Upload batch_2

batch_2/PMC2527472.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527472",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527472\nAUTHORS: Yuki Ito, Tamie Nakajima\n\nABSTRACT:\nDi(2-ethylhexyl)phthalate (DEHP) is a widely used plasticizer and a potentially nongenotoxic carcinogen. Its mechanism had been earlier proposed based on peroxisome proliferator-activated receptor α (PPARα) because metabolites of DEHP are agonists. However, recent evidence also suggests the involvement of non-PPARα multiple pathway in DEHP-induced carcinogenesis. Since there are differences in the function and constitutive expression of PPARα among rodents and humans, species differences are also thought to exist in the carcinogenesis. However, species differences were also seen in the lipase activity involved in the first step of the DEHP metabolism, which should be considered in DEHP-induced carcinogenesis. Taken together, it is very difficult to extrapolate the results from rodents to humans in the case of DEHP carcinogenicity. However, PPARα-null mice or mice with human PPARα gene have been developed, which may lend support to make such a difficult extrapolation. Overall, further mechanical study on DEHP-induced carcinogenicity is warranted using these mice.\n\nBODY:\n1. INTRODUCTIONDi(2-ethylhexyl)phthalate\n(DEHP) a plasticizer around the world, suggesting that many\npeople come across this chemical every day. Animal studies showed that this\nchemical is a nongenotoxic carcinogen. Metabolites of DEHP, mono- and\ndicarboxylic acids, transactivate peroxizome proliferator-activated receptor α (PPARα),\nwhich has been thought to result in nongenotoxic carcinogenesis [1, 2]. However, the latest studies also\nshowed the involvement of non-PPARα pathways; multiple pathways might be\ninvolved in the pathway of DEHP-induced carcinogenicity [3]. There are species differences in\nthe functional activation or constitutive expression of rodent and human PPARα,\nand that in humans is thought to be less active and expressive than those of\nrodents. Recently, inflammation-related carcinogenesis has drawn attention [4, 5]. PPARα is involved not only in\nthe induction of target genes such as β-oxidation enzymes of fatty acids but also in anti-inflammation\nsignaling [6, 7], suggesting that PPARα also may protect\nagainst carcinogenesis. Species differences in lipase activity (DEHP-metabolizing\nenzyme) among mice, rats, and marmosets have been also reported recently [8], suggesting that this kinetic\ndifference should be considered in the species differences in DEHP-induced\ncarcinogenesis. In this review, we focused on DEHP-induced hepatic\ncarcinogenesis in relation to PPARα-dependent and PPARα-independent pathways, and discussed\nthe science policy.2. PPARsPPARs are\ninvolved in a member of the nuclear hormone receptor superfamily, and consist\nof three subunits: PPARα, PPARβ/δ, and PPARγ [9]. These three isoforms have been\nidentified at the organ-specific level. In the respective organ, PPARs function\nas transcription factors through the classic ligand-dependent nuclear hormone\nreceptor mechanism. Upon binding to their ligands, PPARs undergo conformational\nchanges that allow corepressor release [10]. The PPAR-ligand complex binds to\ndirect repeat 1 elements or peroxisome proliferator response elements (PPREs),\nusually located upstream of the target genes, which results in the induction of\nfatty acid transport and metabolism, glucose metabolism, and also elicitation\nof anti-inflammatory effects [6, 11].As one of the three isoforms, PPARα is mainly expressed in\norgans that are critical in fatty acid catabolism, such as liver, heart, and\nkidney [7]. Thus, this nuclear receptor is\nprimarily involved in the regulation of fatty acid metabolism. In addition to\nthis function, PPARα\nalso has various functions including the promotion of gluconeogenesis,\nlipogenesis, ketogenesis, and anti-inflammatory effects [6].3. PPARα LIGANDSThe ligands of PPARα represent a diverse group of\nchemicals including not only endogenous ligands but also exogenous synthetic\nligands with a high likelihood of clinical, occupational, and environmental\nexposure of humans to chemicals [1, 12]. The primary endogenous ligands\nare fatty acids, mainly the 18–20 carbon polyunsaturated fatty acids and\neicosanoids [7, 13–17]. As exogenous ligands, fibrates\nand thiazolidinediones are involved. Additionally, the general population is\nexposed to environmental chemicals such as plasticizers (e.g., phthalates),\nsolvents (e.g., tetrachloroethylene and trichloroethylene), perfluorooctanoic\nacid and herbicides (e.g., 2, 4-dichlorophenoxyacetic acid, diclofop-methyl,\nhaloxyfop, lactofen, and oxidiazon).Of these ligands, the toxicity of DEHP is well\nestablished in relation to PPARα. This chemical is used as a\nplasticizer to improve the plasticity and elasticity of polyvinyl chloride\nproducts that have become ubiquitous in our daily living. These products are\nwidely used in building materials, wallpaper and flooring, wire covering, vinyl\nsheeting for agriculture, food packages, and medical devices such as\nintravenous and hemodialysis tubing and blood bags. The recent production of\nDEHP in Japan\nhas approached 14 000 tons per year, which accounts for about 54% of all\nplasticizers used [11]. It is noted that mono- and dicarboxylic acid\nmetabolites of DEHP, not DEHP itself, act as ligands for PPARα\n[18] and have potentially adverse\neffects on liver, kidney, heart, and reproductive organs though monocarboxylic\nacid, mono(2-ethylhexyl) phthalate (MEHP), also binds to PPARγ [18].4. SPECIES DIFFERENCES IN PPARα\nSince there are\nspecies differences in the toxicity of PPARα agonists, the expression levels or\nfunctions of the receptor are thought to be different among species. Several\nexplanations for the species differences in response to the ligands have been\nsuggested [19, 20]. One of the major factors was considered\nto be due to differences in the levels of PPARα expression [21, 22] although other possibilities include\ndifferences in ligand affinity between rodent and human PPARα, differences in\ncellular context of PPARα expression, and those in PPRE sequences found upstream\nof critical target genes [23, 24]. Indeed, PPARα expression in\nhumans is about 1/10 times less than that in rodents [25]. In addition, micro-RNA\nexpression regulated by PPARα has been recently reported to be changed in\nwild-type mice, but not in mice with human PPARα gene [26]; Wy-14,643 inhibited a micro-RNA\nlet-7C which is involved in suppression of tumorigenesis in wild-type mice, but\nneither in PPARα-null mice nor in mice with human PPARα gene. Mice\nwith human PPARα gene are resistant to hepatocellular proliferation though they\nrespond to Wy-14,643 in β-oxidation and serum triglycerides [27]. These results suggest that the function\nof the PPARα signaling in liver proliferation and tumorigenesis by the chemical\nexposure is not always similar in mice and humans.In regard to the species differences in\nthe PPREs, the lack of acyl CoA oxidase (ACO) induction in studies on liver\nbiopsies from humans treated with hypolipidemic drugs or primary human\nhepatocytes treated with Wy-14,643 may be attributable to an inactive\nfunctional PPRE since the sequence of a PPRE for the ACO gene from a small\nnumber of human liver biopsy samples was found to be different from that of the\nrats [28]. However, Reddy remarked at a\npanel discussion that, although the sequence of ACO gene promoter in the mouse\nwas also different from that in the rat, both rodents are responsive to some\nperoxisome proliferators in ACO induction [20]. In addition, differences in the\nability of rodents and human PPAR to recognize and bind PPRE are unlikely since\nthe DNA binding domains of the human and rodent PPARα are 100% homologous [29, 30]. Though characterized from only a\nlimited number of individuals, the prevalence in the population of defective\nPPAR alleles cannot be determined at this point [31]. The species difference in the\nsequence of PPRE may not be involved in the difference in response to ligands\nbetween rodents and humans.In addition to the lower expression\nlevels of PPARα in human, there was a truncated, inactive form of PPARα in\nhuman liver, suggesting that the expression of full-length functional PPARα was\nvery low. These inactive forms of PPARα may be insufficient to bind PPRE\nbecause PPREs may be occupied in vivo by other nuclear receptors that bind to\nsimilar sequences, thus affecting responsiveness to ligands [25].5. SPECIES DIFFERENCES IN DEHP METABOLISMIn addition to\nthe species differences in PPARα functions or expression levels, we should also\nbe mindful of the importance of those in the metabolism of DEHP between rodents\nand humans. DEHP absorbed in the body is first metabolized by the catalytic\naction of lipase to produce MEHP and 2-ethylhexanol (2-EH) [32]. Some MEHP is then conjugated\nwith UDP-glucuronide by UDP-glucuronosyltransferase (UGT) and excreted in the\nurine. The remaining MEHP is excreted directly in the urine or is oxidized by\ncytochrome P450 4A, then further oxidized by alcohol dehydrogenase (ADH) or\naldehyde dehydrogenase (ALDH) to dicarboxylic acid or ketones. 2-EH is metabolized\nmainly to carboxylic acid (mainly 2-ethylhexanoic acid (2HEA)) via 2-ethylhexanal\nby catalytic action of ADH and ALDH. Thus, lipase may be an essential enzyme to\nregulate the DEHP metabolism; knowing the species difference in the lipase\nactivity may be an important tool to clarify the species difference in\nmetabolism.Recently,\nthe activities of lipase, UGT, ADH, and ALDH for DEHP metabolism in several\norgans were measured and compared among mice, rats, and marmosets [8]. Marmosets were used as a\nreference to human. Clear-cut species differences were seen in the activities\nof the four enzymes involved in the DEHP metabolism among mice, rats, and\nmarmosets. The most prominent difference was observed in the lipase activity\nwith an almost 148- to 357-fold difference between the highest activity in mice\nand the lowest in marmosets (Figure 1). These differences were comparable to\nthose in the kinetic parameter, Vmax. These results suggest that the constitutive levels of lipase were\ngreater in the mice and rats than in marmosets. Indeed, lipase-mRNA\nlevels in livers from mice or rats were much higher than those in marmoset (Figure\n2). Thus, concentrations of MEHPs (ligands to PPARα) in the body were\nhigher in mice or rats than in marmosets when the same dose of DEHP was\nadministered [33].Besides species differences in the\nconstitutive levels of lipase, Km values of DEHP for lipase of marmosets\nwere much higher than in rats or mice, suggesting the species differences in\nthe DEHP affinity for lipase; the affinity of DEHP for lipase in the marmosets\nmay be lower than that of mice or rats. The affinity in human may be even lower\nthan that in primates; cumulative 14C excretion in urine of African green\nmonkey following bolus injection of 14C-DEHP leached into autologous\nplasma occurred earlier than in human [34].6. MECHANISM OF DEHP-INDUCED CANCERDEHP\ncauses tumors, especially in liver when chronically administered to rats and\nmice [35–39],\nsimilar to the other peroxisome proliferators such as Wy-14643. Table 1 shows that DEHP induces hepatic\ntumors in mice and rats. From the viewpoint of percentage in feed, the lowest-observed\neffect-level (LOEL) of DEHP carcinogenicity in the rat was 0.6%, and the no-observed\neffect-level (NOEL) was 0.1% [2]. In the mouse, the corresponding values may\nbe 0.05% for LOEL and 0.01% for NOEL because the study in which male mice were exposed\nto 0.05% DEHP for 78 weeks exhibited a significant increase in the hepatic\ntumor incidence rate compared with controls, but not when exposed to 0.01% DEHP\n[40].DEHP also has potential for carcinogenesis in\nother organs; pancreatic acinar cell adenoma and mononuclear cell leukemia\nincidences were significantly increased in male F344 rat but not in F344 female\nrat and B6C3F1 mouse of both sexes after DEHP exposure [35, 36, 44]. The reason why these cancers are not\nobserved in female rat has not been identified.Chronic\ntreatment with PPARα agonist results in an increased incidence of liver tumors\nwhich were thought to have occurred through a PPARα-mediated mechanism as\nrevealed by the resistance of PPARα-null mice to liver cancer induced by\nWy-14,643 exposure for 11 months [46]. All the\nwild-type mice fed with 0.1% Wy-14643 diet for 11 months had multiple\nhepatocellular neoplasms, including adenomas and carcinomas, while thePPARα-null\nmice fed with the 0.1% Wy-14643 diet for the same duration were unaffected.\nWard et al. [47] reported that\nexposure for only six months to 12 000 ppm DEHP caused induction of peroxisomal\nenzymes, liver enlargement, and histopathological increases in eosinophil\ncounts and peroxisomes in the cytoplasm of wild-type mice, while there were no\nsuch toxic findings in the liver of PPARα-null\nmice. Thus, DEHP-derived carcinogenicity was thought to be mediated by PPARα,\nsimilar to Wy-14,643, and DEHP was considered to cause primarily\nPPARα-dependent carcinogenicity in rodents, but it is considered to be\nrelatively safe in humans, similar to other ligands [2]. However, Ward\net al. [47] could not directly\nobserve DEHP-derived tumors in the wild-type mice, because exposure to DEHP for 6 months may\nnot be sufficient to induce hepatic tumors, as suggested by Marsman et al. [48]; they reported that DEHP\ntumorigenesis required longer exposure periods than Wy-14,643.\nIt is doubtful whether DEHP definitively induces hepatic tumors via PPARα.As mentioned\nabove, the following simple mechanism has been proposed for the DEHP-induced\nhepatocarcinogenesis; when DEHP was administered to rats and mice, the chemical\ncaused an increase in cell proliferation and peroxisome proliferation [49]. The latter\nis accompanied by an increase in both peroxisomal and mitochondrial fatty acid\nmetabolizing enzymes such as ACO. As a byproduct of fatty acid oxidation,\nenzymes involved with β-oxidation generate H2O2,\nresulting in elevated oxidative stress. DEHP also causes an increase in proinflammatory\ncytokines and inhibition of apoptosis [2, 24].DEHP-induced\nliver carcinogenesis in rodents, however, appears to involve more complex\npathways as described in the following events whereby various combinations of\nthe molecular signals and multiple pathways may be involved [3]. DEHP is\nmetabolized to bioactive metabolites which are absorbed and distributed\nthroughout the body; they might induce PPARα-independent activation of\nmacrophages and production of oxidants, and also activate PPARα and sustained\ninduction of target genes. The inductions lead to enlargement of hepatocellular\norganelles, an increase in cell proliferation, a decrease in apoptosis, sustained\nhepatomegaly, chronic low-level oxidative stress and accumulation of DNA damage,\nand selective clonal expansion of the initiated cells. Finally, preneoplastic\nnodules might be induced and might result in adenomas and carcinoma.Peraza et al.\n[10] also suggest that PPARα\nis the only receptor in PPARs that is known to mediate carcinogenesis, while\nthe prevailing evidence suggests that PPARβ, PPARγ, and their ligands appear to\nbe tumor modifiers that inhibit carcinogenesis, albeit there is still\ncontroversy in the field. Melnick [50] also\naddressed non-PPARα mechanisms for DEHP-induced carcinogenicity as follows. (1)\nPeroxisome\nproliferator-induced tumorigenesis is related to the genes involved in cellular\nproliferations of, for example, p38 mitogen-activated protein kinase, which is\nnot involved in peroxisome proliferations [51]. (2) DEHP and other peroxisome\nproliferators stimulated growth regulatory pathways such as immediate early\ngenes for carcinogenesis (c-jun, c-fos, junB, egr-1), mitogen-activated protein\nkinase, extracellular signal-regulated kinase, and phosphorylation of p38,\nwhich were dissociated from PPARα activation in rat\nprimary cultures [52–54]. These findings also support the\nview that peroxisome proliferators, including DEHP, may have the potential for\ntumorigenesis via non-PPARα signal pathways.In recent\nyears, an inflammation-associated model of cancers has been given attention [4, 5].\nPPARα exerts anti-inflammation effects by repressing nuclear factor kappa B\n(NFκB) [55], which\ninhibits inflammation signaling and subsequent cancer [4].Ito et al. [45]\nproposed possibility of DEHP tumorigenesis via a non-PPARα pathway using PPARα-null mice. They compared DEHP-induced\ntumorigenesis in wild-type and PPARα-null mice treated\nfor 22 months with diets containing 0, 0.01, or 0.05% DEHP. Surprisingly, the\nincidence of liver tumors was higher in PPARα-null\nmice exposed to 0.05% DEHP (25.8%) than in similarly exposed wild-type mice (10%), while the incidence was 0% in wild-type miceand 4% in PPARα-null\nmice without DEHP exposure. The levels of 8-hydroxydeoxyguanosine increased\ndose-dependently in mice of both genotypes, but the degree of increase was\nhigher in PPARα-null mice than in\nwild-type mice. NFκB\nlevels also significantly increased in a dose-dependent manner in PPARα-null mice. The proto-oncogene\nc-jun-mRNA was induced, while c-fos-mRNA tended to be induced only in PPARα-null mice fed with 0.05%\nDEHP-containing diet. These results suggest that chronic low-level oxidative\nstress induced by DEHP exposure may lead to the induction of inflammation\nand/or the expression of proto-oncogenes, resulting in a high incidence of\ntumorigenesis in PPARα-null mice. Moderate activated PPARα might protect from p65/p50 NFκB inflammatory pathway caused by\nchronic DEHP exposure in wild-type mice. Although cross-talk of PPARγ,\nbut not PPARα, with cyclooxygenase 2 (Cox-2), which also was related\nwith inflammation-induced hepatocellular carcinoma, has been suggested [56], there was neither induction of\nCox-2 nor PPARγ in both genotyped mice of that study (data\nnot shown).Additionally, we compared the mechanisms\nof tumorigenesis between wild-type mice and PPARα-null\nmice using hepatocellular adenoma tissues of both genotyped mice [57]. The microarray profiles showed\nthat the up- or downregulated genes were quite different between hepatocellular\nadenoma tissues of wild-type mice and PPARα-null\nmice exposed to DEHP, suggesting that their tumorigenesis mechanisms might be\ndifferent. Interestingly, the gene expressions of apoptotic peptidase\nactivating factor 1 and DNA-damage-inducible 45α (Gadd45α) were increased in\nthe hepatocellular adenoma tissues of wild-type mice exposed to DEHP, whereas\nthey were unchanged in corresponding tissues of PPARα-null mice. On the other hand, the expressions of cyclin B2\nand myeloid cell leukemia sequence 1 were increased only in the hepatocellular\nadenoma tissues of PPARα-null mice.\nTaken together, DEHP may induce hepatocellular adenomas, partly via suppression\nof G2/M arrest regulated by Gadd45α and caspase 3-dependent apoptosis in PPARα-null mice. However, these genes\nmay not be involved in tumorigenesis in wild-type mice. In contrast, the\nexpression level of Met was notably increased in the liver adenoma tissue of\nwild-type mice, which may suggest the involvement of Met in DEHP-induced\ntumorigenesis in wild-type mice. However, we could not\ndetermine whether DEHP promoted the spontaneous liver tumor in PPARα-null\nmice because spontaneous hepatocellular tumors are known to occur in these mice\nat 24 months of age [58], while\nwe observed DEHP-induced tumorigenesis at 22 months of age. To clarify this,\ngene expression profiles of liver tumors in the control group must be analyzed.Taken together,\nthe mechanisms of DEHP-induced carcinogenesis do not consist of only a simple\npathway such as PPARα-mediated peroxisome proliferation as mentioned by Rusyn et\nal. [3].\nPPARα-independent pathways may also exist and, by contrast, activated PPARα may\nprotect against DEHP-induced carcinogenesis. The valance of the production of\noxidative stress via the transactivation of PPARα and subsequent DNA damages\nversus the effective exertion of anti-inflammation by activating the receptor may\ndetermine the incidence of DEHP-induced tumors.7. FUTURE INVESTIGATIONSTo determine the mechanism of species\ndifference in response to peroxisome proliferators, a mouse line with human PPARα\nwas produced and designated hPPARα\nTetOff [27]. This mouse line expresses the\nhuman receptor in liver in a PPARα-null\nbackground by placing the hPPARα cDNA under control of the Tet-Off system of\ndoxycycline control with the liver-specific LAP1 (C/EBPβ) promoter.\nInterestingly, the hPPARα\nTetOff mice express the human PPARα protein\nat levels comparable to those\nexpressed in wild-type mice; so we should not need to consider the species\ndifferences in the expression of PPARα between mice and humans. Treatment of\nthis mouse line with Wy-14,643 revealed induction of genes' encoding\nperoxisomal lipid-metabolizing enzymes, including ACO, bifunctional enzyme and peroxisomal\nthiolase, and the fatty acid transporter CD36 at a level comparable to that in\nwild-type mice, expressing native mouse PPARα. This suggested that human PPARα\nis functionally active. Upon treatment with Wy-14,643, hPPARα\nTetOff mice also had lower levels of fasting serum total triglycerides similar to\nwild-type mice. However, hPPARα\nTetOff mice did not show any\nsignificant hepatocellular proliferation, nor did they have an induction of\ncell cycle control genes, in contrast to Wy-14,643-treated wild-type mice where\na significant increase in mRNAs encoding PCNA, cMYC, cJUN, CDK1, CDK4, and\nseveral cyclins was found after treatment with Wy-14,643. hPPARα\nTetOff mice were also found to be resistant to Wy-14,643-induced hepatocarcinogenesis\nafter 11 months of Wy-14,643 feeding in contrast to a 100% incidence in the\nwild-type mouse group [59].Another transgenic mouse line with human PPARα\nwas generated that has the complete human PPARα gene on a P1 phageartificial chromosome (PAC) genomic clone, introduced onto the mouse PPARα-null background [60]. This new line, designated hPPARα\nPAC,\nexpresses human PPARα not only in liver but also in kidney and\nheart. hPPARα\nPAC mice exhibited responses similar to wild-type mice\nwhen treated with fenofibrate lowering of serum triglycerides and induction of\nPPARα target genes' encoding enzymes involved in fatty acid metabolism.\nTreatment of hPPARα\nPAC mice with fenofibrate did not cause\nsignificant hepatomegaly and hepatocyte proliferation similar to hPPARα\nTetOff mice, suggesting that the resistance to the hepatocellular proliferation found\nin the hPPARα\nTetOff mice is not due to lack of expression of the\nreceptor in tissues other than liver.Until now, there are no reports concerning the\ninteraction between DEHP and hPPARα\nTetOff or hPPARα\nPAC.\nRecently, we have compared the transactivation of mouse and human PPARα by DEHP treatments\nusing wild-type and hPPARα\nTetOff mice (unpublished observation). A relatively\nhigh dose of DEHP (5 mmol/kg for 2 weeks) clearly activated PPARα in liver of\nboth genotyped mice, but the activation was very little in hPPARα\nTetOff mice from the standpoint of the target gene expression as well as triglyceride\nlevels in plasma and liver. Human PPARα response to DEHP may be weak when sufficient human PPARα is expressed in the\nhuman liver. Thus, the use of the hPPARα\nTetOff mouse model is a very\nvaluable means to solve the species differences in the toxicity of peroxisome\nproliferators. The results from the typical peroxisome proliferator (Wy-14643)\nmay not always be similar to those of DEHP; a study of each case is needed\nusing hPPARα\nTetOff mouse model.8. PROPOSED SCIENCE POLICY STATEMENTSThe International Agency for Research on Cancer downgraded the level\nof potential health risks of DEHP from 2b (possibly carcinogenic to humans) to 3 (not classifiable as to carcinogenicity to humans) in 2000 [61]. In\nthis report, DEHP carcinogenesis via PPARα was considered not to be relevant to\nhumans because peroxisome proliferation had not been documented either in human\nhepatocyte cultures exposed to DEHP or in the liver of nonhuman primates. This\ndecision has been variously argued by several scientists in the literature [50, 62, 63]. In contrast, the Japan Society\nfor Occupational Health has maintained the 2B class of DEHP carcinogenicity\nbecause of the obvious rodent carcinogenicity [64].Although the US Environmental\nProtection Agency (EPA) had classified the risk for DEHP carcinogenicity as B2 (probable human carcinogen) in 1993, recently, the expert panel of EPA report has provided\nthe current scientific understanding of the mode(s) of action of PPARα agonist-induced\ntumors observed in rodent bioassays that are associated with PPARα agonisms: liver\ntumors in rats and mice as well as Leydig cell and pancreatic acinar cell\ntumors in rats—all of which represent\nlimited evidence [65]. Since the key events for the mode of action, which have\nbeen causally related to liver tumor formation, include the activation of PPARα, perturbation of cell\nproliferation and apoptosis, selective clonal expansion, and the\nPPARα-related key events included in the expression of peroxisomal genes (e.g., palmitoyl CoA oxidase and acyl CoA oxidase) and\nperoxisome proliferation (i.e., an increase in\nthe number and size of peroxisomes) are reliable markers. Additionally, the\nevidence obtained from the findings that PPARa agonists did not activate the\nreceptor in human cell culture or biopsy samples, and from epidemiological\nstudies, shows that humans are apparently refractory to the effects of a PPARα\nagonist. However, the EPA maintained the DEHP carcinogenicity criterion.In 2004, with regard to preclinical and clinical safety assessments\nfor PPAR agonists, the Food and Drug Administration recommended that, due to the prevalence of positive tumor findings of PPAR\nagonists, two-year carcinogenicity studies on mice and rats are required [66].Although IARC changed the criterion for DEHP\ncarcinogenicity, other agencies did not because DEHP is a potential rodent\ncarcinogen of liver and the precise mechanism has not been yet understood,\nthough DEHP is a potentially hepatic carcinogen in rodents.9. CONCLUSIONSAs mentioned above, some studies suggest\nthe possibility of DEHP tumorigenesis via a non-PPARα pathway although DEHP also\nexerts adverse effects via PPARα-dependent pathway. Since there are species\ndifferences regarding expression levels, cellular context, and function of\nPPARα as well as metabolism enzyme activity of DEHP, it is difficult to\nextrapolate the results from rodents to humans in terms of risk. Recently,\nhPPARα mice have been developed, which may help to solve these differences. Re-evaluation\nof the risk of DEHP carcinogenicity may well be warranted if the previous\ndecisions were based on only PPARα-dependent mechanisms.\n\nREFERENCES:\n1. KlaunigJEBabichMABaetckeKPPPARα agonist-induced rodent tumors: modes of action and human relevanceCritical Reviews in Toxicology200333665578014727734\n2. HuberWWGrasl-KrauppBSchulte-HermannRHepatocarcinogenic potential of di(2-ethylhexyl)phthalate in rodents and its implications on human riskCritical Reviews in Toxicology19962643654818817083\n3. RusynIPetersJMCunninghamMLModes of action and species-specific effects of di-(2-ethylhexyl)phthalate in the liverCritical Reviews in Toxicology200636545947916954067\n4. BalkwillFCoussensLMCancer: an inflammatory linkNature2004431700740540615385993\n5. PikarskyEPoratRMSteinINF-κB functions as a tumour promoter in inflammation-associated cancerNature2004431700746146615329734\n6. MandardSMüllerMKerstenSPeroxisome proliferator-activated receptor α target genesCellular and Molecular Life Sciences200461439341614999402\n7. IssemannIGreenSActivation of a member of the steroid hormone receptor superfamily by peroxisome proliferatorsNature199034762946456502129546\n8. ItoYYokotaHWangRSpecies differences in the metabolism of di(2-ethylhexyl) phthalate (DEHP) in several organs of mice, rats, and marmosetsArchives of Toxicology200579314715415798888\n9. KerstenSDesvergneBWahliWRoles of PPARS in health and diseaseNature2000405678542142410839530\n10. PerazaMABurdickADMarinHEGonzalezFJPetersJMThe toxicology of ligands for peroxisome proliferator-activated receptors (PPAR)Toxicological Sciences200690226929516322072\n11. BrownJDPlutzkyJPeroxisome proliferator-activated receptors as transcriptional nodal points and therapeutic targetsCirculation2007115451853317261671\n12. NakajimaTIchiharaGKamijimaMItoharaSAoyamaTFunctional activation of peroxisome proliferator-activated receptor alpha (PPARalpha) by environmental chemicals in relation to their toxicitiesNagoya Journal of Medical Science2002653-4859412580534\n13. DreyerCKreyGKellerHGivelFHelftenbeinGWahliWControl of the peroxisomal β-oxidation pathway by a novel family of nuclear hormone receptorsCell19926858798871312391\n14. GöttlicherMWidmarkELiQGustafssonJ-ÅFatty acids activate a chimera of the clofibric acid-activated receptor and the glucocorticoid receptorProceedings of the National Academy of Sciences of the United States of America19928910465346571316614\n15. KellerHDreyerCMedinJMahfoudiAOzatoKWahliWFatty acids and retinoids control lipid metabolism through activation of peroxisome proliferator-activated receptor-retinoid X receptor heterodimersProceedings of the National Academy of Sciences of the United States of America1993906216021648384714\n16. LembergerTDesvergneBWahliWPeroxisome proliferator-activated receptors: a nuclear receptor signaling pathway in lipid physiologyAnnual Review of Cell and Developmental Biology199612335363\n17. BragtMCEPopeijusHEPeroxisome proliferator-activated receptors and the metabolic syndromePhysiology & Behavior200894218719718191967\n18. MaloneyEKWaxmanDJ\ntrans-Activation of PPARα and PPARγ by structurally diverse environmental chemicalsToxicology and Applied Pharmacology1999161220921810581215\n19. LapinskasPJCortonJCPeroxisome proliferator-activated receptor α: central mediator of peroxisome proliferator toxicityCIIT Activities199717118\n20. LaiDYRodent carcinogenicity of peroxisome proliferators and issues on human relevanceJournal of Environmental Science and Health, Part C20042213755\n21. GonzalezFJShahYMPPARα: mechanism of species differences and hepatocarcinogenesis of peroxisome proliferatorsToxicology200824612818006136\n22. GonzalezFJAnimal models for human risk assessment: the peroxisome proliferator-activated receptor alpha-humanized mouseNutrition Reviews200765supplement 126\n23. GonzalezFJPetersJMCattleyRCMechanism of action of the nongenotoxic peroxisome proliferators: role of the peroxisome proliferator-activated receptor α\nJournal of the National Cancer Institute19989022170217099827524\n24. PetersJMCheungCGonzalezFJPeroxisome proliferator-activated receptor-α and liver cancer: where do we stand?Journal of Molecular Medicine2005831077478515976920\n25. PalmerCNAHsuM-HGriffinKJRaucyJLJohnsonEFPeroxisome proliferator activated receptor-α expression in human liverMolecular Pharmacology199853114229443928\n26. ShahYMMorimuraKYangQTanabeTTakagiMGonzalezFJPeroxisome proliferator-activated receptor α regulates a microRNA-mediated signaling cascade responsible for hepatocellular proliferationMolecular and Cellular Biology200727124238424717438130\n27. CheungCAkiyamaTEWardJMDiminished hepatocellular proliferation in mice humanized for the nuclear receptor peroxisome proliferator-activated receptor α\nCancer Research200464113849385415172993\n28. WoodyattNJLambeKGMyersKATugwoodJDRobertsRAThe peroxisome proliferator (PP) response element upstream of the human acyl CoA oxidase gene is inactive among a sample human population: significance for species differences in response to PPsCarcinogenesis199920336937210190548\n29. SherTYiHFMcBrideOWGonzalezFJcDNA cloning, chromosomal mapping, and functional characterization of the human peroxisome proliferator activated receptorBiochemistry19933221559856047684926\n30. MukherjeeRJowLNoonanDMcDonnellDPHuman and rat peroxisome proliferator activated receptors (PPARs) demonstrate similar tissue distribution but different responsiveness to PPAR activatorsThe Journal of Steroid Biochemistry and Molecular Biology1994513-41571667981125\n31. PineauTHudginsWRLiuLActivation of a human peroxisome proliferator-activated receptor by the antitumor agent phenylacetate and its analogsBiochemical Pharmacology19965246596678759039\n32. AlbroPWLavenharSRMetabolism of di(2-ethylhexyl)phthalateDrug Metabolism Reviews198921113342696633\n33. ItoYYamanoshitaOKurataYKamijimaMAoyamaTNakajimaTInduction of peroxisome proliferator-activated receptor alpha (PPARα)-related enzymes by di(2-ethylhexyl) phthalate (DEHP) treatment in mice and rats, but not marmosetsArchives of Toxicology200781321922616937134\n34. PeckCCAlbroPWToxic potential of the plasticizer di(2-ethylhexyl) phthalate in the context of its disposition and metabolism in primates and manEnvironmental Health Perspectives19824511177140682\n35. DavidRMMooreMRFinneyDCGuestDChronic toxicity of di(2-ethylhexyl)phthalate in miceToxicological Sciences200058237738511099649\n36. DavidRMMooreMRFinneyDCGuestDChronic toxicity of di(2-ethylhexyl)phthalate in ratsToxicological Sciences200055243344310828276\n37. VossCZerbanHBannaschPBergerMRLifelong exposure to di-(2-ethylhexyl)-phthalate induces tumors in liver and testes of Sprague-Dawley ratsToxicology2005206335937115588926\n38. KluweWMHasemanJKDouglasJFHuffJEThe carcinogenicity of dietary di(2-ethylhexyl) phthalate (DEHP) in Fischer 344 rats and B6C3F1 miceJournal of Toxicology and Environmental Health1982104-57978157161829\n39. National Toxicology ProgramCarcinogenesis bioassay of di(2-ethylhexyl)phthalate (CAS No. 117-81-7) in F344 rats and B6C3F1 mice (Feed Studies)National Toxicology Program Technical Report Series1982217112712778218\n40. DavidRMMooreMRCifoneMAFinneyDCGuestDChronic peroxisome proliferation and hepatomegaly associated with the hepatocellular tumorigenesis of di(2-ethylhexyl)phthalate and the effects of recoveryToxicological Sciences199950219520510478855\n41. CattleyRCConwayJGPoppJAAssociation of persistent peroxisome proliferation and oxidative injury with hepatocarcinogenicity in female F-344 rats fed di(2-ethylhexyl)phthalate for 2 yearsCancer Letters1987381-215223690505\n42. AstillBDGingellRGuestDOncogenicity testing of 2-ethylhexanol in Fischer 344 rats and B6C3F1 miceFundamental and Applied Toxicology199631129418998951\n43. KluweWMHuffJEMatthewsHBIrwinRHasemanJKComparative chronic toxicities and carcinogenic potentials of 2-ethylhexyl-containing compounds in rats and miceCarcinogenesis1985611157715834053278\n44. DavidRMMooreMRFinneyDCGuestDReversibility of the chronic effects of di(2-ethylhexyl)phthalateToxicologic Pathology200129443043911560248\n45. ItoYYamanoshitaOAsaedaNDi(2-ethylhexyl)phthalate induces hepatic tumorigenesis through a peroxisome proliferator-activated receptor α-independent pathwayJournal of Occupational Health200749317218217575397\n46. PetersJMCattleyRCGonzalezFJRole of PPARα in the mechanism of action of the nongenotoxic carcinogen and peroxisome proliferator Wy-14,643Carcinogenesis19971811202920339395198\n47. WardJMPetersJMPerellaCMGonzalezFJReceptor and nonreceptor-mediated organ-specific toxicity of di(2-ethylhexyl)phthalate (DEHP) in peroxisome proliferator-activated receptor α-null miceToxicologic Pathology19982622402469547862\n48. MarsmanDSCattleyRCConwayJGPoppJARelationship of hepatic peroxisome proliferation and replicative DNA synthesis to the hepatocarcinogenicity of the peroxisome proliferators di(2-ethylhexyl)phthalate and [4-chloro-6-(2,3-xylidino)-2-pyrimidinylthio]acetic acid (Wy-14,643) in ratsCancer Research19884823673967443180084\n49. DoullJCattleyRElcombeCA cancer risk assessment of di(2-ethylhexyl)phthalate: application of the new U.S. EPA risk assessment guidelinesRegulatory Toxicology and Pharmacology199929332735710388618\n50. MelnickRLIs peroxisome proliferation an obligatory precursor step in the carcinogenicity of di(2-ethylhexyl)phthalate (DEHP)?Environmental Health Perspectives2001109543744211401753\n51. RobertsRAEvidence for cross talk between PPARα and p38 MAP kinaseToxicological Sciences200268227027412151621\n52. PauleyCJLedwithBJKaplanskiCPeroxisome proliferators activate growth regulatory pathways largely via peroxisome proliferator-activated receptor α-independent mechanismsCellular Signalling200214435135811858942\n53. LedwithBJJohnsonTEWagnerLKGrowth regulation by peroxisome proliferators: opposing activities in early and late G1\nCancer Research19965614325732648764118\n54. LedwithBJManamSTroiloPGallowaySMNicholsWWJoslynDJActivation of immediate-early gene expression by peroxisome proliferators in vitroMolecular Carcinogenesis19938120278352887\n55. KostadinovaRWahliWMichalikLPPARs in diseases: control mechanisms of inflammationCurrent Medicinal Chemistry200512252995300916378501\n56. WuTCyclooxygenase-2 in hepatocellular carcinomaCancer Treatment Reviews2006321284416337744\n57. TakashimaKItoYGonzalezFJNakajimaTDifferent mechanisms of DEHP-induced hepatocellular adenoma tumorigenesis in wild-type and Ppar\nα-null miceJournal of Occupational Health200850216918018403868\n58. HowroydPSwansonCDunnCCattleyRCCortonJCDecreased longevity and enhancement of age-dependent lesions in mice lacking the nuclear receptor peroxisome proliferator-activated receptor α (PPARα)Toxicologic Pathology200432559159915603543\n59. MorimuraKCheungCWardJMReddyJKGonzalezFJDifferential susceptibility of mice humanized for peroxisome proliferator-activated receptor α to Wy-14,643-induced liver tumorigenesisCarcinogenesis20062751074108016377806\n60. YangQNaganoTShahYCheungCItoSGonzalezFJThe PPARα-humanized mouse: a model to investigate species differences in liver toxicity mediated by PPARα\nToxicological Sciences2008101113213917690133\n61. IARC2000, http://monographs.iarc.fr/ENG/Monographs/vol77/volume77.pdf\n62. MelnickRLBrodyCDiGangiJHuffJThe IARC evaluation of DEHP excludes key papers demonstrating carcinogenic effectsInternational Journal of Occupational and Environmental Health20039440040215688552\n63. HuffJIARC and the DEHP quagmireInternational Journal of Occupational and Environmental Health20039440240414664499\n64. The Japan Society for Occupational Health2007, http://joh.med.uoeh-u.ac.jp/oel/index.html\n65. U.S. Environmental Protection AgencyProposed OPPTS Science Policy: PPARα-Mediated Hepatocarcinogenesis in Rodents and Relevance to Human Health Risk Assessments2003, http://www.epa.gov/scipoly/sap/meetings/2003/december9/peroxisomeproliferatorsciencepolicypaper.pdf\n66. U.S. Food and Drug AdministrationPreclinical and clinical safety assessment for PPAR agonist2004, http://www.fda.gov/cder/present/DIA2004/Elhage.ppt"
+}

batch_2/PMC2527556.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527556",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527556\nAUTHORS: Kirsty L Buising, Karin A Thursky, James F Black, Lachlan MacGregor, Alan C Street, Marcus P Kennedy, Graham V Brown\n\nABSTRACT:\nBackgroundThe ideal method to encourage uptake of clinical guidelines in hospitals is not known. Several strategies have been suggested. This study evaluates the impact of academic detailing and a computerised decision support system (CDSS) on clinicians' prescribing behaviour for patients with community acquired pneumonia (CAP).MethodsThe management of all patients presenting to the emergency department over three successive time periods was evaluated; the baseline, academic detailing and CDSS periods. The rate of empiric antibiotic prescribing that was concordant with recommendations was studied over time comparing pre and post periods and using an interrupted time series analysis.ResultsThe odds ratio for concordant therapy in the academic detailing period, after adjustment for age, illness severity and suspicion of aspiration, compared with the baseline period was OR = 2.79 [1.88, 4.14], p < 0.01, and for the computerised decision support period compared to the academic detailing period was OR = 1.99 [1.07, 3.69], p = 0.02. During the first months of the computerised decision support period an improvement in the appropriateness of antibiotic prescribing was demonstrated, which was greater than that expected to have occurred with time and academic detailing alone, based on predictions from a binary logistic model.ConclusionDeployment of a computerised decision support system was associated with an early improvement in antibiotic prescribing practices which was greater than the changes seen with academic detailing. The sustainability of this intervention requires further evaluation.\n\nBODY:\nBackgroundWith the rapidly expanding body of medical knowledge, clinicians need access to appropriate, relevant information to guide their clinical decision making. For many conditions, clinical experts have used available evidence and experience to generate guidelines that endeavour to assist clinicians, and improve patient outcomes. A major problem, however, has been finding the best strategies to implement these guidelines in a busy hospital environment. [1-3] Group lectures, one to one academic detailing, laminated cards and advertising material such as posters have all been tried with variable success. [4-7] With the increasing role played by computers as a source of information in the hospital setting, computerised decision support may provide a useful alternate strategy. [8-11]At the Royal Melbourne Hospital, a transferable web based computerised decision support system was developed, with the capacity to present any guideline or algorithm. [12] We chose in the first instance to deploy a guideline for the management of patients with community acquired pneumonia (CAP) as this is one of the most common conditions presenting to hospital emergency departments. International and national guidelines have been produced to guide the management of CAP [13-15], but uptake has been poor. [16]The general aim of this study was to describe the impact of different methods of guideline promotion on clinician prescribing behaviour. More specifically, a comparison of the impact of both academic detailing (AD) and a computerised decision support system (CDSS) on the management of patients with CAP in an emergency department (ED) was examined. The outcomes of interest included the prescription of antibiotics that were concordant with guideline recommendations, the early identification of the severely ill patients and adjustment of antibiotics to meet recommendations for prescribing in the severely ill group, and adjustment of antibiotics to accommodate known patient allergies.MethodsDesignA two stage pre and post intervention cohort study, and a time series analysisSettingThis study was performed at the Royal Melbourne Hospital, an urban adult tertiary teaching hospital with 350 beds including 14 intensive care unit (ICU) beds. The emergency department assesses 50,000 patients per year, leading to 16,000 admissions to hospital. This hospital did not have an electronic medical record or a computerised order entry system. Over 30 different doctors were working in the ED at any point in time over the study periods, and the allocation of doctors to patients was not structured. A computerised antibiotic approval system restricting access to ceftriaxone was also in operation over all three time periods of this study. Its implementation pre dated the commencement of this study. It approved ceftriaxone use for all patients with severe pneumonia, and its content agreed with the CAP guideline content.ParticipantsThis study described the prescribing behaviour of doctors (both senior and junior medical staff) managing patients in the ED. Specifically, the study focused on antibiotic prescribing for all patients who were initially diagnosed with CAP by the treating clinician in the ED.InterventionThe study extended over three distinct time periods. The first, (or 'baseline') period was from April 2003–March 2004. The second (or 'academic detailing') period (AD) was February 2005–October 2005 and the third (or 'computerised decision support') period (CDSS) was from April 2006–September 2006.During the first ('baseline') time period, electronic and paper copies of national antibiotic prescribing guidelines were available to staff in the ED [13] but no particular additional efforts were made to encourage uptake of the guideline.At the start of the second ('academic detailing') time period, a program of academic detailing was initiated at the hospital. This involved training two senior ED clinicians, a pharmacist and a nurse to provide academic detailing to their colleagues. They spent one on one time educating colleagues (doctors and pharmacists) about antibiotic prescribing recommendations. These activities were opportunistic and occurred during the usual rostered hours. Interactions were not scheduled and no formal documentation of AD encounters was made. Posters and laminated cards with information about severity assessments and appropriate antibiotic choices for patients with CAP were distributed and actively promoted throughout the ED during the academic detailing period. These personnel and advertising material remained available throughout the following ('computerised decision support') time period, but were not specifically promoted.At the commencement of the computerised decision support period, the guideline for the management of patients with CAP was deployed on an existing decision support tool. This tool is a web-based transferable system that was designed at the hospital using a .NET framework and implemented in January 2005.The CAP algorithm used the Pneumonia Severity Index (PSI) to guide site of management decisions (inpatient vs. outpatient care) and the modified British Thoracic Society severity score (CURB) to highlight patients with severe pneumonia who were likely to need review by the intensive care unit (ICU) staff. [17,18] The program was integrated with hospital databases containing patient demographics and pathology results to facilitate rapid calculation of scores required for these prediction rules. Use of these scores was not, however mandated. Users could choose to skip the score to obtain antibiotic advice alone. Antibiotic allergy reminders were included. If a user had previously registered an allergy for a patient this was presented, otherwise a reminder was given to check with the patient. Detailed information was included about unusual pathogens to consider, the most appropriate choice of empiric antibiotics, the duration of therapy, and the timing of change from intravenous to oral antibiotic therapy. Users had access to medical literature via the Internet, along with local interpretation of this literature within the CDSS. Users could browse the CDSS content without logging a patient in, so it could be used as an educational tool as well as providing patient specific advice. There was general agreement between the empiric antibiotic recommendations made in the national guideline, the AD directives and the content of the CDSS.The CDSS was available hospital wide and its use was entirely voluntary. All hospital clinicians could access it via a shortcut on the desktop of any hospital computer. No specific incentives were provided to encourage its use. It was not triggered by any other computer systems. It resided alongside other electronic hospital guidelines. An introductory demonstration was provided to the ED staff and to all staff at a hospital grand round. Thereafter, infectious diseases registrars or pharmacists provided demonstrations informally.Data collectionAll patient presentations to the ED were available for inclusion in the study. Patients were prospectively identified from a database in the ED where the treating doctor already routinely recorded the patient's diagnosis. All patients with a diagnosis of pneumonia, chest infection, lower respiratory tract infection, pleuritic chest pain, cough, shortness of breath, and/or aspiration were identified. Patients were included in the study if they had a new respiratory symptom, a new chest x-ray infiltrate consistent with pneumonia, and if the initial assessment made by the treating doctor was that the patient had pneumonia.Exclusion criteria included: Age <18 years, immunocompromised patients (corticosteroids ≥ 15 mg prednisolone/day for ≥ 2 weeks, HIV positive with CD4 <200 umol/L, transplant recipients on immunosuppressive therapy), suspected or known severe acute respiratory syndrome (SARS), nosocomial pneumonia (discharged from hospital in the previous 2 weeks, after an admission longer than 48 hours), and/or known suppurative lung diseases such as cystic fibrosis or bronchiectasis.Data were prospectively collected from the medical history by a single trained research nurse, according to a set of specified rules. A single clinician was assigned to make judgements about any difficult issues, and a random sample of these cases was cross checked with a second infectious diseases physician. This group comprised 5% of the total patient cohort (40 patients). Specific clinical and pathological and radiological data available within the first 24 hours were sought to allow calculation of severity scores. [17,18] Clinicians' comments about suspicion of aspiration, and documentation of known antibiotic allergies were recorded. The time to antibiotic therapy was calculated using the time of presentation, documented electronically by the ED triage nurse, and the time of antibiotic administration as documented on the medication chart by the nurse in ED or on the ward.Information regarding ongoing antibiotic use was collected. Any antibiotics that were clearly being used to treat a separate infection (as described in the patient's medical record) were not included. Where the duration of treatment after discharge was not recorded, it was assumed to be 5 days. Antibiotic costs were calculated using pharmacy purchasing data. No actual changes in the cost of drugs commonly prescribed for pneumonia occurred over the study period. The admission criteria for ICU were based entirely upon the treating clinician's assessment in all time periods. No protocols or guidelines were enforced. Clinicians were not aware that the study was being conducted. The researchers had no clinical role in the ED over the study period. There were no major changes in the number or composition of staff in the ED, or their responsibilities over the study period. This study was approved by the ethics committee of Melbourne Health. Individual consent from the clinicians or the patients involved was not required.Outcome measuresThe primary outcome assessed was the prescription of empiric antibiotic therapy that adequately covered the likely pathogens (both typical and atypical) and was concordant with recommendations. This included the combination of a recommended beta lactam (amoxicillin, ampicillin, benzylpenicillin, ceftriaxone, cefotaxime or cefuroxime) plus either a macrolide (erythromycin, roxithromycin, clarithromycin or azithromycin) or doxycycline. The use of moxifloxacin alone was also classed as appropriate. Patients who received additional antibiotics were still classed as appropriate, so long as their antibiotic regimen included the recommended drugs (reflecting that the patients at least received appropriate cover). The possibility that antibiotics were required for other concordant problems was appreciated, and without detailed clinical information, it was not possible to determine if this additional antibiotic use was unnecessary.A number of secondary outcomes were also examined. For patients who required ICU intervention at any time during their admission, the proportion that were admitted directly from the ED to the ICU was evaluated as a marker of early recognition of severe disease. Similarly, the proportion of patients requiring ICU management at any time during their admission who were initially prescribed the recommended empiric broad spectrum antibiotics for severe pneumonia in the ED was compared. Appropriate therapy for this group was defined as ceftriaxone (or benzylpenicillin plus gentamicin), in combination with either intravenous azithromycin or erythromycin. The use of moxifloxacin alone was also deemed appropriate.The number of patients prescribed an antibiotic to which they had a documented allergy was examined. The overall pattern of antibiotics prescribed, and the average cost of antibiotics per patient, were assessed in each time period. Finally, the time between presentation to the ED and the administration of antibiotics was recorded.Statistical methodsBaseline characteristics of subjects were compared between the three periods using a chi-squared test of homogeneity for categorical variables and analysis of variance for continuous variables. An a priori level of statistical significance of 0.05 was assumed.The baseline period extended over one year to give an indication of the baseline pattern of change in the rate of concordant prescribing over time, in the absence of any intervention. The academic detailing period included enough patients to detect an improvement in mean concordance from 65% to 75% (188 patients, power = 0.8 and p = 0.05). The computerised decision support period included enough patients to detect an expected further improvement in concordance from 75% to 85% (120 patients, power = 0.8, p = 0.05).Multivariable logistic models were used to compare the mean proportions of concordance across the three periods, while adjusting for disease severity, age, and suspected aspiration. Secondary outcome measures were assessed in the same way. Specifically, among the patients who required ICU admission, the proportion directly admitted from ED to the ICU, and the proportion administered appropriate broad-spectrum empiric antibiotic therapy, were compared. This was specifically recorded as a measure of the degree of recognition of markers of severe illness, which were a key focus of the guideline content. The proportion of patients with a known antibiotic allergy who received that antibiotic was also compared. Time to antibiotic administration was recorded as a measure of whether the CDSS delayed decision making to any extent.A time series analysis was performed to evaluate changes in concordance of prescribing over time, covering all three time periods. The rate of concordant prescribing was expected to improve over time. Change in concordance over time was assessed with a binary logistic model, incorporating month of treatment as a continuous variable. The 'expected' proportion of concordant treatment at any given time then plausibly corresponds to a regression line fitted through the data. We hypothesized that the rate of concordant prescribing after the intervention (in the third time period) would be greater than that expected given the observed trend before the intervention (the first and second time periods). Statistical analysis was performed using Stata version 9.0. [19]ResultsThe demographic details of the patients in each of the three time periods are presented in Table 1. During the computerised decision support period (CDSS), patients were generally older than those in the other two time periods (a greater proportion were aged >85 years), and less likely to have received antibiotic therapy prior to presentation. The observed death rate during the CDSS period appeared to be higher than for the other two periods, but this was largely explained by differences in the proportion of patients aged over 85 years, and differences in the number of patients who died in the ED for whom supportive therapy was not thought appropriateTable 1Patient characteristicsVariableBaselineAcademic detailingComputerised decision supportPvalue#N = 392N = 215N = 133Age: median (range)74(18–96)73(18–98)79(18–98)0.05Sex Female: n (%)15840.0%10046.0%6045.1%0.29Nursing home residents: n (%)5514.0%3114.0%1813.5%0.97Suspected aspiration: n (%)399.9%209.3%75.3%0.25Antibiotics prior to ED: n (%)10025.5%5425.1%1813.5%0.01Known beta lactam allergy n (%)4210.7%2310.6%2115.8%0.25 Non-immediate13615 Uncertain21172 Immediate804PSI class (%) I11.9%13.4%12.8% II14.5%17.2%14.3% III17.3%14.8%11.3% IV33.4%}56.1%28.8%}54.4%31.5%}61.6%0.39 V22.7%25.6%30.1%CURB severe n (%)18246.4%9644.6%5541.3%0.65ICU admission any time n (%)266.6%125.6%107.5%0.76Length of stay – days, median (range)4(1–76)4(1–51)4(1–41)0.93Death: Total n (%)379.4%146.5%2115.7%0.15*Death: (excl. died in ED) n (%)35/3908.9%12/2136.5%16/1287.8%0.23*Comorbidities: (%) CCF20.415.318.00.30 COAD23.415.326.30.02 Neoplasia13.714.416.50.73 CRF11.913.012.70.92 Dementia13.214.421.00.09 Alcohol9.67.95.20.27 CVA18.817.612.80.27 Diabetes22.222.719.50.76 Age >8519.612.527.0<0.01* Adjusted for age, # p values calculated using chi squared test for categorical variables and analysis of variance for continuous variablesED: Emergency department, ICU: Intensive care unit, PSI: Pneumonia