c1bb660234c453b25bf" + }, + { + "_id": "6ad1ccb699929673724bc3c95854ce6a", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Norway", + "Representing Norway", + "Representing Norway", + "Representing Norway", + "Representing Norway", + "Representing Norway" + ], + [ + "1980", + "Stockholm Marathon", + "Stockholm, Sweden", + "1st", + "Marathon", + "2:38:45" + ], + [ + "1981", + "Stockholm Marathon", + "Stockholm, Sweden", + "1st", + "Marathon", + "2:41:34" + ], + [ + "1981", + "New York City Marathon", + "New York, United States", + "2nd", + "Marathon", + "2:30:08" + ], + [ + "1982", + "Stockholm Marathon", + "Stockholm, Sweden", + "1st", + "Marathon", + "2:34:26" + ], + [ + "1982", + "European Championships", + "Athens, Greece", + "3rd", + "Marathon", + "2:36:38" + ], + [ + "1982", + "New York City Marathon", + "New York, United States", + "5th", + "Marathon", + "2:33:36" + ], + [ + "1983", + "Houston Marathon", + "Houston, United States", + "1st", + "Marathon", + "2:33:27" + ], + [ + "1984", + "Houston Marathon", + "Houston, United States", + "1st", + "Marathon", + "2:27:51" + ], + [ + "1984", + "World Cross Country Championships", + "New York, United States", + "4th", + "-", + "-" + ], + [ + "1984", + "London Marathon", + "London, United Kingdom", + "1st", + "Marathon", + "2:24:26" + ], + [ + "1984", + "Olympic Games", + "Los Angeles, United States", + "4th", + "Marathon", + "2:27:14" + ], + [ + "1985", + "World Cross Country Championships", + "Lisbon, Portugal", + "3rd", + "-", + "-" + ], + [ + "1985", + "London Marathon", + "London, United Kingdom", + "1st", + "Marathon", + "2:21:06" + ], + [ + "1985", + "Chicago Marathon", + "Chicago, United States", + "2nd", + "Marathon", + "2:23:05" + ], + [ + "1986", + "Boston Marathon", + "Boston, United States", + "1st", + "Marathon", + "2:24:55" + ], + [ + "1986", + "European Championships", + "Stuttgart, West Germany", + "1st", + "10,000 m", + "30:23.25" + ], + [ + "1986", + "Chicago Marathon", + "Chicago, United States", + "1st", + "Marathon", + "2:27:08" + ], + [ + "1987", + "World Cross Country Championships", + "Warsaw, Poland", + "3rd", + "-", + "-" + ], + [ + "1987", + "London Marathon", + "London, United Kingdom", + "1st", + "Marathon", + "2:22:48" + ], + [ + "1987", + "World Championships", + "Rome, Italy", + "1st", + "10,000 m", + "31:05.85" + ], + [ + "1987", + "World Road Race Championships", + "Monte Carlo, Monaco", + "1st", + "15 km", + "47:17" + ], + [ + "1988", + "World Road Race Championships", + "Adelaide, Australia", + "1st", + "15 km", + "48:24" + ], + [ + "1988", + "World Cross Country Championships", + "Auckland, New Zealand", + "1st", + "-", + "-" + ], + [ + "1988", + "London Marathon", + "London, United Kingdom", + "1st", + "Marathon", + "2:25:41" + ], + [ + "1988", + "Olympic Games", + "Seoul, South Korea", + "—", + "10,000 m", + "DNF" + ], + [ + "1989", + "Boston Marathon", + "Boston, United States", + "1st", + "Marathon", + "2:24:33" + ], + [ + "1989", + "New York City Marathon", + "New York, United States", + "1st", + "Marathon", + "2:25:30" + ], + [ + "1991", + "World Championships", + "Tokyo, Japan", + "7th", + "10,000 m", + "32:10.75" + ] + ], + "title": "", + "original_id": "44c97ca5774b136c1cc34aa547a5c2d3" + }, + { + "_id": "69e5ba3d96729c6f6aa2475087e79563", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "2002", + "Central American and Caribbean Junior Championships (U-17)", + "Bridgetown, Barbados", + "1st", + "5 km", + "21:24.33 CR" + ], + [ + "2004", + "Central American and Caribbean Junior Championships (U-20)", + "Coatzacoalcos, México", + "1st", + "10 km", + "43:21.99" + ], + [ + "2004", + "World Junior Championships", + "Grosseto, Italy", + "4th", + "10 km", + "41:01.64" + ], + [ + "2005", + "World Championships", + "Helsinki, Finland", + "8th", + "20 km", + "1:20:45" + ], + [ + "2006", + "Central American and Caribbean Games", + "Cartagena, Colombia", + "2nd", + "20 km", + "1:26:30" + ], + [ + "2007", + "World Championships", + "Osaka, Japan", + "4th", + "20 km", + "1:23:36" + ], + [ + "2008", + "Olympic Games", + "Beijing, PR China", + "15th", + "20 km", + "1:21:53" + ], + [ + "2009", + "World Championships", + "Berlin, Germany", + "3rd", + "20 km", + "1:19:22" + ], + [ + "2010", + "Central American and Caribbean Games", + "Mayagüez, Puerto Rico", + "1st", + "20 km", + "1:22:32 GR" + ], + [ + "2011", + "World Championships", + "Daegu, Korea", + "15th", + "20 km", + "1:23:05" + ], + [ + "2011", + "Pan American Games", + "Guadalajara, Mexico", + "6th", + "20 km", + "1:25:00" + ] + ], + "title": "", + "original_id": "c3b5ccefd2f494f20227e5932ecc5f4a" + }, + { + "_id": "5e3f66007865b50f6fe896724495192d", + "header": [ + "year", + "team", + "co - drivers", + "class", + "laps", + "pos", + "class pos" + ], + "rows": [ + [ + "2002", + "prodrive", + "rickard rydell alain menu", + "gts", + "167", + "dnf", + "dnf" + ], + [ + "2003", + "veloqx prodrive racing", + "peter kox jamie davies", + "gts", + "336", + "10th", + "1st" + ], + [ + "2004", + "prodrive racing", + "peter kox alain menu", + "gts", + "325", + "11th", + "4th" + ], + [ + "2005", + "aston martin racing", + "peter kox pedro lamy", + "gt1", + "327", + "dnf", + "dnf" + ], + [ + "2006", + "aston martin racing", + "darren turner andrea piccini", + "gt1", + "350", + "6th", + "2nd" + ], + [ + "2007", + "aston martin racing", + "johnny herbert peter kox", + "gt1", + "337", + "9th", + "4th" + ], + [ + "2008", + "charouz racing system aston martin racing", + "jan charouz stefan mücke", + "lmp1", + "354", + "9th", + "9th" + ], + [ + "2009", + "amr eastern europe", + "jan charouz stefan mücke", + "lmp1", + "373", + "4th", + "4th" + ], + [ + "2010", + "young driver amr", + "christoffer nygaard peter kox", + "gt1", + "311", + "22nd", + "3rd" + ] + ], + "title": "", + "original_id": "b9c6c463d0a104019f3bd66c71816c25" + }, + { + "_id": "3b15285b448d014937fe296fbabe0ded", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Algeria", + "Representing Algeria", + "Representing Algeria", + "Representing Algeria", + "Representing Algeria", + "Representing Algeria" + ], + [ + "2001", + "World Youth Championships", + "Debrecen, Hungary", + "26th", + "10,000 m walk", + "48:40.35" + ], + [ + "2004", + "World Race Walking Cup", + "Naumburg, Germany", + "–", + "20 km walk", + "DQ" + ], + [ + "2006", + "African Championships", + "Bambous, Mauritius", + "6th", + "20 km walk", + "1:29:34" + ], + [ + "2007", + "All-Africa Games", + "Algiers, Algeria", + "3rd", + "20 km walk", + "1:25:12" + ], + [ + "2007", + "Pan Arab Games", + "Cairo, Egypt", + "3rd", + "20,000 m walk", + "1:43:35.8" + ], + [ + "2008", + "African Championships", + "Addis Ababa, Ethiopia", + "1st", + "20 km walk", + "1:22:55 (CR)" + ], + [ + "2008", + "Olympic Games", + "Beijing, China", + "48th", + "20 km walk", + "1:32:21" + ], + [ + "2009", + "Universiade", + "Belgrade, Serbia", + "15th", + "20 km walk", + "1:26:21" + ], + [ + "2010", + "African Championships", + "Nairobi, Kenya", + "5th", + "20 km walk", + "1:24:53" + ], + [ + "2012", + "African Championships", + "Addis Ababa, Ethiopia", + "3rd", + "20 km walk", + "?" + ], + [ + "2014", + "African Championships", + "Marrakech, Morocco", + "3rd", + "20 km walk", + "1:27:48" + ], + [ + "2015", + "African Games", + "Brazzaville, Republic of the Congo", + "–", + "20 km walk", + "DNF" + ], + [ + "2016", + "African Championships", + "Durban, South Africa", + "7th", + "20 km walk", + "1:26:17" + ], + [ + "2018", + "African Championships", + "Asaba, Nigeria", + "6th", + "20 km walk", + "1:28.38" + ] + ], + "title": "", + "original_id": "ad90ad414ff991cd2c1aed8154091536" + }, + { + "_id": "026db8824291afdf9f2426205fff107d", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Notes", + "-" + ], + "rows": [ + [ + "Representing Ireland", + "Representing Ireland", + "Representing Ireland", + "Representing Ireland", + "Representing Ireland", + "-" + ], + [ + "1978", + "Irish National Marathon Championship", + "Tullamore", + "Gold", + "2:23:19", + "18 June 1978" + ], + [ + "1978", + "1978 European Championships in Athletics", + "Prague", + "29th", + "2:21:01", + "3 September 1978" + ], + [ + "1980", + "Dublin Marathon", + "Dublin", + "Gold", + "2:16:14", + "26 October 1980" + ], + [ + "1980", + "Irish National Marathon Championship", + "Tullamore", + "Gold", + "2:16:27", + "8 July 1980" + ], + [ + "1980", + "Moscow Olympics", + "Moscow", + "38th place", + "2:23:53", + "1 August 1980" + ], + [ + "1981", + "Irish National Marathon Championship", + "Cork", + "Gold", + "2:15:37", + "7 June 1981" + ], + [ + "1982", + "Irish National Marathon Championship", + "Limerick", + "Gold", + "2:12:56", + "6 June 1982" + ], + [ + "1982", + "1982 European Championships in Athletics – Men's Marathon", + "Athens", + "11th place", + "2:20:51", + "12 September 1982" + ], + [ + "1984", + "Irish National Marathon Championship", + "Cork", + "Gold", + "2:14:39", + "23 April 1984" + ], + [ + "1984", + "Los Angeles Olympics", + "Los Angeles", + "51st place", + "2:24:41", + "12 August 1984" + ], + [ + "1985", + "Dublin Marathon", + "Dublin", + "Gold", + "2:13:48", + "27 October 1985" + ], + [ + "1986", + "Dublin Marathon", + "Dublin", + "Gold", + "2:18:10", + "26 October 1986" + ], + [ + "1986", + "1986 European Athletics Championships – Men's marathon", + "Stuttgart", + "16th place", + "2:17.45", + "30 August 1986" + ], + [ + "1987", + "1987 Dublin Marathon", + "Dublin", + "Bronze", + "2:14:36", + "25 October 1987" + ], + [ + "1988", + "Irish National Marathon Championship", + "Wexford", + "Silver", + "2:12:19 PB", + "24 April 1988" + ], + [ + "1988", + "Seoul Olympics", + "Seoul", + "24th place", + "2:17:16", + "2 October 1988" + ], + [ + "1990", + "1990 European Championships in Athletics – Men's Marathon", + "Split", + "23rd place", + "2:32.36", + "1 September 1990" + ], + [ + "1998", + "Irish National Marathon Championship", + "Killenaule", + "Gold", + "(2:22:08)", + "19 April 1998" + ], + [ + "1998", + "New York City Marathon", + "New York City", + "34th place", + "2:22:46", + "1 November 1998" + ] + ], + "title": "", + "original_id": "bf5aa174142f7c00d027c71cde38f669" + }, + { + "_id": "348ad5306db94cbc7568a6520211ea8a", + "header": [ + "Year", + "Winners", + "Score", + "Score.1", + "Runners-up", + "Venue", + "Winning Captain" + ], + "rows": [ + [ + "2000", + "Meath", + "5-14 (29)", + "2-10 (16)", + "Carlow", + "Cusack Park", + null + ], + [ + "2001", + "Kerry", + "4-14 (22)", + "3-10 (19)", + "Westmeath", + "Croke Park", + "Michael 'Boxer' Slattery" + ], + [ + "2002", + "Laois", + "1-20 (23)", + "2-14 (20)", + "Antrim", + "Semple Stadium", + "John Lyons" + ], + [ + "2003", + "Antrim", + "3-18 (27)", + "3-12 (21)", + "Kerry", + "Croke Park", + null + ], + [ + "2004", + "Down", + "5-15 (30)", + "3-7 (16)", + "Westmeath", + "Gaelic Grounds", + "Simon Wilson" + ], + [ + "2005", + "Offaly", + "6-21 (39)", + "4-7 (19)", + "Carlow", + "Semple Stadium", + "Barry Teehan" + ], + [ + "2006", + "Dublin", + "0-16 (16)", + "1-6 (9)", + "Kerry", + "Semple Stadium", + "Philip Brennan" + ], + [ + "2007", + "Laois", + "2-19 (25)", + "0-8 (8)", + "Wicklow", + "Semple Stadium", + "Joe FitzPatrick" + ], + [ + "2008", + "Westmeath", + "2-12 (18)", + "0-12 (12)", + "Carlow", + "Gaelic Grounds", + "Brendan Murtagh" + ], + [ + "2009", + "Offaly", + "1-13 (16)", + "0-13 (13)", + "Wexford", + "Semple Stadium", + "Ger Oakley" + ], + [ + "2010", + "Wexford", + "1-16 (19)", + "2-9 (15)", + "Clare", + "Semple Stadium", + "Diarmuid Lyng" + ], + [ + "2011", + "Limerick", + "4-12 (24)", + "2-13 (19)", + "Clare", + "Cusack Park", + "Gavin O'Mahony" + ], + [ + "2012", + "Clare", + "0-21 (21)", + "1-16 (19)", + "Limerick", + "Gaelic Grounds", + "Patrick Donnellan" + ], + [ + "2013", + "Dublin", + "1-16 (19)", + "1-15 (18)", + "Limerick", + "Semple Stadium", + "TBC" + ] + ], + "title": "", + "original_id": "17df1b57444c60eb8a376c944f8078d4" + }, + { + "_id": "3025830ca114e0a31ad258cc854d2d57", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Germany", + "Representing Germany", + "Representing Germany", + "Representing Germany", + "Representing Germany", + "Representing Germany" + ], + [ + "2006", + "European Championships", + "Gothenburg, Sweden", + "10th (h)", + "1500 m", + "3:42.62" + ], + [ + "2008", + "World Indoor Championships", + "Valencia, Spain", + "10th (h)", + "1500 m", + "3:41.54" + ], + [ + "2008", + "Olympic Games", + "Beijing, China", + "14th (sf)", + "1500 m", + "3:37.94" + ], + [ + "2009", + "European Indoor Championships", + "Turin, Italy", + "12th (h)", + "1500 m", + "3:43.45" + ], + [ + "2009", + "World Championships", + "Berlin, Germany", + "30th (h)", + "1500 m", + "3:44.00" + ], + [ + "2010", + "European Championships", + "Barcelona, Spain", + "2nd", + "1500 m", + "3:43.52" + ], + [ + "2011", + "European Indoor Championships", + "Paris, France", + "4th", + "1500 m", + "3:41.55" + ], + [ + "2012", + "European Championships", + "Helsinki, Finland", + "17th (h)", + "1500 m", + "3:46.52" + ], + [ + "2012", + "Olympic Games", + "London, United Kingdom", + "11th (sf)", + "1500 m", + "3:38.23" + ], + [ + "2013", + "World Championships", + "Moscow, Russia", + "22nd (sf)", + "1500 m", + "3:44.44" + ] + ], + "title": "", + "original_id": "292273783eb28ae67577c7ae703155c7" + }, + { + "_id": "f42c5d9a93f7c9676db31fc6d9126a8c", + "header": [ + "Year", + "Image", + "Winner", + "University", + "Sport", + "Other nominees", + "Ref(s)" + ], + "rows": [ + [ + "2002", + "Sue Bird playing in a basketball game in 2012", + "Sue Bird", + "University of Connecticut Huskies", + "Basketball", + "Natalie Coughlin – California Golden Bears (Swimming) Jennie Finch – Arizona Wildcats (Softball) Stacey Nuveman – UCLA Bruins (Softball) Jackie Stiles – Missouri State Lady Bears (Basketball)", + "-" + ], + [ + "2003", + "Diana Taurasi competing in a basketball match in 2014", + "Diana Taurasi", + "University of Connecticut Huskies", + "Basketball", + "Alana Beard – Duke Blue Devils (Basketball) Natalie Coughlin – California Golden Bears (Swimming) Cat Osterman – Texas Longhorns (Softball)", + "-" + ], + [ + "2004", + "Diana Taurasi at the White House in 2008", + "Diana Taurasi", + "University of Connecticut Huskies", + "Basketball", + "Alana Beard – Duke Blue Devils (Basketball) Tara Kirk – Stanford Cardinal (Swimming) Cat Reddick – North Carolina Tar Heels (Soccer) Jessica van der Linden – Florida State Seminoles (Softball)", + "-" + ], + [ + "2005", + "Cat Osterman competing in a softball tournament in 2006", + "Cat Osterman", + "University of Texas Longhorns", + "Softball", + "Seimone Augustus – LSU Lady Tigers (Basketball) Nicole Corriero – Harvard Crimson (Ice hockey) Kristen Maloney – UCLA Bruins (Gymnastics) Katie Thorlakson – Notre Dame (Soccer)", + "-" + ], + [ + "2006", + "Cat Osterman competing in a softball tournament in 2006", + "Cat Osterman", + "University of Texas Longhorns", + "Softball", + "Seimone Augustus – LSU Lady Tigers (Basketball) Virginia Powell – USC Trojans (Track and field) Christine Sinclair – Portland Pilots (Soccer) Courtney Thompson – Washington Huskies (Volleyball)", + "-" + ], + [ + "2007", + "Taryne Mowatt attending a Red Carpet event in 2008", + "Taryne Mowatt", + "University of Arizona Wildcats", + "Softball", + "Monica Abbott – Tennessee Volunteers (Softball) Kerri Hanks – Notre Dame Fighting Irish (Soccer) Kara Lynn Joyce – Georgia Bulldogs (Swimming)", + "-" + ], + [ + "2008", + "Candace Parker playing for the Los Angeles Sparks in 2017", + "Candace Parker", + "University of Tennessee Lady Vols", + "Basketball", + "Rachel Dawson – North Carolina Tar Heels (Field hockey) Angela Tincher – Virginia Tech Hokies (Softball)", + "-" + ], + [ + "2009", + "Maya Moore attending a celebratory dinner in 2009", + "Maya Moore", + "University of Connecticut Huskies", + "Basketball", + "Kerri Hanks – Notre Dame Fighting Irish (Soccer) Courtney Kupets – Georgia Gymdogs (Gymnastics) Danielle Lawrie – Washington Huskies (Softball) Dana Vollmer – California Golden Bears (Swimming)", + "-" + ], + [ + "2010", + "Maya Moore playing for the United States National Women's Basketball team in 2010", + "Maya Moore", + "University of Connecticut Huskies", + "Basketball", + "Tina Charles – Connecticut Huskies (Basketball) Megan Hodge – Penn State Nittany Lions (Volleyball) Megan Langenfeld – UCLA Bruins (Softball)", + "-" + ], + [ + "2011", + "Maya Moore holding a gold-plated trophy in 2011", + "Maya Moore", + "University of Connecticut Huskies", + "Basketball", + "Blair Brown – Penn State Nittany Lions (Volleyball) Dallas Escobedo – Arizona State Sun Devils (Softball) Melissa Henderson – Notre Dame Fighting Irish (Soccer) Katinka Hosszú – USC Trojans (Swimming)", + "-" + ], + [ + "2012", + "Brittney Griner holding a trophy amongst a group of people in 2012", + "Brittney Griner", + "Baylor University Lady Bears", + "Basketball", + "Alexandra Jupiter – USC Trojans (Volleyball) Caitlin Leverenz – California Golden Bears (Swimming) Teresa Noyola – Stanford Cardinal (Soccer) Jackie Traina – Alabama Crimson Tide (Softball)", + "-" + ], + [ + "2013", + "Brittney Griner competing in a 2017 basketball game", + "Brittney Griner", + "Baylor University Lady Bears", + "Basketball", + "Kara Cannizzaro – North Carolina Tar Heels (Lacrosse) Crystal Dunn – North Carolina Tar Heels (Soccer) Keilani Ricketts – Oklahoma Sooners (Softball)", + "-" + ], + [ + "2014", + "Breanna Stewart holding a plague in her left hand in 2012", + "Breanna Stewart", + "University of Connecticut Huskies", + "Basketball", + "Morgan Brian – Virginia Cavaliers (Soccer) Taylor Cummings – Maryland Terrapins (Lacrosse) Micha Hancock – Penn State Nittany Lions (Volleyball) Hannah Rogers – Florida Gators (Softball)", + "-" + ], + [ + "2015", + "Missy Franklin competing in an outdoor swimming tournament in 2014", + "Missy Franklin", + "University of California, Berkeley Golden Bears", + "Swimming", + "Taylor Cummings – Maryland Terrapins (Lacrosse) Lauren Haeger – Florida Gators (Softball) Micha Hancock – Penn State Nittany Lions (Volleyball) Breanna Stewart – Connecticut Huskies (Basketball)", + "-" + ], + [ + "2016", + "Breanna Stewart holding a gold-plated trophy in both hands in 2016", + "Breanna Stewart", + "University of Connecticut Huskies", + "Basketball", + "Samantha Bricio – USC Trojans (Volleyball) Taylor Cummings – Maryland Terrapins (Lacrosse) Raquel Rodríguez – Penn State Nittany Lions (Soccer) Sierra Romero – Michigan Wolverines (Softball)", + "-" + ], + [ + "2017", + "–", + "Kelly Barnhill", + "University of Florida Gators", + "Softball", + "Inky Ajanaku – Stanford Cardinal (Volleyball) Kadeisha Buchanan – West Virginia Mountaineers (Soccer) Kelsey Plum – Washington Huskies (Basketball) Zoe Stukenberg – Maryland Terrapins (Lacrosse)", + "-" + ] + ], + "title": "", + "original_id": "028ff73df51114e5b016e37593d548ad" + }, + { + "_id": "e41f2eb7764a4df3bd8598835d60decc", + "header": [ + "year", + "title", + "producer", + "narrator", + "author", + "citation" + ], + "rows": [ + [ + "2013", + "the fault in our stars", + "brilliance audio", + "kate rudd", + "john green", + "winner" + ], + [ + "2013", + "artemis fowl : the last guardian", + "listening library", + "nathaniel parker", + "eoin colfer", + "honor" + ], + [ + "2013", + "ghost knight", + "listening library", + "elliot hill", + "cornelia funke", + "honor" + ], + [ + "2013", + "monstrous beauty", + "macmillan audio", + "katherine kellgren", + "elizabeth fama", + "honor" + ], + [ + "2012", + "rotters", + "listening library", + "kirby heyborne", + "daniel kraus", + "winner" + ], + [ + "2012", + "ghetto cowboy", + "brilliance audio", + "jd jackson", + "g neri", + "honor" + ], + [ + "2012", + "okay for now", + "listening library", + "lincoln hoppe", + "gary d schmidt", + "honor" + ], + [ + "2012", + "the scorpio races", + "scholastic audio books", + "steve west fiona hardingham", + "maggie stiefvater", + "honor" + ], + [ + "2012", + "young fredle", + "listening library", + "wendy carter", + "cynthia voigt", + "honor" + ], + [ + "2011", + "the true meaning of smekday", + "listening library", + "bahni turpin", + "adam rex", + "honor" + ], + [ + "2011", + "alchemy and meggy swann", + "listening library", + "katherine kellgren", + "karen cushman", + "honor" + ], + [ + "2011", + "the knife of never letting go", + "brilliance audio", + "nick podehl", + "patrick ness", + "honor" + ], + [ + "2011", + "revolution", + "listening library", + "emily janice card", + "jennifer donnelly", + "honor" + ], + [ + "2011", + "will grayson , will grayson", + "brilliance audio", + "macleod andrews", + "john green david levithan", + "honor" + ], + [ + "2010", + "louise , the adventures of a chicken", + "live oak media", + "barbara rosenblat", + "kate dicamillo", + "winner" + ], + [ + "2010", + "in the belly of the bloodhound", + "listen & live audio", + "katherine kellgren", + "l a meyer", + "honor" + ], + [ + "2010", + "peace , locomotion", + "brilliance audio", + "dion graham", + "jacqueline woodson", + "honor" + ], + [ + "2010", + "we are the ship : the story of negro baseball", + "brilliance audio", + "dion graham", + "kadir nelson", + "honor" + ], + [ + "2009", + "the absolutely true diary of a part - time indian", + "recorded books", + "sherman alexie", + "sherman alexie", + "winner" + ], + [ + "2009", + "curse of the blue tattoo", + "listen & live audio", + "katherine kellgren", + "l a meyer", + "honor" + ], + [ + "2009", + "elijah of buxton", + "listening library", + "mirron willis", + "christopher paul curtis", + "honor" + ], + [ + "2009", + "i'm dirty", + "scholastic media / weston woods studios", + "steve buscemi", + "kate mcmullan jim mcmullan", + "honor" + ], + [ + "2009", + "martina the beautiful cockroach : a cuban folktale", + "peachtree publishers", + "carmen agra deedy", + "carmen agra deedy", + "honor" + ], + [ + "2009", + "nation", + "harperaudio", + "stephen briggs", + "terry pratchett", + "honor" + ], + [ + "2008", + "jazz", + "live oak media", + "james d - train williams vaneese thomas", + "walter dean myers", + "winner" + ], + [ + "2008", + "bloody jack", + "listen & live audio", + "katherine kellgren", + "l a meyer", + "honor" + ], + [ + "2008", + "dooby dooby moo", + "scholastic / weston woods", + "randy travis", + "doreen cronin", + "honor" + ], + [ + "2008", + "harry potter and the deathly hallows", + "listening library", + "jim dales", + "j k rowling", + "honor" + ], + [ + "2008", + "skulduggery pleasant", + "harpercollins children 's audio", + "rupert degas", + "derek landy", + "honor" + ], + [ + "2008", + "treasure island", + "listening library", + "alfred molina", + "robert louis stevenson", + "honor" + ] + ], + "title": "", + "original_id": "a420bb044e68533fb84926d477b77a1b" + }, + { + "_id": "b5a34eb67e735212bbc8c7698046c56c", + "header": [ + "Year", + "Film", + "Director", + "Role", + "Country", + "Notes" + ], + "rows": [ + [ + "2009", + "Third Person Singular Number", + "Mostofa Sarwar Farooki", + "Ruba Haque", + "Bangladesh", + "Meril Prothom Alo Awards in Best Film Actress (Critics') category" + ], + [ + "2010", + "Runway", + "Tareque Masud", + "Selina", + "Bangladesh", + "Guest appearance" + ], + [ + "2012", + "Television", + "Mostofa Sarwar Farooki", + "Kohinoor", + "Bangladesh", + "Bangladesh's submission to Academy Awards" + ], + [ + "2016", + "Rana Pagla: The Mental", + "Shamim Ahamed Roni", + "Simi", + "Bangladesh", + "-" + ], + [ + "2016", + "Ostitto", + "Anonno Mamun", + "Pori", + "Bangladesh", + "National Film Award for Best Actress" + ], + [ + "2017", + "Doob: No Bed of Roses", + "Mostofa Sarwar Farooki", + "Saberi", + "Bangladesh, India", + "Meril Prothom Alo Awards in Best Film Actress(Popular) - Bangladesh's submission to 91st Academy Awards" + ], + [ + "2017", + "Haldaa", + "Tauquir Ahmed", + "Hasu", + "Bangladesh", + "-" + ], + [ + "2018", + "Rupkotha", + "Golam Muktadir Shaan", + "N/A", + "Bangladesh", + "A Bioscope Original production" + ], + [ + "2019", + "Trap", + "Tanim Parvez", + "N/A", + "Bangladesh", + "Iflix original short film" + ], + [ + "2019", + "Fagun Haway", + "Tauquir Ahmed", + "Deepti", + "Bangladesh", + "First Bangladeshi film based on the 1952 Language Movement" + ], + [ + "2019", + "Kintu Jodi Emon Hoto?", + "Emran Emon", + "Bushra", + "Bangladesh", + "First interactive short film in Bangladesh" + ], + [ + "2019", + "Holudboni", + "Mukul Roy Chaudhuri & Taher Shipon", + "Anu", + "India, Bangladesh", + "Post Production" + ], + [ + "2019", + "Saturday Afternoon", + "Mostafa Sarwar Farooki", + "N/A", + "Bangladesh, Germany, Russia", + "Inspired by the terror attack incident of 1st July, 2014 at Holey Artisan Bakery, Gulshan." + ], + [ + "2019", + "Mayaboti", + "Arun Chowdhury", + "Maya", + "Bangladesh", + "Post production" + ], + [ + "2019", + "Sincerely Yours, Dhaka", + "Abdullah Al Noor, Golam Kibria Farooki, Krishnendu Chattopadhyay, Mahmudul Islam, Md Rabiul Alam, Mir Mukarram Hossain, Nuhash Humayun, Rahat Rahman, Syed Ahmed Shawki, Syed Saleh Ahmed Sobhan and Tanvir Ahsan", + "Juthi", + "Bangladesh", + "First Bangladeshi Anthology film consisting of 11 vignettes by 11 Bangladeshi filmmakers" + ], + [ + "2019", + "Boba Rohosshya", + "Abhishek Bagchi", + "N/A", + "India", + "Pre production" + ] + ], + "title": "", + "original_id": "0de7c3849d42dbb530462d3c2d393334" + }, + { + "_id": "b8f5b5f46d80a55df9d995e241ac5cfc", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Russia", + "Representing Russia", + "Representing Russia", + "Representing Russia", + "Representing Russia", + "Representing Russia" + ], + [ + "1996", + "World Junior Championships", + "Sydney, Australia", + "18th (h)", + "3000m", + "9:42.99" + ], + [ + "1996", + "World Junior Championships", + "Sydney, Australia", + "12th", + "5000m", + "16:32.51" + ], + [ + "1997", + "European U23 Championships", + "Turku, Finland", + "7th", + "5000m", + "15:58.60" + ], + [ + "1997", + "European U23 Championships", + "Turku, Finland", + "7th", + "10,000m", + "33:48.43" + ], + [ + "2003", + "World Indoor Championships", + "Birmingham, England", + "6th", + "3000 m", + "8:50.62" + ], + [ + "2003", + "World Championships", + "Paris, France", + "6th", + "10,000 m", + "30:26.20" + ], + [ + "2004", + "World Indoor Championships", + "Budapest, Hungary", + "11th", + "3000 m", + "9:17.15" + ], + [ + "2005", + "World Championships", + "Helsinki, Finland", + "8th", + "10,000 m", + "30:33.75" + ], + [ + "2005", + "World Half Marathon Championships", + "Edmonton, Canada", + "4th", + "Half marathon", + "1:10:34" + ], + [ + "2006", + "European Championships", + "Gothenburg, Sweden", + "4th", + "10,000 m", + "30:35.90" + ], + [ + "2008", + "Rome City Marathon", + "Rome, Italy", + "1st", + "Marathon", + "2:22:53" + ], + [ + "2008", + "Olympic Games", + "Beijing, PR China", + "—", + "Marathon", + "DNF" + ] + ], + "title": "", + "original_id": "f100d3bd641b61a7b65d98cf81586752" + }, + { + "_id": "fcce7ce2ffbf087318796b69c3b9a627", + "header": [ + "Year", + "Award", + "Category", + "Work", + "Result", + "Ref." + ], + "rows": [ + [ + "2002", + "Online Film & Television Association Awards", + "Best Youth Performance", + "Road to Perdition", + "Nominated", + "-" + ], + [ + "2002", + "Saturn Awards", + "Best Performance by a Younger Actor", + "Road to Perdition", + "Won", + "-" + ], + [ + "2003", + "Broadcast Film Critics Association Awards", + "Best Young Actor/Actress", + "Road to Perdition", + "Nominated", + "-" + ], + [ + "2003", + "Las Vegas Film Critics Society Awards", + "Youth in Film", + "Road to Perdition", + "Nominated", + "-" + ], + [ + "2003", + "Phoenix Film Critics Society Awards", + "Best Performance by a Youth in a Leading or Supporting Role – Male", + "Road to Perdition", + "Nominated", + "-" + ], + [ + "2003", + "Young Artist Award", + "Best Performance in a Feature Film – Leading Young Actor", + "Road to Perdition", + "Won", + "-" + ], + [ + "2004", + "Teen Choice Awards", + "Choice Breakout TV Star – Male", + "7th Heaven", + "Nominated", + "-" + ], + [ + "2005", + "Teen Choice Awards", + "Choice TV Actor: Drama", + "7th Heaven", + "Nominated", + "-" + ], + [ + "2005", + "Young Artist Award", + "Best Performance in a TV Series (Comedy or Drama) – Leading Young Actor", + "7th Heaven", + "Nominated", + "-" + ], + [ + "2008", + "Fright Meter Awards", + "Best Supporting Actor", + "Solstice", + "Nominated", + "-" + ], + [ + "2013", + "Young Hollywood Awards", + "Best Ensemble (shared with Holland Roden, Crystal Reed, Dylan O'Brien and Tyler Posey)", + "Teen Wolf", + "Won", + "-" + ], + [ + "2014", + "Teen Choice Awards", + "Choice TV: Male Scene Stealer", + "Teen Wolf", + "Won", + "-" + ], + [ + "2017", + "Saturn Awards", + "Best Guest Performance on a Television Series", + "Supergirl", + "Nominated", + "-" + ] + ], + "title": "", + "original_id": "2d9cd413bf7d15b7e92be8a8a9a12efb" + }, + { + "_id": "85063efb458f805b35d5378318dd7898", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Nigeria", + "Representing Nigeria", + "Representing Nigeria", + "Representing Nigeria", + "Representing Nigeria", + "Representing Nigeria" + ], + [ + "1995", + "African Junior Championships", + "Bouaké, Ivory Coast", + "2nd", + "100 m", + "10.42" + ], + [ + "1995", + "African Junior Championships", + "Bouaké, Ivory Coast", + "2nd", + "200 m", + "20.98" + ], + [ + "1996", + "African Championships", + "Yaoundé, Cameroon", + "3rd", + "100 m", + "10.66" + ], + [ + "1996", + "World Junior Championships", + "Sydney, Australia", + "4th", + "200 m", + "21.11 (wind: -1.6 m/s)" + ], + [ + "1997", + "African Junior Championships", + "Ibadan, Nigeria", + "1st", + "100 m", + "10.55" + ], + [ + "1997", + "African Junior Championships", + "Ibadan, Nigeria", + "1st", + "200 m", + "21.12" + ], + [ + "1998", + "African Championships", + "Dakar, Senegal", + "2nd", + "200 m", + "20.45" + ], + [ + "1999", + "World Championships", + "Seville, Spain", + "49th (qf)", + "200 m", + "21.12" + ], + [ + "1999", + "All-Africa Games", + "Johannesburg, South Africa", + "5th", + "200 m", + "20.75" + ], + [ + "2000", + "Olympic Games", + "Sydney, Australia", + "14th (sf)", + "100 m", + "10.45" + ], + [ + "2000", + "Olympic Games", + "Sydney, Australia", + "8th (h)", + "4 × 100 m relay", + "38.97" + ], + [ + "2001", + "World Indoor Championships", + "Edmonton, Canada", + "52nd (h)", + "60 m", + "7.18" + ], + [ + "2001", + "World Championships", + "Edmonton, Canada", + "10th (h)", + "4 × 100 m relay", + "39.10" + ], + [ + "2002", + "Commonwealth Games", + "Manchester, United Kingdom", + "6th", + "4 × 100 m relay", + "39.01" + ], + [ + "2002", + "African Championships", + "Radès, Tunisia", + "1st", + "4 × 100 m relay", + "39.76" + ] + ], + "title": "", + "original_id": "51dbc10938c42844de86defc6426167b" + }, + { + "_id": "2e9dab5b7209a221bcdb5e39772ffe45", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing New Caledonia", + "Representing New Caledonia", + "Representing New Caledonia", + "Representing New Caledonia", + "Representing New Caledonia", + "Representing New Caledonia" + ], + [ + "1966", + "South Pacific Games", + "Nouméa, New Caledonia", + "1st", + "Shot put", + "15.82 m" + ], + [ + "1966", + "South Pacific Games", + "Nouméa, New Caledonia", + "2nd", + "Discus throw", + "44.68 m" + ], + [ + "1969", + "South Pacific Games", + "Port Moresby, Papua New Guinea", + "1st", + "Shot put", + "17.89 m" + ], + [ + "1969", + "South Pacific Games", + "Port Moresby, Papua New Guinea", + "1st", + "Discus throw", + "50.22 m" + ], + [ + "1969", + "South Pacific Games", + "Port Moresby, Papua New Guinea", + "3rd", + "Hammer throw", + "41.84 m" + ], + [ + "1971", + "South Pacific Games", + "Pirae, French Polynesia", + "1st", + "Shot put", + "18.07 m" + ], + [ + "1971", + "South Pacific Games", + "Pirae, French Polynesia", + "1st", + "Discus throw", + "49.98 m" + ], + [ + "1971", + "South Pacific Games", + "Pirae, French Polynesia", + "3rd", + "Hammer throw", + "44.00 m" + ], + [ + "1975", + "South Pacific Games", + "Tumon, Guam", + "1st", + "Shot put", + "18.07 m" + ], + [ + "1975", + "South Pacific Games", + "Tumon, Guam", + "1st", + "Discus throw", + "48.30 m" + ], + [ + "1975", + "South Pacific Games", + "Tumon, Guam", + "2nd", + "Hammer throw", + "43.66 m" + ], + [ + "1983", + "South Pacific Games", + "Apia, Western Samoa", + "1st", + "Shot put", + "16.97 m" + ], + [ + "1983", + "South Pacific Games", + "Apia, Western Samoa", + "2nd", + "Discus throw", + "48.70 m" + ] + ], + "title": "", + "original_id": "75161f5694422778f9358fe477854946" + }, + { + "_id": "dfa77ca619170d63e349514b73908e41", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "1992", + "CARIFTA Games (U20)", + "Nassau, Bahamas", + "1st", + "Discus throw", + "37.86 m" + ], + [ + "1992", + "CARIFTA Games (U20)", + "Nassau, Bahamas", + "3rd", + "Javelin throw", + "36.37 m" + ], + [ + "1999", + "Central American and Caribbean Championships", + "Bridgetown, Barbados", + "2nd", + "Javelin throw", + "54.24 m" + ], + [ + "2000", + "Olympic Games", + "Sydney, Australia", + "21st (q)", + "Javelin throw", + "56.36 m" + ], + [ + "2005", + "Central American and Caribbean Championships", + "Nassau, Bahamas", + "2nd", + "Javelin throw", + "61.10 m" + ], + [ + "2005", + "World Championships", + "Helsinki, Finland", + "14th (q)", + "Javelin throw", + "58.49 m" + ], + [ + "2006", + "Commonwealth Games", + "Melbourne, Australia", + "3rd", + "Javelin throw", + "58.27 m" + ], + [ + "2006", + "Central American and Caribbean Games", + "Cartagena, Colombia", + "4th", + "Javelin throw", + "56.82 m" + ], + [ + "2008", + "Olympic Games", + "Beijing, China", + "34th (q)", + "Javelin throw", + "55.51 m" + ], + [ + "2011", + "Pan American Games", + "Guadalajara, Mexico", + "7th", + "Javelin throw", + "51.40 m" + ] + ], + "title": "", + "original_id": "7b6040473988da74ffaf42edf90be4a9" + }, + { + "_id": "c3b84eb88426289e4ca4484812ce32b5", + "header": [ + "Outcome", + "No.", + "Year", + "Championship", + "Opponent in the final", + "Score" + ], + "rows": [ + [ + "Winner", + "1.0", + "1987", + "Grand Prix", + "Dennis Taylor", + "10–7" + ], + [ + "Winner", + "2.0", + "1988", + "British Open", + "Mike Hallett", + "13–2" + ], + [ + "Runner-up", + "1.0", + "1988", + "UK Championship", + "Doug Mountjoy", + "12–16" + ], + [ + "Winner", + "3.0", + "1989", + "Asian Open", + "James Wattana", + "9–2" + ], + [ + "Winner", + "4.0", + "1989", + "Dubai Classic", + "Doug Mountjoy", + "9–2" + ], + [ + "Winner", + "5.0", + "1989", + "UK Championship", + "Steve Davis", + "16–12" + ], + [ + "Runner-up", + "2.0", + "1989", + "International Open", + "Steve Davis", + "4–9" + ], + [ + "Runner-up", + "3.0", + "1990", + "European Open", + "John Parrott", + "6–10" + ], + [ + "Winner", + "6.0", + "1990", + "World Snooker Championship", + "Jimmy White", + "18–12" + ], + [ + "Winner", + "7.0", + "1990", + "Grand Prix (2)", + "Nigel Bond", + "10–5" + ], + [ + "Winner", + "8.0", + "1990", + "Asian Open (2)", + "Dennis Taylor", + "9–3" + ], + [ + "Winner", + "9.0", + "1990", + "Dubai Classic (2)", + "Steve Davis", + "9–1" + ], + [ + "Winner", + "10.0", + "1990", + "UK Championship (2)", + "Steve Davis", + "16–15" + ], + [ + "Runner-up", + "4.0", + "1991", + "Classic", + "Jimmy White", + "4–10" + ], + [ + "Winner", + "11.0", + "1991", + "British Open (2)", + "Gary Wilkinson", + "10–9" + ], + [ + "Winner", + "12.0", + "1991", + "Grand Prix (3)", + "Steve Davis", + "10–6" + ], + [ + "Winner", + "13.0", + "1992", + "Welsh Open", + "Darren Morgan", + "9–3" + ], + [ + "Runner-up", + "5.0", + "1992", + "Classic (2)", + "Steve Davis", + "8–9" + ], + [ + "Winner", + "14.0", + "1992", + "World Snooker Championship (2)", + "Jimmy White", + "18–14" + ], + [ + "Runner-up", + "6.0", + "1992", + "Dubai Classic", + "John Parrott", + "8–9" + ], + [ + "Runner-up", + "7.0", + "1993", + "European Open (2)", + "Steve Davis", + "4–10" + ], + [ + "Winner", + "15.0", + "1993", + "International Open", + "Steve Davis", + "10–6" + ], + [ + "Winner", + "16.0", + "1993", + "World Snooker Championship (3)", + "Jimmy White", + "18–5" + ], + [ + "Winner", + "17.0", + "1993", + "Dubai Classic (3)", + "Steve Davis", + "9–3" + ], + [ + "Runner-up", + "8.0", + "1993", + "UK Championship (2)", + "Ronnie O'Sullivan", + "6–10" + ], + [ + "Winner", + "18.0", + "1993", + "European Open", + "Ronnie O'Sullivan", + "9–5" + ], + [ + "Winner", + "19.0", + "1994", + "World Snooker Championship (4)", + "Jimmy White", + "18–17" + ], + [ + "Winner", + "20.0", + "1994", + "UK Championship (3)", + "Ken Doherty", + "10–5" + ], + [ + "Winner", + "21.0", + "1994", + "European Open (2)", + "John Parrott", + "9–3" + ], + [ + "Winner", + "22.0", + "1995", + "World Snooker Championship (5)", + "Nigel Bond", + "18–9" + ], + [ + "Winner", + "23.0", + "1995", + "Grand Prix (4)", + "John Higgins", + "9–5" + ], + [ + "Winner", + "24.0", + "1995", + "UK Championship (4)", + "Peter Ebdon", + "10–3" + ], + [ + "Winner", + "25.0", + "1996", + "World Snooker Championship (6)", + "Peter Ebdon", + "18–12" + ], + [ + "Winner", + "26.0", + "1996", + "UK Championship (5)", + "John Higgins", + "10–9" + ], + [ + "Winner", + "27.0", + "1997", + "Welsh Open (2)", + "Mark King", + "9–2" + ], + [ + "Winner", + "28.0", + "1997", + "International Open (2)", + "Tony Drago", + "9–1" + ], + [ + "Runner-up", + "9.0", + "1997", + "British Open", + "Mark Williams", + "2–9" + ], + [ + "Runner-up", + "10.0", + "1997", + "World Snooker Championship", + "Ken Doherty", + "12–18" + ], + [ + "Runner-up", + "11.0", + "1997", + "UK Championship (3)", + "Ronnie O'Sullivan", + "6–10" + ], + [ + "Winner", + "29.0", + "1998", + "Thailand Masters (3)", + "John Parrott", + "9–6" + ], + [ + "Runner-up", + "12.0", + "1998", + "British Open (2)", + "John Higgins", + "8–9" + ], + [ + "Runner-up", + "13.0", + "1999", + "Welsh Open", + "Mark Williams", + "8–9" + ], + [ + "Winner", + "30.0", + "1999", + "Scottish Open (3)", + "Graeme Dott", + "9–1" + ], + [ + "Winner", + "31.0", + "1999", + "World Snooker Championship (7)", + "Mark Williams", + "18–11" + ], + [ + "Winner", + "32.0", + "1999", + "British Open (3)", + "Peter Ebdon", + "9–1" + ], + [ + "Runner-up", + "14.0", + "2000", + "Thailand Masters", + "Mark Williams", + "5–9" + ], + [ + "Runner-up", + "15.0", + "2001", + "Thailand Masters (2)", + "Ken Doherty", + "3–9" + ], + [ + "Winner", + "33.0", + "2001", + "European Open (3)", + "Joe Perry", + "9–2" + ], + [ + "Runner-up", + "16.0", + "2002", + "World Snooker Championship (2)", + "Peter Ebdon", + "17–18" + ], + [ + "Winner", + "34.0", + "2003", + "Welsh Open (3)", + "Mark Williams", + "9–5" + ], + [ + "Runner-up", + "17.0", + "2003", + "European Open (3)", + "Ronnie O'Sullivan", + "6–9" + ], + [ + "Winner", + "35.0", + "2003", + "British Open (4)", + "Ronnie O'Sullivan", + "9–6" + ], + [ + "Runner-up", + "18.0", + "2003", + "UK Championship (4)", + "Matthew Stevens", + "8–10" + ], + [ + "Runner-up", + "19.0", + "2005", + "Welsh Open (2)", + "Ronnie O'Sullivan", + "8–9" + ], + [ + "Winner", + "36.0", + "2005", + "Malta Cup (4)", + "Graeme Dott", + "9–7" + ], + [ + "Runner-up", + "20.0", + "2005", + "China Open", + "Ding Junhui", + "5–9" + ], + [ + "Runner-up", + "21.0", + "2006", + "UK Championship (5)", + "Peter Ebdon", + "6–10" + ] + ], + "title": "", + "original_id": "0c5e7d0d8e33e31f3e80aab314ef8c61" + }, + { + "_id": "b90d230c45fbd1559b626a6265acc7ad", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Brazil", + "Representing Brazil", + "Representing Brazil", + "Representing Brazil", + "Representing Brazil", + "Representing Brazil" + ], + [ + "2007", + "South American Junior Championships", + "São Paulo, Brazil", + "1st", + "Long jump", + "5.79 m" + ], + [ + "2007", + "World Youth Championships", + "Ostrava, Czech Republic", + "21st", + "Heptathlon", + "4575 pts" + ], + [ + "2008", + "World Junior Championships", + "Bydgoszcz, Poland", + "16th", + "Heptathlon", + "5233 pts" + ], + [ + "2008", + "South American U23 Championships", + "Lima, Peru", + "1st", + "Heptathlon", + "5138 pts" + ], + [ + "2009", + "South American Junior Championships", + "São Paulo, Brazil", + "4th", + "100 m", + "11.95 s" + ], + [ + "2009", + "South American Junior Championships", + "São Paulo, Brazil", + "1st", + "4 × 100 m", + "45.86 s" + ], + [ + "2009", + "South American Junior Championships", + "São Paulo, Brazil", + "1st", + "Heptathlon", + "5574 pts" + ], + [ + "2009", + "Pan American Junior Championships", + "Port of Spain, Trinidad and Tobago", + "1st", + "Heptathlon", + "5574 pts" + ], + [ + "2009", + "South American Championships", + "Lima, Peru", + "1st", + "Heptathlon", + "5578 pts" + ], + [ + "2010", + "South American Games / South American U23 Championships", + "Medellín, Colombia", + "–", + "Heptathlon", + "DNF" + ], + [ + "2010", + "Ibero-American Championships", + "San Fernando, Spain", + "4th", + "Heptathlon", + "5304 pts" + ], + [ + "2011", + "South American Championships", + "Buenos Aires, Argentina", + "1st", + "Heptathlon", + "5428 pts" + ], + [ + "2012", + "South American U23 Championships", + "São Paulo, Brazil", + "1st", + "Heptathlon", + "5899 pts" + ], + [ + "2014", + "Ibero-American Championships", + "São Paulo, Brazil", + "1st", + "Heptathlon", + "5722 pts" + ], + [ + "2015", + "Pan American Games", + "Toronto, Canada", + "3rd", + "Heptathlon", + "6035 pts" + ], + [ + "2015", + "World Championships", + "Beijing, China", + "26th", + "Heptathlon", + "5647 pts" + ], + [ + "2016", + "Olympic Games", + "Rio de Janeiro, Brazil", + "23rd", + "Heptathlon", + "6024 pts" + ], + [ + "2017", + "World Championships", + "London, United Kingdom", + "29th", + "Heptathlon", + "4500 pts" + ], + [ + "2017", + "Universiade", + "Taipei, Taiwan", + "5th", + "Heptathlon", + "5337 pts" + ] + ], + "title": "", + "original_id": "d462f4647ce89a206cfe3e7ecba1b28c" + }, + { + "_id": "39079dab85112235252894687745c901", + "header": [ + "year", + "senior pga championship", + "the tradition", + "senior players championship", + "us senior open", + "senior british open" + ], + "rows": [ + [ + "2013", + "kōki idoki", + "david frost", + "kenny perry (1 / 2)", + "kenny perry (2 / 2)", + "mark wiebe" + ], + [ + "2012", + "roger chapman (1 / 2)", + "tom lehman (3 / 3)", + "joe daley", + "roger chapman (2 / 2)", + "fred couples (2 / 2)" + ], + [ + "2011", + "tom watson (6 / 6)", + "tom lehman (2 / 3)", + "fred couples (1 / 2)", + "olin browne", + "russ cochran" + ], + [ + "2010", + "tom lehman (1 / 3)", + "fred funk (3 / 3)", + "mark o'meara", + "bernhard langer (2 / 2)", + "bernhard langer (1 / 2)" + ], + [ + "2009", + "michael allen", + "mike reid (2 / 2)", + "jay haas (3 / 3)", + "fred funk (2 / 3)", + "loren roberts (4 / 4)" + ], + [ + "2008", + "jay haas (2 / 3)", + "fred funk (1 / 3)", + "d a weibring", + "eduardo romero (2 / 2)", + "bruce vaughan" + ], + [ + "2007", + "denis watson", + "mark mcnulty", + "loren roberts (3 / 4)", + "brad bryant", + "tom watson (5 / 6)" + ], + [ + "2006", + "jay haas (1 / 3)", + "eduardo romero (1 / 2)", + "bobby wadkins", + "allen doyle (4 / 4)", + "loren roberts (2 / 4)" + ], + [ + "2005", + "mike reid (1 / 2)", + "loren roberts (1 / 4)", + "peter jacobsen (2 / 2)", + "allen doyle (3 / 4)", + "tom watson (4 / 6)" + ], + [ + "2004", + "hale irwin (7 / 7)", + "craig stadler (2 / 2)", + "mark james", + "peter jacobsen (1 / 2)", + "pete oakley" + ], + [ + "2003", + "john jacobs", + "tom watson (3 / 6)", + "craig stadler (1 / 2)", + "bruce lietzke", + "tom watson (2 / 6)" + ], + [ + "2002", + "fuzzy zoeller", + "jim thorpe", + "stewart ginn", + "don pooley", + "not a champions tour event" + ], + [ + "2001", + "tom watson (1 / 6)", + "doug tewell (2 / 2)", + "allen doyle (2 / 4)", + "bruce fleisher", + "not a champions tour event" + ], + [ + "2000", + "doug tewell (1 / 2)", + "tom kite", + "raymond floyd (4 / 4)", + "hale irwin (6 / 7)", + "not a champions tour event" + ], + [ + "1999", + "allen doyle (1 / 4)", + "graham marsh (2 / 2)", + "hale irwin (5 / 7)", + "dave eichelberger", + "not a champions tour event" + ], + [ + "1998", + "hale irwin (3 / 7)", + "gil morgan (2 / 3)", + "gil morgan (3 / 3)", + "hale irwin (4 / 7)", + "not a champions tour event" + ], + [ + "1997", + "hale irwin (2 / 7)", + "gil morgan (1 / 3)", + "larry gilbert", + "graham marsh (1 / 2)", + "not a champions tour event" + ], + [ + "1996", + "hale irwin (1 / 7)", + "jack nicklaus (8 / 8)", + "raymond floyd (3 / 4)", + "dave stockton (3 / 3)", + "not a champions tour event" + ], + [ + "1995", + "raymond floyd (2 / 4)", + "jack nicklaus (7 / 8)", + "j c snead", + "tom weiskopf", + "not a champions tour event" + ], + [ + "1994", + "lee trevino (4 / 4)", + "raymond floyd (1 / 4)", + "dave stockton (2 / 3)", + "simon hobday", + "not a champions tour event" + ], + [ + "1993", + "tom wargo", + "tom shaw", + "jack nicklaus (6 / 8)", + "jim colbert", + "not a champions tour event" + ], + [ + "1992", + "lee trevino (2 / 4)", + "lee trevino (3 / 4)", + "dave stockton (1 / 3)", + "larry laoretti", + "not a champions tour event" + ], + [ + "1991", + "jack nicklaus (3 / 8)", + "jack nicklaus (5 / 8)", + "jim albus", + "jack nicklaus (4 / 8)", + "not a champions tour event" + ], + [ + "1990", + "gary player (6 / 6)", + "jack nicklaus (1 / 8)", + "jack nicklaus (2 / 8)", + "lee trevino (1 / 4)", + "not a champions tour event" + ], + [ + "1989", + "larry mowry", + "don bies", + "orville moody (2 / 2)", + "orville moody (1 / 2)", + "not a champions tour event" + ], + [ + "1988", + "gary player (4 / 6)", + "founded in 1989", + "billy casper (2 / 2)", + "gary player (5 / 6)", + "not a champions tour event" + ], + [ + "1987", + "chi chi rodriguez (2 / 2)", + "founded in 1989", + "gary player (3 / 6)", + "gary player (2 / 6)", + "not a champions tour event" + ], + [ + "1986", + "gary player (1 / 6)", + "founded in 1989", + "chi chi rodriguez (1 / 2)", + "dale douglass", + "founded in 1987" + ], + [ + "1985", + "not held", + "founded in 1989", + "arnold palmer (5 / 5)", + "miller barber (5 / 5)", + "founded in 1987" + ], + [ + "1984", + "dec peter thomson", + "founded in 1989", + "arnold palmer (4 / 5)", + "miller barber (4 / 5)", + "founded in 1987" + ], + [ + "1984", + "jan arnold palmer (3 / 5)", + "founded in 1989", + "arnold palmer (4 / 5)", + "miller barber (4 / 5)", + "founded in 1987" + ], + [ + "1983", + "not held", + "founded in 1989", + "miller barber (3 / 5)", + "billy casper (1 / 2)", + "founded in 1987" + ], + [ + "1982", + "don january", + "founded in 1989", + "founded in 1983", + "miller barber (2 / 5)", + "founded in 1987" + ], + [ + "1981", + "miller barber (1 / 5)", + "founded in 1989", + "founded in 1983", + "arnold palmer (2 / 5)", + "founded in 1987" + ], + [ + "1980", + "arnold palmer (1 / 5)", + "founded in 1989", + "founded in 1983", + "roberto devicenzo", + "founded in 1987" + ] + ], + "title": "", + "original_id": "7b4144d4fe9ab8f84ad391281875782a" + }, + { + "_id": "b833022d4bfd275938e1f187a27dc54e", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing India", + "Representing India", + "Representing India", + "Representing India", + "Representing India", + "Representing India" + ], + [ + "Outdoor Competition", + "Outdoor Competition", + "Outdoor Competition", + "Outdoor Competition", + "Outdoor Competition", + "Outdoor Competition" + ], + [ + "2013", + "World Youth Championships in Athletics", + "Donetsk, Ukraine", + "6th", + "100 m", + "11.71 sec" + ], + [ + "2013", + "Asian Athletics Championships", + "Pune, India", + "-", + "200 m", + "23.811 sec" + ], + [ + "2014", + "Asian Junior Athletics Championships", + "Taipei, Taiwan", + "-", + "200 m", + "23.74 sec" + ], + [ + "2014", + "Asian Junior Athletics Championships", + "Taipei, Taiwan", + "-", + "4×400 m relay", + "3.40.53 min" + ], + [ + "2016", + "XXVI G Kosanov Memorial", + "Almaty, Kazakhstan", + "NR", + "100 m", + "11.24 sec" + ], + [ + "2016", + "Rio Olympics(Heat 5)", + "Jakarta, Indonesia", + "H5–7th", + "100 m", + "11.69 sec" + ], + [ + "2017", + "Asian Athletics Championships", + "Bhubaneswar, India", + "-", + "100 m", + "11.52 sec" + ], + [ + "2017", + "Asian Athletics Championships", + "Bhubaneswar, India", + "-", + "4×100 m relay", + "44.57 sec" + ], + [ + "2017", + "World Championships in Athletics (Heat)", + "London, UK", + "H5–5th", + "100 m", + "12.07 sec" + ], + [ + "2018", + "Asian Games", + "Jakarta, Indonesia", + "-", + "100 m", + "11.32 s" + ], + [ + "2018", + "Asian Games", + "Jakarta, Indonesia", + "SF1–1st PB", + "200 m", + "23.00 s" + ], + [ + "2018", + "Asian Games", + "Jakarta, Indonesia", + "-", + "200 m", + "23.20 s" + ], + [ + "2019", + "Asian Athletics Championships", + "Doha, Qatar", + "H4−1st NR", + "100 m", + "11.28 sec" + ], + [ + "2019", + "Asian Athletics Championships", + "Doha, Qatar", + "SF NR", + "100 m", + "11.26 sec" + ], + [ + "2019", + "Asian Athletics Championships", + "Doha, Qatar", + "FL−5th", + "100 m", + "11.44 sec" + ], + [ + "2019", + "Asian Athletics Championships", + "Doha, Qatar", + "-", + "200 m", + "23.24 sec" + ], + [ + "Indoor Competition", + "Indoor Competition", + "Indoor Competition", + "Indoor Competition", + "Indoor Competition", + "Indoor Competition" + ], + [ + "2016", + "Asian Indoor Athletics Championships", + "Doha, Qatar", + "H−1st NR", + "60 m", + "7.28 s" + ], + [ + "2016", + "Asian Indoor Athletics Championships", + "Doha, Qatar", + "-", + "60 m", + "7.37 s" + ], + [ + "2016", + "IAAF World Indoor Championships", + "Portland, USA", + "H5–5th", + "60 m", + "7.30 s" + ], + [ + "2016", + "IAAF World Indoor Championships", + "Portland, USA", + "SF3–8th", + "60 m", + "7.62 s" + ] + ], + "title": "", + "original_id": "cf0df05f56fcaf06eb9a85d57a062ff9" + }, + { + "_id": "300d041d806051c8c53d5d251da99d8b", + "header": [ + "Year", + "Title", + "Language", + "Director", + "Cast", + "Cast", + "Cast" + ], + "rows": [ + [ + "Year", + "Title", + "Language", + "Director", + "Step-mother", + "Son", + "Wife" + ], + [ + "1955", + "Ardhangi", + "Telugu", + "P. Pullaiah", + "Santha Kumari", + "Akkineni Nageswara Rao", + "Savitri" + ], + [ + "1956", + "Pennin Perumai", + "Tamil", + "P. Pullaiah", + "Santha Kumari", + "Gemini Ganesan", + "Savitri" + ], + [ + "1963", + "Bahurani", + "Hindi", + "T. Prakash Rao", + "Lalita Pawar", + "Guru Dutt", + "Mala Sinha" + ], + [ + "1969", + "Mallammana Pavaada", + "Kannada", + "Puttanna Kanagal", + "Advani Lakshmi Devi", + "Rajkumar", + "B Sarojadevi" + ], + [ + "1975", + "Swayamsiddha", + "Bengali", + "Sushil Mukherjee", + "-", + "Ranjit Mallick", + "Mithu Mukherjee" + ], + [ + "1981", + "Jyothi", + "Hindi", + "Pramod Chakravorty", + "Shashikala", + "Jeetendra", + "Hema Malini" + ], + [ + "1987", + "Enga Chinna Rasa", + "Tamil", + "K. Bhagyaraj", + "C. R. Saraswathy", + "K. Bhagyaraj", + "Radha" + ], + [ + "1992", + "Beta", + "Hindi", + "Indra Kumar", + "Aruna Irani", + "Anil Kapoor", + "Madhuri Dixit" + ], + [ + "1993", + "Abbaigaru", + "Telugu", + "E. V. V. Satyanarayana", + "Jayachitra", + "Venkatesh", + "Meena" + ], + [ + "1993", + "Annayya", + "Kannada", + "D. Rajendra Babu", + "Aruna Irani", + "V. Ravichandran", + "Madhoo" + ], + [ + "1998", + "Santan", + "Oriya", + "-", + "Snigdha Mohanty", + "Siddhanta Mahapatra", + "Rachana Banerjee" + ] + ], + "title": "", + "original_id": "b72cc43e9103fe48e3fff8a01511e6f1" + }, + { + "_id": "20d4a0c9c41a21a7c07b49e221714ae2", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Australia", + "Representing Australia", + "Representing Australia", + "Representing Australia", + "Representing Australia", + "Representing Australia" + ], + [ + "2010", + "Oceania Youth Championships", + "Sydney, Australia", + "3rd", + "100 m", + "12.15 s (+0.5 m/s)" + ], + [ + "2010", + "Oceania Youth Championships", + "Sydney, Australia", + "1st", + "100 m hurdles", + "14.12 s (−1.4 m/s)" + ], + [ + "2010", + "Oceania Youth Championships", + "Sydney, Australia", + "1st", + "4 × 100 m relay", + "45.75 s" + ], + [ + "2010", + "Youth Olympic Games", + "Singapore", + "2nd", + "100 m hurdles", + "13.46" + ], + [ + "2012", + "World Junior Championships", + "Barcelona, Spain", + "5th", + "100 m hurdles", + "13.54" + ], + [ + "2014", + "Commonwealth Games", + "Glasgow, United Kingdom", + "5th", + "100 m hurdles", + "13.36" + ], + [ + "2015", + "Universiade", + "Gwangju, South Korea", + "3rd", + "100 m hurdles", + "12.94" + ], + [ + "2015", + "World Championships", + "Beijing, China", + "18th (sf)", + "100 m hurdles", + "13.01" + ], + [ + "2016", + "World Indoor Championships", + "Portland, United States", + "10th (h)", + "60 m hurdles", + "8.10" + ], + [ + "2016", + "Olympic Games", + "Rio de Janeiro, Brazil", + "37th (h)", + "100 m hurdles", + "13.26" + ], + [ + "2017", + "World Championships", + "London, United Kingdom", + "21st (sf)", + "100 m hurdles", + "13.25" + ], + [ + "2017", + "Universiade", + "Taipei, Taiwan", + "8th", + "100 m hurdles", + "14.82" + ], + [ + "2018", + "World Indoor Championships", + "Birmingham, United Kingdom", + "22nd (sf)", + "60 m hurdles", + "8.22" + ], + [ + "2018", + "Commonwealth Games", + "Gold Coast, Australia", + "4th", + "100 m hurdles", + "13.07" + ] + ], + "title": "", + "original_id": "0fb4f4180841f757ff71e13664a49e94" + }, + { + "_id": "2d25376fc3a500d6a9a7f9de805c8369", + "header": [ + "Title", + "Year", + "Album", + "Composer", + "Other artist(s)", + "Notes", + "Ref." + ], + "rows": [ + [ + "\"Bombay City Sukkha Rotti\"", + "1994", + "Rasigan", + "Deva", + "K. S. Chithra", + "-", + "-" + ], + [ + "\"Oru Kaditham\"", + "1995", + "Deva", + "Deva", + "S. P. Balasubrahmanyam", + "-", + "-" + ], + [ + "\"Aiyaiyoo Alamelu\"", + "1995", + "Deva", + "Deva", + "Swarnalatha, Manorama", + "-", + "-" + ], + [ + "\"Kottagiri Kuppamma\"", + "1995", + "Deva", + "Deva", + "Swarnalatha, Manorama", + "-", + "-" + ], + [ + "\"Thottabettaa Rottu Melae\"", + "1995", + "Vishnu", + "Deva", + "Shoba Chandrasekhar", + "-", + "-" + ], + [ + "\"Bombay Party Shilpa Shetty\"", + "1996", + "Coimbatore Mappillai", + "Vidyasagar", + "Shahul Hameed", + "-", + "-" + ], + [ + "\"Thiruppathy Ponaa Mottai\"", + "1996", + "Maanbumigu Maanavan", + "Deva", + "-", + "-", + "-" + ], + [ + "\"Chicken Kari\"", + "1996", + "Selva", + "Sirpy", + "Sirpy, Swarnalatha", + "-", + "-" + ], + [ + "\"Anjaam Number Bussil Yeri\"", + "1997", + "Kaalamellam Kaathiruppen", + "Deva", + "-", + "-", + "-" + ], + [ + "\"Oormilaa Oormilaa\"", + "1997", + "Once More", + "Deva", + "Shoba Chandrasekhar", + "-", + "-" + ], + [ + "\"Oh Baby Baby\"", + "1997", + "Kadhalukku Mariyadhai", + "Ilayaraja", + "Bhavatharini", + "-", + "-" + ], + [ + "\"Tic-Tic-Tic\"", + "1998", + "Thulli Thirintha Kaalam", + "Jayanth", + "Unnikrishnan, Sujatha Mohan", + "-", + "-" + ], + [ + "\"Mowriya Mowriya\"", + "1998", + "Priyamudan", + "Deva", + "Anuradha Sriram", + "-", + "-" + ], + [ + "\"Kaalathuketha Oru Gana\"", + "1998", + "Velai", + "Yuvan Shankar Raja", + "Nassar, Premji Amaren", + "-", + "-" + ], + [ + "\"Nilave Nilave\"", + "1998", + "Nilaave Vaa", + "Vidyasagar", + "Anuradha Sriram", + "-", + "-" + ], + [ + "\"Chandira Mandalathai\"", + "1998", + "Nilaave Vaa", + "Vidyasagar", + "Harini, S. P. B. Charan", + "-", + "-" + ], + [ + "\"Thammadikkira Styla Pathu\"", + "1999", + "Periyanna", + "S. Bharani", + "-", + "-", + "-" + ], + [ + "\"Juddadi Laila\"", + "1999", + "Periyanna", + "S. Bharani", + "Swarnalatha", + "-", + "-" + ], + [ + "\"Roadula Oru\"", + "1999", + "Periyanna", + "S. Bharani", + "-", + "-", + "-" + ], + [ + "\"Thanganirathuku\"", + "1999", + "Nenjinile", + "Deva", + "Swarnalatha", + "-", + "-" + ], + [ + "\"Mississippi Nadhi Kulunga\"", + "2000", + "Priyamanavale", + "S. A. Rajkumar", + "Anuradha Sriram", + "-", + "-" + ], + [ + "\"Ennoda Laila\"", + "2001", + "Badri", + "Ramana Gogula", + "-", + "-", + "-" + ], + [ + "\"Ullathai Killadhae\"", + "2002", + "Thamizhan", + "D. Imman", + "Priyanka Chopra", + "-", + "-" + ], + [ + "\"Coca-Cola (Podango)\"", + "2002", + "Bagavathi", + "Srikanth Deva", + "Vadivelu", + "-", + "-" + ], + [ + "\"Vaadi Vaadi CD\"", + "2005", + "Sachein", + "Devi Sri Prasad", + "Vadivelu", + "-", + "-" + ], + [ + "\"Google Google\"", + "2012", + "Thuppakki", + "Harris Jayaraj", + "Andrea Jeremiah", + "Vijay Award for Favourite Song Nominated—SIIMA Award for Best Male Playback Singer", + "-" + ], + [ + "\"Vanganna Vanakkanganna\"", + "2013", + "Thalaiva", + "G.V. Prakash Kumar", + "Santhanam", + "-", + "-" + ], + [ + "\"Kandangi Kandangi\"", + "2014", + "Jilla", + "D. Imman", + "Shreya Ghoshal", + "-", + "-" + ], + [ + "\"Selfie Pulla\"", + "2014", + "Kaththi", + "Anirudh Ravichander", + "Sunidhi Chauhan", + "Nominated—Vijay Award for Favourite Song Nominated—Filmfare Award for Best Male Playback Singer – Tamil", + "-" + ], + [ + "\"Yaendi Yaendi\"", + "2015", + "Puli", + "Devi Sri Prasad", + "Shruti Haasan", + "Nominated—Filmfare Award for Best Male Playback Singer – Tamil", + "-" + ], + [ + "\"Chella Kutti\"", + "2016", + "Theri", + "G.V. Prakash Kumar", + "Neeti Mohan", + "-", + "-" + ], + [ + "\"Papa Papa\"", + "2017", + "Bairavaa", + "Santhosh Narayanan", + "Priyadarshini", + "-", + "-" + ] + ], + "title": "", + "original_id": "49910cb2c99744cb8fa61b9aa25b36ff" + }, + { + "_id": "da66b9933baed80f04df21c0e2c92c1c", + "header": [ + "Year", + "Competition", + "Venue", + "Position", + "Event", + "Notes" + ], + "rows": [ + [ + "Representing Grenada", + "Representing Grenada", + "Representing Grenada", + "Representing Grenada", + "Representing Grenada", + "Representing Grenada" + ], + [ + "2007", + "CARIFTA Games (U-17)", + "Providenciales, Turks and Caicos Islands", + "6th", + "200 m", + "22.10 (+1.2 m/s)" + ], + [ + "2007", + "CARIFTA Games (U-17)", + "Providenciales, Turks and Caicos Islands", + "1st", + "400 m", + "47.86 PB" + ], + [ + "2007", + "World Youth Championships", + "Ostrava, Czech Republic", + "2nd", + "400 m", + "46.96 PB" + ], + [ + "2008", + "CARIFTA Games (U-17)", + "Basseterre, Saint Kitts and Nevis", + "1st", + "200 m", + "21.38 (+2.0 m/s)" + ], + [ + "2008", + "CARIFTA Games (U-17)", + "Basseterre, Saint Kitts and Nevis", + "1st", + "400 m", + "47.87" + ], + [ + "2008", + "World Junior Championships", + "Bydgoszcz, Poland", + "2nd", + "400 m", + "45.70 PB" + ], + [ + "2008", + "Commonwealth Youth Games", + "Pune, India", + "1st", + "400 m", + "46.66 GR" + ], + [ + "2009", + "CARIFTA Games (U-20)", + "Vieux Fort, Saint Lucia", + "DQ (h1)", + "200 m", + "False start" + ], + [ + "2009", + "CARIFTA Games (U-20)", + "Vieux Fort, Saint Lucia", + "1st", + "400 m", + "45.45 PB GR" + ], + [ + "2009", + "CARIFTA Games (U-20)", + "Vieux Fort, Saint Lucia", + "DQ (h1)", + "4 × 100 m relay", + "Out of zone" + ], + [ + "2009", + "CARIFTA Games (U-20)", + "Vieux Fort, Saint Lucia", + "3rd", + "4 × 400 m relay", + "3:11.93 PB" + ], + [ + "2009", + "World Youth Championships", + "Brixen, Italy", + "1st", + "200 m", + "21.05 (−0.9 m/s) PB" + ], + [ + "2009", + "World Youth Championships", + "Brixen, Italy", + "1st", + "400 m", + "45.24 PB CR" + ], + [ + "2009", + "Pan American Junior Championships", + "Port of Spain, Trinidad and Tobago", + "1st", + "400 m", + "45.43" + ], + [ + "2009", + "Pan American Junior Championships", + "Port of Spain, Trinidad and Tobago", + "5th", + "4 × 400 m relay", + "3:11.91 PB" + ], + [ + "2010", + "CARIFTA Games (U-20)", + "George Town, Cayman Islands", + "1st", + "200 m", + "20.76 (+0.8 m/s) SB" + ], + [ + "2010", + "CARIFTA Games (U-20)", + "George Town, Cayman Islands", + "1st", + "400 m", + "45.02 PB GR" + ], + [ + "2010", + "World Junior Championships", + "Moncton, Canada", + "1st", + "400 m", + "45.89" + ], + [ + "2011", + "CAC Championships", + "Mayagüez, Puerto Rico", + "5th", + "4 × 400 m relay", + "3:04.27 NR PB" + ], + [ + "2011", + "Pan American Junior Championships", + "Miramar, Florida", + "1st", + "200 m", + "20.53 w (+2.2 m/s)" + ], + [ + "2011", + "World Championships", + "Daegu, South Korea", + "1st", + "400 m", + "44.60 PB" + ], + [ + "2012", + "World Indoor Championships", + "Istanbul, Turkey", + "6th", + "400 m", + "46.21" + ], + [ + "2012", + "Olympic Games", + "London, England", + "1st", + "400 m", + "43.94 WL NR PB" + ], + [ + "2013", + "World Championships", + "Moscow, Russia", + "7th", + "400 m", + "44.99" + ], + [ + "2014", + "Commonwealth Games", + "Glasgow, Scotland", + "1st", + "400 m", + "44.24 GR" + ], + [ + "2015", + "World Championships", + "Beijing, China", + "3rd", + "400 m", + "43.78 SB" + ], + [ + "2016", + "Olympic Games", + "Rio de Janeiro, Brazil", + "2nd", + "400 m", + "43.76 SB" + ] + ], + "title": "", + "original_id": "8b247fcb51d1c607ea0ba29eecad1bd2" + }, + { + "_id": "f645cb1a1a9e7d6d6a3efec76350fe0a", + "header": [ + "state", + "1990 - 95", + "1996 - 00", + "2001 - 05", + "2006 - 10" + ], + "rows": [ + [ + "bihar", + "0.41", + "0.3", + "0.43", + "0.88" + ], + [ + "gujarat", + "0.48", + "0.57", + "0.64", + "0.69" + ], + [ + "andhra pradesh", + "0.53", + "0.73", + "0.55", + "0.61" + ], + [ + "punjab", + "0.32", + "0.46", + "0.46", + "0.6" + ], + [ + "jammu & kashmir", + "0.13", + "0.32", + "0.17", + "0.4" + ], + [ + "haryana", + "0.33", + "0.6", + "0.31", + "0.37" + ], + [ + "himachal pradesh", + "0.26", + "0.14", + "0.23", + "0.35" + ], + [ + "tamil nadu", + "0.19", + "0.2", + "0.24", + "0.29" + ], + [ + "madhya pradesh", + "0.23", + "0.22", + "0.31", + "0.29" + ], + [ + "karnataka", + "0.24", + "0.19", + "0.2", + "0.29" + ], + [ + "rajasthan", + "0.27", + "0.23", + "0.26", + "0.27" + ], + [ + "kerala", + "0.16", + "0.2", + "0.22", + "0.27" + ], + [ + "maharashtra", + "0.45", + "0.29", + "0.27", + "0.26" + ], + [ + "uttar pradesh", + "0.11", + "0.11", + "0.16", + "0.21" + ], + [ + "orissa", + "0.22", + "0.16", + "0.15", + "0.19" + ], + [ + "assam", + "0.21", + "0.02", + "0.14", + "0.17" + ], + [ + "west bengal", + "0.11", + "0.08", + "0.03", + "0.01" + ] + ], + "title": "", + "original_id": "577472b9c44b101799d923f48cd30454" + }, + { + "_id": "1569be37dd420682d5112410eac724b9", + "header": [ + "engine type", + "scenario", + "sfc in lb / (lbf h)", + "sfc in g / (kn s)", + "specific impulse (s)", + "effective exhaust velocity (m / s)" + ], + "rows": [ + [ + "nk - 33 rocket engine", + "vacuum", + "10.9", + "309.0", + "331", + "3240" + ], + [ + "ssme rocket engine", + "space shuttle vacuum", + "7.95", + "225.0", + "453", + "4423" + ], + [ + "ramjet", + "mach 1", + "4.5", + "127.0", + "800", + "7877" + ], + [ + "j - 58 turbojet", + "sr - 71 at mach 3.2 (wet)", + "1.9", + "53.8", + "1900", + "18587" + ], + [ + "rolls - royce / snecma olympus 593", + "concorde mach 2 cruise (dry)", + "1.195", + "33.8", + "3012", + "29553" + ], + [ + "cf6 - 80c2b1f turbofan", + "boeing 747 - 400 cruise", + "0.605", + "17.1", + "5950", + "58400" + ], + [ + "general electric cf6 turbofan", + "sea level", + "0.307", + "8.696", + "11700", + "115000" + ] + ], + "title": "", + "original_id": "b60f42005fcd5f0e80b5e791178df802" + }, + { + "_id": "1377b9ce354eee5cc5b61d84c7c0715f", + "header": [ + "city / municipality", + "no of barangays", + "area (km square)", + "population (2010 census)", + "pop density (per km square)" + ], + "rows": [ + [ + "angono", + "10", + "26.22", + "102407", + "3905.68" + ], + [ + "antipolo", + "16", + "306.1", + "677741", + "2214.12" + ], + [ + "baras", + "10", + "84.93", + "32609", + "383.95" + ], + [ + "binangonan", + "40", + "66.34", + "249872", + "3766.54" + ], + [ + "cainta", + "7", + "42.99", + "311845", + "7253.9" + ], + [ + "cardona", + "18", + "28.56", + "47414", + "1660.15" + ], + [ + "jalajala", + "11", + "44.12", + "30074", + "681.64" + ], + [ + "morong", + "8", + "37.58", + "52194", + "1388.88" + ], + [ + "pililla", + "9", + "69.95", + "59527", + "850.99" + ], + [ + "rodriguez", + "11", + "312.7", + "280904", + "898.32" + ], + [ + "san mateo", + "15", + "55.09", + "205255", + "3725.81" + ], + [ + "tanay", + "19", + "200.0", + "98879", + "494.3" + ], + [ + "taytay", + "5", + "38.8", + "288956", + "7447.32" + ] + ], + "title": "", + "original_id": "e98478f17f738dd3bdd2ff3352d71381" + }, + { + "_id": "97b7fff970142fea60ce9f68e3a060ef", + "header": [ + "language", + "quillacollo municipality", + "sipe sipe municipality", + "tiquipaya municipality", + "vinto municipality", + "colcapirhua municipality" + ], + "rows": [ + [ + "quechua", + "52399", + "23819", + "19308", + "18630", + "18050" + ], + [ + "aymara", + "7101", + "1127", + "2481", + "2259", + "2449" + ], + [ + "guaranã­", + "101", + "24", + "43", + "38", + "38" + ], + [ + "another native", + "82", + "24", + "36", + "26", + "46" + ], + [ + "spanish", + "93131", + "23059", + "32704", + "26355", + "38441" + ], + [ + "foreign", + "2087", + "215", + "1100", + "403", + "1136" + ], + [ + "only native", + "5756", + "6544", + "2972", + "3332", + "1365" + ], + [ + "native and spanish", + "50157", + "17704", + "17737", + "16680", + "18139" + ] + ], + "title": "", + "original_id": "5a02841251e9fe91955487687283aa3d" + }, + { + "_id": "2ccb26694f9fe11df71f389fa274d9bf", + "header": [ + "rank", + "country (or dependent territory)", + "july 1 , 2013 projection", + "% of pop", + "average relative annual growth (%)", + "average absolute annual growth" + ], + "rows": [ + [ + "1", + "germany", + "80640000.0", + "15.99", + "0.24", + "196000" + ], + [ + "2", + "united kingdom", + "64231000.0", + "12.73", + "0.73", + "465000" + ], + [ + "3", + "france", + "63820000.0", + "12.65", + "0.49", + "309000" + ], + [ + "4", + "italy", + "59789000.0", + "11.85", + "0.35", + "206000" + ], + [ + "5", + "spain", + "46958000.0", + "9.31", + "- 0.43", + "- 205000" + ], + [ + "6", + "poland", + "38548000.0", + "7.64", + "0.08", + "29000" + ], + [ + "7", + "romania", + "19858000.0", + "3.94", + "- 0.77", + "- 155000" + ], + [ + "8", + "netherlands", + "16795000.0", + "3.33", + "0.33", + "55000" + ], + [ + "9", + "belgium", + "11162000.0", + "2.21", + "0.66", + "73000" + ], + [ + "10", + "greece", + "10758000.0", + "2.13", + "- 0.13", + "- 14000" + ], + [ + "11", + "portugal", + "10609000.0", + "2.1", + "0.19", + "20000" + ], + [ + "12", + "czech republic", + "10519000.0", + "2.09", + "0.23", + "24000" + ], + [ + "13", + "hungary", + "9894000.0", + "1.96", + "- 0.25", + "- 25000" + ], + [ + "14", + "sweden", + "9595000.0", + "1.9", + "0.76", + "72000" + ], + [ + "15", + "austria", + "8477000.0", + "1.68", + "0.61", + "51000" + ], + [ + "16", + "bulgaria", + "7261000.0", + "1.44", + "- 0.59", + "- 43000" + ], + [ + "17", + "denmark", + "5612000.0", + "1.11", + "0.45", + "25000" + ], + [ + "18", + "finland", + "5436000.0", + "1.08", + "0.44", + "24000" + ], + [ + "19", + "slovakia", + "5413000.0", + "1.07", + "0.15", + "8000" + ], + [ + "20", + "ireland", + "4662000.0", + "0.92", + "1.35", + "62000" + ], + [ + "21", + "croatia", + "4258000.0", + "0.84", + "- 0.35", + "- 15000" + ], + [ + "22", + "lithuania", + "2956000.0", + "0.59", + "- 1.30", + "- 39000" + ], + [ + "23", + "slovenia", + "2062000.0", + "0.41", + "0.24", + "5000" + ], + [ + "24", + "latvia", + "2011000.0", + "0.4", + "- 1.23", + "- 25000" + ], + [ + "25", + "estonia", + "1283000.0", + "0.25", + "- 0.62", + "- 8000" + ], + [ + "26", + "cyprus", + "888000.0", + "0.18", + "1.95", + "17000" + ], + [ + "27", + "luxembourg", + "542000.0", + "0.11", + "1.88", + "10000" + ], + [ + "28", + "malta", + "419000.0", + "0.08", + "0.48", + "2000" + ], + [ + "align = left|total", + "504456000", + "100.0", + "0.22", + "1124000", + "311" + ] + ], + "title": "", + "original_id": "3b25f146ef2692abc071056934ba47e7" + }, + { + "_id": "d019e77d19f07e21e6aff8fd71cbf1f6", + "header": [ + "CCC", + "IEEE Conference on Computational Complexity", + "1993", + "1996", + "1999", + "-", + "2007", + "2011", + "2015" + ], + "rows": [ + [ + "EC", + "ACM Conference on Electronic Commerce", + "-", + "-", + "-", + "2003", + "2007", + "2011", + "2015" + ], + [ + "ISCA", + "ACM/IEEE International Symposium on Computer Architecture", + "1993", + "1996", + "1999", + "2003", + "2007", + "2011", + "2015" + ], + [ + "LCTES", + "ACM SIGPLAN/SIGBED Conference on Languages, Compilers, and Tools for Embedded Systems", + "-", + "-", + "1999", + "2003", + "2007", + "-", + "-" + ], + [ + "METRICS", + "ACM SIGMETRICS International Conference on Measurement and Modeling of Computer Systems", + "-", + "1996", + "1999", + "2003", + "2007", + "-", + "2015" + ], + [ + "PLDI", + "ACM SIGPLAN Conference on Programming Language Design and Implementation", + "-", + "1996", + "1999", + "2003", + "2007", + "2011", + "2015" + ], + [ + "PODC", + "ACM Symposium on Principles of Distributed Computing", + "-", + "1996", + "1999", + "-", + "-", + "2011", + "-" + ], + [ + "PPoPP", + "ACM SIGPLAN Symposium on Principles and Practice of Parallel Programming", + "1993", + "-", + "1999", + "2003", + "-", + "-", + "-" + ], + [ + "SPAA", + "ACM Symposium on Parallelism in Algorithms and Architectures", + "-", + "-", + "-", + "2003", + "2007", + "2011", + "2015" + ], + [ + "SoCG", + "ACM Symposium on Computational Geometry", + "1993", + "1996", + "-", + "2003", + "-", + "-", + "-" + ], + [ + "STOC", + "ACM Symposium on Theory of Computing", + "1993", + "1996", + "1999", + "2003", + "2007", + "2011", + "2015" + ] + ], + "title": "", + "original_id": "d4f2e8dcb5e636fd8ee662f635c1f588" + }, + { + "_id": "f842a79d03093f086636923f4abd7496", + "header": [ + "Party", + "Votes", + "%", + "Seats", + "+/-" + ], + "rows": [ + [ + "Liberal Democratic Party", + "24,563,199", + "46.9", + "271", + "17" + ], + [ + "Japan Socialist Party", + "11,478,742", + "21.9", + "118", + "+28" + ], + [ + "Japanese Communist Party", + "5,496,827", + "10.5", + "38", + "+24" + ], + [ + "Komeitō", + "4,436,755", + "8.5", + "29", + "18" + ], + [ + "Democratic Socialist Party", + "3,660,953", + "7.0", + "19", + "12" + ], + [ + "Other parties", + "143,019", + "0.3", + "2", + "+2" + ], + [ + "Independents", + "2,645,582", + "5.0", + "14", + "2" + ], + [ + "Total", + "52,425,079", + "100", + "491", + "+5" + ], + [ + "Source: http://www.stat.go.jp/data/chouki/27.htm", + "Source: http://www.stat.go.jp/data/chouki/27.htm", + "Source: http://www.stat.go.jp/data/chouki/27.htm", + "Source: http://www.stat.go.jp/data/chouki/27.htm", + "Source: http://www.stat.go.jp/data/chouki/27.htm" + ] + ], + "title": "", + "original_id": "6b91092d9b595b1b22ac8c1791a0f2b7" + }, + { + "_id": "089839eb8b3560e19437ddd87dc9a379", + "header": [ + "season", + "series", + "races", + "poles", + "wins", + "points", + "final placing" + ], + "rows": [ + [ + "2003", + "formula renault monza winter series", + "2", + "0", + "0", + "18", + "8th" + ], + [ + "2004", + "formula renault monza", + "16", + "3", + "5", + "375", + "1st" + ], + [ + "2004", + "formula junior 1600 spain", + "9", + "6", + "4", + "119", + "1st" + ], + [ + "2004", + "formula renault 1600 belgium", + "4", + "0", + "1", + "65", + "11th" + ], + [ + "2005", + "austrian fomula three championship", + "7", + "6", + "3", + "75", + "1st" + ], + [ + "2005", + "british formula three", + "5", + "0", + "0", + "0", + "nc" + ], + [ + "2005", + "formula renault 2.0 italia", + "0", + "0", + "0", + "0", + "nc" + ], + [ + "2005", + "recaro formel 3 cup", + "3", + "1", + "0", + "0", + "nc" + ], + [ + "2006", + "formula three euroseries", + "19", + "0", + "0", + "12", + "15th" + ], + [ + "2006", + "british formula three", + "2", + "0", + "0", + "0", + "nc" + ], + [ + "2006", + "masters of formula three", + "1", + "0", + "0", + "n / a", + "13th" + ], + [ + "2007", + "formula renault 3.5 series", + "14", + "0", + "0", + "0", + "nc" + ], + [ + "2007", + "formula three euroseries", + "2", + "0", + "0", + "0", + "nc" + ], + [ + "2008", + "gp2 asia series", + "8", + "0", + "0", + "0", + "23rd" + ], + [ + "2008", + "gp2 series", + "13", + "0", + "0", + "0", + "30th" + ], + [ + "2008 - 09", + "gp2 asia series", + "11", + "0", + "0", + "0", + "33rd" + ], + [ + "2009", + "gp2 series", + "20", + "0", + "0", + "0", + "23rd" + ], + [ + "2009", + "formula renault 3.5 series", + "6", + "0", + "0", + "7", + "23rd" + ], + [ + "2009 - 10", + "gp2 asia series", + "8", + "0", + "0", + "7", + "13th" + ], + [ + "2010", + "gp2 series", + "20", + "0", + "0", + "12", + "16th" + ], + [ + "2011", + "gp2 asia series", + "4", + "0", + "0", + "9", + "8th" + ], + [ + "2011", + "gp2 series", + "18", + "0", + "0", + "1", + "21st" + ] + ], + "title": "", + "original_id": "cf78a80569325500f2aa429285c98f5e" + }, + { + "_id": "7a64b7d52163741ec4b5a25a23e525db", + "header": [ + "hand", + "1 credit", + "2 credits", + "3 credits", + "4 credits", + "5 credits" + ], + "rows": [ + [ + "royal flush", + "250", + "500", + "750", + "1000", + "4000" + ], + [ + "straight flush", + "50", + "100", + "150", + "200", + "250" + ], + [ + "four aces w / 2 , 3 , or 4", + "400", + "800", + "1200", + "1600", + "2000" + ], + [ + "four 2 , 3 , or 4 w / a - 4", + "160", + "320", + "480", + "640", + "800" + ], + [ + "four aces", + "160", + "320", + "480", + "640", + "800" + ], + [ + "four 2 , 3 , or 4", + "80", + "160", + "240", + "320", + "400" + ], + [ + "four 5 - k", + "50", + "100", + "150", + "200", + "250" + ], + [ + "full house", + "10", + "20", + "30", + "40", + "50" + ], + [ + "flush", + "6", + "12", + "18", + "24", + "30" + ], + [ + "straight", + "4", + "8", + "12", + "16", + "20" + ], + [ + "three of a kind", + "3", + "6", + "9", + "12", + "15" + ], + [ + "two pair", + "1", + "2", + "3", + "4", + "5" + ], + [ + "jacks or better", + "1", + "2", + "3", + "4", + "5" + ], + [ + "theoretical return", + "98.9%", + "98.9%", + "98.9%", + "98.9%", + "100.1%" + ] + ], + "title": "", + "original_id": "4cc489011d65d97a1a1c269bbcdd112d" + }, + { + "_id": "87fbe0bbab0304748ac6c38db09da6d1", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1.0", + "Great Britain (GBR)", + "6", + "3", + "2", + "11" + ], + [ + "2.0", + "South Africa (RSA)", + "1", + "2", + "1", + "4" + ], + [ + "3.0", + "Canada (CAN)", + "1", + "1", + "0", + "2" + ], + [ + "4.0", + "Australia (AUS)", + "0", + "1", + "1", + "2" + ], + [ + null, + "Hong Kong (HKG)", + "0", + "1", + "1", + "2" + ], + [ + "6.0", + "Israel (ISR)", + "0", + "0", + "2", + "2" + ], + [ + "7.0", + "South Korea (KOR)", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "629103144efe26a2da56a953c77fa3f8" + }, + { + "_id": "a8be0e66238975ab8d58104de9a653c4", + "header": [ + "year", + "number of tropical storms", + "number of hurricanes", + "number of major hurricanes", + "deaths", + "strongest storm" + ], + "rows": [ + [ + "1860", + "1", + "5", + "1", + "60 +", + "one" + ], + [ + "1861", + "2", + "6", + "0", + "22 +", + "one and three" + ], + [ + "1862", + "3", + "3", + "0", + "3", + "two and three" + ], + [ + "1863", + "4", + "5", + "0", + "90", + "one , two , three & four" + ], + [ + "1864", + "2", + "3", + "0", + "none", + "one , three & five" + ], + [ + "1865", + "4", + "3", + "0", + "326", + "four & seven" + ], + [ + "1866", + "1", + "5", + "1", + "383", + "six" + ], + [ + "1867", + "2", + "6", + "0", + "811", + "'san narciso'" + ], + [ + "1868", + "1", + "3", + "0", + "2", + "one , two & four" + ] + ], + "title": "", + "original_id": "f72902b09ecc9fc2500e114d8c7519c2" + }, + { + "_id": "8664d46460fe1a7645117258f3f432b1", + "header": [ + "agent", + "melting / boiling point", + "effectiveness as blood agent", + "persistence , open area", + "persistence , enclosed area", + "field stability", + "storage stability", + "toxicity as blood agent" + ], + "rows": [ + [ + "hydrogen cyanide", + "- 13 / 26 degree", + "10", + "2", + "9", + "10", + "8", + "10" + ], + [ + "cyanogen", + "- 28 / - 21 degree", + "9", + "2", + "9", + "8", + "7", + "9" + ], + [ + "cyanogen chloride", + "- 6 / 14 degree", + "8", + "3", + "9", + "9", + "9", + "8" + ], + [ + "cyanogen bromide", + "52 / 62 degree", + "9", + "5", + "8", + "5", + "6", + "8" + ], + [ + "arsine", + "- 117 / - 62 degree", + "9", + "3", + "8", + "5", + "9", + "9" + ], + [ + "vinyl arsine", + "124 degree (boiling)", + "7", + "7", + "9", + "8", + "9", + "6" + ], + [ + "phosgene", + "- 118 / 8", + "10", + "6", + "9", + "5", + "8", + "6" + ] + ], + "title": "", + "original_id": "240b0d45a41eb8f3b90989092af6da7b" + }, + { + "_id": "0457cc52b01f798e0c325a2f412ea5ed", + "header": [ + "district", + "2010 population (000)", + "2008 gdp (usd bn) a", + "2008 gdp per capita (usd) a", + "agri culture b", + "mining b", + "manufac turing b", + "services & cons truction b", + "exports (usd mn) 2011", + "median mo salary (usd) a e", + "vehicles (per 1000) d", + "income poverty f", + "structural poverty g" + ], + "rows": [ + [ + "city of buenos aires", + "2890", + "118.0", + "40828", + "0.3", + "1.0", + "12.9", + "85.8", + "426", + "1618", + "528", + "7.3", + "7.8" + ], + [ + "buenos aires province", + "15625", + "161.0", + "10303", + "4.5", + "0.1", + "21.3", + "74.1", + "28134", + "1364", + "266", + "16.2", + "15.8" + ], + [ + "catamarca", + "368", + "2.331", + "6009", + "3.6", + "20.8", + "12.1", + "63.5", + "1596", + "1241", + "162", + "24.3", + "21.5" + ], + [ + "chaco", + "1055", + "2.12", + "2015", + "12.6", + "0.0", + "7.5", + "79.9", + "602", + "1061", + "137", + "35.4", + "33.0" + ], + [ + "chubut", + "509", + "7.11", + "15422", + "6.9", + "21.3", + "10.0", + "61.8", + "3148", + "2281", + "400", + "4.6", + "15.5" + ], + [ + "córdoba", + "3309", + "33.239", + "10050", + "10.6", + "0.2", + "14.0", + "75.2", + "10635", + "1200", + "328", + "14.8", + "13.0" + ], + [ + "corrientes", + "993", + "4.053", + "4001", + "12.6", + "0.0", + "8.2", + "79.2", + "230", + "1019", + "168", + "31.5", + "28.5" + ], + [ + "entre ríos", + "1236", + "7.137", + "5682", + "11.9", + "0.3", + "11.6", + "76.2", + "1908", + "1063", + "280", + "13.0", + "17.6" + ], + [ + "formosa", + "530", + "1.555", + "2879", + "7.6", + "1.5", + "6.4", + "84.5", + "40", + "1007", + "107", + "30.7", + "33.6" + ], + [ + "jujuy", + "673", + "2.553", + "3755", + "5.5", + "0.7", + "14.6", + "79.2", + "456", + "1123", + "153", + "30.0", + "28.8" + ], + [ + "la pampa", + "319", + "2.0", + "5987", + "19.0", + "3.7", + "5.3", + "72.0", + "378", + "1164", + "364", + "13.6", + "10.3" + ], + [ + "la rioja", + "334", + "1.419", + "4162", + "3.9", + "0.1", + "16.8", + "79.2", + "281", + "1040", + "172", + "22.0", + "20.4" + ], + [ + "mendoza", + "1739", + "18.8", + "10758", + "5.4", + "6.1", + "17.5", + "71.0", + "1862", + "1153", + "313", + "12.2", + "15.4" + ], + [ + "misiones", + "1102", + "4.044", + "3751", + "6.7", + "0.0", + "13.0", + "80.3", + "536", + "971", + "153", + "32.6", + "27.1" + ], + [ + "neuquén", + "551", + "14.398", + "26273", + "0.7", + "42.8", + "2.9", + "53.6", + "353", + "2211", + "339", + "11.2", + "17.0" + ], + [ + "río negro", + "639", + "4.924", + "8247", + "4.9", + "8.4", + "7.3", + "79.4", + "670", + "1309", + "285", + "20.6", + "17.9" + ], + [ + "salta", + "1214", + "5.165", + "4220", + "8.1", + "7.6", + "10.4", + "73.9", + "1332", + "1045", + "139", + "29.7", + "31.6" + ], + [ + "san juan", + "681", + "3.927", + "5642", + "8.1", + "0.3", + "15.9", + "75.7", + "2470", + "1293", + "216", + "18.4", + "17.4" + ], + [ + "san luis", + "432", + "2.444", + "5580", + "4.9", + "0.5", + "42.4", + "52.2", + "735", + "1288", + "245", + "22.0", + "15.6" + ], + [ + "santa cruz", + "274", + "6.892", + "30496", + "4.4", + "47.1", + "2.3", + "46.2", + "1857", + "2646", + "432", + "3.6", + "10.4" + ], + [ + "santa fe", + "3195", + "37.5", + "10670", + "10.1", + "0.0", + "17.4", + "72.5", + "17804", + "1265", + "299", + "18.2", + "14.8" + ], + [ + "santiago del estero", + "874", + "2.598", + "3003", + "11.5", + "0.1", + "6.2", + "82.2", + "1082", + "945", + "103", + "31.0", + "31.3" + ], + [ + "tierra del fuego", + "127", + "2.606", + "20682", + "4.7", + "18.5", + "18.6", + "58.2", + "443", + "2267", + "478", + "6.4", + "14.1" + ], + [ + "tucumán", + "1448", + "5.807", + "3937", + "6.0", + "0.1", + "12.6", + "81.3", + "1031", + "973", + "146", + "27.7", + "23.9" + ] + ], + "title": "", + "original_id": "9fd3d8839e4a861d3caeef557dc78e70" + }, + { + "_id": "5ed6ef1952663d04885a78728558a2bc", + "header": [ + "name", + "martyred", + "place", + "beatified", + "canonised" + ], + "rows": [ + [ + "laurent - marie - joseph imbert / st imbert", + "1839", + "korea", + "1925", + "1984" + ], + [ + "jacques - honorã chastan / st chastan", + "1839", + "korea", + "1925", + "1984" + ], + [ + "philip minh van doan / st philip minh", + "1853", + "annam", + "1900", + "1988" + ], + [ + "peter quy cong doan / st peter quy", + "1859", + "annam", + "1909", + "1988" + ], + [ + "paul loc le van / st paul loc", + "1859", + "annam", + "1909", + "1988" + ], + [ + "john hoan trinh doan / st john hoan", + "1861", + "annam", + "1909", + "1988" + ], + [ + "joseph luu van nguyen / st joseph luu", + "1861", + "annam", + "1909", + "1988" + ] + ], + "title": "", + "original_id": "50ba63ef02d5f99c08b8a106602b0d30" + }, + { + "_id": "960c36828e3d2981365aa04319998868", + "header": [ + "jurisdiction", + "for prohibition", + "percent for", + "against prohibition", + "percent against" + ], + "rows": [ + [ + "alberta and saskatchewan", + "6238", + "68.8", + "2824", + "31.2" + ], + [ + "british columbia", + "5731", + "54.6", + "4756", + "45.4" + ], + [ + "manitoba", + "12419", + "80.6", + "2978", + "19.4" + ], + [ + "new brunswick", + "26919", + "72.2", + "9575", + "27.7" + ], + [ + "nova scotia", + "34368", + "87.2", + "5370", + "12.8" + ], + [ + "ontario", + "154498", + "57.3", + "115284", + "42.7" + ], + [ + "prince edward island", + "9461", + "89.2", + "1146", + "10.8" + ], + [ + "quebec", + "28436", + "18.8", + "122760", + "81.2" + ] + ], + "title": "", + "original_id": "d0a81a29b19bb9b01e0e01329ad80112" + }, + { + "_id": "f4fdb28faa55b1fd24b4c61a2a2f3042", + "header": [ + "Year", + "Number", + "Name", + "Year.1", + "Number.1", + "Name.1", + "Year.2", + "Number.2", + "Name.2" + ], + "rows": [ + [ + "1884–1885", + "7", + "Lukin Homphrey Irving (first)", + "1886–1887", + "18", + "Duncan MacPherson", + "1888", + "4", + "William Mahlon Davis" + ], + [ + "1889–1890", + "6", + "Septimus Julius Augustus Denison", + "1891", + "10", + "Victor Brereton Rivers", + "1892", + "86", + "Reuben Wells Leonard" + ], + [ + "1893–1894", + "37", + "E.H. Drury", + "1895–1896", + "15", + "Francis Joseph Dixon", + "1897", + "48", + "A.K. Kirkpatrick" + ], + [ + "1898", + "57", + "H.S. Greenwood", + "1899", + "14", + "John Bray Cochrane", + "1900", + "41", + "Robert Cartwright" + ], + [ + "1901", + "154", + "F.M. Gaudet", + "1902", + "47", + "Ernest Frederick Wurtele", + "1903", + "21", + "A.E. Doucet" + ], + [ + "1904", + "82", + "Wallace Bruce Matthews Carruthers", + "1905", + "188", + "W.A.H. Kerr", + "1906", + "186", + "V.A.S. Williams" + ], + [ + "1907", + "139", + "C.R.F. Coutlee", + "1908", + "232", + "John Houlison", + "1909", + "91", + "J.D. Gibson" + ], + [ + "1910", + "63", + "George Hooper", + "1911", + "255", + "H.A. Panet", + "1912", + "246", + "Major-General Sir Henry Edward Burstall" + ], + [ + "1913", + "268", + "Henry Robert Visart de Bury et de Bocarmé", + "1914; 1919", + "299", + "Col. Harry J. Lamb DSO, VD", + "1920", + "293", + "C.J. Armstrong" + ], + [ + "1920–1922", + "392", + "W.B. Kingsmill", + "1923", + "377", + "A.C. Caldwell", + "1924", + "140", + "G.S. Cartwright" + ], + [ + "1925", + "499", + "Edouard de B. Panet", + "1926", + "631", + "A.B. Gillies", + "1927", + "623", + "S.B. Coristine" + ], + [ + "1928", + "555", + "R.R. Carr-Harris", + "1929", + "667", + "E.G. Hanson", + "1929–1930", + "SUO", + "G.D. de S. Wotherspoon" + ], + [ + "1930–1931", + "1119", + "J.H. Price", + "1932", + "472", + "A.R. Chipman", + "1933–1934", + "805", + "Colin W. G. Gibson" + ], + [ + "1935", + "727", + "D.A. White", + "1936–1937", + "877", + "G.L. Magann", + "1938–1939", + "1003", + "A.M. Mitchell" + ], + [ + "1940–1941", + "803", + "J.V. Young", + "1942–1943", + "1141", + "W.H. O'Reilly", + "1944", + "698", + "Everett Bristol" + ], + [ + "1945", + "982", + "D.W. MacKeen", + "1946", + "1841", + "D.G. Cunningham", + "1947", + "1230", + "S.H. Dobell" + ], + [ + "1948", + "1855", + "Ian S. Johnston", + "1949", + "1625", + "J.D. Watt", + "1950", + "1542", + "E.W. Crowe" + ], + [ + "1951", + "1860", + "Nicol Kingsmill", + "1952", + "1828", + "Ted G.E. Beament", + "1953", + "1620", + "R.R. Labatt" + ], + [ + "1954", + "1766", + "Ken H. Tremain", + "1955", + "1474", + "de L.H.M Panet", + "1956", + "2034", + "Paul Y. Davoud" + ], + [ + "1957", + "1954", + "W.P. Carr", + "1960", + "1379", + "H.A. Mackenzie", + "1961", + "2157", + "J.H.R. Gagnon" + ], + [ + "1962", + "2183", + "James E. Pepall", + "1963", + "2336", + "J.H. Moore", + "1964", + "2351", + "Guy Savard" + ], + [ + "1965", + "2749", + "James B. Cronyn", + "1966", + "2601", + "J. Fergus Maclaren", + "1967", + "2791", + "Jean P.W. Ostiguy" + ], + [ + "1968–1969", + "RCNC90", + "John F. Frank", + "1975–1976", + "3661", + "Terry Yates", + "1976–1977", + "5533", + "Glenn Allen" + ], + [ + "1977–1978", + "3172", + "Marshall Soule", + "1980–1981", + "3251", + "Jim Tremain", + "1981–1982", + "2897", + "Herb Pitts" + ], + [ + "1986–1987", + "5604", + "Ken Smee", + "1987–1988", + "3010", + "Peter McLoughlin", + "1992–1993", + "H3356", + "Robin Cumine" + ], + [ + "1993–1994", + "5244", + "Tony Downs", + "1994–1995", + "H7543", + "Senator Joseph A. Day", + "1995–1996", + "5739", + "Andre Costin" + ], + [ + "1996–1997", + "3550", + "Murray Johnston", + "1997–1998", + "8813", + "John D. Gibson", + "1998–1999", + "G0055", + "Valerie Keyes (first female)" + ], + [ + "1999–2000", + "8833", + "John Leggat", + "2000–2001", + "5758", + "Michael Morres", + "2001–2002", + "16461", + "Ian MacKinnon" + ], + [ + "2002–2003", + "6777", + "Michel Charron", + "2003–2004", + "7776", + "Chris Lythgo", + "2004–2005", + "7943", + "J. William K. Lye" + ], + [ + "2005–2006", + "10080", + "Robert Booth", + "2007–2008", + "6776", + "Tim Sparling", + "2008–2009", + "15988", + "Jeff Kearns" + ], + [ + "2010", + "16412", + "Gord Clarke", + "2011", + "19307", + "David Benoit", + "2012", + "9889", + "Robert Benn" + ], + [ + "2013", + "M0058", + "Marc Drolet (first UTPNCM)", + null, + null, + null, + null, + null, + null + ] + ], + "title": "", + "original_id": "65aadc9add4b1a42f5b5071d6a16cfd6" + }, + { + "_id": "c815f71df234c25567763387c57bf70e", + "header": [ + "name", + "latitude", + "longitude", + "diameter (km)", + "named after" + ], + "rows": [ + [ + "caccini", + "17.4", + "170.4", + "38.1", + "francesca caccini , italian composer" + ], + [ + "caitlin", + "- 65.3", + "12.0", + "14.7", + "irish first name" + ], + [ + "caiwenji", + "- 12.4", + "287.6", + "22.6", + "cai wenji , chinese poet" + ], + [ + "caldwell", + "23.6", + "112.4", + "51.0", + "taylor caldwell , american author" + ], + [ + "callas", + "2.4", + "27.0", + "33.8", + "maria callas , american singer" + ], + [ + "callirhoe", + "21.2", + "140.7", + "33.8", + "callirhoe , greek sculptor" + ], + [ + "caroline", + "6.9", + "306.3", + "18.0", + "french first name" + ], + [ + "carr", + "- 24", + "295.7", + "31.9", + "emily carr , canadian artist" + ], + [ + "carreno", + "- 3.9", + "16.1", + "57.0", + "teresa carreño , n venezuela pianist" + ], + [ + "carson", + "- 24.2", + "344.1", + "38.8", + "rachel carson , american biologist" + ], + [ + "carter", + "5.3", + "67.3", + "17.5", + "maybelle carter , american singer" + ], + [ + "castro", + "3.4", + "233.9", + "22.9", + "rosalía de castro , galician poet" + ], + [ + "cather", + "47.1", + "107.0", + "24.6", + "willa cather , american novelist" + ], + [ + "centlivre", + "19.1", + "290.4", + "28.8", + "susanna centlivre , english actress" + ], + [ + "chapelle", + "6.4", + "103.8", + "22.0", + "georgette chapelle , american journalist" + ], + [ + "chechek", + "- 2.6", + "272.3", + "7.2", + "tuvan first name" + ], + [ + "chiyojo", + "- 47.8", + "95.7", + "40.2", + "chiyojo , japanese poet" + ], + [ + "chloe", + "- 7.4", + "98.6", + "18.6", + "greek first name" + ], + [ + "cholpon", + "40", + "290.0", + "6.3", + "kyrgyz first name" + ], + [ + "christie", + "28.3", + "72.7", + "23.3", + "agatha christie , english author" + ], + [ + "chubado", + "45.3", + "5.6", + "7.0", + "fulbe first name" + ], + [ + "clara", + "- 37.5", + "235.3", + "3.2", + "latin first name" + ], + [ + "clementina", + "35.9", + "208.6", + "4.0", + "portuguese form of clementine , french first name" + ], + [ + "cleopatra", + "65.8", + "7.1", + "105.0", + "cleopatra , egyptian queen" + ], + [ + "cline", + "- 21.8", + "317.1", + "38.0", + "patsy cline , american singer" + ], + [ + "clio", + "6.3", + "333.5", + "11.4", + "greek first name" + ], + [ + "cochran", + "51.9", + "143.4", + "100.0", + "jacqueline cochran , american aviator" + ], + [ + "cohn", + "- 33.3", + "208.1", + "18.3", + "carola cohn , australian artist" + ], + [ + "colleen", + "- 60.8", + "162.2", + "13.5", + "irish first name" + ], + [ + "comnena", + "1.2", + "343.7", + "19.5", + "anna comnena , byzantine princess and writer" + ], + [ + "conway", + "48.3", + "39.0", + "49.3", + "lady anne finch conway , english natural scientist" + ], + [ + "cori", + "25.4", + "72.9", + "56.1", + "gerty cori , czech biochemist" + ], + [ + "corinna", + "22.9", + "40.6", + "19.2", + "corinna , greek poet" + ], + [ + "corpman", + "0.3", + "151.8", + "46.0", + "elizabeth koopman hevelius , astronomer" + ], + [ + "cortese", + "- 11.4", + "218.4", + "27.7", + "isabella cortese , italian physician" + ], + [ + "cotton", + "70.8", + "300.2", + "48.1", + "eugénie cotton , french physicist" + ], + [ + "cunitz", + "14.5", + "350.9", + "48.6", + "maria cunitz , silesian astronomer" + ], + [ + "cynthia", + "- 16.7", + "347.5", + "15.9", + "greek first name" + ] + ], + "title": "", + "original_id": "2883b5cdde8c423fe83ae9741807b51a" + }, + { + "_id": "89f2a48c8afb1697b2ec61283f8c0d35", + "header": [ + "rank", + "country / territory", + "manhunt international", + "1st runner - up", + "2nd runner - up", + "3rd runner - up", + "4th runner - up", + "semifinalists", + "total" + ], + "rows": [ + [ + "1", + "china", + "2", + "1", + "1", + "1", + "0", + "5", + "10" + ], + [ + "2", + "india", + "1", + "2", + "0", + "0", + "3", + "5", + "11" + ], + [ + "3", + "sweden", + "1", + "2", + "0", + "0", + "0", + "3", + "6" + ], + [ + "4", + "venezuela", + "1", + "1", + "1", + "1", + "1", + "6", + "11" + ], + [ + "5", + "turkey", + "1", + "1", + "1", + "1", + "0", + "3", + "7" + ], + [ + "6", + "australia", + "1", + "1", + "0", + "1", + "0", + "4", + "7" + ], + [ + "7", + "germany", + "1", + "1", + "0", + "0", + "0", + "1", + "3" + ], + [ + "8", + "usa", + "1", + "0", + "3", + "1", + "0", + "3", + "8" + ], + [ + "9", + "philippines", + "1", + "0", + "1", + "1", + "0", + "3", + "6" + ], + [ + "10", + "greece", + "1", + "0", + "1", + "0", + "0", + "3", + "5" + ], + [ + "11", + "south africa", + "1", + "0", + "0", + "0", + "1", + "3", + "5" + ], + [ + "12", + "slovakia", + "1", + "0", + "0", + "0", + "1", + "0", + "2" + ], + [ + "13", + "france", + "1", + "0", + "0", + "0", + "0", + "2", + "3" + ], + [ + "14", + "morocco", + "1", + "0", + "0", + "0", + "0", + "0", + "1" + ] + ], + "title": "", + "original_id": "ebcf933b385594298b3d52a00d7d9682" + }, + { + "_id": "9f6a1450baa966a1ff16820938efee0a", + "header": [ + "peak", + "country", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "mount kilimanjaro", + "tanzania", + "5895", + "5885", + "10" + ], + [ + "mount kenya", + "kenya", + "5199", + "3825", + "1374" + ], + [ + "mount meru", + "tanzania", + "4565", + "3170", + "1395" + ], + [ + "mount elgon", + "uganda", + "4321", + "2458", + "1863" + ], + [ + "mulanje massif", + "malawi", + "3002", + "2319", + "683" + ], + [ + "kimhandu", + "tanzania", + "2653", + "2121", + "532" + ], + [ + "mount satima", + "kenya", + "4001", + "2081", + "1920" + ], + [ + "mount hanang", + "tanzania", + "3420", + "2050", + "1370" + ], + [ + "loolmalassin", + "tanzania", + "3682", + "2040", + "1642" + ], + [ + "gelai peak", + "tanzania", + "2948", + "1930", + "1018" + ], + [ + "mount moroto", + "uganda", + "3083", + "1818", + "1265" + ], + [ + "kitumbeine hill", + "tanzania", + "2858", + "1770", + "1088" + ], + [ + "chepunyal hills", + "kenya", + "3334", + "1759", + "1575" + ], + [ + "mount namuli", + "mozambique", + "2419", + "1757", + "662" + ], + [ + "shengena", + "tanzania", + "2464", + "1750", + "714" + ], + [ + "sungwi", + "tanzania", + "2300", + "1730", + "570" + ], + [ + "mount kadam", + "uganda", + "3063", + "1690", + "1373" + ], + [ + "mtorwi", + "tanzania", + "2980", + "1688", + "1292" + ], + [ + "mount kulal", + "kenya", + "2285", + "1542", + "743" + ], + [ + "karenga", + "tanzania", + "2279", + "1529", + "750" + ], + [ + "mount ng'iro", + "kenya", + "2848", + "1501", + "1347" + ] + ], + "title": "", + "original_id": "5a6a21f05be43637076dc55fd0420587" + }, + { + "_id": "1a999d03347413de4af52325731d1a47", + "header": [ + "brno", + "name", + "builder", + "whenbuilt", + "withdrawn" + ], + "rows": [ + [ + "34071", + "601 squadron", + "brighton", + "1948", + "1967" + ], + [ + "34072", + "257 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34073", + "249 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34074", + "46 squadron", + "brighton", + "1948", + "1963" + ], + [ + "34075", + "264 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34076", + "41 squadron", + "brighton", + "1948", + "1966" + ], + [ + "34077", + "603 squadron", + "brighton", + "1948", + "1967" + ], + [ + "34078", + "222 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34079", + "141 squadron", + "brighton", + "1948", + "1966" + ], + [ + "34080", + "74 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34081", + "92 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34082", + "615 squadron", + "brighton", + "1948", + "1966" + ], + [ + "34083", + "605 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34084", + "253 squadron", + "brighton", + "1948", + "1965" + ], + [ + "34085", + "501 squadron", + "eastleigh", + "1948", + "1965" + ], + [ + "34086", + "219 squadron", + "brighton", + "1948", + "1966" + ], + [ + "34087", + "145 squadron", + "eastleigh", + "1948", + "1967" + ], + [ + "34088", + "213 squadron", + "brighton", + "1948", + "1967" + ], + [ + "34089", + "602 squadron", + "eastleigh", + "1948", + "1967" + ], + [ + "34090", + "sir eustace missenden , southern railway", + "brighton", + "1949", + "1967" + ], + [ + "34091", + "weymouth", + "brighton", + "1949", + "1964" + ], + [ + "34092", + "city of wells", + "brighton", + "1949", + "1964" + ], + [ + "34093", + "saunton", + "brighton", + "1949", + "1967" + ], + [ + "34094", + "mortehoe", + "brighton", + "1949", + "1964" + ], + [ + "34095", + "brentor", + "eastleigh", + "1949", + "1967" + ], + [ + "34096", + "trevone", + "brighton", + "1949", + "1964" + ], + [ + "34097", + "holsworthy", + "brighton", + "1949", + "1967" + ], + [ + "34098", + "templecombe", + "brighton", + "1949", + "1967" + ], + [ + "34099", + "lynmouth", + "brighton", + "1949", + "1964" + ], + [ + "34100", + "appledore", + "brighton", + "1949", + "1967" + ], + [ + "34101", + "hartland", + "eastleigh", + "1950", + "1966" + ], + [ + "34102", + "lapford", + "eastleigh", + "1950", + "1967" + ], + [ + "34103", + "calstock", + "brighton", + "1950", + "1965" + ], + [ + "34104", + "bere alston", + "eastleigh", + "1950", + "1967" + ], + [ + "34105", + "swanage", + "brighton", + "1950", + "1964" + ], + [ + "34106", + "lydford", + "brighton", + "march 1950", + "september 1964" + ], + [ + "34107", + "blandford forum", + "brighton", + "april 1950", + "september 1964" + ], + [ + "34108", + "wincanton", + "brighton", + "april 1950", + "june 1967" + ], + [ + "34109", + "sir trafford leigh - mallory", + "brighton", + "may 1950", + "september 1964" + ], + [ + "34110", + "66 squadron", + "brighton", + "january 1951", + "november 1963" + ] + ], + "title": "", + "original_id": "79c7100e623e490d4aabd5361cd50c5b" + }, + { + "_id": "f843aac108f8350d4daf526797b08a9c", + "header": [ + "Row Header", + "Year Ended December 31, 2018 (In cents, except percentage changes)", + "Year Ended December 31, 2017 (In cents, except percentage changes)", + "Percent Increase (Decrease) (In cents, except percentage changes)" + ], + "rows": [ + [ + "Total CASM: Aircraft fuel and related taxes", + "2.86", + "2.22", + "28.8" + ], + [ + "Total CASM: Salaries, wages and benefits", + "4.34", + "4.32", + "0.5" + ], + [ + "Total CASM: Maintenance, materials and repairs", + "0.73", + "0.71", + "2.6" + ], + [ + "Total CASM: Other rent and landing fees", + "0.67", + "0.65", + "3.1" + ], + [ + "Total CASM: Aircraft rent", + "0.45", + "0.43", + "3.5" + ], + [ + "Total CASM: Selling expenses", + "0.54", + "0.53", + "0.9" + ], + [ + "Total CASM: Depreciation and amortization", + "0.65", + "0.62", + "5.9" + ], + [ + "Total CASM: Special items, net", + "0.28", + "0.26", + "8.3" + ], + [ + "Total CASM: Other", + "1.80", + "1.78", + "1.6" + ], + [ + "Regional expenses: Aircraft fuel and related taxes", + "0.65", + "0.50", + "30.7" + ], + [ + "Regional expenses: Other", + "1.88", + "1.87", + "0.4" + ], + [ + "Regional expenses: Total CASM", + "14.85", + "13.88", + "6.9" + ], + [ + "Special items, net: Special items, net", + "(0.28)", + "(0.26)", + "8.3" + ], + [ + "Special items, net: Regional operating special items, net", + "—", + "(0.01)", + "nm (1)" + ], + [ + "Aircraft fuel and related taxes Aircraft fuel and related taxes - mainline", + "(2.86)", + "(2.22)", + "28.8" + ], + [ + "Aircraft fuel and related taxes Aircraft fuel and related taxes - regional", + "(0.65)", + "(0.50)", + "30.7" + ], + [ + "Aircraft fuel and related taxes Total CASM, excluding special items and fuel", + "11.06", + "10.90", + "1.4" + ] + ], + "title": "", + "original_id": "a5de47ae8731889ae862729fb82127b2" + }, + { + "_id": "c724d9317727d019a5f8d670a198b22d", + "header": [ + "no", + "peak", + "location", + "elevation (m)", + "prominence (m)", + "col height (m)", + "col location", + "parent" + ], + "rows": [ + [ + "1", + "mont blanc", + "france / italy", + "4810", + "4697", + "113", + "near lake kubenskoye", + "everest" + ], + [ + "2", + "großglockner", + "austria", + "3798", + "2423", + "1375", + "brenner pass", + "mont blanc" + ], + [ + "3", + "finsteraarhorn", + "switzerland", + "4274", + "2280", + "1994", + "near simplon pass", + "mont blanc" + ], + [ + "4", + "wildspitze", + "austria", + "3768", + "2261", + "1507", + "reschen pass", + "finsteraarhorn 1 / mb 2" + ], + [ + "5", + "piz bernina", + "switzerland", + "4049", + "2234", + "1815", + "maloja pass", + "finsteraarhorn 1 / mb 2" + ], + [ + "6", + "hochkönig", + "austria", + "2941", + "2181", + "760", + "near maishofen", + "großglockner 1 / mb 2" + ], + [ + "7", + "monte rosa", + "switzerland", + "4634", + "2165", + "2469", + "great st bernard pass", + "mont blanc" + ], + [ + "8", + "hoher dachstein", + "austria", + "2995", + "2136", + "859", + "eben im pongau", + "großglockner 1 / mb 2" + ], + [ + "9", + "marmolada", + "italy", + "3343", + "2131", + "1212", + "toblach", + "großglockner 1 / mb 2" + ], + [ + "10", + "monte viso", + "italy", + "3841", + "2062", + "1779", + "le mauvais pass", + "mont blanc" + ], + [ + "11", + "triglav", + "slovenia", + "2864", + "2052", + "812", + "camporosso pass", + "marmolada 1 / mb 2" + ], + [ + "12", + "barre des écrins", + "france", + "4102", + "2045", + "2057", + "col du lautaret", + "mont blanc" + ], + [ + "13", + "säntis", + "switzerland", + "2503", + "2021", + "482", + "heiligkreuz bei mels", + "finsteraarhorn 1 / mb 2" + ], + [ + "14", + "ortler", + "italy", + "3905", + "1953", + "1952", + "fraele pass in the livigno alps", + "piz bernina" + ], + [ + "15", + "monte baldo / cima valdritta", + "italy", + "2218", + "1950", + "268", + "near san giovanni pass in nago - torbole", + "ortler 1 / mb 2" + ], + [ + "16", + "gran paradiso", + "italy", + "4061", + "1891", + "2170", + "near little st bernard pass", + "mont blanc" + ], + [ + "17", + "pizzo di coca", + "italy", + "3050", + "1878", + "1172", + "aprica", + "ortler 1 / mb 2" + ], + [ + "18", + "cima dodici", + "italy", + "2336", + "1874", + "462", + "pergine valsugana", + "marmolada 1 / mb 2" + ], + [ + "19", + "dents du midi", + "switzerland", + "3257", + "1796", + "1461", + "col des montets", + "mont blanc" + ], + [ + "20", + "chamechaude", + "france", + "2082", + "1771", + "311", + "chambéry", + "mont blanc" + ], + [ + "21", + "zugspitze", + "germany / austria", + "2962", + "1746", + "1216", + "near fern pass", + "finsteraarhorn 1 / mb 2" + ], + [ + "22", + "monte antelao", + "italy", + "3264", + "1735", + "1529", + "passo cimabanche", + "marmolada" + ], + [ + "23", + "arcalod", + "france", + "2217", + "1713", + "504", + "viuz in faverges", + "mont blanc" + ], + [ + "24", + "grintovec", + "slovenia", + "2558", + "1706", + "852", + "rateče", + "triglav" + ], + [ + "25", + "großer priel", + "austria", + "2515", + "1700", + "810", + "near pichl - kainisch", + "hoher dachstein 1 / mb 2" + ], + [ + "26", + "grigna settentrionale", + "italy", + "2409", + "1686", + "723", + "balisio in ballabio", + "pizzo di coca 1 / mb 2" + ], + [ + "27", + "monte bondone", + "italy", + "2180", + "1679", + "501", + "near cadine in trento", + "ortler 1 / mb 2" + ], + [ + "28", + "presanella", + "italy", + "3558", + "1676", + "1882", + "tonale pass", + "ortler" + ], + [ + "29", + "birnhorn", + "austria", + "2634", + "1665", + "969", + "hochfilzen", + "großglockner 1 / mb 2" + ], + [ + "30", + "col nudo", + "italy", + "2471", + "1644", + "827", + "passo di sant'osvaldo", + "antelao 1 / mb 2" + ], + [ + "31", + "pointe percée", + "france", + "2750", + "1643", + "1107", + "near pont d'arbon near megève", + "mont blanc" + ], + [ + "32", + "jôf di montasio", + "italy", + "2753", + "1597", + "1156", + "predil pass", + "triglav" + ], + [ + "33", + "mölltaler polinik", + "austria", + "2784", + "1579", + "1205", + "iselsberg pass", + "großglockner 1 / mb 2" + ], + [ + "34", + "tödi", + "switzerland", + "3614", + "1570", + "2044", + "oberalp pass", + "finsteraarhorn" + ], + [ + "35", + "birkkarspitze", + "austria", + "2749", + "1569", + "1180", + "seefeld in tirol", + "zugspitze 1 / mb 2" + ], + [ + "36", + "ellmauer halt", + "austria", + "2344", + "1551", + "793", + "near ellmau", + "großglockner 1 / mb 2" + ], + [ + "37", + "grande tête de l'obiou", + "france", + "2790", + "1542", + "1248", + "col bayard", + "barre des écrins 1 / mb 2" + ], + [ + "38", + "cima tosa", + "italy", + "3173", + "1521", + "1652", + "near campo carlo magno", + "presanella 1 / mb 2" + ], + [ + "39", + "hochtor", + "austria", + "2369", + "1520", + "849", + "schober pass", + "großglockner 1 / mb 2" + ], + [ + "40", + "grimming", + "austria", + "2351", + "1518", + "833", + "near schrödis near tauplitz", + "großer priel" + ], + [ + "41", + "grand combin", + "switzerland", + "4314", + "1517", + "2797", + "fenêtre de durand", + "monte rosa" + ], + [ + "42", + "la tournette", + "france", + "2351", + "1514", + "837", + "col du marais", + "pointe percée 1 / mb 2" + ], + [ + "43", + "zirbitzkogel", + "austria", + "2396", + "1502", + "894", + "neumarkter sattel", + "großglockner 1 / mb 2" + ] + ], + "title": "", + "original_id": "cb663d0399df511cd8a624ea0c85c8f0" + }, + { + "_id": "7f60545d0bfebee9f6051043d95876e0", + "header": [ + "draw", + "language", + "artist", + "song", + "place", + "points" + ], + "rows": [ + [ + "1", + "icelandic", + "beathoven", + "þú og þeir (sókrates)", + "16", + "20" + ], + [ + "2", + "swedish", + "tommy körberg", + "stad i ljus", + "12", + "52" + ], + [ + "3", + "finnish", + "boulevard", + "nauravat silmät muistetaan", + "20", + "3" + ], + [ + "4", + "english", + "scott fitzgerald", + "go", + "2", + "136" + ], + [ + "5", + "turkish", + "mfö", + "sufi", + "15", + "37" + ], + [ + "6", + "spanish", + "la década prodigiosa", + "la chica que yo quiero (made in spain)", + "11", + "58" + ], + [ + "7", + "dutch", + "gerard joling", + "shangri - la", + "9", + "70" + ], + [ + "8", + "hebrew", + "yardena arazi", + "ben adam (בן אדם)", + "7", + "85" + ], + [ + "9", + "french", + "céline dion", + "ne partez pas sans moi", + "1", + "137" + ], + [ + "10", + "english", + "jump the gun", + "take him home", + "8", + "79" + ], + [ + "11", + "german", + "maxi & chris garden", + "lied für einen freund", + "14", + "48" + ], + [ + "12", + "german", + "wilfried", + "lisa mona lisa", + "21", + "0" + ], + [ + "13", + "danish", + "hot eyes", + "ka' du se hva' jeg sa'", + "3", + "92" + ], + [ + "14", + "greek", + "afroditi frida", + "clown (κλόουν)", + "17", + "10" + ], + [ + "15", + "norwegian", + "karoline krüger", + "for vår jord", + "5", + "88" + ], + [ + "16", + "french", + "reynaert", + "laissez briller le soleil", + "18", + "5" + ], + [ + "17", + "french", + "lara fabian", + "croire", + "4", + "90" + ], + [ + "18", + "italian", + "luca barbarossa", + "vivo (ti scrivo)", + "12", + "52" + ], + [ + "19", + "french", + "gérard lenorman", + "chanteur de charme", + "10", + "64" + ], + [ + "20", + "portuguese", + "dora", + "voltarei", + "18", + "5" + ], + [ + "21", + "croatian", + "srebrna krila", + "mangup", + "6", + "87" + ] + ], + "title": "", + "original_id": "1aad7f91605843765c973d07d7f8c341" + }, + { + "_id": "bbbd2b9970010739fe89ae06b87ffdad", + "header": [ + "election", + "dã¡il", + "share of votes", + "seats", + "total seats" + ], + "rows": [ + [ + "1927 (jun)", + "5th", + "26.2%", + "44", + "153" + ], + [ + "1927 (sep)", + "6th", + "35.2%", + "57", + "153" + ], + [ + "1932", + "7th", + "44.5%", + "72", + "153" + ], + [ + "1933", + "8th", + "49.7%", + "76", + "153" + ], + [ + "1937", + "9th", + "45.2%", + "68", + "138" + ], + [ + "1938", + "10th", + "51.9%", + "76", + "138" + ], + [ + "1943", + "11th", + "41.8%", + "66", + "138" + ], + [ + "1944", + "12th", + "48.9%", + "75", + "138" + ], + [ + "1948", + "13th", + "41.9%", + "67", + "147" + ], + [ + "1951", + "14th", + "46.3%", + "68", + "147" + ], + [ + "1954", + "15th", + "43.4%", + "65", + "147" + ], + [ + "1957", + "16th", + "48.3%", + "78", + "147" + ], + [ + "1961", + "17th", + "43.8%", + "70", + "144" + ], + [ + "1965", + "18th", + "47.7%", + "72", + "144" + ], + [ + "1969", + "19th", + "44.6%", + "74", + "144" + ], + [ + "1973", + "20th", + "46.2%", + "68", + "144" + ], + [ + "1977", + "21st", + "50.6%", + "84", + "148" + ], + [ + "1981", + "22nd", + "45.3%", + "77", + "166" + ], + [ + "1982 (feb)", + "23rd", + "47.3%", + "81", + "166" + ], + [ + "1982 (nov)", + "24th", + "45.2%", + "75", + "166" + ], + [ + "1987", + "25th", + "44.2%", + "81", + "166" + ], + [ + "1989", + "26th", + "44.2%", + "77", + "166" + ], + [ + "1992", + "27th", + "39.1%", + "68", + "166" + ], + [ + "1997", + "28th", + "39.3%", + "77", + "166" + ], + [ + "2002", + "29th", + "41.5%", + "81", + "166" + ], + [ + "2007", + "30th", + "41.6%", + "77", + "166" + ], + [ + "2011", + "31st", + "17.4%", + "20", + "166" + ] + ], + "title": "", + "original_id": "66ea61b936831554ebaa4423d2600550" + }, + { + "_id": "8d6c22baa3353ba93a52cedc9da9356d", + "header": [ + "crime", + "reported offenses", + "killeen rate", + "texas rate", + "us rate" + ], + "rows": [ + [ + "murder", + "10", + "8.6", + "5.6", + "5.6" + ], + [ + "rape", + "66", + "56.9", + "32.9", + "29.4" + ], + [ + "robbery", + "216", + "186.4", + "155.2", + "154.0" + ], + [ + "aggravated assault", + "593", + "511.6", + "314.4", + "281.6" + ], + [ + "violent crime", + "885", + "763.5", + "508.2", + "470.6" + ], + [ + "burglary", + "1711", + "1476.2", + "946.5", + "743.4" + ], + [ + "larceny - theft", + "2877", + "2482.2", + "2688.9", + "2200.1" + ], + [ + "motor vehicle theft", + "169", + "145.8", + "351.1", + "330.5" + ], + [ + "non - violent crime", + "4757", + "4104.2", + "3986.6", + "3274.0" + ] + ], + "title": "", + "original_id": "b08634d7cd884455337211051bbfc115" + }, + { + "_id": "59f19a49cb25b3266538b4d0afc736ab", + "header": [ + "Name", + "Season", + "Month", + "Max. sustained winds", + "Max. sustained winds", + "Max. sustained winds", + "Minimum pressure" + ], + "rows": [ + [ + "Name", + "Season", + "Month", + "(Knots)", + "(km/h)", + "(mph)", + "(mbar)" + ], + [ + "Hurricane Ella", + "1978", + "August, September", + "120", + "220", + "140", + "956" + ], + [ + "Hurricane Greta", + "1978", + "September", + "115", + "215", + "130", + "947" + ], + [ + "Hurricane Frederic", + "1979", + "August, September", + "115", + "215", + "130", + "943" + ], + [ + "Hurricane Harvey", + "1981", + "September", + "115", + "215", + "130", + "946" + ], + [ + "Hurricane Debby", + "1982", + "September", + "115", + "215", + "130", + "950" + ], + [ + "Hurricane Diana", + "1984", + "September", + "115", + "215", + "130", + "949" + ], + [ + "Hurricane Gloria", + "1985", + "September, October", + "125", + "230", + "145", + "919" + ], + [ + "Hurricane Helene", + "1988", + "September", + "125", + "230", + "145", + "938" + ], + [ + "Hurricane Joan", + "1988", + "October, November", + "125", + "230", + "145", + "932" + ], + [ + "Hurricane Gabrielle", + "1989", + "August, September", + "125", + "230", + "145", + "935" + ], + [ + "Hurricane Claudette", + "1991", + "September", + "115", + "215", + "130", + "943" + ], + [ + "Hurricane Felix", + "1995", + "August", + "120", + "220", + "140", + "929" + ], + [ + "Hurricane Luis", + "1995", + "August, September", + "120", + "220", + "140", + "935" + ], + [ + "Hurricane Opal", + "1995", + "September, October", + "130", + "240", + "150", + "916" + ], + [ + "Hurricane Edouard", + "1996", + "August, September", + "125", + "230", + "145", + "933" + ], + [ + "Hurricane Hortense", + "1996", + "September", + "120", + "220", + "140", + "935" + ], + [ + "Hurricane Georges", + "1998", + "September, October", + "135", + "250", + "155", + "937" + ], + [ + "Hurricane Bret", + "1999", + "August", + "125", + "230", + "145", + "944" + ], + [ + "Hurricane Cindy", + "1999", + "August", + "120", + "220", + "140", + "942" + ], + [ + "Hurricane Floyd", + "1999", + "September", + "135", + "250", + "155", + "921" + ], + [ + "Hurricane Gert", + "1999", + "September", + "130", + "240", + "150", + "930" + ], + [ + "Hurricane Lenny", + "1999", + "November", + "135", + "250", + "155", + "933" + ], + [ + "Hurricane Isaac", + "2000", + "September, October", + "120", + "220", + "140", + "943" + ], + [ + "Hurricane Keith", + "2000", + "September, October", + "120", + "220", + "140", + "939" + ], + [ + "Sources: Atlantic Hurricane Best Track File 1851–2012", + "Sources: Atlantic Hurricane Best Track File 1851–2012", + "Sources: Atlantic Hurricane Best Track File 1851–2012", + "Sources: Atlantic Hurricane Best Track File 1851–2012", + "Sources: Atlantic Hurricane Best Track File 1851–2012", + "Sources: Atlantic Hurricane Best Track File 1851–2012", + "Sources: Atlantic Hurricane Best Track File 1851–2012" + ] + ], + "title": "", + "original_id": "66ba5aa71ed35406e5bb3d31a2a25ef1" + }, + { + "_id": "822120320795596d38edcd65db11a516", + "header": [ + "june 10 - 11", + "march 27 - 29", + "january 15 - 16", + "november 3", + "august 21 - 22" + ], + "rows": [ + [ + "june 10 , 1964", + "march 28 , 1968", + "january 16 , 1972", + "november 3 , 1975", + "august 22 , 1979" + ], + [ + "127", + "129", + "131", + "133", + "135" + ], + [ + "june 11 , 1983", + "march 29 , 1987", + "january 15 , 1991", + "november 3 , 1994", + "august 22 , 1998" + ], + [ + "137", + "139", + "141", + "143", + "145" + ], + [ + "june 10 , 2002", + "march 29 , 2006", + "january 15 , 2010", + "november 3 , 2013", + "august 21 , 2017" + ], + [ + "147", + "149", + "151", + "153", + "155" + ] + ], + "title": "", + "original_id": "d35caf05d6485bf3aee4d01cd36bdc7b" + }, + { + "_id": "3fc3b3f493f11f6096e1b8dc1480a664", + "header": [ + "year", + "theme", + "artist", + "composition", + "mintage", + "issue price" + ], + "rows": [ + [ + "2000", + "year of the dragon", + "harvey chan", + "75% gold , 25% silver", + "8874", + "388.88" + ], + [ + "2001", + "year of the snake", + "harvey chan", + "75% gold , 25% silver", + "6571", + "388.88" + ], + [ + "2002", + "year of the horse", + "harvey chan", + "75% gold , 25% silver", + "6843", + "388.88" + ], + [ + "2003", + "year of the goat", + "harvey chan", + "75% gold , 25% silver", + "3927", + "398.88" + ], + [ + "2004", + "year of the monkey", + "harvey chan", + "75% gold , 25% silver", + "3318", + "398.88" + ], + [ + "2005", + "year of the rooster", + "harvey chan", + "75% gold , 25% silver", + "4888", + "398.88" + ], + [ + "2006", + "year of the dog", + "harvey chan", + "75% gold , 25% silver", + "4888", + "448.88" + ], + [ + "2007", + "year of the pig", + "harvey chan", + "75% gold , 25% silver", + "4888", + "498.95" + ], + [ + "2008", + "year of the rat", + "harvey chan", + "75% gold , 25% silver", + "4888", + "508.95" + ], + [ + "2009", + "year of the ox", + "harvey chan", + "75% gold , 25% silver", + "4888", + "638.88" + ], + [ + "2010", + "year of the tiger", + "harvey chan", + "75% gold , 25% silver", + "4888", + "555.55" + ], + [ + "2011", + "year of the rabbit", + "harvey chan", + "75% gold , 25% silver", + "4888", + "638.88" + ] + ], + "title": "", + "original_id": "6f416284e0b161716e479a0f4b3e6772" + }, + { + "_id": "e1ab06eef2e611cfcdb477b1a4d9cbd8", + "header": [ + "party", + "seats contested", + "seats won", + "no of votes", + "% of votes", + "% in seats contested", + "seats forfeited", + "2003 seats" + ], + "rows": [ + [ + "bharatiya janata party", + "49", + "0", + "28102", + "1.49%", + "1.79%", + "49", + "0" + ], + [ + "communist party of india", + "2", + "1", + "27891", + "1.48%", + "48.65%", + "0", + "1" + ], + [ + "communist party of india (marxist)", + "56", + "46", + "903009", + "48.01%", + "51.21%", + "0", + "38" + ], + [ + "indian national congress", + "48", + "10", + "684207", + "36.38%", + "44.38%", + "1", + "13" + ], + [ + "nationalist congress party", + "5", + "0", + "1882", + "0.10%", + "0.92%", + "5", + "0" + ], + [ + "all india forward bloc", + "12", + "0", + "2961", + "0.16%", + "0.74%", + "12", + "0" + ], + [ + "all india trinamool congress", + "22", + "0", + "6620", + "0.35%", + "0.92%", + "22", + "0" + ], + [ + "indigenous nationalist party of twipra", + "11", + "1", + "116761", + "6.21%", + "38.23%", + "2", + "6" + ], + [ + "janata dal (united)", + "2", + "0", + "1081", + "0.06%", + "1.74%", + "2", + "0" + ], + [ + "lok janshakti party", + "8", + "0", + "2738", + "0.15%", + "1.07%", + "8", + "0" + ], + [ + "revolutionary socialist party", + "2", + "2", + "31717", + "1.69%", + "52.58%", + "0", + "2" + ], + [ + "amra bangalee", + "19", + "0", + "5532", + "0.29%", + "0.96%", + "19", + "0" + ], + [ + "party of democratic socialism", + "1", + "0", + "2062", + "0.11%", + "6.13%", + "1", + "0" + ], + [ + "independents", + "62", + "0", + "61010", + "3.24%", + "4.94%", + "58", + "0" + ] + ], + "title": "", + "original_id": "cf9dd52a762be9733bb8d507360547ed" + }, + { + "_id": "a9c5a04b69905383a1ecf5a6f1bb2a9b", + "header": [ + "city (utility)", + "residential monthly usage : 1000 kwh", + "small power power demand : 40 kw , consumption 10000 kwh , load factor : 35%", + "medium power power demand : 1000 kw , consumption : 400000 kwh , load factor : 56 %", + "large power power demand : 50000 kw , consumption : 30600000 kwh , load factor : 85%" + ], + "rows": [ + [ + "st john 's ( newfoundland power / nl hydro )", + "11.8", + "11.83", + "9.05", + "3.98" + ], + [ + "charlottetown ( maritime electric )", + "14.51", + "15.18", + "12.68", + "8.36" + ], + [ + "halifax ( nova scotia power )", + "15.01", + "14.25", + "11.99", + "9.0" + ], + [ + "moncton ( nb power )", + "11.82", + "12.46", + "10.98", + "6.86" + ], + [ + "montreal ( hydro - quãbec )", + "6.76", + "8.85", + "7.19", + "4.51" + ], + [ + "ottawa ( hydro ottawa )", + "13.14", + "12.94", + "11.42", + "10.58" + ], + [ + "toronto ( toronto hydro )", + "13.57", + "13.41", + "11.43", + "10.46" + ], + [ + "winnipeg ( manitoba hydro )", + "7.46", + "7.29", + "5.62", + "3.69" + ], + [ + "regina ( saskpower )", + "12.54", + "10.31", + "9.08", + "5.67" + ], + [ + "edmonton ( epcor )", + "12.9", + "12.41", + "11.07", + "6.97" + ], + [ + "calgary ( enmax )", + "13.89", + "11.24", + "9.53", + "8.28" + ] + ], + "title": "", + "original_id": "a6bf1a5c7ab44c8674bb88b508865392" + }, + { + "_id": "07aec928cc2c3847cf3612fc01a6e80c", + "header": [ + "No.", + "SWV", + "Title", + "English", + "Source", + "Details" + ], + "rows": [ + [ + "1", + "257", + "Paratum cor meum, Deus", + "My heart is ready, O God", + "Psalms 108:1–3", + "257" + ], + [ + "2", + "258", + "Exultavit cor meum in Domino", + "My heart rejoiceth in the Lord", + "1 Samuel 2:1–2", + "258" + ], + [ + "3", + "259", + "In te, Domine, speravi", + "I will extol thee, O Lord", + "Psalms 30:1–2,1", + "259" + ], + [ + "4", + "260", + "Cantabo domino in vita mea", + "I will sing unto the Lord as long as I live", + "Psalms 104:33", + "260" + ], + [ + "5", + "261", + "Venite ad me omnes qui laboratis", + "Come unto me, all ye that labour", + "Matthew 11:28–30", + "261" + ], + [ + "6", + "262", + "Jubilate Deo omnis terra", + "Make a joyful noise unto the Lord", + "Psalms 100", + "262" + ], + [ + "7", + "263", + "Anima mea liquefacta est", + "My soul melted when my beloved spoke", + "Song of Solomon 5:6; 2:14; 5:13; 5:8", + "263" + ], + [ + "8", + "264", + "Adjuro vos, filiae Jerusalem", + "I adjure you, daughters of Jerusalem", + "Song of Solomon 5:6; 2:14; 5:13; 5:8", + "264" + ], + [ + "9", + "265", + "O quam tu pulchra es, amica mea", + "How beautiful you are, my love", + "Song of Solomon 4:1-5,8", + "265" + ], + [ + "10", + "266", + "Veni de Libano, veni, amica mea", + "Advance from Lebanon, my spouse", + "Song of Solomon 4:1-5,8", + "266" + ], + [ + "11", + "267", + "Benedicam Dominum in omni tempore", + "I will bless the Lord at all times", + "Psalms 34:1–2", + "267" + ], + [ + "12", + "268", + "Exquisivi Dominum et exaudivit me", + "I sought the Lord, and he heard me", + "Psalms 34:4–6", + "268" + ], + [ + "13", + "269", + "Fili mi, Absalon", + "My son, Absalon", + "2 Samuel 18:32", + "269" + ], + [ + "14", + "270", + "Attendite, popule meus", + "Give ear, O my people", + "Psalms 78:1–3", + "270" + ], + [ + "15", + "271", + "Domine, labia mea aperies", + "O Lord, open thou my lips", + "Psalms 51:15", + "271" + ], + [ + "16", + "272", + "In lectulo per noctes", + "On my bed, throughout the night", + "Song of Solomon 3:1-2,4", + "272" + ], + [ + "17", + "273", + "Invenerunt me costudes civitatis", + "The watchers who guard the city found me", + "Song of Solomon 3:1-2,4", + "273" + ], + [ + "18", + "274", + "Veni, dilecte mi, in hortum meum", + "May my beloved enter into his garden", + "Song of Solomon 5:1", + "274" + ], + [ + "19", + "275", + "Buccinate in neomenia tuba", + "Blow the trumpet when the moon is new", + "Psalms 81:3,1; 98:6", + "275" + ], + [ + "20", + "276", + "Jubilate Deo in chordis", + "Let us rejoice in God with strings and organ", + "Psalms 150:4; Psalms 98:4", + "276" + ] + ], + "title": "", + "original_id": "6bf0106b75631feb6f504e4d48bb895c" + }, + { + "_id": "96b8173c1d13e8344aa2ee35d7cf183d", + "header": [ + "canton", + "years of kindergarten", + "years of kindergarten provided", + "years of kindergarten legally required", + "length of primary school", + "length of mandatory secondary school", + "separate secondary schools", + "cooperative secondary schools", + "integrated secondary schools" + ], + "rows": [ + [ + "zurich", + "2", + "2", + "2", + "6", + "3", + "yes", + "no", + "no" + ], + [ + "bern", + "1", + "1", + "0", + "6", + "3", + "yes", + "yes", + "yes" + ], + [ + "lucerne", + "1", + "1", + "1", + "6", + "3", + "yes", + "yes", + "yes" + ], + [ + "uri", + "1", + "1", + "0", + "6", + "3", + "no", + "no", + "yes" + ], + [ + "schwyz", + "1", + "1", + "1", + "6", + "3", + "no", + "no", + "yes" + ], + [ + "obwalden", + "1", + "1", + "1", + "6", + "3", + "no", + "no", + "yes" + ], + [ + "nidwalden", + "2", + "2", + "1", + "6", + "3", + "no", + "no", + "yes" + ], + [ + "glarus", + "2", + "2", + "1", + "6", + "3", + "yes", + "yes", + "yes" + ], + [ + "zug", + "2", + "1", + "1", + "6", + "3", + "no", + "no", + "yes" + ], + [ + "fribourg", + "2", + "1 or 2", + "0 or 2", + "6", + "3", + "yes", + "no", + "yes" + ], + [ + "solothurn", + "2", + "2", + "0", + "6", + "3", + "yes", + "yes", + "yes" + ], + [ + "basel - stadt", + "2", + "2", + "2", + "4", + "5", + "yes", + "no", + "no" + ], + [ + "basel - landschaft", + "2", + "2", + "1", + "5", + "4", + "yes", + "no", + "no" + ], + [ + "schaffhausen", + "2", + "2", + "1", + "6", + "3", + "no", + "no", + "yes" + ], + [ + "appenzell ausserrhoden", + "2", + "2", + "1", + "6", + "3", + "yes", + "yes", + "yes" + ], + [ + "appenzell innerrhoden", + "2", + "2", + "1", + "6", + "3", + "yes", + "yes", + "yes" + ], + [ + "st gallen", + "2", + "2", + "2", + "6", + "3", + "no", + "no", + "yes" + ], + [ + "graubã¼nden", + "1", + "1", + "0", + "6", + "3", + "yes", + "no", + "no" + ], + [ + "aargau", + "1", + "1", + "0", + "5", + "4", + "yes", + "no", + "no" + ], + [ + "thurgau", + "2", + "2", + "2", + "6", + "3", + "yes", + "no", + "no" + ], + [ + "ticino", + "3", + "3", + "0", + "5", + "4", + "yes", + "no", + "no" + ], + [ + "vaud", + "2", + "2", + "0", + "4", + "5", + "yes", + "no", + "no" + ], + [ + "valais", + "1", + "0", + "0", + "6", + "3", + "yes", + "no", + "no" + ], + [ + "neuchãtel", + "2", + "2", + "0", + "5", + "4", + "yes", + "no", + "no" + ], + [ + "geneva", + "2", + "2", + "0", + "6", + "3", + "yes", + "no", + "no" + ] + ], + "title": "", + "original_id": "bdfcc7e1bb6dc5eef09456c8ba56f46d" + }, + { + "_id": "d3fe9ecacfde1dc41d383e9553b9afe2", + "header": [ + "0", + "pōlô", + "Unnamed: 2", + "Unnamed: 3", + "Unnamed: 4", + "Unnamed: 5", + "Unnamed: 6", + "Unnamed: 7", + "Unnamed: 8", + "Unnamed: 9", + "Unnamed: 10", + "Unnamed: 11", + "Unnamed: 12", + "Unnamed: 13", + "Unnamed: 14", + "Unnamed: 15", + "Unnamed: 16", + "Unnamed: 17", + "Unnamed: 18", + "Unnamed: 19" + ], + "rows": [ + [ + "1", + "əsad", + "11", + "samsad", + "21", + "darwamsad", + "31", + "tolomsad", + "41", + "pamsad", + "51", + "limamsad", + "61", + "nəmsad", + "71", + "pitomsad", + "81", + "walomsad", + "91", + "yamsad" + ], + [ + "2", + "darwā", + "12", + "samdarwā", + "22", + "darwamdarwā", + "32", + "tolomdarwā", + "42", + "pamdarwā", + "52", + "limamdarwā", + "62", + "nəmdarwā", + "72", + "pitomdarwā", + "82", + "walomdarwā", + "92", + "yamdarwā" + ], + [ + "3", + "tolō", + "13", + "samtolō", + "23", + "darwamtolō", + "33", + "tolomtolō", + "43", + "pamtolō", + "53", + "limamtolō", + "63", + "nəmtolō", + "73", + "pitomtolō", + "83", + "walomtolō", + "93", + "yamtolō" + ], + [ + "4", + "əpat", + "14", + "sampat", + "24", + "darwampat", + "34", + "tolompat", + "44", + "pampat", + "54", + "limampat", + "64", + "nəmpat", + "74", + "pitompat", + "84", + "walompat", + "94", + "yampat" + ], + [ + "5", + "limā", + "15", + "samlimā", + "25", + "darwamlimā", + "35", + "tolomlimā", + "45", + "pamlimā", + "55", + "limamlimā", + "65", + "nəmlimā", + "75", + "pitomlimā", + "85", + "walomlimā", + "95", + "yamlimā" + ], + [ + "6", + "ənəm", + "16", + "samnəm", + "26", + "darwamnəm", + "36", + "tolomnəm", + "46", + "pamnəm", + "56", + "limamnəm", + "66", + "nəmnəm", + "76", + "pitomnəm", + "86", + "walomnəm", + "96", + "yamnəm" + ], + [ + "7", + "pitō", + "17", + "sampitō", + "27", + "darwampitō", + "37", + "tolompitō", + "47", + "pampitō", + "57", + "limampitō", + "67", + "nəmpitō", + "77", + "pitompitō", + "87", + "walompitō", + "97", + "yampitō" + ], + [ + "8", + "walō", + "18", + "samwalō", + "28", + "darwamwalō", + "38", + "tolomwalō", + "48", + "pamwalō", + "58", + "limamwalō", + "68", + "nəmwalō", + "78", + "pitomwalō", + "88", + "walomwalō", + "98", + "yamwalō" + ], + [ + "9", + "siyam", + "19", + "samsiyam", + "29", + "darwamsiyam", + "39", + "tolomsiyam", + "49", + "pamsiyam", + "59", + "limamsiyam", + "69", + "nəmsiyam", + "79", + "pitomsiyam", + "89", + "walomsiyam", + "99", + "yamsiyam" + ], + [ + "10", + "sampōlô", + "20", + "darwampōlô", + "30", + "tolompōlô", + "40", + "pampōlô", + "50", + "limampōlô", + "60", + "nəmpōlô", + "70", + "pitompōlô", + "80", + "walompōlô", + "90", + "yampōlô", + "100", + "saŋgatos" + ] + ], + "title": "", + "original_id": "0e1001d55ac9d8f38aa594007e13070e" + }, + { + "_id": "f7eed1c8e05855b0b93d6e9c4dd4ebc5", + "header": [ + "detailed family information", + "from", + "to", + "anchor", + "orientation", + "conserved in mus musculus", + "matrix sim", + "sequence", + "occurrence" + ], + "rows": [ + [ + "cell cycle regulators : cell cycle homology element", + "137", + "149", + "143", + "+ strand", + "conserved", + "0.943", + "ggacttgaattca", + "1" + ], + [ + "gata binding factors", + "172", + "184", + "178", + "+ strand", + "conserved", + "0.946", + "taaagatttgagg", + "1" + ], + [ + "vertebrate tata binding protein factor", + "193", + "209", + "201", + "+ strand", + "conserved", + "0.983", + "tcctataaaatttggat", + "1" + ], + [ + "heat schock factors", + "291", + "315", + "303", + "+ strand", + "conserved", + "0.992", + "cacagaaacgttagaagcatctctt", + "4" + ], + [ + "human and murine ets1 factors", + "512", + "532", + "522", + "+ strand", + "conserved", + "0.984", + "taagccccggaagtacttgtt", + "3" + ], + [ + "zinc finger transcription factor ru49 , zipro1", + "522", + "528", + "525", + "+ strand", + "conserved", + "0.989", + "aagtact", + "2" + ], + [ + "krueppel like transcription factors", + "618", + "634", + "626", + "+ strand", + "conserved", + "0.925", + "tggaggggcagacaccc", + "1" + ] + ], + "title": "", + "original_id": "663af775c49891f680893517237e7158" + }, + { + "_id": "f6107def117892afa7db2e9b9a76fa37", + "header": [ + "tallangatta dfl", + "wins", + "byes", + "losses", + "draws", + "against" + ], + "rows": [ + [ + "kiewa sandy creek", + "16", + "0", + "2", + "0", + "1013" + ], + [ + "tallangatta valley", + "16", + "0", + "2", + "0", + "1165" + ], + [ + "beechworth", + "15", + "0", + "3", + "0", + "1085" + ], + [ + "yackandandah", + "13", + "0", + "5", + "0", + "1277" + ], + [ + "thurgoona", + "11", + "0", + "7", + "0", + "1267" + ], + [ + "mitta united", + "11", + "0", + "7", + "0", + "1689" + ], + [ + "barnawartha", + "8", + "0", + "10", + "0", + "1686" + ], + [ + "rutherglen", + "7", + "0", + "11", + "0", + "1479" + ], + [ + "wahgunyah", + "5", + "0", + "13", + "0", + "1731" + ], + [ + "dederang mt beauty", + "4", + "0", + "14", + "0", + "2027" + ], + [ + "wodonga saints", + "1", + "0", + "17", + "0", + "2250" + ], + [ + "chiltern", + "1", + "0", + "17", + "0", + "2535" + ] + ], + "title": "", + "original_id": "796e946eec60f6acdfae76d3f62e8baf" + }, + { + "_id": "22c5ef926a691b6ca3b7e7ebdac7be6f", + "header": [ + "member state", + "population millions", + "meps", + "inhabitants per mep", + "influence" + ], + "rows": [ + [ + "austria", + "8.27", + "17", + "486235", + "1.71" + ], + [ + "belgium", + "10.51", + "22", + "477773", + "1.74" + ], + [ + "bulgaria", + "7.72", + "17", + "454059", + "1.83" + ], + [ + "cyprus", + "0.77", + "6", + "127667", + "6.52" + ], + [ + "czech republic", + "10.25", + "22", + "465955", + "1.79" + ], + [ + "denmark", + "5.43", + "13", + "417538", + "1.99" + ], + [ + "estonia", + "1.34", + "6", + "224000", + "3.72" + ], + [ + "finland", + "5.26", + "13", + "404308", + "2.06" + ], + [ + "france", + "62.89", + "72", + "873417", + "0.95" + ], + [ + "germany", + "82.43", + "99", + "832606", + "1.0" + ], + [ + "greece", + "11.13", + "22", + "505682", + "1.65" + ], + [ + "hungary", + "10.08", + "22", + "458045", + "1.82" + ], + [ + "ireland", + "4.21", + "12", + "350750", + "2.37" + ], + [ + "italy", + "58.75", + "72", + "816000", + "1.02" + ], + [ + "latvia", + "2.3", + "8", + "286875", + "2.9" + ], + [ + "lithuania", + "3.4", + "12", + "283583", + "2.94" + ], + [ + "luxembourg", + "0.46", + "6", + "76667", + "10.86" + ], + [ + "malta", + "0.4", + "5", + "80800", + "10.3" + ], + [ + "netherlands", + "16.33", + "25", + "653360", + "1.27" + ], + [ + "poland", + "38.16", + "50", + "763140", + "1.09" + ], + [ + "portugal", + "10.57", + "22", + "480455", + "1.73" + ], + [ + "romania", + "21.61", + "33", + "654848", + "1.27" + ], + [ + "slovakia", + "5.39", + "13", + "414538", + "2.01" + ], + [ + "slovenia", + "2.0", + "7", + "286143", + "2.91" + ], + [ + "spain", + "43.76", + "50", + "875160", + "0.95" + ], + [ + "sweden", + "9.05", + "18", + "502667", + "1.66" + ], + [ + "united kingdom", + "60.64", + "72", + "839194", + "0.99" + ] + ], + "title": "", + "original_id": "82e094eabf0ec04f7bda6f1782715c7f" + }, + { + "_id": "46a3e3508dd436678ea1087dee7112d6", + "header": [ + "city", + "comprehension of danish", + "comprehension of swedish", + "comprehension of norwegian", + "average" + ], + "rows": [ + [ + "århus , denmark", + "n / a", + "3.74", + "4.68", + "4.21" + ], + [ + "copenhagen , denmark", + "n / a", + "3.60", + "4.13", + "3.87" + ], + [ + "malmö , sweden", + "5.08", + "n / a", + "4.97", + "5.02" + ], + [ + "stockholm , sweden", + "3.46", + "n / a", + "5.56", + "4.51" + ], + [ + "bergen , norway", + "6.50", + "6.15", + "n / a", + "6.32" + ], + [ + "oslo , norway", + "6.57", + "7.12", + "n / a", + "6.85" + ] + ], + "title": "", + "original_id": "74ea4975885914ad6aad322d4e668f55" + }, + { + "_id": "25a20b5618ec14691432f57dc4e3f702", + "header": [ + "rank", + "name", + "height feet (m)", + "floors", + "year" + ], + "rows": [ + [ + "1", + "one america plaza", + "500 (152)", + "34", + "1991" + ], + [ + "2", + "symphony towers", + "499 (152)", + "34", + "1989" + ], + [ + "3", + "manchester grand hyatt hotel", + "497 (151)", + "40", + "1992" + ], + [ + "4", + "electra", + "475 (145)", + "43", + "2007" + ], + [ + "5 =", + "emerald plaza", + "450 (137)", + "30", + "1990" + ], + [ + "5 =", + "pinnacle marina tower", + "450 (137)", + "36", + "2005" + ], + [ + "7", + "manchester grand hyatt seaport", + "446 (136)", + "34", + "2003" + ], + [ + "8 =", + "harbor club west", + "424 (129)", + "41", + "1992" + ], + [ + "8 =", + "harbor club east", + "424 (129)", + "41", + "1992" + ], + [ + "10 =", + "the grande south at santa fe place", + "420 (128)", + "39", + "2004" + ], + [ + "10 =", + "the grande north at santa fe place", + "420 (128)", + "39", + "2005" + ], + [ + "10 =", + "vantage pointe condominium", + "420 (128)", + "41", + "2009" + ], + [ + "13", + "advanced equities plaza", + "412 (126)", + "23", + "2005" + ], + [ + "14", + "bayside at the embarcadero", + "395 (120)", + "36", + "2009" + ], + [ + "15", + "union bank of california building", + "388 (118)", + "27", + "1969" + ], + [ + "16", + "hilton san diego bayfront", + "385 (117)", + "32", + "2008" + ], + [ + "17", + "the mark", + "381 (116)", + "33", + "2007" + ], + [ + "18", + "sapphire tower", + "380 (116)", + "32", + "2008" + ], + [ + "19", + "first national bank center", + "379 (116)", + "27", + "1982" + ], + [ + "20", + "omni san diego hotel", + "375 (114)", + "34", + "2004" + ], + [ + "21", + "meridian condominiums", + "371 (113)", + "28", + "1985" + ], + [ + "22 =", + "marriott hotel and marina tower i", + "361 (110)", + "24", + "1987" + ], + [ + "22 =", + "marriott hotel and marina tower ii", + "361 (110)", + "24", + "1987" + ], + [ + "24", + "imperial bank tower", + "355 (108)", + "24", + "1982" + ], + [ + "25", + "executive complex", + "350 (107)", + "25", + "1963" + ], + [ + "26", + "at&t building", + "348 (106)", + "20", + "1982" + ], + [ + "27", + "comerica bank building", + "339 (103)", + "23", + "1974" + ], + [ + "28", + "us federal courthouse", + "333 (101)", + "16", + "2012" + ], + [ + "29", + "wells fargo plaza", + "331 (101)", + "23", + "1984" + ], + [ + "30", + "el cortez apartment hotel", + "310 (94)", + "16", + "1927" + ], + [ + "31", + "nbc building", + "306 (93)", + "22", + "1975" + ] + ], + "title": "", + "original_id": "08f183a895a28e77a4ccbcc790997f09" + }, + { + "_id": "f0d20da1e4bf2902865ec886685d50e6", + "header": [ + "Club", + "Season", + "Division", + "League", + "League", + "FA Cup", + "FA Cup", + "Total", + "Total" + ], + "rows": [ + [ + "Club", + "Season", + "Division", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals" + ], + [ + "Leeds United", + "1925–26", + "First Division", + "12", + "0", + "0", + "0", + "12", + "0" + ], + [ + "Leeds United", + "1926–27", + "First Division", + "42", + "0", + "3", + "0", + "45", + "0" + ], + [ + "Leeds United", + "1927–28", + "Second Division", + "38", + "0", + "1", + "0", + "39", + "0" + ], + [ + "Leeds United", + "1928–29", + "First Division", + "39", + "0", + "2", + "0", + "41", + "0" + ], + [ + "Leeds United", + "1929–30", + "First Division", + "16", + "0", + "2", + "0", + "18", + "0" + ], + [ + "Leeds United", + "1930–31", + "First Division", + "38", + "0", + "3", + "0", + "41", + "0" + ], + [ + "Leeds United", + "1931–32", + "Second Division", + "32", + "0", + "0", + "0", + "32", + "0" + ], + [ + "Leeds United", + "1932–33", + "First Division", + "30", + "0", + "4", + "0", + "30", + "4" + ], + [ + "Leeds United", + "1933–34", + "First Division", + "0", + "0", + "0", + "0", + "0", + "0" + ], + [ + "Leeds United", + "Total", + "Total", + "247", + "0", + "15", + "0", + "262", + "0" + ], + [ + "Port Vale", + "1934–35", + "Second Division", + "42", + "0", + "1", + "0", + "43", + "0" + ], + [ + "Port Vale", + "1935–36", + "Second Division", + "40", + "0", + "3", + "0", + "43", + "0" + ], + [ + "Port Vale", + "Total", + "Total", + "82", + "0", + "4", + "0", + "86", + "0" + ], + [ + "Career Total", + "Career Total", + "Career Total", + "329", + "0", + "19", + "0", + "348", + "0" + ] + ], + "title": "", + "original_id": "5b785ebc08f9cca718d92e965814dba8" + }, + { + "_id": "12420c78520dd2dc3497ffe0cf26a39c", + "header": [ + "rank by average", + "competition finish", + "couple", + "total", + "number of dances", + "average" + ], + "rows": [ + [ + "1", + "2", + "darren & lana", + "374", + "11", + "34.0" + ], + [ + "2", + "1", + "darrien & hollie", + "356", + "11", + "32.4" + ], + [ + "3", + "3", + "ben & stephanie", + "342", + "11", + "31.1" + ], + [ + "4", + "6", + "paul & pamela", + "150", + "5", + "30.0" + ], + [ + "5", + "8", + "stewart & clare", + "80", + "3", + "26.7" + ], + [ + "6", + "5", + "mark & jennifer", + "169", + "7", + "24.1" + ], + [ + "7", + "10", + "clive & helga", + "24", + "1", + "24.0" + ], + [ + "8", + "4", + "jp & stacey", + "206", + "9", + "22.9" + ], + [ + "9", + "9", + "rob & dawn", + "45", + "2", + "22.5" + ] + ], + "title": "", + "original_id": "243a25da2e37282f9cdf151f453b167d" + }, + { + "_id": "5b4d59a64368a14778493f8be23a8f90", + "header": [ + "region", + "location", + "from", + "depots (12.09)", + "routes (12.09)", + "vehicles (12.09)" + ], + "rows": [ + [ + "altai krai", + "barnaul", + "19 oct 1973", + "1", + "5", + "57" + ], + [ + "altai krai", + "rubtsovsk", + "28 dec 1973", + "1", + "2", + "49" + ], + [ + "zabaykalsky krai", + "chita", + "30 dec 1970", + "1", + "5", + "77" + ], + [ + "irkutsk obl", + "irkutsk", + "6 nov 1970", + "1", + "5", + "40" + ], + [ + "irkutsk obl", + "bratsk", + "1 feb 1975", + "1", + "5", + "50" + ], + [ + "kemerovo obl", + "kemerovo", + "25 sep 1970", + "1", + "10", + "88" + ], + [ + "kemerovo obl", + "leninsk - kuznetsky", + "11 jan 1984", + "1", + "3", + "31" + ], + [ + "kemerovo obl", + "novokuznetsk", + "1 jan 1978", + "1", + "4", + "53" + ], + [ + "krasnoyarsk krai", + "krasnoyarsk", + "5 nov 1959", + "2", + "8", + "140" + ], + [ + "novosibirsk obl", + "novosibirsk", + "11 nov 1957", + "4", + "14", + "322" + ], + [ + "omsk obl", + "omsk", + "5 nov 1955", + "2", + "10", + "216" + ], + [ + "tomsk obl", + "tomsk", + "7 nov 1967", + "1", + "8", + "93" + ], + [ + "khakassia", + "abakan", + "31 dec 1980", + "1", + "12", + "24" + ] + ], + "title": "", + "original_id": "76080d8c856d385b508b831b036c12ed" + }, + { + "_id": "cef25b6fb10bdbc085e470fcb042325e", + "header": [ + "season", + "total td 's", + "total tc 's", + "total stc 's", + "strongest storm", + "deaths" + ], + "rows": [ + [ + "2000 - 01", + "16", + "4", + "1", + "paula", + "7" + ], + [ + "2001 - 02", + "16", + "5", + "2", + "waka", + "1" + ], + [ + "2002 - 03", + "18", + "10", + "7", + "zoe", + "50" + ], + [ + "2003 - 04", + "15", + "3", + "2", + "heta", + "16" + ], + [ + "2004 - 05", + "19", + "9", + "5", + "percy", + "2" + ], + [ + "2005 - 06", + "15", + "5", + "3", + "wati", + "none" + ], + [ + "2006 - 07", + "15", + "6", + "2", + "xavier", + "4" + ], + [ + "2007 - 08", + "16", + "4", + "3", + "daman", + "8" + ], + [ + "2008 - 09", + "15", + "6", + "0", + "lin", + "11" + ], + [ + "2009 - 10", + "15", + "8", + "5", + "ului", + "12" + ], + [ + "totals", + "160", + "60", + "30", + "zoe", + "111" + ] + ], + "title": "", + "original_id": "6f5355ef4f7c87583b086710fa3a4235" + }, + { + "_id": "2cda6286d12915af159ca336de0762a2", + "header": [ + "rank", + "london borough", + "indian population", + "pakistani population", + "bangladeshi population", + "chinese population", + "other asian population", + "total asian population" + ], + "rows": [ + [ + "1", + "newham", + "42484", + "30307", + "37262", + "3930", + "19912", + "133895" + ], + [ + "2", + "redbridge", + "45660", + "31051", + "16011", + "3000", + "20781", + "116503" + ], + [ + "3", + "brent", + "58017", + "14381", + "1749", + "3250", + "28589", + "105986" + ], + [ + "4", + "tower hamlets", + "6787", + "2442", + "81377", + "8109", + "5786", + "104501" + ], + [ + "5", + "harrow", + "63051", + "7797", + "1378", + "2629", + "26953", + "101808" + ], + [ + "6", + "ealing", + "48240", + "14711", + "1786", + "4132", + "31570", + "100439" + ], + [ + "7", + "hounslow", + "48161", + "13676", + "2189", + "2405", + "20826", + "87257" + ], + [ + "8", + "hillingdon", + "36795", + "9200", + "2639", + "2889", + "17730", + "69253" + ], + [ + "9", + "haringey", + "36795", + "9200", + "2639", + "2889", + "17730", + "69253" + ], + [ + "10", + "barnet", + "27920", + "5344", + "2215", + "8259", + "22180", + "65918" + ], + [ + "11", + "croydon", + "24660", + "10865", + "2570", + "3925", + "17607", + "59627" + ], + [ + "12", + "waltham forest", + "9134", + "26347", + "4632", + "2579", + "11697", + "54389" + ], + [ + "13", + "merton", + "8106", + "7337", + "2216", + "2618", + "15866", + "36143" + ], + [ + "14", + "camden", + "6083", + "1489", + "12503", + "6493", + "8878", + "35446" + ], + [ + "15", + "enfield", + "11648", + "2594", + "5599", + "2588", + "12464", + "34893" + ], + [ + "16", + "wandsworth", + "8642", + "9718", + "1493", + "3715", + "9770", + "33338" + ], + [ + "17", + "westminster", + "7213", + "2328", + "6299", + "5917", + "10105", + "31862" + ], + [ + "18", + "greenwich", + "7836", + "2594", + "1645", + "5061", + "12758", + "29894" + ], + [ + "19", + "barking and dagenham", + "7436", + "8007", + "7701", + "1315", + "5135", + "29594" + ] + ], + "title": "", + "original_id": "f6e61e13e33d853cb131b074e301f10f" + }, + { + "_id": "e006f9d43c7be8f04cfc093bfa87da54", + "header": [ + "engine type", + "scenario", + "sfc in lb / (lbf h)", + "sfc in g / (kn s)", + "specific impulse (s)", + "effective exhaust velocity (m / s)" + ], + "rows": [ + [ + "nk - 33 rocket engine", + "vacuum", + "10.9", + "309.0", + "331", + "3240" + ], + [ + "ssme rocket engine", + "space shuttle vacuum", + "7.95", + "225.0", + "453", + "4423" + ], + [ + "ramjet", + "mach 1", + "4.5", + "127.0", + "800", + "7877" + ], + [ + "j - 58 turbojet", + "sr - 71 at mach 3.2 (wet)", + "1.9", + "53.8", + "1900", + "18587" + ], + [ + "rolls - royce / snecma olympus 593", + "concorde mach 2 cruise (dry)", + "1.195", + "33.8", + "3012", + "29553" + ], + [ + "cf6 - 80c2b1f turbofan", + "boeing 747 - 400 cruise", + "0.605", + "17.1", + "5950", + "58400" + ] + ], + "title": "", + "original_id": "0fe1979e0aa6842d112d19e66e7d8659" + }, + { + "_id": "40749e64ad5fc42663e3f01ad95cbb88", + "header": [ + "Category", + "BMI (kg/m2)", + "BMI (kg/m2)", + "BMI Prime", + "BMI Prime" + ], + "rows": [ + [ + "-", + "from", + "to", + "from", + "to" + ], + [ + "Very severely underweight", + "-", + "15", + "-", + "0.60" + ], + [ + "Severely underweight", + "15", + "16", + "0.60", + "0.64" + ], + [ + "Underweight", + "16", + "18.5", + "0.64", + "0.74" + ], + [ + "Normal (healthy weight)", + "18.5", + "25", + "0.74", + "1.0" + ], + [ + "Overweight", + "25", + "30", + "1.0", + "1.2" + ], + [ + "Obese Class I (Moderately obese)", + "30", + "35", + "1.2", + "1.4" + ], + [ + "Obese Class II (Severely obese)", + "35", + "40", + "1.4", + "1.6" + ], + [ + "Obese Class III (Very severely obese)", + "40", + "45", + "1.6", + "1.8" + ], + [ + "Obese Class IV (Morbidly Obese)", + "45", + "50", + "1.8", + "2" + ], + [ + "Obese Class V (Super Obese)", + "50", + "60", + "2", + "2.4" + ], + [ + "Obese Class VI (Hyper Obese)", + "60", + "-", + "2.4", + "-" + ] + ], + "title": "", + "original_id": "a96ef1252695680c7ca26e0deceb1ea5" + }, + { + "_id": "dbafbacfff6dc95cf5996c2138b648bc", + "header": [ + "-", + "2017", + "2016", + "2015", + "2014", + "2013" + ], + "rows": [ + [ + "Applications", + "41,000", + "42,335", + "39,670", + "37,280", + "33,825" + ], + [ + "Offer Rate (%)", + "89.7", + "86.4", + "90.8", + "88.6", + "86.8" + ], + [ + "Enrols", + "6,065", + "5,960", + "5,810", + "5,820", + "5,505" + ], + [ + "Yield (%)", + "16.5", + "16.3", + "16.1", + "17.6", + "18.7" + ], + [ + "Applicant/Enrolled Ratio", + "6.76", + "7.10", + "6.83", + "6.41", + "6.14" + ], + [ + "Average Entry Tariff", + "n/a", + "176", + "471", + "466", + "463" + ] + ], + "title": "", + "original_id": "63b64c9a76e1cac75d0aa6380a6f5676" + }, + { + "_id": "2a62f34bf46011699af686f8bd252ef8", + "header": [ + "year", + "design", + "issue", + "artist", + "mintage", + "issue price" + ], + "rows": [ + [ + "2003", + "niagara falls", + "hologram", + "gary corcoran", + "29967", + "79.95" + ], + [ + "2003", + "rocky mountains", + "colorized", + "josé osio", + "28793", + "69.95" + ], + [ + "2004", + "iceberg", + "hologram", + "josé osio", + "24879", + "69.95" + ], + [ + "2004", + "northern lights", + "double image hologram", + "gary corcoran", + "34135", + "79.95" + ], + [ + "2004", + "hopewell rocks", + "selectively gold plated", + "josé osio", + "16918", + "69.95" + ], + [ + "2005", + "diamonds", + "double image hologram", + "josé osio", + "35000", + "69.95" + ] + ], + "title": "", + "original_id": "01a470ad358cd77b8f7c3bce8f34e501" + }, + { + "_id": "7edfa802c7412c5491add2ddb4ed7def", + "header": [ + "parties and voter communities", + "% 2006", + "seats 2006", + "% 2001", + "seats 2001" + ], + "rows": [ + [ + "spd", + "38.9", + "11.0", + "39.0", + "12.0" + ], + [ + "cdu", + "33.2", + "10.0", + "33.7", + "11.0" + ], + [ + "bvw", + "21.2", + "6.0", + "20.5", + "6.0" + ], + [ + "fdp", + "6.7", + "2.0", + "6.8", + "2.0" + ], + [ + "total", + "100.0", + "29.0", + "100.0", + "31.0" + ], + [ + "voter turnout in %", + "51.5", + "51.5", + "57.1", + "57.1" + ] + ], + "title": "", + "original_id": "ca4c07d6f3394bb8c1956367b21d84fd" + }, + { + "_id": "f14895e558857bfee888fee23818b555", + "header": [ + "country with flag", + "area (km square)", + "population (1 july 2005 est)", + "population density (per km square)", + "capital" + ], + "rows": [ + [ + "cuba", + "110860", + "11346670", + "102.4", + "havana" + ], + [ + "cayman islands (uk)", + "264", + "54878", + "207.9", + "george town" + ], + [ + "dominican republic", + "48730", + "8950034", + "183.7", + "santo domingo" + ], + [ + "haiti", + "27750", + "8121622", + "292.7", + "port - au - prince" + ], + [ + "jamaica", + "10991", + "2731832", + "248.6", + "kingston" + ], + [ + "puerto rico (usa)", + "9104", + "3916632", + "430.2", + "san juan" + ] + ], + "title": "", + "original_id": "5c7122c5e930420e97932e966e52ae05" + }, + { + "_id": "4df81ddd1ccbdf78470bed84b58cb24a", + "header": [ + "region / country", + "1985 - 1990", + "1990 - 1995", + "1995 - 2000", + "2000 - 2005" + ], + "rows": [ + [ + "asia", + "3.78", + "3.09", + "2.88", + "2.61" + ], + [ + "south - east asia", + "4.11", + "3.99", + "3.84", + "3.4" + ], + [ + "east asia", + "4.08", + "3.08", + "2.82", + "2.52" + ], + [ + "china", + "5.04", + "3.77", + "3.52", + "3.08" + ], + [ + "europe", + "0.78", + "0.37", + "0.14", + "0.13" + ], + [ + "north america", + "1.24", + "0.57", + "1.51", + "1.37" + ], + [ + "oceania", + "1.52", + "1.52", + "1.46", + "1.4" + ] + ], + "title": "", + "original_id": "2e281278e6f6436cc9b74a38eda3965c" + }, + { + "_id": "c75bbf5c04c7d60c2fa9fd341e8b28d6", + "header": [ + "position", + "driver", + "points", + "starts", + "wins", + "top 5s", + "top 10s", + "winnings" + ], + "rows": [ + [ + "1", + "andrew ranger", + "2190", + "13", + "6", + "8", + "13", + "87100" + ], + [ + "2", + "d j kennington", + "2023", + "13", + "2", + "9", + "10", + "72275" + ], + [ + "3", + "ron beauchamp , jr", + "2023", + "13", + "0", + "8", + "11", + "64000" + ], + [ + "4", + "scott steckly", + "1953", + "13", + "2", + "9", + "9", + "69000" + ], + [ + "5", + "kerry micks", + "1942", + "13", + "0", + "5", + "11", + "44850" + ], + [ + "6", + "don thomson , jr", + "1841", + "13", + "1", + "5", + "9", + "39950" + ], + [ + "7", + "jason hathaway", + "1819", + "13", + "0", + "2", + "10", + "37830" + ], + [ + "8", + "anthony simone", + "1800", + "13", + "0", + "4", + "8", + "38700" + ], + [ + "9", + "mark dilley", + "1767", + "13", + "0", + "4", + "6", + "39000" + ] + ], + "title": "", + "original_id": "68580e7287847d1557dfa65443087149" + }, + { + "_id": "7d5e27aca8744b3b394f49c8b68c79e1", + "header": [ + "Line", + "Terminals (District)", + "Terminals (District)", + "Commencement", + "Newest Extension", + "Length km", + "Stations" + ], + "rows": [ + [ + "1", + "Weijianian (Jinniu)", + "Science City (Shuangliu)", + "2010", + "2018", + "40.99", + "35" + ], + [ + "1", + "Weijianian (Jinniu)", + "Wugensong (Shuangliu)", + "2010", + "2018", + "40.99", + "35" + ], + [ + "2", + "Xipu (Pidu)", + "Longquanyi (Longquanyi)", + "2012", + "2014", + "42.32", + "32" + ], + [ + "3", + "Chengdu Medical College (Xindu)", + "Shuangliu West Station (Shuangliu)", + "2016", + "2018", + "49.89", + "37" + ], + [ + "4", + "Wansheng (Wenjiang)", + "Xihe (Longquanyi)", + "2015", + "2017", + "43.28", + "30" + ], + [ + "7 loop line", + "Cuijiadian (Chenghua)", + "Cuijiadian (Chenghua)", + "2017", + "-", + "38.61", + "31" + ], + [ + "10", + "Taipingyuan (Wuhou)", + "Shuangliu International Airport Terminal 2 (Shuangliu)", + "2017", + "-", + "10.90", + "6" + ], + [ + "Total", + "Total", + "Total", + "Total", + "Total", + "226", + "171" + ] + ], + "title": "", + "original_id": "329fcbb5f4b5e6cc960687daf8bb883d" + }, + { + "_id": "66cfc957c8d6548cc8cd9f30cbebd028", + "header": [ + "country", + "2002", + "2003", + "2004", + "2005", + "2006", + "2007", + "2008", + "2009", + "2010", + "2011" + ], + "rows": [ + [ + "chile", + "4580", + "4860", + "5410", + "5320", + "5560", + "5700", + "5330", + "5320", + "5420", + "5420" + ], + [ + "peru", + "843", + "850", + "1040", + "1090", + "1049", + "1200", + "1270", + "1260", + "1250", + "1220" + ], + [ + "united states", + "1140", + "1120", + "1160", + "1150", + "1200", + "1190", + "1310", + "1190", + "1110", + "1120" + ], + [ + "china", + "585", + "565", + "620", + "640", + "890", + "920", + "950", + "960", + "1190", + "1190" + ], + [ + "australia", + "873", + "870", + "854", + "930", + "859", + "860", + "886", + "900", + "870", + "940" + ], + [ + "indonesia", + "1160", + "1170", + "840", + "1050", + "816", + "780", + "651", + "950", + "872", + "625" + ], + [ + "russia", + "695", + "700", + "675", + "675", + "725", + "730", + "750", + "750", + "703", + "710" + ], + [ + "canada", + "600", + "580", + "546", + "580", + "607", + "585", + "607", + "520", + "525", + "550" + ], + [ + "zambia", + "330", + "330", + "427", + "450", + "476", + "530", + "546", + "655", + "690", + "715" + ], + [ + "poland", + "503", + "500", + "531", + "530", + "512", + "470", + "430", + "440", + "425", + "425" + ], + [ + "kazakhstan", + "490", + "480", + "461", + "400", + "457", + "460", + "420", + "410", + "380", + "360" + ], + [ + "mexico", + "330", + "330", + "406", + "420", + "338", + "400", + "247", + "250", + "260", + "365" + ], + [ + "other countries", + "1500", + "1500", + "1610", + "1750", + "1835", + "1800", + "2030", + "2180", + "1900", + "2000" + ], + [ + "world", + "13600", + "13900", + "14600", + "14900", + "15100", + "15600", + "15400", + "15800", + "15900", + "16100" + ] + ], + "title": "", + "original_id": "79d5639224296a573383632068fd219e" + }, + { + "_id": "cb3d0bdfeab978aed425255e55ae5560", + "header": [ + "name of county", + "county seat", + "area (km square)", + "population", + "population density", + "towns / villages" + ], + "rows": [ + [ + "bács - kiskun", + "kecskemét", + "8445", + "541584", + "64", + "119" + ], + [ + "baranya", + "pécs", + "4430", + "402260", + "91", + "301" + ], + [ + "békés", + "békéscsaba", + "5631", + "392845", + "70", + "75" + ], + [ + "borsod - abaúj - zemplén", + "miskolc", + "7247", + "739143", + "102", + "355" + ], + [ + "csongrád", + "szeged", + "4263", + "425785", + "100", + "60" + ], + [ + "fejér", + "székesfehérvár", + "4359", + "428579", + "98", + "108" + ], + [ + "győr - moson - sopron", + "győr", + "4208", + "440138", + "105", + "182" + ], + [ + "hajdú - bihar", + "debrecen", + "6211", + "550265", + "89", + "82" + ], + [ + "heves", + "eger", + "3637", + "323769", + "89", + "119" + ], + [ + "jász - nagykun - szolnok", + "szolnok", + "5582", + "413174", + "74", + "75" + ], + [ + "komárom - esztergom", + "tatabánya", + "2265", + "315886", + "139", + "76" + ], + [ + "nógrád", + "salgótarján", + "2546", + "218218", + "86", + "129" + ], + [ + "pest", + "budapest", + "6393", + "1124395", + "176", + "186" + ], + [ + "somogy", + "kaposvár", + "6036", + "334065", + "55", + "244" + ], + [ + "szabolcs - szatmár - bereg", + "nyíregyháza", + "5936", + "583564", + "98", + "228" + ], + [ + "tolna", + "szekszárd", + "3703", + "247287", + "67", + "108" + ], + [ + "vas", + "szombathely", + "3336", + "266342", + "80", + "216" + ], + [ + "veszprém", + "veszprém", + "4493", + "368519", + "82", + "217" + ] + ], + "title": "", + "original_id": "74b748c6679b4c2e6349f304ff08ff01" + }, + { + "_id": "9488b88bc6b2457dcce98cc7ce063106", + "header": [ + "Model", + "Launch", + "Code name", + "Fab (nm)", + "Bus interface", + "Memory (MiB)", + "Core clock (MHz)", + "Memory clock (MHz)", + "Config core1", + "Fillrate\nMOperations/s", + "Fillrate\nMPixels/s", + "Fillrate\nMTextels/s", + "Fillrate\nMVertices/s", + "Memory\nBandwidth (GB/s)", + "Memory\nBus type", + "Memory\nBus width (bit)", + "DirectX support" + ], + "rows": [ + [ + "Voodoo Graphics", + "October 1, 1996", + "SST1", + "500", + "PCI", + "2, 4", + "50", + "50", + "1:0:1:1", + "50", + "50", + "50", + "0", + "0.8", + "EDO", + "128", + "3.0" + ], + [ + "Voodoo Rush", + "April 1997", + "SST96", + "500", + "AGP 2x, PCI", + "2, 4", + "50", + "50", + "1:0:1:1", + "50", + "50", + "50", + "0", + "0.4", + "EDO", + "64", + "3.0" + ], + [ + "Voodoo2", + "March 1, 1998", + "SST96", + "350", + "PCI", + "8, 12", + "90", + "90", + "1:0:2:1", + "90", + "90", + "180", + "0", + "0.72", + "EDO", + "64", + "3.0" + ], + [ + "Voodoo Banshee", + "June 22, 1998", + "Banshee", + "350", + "AGP 2x, PCI", + "8, 16", + "100", + "100", + "1:0:1:1", + "100", + "100", + "100", + "0", + "1.6", + "SDR", + "128", + "6.0" + ], + [ + "Velocity 100", + "July 26, 1999", + "Avenger", + "250", + "AGP 2x", + "8", + "143", + "143", + "1:0:2:1", + "143", + "143", + "286", + "0", + "2.288", + "SDR", + "128", + "6.0" + ], + [ + "Velocity 200", + "July 26, 1999", + "Avenger", + "250", + "AGP 2x", + "12", + "143", + "143", + "1:0:2:1", + "143", + "143", + "286", + "0", + "2.288", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo3 1000", + "March 1999", + "Avenger", + "250", + "AGP 2x, PCI", + "8, 16", + "125", + "125", + "1:0:2:1", + "125", + "125", + "250", + "0", + "2.0", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo3 2000", + "April 3, 1999", + "Avenger", + "250", + "AGP 2x, PCI", + "16", + "143", + "143", + "1:0:2:1", + "143", + "143", + "286", + "0", + "2.288", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo3 3000", + "April 3, 1999", + "Avenger", + "250", + "AGP 2x, PCI", + "16", + "166", + "166", + "1:0:2:1", + "166", + "166", + "333", + "0", + "2.66", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo3 3500 TV", + "June 1999", + "Avenger", + "250", + "AGP 2x, PCI", + "16", + "183", + "183", + "1:0:2:1", + "183", + "183", + "366", + "0", + "2.928", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo4 4200", + "Never Released", + "VSA-100", + "250", + "AGP 4x, PCI", + "32", + "183", + "183", + "2:0:2:2", + "366", + "366", + "366", + "0", + "1.464", + "SDR", + "64", + "6.0" + ], + [ + "Voodoo4 4500", + "October 13, 2000", + "VSA-100", + "250", + "AGP 4x, PCI", + "32", + "166", + "166", + "2:0:2:2", + "332", + "332", + "332", + "0", + "2.656", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo4 4800", + "Never Released", + "VSA-100", + "250", + "AGP 4x, PCI", + "32", + "200", + "200", + "2:0:2:2", + "400", + "400", + "400", + "0", + "3.2", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo5 5000", + "Never Released", + "VSA-100 x2", + "250", + "AGP 4x, PCI", + "32", + "166", + "166", + "2:0:2:2 x2", + "664", + "664", + "664", + "0", + "2.656", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo5 5500", + "June 22, 2000", + "VSA-100 x2", + "250", + "AGP 4x, PCI", + "64", + "166", + "166", + "2:0:2:2 x2", + "664", + "664", + "664", + "0", + "2.656", + "SDR", + "128", + "6.0" + ], + [ + "Voodoo5 6000", + "Never Released", + "VSA-100 x4", + "250", + "AGP 4x, PCI", + "128", + "166", + "166", + "2:0:2:2 x4", + "1328", + "1328", + "1328", + "0", + "5.312", + "SDR", + "256", + "6.0" + ], + [ + "Spectre 1000", + "Never Released", + "Rampage", + "180", + "AGP 4x", + "64", + "200", + "400", + "4:0:4:4", + "800", + "800", + "800", + "0", + "6.4", + "DDR", + "128", + "?" + ], + [ + "Spectre 2000", + "Never Released", + "Rampage + Sage", + "180", + "AGP 4x", + "64", + "200", + "400", + "4:0:4:4", + "800", + "800", + "800", + "0", + "6.4", + "DDR", + "128", + "?" + ], + [ + "Spectre 3000", + "Never Released", + "Rampage x2 + Sage", + "180", + "AGP 4x", + "128", + "200", + "400", + "4:0:4:4 x2", + "800", + "800", + "800", + "0", + "12.8", + "DDR", + "256", + "?" + ] + ], + "title": "", + "original_id": "a7ebb00ab92abd05868389fd920ebf3d" + }, + { + "_id": "881b0e0de5d21ef2b60c2efa872981cf", + "header": [ + "tournament", + "games played", + "points per game", + "rebounds per game", + "assists per game" + ], + "rows": [ + [ + "2003 eurobasket", + "6", + "6.8", + "5.3", + "0.7" + ], + [ + "2005 eurobasket", + "7", + "7.6", + "7.1", + "0.6" + ], + [ + "2006 fiba world championship", + "9", + "9.7", + "6.7", + "0.6" + ], + [ + "2007 eurobasket", + "7", + "8.9", + "3.7", + "0.6" + ], + [ + "2009 eurobasket", + "8", + "6.5", + "2.9", + "1.1" + ], + [ + "2010 fiba world championship", + "4", + "4.5", + "4.8", + "1.5" + ], + [ + "2011 eurobasket", + "11", + "2.6", + "3.4", + "0.8" + ], + [ + "2012 olympics", + "6", + "4.5", + "2.8", + "0.5" + ] + ], + "title": "", + "original_id": "101eba078641d71762787f977234023b" + }, + { + "_id": "c5a1d4a8540b4c4623e155a8bb314708", + "header": [ + "order", + "couple", + "karen", + "nicky", + "jason", + "ruthie", + "robin", + "total", + "scoreboard", + "song", + "public vote %", + "result" + ], + "rows": [ + [ + "1", + "gareth & maria", + "4.5", + "4.0", + "3.5", + "3.5", + "4.0", + "19 , 5", + "3rd", + "wake me up when september ends - green day", + "6.81%", + "safe" + ], + [ + "2", + "linda & daniel", + "3.5", + "3.0", + "3.0", + "4.0", + "3.0", + "16.5", + "5th", + "candyman - christina aguilera", + "9.09%", + "safe" + ], + [ + "3", + "samantha & pavel", + "3.5", + "3.0", + "3.0", + "3.5", + "3.0", + "16.0", + "7th", + "you can't hurry love - the supremes", + "3.30%", + "eliminated" + ], + [ + "4", + "chris & frankie", + "5.0", + "5.0", + "4.0", + "4.5", + "5.0", + "23.5", + "1st", + "rule the world - take that", + "19.20%", + "safe" + ], + [ + "5", + "aggie & sergey", + "2.5", + "2.0", + "2.0", + "3.5", + "2.5", + "12.5", + "10th", + "total eclipse of the heart - bonnie tyler", + "5.00%", + "safe" + ], + [ + "6", + "steve & susie", + "3.0", + "3.5", + "2.0", + "3.0", + "3.0", + "14.5", + "9th", + "mony mony - billy idol", + "4.68%", + "bottom two" + ], + [ + "7", + "greg & kristina", + "3.5", + "3.5", + "2.5", + "3.0", + "3.0", + "15.5", + "8th", + "licence to kill - gladys knight", + "12.90%", + "safe" + ], + [ + "8", + "zaraah & fred", + "4.0", + "4.5", + "3.0", + "3.5", + "3.5", + "18.5", + "4th", + "take a chance on me - abba", + "7.88%", + "safe" + ] + ], + "title": "", + "original_id": "9bbb4e79fd68658cd40f7088028db149" + }, + { + "_id": "4eba098c19f921719dd2f0092b3798e2", + "header": [ + "department", + "micro (10ha)", + "small (100ha)", + "medium (500ha)", + "big (>500ha)", + "total" + ], + "rows": [ + [ + "chuquisaca", + "1653", + "11370", + "4261", + "3884", + "21168" + ], + [ + "cochabamba", + "1938", + "22225", + "27403", + "35968", + "81925" + ], + [ + "la paz", + "1703", + "21047", + "6052", + "7192", + "35994" + ], + [ + "oruro", + "940", + "3638", + "440", + "9021", + "14039" + ], + [ + "potosi", + "3240", + "10146", + "2254", + "600", + "16240" + ], + [ + "santa cruz", + "269", + "5456", + "8434", + "1080", + "15239" + ], + [ + "tarija", + "785", + "12755", + "17101", + "5710", + "36351" + ] + ], + "title": "", + "original_id": "370718c26741124d19f2a355b0a4bf6d" + }, + { + "_id": "9fd257ea7657f4bb6a2f60bf5f42d255", + "header": [ + "component 1", + "bp comp 1 (˚c)", + "component 2", + "bp comp 2 (˚c)", + "bp azeo (˚c)", + "% wt comp 1", + "% wt comp 2" + ], + "rows": [ + [ + "acetaldehyde", + "21.0", + "diethyl ether", + "34.6", + "20.5", + "76.0", + "24.0" + ], + [ + "acetaldehyde", + "21.0", + "n - butane", + "- 0.5", + "- 7.0", + "16.0", + "84.0" + ], + [ + "acetamide", + "222.0", + "benzaldehyde", + "179.5", + "178.6", + "6.5", + "93.5" + ], + [ + "acetamide", + "222.0", + "nitrobenzene", + "210.9", + "202.0", + "24.0", + "76.0" + ], + [ + "acetamide", + "222.0", + "o - xylene", + "144.1", + "142.6", + "11.0", + "89.0" + ], + [ + "acetonitrile", + "82.0", + "ethyl acetate", + "77.15", + "74.8", + "23.0", + "77.0" + ], + [ + "acetonitrile", + "82.0", + "toluene", + "110.6", + "81.1", + "25.0", + "75.0" + ], + [ + "acetylene", + "- 86.6", + "ethane", + "- 88.3", + "- 94.5", + "40.7", + "59.3" + ], + [ + "aniline", + "184.4", + "o - cresol", + "191.5", + "191.3", + "8.0", + "92.0" + ], + [ + "carbon disulfide", + "46.2", + "diethyl ether", + "34.6", + "34.4", + "1.0", + "99.0" + ], + [ + "carbon disulfide", + "46.2", + "1 , 1 - dichloroethane", + "57.2", + "46.0", + "94.0", + "6.0" + ], + [ + "carbon disulfide", + "46.2", + "methyl ethyl ketone", + "79.6", + "45.9", + "84.7", + "15.3" + ], + [ + "carbon disulfide", + "46.2", + "ethyl acetate", + "77.1", + "46.1", + "97.0", + "3.0" + ], + [ + "carbon disulfide", + "46.2", + "methyl acetate", + "57.0", + "40.2", + "73.0", + "27.0" + ], + [ + "chloroform", + "61.2", + "methyl ethyl ketone", + "79.6", + "79.9", + "17.0", + "83.0" + ], + [ + "chloroform", + "61.2", + "n - hexane", + "68.7", + "60.0", + "72.0", + "28.0" + ], + [ + "carbon tetrachloride", + "76.8", + "methyl ethyl ketone", + "79.9", + "73.8", + "71.0", + "29.0" + ], + [ + "carbon tetrachloride", + "76.8", + "ethylene dichloride", + "84.0", + "75.3", + "78.0", + "22.0" + ], + [ + "carbon tetrachloride", + "76.8", + "ethyl acetate", + "77.1", + "74.8", + "57.0", + "43.0" + ], + [ + "cyclohexane", + "81.4", + "ethyl acetate", + "77.15", + "72.8", + "46.0", + "54.0" + ], + [ + "cyclohexane", + "81.4", + "ethyl nitrate", + "88.7", + "74.5", + "64.0", + "36.0" + ], + [ + "diethyl ether", + "34.6", + "methyl formate", + "31.50", + "28.2", + "44.0", + "56.0" + ], + [ + "diethyl ether", + "34.6", + "methylene chloride", + "40", + "40.8", + "30.0", + "70.0" + ], + [ + "nitromethane", + "101.0", + "toluene", + "110.8", + "96.5", + "55.0", + "45.0" + ], + [ + "tetrahydrofuran", + "65.6", + "chloroform", + "61.2", + "72.5", + "34.5", + "65.5" + ], + [ + "tetrahydrofuran", + "65.6", + "n - hexane", + "69", + "63.0", + "46.5", + "53.5" + ], + [ + "toluene", + "110.63", + "pyridine", + "115.3", + "110.2", + "78.0", + "22.0" + ], + [ + "propylene glycol", + "188.2", + "aniline", + "184.4", + "179.5", + "43.0", + "57.0" + ], + [ + "propylene glycol", + "188.2", + "o - xylene", + "144.4", + "135.8", + "10.0", + "90.0" + ], + [ + "propylene glycol", + "188.2", + "toluene", + "110.6", + "110.5", + "1.5", + "98.5" + ] + ], + "title": "", + "original_id": "d87ba78f49cfae062a5db8fff907ce69" + }, + { + "_id": "7d6ab87f7b560a488df3e434ed1ad453", + "header": [ + "year", + "us rank", + "total s ton", + "domestic s ton", + "foreign total s ton", + "foreign imports s ton", + "foreign exports s ton" + ], + "rows": [ + [ + "2006", + "102", + "2926536", + "2306192", + "620344", + "464774", + "155570" + ], + [ + "2005", + "94", + "3527469", + "2629553", + "897916", + "430396", + "467520" + ], + [ + "2004", + "101", + "3085753", + "2323089", + "762664", + "284347", + "478317" + ], + [ + "2003", + "96", + "3178633", + "2494261", + "684372", + "218233", + "466139" + ], + [ + "2002", + "102", + "2983137", + "2318653", + "664484", + "251203", + "413281" + ], + [ + "2001", + "108", + "2861134", + "2157496", + "703638", + "225281", + "478357" + ], + [ + "2000", + "103", + "3157247", + "2416514", + "740733", + "382240", + "358493" + ] + ], + "title": "", + "original_id": "beb4a172c71e511020b2fff91acf7b15" + }, + { + "_id": "fd738753d4d08931ae0f1b666358b622", + "header": [ + "year", + "number of tropical storms", + "number of hurricanes", + "number of major hurricanes", + "deaths", + "strongest storm" + ], + "rows": [ + [ + "1870", + "11", + "10", + "2", + "2052", + "four" + ], + [ + "1871", + "8", + "6", + "2", + "30", + "three and four" + ], + [ + "1872", + "5", + "4", + "0", + "unknown", + "two" + ], + [ + "1873", + "5", + "3", + "2", + "626", + "five" + ], + [ + "1874", + "7", + "4", + "0", + "unknown", + "seven" + ], + [ + "1875", + "6", + "5", + "1", + "800", + "three" + ], + [ + "1876", + "5", + "4", + "2", + "19", + "san felipe" + ], + [ + "1877", + "8", + "3", + "1", + "34", + "four" + ], + [ + "1878", + "12", + "10", + "1", + "108", + "seven" + ] + ], + "title": "", + "original_id": "12d1926f8fb751cc7834021ab98bbfa6" + }, + { + "_id": "819500e09ba7223f9d817dbb97d33b54", + "header": [ + "Particulars", + "Total", + "Male", + "Female" + ], + "rows": [ + [ + "Total No. of Houses", + "187", + "-", + "-" + ], + [ + "Population", + "892", + "448", + "444" + ], + [ + "Child (0-6)", + "133", + "69", + "64" + ], + [ + "Schedule Caste", + "713", + "355", + "358" + ], + [ + "Schedule Tribe", + "0", + "0", + "0" + ], + [ + "Literacy", + "64.30%", + "67.28%", + "61.32%" + ], + [ + "Total Workers", + "336", + "271", + "65" + ], + [ + "Main Worker", + "254", + "0", + "0" + ], + [ + "Marginal Worker", + "82", + "62", + "20" + ] + ], + "title": "", + "original_id": "9aa29ba13e3118d62ac13f0a06b99b6d" + }, + { + "_id": "66f8db5518d89abd63e075e701369b95", + "header": [ + "Draw", + "Artist", + "Song", + "Jury", + "Televote", + "Total", + "Place" + ], + "rows": [ + [ + "1", + "Kasia Nova", + "\\The Devil\\\"\"", + "0", + "1", + "1", + "11" + ], + [ + "2", + "Edi Ann", + "\\Lovin’U\\\"\"", + "7", + "5", + "12", + "4" + ], + [ + "3", + "Izabela Kopeć", + "\\You've got my love\\\"\"", + "4", + "6", + "10", + "6" + ], + [ + "4", + "Starnawski & Urban Noiz", + "\\It's not a game\\\"\"", + "5", + "0", + "5", + "10" + ], + [ + "5", + "Queens", + "\\I say my body\\\"\"", + "0", + "0", + "0", + "12" + ], + [ + "6", + "Isis Gee", + "\\For life\\\"\"", + "12", + "12", + "24", + "1" + ], + [ + "7", + "Man Meadow", + "\\Viva la Musica\\\"\"", + "2", + "10", + "12", + "3" + ], + [ + "8", + "Afromental", + "\\Thing we’ve got\\\"\"", + "3", + "4", + "7", + "9" + ], + [ + "9", + "Plastic", + "\\Do something\\\"\"", + "10", + "2", + "12", + "5" + ], + [ + "10", + "Sandra Oxenryd", + "\\Superhero\\\"\"", + "6", + "3", + "9", + "8" + ], + [ + "11", + "Natasza Urbańska", + "\\Blow Over\\\"\"", + "8", + "7", + "15", + "2" + ], + [ + "12", + "Margo", + "\\Dlatego walcz\\\"\"", + "1", + "8", + "9", + "7" + ] + ], + "title": "", + "original_id": "cb8ace78b045bc7add8f9981c902af8c" + }, + { + "_id": "7b868c10edb7257252c08085d00a36cd", + "header": [ + "year", + "marriages between men", + "marriages between women", + "same - sex marriages", + "total marriages", + "% same - sex marriages" + ], + "rows": [ + [ + "2005 (since july)", + "923", + "352", + "1275", + "120728", + "1.06" + ], + [ + "2006", + "3190", + "1384", + "4574", + "211818", + "2.16" + ], + [ + "2007", + "2180", + "1070", + "3250", + "203697", + "1.6" + ], + [ + "2008", + "2299", + "1250", + "3549", + "196613", + "1.81" + ], + [ + "2009", + "2212", + "1200", + "3412", + "175952", + "1.94" + ], + [ + "2010", + "2216", + "1367", + "3583", + "170815", + "2.1" + ], + [ + "2011", + "2293", + "1587", + "3880", + "163085", + "2.38" + ] + ], + "title": "", + "original_id": "c1bb893ef3668efd4e9d6a33f283ba01" + }, + { + "_id": "20ac7fc8cc0d3160d3f4d881334e6412", + "header": [ + "rank", + "council area", + "speakers", + "population", + "percentage (%)" + ], + "rows": [ + [ + "1", + "na h - eileanan siar", + "15811", + "26502", + "59.7" + ], + [ + "2", + "highland", + "12673", + "208914", + "6.1" + ], + [ + "3", + "city of glasgow", + "5739", + "577869", + "1.0" + ], + [ + "4", + "argyll and bute", + "4145", + "91306", + "4.5" + ], + [ + "5", + "city of edinburgh", + "3120", + "448624", + "0.7" + ], + [ + "6", + "perth and kinross", + "1434", + "134949", + "1.1" + ], + [ + "7", + "city of aberdeen", + "1412", + "212125", + "0.7" + ], + [ + "8", + "fife", + "1106", + "349429", + "0.3" + ], + [ + "9", + "south lanarkshire", + "1079", + "302216", + "0.4" + ], + [ + "10", + "north lanarkshire", + "1021", + "321067", + "0.3" + ], + [ + "11", + "renfrewshire", + "988", + "172867", + "0.6" + ], + [ + "12", + "stirling", + "939", + "86212", + "1.1" + ], + [ + "13", + "east dunbartonshire", + "895", + "108243", + "0.8" + ], + [ + "14", + "aberdeenshire", + "871", + "226871", + "0.4" + ], + [ + "15", + "city of dundee", + "645", + "145663", + "0.4" + ], + [ + "16", + "east renfrewshire", + "590", + "89311", + "0.7" + ], + [ + "17", + "west lothian", + "571", + "158714", + "0.4" + ], + [ + "18", + "north ayrshire", + "557", + "135817", + "0.4" + ], + [ + "19", + "falkirk", + "529", + "145191", + "0.4" + ], + [ + "20", + "angus", + "485", + "108400", + "0.4" + ], + [ + "21", + "moray", + "459", + "86940", + "0.5" + ], + [ + "22", + "dumfries and galloway", + "448", + "147765", + "0.3" + ], + [ + "23", + "west dunbartonshire", + "437", + "93378", + "0.5" + ], + [ + "24", + "south ayrshire", + "417", + "112097", + "0.4" + ], + [ + "25", + "inverclyde", + "409", + "84203", + "0.5" + ], + [ + "26", + "scottish borders", + "376", + "106764", + "0.4" + ], + [ + "27", + "east ayrshire", + "368", + "120235", + "0.3" + ], + [ + "28", + "east lothian", + "341", + "90088", + "0.4" + ], + [ + "29", + "clackmannanshire", + "301", + "48077", + "0.6" + ], + [ + "30", + "midlothian", + "244", + "80941", + "0.3" + ], + [ + "31", + "shetland", + "97", + "21988", + "0.4" + ], + [ + "32", + "orkney", + "92", + "19245", + "0.5" + ] + ], + "title": "", + "original_id": "c4a6de9e58baabab25d41f6e0767c85a" + }, + { + "_id": "b0855f66516f9ba5bc8d1adcccd4c2e3", + "header": [ + "conflicts prior to israel 's independence", + "military deaths", + "civilian deaths", + "total deaths", + "military and / or civilian wounded", + "total casualties" + ], + "rows": [ + [ + "battle of tel hai", + "6", + "0", + "6", + "0", + "6" + ], + [ + "1920 nebi musa riots", + "0", + "5", + "5", + "216", + "221" + ], + [ + "1921 jaffa riots", + "0", + "47", + "47", + "146", + "193" + ], + [ + "1929 hebron - safed riots", + "0", + "133", + "133", + "339", + "472" + ], + [ + "1933 palestine riots", + "0", + "0", + "0", + "unknown", + "unknown" + ], + [ + "1936 - 1939 arab revolt", + "0", + "415 +", + "415", + "1200 +", + "1615" + ], + [ + "jewish insurgency in mandatory palestine", + "least 34 members of palmach", + "unknown", + "unknown", + "unknown", + "unknown" + ], + [ + "1947 - 48 civil war", + "895", + "408", + "1303 +", + "2000", + "3303" + ] + ], + "title": "", + "original_id": "91e26dae5bd760948530cf4e7bb8624d" + }, + { + "_id": "b61c0f4b6ee8acba164e320004ffce0f", + "header": [ + "Rank", + "Nation", + "Gold", + "Silver", + "Bronze", + "Total" + ], + "rows": [ + [ + "1", + "Japan", + "18", + "8", + "8", + "34" + ], + [ + "2", + "India", + "4", + "5", + "6", + "15" + ], + [ + "3", + "Philippines", + "4", + "3", + "3", + "10" + ], + [ + "4", + "Taiwan", + "2", + "6", + "7", + "15" + ], + [ + "5", + "South Korea", + "2", + "3", + "1", + "6" + ], + [ + "6", + "Thailand", + "2", + "2", + "0", + "4" + ], + [ + "7", + "Pakistan", + "2", + "1", + "0", + "3" + ], + [ + "8", + "Iran", + "2", + "0", + "2", + "4" + ], + [ + "9", + "Israel", + "1", + "0", + "1", + "2" + ], + [ + "10", + "Singapore", + "0", + "4", + "4", + "8" + ], + [ + "11", + "Malaysia", + "0", + "3", + "1", + "4" + ], + [ + "12", + "Iraq", + "0", + "2", + "0", + "2" + ], + [ + "13", + "Kampuchea", + "0", + "0", + "2", + "2" + ], + [ + "14", + "Nepal", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "f2be4389eaadcc68f94fcf9ca3e0fc23" + }, + { + "_id": "ea26b0f0dbe36961851a2a3205cbda28", + "header": [ + "position", + "team", + "points", + "played", + "drawn", + "lost", + "against", + "difference" + ], + "rows": [ + [ + "1", + "palmeiras", + "27", + "16", + "3", + "1", + "20", + "29" + ], + [ + "2", + "vasco da gama", + "17", + "16", + "3", + "6", + "22", + "2" + ], + [ + "3", + "botafogo", + "17", + "16", + "3", + "6", + "31", + "0" + ], + [ + "4", + "flamengo", + "17", + "16", + "5", + "5", + "21", + "- 2" + ], + [ + "5", + "portuguesa", + "17", + "16", + "7", + "4", + "24", + "- 4" + ], + [ + "6", + "são paulo", + "16", + "16", + "2", + "7", + "33", + "- 1" + ], + [ + "7", + "corinthians", + "15", + "16", + "7", + "5", + "27", + "2" + ], + [ + "8", + "fluminense", + "10", + "16", + "4", + "9", + "27", + "- 8" + ], + [ + "9", + "santos", + "8", + "9", + "2", + "4", + "24", + "- 4" + ], + [ + "10", + "america - rj", + "2", + "9", + "2", + "7", + "22", + "- 14" + ] + ], + "title": "", + "original_id": "855b3895f84f656f5bed75b55c0c416a" + }, + { + "_id": "5dd9819006cbc130d81fd02f1454b40e", + "header": [ + "draw", + "artist", + "song", + "first vote", + "place" + ], + "rows": [ + [ + "1", + "deja vu", + "im a part of you", + "1485", + "7" + ], + [ + "2", + "kristīna zaharova feat julian", + "until you find a friend", + "862", + "9" + ], + [ + "3", + "sabīne berezina", + "if i only knew", + "5142", + "5" + ], + [ + "4", + "pirates of the sea", + "wolves of the sea", + "16818", + "1" + ], + [ + "5", + "peter garden & juris vizbulis", + "memory lane", + "1932", + "6" + ], + [ + "6", + "funky drivers", + "summertime", + "1245", + "8" + ], + [ + "7", + "triānas parks", + "bye bye", + "5656", + "4" + ], + [ + "8", + "elizabete zagorska", + "take me home", + "599", + "10" + ], + [ + "9", + "aisha", + "you really got me going", + "8021", + "3" + ], + [ + "10", + "andris ērglis", + "broken lullaby", + "10751", + "2" + ] + ], + "title": "", + "original_id": "005f2f9b83c9863a265221782924df39" + }, + { + "_id": "5f751113c6a3d36ca6a62ea2d3798ed4", + "header": [ + "Crime", + "Reported offenses", + "Killeen rate", + "Texas rate", + "U.S. rate" + ], + "rows": [ + [ + "Murder", + "10", + "8.6", + "5.6", + "5.6" + ], + [ + "Rape", + "66", + "56.9", + "32.9", + "29.4" + ], + [ + "Robbery", + "216", + "186.4", + "155.2", + "154.0" + ], + [ + "Aggravated assault", + "593", + "511.6", + "314.4", + "281.6" + ], + [ + "Violent crime", + "885", + "763.5", + "508.2", + "470.6" + ], + [ + "Burglary", + "1,711", + "1,476.2", + "946.5", + "743.4" + ], + [ + "Larceny – theft", + "2,877", + "2,482.2", + "2,688.9", + "2,200.1" + ], + [ + "Motor vehicle theft", + "169", + "145.8", + "351.1", + "330.5" + ], + [ + "Non-violent crime", + "4,757", + "4,104.2", + "3,986.6", + "3,274.0" + ] + ], + "title": "", + "original_id": "7e2005500f8d07f6945773c1f893a2ec" + }, + { + "_id": "458a9bece8e540e5b298c9db05c358c2", + "header": [ + "election", + "candidates fielded", + "of seats won", + "total votes", + "% of popular vote", + "place" + ], + "rows": [ + [ + "1983", + "4", + "0", + "3078", + "0.19%", + "7th" + ], + [ + "1986", + "9", + "0", + "4660", + "0.24%", + "5th" + ], + [ + "1991", + "42", + "0", + "12650", + "0.86%", + "4th" + ], + [ + "1996", + "71", + "0", + "31511", + "1.99%", + "5th" + ], + [ + "2001", + "72", + "0", + "197231", + "12.39%", + "3rd" + ], + [ + "2005", + "79", + "0", + "161842", + "9.17%", + "3rd" + ], + [ + "2009", + "85", + "0", + "134570", + "8.21%", + "3rd" + ], + [ + "2013", + "61", + "1", + "146607", + "8.13%", + "3rd" + ] + ], + "title": "", + "original_id": "b5662b29ddce625847c130e673373add" + }, + { + "_id": "a236b1b962055764dcad6357e5306169", + "header": [ + "place", + "code", + "area (km 2 )", + "population", + "most spoken language" + ], + "rows": [ + [ + "alldays", + "90901", + "11.75", + "385", + "northern sotho" + ], + [ + "bahanawa", + "90902", + "390.17", + "19068", + "northern sotho" + ], + [ + "bahanawa - ba - kibi", + "90903", + "163.78", + "7763", + "northern sotho" + ], + [ + "bochum part 1", + "90912", + "4.33", + "8501", + "northern sotho" + ], + [ + "bochum part 2", + "90905", + "182.33", + "15911", + "northern sotho" + ], + [ + "dichoeng", + "90906", + "100000.0", + "17347", + "northern sotho" + ], + [ + "manthata", + "90907", + "1335.47", + "72175", + "northern sotho" + ], + [ + "matlala", + "90908", + "180.83", + "8697", + "northern sotho" + ], + [ + "pietersburg", + "90909", + "1.33", + "3818", + "northern sotho" + ], + [ + "ramutla", + "90910", + "7.81", + "1", + "northern sotho" + ], + [ + "seshego", + "90911", + "6.0", + "1058", + "northern sotho" + ], + [ + "remainder of the municipality", + "90904", + "2198.72", + "5539", + "northern sotho" + ] + ], + "title": "", + "original_id": "04107a8b454ee9c6a334cfcbbbd4d1e5" + }, + { + "_id": "a6240fbab201bfae8ee46e1fa2f0a29f", + "header": [ + "Club", + "Season", + "League", + "League", + "Cup", + "Cup", + "Continental", + "Continental", + "Total", + "Total" + ], + "rows": [ + [ + "Club", + "Season", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals" + ], + [ + "River Plate", + "1945", + "1", + "0", + "0", + "0", + "0", + "0", + "1", + "0" + ], + [ + "Huracán (loan)", + "1946", + "25", + "10", + "2", + "0", + "0", + "0", + "27", + "10" + ], + [ + "Huracán (loan)", + "Total", + "25", + "10", + "2", + "0", + "0", + "0", + "27", + "10" + ], + [ + "River Plate", + "1947", + "30", + "27", + "0", + "0", + "2", + "1", + "32", + "28" + ], + [ + "River Plate", + "1948", + "23", + "13", + "1", + "1", + "6", + "4", + "30", + "18" + ], + [ + "River Plate", + "1949", + "12", + "9", + "0", + "0", + "0", + "0", + "12", + "9" + ], + [ + "River Plate", + "Total", + "66", + "49", + "1", + "1", + "8", + "5", + "75", + "55" + ], + [ + "Millonarios", + "1949", + "14", + "16", + "0", + "0", + "0", + "0", + "14", + "16" + ], + [ + "Millonarios", + "1950", + "29", + "23", + "2", + "1", + "0", + "0", + "31", + "24" + ], + [ + "Millonarios", + "1951", + "34", + "32", + "4?", + "4?", + "0", + "0", + "38?", + "36?" + ], + [ + "Millonarios", + "1952", + "24", + "19", + "4?", + "5?", + "0", + "0", + "28?", + "24?" + ], + [ + "Millonarios", + "Total", + "101", + "90", + "10", + "10", + "0", + "0", + "111", + "100" + ], + [ + "Real Madrid", + "1953–54", + "28", + "27", + "0", + "0", + "0", + "0", + "28", + "27" + ], + [ + "Real Madrid", + "1954–55", + "30", + "25", + "0", + "0", + "2", + "0", + "32", + "25" + ], + [ + "Real Madrid", + "1955–56", + "30", + "24", + "0", + "0", + "7", + "5", + "37", + "29" + ], + [ + "Real Madrid", + "1956–57", + "30", + "31", + "3", + "3", + "10", + "9", + "43", + "43" + ], + [ + "Real Madrid", + "1957–58", + "30", + "19", + "7", + "7", + "7", + "10", + "44", + "36" + ], + [ + "Real Madrid", + "1958–59", + "28", + "23", + "8", + "5", + "7", + "6", + "43", + "34" + ], + [ + "Real Madrid", + "1959–60", + "23", + "12", + "5", + "3", + "6", + "8", + "34", + "23" + ], + [ + "Real Madrid", + "1960–61", + "23", + "21", + "9", + "8", + "4", + "1", + "36", + "30" + ], + [ + "Real Madrid", + "1961–62", + "23", + "11", + "8", + "4", + "10", + "7", + "41", + "22" + ], + [ + "Real Madrid", + "1962–63", + "13", + "12", + "9", + "9", + "2", + "1", + "24", + "22" + ], + [ + "Real Madrid", + "1963–64", + "24", + "11", + "1", + "1", + "9", + "5", + "34", + "17" + ], + [ + "Real Madrid", + "1964", + "30", + "50", + "0", + "0", + "0", + "0", + "30", + "50" + ], + [ + "Real Madrid", + "Total", + "282", + "216", + "50", + "40", + "64", + "52", + "396", + "308" + ], + [ + "Espanyol", + "1964–65", + "24", + "7", + "3", + "2", + "0", + "0", + "27", + "9" + ], + [ + "Espanyol", + "1965–66", + "23", + "4", + "4", + "1", + "6", + "0", + "33", + "5" + ], + [ + "Espanyol", + "Total", + "47", + "11", + "7", + "3", + "6", + "0", + "60", + "14" + ], + [ + "Espanyol", + "1966", + "-10", + "-5", + "0", + "0", + "0", + "0", + "-10", + "-5" + ], + [ + "Career totals", + "Career totals", + "521", + "376", + "70", + "54", + "78", + "57", + "669", + "487" + ] + ], + "title": "", + "original_id": "ee041adc4eeb177ab2dc721001f5b804" + }, + { + "_id": "1346aea8867ee032e6868f1c7fe154f1", + "header": [ + "epoch (utc)", + "periselene (km)", + "aposelene (km)", + "eccentricity", + "inclination (deg) (to moon equator)", + "period (h)" + ], + "rows": [ + [ + "november 15 , 2004 , 17:47:12.1", + "6700.72", + "53215.151", + "0.776329", + "81.085", + "129.247777" + ], + [ + "december 4 , 2004 10:37:47.3", + "5454.925", + "20713.095", + "0.583085", + "83.035", + "37.304959" + ], + [ + "january 1 , 2005 , 00:00:00.0", + "10000.0", + "100000.0", + "0.99999", + "150.0", + "100.0" + ], + [ + "january 9 , 2005 , 15:24:55.0", + "2751.511", + "6941.359", + "0.432261", + "87.892", + "8.409861" + ], + [ + "february 28 , 2005 , 05:18:39.9", + "2208.659", + "4618.22", + "0.352952", + "90.063603", + "4.970998" + ], + [ + "march 15 , 2005 , 12:00:00.0", + "10.0", + "100.0", + "0.5", + "80.0", + "10.0" + ], + [ + "april 25 , 2005 , 08:19:05.4", + "2283.738", + "4523.111", + "0.328988", + "90.141407", + "4.949137" + ], + [ + "may 16 , 2005 , 09:08:52.9", + "2291.25", + "4515.857", + "0.326807", + "89.734929", + "4.949919" + ], + [ + "june 20 , 2005 , 10:21:37.1", + "2256.09", + "4549.196", + "0.33696", + "90.232619", + "4.947432" + ] + ], + "title": "", + "original_id": "0bd23a6e9608ac496e063d9e2bde3ced" + }, + { + "_id": "80cb88ce6eb88b7ae9ca955407200cef", + "header": [ + "member countries", + "population", + "area (km square)", + "gdp (billion us)", + "gdp per capita (us)" + ], + "rows": [ + [ + "belgium", + "9052707", + "30528", + "58.316", + "46878" + ], + [ + "france", + "44788852", + "674843", + "312.966", + "40690" + ], + [ + "west germany", + "54292038", + "248717", + "400.554", + "41168" + ], + [ + "italy", + "49476000", + "301336", + "265.192", + "30116" + ], + [ + "luxembourg", + "310291", + "2586", + "2.938", + "113533" + ], + [ + "luxembourg", + "100000000", + "2586", + "2.938", + "113533" + ], + [ + "netherlands", + "11186847", + "41526", + "83.351", + "50355" + ], + [ + "netherlands", + "11186847", + "41526", + "83.351", + "1000" + ], + [ + "ec6 (1958)", + "169106736", + "1299536", + "1123.317", + "6643" + ] + ], + "title": "", + "original_id": "5bc2b242a93f58ca6831351bf7977275" + }, + { + "_id": "11bb2665fc7ee0bb75fc38df8ea10080", + "header": [ + "Works No.", + "CSAR No.", + "SAR No.", + "Tender Works No.", + "Tender No.", + "Class" + ], + "rows": [ + [ + "19195", + "1003", + "767", + "D1540/1", + "N1", + "10CR" + ], + [ + "19196", + "1004", + "768", + "D1540/2", + "N2", + "10CR" + ], + [ + "19197", + "1005", + "769", + "D1540/3", + "N3", + "ABC" + ], + [ + "19198", + "1006", + "770", + "D1540/4", + "N4", + "10CR" + ], + [ + "19199", + "1007", + "771", + "D1540/5", + "N5", + "10CR" + ], + [ + "19200", + "1008", + "772", + "D1540/6", + "N6", + "10C" + ], + [ + "19201", + "1009", + "773", + "D1540/7", + "N7", + "XYZ" + ], + [ + "19202", + "1010", + "774", + "D1540/8", + "N8", + "10CR" + ], + [ + "19203", + "1011", + "775", + "D1540/9", + "N9", + "10CR" + ], + [ + "19204", + "1012", + "776", + "D1540/10", + "N10", + "10C" + ], + [ + "19205", + "1013", + "777", + "D1540/11", + "N11", + "10CR" + ], + [ + "19206", + "1014", + "778", + "D1540/12", + "N12", + "10CR" + ] + ], + "title": "", + "original_id": "9c2f7bc61909c483625cb586d1129b77" + }, + { + "_id": "1ba7dba5e165d08e11f8694e5bee8c75", + "header": [ + "Unnamed: 0", + "no", + "title", + "directed by", + "written by", + "viewers", + "original airdate", + "prod code" + ], + "rows": [ + [ + "13", + "1", + "live and let doyle", + "james allodi", + "allan hawco", + "1038000", + "january 12 , 2011", + "201" + ], + [ + "14", + "2", + "popeye doyle", + "steve scaini", + "allan hawco", + "944000", + "january 19 , 2011", + "202" + ], + [ + "15", + "3", + "a stand up guy", + "steve scaini", + "perry chafe", + "776000", + "january 26 , 2011", + "203" + ], + [ + "16", + "4", + "the son also rises", + "steve dimarco", + "jesse mckeown", + "899000", + "february 2 , 2011", + "204" + ], + [ + "17", + "5", + "something old , someone blue", + "james allodi", + "adam higgs & jackie may", + "854000", + "february 9 , 2011", + "205" + ], + [ + "18", + "6", + "the ryans and the pittmans", + "steve dimarco", + "greg nelson", + "10000000", + "february 16 , 2011", + "206" + ], + [ + "19", + "7", + "crashing on the couch", + "keith samples", + "jackie may", + "760000", + "february 23 , 2011", + "207" + ], + [ + "20", + "8", + "sympathy for the devil", + "stacey curtis", + "john callaghan", + "834400", + "march 2 , 2011", + "208" + ], + [ + "21", + "9", + "will the real des courtney please stand up", + "keith samples", + "greg nelson", + "1026000", + "march 9 , 2011", + "209" + ], + [ + "22", + "10", + "the special detective", + "steve scaini", + "adam higgs", + "836000", + "march 16 , 2011", + "210" + ], + [ + "23", + "11", + "don't gamble with city hall", + "john vatcher", + "jackie may", + "1000", + "march 23 , 2011", + "211" + ], + [ + "24", + "12", + "st john 's town", + "keith samples", + "perry chafe", + "730000", + "march 30 , 2011", + "212" + ] + ], + "title": "", + "original_id": "3a29c3a2e897c3551da6c1be2f183cc6" + }, + { + "_id": "e970906f9d15e0bc1228e2d110f0506e", + "header": [ + "rank by time in office", + "order in office", + "vice president", + "length of term in days", + "explanation" + ], + "rows": [ + [ + "1", + "6", + "daniel d tompkins", + "2922", + "served two full terms" + ], + [ + "1", + "28", + "thomas r marshall", + "2922", + "served two full terms" + ], + [ + "1", + "36", + "richard nixon", + "2922", + "served two full terms" + ], + [ + "1", + "43", + "george h w bush", + "2922", + "served two full terms" + ], + [ + "1", + "45", + "al gore", + "2922", + "served two full terms" + ], + [ + "1", + "46", + "dick cheney", + "2922", + "served two full terms" + ], + [ + "10", + "4", + "george clinton", + "2605", + "died in office during his second term" + ], + [ + "11", + "47", + "joe biden", + "1838", + "currently serving" + ], + [ + "12", + "39", + "spiro agnew", + "1724", + "resigned in his second term to avoid prison" + ], + [ + "13", + "3", + "aaron burr", + "1461", + "served one full term" + ], + [ + "13", + "8", + "martin van buren", + "1461", + "served one full term" + ], + [ + "13", + "9", + "richard johnson", + "1461", + "served one full term" + ], + [ + "13", + "11", + "george m dallas", + "1461", + "served one full term" + ], + [ + "13", + "14", + "john c breckinridge", + "1461", + "served one full term" + ], + [ + "13", + "15", + "hannibal hamlin", + "1461", + "served one full term" + ], + [ + "13", + "17", + "schuyler colfax", + "1461", + "served one full term" + ], + [ + "13", + "19", + "william a wheeler", + "1461", + "served one full term" + ], + [ + "13", + "22", + "levi p morton", + "1461", + "served one full term" + ], + [ + "13", + "23", + "adlai e stevenson", + "1461", + "served one full term" + ], + [ + "13", + "26", + "charles w fairbanks", + "1461", + "served one full term" + ], + [ + "13", + "30", + "charles g dawes", + "1461", + "served one full term" + ], + [ + "13", + "31", + "charles curtis", + "1461", + "served one full term" + ], + [ + "13", + "33", + "henry a wallace", + "1461", + "served one full term" + ], + [ + "13", + "35", + "alben w barkley", + "1461", + "served one full term" + ], + [ + "13", + "38", + "hubert humphrey", + "1461", + "served one full term" + ], + [ + "13", + "42", + "walter mondale", + "1461", + "served one full term" + ], + [ + "13", + "44", + "dan quayle", + "1461", + "served one full term" + ], + [ + "14", + "48", + "john doe", + "1", + "unknown reason" + ], + [ + "31", + "2", + "thomas jefferson", + "1460", + "served one full term without any leap year" + ], + [ + "32", + "27", + "james s sherman", + "1338", + "died in office" + ], + [ + "33", + "37", + "lyndon b johnson", + "1036", + "succeeded to presidency" + ], + [ + "34", + "18", + "henry wilson", + "993", + "died in office" + ], + [ + "35", + "24", + "garret hobart", + "992", + "died in office" + ], + [ + "36", + "29", + "calvin coolidge", + "881", + "succeeded to presidency" + ], + [ + "37", + "41", + "nelson rockefeller", + "763", + "appointed and confirmed mid - term" + ], + [ + "38", + "5", + "elbridge gerry", + "629", + "died in office" + ], + [ + "39", + "12", + "millard fillmore", + "491", + "succeeded to presidency" + ], + [ + "40", + "21", + "thomas a hendricks", + "266", + "died in office" + ], + [ + "42", + "20", + "chester a arthur", + "199", + "succeeded to presidency" + ], + [ + "43", + "25", + "theodore roosevelt", + "194", + "succeeded to presidency" + ], + [ + "44", + "34", + "harry s truman", + "82", + "succeeded to presidency" + ], + [ + "45", + "49", + "jane doe", + "10000", + "unknown reason" + ], + [ + "45", + "13", + "william r king", + "45", + "died in office" + ], + [ + "46", + "16", + "andrew johnson", + "42", + "succeeded to presidency" + ] + ], + "title": "", + "original_id": "325fa1639b088ef23bc145f2a7938f27" + }, + { + "_id": "b098c3bf243e08b7d94aab06bf02900e", + "header": [ + "year", + "matches", + "wins", + "losses", + "no result", + "tied", + "success rate" + ], + "rows": [ + [ + "2008", + "16", + "9", + "7", + "0", + "0", + "56.25%" + ], + [ + "2009", + "15", + "8", + "6", + "1", + "0", + "53.33%" + ], + [ + "2010", + "16", + "9", + "7", + "0", + "0", + "56.25%" + ], + [ + "2011", + "16", + "11", + "5", + "0", + "0", + "68.75%" + ], + [ + "2012", + "19", + "19", + "0", + "0", + "0", + "100.00%" + ], + [ + "2013", + "18", + "12", + "6", + "0", + "0", + "66.67%" + ], + [ + "2014", + "16", + "2", + "14", + "0", + "0", + "12.50%" + ], + [ + "total", + "99", + "59", + "39", + "1", + "0", + "60.2%" + ] + ], + "title": "", + "original_id": "262c922fd14176c9aae71da6264ffff5" + }, + { + "_id": "ed067499e3218e11fce0c173af52635e", + "header": [ + "rank", + "surname", + "number of bearers 1971", + "number of bearers 2009", + "type", + "etymology" + ], + "rows": [ + [ + "1", + "jensen", + "368.631", + "278.782", + "patronymic", + "son of jens" + ], + [ + "2", + "nielsen", + "349.126", + "275.744", + "patronymic", + "son of niels" + ], + [ + "3", + "hansen", + "297.937", + "231.221", + "patronymic", + "son of hans" + ], + [ + "4", + "pedersen", + "203.426", + "173.639", + "patronymic", + "son of peder" + ], + [ + "5", + "andersen", + "188.359", + "165.871", + "patronymic", + "son of anders" + ], + [ + "6", + "christensen", + "159.943", + "125.192", + "patronymic", + "son of christen" + ], + [ + "7", + "larsen", + "148.214", + "122.712", + "patronymic", + "son of lars" + ], + [ + "8", + "sørensen", + "139.111", + "117.3", + "patronymic", + "son of søren" + ], + [ + "9", + "rasmussen", + "117.355", + "99.238", + "patronymic", + "son of rasmus" + ], + [ + "10", + "jørgensen", + "110.132", + "93.182", + "patronymic", + "son of jørgen" + ], + [ + "11", + "petersen", + "130.236", + "85.268", + "patronymic", + "son of peter" + ], + [ + "12", + "madsen", + "1000", + "67.075", + "patronymic", + "son of mads" + ], + [ + "13", + "kristensen", + "58.99", + "62.549", + "patronymic", + "son of kristen" + ], + [ + "14", + "olsen", + "65.194", + "50.904", + "patronymic", + "son of ole" + ], + [ + "15", + "thomsen", + "40.18", + "39.86", + "patronymic", + "son of thomas" + ], + [ + "16", + "christiansen", + "45.984", + "38.528", + "patronymic", + "son of christian" + ], + [ + "17", + "poulsen", + "36.544", + "33.106", + "patronymic", + "son of poul" + ], + [ + "18", + "johansen", + "36.47", + "32.166", + "patronymic", + "son