Severity Index, CURB: modified British Thoracic Society Severity score, CCF: Congestive cardiac failure, COAD: Chronic obstructive airways disease, CRF: Chronic renal failure, CVA: Cerebrovascular diseaseTable 2 details the comparisons in prescribing behaviour over the three time periods. The odds ratio for having received the recommended empiric antibiotic therapy to cover both typical and atypical pathogens ('concordant therapy') in the ED for the academic detailing period compared to the baseline period was 2.58 [1.78, 3.73], p < 0.01, and after adjustment for age, severity (PSI class) and suspicion of aspiration, OR = 2.79 [1.88, 4.14], p < 0.01. The odds ratio for concordant therapy in the computerised decision support period compared to the academic detailing period was 2.03 [1.13, 3.66], p = 0.01, and after adjustment for age, severity and aspiration, OR = 1.99 [1.07, 3.69], p = 0.02. The estimated effect over time within each cohort did not appear to be substantially altered by the inclusion of these covariates.Table 2OutcomesOutcomeBaseline groupAcademic detailing groupComputerised decision support groupP value#N = 392N = 215N = 133Patients receiving recommended antibiotic cover for typical and atypical pathogens*211/34161.9%143/20868.7%113/12689.7%<0.01Patients requiring ICU who went direct from ED17/2665.0%9/1275.0%8/1080%0.68Patients requiring ICU who received appropriate empiric broad spectrum antibiotics#12/2548.0%5/1145.0%9/1090%<0.01PSI class V patients who received appropriate empiric broad spectrum antibiotics#9/7012.8%4/439.3%10/3826.3%<0.01PSI class IV&V patients who received appropriate empiric broad spectrum antibiotics #30/3418.6%9/2084.3%5/3912.8%<0.01CURB 'severe' patients who received appropriate empiric broad spectrum antibiotics#14/1559.0%7/808.7%20/4940.8%<0.01Patients who received an antibiotic to which they had a known allergy11/4226.2%6/2326.1%3/2114.3%0.50Time from ED presentation to administration of antibiotic: median (range)171 minutes(15–1969)158 minutes(15–1154)142 minutes(10–1190)<0.01Average cost of antibiotics for pneumonia per patient$72.07$94.47$84.04NA* = excluding patients suspected of having aspirated and patients who received no antibiotic treatment at all# p values calculated using chi squared test for categorical variables and analysis of variance for continuous variablesED: Emergency department, ICU: Intensive care unit, PSI: Pneumonia Severity Index, CURB: modified British Thoracic Society Severity scoreThe effect of change over time was observed in more detail. Figure 1 illustrates the percentage of empiric antibiotic prescriptions that were concordant with recommendations per month over the entire period. Prescribing patterns improved slowly over time. One year after release of the guideline, in the absence of any promotional efforts, (that is, at the end of the baseline period), the concordance rate was around 60%. The change in the proportion of concordant prescribing between the last month of the baseline period and the first month of the academic detailing period was +10.8% over 12 months. The change in the proportion of concordant prescribing between the last month of the academic detailing period and the first month of the computerised decision support period was +21.5% over 5 months. At the end of the study period, the rate of concordant prescribing was high. The first month post the CDSS intervention had a very high concordance rate (100%) and thereafter the rate remained around 90%, although the study was not long enough to demonstrate whether this level was maintained beyond 6 months.Figure 1Percentage of empiric antibiotics prescribed that were concordant with recommendations per month.Further analysis was performed to compare the observed results with that which would be expected based upon an underlying trend in improvement over time [11]. The observed behaviour in the preceding time periods (over 3 years) were used to predict the expected prescribing behaviour in the latter 6 month period of the study. Figure 2 shows the three regression lines that best fit the observed rate of concordance over the three separate time periods, and the concordance predicted from a logistic regression model based upon the first and second time periods extrapolated forward through the third time period (the 'expected' concordance). While it is important to note that such a regression line may be sensitive to outliers, there were in fact few actual outliers in these actual data and the likelihood of effect would be low.Figure 2Proportion of concordant therapy prescribed over time. The solid lines indicate regression lines that best fit the observed data in each of the three time periods, demonstrating the percentage of empiric antibiotic therapy that was concordant with recommendations per month over time. The broken line is a regression line that best fits the observed data in just the first and second time periods. This line is projected forward over the third time period to demonstrate the 'predicted' concordance if the underlying trend from the first two time periods was to continue. The horizontal arrows demonstrate the timing of the two interventions. The vertical arrow represents the difference between the 'predicted' concordance and the observed concordance after the computerised decision support system (CDSS) intervention.During the first six months of the CDSS period, the proportion of patients who were prescribed concordant therapy was greater than would be expected based on the observed trend. A confidence interval around the trend line was determined, and this described the likelihood of the observed results in the first month of the CDSS period as having a p value of 0.06 based on the existing trend alone.Secondary outcomes were analysed as a measure of the impact of the changes in prescribing on key areas of interest. Regarding those patients who required ICU support, the likelihood that recommended broad spectrum empiric antibiotics were received in the ED increased over time. The odds ratio for the academic detailing period compared to the baseline period was 1.48 [0.35,6.25], p = 0.59, and the odds ratio for the CDSS period compared to the AD period was 10.80 [0.99, 116.99], p = 0.051. Improved early recognition of patients with severe illness was suggested, with a greater proportion of patients requiring ICU care going directly to ICU from the ED over time (65% in baseline, 75% in the academic detailing period and 80% in the period of computerised decision support). The number of patients was too small to comment upon whether this change was statistically significant.There appeared to be a lower likelihood of inappropriately prescribing an antibiotic to a patient who had a documented allergy to that drug during the computerised decision support period. Specifically, comparing the AD period with the baseline, the odds of an allergy prescribing error were 0.99 [0.31, 3.16], p = 0.99; whereas when the comparing the CDSS with the AD period, the odds ratio for such a prescribing error was 0.47 [0.10, 2.19], p = 0.33.Table 3 describes the most frequent antibiotic combinations prescribed to patients in each of the three time periods. The percentage of patients empirically prescribed a cephalosporin was 38.2% for the baseline period, 38.1% for the academic detailing period, and 42.8% for the computerised decision support period. The average cost of antibiotic therapy per patient was calculated for the three patient groups. This calculation was adjusted for changes in pricing over time, though in fact, very little change occurred in the price of the antibiotics most frequently prescribed for CAP during the study. While the average cost per patient increased between the first and second time periods, it fell in the third time period. Finally, the time between a patient being admitted to the emergency department, and an antibiotic being first administered to the patient did not increase, and was actually found to progressively fall over the three time periods, from 171 to 158 and then 142 minutes, p < 0.01.Table 3The most frequent initial antibiotic combinations prescribed (described as percentage of patients)Initial antibiotic combinationPercentage of patientsBaseline periodPenicillin IV + roxithromycin20.6%Ceftriaxone10.2%Ceftriaxone + roxithromycin9.2%Penicillin IV5.8%Penicillin IV + doxycycline5.3%Ceftriaxone + erythromycin IV4.3%Academic detailing periodPenicillin IV + roxithromycin27.4%Ceftriaxone + roxithromycin16.7%Amoxycillin (oral)+ roxithromycin8.3%Ceftriaxone6.9%Roxithromycin5.1%Penicillin IV + doxycycline4.2%Computerised decision support periodPenicillin IV + roxithromycin28.6%Ceftriaxone + roxithromycin17.3%Ceftriaxone + azithromycin12.8%Ceftriaxone6.7%Penicillin IV + doxycycline6.0%DiscussionThis study demonstrates the pattern of behavioural change in emergency department clinicians over three and a half years, and describes the changes surrounding different interventions to promote a particular prescribing strategy. In particular, it demonstrates that the implementation of a computerised decision support system was associated with greater improvement in prescribing practices than would have been expected based upon the predictions made from actual prescribing observed over the preceding 3 years.The baseline period provides an example of the rate of change of prescribing behaviour with passive, informal means of information transfer. It shows that change is slow, and that the rate of change falls with time. This is consistent with the suggestion that while some clinicians respond to recommendations early, others may be more difficult to access, or more resistant to change, and change may be harder to achieve in the later time periods.The improvement in concordance of prescribing was not dramatic with academic detailing, but appeared to be greatest immediately after the CDSS was deployed. It is likely that the interest generated by a novel system, and the attention it received during early education sessions contributed to the high initial concordance. Junior staff in this ED rotated on average every three months, which means that the impact of AD may not be sustained as new staff enter the unit. It is important to note that 100% concordance should not be expected in this context. The CAP guideline represents a basic recommendation, and individual patients vary from the average. In the case of CAP, experienced clinicians would be expected to vary from the guidelines for valid clinical reasons. It is impossible to separate the effect of the computerised decision support system itself, from the effect of the education sessions, which would have increased awareness of the CAP guideline and its recommendations. A longer duration of follow up after deployment of the CDSS would be required to comment upon the sustainability of any change.The CDSS was associated with changes in many of the secondary outcomes of interest that were not demonstrated with academic detailing. In particular, better recognition of patients with severe pneumonia, suggested by increased use of recommended broad-spectrum empiric antibiotics in those requiring ICU care was noted. This change occurred without a major increase in the overall rate of cephalosporin use or the average antibiotic costs per patient. This may be because the content of the decision support system highlighted this perceived problem, and the advice was consistent for all users. In contrast, with passive transfer and academic detailing advice might be less consistent.One of the strengths of this paper is that our statistical analysis has taken in to account the expectation that prescribing practices would improve over time, in the absence of intervention. [11] This improvement is presumably due to a 'learning effect' as information is disseminated. It demonstrates that trends in prescribing practices were already present before any specific intervention and these should be acknowledged.This is one of the first papers to compare the impact of a CDSS with academic detailing alone in the same clinical setting. To date, academic detailing has been one of the more common strategies used to promote guidelines, but it can be a labour intensive exercise. The staff members who provided academic detailing attended a two-day training session, and thereafter dedicated a portion of their clinical time to training purposes. The information provided to different staff members may have varied due to time constraints or the interest of the trainer, and particular areas may not have been discussed. The CDSS, in contrast, provided consistent advice, and could be accessed whenever required by the clinicians. It required an initial investment of clinician's time to develop and test the algorithm, but thereafter did not consume any additional staff resources.To date, most evaluations of CDSS in hospitals have described large purpose built systems, often in academic centres in the USA with a specific interest in computerisation. [8,20] This paper, in contrast, describes a transferable web based computerised decision support system which can be integrated with many existing clinical databases in other hospitals. This study describes a clinical setting that would be familiar to most tertiary Australian hospitals. Previous reviewers have noted the lack of reports of systems outside of the USA, and this paper therefore provides an important contribution. [21]The major limitation of this study is that the changes were not compared with a separate control group. This study used the same group of clinicians at different time points as controls. In order to do this, the effect of time needed to be taken into account. The predictions of prescribing patterns that we have described are extrapolations beyond the actual data, and make assumptions about patterns of practice remaining similar over time. In this hospital, it would not have been practical to separate control and intervention groups without cross contamination. In addition, such a study might increase clinician awareness and introduce bias affecting prescribing practices. Although multiple testing issues are a concern where several hypothesis tests are performed, in this study the findings comparing time periods were relatively consistent across different variables and the statistical significance of the effect was generally better than the 0.05 level.It is also important to recognize that the successful implementation of CDSS depends heavily on the personnel and the setting, hence separate hospitals or wards do not necessarily provide accurate control groups for comparison. The 'culture' within an institution has important effects on guideline implementation strategies. Exploration of the effect of a computerised decision support system on the prescribing practices in other institutions would, therefore, be of interest.ConclusionThis study has demonstrated improved antibiotic prescribing practices in a hospital setting associated with two different strategies for implementation of guidelines. The improvement in prescribing practices was initially more significant with computerised decision support system than with academic detailing alone, although this may represent the effect of increased attention being given to a novel system. Further exploration of the role of computerised decision support system in hospitals is warranted to particularly to assess the sustainability of the effect on clinician decision-making at the point of care.Competing interestsThe authors declare no financial conflict of interest. All authors have been employed by Melbourne Health who now hold the rights to the computerised decision support system evaluated in this study. Melbourne Health had no influence over the findings described in this study. The authors have no other personal financial interests in the CDSS.Authors' contributionsKB and KT designed the study, carried out data collection and data analysis. JB and LM provided specific advice regarding statistical evaluation at the study design and analysis stages. AS GB and MK participated in study design and analysis. All authors contributed to the final manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2527577.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527577",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527577\nAUTHORS: Nicholas LM Cruden, Martin A Denvir\n\nABSTRACT:\nIntroductionIsolated left ventricular non-compaction is a recently described form of cardiomyopathy that is associated with a significant risk of life-threatening arrhythmia and thromboembolic complications.Case presentationWe report the presentation, diagnosis and management of isolated left ventricular non-compaction in a 54-year-old Caucasian woman presenting with progressive symptoms of heart failure.ConclusionAdvances in diagnostic imaging have undoubtedly led to an increase in the detection of isolated left ventricular non-compaction. Diagnosing and differentiating this uncommon condition from other forms of cardiomyopathy are important as treatment and prognosis may differ significantly. Our current understanding of isolated left ventricular non-compaction, including diagnostic criteria, management and prognosis, is discussed.\n\nBODY:\nIntroductionDuring normal foetal development, myocardial compaction usually occurs by day 70 in utero. Where this process fails to take place, prominent left ventricular trabeculations may remain that persist into adult life. In the absence of significant cardiac outflow tract obstruction, the presence of extensive left ventricular trabeculation is associated with the development of left ventricular systolic impairment, cardiac arrhythmias and systemic thromboembolism. Recent advances in diagnostic imaging techniques have led to an increase in the detection of this previously rare form of cardiomyopathy, known as isolated left ventricular non-compaction (IVNC). It is important that clinicians recognise and differentiate this condition from other forms of cardiomyopathy as treatment and prognosis may differ significantly.Case presentationA 54 old-year-old Caucasian woman was admitted with a 3-month history of progressive exertional breathlessness, orthopnoea and chest tightness. On examination she was in sinus rhythm with a rate of 66 beats/minute and a blood pressure of 90/60 mmHg. Auscultation revealed a first and second heart sound with no added sounds and no murmurs, reduced air entry at both lung bases and coarse crepitations at the left lung base.Serum urea, electrolytes, thyroid function, ferritin and full blood count were all within normal limits. A chest X-ray demonstrated cardiomegaly with small bilateral pleural effusions. The electrocardiogram confirmed sinus rhythm with left atrial enlargement, low voltage QRS complexes and lateral T wave inversion. Transthoracic echocardiography demonstrated a dilated left ventricle (end systolic diameter 5.5 cm; end diastolic diameter 5.9 cm) with severe systolic impairment and hypertrabeculation of the left ventricular apex (Fig. 1) in the absence of significant valvular heart disease. Doppler colour flow mapping confirmed colour flow between the trabeculations (Fig. 2). Intravenous injection of ultrasound contrast agent confirmed an area of non-compacted myocardium subtending a thinner walled area of compaction and a diagnosis of IVNC was made (Fig. 3).Figure 1Transthoracic echocardiography. Apical four chamber view demonstrating marked trabeculation of the left ventricular apex (arrow). RA, right atrium; LA, left atrium; LV, left ventricle; RV, right ventricle; PE, pleural effusion.Figure 2Transthoracic echocardiography. Doppler colour flow mapping suggesting blood flow present between the ventricular trabeculations (arrow). RA, right atrium; LA, left atrium; LV, left ventricle; RV, right ventricle.Figure 3Transthoracic echocardiography. Following intravenous injection, contrast agent is visualised between the ventricular trabeculations (arrow). LV, left ventricle.DiscussionIsolated left ventricular non-compaction is a recently described cardiomyopathy [1], the true prevalence of which remains unknown. Advances in diagnostic imaging modalities have undoubtedly led to an increase in detection of this rare condition and it is likely that earlier cases have been misdiagnosed as phenotypically similar cardiomyopathies, such as apical hypertrophic cardiomyopathy [2], where prognosis and treatment may differ significantly. The purpose of this case report is to highlight the diagnosis of IVNC and briefly review our current understanding of the condition.The presence of marked left ventricular trabeculation in patients with IVNC is believed to arise as a result of intrauterine arrest of left ventricular myocardial compaction, although the trigger for this phenomenon is not yet known. Both familial and sporadic forms of IVNC have been described and although no causative gene has yet been identified, familial screening is recommended [3,4].Echocardiography remains the reference standard for the diagnosis of IVNC [5]. Jenni and colleagues identified four criteria for the diagnosis of IVNC by echocardiography [5]. A thick, inner layer of non-compacted myocardium is present subtending an outer, thin compacted layer of myocardium with ratio of non-compacted to compacted myocardium during systole being greater than 2:1. When the left ventricle is divided into nine segments, non-compacted myocardium is present predominantly (more than 80%) on the apical and mid-ventricular aspects of the inferior and lateral walls. Deeply perfused intertrabecular recesses that do not communicate with the coronary circulation can be identified using colour Doppler (Fig. 2). The use of an intravenous ultrasound contrast agent (Fig. 3) or Doppler tissue imaging may improve visualisation of the left ventricular intertrabecular recesses. These features should be present in the absence of any other significant cardiac abnormality.Cardiac magnetic resonance imaging may also be of use in the diagnosis of IVNC, in particular in individuals where the image quality at echocardiography is limited [6]. In contrast to echocardiography, with cardiac magnetic resonance imaging the ratio of non-compacted to compacted myocardium should be measured during diastole, a ratio of greater than 2.3:1 confirming pathological trabeculation of the left ventricle [6].Treatment for patients with IVNC should be directed at the management of left ventricular systolic impairment where present; the detection, treatment and prevention of arrhythmias; and the prevention of systemic embolic events [3,4]. In addition to treatment with angiotensin-converting enzyme inhibitors, β-blockers and, where appropriate, diuretics and/or digoxin, all patients with IVNC should be screened annually with 24-hour electrocardiogram recordings and considered for long-term prophylactic anticoagulation with warfarin. The high incidence of sudden death reported in patients with IVNC has prompted some authors to advocate a strategy of \"early\" automated implantable cardiodefibrillator implantation [3]. The role of biventricular pacemakers in this population remains unclear. Finally, where pharmacological therapy fails to halt the progression to cardiac failure, heart transplantation should be considered [4].Initial data from Europe and America reported a 4- to 6-year combined mortality or transplantation rate of ~50% to 60% [3,4] although recent UK data indicate the prognosis may be more favourable [7]. Our patient responded well to the introduction of angiotensin-converting enzyme inhibition, beta-blockade and warfarin anticoagulation but is currently being considered for cardiac transplantation.ConclusionIsolated left ventricular non-compaction is a rare but important form of cardiomyopathy that should not be overlooked in patients presenting with cardiac failure. This case report emphasises the importance of differentiating this condition from alternative diagnoses where treatment and prognosis may vary significantly.AbbreviationsIVNC: Isolated left ventricular non-compaction.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsNLMC and MAD made the diagnosis and were involved in subsequent management. MAD was the Consultant responsible for the patient. Both authors have drafted, read and approved the manuscript.ConsentWritten informed consent was obtained from the patient for publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2527603.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527603",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527603\nAUTHORS: Francis Ho, Francis Lau, Michael G Downing, Mary Lesperance\n\nABSTRACT:\nBackgroundThe Palliative Performance Scale (PPS) was first introduced in1996 as a new tool for measurement of performance status in palliative care. PPS has been used in many countries and has been translated into other languages.MethodsThis study evaluated the reliability and validity of PPS. A web-based, case scenarios study with a test-retest format was used to determine reliability. Fifty-three participants were recruited and randomly divided into two groups, each evaluating 11 cases at two time points. The validity study was based on the content validation of 15 palliative care experts conducted over telephone interviews, with discussion on five themes: PPS as clinical assessment tool, the usefulness of PPS, PPS scores affecting decision making, the problems in using PPS, and the adequacy of PPS instruction.ResultsThe intraclass correlation coefficients for absolute agreement were 0.959 and 0.964 for Group 1, at Time-1 and Time-2; 0.951 and 0.931 for Group 2, at Time-1 and Time-2 respectively. Results showed that the participants were consistent in their scoring over the two times, with a mean Cohen's kappa of 0.67 for Group 1 and 0.71 for Group 2. In the validity study, all experts agreed that PPS is a valuable clinical assessment tool in palliative care. Many of them have already incorporated PPS as part of their practice standard.ConclusionThe results of the reliability study demonstrated that PPS is a reliable tool. The validity study found that most experts did not feel a need to further modify PPS and, only two experts requested that some performance status measures be defined more clearly. Areas of PPS use include prognostication, disease monitoring, care planning, hospital resource allocation, clinical teaching and research. PPS is also a good communication tool between palliative care workers.\n\nBODY:\nBackgroundThe Palliative Performance Scale (PPS) was first introduced by Anderson and Downing in 1996 as a new tool for measurement of performance status in palliative care [1]. Its initial uses in Victoria, British Columbia included communication, analysis of home nursing care workload, profiling admissions and discharges to the hospice unit and prognostication. PPS has been used in many countries and has been translated into other languages, including French, Japanese, German and Thai (from private correspondence of Downing GM, 2008). In a recent systematic review on clinical assessment tools for quality of life, Jordhoy et al [2] found that out of the 39 existing palliative care assessment tools, 11 included original performance status assessments, and only two of them, PPS and Edmonton Functional Assessment Tool (EFAT) incorporated comprehensive performance status measures. PPS is observer-rated and includes five domains (on a Scale of 0% to 100%, in increments of 10%) – Ambulation; Self-care; Activity Level/Evidence of Disease; Intake and Level of Consciousness (Additional file 1). It is adapted from the Karnofsky Performance Scale [3].A brief review of the literature showed only a dozen articles on PPS, including the original 1996 Anderson article where its development was first reported. Only seven of these articles are on the validity of PPS in prognostication and its usefulness in the prediction of survival of palliative care patients. Five of these articles are in peer-reviewed journals (Morita [4] 1999; Virik [5] 2002; Harrold [6] 2005; Head [7] 2005; Lau [8] 2007), with the other two being conference presentations and abstracts (Younis [9] 2003; Olajudin [10] 2004). Other documented areas where PPS are used include disease progress monitoring and care planning. In the Canadian Health Services Research Foundation report by Dudgeon, on Collaborative Care Plans [11], PPS was one of the assessment tools recommended. In another article on advance planning and palliative care in nursing homes in USA, Levy also used PPS for prognostication and palliative care interventions [12]. The \"BC Palliative Care Benefit Program (2001)\" of British Columbia, Canada, contains a guideline for their Drug Benefit Program, stating that eligible patients must be in the terminal stage of illness with an entry point PPS of 50% level or below [1].Downing et al [13] in their meta-analysis study of PPS, found only Harrold [6] reported interrater reliability test results for PPS in a pilot study with a small sample size (n = 30). As PPS is becoming more widely used in palliative care, and no formal study has been done on its inter- and intrarater reliability and validity, it is important for clinicians to have solid evidence that PPS % level scores can be repeated consistently and also accurately reflect the functional status of the patients assessed.This study has two objectives: (1) to examine the inter- and intrarater reliability of the PPS by clinicians, (2) to examine the validity of the PPS by content validation, questioning clinicians on its purpose and usefulness.MethodsThis study obtained ethics approval for human participant research, by the Human Research Ethics Board, University of Victoria, BC (Protocol Number 07-05-385b), and has met the standards of research design, and the protection of rights and security of data.Reliability studyThe reliability study was designed as a web-based scenarios study using a secure website, initially with 22 simulated palliative care patient case histories created from actual clinical settings (see Additional file 2 for a sample case). Because the time required to evaluate all 22 cases was too long, we randomly divided the cases into two groups: 1 and 2, with 11 cases in each. When a participant first registered, a random number, either 1 or 2 was generated by computer program, and the participant was assigned to the corresponding group. When a participant logged onto the website, he/she was presented with the PPS and its instructions of use. The cases were presented in a random order, so that no two participants in the same group read the cases in the same sequence. The participant was asked to review the history of each case, assign a PPS % level and go on to the next case, until all 11 cases were completed. This was Time-1 of the reliability study. Two weeks later, each participant was invited back to repeat the test in the same way, with the same 11 cases and the same sequence of presentation. This was Time-2 of the reliability study.Case DevelopmentThe cases were in narrative format. Palliative care clinicians from hospices, in-hospital consultation services and palliative out-patient clinics provided us with their patient case histories. Cases were developed using the material obtained, modifying them somewhat to ensure anonymity, with the intention of covering all scenarios of the different PPS % levels, from PPS 10% to PPS 100%. A panel of palliative care experts, three physicians and three nurses (Case Development Experts), reviewed all of the cases at a face to face meeting. First each case was scored by the experts individually, then the score results were compared and the differences in PPS % levels (if any) were discussed, and with consensus, the narration/wordings of each case were adjusted to be consistent with a given PPS % level. There were 22 cases in total.Participant RecruitmentParticipants of the reliability study were recruited through a two step process. An email with an attached invitation to participate, was sent to the administrators and senior clinicians of various palliative care institutions across Canada and the U.S.A. (Victoria, Vancouver, Calgary, Edmonton, Toronto, Hamilton, Kingston, Montreal, Newfoundland, Nova Scotia and North Carolina), requesting that they forward the invitation to their members and colleagues. This invitation provided detailed information about the mechanics of the web-based study, the researchers involved, the anonymyzed format of the data obtained, participants' confidentiality, the time required for participants to complete the study and the steps in giving consent, and/or withdrawing from the study. Upon receiving the forwarded invitation, clinicians (palliative care physicians and nurses) responded by returning an 'acceptance to participate' email to the researchers, agreeing to participate in the study. A username and password were created for each participant and together with the URL of the secure website, were sent to them by email.Validity studyThe validity study was performed through content validation interviews with palliative care experts, discussing their experiences using PPS. An email 'invitation to participate' was sent to clinicians (both physicians and nurses), who were experts in using PPS in their palliative care practice. Potential participants' names were obtained from suggestions by one of the authors of this study. Included in the invitation email was a list of five questions that would be discussed in a telephone interview. The questions were based on five themes: PPS as a clinical assessment tool, areas of usefulness of PPS, how the PPS scores affected clinicians' decision making in patient management, the problems in using PPS, and the adequacy of PPS instruction. Experts were also asked about the number of years they have been using PPS. The questions were approved by the authors of the study before they were sent out to the potential participants. For those who returned an acceptance email, arrangements were made for appropriate interview schedules. The experts recruited were from across Canada and the U.S.A. (Victoria, Vancouver, Edmonton, Toronto, Kingston, and Newfoundland and North Carolina). Each interview took approximately 20–30 minutes, notes were taken and the interviews were audio-recorded for cross-referencing. One author collected all the interview results and all opinion and suggestions were sorted under the five themes. These were presented, discussed and content-analyzed by all authors in a meeting, questions were raised and referred back to the recordings for clarification.Analytical MethodsThe data obtained from the reliability portion of the study was analyzed using SPSS version 15.0 and R version 2.5 software. The reliability of PPS was evaluated using the single rating intraclass correlation coefficient (ICC) for absolute agreement and for consistency using two-way random-effects models. Single rating measures were used because our interest was in ICC measures for individual participants rather than averages of independent measures. The ICCs were obtained for each time period.Participant reliability was evaluated using Cohen's kappa, which is a chance-corrected measure of agreement between two participants. It ranges from 0 (chance agreement) to 1 (perfect agreement), and generally a kappa > 0.7 is considered satisfactory. An interpretation by Landis and Koch [14] divided kappa into six categories: < 0 (no agreement), 0.0–0.20 (very low agreement), 0.21–0.40 (low agreement), 0.41–0.60 (moderate agreement), 0.61–0.80 (full agreement) and 0.81–1.00 (almost perfect agreement).We looked at the results of individual cases, using boxplots. The top and bottom of the box represent the 75th and 25th percentiles respectively, a horizontal line across the box identifies the median, and the hinges on the top or bottom are the highest and lowest values excluding outliers. Outliers are depicted with circles, and are defined as values that extend from 1.5 to 3 box lengths below the 25th percentile or above the 75th percentile. We also compared participants' scores to the intended PPS % levels agreed upon by the Case Development Experts.Content validity is based on the extent to which a measurement adequately and comprehensively reflects the specific intended domain of content, and it employs a reference standard. In our study, we questioned the experts regarding the usefulness and problems of PPS. The reference standard we used was the actual experience of the experts in the domain of palliative care. During our telephone interviews with palliative care experts, notes were taken and the discussions were audio-recorded. Content analysis of the interviews was based on the notes taken, cross referenced with the audio-recording when required and the results were grouped into five themes for reporting.ResultsReliability studyDescriptive AnalysisA total of 62 emails were sent to administrators and senior clinicians of palliative care institutions, requesting them to forward our \"Invitation to Participate\" letter to their colleagues and members. We do not have a record of which administrators and senior clinicians actually forwarded our letter, but we did have a total of 73 individuals who returned a 'consent to participate' email. Out of these participants, 65 completed Time-1, and among them, 53 also completed Time-2. Only scores of participants who completed both Time-1 and Time-2 were included in this study.The participants were randomly assigned to Group 1 or Group 2, each with 11 cases. There were 25 participants in Group 1 and 28 in Group 2. By design, the range of PPS % levels of all the 22 cases (both Group 1 and Group 2) covered the entire spectrum of values, from PPS 10% to PPS 100%. Because the 22 cases were randomly allocated to either Group 1 or Group 2 (each with 11 cases) when the study was first set up, Group 1 ended up with no representation at PPS 20% and PPS 80% and Group 2 with no PPS 40%, 70% and 100%.Figures 1, 2, 3 and 4 are boxplots of the PPS % scores by case for the two time periods for both Group 1 and Group 2. The variation is quite small for most cases, within 0–2 PPS % levels, indicating consistency in scoring. Outliers were present in about half of the cases, not necessarily at the same PPS % levels or with the same case for both Time-1 and Time-2. The second row of numbers on the x-axis of the boxplots represents the intended PPS % level of each case as determined by the Case Development Experts. In each Figure, for eight out of the 11 cases, the intended PPS % levels were the same as the medians of the boxplots and for the remaining three cases, in all but one Figure, the intended PPS % levels fall within the 75th and 25th percentiles of each boxplot. Over all of the participant and case scores, 67.6% were the same as those intended by the Case Development Experts. Thus there is strong agreement between the Case Development Experts and the participants.Figure 1Boxplot Group 1 Time-1. The Y-axis represents the participants' PPS % levels, the top line X-axis shows the individual case number, and the 2nd line X-axis gives the intended PPS % levels as determined by the Case Development Experts.Figure 2Boxplot Group 1 Time-2. The Y-axis represents the participants' PPS % levels, the top line X-axis shows the individual case number, and the 2nd line X-axis gives the intended PPS % levels as determined by the Case Development Experts.Figure 3Boxplot Group 2 Time-1. The Y-axis represents the participants' PPS % levels, the top line X-axis shows the individual case number, and the 2nd line X-axis gives the intended PPS % levels as determined by the Case Development Experts.Figure 4Boxplot Group 2 Time-2. The Y-axis represents the participants' PPS % levels, the top line X-axis shows the individual case number, and the 2nd line X-axis gives the intended PPS % levels as determined by the Case Development Experts.Reliability AnalysisThe reliability of PPS was calculated using ICC for absolute agreement and for consistency using two-way random-effects models. ICC measures the proportion of variance in the measurements attributable to the cases. Larger values, near 1, indicate that most of the variation in the measurements is due to the differences in the cases, rather than to variability between participants. Values were obtained for each time period for the two groups. Absolute agreement measures take into account participant variability, while measures of consistency do not. Table 1 summarizes the reliability results. The consistency and absolute agreement values are very similar and high, around 0.96, indicating good agreement among participants.Table 1PPS – ICCConsistencyAbsolute AgreementGroupTime PeriodIntraclass Correlation (95%CI)Intraclass Correlation (95%CI)1 (n = 28)1.960 (.919, .987).959 (.917, .986)12.963 (.926, .988).964 (.927, .988)2 (n = 25)1.959 (.917, .986).951 (.901, .984)22.938 (.878, .979).931 (.864, .977)Reliability Results – Intraclass Correlations and their 95% Confidence IntervalsParticipants (raters) ReliabilityTable 2 shows a cross tabulation of PPS % levels at Time-1 and Time-2, Group 1 and 2 combined. The x-axis represents PPS % levels of participants at Time-2, and the y-axis represents PPS % levels of participants done at Time-1. The least amount of deviation occurred at the two ends of the PPS % levels, i.e. PPS 10% and PPS 100%, suggesting that it is easier to score the same value (PPS 10% and PPS 100%) in both Time-1 and Time-2, when patients were either healthy or very sick. Overall 74.4% of the scores were on the diagonal, indicating most participants scored with the same values in both Time-1 and Time-2.Table 2Cross Tabulation of Time-1 & Time-2 ScoresTime-1Time-2Level10%20%30%40%50%60%70%80%90%100%Total10%510000000005120%5571110100007530%0103040000004440%004659100007950%0001630300004960%000164142015570%0000118538008080%0000061526104890%0000001534343100%0000000073239Total56674587467073414236563Time 1 vs Time 2 PPS % levels of all 22 cases.The X-axis represents the Time 2 scores and Y-axis represents the Time 1 scores.The values in the table represent the total number of scores at each PPS % level at Time 1 and Time 2.Cohen's kappaTable 3 lists the summary statistics for Cohen's kappa, calculated over all of the participants, for Time 1 and Time 2. Group 1 has a mean kappa of 0.67 and Group 2 has a mean kappa of 0.71, indicating satisfactory results among participants.Table 3Cohen's Kappa StatisticsmeanmedianmaxminGroup 10.66803880.63797101.00000000.2735849Group 20.70999520.68867921.00000000.3592233Validity studyIn this study, we conducted content validation through expert opinions. The 15 experts interviewed included both physicians and nurses working in the field of palliative care as in-hospice clinicians, members of palliative care home teams, hospital palliative consultants, physicians of palliative out-patient clinics and physicians at cancer institutes. They are from across Canada and U.S.A. (British Columbia, Alberta, Ontario, Newfoundland and North Carolina). All of them have used PPS for more than two years; and one expert has used it since it was first introduced over ten years ago.The interviews were conducted, content analyzed and grouped into five themes. The experts' opinions were summarized as follows.i. PPS as a clinical assessment toolThe experts agreed that PPS is a valuable tool in the clinical assessment of all palliative care patients, not just end-of-life patients. Some wanted to apply the usage of PPS to other domains such as pediatric patients, acute in-hospital patients or even suggested teaching patients and their families how to use PPS, to assist them in making end of life decisions. PPS is one of the standard assessment tools in many experts' palliative care practices; although one expert uses ECOG (Eastern Cooperative Oncology Group Performance Status) with his oncology patients and uses PPS only with his other patients, other experts use PPS with all their palliative care patients. One other expert pointed out that PPS is helpful in tracking a disease trajectory, especially when a patient's condition is deteriorating.ii. Areas of usefulness of PPSAreas of use are emphasized differently, depending on the type of practice of the experts. Patients of hospital palliative consultants are in quicker transition, and by the time they are consulted, patients are usually at the end-stage of life. In these situations with PPS levels of 10%–20%, prognostication is a more important issue than disease monitoring. For in-hospice clinicians, patient disease monitoring during their end-of-life course in hospital, is as important as prognostication. For hospital palliative care administrators, patient care planning and hospital resource allocation (e.g. hospital beds), become priorities. A detailed description of patients in the various areas of their palliative care program, using PPS as the indicator of patients' state, can help in administrative planning. Palliative care home nurses frequently use PPS to evaluate which patients require home nursing care. PPS is a useful tool for teaching residents to include patient function in their assessment of whether a patient should be discharged from hospital.iii. How PPS scores affect clinicians' decision making in patient managementAs one expert pointed out, PPS is valuable in placement, but not in treatment decision making. Clinicians are trained to base treatment decisions on patient symptoms. On the other hand, PPS can assist family members in making tough end-of-life decisions. PPS is also helpful in decision in placement of patients, from active care to palliative care.iv. Problems using PPSProblems raised by the experts can be categorized as: (1) on PPS performance status (2) PPS % level scores (3) PPS learning curve and (4) PPS as communication tool. Many experts felt that PPS should be left as is; however, two experts thought some performance status indicators needed to be further defined. For example, ambulation should specify the length of time that a patient can sit in a chair. The term \"oral intake\" should be redefined to include other types of intake, for example, NG/PEG tube feeding and supplements. The scoring of comatose patients is unclear, and the meaning of \"extensive disease\" is more difficult to define in cases of COPD or stroke.Some experts found it more difficult to score at certain PPS % levels. One expert asked what to do with PPS % level scores that fell in between two levels and requested finer grading of PPS % levels. One expert found it easier to score with lower PPS % levels, and more difficult with higher levels. Other experts found it troublesome to distinguish between certain PPS % levels, e.g. between PPS 30% and 40%, or between PPS 80% and 90%. In a tertiary care setting, patients' PPS % level are usually above PPS 60%, and those experts had less experience dealing with lower PPS levels.One expert commented that if PPS % levels were used in disease trajectory monitoring, the trajectory shape, linear or nonlinear could depend on how frequently PPS % level was recorded. For example, a patient admitted with PPS 10%, may be at PPS 40% after treatment, then drop back to 10% within a few days. If PPS % levels were only taken at both ends of this time period, a linear graph would result, with no change in PPS % level. But if the PPS % levels were taken more frequently, then a curve would be obtained.One expert who used PPS only for his non-cancer patients found that PPS had too many variables to remember, so that he frequently referred back to the PPS table and required PPS instructions while using the tool, while others who used PPS regularly had no such problem.Experts agreed the learning curve for PPS is somewhat steep, but once it is used properly, PPS is a good communication tool and becomes a standard reference for palliative care workers to discuss patients' conditions among themselves. One expert suggested, \"Sometimes it is laziness that prevents palliative care workers from understanding how to use PPS.\"v. Adequacy of PPS instructionSome found the guideline was very useful but too long to review and it was sometimes difficult to find detailed information in the descriptions. One expert suggested moving some of the instructions to the actual PPS table. Another expert requested more case examples be included.DiscussionReliabilityPPS is an important clinical assessment tool in palliative care, and its indicators are based on the performance status of the patient. It has been used in prognostication, disease progress monitoring, in administration and health care planning. It is reliable with ICC values for consistency and absolute agreement around 0.96. From Table 2, the Cross Tabulation of Time-1 and Time-2 Scores, the PPS % levels are consistently scored the same over the two time periods. When comparing the participants' PPS % levels with the intended PPS % levels set by the Case Development Experts, the agreement was very good; demonstrating that PPS can produce consistent results among users and that PPS is a reliable tool.Cohen's kappa was used to measure interrater reliability of participants over time, with a mean kappa of 0.67 in Group 1 and 0.71 in Group 2. Because there were only 11 cases evaluated by each participant, kappa values were greatly influenced by any scores that were not the same over the two time periods. With a larger number of cases, we would expect greater test-retest reliability.The boxplots of PPS scores demonstrated that outliers were present. This phenomenon can be explained as a built-in problem of the study design. Participants based the PPS scores on the text narration of the case history. For some cases, a performance status could be determined from only a few words about a patient's condition. If those words or description were overlooked, a different level would be assigned. In an actual clinical setting, each performance evaluation is based on the observation of the patient, and if the clinician is unsure of the patient's function, he/she can re-examine a patient repeatedly to arrive at a satisfactory PPS % level. This minimizes the chance of outliers. Also PPS is usually used as a communicative tool, where palliative care workers can come to consensus of a PPS % level, as the basis for discussion about an individual patient.ValidityThe validity study was based on content validation using interviews with palliative care experts, on different aspects of PPS usage. All of the experts agreed that PPS is a valuable clinical assessment tool in palliative care and many of them have already incorporated PPS as standard in their practice. Most did not feel a need to further modify PPS, with the exception of two experts who suggested fine tuning to better define some performance status indicators, specifically oral intake and mobility.Difficulty can be found in two areas: scoring a PPS % level and in learning how to use PPS. Some experts found occasional uncertainty in differentiating between PPS % levels of 30% and 40%, and also between PPS % levels 80% and 90%. Others were not sure about the 'in-between' values of two adjacent PPS % levels, although it is strongly emphasized in the PPS instruction manual, to utilize the 'best fit' method in determining the best horizontal PPS % level. Some PPS users may not read the instructions carefully enough to extract this intent.Does this mean the PPS scale should be sub-divided into finer grading? There will always be 'in-between' values; no matter how finely tuned the grading system is. The balance between ease of use with fewer scores and complexity of using more line items was weighed in favour of the former. Trying to remember 22 lines versus 11 would reduce the utility, and thus the 'best fit' remains the approved standard. Although the learning curve for PPS is initially difficult for some, its ease of use (including differentiating between certain PPS % levels) comes with practice and experience.The use of PPS in prognostication has been studied by a few researchers [6-8] over the past ten years. PPS is also used in decision making in hospital administration planning and resource allocation and PPS is used as a qualifier for admission into a drug benefit program [15] and home nursing care programs. It is also useful in disease monitoring, clinical teaching and research. Such multiple purposes strengthen its validation.Among hospital and hospice palliative care workers, PPS is a good communication tool for discussing patients' condition. For a given PPS % level, everyone will know what condition the patient is in, and has a clear concept of the performance statuses that come with that particular PPS % level. PPS simplifies and enhances communication.In summary, the palliative care experts agreed that PPS is valuable in clinical assessment, and has been integrated into their standard of practice. Although a few raised the question of modifying the performance status measures, most felt PPS should be left as is. Although it requires time to learn initially, but once mastered, it is very valuable in communication.ConclusionThis article has described the reliability testing and validity study of PPS, a clinical performance assessment tool used in palliative care patient management. The reliability testing showed PPS is a reliable tool. Our validity study was based on the content validation of palliative care experts, and they all agreed that PPS is valuable in the clinical assessment of palliative care patients.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsFH developed the website for the reliability study, composed the 22 web-based cases with consultation with the Case Development Experts and conducted the interviews in the validity study. FL, MGD and ML contributed to the design of the study and the analysis of the data; MGD was also consulted on the development of the cases; ML performed the statistical analyses. All authors read and approved the final manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:Supplementary MaterialAdditional File 1Appendix A. Palliative Performance Scale.Click here for fileAdditional File 2Appendix B. PPS Reliability Study Sample Cases.Click here for file\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2527616.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527616",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527616\nAUTHORS: Melani AM Fork, Hugo Murua Escobar, Jan T Soller, Katharina A Sterenczak, Saskia Willenbrock, Susanne Winkler, Martina Dorsch, Nicola Reimann-Berg, Hans J Hedrich, Jörn Bullerdiek, Ingo Nolte\n\nABSTRACT:\nBackgroundProstate cancer is a frequent finding in man. In dogs, malignant disease of the prostate is also of clinical relevance, although it is a less common diagnosis. Even though there are numerous differences in origin and development of the disease, man and dog share many similarities in the pathological presentation. For this reason, the dog might be a useful animal model for prostate malignancies in man.Although prostate cancer is of great importance in veterinary medicine as well as in comparative medicine, there are only few cell lines available. Thus, it was the aim of the present study to determine whether the formerly established prostate carcinoma cell line CT1258 is a suitable tool for in vivo testing, and to distinguish the growth pattern of the induced tumours.MethodsFor characterisation of the in vivo behaviour of the in vitro established canine prostate carcinoma cell line CT1258, cells were inoculated in 19 NOD.CB17-PrkdcScid/J (in the following: NOD-Scid) mice, either subcutaneously or intraperitoneally. After sacrifice, the obtained specimens were examined histologically and compared to the pattern of the original tumour in the donor.Cytogenetic investigation was performed.ResultsThe cell line CT 1258 not only showed to be highly tumourigenic after subcutaneous as well as intraperitoneal inoculation, but also mimicked the behaviour of the original tumour.ConclusionTumours induced by inoculation of the cell line CT1258 resemble the situation in naturally occurring prostate carcinoma in the dog, and thus could be used as in vivo model for future studies.\n\nBODY:\nBackgroundOnly few species are known to spontaneously develop prostatic neoplasia; therefore the search for a suitable animal model for this disease is difficult. Currently, the dog is used as in vivo model for prostate malignancies in man, since it shows a similar metastatic pattern as well as age dependent development of malignant prostatic lesions [1-3]. Whereas prostate cancer is a frequent finding in man and even one of the leading causes of death in the Western world, it is less common in the dog. The prevalence is only 0. 2%–0. 6% [20]. Since this number is based on necropsy findings, the true number might be higher [4,5]. Although the relative number appears to be quite low, it results in an absolute count of estimated 60,000–180,000 affected dogs in the USA, 6,000–18,000 dogs in the UK, and 5,300–15,900 dogs in Germany, based on population.Although there are some reports observing a permissive or protective effect of androgens [6-10], androgens do not seem to have an influence on development, growth, or metastasis in prostate carcinoma in dogs. Other than in human medicine, the diagnosis is usually made at a very late state of the disease, since for dogs no screening tests are available as there are for man [13]. Therefore treatment options for prostate cancer in the dog are limited and mostly remain to be palliative.Despite the rather high incidence of prostate carcinoma in man, there are only three cell lines of human prostate carcinoma and their sub lines available. Thus, it is not surprising that there are only occasional reports about cell lines of canine prostatic carcinoma [11-13]. Hence the purpose of the present study was to establish an animal model, using the recently described cell line CT1258, which has been derived from a spontaneous canine prostate carcinoma [14,15]. Special attention was directed towards comparison of the clinical behaviour of the induced tumour in mice to the spontaneous tumour in the donor, as well as histological comparison. A comparison of the Ki67 index was performed in order to be able to address a potential change in proliferation. The Ki67 Index has been described to be associated with a poor outcome in human prostate cancer [18].MethodsDonorThe cell line was derived from a prostatic tumour of a Briard, 10 years, male intact, which had been presented at the Small Animal Clinic of the University of Veterinary Medicine Hanover, Germany. The dog had a two week history of dyschezia, gain of abdominal girth, polydipsia, and loss of appetite. Clinical examination revealed an undulating and strained abdomen. Abdominal radiographs showed a highly reduced perceptibility of detail. On abdominal ultrasound an enlarged prostate could be detected, which contained several cysts.Explorative laparatomy was performed and about 3000 ml abdominal fluid were obtained; the prostate itself was highly enlarged and several miliary masses were found in the mesentery. There was no evidence of contact metastases to abdominal organs or distant metastases to the lung. Biopsies have been taken under general anaesthesia; the cytological diagnosis of a highly malignant adenocarcinoma of the prostate resulted in euthanasia ad tabulam. Prior to euthanasia, biopsies have been taken for further histological examination and for cell culture. Histological staining and immunohistochemical staining as well as cytogenetic analysis was performed as described below.Cell lineThe cell culture conditions, as well as the characteristics of the canine prostate carcinoma cell line CT1258 have been described previously [15].AnimalsThis study involved 19 NOD-Scid mice (10 male, 9 female). All animals were bred and maintained in a protected environment at the Institute of Laboratory Animal Science of the Hanover Medical School. The mice were fed autoclaved food and water ad libitum, any manipulation was performed in a laminar flow hood. The animals were observed on a daily basis and sacrificed depending on the clinical condition and the size of detectable tumour, respectively. The tumours were allowed to grow up to a diameter of 10 mm. Additional criteria for euthanasia were ulceration of subcutaneous masses, a reduced level of activity of the mice, and the loss of appetite. The animals were humanely sacrificed by cervical dislocation after inhalation of > 70% carbon dioxide. The study was approved by the Lower Saxony State Office of Consumer Security and Food Safety (33-42502-05/950), the ethical approval was sought from the University of Veterinary Medicine Hanover.Inoculation of CellsThe cells were harvested from the culture flasks with 1 ml of TrypLE Express (Invitrogen, Karlsruhe, Germany) and incubated at room temperature for 1 minute. L-199 medium (Invitrogen, Karlsruhe, Germany) supplemented with 20% FCS was added and the cells were centrifuged at 350 g for 15 minutes. The cell pellet was washed twice with PBS. The cells were resuspended in 200 μl PBS; immediately before application the suspension was aspirated into Insulin-Syringes (BD Micro-Fine, BD, Heidelberg, Germany) and inoculated either subcutaneously into the left flank of the animals or intraperitoneally.For subcutaneous inoculation, the animals received 1 × 106 cells. For intraperitoneal application, mice received either 1 × 105 or 5 × 105 cells. The 19 NOD-Scid mice were subdivided into two groups: One group consisted of four female and five male mice, the animals received 1 × 106cells subcutaneously each. The second group consisted of five male and five female animals, cells were inoculated intraperitoneally. Four of them (2 male, 2 female) received 1 × 105 cells; six animals (3 male, 3 female) received 5 × 105 cells, respectively.Necropsy and histological stainingNecropsy was performed immediately after death had occurred. Lung, liver, spleen, kidneys, gonads, bowel, and detected masses were removed, fixed in 10% buffered formalin, paraffin embedded, sectioned, and stained with hematoxylin and eosin; immunohistochemical staining for Ki67 was performed, using the monoclonal antibody MIB-1 (Dianova, Hamburg, Germany) in a dilution of 1:100. The paraffin sections were pretreated in a microwave oven for 20 minutes in citrate buffer solution, pH 6. The secondary antibody was a biotinylated goat-α-mouse antibody, for detection, the Vectastain ABC-Kit (Vector Laboratories, Burlingame, USA) has been used. The Ki67 Index was determined by detecting the fraction of Ki67 positive stained cells in total 500 cells. This was performed in the original tumour, as well as in the induced tumours. Intestinal mucosa served as positive control. In addition, tumour samples of each mouse were obtained in liquid nitrogen for real time RT-PCR and in Hank's Medium for further in vitro culturing and Cytogenetic analysis. In order to address the growth pattern, the original canine tumour and the murine tumours have been classified based upon the presence of glandular, urothelial, squamoid, or sarcomatoid differentiation.Cytogenetic analysisFor cytogenetic investigation, cells have been processed as described previously [15]. Tissue was transferred to liquid nitrogen immediately after dissection and stored at -70°C until examination.StatisticsThis study was intended to be descriptive rather than statistically significant. However, a paired student's t-test was performed. A P-value < 0.05 was considered to be significant.ResultsPathological and histological examinationOriginal canine tumourOn histological examination the tumour showed to be consisting of poorly differentiated cells with numerous signs of malignancy. A strong anisocytosis, numerous cells with multiple nuclei, anisokaryosis, multiple mitotic figures, to some extent atypical mitotic figures, and a varying nucleus: plasma ratio could be detected. The tumour showed a compact growth with glandular differentiation. The Ki67 index was 43%.Subcutaneous tumoursFor analysis of duration until sacrifice of the mice, only those individuals were considered that were sacrificed due to tumour burden. All female mice and four of five male mice developed a detectable tumour mass after subcutaneous inoculation of 1 × 106 cells of the canine prostate carcinoma cell line CT1258 (Table 1). One mouse without detectable tumour growth was sacrificed due to bad clinical condition; necropsy revealed a mass of the thymus, histologically addressed as thymoma. In the remaining mice tumours were allowed to grow up to a size of 5–8 mm, which lasted 20 to 42 days (mean 25.37 days, median 22 days). Gender distribution showed a mean value of 28.75, median 26.5 days for female mice, and a mean and a median of 22 days for the males. None of the mice showed any signs of metastasis or of invasive growth pathologically or histologically; except for the mouse that did not develop any tumour mass, all animals remained in good clinical and nutritional condition.Table 1Tumour growth after subcutaneous injection of 1 × 106 cells of CT1258.MeanNo growthRangeSD[days][No of animals][days]Male22120–241.63Female28.75020–4210.05Total25.38120–427.58Histology revealed a highly heterogeneous population of cells, numerous mitotic figures, anisokaryosis, anisocytosis, and several cells containing more than one nucleus; there was a variable nucleus: plasma ratio (Figures 1, 2). The centre of the obtained masses showed to be highly necrotic. Glandular differentiation was present. Immunohistochemistry revealed a strong positivity for the Ki67-antigen (Figure 3); the Ki67 index was between 41% and 48%, respectivelyFigure 1Subcutaneous mass with a high mitotic index. The arrow indicates an atypical mitotic figure.Figure 2Subcutaneous mass with multiple mitotic figures and necrotic area; the large pale cells surrounding the hair follicle are part of the sebaceous gland and should not be mistaken as tumour cells (arrow).Figure 3Ki67 staining of subcutaneous mass with a high amount of cells staining positively for Ki67.Intraperitoneal TumoursThe group was subdivided in two categories: Animals receiving 1 × 105 cells, consisting of two males and two females each, and animals receiving 5 × 105 cells, consisting of three males and three females each. The criteria for sacrification were impairment of the general condition, worsening of the nutritional condition, and/or reduction of activity level. Weight gain was not a reliable factor due to the development of massive peritoneal effusion.In all mice receiving 1 × 105 cells tumour growth could be detected. The mean duration until sacrifice was 28 days. In one of three females and two of three males inoculated with 5 × 105 cells tumour growth could be detected, in this group the mean duration until sacrifice was 26 days (Table 2). Overall seven out of ten mice intraperitoneally inoculated with CT1258 developed tumour growth. Of those animals all but one male, which had received 5 × 105 cells, had an extended abdomen and proved to have peritoneal effusion. The male without obvious tumour growth had developed a thymoma, which was the cause for the bad clinical condition. Six of these ten mice developed a mass at the injection site, although at inoculation a proper amount of time had elapsed until withdrawal of the needle. Necropsy showed a moderate to high tumour burden at the peritoneum and no visible signs of metastasis to the lungs (Figure 4). Histological examination of the obtained masses showed a similar pattern as the subcutaneous masses with a glandular differentiation (Figure 5); staining for Ki67 was strongly positive with a Ki67 index between 45% and 47%. Isolated populations of tumour cells could be detected in the lungs, but there was no sign of vascularisation (Figure 6). In abdominal organs only peripheral tumour growth could be observed.Figure 4Diaphragm after i.p. injection of 5 × 105 cells with a high tumour burden; see Figure 5 for histology; the thoracic aspect of the diaphragm is not affected.Figure 5Diaphragmatic mass (see figure 4 for macroscopic appearance).Figure 6Ki67-staining of tumour cells in the lung; there is no evidence of vascularisation, therefore these cells are tumour emboli rather than metastasis.Table 2Tumour growth after intraperitoneal injection of 1 × 105 and 5 × 105 cells.MeanNo growthRangeSD[days][No of animals][days]Male26.75124–303.2Female27.67224–303.211 × 105 cells28024–302.715 × 105cells26324–303.46Total27.14324–301.12Cytogenetic AnalysisThe cytogenetic investigation of intraperitoneal and subcutaneous tumours revealed the same markers that have been shown in analysis of the original tumour and of the cell line [15]. A hyperdiploid karyotype was present. Centromeric fusion between chromosomes 1 and 5 (der (1; 5)) and chromosomes 4 and 5 (der (4; 5)) were detected. A large biarmed marker (mar) was found (Figure 7, 8).Figure 7Metaphase spread from cells derived from the original canine tumour. The arrows indicate the derivative chromosomes der (1; 5), der (4; 5) and the marker chromosome mar, which consists of chromosome 1 and chromosome 2 material.Figure 8Metaphase spread from cells derived from a CT1258 induced tumour. The arrows indicate the derivative chromosomes der (1; 5), der (4; 5) and the marker chromosome mar, which consists of chromosome 1 and chromosome 2 material.DiscussionIdeally a cell line should not only be immortalized spontaneously but also be tumourigenic in experimental animals. Another claim may be the mimicking of the original natural behaviour of the tumour in the host. This condition promotes the predictability of any results obtained with that very cell line. This is true especially for cell lines derived from nonhuman tumours if the origin may serve as a model itself.This study reveals that the cell line CT1258 is highly tumourigenic in NOD-Scid mice. Local tumour growth occurred in 89% of the animals that had received cells subcutaneously; 86% of the animals that had been inoculated intraperitoneally and that had developed tumour growth also developed local tumour growth at the injection site. The latter was not desired, and since it is not known how many cells remained in the branch canal, the size of those accidental masses cannot be compared accurately. Focussing on the mice with cells inoculated i.p., 86% developed peritoneal effusion just as the donor did and all of them had multiple small nodules within the serous membranes of the peritoneum rather than one large mass. The excellent local tumour growth on one hand and the rapid development of pleural effusion on the other hand indicates that in studies to come the use of the cell line might be of a greater value in local administration rather than in systemic inoculation. Orthotopic implantation might be of great value, since this could enable the assessment of local growth and invasion as well as potential metastasis. Due to the lack of vascularisation, the tumour cells found in the lungs of the mice must be addressed as tumour cell embolism rather than metastasis. Since neither the mice nor the donor had evidence of lymphogenic or hematogenic metastasis, we conclude that time for metastasis exceeds the time limitation owed to local tumour growth. Whether this is due to the rapid growth rate or due to potentially little disposition of the cells to degrade extracellular matrix and therefore has a generally low tendency to metastasise remains unclear. The absence of bone metastasis is a remarkable fact, which is contrary to the high incidence of bone metastasis in canine and human patients [5,19]. Potentially there was not enough time for bone metastasis to develop due to rapid local tumour growth, on the other hand, this particular tumour might have a reduced tendency for skeletal metastasis. At first glance this reduces the value of the present tumour model for comparative oncology, but this interesting feature might be used for further studies focussing on skeletal metastasis in particular, if the cause for the absence of metastasis to the skeleton in this otherwise highly malignant prostate carcinoma is detected. The tendency to show necrotic areas in the centre might be due to rapid tumour growth.The number of cells obviously did not seem not to have a direct impact on tumour growth, since all mice that had been inoculated with 1 × 105 cells developed tumours, but 50% of the animals that received 5 × 105 cells did not; although this is not considered to be statistically significant, it suggests that an even lower number of cells might have been sufficient to induce a tumour. The difference between male and female animals is not statistically significant.The Ki67 indices in both, the original tumour and the experimentally induced tumours, were considered to be high. The difference between the original tumour on one hand and the subcutaneous and intraperitoneal masses on the other hand were statistically not significant. In human medicine a high Ki67 index has shown to be associated with a poor prognosis [20]. Considering the histological characteristics of the described tumour, the high Ki67 index is not a surprising finding. Comparison of the Ki67 index of the original tumour to the xenograft revealed no change in proliferation.One limiting factor is that two of the nineteen mice in the study developed thymoma within the course of the study. This is a frequent finding in older NOD-Scid mice [16,17]. Therefore the animals must not be considered to be healthy.ConclusionThe canine prostate carcinoma cell line CT1258 demonstrated to be tumourigenic in the NOD-Scid mouse. Tumours induced in mice resembled the biological behaviour of the tumour from which the cell line was originally derived regarding growth pattern and histological appearance. Therefore we conclude that the use of this animal model will provide results with a high predictability towards clinical use in veterinary medicine and due to the correlation between canine and human prostate carcinoma in humans as well. The lack of skeletal metastasis is a potential field for further studies.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsMAMF was involved in study-design, implemented the in vivo tasks and the histopathology, and wrote the paper, HME was involved in study-design and coordination of in vitro work up, JTS and KAS assisted with dissection of the animals and in vitro work up, SaW prepared the cells for inoculation, SuW was involved in study-design, NR–B was involved in chromosomal preparation, cytogenetic analyses and karyotyping, MD and HHJH were involved in study-design and supervising the in vivo work up, JB and IN incited the study and coordinated the operational procedure. All authors read and approved the final manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2527654.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527654",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527654\nAUTHORS: Jackie F Price, Marlene C Stewart, Ian J Deary, Gordon D Murray, Peter Sandercock, Isabella Butcher, F Gerald R Fowkes\n\nABSTRACT:\nObjective To determine the effects of low dose aspirin on cognitive function in middle aged to elderly men and women at moderately increased cardiovascular risk.Design Randomised double blind placebo controlled trial.Setting Central Scotland.Participants 3350 men and women aged over 50 participating in the aspirin for asymptomatic atherosclerosis trial.Intervention Low dose aspirin (100 mg daily) or placebo for five years.Main outcome measures Tests of memory, executive function, non-verbal reasoning, mental flexibility, and information processing five years after randomisation, with scores used to create a summary cognitive score (general factor).Results At baseline, mean vocabulary scores (an indicator of previous cognitive ability) were similar in the aspirin (30.9, SD 4.7) and placebo (31.1, SD 4.7) groups. In the primary intention to treat analysis, there was no significant difference at follow-up between the groups in the proportion achieving over the median general factor cognitive score (32.7% and 34.8% respectively, odds ratio 0.91, 95% confidence interval 0.79 to 1.05, P=0.20) or in mean scores on the individual cognitive tests. There were also no significant differences in change in cognitive ability over the five years in a subset of 504 who underwent detailed cognitive testing at baseline.Conclusion Low dose aspirin does not affect cognitive function in middle aged to elderly people at increased cardiovascular risk.Trial registration ISRCTN 66587262.\n\nBODY:\nIntroductionCognitive function declines with age, and such decline is of increasing public health concern because of the burden it imposes on individuals, carers, and the wider society.1\n2 Reduced levels of cognitive performance in older age have been associated with the presence of cardiovascular disease,3\n4 possibly mediated through multiple small cerebral infarcts from microatheroma or thromboses in the brain. Antithrombotic medication such as aspirin might therefore have a role in the preservation of cognitive function, particularly in individuals at increased risk of atherosclerotic vascular disease. Conversely, if aspirin promotes microhaemorrhages in the brain, this might exacerbate cognitive decline. Observational studies have reported either no association between regular use of aspirin or other non-steroidal anti-inflammatory drugs and cognitive decline in older age5\n6 or a modest trend towards protection of cognitive function.7\n8\n9\n10 Data from randomised controlled trials, however, are sparse. The results of a recent large clinical trial indicated that long term low dose aspirin had no effect on memory in healthy women aged over 64, with inconclusive findings for executive function.11 Conversely, a much smaller trial in men aged over 55 without dementia who were at risk of cardiovascular disease suggested a beneficial effect of low dose aspirin on verbal fluency and mental flexibility.12We determined the effects of long term low dose aspirin on a wide range of cognitive functions that are known to decline with age in a relatively young population (aged 50 and over) of men and women at moderately high vascular risk. We included two cognitive assessments, one at baseline and one after five years, in an ongoing randomised controlled trial of daily aspirin (100 mg enteric coated) in people aged over 50, in which the primary end points were cardiovascular events and death (the aspirin for asymptomatic atherosclerosis (AAA) trial). At randomisation, all participants in this trial were at moderately increased cardiovascular risk because of a low ankle brachial index, a reduced ratio of systolic blood pressure in the ankle to that in the arm, which is a good predictor of increased mortality and cardiovascular events.13MethodsParticipantsThis double blind, placebo controlled randomised clinical trial took place in central Scotland (Lanarkshire, Edinburgh, and Glasgow) in 1998-2006. All participants gave written informed consent. Volunteers aged 50-75 were recruited by direct mailing of people registered with participating general practices (83% of practices contacted agreed to participate). People were ineligible for screening if they had had a previous myocardial infarction or stroke or if they were taking aspirin or warfarin. The study was advertised in the local press and by posters in general practices.At a screening clinic researchers recorded right and left brachial, posterior tibial, and dorsalis pedis systolic pressures with a standard sphygmomanometer and a Doppler probe. The ankle brachial index was calculated as the ratio of the lowest pressure in either ankle to the higher of the measurements in the left or right arm. Exclusion criteria instituted at the screening clinic included an ankle brachial index >0.95 in both legs; current use of aspirin, other antiplatelet, or anticoagulant; severe indigestion; history of myocardial infarction, stroke, angina, or peripheral arterial disease; chronic liver or kidney disease; chemotherapy; contraindications to treatment with aspirin; and an abnormally high or low packed cell volume.Participants were randomised to either daily aspirin (100 mg enteric coated) or identical placebo (both preparations provided by Bayer HealthCare). Consecutive subject study numbers were assigned to aspirin or placebo with permuted blocks of size eight, which varied randomly. A specialist member of staff who was not otherwise involved in the study produced the randomisation list. Staff at a single dedicated pharmacy labelled bottles containing aspirin or placebo with the appropriate subject numbers. Recruits entering the trial were then allocated the next available study number and provided with the appropriately labelled bottle containing one year’s supply of tablets. Randomisation lists in sealed envelopes were available only to the pharmacy, to an independent member of staff who was responsible for unblinding individual participants in the case of clinical necessity, and to an independent statistician responsible for providing annual reports to the data monitoring committee. Staff working on the trial, the investigators, and participants remained blinded to treatment allocation.Participants were contacted annually by telephone and newsletter, in between which they were encouraged to report admission to hospital or cessation of study medication. If they stopped study medication other than for a medical reason, they were actively encouraged to start again. If they started taking aspirin or another antiplatelet drug, their study medication was discontinued. Participants recorded their compliance in a diary. A specially trained research nurse assessed self reported compliance annually, after which supplies of study tablets were renewed by post.Cognitive function testingParticipants underwent neuropsychological tests three months after they had started the trial medication (baseline cognitive testing) and at five years. At baseline, they completed a combined version of the Junior and Senior Form A synonyms of the Mill Hill vocabulary scale.14 They were presented with a word and asked to identify the closest synonym from six given alternatives. The Mill Hill scale, in common with other vocabulary tests, is primarily an indicator of previous (“best ever” or premorbid) cognitive ability, which changes little with age.15\n16 It was used to compare the baseline characteristics of the trial population and to enable assessment of the impact of any difference in previous cognitive ability on loss to follow-up and on change in cognitive performance over time. The test has been shown previously to correlate highly with other tests of previous cognitive ability that are used in a similar manner.17At about five years, participants underwent a battery of tests in a predetermined order to assess a broad range of cognitive functions (230 participants were tested after four years, 259 after six years, two after seven years, and the remainder at five years). The mini-mental state examination18 was included as a general mental assessment and is often used as a “screen” for dementia. Executive function was assessed with the verbal fluency test,19 which requires participants to generate as many words as possible with a specified initial letter (C, F, and L). As a measure of non-verbal reasoning, participants worked through all five sets (A to E, containing 12 items each) of Raven’s progressive matrices14 and were scored according to the number of items they completed correctly within 20 minutes. Immediate and delayed memory was assessed with the total score on the first five trials (I through V, constituting the same list of 15 words) of the auditory verbal learning test.19 The trail making test20 measured mental flexibility, and the time taken to complete part B was used in the subsequent analysis. In the digit symbol test,21 used as a measure of speed of information processing, we recorded the number of symbols matched correctly to their corresponding numbers in 90 seconds. The hospital anxiety and depression scale (A and D)22 was also used for the assessment of mood states, as these can affect performance on the tests. At follow-up the national adult reading test measured premorbid cognitive ability.23In addition, we undertook a highly sensitive assessment of cognitive change over time in a “cognitive change subset” of recruits who underwent the same detailed battery of tests as above at baseline. We recruited 504 participants at baseline for this purpose from consecutive participants who agreed to complete the Mill Hill vocabulary scale during the period May 2000 to March 2001. Baseline and follow-up cognitive test scores were available on 399 participants in this subset.Data analysisWe used each participant’s score on the Carstairs deprivation index, based on the postal code classification from the 1991 census,24\n25 to assign a deprivation category ranging from I (most affluent) to VII (most deprived).24 Further statistical analysis was carried out with SAS/STAT software, version 9.1, of the SAS System for Windows (SAS Institute, Cary, NC).Our primary analysis was on an intention to treat basis, using both individual test scores and the proportion of participants achieving over an aggregate cognitive score. For the latter, those not achieving the aggregate score would include those failing to complete cognitive testing at follow-up, thereby reducing bias from death or unwillingness to complete the tests (likely to be associated with greater cognitive decline). We estimated that 3300 participants would give 93% power at 5% significance to detect a difference of 47% versus 53% attaining the threshold. For the cognitive change subset, we estimated that two groups of 200 would provide 80% power to detect a treatment effect size of 0.28 standard deviations at 5% significance (90% power for 0.33 SD). Allowing for loss to follow up, we aimed to recruit at least 480 participants into the subset at baseline.Principal components analysis was carried out to determine a summary cognitive score (the general factor) for the cognitive function variables (auditory verbal learning, Raven’s matrix, digit symbol, verbal fluency, and trail making) with scree slope analysis to determine the number of factors. Where one or two of the test results were missing for an individual, we performed multiple imputation, accounting for age, reading score, sex, and deprivation score. This analysis resulted in a single component (the general factor, reflecting general cognitive ability26), which explained 58% of the total variance (standardised scoring coefficients: auditory verbal learning 0.23, Raven’s matrices 0.28, digit symbol 0.29, verbal fluency 0.22, trail making −0.28). This component was extracted as the first unrotated principal component. We subsequently used the median general factor score for all participants with such a score available as the cut-off point for the aggregate cognitive score used to assign participants into two groups in the primary analysis.We determined differences in mean cognitive test scores between the aspirin and placebo groups at follow-up using Student’s t tests. For the cognitive change subset, results are presented as estimates (with 95% confidence intervals) of the difference between the two treatments at follow-up for the factor score and for each individual test of cognition. The difference between the treatments for each variable was estimated after adjustment for baseline values in the first model and baseline values, age, sex, ankle brachial index, total plasma cholesterol concentration, smoking status, and deprivation category in the second model.Interim analyses of cognitive data were not conducted during the course of the study. The primary end points, including the aggregate cognitive score, and statistical comparisons were prespecified. All P values were two sided and were not adjusted for multiple testing.ResultsPrimary analysesOf the 28 980 participants screened, 24 066 were excluded because they had an ankle brachial index >0.95 in both legs. Before randomisation, 631 did not meet other eligibility criteria and 933 declined to take part (figure). The 3350 remaining were randomly assigned to aspirin or placebo. Table 1 shows the characteristics of the two groups at randomisation. In total, 2733 (81.6%) participants (1361 in the aspirin group and 1372 in the placebo group) agreed to complete the Mill Hill vocabulary scale (MHVS). Mean scores on this test were similar between the two groups (30.9 (SD 4.7) and 31.1 (SD 4.7), respectively).Study population and follow-up. *At least one cognitive test in battery of tests completed. †Breakdown of reasons for loss to follow-up by treatment allocation not given to preserve blinding within main trial until cardiovascular end point reached. See text for breakdown of reasons for total trial population (including 160 deaths)Table 1 Characteristics of participants* at randomisation. Figures are means (SD) unless stated otherwiseCharacteristicAspirin group (n=1675)Placebo group (n=1675)Age (years)62 (7)62 (7)No (%) of men481 (29)473 (28)No (%) by Carstairs deprivation category†: I/II287 (17)300 (18) III/IV/V927 (55)884 (53) VI/VII458 (27)489 (29)Ankle brachial index0.86 (0.09)0.86 (0.09)Systolic blood pressure (mm Hg)149 (22)147 (22)Diastolic blood pressure (mm Hg)84 (11)84 (11)Total plasma cholesterol (mmol/l)6.2 (1.1)6.2 (1.1)No (%) of smokers: Current548 (33)539 (32) Previous‡540 (32)561 (34) Never587 (35)575 (34)Mill Hill vocabulary scale score30.9 (4.7)31.1 (4.7)No (%) by recruitment centre: Edinburgh388 (23)364 (22) Glasgow478 (29)497 (30) Lanarkshire809 (48)814 (48)*Data available for all participants except for deprivation score (n=1673 in both groups), diastolic blood pressure (n=1674 in aspirin group and 1671 in placebo group), plasma cholesterol (n=1663 and 1666), Mill Hill vocabulary scale score (n=1361 and 1372).†I (most affluent) to VII (most deprived).‡Smokers who had stopped smoking for at least 6 months before randomisation.A total of 1025 participants were lost to cognitive follow-up: 317 withdrew (n=157) or died (n=160) before testing, 668 refused the cognitive assessments either in a research clinic or in their own homes, 27 could not be contacted, and 13 were not tested for practical reasons (including serious illness and living abroad). Table 2 shows the characteristics at randomisation of the participants who completed at least one cognitive test at follow-up compared with those not cognitively tested. Those not tested were slightly older, more likely to be men, and more socially deprived, with a poorer vascular risk factor profile. Differences between the tested and untested groups in previous cognitive ability were small (vocabulary score 31.1 (SD 4.7) v 30.6 (SD 4.6), P=0.03).Table 2 Characteristics of participants* at randomisation by cognitive test status at follow-up. Figures are means (SD) unless stated otherwiseCharacteristicCognitively tested (n=2325)Not cognitively tested (n=1025)P value†Age (years)62 (7)63 (7)0.001No (%) of men627 (27)327 (32)0.004No (%) by Carstairs deprivation category‡: I/II444 (19)143 (14)<0.001 III/IV/V1269 (55)542 (53) VI/VII610 (26)337 (33)Ankle brachial index0.86 (0.090.85 (0.100.003Systolic blood pressure (mm Hg)147 (21)149 (22)0.02Diastolic blood pressure (mm Hg)84 (11)83 (11)0.26Total plasma cholesterol (mmol/l)6.2 (1.1)6.2 (1.1)0.99No (%) of smokers: Current671 (29)416 (41)<0.001 Previous§779 (33)322 (31) Never875 (38)287 (28)Mill Hill vocabulary scale score31.1 (4.7)30.6 (4.6)0.03*Data available for all participants except for deprivation category (n=2323 in tested group, 1022 in untested group), diastolic blood pressure (n=2322 and 1023), plasma cholesterol (n=2314 and 1015), Mill Hill vocabulary scale score (n=2202 and 531).†P values from χ2 test for categorical variables and t test for continuous variables except ankle brachial index (Mann-Whitney test).‡I (most affluent) to VII (most deprived).§Smokers who had stopped smoking for at least 6 months before randomisation.Of the 2325 participants cognitively tested, 1984 completed the full test battery. Fourteen omitted the adult reading test only and 264 omitted only one or two of the tests used to generate the general cognitive factor score (in which case we calculated their general factor score using imputation). Thus a general factor score was calculated for 2262 participants (1109 in aspirin group and 1153 in placebo group). For the purposes of the primary end point analysis, all 1088 participants without a general factor score at follow-up were included in the group who did not achieve the aggregate score.Overall, 32.7% (n=548) of participants in the aspirin group and 34.8% (n=583) in the placebo group achieved over the median general factor score (odds ratio 0.91, 95% confidence interval 0.79 to 1.05, P=0.20). There was little change in the odds ratio after adjustment for age, sex, ankle brachial index, deprivation category, smoking status, and total plasma cholesterol (0.93, 0.80 to 1.08, P=0.35). These results did not alter greatly when we repeated analyses excluding participants without a general factor score, with proportions of 49.4% and 50.6%, respectively, achieving over the median score (unadjusted 0.96, 0.81 to 1.13, P=0.59; adjusted 0.98, 0.82 to 1.17, P=0.83).Table 3 shows the mean test scores at follow-up in the two groups. There was no significant difference between the two groups for any of the individual tests or for the general factor. The proportion of participants scoring below 24 on the mini-mental state examination was similar (2.4% (27) v 2.5% (29), P=0.91). There was also no significant difference in mean scores on the hospital anxiety scale (5.2 (SD 3.6) v 5.4 (SD 3.6), P=0.12) or the hospital depression scale (2.9 (SD 2.5) v 3.0 (SD 2.7), P=0.82).Table 3 Performance on cognitive function tests at follow-up*Test of cognitionAspirin group (n=1139)Placebo group (n=1186)P valueNo of participantsMean (SD) score; 95% CINo of participantsMean (SD) score; 95% CIGeneral cognitive factor score (summary cognitive score)†11090.00 (1.01); −0.06 to 0.061153−0.01 (0.99); −0.06 to 0.050.83Raven’s progressive matrices (5 sets of 12 item tests; maximum possible score 60)111034.3 (9.5); 33.8 to 34.9115334.4 (9.3); 33.9 to 35.00.83Auditory verbal learning, trials I-V (sum of five trials with same list; maximum possible 75 words)111863.0 (16.7); 62.1 to 64.0115963.0 (16.9); 62.0 to 64.00.93Digit symbol (total No of symbols matched correctly in 90 second test; maximum possible score 93)112640.0 (11.7); 39.3 to 40.7117040.0 (11.7); 39.4 to 40.70.92Verbal fluency (total No of words generated in three 1 minute tests)111737.6 (12.8); 36.9 to 38.4115637.1 (12.7); 36.3 to 37.80.27Trail making (seconds to completion)‡11224.6 (0.4); 4.6 to 4.611674.6 (0.4); 4.6 to 4.60.90Mini-mental state examination (total score, maximum possible 30)113128.6 (1.7); 28.5 to 28.7117828.5 (1.8); 28.4 to 28.60.20*In all tests except trail making, higher scores indicate better function. Imputed test scores were used for individuals with ≤2 scores missing for Raven’s progressive matrices (162 scores imputed), auditory verbal learning (95), digit symbol (10), verbal fluency (45), and trail making (37).†Calculated from factor analysis with unrotated principal component analysis with current cognitive function measures excluding mini-mental state.‡Natural log of time in seconds to complete trail making test (untransformed means 102 seconds for aspirin group and 101 seconds for placebo group).Analysis of cognitive change subsetTable 4 shows that there were no significant differences in the change in cognitive ability over the five years for any of the individual tests or for the general factor between the treatment groups. Scores for tests of speed of processing information and mental flexibility in the cognitive change subset declined over the five years, though the change in mental flexibility scores was not significant (mean digit symbol 45.0 at baseline, 42.4 at follow-up, P<0.001: mean trail making 94.2 seconds at baseline, 97.4 seconds at follow-up, P=0.2). There was no significant difference over time in verbal fluency or non-verbal reasoning and scores on the memory test improved (mean auditory verbal learning 63.8 at baseline, 68.5 at follow-up, P<0.001). Changes observed over time are probably underestimates of the true age related declines26 because the effects of age can be ameliorated by familiarity with the test.Table 4 Change in mean (SD) cognitive test scores in cognitive change subset participating at baseline and follow-up*Test of cognition†AspirinPlaceboDifference (aspirin-placebo) (95% CI), P valueFollow-up scoreChange from baseline‡Follow-up scoreChange from baseline‡Adjusted for baseline valueFully adjusted§General factor score0.39 (0.89)0.26 (0.45)0.37 (0.89)0.27 (0.47)−0.01 (−0.09 to 0.08), 0.890.01 (−0.07 to 0.09), 0.77Raven’s progressive matrices37.8 (8.9)−0.1 (5.9)37.5 (8.9)−0.6 (5.4)0.5 (−0.6 to 1.6), 0.340.7 (−0.3 to 1.8), 0.17Auditory verbal learning68.0 (15.2)3.9 (11.5)68.3 (16.1)5.2 (11.2)−1.1 (−3.3 to 1.1), 0.32−0.7 (−2.9 to 1.4), 0.51Digit symbol42.7 (10.8)−2.6 (6.2)42.3 (11.6)−2.5 (6.3)0.0 (-1.2 to 1.2), 0.960.3 (−0.9 to 1.5), 0.62Verbal fluency41.4 (11.5)0.6 (7.5)41.3 (11.3)0.8 (7.8)−0.1 (−1.6 to 1.3), 0.88−0.2 (−1.6 to 1.3), 0.84Trail making4.50 (0.37)0.02 (0.28)4.51 (0.38)0.02 (0.31)0.00 (−0.06 to 0.06), 1.00−0.01 (−0.07 to 0.04), 0.61*No of participants for each analysis is 399 (including 25 with some imputation at follow-up), 191 in aspirin group and 208 in placebo group.†See table 3 for details of tests.‡Score at follow-up minus score at baseline.§Additional adjustment for age, sex, and baseline values for ankle brachial index, total plasma cholesterol, smoking status, and Carstairs deprivation category. Interaction terms for test specific baseline covariate and treatment group were examined and none was significant.To examine whether compliance might have affected our results, we performed an on treatment analysis for participants who reported that they had taken their study medication for at least two thirds of the year before follow-up. This analysis was planned before unblinding the treatment allocations, but after the data had been collected. Some 1708 participants were confirmed as still taking treatment. Of the 1642 remaining, 160 had died, 269 had had a cardiovascular event, 203 had started taking aspirin for a reason other than a cardiovascular event, 317 had reported known side effects of aspirin or had started medication contraindicated with aspirin, 250 had developed other symptoms or illnesses unrelated to aspirin, and 404 simply no longer wanted to take the study medication (status of 27 was unknown and 12 were still taking study medication but for less than two thirds of preceding year).Of the participants still taking treatment at follow-up, 850 were in the aspirin group and 858 were in the placebo group. There were no significant differences in baseline characteristics between these two groups (data not shown). In each group 42.8% (364) and 45.8% (393) achieved over the median general factor score (0.89, 0.73 to 1.07, P=0.22). Of the 2325 participants cognitively tested at follow-up, 1505 (64.7%) were still taking treatment (743 and 762, respectively). The characteristics at randomisation of these two groups were also similar (data not shown). Mean (SD) cognitive scores at follow-up for the aspirin and placebo treatment groups, respectively, were general factor 0.0 (1.0) in both groups; Raven’s matrix 34.3 (9.6) and 34.8 (9.2); auditory verbal 63.5 (16.7) and 63.3 (16.7); digit symbol 40.6 (11.9) and 40.8 (11.7); verbal fluency 37.8 (13.1) and 37.8 (12.7); trail making 4.6 (0.4) and 4.6 (0.4); and mini-mental state <24 2.7% (n=20) and 1.9% (n=14, P=0.26).DiscussionIn this large double blind, placebo controlled randomised clinical trial we found no significant difference in measures of cognitive function between people randomised to 100 mg aspirin daily compared with placebo over a five year period. Our initial hypothesis was based on observed associations between cardiovascular disease and cognitive decline3\n4 and the positive effects of aspirin on the incidence of cardiovascular events in both primary and secondary prevention trials,27\n28 although it has been argued that aspirin might alter the presentation of cardiovascular disease rather than affecting underlying disease processes.29\n30 There is also evidence that non-steroidal anti-inflammatory drugs might reduce neurotoxic inflammatory responses in the brain or reduce the cellular response to excessive stimulation by excitotoxins, or both.10 Our results, however, do not support a beneficial effect of aspirin on cognitive performance in middle aged to elderly people at increased cardiovascular risk. While aspirin could be expected to have a beneficial role in reducing large vessel cerebral occlusive disease and small vessel disease caused by “microatheroma,” it might not influence (and might even exacerbate) other forms of small vessel disease, such as arteriosclerosis with diffuse white matter damage from ischaemia or “leaky vessels,”31 with or without microhaemorrhages.Veracity of findingsWe studied men and women at increased risk of developing symptomatic cardiovascular disease in whom the effect of aspirin might be expected to be accentuated (correlations of between 0.03 and 0.15 between ankle brachial index and cognitive function have been reported, depending on the cognitive tests performed32). The trial had sufficient power to detect small differences in cognitive function between the groups, and we used various tests to assess a range of cognitive abilities. As virtually all neuropsychological tests are highly intercorrelated, we used a summary cognitive score that represents their shared variance to determine the effect of aspirin on global cognitive capacity. As each test measures a specific aspect of cognition that might differ in its response to treatment we also analysed the test scores individually. In our robust statistical analyses we used a prespecified primary outcome measure that took into account possible associations between performance on the cognitive tests and ability or willingness to complete the cognitive test at follow-up.The effect of aspirin on cognitive performance might be more evident in younger people,7 and cerebral damage caused by micro-thromboses and other neurodegenerative processes might start to become established in middle age. This hypothesis, however, was not supported by our post hoc analyses (data not shown) in which separation of the total trial population into those aged 50-64 and those aged 65 or older had little impact on the overall results.Inability to study the effects of aspirin on younger people was one of the limitations of a recent clinical trial by Kang et al of the effects of aspirin on memory.11 Another was its restriction to women. Again in post hoc analysis, we found no effect of aspirin on verbal memory in women (mean auditory verbal score 65.2 in aspirin group v 65.4 in placebo group, P=0.84) or men (57.2 v 56.5, P=0.62). Crucially, we also studied the effect of aspirin on cognitive functions other than memory, including executive function, non-verbal reasoning, mental flexibility, and information processing. Our findings that aspirin had no effect on these additional measures of cognitive ability contrast with those from the only other clinical trial of low dose aspirin to investigate similar outcomes.12 The latter was a relatively small trial (n=405), however, involving the cognitive testing of a subgroup of men still participating in a clinical trial several years after randomisation. Furthermore, there was no baseline measure of cognitive function, and some participants received warfarin as well as aspirin.Limitations and strengthsA high proportion of participants (30%) failed to complete the cognitive tests at follow-up. This level of non-testing was largely inevitable in a long term intervention study in “healthy” volunteers (the numbers included deaths and trial withdrawals as well as those who refused to take tests) and was consistent with previous studies of a similar design. In the study by Kang et al, only 71% of women initially randomised to aspirin or placebo and selected to take part in the cognitive study agreed to undergo both baseline and follow-up cognitive testing four years later.11 Relatively high levels of non-testing could have biased our findings, especially as it has been shown previously that people with poor cognitive function are more likely to withdraw from studies.33 In our study, however, there was only a small difference in Mill Hill vocabulary scores at baseline between those who did and did not undergo cognitive testing at follow-up. The potential effect of cognitive decline over the period of the study on test completion was further addressed by use of the aggregate cognitive score in our primary analysis.Despite concerted efforts to maintain participants’ compliance with study medication, this fell throughout the duration of the trial and could have affected our results. For the purposes of the “on treatment” analysis, we used a rigorous definition of on treatment and included only participants who reported that they had taken their study medication for at least two thirds of the year before follow-up. This was consistent with definitions used in previous primary prevention trials.34 All participants randomised to aspirin, however, took their study medication for at least some of the trial period before stopping at various stages throughout the trial, such that the total proportion of person years on aspirin was actually much higher than that suggested by the number of participants included in the on treatment analysis. The issue of compliance was further addressed by the on treatment analysis itself, which failed to show any difference in the aggregate or mean cognitive scores between those taking aspirin and those taking placebo, or indeed any shift in the overall results that might have indicated an effect of aspirin.We cannot exclude the possibility that higher doses or longer duration of aspirin treatment, or both, would have led to different results. The participants, although at increased risk of developing symptomatic cardiovascular disease, were free from clinical cardiovascular disease at baseline and otherwise generally healthy. Our follow-up period, although comparing favourably with previous trials on age related cognitive decline, might have been short for such a relatively young and healthy cohort. We could not assess the actual degree of cognitive decline in the population because performance on a given cognitive test (especially memory tests) is known to improve as the test is repeated, even after several years, simply because participants are familiar with the testing procedure (learning effect).35\n36\n37 A population with advanced vascular disease, dementia, or established mild cognitive impairment might have had a different response, as might any other population with more marked middle to late life cognitive decline. Longer follow-up into older age might also be necessary to show any “delayed” effect of aspirin from the time of altered cerebral pathology to development of observable changes in cognitive decrements.What is already known on this topicAtherosclerotic cardiovascular disease might accelerate age related cognitive declineAspirin has a protective role in the secondary prevention of cardiovascular disease and might also reduce age related cognitive declineWhat this study addsLow dose aspirin over five years did not produce any cognitive benefit in men and women aged over 50 years without dementia and at moderately increased risk of cardiovascular disease\n\nREFERENCES:\n1. Hedden T, Gabrieli JDE. Insights into the ageing mind: a view from cognitive neuroscience. Nat Rev Neurosci2004;5:87-97.14735112\n2. Kavanagh S, Knapp M. Cognitive disability and direct care costs for elderly people. Br J Psychiatry1999;174:539-46.10616633\n3. Breteler MMB, Claus JJ, Grobbee DE, Hofman A. Cardiovascular disease and distribution of cognitive function in elderly people: the Rotterdam study. BMJ1994;308:1604-88025427\n4. Johnston SC, O’Meara ES, Manolio TA, Lefkowitz D, O’Leary DH, Goldstein S, et al. Cognitive impairment and decline are associated with carotid artery disease in patients without clinically evident cerebrovascular disease. Ann Intern Med2004;140:237-47.14970146\n5. Fourrier A, Letenneur L, Begaud B, Dartigues JF. Nonsteroidal antiinflammatory drug use and cognitive function in the elderly: inconclusive results from a population-based cohort study. J Clin Epidemiol1996;49:1201.8827002\n6. Henderson AS, Jorm AF, Christensen H, Jacomb PA, Korten AE. Aspirin, anti-inflammatory drugs and risk of dementia. Int J Geriatr Psychiatry1997;12:926-30.9309471\n7. Prince M, Rabe-Hesketh S, Brennan P. Do antiarthritic drugs decrease the risk for cognitive decline? Neurology1997;50:374-9.\n8. Rozzini R, Ferrucci L, Losonczy K, Havlik RJ, Guralnik JM. Protective effect of chronic NSAID use on cognitive decline in older persons. J Am Geriatr Soc1996;44:1025-9.8790225\n9. Saag KG, Rubenstein LM, Chrischilles EA, Wallace RB. Nonsteroidal antiinflammatory drugs and cognitive decline in the elderly. J Rheumatol1995;22:2142-7.8596158\n10. Kang JH, Grodstein F. Regular use of nonsteroidal anti-inflammatory drugs and cognitive function in aging women. Neurology2003;60:1591-7.12771247\n11. Kang JH, Cook N, Manson J, Buring JE, Grodstein F. Low dose aspirin and cognitive function in the women’s health study cognitive cohort. BMJ2007;334:987-90.17468120\n12. Richards M, Meade TW, Peart S, Brennan PJ, Mann AH. Is there any evidence for a protective effect of antithrombotic medication on cognitive function in men at risk of cardiovascular disease?: some preliminary findings. J Neurol Neurosurg Psychiatry1997;62:269-72.9069483\n13. Heald C, Fowkes FGR, Murray G, Price JF, on behalf of the International ABI Collaboration. The ankle brachial pressure index as an indicator of mortality and cardiovascular disease: systematic review. Atherosclerosis2006;189:61-9.16620828\n14. Raven J, Raven JC, Court JH. Manual for Raven’s progressive matrices and vocabulary scales. Oxford: Oxford Psychologists Press, 1998.\n15. Schaie KW. Developmental influences on adult intelligence. Oxford: Oxford University Press, 2005.\n16. Salthouse TA. Localizing age-related individual differences in a hierarchical structure. Intelligence2004;32:541-61.\n17. Crawford JR, Deary IJ, Starr J, Whalley LJ. The NART as an index of prior intellectual functioning: a retrospective validity study covering a 66-year interval. Psychol Med2001;31:451-8.11305853\n18. Folstein MF, Folstein SE. Mini Mental State. A practical method for grading the cognitive state of patients for the clinician. J Psychiatr Res1975;12:189-98.1202204\n19. Lezak MD. Neuropsychological assessment. New York: Oxford University Press, 1995.\n20. Spreen O, Strauss E. A compendium of neuropsychological tests: administration, norms, and commentary. New York: Oxford University Press, 1991.\n21. Wechsler D. Wechsler adult intelligence scale. 3rd ed. London: Psychological Corporation, 1998.\n22. Zigmond AS, Snaith RP. The hospital anxiety and depression scale. Acta Psychiatr Scand1983;67:361-70.6880820\n23. Nelson HE, Willison J. National adult reading test (NART) test manual. 2nd ed. Windsor: NFER-Nelson, 1991.\n24. McLoone, P. Carstairs scores for Scottish postcode sectors from the 1991 census. Glasgow: Public Health Research Unit, University of Glasgow, 2000.\n25. Carstairs V, Morris R. Deprivation and mortality: an alternative to social class? Community Med1989;11:210-9.2605887\n26. Carroll JB. Human cognitive abilities: a survey of factor-analytic studies. Cambridge: Cambridge University Press, 1993.\n27. Berger JS, Roncaglioni MC, Avanzini F, Pangrazzi I, Tognoni G, Brown DL. Aspirin for the primary prevention of cardiovascular events in women and men: a sex-specific meta-analysis of randomised controlled trials. JAMA2006;295:306-13.16418466\n28. Antithrombotic Trialist’s Collaboration. Collaborative meta-analysis of randomised trials of antiplatelet therapy for prevention of death, myocardial infarction, and stroke in high risk patients. BMJ2002;324:71-86.11786451\n29. Cleland JGF. Is aspirin ‘the weakest link’ in cardiovascular prophylaxis?: the surprising lack of evidence supporting the use of aspirin for cardiovascular disease. Prog Cardiovasc Dis2002;44:275-92.12007083\n30. Cleland JGF. Preventing atherosclerotic events with aspirin. BMJ2002;324:103-5.11786458\n31. Wardlaw J, Sandercock PAG, Dennis M, Starr J. Is breakdown of the blood-brain barrier responsible for lacunar stroke, leukoaraiosis, and dementia? Stroke2003;4:806-12.\n32. Price JF, McDowell S, Whiteman M, Fowkes FGR, Deary I. Ankle brachial index as a predictor of cognitive impairment in the general population. The Edinburgh artery study. J Am Geriatr Soc2006;54:763-9.16696741\n33. Cooney TM, Schaie KW, Willis SL. The relationship between prior functioning on cognitive and personality dimensions and subject attrition in longitudinal research. J Gerontol1988;43:12-7.\n34. Ridker PM, Cook NR, Lee IM, Gordon D, Gaziano JM, Manson JE, et al. A randomised trial of low-dose aspirin in the primary prevention of cardiovascular disease in women. N Engl J Med2005;352:1293-304.15753114\n35. Rabbitt P, Diggle P, Smith D, Holland F, McInnes L. Identifying and separating the effects of practice and of cognitive ageing during a large longitudinal study of elderly community. Neuropsychologia2001;39:532-43.11254936\n36. Durga J, van Boxtel MPJ, Schouten EG, Kok FJ, Jolles J, Katan MB, et al. Effect of 3-year folic acid supplementation on cognitive function in older adults in the FACIT trial: a randomised, double blind, controlled trial. Lancet2007;369:208-16.17240287\n37. Salthouse T. Book review: K Warner Schaie, Developmental influences on adult intelligence: the Seattle longitudinal study, Oxford University Press, Oxford, UK, 2005. Intelligence2005;33:551-4."