of johan" + ], + [ + "19", + "knudsen", + "34.66", + "30.634", + "patronymic", + "son of knud" + ], + [ + "20", + "møller", + "31.645", + "0.001", + "occupational", + "miller" + ] + ], + "title": "", + "original_id": "3ed04740126f0e52e20cbf6d02b9a73a" + }, + { + "_id": "d6e62f630f37b7adcaa7bd36a141356a", + "header": [ + "rank", + "company", + "revenues (us billion)", + "profit (us billion)", + "assets (us billion)", + "market value (us billion)" + ], + "rows": [ + [ + "1", + "national bank of greece", + "10.4", + "- 16", + "137.0", + "1.0" + ], + [ + "2", + "bank of greece", + "5.4", + "0.3", + "210.7", + "0.4" + ], + [ + "3", + "coca cola hbc", + "9.3", + "0.3", + "9.5", + "10.2" + ], + [ + "4", + "hellenic telecom", + "1000", + "0.6", + "10.7", + "3.7" + ], + [ + "5", + "alpha bank", + "4.6", + "- 1.4", + "76.9", + "0.5" + ], + [ + "6", + "public power corporation", + "7.7", + "0", + "21.2", + "2.0" + ], + [ + "7", + "piraeus bank", + "3.9", + "- 8.6", + "62.5", + "100" + ], + [ + "8", + "hellenic petroleum", + "13.8", + "0.1", + "9.7", + "3.3" + ], + [ + "9", + "opap", + "5.2", + "0.7", + "2.3", + "2.8" + ], + [ + "10", + "motor oil", + "12.8", + "0.1", + "3.4", + "1.2" + ] + ], + "title": "", + "original_id": "4207fa4b3d87c87ae4a89b2de194c4ad" + }, + { + "_id": "942f5b90f97eb6e0150bb648e05b905c", + "header": [ + "member countries", + "population", + "area (km square)", + "gdp (billion us)", + "gdp per capita (us)", + "languages" + ], + "rows": [ + [ + "cyprus", + "775927", + "9250", + "11.681", + "15054", + "greek turkish" + ], + [ + "czech republic", + "10246178", + "78866", + "105.248", + "10272", + "czech" + ], + [ + "estonia", + "1341664", + "45226", + "22.384", + "16684", + "estonian" + ], + [ + "hungary", + "10032375", + "93030", + "102183.0", + "10185", + "hungarian abc" + ], + [ + "latvia", + "2306306", + "64589", + "24.826", + "10764", + "latvian" + ], + [ + "lithuania", + "3607899", + "65200", + "1000.0", + "8861", + "lithuanian" + ], + [ + "malta", + "396851", + "316", + "5.097", + "12843", + "english maltese" + ], + [ + "poland", + "38580445", + "311904", + "316.438", + "8202", + "polish" + ], + [ + "slovakia", + "5423567", + "49036", + "42.8", + "7810", + "slovak" + ], + [ + "slovenia", + "2011473", + "20273", + "29.633", + "14732", + "slovene" + ], + [ + "accession countries", + "74722685", + "737690", + "685.123", + "9169", + "10 new" + ], + [ + "existing members (2004)", + "381781620", + "3367154", + "7711.871", + "20200", + "11" + ] + ], + "title": "", + "original_id": "6faecd45a67cb3465f2cb766ead68dfd" + }, + { + "_id": "575c0b1683f75bd742be9f19e02533e4", + "header": [ + "episode number", + "title", + "original airing", + "timeslot", + "viewers", + "top 50 ranking", + "scripted show ranking" + ], + "rows": [ + [ + "112", + "nice is different than good", + "february 15 , 2010", + "8:35 pm - 9:30 pm", + "479100", + "12", + "3" + ], + [ + "113", + "being alive)", + "february 22 , 2010", + "8:30 pm - 9:30 pm", + "477080", + "8", + "1" + ], + [ + "114", + "never judge a lady by her lover", + "march 1 , 2010", + "8:30 pm - 9:30 pm", + "447990", + "9", + "1" + ], + [ + "115", + "the god - why - don't - you - love - me blues", + "march 8 , 2010", + "8:30 pm - 9:30 pm", + "471200", + "14", + "4" + ], + [ + "116", + "everybody ought to have a maid", + "march 15 , 2010", + "8:30 pm - 9:30 pm", + "448490", + "15", + "5" + ], + [ + "117", + "don't walk on the grass", + "march 22 , 2010", + "8:30 pm - 9:30 pm", + "2000000", + "12", + "4" + ], + [ + "118", + "careful the things you say", + "march 29 , 2010", + "8:30 pm - 9:30 pm", + "413820", + "13", + "5" + ], + [ + "119", + "the coffee cup", + "april 12 , 2010", + "8:30 pm - 9:30 pm", + "397830", + "23", + "8" + ], + [ + "120", + "would i think of suicide", + "april 19 , 2010", + "8:30 pm - 9:30 pm", + "391220", + "25", + "9" + ], + [ + "121", + "boom crunch", + "april 26 , 2010", + "8:30 pm - 9:30 pm", + "411880", + "21", + "8" + ], + [ + "122", + "if", + "may 3 , 2010", + "8:30 pm - 9:30 pm", + "419020", + "21", + "9" + ], + [ + "123", + "you gotta get a gimmick", + "may 10 , 2010", + "8:30 pm - 9:30 pm", + "429540", + "19", + "8" + ], + [ + "124", + "how about a friendly shrink", + "may 17 , 2010", + "8:30 pm - 9:30 pm", + "375760", + "28", + "10" + ], + [ + "125", + "the glamorous life", + "may 24 , 2010", + "3:00 am - 4:00 am", + "375620", + "25", + "6" + ], + [ + "126", + "lovely", + "may 31 , 2010", + "8:30 pm - 9:30 pm", + "400730", + "28", + "11" + ], + [ + "127", + "the chase", + "june 7 , 2010", + "8:30 pm - 9:30 pm", + "391340", + "23", + "11" + ], + [ + "128", + "chromolume no 7", + "june 14 , 2010", + "8:30 pm - 9:30 pm", + "425620", + "25", + "10" + ], + [ + "129", + "my two young men", + "june 21 , 2010", + "8:30 pm - 9:30 pm", + "392270", + "24", + "7" + ], + [ + "130", + "we all deserve to die", + "june 28 , 2010", + "8:30 pm - 9:30 pm", + "444790", + "21", + "8" + ], + [ + "131", + "epiphany", + "july 5 , 2010", + "8:30 pm - 9:30 pm", + "524440", + "18", + "4" + ], + [ + "132", + "a little night music", + "july 12 , 2010", + "8:30 pm - 9:30 pm", + "464820", + "19", + "6" + ], + [ + "133", + "the ballad of booth", + "july 19 , 2010", + "8:30 pm - 9:30 pm", + "447060", + "19", + "5" + ] + ], + "title": "", + "original_id": "8fd2215bcdb2dd18a9960652f796be73" + }, + { + "_id": "aef05e0c7be04354b5e9bde6f21139e5", + "header": [ + "brno", + "name", + "builder", + "whenbuilt", + "withdrawn" + ], + "rows": [ + [ + "34071", + "601 squadron", + "brighton", + "1948", + "1967" + ], + [ + "34072", + "257 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34073", + "249 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34074", + "46 squadron", + "brighton", + "1948", + "1963" + ], + [ + "34075", + "264 squadron", + "brighton", + "abc", + "1964" + ], + [ + "34076", + "41 squadron", + "brighton", + "1948", + "1966" + ], + [ + "34077", + "603 squadron", + "brighton", + "1948", + "1967" + ], + [ + "34078", + "222 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34079", + "141 squadron", + "brighton", + "1948", + "1966" + ], + [ + "34080", + "74 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34081", + "92 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34082", + "615 squadron", + "brighton", + "1948", + "1966" + ], + [ + "34083", + "605 squadron", + "brighton", + "1948", + "1964" + ], + [ + "34084", + "253 squadron", + "brighton", + "1948", + "1965" + ], + [ + "34085", + "501 squadron", + "eastleigh", + "1948", + "1965" + ], + [ + "34086", + "219 squadron", + "brighton", + "1948", + "1966" + ], + [ + "34087", + "145 squadron", + "eastleigh", + "1234", + "1967" + ], + [ + "34088", + "213 squadron", + "brighton", + "1948", + "1967" + ], + [ + "34089", + "602 squadron", + "eastleigh", + "1948", + "1967" + ], + [ + "34090", + "sir eustace missenden , southern railway", + "brighton", + "1949", + "1967" + ], + [ + "34091", + "weymouth", + "brighton", + "1949", + "1964" + ], + [ + "34092", + "city of wells", + "brighton", + "1949", + "1964" + ], + [ + "34093", + "saunton", + "brighton", + "1949", + "1967" + ], + [ + "34094", + "mortehoe", + "brighton", + "1949", + "1964" + ], + [ + "34095", + "brentor", + "eastleigh", + "1949", + "1967" + ], + [ + "34096", + "trevone", + "brighton", + "1949", + "1964" + ], + [ + "34097", + "holsworthy", + "brighton", + "1949", + "1967" + ], + [ + "34098", + "templecombe", + "brighton", + "1949", + "1967" + ], + [ + "34099", + "lynmouth", + "brighton", + "1949", + "1964" + ], + [ + "34100", + "appledore", + "brighton", + "1949", + "1967" + ], + [ + "34101", + "hartland", + "eastleigh", + "1950", + "1966" + ], + [ + "34102", + "lapford", + "eastleigh", + "1950", + "1967" + ], + [ + "34103", + "calstock", + "brighton", + "1950", + "1965" + ], + [ + "34104", + "bere alston", + "eastleigh", + "1950", + "1967" + ], + [ + "34105", + "swanage", + "brighton", + "1950", + "1964" + ], + [ + "34106", + "lydford", + "brighton", + "march 1950", + "september 1964" + ], + [ + "34107", + "blandford forum", + "brighton", + "april 1950", + "september 1964" + ], + [ + "34108", + "wincanton", + "brighton", + "april 1950", + "june 1967" + ], + [ + "34109", + "sir trafford leigh - mallory", + "brighton", + "may 1950", + "september 1964" + ], + [ + "34110", + "66 squadron", + "brighton", + "january 1951", + "november 1963" + ] + ], + "title": "", + "original_id": "ea363a4fcbe3b456ca111a2bc9b060c8" + }, + { + "_id": "d16d97102efefe80618e471e41a78c2c", + "header": [ + "peak", + "country", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "jbel toubkal", + "morocco", + "4167", + "3755", + "412" + ], + [ + "m'goun", + "morocco", + "4071", + "1904", + "2167" + ], + [ + "koudiet tirbirhine", + "morocco", + "2456", + "1901", + "555" + ], + [ + "lalla khedidja", + "algeria", + "2308", + "1720", + "588" + ], + [ + "adrar bou nasser", + "morocco", + "3340", + "1642", + "1698" + ], + [ + "Mount Everest", + "Nepal", + "8848", + "1000", + "2000" + ], + [ + "djebel chãlia", + "algeria", + "2328", + "1612", + "716" + ], + [ + "jbel igdet", + "morocco", + "3615", + "1609", + "2006" + ], + [ + "Mount Olympus", + "Greece", + "2000", + "-500", + "1500" + ] + ], + "title": "", + "original_id": "c8885f24e03f00a39755b2f3bffcc0a6" + }, + { + "_id": "9c6770bd53c6254a13813c5ce765e3e8", + "header": [ + "Works no.", + "Year built", + "PPR no.", + "IMR no.", + "CSAR no.", + "SAR no." + ], + "rows": [ + [ + "3943", + "1897", + "1", + "1", + "209", + "56" + ], + [ + "3944", + "1897", + "2", + "2", + "210", + "57" + ], + [ + "3945", + "1897", + "3", + "3", + "211", + "58" + ], + [ + "3946", + "1897", + "4", + "4", + "212", + "59" + ], + [ + "3948", + "1897", + "5", + "5", + "213", + "61" + ], + [ + "4127", + "1900", + "-", + "6", + "214", + "60" + ] + ], + "title": "", + "original_id": "a62cd11e920857713b0989bb134d1cc6" + }, + { + "_id": "8a26c3864d11b28d81ddd6064e8974c4", + "header": [ + "county", + "1948", + "1956", + "1966", + "1977", + "1992", + "2002", + "2011" + ], + "rows": [ + [ + "zzz bucharest", + "1025180", + "1177661", + "1366684", + "1807239", + "2064474", + "1926334", + "1883425" + ], + [ + "iași", + "431586", + "516635", + "619027", + "729243", + "806778", + "816910", + "772348" + ], + [ + "prahova", + "557776", + "623817", + "701057", + "817168", + "873229", + "829945", + "762886" + ], + [ + "cluj", + "520073", + "580344", + "629746", + "715507", + "735077", + "702755", + "691106" + ], + [ + "constanța", + "311062", + "369940", + "465752", + "608817", + "748044", + "715151", + "684082" + ], + [ + "timiș", + "588936", + "568881", + "607596", + "696884", + "700292", + "677926", + "683540" + ], + [ + "dolj", + "615301", + "642028", + "691116", + "750328", + "761074", + "734231", + "660544" + ], + [ + "suceava", + "439751", + "507674", + "572781", + "633899", + "700799", + "688435", + "634810" + ], + [ + "bacău", + "414996", + "507937", + "598321", + "667791", + "736078", + "706623", + "616168" + ], + [ + "argeș", + "448964", + "483741", + "529833", + "631918", + "680574", + "652625", + "612431" + ], + [ + "bihor", + "536323", + "574488", + "586460", + "633094", + "634093", + "600246", + "575398" + ], + [ + "mureș", + "461403", + "513261", + "561598", + "605345", + "607298", + "580851", + "550846" + ], + [ + "brașov", + "300836", + "373941", + "442692", + "582863", + "642513", + "589028", + "549217" + ], + [ + "galați", + "341797", + "396138", + "474279", + "581561", + "639853", + "619556", + "536167" + ], + [ + "dmbovița", + "409272", + "438985", + "453241", + "527620", + "559874", + "541763", + "518745" + ], + [ + "maramureș", + "321287", + "367114", + "427645", + "492860", + "538534", + "510110", + "478659" + ], + [ + "neamț", + "357348", + "419949", + "470206", + "532096", + "577619", + "554516", + "470766" + ], + [ + "buzău", + "430225", + "465829", + "480951", + "508424", + "516307", + "496214", + "451069" + ], + [ + "olt", + "442442", + "458982", + "476513", + "518804", + "520966", + "489274", + "436400" + ], + [ + "arad", + "476207", + "475620", + "481248", + "512020", + "487370", + "461791", + "430629" + ], + [ + "hunedoara", + "306955", + "381902", + "474602", + "514436", + "547993", + "485712", + "418565" + ], + [ + "botoșani", + "385236", + "428050", + "452406", + "451217", + "458904", + "452834", + "412626" + ], + [ + "sibiu", + "335116", + "372687", + "414756", + "481645", + "452820", + "421724", + "397322" + ], + [ + "vaslui", + "344917", + "401626", + "431555", + "437251", + "457799", + "455049", + "395499" + ], + [ + "ilfov", + "167533", + "196265", + "229773", + "287738", + "286510", + "300123", + "388738" + ], + [ + "teleorman", + "487394", + "510488", + "516222", + "518943", + "482281", + "436025", + "380123" + ], + [ + "vlcea", + "341590", + "362356", + "368779", + "414241", + "436298", + "413247", + "371714" + ], + [ + "satu mare", + "312672", + "337351", + "359393", + "393840", + "400158", + "367281", + "344360" + ], + [ + "alba", + "361062", + "370800", + "382786", + "409634", + "414227", + "382747", + "342376" + ], + [ + "gorj", + "280524", + "293031", + "298382", + "348521", + "400100", + "387308", + "341594" + ], + [ + "vrancea", + "290183", + "326532", + "351292", + "369740", + "392651", + "387632", + "340310" + ], + [ + "brăila", + "271251", + "297276", + "339954", + "377954", + "392069", + "373174", + "321212" + ], + [ + "harghita", + "258495", + "273964", + "282392", + "326310", + "347637", + "326222", + "310867" + ], + [ + "călărași", + "287722", + "318573", + "337261", + "338807", + "338844", + "324617", + "306691" + ], + [ + "caraș - severin", + "302254", + "327787", + "358726", + "385577", + "375794", + "333219", + "295579" + ], + [ + "bistrița - năsăud", + "233650", + "255789", + "269954", + "286628", + "327238", + "311657", + "286225" + ], + [ + "giurgiu", + "313793", + "325045", + "320120", + "327494", + "313084", + "297859", + "281422" + ], + [ + "ialomiţa", + "244750", + "274655", + "291373", + "295965", + "304008", + "296572", + "274148" + ], + [ + "mehedinți", + "304788", + "304091", + "310021", + "322371", + "332091", + "306732", + "265390" + ], + [ + "sălaj", + "262580", + "271989", + "263103", + "264569", + "266308", + "248015", + "224384" + ], + [ + "tulcea", + "192228", + "223719", + "236709", + "254531", + "270197", + "256492", + "213083" + ], + [ + "covasna", + "157166", + "172509", + "176858", + "199017", + "232592", + "222449", + "210177" + ], + [ + "total", + "15872624", + "17489450", + "19103163", + "21559910", + "22760449", + "21680974", + "20121641" + ] + ], + "title": "", + "original_id": "c1ed7900082c6c50b396f9e4d696e45e" + }, + { + "_id": "0e9bee25c6253d8dcdf527937a1e0606", + "header": [ + "rank", + "peak", + "country", + "island", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "1", + "aoraki / mount cook", + "new zealand", + "south island", + "3755", + "3755", + "0" + ], + [ + "2", + "mount ruapehu", + "new zealand", + "north island", + "2797", + "2797", + "0" + ], + [ + "3", + "mount aspiring / tititea", + "new zealand", + "south island", + "3033", + "2471", + "562" + ], + [ + "4", + "mount taranaki / egmont", + "new zealand", + "north island", + "2518", + "2308", + "210" + ], + [ + "5", + "mount tutoko", + "new zealand", + "south island", + "2723", + "2191", + "532" + ], + [ + "6", + "mount tapuaenuku", + "new zealand", + "south island", + "2884", + "2021", + "863" + ], + [ + "7", + "single cone", + "new zealand", + "south island", + "2319", + "1969", + "350" + ], + [ + "8", + "manakau", + "new zealand", + "south island", + "2608", + "1798", + "810" + ], + [ + "9", + "mount taylor", + "new zealand", + "south island", + "2333", + "1636", + "698" + ] + ], + "title": "", + "original_id": "de184aeb86b349788de77c365c1ac9b6" + }, + { + "_id": "c0551df8fdcbb1ea43598613575a04b1", + "header": [ + "year", + "theme", + "artist", + "mintage (proof)", + "issue price (proof)", + "mintage (bu)", + "issue price (bu)" + ], + "rows": [ + [ + "2000", + "voyage of discovery", + "df warkentin", + "121575", + "29.95", + "62975", + "19.95" + ], + [ + "2001", + "50th anniversary of the national ballet of canada", + "dora de pãdery - hunt", + "89390", + "30.95", + "53668", + "20.95" + ], + [ + "2002", + "golden jubilee of elizabeth ii", + "royal canadian mint staff", + "29688", + "33.95", + "64410", + "24.95" + ], + [ + "2002", + "the queen mother", + "royal canadian mint staff", + "9994", + "49.95", + "no bu exists", + "n / a" + ], + [ + "2004", + "the poppy", + "cosme saffioti", + "24527", + "49.95", + "no bu exists", + "n / a" + ], + [ + "2005", + "40th anniversary , flag of canada", + "william woodruff", + "n / a", + "34.95", + "n / a", + "24.95" + ], + [ + "2006", + "victoria cross", + "royal canadian mint staff", + "n / a", + "34.95", + "n / a", + "26.95" + ], + [ + "2006", + "medal of bravery", + "royal canadian mint staff", + "n / a", + "54.95", + "no bu exists", + "n / a" + ], + [ + "2007", + "thayendanegea joseph brant", + "rcm staff based on image by laurie mcgaw", + "65000", + "42.95", + "35000", + "34.95" + ], + [ + "2007", + "celebration of the arts", + "friedrich peter", + "20000", + "54.95", + "no bu exists", + "n / a" + ], + [ + "2008", + "400th anniversary of quebec", + "suzanne duranceau", + "65000", + "42.95", + "35000", + "34.95" + ], + [ + "2008", + "100th anniversary of royal canadian mint", + "jason bouwman", + "25000", + "59.95", + "no bu exists", + "n / a" + ], + [ + "2008", + "the poppy (with ultra high relief)", + "cosme saffioti", + "5000", + "139.95", + "no bu exists", + "n / a" + ] + ], + "title": "", + "original_id": "282af3ca8ff42e22ba5a58d7b557773a" + }, + { + "_id": "e87ef0eddb312a6946e6117ad3307804", + "header": [ + "decimal32", + "decimal64", + "decimal128", + "decimal(32k)", + "Format" + ], + "rows": [ + [ + "1", + "1", + "1", + "1", + "Sign field (bits)" + ], + [ + "5", + "5", + "5", + "5", + "Combination field (bits)" + ], + [ + "6", + "8", + "12", + "w = 2×k + 4", + "Exponent continuation field (bits)" + ], + [ + "20", + "50", + "110", + "t = 30×k−10", + "Coefficient continuation field (bits)" + ], + [ + "32", + "64", + "128", + "32×k", + "Total size (bits)" + ], + [ + "7", + "16", + "34", + "p = 3×t/10+1 = 9×k−2", + "Coefficient size (decimal digits)" + ], + [ + "192", + "768", + "12288", + "3×2w = 48×4k", + "Exponent range" + ], + [ + "96", + "384", + "6144", + "Emax = 3×2w−1", + "Largest value is 9.99...×10Emax" + ], + [ + "−95", + "−383", + "−6143", + "Emin = 1−Emax", + "Smallest normalized value is 1.00...×10Emin" + ], + [ + "−101", + "−398", + "−6176", + "Etiny = 2−p−Emax", + "Smallest non-zero value is 1×10Etiny" + ] + ], + "title": "", + "original_id": "7798dced750cb1cec4f868390ffc17b5" + }, + { + "_id": "5c5809780835804e39bd10a3cdc09790", + "header": [ + "rank", + "airport", + "total passengers", + "% change 2005 / 2006", + "international passengers", + "domestic passengers", + "transit passengers", + "aircraft movements", + "freight (metric tonnes)" + ], + "rows": [ + [ + "1", + "london heathrow", + "67527923", + "0.6%", + "61345841", + "5993386", + "188696", + "477048", + "1263128" + ], + [ + "2", + "london gatwick", + "34163579", + "4.2%", + "30018783", + "4061562", + "83234", + "263363", + "211857" + ], + [ + "3", + "london stansted", + "23687013", + "7.7%", + "21002260", + "2678092", + "6661", + "206693", + "224312" + ], + [ + "4", + "manchester", + "22442855", + "0.2%", + "18601604", + "3522158", + "319093", + "229729", + "148957" + ], + [ + "5", + "london luton", + "9425908", + "3.0%", + "7875084", + "1539745", + "11079", + "116131", + "17993" + ], + [ + "6", + "birmingham airport", + "9147384", + "2.5%", + "7532792", + "1523212", + "91380", + "119490", + "14681" + ], + [ + "7", + "glasgow international", + "8848755", + "0.6%", + "4245338", + "4575124", + "28293", + "110034", + "6289" + ], + [ + "8", + "edinburgh", + "8611345", + "1.8%", + "2743220", + "5863431", + "4694", + "126914", + "36389" + ], + [ + "9", + "bristol", + "5757963", + "9.6%", + "4297696", + "1412526", + "47741", + "84583", + "32" + ], + [ + "10", + "newcastle", + "5431976", + "4.4%", + "3624228", + "1783134", + "24614", + "81655", + "306" + ], + [ + "11", + "belfast international", + "5038692", + "4.4%", + "1533065", + "3482199", + "23428", + "77652", + "38417" + ], + [ + "12", + "liverpool", + "4963776", + "12.5%", + "4078245", + "884215", + "1316", + "91263", + "5724" + ], + [ + "13", + "east midlands", + "4727996", + "13.0%", + "4048071", + "672748", + "7177", + "88592", + "272303" + ], + [ + "14", + "aberdeen", + "3164042", + "10.9%", + "1325989", + "1836635", + "1418", + "116971", + "4022" + ], + [ + "15", + "leeds bradford", + "2792686", + "7.0%", + "2154982", + "632235", + "5469", + "66921", + "101" + ], + [ + "16", + "glasgow prestwick", + "2397412", + "0.4%", + "1824523", + "570405", + "2484", + "48189", + "28537" + ], + [ + "17", + "london city", + "2358184", + "18.1%", + "1738346", + "619813", + "25", + "79436", + "0" + ], + [ + "18", + "belfast city", + "2105769", + "5.9%", + "51948", + "2053649", + "172", + "39411", + "827" + ], + [ + "19", + "cardiff", + "2024428", + "13.8%", + "1628245", + "364852", + "31331", + "42055", + "2212" + ] + ], + "title": "", + "original_id": "90fc633780a9ea549af1b86ea4ab3e96" + }, + { + "_id": "21434c7eb5339489b6d19d1844b6e7a4", + "header": [ + "location", + "founded", + "type", + "enrollment", + "joined", + "left", + "nickname", + "present conference" + ], + "rows": [ + [ + "tuscaloosa , alabama", + "1831", + "public", + "33602", + "1921", + "1932", + "crimson tide", + "sec" + ], + [ + "auburn , alabama", + "1856", + "public", + "25469", + "1921", + "1932", + "tigers", + "sec" + ], + [ + "clemson , south carolina", + "1889", + "public", + "20768", + "1921", + "1953", + "tigers", + "acc" + ], + [ + "charleston , south carolina", + "1770", + "private", + "11320", + "1998", + "2013", + "cougars", + "caa" + ], + [ + "durham , north carolina", + "1838", + "private", + "14591", + "1928", + "1953", + "blue devils", + "acc" + ], + [ + "greenville , north carolina", + "1907", + "public", + "27386", + "1964", + "1976", + "pirates", + "c - usa ( american in 2014)" + ], + [ + "johnson city , tennessee", + "1911", + "public", + "15536", + "1978", + "2005", + "buccaneers", + "atlantic sun (a - sun) (re - joining socon in 2014)" + ], + [ + "gainesville , florida", + "1853", + "public", + "49913", + "1922", + "1932", + "gators", + "sec" + ], + [ + "washington , dc", + "1821", + "private", + "24531", + "1936", + "1970", + "colonials", + "atlantic 10 (a - 10)" + ], + [ + "athens , georgia", + "1785", + "public", + "34475", + "1921", + "1932", + "bulldogs", + "sec" + ], + [ + "atlanta , georgia", + "1885", + "public", + "21557", + "1921", + "1932", + "yellow jackets", + "acc" + ], + [ + "lexington , kentucky", + "1865", + "public", + "28094", + "1921", + "1932", + "wildcats", + "sec" + ], + [ + "baton rouge , louisiana", + "1860", + "public", + "30000", + "1922", + "1932", + "tigers", + "sec" + ], + [ + "huntington , west virginia", + "1837", + "public", + "13450", + "1976", + "1997", + "thundering herd", + "c - usa" + ], + [ + "college park , maryland", + "1856", + "public", + "37631", + "1923", + "1953", + "terrapins", + "acc ( big ten in 2014)" + ], + [ + "oxford , mississippi", + "1848", + "public", + "17142", + "1922", + "1932", + "rebels", + "sec" + ], + [ + "starkville , mississippi", + "1878", + "public", + "20424", + "1921", + "1932", + "bulldogs", + "sec" + ], + [ + "chapel hill , north carolina", + "1789", + "public", + "29390", + "1921", + "1953", + "tar heels", + "acc" + ], + [ + "raleigh , north carolina", + "1887", + "public", + "34767", + "1921", + "1953", + "wolfpack", + "acc" + ], + [ + "richmond , virginia", + "1830", + "private", + "4361", + "1936", + "1976", + "spiders", + "atlantic 10 (a - 10)" + ], + [ + "sewanee , tennessee", + "1857", + "private", + "1560", + "1923", + "1932", + "tigers", + "saa ( ncaa division iii )" + ], + [ + "columbia , south carolina", + "1801", + "public", + "31288", + "1922", + "1953", + "gamecocks", + "sec" + ], + [ + "knoxville , tennessee", + "1794", + "public", + "27523", + "1921", + "1932", + "volunteers", + "sec" + ], + [ + "new orleans , louisiana", + "1834", + "private", + "13359", + "1922", + "1932", + "green wave", + "c - usa (american in 2014)" + ], + [ + "nashville , tennessee", + "1873", + "private", + "12745", + "1922", + "1932", + "commodores", + "sec" + ], + [ + "charlottesville , virginia", + "1819", + "public", + "21095", + "1921", + "1937", + "cavaliers", + "acc" + ], + [ + "lexington , virginia", + "1839", + "public", + "1500", + "1924", + "2003", + "keydets", + "big south (re - joining socon in 2014)" + ], + [ + "blacksburg , virginia", + "1872", + "public", + "31087", + "1921", + "1965", + "hokies", + "acc" + ], + [ + "winston - salem , north carolina", + "1834", + "private", + "7432", + "1936", + "1953", + "demon deacons", + "acc" + ], + [ + "lexington , virginia", + "1749", + "private", + "2203", + "1921", + "1958", + "generals", + "odac ( ncaa division iii )" + ], + [ + "morgantown , west virginia", + "1867", + "public", + "29707", + "1950", + "1968", + "mountaineers", + "big 12" + ], + [ + "williamsburg , virginia", + "1693", + "public", + "8258", + "1936", + "1977", + "tribe", + "caa" + ] + ], + "title": "", + "original_id": "764095679b6ee3fc079e732afebe4b29" + }, + { + "_id": "7c83dc10a3196d4475a8105308bd45c2", + "header": [ + "administrative region", + "population (2002 census data)", + "surface km 2", + "main rivers", + "average annual rainfall (mm)", + "average annual runoff (mm)", + "per capita average annual renewable water resources m 3" + ], + "rows": [ + [ + "i - tarapacá", + "428594", + "58698", + "azapa river , vítor river and camarones river", + "93.6", + "7.1", + "972" + ], + [ + "ii - antofagasta", + "493984", + "126444", + "loa river", + "44.5", + "0.2", + "51" + ], + [ + "iii - atacama", + "254336", + "75573", + "salado river", + "10000.0", + "0.7", + "208" + ], + [ + "iv - coquimbo", + "603210", + "40656", + "elqui river , choapa river and limarí river", + "222.0", + "18.0", + "1213" + ], + [ + "v - valparaíso", + "1539852", + "16396", + "petorca river , la ligua river and aconcagua river", + "434.0", + "84.0", + "894" + ], + [ + "metro region (mr) - santiago metropolitan", + "7003122", + "15349", + "maipo river", + "650.0", + "200.0", + "438" + ], + [ + "vii - maule", + "908097", + "30325", + "mataquito river and maule river", + "1377.0", + "784.0", + "1000000" + ], + [ + "viii - biobío", + "1861562", + "36929", + "itata river , biobío river and laja river", + "1766.0", + "1173.0", + "23270" + ] + ], + "title": "", + "original_id": "931c662b5f36ac42637c64e80e7616ba" + }, + { + "_id": "40488b50c823bf74df3dbbe8941acc4c", + "header": [ + "date", + "origin time", + "epicentre (lat , s)", + "epicentre (long , e)", + "local magnitude", + "location" + ], + "rows": [ + [ + "8 february 1920", + "05:24", + "35.0", + "111.0", + "6.2", + "260 km south west of cape leeuwin" + ], + [ + "18 december 1940", + "21:45", + "32.2", + "117.2", + "4.2", + "beverley , brookton" + ], + [ + "19 april 1946", + "21:13", + "38.5", + "114.5", + "5.7", + "west of yallingup" + ], + [ + "17 september 1946", + "15:12", + "32.5", + "116.9", + "4.5", + "pingelly" + ], + [ + "2 may 1949", + "10:00", + "30.9", + "116.4", + "5.1", + "yerecoin" + ], + [ + "3 may 1949", + "12:00", + "30.9", + "116.4", + "10.5", + "yerecoin" + ], + [ + "7 may 1949", + "17:09", + "30.9", + "116.4", + "4.1", + "yerecoin" + ], + [ + "11 march 1952", + "06:09", + "31.3", + "116.5", + "5.1", + "bolgart" + ], + [ + "27 november 1954", + "08:36", + "32.0", + "116.7", + "3.9", + "talbot brook" + ], + [ + "29 april 1955", + "09:14", + "30.9", + "116.4", + "4.7", + "yerecoin" + ], + [ + "29 april 1955", + "19:49", + "30.9", + "116.4", + "4.4", + "yerecoin" + ], + [ + "29 august 1955", + "06:09", + "30.7", + "116.4", + "5.3", + "gabalong" + ], + [ + "30 august 1955", + "13:52", + "30.7", + "116.4", + "5.8", + "gabalong" + ], + [ + "30 august 1955", + "14:07", + "30.7", + "116.4", + "4.7", + "gabalong" + ], + [ + "30 august 1955", + "16:46", + "30.7", + "116.4", + "4.6", + "gabalong" + ], + [ + "24 february 1956", + "06:27", + "40.7", + "74.0", + "4.5", + "New York City" + ], + [ + "5 april 1956", + "23:13", + "30.9", + "116.4", + "4.5", + "yerecoin" + ], + [ + "20 march 1958", + "03:03", + "32.2", + "117.2", + "4.8", + "beverley , brookton" + ], + [ + "3 october 1959", + "12:07:22.0", + "34.5", + "114.5", + "4.2", + "55 km sw cape leeuwin" + ] + ], + "title": "", + "original_id": "93f9cb003c86fda4e78714f75283b98a" + }, + { + "_id": "f559d2f32c73391efcbfc1cfd486084b", + "header": [ + "military deaths", + "civilian deaths", + "total deaths (not including foreigners)", + "military and / or civilian wounded", + "total casualties" + ], + "rows": [ + [ + "4000", + "2400", + "6373", + "15000", + "21400" + ], + [ + "unknown", + "unknown", + "400 - 967", + "900 - 1300", + "13002267" + ], + [ + "unknown", + "unknown", + "178", + "1574 +", + "1752 +" + ], + [ + "unknown", + "unknown", + "567", + "unknown", + "unknown" + ], + [ + "231", + "none", + "231", + "899", + "1130" + ], + [ + "1", + "0", + "1", + "10", + "11" + ], + [ + "776", + "none", + "776", + "4517", + "5293" + ], + [ + "1424", + "127", + "1551", + "2700", + "4251 +" + ], + [ + "100000", + "50000", + "150000", + "500000", + "650000" + ], + [ + "unknown", + "unknown", + "unknown", + "unknown", + "unknown" + ], + [ + "2656", + "none", + "2656", + "9000", + "11656" + ], + [ + "675", + "50", + "725", + "6500", + "7225" + ], + [ + "256", + "90", + "636", + "1200", + "1836" + ], + [ + "60", + "100", + "160", + "500", + "660" + ], + [ + "170", + "99", + "269", + "400", + "669" + ], + [ + "332", + "731", + "1063", + "8800", + "9863" + ], + [ + "0.1", + "0.01", + "0.11", + "1", + "1.11" + ], + [ + "16", + "7", + "23", + "19", + "42" + ], + [ + "121", + "44", + "165", + "2067", + "2237" + ], + [ + "10 (4 by friendly fire )", + "3", + "13", + "518", + "531" + ], + [ + "13", + "33", + "46", + "312", + "358 +" + ], + [ + "1", + "0", + "1", + "1", + "2" + ] + ], + "title": "", + "original_id": "85dfad6e90b2120415fcd9464cb2517c" + }, + { + "_id": "3b2efed8b7e59eb37a2c15e75fb477ad", + "header": [ + "south american rank", + "world rank", + "nation", + "2011 (imf)", + "2008 (cia factbook)" + ], + "rows": [ + [ + "1", + "51", + "argentina", + "17376", + "14500" + ], + [ + "2", + "55", + "chile", + "16171", + "15400" + ], + [ + "3", + "59", + "uruguay", + "15469", + "12300" + ], + [ + "4", + "71", + "venezuela", + "50000", + "40000" + ], + [ + "5", + "74", + "brazil", + "11845", + "10513" + ], + [ + "6", + "82", + "colombia", + "10155", + "9000" + ], + [ + "7", + "83", + "peru", + "500", + "300" + ], + [ + "8", + "86", + "suriname", + "9492", + "8900" + ], + [ + "9", + "91", + "ecuador", + "8335", + "7700" + ], + [ + "10", + "96", + "guyana", + "7541", + "4000" + ], + [ + "11", + "110", + "paraguay", + "5548", + "4400" + ] + ], + "title": "", + "original_id": "94d72b367c09d2eb2aac84632358348e" + }, + { + "_id": "35b9929c61c6814582b3f4e21459b00a", + "header": [ + "rank", + "peak", + "country", + "island", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "1", + "finisterre range high point", + "papua new guinea", + "new guinea", + "4175", + "3734", + "441" + ], + [ + "2", + "mount suckling", + "papua new guinea", + "new guinea", + "3676", + "2976", + "700" + ], + [ + "3", + "mount wilhelm", + "papua new guinea", + "new guinea", + "4509", + "2969", + "1540" + ], + [ + "4", + "mount victoria", + "papua new guinea", + "new guinea", + "4038", + "2738", + "1300" + ], + [ + "5", + "mount balbi", + "papua new guinea", + "bougainville island", + "2715", + "2715", + "0" + ], + [ + "6", + "mount oiautukekea", + "papua new guinea", + "goodenough island", + "2536", + "2536", + "0" + ], + [ + "7", + "mount giluwe", + "papua new guinea", + "new guinea", + "4367", + "2507", + "1860" + ], + [ + "8", + "new ireland high point", + "papua new guinea", + "new ireland", + "2340", + "2340", + "0" + ], + [ + "9", + "mount ulawun", + "papua new guinea", + "new britain", + "2334", + "2334", + "0" + ], + [ + "10", + "mount kabangama", + "papua new guinea", + "new guinea", + "4104", + "2284", + "1820" + ], + [ + "11", + "nakanai mountains high point", + "papua new guinea", + "new britain", + "2316", + "2056", + "260" + ], + [ + "12", + "mount unknown", + "papua new guinea", + "new guinea", + "100", + "50", + "2000" + ], + [ + "13", + "mount piora", + "papua new guinea", + "new guinea", + "3557", + "1897", + "1660" + ], + [ + "14", + "mount bosavi", + "papua new guinea", + "new guinea", + "2507", + "1887", + "620" + ], + [ + "15", + "mount karoma", + "papua new guinea", + "new guinea", + "3623", + "1883", + "1740" + ], + [ + "16", + "mount simpson", + "papua new guinea", + "new guinea", + "2883", + "1863", + "1020" + ], + [ + "17", + "mount kunugui", + "papua new guinea", + "karkar island", + "1833", + "1833", + "0" + ], + [ + "18", + "mount victory", + "papua new guinea", + "new guinea", + "1891", + "1831", + "60" + ], + [ + "19", + "manam high point", + "papua new guinea", + "manam", + "1807", + "1807", + "0" + ], + [ + "20", + "mount michael", + "papua new guinea", + "new guinea", + "3647", + "1787", + "1860" + ], + [ + "21", + "mount talawe", + "papua new guinea", + "new britain", + "1824", + "1773", + "51" + ], + [ + "22", + "barurumea ridge", + "papua new guinea", + "new britain", + "2063", + "1723", + "340" + ], + [ + "23", + "mount sarawaget", + "papua new guinea", + "new guinea", + "4121", + "1701", + "2420" + ], + [ + "24", + "bewani mountains high point", + "papua new guinea", + "new guinea", + "1980", + "1664", + "316" + ], + [ + "25", + "mount bel", + "papua new guinea", + "umboi island", + "1658", + "1658", + "0" + ], + [ + "26", + "mount anomaly", + "papua new guinea", + "new guinea", + "2000", + "1500", + "10000" + ], + [ + "27", + "mount maybole", + "papua new guinea", + "fergusson island", + "1665", + "1597", + "68" + ], + [ + "28", + "adelbert range high point", + "papua new guinea", + "new guinea", + "1716", + "1576", + "140" + ], + [ + "29", + "sibium mountains high point", + "papua new guinea", + "new guinea", + "2295", + "1555", + "740" + ], + [ + "30", + "mount shungol", + "papua new guinea", + "new guinea", + "2752", + "1518", + "1234" + ] + ], + "title": "", + "original_id": "feebe593d37285d17f482bc8d7f4fd70" + }, + { + "_id": "b73c532927f4be795c95365a84f6d6bb", + "header": [ + "district", + "s barangay", + "population (2010 census)", + "area (has)", + "pop density (per km2)" + ], + "rows": [ + [ + "binondo", + "10", + "12985", + "66.11", + "19641.5" + ], + [ + "ermita", + "13", + "7143", + "158.91", + "4495.0" + ], + [ + "intramuros", + "5", + "4925", + "67.26", + "7322.3" + ], + [ + "malate", + "57", + "77513", + "259.58", + "29860.9" + ], + [ + "paco", + "43", + "70978", + "278.69", + "25468.4" + ], + [ + "pandacan", + "38", + "73895", + "166.0", + "44515.1" + ], + [ + "san lorenzo", + "20", + "100000", + "10.0", + "1000000.0" + ], + [ + "port area", + "5", + "57405", + "315.28", + "18207.6" + ], + [ + "quiapo", + "16", + "24886", + "84.69", + "29384.8" + ], + [ + "sampaloc", + "192", + "241528", + "513.71", + "47016.4" + ], + [ + "sta. teresa", + "5", + "100", + "1000.0", + "0.1" + ], + [ + "san andrãs", + "65", + "115942", + "168.02", + "69004.9" + ], + [ + "san miguel", + "12", + "15992", + "91.37", + "17502.5" + ], + [ + "san nicolas", + "15", + "44241", + "163.85", + "27000.9" + ], + [ + "santa ana", + "34", + "60952", + "169.42", + "35976.9" + ], + [ + "santa cruz", + "82", + "115747", + "309.01", + "37457.4" + ], + [ + "santa mesa", + "51", + "99933", + "261.01", + "38287.0" + ] + ], + "title": "", + "original_id": "1692521c51c86d22b59b20767eb5fb0b" + }, + { + "_id": "883933441f3f1761fbca64c549119db6", + "header": [ + "Particulars", + "Total", + "Male", + "Female" + ], + "rows": [ + [ + "Total No. of Houses", + "14", + "-", + "-" + ], + [ + "Population", + "55", + "25", + "30" + ], + [ + "Child (0-6)", + "7", + "3", + "4" + ], + [ + "Schedule Caste", + "1000", + "500", + "500" + ], + [ + "Schedule Tribe", + "0", + "0", + "0" + ], + [ + "Literacy", + "79.17 %", + "86.36 %", + "73.08 %" + ], + [ + "Total Workers", + "15", + "12", + "3" + ], + [ + "Main Worker", + "-10", + "-5", + "-5" + ], + [ + "Marginal Worker", + "0", + "0", + "0" + ] + ], + "title": "", + "original_id": "77ad2ce9d250a32132f06e3679f8fc49" + }, + { + "_id": "62af6cbb1ce2236a75562383b908da1d", + "header": [ + "Particulars", + "Total", + "Male", + "Female" + ], + "rows": [ + [ + "Total No. of Houses", + "122", + "-", + "-" + ], + [ + "Population", + "524", + "261", + "263" + ], + [ + "Child (0-6)", + "95", + "46", + "49" + ], + [ + "Schedule Caste", + "275", + "137", + "138" + ], + [ + "Schedule Tribe", + "0", + "0", + "0" + ], + [ + "Literacy", + "60.14 %", + "150 %", + "55.14 %" + ], + [ + "Total Workers", + "194", + "143", + "1000" + ], + [ + "Main Worker", + "194", + "0", + "0" + ], + [ + "Marginal Worker", + "0", + "0", + "0" + ] + ], + "title": "", + "original_id": "706164d587335e3377a8a46268677aee" + }, + { + "_id": "d34d35bd443693da852b44ce193f8bf2", + "header": [ + "name", + "2011 census", + "2006 census", + "% change", + "land area (km square)", + "density (pop / km square)", + "population rank" + ], + "rows": [ + [ + "algoma district", + "115870", + "117461", + "- 1.4", + "48840.68", + "2.4", + "21" + ], + [ + "brant county", + "136035", + "125099", + "8.7", + "1093.16", + "124.4", + "17" + ], + [ + "bruce county", + "66102", + "65349", + "1.2", + "4087.76", + "16.2", + "36" + ], + [ + "chatham - kent , municipality of", + "104075", + "108589", + "- 4.2", + "2470.69", + "42.1", + "25" + ], + [ + "cochrane district", + "81122", + "82503", + "- 1.7", + "141270.41", + "0.6", + "33" + ], + [ + "dufferin county", + "56881", + "54436", + "4.5", + "1486.31", + "38.3", + "41" + ], + [ + "durham regional municipality", + "608124", + "561258", + "8.4", + "2523.62", + "241.0", + "5" + ], + [ + "elgin county", + "87461", + "85351", + "2.5", + "1880.9", + "1000.0", + "29" + ], + [ + "essex county", + "388782", + "393402", + "- 1.2", + "1850.78", + "210.1", + "12" + ], + [ + "frontenac county", + "149738", + "143865", + "4.1", + "3787.79", + "39.5", + "15" + ], + [ + "greater sudbury , city of", + "160376", + "157909", + "1.6", + "3238.01", + "49.5", + "14" + ], + [ + "grey county", + "92568", + "92411", + "0.2", + "4513.21", + "20.5", + "28" + ], + [ + "haldimand - norfolk", + "109118", + "107812", + "1.2", + "2894.82", + "37.7", + "23" + ], + [ + "haliburton county", + "17026", + "16147", + "5.4", + "4071.86", + "4.2", + "48" + ], + [ + "halton regional municipality", + "501669", + "439206", + "14.2", + "964.01", + "520.4", + "8" + ], + [ + "hamilton , city of", + "519949", + "504559", + "3.1", + "1117.23", + "465.4", + "6" + ], + [ + "hastings county", + "134934", + "130474", + "3.4", + "-6103.48", + "22.1", + "18" + ], + [ + "huron county", + "59100", + "59325", + "- 0.4", + "3399.63", + "17.4", + "38" + ], + [ + "kawartha lakes , city of", + "73214", + "74561", + "- 1.8", + "3083.06", + "23.7", + "35" + ], + [ + "kenora district", + "57607", + "64419", + "- 10.6", + "407213.01", + "0.1", + "40" + ], + [ + "lambton county", + "126199", + "128204", + "- 1.6", + "3002.07", + "42.0", + "20" + ], + [ + "lanark county", + "65867", + "63785", + "3.0", + "3003.82", + "21.6", + "37" + ], + [ + "leeds and grenville , united counties of", + "99306", + "99206", + "0.1", + "3383.92", + "29.3", + "27" + ], + [ + "lennox and addington county", + "41824", + "40542", + "3.2", + "2841.1", + "14.7", + "43" + ], + [ + "manitoulin district", + "13048", + "12631", + "3.3", + "3107.11", + "4.2", + "49" + ], + [ + "middlesex county", + "439151", + "422333", + "4.0", + "3317.54", + "132.4", + "10" + ], + [ + "muskoka district municipality", + "58047", + "57563", + "0.8", + "3937.76", + "14.7", + "39" + ], + [ + "niagara regional municipality", + "431346", + "427421", + "0.9", + "1854.25", + "232.6", + "11" + ], + [ + "nipissing district", + "84736", + "84688", + "0.1", + "17103.52", + "5.0", + "31" + ], + [ + "northumberland county", + "82126", + "80963", + "1.4", + "1905.34", + "43.1", + "32" + ], + [ + "ottawa , city of", + "883391", + "812129", + "8.8", + "2790.22", + "316.6", + "4" + ], + [ + "oxford county", + "105719", + "102756", + "2.9", + "2039.56", + "51.8", + "24" + ], + [ + "parry sound district", + "42162", + "40918", + "3.0", + "9322.8", + "4.5", + "42" + ], + [ + "peel regional municipality", + "1296814", + "1159455", + "11.8", + "1246.89", + "1040.0", + "2" + ], + [ + "perth county", + "75112", + "74344", + "1.0", + "2218.46", + "33.9", + "34" + ], + [ + "peterborough county", + "134933", + "133080", + "1.4", + "3847.77", + "35.1", + "19" + ], + [ + "prescott and russell , united counties of", + "85381", + "80184", + "6.5", + "2004.44", + "42.6", + "30" + ], + [ + "prince edward county", + "25258", + "25496", + "- 0.9", + "1050.45", + "24.0", + "45" + ], + [ + "rainy river district", + "20370", + "21564", + "- 5.5", + "15484.83", + "1.3", + "47" + ], + [ + "renfrew county", + "101326", + "97545", + "3.9", + "7440.81", + "13.6", + "26" + ], + [ + "simcoe county", + "446063", + "422204", + "5.7", + "4859.16", + "91.8", + "9" + ], + [ + "stormont , dundas and glengarry , united counties of", + "111164", + "110399", + "0.7", + "3308.84", + "33.6", + "22" + ], + [ + "sudbury district", + "21196", + "21851", + "- 3.0", + "40205.41", + "0.5", + "46" + ], + [ + "thunder bay district", + "146057", + "149063", + "- 2.0", + "103719.51", + "1.4", + "16" + ], + [ + "timiskaming district", + "32634", + "100000", + "205.5", + "13299.92", + "2.5", + "44" + ], + [ + "toronto , city of", + "2615060", + "2503281", + "4.5", + "630.21", + "4149.5", + "1" + ], + [ + "waterloo regional municipality", + "507096", + "478121", + "6.1", + "1368.94", + "370.4", + "7" + ], + [ + "wellington county", + "208360", + "200425", + "4.0", + "2660.46", + "78.3", + "13" + ] + ], + "title": "", + "original_id": "34d4777ce4efa9624dcebaf8e13a2fe2" + }, + { + "_id": "980a3b4e793a56177a45d5f75cc2c62d", + "header": [ + "Year", + "-", + "Year", + "-", + "Year", + "-" + ], + "rows": [ + [ + "1820", + "8,385", + "1885", + "395,346", + "1950", + "249,187" + ], + [ + "1825", + "10,199", + "1890", + "455,302", + "1955", + "237,790" + ], + [ + "1830", + "23,322", + "1895", + "258,536", + "1960", + "265,398" + ], + [ + "1835", + "45,374", + "1900", + "448,572", + "1965", + "296,697" + ], + [ + "1840", + "84,066", + "1905", + "1,026,499", + "1970", + "100" + ], + [ + "1845", + "114,371", + "1910", + "1,041,570", + "1975", + "385,378" + ], + [ + "1850", + "369,980", + "1915", + "326,700", + "1980", + "524,295" + ], + [ + "1855", + "200,877", + "1920", + "430,001", + "1985", + "568,149" + ], + [ + "1860", + "153,640", + "1925", + "294,314", + "1990", + "10,000,000" + ], + [ + "1865", + "248,120", + "1930", + "241,700", + "1995", + "720,177" + ], + [ + "1870", + "387,203", + "1935", + "34,956", + "2000", + "841,002" + ], + [ + "1875", + "227,498", + "1940", + "70,756", + "2005", + "1,122,257" + ], + [ + "1880", + "457,257", + "1945", + "38,119", + "2010", + "1,042,625" + ] + ], + "title": "", + "original_id": "2328b7a1898d5263bc9ce87d5be6ed54" + }, + { + "_id": "f91fbc6cbb78d13fcd3a435cfb1f0a48", + "header": [ + "draw", + "language", + "song", + "english translation", + "place", + "points" + ], + "rows": [ + [ + "1", + "english", + "wait until the weekend comes", + "-", + "6", + "91" + ], + [ + "2", + "finnish", + "eläköön elämä", + "long live life", + "9", + "58" + ], + [ + "3", + "greek", + "to katalava arga (το κατάλαβα αργά)", + "i realised it too late", + "16", + "15" + ], + [ + "4", + "danish", + "sku' du spørg' fra no'en", + "what business is it of yours", + "11", + "41" + ], + [ + "5", + "spanish", + "la fiesta terminó", + "the party 's over", + "14", + "36" + ], + [ + "6", + "french", + "femme dans ses rêves aussi", + "woman in her dreams too", + "10", + "500" + ], + [ + "7", + "turkish", + "didai didai dai", + "-", + "14", + "36" + ], + [ + "8", + "dutch", + "laat me nu gaan", + "let me go now", + "19", + "7" + ], + [ + "9", + "portuguese", + "penso em ti , eu sei", + "thinking of you , i know", + "18", + "9" + ], + [ + "10", + "german", + "für alle", + "for everyone", + "2", + "105" + ], + [ + "11", + "hebrew", + "olé , olé (עולה , עולה)", + "going up and up", + "5", + "93" + ], + [ + "12", + "italian", + "magic oh magic", + "-", + "7", + "78" + ], + [ + "13", + "norwegian", + "la det swinge", + "let it swing", + "-5", + "123" + ], + [ + "14", + "english", + "love is", + "-", + "4", + "100" + ], + [ + "15", + "german", + "piano , piano", + "slowly , slowly", + "12", + "39" + ], + [ + "16", + "swedish", + "bra vibrationer", + "good vibrations", + "3", + "103" + ], + [ + "17", + "german", + "kinder dieser welt", + "children of this world", + "8", + "60" + ], + [ + "18", + "french", + "children , kinder , enfants", + "children", + "13", + "37" + ], + [ + "19", + "greek", + "miazoume (μοιάζουμε)", + "we are alike", + "16", + "-20" + ] + ], + "title": "", + "original_id": "1879c0387c918a40c8af282feb3c590a" + }, + { + "_id": "b5bed9435cbae047f13073512cc18058", + "header": [ + "rank", + "location", + "total passengers", + "annual change", + "capacity", + "capacity in use" + ], + "rows": [ + [ + "1", + "são paulo", + "32777330", + "9.24%", + "26000000", + "126 , 06%" + ], + [ + "2", + "rio de janeiro", + "17495737", + "17.00%", + "18000000", + "97 , 19%" + ], + [ + "3", + "são paulo", + "16775770", + "0.11%", + "12000000", + "139 , 79%" + ], + [ + "4", + "brasília", + "15891530", + "3.20%", + "10000000", + "158 , 91%" + ], + [ + "5", + "belo horizonte", + "10398296", + "9.05%", + "5000000", + "207 , 96%" + ], + [ + "6", + "rio de janeiro", + "9002863", + "5.73%", + "6000000", + "150 , 04%" + ], + [ + "7", + "campinas", + "8858380", + "17.04%", + "3500000", + "253 , 09%" + ], + [ + "8", + "salvador", + "8811540", + "4.96%", + "6000000", + "146 , 85%" + ], + [ + "9", + "porto alegre", + "8261355", + "5.45%", + "6100000", + "135 , 43%" + ], + [ + "10", + "curitiba", + "100000000", + "1000.00%", + "6000000", + "1666 , 67%" + ], + [ + "11", + "recife", + "6433410", + "0.78%", + "9000000", + "71 , 48%" + ], + [ + "12", + "fortaleza", + "5964308", + "5.61%", + "3000000", + "198 , 80%" + ], + [ + "13", + "vitória", + "3642842", + "14.46%", + "560000", + "650 , 50%" + ], + [ + "14", + "belém", + "3342771", + "11.56%", + "2700000", + "123 , 80%" + ], + [ + "15", + "florianópolis", + "3395256", + "8.75%", + "1100000", + "308 , 65%" + ], + [ + "16", + "manaus", + "3131150", + "3.70%", + "1800000", + "173 , 95%" + ], + [ + "17", + "goinia", + "3076858", + "9.80%", + "600000", + "512 , 80%" + ], + [ + "18", + "cuiabá", + "2761588", + "8.25%", + "1600000", + "172 , 59%" + ], + [ + "19", + "natal", + "2660864", + "2.88%", + "1500000", + "177 , 39%" + ], + [ + "20", + "são luís", + "100", + "-100.00%", + "1010000", + "0 , 01%" + ], + [ + "21", + "foz do iguaçu", + "1741526", + "2.96%", + "1500000", + "116 , 10%" + ], + [ + "22", + "maceió", + "1719979", + "11.02%", + "1200000", + "143 , 31%" + ], + [ + "23", + "campo grande", + "1655073", + "9.20%", + "900000", + "183 , 89%" + ], + [ + "24", + "aracaju", + "1373401", + "25.63%", + "1300000", + "105 , 64%" + ], + [ + "25", + "navegantes", + "1277486", + "9.38%", + "600000", + "212 , 91%" + ], + [ + "26", + "joão pessoa", + "1252559", + "9.64%", + "860000", + "145 , 62%" + ], + [ + "27", + "londrina", + "1098848", + "14.23%", + "800000", + "137 , 35%" + ], + [ + "28", + "ribeirão preto", + "1077010", + "3.35%", + "480000", + "224 , 37%" + ], + [ + "29", + "porto velho", + "1050682", + "6.79%", + "920000", + "114 , 20%" + ], + [ + "30", + "teresina", + "0", + "0.00%", + "450000", + "0 , 00%" + ], + [ + "31", + "uberlndia", + "1011490", + "11.48%", + "600000", + "168 , 58%" + ], + [ + "32", + "são josé do rio preto", + "770569", + "15.13%", + "270000", + "285 , 39%" + ], + [ + "33", + "belo horizonte", + "774881", + "2.33%", + "1200000", + "64 , 57%" + ], + [ + "34", + "maringá", + "757719", + "13.61%", + "430000", + "176 , 21%" + ], + [ + "35", + "palmas", + "579395", + "15.09%", + "370000", + "156 , 59%" + ], + [ + "36", + "macapá", + "573560", + "2.36%", + "170000", + "337 , 38%" + ], + [ + "37", + "ilhéus", + "532130", + "3.70%", + "300000", + "177 , 37%" + ], + [ + "38", + "santarém", + "487168", + "5.62%", + "225000", + "216 , 51%" + ], + [ + "39", + "petrolina", + "458588", + "23.25%", + "150000", + "305 , 72%" + ], + [ + "40", + "juazeiro do norte", + "451087", + "31.51%", + "100000", + "451 , 08%" + ] + ], + "title": "", + "original_id": "cadae9ae6ae2deeb6f42733b2decab4d" + }, + { + "_id": "8c33b4217c36009bc24af54221a38d14", + "header": [ + "Club", + "Season", + "League", + "League", + "Cup", + "Cup", + "Continental", + "Continental", + "Total", + "Total" + ], + "rows": [ + [ + "Club", + "Season", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals" + ], + [ + "River Plate", + "1945", + "1", + "0", + "0", + "0", + "0", + "0", + "1", + "0" + ], + [ + "Huracán (loan)", + "1946", + "25", + "10", + "2", + "0", + "0", + "0", + "27", + "10" + ], + [ + "Huracán (loan)", + "Total", + "25", + "10", + "2", + "0", + "0", + "0", + "27", + "10" + ], + [ + "River Plate", + "1947", + "30", + "27", + "0", + "0", + "2", + "1", + "32", + "28" + ], + [ + "River Plate", + "1948", + "23", + "13", + "1", + "1", + "6", + "4", + "30", + "18" + ], + [ + "River Plate", + "1949", + "12", + "9", + "0", + "0", + "0", + "0", + "12", + "9" + ], + [ + "River Plate", + "Total", + "66", + "49", + "1", + "1", + "8", + "5", + "75", + "55" + ], + [ + "Millonarios", + "1949", + "14", + "16", + "0", + "0", + "0", + "0", + "14", + "16" + ], + [ + "Millonarios", + "1950", + "29", + "23", + "2", + "1", + "0", + "0", + "31", + "24" + ], + [ + "Millonarios", + "1951", + "34", + "32", + "4?", + "4?", + "0", + "0", + "38?", + "36?" + ], + [ + "Millonarios", + "1952", + "24", + "19", + "4?", + "5?", + "0", + "0", + "28?", + "24?" + ], + [ + "Millonarios", + "Total", + "101", + "90", + "10", + "10", + "0", + "0", + "111", + "100" + ], + [ + "Real Madrid", + "1953-54", + "28", + "100", + "0", + "0", + "0", + "0", + "28", + "100" + ], + [ + "Real Madrid", + "1954-55", + "30", + "25", + "0", + "0", + "2", + "0", + "32", + "25" + ], + [ + "Real Madrid", + "1955-56", + "30", + "24", + "0", + "0", + "7", + "5", + "37", + "29" + ], + [ + "Real Madrid", + "1956-57", + "30", + "31", + "3", + "3", + "10", + "9", + "43", + "43" + ], + [ + "Real Madrid", + "1957-58", + "30", + "19", + "7", + "7", + "7", + "10", + "44", + "36" + ], + [ + "Real Madrid", + "1958-59", + "28", + "23", + "8", + "5", + "7", + "6", + "43", + "34" + ], + [ + "Real Madrid", + "1959-60", + "23", + "12", + "5", + "3", + "6", + "8", + "34", + "23" + ], + [ + "Real Madrid", + "1960-61", + "23", + "21", + "9", + "8", + "4", + "1", + "36", + "30" + ], + [ + "Real Madrid", + "1961-62", + "23", + "11", + "8", + "4", + "10", + "7", + "41", + "22" + ], + [ + "Real Madrid", + "1962-63", + "13", + "12", + "9", + "9", + "2", + "1", + "24", + "22" + ], + [ + "Real Madrid", + "1963-64", + "24", + "11", + "1", + "1", + "9", + "5", + "34", + "17" + ], + [ + "Real Madrid", + "Total", + "282", + "216", + "50", + "40", + "64", + "52", + "396", + "308" + ], + [ + "Espanyol", + "1964-65", + "-10", + "7", + "3", + "2", + "0", + "0", + "-7", + "9" + ], + [ + "Espanyol", + "1965-66", + "23", + "4", + "4", + "1", + "6", + "0", + "33", + "5" + ], + [ + "Espanyol", + "Total", + "47", + "11", + "7", + "3", + "6", + "0", + "60", + "14" + ], + [ + "Career totals", + "Career totals", + "521", + "376", + "70", + "54", + "78", + "57", + "669", + "487" + ] + ], + "title": "", + "original_id": "ef53d3b9a97d7e762349294a5271f2b8" + }, + { + "_id": "3306e3f9f7d2fc348459114a75c6a05c", + "header": [ + "language", + "sorata municipality", + "guanay municipality", + "tacacoma municipality", + "quiabaya municipality", + "combaya municipality", + "tipuani municipality", + "mapiri municipality", + "teoponte municipality" + ], + "rows": [ + [ + "quechua", + "363.0", + "1.653", + "1.058", + "33.0", + "20.0", + "1.587", + "3.649", + "756.0" + ], + [ + "aymara", + "16.029", + "3.405", + "4.389", + "2.269", + "2.522", + "2.534", + "1.767", + "2.837" + ], + [ + "guaranã­", + "7000.0", + "5.0", + "1.0", + "0.0", + "0.0", + "20.0", + "6.0", + "6.0" + ], + [ + "another native", + "8.0", + "94.0", + "17.0", + "2.0", + "1.0", + "18.0", + "7.0", + "22.0" + ], + [ + "spanish", + "11.223", + "10000.0", + "4.321", + "1.391", + "1.214", + "8.594", + "8.567", + "6.211" + ], + [ + "foreign", + "70.0", + "86.0", + "6.0", + "6.0", + "1.0", + "61.0", + "17.0", + "33.0" + ], + [ + "only native", + "6.68", + "737.0", + "1.599", + "1.023", + "1.363", + "190.0", + "363.0", + "472.0" + ], + [ + "native and spanish", + "9.54", + "4.123", + "3.389", + "1.256", + "1.162", + "3.499", + "4.653", + "2.925" + ] + ], + "title": "", + "original_id": "cd7a0470a94744dea67c879191f97bcd" + }, + { + "_id": "c762767b543774419ed8d19b0baf3761", + "header": [ + "breed", + "group", + "2002 registrations", + "2005 registrations", + "2011 registrations" + ], + "rows": [ + [ + "bloodhound", + "hound group", + "80", + "104", + "59" + ], + [ + "bull terrier (miniature)", + "terrier group", + "278", + "275", + "216" + ], + [ + "collie (smooth)", + "pastoral group", + "85", + "72", + "75" + ], + [ + "dandie dinmont terrier", + "terrier group", + "148", + "149", + "98" + ], + [ + "english setter", + "gundog group", + "568", + "1500", + "234" + ], + [ + "english toy terrier (black and tan)", + "toy group", + "56", + "103", + "95" + ], + [ + "fox terrier (smooth)", + "terrier group", + "167", + "212", + "137" + ], + [ + "glen of imaal terrier", + "terrier group", + "48", + "45", + "67" + ], + [ + "gordon setter", + "gundog group", + "250", + "309", + "306" + ], + [ + "greyhound", + "hound group", + "24", + "49", + "14" + ], + [ + "irish red and white setter", + "gundog group", + "99", + "120", + "83" + ], + [ + "irish terrier", + "terrier group", + "198", + "270", + "277" + ], + [ + "kerry blue terrier", + "terrier group", + "244", + "277", + "10" + ], + [ + "king charles spaniel", + "toy group", + "150", + "193", + "180" + ], + [ + "lakeland terrier", + "terrier group", + "269", + "330", + "247" + ], + [ + "lancashire heeler", + "pastoral group", + "125", + "166", + "98" + ], + [ + "manchester terrier", + "terrier group", + "86", + "140", + "152" + ], + [ + "norwich terrier", + "terrier group", + "153", + "131", + "158" + ], + [ + "otterhound", + "hound group", + "54", + "50", + "38" + ], + [ + "retriever (curly coated)", + "gundog group", + "79", + "82", + "72" + ], + [ + "scottish deerhound", + "hound group", + "231", + "264", + "237" + ], + [ + "sealyham terrier", + "terrier group", + "58", + "58", + "63" + ], + [ + "skye terrier", + "terrier group", + "59", + "30", + "44" + ], + [ + "soft coated wheaten terrier", + "terrier group", + "277", + "321", + "433" + ], + [ + "spaniel (clumber)", + "gundog group", + "170", + "192", + "271" + ], + [ + "spaniel (field)", + "gundog group", + "84", + "86", + "55" + ], + [ + "spaniel (irish water)", + "gundog group", + "145", + "106", + "117" + ], + [ + "spaniel (sussex)", + "gundog group", + "82", + "77", + "68" + ], + [ + "welsh corgi (cardigan)", + "pastoral group", + "56", + "77", + "108" + ], + [ + "welsh terrier", + "terrier group", + "270", + "326", + "415" + ] + ], + "title": "", + "original_id": "db726244de06704566b54e2158b78eaf" + }, + { + "_id": "4a75dbd7372e5edbece891ce9a437722", + "header": [ + "-", + "-", + "-", + "Regular season", + "Regular season", + "Regular season", + "Regular season", + "Regular season", + "Playoffs", + "Playoffs", + "Playoffs", + "Playoffs", + "Playoffs", + "-", + "-" + ], + "rows": [ + [ + "Season", + "Team", + "League", + "-", + "GP", + "G", + "A", + "Pts", + "PIM", + "-", + "GP", + "G", + "A", + "Pts", + "PIM" + ], + [ + "2004–05", + "KalPa", + "Jr. A", + "-", + "1", + "0", + "0", + "0", + "0", + "-", + "—", + "—", + "—", + "—", + "—" + ], + [ + "2005–06", + "KalPa", + "Jr. A", + "-", + "29", + "9", + "5", + "14", + "46", + "-", + "5", + "0", + "0", + "0", + "0" + ], + [ + "2006–07", + "Kamloops Blazers", + "WHL", + "-", + "64", + "32", + "39", + "71", + "52", + "-", + "4", + "0", + "3", + "3", + "4" + ], + [ + "2007–08", + "Kamloops Blazers", + "WHL", + "-", + "60", + "27", + "26", + "53", + "26", + "-", + "4", + "1", + "1", + "2", + "2" + ], + [ + "2008–09", + "Espoo Blues", + "SM-l", + "-", + "53", + "13", + "20", + "33", + "14", + "-", + "14", + "1", + "1", + "2", + "4" + ], + [ + "2009–10", + "Espoo Blues", + "SM-l", + "-", + "54", + "8", + "13", + "21", + "64", + "-", + "2", + "0", + "1", + "1", + "0" + ], + [ + "2010–11", + "HPK", + "SM-l", + "-", + "59", + "26", + "12", + "38", + "46", + "-", + "2", + "1", + "0", + "1", + "4" + ], + [ + "2011–12", + "Milwaukee Admirals", + "AHL", + "-", + "55", + "50", + "50", + "100", + "8", + "-", + "—", + "—", + "—", + "—", + "—" + ], + [ + "2012–13", + "Milwaukee Admirals", + "AHL", + "-", + "73", + "15", + "16", + "31", + "14", + "-", + "4", + "0", + "0", + "0", + "4" + ], + [ + "2013–14", + "HIFK", + "Liiga", + "-", + "51", + "23", + "17", + "40", + "42", + "-", + "2", + "1", + "0", + "1", + "2" + ], + [ + "2014–15", + "HIFK", + "Liiga", + "-", + "47", + "15", + "12", + "27", + "28", + "-", + "7", + "2", + "2", + "4", + "2" + ], + [ + "2015–16", + "HIFK", + "Liiga", + "-", + "50", + "13", + "14", + "27", + "18", + "-", + "14", + "4", + "5", + "9", + "6" + ], + [ + "2016–17", + "HIFK", + "Liiga", + "-", + "48", + "6", + "14", + "20", + "42", + "-", + "13", + "6", + "6", + "12", + "2" + ], + [ + "2017–18", + "JYP Jyväskylä", + "Liiga", + "-", + "10", + "30", + "21", + "51", + "100", + "-", + "6", + "2", + "2", + "4", + "2" + ], + [ + "2018–19", + "Neftekhimik Nizhnekamsk", + "KHL", + "-", + "53", + "20", + "17", + "37", + "20", + "-", + "—", + "—", + "—", + "—", + "—" + ], + [ + "Liiga totals", + "Liiga totals", + "Liiga totals", + "-", + "415", + "134", + "123", + "258", + "298", + "-", + "60", + "17", + "17", + "34", + "22" + ] + ], + "title": "", + "original_id": "18c4f4682db495eb559e388d4b71cd96" + }, + { + "_id": "06fc32f72e71278aaa8326271e9cf6ff", + "header": [ + "peak", + "country", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "mount etna", + "italy ( sicily )", + "3323", + "3323", + "0" + ], + [ + "monte cinto", + "france ( corsica )", + "2706", + "2706", + "0" + ], + [ + "corno grande", + "italy", + "2912", + "2476", + "436" + ], + [ + "punta la marmora", + "italy ( sardinia )", + "1834", + "1834", + "0" + ], + [ + "monte amaro", + "italy", + "2795", + "1812", + "983" + ], + [ + "monte anomaly1", + "italy", + "10000", + "9000", + "1000" + ], + [ + "monte dolcedorme", + "italy", + "2267", + "1715", + "552" + ], + [ + "montalto", + "italy", + "1955", + "1709", + "246" + ], + [ + "monte cimone", + "italy", + "2165", + "1577", + "588" + ], + [ + "monte anomaly2", + "italy", + "100", + "50", + "50" + ] + ], + "title": "", + "original_id": "ae40833e476160358b41b99deb3ab275" + }, + { + "_id": "3f59ee5d1df3b2a7d4de78d62fe6851b", + "header": [ + "Class", + "Image", + "Type", + "Top speed", + "Top speed", + "Number", + "Built" + ], + "rows": [ + [ + "Class", + "Image", + "Type", + "mph", + "km/h", + "Number", + "Built" + ], + [ + "101", + "101692 at Arley.JPG", + "Diesel multiple unit", + "75", + "120", + "6", + "1956-1959" + ], + [ + "142", + "-", + "Diesel multiple unit", + "75", + "120", + "79", + "1985-1987" + ], + [ + "150", + "-", + "Diesel multiple unit", + "75", + "120", + "27", + "1984-1987" + ], + [ + "153", + "153316 at Carlisle.JPG", + "Diesel multiple unit", + "75", + "120", + "8", + "1987-1988" + ], + [ + "156", + "156427 at Carlisle.JPG", + "Diesel multiple unit", + "200", + "320", + "18", + "1987-1989" + ], + [ + "158", + "158751 at Westbury.JPG", + "Diesel multiple unit", + "90", + "145", + "8", + "1989-1992" + ], + [ + "175 Coradia", + "-", + "Diesel multiple unit", + "100", + "160", + "27", + "1999-2001" + ], + [ + "309", + "-", + "electric multiple unit", + "100", + "161", + "1", + "1962-1963" + ], + [ + "322", + "-", + "Electric multiple unit", + "100", + "160", + "4", + "1990" + ], + [ + "323", + "323225 at Manchester Piccadilly.JPG", + "Electric multiple unit", + "90", + "145", + "17", + "2050-2060" + ] + ], + "title": "", + "original_id": "66de0cb7d014e3d24b42c571d71c7140" + }, + { + "_id": "a68670e269a7867503de5b6d9f7eb393", + "header": [ + "economy", + "1980", + "gap from thailand as of 1980 (times)", + "1985", + "1990", + "1995", + "2000", + "2005", + "2010", + "2012", + "gap from thailand as of 2012 (times)", + "gdp as of 2012 after purchasing power parity (ppp) calculations (usd billions)", + "gdp per capita as of 2012 (ppp)" + ], + "rows": [ + [ + "china", + "205", + "0.29", + "290", + "341", + "601", + "945", + "1726", + "4422", + "6076", + "1.07", + "12405.67", + "9162" + ], + [ + "hong kong", + "5679", + "8.16", + "6442", + "13330", + "22939", + "25128", + "25748", + "32429", + "36667", + "6.46", + "369.38", + "51494" + ], + [ + "japan", + "9309", + "13.38", + "11461", + "25144", + "42523", + "37303", + "35787", + "42916", + "46735", + "8.23", + "4627.89", + "36265" + ], + [ + "korea", + "1689", + "2.43", + "2414", + "6308", + "11779", + "11347", + "17551", + "20540", + "23113", + "4.07", + "1613.92", + "32272" + ], + [ + "malaysia", + "1812", + "2.6", + "2026", + "2432", + "4358", + "4030", + "5211", + "8633", + "10304", + "1.81", + "498.48", + "100000" + ], + [ + "singapore", + "4756", + "6.83", + "6754", + "12387", + "23718", + "22791", + "28498", + "44697", + "51162", + "9.01", + "326.51", + "60410" + ], + [ + "taiwan", + "2363", + "3.4", + "3271", + "8086", + "12865", + "14641", + "16023", + "18488", + "20328", + "3.58", + "903.47", + "38749" + ], + [ + "korea", + "1689", + "2.43", + "2414", + "6308", + "11779", + "11347", + "17551", + "20540", + "23113", + "4.07", + "10.92", + "32272" + ] + ], + "title": "", + "original_id": "4f1c9e36f683c1b7a8fa7a335db8f3c3" + }, + { + "_id": "a27858fe9d504b3a3d61a8bf8e881155", + "header": [ + "term abroad", + "2000 / 01", + "2001 / 02", + "2002 / 03", + "2003 / 04", + "2004 / 05", + "2005 / 06", + "2006 / 07", + "2007 / 08", + "2008 / 09" + ], + "rows": [ + [ + "summer term", + "33.7", + "34.4", + "32.7", + "37.0", + "37.2", + "37.2", + "38.7", + "38.1", + "35.8" + ], + [ + "one semester", + "38.5", + "39.0", + "40.3", + "38.1", + "37.5", + "36.9", + "36.3", + "35.5", + "37.3" + ], + [ + "8 weeks or less during academic year", + "7.4", + "7.3", + "9.4", + "8.9", + "8.0", + "9.5", + "9.8", + "11.0", + "11.7" + ], + [ + "january