+}

batch_2/PMC2527658.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527658",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527658\nAUTHORS: Paola Ferrante, Claudia Catalanotti, Giulia Bonente, Giovanni Giuliano\n\nABSTRACT:\nBackground\nChlamydomonas reinhardtii is a model system for algal and cell biology and is used for biotechnological applications, such as molecular farming or biological hydrogen production. The Chlamydomonas metal-responsive CYC6 promoter is repressed by copper and induced by nickel ions. However, induction by nickel is weak in some strains, poorly reversible by chelating agents like EDTA, and causes, at high concentrations, toxicity side effects on Chlamydomonas growth. Removal of these bottlenecks will encourage the wide use of this promoter as a chemically regulated gene expression system.MethodologyUsing a codon-optimized Renilla luciferase as a reporter gene, we explored several strategies to improve the strength and reversibility of CYC6 promoter induction. Use of the first intron of the RBCS2 gene or of a modified TAP medium increases the strength of CYC6 induction up to 20-fold. In the modified medium, induction is also obtained after addition of specific copper chelators, like TETA. At low concentrations (up to 10 µM) TETA is a more efficient inducer than Ni, which becomes a very efficient inducer at higher concentrations (50 µM). Neither TETA nor Ni show toxicity effects at the concentrations used. Unlike induction by Ni, induction by TETA is completely reversible by micromolar copper concentrations, thus resulting in a transient “wave” in luciferase activity, which can be repeated in subsequent growth cycles.ConclusionsWe have worked out a chemically regulated gene expression system that can be finely tuned to produce temporally controlled “waves” in gene expression. The use of cassettes containing the CYC6 promoter, and of modified growth media, is a reliable and economically sustainable system for the temporally controlled expression of foreign genes in Chlamydomonas.\n\nBODY:\nIntroduction\nChlamydomonas reinhardtii is a model system for the biology of green algae. The recent completion of its genome sequence [1] has paved the way for a post-genomics effort, aimed at understanding the function of the majority of Chlamydomonas genes. Stable chloroplast and nuclear transformants can be obtained easily, and a large number of mutants and genetic resources are already available (www.chlamy.org). Scaling up of cultures to large volumes is rapid and biomass production is cost-effective, making Chlamydomonas an interesting system for the production of heterologous proteins [2] and of biohydrogen [3].Gene cassettes allowing chemically regulated gene expression are an essential part of a post-genomics toolkit. Several such systems have been described in plants [4]. These systems allow the temporal or developmental control of the expression of specific genes, thus facilitating the precise determination of their function. They also allow the precise control of the expression of potentially toxic gene products, for industrial or pharmaceutical uses. Ideally, a chemically inducible gene expression system should have the following characteristics:the inducer should be active at very low (micromolar) concentrationsthe induction should be reversible by the addition of micromolar concentrations of an antagonist of the inducerbasal expression levels should be very low, while induced expression levels should be very highthe expression should respond quantitatively and rapidly to the levels of inducer and its antagonistaddition of the inducer, followed by the antagonist should allow transient gene expression, useful for the expression of a gene product at precise moments during the growth cycle of an organismboth the inducer and its antagonist should be non-toxicIn C. reinhardtii, expression of heterologous proteins presents several difficulties. The first problem is represented by the unusual codon bias of the nuclear genes that is highly G-C rich (62%), so that codon optimization must be performed on any gene for which high levels of protein expression are desired [5], [6]. Additionally, expression levels of optimized foreign genes may vary considerably due to position effects or silencing mechanisms [7]. Another feature of most Chlamydomonas nuclear genes is the presence of several small introns in their coding sequences that exert a positive role in gene expression. In particular, the first intron from the gene that encodes the small subunit of ribulose bisphosphate carboxylase (RBCS2) was found to act as an enhancer-like element. This intron (Rb-int) can increase levels of the ble selection marker up to 30-fold [8].Constitutive promoters commonly used for Chlamydomonas transformation are the RBCS2 promoter [9], the HSP70A-RBCS2 tandem promoter [10] and the PSAD promoter [11], whereas inducible promoters are NIT1, CA1 and CYC6. The NIT1 promoter is induced by ammonium starvation [12], the CA1 promoter by low CO2\n[13], whereas the CYC6 promoter is induced by copper (Cu) depletion or nickel (Ni) or cobalt addition [14]. The advantages of using inducible instead of constitutive promoters are that potentially toxic gene products can be expressed only after reaching high cell densities, thus optimizing protein yield, and that strategies can be pursued for the conditional silencing of essential genes. However, none of the above-mentioned promoters has been developed into a robust, widely used chemically regulated gene expression cassette.The Chlamydomonas CYC6 gene encodes cytochrome c6, that replaces, in Cu-limiting conditions, the Cu-containing protein plastocyanin in photosynthetic electron transfer. Plastocyanin is the major copper protein of Chlamydomonas, acting as biological sink of Cu. When Cu is limiting, plastocyanin is degraded to facilitate its redistribution to other more physiologically important copper enzymes such as cytochrome oxidase. Cu deficiency switches on the CYC6 promoter, while addition of sub-micromolar concentrations of Cu ions turns it off [15]. The CYC6 promoter is also activated by Ni and cobalt [14] and oxygen deficiency [16]. Another possible way of induction, i.e. depletion of Cu by specific chelators, has been suggested [17] but not shown to work.Recently, the CYC6 promoter has been used to construct an elegant gene switch for chloroplast genes [18]: a CYC6:NAC2 nuclear transgene, introduced in a nac2 background, allows Cu-repressible expression of the plastid PsbD gene (or of any plastid transgene cloned downstream of the PSBD 5′-UTR). Following PSBD repression by Cu, the culture becomes rapidly anaerobic and a burst of hydrogen production is observed [18]. This burst is, however, only transient, as the CYC6 promoter is rapidly re-induced as soon as anaerobic conditions are established. The availability of methods able to strongly and reversibly induce the CYC6 promoter would extend the range of applications of this gene switch.In the present work we explore several strategies to improve CYC6 activation by Ni and Cu-specific chelators. The use of the first intron of the RBCS2 gene in a specific orientation and position respect to the CYC6 promoter results in an increase of CYC6 activity upon Ni and TETA supplement in the TAP modified media. Induction levels of the CYC6 promoter increase significantly in TAP media with modified transition metal content. The use of the Cu-specific chelators, such as TETA, is proven to be a viable alternative strategy to induce the CYC6 promoter. TETA activation is readily reversible upon Cu addition, allowing, for the first time in an algal, plant or mammalian system, the production of transient “waves” in gene expression.Results and DiscussionMetal inducibility of a CYC6:rLuc constructIn order to provide a sensitive and reliable gene reporter system, we used a synthetic gene encoding Renilla reniformis luciferase (cRLuc) [6], whose sequence has been adapted to the average codon usage of nuclear genes from C. reinhardtii. The estimated half-life of the cRLuc protein in the Chlamydomonas cytoplasm is <2 hours [6]. This is particularly important for studying rapid fluctuations in promoter activity.\ncRLuc was cloned downstream of the strong constitutive PSAD promoter [11] and of the CYC6 promoter [14], [15] (Figure 1A) and transformed into Chlamydomonas. 24 PSAD:cRLuc and 24 CYC6:cRLuc transformants were selected in TAP medium containing paromomycin, and then tested for LUC activity on TAP medium, with or without 75 µM Ni (data not shown). Figure 1C shows LUC activity curves of the highest-expressing PSAD transformant in normal TAP medium and of the highest-expressing CYC6 transformant in normal (Cu-replete) and Cu-deficient TAP medium. The CYC6 promoter was also induced by adding different Ni concentrations, from 25 to 75 µM, to Cu-replete medium. The PSAD promoter shows, in early log phase, a high activity, which decreases over time. To the opposite, the CYC6 promoter has a weak activity in Cu-deficient medium (0.3× PSAD activity 40 hours after Ni addition, Figure 1C), and no activity in Cu-replete medium. The use of acid-treated glassware and plasticware to remove Cu ion traces [17] improved only marginally CYC6 expression in Cu-deficient medium (data not shown). In Cu-replete medium, the addition of Ni at 25 µM does not induce the CYC6 promoter at all while Ni at 50 µM results in a weak induction (0.2× PSAD). A higher induction is reached with Ni at 75 µM (1.2× PSAD) but toxicity effects like inhibition of cell growth (Figure 1B) and a moderate degree of chlorosis (data not shown) start also to be evident.10.1371/journal.pone.0003200.g001Figure 1Comparative expression of PSAD and CYC6 promoters in TAP medium.A: Schematic maps of the PSAD:cRLuc and CYC6:cRLuc constructs. B: Growth curves in Cu-deficient and Cu-replete medium, and in the presence of different Ni concentrations. C: LUC activity driven by PSAD and CYC6 in Cu-deficient and Cu-replete medium, and in the presence of different Ni concentrations.Using Northern blots, Quinn et al. [14] observed activation of CYC6 transcription by 25 µM Ni. The absence of induction of LUC activity by 25 µM Ni observed here may be due to strain-dependent variation, or to the different sensitivity of Northern blots and LUC assays. Whatever the case, the comparison of the LUC activity levels driven by PSAD and of those driven by CYC6 indicates clearly that the latter is a rather weak promoter in TAP medium, when induced with non-toxic concentrations of Ni.Increasing CYC6 promoter strength by optimization of medium compositionTransition metals are added to the TAP medium as EDTA-complexes in a solution known as Hutner trace solution [19]. This solution was originally developed for the growth of bacteria and up to now has not been optimized for the metabolism of Chlamydomonas strains [20]. Although transition metals are essential for Chlamydomonas growth, the minimum required concentrations are presumably much lower than those provided by the Hutner solution. Table 1 shows the concentration of each transition metal provided by the Hutner solution and the minimal estimated concentration required to support Chlamydomonas growth up to the stationary phase [20]. It is clear from Table 1 that all transition metals are present in large excess. Some of the transition metals are likely to interfere with Cu signal transduction, like cobalt ions that promote CYC6 activation even in fully Cu-replete cells [14]. In addition, an excess of Cu is likely to antagonize CYC6 induction by nickel. Taking these facts into account, two new trace solutions were prepared (Table 1). ENEA1 solution is identical to the Hutner solution except for Cu, which is 0.3 µM instead of 6 µM (final concentration). ENEA2 contains 0.3 µM Cu and lowered concentrations of all other transition metals and the chelator EDTA. The rationale of lowering EDTA concentration is to avoid having an excess of EDTA, that may chelate nickel with high affinity (the stability constant of EDTA-Ni is 18.56 [21]), thus antagonizing CYC6 activation by this metal.10.1371/journal.pone.0003200.t001Table 1Trace element concentrations (µM).Minimum Required*\nTAPTAP ENEA1TAP ENEA2Zn1.777773Mn1.726263Fe3.318185Co0.003770.1Cu0.360.30.3Mo0.003110.1EDTA-13413415*Calculated from data in [20].\nFigure 2 shows the growth and LUC activity curves of the CYC6:cRLuc transformant grown in canonical TAP medium, or with ENEA1 or ENEA2 trace element compositions, and induced with 25 µM, 50 µM, and 75 µM Ni. The growth curves of the non induced cultures show that the ENEA trace solutions provide concentrations of transition metals sufficient to sustain Chlamydomonas growth up to the stationary phase while Ni at 75 µM causes cell growth inhibition irrespective of media tested (panel A).10.1371/journal.pone.0003200.g002Figure 2Effect of modified TAP media on Chlamydomonas growth and on CYC6 promoter expression.A: Growth curves in media with different transition metal/EDTA composition, in the presence of different Ni concentrations. For composition of the different media, see Table 1. B: LUC activity in the above media at different Ni concentrations.LUC activity curves (panel B) show that 25 µM Ni is effective in activating the CYC6 promoter only in TAP ENEA2 medium, whereas no induction is observed in TAP and TAP ENEA1 media. At higher Ni concentrations (50 and 75 µM), Ni induces the CYC6 promoter in all three media tested, but maximum CYC6 induction differs significantly among TAP media. At 50 µM Ni, the CYC6 activity at 40 hours, is 0.2× PSAD in TAP medium, 0.6× PSAD in TAP ENEA1 and 3.5× PSAD in TAP ENEA2 medium (Table 2). This means a 17.5-fold improvement in expression between classical TAP and TAP ENEA2, without detectable toxicity effects.10.1371/journal.pone.0003200.t002Table 2Strength of the CYC6 promoter relative to PSAD in different growth media*.TAPTAP ENEA1TAP ENEA225 µM Ni<0.01<0.011.6050 µM Ni0.200.603.5075 µM Ni1.202.204.40*Promoter strength has been calculated 40 hours after Ni addition (70 hours after subculture), when CYC6, but not PSAD, expression is maximal. Therefore, the data reflect CYC6 relative expression in different growth media, rather than absolute CYC6/PSAD ratios at the relative expression peaks.These findings suggest that both the levels of Cu and the levels of transition metals and EDTA regulate CYC6 induction by Ni. The increased induction levels observed in TAP ENEA1 versus classical TAP medium can be explained considering that copper antagonizes induction by Ni, since the difference between these two media is only the copper content. On the other hand, the increased levels of CYC6 induction in TAP ENEA2 medium compared to TAP ENEA1 medium can be explained by an increased Ni uptake by Chlamydomonas cells. Transport of transition metal cations like Zn, Cd, Co, Ni or Mn across the plasma membrane is mediated by non-specific cation transporters [22] and hence, in TAP ENEA2 medium, where all of the cations are reduced, Ni uptake is probably enhanced.Reversibility of the CYC6 promoter induction: Ni/EDTA systemAn ideal inducible system should be readily reversible by the addition of an antagonist of the inducer, acting at micromolar concentrations. Using Northern blotting, Quinn et al.\n[14] have shown that EDTA, added 5 hs after Ni addition, is able to prevent induction of CYC6 transcript levels by Ni. Since, at this time, the CYC6 transcript is still undetectable, this cannot formally be considered as a reversion, but rather as a lack of induction.To verify if the Ni/EDTA system can be used for driving the reversible expression of a heterologous protein, we induced the promoter with 50 µM Ni in TAP ENEA2 and canonical TAP medium. EDTA was added at the final concentration of 50 and 150 µM (Figure 3) 16 hs after Ni addition, when LUC activity becomes detectable.As can be seen (Figure 3), in both media induction of the CYC6 promoter is poorly reversible by EDTA, even when added at very high concentrations. In TAP ENEA2, LUC activity keeps increasing after EDTA addition, even if at a lower pace. In all cases, LUC activity is well above background levels even 48 hours after EDTA addition. Similar lack of reversion is observed after induction with 25 µM Ni in TAP ENEA2 medium or with 50 µM Ni in canonical TAP medium (Figure S1).10.1371/journal.pone.0003200.g003Figure 3Induction by Ni is not reversible by EDTA.LUC activity, induced with 50 µM Ni in TAP and TAP ENEA2 medium, and supplemented with different concentrations of EDTA 16 hours after Ni addition.A different option to reversibly regulate the CYC6 promoter would be to add Cu to cultures induced by Ni. We tried adding 25 µM and 100 µM Cu concentrations 16 hours after induction by Ni (25, 50 and 75 µM) in canonical TAP and in TAP ENEA2 media and we found them ineffective in switching off the CYC6 promoter (Figure S2). These results are in agreement with the model proposed by Kropat et al.\n[23], in which Ni binds at the Cu-sensing site of the Cu Response Regulator 1 (CRR1) with high affinity, precluding subsequent displacement by Cu. The irreversible nature of Ni binding to the CRR1 regulator is also suggested by the fact that EDTA, added 40 hs after Ni addition is completely ineffective in switching off the CYC6 promoter (Figure S3).These data, taken together, seem to indicate that the rate limiting step for achieving high level of CYC6 induction is the amount of Ni inside the cell available to bind the CRR1 regulator. Our results indicate that high levels of CYC6 induction can be obtained in transition metal-poor media, where Ni uptake is probably increased compared to standard media. The addition of EDTA at early times after Ni induction prevents efficient Ni uptake and CYC6 induction, while later addition is not able to revert the action exerted by the Ni that has been already taken up. From these results we conclude that the Ni/EDTA system is not ideal in driving reversible expression of a heterologous protein put under the control of the CYC6 promoter.\nCYC6 induction by specific Cu chelatorsSince the CYC6 promoter is naturally responsive to Cu deficiency in the growth medium, Cu-specific chelators may provide an alternative strategy for inducing gene expression. We tested several chelators, both with a broad chelating activity and specific to Cu (listed in Table 3). Several of the Cu-specific chelators are used as remedies in Wilson's disease, a genetic disorder in which copper accumulates in the brain and the liver, causing neuropsychiatric symptoms and liver disease [24].10.1371/journal.pone.0003200.t003Table 3Characteristics of the different Cu chelators tested.Short nameFull nameCommentsReferencePHE1,10-phenanthrolineCu-chelator\n[32]\nCDTAtrans-1,2-diaminocyclohexane-N,N,N′,N′-tetraacetic acidCu-chelator. Remedy in metal poisoning\n[33]\nTETAtriethylentetramineCu-chelator. Remedy in Wilson's disease\n[34]\nDDCsodium diethyldithiocarbamateCu-chelator\n[32]\nDPAD-penicillamineCu-chelator. Remedy in Wilson's disease\n[34]\nBCSbathocuproinedisulfonic acidCu-chelator\n[35]\nIM1,3,5-cis,cis,--triaminocyclohexane-N,N′,N″-tris-(2-methyl-(N-methylimidazole))Cu-chelator\n[25]\nDOTA1,4,7,10-Tetraazacyclododecane-1,4,7,10-tetraacetic acidCu-chelator\n[36]\nThe chelators were tested in TAP ENEA2 medium, since in this medium transition metals and EDTA are low, providing a low buffering capacity against the addition of chelators. In theory, the concentration of chelator causing preferential chelation of Cu over other essential cations can be calculated from the stability constants of the chelator-metal complexes. In practice, in vivo chelation reactions may differ extensively from what would be expected on the basis of the chemical knowledge about the metal and the chelating agent. Therefore, in this initial screening we used 2 µM and 10 µM concentrations of all chelators.The only chelator showing toxicity effects (at 10 µM) is 1,10-phenanthroline, whereas all the other chelators do not have negative effects on Chlamydomonas growth, in spite of the low transition metal content of TAP ENEA2 medium (Figure 4A). Several chelators, like TETA (2 and 10 µM), BCS (10 µM) and IM (10 µM) result in a measurable activation of the CYC6 promoter (Figure 4B).10.1371/journal.pone.0003200.g004Figure 4Induction of CYC6 promoter expression by different chelators in modified TAP media.A: Growth curves in TAP ENEA2 medium in the presence of different chelators. The chelator full names and references are given in Table 3. B: LUC activity in the above conditions. C: Induction of LUC activity by TETA in classical and modified TAP media.We tested a broader range of TETA in TAP and TAP ENEA2 media (Figure 4C). As expected, activation by TETA is much more efficient in TAP ENEA2 than in classical TAP. Activation by TETA in classical TAP medium is observed only at 25 µM and is very weak (0.006× PSAD) whereas 2, 10 and 25 µM are effective in activating the CYC6 promoter in TAP ENEA2 medium. These results are explained considering that TETA is a copper-specific chelator and that classical TAP medium has a large amount of copper that cannot be completely sequestered by TETA. Figure 4C also shows that the CYC6 promoter responds quantitatively to the levels of TETA added (from 2 µM to 25 µM in TAP ENEA2 medium) reaching, after 64 hours, induction levels from 0.2× PSAD at 2 µM TETA to 0.6× PSAD at 25 µM TETA. Growth curves (not shown) indicate that TETA is not toxic at all the concentrations tested. In this way the expression of a protein can be quantitatively modulated by the levels of TETA without interfering with cell growth. It must be noted that, although induction by Ni reaches higher activity levels, at low concentrations (10 µM) TETA is a more potent inducer than Ni (Figure S3).Reversibility of the CYC6 promoter induction: TETA/Cu systemAt all the TETA concentrations tested, LUC activity is already detectable at 16 hours and increases steadily until 64 hours. When Cu is added at 16 hours (1, 2 and 5 µM respectively for 2, 5 and 10 µM TETA), LUC activity drops, at 64 hours, to the levels of the non induced samples (Figure 5A). This creates a reversible wave-like pattern, in which gene expression is switched on by the addition of TETA, and then off again by the addition of Cu. Even if added at 40 hs after TETA induction, Cu reverses readily CYC6 activation (Figure S3).10.1371/journal.pone.0003200.g005Figure 5Induction by TETA is reversible by Cu.A: LUC activity in cultures induced with TETA, and supplemented with different concentrations of Cu 16 hours later. B: LUC activity in cultures induced with 5 µM TETA and repressed with 2 µM Cu for two subsequent cycles.In principle, the TETA/Cu reversible system should be usable for more than one cycle of activation-repression. In order to verify this hypothesis, gene expression was induced with 5 µM TETA and repressed with 2 µM Cu, added 16 hours later (Fig. 5B). After 88 hours, the cultures have reached stationary phase and are diluted 1∶20 with fresh TAP ENEA2 medium. In this new growth cycle, TETA is again added at 30 hours and Cu 16 hours later. In both cases, a second cycle of activation-repression is obtained. The maximum levels of CYC6 induction are lower in the second cycle with respect to the first one, probably due to carry-over of the Cu used for repression during the dilution of the medium. Similar trends are observed after induction with 2 µM TETA, followed by repression by 1 µM Cu (Figure S4)Increasing CYC6 promoter strength with the RBCS2 intronStudies of gene expression in C. reinhardtii have shown that introns play an important role in regulating gene expression levels, altering nuclear export, stability of transcripts or the rate of transcription. In particular, the first intron of RBCS2 gene (Rb-int) has been widely used as a transcriptional enhancer, able to increase expression up to 30-fold, regardless of its orientation or position relative to the RBCS2 promoter [8].As an alternative strategy to increase the strength of the CYC6 promoter, Rb-int was cloned upstream (in both orientations) and downstream of said promoter (Figure 6A). Luciferase activity was determined, in TAP ENEA2 medium, uninduced or after induction with 50 µM Ni or 10 µM TETA, on 24 transformants for each of the five constructs shown in figures 1A and 6A. The results (Figure 6B) show that the Rb-int1 construct has the highest expression levels after Ni/TETA addition. However the basal level of activity in the absence of Ni/TETA is high (Figure 6B), indicating that Rb-int acts as a constitutive enhancer downstream the CYC6 promoter. Rb-int2 transformants behave as CYC6 transformants (Figure 6B). To the opposite, the induction of Rb-int3 transformants by Ni and TETA is higher than that of CYC6 transformants (Figure 6B). From these results we conclude that Rb-int behaves as a constitutive enhancer downstream of CYC6 whereas it exerts a positive effect on CYC6 induction by Ni and TETA when placed in 3′-5′ orientation, upstream of the CYC6 promoter.10.1371/journal.pone.0003200.g006Figure 6Effect of the first intron of RBCS2 on CYC6 promoter expression.A: Schematic maps of the CYC6:Rb-int1, 2 and 3 constructs. B: LUC activity, 40 hours after inducer addition, of 24 independent transformants for each of the constructs shown in panel A and for the CYC6 construct. LUC activity values are in log scale. Horizontal bars represent the average expression of the 24 transformants.ConclusionsWe have shown that, after optimization of the Chlamydomonas growth media, expression of the CYC6 promoter is strongly induced by non-toxic concentrations of Ni, or, to lower levels, of a specific Cu chelator, such as TETA. The activity induced by Ni is increased up to 18-fold in a transition metal and EDTA - poor medium, TAP ENEA2, with respect to classical TAP.Ni induction is poorly reversible by EDTA. EDTA acts probably by preventing the penetration of Ni into the cell and, if added at early stages after induction [14]it blocks CYC6 activation. On the contrary, if it is added at later stages of induction, EDTA is unable to completely revert Ni induction.In TAP ENEA2 medium, the CYC6 promoter is activated, at low levels, by the addition of a specific Cu-chelator, such as TETA. TETA is not toxic at all the concentrations tested and its induction is readily and completely reversible by Cu, this resulting in a transient “wave” in gene expression. Several Cu chelators, developed for clinical applications [25] are now being tested, and some of them are more effective CYC6 inducers than TETA, while retaining reversibility by Cu.Finally, the use of the first intron of the RBCS2 gene in a specific orientation and position with respect to the CYC6 promoter results in an increased inducibility of CYC6 by Ni and TETA.To our knowledge, this is the first time that a temporally reversible tuning of gene expression (turn on by an inducer, followed by turn off by an antagonist) is described in a chemically regulated system for algal, plant, or mammalian cells. The Tet-on, Tet-off system used in mammalian cells [26], functions in a fundamentally different way: in that case, the same chemical can act as an inducer or a repressor, depending on the construct used. A Dex-on, Tet-off system has been described in plants [27], but in that case the administration of the inducer and the antagonist are simultaneous, and do not give rise to gene expression “waves” like the ones described here.These findings open new perspectives for basic biology applications as well as for biotechnological applications. Chlamydomonas has been proposed as a “cell factory” system for the production of heterologous proteins [28]. Some of these proteins may be toxic to the cell, and thus require an inducible, rather than a constitutive expression system. The system proposed here uses simple media, with very low concentrations of transition metals and EDTA, which might interfere with protein activity/purification. Induction can be achieved also in the absence of Ni, whose presence might interfere with some applications, such as the use of His affinity tags. Preparation of the medium does not require laborious acid washes of the glassware and plasticware, or use of ultra pure reagents, as in the case of induction by Cu depletion [17]. Finally, the system described here can be used to drive Ni- and TETA-inducible chloroplast gene expression [18]. Chlamydomonas is also used for the biotechnological production of hydrogen through indirect photobiolysis [3]. In the currently used system, downregulation of Photosystem II activity, leading to hydrogen production, is triggered by cycling Chlamydomonas cultures between sulphur-replete and sulphur-depleted medium. The method presents evident challenges, such as the difficulty of centrifuging the huge volumes of algal cultures needed for making hydrogen production economically interesting. The use of the TETA/Cu reversible system described here could be used to trigger several subsequent cycles of gene expression/silencing in a cheap, energy-efficient way.Materials and MethodsStrains and culture conditionsThe cell wall-deficient Chlamydomonas reinhardtii strain cw15\n[29] was used for all experiments. Cells were grown photomixotrophically in TAP medium [29], supplemented with 1% (w/v) sorbitol at 25°C under irradiation (16 L:8 D) with fluorescent white light (40 µE m−2 s−1). TAP medium was prepared using standard purity chemicals and MilliQ-purified water. All the glassware and plasticware was rinsed three times with MilliQ-purified water. ENEA1 and ENEA2 trace solutions were prepared according to [29] with modifications as in Table 1. TAP ENEA2 medium was supplemented with NaCl (200 µM final concentration). Nuclear transformation was performed as described [30]. Transformants were selected on paromomycine (10 µg/ml)–containing TAP agar plates and recovered 10 days after plating. For the experiment shown in Figure 6B, colonies were inoculated in duplicate in 250 µl of TAP ENEA2 medium in 96-well plates (Greiner bio-one, catalog number 655180), grown to the stationary phase at 600 rpm on a rotary shaker and then diluted 1∶20. 30 hours after the dilution, Ni and TETA were added at 50 and 10 µM, respectively. For all other experiments, stationary phase cultures of high-expressing CYC6 and PSAD transformants were diluted 1∶20 in 2.5 ml of media in 24-well blocks (Qiagen, cat. 19583) and grown at 160 rpm on a rotary shaker. The plates were covered with Breathe-Easy membrane (Diversified Biotech, cat. BEM-1) to prevent evaporation without limiting gaseous and light exchange. Inducers (Ni, TETA) were added 30 hours after inoculum, when cell density had reached approx. 5×106 cells/ml. Volumes were monitored throughout the growth curve, and evaporation was always <5% of the total volume. For the experiment shown in Figure 5B, the cultures from the first cycle were diluted 1∶20 88 hours after TETA addition. After 30 hours, TETA was added and, 16 hours later, Cu was added.Plasmid constructionPlasmid pSL18 [31], carrying an expression cassette composed of the PSAD promoter and polyadenylation site and a paromomycin resistance cassette, was used for all subsequent manipulations. The 874-bp XhoI-XbaI fragment containing the PSAD promoter was excised and substituted with a 931-bp fragment corresponding to the CYC6 promoter+5′UTR (−852 to +79 with respect to the start site of transcription) [15]; this fragment was amplified by PCR from genomic DNA with primers adding XhoI and XbaI sites to 5′ and 3′ ends respectively and cloned in pSL18. The unique NotI restriction site in pSL18 was disrupted by filling of 3′ recessed ends after digestion. Then a polylinker sequence (50 bp long) containing the unique restriction sites StuI, NotI, PstI, SpeI, BglII, EcoRI, FseI was cloned in the XbaI site by annealing two primers with the following sequence:Primer forward:\nCTAGAGGCCTGCGGCCGCCTGCAGACTAGTAGATCTGAATTCGGCCGGCC\nPrimer reverse:\nCTAGGGCCGGCCGAATTCAGATCTACTAGTCTGC AGGCGGCCGCAGGCCT\nThe synthetic gene encoding the Renilla reniformis luciferase (cRLuc) was cloned downstream of the CYC6 promoter in the XbaI and BglII sites, forming plasmid pSL18:CYC6:cRLuc. Then, the XhoI-XbaI fragment containing the CYC6 promoter was replaced with a 874-bp XhoI-XbaI fragment containing the PSAD promoter obtained through digestion of pSL18. Since the vector sequences downstream of the PSAD promoter (60 bp) contain a NdeI site (containing an ATG codon in frame with the cRluc gene), they were removed by digestion with NdeI and XbaI, filling with Klenow polymerase, and religation. The vector obtained was named pSL18:PSAD:cRLuc.The constructs containing the first intron of RBCS2 (Rb-int) upstream and downstream of the CYC6 promoter were obtained by cloning the corresponding sequences in the XhoI (upstream) and XbaI (downstream) sites. Rb-int was isolated from the pSL18 plasmid by PCR.Ni- and chelator-induced gene expressionCultures were supplemented with NiCl2, CuCl2, and chelators (Table 3) from 1000× stock solutions. All chelators were ACS-grade and were purchased from Sigma-Aldrich with the exception of DOTA and IM that were kindly donated by M.W. Brechbiel. Growth was routinely monitored by reading the A595 with a Victor3 1420 Microplate Reader (Perkin-Elmer), and the number of cells was deduced using a conversion factor deduced by counting cultures at different densities with a haemocytometer. 100 µl of cell suspension was collected at the times indicated and centrifuged at 2,600×g for 20 minutes at 4°C in a 96-well PCR plate. Cell pellets were frozen in liquid nitrogen and stored at −80°C until used.Luciferase assayLuciferase assay was performed using the Renilla Luciferase Assay System (Promega, cat. E2820) according to the manufacturer's instructions. Frozen cell pellets in multiwell plates were resuspended in 40 µl of 1× lysis buffer, lysed at room temperature for 15 minutes on a rotary shaker (750 rpm) and then incubated on ice until assayed. In these conditions, LUC activity remains stable for at least 1 hour (data not shown). Since LUC activity decays during the assay, with a half-life of approx 3 minutes, the assay was performed on 8 samples at a time operating with a multichannel pipet. 5 µl of each lysate was added to 25 µl of assay buffer in Optiplate 384-well plates (Perkin-Elmer cat. 6007290), supplemented with 1× coelenterazine, at room temperature, mixed for 3 seconds and luminescence was recorded for 2 seconds using a Victor3 1420 Microplate Reader (Perkin-Elmer). For each experimental point, two biological replicas (separate cultures) and two technical replicas (separate assays) were assayed, for a total of four replicas.Supporting InformationFigure S1(0.05 MB PDF)Click here for additional data file.Figure S2(0.05 MB PDF)Click here for additional data file.Figure S3(0.05 MB PDF)Click here for additional data file.Figure S4(0.05 MB PDF)Click here for additional data file.\n\nREFERENCES:\n1. MerchantSSProchnikSEVallonOHarrisEHKarpowiczSJ\n2007\nThe Chlamydomonas genome reveals the evolution of key animal and plant functions.\nScience\n318\n245\n250\n17932292\n2. FranklinSEMayfieldSP\n2004\nProspects for molecular farming in the green alga Chlamydomonas.\nCurr Opin Plant Biol\n7\n159\n165\n15003216\n3. MelisA\n2007\nPhotosynthetic H2 metabolism in Chlamydomonas reinhardtii (unicellular green algae).\nPlanta\n226\n1075\n1086\n17721788\n4. PadidamM\n2003\nChemically regulated gene expression in plants.\nCurr Opin Plant Biol\n6\n169\n177\n12667875\n5. FuhrmannMOertelWHegemannP\n1999\nA synthetic gene coding for the green fluorescent protein (GFP) is a versatile reporter in Chlamydomonas reinhardtii.\nPlant J\n19\n353\n361\n10476082\n6. FuhrmannMHausherrAFerbitzLSchodlTHeitzerM\n2004\nMonitoring dynamic expression of nuclear genes in Chlamydomonas reinhardtii by using a synthetic luciferase reporter gene.\nPlant Mol Biol\n55\n869\n881\n15604722\n7. SchrodaM\n2006\nRNA silencing in Chlamydomonas: mechanisms and tools.\nCurr Genet\n49\n69\n84\n16308700\n8. LumbrerasVStevensDRPurtonS\n1998\nEfficient foreign gene expression in Chlamydomonas reinhardtii mediated by an endogenous intron.\nPlant J\n14\n441\n447\n9. StevensDRRochaixJDPurtonS\n1996\nThe bacterial phleomycin resistance gene ble as a dominant selectable marker in Chlamydomonas.\nMol Gen Genet\n251\n23\n30\n8628243\n10. SchrodaMBlockerDBeckCF\n2000\nThe HSP70A promoter as a tool for the improved expression of transgenes in Chlamydomonas.\nPlant J\n21\n121\n131\n10743653\n11. FischerNRochaixJD\n2001\nThe flanking regions of PsaD drive efficient gene expression in the nucleus of the green alga Chlamydomonas reinhardtii.\nMol Genet Genomics\n265\n888\n894\n11523806\n12. OhresserMMatagneRFLoppesR\n1997\nExpression of the arylsulphatase reporter gene under the control of the nit1 promoter in Chlamydomonas reinhardtii.\nCurr Genet\n31\n264\n271\n9065390\n13. VillandPErikssonMSamuelssonG\n1997\nCarbon dioxide and light regulation of promoters controlling the expression of mitochondrial carbonic anhydrase in Chlamydomonas reinhardtii.\nBiochem J\n327(Pt 1)\n51\n57\n9355734\n14. QuinnJMKropatJMerchantS\n2003\nCopper response element and Crr1-dependent Ni(2+)-responsive promoter for induced, reversible gene expression in Chlamydomonas reinhardtii.\nEukaryot Cell\n2\n995\n1002\n14555481\n15. QuinnJMMerchantS\n1995\nTwo copper-responsive elements associated with the Chlamydomonas Cyc6 gene function as targets for transcriptional activators.\nPlant Cell\n7\n623\n628\n7780310\n16. QuinnJMErikssonMMoseleyJLMerchantS\n2002\nOxygen deficiency responsive gene expression in Chlamydomonas reinhardtii through a copper-sensing signal transduction pathway.\nPlant Physiol\n128\n463\n471\n11842150\n17. QuinnJMMerchantS\n1998\nCopper-responsive gene expression during adaptation to copper deficiency.\nMethods Enzymol\n297\n263\n279\n9750208\n18. SurzyckiRCournacLPeltierGRochaixJD\n2007\nPotential for hydrogen production with inducible chloroplast gene expression in Chlamydomonas.\nProc Natl Acad Sci U S A\n104\n17548\n17553\n17951433\n19. HutnerSHProvasoliLSchatzCPHaskinsCP\n1950\nSome approaches to the study of the role of metals in the metabolism of microorganisms.\nProc Am Philos Soc\n94\n152\n170\n20. MerchantSSAllenMDKropatJMoseleyJLLongJC\n2006\nBetween a rock and a hard place: trace element nutrition in Chlamydomonas.\nBiochim Biophys Acta\n1763\n578\n594\n16766055\n21. UemasuIIwamotoT\n1982\nCadmium ion selective electrode and ethylenedinitrilotetraacetatocadmium(II) for endpoint detection in chelatometric titration of nichel(II) ion.\nAnal Chem\n54\n835\n836\n22. HanikenneMKramerUDemoulinVBaurainD\n2005\nA comparative inventory of metal transporters in the green alga Chlamydomonas reinhardtii and the red alga Cyanidioschizon merolae.\nPlant Physiol\n137\n428\n446\n15710683\n23. KropatJTotteySBirkenbihlRPDepegeNHuijserP\n2005\nA regulator of nutritional copper signaling in Chlamydomonas is an SBP domain protein that recognizes the GTAC core of copper response element.\nProc Natl Acad Sci U S A\n102\n18730\n18735\n16352720\n24. AlaAWalkerAPAshkanKDooleyJSSchilskyML\n2007\nWilson's disease.\nLancet\n369\n397\n408\n17276780\n25. MaDLuFOverstreetTMilenicDEBrechbielMW\n2002\nNovel chelating agents for potential clinical applications of copper.\nNucl Med Biol\n29\n91\n105\n11786280\n26. SprengelRHasanMT\n2007\nTetracycline-controlled genetic switches.\nHandb Exp Pharmacol\n49\n72\n17203651\n27. BohnerSGatzC\n2001\nCharacterisation of novel target promoters for the dexamethasone-inducible/tetracycline-repressible regulator TGV using luciferase and isopentenyl transferase as sensitive reporter genes.\nMol Gen Genet\n264\n860\n870\n11254134\n28. MayfieldSPManuellALChenSWuJTranM\n2007\nChlamydomonas reinhardtii chloroplasts as protein factories.\nCurr Opin Biotechnol\n18\n126\n133\n17317144\n29. HarrisEH\n1989\nThe Chlamydomonas sourcebook: A comprehensive guide to biology and laboratory use\nSan Diego\nAcademic Press\n30. KindleKL\n1990\nHigh-frequency nuclear transformation of Chlamydomonas reinhardtii.\nProc Natl Acad Sci U S A\n87\n1228\n1232\n2105499\n31. DepegeNBellafioreSRochaixJD\n2003\nRole of chloroplast protein kinase Stt7 in LHCII phosphorylation and state transition in Chlamydomonas.\nScience\n299\n1572\n1575\n12624266\n32. BardsleyWGChildsRECrabbeMJ\n1974\nInhibition of enzymes by metal ion-chelating reagents. The action of copper-chelating reagents on diamine oxidase.\nBiochem J\n137\n61\n66\n4206911\n33. SanchezDJColominaMTDomingoJLLlobetJMCorbellaJ\n1994\nDevelopmental toxicity of cyclohexanediaminetetraacetic acid (CDTA) in mice.\nRes Commun Chem Pathol Pharmacol\n83\n329\n340\n8008982\n34. CohenNLKeenCLLonnerdalBHurleyLS\n1983\nThe effect of copper chelating drugs on liver iron mobilization in the adult rat.\nBiochem Biophys Res Commun\n113\n127\n134\n6860330\n35. LiYTrushMA\n1993\nOxidation of hydroquinone by copper: chemical mechanism and biological effects.\nArch Biochem Biophys\n300\n346\n355\n8424668\n36. BoswellCASunXNiuWWeismanGRWongEH\n2004\nComparative in vivo stability of copper-64-labeled cross-bridged and conventional tetraazamacrocyclic complexes.\nJ Med Chem\n47\n1465\n1474\n14998334"
+}

batch_2/PMC2527792.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527792",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527792\nAUTHORS: K A Landers, H Samaratunga, L Teng, M Buck, M J Burger, B Scells, M F Lavin, R A Gardiner\n\nABSTRACT:\nIn the quest for markers of expression and progression for prostate cancer (PCa), the majority of studies have focussed on molecular data exclusively from primary tumours. Although expression in metastases is inferred, a lack of correlation with secondary tumours potentially limits their applicability diagnostically and therapeutically. Molecular targets were identified by examining expression profiles of prostate cell lines using cDNA microarrays. Those genes identified were verified on PCa cell lines and tumour samples from both primary and secondary tumours using real-time RT–PCR, western blotting and immunohistochemistry. Claudin-4, coding for an integral membrane cell-junction protein, was the most significantly (P<0.00001) upregulated marker in both primary and metastatic tumour specimens compared with benign prostatic hyperplasia at both RNA and protein levels. In primary tumours, claudin-4 was more highly expressed in lower grade (Gleason 6) lesions than in higher grade (Gleason ⩾7) cancers. Expression was prominent throughout metastases from a variety of secondary sites in fresh-frozen and formalin-fixed specimens from both androgen-intact and androgen-suppressed patients. As a result of its prominent expression in both primary and secondary PCas, together with its established role as a receptor for Clostridium perfringens enterotoxin, claudin-4 may be useful as a potential marker and therapeutic target for PCa metastases.\n\nBODY:\nThe prostate-specific antigen (PSA) and transrectal ultrasound biopsy approach for detection of prostate cancer (PCa) has resulted in a stage shift in terms of earlier diagnosis (Hankey et al, 1999). However, even when the tumour is considered localised clinically, a significant proportion of patients already have micrometastases, which declare themselves subsequent to treatment with curative intent (Freedland et al, 2003). Currently, localised tumour is potentially curable but metastatic cancer is not (Fusi et al, 2004). Intuitively, understanding key molecular events leading to PCa will lead to the identification of potential diagnostic and/or prognostic biomarkers, more reliable and earlier detection together with implications for diagnostic and therapeutic targeting (Hanahan and Weinberg, 2000). Methods used for the identification of potential markers for PCa include gene expression analysis (e.g. microarrays and quantitative PCR) and protein markers (e.g. histopathology, mass spectrometry) (Ornstein and Tyson, 2006). Numerous genes that are up- or downregulated in PCa have been identified with α-methylacyl-CoA racemase (AMACR) (Rubin et al, 2002), prostate-specific membrane antigen (PSMA) (Burger et al, 2002), Hepsin (Stephan et al, 2004), DD3/PCA3 (Hessels et al, 2003) and hTERT (Sommerfeld et al, 1996) among the more common (Ross et al, 2003).In PCa detection, greater value would be afforded if markers were not only able to distinguish between benign and malignant tumours, but also to indicate innate tumour aggressiveness (including likelihood of metastasis). Their value would be enhanced even further if expression in primary tumours correlated with those in metastases and most valuable if they were also targets for imaging and therapeutic strategies. Evidence to date indicates that provision of such information is beyond the scope of any one marker (Landers et al, 2005), and it is apparent that different genes have relative strengths and weaknesses in this context. Thus, this study aimed to correlate the use of potential biomarkers of PCa primary lesions with metastases by comparing expression profiles of normal prostate cells with those of clinically significant PCa cells from primary and from metastatic tumours.Materials and methodsTissue cultureRWPE1 cells, derived from the peripheral zone of a histologically normal adult human prostate and transformed with a single copy of the human papilloma virus-18 (HPV-18), and metastatic PCa cell lines ALVA41, DU145, LNCaP and PC3 were obtained from Professor Judith Clements (Queensland University of Technology, Australia). The PCa cell lines were cultured in 10% (v/v) FCS in RPMI-1640 medium with 100 U ml−1 penicillin-G (GIBCO™ Invitrogen Corporation MT Waverley, Australia) and 100 U ml−1 streptomycin (GIBCO); RWPE1 cells were cultured in keratinocyte serum-free media (KSFM; GIBCO) supplemented with 5 ng ml−1 human recombinant epidermal growth factor and 0.05 mg ml−1 bovine pituitary extract. Cell cultures were maintained at 37°C in a humidified atmosphere of 5% CO2.Specimen collectionAll tissue specimens collected were obtained from consenting patients Royal Brisbane Women's Hospital, Queensland, as approved by the Institutional Ethics Committee. Primary PCa tissue specimens were obtained from patients undergoing either a radical prostatectomy (RP) or a transurethral resection of prostate (TURP) with secondary tumours provided by HS from both androgen-intact and androgen-suppressed patients. Benign prostatic hyperplasia (BPH) tissue specimens were obtained from men who had either TURP or an open enucleative prostatectomy. Tissue fragments were frozen immediately using liquid nitrogen and transported on dry ice for storage at −70°C with closely adjacent tissue specimens placed in OCT and snap frozen or formalin-fixed and paraffin-embedded. Tissues prepared for histology were examined to confirm the diagnosis of BPH or PCa and to determine the proportion of epithelial cells to stromal cells. Nonsampled tissues were analysed histopathologically, as per routine practice, to confirm the clinical diagnosis and, for PCa, to determine Gleason scores and the percentage of tumour cells present. Additional paraffin sections with high-grade prostatic intraepithelial neoplasia (HG-PIN), PCa or metastatic tissue were obtained by HS. Control benign sections, harvested from deceased individuals following appropriate consent, were kindly provided by Associate Professor David Horsfall (Hanson Institute, Adelaide).RNA extractionTissue fragments were homogenised using a Polytron PK® homogeniser, in 1 ml TRI Reagent® (Sigma-Aldrich, Castle Hill, New South Wales, Australia) per 50 mg of tissue. Prostate cell lines were grown until confluent and 5–10 × 106 cells collected, washed in PBS and resuspended in TRI Reagent and subsequently extracted using the recommended protocol.cDNA microarraysTwenty micrograms of total RNA from a prostate cell line and the reference RNA, isolated as described above, were indirectly labelled with aminoallyl-dUTP (Amersham Biosciences, Piscataway, NJ, USA) by reverse transcription using an oligo(dT)15 primer (Roche Diagnostics, Castle Hill, New South Wales, Australia) and Superscript III™ (Invitrogen). Following synthesis, aminoallyl-labelled cDNA was purified, dried and the pellet resuspended in 100 mM sodium carbonate, pH 9.0. Cy5 or Cy3 dyes (Amersham Biosciences) were added to respective samples and the coupling reaction allowed to proceed for 1 h. Unincorporated dyes were removed from the reactions with 4 M hydroxylamine. The Cy3- and Cy5-labelled cDNAs were combined and purified using QIAquick™ PCR kit (Qiagen, Doncaster, Victoria, Australia). Human Cot1 DNA (10 μg) and polydA (2 μg) were added to the purified probe mix and dried before redissolving in 4 × SSC, 50% deionised formamide and 0.25% SDS. Following incubation at 95°C for 5 min and 45°C for 90 min, the labelled probe mix was loaded on to a Human V6 custom microarray prepared in house. Following hybridisation, the microarray chip was washed in 0.2 × SSC, 0.05% SDS, followed by 0.2 × SSC and centrifuged at low speed to dry. Cy3 and Cy5 fluorescence on the microarray chip were detected with a GMS 418 Array Scanner (Genetic Microsystems, Woburn, MA, USA) using Imagene™ (BioDiscovery, El Segundo, CA, USA). Data generated using Imagene were normalised and filtered using the GeneSpring™ (GeneWorks Pty Ltd, The Barton, South Australia) software. Normalisations included per spot and per chip intensity-dependent (Lowess) normalisations; data transformation set measurements less than 0.01–0.01 and per chip normalisations to the 50th percentile. The Human V6 microarray, consisting of 4600 cDNA probes ∼200 bp in length spotted in duplicate on a single chip, was developed in-house and its use has been described by us previously (Burger et al, 2002).Quantitative reverse transcription PCRPrimers for the candidate genes were designed using Taqman (PE Applied Biosystems, Foster City, CA, USA) guidelines and optimised using Amplitaq Gold. The following primers were synthesised: β2-microglobulin forward 5′-TGAATTCGTATGTGTCTGGGT-3′, β2-microglobulin reverse 5′-CCTCCATGATGCTGCTTACAT-3′; claudin-4 forward 5′-AGCTCTGTGGCCTCAGGACTCT-3′, claudin-4 reverse 5′-CAGTGATGAATAGCTCTTCTTAAATTACAA-3′; DAD1 forward 5′-CAACCCACAGAACAAAGCGG-3′, DAD1 reverse 5′-CTGCCATCTCCAGAACTCTTATCC-3′; POX1 forward 5′-GCTGGAAACCTGGCAGTGATAC-3′, POX1 reverse 5′-CAAAGGAAGAAAGGCTGGTCTCTC-3′; TPD52 forward 5′-GCTGCTTTTTGCTCTGTTGGC-3′ and TPD52 reverse 5′-TTTTCTGGAAGAGGCTCCGTGG-3′. Real-time PCRs were performed in 15 μl volumes (cDNA, 1 × Plantinum® SYBR Green Quantitative PCR SuperMix-UDG (Life Technologies™) and 5 pmol each primer) using a 32-well Rotorgene real-time PCR machine (Corbett Life Science, Mortlake, New South Wales, Australia). Cycles consisted of a 94°C, 2 min hot start, 15 s 94°C denaturing step, a 15 s 55°C annealing step and a 15 s 72°C extension step for 35–40 cycles. The PCR finished with a melt curve between 55 and 100°C. Expression of each gene was calculated using a standard curve determined by expression of β2-microglobulin (β2M) in the control normal prostate cell line, RWPE1. Prostate-specific antigen was used to confirm that the RNA was of prostatic origin. Expression of each gene was determined in an average of 18 BPH, 17 PCa and 5 metastatic lesions. The transcript value of each gene was normalised in Excel by determining ratio of the candidate gene transcript/β2M transcript value. Results are presented as mean±s.e.Western blot analysisCells were washed and lysed in lysis buffer (20 mM Tris pH 8.0, 1 mM EDTA, 1 mM (p-amidinophenyl) methanesulfonyl fluoride hydrochloride and 1% (v/v) Triton X-100) as described by Liu et al (1997). Protein concentration was estimated using the DC protein Assay (Bio-Rad Laboratories Pty Ltd, Gladesville, New South Wales, Australia) and BSA protein standards. The protein (20 μg) samples were mixed with loading buffer (2 × : 0.5 ml β-mercaptoethanol, 20% (v/v) glycerol, 2% (v/v) SDS, 37.3 M bromophenol blue, 0.25 M Tris, pH 8.8) and heated to 100°C for 2 min. Samples were resolved on a 15% polyacrylamide gel (15% (v/v) acrylamide, 0.375 M Tris pH 8.8, 0.1% (v/v) SDS, 0.1% (w/v) ammonium persulfate and 4 μl TEMED in 10 ml) with stacking gel (1.5% (v/v) acrylamide, 0.038 M Tris pH 6.8, 0.03% (v/v) SDS, 0.03% (w/v) ammonium persulfate and 3 μl TEMED) at 20 mA in running buffer (25 mM Tris, 0.19 M Glycerine, 0.1% (v/v) SDS in H2O). Proteins were transferred onto a nitrocellulose membrane in a carbonate buffer (10 mM NaHCO3, 3 mM Na2CO3, 20% (v/v) methanol in H2O) at 40 V for 3 h at 4°C. Membranes were blocked in 5% (w/v) skim milk powder in 0.05% (v/v) Tween 20 in PBS (PBST) for 1 h at RT and probed overnight with anti-claudin-4 mouse antibody (3 μg per 10 ml in PBST; Zymed® Laboratories, San Francisco, CA, USA). Secondary anti-mouse IgG antibody conjugated to horseradish peroxidase (HRP) (Chemicon Australia Pty Ltd, Boronia, Victoria, Australia) was added for 1 h at 4°C. Following washing with PBST, proteins were detected using ECL Western blotting procedure (Amersham/GE Healthcare Biosciences Pty Ltd, Rydalmere, New South Wales, Australia) following the manufacturer's instructions. β-actin was also assayed to confirm protein loading was equal for all samples.Immunofluorescent staining of claudin-4 in prostate cell linesALVA41, DU145, LNCaP, PC3, RWPE1 and HeLa cells (1 × 104) cultured in six-well plates were washed in 1% (v/v) FCS in PBS and fixed in 4% paraformaldehyde for 30 min at room temperature. Cells were washed, permeabilised with 0.1% (v/v) Triton X-100 in PBS for 30 min, washed again and blocked in 5% skim milk in PBST for 30 min. After removal of blocking reagent, the fixed cells were washed and incubated with the mouse anti-claudin-4 antibody (3 μg ml−1) for 1 h at RT. Cells were again washed and incubated with the secondary anti-mouse IgG conjugated to FITC for 20 min. Cells were rinsed, stained with DAPI for 10 min, washed again and the coverslip inverted onto a slide with a drop of 80% (v/v) glycerol. The cells were visualised using a Carl Zeiss fluorescence microscope (Axioskop 2 plus MOT).Immunohistochemistry on paraffin-embedded sectionsThe paraffin-embedded prostate tissue sections were obtained from patients with a range of prostate conditions, including 29 benign prostate, 19 BPH, 19 PIN with no associated cancer, 25 PCa (including 21 with associated PIN) and 45 metastatic sections from a range of distant sites. Paraffin-embedded prostate tissue sections were processed as previously described (Burger et al, 2002). The paraffin tissue sections were rehydrated in xylene for 5 min and rinsed in 100% ethanol followed by 70% (v/v) ethanol and PBS. Antigen retrieval within the sections was performed by covering the slides in citrate buffer for 15 min at 105°C and left to cool to room temperature. The slides were incubated in 2% (v/v) hydrogen peroxidase for 15 min to inactivate endogenous peroxidases. Slides were washed in PBS and blocked with 10% (v/v) goat serum and the primary antibody (anti-claudin-4 raised in mouse, 3 μg ml−1; anti-AMACR raised in mouse, 3 μg ml−1; Zymed) overnight in a humidifier chamber. Control slides were treated as above without the addition of the primary antibody. The following day, sections were washed twice in PBS for 5 min and incubated with anti-mouse IgG HRP-conjugated secondary antibody (DakoCytomation, EnVision+® System: Dako Australasia Pty Ltd, Kingsgrove, Australia) for 20 min at room temperature. The labelled secondary antibody was visualised by adding a substrate containing diaminobenzadine (Zymed), and sections were counter-stained, dehydrated and mounted.ResultsIdentification of metastatic markers for prostate cancerWe previously identified a number of genes upregulated in PCa, which when used in combination represent useful biomarkers for detection of this disease (Landers et al, 2005). As an extension of this approach to relate these and additional markers of primary PCa to PCa metastases, gene expression profiling was carried out for three PCa metastatic tumour cell lines (ALVA41, DU145 and LNCaP) and compared with the normal prostate cell line, RWPE1. Reference RNA was also included by pooling total RNA from a selection of different cell types. The cell lines were indirectly labelled with Cy dyes and hybridised to an approximately 4600 gene in-house cDNA microarray chip. After an initial identification of the genes upregulated in the pooled tumour lines compared with the control cell line, RPWE1, these genes were plotted on a Venn diagram that allowed for identification of a short list of 51 genes upregulated twofold or greater, common to all three cell lines (Figure 1). A list of these genes is presented in Table 1. Potential biomarker candidate genes were selected not only on the basis of fold change but also on the basis of a number of other criteria that included twofold upregulation, published literature describing expression in prostate, PCa or other cancers, function, potential as a biomarker and whether the gene encoded a membrane protein suitable for possible use in a diagnostic test. On the basis of these criteria, we radically reduced the number of candidate genes to four, claudin-4, defender against cell death 1 (DAD1), peroxiredoxin 1 (POX1) and tumour protein D52 (TPD52), which were upregulated 3.7-, 2.1-, 3.3- and 3.2-fold, respectively (Table 1).Confirmation of overexpression of these four genes was then undertaken using real-time RT–PCR. When upregulation of claudin-4, DAD1, POX1 and TPD52 was averaged across the three PCa cell lines compared with RWPE1, values of 35-, 20-, 23- and 17-fold respectively, were observed (Figure 2), confirming data from the cDNA microarray. Quantitative PCR was also employed to compare the expression of these genes in BPH, primary tumours and metastatic lesions. Claudin-4 was significantly (P=0.00001) upregulated by sixfold in PCa specimens (mean=17.7) compared with BPH (mean=2.8; Figure 3 and Table 2). Similarly, claudin-4 was significantly (P=0.00001) upregulated by fivefold in PCa metastases (mean=14.2) compared with BPH. No significant difference was observed between primary PCa and PCa metastases. DAD1 was significantly (P=0.005) upregulated twofold in PCa (mean=0.44) compared with BPH (mean=0.18; Figure 3 and Table 2). The sevenfold difference between PCa metastases (mean=1.26) and BPH was significant (P=0.0001) as well as the threefold difference between PCa and PCa metastases (P=0.003). POX1 was expressed significantly (P=0.012) threefold higher in PCa (mean=0.96) compared with BPH (mean=0.36) and ninefold (P=0.001) higher in BPH compared with PCa metastases (mean=3.4) and fourfold (P=0.003) higher in PCa metastasis compared with PCa (Figure 3; Table 2). TPD52 was significantly (P=0.007) overexpressed in PCa (mean=0.89) compared with BPH (mean=0.20) by fivefold. The sevenfold difference between PCa metastases (mean=1.41) and BPH was significant (P=0.008) but the twofold difference between PCa and PCa metastases was not significant (P=0.066). Although the difference in transcript ratio between BPH and PCa was significant for all four biomarkers, claudin-4 was selected for further studies because of its high differential level of expression overall.Expression and localisation of claudin-4 in prostate cancer cell linesImmunoblotting was used to verify whether the increase in claudin-4 transcript was also observed at the protein level. Claudin-4 was present in all the metastatic prostate tumour cell lines and decreased in the order of expression, PC3, DU145, LNCaP and ALVA41 (Figure 4). Low levels of claudin-4 protein were also detected in RWPE1, but, as expected, no protein was detected in HeLa cells. The level of proliferating cell nuclear antigen (β-actin ∼42 kDa) served as a loading control (Figure 4).Immunofluorescence was used to determine the localisation of claudin-4 protein in the different cell lines (Figure 5A–F). The nuclei of cells were stained with DAPI (Figure 5G–L) and the images merged (Figure 5M–R). Claudin-4 staining was localised predominantly in the cell membrane, with diffuse staining in the cytoplasm of the metastatic prostate cell lines ALVA41, DU145, LNCaP and PC3 (Figure 5M–P). Some membranous staining was observed in ALVA41, DU145 and LNCaP cells (Figure 5M–O). However, PC3 cells had a localised region of the membrane with intense claudin-4 staining (Figure 5P). No claudin-4 staining was evident in RWPE1 or the negative control HeLa cell line above background (Figure 5Q–R).Expression of claudin-4 in prostate tissueAs claudin-4 was expressed at variable amounts in the prostate cell lines, it was important to determine whether upregulation and overexpression were also present in PCa primary and secondary tissues. Intensity of claudin-4 expression was classified as negative (−), light (+), moderate (++), strong (+++) or intense positive (++++). The percentage of cells stained were categorised as either < 25, 25–50% or >50% of cells within the section. In addition, staining was compared with that of PSMA and AMACR (Jiang et al, 2001; Rubin et al, 2002). Immunohistochemical analysis was undertaken on a range of prostatic sections including, normal prostate, BPH, HG-PIN, PCa and metastases. Benign epithelium in which claudin-4 and PSMA did stain positively was localised to the cell membrane of luminal cells. Membranous staining for claudin-4 and PSMA was also observed in luminal cells of HG-PIN and in carcinoma cells. AMACR was localised to the cytoplasm of luminal cells of benign epithelium or HG-PIN and to the cytoplasm of carcinoma cells. Basal epithelium and the surrounding stromal cells did not stain positively for claudin-4, AMACR or PSMA. These findings are illustrated in Figure 6. AMACR staining was localised to the cytoplasm of cells. Claudin-4 staining was localised predominantly to the membrane with weaker cytoplasmic staining, which seemed to be variable. Similarly, PSMA was localised predominantly to the membrane.Normal prostate sectionsIn the 29 normal prostate sections collected, claudin-4 was localised to the cell membrane of luminal cells at a moderate intensity in 24% (7 out of 29), at a low intensity in 66% (19 out of 29) and was absent in 10% (3 out of 29) of the sections (Figure 6A; Table 3). Approximately 25–50% of the cells stained positively in most sections. There was no correlation with level of claudin-4 expression in the prostate and age. In the normal prostate sections, AMACR staining was weak in 20% (3 out of 15) of sections and absent in 80% (12 out of 15). Prostate-specific membrane antigen was present at moderate levels of expression in 14% (2 out of 14), at low levels in 79% (11 out of 14) and was absent in 7% (1 out of 14) sections.Benign prostatic hyperplasiaFrom 19 BPH sections, consisting of nodules of hyperplastic glands and intervening stroma or stromal nodules (Foster, 2000), claudin-4 staining was strong in 10.5% (2 out of 19) of cases and moderate in 63.2% (12 out of 19) (Figure 6B; Table 2). The remaining sections had either low (21%; 4 out of 19) or no (5.26%; 1 out of 19) claudin-4 staining. Staining was localised to the membrane and in some cases to the cytoplasm of acinar cells. Weak AMACR staining was detected in 14% (2 out of 14), and the remaining 86% (12 out of 14) did not reveal any staining. Prostate-specific membrane antigen was expressed moderately in 31% (4 out of 13) and weakly in 54% (7 out of 13; Figure 6: Table 3). The remaining sections (15%; 2 out of 13) did not have any PSMA present.High-grade prostatic intraepithelial neoplasiaBoth focal and extensive HG-PIN, characterised by progressive basal layer disruption, loss of markers of secretory differentiation, nuclear and nucleolar abnormalities, increasing proliferative potential, microvessel density, variation in DNA content and allelic loss (Bostwick et al, 2004), were studied. Initially, 18 sections with HG-PIN without invasive carcinoma were examined for claudin-4 expression. From the 18 HG-PIN sections obtained, 72% (13 out of 18) were of a moderate intensity for claudin-4 expression (Figure 6C; Table 3). Within these sections, >50% of the cells were positive for claudin-4, with staining localised to the membrane of HG-PIN cells. The remaining 11% (2 out of 18) of sections were strong or 17% (3 out of 18) low. AMACR staining was high in 9% (1 out of 11), moderate in 9% (1 out of 11), low in 36% (4 out of 11) and absent in 46% (5 out of 11) of HG-PIN in the absence of invasive carcinoma. Prostate-specific membrane antigen was present at a high level in 9% (1 out of 11), at a low level in 55% (6 out of 11) and absent in 36% (4 out of 11) of sections.HG-PIN in the presence of PCaAs PCa is commonly associated with the presence of HG-PIN (Bostwick et al, 2000), PCa sections were collected from 25 individuals, with 21 of the sections containing HG-PIN and PCa. Strong staining for claudin-4 was present (71%; 15 out of 21), with moderate staining in 28.5% (6 out of 21) or >25% of cells (Figure 6D; Table 3). On the other hand, the majority of the invasive tumour cells studied exhibited moderate staining (64%; 16 out of 25) for claudin-4, whereas 24% (6 out of 25) were strong and 8% (2 out of 25) low. Interestingly, lower grade (Gleason grade 3) tumours had higher staining for claudin-4 compared with higher grade (Gleason grade 5) tumours (Figure 6E; Table 3). Furthermore, benign glands in the PCa sections were moderate (56%; 14 out of 25) to high (44%; 11 out of 25) for claudin-4 staining and, in some cases, higher than that found in invasive carcinoma cells.High-grade prostatic intraepithelial neoplasia cells found within PCa sections demonstrated low (32%; 6 out of 19) to moderate (21%; 4 out of 19) levels of expression for AMACR, with a small percentage staining high (10%; 2 out of 19). The remaining 37% (7 out of 19) did not have AMACR present. In invasive carcinoma cells, AMACR staining was intense in 5% (1 out of 21), high in 33% (7 out of 21), moderate in 24% (5 out of 21), low in 24% (5 out of 21) and absent in 14% (3 out of 21) of cases. Benign epithelial cells in those sections showed low staining for AMACR (5%; 1 out of 21), whereas the remaining (95%; 20 out of 21) sections did not show AMACR. Prostate-specific membrane antigen staining of HG-PIN cells in the presence of invasive carcinoma was high in 17% (3 out of 18) of sections, moderate in 44% (8 out of 18) and low in 39% (7 out of 18). In contrast, PSMA was high in 38% (8 out of 21) of sections containing invasive carcinoma cells, moderate in 38% (8 out of 21) and low in 24% (5 out of 21). The benign cells in these sections were high for PSMA in 33% (7 out of 21) of PCa sections and low in 52% (11 out of 21) of sections. The remaining 14% (3 out of 21) of sections did not have any PSMA present (Table 3).PCa metastatic lesionsAlthough lymph node and bone metastases predominate in patients with advanced PCa (Bubendorf et al, 2000), lesions from a wide range of secondary sites were studied (45 sections in total). Specimens from both androgen-intact and androgen-suppressed patients were isolated from a range of tissues including lymph nodes (18 out of 45), bone (8 out of 45), liver (1 out of 45), lung (1 out of 45), penile (2 out of 45), seminal vesicles (2 out of 45) and biopsies of pelvic retroperitoneal tumours (13 out of 45). From the 45 tumour metastases sections examined, 36% (16 out of 45) had strong, 29% (13 out of 45) had moderate, 20% (9 out of 45) had low and 7% (3 out of 45) had negative staining for claudin-4. It was also observed that a small percentage (9%; 4 out of 45) of metastases showed intense staining for claudin-4. Furthermore, in 47% of sections of metastases, >50–100% of carcinoma cells stained positively for claudin-4 (Figure 6F; Table 3). Those sections with intense claudin-4 staining included liver, lymph node, bone and lung metastases. AMACR expression was high in 16% (6 out of 38) of sections and moderate in 92% (11 out of 38). Twenty-six per cent (10 out of 38) of the sections had low staining for AMACR, whereas the remaining (29%; 11 out of 38) of sections had no AMACR staining. Prostate-specific membrane antigen staining of sections with metastases revealed high levels in 44% (7 out of 16), moderate levels in 31% (5 out of 16) and low levels in 25% (4 out of 16) of sections (Table 3).DiscussionIn previous work, we examined the expression profiles of prostatic tissues using cDNA microarrays, which revealed δ-Catenin and PSMA to be significantly overexpressed in primary PCa tumours compared with BPH (Burger et al, 2002). In addition, we revealed that a combination of four PCa biomarkers, UDP-N-acetyl-α-D-galactosamine transferase (GalNAc-T3), PSMA, Hepsin and DD3/PCA3 represented a powerful new approach for detecting all PCa cells by molecular profiling (Landers et al, 2005). The present study was designed to extend this approach to encompass metastases in addition to primary PCa. Fifty-one genes were upregulated in all three of the metastatic cell lines and of these claudin-4, DAD1, POX1 and TPD52 were selected for detailed evaluation. From the four candidate genes, our findings indicated that claudin-4 had the greatest potential as a PCa biomarker for both primary tumours and metastases.Claudins are essential components of tight junction structures (Morita et al, 1999) and show a distinct organ-specific distribution in the body (Rahner et al, 2001). Claudin-4 encodes a 209 amino-acid (22 kDa) protein that contains four putative transmembrane regions (Katahira et al, 1997a) sharing close homology with claudin-3. Both claudin-4 and claudin-3 (to a lesser extent) function as receptors for Clostridium perfringens enterotoxin (CPE) (Katahira et al, 1997b), the virulence factor responsible for the symptoms of C. perfringens strain A food poisoning. By targeting intestinal epithelial cells, CPE is thought to act by forming small pores to increase membrane permeability with a subsequent loss of osmotic equilibrium resulting in cell lysis (Stark and Duncan, 1971; Matsuda and Sugimoto, 1979).There have been previous reports to indicate that claudin-4 is upregulated in primary breast (Kominsky et al, 2004; Tokes et al, 2005), ovarian (Rangel et al, 2003; Agarwal et al, 2005; Santin et al, 2005), prostate (Long et al, 2001; Sheehan et al, 2007) squamous cell carcinoma (Morita et al, 2004) and pancreatic cancers (Michl et al, 2001, 2003; Nichols et al, 2004; Sato et al, 2004) but is downregulated in gastric cancer (Lee et al, 2005). In this study, the increasing prominence of claudin-4 compared with other candidate genes evaluated at both RNA and protein levels was confirmed with highest levels in PCa metastatic cells. Long et al (2001) observed claudin-4 expression in metastatic prostate tissue samples; however, they failed to observe expression in the metastatic cell lines LNCaP and PC3, attributing this inconsistency to the possibility of alterations induced with long periods of passaging (Long et al, 2001). Interestingly, we found that claudin-4 localisation in PC3 cells was confined to only a sector of the membrane but the reasons for this finding are unclear. One possible explanation is a loss of cellular organisation due to a defect in tight junction formation or cell polarity, features common in tumour cells (Weinstein et al, 1976).Immunohistochemical staining in situ confirmed localisation of claudin-4 and PSMA to the membrane of luminal cells of benign epithelial glands and HG-PIN as well as PCa cells (Chang et al, 1999), with increasing expression for claudin-4 from benign, through premaligant to malignant, being most evident in metastatic PCas. In the few cases in which AMACR was present in benign glands or HG-PIN, it was localised to the cytoplasm of luminal cells (Hameed and Humphrey, 2005) with a similar localisation in PCa cells. Normal prostate sections exhibited a low level of staining for claudin-4 and PSMA, but the majority was negative for AMACR. Benign prostatic hyperplasia glands stained primarily with a moderate intensity for claudin-4 compared with PSMA and AMACR, which stained at low intensity and negatively, respectively.High-grade prostatic intraepithelial neoplasia, previously considered to be an invariable precursor lesion of PCa and commonly found in association with PCa, does not always proceed to invasive carcinoma and, when it does, this may develop decades later (Montironi et al, 2002). In considering this relationship, sections containing HG-PIN without associated invasive carcinoma were of moderate intensity for claudin-4 and of low intensity for PSMA and AMACR. Cells containing HG-PIN in association with invasive carcinoma exhibited strong levels of claudin-4 staining. In contrast, AMACR levels were low and PSMA levels moderate. This observation that claudin-4 expression is increased in HG-PIN in the presence of PCa may indicate that claudin-4 plays a role in the early events of PCa development.Although a moderate level of staining for claudin-4 was evident in the majority of invasive PCa cells, a closer examination of tumour sections revealed that claudin-4 expression tended to be higher in lower grade carcinomas compared with those of higher grades (Gleason 5) (data not shown). Furthermore, epithelial cells in surrounding benign glands within the PCa sections also had moderate to strong claudin-4 staining. As cellular organisation is lost in cancer, not uncommonly a reduction in tight junction function is observable, consistent with changes in cellular polarity associated with increased cellular mobility (Weinstein et al, 1976).Prostate cancer metastases examined by immunohistochemistry were from a range of secondary sites. Most of the metastatic tumours stained positively for claudin-4, with the majority classified as strong or intense and only a minority registering moderate expression. No difference was evident in specimens from androgen-suppressed and nonandrogen-suppressed patients (data not shown). Furthermore, there did not appear to be a correlation with type of metastatic site and the intensity of claudin-4 expression: those sections with the strongest claudin-4 staining were from liver, lymph node, bone and lung. Although decreased polarity and differentiation are regarded as important for the metastatic phenotype, to enable individual cells to leave the primary site and enter the circulation to reach distant sites (Martin and Jiang, 2001), circumstances are different in established metastases in which a reversal is required to permit growth of established secondary lesions (Yang et al, 2006).Sheehan et al (2007) in their evaluation of 141 RP specimens reported an increase in claudin-4 expression in advanced-stage tumours compared with adjacent benign glands and concluded that claudin-4 expression persisted in PCa and correlated with an adverse prognosis. In contrast, our study of both primary and secondary lesions examined 182 sections from patients with a range of prostate conditions to provide a better understanding of the role of claudin-4 in the prostate and in tumour progression: our findings are consistent with current concepts of the carcinogenesis/invasion process. A further difference to the report from Sheehan et al (2007) is that our immunohistochemical analysis of claudin-4 was supported by a comparative evaluation of AMACR and PSMA, two well-established PCa markers.In a small study of pancreatic cancer, Michl et al (2003) concluded that claudin-4 expression tended to be stronger in well-differentiated tumours compared with poorly differentiated tumours, which correlates with the expression pattern observed within PCa primary lesions in this study. Also, in primary pancreatic cancer sections, Nichols et al (2004) reported that immunohistochemical expression of claudin-4 was present in pancreatic intraepithelial neoplasia cells and in all of the metastatic cancers examined (Nichols et al, 2004) reflecting our observation that claudin-4 expression was present in all HG-PIN sections associated with PCa.It is not known what regulates claudin-4 expression; however, studies in pancreatic cancer have implicated the TGF-β pathway (Michl et al, 2003). TGF-β is known as a potent mediator of tumour progression by inducing cell spreading, migration, angiogenesis and tumour cell invasion (Wikstrom et al, 1998; Massague et al, 2000). A study into the regulation of claudin-4 by TGF-β revealed that this cytokine downregulated claudin-4 expression within pancreatic cancer, which may be the mechanism by which TGF-β promotes tumour invasion (Michl et al, 2003). Furthermore, inhibition of Ras signalling by dominant-negative Ras and specific inhibitors of downstream effectors, mitogen-activated protein/extracellular signal-regulated kinase kinase and phosphatidylinositol 3′-kinase, has been suggested to decrease claudin-4 expression (Michl et al, 2003). More recently, overexpression of claudin-4 in ovarian cancer was found to be partly regulated by a small region in the claudin-4 promoter-containing Sp1 sites (Honda et al, 2006). The claudin-4 promoter is also controlled by epigenetic modifications (Boireau et al, 2007). It was revealed that cells overexpressing claudin-4 exhibited low DNA methylation and high histone H3 acetylation of the critical claudin-4 promoter region with the converse observed for cells expressing low levels of claudin-4 (Boireau et al, 2007). Studies are currently underway in our laboratory to determine if this mechanism is also responsible for the regulation of claudin-4 in the prostate.The results obtained within this study have revealed a distinct and progressing pattern of claudin-4 expression within the prostate with noncancerous pathological changes as well as in PCa and PCa metastases by RT–PCR and immunohistochemistry of both primary and secondary tumours. In addition, elevated levels of claudin-4 were observed in suspected premalignant and malignant lesions.Many genes and proteins have been proposed as useful markers for diagnosis, imaging and therapeutic targeting in PCa. In diagnosis, the large proportion of those nominated was related to an aggressive phenotype with relatively few identified as potential indicators of low risk PCa. With burgeoning numbers of this category of patients being identified as a consequence of PSA screening, there is a pressing need for low-risk disease markers, particularly for those men considering close observation (Smith and Catalona, 1994; Hoedemaeker et al, 2000). However, before claudin-4 can be considered for any role in this regard despite its proclivity to be overexpressed preferentially in lower Gleason score tumours, further evaluation is essential. Similarly, its potential as a target for imaging or therapy must remain speculative until further definitive research is undertaken.\n\nREFERENCES:\n1. Agarwal R, D'Souza T, Morin PJ (2005) Claudin-3 and claudin-4 expression in ovarian epithelial cells enhances invasion and is associated with increased matrix metalloproteinase-2 activity. Cancer Res\n65: 7378–738516103090\n2. Boireau S, Buchert M, Samuel MS, Pannequin J, Ryan JL, Choquet A, Chapuis H, Rebillard X, Avancès C, Ernst M, Joubert D, Mottet N, Hollande F (2007) DNA-methylation-dependent alterations of claudin-4 expression in human bladder carcinoma. Carcinogenesis\n28: 246–25816829686\n3. Bostwick DG, Liu L, Brawer MK, Qian J (2004) High-grade prostatic intraepithelial neoplasia. Rev Urol\n6: 171–17916985598\n4. Bostwick DG, Norlen BJ, Denis L (2000) Prostatic intraepithelial neoplasia: the preinvasive stage of prostate cancer. Overview of the prostate committee report. Scand J Urol Nephrol Suppl\n205: 1–2\n5. Bubendorf L, Schopfer A, Wagner U, Sauter G, Moch H, Willi N, Gasser TC, Mihatsch MJ (2000) Metastatic patterns of prostate cancer: an autopsy study of 1589 patients. Hum Pathol\n31: 578–58310836297\n6. Burger MJ, Tebay MA, Keith PA, Samaratunga HM, Clements J, Lavin MF, Gardiner RA (2002) Expression analysis of delta-catenin and prostate-specific membrane antigen: their potential as diagnostic markers for prostate cancer. Int J Cancer\n100: 228–23712115574\n7. Chang SS, Reuter VE, Heston WD, Bander NH, Grauer LS, Gaudin PB (1999) Five different anti-prostate-specific membrane antigen (PSMA) antibodies confirm PSMA expression in tumor-associated neovasculature. Cancer Res\n59: 3192–319810397265\n8. Foster CS (2000) Pathology of benign prostatic hyperplasia. Prostate Suppl\n9: 4–1411056496\n9. Freedland SJ, Presti Jr JC, Amling CL, Kane CJ, Aronson WJ, Dorey F, Terris MK, SEARCH Database Study Group (2003) Time trends in biochemical recurrence after radical prostatectomy: results of the SEARCH database. Urology\n61: 736–74112670557\n10. Fusi A, Procopio G, Della Torre S, Ricotta R, Bianchini G, Salvioni R, Ferrari L, Martinetti A, Salvelli G, Villa S, Bajetta E (2004) Treatment options in hormone-refractory metastatic prostate carcinoma. Tumori\n90: 535–54615762353\n11. Hameed O, Humphrey PA (2005) p63/AMACR antibody cocktail restaining of prostate needle biopsy tissue after transfer to charged slides: a viable approach in the diagnosis of small atypical foci that are lost on block sectioning. Am J Clin Pathol\n124: 708–71516203278\n12. Hanahan D, Weinberg RA (2000) The hallmarks of cancer. Cell\n100: 57–7010647931\n13. Hankey BF, Feuer EJ, Clegg LX, Hayes RB, Legler JM, Prorok PC, Ries LA, Merrill RM, Kaplan RS (1999) Cancer surveillance series: interpreting trends in prostate cancer – part I: Evidence of the effects of screening in recent prostate cancer incidence, mortality, and survival rates. J Natl Cancer Inst\n91: 1017–102410379964\n14. Hessels D, Klein Gunnewiek JMT, van Oort I, Karthaus HFM, van Leenders GJL, van Balken B, Kiemeney LA, Witjes JA, Schalken JA (2003) DD3(PCA3)-based molecular urine analysis for the diagnosis of prostate cancer. Eur Urol\n44: 8–1512814669\n15. Hoedemaeker RF, Rietbergen JB, Kranse R, Schröder FH, van der Kwast TH (2000) Histopathological prostate cancer characteristics at radical prostatectomy after population based screening. J Urol\n164: 411–41510893598\n16. Honda H, Pazin MJ, Ji H, Wernyj RP, Morin PJ (2006) Crucial roles of Sp1 and epigenetic modifications in the regulationof the CLDN4 promoter in ovarian cancer cells. J Biol Chem\n281: 21433–2144416714763\n17. Jiang Z, Woda BA, Rock KL, Xu Y, Savas L, Khan A, Pihan G, Cai F, Babcook JS, Rathanaswami P, Reed SG, Xu J, Fanger GR (2001) P504S: a new molecular marker for the detection of prostate carcinoma. Am J Surg Pathol\n25: 1397–140411684956\n18. Katahira J, Inoue N, Horiguchi Y, Matsuda M, Sugimoto N (1997a) Molecular cloning and functional characterization of the receptor for Clostridium perfringens enterotoxin. J Cell Biol\n136: 1239–12479087440\n19. Katahira J, Sugiyama H, Inoue N, Horiguchi Y, Matsuda M, Sugimoto N (1997b) Clostridium perfringens enterotoxin utilizes two structurally related membrane proteins as functional receptors in vivo. J Biol Chem\n272: 26652–266589334247\n20. Kominsky SL, Vali M, Korz D, Gabig TG, Weitzman SA, Argani P, Sukumar S (2004) Clostridium perfringens enterotoxin elicits rapid and specific cytolysis of breast carcinoma cells mediated through tight junction proteins claudin 3 and 4. Am J Pathol\n164: 1627–163315111309\n21. Landers KA, Burger MJ, Tebay MA, Purdie DM, Scells B, Samaratunga H, Lavin MF, Gardiner RA (2005) Use of multiple biomarkers for a molecular diagnosis of prostate cancer. Int J Cancer\n114: 950–95615609297\n22. Lee SK, Moon J, Park SW, Song SY, Chung JB, Kang JK (2005) Loss of the tight junction protein claudin 4 correlates with histological growth-pattern and differentiation in advanced gastric adenocarcinoma. Oncol Rep\n13: 193–19915643498\n23. Liu H, Moy P, Kim S, Xia Y, Rajasekaran A, Navarro V, Knudsen B, Bander NH (1997) Monoclonal antibodies to the extracellular domain of prostate-specific membrane antigen also react with tumor vascular endothelium. Cancer Res\n57: 3629–36349288760\n24. Long H, Crean CD, Lee WH, Cummings OW, Gabig TG (2001) Expression of Clostridium perfringens enterotoxin receptors claudin-3 and claudin-4 in prostate cancer epithelium. Cancer Res\n61: 7878–788111691807\n25. Martin TA, Jiang WG (2001) Tight junctions and their role in cancer metastasis. Histol Histopathol\n16: 1183–119511642738\n26. Massague J, Blain SW, Lo RS (2000) TGFbeta signaling in growth control, cancer, and heritable disorders. Cell\n103: 295–30911057902\n27. Matsuda M, Sugimoto N (1979) Calcium-independent and dependent steps in action of Clostridium perfringens enterotoxin on HeLa and Vero cells. Biochem Biophys Res Commun\n91: 629–636229852\n28. Michl P, Barth C, Buchholz M, Lerch MM, Rolke M, Holzmann KH, Menke A, Fensterer H, Giehl K, Löhr M, Leder G, Iwamura T, Adler G, Gress TM (2003) Claudin-4 expression decreases invasiveness and metastatic potential of pancreatic cancer. Cancer Res\n63: 6265–627114559813\n29. Michl P, Buchholz M, Rolke M, Kunsch S, Löhr M, McClane B, Tsukita S, Leder G, Adler G, Gress TM (2001) Claudin-4: a new target for pancreatic cancer treatment using Clostridium perfringens enterotoxin. Gastroenterology\n121: 678–68411522752\n30. Montironi R, Mazzucchelli R, Scarpelli M (2002) Precancerous lesions and conditions of the prostate: from morphological and biological characterization to chemoprevention. Ann N Y Acad Sci\n963: 169–18412095942\n31. Morita K, Furuse M, Fujimoto K, Tsukita S (1999) Claudin multigene family encoding four-transmembrane domain protein components of tight junction strands. Proc Natl Acad Sci USA\n96: 511–5169892664\n32. Morita K, Tsukita S, Miyachi Y (2004) Tight junction-associated proteins (occludin, ZO-1, claudin-1, claudin-4) in squamous cell carcinoma and Bowen's disease. Br J Dermatol\n151: 328–33415327539\n33. Nichols LS, Ashfaq R, Iacobuzio-Donahue CA (2004) Claudin 4 protein expression in primary and metastatic pancreatic cancer: support for use as a therapeutic target. Am J Clin Pathol\n121: 226–23014983936\n34. Ornstein DK, Tyson DR (2006) Proteomics for the identification of new prostate cancer biomarkers. Urol Oncol\n24: 231–23616678055\n35. Rahner C, Mitic LL, Anderson JM (2001) Heterogeneity in expression and subcellular localization of claudins 2, 3, 4, and 5 in the rat liver, pancreas, and gut. Gastroenterology\n120: 411–42211159882\n36. Rangel LB, Agarwal R, D'Souza T, Pizer ES, Alò PL, Lancaster WD, Gregoire L, Schwartz DR, Cho KR, Morin PJ (2003) Tight junction proteins claudin-3 and claudin-4 are frequently overexpressed in ovarian cancer but not in ovarian cystadenomas. Clin Cancer Res\n9: 2567–257512855632\n37. Ross JS, Sheehan CE, Fisher HA, Kaufman Jr RP, Kaur P, Gray K, Webb I, Gray GS, Mosher R, Kallakury BV (2003) Correlation of primary tumor prostate-specific membrane antigen expression with disease recurrence in prostate cancer. Clin Cancer Res\n9: 6357–636214695135\n38. Rubin MA, Zhou M, Dhanasekaran SM, Varambally S, Barrette TR, Sanda MG, Pienta KJ, Ghosh D, Chinnaiyan AM (2002) alpha-Methylacyl coenzyme A racemase as a tissue biomarker for prostate cancer. JAMA\n287: 1662–167011926890\n39. Santin AD, Cane S, Bellone S, Palmieri M, Siegel ER, Thomas M, Roman JJ, Burnett A, Cannon MJ, Pecorelli S (2005) Treatment of chemotherapy-resistant human ovarian cancer xenografts in C.B-17/SCID mice by intraperitoneal administration of Clostridium perfringens enterotoxin. Cancer Res\n65: 4334–434215899825\n40. Sato N, Fukushima N, Maitra A, Iacobuzio-Donahue CA, van Heek NT, Cameron JL, Yeo CJ, Hruban RH, Goggin M (2004) Gene expression profiling identifies genes associated with invasive intraductal papillary mucinous neoplasms of the pancreas. Am J Pathol\n164: 903–91414982844\n41. Sheehan GM, Kallakury BV, Sheehan CE, Fisher HA, Kaufman Jr RP, Ross JS (2007) Loss of claudins-1 and -7 and expression of claudins-3 and -4 correlate with prognostic variables in prostatic adenocarcinomas. Hum Pathol\n38: 564–56917306334\n42. Smith DS, Catalona WJ (1994) The nature of prostate cancer detected through prostate specific antigen based screening. J Urol\n152: 1732–17367523720\n43. Sommerfeld HJ, Meeker AK, Piatyszek MA, Bova GS, Shay JW, Coffey DS (1996) Telomerase activity: a prevalent marker of malignant human prostate tissue. Cancer Res\n56: 218–2228548767\n44. Stark RL, Duncan CL (1971) Biological characteristics of Clostridium perfringens type A enterotoxin. Infect Immun\n4: 89–964343403\n45. Stephan C, Yousef GM, Scorilas A, Jung K, Jung M, Kristiansen G, Hauptmann S, Kishi T, Nakamura T, Loening SA, Diamandis EP (2004) Hepsin is highly over expressed in and a new candidate for a prognostic indicator in prostate cancer. J Urol\n171: 187–19114665873\n46. Tokes AM, Kulka J, Paku S, Szik A, Páska C, Novák PK, Szilák L, Kiss A, Bögi K, Schaff Z (2005) Claudin-1, -3 and -4 proteins and mRNA expression in benign and malignant breast lesions: a research study. Breast Cancer Res\n7: R296–R30515743508\n47. Weinstein RS, Merk FB, Alroy J (1976) The structure and function of intercellular junctions in cancer. Adv Cancer Res\n23: 23–89179291\n48. Wikstrom P, Stattin P, Franck-Lissbrant I, Damber JE, Bergh A (1998) Transforming growth factor beta1 is associated with angiogenesis, metastasis, and poor clinical outcome in prostate cancer. Prostate\n37: 19–299721065\n49. Yang J, Mani SA, Weinberg RA (2006) Exploring a new twist on tumor metastasis. Cancer Res\n66: 4549–455216651402"
+}

batch_2/PMC2527797.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2527797",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2527797\nAUTHORS: D Puliti, G Miccinesi, N Collina, V De Lisi, M Federico, S Ferretti, A C Finarelli, F Foca, L Mangone, C Naldoni, M Petrella, A Ponti, N Segnan, A Sigona, M Zarcone, M Zorzi, M Zappa, E Paci\n\nABSTRACT:\nThe aim of this study was the evaluation of the impact of service screening programmes on breast cancer mortality in five regions of Italy. We conducted a matched case–control study with four controls for each case. Cases were defined as breast cancer deaths occurred not later than 31 December 2002. Controls were sampled from the local municipality list and matched by date of birth. Screening histories were assessed by the local, computerised, screening database and subjects were classified as either invited or not-yet-invited and as either screened or unscreened. There were a total of 1750 breast cancer deaths within the 50 to 74-year-old breast cancer cases and a total of 7000 controls. The logistic conditional estimate of the cumulative odds ratios comparing invited with not-yet-invited women was 0.75 (95% CI: 0.62–0.92). Restricting the analyses to invited women, the odds ratio of screened to never-respondent women corrected for self-selection bias was 0.55 (95% CI: 0.36–0.85). The introduction of breast cancer screening programmes in Italy is associated with a reduction in breast cancer mortality attributable to the additional impact of service screening over and above the background access to mammography.\n\nBODY:\nBreast cancer screening has been shown in several randomised clinical trials (RCTs) conducted between the mid-1960s and mid-1980s to be effective in reducing breast cancer mortality (IARC, 2002).Mammographic screening is now widespread in western countries but access modalities differ. In the United States, the use of screening is based on spontaneous access to mammographic facilities, usually associated with a clinical breast examination and with different guidelines on age range and screening interval (Smith-Bindman et al, 2003; Smith et al, 2007). In Europe service screening is a public health initiative, offering two-views mammography every 2 years, in which all women of the target population (in Italy, 50–69 years of age) are invited to participate (Perry et al, 2006). Programme performance indicators have been developed in accordance with European guidelines and assessments have been reported (Lynge et al, 2003; Giordano et al, 2006). The first screening programme in Italy was started at the beginning of the 1990s in the cities of Florence and Turin, and since then other programmes have been started in other regions. In 2006 the National Centre for Screening Monitoring reported a coverage of more than 90% of the target population in northern and central Italy (Zappa and Rosselli Del Turco, 2007).Now that screening is widespread, two questions become relevant: (a) are the effects of breast cancer screening under usual conditions within the community comparable with those detected by the RCTs (Harris, 2005), and (b) is service screening able to have an additional impact over and above the background, spontaneous use of mammography in the population?There are several methods to assess the effectiveness of screening for reducing breast cancer mortality. In particular, incidence-based mortality and geographical comparisons have been used (Paci et al, 2002; Duffy et al, 2002a; Olsen et al, 2007). However, the case–control study is a traditional tool for the evaluation of screening outcome (Collette et al, 1984; Verbeek et al, 1984; Palli et al, 1986), although with high methodological complexity (Walter, 2003; Fielder et al, 2004; Elmore et al, 2005), and was used in several studies at the end of the eighties. The case–control study design has been used because of its efficiency. The collection of screening histories of a limited number of controls allows a more accurate and valid evaluation than it is possible for the whole invited or screened population. Several statistical simulations, like the one by Connor et al, (2000), have shown that, with adequate study design, the case–control study results are comparable to the observed in prospective cohort studies. Estimates of mortality reduction from randomised trials and case–control studies have been compared in review (Demissie et al, 1998).The aim of this case–control study has been to evaluate the effectiveness of service screening programmes in reducing breast cancer mortality in the Italian areas participating in the IMPACT study. The outcome is interpreted as the additional impact of the organised programme offered to the community over and above the usual care in that population, that is, the existing, background access of target women to mammography.Materials and methodsThe IMPACT studyThe IMPACT database (Zorzi et al, 2006) was collected from cancer registries data of in situ and invasive breast cancer cases diagnosed between 1988 and 2001 in women aged 40–79, resident in 17 areas mainly located in central and northern Italy. All cases were followed up for living status and the specific cause of death was obtained from the regional mortality registers. All cases were linked to the screening files and classified by detection method as either screen-detected, not screen-detected but with at least one screening test, never-respondent to the screening invitation or diagnosed before the screening invitation.The case–control study designAll areas where both screening and a cancer registry were active were included in the case–control study. The study base was the dynamic population of women aged 50–74 years resident in the selected areas between the year before the start of service screening and 2001 (i.e., all women who were resident in the areas for any period of time during the study period were eligible for the study).Cases were defined as breast cancer deaths as reported in death certificates occurred not later than 31 December 2002 in the study base. To check for the information bias because of possible misclassification of cause of death, all deaths within breast cancer cases diagnosed in the study base were included in the study and a sensitivity analysis using deaths for whatever cause was performed.Each case was matched to four controls using incidence–density sampling. The risk set for each case was defined as the women resident in the municipality in the subject's year of death. Controls were individually matched to the fatal breast cancer cases by area of residence and date of birth (±3 months). All controls had to be free of breast cancer up to the date of diagnosis of the matched case (the eligibility was assessed by linkage with the cancer registry).Cases and controls were only enrolled if they were resident in their municipality from at least 2 years before the date of case diagnosis or from the screening programme start date.Definition of exposureThe service screening histories of cases and controls, including the date of their first invitation and the dates of all their screening tests following the invitation, if any, were extracted from the local, computerised, screening database. All and only mammography tests performed in service screening, that is, following an invitation to be screened, were included in the analysis, regardless of the actual test result.The date of incidence reported in the cancer registry and the date of pseudodiagnosis for controls (i.e., the date of censoring the screening history for controls) were selected as the index dates for the classification of subjects as either invited or not-yet-invited and as either screened or unscreened.Statistical modelling using microsimulation has been implemented by Connor et al. (2000) showing how estimates of mortality odds ratios are influenced by the choice of a time window in which controls are eligible to be screened. If a matched case is detected clinically, the date of pseudodiagnosis of the control should be defined as the date of diagnosis of the matched case (so excluding later screening test). Screen-detected breast cancer cases live without symptoms in a period corresponding to the diagnostic anticipation. Therefore detection at screening shortens a matched control's opportunity to be screened. On the basis of the results of microsimulation, Connor et al (2000) postulated that the definition of exposure to screening should include any screen up to the time the case would have been clinically diagnosed in the absence of screening. To compensate for the lead time owing to screen detection, the pseudodiagnosis date of the controls matched to each screen-detected case was postponed for 1 year by allowing the controls to be screened for a duration comparable with the preclinical detectable phase.Statistical analysesWe present firstly the analysis by allocation, that is, invited vs not-yet-invited women. In Italy, a large proportion of women waited for 2–4 years after the official programme start date before receiving their invitation to an appointment for the mammography test. This waiting time was an expected logistical and organisational consequence of enrolling the whole target population.Our second analysis is the comparison of the mortality for breast cancer between screened and unscreened women (i.e., never-respondent plus not-yet-invited women). The inclusion of not-yet-invited women in the reference category with the never-respondent women would likely decrease the possible distortion of the comparison, but the combining of the two groups is not, per se, a guarantee of an unbiased estimate. In fact, respondent women might be different from never-respondent women because of the so-called ‘self-selection bias’: those screened have elected to be screened whereas those never screened (after the invitation) have refused the offer to be screened, thereby introducing a self-selection bias into the allocation of exposure (Cuzick et al, 1997).Finally we compare screened with never-respondent women. The method proposed by Duffy et al (2002b), to correct for selection bias and thus obtain the effect of screening in potential attendees, was applied. The odds ratio corrected for selection bias was estimated with the following formula, where p is the attendance rate and φ is the crude uncorrected odds ratio and Dr is the mortality differential between never-respondent and not-yet-invited women:  To estimate the mortality differential Dr, the odds ratio of never-respondent to not-yet-invited women was calculated.The odds ratios and 95% confidence intervals were calculated using conditional logistic regression retaining individual matching for birth cohort and area of residence. The statistics package used for the analyses was STATA 9.2.ResultsA total of 2371 deaths within breast cancer cases diagnosed in the target population of women aged 50–74 years were included in the study. Four controls were matched to each case by date of birth and municipality of residence for a total of 9484 controls (1 : 4). A total of 1750 (73.8%) deaths were caused by breast cancer.Patient characteristics and screening history by case–control status are presented in Table 1. The year of screening activation is different between programmes and it varies from the early 1990s in Tuscany and Piedmont to the late 1990s in Veneto. The average age at diagnosis/pseudodiagnosis was 62.3 years for cases and 62.2 years for controls. The 37.5 and 39.6% among cases and controls respectively had been invited to screening. Considering invited women only, 54.8 and 38.0% had never attended to screening among cases and controls respectively. Mean age at first screening was 59.2 for cases and 60.0 for controls.Screen-detected cases accounted for 10.3% of breast cancer deaths, 6.6% were diagnosed in not screen-detected women with at least one screening test and 20.6% in never-respondent women. The remaining breast cancer deaths occurred among the not-yet-invited women. Among the case subjects who died for breast cancer, 173 (9.9%) were classified as early cancer at diagnosis (stage less than II) and 1301 (74.3%) were stage II+. The average age at death was 65.2 and average time from diagnosis to death was 2.9 years (range: <1–12 years), with mean times of 3.2 years for screen-detected breast cancer cases, 2.4 years for never-respondent women and 3.0 years for not-yet-invited women.The logistic conditional estimate of the odds ratios for risk of breast cancer deaths comparing invited with not-yet-invited women was 0.75 (95% CI: 0.62–0.92), a 25% mortality reduction, and the odds ratio comparing screened with unscreened women was 0.50 (95% CI: 0.42–0.59) (Table 2). These odds ratios do not vary significantly by age group (homogeneity test: P=0.278 and P=0.196, respectively).The odds ratios comparing screened with never-respondent women were performed including only cases and controls with at least one invitation to screening (N cases=657), to ensure that all subjects were comparable with respect to screening opportunity. The odds ratio of screened to never-respondent women was 0.46 (95% CI: 0.38–0.56), a 54% mortality reduction (Table 2). According to Duffy et al (2002b), the correction for selection bias brought to an estimate of the corrected odds ratio for screened to never-respondent women equal to 0.55 (95% CI: 0.36–0.85), a 45% mortality reduction, confirming the protective effect of screening for those women attending (Table 2). This corrected estimate has been obtained assuming 65% of attendance and estimating the mortality differential through the odds ratio of never-respondent to not-yet-invited women (1.11, 95% CI: 0.87–1.40).We performed a sensitivity analysis including deaths within breast cancer cases for whatever cause. The probability of dying for all causes for invited vs not-yet-invited women was 0.83 (95% CI: 0.70–0.98) and for screened vs unscreened women was 0.63 (95% CI: 0.55–0.73).DiscussionData from this study has been extracted from the Italian IMPACT database where all breast cancer cases have been classified by detection method and staged. The definition of the exposure to screening is based on computerised records of screening service. Breast cancer cases have been obtained from cancer registries (independent sources) and linked blind to the screening histories.With a study size of 1750 cases and 7000 matched controls, the study has 90% power (α=0.05) to detect an 18% difference in mortality between invited and not-yet-invited women.The results of this study show that service screening is associated with a 25% reduction in the probability of dying for breast cancer by allocation to screening invitation and with a 45% reduction when comparing screened with never-respondent women after correction for selection bias.The analysis by allocation allows an estimation of how much the organised screening programme has added to the background use of mammography. It should be considered as equivalent to an intention-to-treat, non-randomised analysis (Selby, 1994). Invited women included never-respondent women. Only screened cases benefit from a screening programme, and therefore the estimate of the impact of service screening is conditioned by the rate of compliance to the invitation. According to this analysis, our study has shown a reduction of breast cancer mortality within the range expected on the basis of RCTs reported in the literature (IARC, 2002). The summary estimate of the breast cancer mortality reduction, after pooling the results from eight RCTs, is equal to 24% (31–17%) (Demissie et al, 1998).The analyses by exposure to screening measures the benefit of screening among women who agree to be screened, and therefore the result may be affected by self-selection bias. We followed two different strategies to deal with this possible bias: the comparison of the mortality for breast cancer between screened and unscreened women, that is, never-respondent plus not-yet-invited, and the comparison of screened women with those never-respondent among the invited women corrected for self-selection (Duffy et al, 2002b). Both the estimates showed that service screening is effective in reducing breast cancer mortality by about 45–50% in women attending after invitation.In other recent case–control screening studies, there has been a range of results from small (Elmore et al, 2005) to large benefit (Fielder et al, 2004; Allgood et al, 2008). Elmore's study assesses the efficacy of screening in a context where the screening is based on spontaneous access to mammographic facilities, and the subject's screening history has been extracted from medical records. The lack of a reduction in breast cancer mortality may be partly because of a differential misclassification of the status of screening exposure. In contrast, in the case–control studies where the aim is to evaluate service-screening programmes, only mammography tests performed following an invitation have been included in the analysis. The design of these studies is rather similar to ours; in UK the study by Allgood et al (2008) estimated a 65% reduction of breast cancer mortality in women attending screening, whereas the study by Fielder et al (2004) estimated a 38% reduction.Screened and never-respondent women could have a different background access to mammography, as well as other differences related to the measure of the screening effect. To fully control this selection bias, we performed the analysis using the method proposed by Duffy et al (2002b). This method of correction for self-selection bias, which has been used in several case–control studies (Fielder et al, 2004; Allgood et al, 2008), makes the crucial assumption that the relative excess mortality for ‘non-compliers’ compared with a population not invited for screening is the same in the programme in question as in the RCTs (pooled estimate: 36%). The estimate of the relative mortality obtained from RCTs is too high for the Italian service-screening programme where the participation rate is lower and therefore the difference between compliers and non-compliers is not expected to be so large. From the information available in our dataset, we estimated a 11% relative excess mortality for never-respondent women and we used this internal estimate in the correction for self-selection bias.Exposure is theoretically defined as screening (invitation or test) that takes place within that period before the time at which the case would have been diagnosed in the absence of screening. In empirical studies the time of diagnosis in the absence of screening for cancer is not observable and it is necessary, therefore, to use estimates of the average duration of the preclinical phase. We have assumed a 1-year time lag in exposure for controls matched to screen-detected cases. To evaluate the impact on the odds ratio of different time lags, we performed a sensitive analysis. The estimates of the odds ratios comparing invited with not-yet-invited women were 0.82 and 0.72 using time lags of 6 months and 1.5 years, respectively. The odds ratios comparing screened to unscreened women were 0.54–0.49, respectively.We considered the possible information bias due to misclassification of cause of death (Gill and Horwitz, 1995). Extending the analysis to deaths for whatever cause, we obtained an estimate of 17% for the mortality reduction for invited women and 37% for screened women. A possible bias in the attribution of the cause of death cannot be excluded, but it seems implausible that it could explain all of the observed benefit.We also considered the possibility that improvements in breast cancer treatment could have affected our estimate on the impact of screening, as far as the comparison of invited vs not-yet-invited is concerned. As a matter of fact the median year of diagnosis is 1 year more recent for invited with respect to not-yet-invited women. We do not think that important treatment improvements had occurred in so short a period. Furthermore, we previously showed in two of the areas participating in the IMPACT study that the improvement in survival rates were almost completely explained by stage distribution and not by increase of the survival rate by stage (Paci et al, 2005).Few screen-detected breast cancer cases were dead at the end of follow-up (10.4% of the total deaths), and the majority of deaths were among the not-yet-invited and never-respondent women. This is the expected outcome if early diagnosis by mammographic screening is changing the probability of dying for breast cancer. Longer follow-up can confirm that service screening will continue to achieve a reduction of mortality for breast cancer.In conclusion, the present study shows that the introduction of breast cancer screening programmes in Italy is associated with a reduction in breast cancer mortality, consistent with the results of randomised trials of mammographic screening and attributable to the additional impact of service screening over and above the background access to mammography.\n\nREFERENCES:\n1. Allgood PC, Warwick J, Warren RML, Day NE, Duffy SW (2008) A case-control study of the impact of the East Anglian breast screening programme on breast cancer mortality. Br J Cancer\n98: 206–20918059396\n2. Collette HJ, Day NE, Rombach JJ, de Waard F (1984) Evaluation of screening for breast cancer in a non-randomized study (the DOM project) by means of a case-control study. Lancet\n1: 1224–12266144934\n3. Connor RJ, Boer R, Prorok PC, Weed DL (2000) Investigation of design and bias issues in case-control studies of cancer screening using microsimulation. Am J Epidemiol\n151: 991–99810853638\n4. Cuzick J, Edwards R, Segnan N (1997) Adjusting for non-compliance and contamination in randomized clinical trial. Statist Med\n16: 1017–1029\n5. Demissie K, Mills OF, Rhoads GG (1998) Empirical comparison of the results of randomized controlled trials and case-control studies in evaluating the effectiveness of screening mammography. J Clin Epidemiol\n51: 81–919474068\n6. Duffy SW, Cuzick J, Tabar L, Vitak B, Hsiu-Hsi Chen T, Yen MF, Smith RA (2002b) Correcting for non-compliance bias in case-control studies to evaluate cancer screening programmes. J Royal Stat Soc Series C\n51: 235–243\n7. Duffy SW, Tabar L, Chen HH, Holmqvist M, Yen MF, Abdsalah S, Epstein B, Frodis E, Ljungberg E, Hedborg-Melander C, Sundbom A, Tholin M, Wiege M, Akerlund A, Wu HM, Tung TS, Chiu YH, Chiu CP, Huang CC, Smith RA, Rosén M, Stenbeck M, Holmberg L (2002a) The impact of organized mammography service screening on breast carcinoma mortality in seven Swedish counties. Cancer\n95: 458–46912209737\n8. Elmore JG, Reisch LM, Barton MB, Barlow WE, Rolnick S, Harris EL, Herrinton LJ, Geiger AM, Beverly RK, Hart G, Yu O, Greene SM, Weiss NS, Fletcher SW (2005) Efficacy of breast cancer screening in the community according to risk level. J Natl Cancer Inst\n97: 1035–104316030301\n9. Fielder HM, Warwick J, Brook D, Gower-Thomas K, Cuzick J, Monypenny I, Duffy SW (2004) A case-control study to estimate the impact on breast cancer death of the breast screening programme in Wales. J Med Screen\n11: 194–19815563774\n10. Gill TM, Horwitz RI (1995) Evaluating the efficacy of cancer screening: clinical distinctions and case-control studies. J Clin Epidemiol\n48: 281–2927869074\n11. Giordano L, Giorgi D, Frigerio A, Bravetti P, Paci E, Petrella M, Ponti A, de' Bianchi PS, Gruppo Italiano per lo Screening Mammografico (2006) Process indicators and standards for the evaluation of breast cancer screening programmes. Epidemiol Prev\n30(Suppl 1): 5–9, 11–47\n12. Harris R (2005) Effectiveness: the next question for breast cancer screening. J Natl Cancer Inst\n97: 1021–102316030293\n13. IARC Handbooks of Cancer Prevention (2002) Breast Cancer Screening. Vol 7. IARC: Lyon\n14. Lynge E, Olsen AH, Fracheboud J, Patnick J (2003) Reporting of performance indicators of mammography screening in Europe. Eur J Cancer Prev Jun\n12(3): 213–222. Review\n15. Olsen AH, Njor SH, Lynge E (2007) Estimating the benefits of mammography screening: the impact of study design. Epidemiology\n18(4): 487–49217486020\n16. Paci E, Duffy SW, Giorgi D, Zappa M, Crocetti E, Vezzosi V, Bianchi S, del Turco MR (2002) Quantification of the effect of mammographic screening on fatal breast cancer: the Florence Programme 1990–96. Br J Cancer\n87(1): 65–6912085258\n17. Paci E, Ponti A, Zappa M, Patriarca S, Falini P, Delmastro G, Bianchi S, Sapino A, Vezzosi V, Senore C, Crocetti E, Frigerio A, Zanetti R, Del Turco MR, Segnan N (2005) Early diagnosis, not differential treatment, explains better survival in service screening. Eur J Cancer\n41(17): 2728–273416239106\n18. Palli D, Del Turco MR, Buiatti E, Carli S, Ciatto S, Toscani L, Maltoni G (1986) A case-control study of the efficacy of a non-randomized breast cancer screening programme in Florence (Italy). Int J Cancer\n38(4): 501–5043093391\n19. Perry N, Broeders M, de Wolf C, Tornberg S, Holland R, von Karsa L, Puthar E (2006) (eds) European Guidelines for Quality Assurance in Breast Cancer Screening and Diagnosis. 4th edn, Office for Official Publications of the European Commission: Luxembourg\n20. Selby JV (1994) Case-control evaluation of treatment and program efficacy. Epidemiologic Rev\n16(1): 90–101\n21. Smith RA, Cokkinides V, Eyre HJ (2007) Cancer screening in the United States, 2007: a review of current guidelines, practices, and prospects. CA Cancer J Clin\n57(2): 90–10417392386\n22. Smith-Bindman R, Chu PW, Miglioretti DL, Sickles EA, Blanks R, Ballard-Barbash R, Bobo JK, Lee NC, Wallis MG, Patnick J, Kerlikowske K (2003) Comparison of screening mammography in the United States and the United kingdom. JAMA\n290(16): 2129–213714570948\n23. Verbeek AL, Hendriks JH, Holland R, Mravunac M, Sturmans F, Day NE (1984) Reduction of breast cancer mortality through mass screening with modern mammography. First results of the Nijmegen project, 1975–81. Lancet\n1(8388): 1222–12246144933\n24. Walter SD (2003) Mammographic screening: case-control studies. Ann Oncol\n14(8): 1190–119212881374\n25. Zappa M, Rosselli Del Turco M (2007) The National Centre for Screening Monitoring: 5th Report. Epidemiol Prev\n31(Suppl 2): 7–32\n26. Zorzi M, Puliti D, Vettorazzi M, De Lisi V, Falcini F, Federico M, Ferretti S, Moffa IF, Mangone L, Mano MP, Naldoni C, Ponti A, Traina A, Tumino R, Paci E, IMPACT Working Group (2006) Mastectomy rates are decreasing in the era of service screening: a population-based study in Italy (1997–2001). Br J Cancer\n95(9): 1265–126817043685"