term", + "7.0", + "6.0", + "50.0", + "5.7", + "6.0", + "5.4", + "6.8", + "7.2", + "7.0" + ], + [ + "academic year", + "7.3", + "7.8", + "6.7", + "6.0", + "6.0", + "5.3", + "4.3", + "4.1", + "4.1" + ], + [ + "one quarter", + "4.1", + "3.9", + "3.8", + "3.3", + "3.3", + "3.3", + "3.4", + "3.4", + "3.3" + ], + [ + "two quarters", + "0.6", + "0.5", + "0.4", + "0.5", + "1.3", + "0.9", + "0.5", + "0.6", + "100.0" + ] + ], + "title": "", + "original_id": "558a7154502318571bf00b0fa0773817" + }, + { + "_id": "9f43195a007b7e58295f139fdba110fe", + "header": [ + "rank", + "country (or dependent territory)", + "july 1 , 2013 projection", + "% of pop", + "average relative annual growth (%)", + "average absolute annual growth" + ], + "rows": [ + [ + "1", + "egypt", + "84605000.0", + "22.81", + "2.29", + "1893000" + ], + [ + "2", + "algeria", + "38295000.0", + "10.32", + "2.11", + "792000" + ], + [ + "3", + "iraq", + "35404000.0", + "9.54", + "3.06", + "1051000" + ], + [ + "4", + "sudan", + "35150000.0", + "9.47", + "2.52", + "863000" + ], + [ + "5", + "morocco", + "100000000.0", + "30.0", + "10.0", + "5000000" + ], + [ + "6", + "saudi arabia", + "30193000.0", + "8.14", + "3.41", + "997000" + ], + [ + "7", + "yemen", + "25252000.0", + "6.81", + "2.96", + "725000" + ], + [ + "8", + "syria", + "22169000.0", + "5.98", + "2.45", + "531000" + ], + [ + "9", + "tunisia", + "10889000.0", + "2.94", + "1.03", + "111000" + ], + [ + "10", + "somalia", + "9662000.0", + "2.6", + "1.17", + "112000" + ], + [ + "11", + "united arab emirates", + "8659000.0", + "2.33", + "1.56", + "133000" + ], + [ + "12", + "jordan", + "1000.0", + "0.01", + "-5.0", + "-10000" + ], + [ + "13", + "libya", + "6323000.0", + "1.7", + "1.56", + "97000" + ], + [ + "14", + "palestine", + "4421000.0", + "1.19", + "2.91", + "125000" + ], + [ + "15", + "lebanon", + "4127000.0", + "1.11", + "1.58", + "64000" + ], + [ + "16", + "oman", + "3942000.0", + "1.06", + "8.8", + "319000" + ], + [ + "17", + "kuwait", + "3852000.0", + "1.04", + "2.94", + "110000" + ], + [ + "18", + "mauritania", + "3461000.0", + "0.93", + "2.58", + "87000" + ], + [ + "19", + "qatar", + "1917000.0", + "0.52", + "3.85", + "71000" + ], + [ + "20", + "bahrain", + "1546000.0", + "0.42", + "7.36", + "106000" + ], + [ + "21", + "djibouti", + "912000.0", + "0.25", + "2.7", + "24000" + ], + [ + "22", + "comoros", + "743000.0", + "0.2", + "2.62", + "19000" + ], + [ + "align = left|total", + "370989000", + "100.0", + "2.42", + "8763000.0", + "29" + ] + ], + "title": "", + "original_id": "ebaeb6688f63e8773d574ff53c90316c" + }, + { + "_id": "f8fc7f173f77c628ba87fca6da0dcdc0", + "header": [ + "Row Header", + "Year Ended December 31, 2018 (In cents, except percentage changes)", + "Year Ended December 31, 2017 (In cents, except percentage changes)", + "Percent Increase (Decrease) (In cents, except percentage changes)" + ], + "rows": [ + [ + "Total CASM: Aircraft fuel and related taxes", + "2.86", + "2.22", + "28.8" + ], + [ + "Total CASM: Salaries, wages and benefits", + "4.34", + "4.32", + "0.5" + ], + [ + "Total CASM: Maintenance, materials and repairs", + "0.73", + "0.71", + "50.0" + ], + [ + "Total CASM: Other rent and landing fees", + "0.67", + "0.65", + "3.1" + ], + [ + "Total CASM: Aircraft rent", + "0.45", + "0.43", + "3.5" + ], + [ + "Total CASM: Selling expenses", + "0.54", + "0.53", + "-10.0" + ], + [ + "Total CASM: Depreciation and amortization", + "0.65", + "0.62", + "5.9" + ], + [ + "Total CASM: Special items, net", + "0.28", + "0.26", + "8.3" + ], + [ + "Total CASM: Other", + "1.80", + "1.78", + "1.6" + ], + [ + "Regional expenses: Aircraft fuel and related taxes", + "0.65", + "0.50", + "30.7" + ], + [ + "Regional expenses: Other", + "100.00", + "1.87", + "5221.9" + ], + [ + "Regional expenses: Total CASM", + "14.85", + "13.88", + "6.9" + ], + [ + "Special items, net: Special items, net", + "(0.28)", + "(0.26)", + "8.3" + ], + [ + "Special items, net: Regional operating special items, net", + "—", + "(0.01)", + "nm (1)" + ], + [ + "Aircraft fuel and related taxes Aircraft fuel and related taxes - mainline", + "(2.86)", + "(2.22)", + "28.8" + ], + [ + "Aircraft fuel and related taxes Aircraft fuel and related taxes - regional", + "(0.65)", + "(0.50)", + "30.7" + ], + [ + "Aircraft fuel and related taxes Total CASM, excluding special items and fuel", + "11.06", + "10.90", + "1.4" + ] + ], + "title": "", + "original_id": "d74bd0f451fc44950fd4887cbc214eae" + }, + { + "_id": "0b8a37539f3450e2afbce8e27d7ec592", + "header": [ + "number", + "symbol", + "name", + "21st", + "22nd", + "23rd", + "24th", + "25th", + "26th", + "27th", + "28th", + "29th", + "30th" + ], + "rows": [ + [ + "21", + "Sc", + "scandium", + "582163", + null, + null, + null, + null, + null, + null, + null, + null, + null + ], + [ + "22", + "Ti", + "titanium", + "602930", + "639294.0", + null, + null, + null, + null, + null, + null, + null, + null + ], + [ + "23", + "V", + "vanadium", + "151440", + "661050.0", + "699144.0", + null, + null, + null, + null, + null, + null, + null + ], + [ + "24", + "Cr", + "chromium", + "157700", + "166090.0", + "721870.0", + "761733.0", + null, + null, + null, + null, + null, + null + ], + [ + "25", + "Mn", + "manganese", + "158600", + "172500.0", + "181380.0", + "785450.0", + "827067.0", + null, + null, + null, + null, + null + ], + [ + "26", + "Fe", + "iron", + "163000", + "173600.0", + "188100.0", + "195200.0", + "851800.0", + "895161.0", + null, + null, + null, + null + ], + [ + "27", + "Co", + "cobalt", + "167400", + "178100.0", + "189300.0", + "204500.0", + "214100.0", + "920870.0", + "966023.0", + null, + null, + null + ], + [ + "28", + "Ni", + "nickel", + "169400", + "182700.0", + "194000.0", + "205600.0", + "221400.0", + "231490.0", + "992718.0", + "1039668.0", + null, + null + ], + [ + "29", + "Cu", + "copper", + "174100", + "184900.0", + "198800.0", + "210500.0", + "222700.0", + "239100.0", + "249660.0", + "1067358.0", + "1116105.0", + null + ], + [ + "30", + "Zn", + "zinc", + "179100", + null, + null, + null, + null, + null, + null, + null, + null, + null + ], + [ + "36", + "Kr", + "krypton", + "85300", + "90400.0", + "96300.0", + "101400.0", + "111100.0", + "116290.0", + "282500.0", + "296200.0", + "311400.0", + "326200.0" + ], + [ + "42", + "Mo", + "molybdenum", + "87000", + "93400.0", + "98420.0", + "104400.0", + "121900.0", + "127700.0", + "133800.0", + "139800.0", + "148100.0", + "154500.0" + ] + ], + "title": "", + "original_id": "381b3da7c2758e821a32852d99d1ef92" + }, + { + "_id": "f95fe07f5a6c458d93f0e1eae5968bc1", + "header": [ + "Round", + "Václav Klaus", + "Václav Klaus", + "Jaroslava Moserová", + "Jaroslava Moserová", + "Miloš Zeman", + "Miloš Zeman" + ], + "rows": [ + [ + "Round", + "Deputies", + "Senators", + "Deputies", + "Senators", + "Deputies", + "Senators" + ], + [ + "1st", + "89", + "32", + "25", + "43", + "78", + "5" + ], + [ + "1st", + "121", + "121", + "68", + "68", + "83", + "83" + ], + [ + "2nd", + "85", + "33", + "32", + "42", + "-", + "-" + ], + [ + "2nd", + "118", + "118", + "74", + "74", + "-", + "-" + ], + [ + "3rd", + "95", + "32", + "26", + "39", + "-", + "-" + ], + [ + "3rd", + "127", + "127", + "65", + "65", + "-", + "-" + ] + ], + "title": "", + "original_id": "c8223578cf6dbfd367df3afbb270a180" + }, + { + "_id": "d8534b59f93f2f4ea74708bfa6422b9c", + "header": [ + "males rank", + "females rank", + "state", + "hiv awareness (males%)", + "females (%)" + ], + "rows": [ + [ + "1", + "2", + "kerala", + "99", + "95" + ], + [ + "2", + "1", + "manipur", + "99", + "99" + ], + [ + "3", + "3", + "tamil nadu", + "98", + "94" + ], + [ + "4", + "3", + "mizoram", + "96", + "94" + ], + [ + "5", + "10", + "andhra pradesh", + "93", + "74" + ], + [ + "6", + "5", + "goa", + "92", + "83" + ], + [ + "6", + "7", + "himachal pradesh", + "92", + "79" + ], + [ + "6", + "12", + "punjab", + "92", + "70" + ], + [ + "9", + "15", + "nagaland", + "91", + "81" + ], + [ + "10", + "8", + "uttarakhand", + "90", + "79" + ], + [ + "11", + "7", + "maharashtra", + "87", + "82" + ], + [ + "12", + "9", + "sikkim", + "89", + "75" + ], + [ + "12", + "11", + "tripura", + "89", + "73" + ], + [ + "14", + "17", + "jammu and kashmir", + "88", + "61" + ], + [ + "15", + "18", + "haryana", + "87", + "60" + ], + [ + "16", + "13", + "karnataka", + "85", + "66" + ], + [ + "17", + "23", + "gujarat", + "80", + "49" + ], + [ + "17", + "19", + "whole india", + "80", + "57" + ], + [ + "19", + "13", + "arunachal pradesh", + "75", + "66" + ], + [ + "19", + "21", + "assam", + "75", + "53" + ], + [ + "21", + "28", + "west bengal", + "74", + "50" + ], + [ + "21", + "26", + "uttar pradesh", + "74", + "40" + ], + [ + "21", + "22", + "rajasthan", + "74", + "34" + ], + [ + "24", + "16", + "odisha", + "73", + "62" + ], + [ + "25", + "27", + "bihar", + "70", + "35" + ], + [ + "26", + "24", + "madhya pradesh", + "68", + "45" + ], + [ + "27", + "25", + "chattisgarh", + "67", + "41" + ], + [ + "28", + "19", + "meghalaya", + "63", + "57" + ], + [ + "29", + "29", + "jharkhand", + "53", + "29" + ] + ], + "title": "", + "original_id": "dcee3efa18d9eb2b672f632300e2df53" + }, + { + "_id": "f3de55fc70e240884e89dcb05517de45", + "header": [ + "Row Header", + "Total", + "Owned", + "Leased", + "Seats in Standard Configuration", + "Average Age (In Years)" + ], + "rows": [ + [ + "777-300ER", + "14", + "14", + "—", + "366", + "0.7" + ], + [ + "777-200ER", + "55", + "40", + "15", + "267-269", + "17.8" + ], + [ + "777-200", + "19", + "19", + "—", + "364", + "20.5" + ], + [ + "787-9", + "21", + "21", + "—", + "252", + "2.1" + ], + [ + "787-8", + "12", + "12", + "—", + "219", + "4.5" + ], + [ + "767-400ER", + "16", + "14", + "2", + "242", + "16.3" + ], + [ + "767-300ER", + "35", + "22", + "13", + "183-214", + "22.5" + ], + [ + "757-300", + "21", + "9", + "12", + "213", + "15.3" + ], + [ + "757-200", + "56", + "50", + "6", + "142-169", + "21.7" + ], + [ + "737-900ER", + "136", + "136", + "—", + "179", + "5.0" + ], + [ + "737-900", + "12", + "8", + "4", + "179", + "16.3" + ], + [ + "737-800", + "141", + "77", + "64", + "154-166", + "13.8" + ], + [ + "737-700", + "40", + "20", + "20", + "118-126", + "18.8" + ], + [ + "A320-200", + "99", + "66", + "33", + "150", + "19.3" + ], + [ + "A319-100", + "67", + "50", + "17", + "128", + "16.7" + ], + [ + "Total mainline", + "744", + "558", + "186", + "", + "14.3" + ] + ], + "title": "", + "original_id": "6237bbbb18e2f1614656f1730f37f02a" + }, + { + "_id": "ec68c9b1129e1a66bf85b102efe4cd24", + "header": [ + "building", + "height", + "floors", + "built", + "city", + "architect" + ], + "rows": [ + [ + "eaton 's department store", + "46", + "9", + "1904", + "winnipeg", + "john woodman" + ], + [ + "union bank tower", + "48", + "10", + "1904", + "winnipeg", + "darling and pearson" + ], + [ + "lindsay building", + "44", + "11", + "1911", + "winnipeg", + "woodman and carey" + ], + [ + "confederation building", + "46", + "12", + "1911", + "winnipeg", + "j wilson gray" + ], + [ + "national bank building", + "50", + "13", + "1911", + "winnipeg", + "john d atchison" + ], + [ + "electric railway chambers", + "45", + "12", + "1912", + "winnipeg", + "pratt and ross , charles s frost" + ], + [ + "hotel fort garry", + "59", + "14", + "1913", + "winnipeg", + "ross and macfarlane" + ], + [ + "marlbourgh hotel", + "42", + "10", + "1913", + "winnipeg", + "j chisholm & son" + ], + [ + "paris building", + "42", + "11", + "1915", + "winnipeg", + "woodman and carey" + ], + [ + "bank of hamilton building", + "45", + "10", + "1916", + "winnipeg", + "john d atchison" + ], + [ + "manitoba legislative building", + "79", + "5", + "1920", + "winnipeg", + "simon and boddington" + ] + ], + "title": "", + "original_id": "56fb46be47a462ccb8af7c501404ce76" + }, + { + "_id": "01882e70a5479c6efdd02f2e3da2a405", + "header": [ + "round", + "pick", + "overall", + "name", + "position", + "college" + ], + "rows": [ + [ + "1", + "13", + "13", + "brian orakpo", + "de", + "texas" + ], + [ + "3", + "16", + "80", + "kevin barnes", + "cb", + "maryland" + ], + [ + "5", + "22", + "158", + "cody glenn", + "lb", + "nebraska" + ], + [ + "6", + "13", + "186", + "robert henson", + "lb", + "texas christian" + ], + [ + "7", + "12", + "221", + "eddie williams", + "te", + "idaho" + ], + [ + "7", + "34", + "243", + "marko mitchell", + "wr", + "nevada" + ] + ], + "title": "", + "original_id": "4c147e78894f919ff89514f23c84bc12" + }, + { + "_id": "1139fa365500821052a27ced59ca1fb0", + "header": [ + "metropolitan ring", + "localities", + "total", + "jews and others 1", + "thereof : jews", + "arabs", + "population density (per km square)", + "annual population growth rate" + ], + "rows": [ + [ + "core 2", + "1", + "264800", + "237800", + "214200", + "27100", + "3838.2", + "0.0%" + ], + [ + "inner ring 3", + "30", + "271200", + "241700", + "224500", + "29500", + "1046.8", + "0.5%" + ], + [ + "northern section", + "3", + "112400", + "112300", + "101900", + "100", + "5591.7", + "- 0.2%" + ], + [ + "eastern section", + "16", + "84000", + "80100", + "76000", + "4000", + "1014.9", + "1.0%" + ], + [ + "southern section", + "11", + "74800", + "49300", + "46700", + "25500", + "481.4", + "1.0%" + ], + [ + "outer ring 4", + "98", + "484900", + "240100", + "223000", + "244900", + "678.8", + "1.8%" + ], + [ + "northern section", + "57", + "362800", + "147300", + "134500", + "215600", + "948.1", + "1.6%" + ], + [ + "eastern section", + "23", + "82300", + "64300", + "60800", + "18000", + "534.5", + "1.7%" + ], + [ + "southern section", + "18", + "39800", + "28500", + "27800", + "11300", + "224.0", + "3.7%" + ] + ], + "title": "", + "original_id": "ce2930301220686e3acbc890a52ba84d" + }, + { + "_id": "f14161e603da2313cb849b9832a02ec3", + "header": [ + "year", + "property taxes", + "investment earnings", + "other local sources", + "state & federal", + "total revenue" + ], + "rows": [ + [ + "2005", + "24384901", + "255041", + "2670060", + "13581968", + "40891700" + ], + [ + "2004", + "21099214", + "181103", + "2624131", + "13999169", + "37903617" + ], + [ + "2003", + "17199210", + "509862", + "2309087", + "12794922", + "32539572" + ], + [ + "2002", + "14359199", + "879398", + "2168096", + "15132879", + "32539572" + ], + [ + "2001", + "11631227", + "1949885", + "1987436", + "12929489", + "28498037" + ], + [ + "2000", + "10608734", + "493839", + "2127480", + "8549565", + "21779618" + ] + ], + "title": "", + "original_id": "106f3d501745fe92f5e6b513acff4a61" + }, + { + "_id": "2f288898fd45e256707a7c21c5c1e527", + "header": [ + "Canal", + "Length (miles)", + "Locks", + "Max length (ft)", + "Width (ft)", + "Year opened", + "Year abandoned", + "Year restored" + ], + "rows": [ + [ + "Aberdeenshire Canal", + "18.0", + "18.0", + null, + null, + "1805.0", + "1854.0", + null + ], + [ + "Buchan Canal", + null, + null, + null, + null, + null, + null, + null + ], + [ + "Caledonian Canal", + "62.0", + "29.0", + "150.0", + "35.0", + "1822.0", + null, + null + ], + [ + "Crinan Canal", + "9.0", + "15.0", + "86.75", + "19.65", + "1817.0", + null, + null + ], + [ + "Dingwall Canal", + "1.1", + "0.0", + null, + null, + "1816.0", + "1840.0", + null + ], + [ + "Forth and Clyde Canal", + "35.0", + "38.0", + "68.58", + "19.75", + "1790.0", + "1963.0", + "2002.0" + ], + [ + "Glasgow, Paisley and Johnstone Canal", + "11.0", + "0.0", + null, + null, + "1811.0", + "1881.0", + null + ], + [ + "Monkland Canal", + "12.25", + "18.0", + "71.0", + "14.0", + "1794.0", + "1942.0", + null + ], + [ + "Stevenston Canal", + "2.25", + "0.0", + null, + "13.0", + "1772.0", + "1830.0", + null + ], + [ + "Union Canal", + "31.5", + "3.0", + "63.0", + "12.5", + "1822.0", + "1930.0", + "2000.0" + ] + ], + "title": "", + "original_id": "3b8eafab24cc0cc641819cebe50d9764" + }, + { + "_id": "c700b2088bc72bf3b7f32b2f159e6e3d", + "header": [ + "country", + "year", + "total", + "hydroelectricity", + "wind power", + "biomass and waste", + "solar" + ], + "rows": [ + [ + "china", + "2011", + "797.4", + "687.1", + "73.2", + "34", + "3.0" + ], + [ + "european union", + "2010", + "699.3", + "397.7", + "149.1", + "123.3", + "23.1" + ], + [ + "united states", + "2011", + "520.1", + "325.1", + "119.7", + "56.7", + "1.81" + ], + [ + "brazil", + "2011", + "459.2", + "424.3", + "2.71", + "32.2", + "0.0002" + ], + [ + "canada", + "2011", + "399.1", + "372.6", + "19.7", + "6.4", + "0.43" + ], + [ + "russia", + "2010", + "166.6", + "163.3", + "0.004", + "2.8", + "0.0" + ], + [ + "india", + "2011", + "162.0", + "131.0", + "26.0", + "4", + "1.0" + ], + [ + "germany", + "2012", + "136.1", + "21.2", + "45.3", + "40.9", + "28.0" + ], + [ + "norway", + "2011", + "121.4", + "119.6", + "1.29", + "0.48", + "0.02" + ], + [ + "japan", + "2011", + "116.4", + "82.5", + "4.35", + "23.1", + "3.8" + ], + [ + "italy", + "2012", + "89.759", + "43.256", + "13.333", + "9.281 (2010)", + "18.637" + ] + ], + "title": "", + "original_id": "f8d592d15f1611f0aa015d7ee3d75a23" + }, + { + "_id": "730733827c922ab2699d662df2502b94", + "header": [ + "driver", + "points", + "races", + "wins", + "second", + "third" + ], + "rows": [ + [ + "gunther gooverts", + "182", + "27", + "2", + "-", + "3" + ], + [ + "gunther gooverts", + "135", + "18", + "1", + "2", + "1" + ], + [ + "gunther gooverts", + "27", + "8", + "-", + "-", + "1" + ], + [ + "gunther gooverts", + "155", + "16", + "-", + "3", + "2" + ], + [ + "gert devoldere", + "3", + "2", + "-", + "-", + "-" + ], + [ + "daniël willemsen", + "40", + "2", + "2", + "-", + "-" + ], + [ + "martin gölz", + "90", + "20", + "-", + "-", + "-" + ], + [ + "gerton kops", + "17", + "2", + "-", + "-", + "-" + ], + [ + "peter steegmans", + "16", + "2", + "-", + "-", + "-" + ], + [ + "daniël willemsen", + "320", + "22", + "5", + "4", + "7" + ], + [ + "daniël willemsen", + "377", + "22", + "8", + "5", + "3" + ], + [ + "are kaurit", + "268", + "16", + "-", + "3", + "2" + ], + [ + "daniël willemsen", + "88", + "4", + "-", + "4", + "-" + ], + [ + "kristers serģis", + "501", + "26", + "12", + "7", + "1" + ], + [ + "kristers serģis", + "246", + "12", + "6", + "1", + "2" + ], + [ + "frank hofman", + "22", + "2", + "-", + "-", + "-" + ], + [ + "daniël willemsen", + "478", + "22", + "15", + "4", + "-" + ], + [ + "daniël willemsen", + "341", + "16", + "13", + "-", + "-" + ], + [ + "nicky pulinx", + "22", + "4", + "-", + "-", + "-" + ], + [ + "jarno van den boomen", + "8", + "2", + "-", + "-", + "-" + ], + [ + "gerrit van werven", + "6", + "2", + "-", + "-", + "-" + ], + [ + "daniël willemsen", + "341", + "17", + "11", + "-", + "-" + ], + [ + "peter steegmans", + "212", + "20", + "-", + "1", + "1" + ], + [ + "daniël willemsen", + "437", + "21", + "14", + "3", + "-" + ], + [ + "ben adriaenssen", + "385", + "22", + "-", + "-", + "6" + ], + [ + "overall 1993 - 2012", + "4717", + "327", + "89", + "37", + "29" + ] + ], + "title": "", + "original_id": "22ca06f97417eaae94a58549e8bfd1d4" + }, + { + "_id": "041b787351f2709197ed40b9bd3cd5cd", + "header": [ + "round", + "pick", + "overall", + "name", + "position", + "college" + ], + "rows": [ + [ + "1", + "10", + "10", + "forest evashevski", + "rb", + "michigan" + ], + [ + "3", + "10", + "25", + "fred davis", + "ot", + "alabama" + ], + [ + "5", + "10", + "40", + "jim stuart", + "ot", + "oregon" + ], + [ + "6", + "10", + "50", + "ed cifers", + "e", + "tennessee" + ], + [ + "7", + "10", + "60", + "al krueger", + "e", + "southern california" + ], + [ + "8", + "10", + "70", + "henry wilder", + "rb", + "iowa state" + ], + [ + "9", + "10", + "80", + "bill grimmett", + "e", + "tulsa" + ], + [ + "10", + "10", + "90", + "ed hickerson", + "g", + "alabama" + ], + [ + "11", + "10", + "100", + "joe aguirre", + "e", + "st mary 's (cal)" + ], + [ + "12", + "10", + "110", + "jack banta", + "hb", + "southern california" + ], + [ + "13", + "10", + "120", + "roy conn", + "ot", + "arizona" + ], + [ + "14", + "10", + "130", + "deward tornell", + "rb", + "san josé state" + ], + [ + "15", + "10", + "140", + "morris buckingham", + "c", + "san josé state" + ], + [ + "16", + "10", + "150", + "ken dow", + "fb", + "oregon state" + ], + [ + "17", + "10", + "160", + "stan mcrae", + "e", + "michigan state" + ], + [ + "18", + "10", + "170", + "joe osmanski", + "fb", + "holy cross" + ], + [ + "19", + "10", + "180", + "earl fullilove", + "ot", + "georgetown" + ], + [ + "20", + "10", + "190", + "ed hiestand", + "e", + "vanderbilt" + ], + [ + "21", + "5", + "195", + "tom riggs", + "ot", + "illinois" + ], + [ + "22", + "5", + "200", + "lee gentry", + "hb", + "tulsa" + ] + ], + "title": "", + "original_id": "b23a9876b3db50bf256522a0342f666d" + }, + { + "_id": "04f1c77ae5297b89160a5b541e06dfec", + "header": [ + "locomotive", + "type", + "builder", + "builder 's no", + "built", + "entered service", + "withdrawn" + ], + "rows": [ + [ + "2", + "0 - 6 - 0st", + "beyer peacock & co", + "2575", + "1884", + "1884", + "1938" + ], + [ + "3", + "0 - 6 - 0st", + "beyer peacock & co", + "4558", + "1903", + "1903", + "1920" + ], + [ + "62xx", + "0 - 6 - 0", + "robert stephenson and company", + "2195", + "1874", + "1903", + "1927" + ], + [ + "2020", + "2 - 6 - 4t", + "beyer peacock & co", + "3206", + "1891", + "1834", + "1955" + ], + [ + "2017", + "2 - 6 - 4t", + "beyer peacock & co", + "3289", + "1891", + "1939", + "1956" + ], + [ + "1", + "2 - 6 - 2t", + "robert stephenson and hawthorns", + "e7841", + "1955", + "1955", + "1967" + ], + [ + "j & a brown 26", + "2 - 6 - 4t", + "beyer peacock & co", + "2567", + "1885", + "1967", + "1967" + ], + [ + "3013", + "4 - 6 - 4t", + "beyer peacock & co", + "4456", + "1903", + "1967", + "1976" + ] + ], + "title": "", + "original_id": "13268aef491b17ad2d89c67d8bfa336d" + }, + { + "_id": "168cc4c20c2c074cc1c50ae6b987594f", + "header": [ + "country", + "orphans as % of all children", + "aids orphans as % of orphans", + "total orphans (total)", + "total orphans (aids related)", + "maternal (total)", + "maternal (aids related)", + "paternal (total)", + "paternal (aids related)", + "double (total)", + "double (aids related)" + ], + "rows": [ + [ + "botswana (1990)", + "5.9", + "3.0", + "34000", + "1000", + "14000", + "< 100", + "23000", + "1000", + "2000", + "< 100" + ], + [ + "botswana (1995)", + "8.3", + "33.7", + "52000", + "18000", + "19000", + "7000", + "37000", + "13000", + "5000", + "3000" + ], + [ + "botswana (2001)", + "15.1", + "70.5", + "98000", + "69000", + "69000", + "58000", + "91000", + "69000", + "62000", + "61000" + ], + [ + "lesotho (1990)", + "10.6", + "2.9", + "73000", + "< 100", + "31000", + "< 100", + "49000", + "< 100", + "8000", + "< 100" + ], + [ + "lesotho (1995)", + "10.3", + "5.5", + "77000", + "4000", + "31000", + "1000", + "52000", + "4000", + "7000", + "1000" + ], + [ + "lesotho (2001)", + "17.0", + "53.5", + "137000", + "73000", + "66000", + "38000", + "108000", + "63000", + "37000", + "32000" + ], + [ + "malawi (1990)", + "11.8", + "5.7", + "524000", + "30000", + "233000", + "11000", + "346000", + "23000", + "55000", + "6000" + ], + [ + "malawi (1995)", + "14.2", + "24.6", + "664000", + "163000", + "305000", + "78000", + "442000", + "115000", + "83000", + "41000" + ], + [ + "malawi (2001)", + "17.5", + "49.9", + "937000", + "468000", + "506000", + "282000", + "624000", + "315000", + "194000", + "159000" + ], + [ + "uganda (1990)", + "12.2", + "17.4", + "1015000", + "177000", + "437000", + "72000", + "700000", + "138000", + "122000", + "44000" + ], + [ + "uganda (1995)", + "14.9", + "42.4", + "1456000", + "617000", + "720000", + "341000", + "1019000", + "450000", + "282000", + "211000" + ], + [ + "uganda (2001)", + "14.6", + "51.1", + "1731000", + "884000", + "902000", + "517000", + "1144000", + "581000", + "315000", + "257000" + ] + ], + "title": "", + "original_id": "5876f5eaa7677055acaf8f89e1215cd8" + }, + { + "_id": "63c78bea545ddcd228dede2c58e56af3", + "header": [ + "rank", + "airline / holding", + "passenger fleet", + "current destinations", + "alliance / association" + ], + "rows": [ + [ + "1", + "lufthansa group", + "627", + "283", + "star alliance" + ], + [ + "2", + "ryanair", + "305", + "176", + "elfaa" + ], + [ + "3", + "air france - klm", + "621", + "246", + "skyteam" + ], + [ + "4", + "international airlines group", + "435", + "207", + "oneworld" + ], + [ + "5", + "easyjet", + "194", + "126", + "elfaa" + ], + [ + "6", + "turkish airlines", + "222", + "245", + "star alliance" + ], + [ + "7", + "air berlin group", + "153", + "145", + "oneworld" + ], + [ + "8", + "aeroflot group", + "239", + "189", + "skyteam" + ], + [ + "9", + "sas group", + "173", + "157", + "star alliance" + ], + [ + "10", + "alitalia", + "143", + "101", + "skyteam" + ], + [ + "11", + "norwegian air shuttle asa", + "79", + "120", + "elfaa" + ], + [ + "12", + "pegasus airlines", + "42", + "70", + "n / a" + ], + [ + "13", + "wizz air", + "45", + "83", + "elfaa" + ], + [ + "14", + "transaero", + "93", + "113", + "n / a" + ], + [ + "15", + "tap portugal", + "71", + "80", + "star alliance" + ], + [ + "16", + "aer lingus", + "46", + "75", + "n / a" + ], + [ + "17", + "finnair", + "44", + "65", + "oneworld" + ], + [ + "18", + "s7", + "52", + "90", + "oneworld" + ], + [ + "19", + "air europa", + "40", + "54", + "skyteam" + ], + [ + "20", + "utair aviation", + "108", + "117", + "n / a" + ], + [ + "21", + "sunexpress", + "23", + "48", + "n / a" + ], + [ + "22", + "flybe", + "68", + "56", + "elfaa" + ], + [ + "23", + "brussels airlines", + "45", + "67", + "star alliance" + ], + [ + "24", + "aegean airlines", + "29", + "40", + "star alliance" + ], + [ + "25", + "monarch airlines", + "39", + "30", + "n / a" + ], + [ + "26", + "virgin atlantic", + "41", + "37", + "n / a" + ], + [ + "27", + "atlasjet", + "15", + "15", + "n / a" + ], + [ + "28", + "lot polish airlines", + "40", + "54", + "star alliance" + ], + [ + "29", + "jet2.com", + "49", + "59", + "elfaa" + ], + [ + "30", + "meridiana fly", + "18", + "40", + "n / a" + ], + [ + "31", + "ural airlines", + "29", + "66", + "n / a" + ], + [ + "32", + "czech airlines", + "25", + "49", + "skyteam" + ], + [ + "33", + "airbaltic", + "28", + "60", + "n / a" + ], + [ + "34", + "onur air", + "29", + "21", + "n / a" + ], + [ + "35", + "ukraine international airlines", + "40", + "54", + "n / a" + ], + [ + "36", + "olympic air", + "16", + "37", + "n / a" + ], + [ + "37", + "tarom", + "23", + "48", + "skyteam" + ], + [ + "38", + "icelandair", + "27", + "36", + "n / a" + ], + [ + "39", + "croatia airlines", + "13", + "40", + "star alliance" + ], + [ + "40", + "air serbia", + "13", + "34", + "n / a" + ], + [ + "41", + "belavia", + "23", + "40", + "n / a" + ], + [ + "42", + "cyprus airways", + "9", + "18", + "n / a" + ], + [ + "43", + "bulgaria air", + "11", + "22", + "n / a" + ], + [ + "44", + "adria airways", + "12", + "37", + "star alliance" + ] + ], + "title": "", + "original_id": "6b1d72a62b98d5e4cc0ab30df170fe0d" + }, + { + "_id": "3b4a8db1540c25df2e2c53242efd2b78", + "header": [ + "rank", + "airport", + "city", + "code (iata / icao)", + "2008", + "2009", + "2010" + ], + "rows": [ + [ + "1", + "henri coandă international airport", + "bucharest", + "otp / lrop", + "5063555", + "4480765", + "4802510" + ], + [ + "2", + "traian vuia international airport", + "timișoara", + "tsr / lrtr", + "886083", + "991737", + "1136064" + ], + [ + "3", + "cluj - napoca international airport", + "cluj - napoca", + "clj / lrcl", + "752181", + "834400", + "1028907" + ], + [ + "4", + "aurel vlaicu international airport", + "bucharest", + "bbu / lrob", + "1724633", + "1974337", + "1881509" + ], + [ + "5", + "george enescu international airport", + "bacău", + "bcm / lrbc", + "116492", + "195772", + "240735" + ], + [ + "6", + "trgu mureș transilvania airport", + "trgu mureș", + "tgm / lrtm", + "69945", + "84062", + "74353" + ], + [ + "7", + "sibiu international airport", + "sibiu", + "sbz / lrsb", + "141032", + "148527", + "198753" + ], + [ + "8", + "iași international airport", + "iași", + "ias / lria", + "144043", + "148538", + "159615" + ], + [ + "9", + "mihail kogălniceanu international airport", + "constanța", + "cnd / lrck", + "60477", + "68690", + "74587" + ], + [ + "10", + "oradea airport", + "oradea", + "omr / lrod", + "38843", + "41692", + "36477" + ], + [ + "11", + "craiova international airport", + "craiova", + "cra / lrcv", + "12988", + "15130", + "23629" + ], + [ + "12", + "suceava ștefan cel mare airport", + "suceava", + "scv / lrsv", + "23398", + "32561", + "34437" + ], + [ + "13", + "satu mare international airport", + "satu mare", + "suj / lrsm", + "7298", + "11101", + "18859" + ], + [ + "14", + "baia mare airport", + "baia mare", + "bay / lrbm", + "22307", + "23818", + "19020" + ], + [ + "15", + "arad international airport", + "arad", + "arw / lrar", + "78047", + "44743", + "8359" + ], + [ + "16", + "tulcea danube delta airport", + "tulcea", + "tce / lrtc", + "788", + "854", + "427" + ] + ], + "title": "", + "original_id": "223b47a687dda4049cbd996cc8e111be" + }, + { + "_id": "6d85772402e8a49d79b204ccf6080b18", + "header": [ + "Club", + "Season", + "League", + "League", + "League", + "FA Cup", + "FA Cup", + "League Cup", + "League Cup", + "Other", + "Other", + "Total", + "Total" + ], + "rows": [ + [ + "Club", + "Season", + "Division", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals", + "Apps", + "Goals" + ], + [ + "Stoke City", + "1998–99", + "Second Division", + "4", + "0", + "0", + "0", + "0", + "0", + "1", + "0", + "5", + "0" + ], + [ + "Stoke City", + "1999–2000", + "Second Division", + "42", + "5", + "1", + "0", + "3", + "0", + "9", + "3", + "55", + "8" + ], + [ + "Stoke City", + "2000–01", + "Second Division", + "44", + "8", + "1", + "0", + "5", + "2", + "4", + "0", + "54", + "10" + ], + [ + "Stoke City", + "2001–02", + "Second Division", + "43", + "2", + "4", + "0", + "0", + "0", + "3", + "1", + "50", + "3" + ], + [ + "Stoke City", + "2002–03", + "First Division", + "43", + "0", + "3", + "0", + "1", + "0", + "0", + "0", + "47", + "0" + ], + [ + "Stoke City", + "Total", + "Total", + "176", + "16", + "9", + "0", + "9", + "2", + "17", + "4", + "211", + "22" + ], + [ + "West Bromwich Albion", + "2003–04", + "First Division", + "30", + "0", + "1", + "0", + "5", + "0", + "0", + "0", + "36", + "0" + ], + [ + "West Bromwich Albion", + "2004–05", + "Premier League", + "0", + "0", + "1", + "0", + "1", + "0", + "0", + "0", + "2", + "0" + ], + [ + "West Bromwich Albion", + "Total", + "Total", + "30", + "0", + "2", + "0", + "6", + "0", + "0", + "0", + "38", + "0" + ], + [ + "Burnley", + "2004–05", + "Championship", + "21", + "2", + "1", + "0", + "1", + "0", + "0", + "0", + "23", + "2" + ], + [ + "Burnley", + "2005–06", + "Championship", + "45", + "3", + "1", + "0", + "3", + "0", + "0", + "0", + "49", + "3" + ], + [ + "Burnley", + "2006–07", + "Championship", + "42", + "3", + "1", + "0", + "1", + "0", + "0", + "0", + "44", + "3" + ], + [ + "Burnley", + "2007–08", + "Championship", + "29", + "3", + "1", + "0", + "3", + "0", + "0", + "0", + "33", + "3" + ], + [ + "Burnley", + "Total", + "Total", + "137", + "11", + "4", + "0", + "8", + "0", + "0", + "0", + "149", + "11" + ], + [ + "Sheffield Wednesday", + "2008–09", + "Championship", + "41", + "0", + "1", + "0", + "1", + "0", + "0", + "0", + "43", + "0" + ], + [ + "Sheffield Wednesday", + "2009–10", + "Championship", + "44", + "3", + "1", + "0", + "1", + "0", + "0", + "0", + "46", + "3" + ], + [ + "Sheffield Wednesday", + "2010–11", + "League One", + "36", + "2", + "4", + "0", + "2", + "0", + "3", + "2", + "45", + "4" + ], + [ + "Sheffield Wednesday", + "2011–12", + "League One", + "18", + "1", + "1", + "0", + "2", + "0", + "1", + "0", + "22", + "1" + ], + [ + "Sheffield Wednesday", + "Total", + "Total", + "139", + "6", + "7", + "0", + "6", + "0", + "4", + "2", + "156", + "8" + ], + [ + "Career Total", + "Career Total", + "Career Total", + "482", + "33", + "22", + "0", + "29", + "2", + "21", + "6", + "554", + "41" + ] + ], + "title": "", + "original_id": "86f27f6eb9945a8e587457aca56b0309" + }, + { + "_id": "ca5b2fbc6211d4f1baba4bce38f6e887", + "header": [ + "aircraft", + "introduced", + "retired", + "seating", + "notes" + ], + "rows": [ + [ + "airbus a319 - 100", + "2004", + "-", + "156", + "in service" + ], + [ + "airbus a320 - 200", + "2008", + "-", + "180", + "in service" + ], + [ + "airbus a321 - 200", + "2008", + "2010", + "220", + "inherited from gb airways" + ], + [ + "boeing 737 - 204", + "1995", + "1996", + "115", + "replaced by 737 - 300s" + ], + [ + "boeing 737 - 300", + "1996", + "2007", + "148 / 9", + "replaced by a319s" + ], + [ + "boeing 737 - 700", + "2000", + "2011", + "149", + "replaced by a319s and a320s" + ] + ], + "title": "", + "original_id": "5493c5c3be6eea36c6ff32cce6255f8c" + }, + { + "_id": "a253219fdb22abb63c22f828a55fb547", + "header": [ + "ensemble", + "gold medals", + "silver medals", + "bronze medals", + "total medals" + ], + "rows": [ + [ + "amador valley hs", + "0", + "1", + "0", + "1" + ], + [ + "ayala high school", + "4", + "2", + "1", + "7" + ], + [ + "baldwinsville hs", + "2", + "0", + "0", + "2" + ], + [ + "claremont hs", + "1", + "1", + "0", + "2" + ], + [ + "downers grove hs", + "0", + "0", + "1", + "1" + ], + [ + "father ryan hs", + "0", + "1", + "0", + "1" + ], + [ + "fort mill hs", + "2", + "1", + "2", + "5" + ], + [ + "franklin central hs", + "6", + "0", + "0", + "6" + ], + [ + "gateway high school", + "2", + "1", + "1", + "4" + ], + [ + "goshen hs", + "0", + "2", + "1", + "3" + ], + [ + "harrison central paragon hs", + "0", + "0", + "1", + "1" + ], + [ + "james logan high school", + "1", + "1", + "0", + "2" + ], + [ + "john overton hs", + "0", + "1", + "2", + "3" + ], + [ + "king philip high school", + "0", + "1", + "0", + "1" + ], + [ + "mansfield hs", + "0", + "1", + "0", + "1" + ], + [ + "mission viejo high school", + "0", + "1", + "0", + "1" + ], + [ + "muscle shoals hs", + "1", + "1", + "2", + "4" + ], + [ + "new philadelphia hs", + "0", + "1", + "0", + "1" + ], + [ + "northglenn hs", + "0", + "0", + "1", + "1" + ], + [ + "rangeview hs", + "0", + "1", + "0", + "1" + ], + [ + "roland hayes school", + "0", + "0", + "1", + "1" + ], + [ + "tarpon springs hs", + "0", + "1", + "0", + "1" + ], + [ + "tunstall hs", + "0", + "3", + "4", + "7" + ], + [ + "warsaw community hs", + "0", + "0", + "1", + "1" + ], + [ + "woodbridge hs", + "1", + "0", + "0", + "1" + ] + ], + "title": "", + "original_id": "c56b85419c6abec8753dcc96be88024f" + }, + { + "_id": "341a0f8a4383584f3bd2eba5812c9175", + "header": [ + "producer", + "product", + "samples taken", + "samples failed", + "melamine content (mg / kg)" + ], + "rows": [ + [ + "shijiazhuang sanlu group", + "三鹿牌嬰幼兒配方乳粉", + "11", + "11", + "2563.0" + ], + [ + "shanghai panda dairy", + "熊貓可寶牌嬰幼兒配方乳粉", + "5", + "3", + "619.0" + ], + [ + "qingdao shengyuan dairy", + "聖元牌嬰幼兒配方乳粉", + "17", + "8", + "150.0" + ], + [ + "shanxi gu cheng dairy", + "古城牌嬰幼兒配方乳粉", + "13", + "4", + "141.6" + ], + [ + "jiangxi guangming yingxiong dairy", + "英雄牌嬰幼兒配方乳粉", + "2", + "2", + "98.6" + ], + [ + "baoji huimin dairy", + "惠民牌嬰幼兒配方乳粉", + "1", + "1", + "79.17" + ], + [ + "inner mongolia mengniu dairy", + "蒙牛牌嬰幼兒配方乳粉", + "28", + "3", + "68.2" + ], + [ + "torador dairy industry (tianjin)", + "可淇牌嬰幼兒配方乳粉", + "1", + "1", + "67.94" + ], + [ + "guangdong yashili group", + "雅士利牌嬰幼兒配方乳粉", + "30", + "8", + "53.4" + ], + [ + "hunan peiyi dairy", + "南山倍益牌嬰幼兒配方乳粉", + "3", + "1", + "53.4" + ], + [ + "heilongjiang qilin dairy", + "嬰幼兒配方乳粉2段基粉", + "1", + "1", + "31.74" + ], + [ + "shanxi yashili dairy", + "雅士利牌嬰幼兒配方乳粉", + "4", + "2", + "26.3" + ], + [ + "shenzhen jinbishi milk", + "金必氏牌嬰幼兒配方乳粉", + "2", + "2", + "18.0" + ], + [ + "scient (guangzhou) infant nutrition", + "施恩牌嬰幼兒配方乳粉", + "20", + "14", + "17.0" + ], + [ + "guangzhou jinding dairy products factory", + "金鼎牌嬰幼兒配方乳粉", + "3", + "1", + "16.2" + ], + [ + "inner mongolia yili industrial group", + "伊利牌兒童配方乳粉", + "35", + "1", + "12.0" + ], + [ + "yantai ausmeadow nutriment", + "澳美多牌嬰幼兒配方乳粉", + "16", + "6", + "10.7" + ], + [ + "qingdao suncare nutritional technology", + "��可丁牌嬰幼兒配方乳粉", + "3", + "1", + "4.8" + ], + [ + "xi'an baiyue dairy", + "御寶牌嬰幼兒配方乳粉", + "3", + "1", + "3.73" + ], + [ + "yantai leilei dairy", + "磊磊牌嬰幼兒配方乳粉", + "3", + "3", + "1.2" + ], + [ + "shanghai baoanli dairy", + "寶安力牌嬰幼兒配方乳粉", + "1", + "1", + "0.21" + ], + [ + "fuding chenguan dairy", + "聰爾壯牌嬰幼兒配方乳粉", + "1", + "1", + "0.09" + ] + ], + "title": "", + "original_id": "07ff6fa731c9061bf28789d3352ccd5c" + }, + { + "_id": "2293486fab949514c949e36ebfad551d", + "header": [ + "Party", + "First Duma", + "Second Duma", + "Third Duma", + "Fourth Duma" + ], + "rows": [ + [ + "Russian Social Democratic Party", + "18 (Mensheviks)", + "47 (Mensheviks)", + "19 (Bolsheviks)", + "15 (Bolsheviks)" + ], + [ + "Socialist-Revolutionary Party", + "–", + "37", + "–", + "–" + ], + [ + "Labour group", + "136", + "104", + "13", + "10" + ], + [ + "Progressist Party", + "27", + "28", + "28", + "41" + ], + [ + "Constitutional Democratic Party (Kadets)", + "179", + "92", + "52", + "57" + ], + [ + "Non-Russian National Groups", + "121", + "–", + "26", + "21" + ], + [ + "Centre Party", + "–", + "–", + "–", + "33" + ], + [ + "Octobrist Party", + "17", + "42", + "154", + "95" + ], + [ + "Nationalists", + "60", + "93", + "26", + "22" + ], + [ + "Rightists", + "8", + "10", + "147", + "154" + ], + [ + "TOTAL", + "566", + "453", + "465", + "448" + ] + ], + "title": "", + "original_id": "8c3668697e8601047edef065555855fc" + }, + { + "_id": "bd8da6d10cf6946173ed099789acc21e", + "header": [ + "episode", + "date", + "official itv rating (millions)", + "weekly rank", + "share (%)", + "official itv hd rating (millions)", + "total itv viewers (millions)" + ], + "rows": [ + [ + "auditions 1", + "13 april", + "9.58", + "1", + "36.9", + "1.15", + "10.73" + ], + [ + "auditions 2", + "20 april", + "9.72", + "1", + "43.9", + "1.43", + "11.15" + ], + [ + "auditions 3", + "27 april", + "9.17", + "1", + "43.9", + "1.31", + "10.48" + ], + [ + "auditions 4", + "4 may", + "9.6", + "1", + "45.0", + "1.31", + "10.91" + ], + [ + "auditions 5", + "11 may", + "10.24", + "1", + "45.2", + "1.71", + "11.95" + ], + [ + "auditions 6", + "18 may", + "9.11", + "1", + "38.1", + "1.25", + "10.36" + ], + [ + "auditions 7", + "26 may", + "8.09", + "3", + "38.0", + "1.13", + "9.22" + ], + [ + "semi - final 1", + "27 may", + "9.52", + "1", + "41.5", + "1.46", + "10.98" + ], + [ + "semi - final 1 results", + "27 may", + "7.6", + "10", + "31.4", + "1.14", + "8.74" + ], + [ + "semi - final 2", + "28 may", + "8.54", + "6", + "36.5", + "1.21", + "9.75" + ], + [ + "semi - final 2 results", + "28 may", + "7.13", + "14", + "28.5", + "n / a", + "7.13" + ], + [ + "semi - final 3", + "30 may", + "8.17", + "8", + "37.5", + "1.27", + "9.44" + ], + [ + "semi - final 3 results", + "30 may", + "7.18", + "13", + "32.3", + "n / a", + "7.18" + ], + [ + "semi - final 4", + "31 may", + "8.28", + "7", + "37.5", + "1.12", + "9.4" + ], + [ + "semi - final 4 results", + "31 may", + "7.29", + "12", + "32.7", + "n / a", + "7.29" + ], + [ + "semi - final 5", + "1 june", + "8.02", + "9", + "41.9", + "1.20", + "9.22" + ], + [ + "semi - final 5 results", + "1 june", + "7.46", + "11", + "32.8", + "1.07", + "8.53" + ], + [ + "live final", + "8 june", + "10.43", + "1", + "48.9", + "1.80", + "12.23" + ] + ], + "title": "", + "original_id": "d277ebc4a7a4c1aec7fd73a98ae56d13" + }, + { + "_id": "8b0c71f1ad0e630fcc31cc005a70ff5e", + "header": [ + "rank", + "centre", + "country", + "rating", + "change" + ], + "rows": [ + [ + "41", + "isle of man ( cd )", + "isle of man ( cd )", + "638", + "7" + ], + [ + "42", + "abu dhabi", + "united arab emirates", + "637", + "12" + ], + [ + "43", + "wellington", + "new zealand", + "636", + "10" + ], + [ + "44", + "istanbul", + "turkey", + "633", + "7" + ], + [ + "45", + "amsterdam", + "netherlands", + "629", + "26" + ], + [ + "46", + "buenos aires", + "argentina", + "628", + "5" + ], + [ + "47", + "riyadh", + "saudi arabia", + "627", + "29" + ], + [ + "48", + "british virgin islands ( bot )", + "british virgin islands ( bot )", + "626", + "14" + ], + [ + "49", + "copenhagen", + "denmark", + "625", + "18" + ], + [ + "50", + "taipei", + "taiwan", + "619", + "34" + ], + [ + "51", + "milan", + "italy", + "618", + "34" + ], + [ + "52", + "bahrain", + "bahrain", + "610", + "3" + ], + [ + "53", + "malta", + "malta", + "608", + "13" + ], + [ + "54", + "madrid", + "spain", + "607", + "28" + ], + [ + "55", + "jakarta", + "indonesia", + "606", + "14" + ], + [ + "56", + "dublin", + "ireland", + "605", + "22" + ], + [ + "57", + "helsinki", + "finland", + "604", + "30" + ], + [ + "58", + "bangkok", + "thailand", + "600", + "19" + ], + [ + "59", + "beijing", + "china", + "598", + "24" + ], + [ + "60", + "brussels", + "belgium", + "597", + "44" + ], + [ + "61", + "johannesburg", + "south africa", + "592", + "18" + ], + [ + "62", + "edinburgh", + "united kingdom", + "590", + "42" + ], + [ + "63", + "panama city", + "panama", + "589", + "8" + ], + [ + "64", + "manila", + "philippines", + "587", + "1" + ], + [ + "65", + "glasgow", + "united kingdom", + "586", + "50" + ], + [ + "66", + "mexico city", + "mexico", + "584", + "44" + ], + [ + "67", + "the bahamas", + "the bahamas", + "583", + "4" + ], + [ + "68", + "mauritius", + "mauritius", + "581", + "9" + ], + [ + "69", + "moscow", + "russia", + "580", + "26" + ], + [ + "70", + "gibraltar ( bot )", + "gibraltar ( bot )", + "572", + "43" + ], + [ + "71", + "warsaw", + "poland", + "571", + "37" + ], + [ + "72", + "mumbai", + "india", + "570", + "35" + ], + [ + "73", + "prague", + "czech republic", + "565", + "46" + ], + [ + "74", + "cyprus", + "cyprus", + "536", + "40" + ], + [ + "75", + "lisbon", + "portugal", + "535", + "17" + ], + [ + "76", + "saint petersburg", + "russia", + "522", + "63" + ], + [ + "77", + "budapest", + "hungary", + "515", + "26" + ], + [ + "78", + "tallinn", + "estonia", + "495", + "94" + ], + [ + "79", + "reykjavik", + "iceland", + "479", + "67" + ], + [ + "80", + "athens", + "greece", + "469", + "4" + ] + ], + "title": "", + "original_id": "39987999e1badc7cd1a6f52f52b106cc" + }, + { + "_id": "b6590c918bc7021b18c905d97bda9c55", + "header": [ + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "Measure unit", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)" + ], + "rows": [ + [ + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "Measure unit", + "TOTAL", + "0-9", + "10-19", + "20-29", + "30-39", + "40-49", + "50-59", + "60-69", + "70-79", + "80 +" + ], + [ + "I.", + "TOTAL", + "TOTAL", + "TOTAL", + "TOTAL", + "person", + "287", + "41", + "45", + "47", + "27", + "38", + "31", + "20", + "24", + "14" + ], + [ + "I.", + "—", + "of which in", + "of which in", + "of which in", + "%", + "100", + "14.3", + "15.7", + "16.4", + "9.4", + "13.2", + "10.8", + "7", + "8.4", + "4.9" + ], + [ + "I.", + "1.", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX" + ], + [ + "I.", + "1.", + "A.", + "Males", + "Males", + "person", + "145", + "23", + "23", + "25", + "13", + "20", + "16", + "11", + "11", + "3" + ], + [ + "I.", + "1.", + "A.", + "—", + "of which in", + "%", + "50.5", + "8", + "8", + "8.7", + "4.5", + "7", + "5.6", + "3.8", + "3.8", + "1" + ], + [ + "I.", + "1.", + "B.", + "Females", + "Females", + "person", + "142", + "18", + "22", + "22", + "14", + "18", + "15", + "9", + "13", + "11" + ], + [ + "I.", + "1.", + "B.", + "—", + "of which in", + "%", + "49.5", + "6.3", + "7.7", + "7.7", + "4.9", + "6.3", + "5.2", + "3.1", + "4.5", + "3.8" + ] + ], + "title": "", + "original_id": "50a1c817a7b50bcd7d9972f1f2ddeff9" + }, + { + "_id": "43e9f9ba1861cdf9e67cfe43eb843627", + "header": [ + "name", + "area (km square)", + "pop", + "pop / area (1 / km square)", + "no p", + "no c / no t", + "subregion" + ], + "rows": [ + [ + "águeda", + "335.3", + "47729", + "148", + "20", + "1", + "baixo vouga" + ], + [ + "albergaria - a - velha", + "155.4", + "25497", + "164", + "8", + "0", + "baixo vouga" + ], + [ + "anadia", + "216.6", + "31671", + "146", + "15", + "1", + "baixo vouga" + ], + [ + "arouca", + "329.1", + "24019", + "73", + "20", + "0", + "entre douro e vouga" + ], + [ + "aveiro", + "199.9", + "73626", + "368", + "14", + "1", + "baixo vouga" + ], + [ + "castelo de paiva", + "115.0", + "17089", + "149", + "9", + "0 / 2", + "tmega" + ], + [ + "espinho", + "21.1", + "31703", + "1503", + "5", + "1 / 1", + "grande porto" + ], + [ + "estarreja", + "108.4", + "28279", + "261", + "7", + "1 / 3", + "baixo vouga" + ], + [ + "ílhavo", + "73.5", + "39247", + "534", + "4", + "2", + "baixo vouga" + ], + [ + "mealhada", + "110.7", + "20496", + "194", + "8", + "1", + "baixo vouga" + ], + [ + "murtosa", + "73.3", + "9657", + "132", + "4", + "0 / 1", + "baixo vouga" + ], + [ + "oliveira de azeméis", + "163.5", + "71243", + "436", + "19", + "1 / 9", + "entre douro e vouga" + ], + [ + "oliveira do bairro", + "87.3", + "22365", + "256", + "6", + "1", + "baixo vouga" + ], + [ + "ovar", + "147.4", + "56715", + "385", + "8", + "2 / 3", + "baixo vouga" + ], + [ + "santa maria da feira", + "215.1", + "142295", + "662", + "31", + "3 / 13", + "entre douro e vouga" + ], + [ + "são joão da madeira", + "7.9", + "21538", + "2726", + "1", + "1 / 0", + "entre douro e vouga" + ], + [ + "sever do vouga", + "129.6", + "12940", + "100", + "9", + "0", + "baixo vouga" + ], + [ + "vagos", + "169.9", + "23205", + "137", + "11", + "0 / 2", + "baixo vouga" + ], + [ + "vale de cambra", + "146.5", + "22864", + "169", + "9", + "1", + "entre douro e vouga" + ] + ], + "title": "", + "original_id": "a44c1a6d08cd0dac4f0d91df912f222c" + }, + { + "_id": "89c3633d9a64c946b122c1e3c7636bf0", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "soviet union", + "7", + "6", + "0", + "13" + ], + [ + "2", + "hungary", + "2", + "2", + "1", + "5" + ], + [ + "3", + "japan", + "2", + "0", + "3", + "5" + ], + [ + "4", + "romania", + "1", + "3", + "1", + "5" + ], + [ + "5", + "iran", + "1", + "0", + "1", + "2" + ], + [ + "6", + "turkey", + "1", + "0", + "1", + "2" + ], + [ + "7", + "finland", + "1", + "0", + "0", + "1" + ], + [ + "7", + "france", + "1", + "0", + "0", + "1" + ], + [ + "9", + "bulgaria", + "0", + "2", + "2", + "4" + ], + [ + "10", + "united states", + "0", + "1", + "2", + "3" + ], + [ + "11", + "east germany", + "0", + "1", + "0", + "1" + ], + [ + "11", + "india", + "0", + "1", + "0", + "1" + ], + [ + "13", + "czechoslovakia", + "0", + "0", + "1", + "1" + ], + [ + "13", + "mongolia", + "0", + "0", + "1", + "1" + ], + [ + "13", + "poland", + "0", + "0", + "1", + "1" + ], + [ + "13", + "south korea", + "0", + "0", + "1", + "1" + ], + [ + "13", + "sweden", + "0", + "0", + "1", + "1" + ], + [ + "total", + "total", + "16", + "16", + "16", + "48" + ] + ], + "title": "", + "original_id": "0d30032f9b5ffaf48989a02191dbb9c9" + }, + { + "_id": "54299fbe01082a5cfda0ec468e6e8a0e", + "header": [ + "year", + "births (000s)", + "deaths", + "natural growth", + "total fertility rate" + ], + "rows": [ + [ + "1990", + "0.7", + "0.4", + "0.3", + "1.58" + ], + [ + "1991", + "2.4", + "1.85", + "0.55", + "1.31" + ], + [ + "1992", + "3.4", + "2.7", + "0.7", + "1.33" + ], + [ + "1993", + "4.6", + "3.3", + "1.3", + "1.52" + ], + [ + "1994", + "5.8", + "4.0", + "1.8", + "1.65" + ], + [ + "1995", + "6.75", + "4.6", + "2.15", + "1.72" + ], + [ + "1996", + "7.5", + "5.0", + "2.5", + "1.70" + ], + [ + "1997", + "8.2", + "5.4", + "2.8", + "1.71" + ], + [ + "1998", + "8.9", + "5.9", + "3.0", + "1.71" + ], + [ + "1999", + "9.3", + "6.3", + "3.0", + "1.63" + ], + [ + "2000", + "10.1", + "6.7", + "3.4", + "1.62" + ], + [ + "2001", + "10.3", + "6.9", + "3.4", + "1.56" + ], + [ + "2002", + "10.6", + "7.2", + "3.4", + "1.55" + ], + [ + "2003", + "11.1", + "7.25", + "3.85", + "1.60" + ], + [ + "2004", + "10.9", + "7.4", + "3.5", + "1.55" + ], + [ + "2005", + "11.0", + "7.6", + "3.4", + "1.55" + ], + [ + "2006", + "11.2", + "7.6", + "3.6", + "na" + ], + [ + "2007", + "10.3", + "7.8", + "2.5", + "na" + ], + [ + "2008", + "11.6", + "7.8", + "3.8", + "na" + ], + [ + "2009", + "11.7", + "7.6", + "4.1", + "na" + ], + [ + "1990 - 2009", + "166.4", + "113.3", + "53.1", + "na" + ] + ], + "title": "", + "original_id": "19f5fcd6b29df032293fab57a9cd5e91" + }, + { + "_id": "8fb087e86ec0ff6a0d0b7626570853b8", + "header": [ + "year", + "class", + "team", + "points", + "rank", + "wins" + ], + "rows": [ + [ + "1994", + "125cc", + "honda", + "24", + "20th", + "0" + ], + [ + "1995", + "125cc", + "honda", + "102", + "8th", + "0" + ], + [ + "1996", + "125cc", + "honda", + "167", + "3rd", + "1" + ], + [ + "1997", + "125cc", + "honda", + "190", + "3rd", + "0" + ], + [ + "1998", + "125cc", + "honda", + "217", + "2nd", + "5" + ], + [ + "1999", + "250cc", + "yamaha", + "52", + "15th", + "0" + ] + ], + "title": "", + "original_id": "74a141ffb44ab78e143b3824b352eee2" + }, + { + "_id": "2d589380fda1881f58d9052bba173d4c", + "header": [ + "year", + "builder", + "motors", + "trailers", + "control trailers" + ], + "rows": [ + [ + "1923", + "brcw", + "-", + "1", + "-" + ], + [ + "1923", + "clco", + "-", + "1", + "-" + ], + [ + "1923", + "grcw", + "-", + "1", + "1" + ], + [ + "1923", + "leeds", + "-", + "1", + "-" + ], + [ + "1923", + "mcwf", + "-", + "1", + "-" + ], + [ + "1923", + "brcw", + "-", + "35", + "-" + ], + [ + "1923", + "clco", + "41", + "40", + "-" + ], + [ + "1923", + "mcwf", + "40", + "-", + "35" + ], + [ + "1924", + "brcw", + "-", + "50", + "-" + ], + [ + "1924", + "clco", + "-", + "-", + "25" + ], + [ + "1924", + "mcwf", + "52", + "-", + "-" + ], + [ + "1925", + "clco", + "48", + "-", + "-" + ], + [ + "1925", + "mcwf", + "-", + "5", + "67" + ], + [ + "1926", + "mcwf", + "64", + "48", + "-" + ], + [ + "1927", + "mcwf", + "110", + "160", + "36" + ], + [ + "1927", + "ucc", + "77", + "37", + "68" + ], + [ + "1929", + "ucc", + "18", + "17", + "18" + ], + [ + "1930", + "mccw", + "22", + "20", + "20" + ], + [ + "1930", + "ucc", + "2", + "4", + "-" + ], + [ + "1931", + "brcw", + "-", + "90", + "-" + ], + [ + "1931", + "grcw", + "-", + "40", + "-" + ], + [ + "1931", + "mccw", + "145", + "-", + "-" + ], + [ + "1934", + "mccw", + "26", + "-", + "-" + ], + [ + "totals", + "1466", + "645", + "551", + "270" + ] + ], + "title": "", + "original_id": "6ba14be153d5a11f0caeebe3e441125d" + }, + { + "_id": "8256d79143780e5b70b0130485e9382f", + "header": [ + "year", + "show", + "season", + "episode title", + "episode" + ], + "rows": [ + [ + "2011", + "treme", + "2", + "what is new orleans", + "9" + ], + [ + "2010", + "treme", + "1", + "the foot of canal street", + "4" + ], + [ + "2010", + "the pacific", + "1", + "part 3", + "3" + ], + [ + "2008", + "the wire", + "5", + "late editions", + "9" + ], + [ + "2006", + "the wire", + "4", + "that 's got his own", + "12" + ], + [ + "2004", + "the wire", + "3", + "middle ground", + "11" + ], + [ + "2004", + "the wire", + "3", + "slapstick", + "9" + ], + [ + "2004", + "the wire", + "3", + "hamsterdam", + "4" + ], + [ + "2003", + "the wire", + "2", + "bad dreams", + "11" + ], + [ + "2003", + "the wire", + "2", + "duck and cover", + "8" + ], + [ + "2002", + "the wire", + "1", + "cleaning up", + "12" + ] + ], + "title": "", + "original_id": "d8ac38ac5b42068555d9ce6ab619d048" + }, + { + "_id": "e083033db4d70a6fc045588c28b2a3c0", + "header": [ + "year", + "theme", + "artist", + "mintage", + "issue price" + ], + "rows": [ + [ + "2005", + "fur traders", + "john mardon", + "4500", + "489.95" + ], + [ + "2006", + "timber trade", + "john mardon", + "4500", + "489.95" + ], + [ + "2007", + "fishing trade", + "john mardon", + "4000", + "579.95" + ], + [ + "2008", + "agricultural commerce", + "john mardon", + "4000", + "619.95" + ], + [ + "2009", + "coal mining trade", + "john mardon", + "4000", + "697.95" + ], + [ + "2010", + "petroleum and oil trade", + "john mardon", + "4000", + "999.95" + ] + ], + "title": "", + "original_id": "a6b444f9bff38624cc77a5eb368f41c2" + }, + { + "_id": "585d94f6404375fcece657b7e3ef9155", + "header": [ + "rank", + "country", + "year", + "males", + "females", + "total" + ], + "rows": [ + [ + "1", + "south korea", + "2011", + "39.3", + "19.7", + "28.4" + ], + [ + "2", + "hungary", + "2009", + "33.8", + "8.0", + "19.8" + ], + [ + "3", + "japan", + "2009", + "29.2", + "10.5", + "19.7" + ], + [ + "4", + "finland", + "2009", + "26.0", + "8.9", + "17.3" + ], + [ + "5", + "slovenia", + "2009", + "28.2", + "6.7", + "17.2" + ], + [ + "6", + "estonia", + "2009", + "31.2", + "4.8", + "16.8" + ], + [ + "7", + "belgium", + "2005", + "24.6", + "8.4", + "16.2" + ], + [ + "8", + "switzerland", + "2007", + "20.6", + "8.7", + "14.3" + ], + [ + "9", + "france", + "2008", + "21.6", + "6.8", + "13.8" + ], + [ + "10", + "poland", + "2008", + "23.3", + "3.5", + "12.9" + ], + [ + "11", + "austria", + "2009", + "19.7", + "5.2", + "12.0" + ], + [ + "12", + "czech republic", + "2009", + "20.1", + "3.4", + "11.4" + ], + [ + "13", + "ireland", + "2009", + "18.0", + "4.6", + "11.3" + ], + [ + "14", + "new zealand", + "2007", + "17.8", + "5.0", + "11.2" + ], + [ + "15", + "sweden", + "2008", + "16.1", + "6.0", + "11.0" + ], + [ + "16", + "chile", + "2007", + "18.5", + "4.1", + "11.0" + ], + [ + "17", + "norway", + "2009", + "15.7", + "6.2", + "10.9" + ], + [ + "18", + "united states", + "2007", + "17.1", + "4.3", + "10.5" + ], + [ + "19", + "iceland", + "2009", + "16.6", + "3.9", + "10.3" + ], + [ + "20", + "canada", + "2004", + "15.7", + "4.9", + "10.2" + ], + [ + "21", + "denmark", + "2006", + "15.3", + "5.3", + "9.9" + ], + [ + "22", + "slovak republic", + "2011", + "17.4", + "2.8", + "9.9" + ], + [ + "23", + "germany", + "2006", + "14.5", + "4.3", + "9.1" + ], + [ + "24", + "netherlands", + "2009", + "11.2", + "4.6", + "7.8" + ], + [ + "25", + "luxembourg", + "2008", + "13.3", + "2.7", + "7.8" + ], + [ + "26", + "australia", + "2006", + "11.9", + "3.3", + "7.5" + ], + [ + "27", + "portugal", + "2009", + "12.5", + "2.9", + "7.3" + ], + [ + "28", + "united kingdom", + "2009", + "9.8", + "2.6", + "6.2" + ], + [ + "29", + "spain", + "2008", + "9.7", + "2.6", + "6.0" + ], + [ + "30", + "israel", + "2008", + "8.8", + "1.6", + "5.0" + ], + [ + "31", + "italy", + "2007", + "8.0", + "2.1", + "4.9" + ], + [ + "32", + "mexico", + "2008", + "7.5", + "1.5", + "4.4" + ], + [ + "33", + "turkey", + "2008", + "5.36", + "2.5", + "3.94" + ], + [ + "34", + "greece", + "2009", + "4.8", + "0.8", + "2.8" + ] + ], + "title": "", + "original_id": "f336acf7ae0825191c3faa000c143abc" + }, + { + "_id": "45e90502f58e749f872585caa6d7235b", + "header": [ + "year", + "competition", + "location", + "apparatus", + "rank - final", + "score - final", + "rank - qualifying", + "score - qualifying" + ], + "rows": [ + [ + "2011", + "world cup", + "ghent", + "uneven bars", + "3", + "15.35", + "1", + "15.35" + ], + [ + "2011", + "world cup", + "ghent", + "balance beam", + "1", + "14.975", + "2", + "14.85" + ], + [ + "2011", + "world cup", + "ghent", + "floor exercise", + "2", + "13.65", + "3", + "13.475" + ], + [ + "2010", + "world cup", + "ghent", + "uneven bars", + "1", + "15.05", + "2", + "14.775" + ], + [ + "2010", + "world cup", + "ghent", + "balance beam", + "3", + "13.65", + "2", + "14.7" + ], + [ + "2010", + "world cup", + "ghent", + "floor", + "6", + "12.7", + "5", + "13.45" + ], + [ + "2010", + "world cup", + "doha", + "uneven bars", + "2", + "13.85", + "2", + "15.025" + ], + [ + "2010", + "world cup", + "doha", + "balance beam", + "1", + "14.7", + "1", + "14.525" + ], + [ + "2010", + "world cup", + "doha", + "floor", + "1", + "13.975", + "6", + "12.95" + ] + ], + "title": "", + "original_id": "8d2fb18ef60aa6895563b87a717d89e6" + }, + { + "_id": "ac0ce6e91465a2bb5fcc9932128fb8eb", + "header": [ + "year", + "theme", + "artist", + "composition", + "mintage", + "issue price" + ], + "rows": [ + [ + "2008", + "newfoundland and labrador", + "royal canadian mint engravers", + "58.33% gold , 41.67% silver", + "1000", + "1541.95" + ], + [ + "2008", + "alberta", + "royal canadian mint engravers", + "58.33% gold , 41.67% silver", + "1000", + "1631.95" + ], + [ + "2009", + "yukon", + "royal canadian mint engravers", + "58.33% gold , 41.67% silver", + "1000", + "1659.95" + ], + [ + "2009", + "prince edward island", + "royal canadian mint engravers", + "58.33% gold , 41.67% silver", + "1000", + "1949.95" + ], + [ + "2010", + "british columbia", + "royal canadian mint engravers", + "58.33% gold , 41.67% silver", + "500", + "2249.95" + ], + [ + "2010", + "new brunswick", + "royal canadian mint engravers", + "58.33% gold , 41.67% silver", + "500", + "2249.95" + ] + ], + "title": "", + "original_id": "be503c55c3cf1fbec022f0311349e163" + }, + { + "_id": "bd856a89b879944e2d52f507bfbb5d14", + "header": [ + "year", + "district - wide", + "high schools", + "middle schools", + "elementary schools", + "other programs & adjustments" + ], + "rows": [ + [ + "2006 - 2007", + "31221", + "8808", + "6405", + "14369", + "1639" + ], + [ + "2005 - 2006", + "31599", + "8570", + "6610", + "14249", + "2170" + ], + [ + "2004 - 2005", + "31851", + "8620", + "6876", + "14384", + "1971" + ], + [ + "2003 - 2004", + "32150", + "8430", + "7115", + "14497", + "2108" + ], + [ + "2002 - 2003", + "32464", + "8696", + "7103", + "14733", + "1932" + ], + [ + "2001 - 2002", + "35399", + "10114", + "5504", + "19541", + "240" + ] + ], + "title": "", + "original_id": "a9196b8ddb587ea972419f2fec183f52" + }, + { + "_id": "8cd8feb4a60019a3f0cf3a992f7ab78f", + "header": [ + "Year", + "Political Rights", + "Civil Liberties", + "Status", + "President" + ], + "rows": [ + [ + "1972", + "6", + "6", + "Not Free", + "Hamani Diori" + ], + [ + "1973", + "6", + "6", + "Not Free", + "Hamani Diori" + ], + [ + "1974", + "7", + "6", + "Not Free", + "Hamani Diori" + ], + [ + "1975", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1976", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1977", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1978", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1979", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1980", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1981", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1982", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1983", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1984", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1985", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1986", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1987", + "7", + "6", + "Not Free", + "Seyni Kountché" + ], + [ + "1988", + "6", + "6", + "Not Free", + "Ali Saibou" + ], + [ + "1989", + "7", + "6", + "Not Free", + "Ali Saibou" + ], + [ + "1990", + "6", + "5", + "Not Free", + "Ali Saibou" + ], + [ + "1991", + "6", + "5", + "Partly Free", + "Ali Saibou" + ], + [ + "1992", + "5", + "4", + "Partly Free", + "Ali Saibou" + ], + [ + "1993", + "3", + "4", + "Partly Free", + "Ali Saibou" + ], + [ + "1994", + "3", + "5", + "Partly Free", + "Mahamane Ousmane" + ], + [ + "1995", + "3", + "5", + "Partly Free", + "Mahamane Ousmane" + ], + [ + "1996", + "7", + "5", + "Not Free", + "Mahamane Ousmane" + ], + [ + "1997", + "7", + "5", + "Not Free", + "Ibrahim Baré Maïnassara" + ], + [ + "1998", + "7", + "5", + "Not Free", + "Ibrahim Baré Maïnassara" + ], + [ + "1999", + "5", + "5", + "Partly Free", + "Ibrahim Baré Maïnassara" + ], + [ + "2000", + "4", + "4", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2001", + "4", + "4", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2002", + "4", + "4", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2003", + "4", + "4", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2004", + "3", + "3", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2005", + "3", + "3", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2006", + "3", + "3", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2007", + "3", + "4", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2008", + "3", + "4", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2009", + "5", + "4", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2010", + "5", + "4", + "Partly Free", + "Mamadou Tandja" + ], + [ + "2011", + "3", + "4", + "Partly Free", + "Salou Djibo" + ] + ], + "title": "", + "original_id": "8fe93b8586be52209d3d522455a43430" + }, + { + "_id": "c7015403129d26d253f368bc25d63ef1", + "header": [ + "year", + "matches", + "wins", + "losses", + "no result", + "tied", + "success rate" + ], + "rows": [ + [ + "2008", + "16", + "9", + "7", + "0", + "0", + "56.25%" + ], + [ + "2009", + "15", + "8", + "6", + "1", + "0", + "53.33%" + ], + [ + "2010", + "16", + "9", + "7", + "0", + "0", + "56.25%" + ], + [ + "2011", + "16", + "11", + "5", + "0", + "0", + "68.75%" + ], + [ + "2012", + "19", + "19", + "11", + "8", + "0", + "52.63%" + ], + [ + "2013", + "18", + "12", + "6", + "0", + "0", + "66.67%" + ], + [ + "total", + "99", + "59", + "39", + "1", + "0", + "60.2%" + ] + ], + "title": "", + "original_id": "3f6993cc9f6540e04eaba1d69d6d69b6" + }, + { + "_id": "8c642fc37e80ca05e93d11c8d61727bf", + "header": [ + "year", + "theme", + "artist", + "composition", + "mintage", + "issue price" + ], + "rows": [ + [ + "2007", + "blue crystal - piedfort", + "konrad wachelko", + "92.5% silver , 7.5% copper", + "5000", + "94.95" + ], + [ + "2007", + "iridescent crystal - piedfort", + "konrad wachelko", + "92.5% silver , 7.5% copper", + "5000", + "94.95" + ], + [ + "2008", + "amethyst crystal", + "konrad wachelko", + "99.99% silver", + "7500", + "94.95" + ], + [ + "2008", + "sapphire crystal", + "konrad wachelko", + "99.99% silver", + "7500", + "94.95" + ], + [ + "2009", + "blue crystal", + "konrad wachelko", + "99.99% silver", + "7500", + "94.95" + ], + [ + "2009", + "pink crystal", + "konrad wachelko", + "99.99% silver", + "7500", + "94.95" + ], + [ + "2010", + "blue crystal", + "konrad wachelko", + "99.99% silver", + "7500", + "99.95" + ], + [ + "2010", + "tanzanite crystal", + "konrad wachelko", + "99.99% silver", + "7500", + "99.95" + ], + [ + "2011", + "emerald crystal", + "konrad wachelko", + "99.99% silver", + "15000", + "114.95" + ], + [ + "2011", + "topaz crystal", + "konrad wachelko", + "99.99% silver", + "15000", + "114.95" + ], + [ + "2011", + "hyacinth red small crystal", + "konrad wachelko", + "99.99% silver", + "15000", + "114.95" + ], + [ + "2011", + "montana blue small crystal", + "konrad wachelko", + "99.99% silver", + "15000", + "114.95" + ] + ], + "title": "", + "original_id": "56035c2708fa70250d3e771b00e74871" + }, + { + "_id": "cf7f909b6e38ac615aafc6b5a55eeba4", + "header": [ + "Year", + "Country", + "City", + "Number of Examinees by Level", + "Number of Examinees by Level", + "Number of Examinees by Level", + "Number of Examinees by Level", + "Number of Examinees by Level" + ], + "rows": [ + [ + "Year", + "Country", + "City", + "L1", + "L2", + "L3", + "L4", + "Total" + ], + [ + "2006", + "Kazakhstan", + "Almaty", + "50", + "98", + "135", + "91", + "374" + ], + [ + "2006", + "Russia", + "Khabarovsk", + "18", + "56", + "89", + "63", + "226" + ], + [ + "2006", + "Russia", + "Moscow", + "64", + "259", + "465", + "374", + "1,162" + ], + [ + "2006", + "Russia", + "Novosibirsk", + "12", + "61", + "115", + "82", + "270" + ], + [ + "2006", + "Russia", + "Vladivostok", + "23", + "92", + "105", + "85", + "305" + ], + [ + "2006", + "Russia", + "Yuzhno-Sakhalinsk", + "5", + "32", + "78", + "89", + "204" + ], + [ + "2006", + "Ukraine", + "Kiev", + "29", + "89", + "127", + "109", + "354" + ], + [ + "2006", + "Uzbekistan", + "Tashkent", + "61", + "111", + "145", + "88", + "405" + ], + [ + "2005", + "Kazakhstan", + "Almaty", + "28", + "43", + "68", + "25", + "164" + ], + [ + "2005", + "Russia", + "Moscow", + "48", + "197", + "316", + "287", + "848" + ], + [ + "2005", + "Russia", + "Vladivostok", + "23", + "56", + "97", + "55", + "231" + ], + [ + "2005", + "Ukraine", + "Kiev", + "27", + "63", + "120", + "54", + "284" + ], + [ + "2005", + "Uzbekistan", + "Tashkent", + "41", + "101", + "122", + "69", + "333" + ], + [ + "2004", + "Kazakhstan", + "Almaty", + "34", + "63", + "61", + "28", + "186" + ], + [ + "2004", + "Russia", + "Moscow", + "33", + "168", + "265", + "310", + "776" + ], + [ + "2004", + "Russia", + "Vladivostok", + "23", + "94", + "58", + "58", + "233" + ], + [ + "2003", + "Kazakhstan", + "Almaty", + "41", + "87", + "42", + "24", + "194" + ], + [ + "2003", + "Russia", + "Moscow", + "34", + "157", + "224", + "207", + "622" + ], + [ + "2003", + "Russia", + "Vladivostok", + "20", + "73", + "61", + "45", + "199" + ], + [ + "2002", + "Data missing", + "Data missing", + "Data missing", + "Data missing", + "Data missing", + "Data missing", + "Data missing" + ], + [ + "2001", + "Russia", + "Moscow", + "34", + "78", + "173", + "159", + "444" + ], + [ + "2001", + "Russia", + "Vladivostok", + "17", + "34", + "84", + "38", + "173" + ], + [ + "2000", + "Russia", + "Moscow", + "26", + "120", + "122", + "94", + "362" + ], + [ + "1999", + "Russia", + "Moscow", + "24", + "101", + "135", + "88", + "348" + ], + [ + "1998", + "Russia", + "Moscow", + "-", + "-", + "-", + "-", + "278" + ] + ], + "title": "", + "original_id": "f523566ee3da17b344ecfb521835f84e" + }, + { + "_id": "ebe77d6c0fb340e20ff13a536dc1ee42", + "header": [ + "Year", + "R class in service at start of year", + "R1 class in service at start of year", + "Quantity withdrawn", + "Locomotive numbers", + "Notes" + ], + "rows": [ + [ + "1931", + "11", + "13", + "1", + "1342", + "-" + ], + [ + "1932", + "10", + "13", + "1", + "1077", + "-" + ], + [ + "1934", + "9", + "13", + "3", + "1126, 1152, 1338", + "-" + ], + [ + "1935", + "6", + "13", + "1", + "1153", + "-" + ], + [ + "1937", + "5", + "13", + "1", + "1125", + "-" + ], + [ + "1939", + "4", + "13", + "1", + "1155", + "-" + ], + [ + "1941", + "3", + "13", + "1", + "1336", + "-" + ], + [ + "1942", + "2", + "13", + "1", + "1070", + "-" + ], + [ + "1943", + "1", + "13", + "1", + "1124", + "-" + ], + [ + "1949", + "0", + "13", + "1", + "1127", + "-" + ], + [ + "1955", + "—", + "12", + "2", + "31154, 31335", + "-" + ], + [ + "1958", + "—", + "10", + "2", + "31069, 31147", + "-" + ], + [ + "1959", + "—", + "8", + "6", + "31010, 31107, 31128, 31174, 31339, 31340", + "-" + ], + [ + "1960", + "—", + "2", + "2", + "31047, 31337", + "-" + ] + ], + "title": "", + "original_id": "8c08ad04ed79ae9165b5ae54d1c489bd" + }, + { + "_id": "1cc44f2c87511ec69e681c8e0316e6f1", + "header": [ + "rank", + "name", + "height m ( ft )", + "floors", + "year" + ], + "rows": [ + [ + "1", + "édifice marie - guyart", + "-", + "33", + "1972" + ], + [ + "2", + "complexe jules dallaire ii", + "-", + "28", + "2013" + ], + [ + "3", + "place hauteville", + "-", + "34", + "1974" + ], + [ + "4", + "hôtel loews le concorde", + "-", + "31", + "1974" + ], + [ + "5", + "hôtel hilton québec", + "-", + "28", + "1974" + ], + [ + "6", + "édifice price", + "-", + "18", + "1930" + ], + [ + "7", + "place de la capitale", + "-", + "21", + "1974" + ], + [ + "8", + "le samuel - holland i", + "-", + "24", + "1981" + ], + [ + "9", + "chteau frontenac", + "-", + "18", + "1893" + ], + [ + "10", + "édifice d'youville", + "-", + "21", + "1969" + ], + [ + "11", + "complexe jules - dallaire i", + "-", + "17", + "2010" + ] + ], + "title": "", + "original_id": "64b77c1e7f30ca236e405528bdeac502" + }, + { + "_id": "d5f1b39e37e774e5f5c281c7bf31c6bc", + "header": [ + "year", + "team", + "apps", + "tries", + "goals", + "points" + ], + "rows": [ + [ + "2004", + "castleford tigers", + "3", + "0", + "0", + "0" + ], + [ + "2005", + "castleford tigers", + "29", + "24", + "0", + "96" + ], + [ + "2006", + "castleford tigers", + "27", + "8", + "0", + "32" + ], + [ + "2007", + "castleford tigers", + "20", + "19", + "0", + "76" + ], + [ + "2008", + "castleford tigers", + "22", + "13", + "0", + "52" + ], + [ + "2009", + "castleford tigers", + "30", + "19", + "0", + "76" + ], + [ + "2010", + "castleford tigers", + "22", + "10", + "0", + "40" + ], + [ + "total", + "castleford tigers", + "153", + "93", + "0", + "372" + ] + ], + "title": "", + "original_id": "0c698f73ee431f8e473ef3bda75f5427" + }, + { + "_id": "a58864d5ddde4a97fc43a0b3881b8915", + "header": [ + "Year", + "Dates", + "No. of shows", + "No. of performances", + "Attendance", + "Venues", + "References" + ], + "rows": [ + [ + "1994", + "June 23 – July 2", + "53", + "315", + "4,630", + "6", + "-" + ], + [ + "1995", + "June 22 – July 3", + "≤50", + "400", + "5,500", + "5", + "-" + ], + [ + "1996", + "June 20–30", + "46", + "250", + "4,464", + "5", + "-" + ], + [ + "1997", + "June 19–29", + "35", + "—", + "4,300", + "5", + "-" + ], + [ + "1998", + "July 30 – August 9", + "38", + "~200", + "6,573", + "6", + "-" + ], + [ + "1999", + "July 29 – August 8", + "68", + "—", + "15,447", + "10", + "-" + ], + [ + "2000", + "July 28 – August 6", + "100", + "500", + ">23,000", + "19", + "-" + ], + [ + "2001", + "August 3–12", + "120", + "—", + "28,835", + "21", + "-" + ], + [ + "2002", + "August 2–11", + "148", + ">675", + "32,000", + "14", + "-" + ], + [ + "2003", + "August 1–10", + "162", + "783", + "40,500", + "20", + "-" + ], + [ + "2004", + "August 6–15", + "176", + "900", + "43,836", + "24", + "-" + ], + [ + "2005", + "August 4–14", + "168", + "855", + "44,630", + "20", + "-" + ], + [ + "2006", + "August 3–13", + "165", + "890", + "44,814", + "23", + "-" + ], + [ + "2007", + "August 2–12", + "162", + "872", + "37,752", + "23", + "-" + ], + [ + "2008", + "July 31 – August 10", + "156", + "808", + "40,926", + "18", + "-" + ], + [ + "2009", + "July 30 – August 9", + "162", + "843", + "46,189", + "22", + "-" + ], + [ + "2010", + "August 5–15", + "169", + "876", + "50,256", + "15", + "-" + ], + [ + "2011", + "August 4–14", + "168", + "865", + "48,350", + "18", + "-" + ], + [ + "2012", + "August 2–12", + "164", + "840", + "48,432", + "15", + "-" + ], + [ + "2013", + "August 1–11", + "177", + "897", + "50,007", + "16", + "-" + ], + [ + "2014", + "July 31 – August 10", + "169", + "878", + "50,265", + "15", + "-" + ], + [ + "2015", + "July 30 – August 9", + "174", + "909", + "50,338", + "24", + "-" + ], + [ + "2016", + "August 4��14", + "168", + "869", + "47,882", + "19", + "-" + ], + [ + "2017", + "August 3–13", + "167", + "850", + "46,076", + "17", + "-" + ], + [ + "2018", + "August 2–12", + "138", + "694", + "~36,400", + "16", + "-" + ] + ], + "title": "", + "original_id": "9eb17e466a9ae8c241c276e69e368046" + }, + { + "_id": "895e6b425a90c76c0bf257a792ddfc61", + "header": [ + "Year", + "-", + "Year", + "-", + "Year", + "-" + ], + "rows": [ + [ + "1820", + "8,385", + "1885", + "395,346", + "1950", + "249,187" + ], + [ + "1825", + "10,199", + "1890", + "455,302", + "1955", + "237,790" + ], + [ + "1830", + "23,322", + "1895", + "258,536", + "1960", + "265,398" + ], + [ + "1835", + "45,374", + "1900", + "448,572", + "1965", + "296,697" + ], + [ + "1840", + "84,066", + "1905", + "1,026,499", + "1970", + "373,326" + ], + [ + "1845", + "114,371", + "1910", + "1,041,570", + "1975", + "385,378" + ], + [ + "1850", + "369,980", + "1915", + "326,700", + "1980", + "524,295" + ], + [ + "1855", + "200,877", + "1920", + "430,001", + "1985", + "568,149" + ], + [ + "1860", + "153,640", + "1925", + "294,314", + "1990", + "1,535,872" + ], + [ + "1865", + "248,120", + "1930", + "241,700", + "1995", + "720,177" + ], + [ + "1870", + "387,203", + "1935", + "34,956", + "2000", + "841,002" + ], + [ + "1875", + "227,498", + "1940", + "70,756", + "2005", + "1,122,257" + ], + [ + "1880", + "457,257", + "1945", + "38,119", + "2010", + "1,042,625" + ] + ], + "title": "", + "original_id": "c3ce5811d8041e247d700aa708d16934" + }, + { + "_id": "570dfe08a4a8b7e6dcae6ed255b11bcf", + "header": [ + "Year", + "Order", + "Quantity", + "GER Nos." + ], + "rows": [ + [ + "1893", + "N31", + "1", + "999" + ], + [ + "1893", + "H33", + "10", + "979–988" + ], + [ + "1894", + "L33", + "10", + "989–998" + ], + [ + "1894", + "E34", + "10", + "969–978" + ], + [ + "1896", + "N37", + "10", + "959–968" + ], + [ + "1897", + "H40", + "10", + "949–958" + ], + [ + "1897", + "O41", + "10", + "602–608, 946–948" + ], + [ + "1898", + "G42", + "10", + "542–551" + ], + [ + "1898", + "K43", + "10", + "562–571" + ] + ], + "title": "", + "original_id": "e22a374e087942766de36d3bd733f72a" + }, + { + "_id": "7770ed4b9f9fe8778a7df5792600be01", + "header": [ + "Year", + "Injuries (US $000)", + "Deaths (age <15)", + "CPSC toy safety funding\n(US$ Millions)", + "Toy sales\n(US $ Billions)" + ], + "rows": [ + [ + "1994", + "154", + null, + null, + null + ], + [ + "1995", + "139", + null, + null, + null + ], + [ + "1996", + "130", + null, + null, + null + ], + [ + "1997", + "141", + null, + null, + null + ], + [ + "1998", + "153", + "14.0", + null, + null + ], + [ + "1999", + "152", + "16.0", + "13.6", + null + ], + [ + "2000", + "191", + "17.0", + "12.0", + null + ], + [ + "2001", + "255", + "25.0", + "12.4", + null + ], + [ + "2002", + "212", + "13.0", + "12.2", + "21.3" + ], + [ + "2003", + "206", + "11.0", + "12.8", + "20.7" + ], + [ + "2004", + "210", + "16.0", + "11.5", + "22.4" + ], + [ + "2005", + "202 (estimate)", + "20.0", + "11.0", + "22.2" + ], + [ + "2006", + "no data", + "22.0", + "no data†", + "22.3" + ], + [ + "2007", + "no data", + "22.0", + "no data", + null + ], + [ + "2008", + "no data", + "19.0", + "no data", + null + ], + [ + "2009", + "no data", + "12.0", + "no data", + null + ] + ], + "title": "", + "original_id": "a5a2c7fb09f32d5546caa62d152930f8" + }, + { + "_id": "ce49ed4ca041646fe740e766159e324f", + "header": [ + "ship name", + "year", + "length", + "width", + "passengers", + "vessels", + "speed" + ], + "rows": [ + [ + "mytilene", + "1973", + "138 , 3 m", + "22 , 4 m", + "1.73", + "225", + "20" + ], + [ + "european express", + "1974", + "159 , 5 m", + "21 , 5 m", + "1.0", + "350", + "23" + ], + [ + "ionian sky", + "1974", + "164 m", + "24 m", + "1.09", + "600", + "22" + ], + [ + "theofilos", + "1975", + "149 , 4 m", + "23 , 5 m", + "1.66", + "433", + "18" + ], + [ + "taxiarchis", + "1976", + "135 , 8 m", + "20 , 6 m", + "591.0", + "392", + "18" + ], + [ + "aqua jewel", + "2002", + "108 m", + "16 , 6 m", + "1.675", + "175", + "18 , 5" + ], + [ + "aqua maria", + "1975", + "101 , 3 m", + "18 m", + "592.0", + "230", + "17" + ], + [ + "aqua spirit", + "2000", + "75 m", + "15 m", + "400.0", + "60", + "17" + ] + ], + "title": "", + "original_id": "21ed2d8a7cbb07a4ae880fc3fdbe5cbb" + }, + { + "_id": "e30340bdb05532a8b1e7be1a7112c7a1", + "header": [ + "rank", + "name", + "height ft / m", + "floors", + "year" + ], + "rows": [ + [ + "1", + "xerox tower", + "443 / 135", + "30", + "1968" + ], + [ + "2", + "bausch & lomb place", + "401 / 122", + "20", + "1995" + ], + [ + "3", + "chase tower", + "392 / 119", + "27", + "1973" + ], + [ + "4", + "kodak tower", + "360 / 110", + "19", + "1914" + ], + [ + "5", + "first federal plaza", + "309 / 94", + "21", + "1976" + ], + [ + "6", + "one hsbc plaza", + "284 / 87", + "21", + "1970" + ], + [ + "7", + "hyatt regency hotel", + "271 / 83", + "25", + "1990" + ], + [ + "8", + "times square building", + "260 / 79", + "14", + "1930" + ], + [ + "9", + "midtown tower", + "251 / 77", + "18", + "1962" + ], + [ + "10", + "saint michael 's church", + "246 / 75", + "1", + "1890" + ], + [ + "11", + "temple building", + "218 / 66", + "14", + "1925" + ], + [ + "12", + "crossroads building", + "215 / 66", + "15", + "1969" + ], + [ + "13", + "eastman school of music student living center", + "213 / 65", + "14", + "1990" + ], + [ + "14", + "seneca towers apartments", + "212 / 65", + "22", + "1968" + ], + [ + "15", + "sibley center", + "203 / 62", + "12", + "1926" + ], + [ + "16", + "clinton square building", + "200 / 61", + "14", + "1990" + ] + ], + "title": "", + "original_id": "2cc3663accdc89ab60ba15c630072e4b" + }, + { + "_id": "3191f66bb2ff3ecc44bcb6bc45433904", + "header": [ + "Builder", + "Year", + "Works No.", + "CSAR No.", + "SAR No.", + "Class" + ], + "rows": [ + [ + "NBL", + "1910", + "18976", + "670", + "752", + "10B" + ], + [ + "NBL", + "1910", + "18977", + "671", + "753", + "10BR" + ], + [ + "NBL", + "1910", + "18978", + "672", + "754", + "10BR" + ], + [ + "NBL", + "1910", + "18979", + "673", + "755", + "10B" + ], + [ + "NBL", + "1910", + "18980", + "674", + "756", + "10BR" + ], + [ + "BP", + "1911", + "5483", + "-", + "757", + "10B" + ], + [ + "BP", + "1911", + "5484", + "-", + "758", + "10BR" + ], + [ + "BP", + "1911", + "5486", + "-", + "759", + "10BR" + ], + [ + "BP", + "1911", + "5487", + "-", + "760", + "10B" + ], + [ + "BP", + "1911", + "5485", + "-", + "761", + "10B" + ] + ], + "title": "", + "original_id": "8d8faa04091d6652a0503ea81462de9f" + }, + { + "_id": "ba346c7c40dc3c2f96db76ccd3bd7a4c", + "header": [ + "name", + "rank", + "out of", + "source", + "year" + ], + "rows": [ + [ + "number of agricultural machinery : tractors", + "22", + "190", + "world bank", + "2003" + ], + [ + "irrigated land per capita", + "14", + "173", + "cia world factbook", + "2003" + ], + [ + "total agricultural land", + "15", + "199", + "world bank", + "2005" + ], + [ + "total agricultural land per capita", + "57", + "199", + "world bank", + "2005" + ], + [ + "area of permanent crops", + "18", + "181", + "food and agriculture organization", + "2000" + ], + [ + "arable land as % of total land area", + "109", + "199", + "world bank", + "2005" + ], + [ + "permanent cropland area as % of total land area", + "110", + "187", + "world bank", + "2005" + ], + [ + "index of agricultural production", + "13", + "149", + "united nations", + "1996 - 98" + ], + [ + "annual diesel consumption in agriculture", + "7", + "107", + "united nations", + "2005" + ], + [ + "agricultural electricity consumption per capita", + "18", + "110", + "united nations", + "2005" + ], + [ + "cereal production", + "13", + "149", + "world resources institute", + "2001" + ], + [ + "meat production per capita", + "73", + "149", + "united nations", + "1998" + ] + ], + "title": "", + "original_id": "1d89eced1aa8f63f0c2c2cce640a2209" + }, + { + "_id": "7a5f2515e383101b3c6803f34c71070d", + "header": [ + "year", + "total support and revenue", + "total expenses", + "increase in net assets", + "net assets at end of year" + ], + "rows": [ + [ + "2003 / 2004", + "80129", + "23463", + "56666", + "56666" + ], + [ + "2004 / 2005", + "379088", + "177670", + "211418", + "268084" + ], + [ + "2005 / 2006", + "1508039", + "791907", + "736132", + "1004216" + ], + [ + "2006 / 2007", + "2734909", + "2077843", + "654066", + "1658282" + ], + [ + "2007 / 2008", + "5032981", + "3540724", + "3519886", + "5178168" + ], + [ + "2008 / 2009", + "8658006", + "5617236", + "3053599", + "8231767" + ], + [ + "2009 / 2010", + "17979312", + "10266793", + "6310964", + "14542731" + ], + [ + "2010 / 2011", + "24785092", + "17889794", + "9649413", + "24192144" + ], + [ + "2011 / 2012", + "38479665", + "29260652", + "10736914", + "34929058" + ] + ], + "title": "", + "original_id": "85f02843832ba639726c2aed89720e35" + }, + { + "_id": "4283e79d0b55d6c7c14b1002f504151c", + "header": [ + "length (feet)", + "year", + "make and model", + "floor type", + "number of seats", + "bicycle capacity", + "fuel propulsion", + "quantity" + ], + "rows": [ + [ + "30", + "2001", + "novabus rts", + "high", + "27", + "2", + "diesel", + "4" + ], + [ + "35", + "2010", + "new flyer de35lf", + "low", + "29", + "3", + "diesel - electric hybrid", + "7" + ], + [ + "40", + "2000", + "novabus rts", + "high", + "39", + "3", + "diesel", + "14" + ], + [ + "40", + "2003", + "orion bus industries v", + "high", + "41", + "3", + "diesel", + "80" + ], + [ + "45", + "1999", + "mci 102dl3", + "high", + "57", + "2", + "diesel", + "14" + ], + [ + "45", + "2003", + "mci d4500", + "high", + "57", + "2", + "diesel", + "6" + ], + [ + "45", + "2010 , 2012", + "mci d4500ct", + "high", + "57", + "2", + "diesel", + "55" + ], + [ + "60 ( articulated )", + "2007", + "new flyer d60lf", + "low", + "58", + "3", + "diesel", + "10" + ] + ], + "title": "", + "original_id": "0cb2dc3734b6343b4e1c97761f1fbb03" + }, + { + "_id": "b9105262c20c78f35126500b512867e2", + "header": [ + "year", + "bötzow", + "schwante", + "vehlefanz", + "neu - vehlefanz", + "marwitz", + "bärenklau", + "eichstädt" + ], + "rows": [ + [ + "2004", + "2.785", + "1.983", + "1.771", + "340", + "1.407", + "1.291", + "942" + ], + [ + "2005", + "2.904", + "1.997", + "1.777", + "348", + "1.4", + "1.294", + "939" + ], + [ + "2006", + "2.973", + "2.061", + "1.814", + "391", + "1.432", + "1.33", + "926" + ], + [ + "2007", + "2.947", + "2.061", + "1.821", + "379", + "1.435", + "1.313", + "929" + ], + [ + "2008", + "2.937", + "2.043", + "1.8", + "355", + "1.398", + "1.294", + "876" + ], + [ + "2009", + "2.967", + "2.039", + "1.759", + "365", + "1.417", + "1.27", + "848" + ], + [ + "2010", + "2.981", + "2.089", + "1.765", + "385", + "1.429", + "1.288", + "850" + ] + ], + "title": "", + "original_id": "8dcdb337eb9607dcb80c77dae5ac6e20" + }, + { + "_id": "aabfb55d8826ca4b53e6cd0ed0720557", + "header": [ + "year", + "political rights", + "civil liberties", + "status", + "president" + ], + "rows": [ + [ + "1972", + "7", + "7", + "not free", + "idi amin" + ], + [ + "1973", + "7", + "7", + "not free", + "idi amin" + ], + [ + "1974", + "7", + "7", + "not free", + "idi amin" + ], + [ + "1975", + "7", + "7", + "not free", + "idi amin" + ], + [ + "1976", + "7", + "7", + "not free", + "idi amin" + ], + [ + "1977", + "7", + "7", + "not free", + "idi amin" + ], + [ + "1978", + "7", + "7", + "not free", + "idi amin" + ], + [ + "1979", + "6", + "6", + "not free", + "idi amin" + ], + [ + "1980", + "4", + "4", + "not free", + "godfrey binaisa" + ], + [ + "1981", + "5", + "5", + "partly free", + "milton obote" + ], + [ + "1982", + "5", + "5", + "partly free", + "milton obote" + ], + [ + "1983", + "4", + "5", + "partly free", + "milton obote" + ], + [ + "1984", + "4", + "5", + "partly free", + "milton obote" + ], + [ + "1985", + "5", + "4", + "partly free", + "milton obote" + ], + [ + "1986", + "5", + "4", + "partly free", + "tito okello" + ], + [ + "1987", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "1988", + "5", + "5", + "partly free", + "yoweri museveni" + ], + [ + "1989", + "6", + "4", + "partly free", + "yoweri museveni" + ], + [ + "1990", + "6", + "5", + "partly free", + "yoweri museveni" + ], + [ + "1991", + "6", + "6", + "not free", + "yoweri museveni" + ], + [ + "1992", + "6", + "5", + "not free", + "yoweri museveni" + ], + [ + "1993", + "6", + "5", + "not free", + "yoweri museveni" + ], + [ + "1994", + "5", + "5", + "partly free", + "yoweri museveni" + ], + [ + "1995", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "1996", + "4", + "4", + "partly free", + "yoweri museveni" + ], + [ + "1997", + "4", + "4", + "partly free", + "yoweri museveni" + ], + [ + "1998", + "4", + "4", + "partly free", + "yoweri museveni" + ], + [ + "1999", + "5", + "5", + "partly free", + "yoweri museveni" + ], + [ + "2000", + "6", + "5", + "partly free", + "yoweri museveni" + ], + [ + "2001", + "6", + "5", + "partly free", + "yoweri museveni" + ], + [ + "2002", + "6", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2003", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2004", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2005", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2006", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2007", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2008", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2009", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2010", + "5", + "4", + "partly free", + "yoweri museveni" + ], + [ + "2011", + "5", + "4", + "free", + "yoweri museveni" + ] + ], + "title": "", + "original_id": "912908fb008a8e1d4fd9e79bfc7abd07" + }, + { + "_id": "196ea85a358308f31e5d67fb98bf0996", + "header": [ + "year", + "population", + "Catholics (based on registration by the church itself)", + "Percentage (based on registration by the church itself)" + ], + "rows": [ + [ + "1970", + "12,957,621", + "5,320,000", + "40.5" + ], + [ + "1980", + "14,091,014", + "5,620,000", + "39.5" + ], + [ + "1990", + "14,892,574", + "5,560,000", + "37.0" + ], + [ + "1995", + "15,424,122", + "5,385,258", + "34.8" + ], + [ + "2000", + "15,863,950", + "5,060,413", + "31.6" + ], + [ + "2005", + "16,305,526", + "4,406,000", + "27.0" + ], + [ + "2010", + "16,574,989", + "4,166,000", + "25.0" + ], + [ + "2015", + "16,900,726", + "3,882,000", + "22.9" + ], + [ + "2016", + "16,979,120", + "3,832,000", + "22.4" + ], + [ + "2017", + "17,081,057", + "3,769,000", + "21.9" + ] + ], + "title": "", + "original_id": "a9c67600eb25ab046e30bae4b5075d92" + }, + { + "_id": "fa29b9ee33f4d3ff21810d4eac2ead5e", + "header": [ + "Player", + "Games Played", + "Field Goals", + "Free Throws", + "Points" + ], + "rows": [ + [ + "Ralf Woods", + "16", + "54", + "70", + "178" + ], + [ + "Clyde Alwood", + "15", + "57", + "0", + "114" + ], + [ + "Ernest McKay", + "15", + "39", + "3", + "81" + ], + [ + "Ray Woods", + "16", + "19", + "0", + "38" + ], + [ + "John Felmley", + "6", + "7", + "4", + "18" + ], + [ + "George Halas", + "11", + "5", + "0", + "10" + ], + [ + "R.C. Haas", + "3", + "1", + "0", + "2" + ], + [ + "Gordon Otto", + "4", + "1", + "0", + "2" + ] + ], + "title": "", + "original_id": "9ab870fb9dbf99e35b45ed0809178a22" + }, + { + "_id": "ce6f1cac5d0cd168295fb75929a16268", + "header": [ + "ship", + "13.5 - inch / 1400lb", + "13.5 - inch / 1250lb", + "12 - inch", + "total" + ], + "rows": [ + [ + "lützow", + "0", + "2", + "8", + "10" + ], + [ + "derfflinger", + "0", + "0", + "3", + "3" + ], + [ + "seydlitz", + "0", + "0", + "1", + "1" + ], + [ + "könig", + "7", + "1", + "0", + "8" + ], + [ + "markgraf", + "0", + "1", + "0", + "1" + ], + [ + "total", + "7", + "4", + "12", + "23" + ] + ], + "title": "", + "original_id": "c1636b31680a83b5463cbc8c13e26500" + }, + { + "_id": "87962ab7674090dea6153e95e6e31ad0", + "header": [ + "rank", + "company", + "revenues (us billion)", + "profit (us billion)", + "assets (us billion)", + "market value (us billion)" + ], + "rows": [ + [ + "1", + "national bank of greece", + "10.4", + "- 16", + "137.0", + "1.0" + ], + [ + "2", + "bank of greece", + "5.4", + "0.3", + "210.7", + "0.4" + ], + [ + "3", + "coca cola hbc", + "9.3", + "0.3", + "9.5", + "10.2" + ], + [ + "4", + "hellenic telecom", + "6.2", + "0.6", + "10.7", + "3.7" + ], + [ + "5", + "alpha bank", + "4.6", + "- 1.4", + "76.9", + "0.5" + ], + [ + "6", + "public power corporation", + "7.7", + "0", + "21.2", + "2.0" + ], + [ + "7", + "piraeus bank", + "3.9", + "- 8.6", + "62.5", + "0.3" + ], + [ + "8", + "hellenic petroleum", + "13.8", + "0.1", + "9.7", + "3.3" + ], + [ + "9", + "opap", + "5.2", + "0.7", + "2.3", + "2.8" + ], + [ + "10", + "motor oil", + "12.8", + "0.1", + "3.4", + "1.2" + ] + ], + "title": "", + "original_id": "839734f9a3d8150f3099c50c3280af75" + }, + { + "_id": "4e006f87d4ba1c4e072f2a36fbc1daee", + "header": [ + "no in series", + "no in season", + "title", + "directed by", + "written by", + "original air date", + "prod no", + "viewers (millions)" + ], + "rows": [ + [ + "25", + "1", + "human traffic", + "james whitmore , jr", + "shane brennan", + "september 21 , 2010", + "201", + "15.76" + ], + [ + "26", + "2", + "black widow", + "kate woods", + "dave kalstein", + "september 21 , 2010", + "202", + "13.6" + ], + [ + "27", + "3", + "borderline", + "terrence o'hara", + "r scott gemmill", + "september 28 , 2010", + "203", + "16.51" + ], + [ + "28", + "4", + "special delivery", + "tony wharmby", + "gil grant", + "october 5 , 2010", + "204", + "16.15" + ], + [ + "29", + "5", + "little angels", + "steven depaul", + "frank military", + "october 12 , 2010", + "205", + "16.05" + ], + [ + "30", + "6", + "standoff", + "dennis smith", + "joseph c wilson", + "october 19 , 2010", + "206", + "16.0" + ], + [ + "31", + "7", + "anonymous", + "norberto barba", + "christina m kim", + "october 26 , 2010", + "207", + "15.99" + ], + [ + "32", + "8", + "bounty", + "felix alcala", + "dave kalstein", + "november 9 , 2010", + "208", + "15.61" + ], + [ + "33", + "9", + "absolution", + "steven depaul", + "r scott gemmill", + "november 16 , 2010", + "209", + "15.81" + ], + [ + "34", + "10", + "deliverance", + "tony wharmby", + "frank military and shane brennan", + "november 23 , 2010", + "210", + "14.96" + ], + [ + "35", + "11", + "disorder", + "jonathan frakes", + "gil grant and david kalstien", + "december 14 , 2010", + "211", + "16.82" + ], + [ + "36", + "12", + "overwatch", + "karen gaviola", + "lindsay jewett sturman", + "january 11 , 2011", + "212", + "18.13" + ], + [ + "37", + "13", + "archangel", + "tony wharmby", + "r scott gemmill and shane brennan", + "january 18 , 2011", + "213", + "17.29" + ], + [ + "38", + "14", + "lockup", + "jan eliasberg", + "christina m kim and frank military", + "february 1 , 2011", + "214", + "17.7" + ], + [ + "39", + "15", + "tin soldiers", + "terrence o'hara", + "r scott gemmill", + "february 8 , 2011", + "215", + "17.16" + ], + [ + "40", + "16", + "empty quiver", + "james whitmore", + "dave kalstein", + "february 15 , 2011", + "216", + "16.8" + ], + [ + "41", + "17", + "personal", + "kate woods", + "joseph c wilson", + "february 22 , 2011", + "217", + "18.69" + ], + [ + "42", + "18", + "harm 's way", + "tony wharmby", + "shane brennan", + "march 1 , 2011", + "218", + "15.67" + ], + [ + "43", + "19", + "enemy within", + "steven depaul", + "lindsay jewett sturman", + "march 22 , 2011", + "219", + "16.56" + ], + [ + "44", + "20", + "the job", + "terrence o'hara", + "frank military and christina m kim", + "march 29 , 2011", + "220", + "15.34" + ], + [ + "45", + "21", + "rocket man", + "dennis smith", + "roger director", + "april 12 , 2011", + "221", + "15.46" + ], + [ + "46", + "22", + "plan b", + "james whitmore , jr", + "dave kalstein and joseph c wilson", + "may 3 , 2011", + "222", + "14.16" + ], + [ + "47", + "23", + "imposters", + "john p kousakis", + "r scott gemmill", + "may 10 , 2011", + "223", + "14.74" + ] + ], + "title": "", + "original_id": "80ec47226c5b0cbb341420c031fe2f81" + }, + { + "_id": "bc53deb312ade503dbcde4645100d5c5", + "header": [ + "rating", + "share", + "rating / share (18 - 49)", + "viewers (millions)", + "rank (overall)" + ], + "rows": [ + [ + "5.4", + "9", + "2.6 / 7", + "9.2", + "27" + ], + [ + "4.4", + "7", + "2.6 / 6", + "7.81", + "34" + ], + [ + "6.6", + "11", + "3.0 / 8", + "10.6", + "18" + ], + [ + "6.1", + "10", + "3.1 / 8", + "10.13", + "28" + ], + [ + "5.9", + "10", + "3.1 / 8", + "10.33", + "26" + ], + [ + "7.2", + "11", + "3.2 / 8", + "12.42", + "15" + ], + [ + "7.1", + "11", + "3.8 / 10", + "11.97", + "12" + ], + [ + "6.2", + "10", + "2.9 / 8", + "10.58", + "18" + ], + [ + "6.1", + "10", + "n / a", + "10.31", + "20" + ], + [ + "6.0", + "10", + "n / a", + "10.27", + "17" + ], + [ + "6.8", + "9", + "2.0 / 7", + "10.84", + "20" + ], + [ + "7.6", + "10", + "n / a", + "12.49", + "19" + ] + ], + "title": "", + "original_id": "07ff0047fb0924e84ec62261007e0902" + }, + { + "_id": "50ad0c344fa2b715c5a07c25263de0a3", + "header": [ + "rank", + "airport", + "total passengers", + "% change 2006 / 2007", + "international passengers", + "domestic passengers", + "transit passengers", + "aircraft movements", + "freight (metric tonnes)" + ], + "rows": [ + [ + "1", + "london heathrow", + "68066028", + "0.8%", + "62098911", + "5753476", + "213641", + "481476", + "1310987" + ], + [ + "2", + "london gatwick", + "35216113", + "3.1%", + "31142002", + "4023402", + "50709", + "266550", + "171078" + ], + [ + "3", + "london stansted", + "23779697", + "0.4%", + "21204946", + "2554304", + "20447", + "208462", + "203747" + ], + [ + "4", + "manchester", + "22112625", + "1.5%", + "18662468", + "3229255", + "220902", + "222703", + "165366" + ], + [ + "5", + "london luton", + "9927321", + "5.3%", + "8427894", + "1491467", + "7960", + "120238", + "38095" + ], + [ + "6", + "birmingham airport", + "9226340", + "0.9%", + "7592240", + "1541815", + "92285", + "114679", + "13585" + ], + [ + "7", + "edinburgh", + "9047558", + "5.1%", + "3417891", + "5619309", + "10358", + "128172", + "19292" + ], + [ + "8", + "glasgow international", + "8795727", + "0.6%", + "4131512", + "4594575", + "69640", + "108305", + "4276" + ], + [ + "9", + "bristol", + "5926774", + "2.9%", + "4608290", + "1275566", + "42918", + "76428", + "20" + ], + [ + "10", + "newcastle", + "5650716", + "4.0%", + "3948594", + "1675013", + "27109", + "79200", + "785" + ], + [ + "11", + "liverpool", + "5468510", + "10.2%", + "4636149", + "827085", + "5276", + "86668", + "3709" + ], + [ + "12", + "east midlands", + "5413360", + "14.5%", + "4709855", + "696649", + "6856", + "93989", + "274753" + ], + [ + "13", + "belfast international", + "5272664", + "4.6%", + "1788807", + "3447248", + "36609", + "77395", + "38429" + ], + [ + "14", + "aberdeen", + "3412257", + "7.8%", + "1475988", + "1935152", + "1117", + "121927", + "3434" + ], + [ + "15", + "london city", + "2912123", + "23.5%", + "2214884", + "697239", + "0", + "91177", + "0" + ], + [ + "16", + "leeds bradford", + "2881539", + "3.2%", + "2229283", + "630575", + "21681", + "65249", + "109" + ], + [ + "17", + "glasgow prestwick", + "2422332", + "1.0%", + "1827592", + "593117", + "1623", + "47910", + "31517" + ], + [ + "18", + "belfast city", + "2186993", + "3.9%", + "93547", + "2093320", + "126", + "43022", + "1057" + ], + [ + "19", + "cardiff", + "2111148", + "4.3%", + "1665247", + "428260", + "17641", + "43963", + "2391" + ] + ], + "title": "", + "original_id": "aa9a653502bd85c8923c87279499a902" + }, + { + "_id": "4887619ae03885c4cac73e9bb74be126", + "header": [ + "School", + "2007", + "2008", + "2009", + "2010", + "2011" + ], + "rows": [ + [ + "Francisco Bravo Medical Magnet High School", + "807.0", + "818", + "815", + "820", + "832.0" + ], + [ + "Marc and Eva Stern Math and Science School", + "718.0", + "792", + "788", + "788", + "809.0" + ], + [ + "Oscar De La Hoya Animo Charter High School", + "662.0", + "726", + "709", + "710", + "744.0" + ], + [ + "James A. Garfield High School", + "553.0", + "597", + "593", + "632", + "705.0" + ], + [ + "Abraham Lincoln High School", + "594.0", + "609", + "588", + "616", + "643.0" + ], + [ + "Woodrow Wilson High School", + "582.0", + "585", + "600", + "615", + "636.0" + ], + [ + "Theodore Roosevelt High School", + "557.0", + "551", + "576", + "608", + null + ], + [ + "Thomas Jefferson High School", + "457.0", + "516", + "514", + "546", + "546.0" + ], + [ + "Santee Education Complex", + null, + "502", + "521", + "552", + "565.0" + ] + ], + "title": "", + "original_id": "63778f1c58e40f5f1d126bdcb4c30665" + }, + { + "_id": "ab434520f842c54970bd5f9b04bea54c", + "header": [ + "class", + "wheel arrangement", + "railway", + "number at doncaster", + "number at pyewipe", + "number at march" + ], + "rows": [ + [ + "d13", + "4 - 4 - 0", + "ger", + "3", + "3", + "6" + ], + [ + "d14", + "4 - 4 - 0", + "ger", + "0", + "0", + "1" + ], + [ + "d15", + "4 - 4 - 0", + "ger", + "1", + "0", + "4" + ], + [ + "e4", + "2 - 4 - 0", + "ger", + "1", + "0", + "4" + ], + [ + "j14", + "0 - 6 - 0", + "ger", + "0", + "0", + "1" + ], + [ + "j15", + "0 - 6 - 0", + "ger", + "0", + "3", + "17" + ], + [ + "j16", + "0 - 6 - 0", + "ger", + "0", + "1", + "7" + ], + [ + "j17", + "0 - 6 - 0", + "ger", + "0", + "2", + "15" + ], + [ + "j18", + "0 - 6 - 0", + "ger", + "0", + "0", + "7" + ], + [ + "j19", + "0 - 6 - 0", + "ger", + "0", + "0", + "8" + ], + [ + "j20", + "0 - 6 - 0", + "ger", + "0", + "0", + "14" + ], + [ + "j66", + "0 - 6 - 0t", + "ger", + "0", + "3", + "10" + ], + [ + "j67", + "0 - 6 - 0t", + "ger", + "0", + "0", + "1" + ], + [ + "j68", + "0 - 6 - 0t", + "ger", + "0", + "0", + "1" + ] + ], + "title": "", + "original_id": "5fff0c0fb4be0e28ec40c3b1dcbcd84b" + }, + { + "_id": "044e4cdbedef55274d201e851cd65c00", + "header": [ + "university", + "established as a university", + "first establishment", + "student population ( fte , 2009)", + "research grants (2009 , in billion sek )" + ], + "rows": [ + [ + "uppsala university", + "1477", + "1477", + "20450", + "3.265" + ], + [ + "lund university", + "1666", + "1666", + "28554", + "3.975" + ], + [ + "university of gothenburg", + "1954", + "1891", + "24900", + "2.999" + ], + [ + "stockholm university", + "1960", + "1878", + "28200", + "2.203" + ], + [ + "karolinska institutet", + "1965", + "1810", + "5500", + "4.027" + ], + [ + "umeå university", + "1965", + "1965", + "15850", + "1.977" + ], + [ + "royal institute of technology", + "1970", + "1827", + "11950", + "2.033" + ], + [ + "linköping university", + "1975", + "1969", + "17200", + "1.516" + ], + [ + "swedish university of agricultural sciences", + "1977", + "1775", + "3600", + "1.812" + ], + [ + "luleå university of technology", + "1997", + "1971", + "6350", + "0.711" + ], + [ + "karlstad university", + "1999", + "1977", + "7750", + "0.303" + ], + [ + "örebro university", + "1999", + "1977", + "8600", + "0.342" + ], + [ + "mid sweden university", + "2005", + "1993", + "7600", + "0.333" + ] + ], + "title": "", + "original_id": "7b2b22eab80f669caa57a1b8887c6684" + }, + { + "_id": "a4b6cb83a76c0fe81b0776753047195a", + "header": [ + "Pump type and source", + "Typical use", + "35 °C\n(e.g. heated screed floor)", + "45 °C\n(e.g. heated screed floor)", + "55 °C\n(e.g. heated timber floor)", + "65 °C\n(e.g. radiator or DHW)", + "75 °C\n(e.g. radiator and DHW)", + "85 °C\n(e.g. radiator and DHW)" + ], + "rows": [ + [ + "High-efficiency air source heat pump (ASHP), air at −20 °C", + null, + "2.2", + "2.0", + "‐", + "‐", + "‐", + "‐" + ], + [ + "Two-stage ASHP, air at −20 °C", + "Low source temperature", + "2.4", + "2.2", + "1.9", + "‐", + "‐", + "‐" + ], + [ + "High efficiency ASHP, air at 0 °C", + "Low output temperature", + "3.8", + "2.8", + "2.2", + "2.0", + "‐", + "‐" + ], + [ + "Prototype transcritical CO\n2 (R744) heat pump with tripartite gas cooler, source at 0 °C", + "High output temperature", + "3.3", + "‐", + "‐", + "4.2", + "‐", + "3.0" + ], + [ + "Ground source heat pump (GSHP), water at 0 °C", + null, + "5.0", + "3.7", + "2.9", + "2.4", + "‐", + "‐" + ], + [ + "GSHP, ground at 10 °C", + "Low output temperature", + "7.2", + "5.0", + "3.7", + "2.9", + "2.4", + "‐" + ], + [ + "Theoretical Carnot cycle limit, source −20 °C", + null, + "5.6", + "4.9", + "4.4", + "4.0", + "3.7", + "3.4" + ], + [ + "Theoretical Carnot cycle limit, source 0 °C", + null, + "8.8", + "7.1", + "6.0", + "5.2", + "4.6", + "4.2" + ], + [ + "Theoretical Lorentzen cycle limit (CO\n2 pump), return fluid 25 °C, source 0 °C", + null, + "10.1", + "8.8", + "7.9", + "7.1", + "6.5", + "6.1" + ], + [ + "Theoretical Carnot cycle limit, source 10 °C", + null, + "12.3", + "9.1", + "7.3", + "6.1", + "5.4", + "4.8" + ] + ], + "title": "", + "original_id": "269d45d8e00d4b4d76981406ea14ce69" + }, + { + "_id": "bfec566a18b0c68147fc42f739b56161", + "header": [ + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "Measure unit", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)" + ], + "rows": [ + [ + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "Measure unit", + "TOTAL", + "0–9", + "10–19", + "20–29", + "30–39", + "40–49", + "50–59", + "60–69", + "70–79", + "80 +" + ], + [ + "I.", + "TOTAL", + "TOTAL", + "TOTAL", + "TOTAL", + "person", + "156", + "21", + "38", + "17", + "17", + "22", + "15", + "10", + "10", + "6" + ], + [ + "I.", + "—", + "of which in", + "of which in", + "of which in", + "%", + "100", + "13.5", + "24.4", + "10.9", + "10.9", + "14.1", + "9.6", + "6.4", + "6.4", + "3.8" + ], + [ + "I.", + "1.", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX" + ], + [ + "I.", + "1.", + "A.", + "Males", + "Males", + "person", + "74", + "13", + "16", + "10", + "8", + "10", + "9", + "4", + "3", + "1" + ], + [ + "I.", + "1.", + "A.", + "—", + "of which in", + "%", + "47.4", + "8.3", + "10.3", + "6.4", + "5.1", + "6.4", + "5.8", + "2.6", + "1.9", + "0.6" + ], + [ + "I.", + "1.", + "B.", + "Females", + "Females", + "person", + "82", + "8", + "22", + "7", + "9", + "12", + "6", + "6", + "7", + "5" + ], + [ + "I.", + "1.", + "B.", + "—", + "of which in", + "%", + "52.6", + "5.1", + "14.1", + "4.5", + "5.8", + "7.7", + "3.8", + "3.8", + "4.5", + "3.2" + ] + ], + "title": "", + "original_id": "0e6bfa743fe904ddbfc8db43b39bfb3d" + }, + { + "_id": "cf3bbeaa045a608bc774f241d7e856c4", + "header": [ + "province", + "population (2004 estimate)", + "area (km square)", + "density", + "gdp (2003 , pps in mil )", + "gdp per cap (2003 , in )" + ], + "rows": [ + [ + "south holland", + "3453000", + "2860", + "1207.3", + "95868", + "27825" + ], + [ + "north holland", + "2583900", + "2660", + "971.4", + "65295", + "27169" + ], + [ + "utrecht", + "1159200", + "1356", + "854.9", + "38355", + "33148" + ], + [ + "limburg", + "1143000", + "2167", + "527.5", + "28038", + "24585" + ], + [ + "north brabant", + "2406900", + "4938", + "487.4", + "65295", + "27169" + ], + [ + "gelderland", + "1967600", + "4995", + "393.9", + "45043", + "22942" + ], + [ + "overijssel", + "1105800", + "3337", + "331.4", + "25854", + "23441" + ], + [ + "flevoland", + "356400", + "1426", + "249.9", + "6915", + "19439" + ], + [ + "groningen", + "575900", + "2344", + "245.7", + "18496", + "32245" + ], + [ + "zeeland", + "378300", + "1792", + "211.1", + "9354", + "24706" + ], + [ + "friesland", + "642500", + "3361", + "191.2", + "13989", + "21830" + ], + [ + "drenthe", + "482300", + "2652", + "181.9", + "10323", + "21427" + ] + ], + "title": "", + "original_id": "020c4e86f2a942c2b0dbebb4919584d2" + }, + { + "_id": "2ff576acb49ed4b97f8ed3921a6d169b", + "header": [ + "rank", + "peak", + "country", + "island", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "1", + "finisterre range high point", + "papua new guinea", + "new guinea", + "4175", + "3734", + "441" + ], + [ + "2", + "mount suckling", + "papua new guinea", + "new guinea", + "3676", + "2976", + "700" + ], + [ + "3", + "mount wilhelm", + "papua new guinea", + "new guinea", + "4509", + "2969", + "1540" + ], + [ + "4", + "mount victoria", + "papua new guinea", + "new guinea", + "4038", + "2738", + "1300" + ], + [ + "5", + "mount balbi", + "papua new guinea", + "bougainville island", + "2715", + "2715", + "0" + ], + [ + "6", + "mount oiautukekea", + "papua new guinea", + "goodenough island", + "2536", + "2536", + "0" + ], + [ + "7", + "mount giluwe", + "papua new guinea", + "new guinea", + "4367", + "2507", + "1860" + ], + [ + "8", + "new ireland high point", + "papua new guinea", + "new ireland", + "2340", + "2340", + "0" + ], + [ + "9", + "mount ulawun", + "papua new guinea", + "new britain", + "2334", + "2334", + "0" + ], + [ + "10", + "mount kabangama", + "papua new guinea", + "new guinea", + "4104", + "2284", + "1820" + ], + [ + "11", + "nakanai mountains high point", + "papua new guinea", + "new britain", + "2316", + "2056", + "260" + ], + [ + "12", + "mount kilkerran", + "papua new guinea", + "fergusson island", + "1947", + "1947", + "0" + ], + [ + "13", + "mount piora", + "papua new guinea", + "new guinea", + "3557", + "1897", + "1660" + ], + [ + "14", + "mount bosavi", + "papua new guinea", + "new guinea", + "2507", + "1887", + "620" + ], + [ + "15", + "mount karoma", + "papua new guinea", + "new guinea", + "3623", + "1883", + "1740" + ], + [ + "16", + "mount simpson", + "papua new guinea", + "new guinea", + "2883", + "1863", + "1020" + ], + [ + "17", + "mount kunugui", + "papua new guinea", + "karkar island", + "1833", + "1833", + "0" + ], + [ + "18", + "mount victory", + "papua new guinea", + "new guinea", + "1891", + "1831", + "60" + ], + [ + "19", + "manam high point", + "papua new guinea", + "manam", + "1807", + "1807", + "0" + ], + [ + "20", + "mount michael", + "papua new guinea", + "new guinea", + "3647", + "1787", + "1860" + ], + [ + "21", + "mount talawe", + "papua new guinea", + "new britain", + "1824", + "1773", + "51" + ], + [ + "22", + "barurumea ridge", + "papua new guinea", + "new britain", + "2063", + "1723", + "340" + ], + [ + "23", + "mount sarawaget", + "papua new guinea", + "new guinea", + "4121", + "1701", + "2420" + ], + [ + "24", + "bewani mountains high point", + "papua new guinea", + "new guinea", + "1980", + "1664", + "316" + ], + [ + "25", + "mount bel", + "papua new guinea", + "umboi island", + "1658", + "1658", + "0" + ], + [ + "26", + "unnamed summit", + "papua new guinea", + "new britain", + "1951", + "1651", + "300" + ], + [ + "27", + "mount maybole", + "papua new guinea", + "fergusson island", + "1665", + "1597", + "68" + ], + [ + "28", + "adelbert range high point", + "papua new guinea", + "new guinea", + "1716", + "1576", + "140" + ], + [ + "29", + "sibium mountains high point", + "papua new guinea", + "new guinea", + "2295", + "1555", + "740" + ], + [ + "30", + "mount shungol", + "papua new guinea", + "new guinea", + "2752", + "1518", + "1234" + ], + [ + "31", + "mount taraka", + "papua new guinea", + "bougainville island", + "2251", + "1511", + "740" + ] + ], + "title": "", + "original_id": "f70dbcddfad0dc93b70e326d3001cb0c" + }, + { + "_id": "119237f299f70f62a6aaa9fd1082bcee", + "header": [ + "rd", + "pick", + "player", + "team (league)", + "reg gp", + "pl gp" + ], + "rows": [ + [ + "2", + "23", + "ron sedlbauer", + "kitchener rangers ( oha )", + "325", + "10" + ], + [ + "3", + "41", + "john hughes", + "toronto marlboros ( oha )", + "52", + "4" + ], + [ + "4", + "59", + "harold snepsts", + "edmonton oil kings ( wchl )", + "781", + "44" + ], + [ + "5", + "77", + "mike rogers", + "calgary centennials ( wchl )", + "0", + "0" + ], + [ + "6", + "95", + "andy spruce", + "london knights ( oha )", + "51", + "0" + ], + [ + "7", + "113", + "jim clarke", + "toronto marlboros ( oha )", + "0", + "0" + ], + [ + "8", + "130", + "robbie watt", + "flin flon bombers ( wchl )", + "0", + "0" + ], + [ + "9", + "147", + "marc gaudreault", + "lake superior state university ( ncaa )", + "0", + "0" + ] + ], + "title": "", + "original_id": "ac040e9638b60682e8102d7bcfc4a8f7" + }, + { + "_id": "94646de7ec23696f96ff5d0a1b42598f", + "header": [ + "institution", + "location", + "established", + "gained university status", + "vice - chancellor", + "total number of students", + "research funding (000)" + ], + "rows": [ + [ + "birkbeck , university of london", + "london", + "1823", + "1920", + "professor david latchman", + "19020", + "9985" + ], + [ + "university of east anglia", + "norwich", + "1963", + "1963", + "professor edward acton", + "19585", + "16482" + ], + [ + "university of essex", + "colchester", + "1964", + "1964", + "professor anthony forster", + "11690", + "9967" + ], + [ + "goldsmiths , university of london", + "london", + "1891", + "1904", + "dr pat loughrey", + "7615", + "8539" + ], + [ + "institute of education , university of london", + "london", + "1902", + "1932", + "professor chris husbands", + "7215", + "7734" + ], + [ + "university of lancaster", + "lancaster", + "1964", + "1964", + "professor mark smith", + "12695", + "18640" + ], + [ + "university of leicester", + "leicester", + "1921", + "1957", + "professor robert burgess", + "16160", + "22225" + ], + [ + "loughborough university", + "loughborough", + "1909", + "1966", + "professor robert allison", + "17825", + "22398" + ], + [ + "royal holloway , university of london", + "egham", + "1849", + "1900", + "professor paul layzell (principal)", + "7620", + "13699" + ], + [ + "soas , university of london", + "london", + "1916", + "1916", + "professor paul webley", + "4525", + "7238" + ], + [ + "university of sussex", + "brighton", + "1961", + "1961", + "professor michael farthing", + "12415", + "16196" + ] + ], + "title": "", + "original_id": "426ece7cddb74096a231a636656e3cd3" + }, + { + "_id": "134c03580363d22107186bac746ce31a", + "header": [ + "rank", + "english title", + "chinese title", + "average", + "peak", + "premiere", + "finale", + "hk viewers" + ], + "rows": [ + [ + "1", + "the family link", + "師奶兵團", + "33", + "42", + "31", + "33", + "2.12 million" + ], + [ + "2", + "fathers and sons", + "爸爸閉翳", + "32", + "40", + "31", + "37", + "2.11 million" + ], + [ + "3", + "heart of greed", + "溏心風暴", + "32", + "48", + "29", + "40", + "2.08 million" + ], + [ + "4", + "ten brothers", + "十兄弟", + "32", + "39", + "29", + "36", + "2.05 million" + ], + [ + "5", + "on the first beat", + "學警出更", + "31", + "38", + "30", + "35", + "2.03 million" + ], + [ + "6", + "the green grass of home", + "緣來自有機", + "31", + "36", + "29", + "33", + "2.01 million" + ], + [ + "7", + "dicey business", + "賭場風雲", + "31", + "37", + "30", + "34", + "1.99 million" + ], + [ + "8", + "steps", + "舞動全城", + "31", + "36", + "31", + "32", + "1.98 million" + ], + [ + "9", + "the drive of life", + "歲月風雲", + "30", + "39", + "31", + "33", + "1.97 million" + ] + ], + "title": "", + "original_id": "9c3b3255f540891cedc76da5e251d40f" + }, + { + "_id": "3ab7010a2a513395340a022ed743300e", + "header": [ + "rank", + "company", + "country", + "industry", + "sales (billion )", + "profits (billion )", + "assets (billion )", + "market value (billion )" + ], + "rows": [ + [ + "1", + "citigroup", + "usa", + "banking", + "108.28", + "17.05", + "1 , 4.10", + "247.66" + ], + [ + "2", + "general electric", + "usa", + "conglomerates", + "152.36", + "16.59", + "750.33", + "372.14" + ], + [ + "3", + "american international group", + "usa", + "insurance", + "95.04", + "10.91", + "776.42", + "173.99" + ], + [ + "4", + "bank of america", + "usa", + "banking", + "65.45", + "14.14", + "1110.46", + "188.77" + ], + [ + "5", + "hsbc", + "uk", + "banking", + "62.97", + "9.52", + "1031.29", + "186.74" + ], + [ + "6", + "exxonmobil", + "usa", + "oil & gas", + "263.99", + "25.33", + "195.26", + "405.25" + ], + [ + "7", + "royal dutch shell", + "netherlands", + "oil & gas", + "265.19", + "18.54", + "193.83", + "221.49" + ], + [ + "8", + "bp", + "uk", + "oil & gas", + "285.06", + "15.73", + "191.11", + "231.88" + ], + [ + "9", + "ing group", + "netherlands", + "diversified financials", + "92.01", + "8.1", + "1175.16", + "68.04" + ], + [ + "10", + "toyota", + "japan", + "automotive", + "165.68", + "11.13", + "211.15", + "140.89" + ] + ], + "title": "", + "original_id": "394939e9fa1967642597a49620069b78" + }, + { + "_id": "537498b50c6bb2fc2ce88ed8b27fea2a", + "header": [ + "Rank", + "Magnitude", + "Death toll", + "Location", + "Depth (km)", + "Date" + ], + "rows": [ + [ + "1", + "7.6", + "0", + "Peru Madre de Dios Region, Peru", + "612.2", + "August 19" + ], + [ + "2", + "7.5", + "2", + "Japan Miyazaki Prefecture, Kyushu, Japan", + "35.0", + "February 26" + ], + [ + "2", + "7.5", + "0", + "Peru Ucayali Region, Peru", + "619.9", + "August 31" + ], + [ + "3", + "7.4", + "0", + "New Zealand Kermadec Islands, New Zealand", + "421.1", + "June 18" + ], + [ + "4", + "7.3", + "0", + "Indonesia Gulf of Tomini, Indonesia", + "144.8", + "March 28" + ], + [ + "4", + "7.3", + "0", + "Vanuatu Vanuatu", + "25.0", + "July 23" + ], + [ + "4", + "7.3", + "0", + "United Kingdom South Sandwich Islands", + "129.2", + "September 1" + ], + [ + "5", + "7.2", + "0", + "Japan off the east coast of Honshu, Japan", + "30.0", + "January 16" + ], + [ + "5", + "7.2", + "0", + "Peru Madre de Dios Region, Peru", + "597.5", + "August 31" + ], + [ + "6", + "7.1", + "0", + "Japan eastern Hokkaido, Japan", + "43.9", + "August 11" + ], + [ + "6", + "7.1", + "0", + "United Kingdom South Sandwich Islands", + "100.9", + "September 8" + ], + [ + "7", + "7.0", + "0", + "Japan off the east coast of Honshu, Japan", + "30.0", + "January 16" + ], + [ + "7", + "7.0", + "0", + "New Zealand Kermadec Islands, New Zealand", + "30.0", + "March 7" + ], + [ + "7", + "7.0", + "0", + "China southern Xinjiang Province, China", + "35.0", + "April 13" + ], + [ + "7", + "7.0", + "0", + "Japan Ryukyu Islands, Japan", + "30.6", + "July 18" + ] + ], + "title": "", + "original_id": "7bec36f08c73ba8d7e122f15b4736e19" + }, + { + "_id": "f5ac5bd722018815de00b67f8be02c79", + "header": [ + "government", + "federal excise tax ( cad / l )", + "total excise tax (cad / l)", + "minimum tax incl sales taxes (cad / l)", + "min tax (cad / us gal)" + ], + "rows": [ + [ + "canada (average)", + "10", + "24.5", + "25.3", + "95.8" + ], + [ + "newfoundland and labrador", + "10", + "26.5", + "29.9", + "113.2" + ], + [ + "prince edward island", + "10", + "25.8", + "27.0", + "102.2" + ], + [ + "nova scotia", + "10", + "25.5", + "29.3", + "110.9" + ], + [ + "new brunswick", + "10", + "23.6", + "26.7", + "101.1" + ], + [ + "québec excluding montréal", + "10", + "30.2", + "46.5", + "175.8" + ], + [ + "ontario", + "10", + "24.7", + "27.9", + "105.7" + ], + [ + "manitoba", + "10", + "24.0", + "22.6", + "85.6" + ], + [ + "saskatchewan", + "10", + "25.0", + "26.2", + "99.2" + ], + [ + "alberta", + "10", + "19.0", + "20.0", + "75.7" + ], + [ + "british columbia excluding vancouver and victoria", + "10", + "30.06", + "31.56", + "119.5" + ], + [ + "yukon", + "10", + "16.2", + "17.0", + "64.4" + ], + [ + "northwest territories", + "10", + "20.7", + "21.7", + "82.1" + ], + [ + "nunavut", + "10", + "20.7", + "21.7", + "82.1" + ], + [ + "montréal , qc", + "10", + "33.2", + "49.7", + "187.8" + ], + [ + "vancouver , bc", + "10", + "39.06", + "41.01", + "155.2" + ], + [ + "victoria , bc", + "10", + "33.56", + "35.24", + "133.4" + ] + ], + "title": "", + "original_id": "04cf2b8af2cc55d95cbf6e7103be20ae" + }, + { + "_id": "dcbc9152782e320444b9eea6cc2d4953", + "header": [ + "rank ( wjc )", + "rank (arda)", + "metro area", + "number of jews (wjc)", + "number of jews (asarb)" + ], + "rows": [ + [ + "1", + "1", + "new york city", + "1750000", + "2028200" + ], + [ + "2", + "3", + "miami", + "535000", + "337000" + ], + [ + "3", + "2", + "los angeles", + "490000", + "662450" + ], + [ + "4", + "4", + "philadelphia", + "254000", + "285950" + ], + [ + "5", + "6", + "chicago", + "248000", + "265400" + ], + [ + "6", + "8", + "san francisco", + "210000", + "218700" + ], + [ + "7", + "7", + "boston", + "208000", + "261100" + ] + ], + "title": "", + "original_id": "2c2b2f4c7e4731dc5f241888ad978878" + }, + { + "_id": "13d54233d58129944e88b34bd38e2a31", + "header": [ + "Works no.", + "Year built", + "NGR no.", + "SAR no.", + "SAR Class" + ], + "rows": [ + [ + "18829", + "1909", + "330", + "1446", + "3R" + ], + [ + "18830", + "1909", + "331", + "1447", + "3R" + ], + [ + "18831", + "1909", + "332", + "1448", + "3R" + ], + [ + "18832", + "1909", + "333", + "1449", + "3R" + ], + [ + "18833", + "1909", + "334", + "1450", + "3R" + ], + [ + "19217", + "1910", + "345", + "1451", + "3R" + ], + [ + "19218", + "1910", + "346", + "1452", + "3R" + ], + [ + "19219", + "1910", + "347", + "1453", + "3R" + ], + [ + "19220", + "1910", + "348", + "1454", + "3R" + ], + [ + "19221", + "1910", + "349", + "1455", + "3R" + ], + [ + "19222", + "1910", + "350", + "1456", + "3R" + ], + [ + "19223", + "1910", + "351", + "1457", + "3" + ], + [ + "19224", + "1910", + "352", + "1458", + "3R" + ], + [ + "19225", + "1910", + "353", + "1459", + "3R" + ], + [ + "19226", + "1910", + "354", + "1460", + "3R" + ], + [ + "19227", + "1910", + "355", + "1461", + "3R" + ], + [ + "19228", + "1910", + "356", + "1462", + "3R" + ], + [ + "19229", + "1910", + "357", + "1463", + "3R" + ], + [ + "19230", + "1910", + "358", + "1464", + "3R" + ], + [ + "19231", + "1910", + "359", + "1465", + "3R" + ], + [ + "19232", + "1910", + "360", + "1466", + "3R" + ], + [ + "19233", + "1910", + "361", + "1467", + "3R" + ], + [ + "19234", + "1910", + "362", + "1468", + "3R" + ], + [ + "19235", + "1910", + "363", + "1469", + "3R" + ], + [ + "19236", + "1910", + "364", + "1470", + "3R" + ], + [ + "19237", + "1910", + "365", + "1471", + "3R" + ], + [ + "19238", + "1910", + "366", + "1472", + "3R" + ], + [ + "19239", + "1910", + "367", + "1473", + "3R" + ], + [ + "19240", + "1910", + "368", + "1474", + "3R" + ], + [ + "19241", + "1910", + "369", + "1475", + "3R" + ] + ], + "title": "", + "original_id": "cc21a2e2ee8475bf4f2f7e6bc0021832" + }, + { + "_id": "5b83217da3b11fc221d63e9f48789c29", + "header": [ + "hand", + "1 credit", + "2 credits", + "3 credits", + "4 credits", + "5 credits" + ], + "rows": [ + [ + "natural royal flush", + "300", + "600", + "900", + "1200", + "4000" + ], + [ + "four deuces", + "200", + "400", + "600", + "800", + "1000" + ], + [ + "wild royal flush", + "25", + "50", + "75", + "100", + "125" + ], + [ + "five of a kind", + "15", + "30", + "45", + "60", + "75" + ], + [ + "straight flush", + "9", + "18", + "27", + "36", + "45" + ], + [ + "four of a kind", + "5", + "10", + "15", + "20", + "25" + ], + [ + "full house", + "3", + "6", + "9", + "12", + "15" + ], + [ + "flush", + "2", + "4", + "6", + "8", + "10" + ], + [ + "straight", + "2", + "4", + "6", + "8", + "10" + ], + [ + "three of a kind", + "1", + "2", + "3", + "4", + "5" + ] + ], + "title": "", + "original_id": "94a9383e2a483fdd061810759e892812" + }, + { + "_id": "ad19dcf559c03b4f9a979cb0c7117bdb", + "header": [ + "position", + "album title", + "artist", + "highest position", + "sales" + ], + "rows": [ + [ + "1", + "scissor sisters", + "scissor sisters", + "1", + "1594259" + ], + [ + "2", + "hopes and fears", + "keane", + "1", + "1593677" + ], + [ + "3", + "greatest hits", + "robbie williams", + "1", + "1530000" + ], + [ + "4", + "songs about jane", + "maroon 5", + "1", + "1495000" + ], + [ + "5", + "call off the search", + "katie melua", + "1", + "1350000" + ], + [ + "6", + "anastacia", + "anastacia", + "1", + "1110000" + ], + [ + "7", + "confessions", + "usher", + "1", + "1095000" + ], + [ + "8", + "encore", + "eminem", + "1", + "1077000" + ], + [ + "9", + "feels like home", + "norah jones", + "1", + "1000000" + ], + [ + "10", + "final straw", + "snow patrol", + "3", + "980000" + ], + [ + "11", + "il divo", + "il divo", + "1", + "960000" + ], + [ + "12", + "greatest hits", + "guns n' roses", + "1", + "920000" + ], + [ + "13", + "10 years of hits", + "ronan keating", + "1", + "870000" + ], + [ + "14", + "a grand don't come for free", + "the streets", + "1", + "869000" + ], + [ + "15", + "how to dismantle an atomic bomb", + "u2", + "1", + "855000" + ], + [ + "16", + "the soul sessions", + "joss stone", + "4", + "775000" + ], + [ + "17", + "franz ferdinand", + "franz ferdinand", + "3", + "770000" + ], + [ + "18", + "american idiot", + "green day", + "1", + "746364" + ], + [ + "19", + "unwritten", + "natasha bedingfield", + "1", + "680000" + ], + [ + "20", + "patience", + "george michael", + "1", + "660000" + ], + [ + "21", + "friday 's child", + "will young", + "1", + "640000" + ], + [ + "22", + "ultimate kylie", + "kylie minogue", + "4", + "595000" + ], + [ + "23", + "speakerboxxx / the love below", + "outkast", + "8", + "590000" + ], + [ + "24", + "allow us to be frank", + "westlife", + "3", + "585000" + ], + [ + "25", + "greatest hits : my prerogative", + "britney spears", + "2", + "585000" + ], + [ + "26", + "elephunk", + "the black eyed peas", + "3", + "580000" + ], + [ + "27", + "twentysomething", + "jamie cullum", + "3", + "565000" + ], + [ + "28", + "greatest hits", + "shania twain", + "6", + "545000" + ], + [ + "29", + "room on the third floor", + "mcfly", + "1", + "540000" + ], + [ + "30", + "life for rent", + "dido", + "1", + "520000" + ], + [ + "31", + "under my skin", + "avril lavigne", + "1", + "510000" + ], + [ + "32", + "o", + "damien rice", + "8", + "495000" + ], + [ + "33", + "mind body & soul", + "joss stone", + "1", + "490000" + ], + [ + "34", + "the college dropout", + "kanye west", + "12", + "455000" + ], + [ + "35", + "thank you", + "jamelia", + "4", + "425000" + ], + [ + "36", + "destiny fulfilled", + "destiny 's child", + "5", + "420000" + ], + [ + "37", + "best of", + "blue", + "6", + "415000" + ], + [ + "38", + "the best of", + "leann rimes", + "2", + "410000" + ], + [ + "39", + "love songs : a compilation old and new", + "phil collins", + "10", + "408000" + ], + [ + "40", + "the singles 1992 - 2003", + "no doubt", + "5", + "406000" + ] + ], + "title": "", + "original_id": "eb0fb4b94b11893ab0deabdb1ea670e5" + }, + { + "_id": "e350284db05bf4fa34a054f714490463", + "header": [ + "institution", + "location", + "founded", + "enrollment", + "nickname", + "varsity sports", + "joined" + ], + "rows": [ + [ + "college of idaho", + "caldwell , idaho (31041)", + "1891", + "1042", + "coyotes", + "17", + "1988" + ], + [ + "concordia university", + "portland , oregon (538554)", + "1905", + "3111", + "cavaliers", + "13", + "1988" + ], + [ + "corban university", + "salem , oregon (142914)", + "1935", + "1160", + "warriors", + "13", + "1988" + ], + [ + "eastern oregon university", + "la grande , oregon (12282)", + "1929", + "3743", + "mountaineers", + "10", + "1988" + ], + [ + "the evergreen state college", + "olympia , washington (44114)", + "1967", + "4509", + "geoducks", + "8", + "1999" + ], + [ + "northwest university", + "kirkland , washington (45814)", + "1934", + "1280", + "eagles", + "9", + "1997" + ], + [ + "northwest christian university", + "eugene , oregon (142185)", + "1895", + "1290", + "beacons", + "12", + "2007" + ], + [ + "oregon institute of technology", + "klamath falls , oregon (20840)", + "1947", + "3927", + "owls", + "9", + "1988" + ], + [ + "southern oregon university", + "ashland , oregon (20406)", + "1882", + "6744", + "raiders", + "12", + "1988" + ], + [ + "warner pacific college", + "portland , oregon (538554)", + "1937", + "1333", + "knights", + "9", + "1999" + ] + ], + "title": "", + "original_id": "447813cef258e268820b0788458283ad" + }, + { + "_id": "39d35fcf27eb50a51972d7af4a75605d", + "header": [ + "rank", + "building", + "height", + "floors", + "completed" + ], + "rows": [ + [ + "1", + "fenwick tower (residential)", + "98 m (322ft)", + "32", + "1971" + ], + [ + "2", + "purdy 's wharf tower 2 (office)", + "88 m (289ft)", + "22", + "1990" + ], + [ + "3", + "1801 hollis street (office)", + "87 m (285ft)", + "22", + "1985" + ], + [ + "4", + "barrington tower (office)", + "84 m (276ft)", + "20", + "1975" + ], + [ + "5", + "cogswell tower (office)", + "79 m (259ft)", + "20", + "1975" + ], + [ + "6", + "maritime centre (office)", + "78 m (256ft)", + "21", + "1974" + ], + [ + "7", + "queen square (office)", + "75 m (246ft)", + "19", + "1975" + ], + [ + "8", + "purdy 's wharf tower 1 (office)", + "74 m (243ft)", + "18", + "1985" + ], + [ + "9", + "bank of montreal building (office)", + "73 m (240ft)", + "18", + "1971" + ], + [ + "10", + "td tower (office)", + "73 m (240ft)", + "18", + "1974" + ], + [ + "11", + "duke tower (office)", + "71 m (233ft)", + "16", + "1970" + ], + [ + "12", + "founders square (office)", + "71 m (233ft)", + "15", + "1970" + ], + [ + "13", + "tupper building (educational)", + "70 m (233ft)", + "16", + "1967" + ], + [ + "14", + "park victoria (residential)", + "70 m (233ft)", + "21", + "1969" + ], + [ + "15", + "summer gardens (residential)", + "70 m (233ft)", + "21", + "1990" + ], + [ + "16", + "loyola residence tower (residential)", + "67 m (220ft)", + "22", + "1971" + ], + [ + "17", + "metropolitan place (office)", + "67 m (218ft)", + "16", + "1987" + ], + [ + "18", + "bank of commerce (office)", + "66 m (217ft)", + "16", + "1977" + ], + [ + "19", + "the trillium (residential)", + "65 m (213ft)", + "19", + "2011" + ] + ], + "title": "", + "original_id": "234c6edbcd38217533fb4463d944bf90" + }, + { + "_id": "18f0d71414bfc141d91a3fbde18d3a33", + "header": [ + "no", + "episode", + "air date", + "timeslot", + "rating", + "share", + "1849 (rating / share)", + "viewers (m)", + "rank " + ], + "rows": [ + [ + "1", + "pilot", + "2007 - 09 - 25 september 25 , 2007", + "tuesday 9 / 8c", + "2.1", + "3", + "1.5 / 3", + "3.28", + "85" + ], + [ + "2", + "charged", + "2007 - 10 - 02 october 2 , 2007", + "tuesday 9 / 8c", + "1.8", + "3", + "1.3 / 3", + "2.86", + "93" + ], + [ + "3", + "all mine", + "2007 - 10 - 09 october 9 , 2007", + "tuesday 9 / 8c", + "1.8", + "3", + "1.3 / 3", + "2.65", + "90" + ], + [ + "4", + "magic", + "2007 - 10 - 16 october 16 , 2007", + "tuesday 9 / 8c", + "2.2", + "3", + "1.5 / 3", + "3.27", + "86" + ], + [ + "5", + "what about blob", + "2007 - 10 - 23 october 23 , 2007", + "tuesday 9 / 8c", + "1.8", + "3", + "1.2 / 3", + "2.61", + "88" + ], + [ + "6", + "leon", + "2007 - 10 - 30 october 30 , 2007", + "tuesday 9 / 8c", + "1.7", + "3", + "1.1 / 3", + "2.6", + "89" + ], + [ + "7", + "love , bullets and blacktop", + "2007 - 11 - 06 november 6 , 2007", + "tuesday 9 / 8c", + "1.6", + "2", + "1.0 / 2", + "2.42", + "94" + ], + [ + "8", + "the cop", + "2007 - 11 - 13 november 13 , 2007", + "tuesday 9 / 8c", + "1.6", + "2", + "1.2 / 2", + "2.46", + "93" + ], + [ + "9", + "ashes to ashes", + "2007 - 11 - 27 november 27 , 2007", + "tuesday 9 / 8c", + "1.5", + "2", + "1.1 / 2", + "2.26", + "91" + ], + [ + "10", + "cash out", + "2007 - 12 - 04 december 4 , 2007", + "tuesday 9 / 8c", + "1.7", + "3", + "1.3 / 3", + "2.64", + "89" + ], + [ + "11", + "hungry for fame", + "2008 - 03 - 13 march 13 , 2008", + "thursday 9 / 8c", + "1.7", + "3", + "1.2 / 3", + "2.81", + "88" + ], + [ + "12", + "unseen", + "2008 - 03 - 20 march 20 , 2008", + "thursday 9 / 8c", + "1.9", + "3", + "1.2 / 3", + "2.94", + "79" + ], + [ + "13", + "acid queen", + "2008 - 03 - 27 march 27 , 2008", + "thursday 9 / 8c", + "1.8", + "3", + "1.2 / 2", + "2.76", + "81" + ], + [ + "14", + "rebellion", + "2008 - 04 - 22 april 22 , 2008", + "tuesday 9 / 8c", + "1.6", + "2", + "1.1 / 3", + "2.6", + "93" + ], + [ + "15", + "coming to grips", + "2008 - 04 - 29 april 29 , 2008", + "tuesday 9 / 8c", + "1.7", + "3", + "1.1 / 3", + "2.51", + "86" + ], + [ + "16", + "greg schmeg", + "2008 - 05 - 06 may 6 , 2008", + "tuesday 9 / 8c", + "1.6", + "2", + "1.0 / 3", + "2.47", + "tba" + ], + [ + "17", + "the leak", + "2008 - 05 - 13 may 13 , 2008", + "tuesday 9 / 8c", + "1.5", + "2", + "0.9 / 2", + "1.99", + "tba" + ] + ], + "title": "", + "original_id": "7fe4b8c7bbb482bd28dc3cf9a6f7e023" + }, + { + "_id": "b3107f0cc60c803743d2d017ba87f193", + "header": [ + "interval name", + "size (steps)", + "size (cents)", + "just ratio", + "just (cents)", + "error" + ], + "rows": [ + [ + "perfect fifth", + "24", + "702.44", + "3:2", + "701.96", + "+ 0.48" + ], + [ + "septimal