+}

batch_2/PMC2528002.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2528002",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2528002\nAUTHORS: Andrej Benjak, Astrid Forneck, Josep M. Casacuberta\n\nABSTRACT:\nBackgroundThe grapevine is a widely cultivated crop and a high number of different varieties have been selected since its domestication in the Neolithic period. Although sexual crossing has been a major driver of grapevine evolution, its vegetative propagation enhanced the impact of somatic mutations and has been important for grapevine diversity. Transposable elements are known to be major contributors to genome variability and, in particular, to somatic mutations. Thus, transposable elements have probably played a major role in grapevine domestication and evolution. The recent publication of the complete grapevine genome opens the possibility for an in deep analysis of its transposon content.Principal FindingsWe present here a detailed analysis of the “cut-and-paste” class II transposons present in the genome of grapevine. We characterized 1160 potentially complete grapevine transposons as well as 2086 defective copies. We report on the structure of each element, their potentiality to encode a functional transposase, and the existence of matching ESTs that could suggest their transcription.ConclusionsOur results show that these elements have transduplicated and amplified cellular sequences and some of them have been domesticated and probably fulfill cellular functions. In addition, we provide evidences that the mobility of these elements has contributed to the genomic variability of this species.\n\nBODY:\nIntroductionThe grapevine (Vitis vinifera L.) is a widely cultivated crop that has accompanied the development of human culture since its domestication in the Neolithic period (c. 8500-4000 BC). Cultivated grapevine (Vitis vinifera spp. sativa) is supposed to have been domesticated from wild grapevine populations (Vitis vinifera spp. sylvestris Gmelin) in the Near East, from where its culture expanded through Europe [1], although recent results suggest that different domestication events took place in both East and West Europe [2], [3]. The domestication of grapevine has undergone a selection for traits important for its cultivation and usage (e.g. vigor, hermaphrodite flowers, berry content and size, cluster structure). Although sexual crossing has been a major driver of grapevine evolution, its vegetative propagation enhanced the impact of somatic mutations and has been important for grapevine diversity. Clonal selection of superior individuals identified by growers has led to many clones with different phenotypes while maintaining the same cultivar [4]. Some of these mutations exist and are maintained in a chimeric state affecting only single cell layers [5], the phenotype of the plant being the result of the combination in different cells of two different genotypes.Transposable elements (TEs) are known to be major contributors to genome variability and, in particular, to somatic mutations. Plant genomes contain high albeit variable amounts of TEs that account for 15–80% of their genome. Most plant TEs are activated in somatic cells by different biotic and abiotic stresses including wounding, and they are usually silent in germinal cells, which limits their mutagenic capacity and their ability to colonize plant genomes (e.g. [6]). The propagation of grapevine includes layering (in the native habitats), cutting of dormant and green shoots, grafting and sometimes tissue culture steps. This practice enhances the impacts of somatic mutations and possibly increases the chance of TEs to transpose and multiplicate. Thus, TEs could have been a major force creating the variability used for grapevine breeding from its domestication to present times. Indeed, the skin color in white grapes, a highly desired trait for grape berry and wine quality, has been shown to be the consequence of a retrotransposon insertion in the promoter of a Myb-related gene that regulates anthocyanin biosynthesis [7]. This mutation is present in most white grape varieties [8], [9].Transposable elements are usually classified in two major groups based on their structure and transposition mechanism: Retrotransposons or class I elements, which transpose by an RNA intermediate, and class II or DNA transposons, which use an intermediate of DNA. Up to now, in addition to Gret1, the element responsible for the grape color phenotype, two other retrotransposons have been characterized in grapevine [10], [11]. On the contrary, although there is a handful of sequences of grapevine class II elements deposited in the Repbase database (www.girinst.org) up to now no DNA transposon has been characterized in detail in this plant.Recently, two articles describing the Vitis genome have been published [12], [13] and shotgun sequences of grapevine genome have been made available opening the possibility for a genome-wide bioinformatical analysis. We present here a global and detailed analysis of the “cut-and-paste” class II transposons present in the genome of Vitis vinifera L. We characterized 1160 potentially complete grapevine transposons as well as 2086 defective copies. Our results show that these elements have transduplicated and amplified cellular sequences and some of them have probably been domesticated (i.e. have lost their ability to transpose and fulfill cellular functions, as a conventional cellular gene). In addition, we provide evidences of recent mobility of some of these elements showing the high mutagenic capacity of grapevine transposons and their capacity to induce genomic variability in this species.Results and DiscussionThe “cut-and-paste” transposon landscape in Vitis vinifera\nMost class II transposons excise from the donor site as double-stranded DNA which is reinserted elsewhere in the genome by a mechanism usually known as “cut-and-paste” transposition. The only class II elements that transpose by a different mechanism are Helitrons and related elements, that transpose by rolling-circle replication, Mavericks, whose transposition mechanism is not yet known [14], and the bacterial IS200/605 family of insertion sequences that transpose as a single stranded transposon circle [15], [16]. “Cut-and-paste” class II transposons typically contain terminal inverted repeats (TIRs) and encode a transposase that catalyses their mobilization. The sequence and structure of the transposase together with the sequence of the TIRs recognized by this protein and the characteristics of the flanking target site duplication generated by the transposase upon inserting the element has been used to classify class II elements in ten different superfamilies: CACTA, hAT, Merlin, Mutator, P element, PIF, piggyBac, Tc1/Mariner, Transib and Banshee\n[14], [17], [18]. In plants, only elements belonging to the CACTA, hAT, Mutator, PIF, and Tc1/Mariner superfamilies have been described to date [14].We searched the grapevine genome sequence for the presence of class II transposons of the five superfamilies by means of blastx searches of the shotgun sequences made publicly available by Velasco et al. [13] and using the sequences made available later by Jaillon et al. [12] for confirmation (see Materials and Methods section for details). We have not been able to detect any grapevine sequence that could represent a Tc1-Mariner element. Although few sequences with very limited similarity (below the threshold set) to these elements exist, they probably represent old defective elements and were not included in this analysis. We found representatives of the other superfamilies of elements: CACTA, hAT, Mutator, PIF. We have characterized a total of 1160 potentially complete DNA transposons, as well as 2086 defective elements, which altogether represent 1.98% of the Vitis genome (Table 1).10.1371/journal.pone.0003107.t001Table 1Total number and genome coverage of class II elements in Vitis vinifera.SuperfamilyCopiesN° of full length copies1\nN° of deleted copiesMbCoverage\nhAT\n14595978623.640.66%\nPIF\n236931430.60.11%\nMutator\n11723318414.730.86%\nCACTA\n3641242401.90.34%Total323111452\n208610.871.98%1These are copies which have at least 90% of the putative transposase gene and represent potential full length elements (see Materials and Methods for details).2Domesticated TEs were not included (15 in total).The two recent reports on the draft sequence of the genome of Vitis vinifera spp. sativa contain a general analysis giving an overview of the transposon content in this genome [12], [13]. Both reports predict higher copy numbers of DNA-transposon-related sequences (6,344 and 9,562 respectively) compared to our results, but with substantially lower transposon content in terms of genome fraction (0.43% and 1.6% respectively). The reported mean length of the described copies is low (0.3 Kb/element and 0.9 Kb/element respectively), possibly because the characterized sequences are limited to the well conserved coding regions of TEs and thus miss most of the transposon sequences which are non-coding. We have performed a stringent search and have characterized these elements in their full sequence (up to the TIRs when present) omitting only TEs deleted copies representing less than 20% of the length of the complete TE representative for each family. Employing these parameters for analysis is crucial to research the structure and possible mobility of TEs, and analyze their capacity to transduplicate sequences or become domesticated. Our analysis shows the mean TE length of 3.3 Kb/element, which is more than three times bigger when compared with previous reports.In order to get insight on the evolutionary dynamics of class II TEs in grapevine we conducted a detailed TE analysis: For each superfamily we have compared the protein sequence of the putative transposase of all elements containing a transposase conserved region characteristic of this superfamily (see Methods for details). Maximum likelihood trees were generated from protein sequence alignments which allowed us to define different families for each transposon superfamily. We have analyzed the presence of STOP codons and frameshifts in the potential ORFs as well as the existence of ESTs in the grapevine databases that could suggest transcription of transposases and possible transpositional activity. Defective elements were identified for each family by blastn analyses using representatives of complete TEs as queries.\nhAT is the most prevalent superfamily of transposons in grapevineWe have found 1459 hAT-related elements in the grapevine genome, which makes hATs as the most prevalent “cut-and-paste” transposon family in grapevine in terms of copy number (Table 1). The phylogenetic analysis of these elements showed that they can be grouped in different families (Figure 1 and Table 2 and Dataset S1). Most of these families include a high copy number of both potentially complete and defective elements. Single copy elements were found as well. These elements possibly represent domesticated transposases and are discussed in a separate chapter (see below). The hAT elements belonging to the high copy number families contain TIRs of 8–23 bp, with sequences similar to that of typical hATs\n[19], and are flanked by TSDs of 8 bp, as expected for elements of this superfamily [19]. The hAT superfamily is relatively ancient and is widespread in eukaryote genomes [19]. Thus, the high variability of grapevine hATs, and the high proportion of defective elements is not unexpected. However, our results show that some grapevine hAT families contain potentially complete elements with the capacity to encode a transposase (Table 2), suggesting that some hATs could have maintained the capacity to transpose. This is the case of Hatvine-1, Hatvine-2, Hatvine-7, Hatvine-9 and Hatvine-10 families that contain a high number of potentially complete elements with intact ORFs and match to transcripts in the grapevine EST collections (Table 2).10.1371/journal.pone.0003107.g001Figure 1Maximum likelihood tree of the hAT superfamily.Bootstrap values higher than 50 are shown. Numbers in brackets show the number of sequences analyzed for each family. Names written in bold are Vitis families. Names in plain text are hAT elements from other plants with the first two letters representing the species name (Am = Antirrhinum majus, At = Arabidopsis thaliana, Os = Oryza sativa, Zm = Zea mays). DAYSLEEPER and r-gary1 are domesticated hAT-related transposases.10.1371/journal.pone.0003107.t002Table 2List of hAT-related families of transposons characterized in Vitis vinifera.Family nameLength of complete TE (kb)N° of TEs having >90% TPaseN° of TEs with potentially functional ORFsN° of deleted copiesTIR length in bpTSD length in bpN° of EST hitsRepresentativeCoordinates\nVinesleeper-1\n2.1110--4am486739.19525-7456\nVinesleeper-2\n2110--11am487463.24039-6070\nHatvine-1\n5.512573011889\nVIHAT1\nRepbase\nHatvine-2\n4.590196823815\nVIHAT2\nRepbase\nHatvine-3\n3.982281061683\nVIHAT3\nRepbase\nHatvine-4\n2.81?0--0am480519.15243-8086\nHatvine-5\n4.8110674am478512.27540-5033\nHatvine-6\nvariable3517591392\nhAT-6_VV\nRepbase\nHatvine-7\n3.988105617815\nhAT-7_VV\nRepbase\nHatvine-8\n*\n2.4100--0am448381.13245-5709\nHatvine-9\n2.9766113887am463419.27518-10707\nHatvine-10\n5.5679941187\nhAT-10_VV\nRepbase\nHatvine-11\n3.43106511-0\nhAT-11N_VV\nRepbase*\nHatvine-8 was not included in the phylogenetical analysis because it lacks the conserved domain used for the alignments (see Materials and Methods).\nCACTA is the less active superfamily of transposons in grapevine\nCACTA elements are the most abundant class II elements in Brassica oleracea\n[20] and also seem to be highly abundant in Triticum\n[21] while they are much less abundant in Arabidopsis\n[20] where they have been found almost exclusively in pericentromeric regions [22]. In grapevine we have found only 364 CACTA elements, one third of which are potentially complete (Table 3 and Dataset S2). However, as grapevine CACTAs are very long (ranging from 10 to 25 Kb) these elements account for a significant fraction of the grapevine genome (0.34%). The high diversity of the CACTA superfamily in grapevine, which can be divided in at least nine different families, and the low number of elements having an intact transposase-encoding ORF, suggests that grapevine CACTA are relatively old elements, and most of them are probably defective. Moreover, grapevine databases contain a low number of EST sequences corresponding to the CACTA elements described here, suggesting that most of them are probably silent at present. Of the nine CACTA families only Cactavine-2, Cactavine-5 and Cactavine-13 seem to have retained the capacity to be transcribed (Table 3). Interestingly these subfamilies are phylogenetically related and may have arisen recently during grapevine evolution (Figure 2).10.1371/journal.pone.0003107.g002Figure 2Maximum likelihood tree of the CACTA superfamily.Bootstrap values higher than 50 are shown. Numbers in brackets show the number of sequences analyzed for each family. Dashed line shows a clade of elements sharing a high similarity of the transposase gene among different families. Names written in bold are Vitis families. Families containing an ULP1-like region are labeled with a triangle. Names in plain text are CACTA elements from other plants taken from Repbase or NCBI with the first two letters representing the species name (Am = Antirrhinum majus, At = Arabidopsis thaliana, Os = Oryza sativa, Ph = Petunia×hybrida, Zm = Zea mays).10.1371/journal.pone.0003107.t003Table 3List of CACTA-related families of transposons characterized in Vitis vinifera.Family nameLength of complete TE (kb)N° of TEs having >90% TPaseN° of TEs with potentially functional ORFsN° of deleted copiesTIR length in bpTSD length in bpN° of EST hitsRepresentativeCoordinates\nCactavine-1\n13.4300458-0\nEnSpm1_VV\nRepbase\nCactavine-2\n14.4172185-6\nEnSpm2_VV\nRepbase\nCactavine-3\n151308530\nEnSpm-3_VV\nRepbase\nCactavine-4\n11.4181101630\nEnSpm-4_VV\nRepbase\nCactavine-5\n21–2514272334\nEnSpm-5_VV\nRepbase\nCactavine-6\n13.85081330\nEnSpm-6_VV\nRepbase\nCactavine-7\n?20110-0am424884.11597-26953\nCactavine-8\n10.51011--0\nEnSpm-8N_VV\nRepbase\nCactavine-9\n∼4005--0CAAP02001186.158559-52598\nCactavine-10\n∼5002--0am460863.19708-4784\nCactavine-11\n∼4002--0am469125.1155-3279\nCactavine-12\n?001--0am480617.1375-1681\nCactavine-13\n12.7242315-4\nEnSpm-13_VV\nRepbaseGrapevine contains elements of the three major MULE families MuDR, Jittery and Hop\nThe Mutator superfamily (named after the Mutator (Mu) element in maize [23]) is a highly abundant and diverse superfamily of class II elements in plants [24]. Elements belonging to the Mutator superfamily are generally called Mutator-like elements (MULEs). They are the most abundant transposons in many plant genomes such as Arabidopsis thaliana\n[20], Lotus japonicus\n[25] and Oryza sativa\n[26], [27]. While most autonomous MULEs encode a protein similar to the MURA transposase of the MuDR transposon (the autonomous version of the maize Mu element), two other families of MULEs distantly related to MuDR have been recently reported in plants. The Jittery family described in maize [28] and shown later to be present also in other plants [25] and a family related to the fungal Hop element [29] which in plants has so far only been found in legumes [25]. As the three subfamilies are only distantly related we have performed an independent search for MuDR-like elements and for elements related to the Jittery and Hop subfamilies. A high number of MULEs related to the three families, Mutator (MuDR), Jittery and Hop were identified (Table 4 and Dataset S3).10.1371/journal.pone.0003107.t004Table 4List of Mutator-related families of transposons characterized in Vitis vinifera.Family nameLength of complete TE (kb)N° of TEs having >90% TPaseN° of TEs with potentially functional ORFsN° of deleted copiesTIR length in bpTSD length in bpN° of EST hitsrepresentativecoordinates\nMUGvine-1\n1.8110--9am430496.26403-8211\nMUGvine-2\n2.1110--6am482126.13329-5578\nMUGvine-3\n1.7111--7am460323.15496-3745\nMUGvine-4\n2.2110--7am480719.130558-28296\nMUGvine-5\n1.1–1.7210--6am472189.18046-6928\nMUGvine-6\n2.5110--8am459930.18292-5740\nMUGvine-7\n2.3110--4am461949.294006-91664\nMUGvine-8\n2.9110--5am425404.112677-9702\nMutavine-1\n17.7 kb43123870-5\nMudravi1\nRepbase\nMutavine-2\n1128475180-9\nMudravi2\nRepbase\nMutavine-3\n9.2–9.44*\n058158-0\nMuDR-3_VV\nRepbase\nMutavine-4\n7.18*\n?57141–14490\nMuDR-4_VV\nRepbase\nMutavine-5\n4.56035-91\nMuDR-5_VV\nRepbase\nMutavine-6\n1020494-91\nMuDR-6_VV\nRepbase\nMutavine-7\n5.852971090\nMuDR-7_VV\nRepbase\nMutavine-8\n9–102617280-2\nMuDR-8_VV\nRepbase\nMutavine-9\n73331297891\nMuDR-9_VV\nRepbase\nMutavine-10\n2.5110--0am455011.18702-6234\nMutavine-11\n419012--0\nMuDR-11N_VV\nRepbase\nMutavine-12\n109562416–44192\nMuDR-12_VV\nRepbase\nMutavine-13\n8–938332--0\nMuDR-13_VV\nRepbase\nMutavine-14\n924450--0am426759.212676-3445\nMutavine-15\n?110--3am458922.14659-2101\nMutavine-16\n1.8110--0am471827.23011-1176\nMutavine-17\n∼10 kb6*\n437--15am434092.22041-10910\nMutavine-18\n16.24*\n011230–263-3am425680.23913-20102\nHopvine-1\n4.1207--0am471191.134-4066\nHopvine-2\n2.511---1am457042.17944-5360\nJitvine-1\n11.916220--7\nMuDR-21_VV\nRepbase\nJitvine-2\n14.435742--3am427034.215944-1482\nJithouse-1\n4.811---0am484711.133032-35173\nJithouse-2\n2.311---4am431471.222110-24383\nJithouse-3\n2.211---1am467237.21900-8454\nJithouse-4\n2.511---1am425354.246053-43540\nJithouse-5\n2.211---0am465780.15208-7475* = including the ULP-1 region.We have characterized a total of 1172 MULEs belonging to high copy number families, 30% probably corresponding to full-length elements (Figure 3 and Table 4). Most MuDR-like elements belonging to the high copy number families lack an intact transposase-encoding ORF and very few of them are represented in the grapevine EST collections (Table 4), suggesting that they are old elements that mostly have lost the capacity to transpose. The Mutavine-1 and Mutavine-17 families could be exceptions as judged by the number of ESTs corresponding to these elements found in the grapevine databases and the existence of several elements with conserved transposase ORFs (Table 4). We have only been able to find the TSDs for a subset of MULEs, probably because of the older age of grapevine MULE insertions. However when present the TSD are always of 9 nt which is typical for MULEs in other plant genomes. Typically, MULEs have long TIRs, although a fraction of them do not [30], [31]. 40% of the MULEs reported here (Mutavine-5, Mutavine-6, Mutavine-11, Mutavine-13, Mutavine-14 and Mutavine-17 families) do not contain TIRs, which is similar to what has been reported for Arabidopsis where one third of the MULEs are devoid of TIRs [30], [31]. Some of these MULE families are relatively old, and the absence of recognizable TIRs could simply be due to the effect of mutations. Nevertheless in some cases, like for the Mutavine-6 family, clear 9 nt-long TSDs were found, suggesting that these elements were mobilized in spite of their absence of TIRs, confirming the evidence found in Arabidopsis that non-TIR MULEs could be mobile [31]. It is interesting to note that the grapevine non-TIR MULE families do not form a monophyletic branch in a transposase-based tree (Figure 3A), suggesting a different phylogenetic history of the transposase-encoding sequences and the TIRs. This stresses the enormous variability of MULEs and their particular evolutionary dynamics [24].10.1371/journal.pone.0003107.g003Figure 3Maximum likelihood tree of the Mutator superfamily.Bootstrap values higher than 50 are shown. Numbers in brackets show the number of sequences analyzed for each family. Names written in bold are Vitis families. Names in plain text are Mutator elements from other plants (see Materials and Methods for details). Dashed lines represent domesticated mudrA transposases (MUG genes). Families in which no TIRs were found are labeled with black stars. Families containing an ULP1-like region are labeled with a triangle (pointing right for ULP1 orientated in the same frame as the TPase, pointing to the left for the opposite orientation). “A” represents all the MuDR-like families characterized in Vitis and “B” includes including the Jittery-like and Hop-like families with additional MuDR-like families for comparison.In addition to the MuDR-like MULEs, we have found two multi-copy families of the MULEs phylogenetically related to Jittery-like elements and one multi-copy family, Hopvine-1, phylogenetically related to Hop, (Figure 3B). While Jittery elements have been found to be present in various plant genomes, up to now Hop-like transposons were found only in fungi and in legumes, and it has been proposed that they may have arisen during the emergence of the legume family through an ancient horizontal transfer event between fungus and legume ancestor [25]. Our results show that the Hop family of MULEs is more widely distributed in plants than previously thought and suggest that if these elements have been introduced into plants by fungal infections, these would have occurred several times in the evolution and would affected different plant genera. Alternatively, Hop elements may be an old family in plants that has been lost in most genomes except in legumes and some other species like Vitis vinifera. The fact that none of the 9 copies of Hopvine-1 contains an uninterrupted ORF potentially coding for a transposase and that we have not detected any corresponding EST in the grapevine databases suggest that these elements are relatively old and have lost their capacity to be expressed and to transpose. On the contrary, the two Jittery-like families here characterized Jitvine-1 and Jitvine-2, are expressed and could have maintained their capacity to transpose. Both families (particularly Jitvine-1) contain elements potentially coding for a transposase and the grapevine databases contain several ESTs that could correspond to these elements (Table 4).Grapevine contains potentially active PIF but not Pong elementsWe have found a total of 236 PIF/Pong-related sequences in the grapevine genome. Pong elements have been shown to have undergone recent amplification in Arabidopsis and to a higher extend in Brassica oleracea whereas PIF elements have not been significantly amplified in both genomes [20]. The opposite was found in the genome of grapevine: PIF elements have attained a moderate copy number while no Pong element has been maintained in this genome (Figure 4). The analysis of the 236 grapevine PIFs shows that 93 of these elements are potentially complete, 24 of which have intact ORFs (Table 1 and 5; Dataset S4), which is the highest proportion of intact ORFs among all superfamilies analyzed in our study and strongly indicates that PIF elements have amplified recently during grapevine evolution. The phylogenetic analysis show that the grapevine PIFs group into four families and do not plot together to the families previously defined in other plant genomes [32] (Figure 4). This confirms a recent grapevine specific amplification of PIF elements. Moreover, these elements have conserved TIRs and TSDs (mostly TAA or TTA trinucleotides), have maintained the capacity to code for a transposase as well as the second ORF usually found in PIF elements and known as ORF1 or PIFp2 [32]–[34] (Table 5) and the grapevine database contains a relevant number of ESTs corresponding to PIF elements, especially from the Pifvine-3 and Pifvine-4 families (Table 5) confirming that these elements are transcribed and potentially active.10.1371/journal.pone.0003107.g004Figure 4Maximum likelihood tree of the PIF superfamily.Bootstrap values higher than 50 are shown. Numbers in brackets show the number of sequences analyzed for each family. Names written in bold are Vitis families. Names in plain text are PIF elements from other plants (see Materials and Methods for details). The Ping/Pong branch is bent to reduce picture size.10.1371/journal.pone.0003107.t005Table 5List of PIF-related families of transposons characterized in Vitis vinifera.Family nameLength of complete TE (kb)N° of TEs having >90% TPase*\nN° of TEs with potentially functional ORFsN° of deleted copiesTIR length in bpTSD length in bpN° of EST hitsrepresentativecoordinates\nPifvine-1\n5.7124252031\nHarbinger-1_VV\nRepbase\nPifvine-2\n7.2155232634\nVHARB-N2_VV\nRepbase\nPifvine-3\n6.7–5.83362523310\nHarbinger-3_VV\nRepbase\nPifvine-4\n53397035310\nVHARB-N4_VV\nRepbase* = including the ORF1.Transduplicated cellular gene fragments are present in all superfamilies of Vitis class II elementsTransposons can capture host genome sequences and mobilize and amplify them together with their own sequences in a process known as transduplication. Although most of these captured gene fragments seem to be non-functional pseudogenes [31], it has been recently reported that in some cases transduplicated exons could be incorporated into host transcripts by alternative splicing giving rise to new host proteins [35]. Even having lost their coding capacity, transduplicated sequences may undergo transcription and have a regulatory function [31].MULEs have been shown to frequently capture gene fragments and form Pack-MULEs [36]. MULEs containing transduplicated gene fragments have been reported in Arabidopsis\n[31], [37], Lotus japonicus\n[25], melon [38], and rice, were they reach a very high copy number [26], [36]. A particular case is the Arabidopsis KAONASHI-MULE (KI-MULE), a non-TIR MULE found in high copy number that contains a cystein protease domain of 200 amino acids found in ubiquitin-like protein-specific protease (ULP) [31]. In KI-MULEs, the ULP protease domain is found in the reverse orientation with respect to the mudrA gene. However, examples of ULP-containing MULEs in both direct and reverse orientation have been described also in melon and rice [38]. In addition, the ULP domain in melon can be found in TIR-MULEs and in the distantly related Jittery-like MULEs [38]. Our results show that several MULE families identified in grapevine contain sequences with high similarity to ULP genes downstream of the TPase encoding ORF. The ULP coding sequence is found in both orientations in both TIR-MULEs and non-TIR MULEs (Table 4). In addition to MuDR-like MULEs, some Jittery-like families of grapevine MULEs also contain ULP coding sequences downstream of the transposase ORF (Figure 3). The MULE families containing ULP sequences did not form a monophyletic group (Figures 2A and 2B). In fact, the ULP sequences are found in distantly related elements (MuDR-like and Jittery-like), being absent in other closely related families, and their presence does not correlate either with the presence or the absence of TIRs, suggesting that ULP transduplication by MULEs is a frequent phenomenon that has occurred independently several times during plant genome evolution. Alternatively, ULP sequences may be frequently lost from MULEs.In addition to MULEs, CACTA elements have also shown to transduplicate cellular genes [39], [40], although up to know none has been reported to contain an ULP transduplicated domain. We have found ULP domains in five CACTA families (Cactavine-2, Cactavine-3, Cactavine-4, Cactavine-5 and Cactavine-13). We have searched in NCBI for proteins containing the same conserved domain structures as the CACTA-ULP found in grapevine and found several proteins from rice that have the Tnp2 and the ULP1 domains. Therefore it appears that CACTA-ULPs are common in plants (although perhaps not equally abundant or functional in all genomes since we did not find any similar proteins in Arabidopsis or Medicago which are genetically closer to Vitis than rice is). This also suggests a special “affinity” of the ULP domain to transposons in general.ULP transduplication is only one example of transduplication. Other genic or non-genic sequences could be “captured” by TEs. For example, in the Mutators we have found a family containing intronic and exonic sequences of a putative cellulose synthase gene (Figure 5). In the CACTAs, two copies of the Cactavine-5 family contain part of the coding sequence and the 3′ untranslated region of a gene encoding for an unknown protein that contains a pentatricopeptide repeat (PPR) domain (Figure 5). This sequence, located downstream of the transposase encoding ORF is found in opposite orientation, and in case of being transcribed from the transposon promoter, would give rise to a transcript antisense to PPR genes with potential regulatory functions.10.1371/journal.pone.0003107.g005Figure 5Transduplications of genomic fragments found in different class II elements of Vitis.Thick lines represent TEs. Triangles are TIRs. For each source sequence the accession number is given and only for TEs coordinates are given as well. Arrows show the orientation of ORFs. All sequences are draw to the scale.Although transduplication has only been reported for MULEs and CACTA elements in plants, the fact that some of the PIF and hAT elements here described are unusually long has prompted us to analyze whether these elements contain transduplicated sequences as well. We have analyzed the elements of the Pifvine-3 family because they very frequently contain a long 5′ region (up to 3.5 kb) that do not correspond to the canonical ORF1 nor transposase coding regions characteristic for these elements. The analysis of these sequences showed that in most cases they share high sequence identity to grapevine genome sequences (including exons and introns) (Figure 5). These transduplications are shared in some cases by multiple copies suggesting that they do not inactivate the transposition of PIF elements. Elements of the hAT-family Hatvine-6 share a similar transposase coding sequence and the TIRs, but the rest of the sequence is often unique, or it is shared by only few elements. Analysis of the variable region of Hatvine-6 elements revealed that these sequences often share high sequence identity to genic (introns and exons) as well as non-genic grapevine sequences (Figure 5).Our results show that transduplications are common in grapevine TEs of all superfamilies. We suggest that most plant TEs share this ability as well. Because of their complicated structures and the difficulties to assemble an automated pipeline for their detection, transduplication events are not routinely reported in TE analyses. Thorough analyses, such as the one presented here, are needed to correctly characterize TEs and describe phenomena like the transduplication of cellular sequences.MULE and hAT domesticated transposonsTransposons can lose their ability to transpose and be a source of cellular genes in a process known as domestication. Transposases are specific DNA-binding proteins that catalyze DNA cleavage and strand transfer reactions needed for transposition. Both the DNA binding and the catalytic activity of transposases can be domesticated to give rise to cellular genes [41]. Examples of plant domesticated transposases are the Arabidopsis transcription factors FAR1 and FHY3, derived from MULE transposases [42], [43] or DAYSLEEPER, a gene essential for Arabidopsis development which probably encodes a transcription factor derived from a hAT transposase [44]. Other domesticated transposons of unknown function are the MUSTANG and the Gary elements, the former originated from MULE and the later from hAT transposons [45], [46]. Domesticated transposons are not able to transpose, and for this reason they are in general present as single-copy genes and do not contain TIRs or TSDs.Five hAT-like sequences found in our search are present in single copy and lack TIRs and TSDs: Vinesleeper-1, Vinesleeper-2, Hatvine-4, Hatvine-5 and Hatvine-8. The Vinesleeper-1 and Vinesleeper-2 elements are phylogenetically closely related to the Arabidopsis DAYSLEEPER (Figure 1) and one of them could be its grapevine orthologue. All 4 ESTs corresponding to Vinesleeper-1 derive from flower tissues and most of the 11 ESTs corresponding to Vinesleeper-2 are obtained from different tissues of different developmental stages (Table S1) which suggest a pattern of expression for both genes compatible with a developmentally related function similar to that of DAYSLEEPER from Arabidopsis\n[44]. The fact that the grapevine genome contains two potential orthologues for DAYSLEEPER suggests that this gene has been duplicated during grapevine evolution and, because of different numbers and origins of corresponding ESTs, the two genes might have diverged to fulfill specialized functions. The other putative domesticated hAT-like transposases Hatvine-4, Hatvine-5, and Hatvine-8 are not phylogenetically related to DAYSLEEPER nor the previously characterized Gary element [46]. Hatvine-8 has a non-functional and partially deleted TPase gene which did not allow its alignment and phylogenetical analysis with other members of the hAT superfamily, while Hatvine-4 seems to lack a start codon in its ORF. However, Hatvine-5 has an intact ORF which matches to transcripts deriving from berry tissue (Table S1) that could be compatible with this element being a domesticated transposase with a function in fruit-related processes.We have also found MULE-related sequences as candidates for domesticated transposases because of their presence in single copy and lack of TIRs or TSDs (Table 4). These elements belong to the MuDR, Jittery and Hop families. The MuDR-like elements are phylogenetically closely related to the MUSTANG elements previously described in Arabidopsis and sugarcane [45], [47] (Figure 3A) and could be the grapevine orthologues of these genes. We have found grapevine ESTs accumulating in different organs and parts of the plant matching to most of these elements (Table 4 and Table S1) which suggests a pattern of expression similar to that of the Arabidopsis and sugarcane MUSTANGs [45], [47]. Five single copy elements belonging to the Jittery family (named Jithouse) have been identified (Figure 3B and Table 4) to potentially encode for proteins containing the three domains found in FAR1/FHY3-domesticated transposases (N-terminal C2H2-type zinc-chelating motif of the WRKY-GCM1 family, a central putative core transposase domain and a C-terminal SWIM motif [43]). A recent report has identified 4 out of 5 elements described here as FRS3-related FAR1/FHY3 genes [43]. Although the sequence of Jithouse-4 was not included in that report, its phylogenetical relationship to the other four elements (Figure 3B) suggests that this is also a FAR1/FHY3-related domesticated transposase. Finally, we found one potential domesticated transposase of the Hop family, the Hopvine-2 element present in a single copy and lacks TIRs and TSDs flanking the coding region. The corresponding EST matching to its ORF suggests that Hopvine-2 be a transposase-related functional gene.Although the number of ESTs present in grapevine databases is limited for extended expression pattern studies of each putative domesticated element identified, we think the specific nature of these elements could be confirmed. TEs are induced under stress situations, while domesticated transposons lack such a biased expression, most domesticated transposases playing a role in developmentally related processes. 22% of the ESTs corresponding to the putative domesticated transposases here described belong to EST collections obtained from stressed material, which is almost exactly the percentage of the stress-related EST collections in the total grapevine EST databases (23%). Contrastingly, 77% of the ESTs corresponding to potentially mobile transposons are obtained from stressed material which is significantly more than expected (χ2 test, pvalue<0.0001). This difference in expression confirms the classification as true transposons and domesticated transposases made here based on molecular characteristics.Insertion polymorphisms of grapevine cut-and-paste transposons revealed by PCRThe results presented here show that a high number of grapevine transposons have maintained the capacity to encode a transposase and are expressed under particular situations, suggesting that they may have retained the capacity to transpose. In order to get more information on the possible mobility of these elements, we looked for insertion polymorphisms of eleven of these elements among seven grapevine cultivars. We have also included in this analysis four putative domesticated elements which are supposed to have lost their ability to transpose. The presence of a given element at a particular location in the genome was revealed by a PCR amplification using a primer complementary to the internal region of the TE and a primer designed in the flanking region. To check for the absence of a given element at a particular location we performed PCR amplifications with two primers complementary to the regions flanking the element at both sides (see Materials and Methods for details). Some randomly chosen bands were sequenced to confirm the nature of the amplification products.None of the four putative domesticated transposases analyzed showed insertion polymorphisms (Figure 6, bottom panel). Taking into account the high heterozygosity of grapevine this result suggests that domesticated transposons fulfill important cellular roles and have been under strong selective pressure for their maintenance. On the contrary, all but one (Hatvine-7.1) transposon insertions analyzed are polymorphic (8 examples are shown in Figure 6, top and middle panels). This could suggest that most transposon insertions are not under strong selective pressure and are randomly distributed among cultivars. Alternatively, this result may also indicate that some of these insertions are recent and have not had time to become fixed. In particular, Pifvine-2 insertions could be relatively recent (possibly after the domestication of grapevine), as only two out of seven cultivars contain the insertion at this particular locus (Figure 6). In some cases we obtained multiple bands, or products with unexpected sizes. The sequence of the unexpectedly small bands of the Pifvine-2 empty sites (for samples 4 and 6) and the unusually bigger band of the Pifvine-3 empty site (sample 5) revealed sequence polymorphisms unrelated to the transposition of the elements here reported. In the case of Pifvine-2 we found a 154 bp-long deletion present 216 bp downstream of the target site, while in the case of Pifvine-3 there is an insertion of a putative SINE element (155 bp-long with 13 bp-long TSDs) 22 bp after the target site.10.1371/journal.pone.0003107.g006Figure 6Examples of the insertion polymorphism of different TEs and domesticated transposases from grapevine.The culivars analyzed are Pinot Noir (1), Riesling (2), Chardonnay (3), Cabernet Sauvignon (4), cabernet Mitos (5), Cabernet Cortis(6) and cabernet Carbon (7). “+” indicate the insertion at a given locus, while “−” indicate an empty site. Arrows indicate the expected size of the band. Numbers are grapevine cultivars (in the same order as given in Table S2).This results thus show that a high proportion of grapevine “cut-and-paste” transposons have recently transposed during grapevine evolution, accompanying its domestication and breeding processare polymorphic and contribute to the high variability of grapevine genome.ConclusionsWe have performed a detailed analysis of the “cut-and-paste” transposons of Vitis vinifera L, and found that this genome contains elements belonging to four of the five superfamilies of elements described in plants, hAT, CACTA, Mutator and PIF. hAT and Mutator superfamilies are the most prevalent in grapevine, while CACTA is probably the superfamily that has had the less activity in the recent grapevine genome evolution. The presence of TSDs, intact ORFs and high number of corresponding ESTs, as well as the high frequency of insertion polymorphisms among different grapevine cultivars show that these elements have transposed recently during grapevine evolution and suggests that some of them may have retained the capacity to transpose. On the contrary, the genome of grapevine also contains an important number of domesticated transposases belonging to different superfamilies that have lost the ability to transpose and probably fulfill cellular functions. Additionally, we found that transduplication of gene fragments is not restricted only to MULEs and CACTAs but can occur in other superfamilies as well. Our results show that, as in most complex genomes, TEs have made an important contribution to grapevine genome evolution and variation today.Materials and MethodsTransposon miningWe performed our analyses using the whole genome shotgun sequences of the grapevine genome made available at NCBI by Velasco et al. in January 2007 [13]. Sequences from Jaillon et al. [12] were made available at NCBI after we had started with our analyses and were used as confirmation references. As a first approach to characterize grapevine class II “copy-and-paste” transposons we used a homology-based strategy to look for sequences with similarities with known transposases. We retrieved protein sequences of plants from NCBI (in May 2007) using keywords as “transposase” or class II superfamily names like “Mutator”, “MUDRA”, “CACTA”, “hAT” etc. We grouped the retrieved transposase sequences into belonging superfamilies and performed a blastx search [48] with the grapevine genome shotguns as queries. We considered all shotguns having an e-value lower than 1×10−50 for their best TPase hit. These shotguns were manually checked and the putative TPase was analyzed. TPase genes were characterized by blastx of the shotgun of interest to the whole NCBI protein database. In this way, similarities with non-annotated proteins could be determined as well. As both [12] and [13] performed computational gene predictions, the NCBI contains a significant number of predicted (but not annotated) Vitis proteins which were useful to precisely determine the borders of putative TPase for each TE family analyzed. The TPase regions with several kb of flanking sequence were blasted against the whole Vitis shotgun database to determine the full length or the borders of the element. TIRs were manually looked for, or by using the FastPCR software (Kalendar 2006, www.biocenter.helsinki.fi/bi/programs/fastpcr.htm). By blasting the putative full length element to the Vitis whole genome shotgun database we could also find non-autonomous or deleted elements of the same family which have lost the TPase gene. To quantify all sequences belonging to the same family we used a full length element as query and considered all fragments with at least 80% identity and having at least 20% of the query length. We used the rule of >80% sequence similarity to group elements into the same family.Phylogeny of the TEsEach TE superfamily was phylogenetically analyzed to determine the number and relationships of the families and to compare them to some known elements from other plants. We aligned amino-acid sequences of conserved TPase regions using ClustalW algorithm [49] implemented in the BioEdit software [50]. PHYML software [51] was used to build phylogenies using maximum likelihood with the JTT model of evolution, four substitution rate categories, fixed proportion of invariable sites and non parametric bootstrap analysis of 100 replicates.\nFor the \nhAT\n superfamily we used a 39 aa-long region as in [52]. For comparison with ­Vitis elements ­we included the following hAT TEs in the phylogenetical tree: AC9 (accession No X05424), Bg (accession No X56877), Tag1 (accession No AAC25101), Tam3 (accession No X55078). We also included the domesticated TPases DAYSLEEPER\n[44] and r-gary1\n[46]. The multiple alignments are given in Dataset S5.\nFor the \nCACTA\n superfamily we used amino-acid fragments homologous to the En-1 TPase (accession No AAA66266), between positions 287 and 435. For comparison with Vitis elements we included the following elements in the phylogenetical tree: PSL (accession number AF009516), ATENSPM2\n[54], Doppia4 (accession No AF187822), En1 (accession No AAA66266), TNP2 (accession No CAA40555.1) and OSHOOTER\n[55]. The multiple alignments are given in Dataset S6.\nFor the \nMutator\n superfamily we used amino-acid fragments homologous to MURA between positions 468 and 640 as in Saccaro et al., [47] . For comparison with Vitis elements we included MURA, TE165, OsMUG1, SCMUG263, SCMUG228, AtMUG1, AtMUG05a, AtMUG05b, AtMUG03b, AtMUG03c [47] and MuDR2_OS [53]. The multiple alignments are given in Dataset S7. Comparison between MuDR-like and Jittery/Hop-like elements was possible only by comparing the amino-acid fragments homologous to Jittery TPase (accession No AAF66982) between positions 217 and 343 and Hop (accession No AAP31248.1) between positions 203 and 331. The only MuDR-like elements form Vitis that could be aligned with Jittery and Hop were Mutavine-1, 12 and 14 as well as MUGvine-5. The multiple alignments are given in Dataset S8.\nFor the \nPIF\n superfamily we used amino-acid fragments as described in Figure 1 in Zhang et al. [32] . For comparison with Vitis elements we included Os_Pong and Os_Ping and representatives from each PIF cluster from the Figure 3 in Zhang et al. [32]: HvBF628721 for cluster A1, ShAY362818 for cluster A2, AtAC007123 for cluster A3, LjAP004528 for cluster A4, Zm_PIF for cluster A5, BoBH561775 for cluster B, BoBH485472 for cluster C and ZmAF072725 for cluster D. In addition we included Harbinger\n[54]. The multiple alignments are given in Dataset S9.All trees were visualized using MEGA version 3.1. [56]\nSubmission to Repbase ReportsFor some families having true full length individual copies (with TSDs and/or TIRs and the coding region) consensus sequences were created and submitted to Repbase Reports (http://www.girinst.org/repbase/). Names were changed according to the new Repbase nomenclature (Tables 1–\n\n\n5).Plant materialA list of samples and their source is given in Table S2. DNA from all samples was extracted using E.Z.N.A. SP Plant DNA Mini Kit (Omega Bio-tek).PCR analysisPrimers were designed using FastPCR software (Kalendar 2006, www.biocenter.helsinki.fi/bi/programs/fastpcr.htm). Each primer was blasted against the whole Vitis genomic database to check for specificity. The list of primers is given in Table S3. PCRs were done in 20 µl reaction volumes using approximately 30 ng of template DNA, 0.5 µl of each primer (10 pmol/µl), and TaKaRa Ex Taq in the following conditions: 94 °C·2 min−1+40×(94 °C·25 s−1, 59 °C·45 s−1, 72 °C·1 min−1)+72 °C·5 min−1. PCR products were run in 1.2% agarose gels with EtBr in a 1× TAE buffer and visualized under UV light.Supporting InformationTable S1Detailed information of TEs and ESTs from grapevine.(0.15 MB DOC)Click here for additional data file.Table S2List of samples used for the PCR analysis.(0.03 MB DOC)Click here for additional data file.Table S3The list of primers used for insertion polymorphism analysis.(0.04 MB DOC)Click here for additional data file.Dataset S1Supporting information on the hAT superfamily(0.50 MB XLS)Click here for additional data file.Dataset S2Supporting information on the CACTA superfamily(0.12 MB XLS)Click here for additional data file.Dataset S3Supporting information on the Mutator superfamily(0.43 MB XLS)Click here for additional data file.Dataset S4Supporting information on the PIF superfamily(0.22 MB XLS)Click here for additional data file.Dataset S5Multiple alignments used for the phylogenetical analysis of hAT elements.(0.05 MB DOC)Click here for additional data file.Dataset S6Multiple alignments used for the phylogenetical analysis of CACTA elements.(0.03 MB DOC)Click here for additional data file.Dataset S7Multiple alignments used for the phylogenetical analysis of Mutator elements.(0.10 MB DOC)Click here for additional data file.Dataset S8Multiple alignments used for the phylogenetical analysis of Jittery-like and Hop-like elements.(0.01 MB DOC)Click here for additional data file.Dataset S9Multiple alignments used for the phylogenetical analysis of PIF elements.(0.02 MB DOC)Click here for additional data file.\n\nREFERENCES:\n1. LevadouxL\n1956\nLes populations sauvages et cultivées de Vitis vinifera L.\nAnn Amélior Plant\n6\n59\n117\n2. Arroyo-GarciaRRuiz-GarciaLBollingLOceteRLopezMA\n2006\nMultiple origins of cultivated grapevine (Vitis vinifera L. ssp. sativa) based on chloroplast DNA polymorphisms.\nMolecular Ecology\n15\n3707\n3714\n17032268\n3. ThisPLacombeTThomasMR\n2006\nHistorical origins and genetic diversity of wine grapes.\nTrends in Genetics\n22\n511\n519\n16872714\n4. ForneckA\n2005\nPlant Breeding: Clonality - A concept for stability and variability during vegetative propagation.\nEsserULKBeyschlagWMurataJ\nProgress in Botany\nHeidelberg, Germany\nSpringer Berlin\n165\n183\n5. FranksTBottaRThomasMRFranksJ\n2002\nChimerism in grapevines: implications for cultivar identity, ancestry and genetic improvement.\nTAG Theoretical and Applied Genetics\n104\n192\n199\n12582686\n6. LeQMelayahDBonnivardEPetitMGrandbastienM\n2007\nDistribution dynamics of the Tnt1 retrotransposon in tobacco.\nMolecular Genetics and Genomics\n278\n1617\n4615\n7. KobayashiSGoto-YamamotoNHirochikaH\n2004\nRetrotransposon-Induced Mutations in Grape Skin Color.\nScience\n304\n982-\n15143274\n8. LijavetzkyDRuiz-GarcíaLCabezasJDe AndrésMBravoG\n2006\nMolecular genetics of berry colour variation in table grape.\nMolecular Genetics and Genomics\n276\n427\n435\n16924546\n9. WalkerALeeEBogsJMcDavidDThomasM\n2007\nWhite grapes arose through the mutation of two similar and adjacent regulatory genes.\nThe Plant Journal\n49\n772\n785\n17316172\n10. PelsyFMerdinogluD\n2002\nComplete sequence of Tvv1, a family of Ty1 copia-like retrotransposons of Vitis vinifera L., reconstituted by chromosome walking.\nTAG Theoretical and Applied Genetics\n105\n614\n621\n12582512\n11. VerrièsCBèsCThisPTesnièreC\n2000\nCloning and characterization of Vine-1, a LTR-retrotransposon-like element in Vitis vinifera L., and other Vitis species.\nGenome\n43\n366\n376\n10791826\n12. JaillonOAuryJMNoelBPolicritiAClepetC\n2007\nThe grapevine genome sequence suggests ancestral hexaploidization in major angiosperm phyla.\nNature\n449\n463\n467\n17721507\n13. VelascoRZharkikhATroggioMCartwrightDCestaroA\n2007\nA High Quality Draft Consensus Sequence of the Genome of a Heterozygous Grapevine Variety.\nPLoS ONE\n2\ne1326\n18094749\n14. FeschotteCPrithamEJ\n2007\nDNA Transposons and the Evolution of Eukaryotic Genomes.\nAnnual Review of Genetics\n41\n331\n368\n15. GuynetCHickmanABBarabasODydaFChandlerM\n2008\nIn Vitro Reconstitution of a Single-Stranded Transposition Mechanism of IS608.\nMolecular Cell\n29\n302\n312\n18280236\n16. BarabasORonningDRGuynetCHickmanABTon-HoangB\n2008\nMechanism of IS200/IS605 Family DNA Transposases: Activation and Transposon-Directed Target Site Selection.\nCell\n132\n208\n220\n18243097\n17. WickerTSabotFHua-VanABennetzenJLCapyP\n2007\nA unified classification system for eukaryotic transposable elements.\nNat Rev Genet\n8\n973\n982\n17984973\n18. FeschotteCOsterlundMTPeelerRWesslerSR\n2005\nDNA-binding specificity of rice mariner-like transposases and interactions with Stowaway MITEs.\nNucl Acids Res\n33\n2153\n2165\n15831788\n19. RubinELithwickGLevyAA\n2001\nStructure and Evolution of the hAT Transposon Superfamily.\nGenetics\n158\n949\n957\n11454746\n20. ZhangXWesslerSR\n2004\nGenome-wide comparative analysis of the transposable elements in the related species Arabidopsis thaliana and Brassica oleracea.\nProceedings of the National Academy of Sciences\n101\n5589\n5594\n21. WickerTGuyotRYahiaouiNKellerB\n2003\nCACTA Transposons in Triticeae. A Diverse Family of High-Copy Repetitive Elements.\nPlant Physiol\n132\n52\n63\n12746511\n22. MiuraAKatoMWatanabeKKawabeAKotaniH\n2004\nGenomic localization of endogenous mobile CACTA family transposons in natural variants of Arabidopsis thaliana.\nMolecular Genetics and Genomics\n270\n524\n532\n14608503\n23. RobertsonD\n1978\nCharacterization of a mutator system in maize.\nMutant Research\n51\n21\n28\n24. LischD\n2002\nMutator transposons.\nTrends in Plant Science\n7\n498\n504\n12417150\n25. HolliganDZhangXJiangNPrithamEJWesslerSR\n2006\nThe Transposable Element Landscape of the Model Legume Lotus japonicus.\nGenetics\n174\n2215\n2228\n17028332\n26. JureticNHoenDRHuynhMLHarrisonPMBureauTE\n2005\nThe evolutionary fate of MULE-mediated duplications of host gene fragments in rice.\nGenome Res\n15\n1292\n1297\n16140995\n27. TurcotteKSrinivasanSBureauT\n2001\nSurvey of transposable elements from rice genomic sequences.\nThe Plant Journal\n25\n169\n179\n11169193\n28. XuZYanXMauraisSFuHO'BrienDG\n2004\nJittery, a Mutator Distant Relative with a Paradoxical Mobile Behavior: Excision without Reinsertion.\nPlant Cell\n16\n1105\n1114\n15075398\n29. ChalvetFGrimaldiCKaperFLanginTDaboussiM-J\n2003\nHop, an Active Mutator-like Element in the Genome of the Fungus Fusarium oxysporum.\nMol Biol Evol\n20\n1362\n1375\n12777515\n30. LeQHWrightSYuZBureauT\n2000\nTransposon diversity in Arabidopsis thaliana.\nProceedings of the National Academy of Sciences\n97\n7376\n7381\n31. HoenDRParkKCElroubyNYuZMohabirN\n2006\nTransposon-Mediated Expansion and Diversification of a Family of ULP-like Genes.\nMol Biol Evol\n23\n1254\n1268\n16581939\n32. ZhangXJiangNFeschotteCWesslerSR\n2004\nPIF- and Pong-Like Transposable Elements: Distribution, Evolution and Relationship With Tourist-Like Miniature Inverted-Repeat Transposable Elements.\nGenetics\n166\n971\n986\n15020481\n33. CasolaCLawingAMBetranEFeschotteC\n2007\nPIF-like Transposons are Common in Drosophila and Have Been Repeatedly Domesticated to Generate New Host Genes.\nMol Biol Evol\n24\n1872\n1888\n17556756\n34. KapitonovVVJurkaJ\n2004\nHarbinger Transposons and an Ancient HARBI1 Gene Derived from a Transposase.\nDNA and Cell Biology\n23\n311\n324\n15169610\n35. ZabalaGVodkinL\n2007\nNovel exon combinations generated by alternative splicing of gene fragments mobilized by a CACTA transposon in Glycine max.\nBMC Plant Biology\n7\n38\n17629935\n36. JiangNBaoZZhangXEddySRWesslerSR\n2004\nPack-MULE transposable elements mediate gene evolution in plants.\nNature\n431\n569\n573\n15457261\n37. YuZWrightSIBureauTE\n2000\nMutator-like Elements in Arabidopsis thaliana: Structure, Diversity and Evolution.\nGenetics\n156\n2019\n2031\n11102392\n38. van LeeuwenHMonfortAPuigdomenechP\n2007\nMutator -like elements identified in melon, Arabidopsis and rice contain ULP1 protease domains.\nMolecular Genetics and Genomics\n277\n357\n364\n17136348\n39. KawasakiSNitasakaE\n2004\nCharacterization of Tpn1 Family in the Japanese Morning Glory: En/Spm-related Transposable Elements Capturing Host Genes.\nPlant Cell Physiol\n45\n933\n944\n15295077\n40. ZabalaGVodkinLO\n2005\nThe wp Mutation of Glycine max Carries a Gene-Fragment-Rich Transposon of the CACTA Superfamily.\nPlant Cell\n17\n2619\n2632\n16141454\n41. VolffJ-N\n2006\nTurning junk into gold: domestication of transposable elements and the creation of new genes in eukaryotes.\nBioEssays\n28\n913\n922\n16937363\n42. HudsonMELischDRQuailPH\n2003\nThe FHY3 and FAR1 genes encode transposase-related proteins involved in regulation of gene expression by the phytochrome A-signaling pathway.\nThe Plant Journal\n34\n453\n471\n12753585\n43. LinRDingLCasolaCRipollDRFeschotteC\n2007\nTransposase-Derived Transcription Factors Regulate Light Signaling in Arabidopsis.\nScience\n318\n1302\n1305\n18033885\n44. BundockPHooykaasP\n2005\nAn Arabidopsis hAT-like transposase is essential for plant development.\nNature\n436\n282\n284\n16015335\n45. CowanRKHoenDRSchoenDJBureauTE\n2005\nMUSTANG Is a Novel Family of Domesticated Transposase Genes Found in Diverse Angiosperms.\nMol Biol Evol\n22\n2084\n2089\n15987878\n46. MuehlbauerGBhauBSyedNHeinenSChoS\n2006\nA hAT superfamily transposase recruited by the cereal grass genome.\nMolecular Genetics and Genomics\n275\n553\n563\n16468023\n47. SaccaroJNLVan SluysM-Ade Mello VaraniARossiM\n2007\nMudrA-like sequences from rice and sugarcane cluster as two bona fide transposon clades and two domesticated transposases.\nGene\n392\n117\n125\n17289300\n48. Altschul SFGWMillerWMyersEWLipmanDJ\n1990\nBasic local alignment search tool.\nJ Mol Biol\n215\n403\n410\n2231712\n49. ThompsonJDHigginsDGGibsonTJ\n1994\nCLUSTAL W: improving the sensitivity of progressive multiple sequence alignment through sequence weighting, position-specific gap penalties and weight matrix choice.\nNucleic Acids Res\n22\n4673\n4680\n7984417\n50. HallTA\n1999\nBioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT.\nNucl Acids Symp Ser\n41\n95\n98\n51. GuindonSLethiecFDurouxPGascuelO\n2005\nPHYML Online–a web server for fast maximum likelihood-based phylogenetic inference.\nNucl Acids Res\n33\nW557\n559\n15980534\n52. KempkenFWindhoferF\n2001\nThe hAT family: a versatile transposon group common to plants, fungi, animals, and man.\nChromosoma\n110\n1\n9\n11398971\n53. JurkaJ\n2005\nMuDR2_OS: MuDR-type DNA transposon from rice.\nRepbase Reports\n5\n201\n201\n54. KapitonovVJurkaJ\n1999\nMolecular paleontology of transposable elements from Arabidopsis thaliana.\nGenetica\n107\n27\n37\n10952195\n55. JurkaJ\n2005\nOSHOOTER: EnSpm-type DNA transposon from rice.\nRepbase Reports\n5\n205\n56. KumarSTamuraKNeiM\n2004\nMEGA3: Integrated software for Molecular Evolutionary Genetics Analysis and sequence alignment.\nBriefings in Bioinformatics\n5\n150\n163\n15260895"
+}

batch_2/PMC2528161.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2528161",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2528161\nAUTHORS: T Akagi, Q T Luong, D Gui, J Said, J Selektar, A Yung, C M Bunce, G D Braunstein, H P Koeffler\n\nABSTRACT:\nThyroid carcinoma cells often do not express thyroid-specific genes including sodium iodide symporter (NIS), thyroperoxidase (TPO), thyroglobulin (TG), and thyrotropin-stimulating hormone receptor (TSHR). Treatment of thyroid carcinoma cells (four papillary and two anaplastic cell lines) with histone deacetylase inhibitors (SAHA or VPA) modestly induced the expression of the NIS gene. The promoter regions of the thyroid-specific genes contained binding sites for hepatocyte nuclear factor 3 β (HNF3β)/forkhead box A2 (FoxA2), thyroid transcription factor 1 (TTF-1), and CCAAT/enhancer binding protein β (C/EBPβ). Quantitative reverse transcription-polymerase chain reaction (RT–PCR) showed decreased expression of HNF3β/FoxA2 and TTF-1 mRNA in papillary thyroid carcinoma cell lines, when compared with normal thyroid cells. Forced expression of these genes in papillary thyroid carcinoma cells inhibited their growth. Furthermore, the CpG island in the promoter region of HNF3β/FoxA2 was aberrantly methylated; and treatment with 5-aza-2-deoxycytidine (5-Az) induced its expression. Immunohistochemical staining showed that C/EBPβ was localised in the nucleus in normal thyroid cells but was detected in the cytoplasm in papillary thyroid carcinoma cells. Subcellular fractionation of papillary thyroid carcinoma cell lines also demonstrated high levels of expression of C/EBPβ in the cytoplasm, suggesting that a large proportion of C/EBPβ protein is inappropriately localised in the cytoplasm. In summary, these findings reveal novel abnormalities in thyroid carcinoma cells\n\nBODY:\nDevelopment of thyroid carcinoma is accompanied by a block of differentiation of these cells. Papillary and follicular thyroid carcinomas initially are relatively well-differentiated tumours that over time may de-differentiate, whereas anaplastic thyroid carcinoma is an undifferentiated tumour (Farid et al, 1994). Poorly differentiated or undifferentiated carcinomas no longer express mature thyroid-specific genes including sodium iodide symporter (NIS), thyroperoxidase (TPO), thyroglobulin (TG), and thyrotropin-stimulating hormone receptor (TSHR). In normal thyroid cells, TSHR is stimulated by thyrotropin-stimulating hormone, resulting in the activation of NIS, which incorporates iodine. Thyroglobulin and iodine are catalysed into thyroid hormones by TPO (Carrasco, 1993). Investigators have predominantely attempted to induce differentiation of thyroid cancer cells by exposure to compounds associated with known differentiation of other cancers.Retinoic acid, including all-trans retinoic acid (ATRA) and 9-cis retinoic acid (9-cis RA), induces differentiation of acute promyelocytic leukaemia cells and neuroblastoma cells and is used in the therapy for these cancers. Retinoids have been reported to induce the expression of TPO, TG, and NIS mRNAs in thyroid carcinoma cell lines (Schmutzler et al, 1997; Haugen, 2004). The NIS promoter contains CpG islands, and a DNA demethylating agent (such as, 5-aza-2-deoxycytidine (5-Az)) combined with a histone deacetylase inhibitor has been shown to induce NIS expression and radioactive iodine uptake in follicular and anaplastic thyroid carcinoma cell lines (Venkataraman et al, 1999; Haugen, 2004).The transcription factors of paired box gene 8 (Pax-8) and thyroid transcription factor 1 (TTF-1) have been analysed in thyroid cells. Paired box gene 8 is necessary for the formation of thyroxine-producing follicular cells in the thyroid gland (Mansouri et al, 1998, 1999); and fusion of the Pax-8 and peroxisome proliferator-activated receptor γ (PPARγ) genes occurs in approximately 30% of follicular thyroid carcinomas (Kroll et al, 2000; Dwight et al, 2003). Thyroid transcription factor 1 is required for the development of the thyroid gland, and TTF-1-deficient mice lack a thyroid gland and die at birth (Kimura et al, 1996). The expression of Pax-8 and TTF-1 is low in thyroid carcinoma (Ros et al, 1999); and stable transfection with a Pax-8 expression vector in anaplastic thyroid carcinoma cell line, ARO, caused re-expression of endogenous NIS, TG, and TPO (Presta et al, 2005). Reporter gene analysis found that the promoter region of TG, TPO, and TSHR could be activated by the forced expression of either Pax-8 or TTF-1 in the papillary thyroid carcinoma cell line NPA (Ros et al, 1999). Co-transfection of Pax-8 and TTF-1 restored TG promoter activity in WRO (follicular thyroid carcinoma) and ARO cells (Chun et al, 1998).In this study, we attempted to induce differentiation of papillary and anaplastic thyroid carcinoma cells as measured by the induction of NIS, TPO, TG, and TSHR by exposing the cells to 5-Az, histone deacetylase inhibitors (suberoylanilide hydroxamic acid (SAHA) and valproic acid), ATRA, 9-cis RA, troglitazone (PPARγ ligand), 1,25-dihydroxyvitamin D3 (1,25(OH)2D3), thyroid hormone T3, and thyrotropin-stimulating hormone. Furthermore, dysregulation of three transcription factors (TTF-1, hepatocyte nuclear factor 3 β (HNF3β)/forkhead box A2 (FoxA2), and CCAAT/enhancer binding protein β (C/EBPβ)) was examined in thyroid carcinoma cells.Materials and methodsCell culture and drug treatmentsBHP (sublines 2–7, 7–13, 10-3 and 18–21) and NPA papillary, and ARO and FRO anaplastic thyroid carcinoma cell lines were cultured as described before (Fagin et al, 1996; Ohta et al, 1997; Luong et al, 2006). The normal rat thyroid cell line FRTL-5 cells (from Dr Shlomo Melmed at Cedars-Sinai Medical Center) were cultured in Ham's F12K medium (Invitrogen, Carlsbad, CA, USA) with 5% bovine calf serum (Invitrogen) together with 10 mU ml−1 thyrotropin-stimulating hormone, 0.01 mg ml−1 insulin, 10 nM hydrocortisone, 5 ng ml−1 transferrin, 10 ng ml−1 somatostatin, and 10 ng ml−1 glycyl-L-histidyl-L-lysine acetate.Cultured cells were treated with the following agents either alone or in combinations with 5-Az (1 μM), SAHA (5 μM), valproic acid (1 μM), ATRA (100 nM), 9-cis RA (100 nM), troglitazone (PPARγ ligand, 10 μM), 1,25(OH)2D3 (1 μM), thyroid hormone T3 (10 nM), and thyrotropin-stimulating hormone (1 mU ml−1) for 48–96 h. 5-Aza-2-deoxycytidine, valproic acid, thyroid hormone T3, and thyrotropin-stimulating hormone were dissolved in water; SAHA and troglitazone were diluted in dimethyl sulphoxide (DMSO); ATRA, 9-cis RA, and 1,25(OH)2D3 were placed in ethanol. Equal volume of DMSO and ethanol were added in control samples.Real-time reverse transcription polymerase chain reactionTotal RNA was isolated from thyroid carcinoma cell lines and normal thyroid tissues using Trizol reagent (Invitrogen), and cDNA was prepared from 1 μg of total RNA with Superscript III reverse transcriptase (Invitrogen). Expression of mRNAs was measured by real-time PCR using an iCycler iQ system (Bio-Rad, Hercules, CA, USA) as described previously (Xie et al, 2001). To determine the expression levels of NIS, C/EBPα, and C/EPBβ with probes, amplification reactions were performed with the Universal Taqman PCR mastermix (Applied Biosystems, Foster City, CA, USA). Expression levels of TPO, TG, TSHR, HNF3β/FoxA2, TTF-1, and Pax-8 were measured with platinum Taq DNA Polymerase (Invitrogen) and SYBRGreen I (Molecular Probes, Carlsbad, CA, USA). Expression levels of target genes were normalised with 18S or β-actin. Specificity of all PCR products was checked on agarose gel, and only one product of the correct size was observed for each primer pair. Sequences of primers and probes, the melting temperature, and product size are shown in Table 1.Radioactive iodine (125I) uptake assayNa125I (100 μCi μl−1) stock was diluted to 0.02 μCi μl−1 using Hanks' Balanced Salt Solution (HBSS). Cells were plated at 1 × 105 cells per well in 12-well plates and treated with appropriate drugs, either with or without 10 mU ml−1 thyrotropin-stimulating hormone and/or cold (unlabelled) NaI. For radioactive iodine uptake, cells were washed twice with HBSS and 500 μl of Na125I working solution was added. After incubation for 3 h at 37°C, cells were washed with 1 ml cold HBSS and lysed with 1 ml of 95% ethanol for 1 h at 37°C. Lysates were transferred to vials for counting, and total counts were normalised to number of viable cells in parallel cultures.Plasmid transfection and colony assayExpression vectors of pTTF-1 and pHNF3β/FoxA2 were generous gifts from Dr Edward Morrisey (University of Pennsylvania). Plasmids of 1 μg pTag1 (empty vector), pTTF-1, and pHNF3β/FoxA2 were transfected into BHPs cells using Lipofectamine 2000 (Invitrogen). The zinc-inducible pMT-C/EBPβ expression plasmid (Gery et al, 2005) was transfected into BHP cells (sublines 2–7 and 7–13), which were selected with 500 μg ml−1 G418 for 48 h.For colony assay, cells transfected with plasmid were plated at 1 × 105 cells per well in 12-well plates in 1 ml culture media containing 500 μg ml−1 G418. After 2 weeks, cells were stained with Crystal violet dye (0.25% crystal violet dissolved in 50% methanol).3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide and clonogenic soft agar assayCells were treated with 10 μl of 5 mg ml−1 MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide; Sigma-Aldrich, St Louis, MO, USA), and incubated at 37°C for 4 h. Medium was removed, and 50 μl DMSO was added to the cells to solubilise the MTT. Plates were read at wavelength of 540 nm on a plate reader.For clonogenic soft agar assays, cells were plated into 24-well flat-bottomed wells using a two-layer soft agar system with 1 × 103 cells per well in a volume of 400 μl per well as previously described (Luong et al, 2006). After 14 days of incubation, colonies were counted.Methylation analysis of HNF3β/FoxA2 geneGenomic DNA was modified by sodium bisulphate using EZ DNA Methylation Kit (Zymo Research, Orange, CA, USA). The CpG island (−761 to −561, ATG codon considered as +1) of the HNF3β/FoxA2 gene was amplified from the bisulphate-modified genomic DNA with specific primers (sense primer: 5′-TTTTAGGGGATTTGTTGTGG-3′, anti-sense primer: 5′-AAATAATCAACTCACACC-3′). For PCR amplification, a total volume of 10 μl was used containing modified genomic DNA, 0.5 μM of each primers, 5.0 μl of FailSafe PCR 2 × PreMixe E (Epicentre Biotechnologies, Madison, WI, USA) and 1.0 U platinum Taq (Invitrogen). Polymerase chain reaction products were subcloned into pCR 2.1 vector (Invitrogen) and sequenced.Subcellular fractionation, Western blot analysis, and immunohistochemistryTotal cell lysates were prepared by lysing cells in RIPA buffer (1% Nonidet P-40, 0.5% sodium deoxycholate, 0.1% SDS, 50 mM Tris-HCl (pH 7.5)) containing a protease inhibitor cocktail (Roche Diagnostics GmbH, Mannheim, Germany) as well as 1 mM NaF and 1 mM NaVO4. To separate nuclear and cytoplasmic fractions, cells were fractionated with NE-PER Nuclear and Cytoplasmic Extraction Reagent (Pierce Biotechnology, Rockford, IL, USA). These samples were subjected to sodium dodecyl sulphate–polyacrylamide gel electrophoresis (SDS–PAGE) followed by an electrotransfer to polyvinylidene difluoride membrane. The signals were developed with either Supersignal West Pico Chemiluminescent or Supersignal West Dura Extended Duration Substrate (Pierce Biotechnology). Anti-PPARγ, C/EBPβ, β-actin, and heterogeneous nuclear ribonuclear protein (hnRNP) A1 antibodies were obtained from Santa Cruz Technology (Santa Cruz, CA, USA). Anti-glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was from Research Diagnostics Inc. (Concord, MA, USA).Normal and papillary thyroid carcinoma tissue blocks were cut at 3 μM thickness, deparaffinised and pre-treated in Tris-HCl (pH 9.0). These samples were incubated overnight with anti-C/EBPβ antibody (1 : 500 dilution), washed, followed by the HRP-conjugated secondary antibody (Dako, Carpinteria, CA, USA), and DAB chromogen. The tissues were counterstained with haematoxylin and then coverslipped. Three samples of normal and three carcinomas were examined.ResultsInduction of expression of thyroid-specific genes: effect of 5-Az, SAHA, valproic acid, and nuclear hormone receptor ligands in thyroid carcinoma cell linesSilencing of genes can be associated with epigenetic change including abnormal methylation of CpG islands and/or deacetylation of histones. Therefore, papillary (BHP sublines 2–7, 7–13, 10-3, and 18–21) and two anaplastic thyroid carcinoma (ARO and FRO) cell lines were cultured either with or without 5-Az (1 μM) and/or histone deacetylase inhibitors (SAHA (5 μM) or valproic acid (1 μM)). Quantitative reverse transcription-polymerase chain reaction (RT–PCR) showed that expressions of thyroid-specific genes (TPO, TG, and TSHR) were either extremely low or at undetectable levels compared with normal thyroid tissue (data not shown).We also examined the effects of several ligands of nuclear hormone receptors either with or without SAHA. As shown in Figure 1, 1,25(OH)2D3, ATRA, 9-cis RA, troglitazone, or thyroid hormone T3 alone was able to induce the expression of NIS mRNA in ARO and BHP (sublines 2–7 or 10–3) cells. The combination of SAHA with ATRA, 9-cis RA, troglitazone, or thyroid hormone T3 did not enhance the expression of NIS compared with SAHA alone in BHP papillary thyroid carcinoma cells (sublines 2–7 and 10–3).Thyroid-related transcription factors are poorly expressed in papillary and anaplastic thyroid carcinoma cell linesThe above data showed that the four thyroid-specific genes (NIS, TPO, TG, and TSHR) were negligibly expressed in the thyroid carcinoma cell lines; therefore, common transcription factor(s) that regulate these genes might not be expressed in these cell lines. The promoter regions of these genes contain putative transcription factor binding sites for HNF3β/FoxA2, C/EBPs, PPARγ, Pax-8, and TTF-1. Real-time PCR showed that HNF3β/FoxA2, TTF-1, and Pax-8 were expressed in normal thyroid tissue; in contrast, levels were either very low or undetectable in thyroid carcinoma cell lines (Figure 2). Western blot analysis showed that the protein expression of PPARγ was barely detectable in BHP sublines, but easily found in ARO and FRO cell lines (data not shown).Forced expression of either HNF3β/FoxA2 or TTF-1 in thyroid carcinoma cellsNext, we transfected either the HNF3β/FoxA2 or the TTF-1 expression vector into papillary thyroid carcinoma cell lines. Neither HNF3β/FoxA2- nor TTF-1-expressing BHP cells (subline 2–7) had an increase in 125I uptake, when compared with normal FRTL-5 thyroid cells (Figure 3). Nevertheless, the forced expression of either HNF3β/FoxA2 or TTF-1 resulted in growth inhibition compared with cells transfected with an empty vector as measured by MTT assay (data not shown), suggesting that these transcription factors have antiproliferative activity in papillary thyroid carcinoma cells.Methylation status of HNF3β/FoxA2 gene in papillary thyroid carcinoma cellsThe HNF3β/FoxA2 gene has a CpG island in its promoter; and the region is often methylated in breast and lung cancers (Halmos et al, 2004; Miyamoto et al, 2005) prompting us to examine thyroid carcinoma cells. The great majority of the 21 CpG sites in the promoter were methylated in BHP (subline 2–7) and NPA papillary thyroid carcinoma cells (Figure 4A), as well as in the anaplastic thyroid carcinoma cell line FRO (data not shown). In contrast, the region was unmethylated in normal thyroid tissues (Figure 4B). Real-time PCR showed that the expression of HNF3β/FoxA2 mRNA was induced after the treatment of BHP cells (subline 2–7) with the demethylating agent 5-Az (1 μM, 96 h) (Figure 4C). Taken together, these results suggest that the expression of the HNF3β/FoxA2 gene is epigenetically repressed in thyroid carcinoma cell lines.Forced expression of C/EBPβ in thyroid carcinoma cellsNext, we placed a Zn-inducible C/EBPβ expression vector into BHP cells (sublines 2–7 and 7–13) (Figure 5A). CCAAT/enhancer binding protein β has two isoforms, LAP (liver-enriched transcriptional activating protein) and LIP (liver-enriched transcriptional inhibitory protein). The smaller form of C/EBPβ (LIP) clearly increased in the cells treated with zinc. Induction of C/EBPβ expression resulted in a 60% growth reduction compared to the non-induced cells (Figure 5B, left panel). The more sensitive clonogenic soft agar assay showed that clonogenic growth decreased even in the absence of zinc, suggesting that this vector was ‘leaky’ resulting in C/EBPβ expression even in the absence of zinc. Nevertheless, clonogenic growth decreased 50% in the presence of zinc compared with the absence of zinc (Figure 5B, right panel). Similarly, crystal violet staining demonstrated that C/EBPβ had anti-growth activity in another subline, BHP 17-3 (Figure 5C). Taken together, these results suggested that forced expression of C/EBPβ can cause growth inhibition in BHP papillary thyroid carcinoma cells.Cellular localisation of C/EBPβ in human normal and papillary thyroid carcinoma tissues and cell linesTo examine expression of C/EBPβ in human thyroid tissues, normal and papillary thyroid carcinoma tissues were stained with anti-C/EBPβ antibody. Immunohistochemistry revealed that C/EBPβ signal was strongly detected in the nucleus in normal thyroid cells (Figure 6A). Interestingly, C/EBPβ was detected in the cytoplasm and to a lesser extent the nucleus of papillary thyroid carcinoma cells (Figure 6B). The subcellular localisation of C/EBPβ in four thyroid carcinoma cell lines (BHP2-7, NPA, FRO and ARO) was also determined by fractionation (Figure 6C). CCAAT/enhancer binding protein β-LAP was detected in both the nucleus and the cytoplasm. CCAAT/enhancer binding protein β-LIP, which has a dominant-negative activity against LAP, was expressed in NPA and FRO cell lines, and localised in the nucleus.DiscussionWe attempted to induce differentiation and inhibit proliferation of thyroid carcinoma cells with various compounds and transcription factors; and in addition, we explored the abnormalities in endogenous expression of these transcription factors in thyroid carcinoma cells. Suberoylanilide hydroxamic acid modestly induced the expression of TPO, TG and TSHR; and the combination of SAHA and 1,25(OH)2D3 further enhanced the expression of NIS in BHP cell line. However, these agents were not potent stimulators of NIS expression level, when compared with expression levels found in normal thyroid tissues. Induced expression of these transcripts was about 10- to 100-fold lower than those found in normal thyroid cells. Therefore taken together, our data suggest that these compounds had little differentiation inducing activity and would be unlikely candidates to enhance the therapeutic value of radioactive iodine (131I) for the treatment of thyroid tumours. Notably, two histone deacetylase inhibitors, depsipeptide and Trichostatin A, have been shown to induce the expression of NIS and 125I uptake in several follicular and anaplastic thyroid carcinoma cell lines (Haugen, 2004).Survey of the thyroid-specific genes showed that each promoter had transcription factor binding sites for HNF3β/FoxA2, TTF-1, C/EBPβ, and Pax-8. Earlier studies using either the TG or TPO promoter found that they were activated by TTF-1 and HNF3β/FoxA2 in thyroid carcinoma cell lines (Sato and Di Lauro, 1996; Ros et al, 1999; Shimura et al, 2001). In addition, Pax-8 leads to the re-expression of NIS, TPO, TG, and TTF-1 mRNAs in ARO cells (Presta et al, 2005). Our present study demonstrated that forced expression of either HNF3β/FoxA2 or TTF-1 was unable to induce differentiation of the thyroid cancer cells as measured by NIS mRNA expression and radioiodine uptake. Similarly, co-transfection of HNF3β/FoxA2 and TTF-1 did not induce the expression of TPO, TG or TSHR mRNAs in BHP cells (data not shown), indicating that other molecule(s) might be required to induce endogenous mRNA expression of these thyroid-related differentiation genes. Interestingly, HNF3β/FoxA2 is a methylated gene in breast and lung cancer cells; and overexpression of HNF3β/FoxA2 in a lung cancer cell line leads to growth arrest and apoptosis (Halmos et al, 2004; Miyamoto et al, 2005). Here, we report for the first time that the presence of aberrant methylation of HNF3β/FoxA2 in thyroid carcinoma cell lines, and forced expression of the gene, resulted in growth inhibition.Recently, Pomérance et al (2005) detected cytoplasmic localisation of C/EBPβ in papillary thyroid carcinoma tissues. Our immunohistochemical analysis also showed cytoplasmic localisation of C/EBPβ in papillary thyroid carcinoma tissues. In addition, we demonstrated by cell fractionation that C/EBPβ-LAP was present in both the nucleus and the cytoplasm; in contrast, C/EBPβ-LIP, a dominant-negative form of C/EBPβ, was localised in the nucleus in NPA and FRO cells. Nucleocytoplasmic distribution of C/EBPβ has been found in several other types of cancer. Human acute myeloid leukaemic cell line HL-60 showed cytoplasmic localisation of C/EBPβ-LAP when Thr235 was phosphorylated, and the induction of differentiation and the inhibition of proliferation of these cells by 1,25(OH)2D3 resulted in nuclear translocation of the transcription factor (Marcinkowska et al, 2006). In other experiments, C/EBPβ phosphorylation at Ser288 was associated with cytoplasmic localisation of the protein in human liver cancer cells; in contrast, normal liver cells had neither phosphorylation of Ser288 nor cytoplasmic C/EBPβ (Buck et al, 2001). CCAAT/enhancer binding protein β-LAP and -LIP contain both nuclear localisation signal and nuclear export signal in their common C-terminal region (Williams et al, 1997). The N-terminal region, which is specific for C/EBPβ-LAP, might contain a motif that causes cytoplasmic retention in thyroid cancer cells. In general, transcription factors including C/EBPβ function in the nucleus, suggesting that deregulation of nuclear localisation of C/EBPβ leads to functional deficiency and result in cell abnormalities.In summary, we found that the thyroid cancer cells had decreased the expression of TTF-1 and HNF3β/FoxA2; and their forced re-expression was associated with decreased cell growth. In addition, methylation of HNF3β/FoxA2 and inappropriate cellular localisation of C/EBPβ were identified as novel abnormalities. Future studies will screen for small molecules that can induce expression of these transcription factors resulting in a unique therapy for thyroid cancer.\n\nREFERENCES:\n1. Buck M, Zhang L, Halasz NA, Hunter T, Chojkier M (2001) Nuclear export of phosphorylated C/EBPbeta mediates the inhibition of albumin expression by TNF-alpha. EMBO J\n20: 6712–672311726507\n2. Carrasco N (1993) Iodide transport in the thyroid gland. Biochim Biophys Acta\n1154: 65–828507647\n3. Chun YS, Saji M, Zeiger MA (1998) Overexpression of TTF-1 and PAX-8 restores thyroglobulin gene promoter activity in ARO and WRO cell lines. Surgery\n124: 1100–11059854590\n4. Dwight T, Thoppe SR, Foukakis T, Lui WO, Wallin G, Höög A, Frisk T, Larsson C, Zedenius J (2003) Involvement of the PAX8/peroxisome proliferator-activated receptor gamma rearrangement in follicular thyroid tumors. J Clin Endocr Metab\n88: 4440–444512970322\n5. Farid NR, Shi Y, Zou M (1994) Molecular basis of thyroid cancer. Endocr Rev\n15: 202–2328026388\n6. Fagin JA, Tang SH, Zeki K, Di Lauro R, Fusco A, Gonsky R (1996) Reexpression of thyroid peroxidase in a derivative of an undifferentiated thyroid carcinoma cell line by introduction of wild-type p53. Cancer Res\n56: 765–7718631011\n7. Gery S, Gombart AF, Yi WS, Koeffler C, Hofmann WK, Koeffler HP (2005) Transcription profiling of C/EBP targets identifies Per2 as a gene implicated in myeloid leukemia. Blood\n106: 2827–283615985538\n8. Halmos B, Bassères DS, Monti S, D'Aló F, Dayaram T, Ferenczi K, Wouters BJ, Huettner CS, Golub TR, Tenen DG (2004) A transcriptional profiling study of CCAAT/enhancer binding protein targets identifies hepatocyte nuclear factor 3 beta as a novel tumor suppressor in lung cancer. Cancer Res\n64: 4137–414715205324\n9. Haugen BR (2004) Redifferentiation therapy in advanced thyroid cancer. Curr Drug Targets Immune Endocr Metabol Disord\n4: 175–18015379720\n10. Kimura S, Hara Y, Pineau T, Fernandez-Salguero P, Fox CH, Ward JM, Gonzalez FJ (1996) The T/ebp null mouse: thyroid-specific enhancer-binding protein is essential for the organogenesis of the thyroid, lung, ventral forebrain, and pituitary. Genes Dev\n10: 60–698557195\n11. Kroll TG, Sarraf P, Pecciarini L, Chen CJ, Mueller E, Spiegelman BM, Fletcher JA (2000) PAX8-PPAR-gamma-1 fusion in oncogene human thyroid carcinoma. Science\n289: 1357–136010958784\n12. Luong QT, O′Kelly J, Braunstein GD, Hershman JM, Koeffler HP (2006) Antitumor activity of suberoylanilide hydroxamic acid against thyroid cancer cell lines in vitro and in vivo. Clin Cancer Res\n12: 5570–557717000694\n13. Mansouri A, Chowdhury K, Gruss P (1998) Follicular cells of the thyroid gland require Pax8 gene function. Nature Genet\n19: 87–909590297\n14. Mansouri A, St-Onge L, Gruss P (1999) Role of Pax genes in endoderm-derived organs. Trends Endocrinol Metab\n10: 164–16710322412\n15. Marcinkowska E, Garay E, Gocek E, Chrobak A, Wang X, Studzinski GP (2006) Regulation of C/EBPbeta isoforms by MAPK pathways in HL60 cells induced to differentiate by 1,25-dihydroxyvitamin D3. Exp Cell Res\n312: 2054–206516624284\n16. Miyamoto K, Fukutomi T, Akashi-Tanaka S, Hasegawa T, Asahara T, Sugimura T, Ushijima T (2005) Identification of 20 genes aberrantly methylated in human breast cancers. Int J Cancer\n116: 407–41415818620\n17. Ohta K, Pang XP, Berg L, Hershman JM (1997) Growth inhibition of new human thyroid carcinoma cell lines by activation of adenylate cyclase through the beta-adrenergic receptor. J Clin Endocrinol Metab\n82: 2633–26389253346\n18. Pomérance M, Mockey M, Young J, Quillard J, Blondeau JP (2005) Expression, hormonal regulation, and subcellular localization of CCAAT/enhancer-binding protein-beta in rat and human thyrocytes. Thyroid\n15: 197–20415785238\n19. Presta I, Arturi F, Ferretti E, Mattei T, Scarpelli D, Tosi E, Scipioni A, Celano M, Gulino A, Filetti S, Russo D (2005) Recovery of NIS expression in thyroid cancer cells by overexpression of Pax8 gene. BMC Cancer\n5: 8016029487\n20. Ros P, Rossi DL, Acebrón A, Santisteban P (1999) Thyroid-specific gene expression in the multi-step process of thyroid carcinogenesis. Biochimie\n81: 389–39610401674\n21. Sato K, Di Lauro R (1996) Hepatocyte nuclear factor 3beta participates in the transcriptional regulation of the thyroperoxidase promoter. Biochem Biophys Res Commun\n220: 86–938602863\n22. Schmutzler C, Winzer R, Meissner-Weigl J, Köhrle J (1997) Retinoic acid increases sodium/iodide symporter mRNA levels in human thyroid cancer cell lines and suppresses expression of functional symporter in nontransformed FRTL-5 rat thyroid cells. Biochem Biophys Res Commun\n240: 832–8389398654\n23. Shimura H, Suzuki H, Miyazaki A, Furuya F, Ohta K, Haraguchi K, Endo T, Onaya T (2001) Transcriptional activation of the thyroglobulin promoter directing suicide gene expression by thyroid transcription factor-1 in thyroid cancer cells. Cancer Res\n61: 3640–364611325833\n24. Venkataraman GM, Yatin M, Marcinek R, Ain KB (1999) Restoration of iodide uptake in dedifferentiated thyroid carcinoma: relationship to human Na+/I− symporter gene methylation status. J Clin Endocrinol Metab\n84: 2449–245710404820\n25. Williams SC, Angerer ND, Johnson PF (1997) C/EBP proteins contain nuclear localization signals imbedded in their basic regions. Gene Expr\n6: 371–3859495318\n26. Xie D, Nakachi K, Wang H, Elashoff R, Koeffler HP (2001) Elevated levels of connective tissue growth factor, WISP-1, and CYR61 in primary breast cancers associated with more advanced features. Cancer Res\n61: 8917–892311751417"
+}

batch_2/PMC2528555.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2528555",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2528555\nAUTHORS: A.S.A. Brazier, L.G. Balneaves, D. Seely, J.E. Stephen, N. Suryaprakash, J.W. Taylor–Brown\n\nABSTRACT:\nObjectiveCancer patients are increasingly known to use complementary medicine (cam) during conventional treatment, but data are limited on how Canadian oncology health professionals attempt to assist patients with their use of cam in the context of conventional cancer care. As part of a larger qualitative study assessing the perceptions of Canadian oncology health professionals regarding integrated breast cancer care, we undertook an exploration of current integrative practices of oncology health professionals.DesignUsing an interpretive description research design and a purposive sampling, we conducted a series of in-depth qualitative interviews with various oncology health professionals recruited from provincial cancer agencies, hospitals, integrative clinics, and private practice settings in four Canadian cities: Vancouver, Winnipeg, Montreal, and Halifax. A total of 16 oncology health professionals participated, including medical and radiation oncologists, nurses, and pharmacists.ResultsFindings highlighted two main strategies used by oncology health professionals to create a more integrative approach for cancer patients:\n acting as an integrative care guide, and collaborating with other health professionals.ConclusionsAlthough few clear standards of practice or guidance material were in place within their organizational settings, health professionals discussed some integrative roles that they had adopted, depending on interest, knowledge, and skills, in supporting patients with cam decisions. Given that cancer patients report that they want to be able to confer with their conventional health professionals, particularly their oncologists, about their cam use, health professionals who elect to adopt integrative practices are likely offering patients much-welcomed support.\n\nBODY:\nNo Body Content\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2528558.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2528558",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2528558\nAUTHORS: L.G. Balneaves, L. Weeks, D. Seely\n\nABSTRACT:\nObjectiveIn this paper, we set out to describe the personal and social contexts of treatment decisions made by cancer patients concerning complementary and alternative medicine (cam) and also the process through which cancer patients reach cam decisions throughout the cancer trajectory.MethodsWe selected and reviewed a variety of cam decision-making models published in the past 10 years within the Canadian health literature.ResultsThe cam decision-making process is influenced by a variety of sociodemographic, disease-related, psychological, and social factors. We reviewed four main phases of the cam decision-making process: Taking stock of treatment options Gathering and evaluating cam information Making cam decisions Revisiting the cam decisionImmediately following diagnosis, cancer patients become interested in taking stock of the full spectrum of conventional and cam treatment options that may enhance the effectiveness of their treatment and mediate potential side effects. Information about cam is then gathered from numerous information sources that vary in terms of credibility and scientific legitimacy, and is evaluated. When making a decision regarding cam options, patients attempt to make sense of the diverse information obtained, while acknowledging their beliefs and values. The cam decision is often revisited at key milestones, such as the end of conventional treatment and when additional information about disease, prognosis, and treatment is obtained.ConclusionsThe cam decision-making process is a dynamic and iterative process that is influenced by a complex array of personal and social factors. Oncology health professionals need to be prepared to offer decision support related to cam throughout the cancer trajectory.\n\nBODY:\n1. INTRODUCTIONSince the late 1990s, a growing number of studies have focused on the engagement of cancer patients in the treatment decision-making process 1–4. The use of qualitative research methods has provided a greater understanding of how cancer patients make sense of the treatment recommendations provided by their health professionals, and of the process by which they seek additional information and evaluate the risks and benefits of available treatment options 5–8. Individuals living with cancer have varying needs regarding their preferred level of involvement in treatment decisions, and correspondingly, vary in the way in which they can be best supported by health professionals during the decision-making process 9,10. Although previous research has provided insight into the decision-support strategies required by patients faced with conventional treatment decisions, its applicability to patients making decisions about complementary and alternative medicine (cam) is questionable.The literature suggests that most Canadian cancer patients use cam at some point during their illness 11,12. It is therefore essential that oncology health professionals understand and acknowledge the unique contexts and processes that influence treatment decisions specific to cam for each patient. This acknowledgment is especially important given the emerging field of integrative oncology in North America, in which evidence-based cam therapies are gradually being integrated into mainstream cancer care 13. Decision-support strategies that facilitate patients’ informed use of cam and full disclosure of cam use with health professionals are essential for the safe integration of cam with conventional cancer care.Canadian researchers have taken a leading role in examining the treatment decision-making process of cancer patients interested in cam\n14–18. This work has resulted in the development of several decision-making models that capture the complex interplay between key personal, social, and cultural factors and the cognitive processes that underlie the cam decision-making process. Although these models have been limited mainly to breast and prostate cancer and have yet to be empirically tested, they provide health professionals with insight into the experiences of patients making cam decisions, and they highlight moments during the cancer trajectory when patients may possibly benefit most from decision support.In the present paper, we begin our discussion by highlighting the highly complex, dynamic, and individualized nature of cam decisions, which results from the unique personal, social, and cultural contexts in which these decisions are embedded. We then draw on previous decision-making models and provide a summary of the main stages within the cam decision-making process (Figure 1): Taking stock of treatment options Gathering and evaluating cam information Making a decision Revisiting the decisionThis overview emphasizes the iterative nature of the cam decision-making process and how it unfolds across the cancer trajectory.2. DISCUSSION2.1 The Context of CAM DecisionsThe decision about whether to use cam, and if so, the type or types of cam to use, is influenced throughout the cancer trajectory by a myriad of factors that can be grouped as follows: sociodemographic and disease-related factors, psychological factors, and social factors.2.1.1 Sociodemographic and Disease-Related FactorsAt a basic level, specific demographic and disease-related factors have been found to be associated with cam use, including age (younger), sex (women), and socio-economic status (higher education and income) 19–21. These personal factors have been identified as being predictive of other self-care health behaviours and reflect health care access issues and the increased use of health care services by women 22. Further, despite an increasing number of private health insurance plans providing coverage for specific cam practices (such as acupuncture and chiropractic treatment), many cam therapies are not covered through public or private health insurance. As a result, the decision to use cam can be an expensive undertaking for many patients, particularly those who are on disability as a result of their illness.In Canada’s multicultural society, it is also imperative to acknowledge the important influence that ethnicity may have on cam use. For a growing number of immigrants and indigenous peoples, traditional medical systems (for example, Traditional Chinese Medicine, Ayurveda, First Nations traditional healing) are the primary source of health care. As a result, many cancer patients arrive at initial consultations already using or interested in trying cam therapies that are not considered “alternative” within their ethnocultural community.Increased cam use has also been related to disease characteristics. It has been observed to be higher in breast and prostate cancer populations than in populations with other cancer diagnoses 20,23. The heightened interest in cam in these populations may be a consequence of the proactive nature of these patient groups with regard to advocacy and self-care (that is, support-group membership). Cancer patients with advanced disease have also been found to have a heightened interest in cam\n24, which may reflect their attempt to maintain hope when presented with a poor prognosis and limited conventional treatment options, coupled with a search for healing when cure is not possible. Lastly, cam therapies that require intensive time and energy, such as restrictive diets or frequent visits to a practitioner, may be impractical for patients undergoing active cancer treatment, particularly for those experiencing fatigue or other debilitating physical or psychological symptoms.2.1.2 Psychological FactorsEqually influential in the cam decision-making process are psychological factors. For many individuals, the initial decision to explore cam treatment options arises from a strong internal locus of control (that is, the tendency to attribute event outcomes to one’s own control 25) and a desire to be an active participant in treatment decisions 18,26–29. In addition, for some patients, cam therapies may also provide the hope and optimism required to cope with the cancer journey 18,30. For others, their fears about death and dying may motivate their search for treatment options beyond conventional cancer care so that they can “cover all their bases” 18,31.2.1.3 Social FactorsIt is important to recognize how the personal and psychological factors associated with cam use are also embedded within a larger social context that legitimizes and reinforces the exploration and use of many cam therapies. For example, the increasing tendency of cancer patients to consider cam as a treatment option during their illness may reflect the currently persistent postmodern ideals of individualism, consumerism, and holism 32,33. In addition, an individual’s understandings of what constitutes appropriate treatment and how it can best be achieved are derived not only from personal experience, but also from social interaction and interface with cultural products—most notably the mass media 32. Information about cam is increasingly available and accessible through media sources 34, which lend visibility and perceived legitimacy to this group of therapies and practices.Further, male and female cancer patients both describe family members, friends, and fellow cancer survivors to be highly influential in their cam decisions 15,16,35,36. Members of a patient’s social network can take on a variety of decision-support roles depending on a patient’s diagnosis and stage of illness, and the nature of their relationship with the patient 35,36. These roles include “interested bystander” (a person who listens and supports a patient’s cam decisions), “information gatherer and reviewer” (a person who helps collect and evaluate information), and “director” (a person who takes over the decision-making process on behalf of the patient) 36.2.2 The CAM Decision-Making ProcessUnlike the many rational treatment decision-making models presented within the health care literature, the cam decision-making process has been described as a dynamic and iterative process that is highly variable across individuals 14,15,18. Despite its complex, nonlinear, and individualized nature, some common stages of the cam decision-making process can be explicated.2.2.1 Taking Stock of Treatment OptionsResearch has shown that the cam decision-making process begins immediately following a diagnosis of cancer 14,15,18. Despite being emotionally overwhelmed by the news of their diagnosis, most cancer patients are eager to learn about the full spectrum of treatment options and often do not distinguish between conventional and complementary therapies 18. At the time of diagnosis, patients are particularly interested in cam therapies that will enhance the effectiveness of their conventional treatment protocols and mediate potential side effects 14 such as fatigue, nausea and vomiting, and anxiety. However, the already complex decision about whether to use cam is challenged by concerns held by some patients and their health professionals regarding the potential risks posed by inappropriate cam use 14,16,37.2.2.2 Gathering and Evaluating CAM InformationDuring the initial phase of taking stock of available treatment options and identifying a personal interest in cam, cancer patients begin to gather and evaluate information about the possible role of cam in their cancer experience. Because the decision-making process is highly dependent on the patient’s unique contextual factors, the process of gathering and evaluating information is highly variable across individuals.For some cancer patients, particularly those who feel overwhelmed by their diagnosis, the information gathering and evaluation phase is a passive process in which they seek information only about the cam therapies that they have had previous experience with or that are recommended by a trusted health professional, family member, or friend 14,15,18. Other cancer patients take on a more active role in which they engage in an extensive and iterative information-seeking and evaluation process related to a diverse range of cam therapies. This process often continues throughout their cancer journey and is revisited at key milestones, such as at the end of conventional cancer treatment and at diagnosis of recurrence 14,18,35. For these individuals, the search for cam information is motivated by their information needs, including the potential risks and benefits of cam use, the likelihood of negative interactions of specific cam therapies (typically natural health products) with conventional treatments (that is, chemotherapy, radiation, hormone therapy), the appropriate timing of cam use in the conventional cancer treatment trajectory, and the availability and financial cost of specific therapies 14,15,18.The type of evidence privileged by cancer patients in making cam decisions varies widely and includes professional advice, the scientific literature, anecdotes about cam use from social networks, the Internet, and previous personal experiences with cam\n14,35,38. As a result, patients seek information about cam from a multitude of sources, although there is a preference to seek assistance from trusted individuals who are perceived as being credible, such as oncologists, family physicians, or regulated cam practitioners (a naturopathic physician, for instance) 14,16,39. Whether these health professionals have the training, knowledge, or interest to discuss cam therapy options with cancer patients, however, is discussed in elsewhere in this issue 40.The information gathering and evaluation phase can be an anxiety-provoking experience. Some individuals are able to control the amount of information they obtain about cam by restricting their search to a limited number of therapies or by avoiding certain resources, such as the Internet, but others report feeling overwhelmed by the amount of cam information they acquire 14,18. Some patients struggle to make sense of the often contradictory information that exists about cam\n14,41, and they report being particularly distressed about the lack of consensus between and among their cam and conventional health professionals about the implications of cam use. This conflict causes profound anxiety in some cancer patients who are fearful of making the “wrong” treatment decision that could have potentially serious consequences regarding their survival.2.2.3 Making a CAM DecisionHow cancer patients ultimately reach a decision about cam varies considerably between individuals and along the cancer trajectory. This complex process, labelled “bridging the gap” by Balneaves et al.