tritone", + "20", + "585.37", + "7:5", + "582.51", + "+ 2.85" + ], + [ + "11:8 wide fourth", + "19", + "556.1", + "11:8", + "551.32", + "+ 4.78" + ], + [ + "15:11 wide fourth", + "18", + "526.83", + "15:11", + "536.95", + "10.12" + ], + [ + "27:20 wide fourth", + "18", + "526.83", + "27:20", + "519.55", + "+ 7.28" + ], + [ + "perfect fourth", + "17", + "497.56", + "4:3", + "498.04", + "0.48" + ], + [ + "septimal narrow fourth", + "16", + "468.29", + "21:16", + "470.78", + "2.48" + ], + [ + "septimal major third", + "15", + "439.02", + "9:7", + "435.08", + "+ 3.94" + ], + [ + "undecimal major third", + "14", + "409.76", + "14:11", + "417.51", + "7.75" + ], + [ + "pythagorean major third", + "14", + "409.76", + "81:64", + "407.82", + "+ 1.94" + ], + [ + "major third", + "13", + "380.49", + "5:4", + "386.31", + "5.83" + ], + [ + "inverted 13th harmonic", + "12", + "351.22", + "16:13", + "359.47", + "8.25" + ], + [ + "undecimal neutral third", + "12", + "351.22", + "11:9", + "347.41", + "+ 3.81" + ], + [ + "minor third", + "11", + "321.95", + "6:5", + "315.64", + "+ 6.31" + ], + [ + "pythagorean minor third", + "10", + "292.68", + "32:27", + "294.13", + "1.45" + ], + [ + "tridecimal minor third", + "10", + "292.68", + "13:11", + "289.21", + "+ 3.47" + ], + [ + "septimal minor third", + "9", + "263.41", + "7:6", + "266.87", + "3.46" + ], + [ + "septimal whole tone", + "8", + "234.15", + "8:7", + "231.17", + "+ 2.97" + ], + [ + "whole tone , major tone", + "7", + "204.88", + "9:8", + "203.91", + "+ 0.97" + ], + [ + "whole tone , minor tone", + "6", + "175.61", + "10:9", + "182.4", + "6.79" + ], + [ + "lesser undecimal neutral second", + "5", + "146.34", + "12:11", + "150.64", + "4.30" + ], + [ + "septimal diatonic semitone", + "4", + "117.07", + "15:14", + "119.44", + "2.37" + ], + [ + "diatonic semitone", + "4", + "117.07", + "16:15", + "111.73", + "+ 5.34" + ], + [ + "pythagorean diatonic semitone", + "3", + "87.8", + "256:243", + "90.22", + "2.42" + ], + [ + "septimal chromatic semitone", + "3", + "87.8", + "21:20", + "84.47", + "+ 3.34" + ], + [ + "chromatic semitone", + "2", + "58.54", + "25:24", + "70.67", + "12.14" + ], + [ + "28:27 semitone", + "2", + "58.54", + "28:27", + "62.96", + "4.42" + ], + [ + "septimal comma", + "1", + "29.27", + "64:63", + "27.26", + "+ 2.00" + ] + ], + "title": "", + "original_id": "0b5b037022d36184f582c1aaf15969ad" + }, + { + "_id": "3107194634e19e06bfaf0e06efa36ab1", + "header": [ + "peak", + "country", + "elevation (m)", + "prominence (m)", + "col (m)" + ], + "rows": [ + [ + "mount ida", + "greece ( crete )", + "2456", + "2456", + "0" + ], + [ + "taygetus", + "greece", + "2404", + "2344", + "60" + ], + [ + "lefka ori", + "greece ( crete )", + "2453", + "2038", + "415" + ], + [ + "mount olympus", + "cyprus", + "1952", + "1952", + "0" + ], + [ + "mount kyllini", + "greece", + "2376", + "1870", + "506" + ], + [ + "dikti", + "greece ( crete )", + "2148", + "1798", + "350" + ], + [ + "dirfi", + "greece ( euboea )", + "1743", + "1743", + "0" + ], + [ + "mount ainos", + "greece ( kefalonia )", + "1628", + "1628", + "0" + ], + [ + "fengari", + "greece ( samothrace )", + "1611", + "1611", + "0" + ] + ], + "title": "", + "original_id": "6ebaaae261c6b9d895458c5ebe3795a3" + }, + { + "_id": "ed5e3196aad6e9a982d31fa94497fbe6", + "header": [ + "physical property", + "helium", + "neon", + "argon", + "krypton", + "xenon" + ], + "rows": [ + [ + "boiling point (degree)", + "268.8", + "245.9", + "185.8", + "151.7", + "106.6" + ], + [ + "melting point (degree)", + "-", + "248.5", + "189.6", + "157.4", + "111.5" + ], + [ + "critical temperature (k)", + "5.25", + "44.5", + "150.85", + "209.35", + "289.74" + ], + [ + "critical pressure (atm)", + "2.26", + "26.9", + "48.3", + "54.3", + "57.64" + ], + [ + "critical density (g / ml)", + "0.0693", + "0.484", + "0.536", + "0.908", + "1.1" + ], + [ + "triple point temperature (k)", + "24.562", + "83.8", + "115.76", + "161.37", + "202.0" + ], + [ + "triple point pressure (kpa)", + "5.1", + "43.37", + "68.9", + "73.15", + "81.66" + ] + ], + "title": "", + "original_id": "c7bc350bc9bde43c892968a9664344be" + }, + { + "_id": "413d4285f40fcf65977a578eebc23c92", + "header": [ + "rank in nyagatare sectors , 2012", + "sector", + "area in sqkm", + "population august 15 , 2012", + "population , august 15 , 2002", + "population change 2002 - 2012 (%)", + "population density 2012 (km 2 )" + ], + "rows": [ + [ + "8", + "gatunda", + "52", + "27879", + "19716", + "41.4", + "535" + ], + [ + "10", + "karama", + "53", + "26727", + "19727", + "35.5", + "499" + ], + [ + "2", + "karangazi", + "563", + "56871", + "21234", + "167.8", + "101" + ], + [ + "4", + "katabagemu", + "98", + "34651", + "22101", + "56.8", + "354" + ], + [ + "14", + "kiyombe", + "69", + "17061", + "16483", + "3.5", + "247" + ], + [ + "11", + "matimba", + "79", + "24168", + "13476", + "79.3", + "307" + ], + [ + "9", + "mimuli", + "48", + "27366", + "22452", + "21.9", + "573" + ], + [ + "12", + "mukama", + "64", + "21819", + "17970", + "21.4", + "339" + ], + [ + "7", + "musheli", + "96", + "32403", + "14742", + "119.8", + "338" + ], + [ + "3", + "nyagatare", + "164", + "52125", + "19475", + "167.7", + "317" + ], + [ + "5", + "rukomo", + "58", + "34377", + "20945", + "64.1", + "588" + ], + [ + "13", + "rwempasha", + "169", + "19328", + "11428", + "69.1", + "115" + ], + [ + "1", + "rwimiyaga", + "309", + "58847", + "16802", + "250.2", + "190" + ], + [ + "6", + "tabagwe", + "106", + "33322", + "18533", + "79.6", + "313" + ] + ], + "title": "", + "original_id": "be0a8690532485156b570f11e933f6fe" + }, + { + "_id": "9e462fba4252b3dd3a6f738215996072", + "header": [ + "peak", + "elevation (m)", + "prominence (m)", + "isolation (km)", + "municipality", + "county" + ], + "rows": [ + [ + "galdhøpiggen", + "2469", + "2372", + "1570", + "lom", + "oppland" + ], + [ + "jiehkkevárri", + "1833", + "1741", + "140", + "lyngen , tromsø", + "troms" + ], + [ + "snøhetta", + "2286", + "1675", + "83", + "dovre", + "oppland" + ], + [ + "store lenangstind", + "1625", + "1576", + "47", + "lyngen", + "troms" + ], + [ + "gjegnen / blånibba", + "1670", + "1460", + "47", + "bremanger", + "sogn og fjordane" + ], + [ + "hamperokken", + "1404", + "1396", + "18", + "tromsø", + "troms" + ], + [ + "skårasalen", + "1542", + "1385", + "7", + "ørsta", + "møre og romsdal" + ], + [ + "oksskolten", + "1916", + "1384", + "185", + "hemnes", + "nordland" + ], + [ + "botnafjellet", + "1572", + "1339", + "15", + "gloppen", + "sogn og fjordane" + ], + [ + "kvitegga", + "1717", + "1324", + "23", + "stranda , ørsta", + "møre og romsdal" + ], + [ + "fresvikbreen", + "1660", + "1310", + "17", + "vik", + "sogn og fjordane" + ], + [ + "smørskredtindane", + "1630", + "1306", + "12", + "stranda , ørsta", + "møre og romsdal" + ], + [ + "njunis", + "1717", + "1305", + "53", + "målselv", + "troms" + ], + [ + "store trolla", + "1850", + "1292", + "11", + "sunndal", + "møre og romsdal" + ], + [ + "langlitinden", + "1276", + "1276", + "26", + "ibestad", + "troms" + ], + [ + "indre russetind", + "1527", + "1268", + "9", + "balsfjord", + "troms" + ], + [ + "møysalen", + "1262", + "1262", + "60", + "hinnøya", + "nordland" + ], + [ + "stortind", + "1320", + "1242", + "14", + "tromsø", + "troms" + ], + [ + "folgefonna", + "1660", + "1233", + "29", + "kvinnherad , odda", + "hordaland" + ], + [ + "daurmål", + "1446", + "1230", + "4", + "gloppen , jølster", + "sogn og fjordane" + ] + ], + "title": "", + "original_id": "2d3e281b34b0a331871518a8fee622e3" + }, + { + "_id": "3e5084fd782edcb2201af7704704e3c1", + "header": [ + "Player", + "G", + "IP", + "W", + "L", + "ERA", + "SO" + ], + "rows": [ + [ + "Noodles Hahn", + "35", + "297.2", + "16", + "18", + "2.06", + "98" + ], + [ + "Jack Harper", + "34", + "293.2", + "23", + "9", + "2.30", + "125" + ], + [ + "Win Kellum", + "31", + "224.2", + "15", + "10", + "2.60", + "70" + ], + [ + "Tom Walker", + "24", + "217", + "15", + "8", + "2.24", + "64" + ], + [ + "Bob Ewing", + "26", + "212", + "11", + "13", + "2.46", + "99" + ], + [ + "Jack Sutthoff", + "12", + "90", + "5", + "6", + "2.30", + "27" + ] + ], + "title": "", + "original_id": "2962b6f7f7a0902cee3063e870704e24" + }, + { + "_id": "021bd35badd26b928ee88a7777319153", + "header": [ + "chambering", + "p1 diameter (mm)", + "a external (cm 2 )", + "p max ( bar )", + "f bolt ( kgf )", + "f bolt" + ], + "rows": [ + [ + ".22 long rifle", + "5.74", + "0.2587", + "1650", + "435", + "n (lbf)" + ], + [ + "9x19 mm parabellum", + "9.93", + "0.7744", + "2350", + "1820", + "n ( lbf )" + ], + [ + ".357 sig", + "10.77", + "0.911", + "3050", + "2779", + "n (lbf)" + ], + [ + ".380 acp", + "9.7", + "0.739", + "1500", + "1130", + "n (lbf)" + ], + [ + ".40 s&w", + "10.77", + "0.911", + "2250", + "2050", + "n (lbf)" + ], + [ + "10 mm auto", + "10.81", + "0.9178", + "2300", + "2111", + "n (lbf)" + ], + [ + ".45 acp", + "12.09", + "1.1671", + "1300", + "1517", + "n (lbf)" + ], + [ + ".454 casull", + "12.13", + "1.1556", + "3900", + "4507", + "n (lbf)" + ] + ], + "title": "", + "original_id": "e81397add1c0790a16461b55739e62f0" + }, + { + "_id": "ee515e26294b20dc47d6b95e2b7185cb", + "header": [ + "country", + "number of troops", + "% of total troops", + "troops per one million population", + "troops per 1 billion ( usd ) gdp" + ], + "rows": [ + [ + "united states", + "74400", + "68.216%", + "291.3", + "6.06" + ], + [ + "united kingdom", + "9500", + "7.201%", + "153.5", + "4.21" + ], + [ + "germany", + "4318", + "3.721%", + "59.8", + "1.44" + ], + [ + "italy", + "4000", + "3.016%", + "63.5", + "1.81" + ], + [ + "france", + "2453", + "2.892%", + "61.4", + "1.49" + ], + [ + "poland", + "2432", + "1.915%", + "66.5", + "5.41" + ], + [ + "romania", + "1808", + "1.308%", + "81.4", + "10.52" + ], + [ + "georgia", + "1561", + "1.218%", + "219.0", + "85.95" + ], + [ + "australia", + "1550", + "1.175%", + "72.1", + "1.35" + ], + [ + "spain", + "1500", + "1.136%", + "33.1", + "1.02" + ], + [ + "turkey", + "1271", + "1.364%", + "23.8", + "2.76" + ], + [ + "canada", + "950", + "2.198%", + "27.7", + "1.85" + ], + [ + "denmark", + "624", + "0.565%", + "136.4", + "2.35" + ], + [ + "bulgaria", + "563", + "0.584%", + "81.1", + "12.66" + ], + [ + "norway", + "538", + "0.313%", + "85.0", + "1.01" + ], + [ + "belgium", + "520", + "0.400%", + "49.3", + "1.13" + ], + [ + "netherlands", + "500", + "0.149%", + "11.8", + "0.24" + ], + [ + "sweden", + "500", + "0.671%", + "53.8", + "1.14" + ], + [ + "czech republic", + "423", + "0.351%", + "44.5", + "2.35" + ], + [ + "hungary", + "563", + "0.584%", + "48.4", + "3.57" + ], + [ + "republic of korea", + "350", + "0.323%", + "8.8", + "0.47" + ], + [ + "slovakia", + "343", + "0.224%", + "54.7", + "3.01" + ], + [ + "croatia", + "320", + "0.227%", + "67.8", + "4.66" + ], + [ + "lithuania", + "241", + "0.142%", + "57.7", + "4.99" + ], + [ + "albania", + "211", + "0.195%", + "81.1", + "19.59" + ], + [ + "finland", + "181", + "0.125%", + "30.8", + "0.71" + ], + [ + "latvia", + "180", + "0.103%", + "60.7", + "5.38" + ], + [ + "macedonia", + "177", + "0.124%", + "79.9", + "17.12" + ], + [ + "estonia", + "154", + "0.120%", + "117.8", + "8.21" + ], + [ + "new zealand", + "152", + "0.179%", + "54.9", + "2.00" + ], + [ + "portugal", + "137", + "0.086%", + "10.7", + "0.49" + ], + [ + "armenia", + "127", + "0.030%", + "42.8", + "3.36" + ], + [ + "mongolia", + "101", + "0.047%", + "23.0", + "11.79" + ], + [ + "azerbaijan", + "94", + "0.071%", + "10.5", + "2.04" + ], + [ + "slovenia", + "80", + "0.060%", + "38.9", + "1.60" + ], + [ + "bosnia and herzegovina", + "59", + "0.034%", + "12.0", + "2.45" + ], + [ + "tonga", + "55", + "0.047%", + "528.8", + "183.70" + ], + [ + "malaysia", + "42", + "0.023%", + "1.1", + "0.16" + ], + [ + "montenegro", + "41", + "0.027%", + "57.5", + "7.47" + ], + [ + "united arab emirates", + "35", + "0.027%", + "7.4", + "0.12" + ], + [ + "ukraine", + "24", + "0.015%", + "0.4", + "0.17" + ], + [ + "greece", + "12", + "0.100%", + "11.8", + "0.40" + ], + [ + "luxembourg", + "10", + "0.007%", + "18.3", + "0.17" + ], + [ + "ireland", + "6", + "0.005%", + "1.5", + "0.03" + ], + [ + "austria", + "3", + "0.002%", + "0.4", + "0.01" + ], + [ + "iceland", + "3", + "0.002%", + "6.1", + "0.17" + ], + [ + "isaf exact total", + "112579", + "100.000%", + "117.1 (average)", + "3.49 (average)" + ] + ], + "title": "", + "original_id": "7c6e7784308c8ce8f52b80e50368bc49" + }, + { + "_id": "0858a8ee1ba85b8c3ece21966158f385", + "header": [ + "no", + "name", + "mi from kingston", + "km from kingston", + "parish", + "length feet", + "length meters" + ], + "rows": [ + [ + "1", + "scotts pass", + "44.25", + "71.2", + "clarendon", + "70", + "21.3" + ], + [ + "2", + "scotts pass", + "44.5", + "71.6", + "clarendon", + "170", + "51.8" + ], + [ + "3", + "comfort hall", + "65.5", + "105.4", + "st elizabeth", + "688", + "209.1" + ], + [ + "4", + "balaclava", + "70.0", + "112.6", + "st elizabeth", + "348", + "106.1" + ], + [ + "5", + "highworth", + "84.0", + "135.2", + "st elizabeth", + "182", + "55.5" + ], + [ + "6", + "y s", + "84.5", + "136.0", + "st elizabeth", + "218", + "66.4" + ], + [ + "7", + "ipswich", + "86.25", + "138.8", + "st elizabeth", + "855", + "260.6" + ], + [ + "8", + "unnamed", + "87.75", + "141.2", + "st james", + "555", + "164.6" + ], + [ + "9", + "merrywood", + "88.5", + "142.4", + "st james", + "362", + "115.8" + ], + [ + "10", + "anchovy", + "104.5", + "168.2", + "st james", + "102", + "31.1" + ], + [ + "11", + "ramble", + "108.0", + "173.8", + "st james", + "182", + "55.5" + ], + [ + "12", + "bogue hill", + "108.5", + "174.6", + "st james", + "1276", + "388.9" + ] + ], + "title": "", + "original_id": "979a0eff0ecb9837c0a9c7968160830e" + }, + { + "_id": "a5e2cdf14939e184e0bb158e2cd57812", + "header": [ + "ecozone", + "area (km square) territorial waters", + "area (km square) exclusive economic zone", + "percentage of total area (foreez)", + "percentage of marine area (foreez)" + ], + "rows": [ + [ + "pacific marine", + "102920", + "457646", + "3.1", + "8.3" + ], + [ + "arctic basin marine", + "24997", + "704849", + "4.8", + "12.7" + ], + [ + "arctic archipelago marine", + "2051393", + "2178998", + "14.8", + "39.3" + ], + [ + "northwest atlantic marine", + "536895", + "1205981", + "8.2", + "21.8" + ], + [ + "atlantic marine", + "72144", + "996439", + "6.8", + "17.9" + ], + [ + "total", + "2788349", + "5543913", + "37.7", + "100.0" + ] + ], + "title": "", + "original_id": "db1f2cac2692f10d66aee19c3bc2ae6c" + }, + { + "_id": "d697fcf2541d0982d00d1a13cae21838", + "header": [ + "line", + "operator", + "line length (kilometres)", + "number of stations", + "annual ridership (1998)", + "annual ridership (2008)" + ], + "rows": [ + [ + "mitre", + "ugoms", + "185 , 5", + "55", + "84081493", + "73207048" + ], + [ + "belgrano norte", + "ferrovías", + "54 , 3", + "22", + "35931801", + "45830200" + ], + [ + "belgrano sur", + "ugofe", + "66 , 3", + "30", + "16219806", + "11472416" + ], + [ + "roca", + "ugofe", + "237 , 2", + "70", + "152082063", + "125556026" + ], + [ + "san martín", + "ugofe", + "56 , 3", + "19", + "25581310", + "46647676" + ], + [ + "sarmiento", + "ugoms", + "184 , 1", + "40", + "113218819", + "118143006" + ], + [ + "urquiza", + "metrovías", + "29 , 9", + "23", + "25581310", + "24212133" + ], + [ + "totals :", + "-", + "813", + "259", + "451971849", + "445068505" + ] + ], + "title": "", + "original_id": "8854b91e5e00c20c99e6434d90887fe5" + }, + { + "_id": "c58bba82dbd1dee481d4cd0c8e9d7598", + "header": [ + "rank", + "location", + "total passengers", + "annual change", + "capacity", + "capacity in use" + ], + "rows": [ + [ + "1", + "são paulo", + "26849185", + "23.57%", + "20500000", + "130.97%" + ], + [ + "2", + "são paulo", + "15499462", + "13.14%", + "12000000", + "129.16%" + ], + [ + "3", + "brasília", + "14347061", + "17.46%", + "10000000", + "143.47%" + ], + [ + "4", + "rio de janeiro", + "12337944", + "4.3%", + "18000000", + "68.54%" + ], + [ + "5", + "rio de janeiro", + "7822848", + "53.4%", + "5000000", + "156.45%" + ], + [ + "6", + "salvador", + "7696307", + "9.13%", + "6000000", + "128.27%" + ], + [ + "7", + "belo horizonte", + "7261064", + "29.26%", + "5000000", + "145.22%" + ], + [ + "8", + "porto alegre", + "6676216", + "19.1%", + "4000000", + "166.9%" + ], + [ + "9", + "recife", + "5958982", + "13.49%", + "9000000", + "66.21%" + ], + [ + "10", + "curitiba", + "5774615", + "18.97%", + "6000000", + "96.16%" + ], + [ + "11", + "campinas", + "5430066", + "61.39%", + "3500000", + "155.14%" + ], + [ + "12", + "fortaleza", + "5072721", + "20.44%", + "3000000", + "169.09%" + ], + [ + "13", + "manaus", + "2705131", + "17.6%", + "1800000", + "150.28%" + ], + [ + "14", + "florianópolis", + "2672250", + "26.7%", + "1100000", + "242.93%" + ], + [ + "15", + "vitória", + "2644729", + "12.9%", + "560000", + "472.27%" + ], + [ + "16", + "belém", + "2570899", + "16.7%", + "2700000", + "95.21%" + ], + [ + "17", + "natal", + "2413416", + "27.4%", + "1500000", + "160.89%" + ], + [ + "18", + "goinia", + "2348648", + "32.5%", + "600000", + "391.44%" + ], + [ + "19", + "cuiabá", + "2134267", + "27.7%", + "1600000", + "133.39%" + ], + [ + "20", + "maceió", + "1431781", + "28.15%", + "1200000", + "119 , 31%" + ] + ], + "title": "", + "original_id": "4a7f8f5b7fe1a05ef29d8a979b8f013f" + }, + { + "_id": "f857987537701367e36338ecf97cd902", + "header": [ + "name", + "2011 census", + "2006 census", + "% change", + "land area (km square)", + "density (pop / km square)", + "population rank" + ], + "rows": [ + [ + "algoma district", + "115870", + "117461", + "- 1.4", + "48840.68", + "2.4", + "21" + ], + [ + "brant county", + "136035", + "125099", + "8.7", + "1093.16", + "124.4", + "17" + ], + [ + "bruce county", + "66102", + "65349", + "1.2", + "4087.76", + "16.2", + "36" + ], + [ + "chatham - kent , municipality of", + "104075", + "108589", + "- 4.2", + "2470.69", + "42.1", + "25" + ], + [ + "cochrane district", + "81122", + "82503", + "- 1.7", + "141270.41", + "0.6", + "33" + ], + [ + "dufferin county", + "56881", + "54436", + "4.5", + "1486.31", + "38.3", + "41" + ], + [ + "durham regional municipality", + "608124", + "561258", + "8.4", + "2523.62", + "241.0", + "5" + ], + [ + "elgin county", + "87461", + "85351", + "2.5", + "1880.9", + "46.5", + "29" + ], + [ + "essex county", + "388782", + "393402", + "- 1.2", + "1850.78", + "210.1", + "12" + ], + [ + "frontenac county", + "149738", + "143865", + "4.1", + "3787.79", + "39.5", + "15" + ], + [ + "greater sudbury , city of", + "160376", + "157909", + "1.6", + "3238.01", + "49.5", + "14" + ], + [ + "grey county", + "92568", + "92411", + "0.2", + "4513.21", + "20.5", + "28" + ], + [ + "haldimand - norfolk", + "109118", + "107812", + "1.2", + "2894.82", + "37.7", + "23" + ], + [ + "haliburton county", + "17026", + "16147", + "5.4", + "4071.86", + "4.2", + "48" + ], + [ + "halton regional municipality", + "501669", + "439206", + "14.2", + "964.01", + "520.4", + "8" + ], + [ + "hamilton , city of", + "519949", + "504559", + "3.1", + "1117.23", + "465.4", + "6" + ], + [ + "hastings county", + "134934", + "130474", + "3.4", + "6103.48", + "22.1", + "18" + ], + [ + "huron county", + "59100", + "59325", + "- 0.4", + "3399.63", + "17.4", + "38" + ], + [ + "kawartha lakes , city of", + "73214", + "74561", + "- 1.8", + "3083.06", + "23.7", + "35" + ], + [ + "kenora district", + "57607", + "64419", + "- 10.6", + "407213.01", + "0.1", + "40" + ], + [ + "lambton county", + "126199", + "128204", + "- 1.6", + "3002.07", + "42.0", + "20" + ], + [ + "lanark county", + "65867", + "63785", + "3.0", + "3003.82", + "21.6", + "37" + ], + [ + "leeds and grenville , united counties of", + "99306", + "99206", + "0.1", + "3383.92", + "29.3", + "27" + ], + [ + "lennox and addington county", + "41824", + "40542", + "3.2", + "2841.1", + "14.7", + "43" + ], + [ + "manitoulin district", + "13048", + "12631", + "3.3", + "3107.11", + "4.2", + "49" + ], + [ + "middlesex county", + "439151", + "422333", + "4.0", + "3317.54", + "132.4", + "10" + ], + [ + "muskoka district municipality", + "58047", + "57563", + "0.8", + "3937.76", + "14.7", + "39" + ], + [ + "niagara regional municipality", + "431346", + "427421", + "0.9", + "1854.25", + "232.6", + "11" + ], + [ + "nipissing district", + "84736", + "84688", + "0.1", + "17103.52", + "5.0", + "31" + ], + [ + "northumberland county", + "82126", + "80963", + "1.4", + "1905.34", + "43.1", + "32" + ], + [ + "ottawa , city of", + "883391", + "812129", + "8.8", + "2790.22", + "316.6", + "4" + ], + [ + "oxford county", + "105719", + "102756", + "2.9", + "2039.56", + "51.8", + "24" + ], + [ + "parry sound district", + "42162", + "40918", + "3.0", + "9322.8", + "4.5", + "42" + ], + [ + "peel regional municipality", + "1296814", + "1159455", + "11.8", + "1246.89", + "1040.0", + "2" + ], + [ + "perth county", + "75112", + "74344", + "1.0", + "2218.46", + "33.9", + "34" + ], + [ + "peterborough county", + "134933", + "133080", + "1.4", + "3847.77", + "35.1", + "19" + ], + [ + "prescott and russell , united counties of", + "85381", + "80184", + "6.5", + "2004.44", + "42.6", + "30" + ], + [ + "prince edward county", + "25258", + "25496", + "- 0.9", + "1050.45", + "24.0", + "45" + ], + [ + "rainy river district", + "20370", + "21564", + "- 5.5", + "15484.83", + "1.3", + "47" + ], + [ + "renfrew county", + "101326", + "97545", + "3.9", + "7440.81", + "13.6", + "26" + ], + [ + "simcoe county", + "446063", + "422204", + "5.7", + "4859.16", + "91.8", + "9" + ], + [ + "stormont , dundas and glengarry , united counties of", + "111164", + "110399", + "0.7", + "3308.84", + "33.6", + "22" + ], + [ + "sudbury district", + "21196", + "21851", + "- 3.0", + "40205.41", + "0.5", + "46" + ], + [ + "thunder bay district", + "146057", + "149063", + "- 2.0", + "103719.51", + "1.4", + "16" + ], + [ + "timiskaming district", + "32634", + "33283", + "- 1.9", + "13299.92", + "2.5", + "44" + ], + [ + "toronto , city of", + "2615060", + "2503281", + "4.5", + "630.21", + "4149.5", + "1" + ], + [ + "waterloo regional municipality", + "507096", + "478121", + "6.1", + "1368.94", + "370.4", + "7" + ], + [ + "wellington county", + "208360", + "200425", + "4.0", + "2660.46", + "78.3", + "13" + ] + ], + "title": "", + "original_id": "ce760118539d5455482744e3607aaf15" + }, + { + "_id": "5f1422ed3f70e5d6d5b5ecc5c5b3af14", + "header": [ + "country", + "carbon dioxide emissions per year (10 6 tons) (2006)", + "percentage of global total", + "avg emission per km 2 of its land (tons)", + "carbon dioxide emissions per year (tons per person) (2007)" + ], + "rows": [ + [ + "china", + "6103", + "21.5%", + "636", + "4.9" + ], + [ + "united states", + "5752", + "20.2%", + "597", + "19.3" + ], + [ + "russia", + "1564", + "5.5%", + "91", + "11.6" + ], + [ + "india", + "1510", + "5.3%", + "459", + "1.4" + ], + [ + "japan", + "1293", + "4.6%", + "3421", + "9.8" + ], + [ + "germany", + "805", + "2.8%", + "2254", + "9.6" + ], + [ + "united kingdom", + "568", + "2.0%", + "2338", + "8.9" + ], + [ + "canada", + "544", + "1.9%", + "54", + "16.5" + ], + [ + "south korea", + "475", + "1.7%", + "4758", + "10.5" + ] + ], + "title": "", + "original_id": "f743425041cec393cf99fb42233b61e8" + }, + { + "_id": "144912303d7d7500de30616ba1df3386", + "header": [ + "manager", + "years", + "games", + "wins", + "losses" + ], + "rows": [ + [ + "chuck goggin", + "1978", + "141", + "64", + "77" + ], + [ + "george scherger", + "1979", + "144", + "83", + "61" + ], + [ + "stump merrill", + "1980 - 1981", + "286", + "178", + "108" + ], + [ + "johnny oates", + "1982", + "144", + "77", + "67" + ], + [ + "doug holmquist", + "1983", + "146", + "88", + "58" + ], + [ + "jim marshall", + "1984", + "147", + "74", + "73" + ], + [ + "lee walls", + "1985", + "7", + "3", + "4" + ], + [ + "leon roberts", + "1985", + "7", + "2", + "5" + ], + [ + "gordon mackenzie", + "1985", + "127", + "66", + "61" + ], + [ + "leon roberts", + "1986", + "142", + "68", + "74" + ], + [ + "jack lind", + "1987 - 1988", + "217", + "102", + "115" + ], + [ + "wayne garland", + "1988", + "3", + "1", + "2" + ], + [ + "george scherger", + "1988", + "1", + "0", + "1" + ], + [ + "jim hoff", + "1988", + "22", + "12", + "10" + ], + [ + "frank lucchesi", + "1988 - 1989", + "185", + "96", + "89" + ], + [ + "pete mackanin", + "1990 - 1992", + "366", + "186", + "180" + ], + [ + "dave miley", + "1992", + "68", + "32", + "36" + ], + [ + "rick renick", + "1993 - 1996", + "575", + "309", + "266" + ], + [ + "tom spencer", + "1997", + "143", + "74", + "69" + ], + [ + "trent jewett", + "1998 - 2000", + "339", + "176", + "163" + ], + [ + "richie hebner", + "2000", + "85", + "34", + "51" + ], + [ + "marty brown", + "2001 - 2002", + "284", + "136", + "148" + ], + [ + "trent jewett", + "2003 - 2004", + "285", + "144", + "141" + ], + [ + "frank kremblas", + "2005 - 2008", + "572", + "299", + "273" + ], + [ + "don money", + "2009 - 2011", + "432", + "223", + "209" + ], + [ + "mike guerrero", + "2012 - 2013", + "288", + "124", + "164" + ], + [ + "darnell coles", + "2014 - beyond", + "0", + "0", + "0" + ], + [ + "totals", + "totals", + "5157", + "2651", + "2506" + ] + ], + "title": "", + "original_id": "f2b0448d8f1a65a43b44bd17198bf0ea" + }, + { + "_id": "551c13f917a07d79ef6925adb08cd070", + "header": [ + "episode", + "rating", + "share", + "viewers (millions)", + "weekly rank" + ], + "rows": [ + [ + "slay everyone , trust no one", + "8.1", + "13", + "14.15", + "14" + ], + [ + "it 's getting the best of me", + "6.9", + "11", + "11.94", + "11" + ], + [ + "that girl is like a virus", + "6.7", + "10", + "11.6", + "14" + ], + [ + "tonight , we make our move", + "7.2", + "12", + "12.72", + "17" + ], + [ + "knights of the round table", + "7.0", + "11", + "12.17", + "14" + ], + [ + "banana etiquette", + "6.6", + "11", + "11.15", + "15" + ], + [ + "i'm not a good villain", + "6.7", + "12", + "11.26", + "11" + ], + [ + "expectations", + "7.3", + "12", + "12.38", + "13" + ], + [ + "survivor history", + "7.1", + "13", + "12.31", + "12" + ], + [ + "going down in flames", + "7.0", + "12", + "11.89", + "8" + ], + [ + "jumping ship", + "7.6", + "13", + "12.74", + "9" + ], + [ + "a sinking ship", + "7.7", + "14", + "13.06", + "8" + ], + [ + "loose lips sink ships", + "7.7", + "13", + "13.28", + "11" + ], + [ + "anything could happen", + "7.2", + "12", + "13.46", + "9" + ], + [ + "the reunion", + "5.9", + "10", + "10.65", + "22" + ] + ], + "title": "", + "original_id": "86e19cb374ce7c6940e9a9d467303067" + }, + { + "_id": "4ab0e3804d5f49ed8d082dd24a29ffc0", + "header": [ + "Animal", + "Sex", + "Metabolic rate", + "Mean", + "Difference from mean", + "Squared difference from mean" + ], + "rows": [ + [ + "1", + "Female", + "727.7", + "1285.5", + "557.8", + "311140.84" + ], + [ + "2", + "Female", + "1086.5", + "1285.5", + "199.0", + "39601.00" + ], + [ + "3", + "Female", + "1091.0", + "1285.5", + "194.5", + "37830.25" + ], + [ + "4", + "Female", + "1361.3", + "1285.5", + "75.8", + "5745.64" + ], + [ + "5", + "Female", + "1490.5", + "1285.5", + "205.0", + "42025.00" + ], + [ + "6", + "Female", + "1956.1", + "1285.5", + "670.6", + "449704.36" + ], + [ + "-", + "-", + "-", + "-", + "-", + "-" + ], + [ + "Mean of metabolic rates", + "Mean of metabolic rates", + "Mean of metabolic rates", + "1285.5", + "Sum of squared differences", + "886047.09" + ] + ], + "title": "", + "original_id": "f51a77d4ffba1aedfe3cc6743ed3e054" + }, + { + "_id": "0fc5392270225864dd6577bb60a64160", + "header": [ + "language", + "sorata municipality", + "guanay municipality", + "tacacoma municipality", + "quiabaya municipality", + "combaya municipality", + "tipuani municipality", + "mapiri municipality", + "teoponte municipality" + ], + "rows": [ + [ + "quechua", + "363.0", + "1.653", + "1.058", + "33.0", + "20.0", + "1.587", + "3.649", + "756.0" + ], + [ + "aymara", + "16.029", + "3.405", + "4.389", + "2.269", + "2.522", + "2.534", + "1.767", + "2.837" + ], + [ + "guaranã­", + "7.0", + "5.0", + "1.0", + "0.0", + "0.0", + "20.0", + "6.0", + "6.0" + ], + [ + "another native", + "8.0", + "94.0", + "17.0", + "2.0", + "1.0", + "18.0", + "7.0", + "22.0" + ], + [ + "spanish", + "11.223", + "10.064", + "4.321", + "1.391", + "1.214", + "8.594", + "8.567", + "6.211" + ], + [ + "foreign", + "70.0", + "86.0", + "6.0", + "6.0", + "1.0", + "61.0", + "17.0", + "33.0" + ], + [ + "only native", + "6.68", + "737.0", + "1.599", + "1.023", + "1.363", + "190.0", + "363.0", + "472.0" + ], + [ + "native and spanish", + "9.54", + "4.123", + "3.389", + "1.256", + "1.162", + "3.499", + "4.653", + "2.925" + ] + ], + "title": "", + "original_id": "2f5bd1470c21eed07d5d123b6aaa1c04" + }, + { + "_id": "dc6738fe051c24488e626105096ec08e", + "header": [ + "solution", + "other name", + "(mmol / l)", + "(mmol / l).1", + "(mmol / l).2", + "(mg / dl)" + ], + "rows": [ + [ + "d5w", + "5% dextrose", + "0", + "0", + "278", + "5000" + ], + [ + "2 / 3d & 1 / 3s", + "3.3% dextrose / 0.3% saline", + "51", + "51", + "185", + "3333" + ], + [ + "half - normal saline", + "0.45% nacl", + "77", + "77", + "0", + "0" + ], + [ + "normal saline", + "0.9% nacl", + "154", + "154", + "0", + "0" + ], + [ + "ringer 's lactate", + "lactated ringer", + "130", + "109", + "0", + "0" + ], + [ + "d5ns", + "5% dextrose , normal saline", + "154", + "154", + "278", + "5000" + ] + ], + "title": "", + "original_id": "f26088bc16a0ad142dc69de97dfd6227" + }, + { + "_id": "f56cf963775848f377b639e3241e07fc", + "header": [ + "Election year", + "# of\nconstituency votes", + "% of\nconstituency votes", + "+/–", + "# of\nparty list votes", + "% of\nparty list votes", + "+/–.1", + "# of\noverall seats won" + ], + "rows": [ + [ + "1965", + "587,216", + "1.8", + "1.8", + "664,193", + "2.0", + "2.0", + "0 / 518" + ], + [ + "1969", + "1,189,375", + "3.6", + "1.8", + "1,422,010", + "4.3", + "2.3", + "0 / 518" + ], + [ + "1972", + "194,389", + "0.5", + "3.1", + "207,465", + "0.6", + "3.7", + "0 / 518" + ], + [ + "1976", + "136.023", + "0.4", + "0.1", + "122,661", + "0.3", + "0.3", + "0 / 518" + ], + [ + "1980", + null, + null, + null, + "68,096", + "0.2", + "0.1", + "0 / 497" + ], + [ + "1983", + "57,112", + "0.1", + "0.3", + "91,095", + "0.2", + "0.0", + "0 / 498" + ], + [ + "1987", + "182,880", + "0.5", + "0.4", + "227,054", + "0.6", + "0.4", + "0 / 497" + ], + [ + "1990", + "190,105", + "0.4", + "0.1", + "145,776", + "0.3", + "0.3", + "0 / 662" + ], + [ + "1998", + "45,043", + "0.1", + "0.3", + "126,571", + "0.3", + "0.0", + "0 / 669" + ], + [ + "2002", + "103,209", + "0.1", + "0.1", + "215,232", + "0.4", + "0.1", + "0 / 603" + ], + [ + "2005", + "857.777", + "1.8", + "1.6", + "748,568", + "1.6", + "1.2", + "0 / 614" + ], + [ + "2009", + "768,442", + "1.8", + "0.0", + "635,525", + "1.5", + "0.1", + "0 / 620" + ], + [ + "2013", + "634,842", + "1.5", + "0.3", + "560,660", + "1.3", + "0.2", + "0 / 630" + ] + ], + "title": "", + "original_id": "b878f1ad3f7646fcd7ede1bc02533f33" + }, + { + "_id": "7797cade115b7f4f92672a141f64829a", + "header": [ + "party", + "administrative panel", + "agricultural panel", + "cultural and educational panel", + "industrial and commercial panel", + "labour panel", + "national university of ireland", + "university of dublin", + "nominated by the taoiseach", + "total" + ], + "rows": [ + [ + "fianna fáil", + "2", + "3", + "2", + "2", + "2", + "1", + "0", + "0", + "12" + ], + [ + "fine gael", + "1", + "2", + "2", + "3", + "0", + "1", + "0", + "2", + "11" + ], + [ + "labour party", + "0", + "2", + "1", + "1", + "3", + "0", + "0", + "2", + "9" + ], + [ + "clann na talmhan", + "1", + "1", + "0", + "0", + "1", + "0", + "0", + "0", + "3" + ], + [ + "clann na poblachta", + "0", + "0", + "0", + "0", + "0", + "0", + "0", + "2", + "1" + ], + [ + "independent", + "1", + "1", + "0", + "1", + "1", + "1", + "3", + "5", + "14" + ], + [ + "total", + "7", + "11", + "5", + "9", + "11", + "3", + "3", + "11", + "60" + ] + ], + "title": "", + "original_id": "cb0e9191e00b1c14c4245fa8c0a04efd" + }, + { + "_id": "cd26f3cb592f9097cccd9415f0eb486f", + "header": [ + "Unnamed: 0", + "no", + "title", + "directed by", + "written by", + "viewers", + "original airdate", + "prod code" + ], + "rows": [ + [ + "13", + "1", + "live and let doyle", + "james allodi", + "allan hawco", + "1038000", + "january 12 , 2011", + "201" + ], + [ + "14", + "2", + "popeye doyle", + "steve scaini", + "allan hawco", + "944000", + "january 19 , 2011", + "202" + ], + [ + "15", + "3", + "a stand up guy", + "steve scaini", + "perry chafe", + "776000", + "january 26 , 2011", + "203" + ], + [ + "16", + "4", + "the son also rises", + "steve dimarco", + "jesse mckeown", + "899000", + "february 2 , 2011", + "204" + ], + [ + "17", + "5", + "something old , someone blue", + "james allodi", + "adam higgs & jackie may", + "854000", + "february 9 , 2011", + "205" + ], + [ + "18", + "6", + "the ryans and the pittmans", + "steve dimarco", + "greg nelson", + "843000", + "february 16 , 2011", + "206" + ], + [ + "19", + "7", + "crashing on the couch", + "keith samples", + "jackie may", + "760000", + "february 23 , 2011", + "207" + ], + [ + "20", + "8", + "sympathy for the devil", + "stacey curtis", + "john callaghan", + "834400", + "march 2 , 2011", + "208" + ], + [ + "21", + "9", + "will the real des courtney please stand up", + "keith samples", + "greg nelson", + "1026000", + "march 9 , 2011", + "209" + ], + [ + "22", + "10", + "the special detective", + "steve scaini", + "adam higgs", + "836000", + "march 16 , 2011", + "210" + ], + [ + "23", + "11", + "don't gamble with city hall", + "john vatcher", + "jackie may", + "1021000", + "march 23 , 2011", + "211" + ], + [ + "24", + "12", + "st john 's town", + "keith samples", + "perry chafe", + "730000", + "march 30 , 2011", + "212" + ] + ], + "title": "", + "original_id": "7648f00905c0673b773a2bf6ad1d8223" + }, + { + "_id": "f0dd1998cb99899404804827ca2d73b5", + "header": [ + "economy", + "1980", + "gap from thailand as of 1980 (times)", + "1985", + "1990", + "1995", + "2000", + "2005", + "2010", + "2012", + "gap from thailand as of 2012 (times)", + "gdp as of 2012 after purchasing power parity (ppp) calculations (usd billions)", + "gdp per capita as of 2012 (ppp)" + ], + "rows": [ + [ + "china", + "205", + "0.29", + "290", + "341", + "601", + "945", + "1726", + "4422", + "6076", + "1.07", + "12405.67", + "9162" + ], + [ + "hong kong", + "5679", + "8.16", + "6442", + "13330", + "22939", + "25128", + "25748", + "32429", + "36667", + "6.46", + "369.38", + "51494" + ], + [ + "japan", + "9309", + "13.38", + "11461", + "25144", + "42523", + "37303", + "35787", + "42916", + "46735", + "8.23", + "4627.89", + "36265" + ], + [ + "korea", + "1689", + "2.43", + "2414", + "6308", + "11779", + "11347", + "17551", + "20540", + "23113", + "4.07", + "1613.92", + "32272" + ], + [ + "malaysia", + "1812", + "2.6", + "2026", + "2432", + "4358", + "4030", + "5211", + "8633", + "10304", + "1.81", + "498.48", + "16922" + ], + [ + "singapore", + "4756", + "6.83", + "6754", + "12387", + "23718", + "22791", + "28498", + "44697", + "51162", + "9.01", + "326.51", + "60410" + ], + [ + "taiwan", + "2363", + "3.4", + "3271", + "8086", + "12865", + "14641", + "16023", + "18488", + "20328", + "3.58", + "903.47", + "38749" + ] + ], + "title": "", + "original_id": "fa409ae64ba45abe8542615ebf93a304" + }, + { + "_id": "7535753b7be4b68dbeb99231582de934", + "header": [ + "Model", + "8A", + "8Aa", + "8Ab", + "8B", + "8F" + ], + "rows": [ + [ + "Bore (mm)", + "120", + "120", + "120", + "120", + "140" + ], + [ + "Stroke (mm)", + "130", + "130", + "130", + "130", + "150" + ], + [ + "Displacement (l)", + "11.76", + "11.76", + "11.76", + "18.47", + "-" + ], + [ + "Compression ratio", + "4.7", + "4.7", + "5.3", + "5.3", + "5.3" + ], + [ + "Length (m)", + "1.19", + "1.25", + "1.31", + "1.36", + "1.32" + ], + [ + "Width (m)", + "0.81", + "0.83", + "0.85", + "0.86", + "0.89" + ], + [ + "Height (m)", + "0.77", + "0.81", + "0.87", + "0.90", + "0.88" + ], + [ + "Weight(kg)", + "195", + "215", + "230", + "236", + "256" + ], + [ + "Power output (hp)", + "140", + "150", + "180", + "200/235", + "300" + ], + [ + "at (rpm)", + "1900", + "2000", + "2100", + "2300", + "2100" + ] + ], + "title": "", + "original_id": "4af852836dd997ea05b065d0c530910b" + }, + { + "_id": "726f2b956788f88a91cc2b95c0fa2957", + "header": [ + "Place", + "PoW", + "Tanks", + "Guns" + ], + "rows": [ + [ + "Sidi Barrani", + "38,289", + "73", + "297" + ], + [ + "Sidi Omar", + "900", + "0", + "8" + ], + [ + "Bardia", + "42,000", + "130", + "275" + ], + [ + "Tobruk", + "25,000", + "87", + "208" + ], + [ + "Mechili", + "100", + "13", + "0" + ], + [ + "Derna Benghazi", + "2,000", + "10", + "24" + ], + [ + "Benghazi Agedabia", + "25,000", + "107", + "93" + ], + [ + "Total", + "133,298", + "420", + "845" + ] + ], + "title": "", + "original_id": "38f99d0e172d93c9772406669a71d12e" + }, + { + "_id": "af6ffd09f502735be86c261fd9de3e5d", + "header": [ + "no in series", + "no in season", + "title", + "directed by", + "written by", + "original air date", + "production code", + "us viewers (millions)" + ], + "rows": [ + [ + "67", + "1", + "charmed again (part 1)", + "michael schultz", + "brad kern", + "october 4 , 2001", + "4301801", + "6.0" + ], + [ + "68", + "2", + "charmed again (part 2)", + "michael schultz", + "brad kern", + "october 4 , 2001", + "4301801", + "6.0" + ], + [ + "69", + "3", + "hell hath no fury", + "chris long", + "krista vernoff", + "october 11 , 2001", + "4301069", + "5.0" + ], + [ + "70", + "4", + "enter the demon", + "joel j feigenbaum", + "daniel cerone", + "october 18 , 2001", + "4301071", + "5.7" + ], + [ + "71", + "5", + "size matters", + "noel nosseck", + "nell scovell", + "october 25 , 2001", + "4301070", + "5.3" + ], + [ + "72", + "6", + "a knight to remember", + "david straiton", + "alison schapker & monica breen", + "november 1 , 2001", + "4301072", + "4.7" + ], + [ + "73", + "7", + "brain drain", + "john behring", + "curtis kheel", + "november 8 , 2001", + "4301073", + "4.7" + ], + [ + "74", + "8", + "black as cole", + "les landau", + "abbey campbell , brad kern & nell scovell", + "november 15 , 2001", + "4301074", + "5.1" + ], + [ + "75", + "9", + "muse to my ears", + "joel j feigenbaum", + "krista vernoff", + "december 13 , 2001", + "4301075", + "4.5" + ], + [ + "76", + "10", + "a paige from the past", + "james l conway", + "daniel cerone", + "january 17 , 2002", + "4301076", + "3.4" + ], + [ + "77", + "11", + "trial by magic", + "chip scott laughlin", + "michael gleason", + "january 24 , 2002", + "4301077", + "4.1" + ], + [ + "78", + "12", + "lost and bound", + "noel nosseck", + "nell scovell", + "january 31 , 2002", + "4301078", + "3.9" + ], + [ + "79", + "13", + "charmed and dangerous", + "jon pare", + "alison schapker & monica breen", + "february 7 , 2002", + "4301079", + "4.7" + ], + [ + "80", + "14", + "the three faces of phoebe", + "joel j feigenbaum", + "curtis kheel", + "february 14 , 2002", + "4301080", + "4.7" + ], + [ + "81", + "15", + "marry - go - round", + "chris long", + "daniel cerone", + "march 14 , 2002", + "4301081", + "4.5" + ], + [ + "82", + "16", + "the fifth halliwheel", + "david straiton", + "krista vernoff", + "march 21 , 2002", + "4301082", + "4.8" + ], + [ + "83", + "17", + "saving private leo", + "john behring", + "daniel cerone & doug e jones", + "march 28 , 2002", + "4301083", + "3.9" + ], + [ + "84", + "18", + "bite me", + "john t kretchmer", + "curtis kheel", + "april 18 , 2002", + "4301084", + "3.6" + ], + [ + "85", + "19", + "we 're off to see the wizard", + "timothy lonsdale", + "alison schapker & monica breen", + "april 25 , 2002", + "4301085", + "4.2" + ], + [ + "86", + "20", + "long live the queen", + "jon parã", + "krista vernoff", + "may 2 , 2002", + "4301086", + "2.8" + ], + [ + "87", + "21", + "womb raider", + "mel damski", + "daniel cerone", + "may 9 , 2002", + "4301087", + "5.0" + ] + ], + "title": "", + "original_id": "0a593de4b82e18d255d786e3fee0d85f" + }, + { + "_id": "4f698906355b19f5079285735455ee3e", + "header": [ + "date", + "origin time", + "epicentre (lat , s)", + "epicentre (long , e)", + "local magnitude", + "location" + ], + "rows": [ + [ + "8 february 1920", + "05:24", + "35.0", + "111.0", + "6.2", + "260 km south west of cape leeuwin" + ], + [ + "18 december 1940", + "21:45", + "32.2", + "117.2", + "4.2", + "beverley , brookton" + ], + [ + "19 april 1946", + "21:13", + "38.5", + "114.5", + "5.7", + "west of yallingup" + ], + [ + "17 september 1946", + "15:12", + "32.5", + "116.9", + "4.5", + "pingelly" + ], + [ + "2 may 1949", + "10:00", + "30.9", + "116.4", + "5.1", + "yerecoin" + ], + [ + "7 may 1949", + "17:09", + "30.9", + "116.4", + "4.1", + "yerecoin" + ], + [ + "11 march 1952", + "06:09", + "31.3", + "116.5", + "5.1", + "bolgart" + ], + [ + "27 november 1954", + "08:36", + "32.0", + "116.7", + "3.9", + "talbot brook" + ], + [ + "29 april 1955", + "09:14", + "30.9", + "116.4", + "4.7", + "yerecoin" + ], + [ + "29 april 1955", + "19:49", + "30.9", + "116.4", + "4.4", + "yerecoin" + ], + [ + "29 august 1955", + "06:09", + "30.7", + "116.4", + "5.3", + "gabalong" + ], + [ + "30 august 1955", + "13:52", + "30.7", + "116.4", + "5.8", + "gabalong" + ], + [ + "30 august 1955", + "14:07", + "30.7", + "116.4", + "4.7", + "gabalong" + ], + [ + "30 august 1955", + "16:46", + "30.7", + "116.4", + "4.6", + "gabalong" + ], + [ + "24 february 1956", + "06:27", + "30.9", + "116.4", + "4.5", + "yerecoin" + ], + [ + "5 april 1956", + "23:13", + "30.9", + "116.4", + "4.5", + "yerecoin" + ], + [ + "20 march 1958", + "03:03", + "32.2", + "117.2", + "4.8", + "beverley , brookton" + ], + [ + "3 october 1959", + "12:07:22.0", + "34.5", + "114.5", + "4.2", + "55 km sw cape leeuwin" + ] + ], + "title": "", + "original_id": "1ff37e4c567cfe5f66c6db366400f737" + }, + { + "_id": "9bb93eb5e9526c7ef1d06da58e3d5e7c", + "header": [ + "place", + "code", + "area (km 2 )", + "population", + "most spoken language" + ], + "rows": [ + [ + "alldays", + "90901", + "11.75", + "385", + "northern sotho" + ], + [ + "bahanawa", + "90902", + "390.17", + "19068", + "northern sotho" + ], + [ + "bahanawa - ba - kibi", + "90903", + "163.78", + "7763", + "northern sotho" + ], + [ + "bochum part 1", + "90912", + "4.33", + "8501", + "northern sotho" + ], + [ + "bochum part 2", + "90905", + "182.33", + "15911", + "northern sotho" + ], + [ + "dichoeng", + "90906", + "58.29", + "17347", + "northern sotho" + ], + [ + "manthata", + "90907", + "1335.47", + "72175", + "northern sotho" + ], + [ + "matlala", + "90908", + "180.83", + "8697", + "northern sotho" + ], + [ + "pietersburg", + "90909", + "1.33", + "3818", + "northern sotho" + ], + [ + "ramutla", + "90910", + "7.81", + "1047", + "northern sotho" + ], + [ + "seshego", + "90911", + "6.0", + "1058", + "northern sotho" + ], + [ + "remainder of the municipality", + "90904", + "2198.72", + "5539", + "northern sotho" + ] + ], + "title": "", + "original_id": "3122e367beb2513ff31cd9040b8f9547" + }, + { + "_id": "4b7c3c65256b11060492de20ffced89e", + "header": [ + "Particulars", + "Total", + "Male", + "Female" + ], + "rows": [ + [ + "Total No. of Houses", + "122", + "-", + "-" + ], + [ + "Population", + "524", + "261", + "263" + ], + [ + "Child (0-6)", + "95", + "46", + "49" + ], + [ + "Schedule Caste", + "275", + "137", + "138" + ], + [ + "Schedule Tribe", + "0", + "0", + "0" + ], + [ + "Literacy", + "60.14 %", + "65.12 %", + "55.14 %" + ], + [ + "Total Workers", + "194", + "143", + "51" + ], + [ + "Main Worker", + "194", + "0", + "0" + ], + [ + "Marginal Worker", + "0", + "0", + "0" + ] + ], + "title": "", + "original_id": "910bce6a7c6d7346fb3efa20a9469d9f" + }, + { + "_id": "29dfe4db57b858d34423da705c61406a", + "header": [ + "s dam and gnis query link", + "s lake and gnis query link", + "s reservoir and gnis query link", + "borough or census area", + "comment" + ], + "rows": [ + [ + "5", + "27", + "0", + "aleutians east", + "lakes in table , reservoirs done" + ], + [ + "15", + "134", + "0", + "aleutians west (ca)", + "lakes , reservoirs done" + ], + [ + "8", + "58", + "6", + "anchorage", + "lakes and reservoirs in table" + ], + [ + "0", + "81", + "0", + "bethel (ca)", + "lakes , reservoirs done" + ], + [ + "0", + "0", + "0", + "bristol bay", + "lakes and reservoirs done" + ], + [ + "0", + "50", + "0", + "denali", + "lakes in table , reservoirs done" + ], + [ + "0", + "55", + "0", + "dillingham (ca)", + "lakes , reservoirs done" + ], + [ + "3", + "19", + "1", + "fairbanks north star", + "lakes and reservoirs in table" + ], + [ + "3", + "10", + "0", + "haines", + "lakes in table , reservoirs done" + ], + [ + "6", + "55", + "3", + "hoonah - angoon (ca)", + "lakes and reservoirs in table" + ], + [ + "8", + "31", + "5", + "juneau", + "lakes and reservoirs in table" + ], + [ + "10", + "440", + "4", + "kenai peninsula", + "lakes , reservoirs in table" + ], + [ + "12", + "57", + "8", + "ketchikan gateway", + "lakes , reservoirs in table" + ], + [ + "31", + "82", + "11", + "kodiak island", + "lakes , reservoirs in table" + ], + [ + "3", + "83", + "0", + "lake and peninsula", + "lakes , reservoirs done" + ], + [ + "5", + "451", + "1", + "matanuska - susitna", + "lakes , reservoirs in table" + ], + [ + "1", + "36", + "0", + "nome (ca)", + "lakes in table , reservoirs done" + ], + [ + "2", + "142", + "2", + "north slope", + "lakes , reservoirs in table" + ], + [ + "1", + "80", + "1", + "northwest arctic", + "lakes , reservoirs in table" + ], + [ + "9", + "163", + "4", + "p of wales - o ketchikan (ca)", + "lakes , reservoirs in table" + ], + [ + "9", + "90", + "3", + "sitka", + "lakes , reservoirs in table" + ], + [ + "3", + "9", + "3", + "skagway", + "lakes and reservoirs in table" + ], + [ + "0", + "130", + "0", + "southeast fairbanks (ca)", + "lakes , reservoirs in table" + ], + [ + "22", + "293", + "10", + "valdez - cordova (ca)", + "lakes , reservoirs in table" + ], + [ + "1", + "21", + "0", + "wade hampton (ca)", + "lakes in table , reservoirs done" + ], + [ + "8", + "60", + "5", + "wrangell - petersburg (ca)", + "lakes , reservoirs in table" + ], + [ + "0", + "26", + "0", + "yakutat", + "lakes in table , reservoirs done" + ], + [ + "2", + "513", + "0", + "yukon - koyukuk (ca)", + "lakes , reservoirs done" + ] + ], + "title": "", + "original_id": "f6ecd642029c0d49a2548e984de32a34" + }, + { + "_id": "4588b3ba19a40ac9efd316250836b8ee", + "header": [ + "rank", + "city", + "state", + "gdp in id b", + "population m (luz)", + "gdp per capita id k", + "eurozone" + ], + "rows": [ + [ + "1", + "paris", + "france", + "731", + "11.5", + "62.4", + "y" + ], + [ + "2", + "london", + "united kingdom", + "565", + "11.9", + "49.4", + "n" + ], + [ + "3", + "moscow", + "russia", + "321", + "10.5", + "30.6", + "n" + ], + [ + "4", + "madrid", + "spain", + "230", + "5.8", + "39.7", + "y" + ], + [ + "5", + "istanbul", + "turkey", + "187", + "13.2", + "14.2", + "n" + ], + [ + "6", + "barcelona", + "spain", + "177", + "4.97", + "35.6", + "y" + ], + [ + "7", + "rome", + "italy", + "144", + "3.46", + "41.6", + "y" + ], + [ + "8", + "milan", + "italy", + "136", + "3.08", + "44.2", + "y" + ], + [ + "9", + "vienna", + "austria", + "122", + "2.18", + "56.0", + "y" + ], + [ + "10", + "lisbon", + "portugal", + "98", + "2.44", + "40.2", + "y" + ], + [ + "11", + "athens", + "greece", + "96", + "4.01", + "23.9", + "y" + ], + [ + "12", + "berlin", + "germany", + "95", + "4.97", + "19.1", + "y" + ] + ], + "title": "", + "original_id": "9bd2405b2c4d9af26013351147098518" + }, + { + "_id": "327d0e569caa09f3398bc0f02f9a8ae1", + "header": [ + "year", + "class", + "team", + "points", + "wins" + ], + "rows": [ + [ + "1961", + "125cc", + "suzuki", + "0", + "0" + ], + [ + "1961", + "250cc", + "suzuki", + "0", + "0" + ], + [ + "1962", + "50cc", + "suzuki", + "23", + "0" + ], + [ + "1962", + "125cc", + "suzuki", + "4", + "0" + ], + [ + "1963", + "50cc", + "suzuki", + "20", + "1" + ], + [ + "1963", + "125cc", + "suzuki", + "1", + "0" + ], + [ + "1964", + "50cc", + "suzuki", + "19", + "0" + ], + [ + "1964", + "125cc", + "suzuki", + "6", + "0" + ], + [ + "1965", + "50cc", + "suzuki", + "16", + "0" + ], + [ + "1966", + "50cc", + "suzuki", + "3", + "0" + ], + [ + "1966", + "125cc", + "suzuki", + "4", + "0" + ], + [ + "1967", + "50cc", + "suzuki", + "8", + "1" + ] + ], + "title": "", + "original_id": "682fdc552a15e3f41d082db3957a5870" + }, + { + "_id": "18b921623ebacc8b6dd80cd388208bf0", + "header": [ + "no for season", + "no for series", + "episode", + "airdate", + "viewers (in millions)" + ], + "rows": [ + [ + "1", + "43", + "coast to coast", + "september 3 , 2013", + "2.01" + ], + [ + "2", + "44", + "alaskan adventure", + "september 10 , 2013", + "1.45" + ], + [ + "3", + "45", + "off road racing", + "september 17 , 2013", + "1.54" + ], + [ + "4", + "46", + "america 's biggest cars", + "september 24 , 2013", + "1.88" + ], + [ + "5", + "47", + "sturgis", + "october 22 , 2013", + "1.73" + ], + [ + "6", + "48", + "can cars float", + "october 29 , 2013", + "1.58" + ] + ], + "title": "", + "original_id": "b361d02410aacce63a84d3f811844411" + }, + { + "_id": "768cdea36e378e70188f4394d9825acf", + "header": [ + "year", + "region total", + "goondiwindi", + "waggamba", + "inglewood" + ], + "rows": [ + [ + "1933", + "8696", + "1931", + "2468", + "4297" + ], + [ + "1947", + "9114", + "2467", + "2590", + "4057" + ], + [ + "1954", + "10359", + "2950", + "2968", + "4441" + ], + [ + "1961", + "11265", + "3274", + "3123", + "4868" + ], + [ + "1966", + "10608", + "3529", + "2895", + "4184" + ], + [ + "1971", + "10253", + "3695", + "2913", + "3645" + ], + [ + "1976", + "9509", + "3741", + "2539", + "3229" + ], + [ + "1981", + "9334", + "3576", + "2732", + "3026" + ], + [ + "1986", + "9859", + "4103", + "2757", + "2999" + ], + [ + "1991", + "10181", + "4331", + "2898", + "2952" + ], + [ + "1996", + "9857", + "4374", + "2712", + "2771" + ], + [ + "2001", + "10348", + "4760", + "2975", + "2613" + ], + [ + "2006", + "10399", + "4873", + "2951", + "2575" + ], + [ + "2011", + "10628", + "4821", + "3221", + "2586" + ] + ], + "title": "", + "original_id": "3580eb2f494c1cd03a70cb2a1d754ee9" + }, + { + "_id": "b049032b5ce25cafb874cabb19fd44a1", + "header": [ + "episode no", + "airdate", + "viewers", + "bbc three weekly ranking", + "cable rank" + ], + "rows": [ + [ + "1", + "21 october 2010", + "956000", + "3", + "10" + ], + [ + "2", + "28 october 2010", + "959000", + "4", + "14" + ], + [ + "3", + "4 november 2010", + "1277000", + "2", + "6" + ], + [ + "4", + "11 november 2010", + "817000", + "6", + "18" + ], + [ + "5", + "18 november 2010", + "1019000", + "3", + "11" + ], + [ + "6", + "25 november 2010", + "869000", + "3", + "23" + ], + [ + "7", + "2 december 2010", + "982000", + "2", + "19" + ], + [ + "8", + "9 december 2010", + "953000", + "3", + "12" + ] + ], + "title": "", + "original_id": "813394653021785aae4edf6109618202" + }, + { + "_id": "daacbb11b8f51ed92cf7f2550044c7d5", + "header": [ + "Year of election", + "Candidates elected", + "# of seats available", + "# of votes", + "% of popular vote" + ], + "rows": [ + [ + "1963", + "7", + "108", + "n.a.", + "15.5%" + ], + [ + "1967", + "20", + "117", + "n.a.", + "25.9%" + ], + [ + "1971", + "19", + "117", + "n.a.", + "27.1%" + ], + [ + "1975", + "38", + "125", + "n.a.", + "28.9%" + ], + [ + "1977", + "33", + "125", + "n.a.", + "28.0%" + ], + [ + "1981", + "21", + "125", + "n.a.", + "21.2%" + ], + [ + "1985", + "25", + "125", + "865,507", + "23.8%" + ], + [ + "1987", + "19", + "130", + "970,813", + "25.7%" + ], + [ + "1990", + "74", + "130", + "1,509,506", + "37.6%" + ], + [ + "1995", + "17", + "129", + "854,163", + "20.6%" + ], + [ + "1999", + "9", + "103", + "551,009", + "12.6%" + ], + [ + "2003", + "7", + "103", + "660,730", + "14.7%" + ], + [ + "2007", + "10", + "107", + "741,043", + "16.8%" + ], + [ + "2011", + "17", + "107", + "980,204", + "22.73%" + ] + ], + "title": "", + "original_id": "a7d1be3dbb4f336774ab56d00253e5c4" + }, + { + "_id": "3310dbdb157351ccc5fd4da05f93c178", + "header": [ + "season", + "timeslot (edt)", + "season premiere", + "season finale", + "tv season", + "rank", + "viewers (in millions)", + "18 - 49 average" + ], + "rows": [ + [ + "1", + "sunday 9:00 pm", + "october 3 , 2004", + "may 22 , 2005", + "2004 - 2005", + "4", + "23.69", + "10.66" + ], + [ + "2", + "sunday 9:00 pm", + "september 25 , 2005", + "may 21 , 2006", + "2005 - 2006", + "4", + "21.7", + "10.09" + ], + [ + "3", + "sunday 9:00 pm", + "september 24 , 2006", + "may 20 , 2007", + "2006 - 2007", + "12", + "16.7", + "7.57" + ], + [ + "4", + "sunday 9:00 pm", + "september 30 , 2007", + "may 18 , 2008", + "2007 - 2008", + "8", + "17.52", + "6.71" + ], + [ + "5", + "sunday 9:00 pm", + "september 28 , 2008", + "may 17 , 2009", + "2008 - 2009", + "9", + "15.66", + "5.29" + ], + [ + "6", + "sunday 9:00 pm", + "september 27 , 2009", + "may 16 , 2010", + "2009 - 2010", + "20", + "12.83", + "4.25" + ], + [ + "7", + "sunday 9:00 pm", + "september 26 , 2010", + "may 15 , 2011", + "2010 - 2011", + "26", + "11.86", + "3.46" + ], + [ + "8", + "sunday 9:00 pm", + "september 25 , 2011", + "may 13 , 2012", + "2011 - 2012", + "37", + "10.6", + "2.74" + ] + ], + "title": "", + "original_id": "c9cdf1b4641dd95e6109b788dd0f8c95" + }, + { + "_id": "017c025a22ddc76c0621c7638cda2326", + "header": [ + "election", + "candidates fielded", + "of seats won", + "total votes", + "% of popular vote", + "place" + ], + "rows": [ + [ + "1983", + "4", + "0", + "3078", + "0.19%", + "7th" + ], + [ + "1986", + "9", + "0", + "4660", + "0.24%", + "5th" + ], + [ + "1991", + "42", + "0", + "12650", + "0.86%", + "4th" + ], + [ + "1996", + "71", + "0", + "31511", + "1.99%", + "5th" + ], + [ + "2001", + "72", + "0", + "197231", + "12.39%", + "3rd" + ], + [ + "2005", + "79", + "0", + "161842", + "9.17%", + "3rd" + ], + [ + "2009", + "85", + "0", + "134570", + "8.21%", + "3rd" + ] + ], + "title": "", + "original_id": "a3e33d0126a25007ebd7c38e3805f251" + }, + { + "_id": "652ac846352224bb50044a015196f36d", + "header": [ + "year", + "starts", + "wins", + "top 5", + "top 10", + "poles", + "avg start", + "avg finish", + "winnings", + "position", + "team (s)" + ], + "rows": [ + [ + "1990", + "4", + "0", + "0", + "0", + "0", + "27.8", + "31.0", + "17190", + "49th", + "50 ted musgrave racing 2 us motorsports inc" + ], + [ + "1991", + "29", + "0", + "0", + "0", + "0", + "29.6", + "22.0", + "200910", + "23rd", + "55 us motorsports inc" + ], + [ + "1992", + "29", + "0", + "1", + "7", + "0", + "24.3", + "16.7", + "449121", + "18th", + "55 radius motorsports" + ], + [ + "1993", + "29", + "0", + "2", + "5", + "0", + "21.7", + "22.0", + "458615", + "25th", + "55 radius motorsports" + ], + [ + "1994", + "31", + "0", + "1", + "8", + "3", + "20.0", + "17.4", + "656187", + "13th", + "16 roush racing" + ], + [ + "1995", + "31", + "0", + "7", + "13", + "1", + "17.6", + "13.2", + "1147445", + "7th", + "16 roush racing" + ], + [ + "1996", + "31", + "0", + "2", + "7", + "1", + "21.2", + "17.6", + "961512", + "16th", + "16 roush racing" + ], + [ + "1997", + "32", + "0", + "5", + "8", + "0", + "22.5", + "18.3", + "1256680", + "12th", + "16 roush racing" + ], + [ + "1999", + "32", + "0", + "0", + "2", + "0", + "27.2", + "26.5", + "1162403", + "33rd", + "75 butch mock motorsports" + ], + [ + "2001", + "1", + "0", + "0", + "0", + "0", + "15.0", + "29.0", + "73287", + "64th", + "7 ultra motorsports" + ], + [ + "2002", + "5", + "0", + "0", + "0", + "0", + "33.0", + "24.2", + "283770", + "50th", + "07 ultra motorsports 44 petty enterprises" + ] + ], + "title": "", + "original_id": "25b95d634bfc9a85d37e8e502149baae" + }, + { + "_id": "1a450c8ff4e316e2c06a06f213fde03c", + "header": [ + "year", + "start", + "qual", + "rank", + "finish", + "laps" + ], + "rows": [ + [ + "1951", + "31", + "132.226", + "26", + "4", + "200" + ], + [ + "1952", + "2", + "137.002", + "4", + "33", + "20" + ], + [ + "1953", + "5", + "136.06", + "19", + "33", + "3" + ], + [ + "1954", + "23", + "137.82", + "28", + "25", + "165" + ], + [ + "1955", + "8", + "139.098", + "22", + "6", + "200" + ], + [ + "1956", + "9", + "143.056", + "11", + "27", + "90" + ], + [ + "1957", + "12", + "143.244", + "5", + "5", + "200" + ] + ], + "title": "", + "original_id": "18d386e63b6b9369923115e348b965e7" + }, + { + "_id": "0a10af99b5cd4be438fd71cada5de4a9", + "header": [ + "episode", + "broadcast date", + "bbc one presenter (s)", + "starring", + "radio 1 presenter", + "viewers (millions)" + ], + "rows": [ + [ + "1", + "2005", + "clare balding", + "doug segal", + "n / a", + "6.43" + ], + [ + "2", + "2006", + "myleene klass", + "gethin jones , natasha kaplinsky & alesha dixon", + "n / a", + "6.06" + ], + [ + "3", + "2007", + "myleene klass", + "gethin jones , natasha kaplinsky & nick knowles", + "n / a", + "5.35" + ], + [ + "5", + "2009", + "myleene klass", + "n / a", + "nihal", + "7.65" + ], + [ + "6", + "2010", + "jake humphrey", + "n / a", + "nihal", + "9.37" + ], + [ + "7", + "2011", + "jake humphrey", + "n / a", + "nihal", + "10.67" + ], + [ + "8", + "2012", + "gabby logan", + "n / a", + "nihal", + "9.73" + ] + ], + "title": "", + "original_id": "ff185bf6ffc9bfde288ad3299663fdff" + }, + { + "_id": "f05ec81210c8bb76ee23479bcee3dd69", + "header": [ + "year", + "starts", + "wins", + "top 5", + "top 10", + "poles", + "avg start", + "avg finish", + "winnings", + "position", + "team (s)" + ], + "rows": [ + [ + "1985", + "1", + "0", + "0", + "0", + "0", + "16.0", + "14.0", + "2925", + "101st", + "07 bob johnson racing" + ], + [ + "1986", + "1", + "0", + "0", + "0", + "0", + "20.0", + "29.0", + "1815", + "107th", + "07 bob johnson racing" + ], + [ + "1988", + "1", + "0", + "0", + "0", + "0", + "29.0", + "37.0", + "1460", + "97th", + "74 wawak racing" + ], + [ + "1989", + "1", + "0", + "0", + "0", + "0", + "32.0", + "28.0", + "2725", + "83rd", + "63 linro motorsports" + ], + [ + "1990", + "2", + "0", + "0", + "0", + "0", + "33.0", + "35.5", + "6675", + "73rd", + "13 linro motorsports" + ], + [ + "1994", + "3", + "0", + "0", + "0", + "0", + "20.3", + "19.7", + "30565", + "48th", + "20 moroso racing 02 tw taylor" + ], + [ + "1995", + "14", + "0", + "0", + "0", + "0", + "29.4", + "27.4", + "281945", + "40th", + "22 bill davis racing 40 brooks / sabco racing" + ], + [ + "1998", + "9", + "0", + "1", + "3", + "0", + "25.3", + "26.2", + "336905", + "49th", + "50 hendrick motorsports" + ], + [ + "1999", + "2", + "0", + "0", + "0", + "0", + "19.0", + "38.5", + "71200", + "61st", + "14 no fear racing" + ], + [ + "2004", + "3", + "0", + "0", + "0", + "0", + "41.0", + "40.3", + "160261", + "68th", + "80 hover motorsports 98 mach 1 motorsports" + ] + ], + "title": "", + "original_id": "55f3914d42075dcde9c9c77774156a6c" + }, + { + "_id": "88c95446b1ace3ad63e52861f4323da0", + "header": [ + "year", + "edmonton hundred", + "elthorne hundred", + "gore hundred", + "isleworth hundred", + "holborn division", + "finsbury division", + "kensington division", + "tower division", + "spelthorne hundred", + "within the walls", + "without the walls", + "inns of court and chancery", + "westminster city and liberty", + "total" + ], + "rows": [ + [ + "1801", + "16885", + "16853", + "6968", + "9266", + "171202", + "73268", + "40642", + "215382", + "12743", + "63832", + "70676", + "1907", + "157890", + "818129" + ], + [ + "1811", + "20577", + "19929", + "8738", + "10669", + "214946", + "92538", + "54550", + "272966", + "14409", + "55484", + "70489", + "1796", + "166438", + "953774" + ], + [ + "1821", + "24771", + "23479", + "9806", + "12285", + "272131", + "119802", + "70808", + "339075", + "16966", + "56174", + "74765", + "1546", + "186584", + "1144531" + ], + [ + "1831", + "26930", + "26976", + "11315", + "13568", + "341981", + "151409", + "87961", + "427090", + "19204", + "55778", + "73442", + "1271", + "206116", + "1358130" + ], + [ + "1841", + "30683", + "34943", + "12487", + "15893", + "399218", + "185174", + "122795", + "513501", + "21298", + "54626", + "74758", + "1708", + "226241", + "1574416" + ], + [ + "1851", + "32109", + "35828", + "12956", + "18463", + "480942", + "239788", + "169317", + "641918", + "22107", + "54702", + "79096", + "1398", + "241450", + "1886576" + ], + [ + "1861", + "40885", + "42274", + "15341", + "23610", + "551487", + "312553", + "223305", + "773621", + "24795", + "44400", + "73125", + "1272", + "254463", + "2206485" + ], + [ + "1871", + "57332", + "46996", + "21291", + "30463", + "604891", + "381702", + "350688", + "902056", + "33069", + "28093", + "50733", + "1138", + "246592", + "2539765" + ] + ], + "title": "", + "original_id": "8f34be2fd33561d93c5f2053baa58892" + }, + { + "_id": "eb1a8a3c13be9f6344be596109a91143", + "header": [ + "year", + "start", + "qual", + "rank", + "finish", + "laps" + ], + "rows": [ + [ + "1960", + "28", + "142.354", + "29", + "9", + "200" + ], + [ + "1962", + "10", + "147.753", + "10", + "15", + "200" + ], + [ + "1963", + "25", + "148.227", + "27", + "28", + "46" + ], + [ + "1964", + "19", + "151.21", + "26", + "6", + "198" + ], + [ + "1965", + "24", + "154.672", + "23", + "16", + "115" + ], + [ + "1966", + "27", + "159.144", + "26", + "21", + "16" + ], + [ + "1967", + "25", + "163.228", + "22", + "14", + "182" + ], + [ + "1968", + "18", + "164.444", + "17", + "16", + "158" + ], + [ + "1969", + "18", + "166.597", + "18", + "15", + "155" + ], + [ + "1971", + "17", + "170.156", + "24", + "7", + "198" + ] + ], + "title": "", + "original_id": "12015a78608d814a680338824e98cc15" + }, + { + "_id": "0537440273cd388fe748df164fd1937c", + "header": [ + "year", + "total region", + "biggenden", + "eidsvold", + "gayndah", + "monto", + "mundubbera", + "perry" + ], + "rows": [ + [ + "1933", + "14322", + "2476", + "1475", + "3760", + "3514", + "2302", + "795" + ], + [ + "1947", + "13861", + "2179", + "1313", + "3407", + "4270", + "2064", + "628" + ], + [ + "1954", + "13917", + "1974", + "1311", + "3352", + "4458", + "2326", + "496" + ], + [ + "1961", + "13993", + "1882", + "1242", + "3400", + "4397", + "2617", + "455" + ], + [ + "1966", + "13715", + "1722", + "1702", + "3182", + "4155", + "2580", + "374" + ], + [ + "1971", + "12230", + "1639", + "1222", + "3107", + "3495", + "2391", + "376" + ], + [ + "1976", + "11504", + "1532", + "1231", + "2814", + "3228", + "2395", + "304" + ], + [ + "1981", + "11565", + "1411", + "1256", + "2859", + "3249", + "2481", + "309" + ], + [ + "1986", + "11583", + "1553", + "1212", + "2887", + "3266", + "2355", + "310" + ], + [ + "1991", + "11230", + "1574", + "1028", + "2856", + "3058", + "2340", + "374" + ], + [ + "1996", + "11243", + "1570", + "970", + "2916", + "2922", + "2514", + "351" + ], + [ + "2001", + "10782", + "1486", + "933", + "2894", + "2592", + "2451", + "426" + ] + ], + "title": "", + "original_id": "b9d8ed898f79c1447bf6ca63051b60e9" + }, + { + "_id": "5211d299fe4fa4b60f2bcc502c555d6c", + "header": [ + "electoral district", + "registered voters", + "seats in congress", + "candidates per party", + "participating parties", + "total candidates" + ], + "rows": [ + [ + "amazonas", + "179331", + "2", + "3", + "17", + "47" + ], + [ + "ancash", + "611881", + "5", + "5", + "21", + "99" + ], + [ + "apurímac", + "195954", + "2", + "3", + "21", + "55" + ], + [ + "arequipa", + "770535", + "5", + "5", + "21", + "101" + ], + [ + "ayacucho", + "306662", + "3", + "3", + "20", + "58" + ], + [ + "cajamarca", + "721239", + "5", + "5", + "23", + "109" + ], + [ + "callao", + "541730", + "4", + "4", + "24", + "92" + ], + [ + "cusco", + "643629", + "5", + "5", + "22", + "98" + ], + [ + "huancavelica", + "203844", + "2", + "3", + "15", + "39" + ], + [ + "huánuco", + "354416", + "3", + "3", + "22", + "65" + ], + [ + "ica", + "451197", + "4", + "5", + "22", + "88" + ], + [ + "junín", + "701190", + "5", + "5", + "22", + "99" + ], + [ + "la libertad", + "942656", + "7", + "7", + "22", + "145" + ], + [ + "lambayeque", + "676735", + "5", + "5", + "22", + "101" + ], + [ + "lima", + "6063109", + "35", + "35", + "24", + "738" + ], + [ + "loreto", + "416419", + "3", + "3", + "22", + "60" + ], + [ + "madre de dios", + "47742", + "1", + "3", + "14", + "35" + ], + [ + "moquegua", + "99962", + "2", + "3", + "18", + "44" + ], + [ + "pasco", + "135670", + "2", + "3", + "17", + "51" + ], + [ + "piura", + "914912", + "6", + "6", + "23", + "136" + ], + [ + "puno", + "674865", + "5", + "5", + "23", + "106" + ], + [ + "san martín", + "357124", + "3", + "3", + "17", + "47" + ], + [ + "tacna", + "172427", + "2", + "3", + "18", + "57" + ], + [ + "tumbes", + "110335", + "2", + "3", + "19", + "57" + ], + [ + "ucayali", + "201342", + "2", + "3", + "22", + "60" + ] + ], + "title": "", + "original_id": "8375929c803567a8bb59bb0470b615ab" + }, + { + "_id": "ff84765ce496a977dff04689e3037e12", + "header": [ + "series", + "season", + "title", + "directed by", + "written by", + "original air date", + "prod code", + "us viewers (millions)" + ], + "rows": [ + [ + "22", + "1", + "out of control", + "gerren keith", + "sarah jane cunningham & suzie v freeman", + "october 3 , 2003", + "203", + "2.9" + ], + [ + "23", + "2", + "don't have a cow", + "rich correll", + "michael carrington", + "october 17 , 2003", + "204", + "4.5" + ], + [ + "24", + "3", + "run , raven , run", + "rich correll", + "marc warren", + "november 7 , 2003", + "202", + "4.1" + ], + [ + "25", + "4", + "clothes minded", + "sean mcnamara", + "edward c evans", + "january 1 , 2004", + "207", + "3.6" + ], + [ + "26", + "5", + "four 's a crowd", + "rich correll", + "michael feldman", + "january 30 , 2004", + "206", + "5.5" + ], + [ + "27", + "6", + "hearts and minds", + "rich correll", + "michael feldman", + "february 6 , 2004", + "212", + "3.8" + ], + [ + "28", + "7", + "close encounters of the nerd kind", + "john tracy", + "josh lynn & danny warren", + "march 26 , 2004", + "211", + "2.4" + ], + [ + "29", + "8", + "that 's so not raven", + "sean mcnamara", + "dennis rinsler", + "april 9 , 2004", + "201", + "7.1" + ], + [ + "30", + "9", + "blue in the face", + "sean mcnamara", + "maisha closson", + "april 16 , 2004", + "208", + "1.9" + ], + [ + "31", + "10", + "spa day afternoon", + "carl lauten", + "dava savel", + "may 21 , 2004", + "209", + "2.4" + ], + [ + "32", + "11", + "leave it to diva", + "donna pescow", + "marc warren", + "may 28 , 2004", + "213", + "2.9" + ], + [ + "33", + "12", + "there goes the bride", + "erma elzy - jones", + "sarah jane cunningham & suzie v freeman", + "june 11 , 2004", + "216", + "2.7" + ], + [ + "34", + "13", + "radio heads", + "rich correll", + "dennis rinsler", + "june 25 , 2004", + "215", + "3.7" + ], + [ + "35", + "14", + "a goat 's tale", + "debbie allen", + "edward c evans", + "july 2 , 2004", + "217", + "4.3" + ], + [ + "36", + "15", + "he 's got the power", + "john tracy", + "dava savel", + "july 9 , 2004", + "205", + "4.9" + ], + [ + "37", + "16", + "skunk'd", + "christopher b pearman", + "sarah jane cunningham & suzie v freeman", + "july 16 , 2004", + "219", + "5.0" + ], + [ + "38", + "17", + "the dating shame", + "sean mcnamara", + "edward c evans & michael feldman", + "july 23 , 2004", + "218", + "4.6" + ], + [ + "39", + "18", + "the road to audition", + "debbie allen", + "beth seriff & geoff tarson", + "july 30 , 2004", + "214", + "4.3" + ], + [ + "40", + "19", + "the lying game", + "rich correll", + "dennis rinsler & marc warren", + "august 6 , 2004", + "220", + "4.27" + ], + [ + "41", + "20", + "numb and number", + "rondell sheridan", + "michael feldman & dava savel", + "september 10 , 2004", + "221", + "3.65" + ] + ], + "title": "", + "original_id": "68c1029fd30571a6e389a3a683fb73a2" + }, + { + "_id": "b471331ca8ea674c1535d52039bf7783", + "header": [ + "no", + "-", + "title", + "directed by", + "written by", + "original air date", + "production code", + "us viewers (million)" + ], + "rows": [ + [ + "89", + "1", + "revival", + "steward lee", + "chris collins", + "september 29 , 2012", + "4.26", + "1.94" + ], + [ + "90", + "2", + "a war on two fronts", + "dave filoni", + "chris collins", + "october 6 , 2012", + "4.15", + "1.71" + ], + [ + "91", + "3", + "front runners", + "steward lee", + "chris collins", + "october 13 , 2012", + "4.16", + "1.75" + ], + [ + "92", + "4", + "the soft war", + "kyle dunlevy", + "chris collins", + "october 20 , 2012", + "4.17", + "1.57" + ], + [ + "93", + "5", + "tipping points", + "bosco ng", + "chris collins", + "october 27 , 2012", + "4.18", + "1.42" + ], + [ + "94", + "6", + "the gathering", + "kyle dunlevy", + "christian taylor", + "november 3 , 2012", + "4.22", + "1.66" + ], + [ + "95", + "7", + "a test of strength", + "bosco ng", + "christian taylor", + "november 10 , 2012", + "4.23", + "1.74" + ], + [ + "96", + "8", + "bound for rescue", + "brian kalin o'connell", + "christian taylor", + "november 17 , 2012", + "4.24", + "1.96" + ], + [ + "97", + "9", + "a necessary bond", + "danny keller", + "christian taylor", + "november 24 , 2012", + "4.25", + "1.39" + ], + [ + "98", + "10", + "secret weapons", + "danny keller", + "brent friedman", + "december 1 , 2012", + "5.04", + "1.46" + ], + [ + "99", + "11", + "a sunny day in the void", + "kyle dunlevy", + "brent friedman", + "december 8 , 2012", + "5.05", + "1.43" + ], + [ + "100", + "12", + "missing in action", + "steward lee", + "brent friedman", + "january 5 , 2013", + "5.06", + "1.74" + ], + [ + "101", + "13", + "point of no return", + "bosco ng", + "brent friedman", + "january 12 , 2013", + "5.07", + "1.47" + ], + [ + "102", + "14", + "eminence", + "kyle dunlevy", + "chris collins", + "january 19 , 2013", + "5.01", + "1.85" + ], + [ + "103", + "15", + "shades of reason", + "bosco ng", + "chris collins", + "january 26 , 2013", + "5.02", + "1.83" + ], + [ + "104", + "16", + "the lawless", + "brian kalin o'connell", + "chris collins", + "february 2 , 2013", + "5.03", + "1.86" + ], + [ + "105", + "17", + "sabotage", + "brian kalin o'connell", + "charles murray", + "february 9 , 2013", + "5.08", + "2.02" + ], + [ + "106", + "18", + "the jedi who knew too much", + "danny keller", + "charles murray", + "february 16 , 2013", + "5.09", + "1.64" + ], + [ + "107", + "19", + "to catch a jedi", + "kyle dunlevy", + "charles murray", + "february 23 , 2013", + "5.1", + "2.06" + ] + ], + "title": "", + "original_id": "0116e7d6e612aa460deb91c8cd6ffe15" + }, + { + "_id": "a3d18431128b35b72e04eedd68faf64e", + "header": [ + "rank", + "city", + "province", + "date of official foundation of municipality", + "2006", + "1996", + "1986", + "1976", + "1966", + "1956" + ], + "rows": [ + [ + "1", + "tehran", + "tehran", + "1885", + "7705036", + "6758845", + "6042584", + "4530223", + "2719730", + "1512082" + ], + [ + "2", + "mashhad", + "razavi khorasan", + "1918", + "2410800", + "1887405", + "1463508", + "667770", + "409616", + "241984" + ], + [ + "3", + "esfahān", + "esfahān", + "1928", + "1602110", + "1266072", + "986753", + "661510", + "424045", + "254708" + ], + [ + "4", + "tabriz", + "east azarbaijan", + "1917", + "1398060", + "1191043", + "971482", + "597976", + "403413", + "289996" + ], + [ + "5", + "karaj", + "alborz", + "1934", + "1377450", + "940968", + "611510", + "137926", + "44243", + "14526" + ], + [ + "6", + "shiraz", + "fars", + "1950", + "1227311", + "1053025", + "848289", + "425813", + "269865", + "170659" + ] + ], + "title": "", + "original_id": "f08b94c7f4b830fd8c090b2ef668f701" + }, + { + "_id": "a0f50b6d629f6a507815c685d85a4bc8", + "header": [ + "2006", + "2007", + "2008", + "2009", + "2010" + ], + "rows": [ + [ + "20.0", + "19.9", + "20.4", + "20.0", + "20.7" + ], + [ + "17.5", + "17.6", + "17.2", + "16.9", + "16.4" + ], + [ + "6.9", + "7.1", + "6.9", + "6.9", + "6.9" + ], + [ + "8.2", + "7.5", + "6.8", + "6.5", + "6.4" + ], + [ + "4.9", + "4.6", + "4.7", + "4.7", + "4.6" + ], + [ + "2.0", + "2.0", + "1.9", + "2.1", + "1.9" + ], + [ + "1.4", + "1.3", + "1.6", + "1.7", + "2.0" + ], + [ + "1.7", + "1.7", + "1.4", + "1.4", + "1.1" + ], + [ + "1.2", + "1.3", + "1.3", + "1.3", + "1.2" + ], + [ + "1.0", + "1.1", + "1.2", + "1.3", + "1.4" + ], + [ + "1.7", + "1.1", + "1.0", + "1.2", + "0.9" + ], + [ + "1.4", + "1.3", + "1.2", + "1.2", + "1.2" + ], + [ + "0.6", + "0.7", + "0.9", + "1.1", + "1.0" + ], + [ + "0.4", + "0.6", + "1.1", + "1.0", + "0.9" + ], + [ + "0.4", + "0.7", + "0.9", + "0.9", + "1.0" + ], + [ + "0.6", + "0.7", + "0.8", + "0.8", + "1.0" + ], + [ + "0.8", + "0.6", + "0.5", + "0.6", + "0.5" + ], + [ + "1.0", + "0.7", + "0.6", + "0.5", + "0.5" + ], + [ + "0.4", + "0.5", + "0.5", + "0.5", + "0.4" + ], + [ + "0.5", + "0.5", + "0.4", + "0.5", + "0.6" + ], + [ + "0.5", + "0.5", + "0.4", + "0.5", + "0.4" + ], + [ + "0.3", + "0.3", + "0.2", + "0.2", + "0.2" + ], + [ + "0.3", + "0.3", + "0.3", + "0.2", + "0.2" + ], + [ + "0.3", + "0.2", + "0.2", + "0.2", + "0.2" + ], + [ + "0.4", + "0.2", + "0.2", + "0.1", + "0.1" + ], + [ + "0.3", + "0.2", + "0.1", + "0.1", + "0.1" + ], + [ + "0.2", + "0.2", + "0.2", + "0.1", + "0.1" + ], + [ + "0.2", + "0.2", + "0.1", + "0.1", + "0.1" + ] + ], + "title": "", + "original_id": "0203d48d1ea51d76ce1d8867c8b9843a" + }, + { + "_id": "85eb2e15a52bd11da2dc66260fea82a2", + "header": [ + "rank", + "airport", + "passengers", + "aircraft movements", + "carriers" + ], + "rows": [ + [ + "1", + "shanghai , china", + "192701", + "1465", + "china eastern airlines , jin air" + ], + [ + "2", + "osaka , japan", + "131338", + "1157", + "jeju air , korean air" + ], + [ + "3", + "tokyo , japan", + "124296", + "734", + "korean air" + ], + [ + "4", + "beijing , china", + "97055", + "768", + "china eastern airlines , korean air" + ], + [ + "5", + "taipei , republic of china (taiwan)", + "73754", + "585", + "jin air , transasia airways" + ], + [ + "6", + "ningbo , china", + "44067", + "303", + "china eastern airlines , eastar jet" + ], + [ + "7", + "nagoya , japan", + "41460", + "416", + "korean air" + ], + [ + "8", + "harbin , china", + "31574", + "201", + "china southern airlines , jin air" + ], + [ + "9", + "changchun , china", + "29129", + "214", + "china southern airlines" + ], + [ + "10", + "fukuoka , japan", + "27592", + "306", + "asiana airlines" + ], + [ + "11", + "shenyang , china", + "26168", + "238", + "china southern airlines" + ], + [ + "12", + "dalian , china", + "25359", + "204", + "china southern airlines" + ], + [ + "13", + "hong kong", + "24940", + "208", + "dragonair" + ], + [ + "14", + "hangzhou , china", + "22191", + "165", + "china eastern airlines" + ], + [ + "15", + "macau", + "21278", + "178", + "eastar jet" + ], + [ + "16", + "nanning , china", + "17114", + "122", + "eastar jet" + ], + [ + "17", + "xi'an , china", + "15022", + "107", + "jin air" + ], + [ + "18", + "guangzhou , china", + "14983", + "95", + "korean air" + ], + [ + "19", + "hefei , china", + "14226", + "105", + "eastar jet" + ], + [ + "20", + "changsha , china", + "12947", + "105", + "eastar jet" + ] + ], + "title": "", + "original_id": "f557ff1c99aaf41e253a7295f416c91a" + }, + { + "_id": "1c79d8afc74cc1ee275f284b9f5a3bfc", + "header": [ + "Works No.", + "IMR No.", + "PPR No.", + "CSAR No.", + "BMR or RRM No.", + "NGR No.", + "SAR No." + ], + "rows": [ + [ + "5677", + "-", + "-", + "-", + "RRM 63", + "-", + "949" + ], + [ + "5835", + "128", + "-", + "373", + "-", + "-", + "1032" + ], + [ + "5836", + "129", + "-", + "374", + "-", + "-", + "1033" + ], + [ + "5837", + "130", + "-", + "375", + "-", + "-", + "1034" + ], + [ + "5813", + "106", + "-", + "376", + "Pauling", + "-", + "1035" + ], + [ + "5814", + "107", + "-", + "377", + "-", + "-", + "1036" + ], + [ + "5815", + "108", + "-", + "378", + "-", + "-", + "1037" + ], + [ + "5816", + "109", + "-", + "379", + "-", + "-", + "1038" + ], + [ + "5817", + "110", + "-", + "-", + "MR 19", + "-", + "1355 (7D)" + ], + [ + "5818", + "111", + "-", + "381", + "-", + "-", + "1058" + ], + [ + "5819", + "112", + "-", + "382", + "-", + "-", + "1039" + ], + [ + "5820", + "113", + "-", + "383", + "Pauling", + "-", + "1040" + ], + [ + "5826", + "119", + "-", + "384", + "-", + "327", + "1055" + ], + [ + "5822", + "115", + "-", + "385", + "-", + "-", + "1041" + ], + [ + "5823", + "116", + "-", + "386", + "-", + "-", + "1042" + ], + [ + "5824", + "117", + "-", + "387", + "-", + "-", + "1043" + ], + [ + "5825", + "118", + "-", + "388", + "-", + "-", + "1044" + ], + [ + "5830", + "123", + "-", + "389", + "-", + "328", + "1056" + ], + [ + "5827", + "120", + "-", + "390", + "-", + "-", + "1045" + ], + [ + "5828", + "121", + "-", + "391", + "-", + "-", + "1046" + ], + [ + "5829", + "122", + "-", + "392", + "-", + "-", + "1047" + ], + [ + "5821", + "114", + "-", + "393", + "-", + "329", + "1057" + ], + [ + "5831", + "124", + "-", + "394", + "-", + "-", + "1048" + ], + [ + "5832", + "125", + "-", + "395", + "-", + "-", + "1049" + ], + [ + "5833", + "126", + "-", + "396", + "-", + "-", + "1050" + ], + [ + "5834", + "127", + "-", + "397", + "-", + "-", + "1051" + ], + [ + "5904", + "-", + "7", + "398", + "-", + "-", + "1052" + ], + [ + "5905", + "-", + "8", + "399", + "-", + "-", + "1053" + ], + [ + "5906", + "-", + "9", + "400", + "-", + "-", + "1054" + ] + ], + "title": "", + "original_id": "7c1ab41b76a1e613f892adbb60910e26" + }, + { + "_id": "7ffc5416643e949c76bce588f1337bb3", + "header": [ + "name", + "team", + "qual 1", + "qual 2", + "best" + ], + "rows": [ + [ + "sãbastien bourdais", + "n / h / l racing", + "58.783", + "58.288", + "58.288" + ], + [ + "justin wilson", + "rsports", + "59.099", + "58.299", + "58.299" + ], + [ + "oriol servia", + "forsythe racing", + "58.801", + "58.661", + "58.661" + ], + [ + "simon pagenaud", + "team australia", + "59.341", + "58.664", + "58.664" + ], + [ + "bruno junqueira", + "dale coyne racing", + "59.547", + "58.675", + "58.675" + ], + [ + "alex tagliani", + "rsports", + "59.737", + "58.779", + "58.779" + ], + [ + "will power", + "team australia", + "1:01.040", + "58.79", + "58.79" + ], + [ + "jan heylen", + "conquest racing", + "59.813", + "58.816", + "58.816" + ], + [ + "neel jani", + "pkv racing", + "1:00.123", + "58.834", + "58.834" + ], + [ + "paul tracy", + "forsythe racing", + "59.368", + "58.882", + "58.882" + ], + [ + "ryan dalziel", + "pacific coast motorsports", + "59.880", + "58.912", + "58.912" + ], + [ + "robert doornbos", + "minardi team usa", + "59.132", + "59.024", + "59.024" + ], + [ + "dan clarke", + "minardi team usa", + "59.288", + "59.263", + "59.263" + ], + [ + "tristan gommendy", + "pkv racing", + "59.624", + "59.265", + "59.265" + ], + [ + "graham rahal", + "n / h / l racing", + "59.456", + "59.384", + "59.384" + ], + [ + "katherine legge", + "dale coyne racing", + "59.520", + "59.562", + "59.52" + ], + [ + "alex figge", + "pacific coast motorsports", + "1:00.880", + "59.973", + "59.973" + ] + ], + "title": "", + "original_id": "5a118654a5c97985b6778b93673e8ba0" + }, + { + "_id": "ade331139ebb44240fcbc58dd32aa24d", + "header": [ + "draw", + "language", + "artist", + "english translation", + "place", + "points" + ], + "rows": [ + [ + "1", + "finnish", + "marion rung", + "chirpy chirp", + "7", + "4" + ], + [ + "2", + "french", + "fud leclerc", + "your name", + "13", + "0" + ], + [ + "3", + "spanish", + "victor balaguer", + "call me", + "13", + "0" + ], + [ + "4", + "german", + "eleonore schwarz", + "only in the vienna air", + "13", + "0" + ], + [ + "5", + "danish", + "ellen winther", + "lullaby", + "10", + "2" + ], + [ + "6", + "swedish", + "inger berggren", + "sun and spring", + "7", + "4" + ], + [ + "7", + "german", + "conny froboess", + "two little italians", + "6", + "9" + ], + [ + "8", + "dutch", + "de spelbrekers", + "-", + "13", + "0" + ], + [ + "9", + "french", + "isabelle aubret", + "a first love", + "1", + "26" + ], + [ + "10", + "norwegian", + "inger jacobsen", + "come sun , come rain", + "10", + "2" + ], + [ + "11", + "french", + "jean philippe", + "the return", + "10", + "2" + ], + [ + "12", + "serbian", + "lola novaković", + "don't turn the lights on at twilight", + "4", + "10" + ], + [ + "13", + "english", + "ronnie carroll", + "-", + "4", + "10" + ], + [ + "14", + "french", + "camillo felgen", + "little chap", + "3", + "11" + ], + [ + "15", + "italian", + "claudio villa", + "goodbye , goodbye", + "9", + "3" + ], + [ + "16", + "french", + "françois deguelt", + "say nothing", + "2", + "13" + ] + ], + "title": "", + "original_id": "fb02efe3a1c329c715cb8d0644dcbc02" + }, + { + "_id": "a493b2bb599437530a09529d99a0104a", + "header": [ + "draw", + "song", + "performer", + "televotes", + "rank" + ], + "rows": [ + [ + "1", + "preku moreto", + "tanja carovska", + "1339", + "12" + ], + [ + "2", + "ne zaboravaj", + "kaliopi", + "3834", + "9" + ], + [ + "3", + "son", + "monika sokolovska", + "862", + "15" + ], + [ + "4", + "ostani do kraj", + "toše proeski & megatim plus", + "4210", + "8" + ], + [ + "5", + "daj mi pricina da se razbudam", + "tanja , lidija & zorica pancic", + "2459", + "11" + ], + [ + "6", + "samovilska svadba", + "sašo gigov - giš", + "34774", + "2" + ], + [ + "7", + "ne baraj me", + "iskra trpeva & granit", + "681", + "20" + ], + [ + "8", + "ne veruvam", + "risto samardziev", + "8866", + "5" + ], + [ + "9", + "daj mi šansa", + "dule & koki", + "23615", + "3" + ], + [ + "10", + "koj si ti", + "biljana dodeva", + "828", + "16" + ], + [ + "11", + "te sakam beskrajno", + "pece ognenov and adrijana janevska", + "1100", + "13" + ], + [ + "12", + "bez tebe", + "duo maratov", + "764", + "17" + ], + [ + "13", + "ljubovta nema granici", + "intervali", + "694", + "19" + ], + [ + "14", + "kameleon", + "maja grozdanovska & bumerang", + "3319", + "10" + ], + [ + "15", + "andrea", + "marjan necak", + "725", + "18" + ], + [ + "16", + "opomena", + "suzana spasovska", + "5441", + "6" + ], + [ + "17", + "broj do deset", + "maja vukicevic", + "908", + "14" + ], + [ + "18", + "ne zori , zoro", + "vlado janevski", + "38642", + "1" + ], + [ + "19", + "ukradeni nokji", + "karolina gočeva", + "10454", + "4" + ], + [ + "20", + "pari pari", + "mico atanasiu", + "4453", + "7" + ] + ], + "title": "", + "original_id": "531afa6132809309425cb9afae455a06" + }, + { + "_id": "9403efcd20619260970d390f949a26aa", + "header": [ + "P", + "T", + "PC", + "Composition" + ], + "rows": [ + [ + "Musicalische Ergötzung (1691)", + "Musicalische Ergötzung (1691)", + "Musicalische Ergötzung (1691)", + "Musicalische Ergötzung (1691)" + ], + [ + "370a", + "331", + "348", + "Suite in F major, 2vn, b.c." + ], + [ + "371", + "332", + "349", + "Suite in C minor, 2vn, b.c." + ], + [ + "372", + "333", + "350", + "Suite in E-flat major, 2vn, b.c." + ], + [ + "373", + "334", + "351", + "Suite in E minor, 2vn, b.c." + ], + [ + "374", + "335", + "352", + "Suite in C major, 2vn, b.c." + ], + [ + "375", + "336", + "353", + "Suite in B-flat major, 2vn, b.c." + ], + [ + "-", + "-", + "-", + "-" + ], + [ + "28", + "341", + "-", + "Aria with 9 variations in A major, vn, 2vg" + ], + [ + "37", + "337", + "358", + "Canon and gigue in D major, 3vn, b.c." + ], + [ + "427*", + "-", + "359", + "Sonata in G major, vn, k.i." + ], + [ + "449", + "340", + "354", + "Suite in F-sharp minor, vn, 2va, b.c." + ], + [ + "450", + "339", + "355b?", + "Suite in G major (no. 1), vn, 2va, vle (Perrault writes: The lack of figuration for the lower part means that it was not a b.c., so that this work may well count as the first true string quartet, at least within the Germanophone domain.)" + ], + [ + "451", + "338", + "355a?", + "Suite in G major (no. 2), 2vn, 2va, b.c." + ], + [ + "453", + "-", + "-", + "Suite [tonality unspecified], vn, 2va, k.i., (?)b.c." + ] + ], + "title": "", + "original_id": "7160d3342f1a91cd79b02642e8702aa1" + }, + { + "_id": "e81f9af66841e45aef11da48c5c876c0", + "header": [ + "club", + "played", + "won", + "drawn", + "lost", + "points for", + "points against", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + "rows": [ + [ + "club", + "played", + "won", + "drawn", + "lost", + "points for", + "points against", + "tries for", + "tries against", + "try bonus", + "losing bonus", + "points" + ], + [ + "bryncoch rfc", + "22", + "21", + "0", + "1", + "743", + "403", + "106", + "58", + "13", + "0", + "93 1" + ], + [ + "ystalyfera rfc", + "22", + "15", + "0", + "7", + "563", + "379", + "67", + "47", + "5", + "4", + "69" + ], + [ + "taibach rfc", + "22", + "14", + "1", + "7", + "514", + "340", + "75", + "42", + "8", + "2", + "68" + ], + [ + "glyncorrwg rfc", + "22", + "13", + "1", + "8", + "468", + "311", + "61", + "38", + "5", + "6", + "65" + ], + [ + "resolven rfc", + "22", + "12", + "0", + "10", + "460", + "439", + "61", + "62", + "7", + "6", + "61" + ], + [ + "pontycymmer rfc", + "22", + "10", + "0", + "12", + "384", + "405", + "52", + "49", + "5", + "5", + "50" + ], + [ + "aberavon green stars rfc", + "22", + "10", + "0", + "12", + "342", + "598", + "49", + "85", + "5", + "3", + "48" + ], + [ + "ystradgynlais rfc", + "22", + "9", + "0", + "13", + "366", + "451", + "44", + "59", + "4", + "3", + "43" + ], + [ + "porthcawl rfc", + "22", + "7", + "1", + "14", + "490", + "517", + "64", + "72", + "6", + "6", + "42" + ], + [ + "vardre rfc", + "22", + "8", + "1", + "13", + "343", + "381", + "44", + "46", + "1", + "6", + "41" + ], + [ + "neath athletic rfc", + "22", + "7", + "0", + "15", + "352", + "521", + "48", + "75", + "5", + "8", + "41" + ], + [ + "birchgrove rfc", + "22", + "4", + "0", + "18", + "286", + "566", + "38", + "76", + "1", + "4", + "21" + ] + ], + "title": "", + "original_id": "d4b8c6cc2e2a7c529cf0fcb18b7849ef" + }, + { + "_id": "5e0dae69fc69a685ddd49f61e2661783", + "header": [ + "tribunal", + "number of autos da fé with known sentences", + "executions in persona", + "executions in effigie", + "penanced", + "total" + ], + "rows": [ + [ + "lisbon", + "248 (1540 - 1794)", + "461", + "181", + "7024", + "7666" + ], + [ + "évora", + "164 (1536 - 1781)", + "344", + "163", + "9466", + "9973" + ], + [ + "coimbra", + "277 (1541 - 1781)", + "313", + "234", + "9000", + "9547" + ], + [ + "goa", + "71 (1600 - 1773)", + "57", + "64", + "4046", + "4167" + ], + [ + "tomar", + "2 (1543 - 1544)", + "4", + "0", + "17", + "21" + ], + [ + "porto", + "1 (1543)", + "4", + "21", + "58", + "83" + ], + [ + "lamego", + "0", + "0", + "0", + "0", + "0" + ], + [ + "total", + "763", + "1183 (3.76%)", + "663 (2.11%)", + "29611 (94.13%)", + "31457 (100%)" + ] + ], + "title": "", + "original_id": "075477a3410897b75dcf401975444271" + }, + { + "_id": "46dcaa686ff3c3fcc27beb9de8b35b5a", + "header": [ + "artist", + "jaanu någisto", + "iiris vesik", + "erik morna", + "veronika portsmuth", + "chalice", + "kristo rajasaare", + "hannaliisa uusmaa", + "siim nestor", + "peeter vã¤hi", + "helen sildna", + "ott lepland", + "total", + "points" + ], + "rows": [ + [ + "ithaka maria", + "4", + "4", + "3", + "9", + "6", + "2", + "3", + "5", + "6", + "5", + "5", + "52", + "3" + ], + [ + "rolf junior", + "8", + "7", + "7", + "1", + "2", + "4", + "8", + "9", + "5", + "8", + "8", + "67", + "6" + ], + [ + "orelipoiss", + "1", + "5", + "10", + "10", + "10", + "9", + "9", + "10", + "1", + "9", + "7", + "81", + "10" + ], + [ + "getter jaani", + "9", + "9", + "6", + "5", + "3", + "5", + "4", + "8", + "10", + "3", + "6", + "68", + "7" + ], + [ + "jana kask", + "6", + "6", + "5", + "6", + "9", + "3", + "10", + "7", + "9", + "4", + "9", + "74", + "8" + ], + [ + "mid", + "3", + "1", + "9", + "7", + "8", + "10", + "7", + "4", + "2", + "7", + "4", + "62", + "5" + ], + [ + "outloudz", + "10", + "10", + "8", + "8", + "7", + "7", + "5", + "6", + "4", + "6", + "10", + "81", + "9" + ], + [ + "mimicry", + "5", + "3", + "1", + "4", + "4", + "6", + "2", + "2", + "3", + "1", + "1", + "32", + "2" + ], + [ + "noorkuu", + "7", + "2", + "2", + "3", + "1", + "1", + "1", + "3", + "7", + "2", + "2", + "31", + "1" + ] + ], + "title": "", + "original_id": "90003a11af0ec6e41c63642cc190c8ad" + }, + { + "_id": "7c9f16108cf02bfa416f02aaf9cface3", + "header": [ + "State/Region Hluttaws", + "MPs", + "Military MPs", + "Ethnic Minister", + "Total" + ], + "rows": [ + [ + "State Hluttaws", + "State Hluttaws", + "State Hluttaws", + "State Hluttaws", + "State Hluttaws" + ], + [ + "Chin State Hluttaw", + "18", + "6", + "0", + "24" + ], + [ + "Kachin State Hluttaw", + "36", + "13", + "4", + "53" + ], + [ + "Kayah State Hluttaw", + "14", + "5", + "1", + "20" + ], + [ + "Kayin State Hluttaw", + "14", + "6", + "3", + "23" + ], + [ + "Mon State Hluttaw", + "20", + "8", + "3", + "31" + ], + [ + "Rakhine State Hluttaw", + "34", + "12", + "1", + "47" + ], + [ + "Shan State Hluttaw", + "96", + "34", + "7", + "137" + ], + [ + "Regional Hluttaws", + "Regional Hluttaws", + "Regional Hluttaws", + "Regional Hluttaws", + "Regional Hluttaws" + ], + [ + "Ayeyarwady Region Hluttaw", + "52", + "18", + "2", + "72" + ], + [ + "Bago Region Hluttaw", + "56", + "19", + "1", + "76" + ], + [ + "Magway Region Hluttaw", + "50", + "17", + "1", + "68" + ], + [ + "Mandalay Region Hluttaw", + "56", + "19", + "1", + "76" + ], + [ + "Sagaing Region Hluttaw", + "74", + "25", + "2", + "101" + ], + [ + "Taninthayi Region Hluttaw", + "20", + "7", + "1", + "28" + ], + [ + "Yangon Region Hluttaw", + "90", + "31", + "2", + "123" + ], + [ + "-", + "630", + "220", + "29", + "879" + ] + ], + "title": "", + "original_id": "175726966dad3404ab9f4ea4021103dc" + }, + { + "_id": "e5ae2d74e0e8d60938f64dea3eb1b402", + "header": [ + "rank by average", + "competition finish", + "couple", + "total", + "number of dances", + "average" + ], + "rows": [ + [ + "1", + "1", + "jill & darren", + "371", + "11", + "33.7" + ], + [ + "2", + "2", + "denise & ian", + "359", + "11", + "32.6" + ], + [ + "3", + "4", + "aled & lilia", + "256", + "9", + "28.4" + ], + [ + "4", + "6", + "sarah & brendan", + "140", + "5", + "28.0" + ], + [ + "5", + "3", + "julian & erin", + "269", + "11", + "24.5" + ], + [ + "6", + "5", + "roger & camilla", + "165", + "7", + "23.6" + ], + [ + "7", + "9", + "carol & paul", + "42", + "2", + "21.0" + ], + [ + "8", + "8", + "esther & anton", + "56", + "3", + "18.7" + ], + [ + "9", + "7", + "diarmuid & nicole", + "55", + "4", + "13.8" + ] + ], + "title": "", + "original_id": "45f4f92e48b5167842bf0c30f624d0b4" + }, + { + "_id": "83a401546ee15751841ca78a9e3058f7", + "header": [ + "series", + "season", + "title", + "written by", + "original air date", + "us viewers (millions)" + ], + "rows": [ + [ + "36", + "1", + "the big bang", + "kari lizer & jeff astrof", + "february 4 , 2008", + "9.43" + ], + [ + "37", + "2", + "beauty is only spanx deep", + "kari lizer", + "february 11 , 2008", + "9.89" + ], + [ + "38", + "3", + "popular", + "jennifer crittenden", + "february 18 , 2008", + "9.4" + ], + [ + "39", + "4", + "traffic", + "jeff astrof", + "february 25 , 2008", + "9.14" + ], + [ + "40", + "5", + "between a rock and a hard place", + "aaron shure", + "march 3 , 2008", + "8.35" + ], + [ + "41", + "6", + "the new adventures of old christine", + "frank pines", + "march 10 , 2008", + "7.38" + ], + [ + "42", + "7", + "house", + "katie palmer", + "march 10 , 2008", + "9.62" + ], + [ + "43", + "8", + "burning down the house (part 1)", + "aaron shure", + "march 17 , 2008", + "11.47" + ] + ], + "title": "", + "original_id": "b31b52e170963e2b4d7fae9a6f59cc63" + }, + { + "_id": "e043ed780447d398b5fc8b120aeb87ba", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "cuba", + "27", + "16", + "8", + "51" + ], + [ + "2", + "mexico", + "6", + "9", + "6", + "21" + ], + [ + "3", + "colombia", + "3", + "1", + "7", + "11" + ], + [ + "4", + "bahamas", + "2", + "4", + "3", + "9" + ], + [ + "5", + "puerto rico", + "2", + "3", + "6", + "11" + ], + [ + "6", + "jamaica", + "1", + "3", + "3", + "7" + ], + [ + "7", + "us virgin islands", + "1", + "0", + "1", + "2" + ], + [ + "8", + "guyana", + "1", + "0", + "0", + "1" + ], + [ + "9", + "dominican republic", + "0", + "4", + "2", + "6" + ], + [ + "10", + "trinidad and tobago", + "0", + "2", + "1", + "3" + ], + [ + "10", + "venezuela", + "0", + "2", + "1", + "3" + ], + [ + "12", + "barbados", + "0", + "0", + "2", + "2" + ], + [ + "13", + "haiti", + "0", + "0", + "1", + "1" + ], + [ + "13", + "panama", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "9850b7df3d67a990615a254038222699" + }, + { + "_id": "d67cddfe71e4601b36a7d4e1438526c9", + "header": [ + "asian rank", + "world rank", + "country", + "gdp per capita", + "gdp world rank" + ], + "rows": [ + [ + "1", + "1", + "qatar", + "85638", + "69" + ], + [ + "2", + "4", + "brunei", + "50790", + "113" + ], + [ + "3", + "5", + "singapore", + "49754", + "44" + ], + [ + "4", + "9", + "kuwait", + "39344", + "56" + ], + [ + "5", + "14", + "united arab emirates", + "37941", + "55" + ], + [ + "6", + "22", + "japan", + "33596", + "3" + ], + [ + "7", + "24", + "bahrain", + "31899", + "105" + ], + [ + "8", + "26", + "republic of china (taiwan)", + "30322", + "19" + ], + [ + "9", + "31", + "israel", + "27147", + "52" + ], + [ + "10", + "34", + "south korea", + "24803", + "14" + ], + [ + "11", + "36", + "oman", + "23987", + "77" + ], + [ + "12", + "38", + "saudi arabia", + "22852", + "22" + ], + [ + "13", + "59", + "malaysia", + "13385", + "30" + ], + [ + "14", + "66", + "lebanon", + "11279", + "84" + ], + [ + "15", + "71", + "iran", + "10570", + "18" + ], + [ + "16", + "83", + "thailand", + "7907", + "24" + ], + [ + "17", + "100", + "people 's republic of china", + "7325", + "2" + ], + [ + "18", + "105", + "jordan", + "6976", + "99" + ], + [ + "19", + "106", + "bhutan", + "6962", + "n / a" + ], + [ + "20", + "109", + "maldives", + "4603", + "n / a" + ], + [ + "21", + "111", + "syria", + "6892", + "63" + ], + [ + "22", + "113", + "sri lanka", + "6765", + "65" + ], + [ + "23", + "120", + "indonesia", + "6728", + "16" + ], + [ + "24", + "122", + "philippines", + "3383", + "37" + ], + [ + "25", + "124", + "mongolia", + "3222", + "141" + ], + [ + "26", + "127", + "pakistan", + "2594", + "26" + ], + [ + "27", + "128", + "vietnam", + "2589", + "46" + ], + [ + "28", + "129", + "india", + "2563", + "4" + ], + [ + "29", + "107", + "east timor", + "4770", + "156" + ], + [ + "30", + "132", + "yemen", + "2343", + "81" + ], + [ + "31", + "136", + "laos", + "2054", + "128" + ], + [ + "32", + "140", + "papua new guinea", + "1974", + "131" + ], + [ + "33", + "143", + "cambodia", + "1818", + "103" + ], + [ + "34", + "153", + "bangladesh", + "1311", + "48" + ], + [ + "35", + "159", + "nepal", + "3397", + "96" + ], + [ + "36", + "161", + "burma", + "1040", + "78" + ] + ], + "title": "", + "original_id": "47219e7225da35f61cb5307288f2eac3" + }, + { + "_id": "2417200ef525319a013463f25625f74f", + "header": [ + "Number", + "Manufacturer", + "Build date", + "Length (mm)", + "Weight (t)" + ], + "rows": [ + [ + "201", + "Nippon Sharyo", + "1961", + "20,000", + "30.0" + ], + [ + "202", + "Nippon Sharyo", + "1961", + "20,000", + "30.0" + ], + [ + "203", + "Nippon Sharyo", + "1963", + "20,000", + "30.0" + ], + [ + "204", + "Nippon Sharyo", + "1963", + "20,000", + "30.0" + ], + [ + "205", + "Nippon Sharyo", + "1963", + "20,000", + "30.0" + ], + [ + "206", + "Nippon Sharyo", + "1963", + "20,000", + "30.0" + ], + [ + "207", + "Nippon Sharyo", + "1970", + "20,000", + "30.0" + ], + [ + "208", + "Nippon Sharyo", + "1970", + "20,000", + "30.0" + ], + [ + "209", + "Nippon Sharyo", + "1970", + "20,000", + "30.0" + ], + [ + "210", + "Nippon Sharyo", + "1970", + "20,000", + "30.0" + ], + [ + "211", + "Nippon Sharyo", + "1975", + "20,000", + "30.0" + ], + [ + "212", + "Nippon Sharyo", + "1975", + "20,000", + "30.0" + ], + [ + "213", + "Nippon Sharyo", + "1977", + "20,000", + "30.0" + ], + [ + "214", + "Nippon Sharyo", + "1977", + "20,000", + "30.0" + ] + ], + "title": "", + "original_id": "759da94748ad76efea4d2e7f8a1a0f98" + }, + { + "_id": "f7ab51757585823845d52b73b00f7a3d", + "header": [ + "warship", + "tons ( lton )", + "horse - power", + "speed ( knots )", + "main artillery", + "built year" + ], + "rows": [ + [ + "o'higgins", + "1101.0", + "300", + "12", + "3x115 - 2x70 - 2x12 - pounders", + "1874" + ], + [ + "chacabuco", + "1101.0", + "300", + "11", + "1x115 - 2x70 - 2x12 - pounders", + "1874" + ], + [ + "abtao", + "1051.0", + "300", + "8", + "3x115 - 3x30 - pounders", + "1870" + ], + [ + "magallanes", + "772.0", + "260", + "115", + "1x115 - 1x64 - 2x20 - pounders", + "1874" + ], + [ + "covadonga", + "412.0", + "140", + "7", + "2x70 - 3x40 - pounders", + "1859" + ], + [ + "esmeralda", + "854.0", + "200", + "8", + "16x32 - 2x12 - pounders", + "1855" + ], + [ + "uniã cubicn", + "1.15", + "320", + "13", + "12x68 - 1x9 - pounders", + "1864" + ] + ], + "title": "", + "original_id": "93fdf9fdfc3faa74391119e6248abd37" + }, + { + "_id": "122ec56280332bdc97fdfe6580fddeca", + "header": [ + "rank", + "circuit", + "headquarters", + "screens", + "sites" + ], + "rows": [ + [ + "1", + "regal entertainment group", + "knoxville , tn", + "7367", + "580" + ], + [ + "2", + "amc entertainment inc", + "kansas city , mo", + "5894", + "483" + ], + [ + "3", + "cinemark theatres", + "plano , tx", + "3895", + "298" + ], + [ + "4", + "carmike cinemas , inc", + "columbus , ga", + "2242", + "232" + ], + [ + "5", + "cineplex entertainment", + "toronto , on", + "1438", + "133" + ], + [ + "6", + "rave motion pictures", + "dallas , tx", + "939", + "62" + ], + [ + "7", + "marcus theatres", + "milwaukee , wi", + "687", + "55" + ], + [ + "8", + "national amusements", + "dedham , ma", + "450", + "34" + ], + [ + "9", + "empire theatres", + "stellarton , ns", + "438", + "53" + ] + ], + "title": "", + "original_id": "60670a8d9b1e39dd845fb1639d0d8b86" + }, + { + "_id": "42183e426ca6b353dc24e26ece160332", + "header": [ + "ballarat fl", + "wins", + "byes", + "losses", + "draws", + "against" + ], + "rows": [ + [ + "sunbury", + "16", + "1", + "1", + "0", + "1022" + ], + [ + "melton south", + "12", + "2", + "4", + "0", + "1191" + ], + [ + "redan", + "12", + "2", + "4", + "0", + "974" + ], + [ + "lake wendouree", + "12", + "2", + "4", + "0", + "1127" + ], + [ + "daylesford", + "11", + "2", + "5", + "0", + "1109" + ], + [ + "darley", + "11", + "2", + "5", + "0", + "1230" + ], + [ + "ballarat", + "5", + "2", + "11", + "0", + "1665" + ], + [ + "melton", + "4", + "2", + "12", + "0", + "1638" + ], + [ + "sebastapol", + "3", + "1", + "14", + "0", + "1802" + ], + [ + "east point", + "2", + "1", + "15", + "0", + "2090" + ], + [ + "bacchus marsh", + "2", + "1", + "15", + "0", + "2375" + ] + ], + "title": "", + "original_id": "c5b41b1733a460472e3d1bc744be96d1" + }, + { + "_id": "7293f2fa7eafab2bd6237d51379d0fbd", + "header": [ + "language", + "totora municipality", + "pojo municipality", + "pocona municipality", + "chimoré municipality", + "puerto villarroel municipality", + "entre ríos municipality" + ], + "rows": [ + [ + "quechua", + "11671", + "10203", + "12482", + "9596", + "29940", + "14789" + ], + [ + "aymara", + "72", + "74", + "39", + "965", + "1590", + "907" + ], + [ + "guaraní", + "7", + "9", + "3", + "19", + "39", + "41" + ], + [ + "another native", + "16", + "9", + "6", + "424", + "235", + "27" + ], + [ + "spanish", + "4967", + "4991", + "4954", + "11530", + "29377", + "17164" + ], + [ + "foreign", + "32", + "15", + "22", + "128", + "199", + "142" + ], + [ + "only native", + "7060", + "5623", + "7706", + "2518", + "8131", + "3207" + ], + [ + "native and spanish", + "4645", + "4598", + "4790", + "7811", + "22426", + "11864" + ], + [ + "only spanish", + "322", + "393", + "166", + "3726", + "6956", + "5314" + ] + ], + "title": "", + "original_id": "9ea49f48f21f83149313285053b6621c" + }, + { + "_id": "8e960f5839593acb4752ea0ce7c0aca6", + "header": [ + "series", + "model", + "cpu clock ( mhz )", + "cpu cores", + "tdp ( w )", + "l2 cache (kib)", + "radeon cores", + "ddr3 speed" + ], + "rows": [ + [ + "c - series", + "c - 30", + "1000", + "1", + "0 9", + "512", + "80", + "1066" + ], + [ + "c - series", + "c - 50", + "1000", + "2", + "0 9", + "2512", + "80", + "1066" + ], + [ + "c - series", + "c - 60", + "1000 / 1333 (turbo)", + "2", + "0 9", + "2512", + "80", + "1066" + ], + [ + "c - series", + "c - 70", + "1000 / 1333 (turbo)", + "2", + "0 9", + "2512", + "80", + "1066" + ], + [ + "e - series", + "e - 240", + "1500", + "1", + "18", + "512", + "80", + "1066" + ], + [ + "e - series", + "e - 300", + "1300", + "2", + "18", + "2512", + "80", + "1066" + ], + [ + "e - series", + "e - 350", + "1600", + "2", + "18", + "2512", + "80", + "1066" + ], + [ + "e - series", + "e - 450", + "1650", + "2", + "18", + "2512", + "80", + "1333" + ], + [ + "e - series", + "e1 - 1200", + "1400", + "2", + "18", + "2512", + "80", + "1066" + ], + [ + "e - series", + "e1 - 1500", + "1480", + "2", + "18", + "2512", + "80", + "1066" + ], + [ + "e - series", + "e2 - 1800", + "1700", + "2", + "18", + "2512", + "80", + "1333" + ], + [ + "e - series", + "e2 - 2000", + "1750", + "2", + "18", + "2512", + "80", + "1333" + ], + [ + "g - series", + "t - 24l", + "0 800", + "1", + "0 5", + "512", + "80", + "1066" + ], + [ + "g - series", + "t - 30l", + "1400", + "1", + "18", + "512", + "80", + "1333" + ], + [ + "g - series", + "t - 40n", + "1000", + "2", + "0 9", + "2512", + "80", + "1066" + ], + [ + "g - series", + "t - 44r", + "1200", + "1", + "0 9", + "512", + "80", + "1066" + ], + [ + "g - series", + "t - 48l", + "1400", + "2", + "18", + "2512", + "80", + "1066" + ], + [ + "g - series", + "t - 48n", + "1400", + "2", + "18", + "2512", + "80", + "1066" + ], + [ + "g - series", + "t - 52r", + "1500", + "1", + "18", + "512", + "80", + "1066" + ], + [ + "g - series", + "t - 56n", + "1600", + "2", + "18", + "2512", + "80", + "1066" + ], + [ + "z - series", + "z - 01", + "1000", + "2", + "5.9", + "2512", + "80", + "1066" + ], + [ + "z - series", + "z - 60", + "1000", + "2", + "4.5", + "2512", + "80", + "1066" + ] + ], + "title": "", + "original_id": "a391095376b9b00a461c12b58b5cf94b" + }, + { + "_id": "41c5c295549635003a30b51ff8d88987", + "header": [ + "ensemble", + "gold medals", + "silver medals", + "bronze medals", + "total medals" + ], + "rows": [ + [ + "amador valley hs", + "0", + "1", + "0", + "1" + ], + [ + "ayala high school", + "4", + "2", + "1", + "7" + ], + [ + "baldwinsville hs", + "2", + "0", + "0", + "2" + ], + [ + "claremont hs", + "1", + "1", + "0", + "2" + ], + [ + "downers grove hs", + "0", + "0", + "1", + "1" + ], + [ + "father ryan hs", + "0", + "1", + "0", + "1" + ], + [ + "fort mill hs", + "2", + "1", + "2", + "5" + ], + [ + "franklin central hs", + "6", + "0", + "0", + "6" + ], + [ + "gateway high school", + "2", + "1", + "1", + "4" + ], + [ + "goshen hs", + "0", + "2", + "1", + "3" + ], + [ + "harrison central paragon hs", + "0", + "0", + "1", + "1" + ], + [ + "james logan high school", + "1", + "1", + "0", + "2" + ], + [ + "john overton hs", + "0", + "1", + "2", + "3" + ], + [ + "king philip high school", + "0", + "1", + "0", + "1" + ], + [ + "mansfield hs", + "0", + "1", + "0", + "1" + ], + [ + "mission viejo high school", + "0", + "1", + "0", + "1" + ], + [ + "muscle shoals hs", + "1", + "1", + "2", + "4" + ], + [ + "new philadelphia hs", + "0", + "1", + "0", + "1" + ], + [ + "northglenn hs", + "0", + "0", + "1", + "1" + ], + [ + "rangeview hs", + "0", + "1", + "0", + "1" + ], + [ + "roland hayes school", + "0", + "0", + "1", + "1" + ], + [ + "tarpon springs hs", + "0", + "1", + "0", + "1" + ], + [ + "tunstall hs", + "0", + "3", + "4", + "7" + ], + [ + "warsaw community hs", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "7982e29a97a23d0882ec57e3f0ef5106" + }, + { + "_id": "1128d489978c5410ef44cd0f04c35ce6", + "header": [ + "sr no", + "name of road", + "passes through - district (s", + "length (in km)", + "mdr no" + ], + "rows": [ + [ + "1", + "nahan dadahul haripurdhar", + "sirmour", + "87.0", + "1" + ], + [ + "2", + "solan meenus (except state highway 6 portion)", + "sirmour / solan", + "98.0", + "2" + ], + [ + "3", + "banethi rajgarh chandol", + "sirmour", + "127.0", + "3" + ], + [ + "4", + "markanda bridge suketi park kala amb trilokpur", + "sirmour", + "21.5", + "4" + ], + [ + "5", + "kolar bilaspur", + "sirmour", + "13.0", + "5" + ], + [ + "6", + "parwanoo kasauli dharampur sabhathu solan", + "solan", + "65.32", + "6" + ], + [ + "7", + "barotiwala baddi sai ramshar", + "solan", + "44.95", + "7" + ], + [ + "8", + "kufri chail kandaghat", + "solan / shimla", + "57.0", + "8" + ], + [ + "9", + "solan barog kumarhatti", + "solan", + "13.0", + "9" + ], + [ + "10", + "dharampur kasauli", + "solan", + "10.5", + "10" + ], + [ + "11", + "arki dhundan bhararighat", + "solan", + "18.7", + "11" + ], + [ + "12", + "nalagarh dhabota bharatgarh", + "solan", + "9.4", + "12" + ], + [ + "13", + "shogi mehli junga sadhupul", + "shimla", + "49.4", + "13" + ], + [ + "14", + "mashobra bhekhalti", + "shimla", + "18.0", + "14" + ], + [ + "15", + "narkanda thanadhar kotgarh bithal", + "shimla", + "44.0", + "15" + ], + [ + "16", + "rampur mashnoo sarahan jeori", + "shimla", + "62.0", + "19" + ], + [ + "17", + "bakrot karsog (sanarli) sainj", + "mandi", + "41.8", + "21" + ], + [ + "18", + "salapper tattapani suni luhri", + "mandi / shimla", + "120.8", + "22" + ], + [ + "19", + "mandi kataula bajaura", + "mandi", + "51.0", + "23" + ], + [ + "20", + "mandi gagal chailchowk janjehli", + "mandi", + "45.8", + "24" + ], + [ + "21", + "chailchowk gohar pandoh", + "mandi", + "29.6", + "25" + ], + [ + "22", + "mandi rewalsar kalkhar", + "mandi", + "28.0", + "26" + ], + [ + "23", + "nore wazir bowli", + "kullu", + "37.0", + "28" + ], + [ + "24", + "kullu nagar manali (left bank)", + "kullu", + "39.4", + "29" + ], + [ + "25", + "jia manikarn", + "kullu", + "33.5", + "30" + ], + [ + "26", + "swarghat nainadevi bhakhra", + "bilaspur / una", + "55.7", + "31" + ], + [ + "27", + "nainadevi kaula da toba", + "bilaspur", + "12.2", + "32" + ], + [ + "28", + "bamta kandrour", + "bilaspur", + "6.7", + "33" + ], + [ + "29", + "nagaon beri", + "bilaspur / solan", + "37.0", + "34" + ], + [ + "30", + "hamirpur bhoranj jahu", + "hamirpur", + "30.0", + "35" + ], + [ + "31", + "nadaun sujanpur", + "hamirpur", + "21.0", + "36" + ], + [ + "32", + "barsar deothsidh", + "hamirpur", + "11.3", + "37" + ], + [ + "33", + "sujanpur sandhol marhi", + "hamirpur / mandi", + "45.0", + "38" + ], + [ + "35", + "una hoshiarpur bankhandi hoshairpur", + "una", + "15.0", + "40" + ], + [ + "36", + "tahliwal garhshankar (hp boundary)", + "una", + "8.0", + "41" + ], + [ + "37", + "bharwain chintpurni kandrori damtal", + "una / kangra", + "95.56", + "42" + ], + [ + "38", + "baijnath ladbharol kandapattan", + "kangra / mandi", + "33.0", + "43" + ], + [ + "39", + "gaggal chetru dharamshala mcleodganj", + "kangra", + "24.0", + "44" + ], + [ + "40", + "rait charhi dharamshala", + "kangra", + "20.0", + "45" + ], + [ + "41", + "kaloha pragpur dhaliara dadasiba sansarpur", + "kangra", + "60.92", + "46" + ], + [ + "42", + "kandwal damtal", + "kangra", + "16.5", + "47" + ], + [ + "43", + "dadh malan", + "kangra", + "4.0", + "48" + ], + [ + "44", + "banikhet dalhouse khajiar", + "chamba", + "29.0", + "49" + ], + [ + "45", + "chamba bharmour", + "chamba", + "45.0", + "52" + ] + ], + "title": "", + "original_id": "5c2f583f71d78d31ef4fca4f4f3e084f" + }, + { + "_id": "eb65b158687008218de778e57ce630c1", + "header": [ + "#", + "Name", + "Birth and death", + "Office started", + "Office ended" + ], + "rows": [ + [ + "1", + "Geir Vídalín", + "27 October 1761\n–\n20 September 1823", + "1801", + "1823" + ], + [ + "2", + "Steingrímur Jónsson", + null, + "1824", + "1845" + ], + [ + "3", + "Helgi Thordersen", + "8 April 1794\n–\n4 December 1867", + "1846", + "1866" + ], + [ + "4", + "'Pétur Pétursson", + "3 October 1808\n–\n15 May 1891", + "1866", + "1889" + ], + [ + "5", + "Hallgrímur Sveinsson", + "5 April 1841\n–\n16 December 1909", + "1889", + "1908" + ], + [ + "6", + "Þórhallur Bjarnarson", + "2 December 1855\n–\n15 December 1916", + "1908", + "1916" + ], + [ + "7", + "Jón Helgason", + "1866\n–\n1942", + "1917", + "1939" + ], + [ + "8", + "Sigurgeir Sigurðsson", + "3 August 1890\n-\n13 October 1953", + "1939", + "1953" + ], + [ + "9", + "Ásmundur Guðmundsson", + "6 October 1888\nReykholt\n–\n29 May 1969\nReykjavík", + "1954", + "1989" + ], + [ + "10", + "Sigurbjörn Einarsson", + "30 June 1911\nVestur-Skaftafellssýsla\n–\n28 August 2008\nReykjavík", + "1959", + "1981" + ], + [ + "11", + "Pétur Sigurgeirsson\n(son of Sigurgeir Sigurðsson, 8th Bishop of Iceland)", + "2 June 1919\n–\n3 June 2010", + "1981", + "1989" + ], + [ + "12", + "Ólafur Skúlason", + "29 December 1929\n–\n9 June 2008", + "1989", + "1997" + ], + [ + "13", + "Karl Sigurbjörnsson\n(son of Sigurbjörn Einarsson, 10th Bishop of Iceland)", + "5 February 1947\nReykjavík", + "1998", + "2012" + ], + [ + "14", + "Agnes Sigurðardóttir", + "19 October 1954\nÍsafjörður", + "24 June 2012", + "Incumbent" + ] + ], + "title": "", + "original_id": "aca822dccfa5b7a04abe4dd08ba88e50" + }, + { + "_id": "7624895211adc46a0d6444ade17518a9", + "header": [ + "rank", + "nation", + "gold", + "silver", + "bronze", + "total" + ], + "rows": [ + [ + "1", + "australia", + "3", + "3", + "5", + "11" + ], + [ + "2", + "russia", + "3", + "3", + "2", + "8" + ], + [ + "3", + "italy", + "3", + "1", + "2", + "6" + ], + [ + "4", + "united states", + "2", + "0", + "0", + "2" + ], + [ + "5", + "germany", + "1", + "2", + "3", + "6" + ], + [ + "6", + "netherlands", + "1", + "2", + "0", + "3" + ], + [ + "7", + "belgium", + "1", + "0", + "0", + "1" + ], + [ + "7", + "spain", + "1", + "0", + "0", + "1" + ], + [ + "7", + "lithuania", + "1", + "0", + "0", + "1" + ], + [ + "7", + "norway", + "1", + "0", + "0", + "1" + ], + [ + "7", + "slovenia", + "1", + "0", + "0", + "1" + ], + [ + "12", + "france", + "0", + "2", + "2", + "4" + ], + [ + "13", + "denmark", + "0", + "1", + "1", + "2" + ], + [ + "13", + "portugal", + "0", + "1", + "1", + "2" + ], + [ + "15", + "hungary", + "0", + "1", + "0", + "1" + ], + [ + "15", + "switzerland", + "0", + "1", + "0", + "1" + ], + [ + "15", + "ukraine", + "0", + "1", + "0", + "1" + ], + [ + "18", + "new zealand", + "0", + "0", + "1", + "1" + ], + [ + "18", + "south africa", + "0", + "0", + "1", + "1" + ] + ], + "title": "", + "original_id": "ef758cb602e41211846652763d99176e" + }, + { + "_id": "a2c051cfd28eefbe60f38b96d011a803", + "header": [ + "administrative region", + "population (2002 census data)", + "surface km 2", + "main rivers", + "average annual rainfall (mm)", + "average annual runoff (mm)", + "per capita average annual renewable water resources m 3" + ], + "rows": [ + [ + "i - tarapacá", + "428594", + "58698", + "azapa river , vítor river and camarones river", + "93.6", + "7.1", + "972" + ], + [ + "ii - antofagasta", + "493984", + "126444", + "loa river", + "44.5", + "0.2", + "51" + ], + [ + "iii - atacama", + "254336", + "75573", + "salado river", + "82.4", + "0.7", + "208" + ], + [ + "iv - coquimbo", + "603210", + "40656", + "elqui river , choapa river and limarí river", + "222.0", + "18.0", + "1213" + ], + [ + "v - valparaíso", + "1539852", + "16396", + "petorca river , la ligua river and aconcagua river", + "434.0", + "84.0", + "894" + ], + [ + "metro region (mr) - santiago metropolitan", + "7003122", + "15349", + "maipo river", + "650.0", + "200.0", + "438" + ], + [ + "vii - maule", + "908097", + "30325", + "mataquito river and maule river", + "1377.0", + "784.0", + "26181" + ], + [ + "viii - biobío", + "1861562", + "36929", + "itata river , biobío river and laja river", + "1766.0", + "1173.0", + "23270" + ] + ], + "title": "", + "original_id": "2e09024d7ebcee21c3bd33ae5f07e020" + }, + { + "_id": "61f16dcb195739cb066a453534f61a66", + "header": [ + "name", + "location", + "enrollment", + "1 - year ranking of 727", + "5 - year ranking of 693" + ], + "rows": [ + [ + "centennial collegiate vocational institute", + "guelph", + "1533", + "63", + "22" + ], + [ + "centre dufferin district high school", + "shelburne", + "998", + "265", + "281" + ], + [ + "centre wellington district high school", + "fergus", + "1459", + "330", + "246" + ], + [ + "college heights secondary school", + "guelph", + "649", + "717", + "688" + ], + [ + "erin district high school", + "erin", + "616", + "197", + "148" + ], + [ + "guelph collegiate vocational institute", + "guelph", + "1314", + "16", + "30" + ], + [ + "john f ross collegiate vocational institute", + "guelph", + "1895", + "181", + "165" + ], + [ + "norwell district secondary school", + "palmerston", + "795", + "126", + "343" + ], + [ + "orangeville district secondary school", + "orangeville", + "1574", + "181", + "194" + ], + [ + "wellington heights secondary school", + "mount forest", + "680", + "371", + "426" + ], + [ + "westside secondary school", + "orangeville", + "996", + "478", + "343" + ] + ], + "title": "", + "original_id": "be9cbb9a182bb4bf349e35b9d80a915c" + }, + { + "_id": "5d0543391a930a7668018882a7eb6475", + "header": [ + "location", + "founded", + "type", + "enrollment", + "nickname", + "joined", + "left", + "current conference" + ], + "rows": [ + [ + "mount berry , georgia", + "1902", + "private", + "1937", + "vikings", + "1996", + "2004", + "saa (ncaa division iii)" + ], + [ + "birmingham , alabama", + "1856", + "private", + "1400", + "panthers", + "1996", + "2001", + "saa (ncaa division iii)" + ], + [ + "nashville , tennessee", + "1891", + "private", + "4278", + "bisons", + "1996", + "2001", + "atlantic sun (a - sun) (ncaa division i)" + ], + [ + "cleveland , tennessee", + "1918", + "private", + "4954", + "flames", + "1996", + "2004", + "ssac , gulf south in 2013" + ], + [ + "nashville , tennessee", + "1901", + "private", + "2345", + "trojans", + "1996", + "2012", + "g - mac (ncaa division ii)" + ], + [ + "jackson , tennessee", + "1823", + "private", + "4259", + "union", + "1996", + "2012", + "gulf south (gsc) (ncaa division ii)" + ], + [ + "walnut ridge , arkansas", + "1941", + "private", + "700", + "eagles", + "1996", + "2001", + "american midwest" + ], + [ + "batesville , arkansas", + "1872", + "private", + "600", + "scots", + "1997", + "2012", + "american midwest" + ], + [ + "memphis , tennessee", + "1941", + "private", + "1970", + "eagles", + "2005", + "2009", + "uscaa / nccaa independent" + ], + [ + "jackson , tennessee", + "1843", + "private", + "800", + "eagles", + "2006", + "2009", + "closed in 2011" + ], + [ + "lebanon , tennessee", + "1842", + "private", + "1500", + "bulldogs", + "2002", + "2012", + "mid - south" + ] + ], + "title": "", + "original_id": "7836545f3321d5afd884f55b7532878a" + }, + { + "_id": "28938d88502e1276dad58e2a1ba93a91", + "header": [ + "station name", + "2002 - 03", + "2004 - 05", + "2005 - 06", + "2006 - 07", + "2007 - 08", + "2008 - 09", + "2009 - 10", + "2010 - 11", + "2011 - 12" + ], + "rows": [ + [ + "devonport", + "18795", + "16202", + "18573", + "19655", + "17450", + "21652", + "21674", + "27006", + "27756" + ], + [ + "dockyard", + "4070", + "5088", + "4895", + "5335", + "4924", + "5280", + "5524", + "5406", + "7716" + ], + [ + "keyham", + "8957", + "6374", + "7594", + "7976", + "5050", + "5648", + "5016", + "6330", + "7708" + ], + [ + "st budeaux victoria road", + "5451", + "5818", + "6146", + "5264", + "5193", + "5678", + "7026", + "6942", + "7780" + ], + [ + "bere ferrers", + "17808", + "12862", + "11459", + "10824", + "10824", + "11580", + "12606", + "14374", + "15020" + ], + [ + "bere alston", + "37944", + "29552", + "27263", + "26866", + "28936", + "32454", + "36272", + "41666", + "44792" + ], + [ + "calstock", + "25739", + "24024", + "21123", + "23476", + "26825", + "31168", + "33368", + "33198", + "32456" + ], + [ + "gunnislake", + "39009", + "37190", + "43885", + "43676", + "48747", + "49070", + "51424", + "50218", + "52116" + ] + ], + "title": "", + "original_id": "f98c79fd3e60a413ecc94008e44c91b3" + }, + { + "_id": "f6b2b02751c12bc7370a4c1a775e81c6", + "header": [ + "Party", + "No. of candidates", + "No. of elected", + "No. of votes", + "%" + ], + "rows": [ + [ + "Indian National Congress", + "236", + "150", + "2889994", + "38.82%" + ], + [ + "Communist Party of India", + "86", + "28", + "800951", + "10.76%" + ], + [ + "Kisan Mazdoor Praja Party", + "129", + "15", + "667446", + "8.97%" + ], + [ + "Bharatiya Jana Sangh", + "85", + "9", + "415458", + "5.58%" + ], + [ + "Forward Bloc (Marxist Group)", + "48", + "11", + "393591", + "5.29%" + ], + [ + "Socialist Party", + "63", + "0", + "215382", + "2.89%" + ], + [ + "Akhil Bharatiya Hindu Mahasabha", + "33", + "4", + "176762", + "2.37%" + ], + [ + "Forward Bloc (Ruikar)", + "32", + "2", + "107905", + "1.45%" + ], + [ + "Revolutionary Socialist Party", + "16", + "0", + "63173", + "0.85%" + ], + [ + "Revolutionary Communist Party of India", + "10", + "0", + "32859", + "0.44%" + ], + [ + "Bolshevik Party of India", + "8", + "0", + "20117", + "0.27%" + ], + [ + "Akhil Bharatiya Ram Rajya Parishad", + "14", + "0", + "7100", + "0.10%" + ], + [ + "Independents", + "614", + "19", + "1653165", + "22.21%" + ], + [ + "Total:", + "1374", + "238", + "7443903", + "-" + ] + ], + "title": "", + "original_id": "439da477576bb07f8300853e210649dc" + }, + { + "_id": "9bdb2ce7f880a0e1c65d339b1bb92d23", + "header": [ + "Tribunal", + "Number of autos da fe", + "Executions in persona", + "Executions in effigie", + "Penanced", + "Total" + ], + "rows": [ + [ + "Barcelona", + "8", + "1", + "1", + "15", + "17" + ], + [ + "Logroño", + "1", + "1", + "0", + "0?", + "1?" + ], + [ + "Palma de Mallorca", + "3", + "0", + "0", + "11", + "11" + ], + [ + "Saragossa", + "1", + "0", + "0", + "3", + "3" + ], + [ + "Valencia", + "4", + "2", + "0", + "49", + "51" + ], + [ + "Las Palmas", + "0", + "0", + "0", + "0", + "0" + ], + [ + "Córdoba", + "13", + "17", + "19", + "125", + "161" + ], + [ + "Cuenca", + "7", + "7", + "10", + "35", + "52" + ], + [ + "Santiago de Compostela", + "4", + "0", + "0", + "13", + "13" + ], + [ + "Granada", + "15", + "36", + "47", + "369", + "452" + ], + [ + "Llerena", + "5", + "1", + "0", + "45", + "46" + ], + [ + "Madrid", + "4", + "11", + "13", + "46", + "70" + ], + [ + "Murcia", + "6", + "4", + "1", + "106", + "111" + ], + [ + "Seville", + "15", + "16", + "10", + "220", + "246" + ], + [ + "Toledo", + "33", + "6", + "14", + "128", + "148" + ], + [ + "Valladolid", + "10", + "9", + "2", + "70", + "81" + ], + [ + "Total", + "125", + "111", + "117", + "1235", + "1463" + ] + ], + "title": "", + "original_id": "4fbaad0b3bacf8c4a5741ff081c032c4" + }, + { + "_id": "340766308116e1bc3d18f7d043a6e5ac", + "header": [ + "incident no", + "date", + "place", + "killed", + "injured" + ], + "rows": [ + [ + "1", + "february", + "tumkur , karnataka", + "6", + "0" + ], + [ + "2", + "august", + "dantewada , chattisgarh", + "350", + "0" + ], + [ + "3", + "17 august", + "andhra pradesh", + "0", + "0" + ], + [ + "4", + "11 november", + "giridih , jharkhand", + "0", + "0" + ], + [ + "5", + "11 november", + "giridih , jharkhand", + "5", + "16" + ], + [ + "6", + "13 november", + "jehanabad , bihar", + "4", + "5" + ], + [ + "7", + "30 december", + "dantewada , chhattisgarh", + "2", + "0" + ], + [ + "total", + "total", + "total", + "367", + "21" + ] + ], + "title": "", + "original_id": "f3e8910d05ad5055c1c42a079952b8da" + }, + { + "_id": "298909e2d6ec586736b401c4352e4c3a", + "header": [ + "rank", + "peak", + "elevation (m)", + "prominence (m)", + "isolation (km)", + "municipality", + "county" + ], + "rows": [ + [ + "1", + "galdhøpiggen", + "2469", + "2372", + "1570", + "lom", + "oppland" + ], + [ + "2", + "jiehkkevárri", + "1833", + "1741", + "140", + "lyngen , tromsø", + "troms" + ], + [ + "3", + "snøhetta", + "2286", + "1675", + "83", + "dovre", + "oppland" + ], + [ + "4", + "store lenangstind", + "1625", + "1576", + "47", + "lyngen", + "troms" + ], + [ + "5", + "gjegnen / blånibba", + "1670", + "1460", + "47", + "bremanger", + "sogn og fjordane" + ], + [ + "6", + "hamperokken", + "1404", + "1396", + "18", + "tromsø", + "troms" + ], + [ + "7", + "skårasalen", + "1542", + "1385", + "7", + "ørsta", + "møre og romsdal" + ], + [ + "8", + "oksskolten", + "1916", + "1384", + "185", + "hemnes", + "nordland" + ], + [ + "9", + "botnafjellet", + "1572", + "1339", + "15", + "gloppen", + "sogn og fjordane" + ], + [ + "10", + "kvitegga", + "1717", + "1324", + "23", + "stranda , ørsta", + "møre og romsdal" + ], + [ + "11", + "fresvikbreen", + "1660", + "1310", + "17", + "vik", + "sogn og fjordane" + ], + [ + "12", + "smørskredtindane", + "1630", + "1306", + "12", + "stranda , ørsta", + "møre og romsdal" + ], + [ + "13", + "njunis", + "1717", + "1305", + "53", + "målselv", + "troms" + ], + [ + "14", + "store trolla", + "1850", + "1292", + "11", + "sunndal", + "møre og romsdal" + ], + [ + "15", + "langlitinden", + "1276", + "1276", + "26", + "ibestad", + "troms" + ], + [ + "16", + "indre russetind", + "1527", + "1268", + "9", + "balsfjord", + "troms" + ], + [ + "17", + "møysalen", + "1262", + "1262", + "60", + "hinnøya", + "nordland" + ], + [ + "18", + "stortind", + "1320", + "1242", + "14", + "tromsø", + "troms" + ], + [ + "19", + "folgefonna", + "1660", + "1233", + "29", + "kvinnherad , odda", + "hordaland" + ] + ], + "title": "", + "original_id": "f54fdc8f3471782a34be35f0f3e38535" + }, + { + "_id": "c220d3fb6e6ac058f53e5fd86f5a50f4", + "header": [ + "place", + "code", + "area (km 2 )", + "population", + "most spoken language" + ], + "rows": [ + [ + "abantungwa / kholwa", + "51401", + "245.25", + "57273", + "zulu" + ], + [ + "colenso", + "51402", + "4.9", + "4476", + "zulu" + ], + [ + "ezakheni", + "51404", + "39.0", + "59943", + "zulu" + ], + [ + "kliprivier nu", + "51406", + "2.8", + "381", + "zulu" + ], + [ + "kliprivier", + "51405", + "107.21", + "27696", + "zulu" + ], + [ + "ladysmith", + "51407", + "91.97", + "41425", + "zulu" + ], + [ + "mchunu", + "51408", + "34.42", + "2301", + "zulu" + ], + [ + "mthembu", + "51409", + "80.7", + "6920", + "zulu" + ], + [ + "mvelani", + "51410", + "2.43", + "11898", + "zulu" + ], + [ + "nkankezi", + "51411", + "4.86", + "824", + "zulu" + ], + [ + "remainder of the municipality", + "51403", + "2350.72", + "12316", + "zulu" + ] + ], + "title": "", + "original_id": "29c36dbc873ed833d3fdc8c19375453b" + }, + { + "_id": "d4804193a3d2483988e79a34f3545aee", + "header": [ + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "Measure unit", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)", + "POPULATION (by age group in 2002)" + ], + "rows": [ + [ + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "SPECIFICATION", + "Measure unit", + "TOTAL", + "0–9", + "10–19", + "20–29", + "30–39", + "40–49", + "50–59", + "60–69", + "70–79", + "80 +" + ], + [ + "I.", + "TOTAL", + "TOTAL", + "TOTAL", + "TOTAL", + "person", + "214", + "35", + "44", + "28", + "26", + "23", + "22", + "12", + "16", + "8" + ], + [ + "I.", + "—", + "of which in", + "of which in", + "of which in", + "%", + "100", + "16.4", + "20.6", + "13.1", + "12.1", + "10.7", + "10.3", + "5.6", + "7.5", + "3.7" + ], + [ + "I.", + "1.", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX", + "BY SEX" + ], + [ + "I.", + "1.", + "A.", + "Males", + "Males", + "person", + "103", + "16", + "21", + "12", + "14", + "13", + "10", + "6", + "8", + "3" + ], + [ + "I.", + "1.", + "A.", + "—", + "of which in", + "%", + "48.1", + "7.5", + "9.8", + "5.6", + "6.5", + "6.1", + "4.7", + "2.8", + "3.7", + "1.4" + ], + [ + "I.", + "1.", + "B.", + "Females", + "Females", + "person", + "111", + "19", + "23", + "16", + "12", + "10", + "12", + "6", + "8", + "5" + ], + [ + "I.", + "1.", + "B.", + "—", + "of which in", + "%", + "51.9", + "8.9", + "10.7", + "7.5", + "5.6", + "4.7", + "5.6", + "2.8", + "3.7", + "2.3" + ] + ], + "title": "", + "original_id": "a0d083844e9797e0e9f96920b57ce41d" + }, + { + "_id": "d34c47757ee2db65b7338a57feae28a1", + "header": [ + "city", + "january (avg high degree)", + "january (avg low degree)", + "july (avg high degree)", + "july (avg low degree)" + ], + "rows": [ + [ + "winnipeg , mb", + "10.6", + "6.5", + "78.4", + "56.3" + ], + [ + "saskatoon , sk", + "13.8", + "5.3", + "77.5", + "52.9" + ], + [ + "regina , sk", + "15.3", + "4.2", + "78.2", + "53.4" + ], + [ + "quebec city , qc", + "19.4", + "3.0", + "76.5", + "57.2" + ], + [ + "edmonton , ab", + "20.7", + "0.1", + "73.0", + "49.1" + ], + [ + "ottawa , on", + "21.6", + "6.1", + "79.9", + "60.3" + ], + [ + "calgary , ab", + "30.4", + "8.2", + "73.8", + "49.6" + ], + [ + "montreal , qc", + "22.5", + "6.8", + "79.3", + "61.0" + ], + [ + "halifax , ns", + "31.8", + "17.2", + "73.6", + "59.2" + ], + [ + "st john 's , nl", + "30.6", + "17.2", + "69.3", + "51.6" + ], + [ + "toronto , on", + "30.7", + "19.8", + "79.9", + "64.4" + ], + [ + "windsor , on", + "31.5", + "18.9", + "82.6", + "64.2" + ], + [ + "vancouver , bc", + "44.2", + "34.3", + "71.8", + "56.7" + ], + [ + "kamloops , bc", + "32.7", + "21.4", + "84.0", + "57.6" + ], + [ + "yellowknife , nt", + "6.9", + "21.1", + "70.3", + "54.7" + ], + [ + "iqaluit , nu", + "9.0", + "23.6", + "54.1", + "39.4" + ], + [ + "moncton , nb", + "25.3", + "6.8", + "76.5", + "55.2" + ], + [ + "charlottetown , pei", + "25.9", + "10.2", + "73.9", + "57.4" + ], + [ + "whitehorse , yt", + "12.2", + "2.6", + "69.1", + "46.4" + ] + ], + "title": "", + "original_id": "58c12f5c85dc3306c3e383b2ae5f130c" + }, + { + "_id": "e1f55363e53c35e41a7d01c351a558b9", + "header": [ + "-", + "Total", + "Male", + "Female" + ], + "rows": [ + [ + "Population", + "7159", + "3645", + "3514" + ], + [ + "Children aged below 6 years", + "913", + "479", + "434" + ], + [ + "Scheduled caste", + "1782", + "890", + "892" + ], + [ + "Scheduled tribe", + "744", + "383", + "361" + ], + [ + "Literates", + "4323", + "2642", + "1681" + ], + [ + "Workers (all)", + "3612", + "2007", + "1605" + ], + [ + "Main workers (total)", + "2187", + "1463", + "724" + ], + [ + "Main workers: Cultivators", + "756", + "500", + "256" + ], + [ + "Main workers: Agricultural labourers", + "830", + "443", + "387" + ], + [ + "Main workers: Household industry workers", + "107", + "86", + "21" + ], + [ + "Main workers: Other", + "494", + "434", + "60" + ], + [ + "Non-workers (total)", + "3547", + "1638", + "1909" + ] + ], + "title": "", + "original_id": "ee32b677b3e51d25608fcdbef787f33b" + } +] \ No newline at end of file