\n14, involves cancer patients attempting to make sense of the disparate advice and information they have gathered about cam while reflecting on their personal beliefs about cancer, treatment, and healing.In our previous work, we identified three different types of cam decisions.First, individuals in the midst of conventional treatment who are experiencing high anxiety and conflict often “take it one step at a time” and postpone their cam decisions to later in the cancer trajectory when they have more energy to reflect on a broader spectrum of treatments. This delay is particularly evident in patients who have received limited support from their oncology health professionals in the cam decision-making process. The cam therapies chosen by these patients are typically those that fall within the realm of supportive care (for example, massage, relaxation therapy) and have been associated with positive psychosocial outcomes 14,18.Second, cancer patients who have a high level of trust in the conventional health care system engage in a “playing it safe” decision-making process in which the advice of their oncologists is privileged throughout the cancer trajectory. Only cam therapies that can be easily incorporated into their conventional treatment protocol are chosen. Frequently, these patients perceive their cancer diagnosis to be “too serious to play around with” and are hesitant to use any therapies, particularly natural health products, that may negatively interact with their conventional treatment 14,42.In contrast, a third group of cancer patients is able to “bring it all together” and make treatment decisions that incorporate cam as part of their treatment plan with minimal conflict and anxiety. These individuals often report having a life-long commitment to cam use that precedes their diagnosis, and they believe that cam therapies are natural, supportive of the body’s innate ability to heal, and better able to holistically address physiologic and psychosocial needs than conventional care can 14,35,43. However, some of these patients have described feeling “pushed” towards cam as result of their beliefs about conventional cancer treatments being “toxic,” “poisonous,” or immunosuppressive 21,37. Still others have turned toward cam because of their dissatisfaction with conventional care, including the quality and quantity of their interactions with health professionals, the adverse effects of conventional treatment, and their experiences with ineffective therapies 16,35,37,44,45. These latter patients are most at risk of abandoning conventional care in lieu of alternative treatments.2.2.4 Revisiting the CAM DecisionAs patients move through the cancer trajectory and reach the end of their conventional treatment protocol, many revisit the cam decisions made following their diagnosis and during adjuvant treatment. For some individuals, this reflection is a consequence of feeling as if they have “fallen off the cliff” as they lose the frequent contact they have had with their oncology health professionals during active treatment 46. Adding cam therapies to their health care repertoire allows these individuals to feel as if they are “still doing something” and helping their bodies recover from the trauma of chemotherapy and radiation. Other cancer patients see the end of conventional treatment as opening the door to specific cam therapies, especially natural health products, which were discouraged while they were undergoing treatment because of fears of negative interactions 14. Lastly, the completion of conventional treatment also liberates patients from what can be an extensive commitment of time and physical and emotional energy; it gives them the opportunity to explore new treatment options that were too overwhelming to consider at the beginning of the illness experience.Cancer patients also revisit their cam decisions in response to new information received regarding disease progression and prognosis 14,18. The identification of a recurrence or metastases can result in some individuals returning to the taking-stock phase of the decision-making process to reconsider their cam decisions and perhaps expand their search for cam therapies, including more alternative forms of treatment. Others interpret disease progression as a sign of ineffectiveness, and they withdraw or significantly alter their cam regimen. Conversely, results suggestive of remission or tumour regression can encourage some individuals to maintain or increase their use of cam.Lastly, the growing field of cam research is providing new data on the efficacy and safety of specific cam therapies on almost a daily basis. This information is rapidly translated to cancer patients and oncology health professionals through the media, scientific journals, and research-based databases [for example, Natural Standards (www.naturalstandard.com)]. For individuals for whom scientific evidence is an important consideration in their treatment decisions, such information may encourage their exploration of promising cam therapies or their withdrawal from products or practices suggested to be ineffective or potentially harmful 14,38.3. SUMMARYOur review of the cam decision-making process (see Figure 1) highlights the fact that cam decisions are highly individualized, complicated, and multifaceted, and that they involve dynamic processes that vary throughout the cancer trajectory. The decision to use—or not to use—cam is not a one-time whimsical decision; instead, it is a decision that leads cancer patients to reflect on their unique personal and social context and to ponder how cam may fit with their values, beliefs, and specific health care needs. As the individual and social contexts of patients change, the appropriateness of select cam therapies in their treatment regimen also changes. Decisions about cam are not static; rather, they are dynamic entities that require assessment and follow-up by health professionals throughout a patient’s illness.Recognizing that cam decision-making can be an anxiety-laden experience for patients suggests the need for ongoing decision and information support by oncology health professionals from diagnosis through survivorship—and for some individuals, through end of life. Research indicates that cam decisions coincide with patients’ decisions about conventional treatment, with many individuals regarding conventional and cam therapies as part of the same continuum of care 14,18. As a consequence, cancer patients often assume that discussions about treatment options with their oncology health professionals will include both conventional and cam therapies. However, oncology health professionals are often hampered in these types of discussions because of the limited evidence that supports the safety and efficacy of many cam therapies in the context of conventional cancer care and because of the lack of integration of cam education into their professional training programs 47,48.Despite the need for additional research and professional education on cam, it is essential that oncology health professionals begin a dialogue with patients that focuses not just on individual cam therapies, but also on how to make treatment decisions that acknowledge scientific evidence and each patient’s beliefs, values, and sociocultural contexts.A dialogue regarding cam-related treatment decisions would ideally be an ongoing discussion that corresponds with key milestones in a patient’s illness, such as diagnosis, end of conventional treatment, and recurrence or metastasis. A key element of patient-centered decision support is an assessment of an individual’s preferred level of engagement in the decision-making process and preferred degree of involvement of their oncology health professionals. Further, recognizing the individual contexts of patients, including pre-existing beliefs about healing, previous experiences with conventional medicine and cam, and the influence of significant others and the surrounding community, is also essential. Assessing patient goals related to cam use is also important and can illuminate important belief systems and experiences that need to be acknowledged in tailoring decision support. Although some patients may be interested in using cam for curative reasons and to address the side effects of conventional treatment, other patients may be pursuing cam to preserve hope in the face of a terminal prognosis. In addition, acknowledging the potential barriers to cam use can help patients consider the fuller implications of using cam therapies beyond the physiologic effect and their own physical limitations in using a diverse range of therapies.Verhoef, Boon, and Page 40 provide further suggestions regarding how oncology health professionals can communicate with patients about cam. As research in this field continues, we can expect to see evidence-based decision-support strategies emerge, such as decision-support aids and counselling strategies that will assist patients and professionals alike in the cam decision-making process.FIGURE 1The complementary and alternative medicine (cam) decision-making process.\n\nREFERENCES:\n1. CharlesCGafniAWhelanTDecision-making in the physician–patient encounter: revisiting the shared treatment decision-making modelSoc Sci Med1999496516110452420\n2. DiefenbachMADorseyJUzzoRGDecision-making strategies for patients with localized prostate cancerSemin Urol Oncol200220556211828358\n3. GattellariMVoigtKJButowPNTattersallMHWhen the treatment goal is not cure: are cancer patients equipped to make informed decisions?J Clin Oncol2002205031311786580\n4. RobinsonAThomsonRVariability in patient preferences for participating in medical decision making: implication for the use of decision support toolsQual Health Care200110suppl 1i34811533436\n5. ElitLCharlesCGoldIWomen’s perceptions about treatment decision making for ovarian cancerGynecol Oncol200388899512586585\n6. HenmanMJButowPNBrownRFBoyleFTattersallMHLay constructions of decision-making in cancerPsychooncology20021129530612203743\n7. SainioCErikssonELauriSPatient participation in decision making about careCancer Nurs200124172911409060\n8. SandersTSkevingtonSDo bowel cancer patients participate in treatment decision-making? Findings from a qualitative studyEur J Cancer Care (Engl)2003121667512787015\n9. DavisonBJGleaveMEGoldenbergSLDegnerLFHoffartDBerkowitzJAssessing information and decision preferences of men with prostate cancer and their partnersCancer Nurs20022542911838719\n10. DegnerLFKristjansonLJBowmanDInformation needs and decisional preferences of women with breast cancerJAMA19972771485929145723\n11. BalneavesLGBottorffJLHislopTGHerbertCLevels of commitment: exploring complementary therapy use by women with breast cancerJ Altern Complement Med2006124596616813510\n12. EngJRamsumDVerhoefMGunsEDavisonBJGallagherRA population based survey of complementary and alternative medicine use in men recently diagnosed with prostate cancerIntegr Cancer Ther200322121615035882\n13. DengGECassilethBRCohenLIntegrative oncology practice guidelinesJ Soc Integr Oncol20075658417511932\n14. BalneavesLGTruantTLKellyMVerhoefMJDavisonBJBridging the gap: decision-making processes of women with breast cancer using complementary and alternative medicine (cam)Support Care Cancer2007159738317609997\n15. BoonHBrownJBGavinAKennardMAStewartMBreast cancer survivors’ perceptions of complementary/alternative medicine (cam): making the decision to use or not to useQual Health Res199996395310558372\n16. BoonHBrownJBGavinAWestlakeKMen with prostate cancer: making decisions about complementary/alternative medicineMed Decis Making200323471914672107\n17. MontbriandMJAlternative therapies as control behaviours used by cancer patientsJ Adv Nurs199522646548708182\n18. TruantTBottorffJLDecision making related to complementary therapies: a process of regaining controlPatient Educ Couns1999381314214528705\n19. BuettnerCKroenkeCHPhillipsRSDavisRBEisenbergDMHolmesMDCorrelates of use of different types of complementary and alternative medicine by breast cancer survivors in the nurses’ health studyBreast Cancer Res Treat20061002192716821087\n20. KimbyCKLaunsoLHenningsenILanggaardHChoice of unconventional treatment by patients with cancerJ Altern Complement Med200395496114499031\n21. VerhoefMJBalneavesLGBoonHSVroegindeweyAReasons for and characteristics associated with complementary and alternative medicine use among adult cancer patients: a systematic reviewIntegr Cancer Ther200542748616282504\n22. EngKFeenyDComparing the health of low income and less well educated groups in the United States and CanadaPopul Health Metr200751017939874\n23. PattersonRENeuhouserMLHeddersonMMTypes of alternative medicine used by patients with breast, colon, or prostate cancer: predictors, motives, and costJ Altern Complement Med200284778512230908\n24. BroomAToveyPThe dialectical tension between individuation and depersonalization in cancer patients’ mediation of complementary, alternative and biomedical cancer treatmentsSociology200741102139\n25. RotterJBGeneralized expectancies for internal versus external control of reinforcementPsychol Monogr1966801285340840\n26. BalneavesLGKristjansonLJTatarynDBeyond convention: describing complementary therapy use by women living with breast cancerPatient Educ Couns1999381435314528706\n27. BishopFLYardleyLConstructing agency in treatment decisions: negotiating responsibility in cancerHealth (London)2004844658215358899\n28. DavidsonRGeogheganLMcLaughlinLWoodwardRPsychological characteristics of cancer patients who use complementary therapiesPsychooncology2005141879515386777\n29. TurtonPCookeHMeeting the needs of people with cancer for support and self-managementComplement Ther Nurs Midwifery20006130711858470\n30. SalmenperaLThe use of complementary therapies among breast and prostate cancer patients in FinlandEur J Cancer Care (Engl)200211445011966834\n31. RakovitchEPignolJPChartierCComplementary and alternative medicine use is associated with an increased perception of breast cancer risk and deathBreast Cancer Res Treat2005901394815803360\n32. LuptonDLuptonDTheoretical perspectives on medicine and societyMedicine As Culture2nd edLondonSage1994521\n33. SealeCHealth and MediaLondonSage2003\n34. WeeksLVerhoefMScottCPresenting the alternative: cancer and complementary and alternative medicine in the Canadian print mediaSupport Care Cancer200715931817624558\n35. EvansMShawAThompsonEADecisions to use complementary and alternative medicine (cam) by male cancer patients: information-seeking roles and types of evidence usedBMC Complement Altern Med200772517683580\n36. ÖhlénJBalneavesLGBottorffJLBrazierASThe influence of significant others in complementary and alternative decisions by cancer patientsSoc Sci Med20066316253616725245\n37. SinghHMaskarinecGShumayDMUnderstanding the motivation for conventional and complementary/alternative medicine use among men with prostate cancerIntegr Cancer Ther200541879415911931\n38. VerhoefMJMulkinsACarlsonLEHilsdenRJKaniaAAssessing the role of evidence in patients’ evaluation of complementary therapies: a quality studyIntegr Cancer Ther200763455318048882\n39. RobertsCSBakerFHannDPatient–physician communication regarding use of complementary therapies during cancer treatmentJ Psychosoc Oncol200523356016618687\n40. VerhoefMJBoonHSPageSATalking to cancer patients about complementary therapies: is it the physician’s responsibility?Curr Oncol200815suppl 2S88S9318769581\n41. EvansMAShawARSharpDJMen with cancer: is their use of complementary and alternative medicine a response to needs unmet by conventional care?Eur J Cancer Care (Engl)2007165172517944766\n42. MontbriandMJDecision tree model describing alternate health care choices made by oncology patientsCancer Nurs199518104177720049\n43. LengacherCABennettMPKipKEGonzalezLJacobsenPCoxCERelief of symptoms, side effects, and psychological distress through use of complementary and alternative medicine in women with breast cancerOncol Nurs Forum2006339710416470237\n44. HannDAllenSCiambroneDShahAUse of complementary therapies during chemotherapy: influence of patients’ satisfaction with treatment decision making and the treating oncologistIntegr Cancer Ther200652243116880427\n45. ShumayDMMaskarinecGGotayCCHeibyEMKakaiHDeterminants of the degree of complementary and alternative medicine use among patients with cancerJ Altern Complement Med200286617112470448\n46. BoydDBIntegrative oncology: the last ten years—a personal retrospectiveAltern Ther Health Med200713566417283742\n47. Corbin WinslowLShapiroHPhysician want education about complementary and alternative medicine to enhance communication with their patientsArch Intern Med200216211768112020190\n48. HessigREArcandLLFrostMHThe effects of an educational intervention on oncology nurses’ attitude, perceived knowledge, and self-reported application of complementary therapiesOncol Nurs Forum20043171814722590"
+}

batch_2/PMC2528567.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2528567",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2528567\nAUTHORS: S.B. Sutcliffe\n\nABSTRACT:\nThe burden of cancer continues to increase globally, with substantial personal, societal, and economic consequences. Population growth and aging underlie this increase—a reflection of the effect of population health interventions in the last two centuries. Much of this gain has come through observation, derivation of evidence, and rigorous application of valid science to the public, both healthy and affected by diseases such as cancer. Increasingly, molecular medicine will affect the knowledge of cause and the personalization of therapy. However, science informs the decision-making process and places evidence within the beliefs of individuals and society as they relate to innovation, judgment, and values—the “logic” underlying alignment of conventional and complementary (holistic) care as a basis for compelling, consistent, and confident decisions.\n\nBODY:\n1. INTRODUCTIONIntegrative medicine brings together the care philosophies inherent in biomedicine—commonly conceived as Western, “evidence-based,” and rooted in science—and holistic medicine—often described in alternative or complementary medicine terms and based strongly in values or beliefs. Not uncommonly, this integration is obscured by debate as to which paradigm is “right” or “correct.” However, such a distinction is largely without value if the goal is to justify “care and decision-making” according to science (biomedicine) or to human values and beliefs (holistic medicine).Science informs the process of decision-making and human values place scientific evidence within the context of the individual and society. In integrative care, not only are practices based in science and complementary medicine brought together, also brought together are the philosophies of analytic and deductive reasoning based in evidence (science) and the contextualization of science within the beliefs of individuals and society based on invention, judgment, and values (logic). A satisfactory outcome for the person needing care is confidence in the decision or decisions because information was made available, because the processes of assembling information were codified to allow for alignment with beliefs, and because the rationale for care formulated within the values of the individual was such that the eventual decision is compelling and consistent for that person.2. DISCUSSION2.1 Life, Death, and Human ValuesIn his treatise on the health of individuals and populations, Cairns notes that one cannot interpret health (life), without first being knowledgeable about illness and death 1. In Figure 1, attention is drawn to the unchanging pattern of human mortality from the earliest of available evidence to the mid-19th century, preceding the Industrial Revolution in the Westernized world. By contrast, the profound change in mortality following the Industrial Revolution (post-1850) is shown in the population survival plot for England in the 1990s (Figure 1). The illustration demonstrates certain points: The power of interventions to change survival—in this case, interventions largely related to the introduction of public health measures and, to a lesser, more recent degree, interventions based in medical treatment The value of observations validated through scientific methods as a basis for improvements in survival The factual basis for interventions designed to achieve longevity through informed, valid, applied health policyIn large part, interventions designed to control communicable diseases (pathogen A causes disease B, which can be controlled by intervention or interventions C) have resulted in avoidance of premature death, with resultant longevity. This benefit is based on a proposition that values longevity.Through observation, deductive reasoning, intervention, validation through scientific method, analysis of outcome, and application to practice through policy, the population has, over one and one-half centuries, gained on average an extra 30 years of life expectancy from birth. However, in Westernized, high-income economies, cancer and most chronic diseases causing premature death are not communicable diseases for which straightforward interventions are available. Accordingly, the value set for communicable disease (longevity through avoidance of premature death) is not necessarily the same as that set for cancer or non-communicable diseases, in which functionality and quality determinants may take greater precedence than does longevity. Furthermore, the existing organization of health services based on an acute reversible illness model does not necessarily align well with the management of interventions to ameliorate the personal and societal impacts of chronic disease.In Figure 2, domains of scientific enquiry are related to effects on humanity according to the value proposition applied to the preferred outcome. The illustration draws recognition to the roles of individual values and societal values in determining the expected role of the intervention, thereby highlighting the dichotomy of the individual and society as consumer and beneficiary and funder of health care in a publicly funded health system.2.2 The Cancer Control ProblemThe population burden of cancer continues to increase, primarily as a function of the increase in population numbers and the structure of increasing age of our society. Cancer is principally a disease of aging, the rate increasing substantially after the age of 60 years. The rising burden of cancer draws attention to several issues: The effect of our interventions is insufficient to offset the increasing incidence consequent upon aging and population growth. The burden of cancer is not borne equally by individuals or populations: disparities exist within and across communities and populations. The interpretation and the effect of the burden has different meanings, all encompassed within the context of health need. That is, “burden” as a statement of medically necessary care, “burden” as a personal or societal consequence of illness,“burden” as an expression of capacity to benefit from intervention,“burden” as the capacity to afford necessary health care, and “burden” as the expression of inequality to achieve the gains of intervention.The interpretation of burden has both a personal and societal context and value proposition. Not-withstanding the definition or value placed on burden, the problem is not solely that the burden is rising—that is a fact. The problem is what can be done about the rising burden, individually and societally. A further point of importance is that the variation in health outcomes across communities and populations has as much, if not more, to do with variations in exposure to risk factors (environment, occupation, smoking, diet, obesity, nutrition, and exercise, among others) as with variations in access to interventional care.2.3 Cancer As a Process, Not an EventMolecular medicine has identified cancer as a genetic disease. Thus, the transformation of the healthy cell through a series of events that lead to a cancer cell with the properties of invasion and metastasis that may lead to death is underwritten in serial and cumulative changes within the genome of the cell. These are measurable biologic changes that correlate with predisposition, expression, sensitivity or resistance to therapies, and the prognosis of cancer—a concept underlying aspects of the uniqueness of cancer to the individual and to the personalization of care.If we accept cancer as a process, arising in health and, if unperturbed, resulting in illness, disability, and death, then the strategy for cancer control must address the process, not just the disease. In the case of symptomatic cancer, the process is well advanced and the opportunities for intervention limited to treatment or palliation.In the context of addressing the process of cancer, the definition and the nature of interventions related to cancer control assume importance 2. Cancer control encompasses cancer treatment: treatment interventions for individuals with an established diagnosis of cancer, commonly delivered through hospitals or cancer centres, focused on the treatment episode and the requirement for acute hospital-based services. cancer care: integrated programs across care settings (hospital, community, home) by networks of providers, with the goal of coordinated, continuous services for the individual or individuals experiencing cancer and needing care. cancer control: interventions directed to the healthy (at risk), those experiencing cancer, and those who are cured (survivors) or dying of their cancer. The interventions engage multiple sectors (health, education, and transport, among others) and are ultimately attempting to achieve a responsive, efficient, effective, and sustainable system to improve health and control cancer (as a process, not as an event).Within each of these contexts of cancer intervention, values attached to the delivery of treatment, care, or control will be relevant both from an individual and a societal perspective. What ultimately drives the decisions regarding provision and access to interventions? How is this expressed from the perspective of the public, the patient, the care provider, and the funder?Factors of relevance relate to the quality of the service (processes, outcomes), safety (incidents, errors, adverse events), accessibility (distance, costs), availability (timeliness), cost-efficiency and cost-effectiveness, satisfaction and sustainability (individually and societally), and attachment of individual and societal values and judgments to the foregoing parameters.The premise underlying reductionism is that complex problems can be solved by dividing them into smaller—indeed individual—parts and by so doing, represent the whole by the sum of the individual parts. Scientific method would naturally lead us in the direction of the necessity to control all variation other than the characteristics and performance related to a single attribute or a small number of attributes. The current pursuit of targeted therapies is an illustration of that ideology, and it has been remarkably successful in a number of circumstances—for example, imatinib and tyrosine kinase inhibition in chronic myeloid leukemia and gastrointestinal stromal tumours; rituximab for CD20+ lymphoma; trastuzumab for breast cancer that is positive for human epidermal growth factor receptor. Yet notwithstanding these remarkable examples, reductionism has profound limitations as a strategy to explain and treat disease: It focuses on a single factor as cause. It emphasizes static control of function rather than dynamic management of a range of function. It implies a one-target, one-risk-factor approach to disease management. It takes a piecemeal approach to the multiple problems inherent in a chronic disease process.Although inappropriately simplistic, reductionism aligns more to the management of communicable disease (pathogen A causes disease B, necessitating intervention C) than to the more complex gene–environment interactions characterizing non-communicable diseases including cancer.Reductionism is a tool to investigate cause-and-effect through the scientific method, but other than in unique circumstances, it is incapable of addressing the whole simply as the sum of the parts within a system that is characterized by multiple biologic processes, multiple genes within multiple pathways, multiple targets, and multiple organ systems (tumour, tissue micro-environment, organ, host, and host environment). Even if a reductionist approach were to be employed to “dissect” the multiple, individual pathways underlying the cause and expression of cancer, would the establishment of therapeutic benefit through current clinical trial methods be feasible or practical? Current oncologic practice would suggest that only 5% of novel therapeutics actually enter clinical application, with an expected investment in excess of $800 million for each successful drug candidate achieving approval 3.Challenges within the reductionist approach have stimulated the concept of a systems perspective to biology and health. In this construct, the holistic and composite characteristics of the problem are recognized, and the integration and interplay of relevant attributes are explored as an explanatory basis for observations. A relevant metaphor would be that “the forest cannot be explained by the study of individual trees.” The systems perspective would follow the principle that behaviour is explained by the system as a whole, not by the sum of the parts; that rarely is there a magic bullet for a unique, single target that will address health and illness; that many targets and many functions will be relevant to the control of biologic networks that include both cancer cells and normal cells; that time, space, and context will be relevant to how networks behave and respond; and that health is better defined by robustness, adaptability, and homeodynamism than by normalcy, control, and homeostasis 4.2.4 The Concept of Integrated HealthAccordingly, how might health be viewed from a systems perspective?A definition that would align to this concept would be “Health is the extent to which an individual or group is able, on the one hand, to realize aspirations and satisfy needs, and on the other hand, to change and cope with the environment. Health is, therefore, seen as a resource for everyday life, not the objective of living: it is a positive concept emphasizing social and personal resources as well as physical capacities” (cited in Young 1998 5).This concept describes health in the context of functional potential: the individual as an asset whose function can be maximized and dysfunction minimized through planned mitigating interventions, recognizing that health risks (risk factors) are largely created and maintained by social systems, that the magnitude of risk exposure is a function of socio-economic disparities and psychosocial gradients, and that the development of sustained health or illness plays out over extended periods of time, crossing many stages of human development (prenatal to late adult, environmental, and socio-economic political domains) 6.In this framework, disparities in health outcomes and in psychological adjustment to varying health states, rather than being attributable to discrete causes and actions, are determined by cumulative, compounding early-life events reflective of genes, biology, and environment embedded within the individual’s make-up, sustained by social, cultural, and economic forums, and affected by biologic, psychosocial, socio-economic, cultural, and physical environments. In each of these contexts, evidence established through the scientific method contributes to the development of a conceptual model for health and illness and the resultant response of health policies, practices, and systems 6.3. CONCLUSIONSIntegrative care may be most aptly understood from the perspective of the beneficiary of care, the patient, rather than from the perspective of the care provider (the biomedical, complementary, or alternative medicine practitioner). In whose hands is the decision-making process placed? Which tools and information sources are made available to assist with the decision? How are the processes of reasoning codified—be they scientific, evidence-based, or debated—to provide a basis for decision-making that is aligned to individual beliefs? And how are arguments for interventions placed within the values and the priorities of the individuals?Good decisions are made with the full confidence of the patient. Confidence requires the information to be sound, the rationale compelling, and the judgment to be fully aligned to patient needs and values. The inputs to the decision, be they scientific, holistic, complementary, or belief-based are all relevant inasmuch as trust in the inputs will lead to trust in the decisions.FIGURE 1Patterns of survival in Breslau (17th century), Liverpool (19th century), and modern England (late 20th century). From Cairns 1997 1, p. 21, reproduced with permission.FIGURE 2Domains of scientific enquiry.\n\nREFERENCES:\n1. CairnsJMatters of Life and DeathPrincetonPrinceton University Press1997\n2. CaronLDe CivitaMLawSBraultICancer Control Interventions in Selected Jurisdictions: Design, Governance, and ImplementationMonograph aetmiS 07-08aMontrealAgence d’évaluation des technologies et des modes d’intervention en santé2008339\n3. KolaILandisJCan the pharmaceutical industry reduce attrition rates?Nat Rev Drug Discov200437111515286737\n4. AhnACTewanMPoonCSPhillipsRSThe limits of reductionism in medicine: could systems biology offer an alternative?PLoS Med2006370913\n5. YoungTKPopulation Health: Concepts and MethodsNew YorkOxford University Press1998\n6. HalfonNHochsteinMLife course health development: an integrated framework for developing health, policy and researchMilbank Q200280133"
+}

batch_2/PMC2528947.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2528947",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2528947\nAUTHORS: Thierry Wirth, Falk Hildebrand, Caroline Allix-Béguec, Florian Wölbeling, Tanja Kubica, Kristin Kremer, Dick van Soolingen, Sabine Rüsch-Gerdes, Camille Locht, Sylvain Brisse, Axel Meyer, Philip Supply, Stefan Niemann\n\nABSTRACT:\nThe evolutionary timing and spread of the Mycobacterium tuberculosis complex (MTBC), one of the most successful groups of bacterial pathogens, remains largely unknown. Here, using mycobacterial tandem repeat sequences as genetic markers, we show that the MTBC consists of two independent clades, one composed exclusively of M. tuberculosis lineages from humans and the other composed of both animal and human isolates. The latter also likely derived from a human pathogenic lineage, supporting the hypothesis of an original human host. Using Bayesian statistics and experimental data on the variability of the mycobacterial markers in infected patients, we estimated the age of the MTBC at 40,000 years, coinciding with the expansion of “modern” human populations out of Africa. Furthermore, coalescence analysis revealed a strong and recent demographic expansion in almost all M. tuberculosis lineages, which coincides with the human population explosion over the last two centuries. These findings thus unveil the dynamic dimension of the association between human host and pathogen populations.\n\nBODY:\nIntroductionThe Mycobacterium tuberculosis complex (MTBC) is composed of closely related bacterial sub-species that have plagued human and animal populations for thousands of years. The most famous member of the MTBC is M. tuberculosis, the etiological agent of tuberculosis in humans that killed 1.7 million people in 2004 according to the World Health Organization [1]. A new threat is the worldwide emergence of multi-drug resistant (MDR) and extremely drug-resistant (XDR) strains. Recent data suggest that the propensity to gain drug resistance as well as the pathogen's transmissibility profile may be influenced by the genetic and evolutionary background of M. tuberculosis strains [2]. Thus, understanding the relationships and dynamics of the MTBC lineages will undoubtedly help to unravel the basis for the considerable success and spread of tuberculosis, in both humans and animals. The MTBC is essentially clonal with little evidence of horizontal gene exchange [3],[4],[5], and probably derived from a pool of ancestral tubercle bacilli, collectively called “Mycobacterium prototuberculosis” [6]. However, despite the highly successful worldwide spread of the MTBC, the evolutionary timing of this spread remains largely unknown.This lack of knowledge is largely due to the limitations of the genetic markers used so far. All efforts to time MTBC evolution with single nucleotide polymorphisms (SNPs) have been based on a non-warranted hypothesis of universal bacterial mutation rates, itself extrapolated from a very hypothetical time of divergence between Escherichia coli and Salmonella enterica\n[7].In this study, we used a completely new approach by employing genetic markers based on mycobacterial interspersed repetitive units (MIRUs) to determine the timing of divergence, population diversity and spread of the MTBC. MIRU loci comprise variable numbers of tandem repeat (VNTR) sequences, which allow them to be used as powerful genotyping markers [8],[9]. In terms of genetic diversity and mutation rates, they resemble human microsatellites, which are widely used in human population genetics studies [10]. Similar to microsatellites, MIRUs behave as selectively neutral phylogenetic markers if sufficient numbers of loci are used to buffer against potential biases.Here we used experimental data on the variability and evolution of these markers in clinical isolates of infected patients, which allowed us to calculate the MIRU molecular clock and model their evolution in coalescence approaches. Based on this information and extensive analysis of a large collection of representative MTBC strains, we obtained new insights into the origin and demography of the MTBC and its dynamic association with the human host.Results\nM. tuberculosis phylogenyTo infer the MTBC evolutionary history, we used a sample collection of 355 isolates, representative of well-identified primary branches of the MTBC world distribution (Table S1). A recently standardized combination of 24 MIRU loci (Figure S1), which does not comprise saturated loci [11], was utilized. To illustrate the power of MIRUs to reconstruct geographical patterns of genetic differentiation and their level of resolution, a distance-based tree was constructed using individual genotypes and a neighbour-joining algorithm (Figure 1A). The tree grouped all M. tuberculosis sensu stricto isolates (all from human patients) in a distinct lineage with the notable exception of the East African-Indian (EAI) population whose affiliation is unclear based on this approach. Another major lineage encompassed all MTBC strains from animals (M. microti. M. bovis, M. caprae and M. pinipedii) and the human isolates from West-Africa (M. africanum West African 1 and 2). From the resulting tree, it appears that the groupings of isolates within the primary MTBC branches based on SNPs, spoligotyping and large sequence polymorphisms (LSPs) [12],[13],[14],[15],[16],[17] (Figure S2) are highly congruent with those based on the MIRU typing, albeit the branch resolution was higher in the latter. In order to more robustly define the relationships between the lineages (by reducing the number of individuals vs the number of markers), we then grouped individual isolates into the populations defined by the above groupings and built a tree based on MIRU allelic frequencies in these populations (Figure 1B). The tree was rooted with samples of M. prototuberculosis (including M. canettii), which was recently reported to represent the progenitor of the MTBC [6]. This approach clearly revealed the distinctiveness of the two major lineages with strong bootstrap support, called hereafter clades 1 and 2. A further geographic sub-structuring within clade 1 became apparent, with distinct branches for the African (Uganda, Cameroon and S), Asian (Beijing and CAS), Latin American-Mediterranean and African-European populations (X, Ghana and Haarlem). Clade 2 is composed of both animal and human pathogenic isolates. A basal position of EAI (human tuberculosis) in clade 2 has strong statistical support, indicating a human origin for this predominantly animal-associated MTBC lineage. However, low bootstrap values within clade 2 prevent us from drawing further inferences on the branching order.10.1371/journal.ppat.1000160.g001Figure 1Evolutionary relationships of the Mycobacterium tuberculosis complex.(A) Unrooted MIRU Neighbour-joining phenogram depicting genetic distance relationships among tubercle bacilli isolates based on Nei et al.'s DA distances. (B) Rooted MIRU population Neighbour-joining tree based on genetic distance. M. prototuberculosis was used as an outgroup. Values on the nodes represent the percentage of bootstrap replicates over individuals (N = 1000) showing the particular nodes. Branch lengths are proportional to the genetic distance between the tubercle lineages. It is noteworthy that low bootstrap values within clade 2 prevent us from drawing further inferences on the branching order in this clade (see also main text). Wa, West-Africa. (C) Population structure of 20 MTBC clonal lineages using the no-admixture model, where K = 3. Each colour represents one cluster, and the length of the color segment shows the strains' estimated proportion of membership in that cluster. Results shown are averages over 10 STRUCTURE runs. For clarity, strains codes are also given according to Gagneux et al. (2006).A population genetics perspectiveTo confirm the groupings and the deep dichotomy obtained with the MIRUs, we used an independent approach, based on the ‘no-admixture’ model of the STRUCTURE program [18]. In this Bayesian approach, multilocus genotypic data are used to define a set of populations with distinct allele frequencies and assign individuals probabilistically to them, with or without prior knowledge of geographic sampling information. We applied STRUCTURE to the global data set (including the outgroup) and in ten independent runs, at K = 3 populations (Fig. 1C) STRUCTURE detected the same two deeply divergent clades 1 and 2 that were identified with the neighbour joining analysis (see Figure 1B). Notably, this separation is independently supported by the fact that TbD1 (M. tuberculosis deletion 1) is lacking in all clade 1 strains but present in all clade 2 strains, including those from EAI (Figure 1B and S2) [12]. The robustness of these clades was further evidenced by STRUCTURE analysis, because each isolate derived all of its MIRU's from only one of the three ancestral sources of clade 1, clade 2 or M. prototuberculosis (see Protocol S1). We further modelled the Bayesian assignments of the two main clades by sub-dividing them into additional clusters (Figure S3A). The bacterial isolates were consistently split into the same major clusters as those defined by the distance-based approach (see above). The highest likelihoods were obtained for K = 6 populations in each of the two main clades. Only three isolates (0.85%) were assigned to unexpected clusters by the Bayesian approach (Figure S3A), further illustrating the consistency of MIRU-VNTR cluster designations. To detect possible horizontal genetic transfer events, we used the STRUCTURE ‘linkage model’ as was done to detect ongoing genetic exchange in Helicobacter pylori\n[19],[20], Escherichia coli\n[21] and Moraxella catarrhalis\n[22]. Runs without prior knowledge of population source (Figure S3B) suggested that the vast majority of the MTBC strains are clonal, while some M. prototuberculosis strains might be hybrids with MTBC genotypes, in accordance with previous results [3],[5],[6].MTBC ancestral lineages and genetic diversityTo further assess the deep dichotomy, we calculated the allelic richness (the number of alleles) of the populations within the two main clades after correcting for sample size effects [23] (Fig. 2). High levels of genetic diversity are a surrogate indication of ancestral origins as illustrated in the highly divergent African human populations. The mean allelic richness per locus was close to five for both clades, and the difference was not significant (Fig. 2C), arguing for a simultaneous split of the two clades. As expected, LAM and EAI, the most basal populations in clades 1 and 2 respectively, contained the highest number of alleles (Fig. 2A, 2B). However, some uncertainty remains on a basal position for LAM because it conflicts with groupings based on internal deletions of the pks15/1 gene and on SNPs [13].10.1371/journal.ppat.1000160.g002Figure 2Genetic variability in the different MTBC lineages.(A and B) MIRU allelic richness in each population within clade 1 and 2 respectively. Rarefaction included eight isolates per population (smaller populations were not considered in this analysis. (C) Clades mean allelic richness. Notice that the difference between clade 1 and 2 is not significant (t-test, P = 0.08).Dating the disease and the evolutionary radiation stepsIn order to estimate the time to the most recent common ancestor (TMRCA) in the MTBC, we made use of recent analytical tools [24],[25], which make these estimations possible. They rely on Bayesian statistics and apply a stepwise mutation model (SMM) for genetic markers. This model is a reasonable assumption for MIRU mutations, as initially shown for MIRU locus 4 in the BCG evolutionary framework [9]. To test the validity of this model for the total set of the MIRU loci used, we built a minimal spanning tree of all MTBC strains based on the degree of allele sharing. We then evaluated the proportion of strains that differed from their closest relative by one step (single-locus variants- SLVs) or by multiple steps, which would violate the SMM model. This simple method will certainly overestimate any violations of the SMM model because our sampling scheme is not exhaustive, resulting in some spurious missing links (intermediate strains) that falsely invalidate the SMM model. However, the data showed that at least 64% of the allelic changes fit the stepwise mutation model, a result that is close to the 75% and 81% observed in E. coli and yeast VNTRs, respectively [26],[27].To further evaluate the validity of the SMM model, eBURST analysis was performed on a much larger dataset comprising 1,733 MIRU-VNTR profiles from two population-based studies performed at regional and national levels (see Materials and Methods). This analysis identified 142 groups and 1061 singletons. In order to determine whether tandem repeats evolve following a SMM model and to detect a potential bias towards increase or decrease in repeat numbers, we computed within each eBURST group all differences in number of repeats along the evolutionary path, starting from the putative founder of the group to its surrounding SLVs (Figure S4). For all but two of the 24 loci, the most frequent change was either −1 or +1 repeat unit, with the symmetric change generally being the next most frequent. The only minor exceptions were loci MIRU-VNTR 3007 and 2347, which contain little information, because the only changes were one occurrence each of −2 and +1 repeat units, and four occurrences of −2 and two of +1 respectively. Both for the individual loci and for data cumulated over the 24 loci (Figure S5), the distribution of occurrences was unimodal and centered on 0 (average of −0.07±0.23, CI = 0.95, for cumulated data). At least sixty-five percent of the allelic changes matched the stepwise mutation model. It is noteworthy that missing links falsely invalidating the SMM model probably occur even in this population-based dataset, because many patients from the population studied (from the Brussels region and the entire Netherlands) were foreign-born and have probably acquired their infection abroad. Therefore, tandem repeats in M. tuberculosis most frequently evolve by progressive gain or loss of single repeat units without significant general bias towards increase or decrease.To estimate MIRU mutation rates, we used data from large sets of serial or epidemiologically-linked isolates. The probability of showing a repeat change over periods of up to 7 years was estimated to be about 1% for five of the most variable loci [11]. This corresponds to a single-locus mutation rate of 1.4×10−3 per year. Consistently, 4 of these 5 loci composed the top 4 in the hierarchy of single-locus variation frequencies measured among the MIRU loci, both in a global MTBC isolate dataset [11] and in the above population-based dataset (data not shown). This supports the use of these frequencies as a surrogate for estimating relative mutation rates of the different markers, and especially those of the less variable loci, for which repeat changes among serial or epidemiologically-linked isolates were not observed [11]. We therefore somewhat arbitrarily chose a lower mean mutation rate per year of 10��4 as a prior for the Bayesian inferences [25] over all loci, in order to accommodate the less variable loci which were associated with up to 38fold lower frequencies of single-locus variation. It is noteworthy that this initial value was well supported by posterior Bayesian analysis, as the calculated posterior mean for the mutation rate was 10−3.91 (Figure 3). By applying this mutation rate and a generation time of one day for the tuberculosis bacilli, we estimated a mean TMRCA of ≈40,000 years before present for the complex (Table 1). The TMRCAs for clades 1 and 2 were estimated as 21,000 and 33,000 years, respectively, and two of the oldest lineages, EAI and LAM coalesced at 13,700 and 7,000 years, respectively (Table 1).10.1371/journal.ppat.1000160.g003Figure 3Calculated posterior mean for MIRU-VNTR mutation rate among loci using the MSVAR algorithm.This graph corresponds to the output obtained for the Haarlem population sample and the 95% interval confidence is given (red dotted lines).10.1371/journal.ppat.1000160.t001Table 1Estimated Times (in years) since the most recent common ancestor (TMRCA).TMRCAAge in yearsCIsHierarchic levelLAM-Beijing21,300(14,300–31,600)Clade 1Beijing-CAS17,100(11,600–25,400)Asian TBLAM-LAM7,060(4,370–11,100)LAMCAS-CAS9,450(6,100–14,700)CASEAI-WA232,800(27,900–38,300)Clade2EAI-EAI13,700(9,100–21,000)EAI\nM. bovis-M. bovis\n5,750(4,560–7230)\nM. bovis\nEAI-LAM41,500(29,100–60,000)MTBCEAI-Beijing37,500(25,800–55,100)MTBCEstimates and 95% confidence intervals were calculated with the software YTime.In a second step, we used the MSVAR software [25] that infers past demographic changes and calculates additional parameters, including TMRCA of monophyletic populations using slightly different algorithms. For this procedure, we focused on lineages for which at least 30 isolates were included in the study, in order to avoid small sample size artefacts. The use of this method confirmed the TMRCA of the EAI population at ≈7,000 years (Figure 4B and Table 2), albeit with very wide confidence intervals (150–190,000 years).10.1371/journal.ppat.1000160.g004Figure 4Detection of recent expansion in different MTBC lineages.(A) Posterior distribution of M. bovis TMRCA, including the 95% confidence interval and density plots of the marginal posterior distribution of log (N0), where N0 is the current effective number of chromosomes and log (Nd), where Nd is the number of chromosomes before expansion. (B) Same plots for EAI. ta is expressed in years (±SD) and denotes the time that has elapsed since the population growth began.10.1371/journal.ppat.1000160.t002Table 2Time to the most recent common ancestor (TMRCA), time elapsed since the last expansion began (ta) and growth rate estimates based on the MSVAR software.TMRCA\nta\nGrowthlowermodalupperlowermodaluppermodalAfrica2.0243.5105.0850.4182.1934.6040.60Asia2.1263.6205.0220.8332.0063.7742.16Europe2.2573.7015.0290.7102.3213.5272.12Beijing0.9393.0405.3960.5662.5144.4212.71CAS1.8653.5405.1560.3892.3453.6241.67LAM2.3784.0075.7581.3412.9894.3811.80EAI2.2083.8545.2820.1342.1456.2740.81\nM. bovis\n2.3793.6874.8591.3163.1845.2221.83Modal values and 95% confidence intervals are presented. The results are on a log scale.\nM. tuberculosis demographic expansionFinally, genetic data can also unravel recent demographic change signatures in bacterial populations. By using Bayesian statistics, we tested whether a recent decline or expansion occurred in the MTBC population, and calculated ta, which reflects the time that has elapsed since the decline or expansion began. All MTBC populations from human sources that we considered displayed markedly consistent expansion rates and EAI is typical in that respect (see Figure 3B). The detected growth rates (on a log scale) ranged from a modest 0.6 value, as seen in Africa, to 2.7 for Beijing, which is probably the most successful present day lineage. This latter value translates into a recent 500-fold population size increase. The mean modal value of log10 ta was 2.25 (range 2.00–2.5) for the different populations, with the exception of the LAM lineage. This corresponds to a tuberculosis expansion that began 180 years ago (see Table 2).DiscussionTaken together, the findings presented in this study indicate that the MTBC is composed of two major lineages and has emerged approximately 40,000 years ago. This estimate is strikingly close to the proposed time of dispersal of founder modern human populations from the Horn of Africa [28]. However this dating must be considered with caution in the light of the large confidence intervals. Our results support the emergence of the MTBC clone from the M. prototuberculosis progenitor pool and its co-migration with modern humans out of Africa [6]. A similar trend was recently proposed for H. pylori and M. leprae\n[29],[30]. We suggest that two main lineages arose later some 20,000 to 30,000 years ago from the common MTBC ancestor, one of which spread exclusively among humans, with subsequent waves of migration to Asia, Europe and continental Africa (Figure 5). This spreading scenario fits well with the current worldwide distribution of the main MTBC lineages, as reflected by the SpolDB4 database [12],[13],[14],[15],[16],[17] and LSP analysis [14],[17]. The second lineage (clade 2) arose from a human EAI-like population some 30,000 years ago and is the probable source of animal tuberculosis [12],[31], a derivation that is strongly and convergently supported by both distance-based and probabilistic methods (i.e. NJ and STRUCTURE). This conclusion is consistent with the finding that extant representatives of M. tuberculosis, which derived from the proposed progenitor of MTBC, are human pathogens [6]. Thus it is likely that humans infected their livestock and not the other way around. Clade 2 secondary branches include M. bovis and M. caprae, the infectious agents of tuberculosis in a wide variety of animals including cattle and goat, which were first domesticated in the Near East [32],[33]. The transition from human to animal hosts may thus be linked to plant and animal domestication that took place in the Fertile Crescent some 13,000 years ago. This period corresponds to the estimated time of diversification of the oldest EAI and LAM populations (Table 2). In the Fertile Crescent, and during that era of human history, small nomadic hunter-gatherer groups were replaced by farming societies based on domesticated livestock and crops [34]. This paramount event in human history was probably not without consequence for an epidemic, infectious disease such as tuberculosis, where crowded farming populations may have promoted high infection rates, bacterial spread and transition to new niches and animal hosts [35]. Clade 2 also includes M. africanum strains that primarily infect humans. However, it has recently been speculated that M. africanum may not be primarily adapted to the human host but might have originated from an unknown animal reservoir [36].10.1371/journal.ppat.1000160.g005Figure 5\nM. tuberculosis evolutionary scenario (out of Mesopotamia).The main migrations events are numbered and correspond to: 1, M. prototuberculosis, the ancestor of the MTBC, this bacterium reached the Fertile Crescent some 40,000 years ago by sea or land; 2 and 3, two distinct basal lineages arose, EAI and LAM and spread out of Mesopotamia some 10, 000 years ago; 4, 5 and 6, later on (8–5000 years ago) derived populations from clade 1 followed main human migration patterns to Africa, Asia and Europe, giving rise to locally adapted tubercle strains and further diversifications. Note that the depicted borders are “artificial” and are used for the demonstration. Global movements and intercontinental exchanges tend to blur this phylogenetic signal though strong enough to be detected nowadays.All MTBC populations from human sources displayed markedly constant expansion rates, corresponding to an expansion that dates back to only about 180 years. Furthermore, the largest population size increase (500-fold) was detected for Beijing, which is thought to be the most successful present day lineage. These results suggest that the expansion of the most recent form of human tuberculosis was coupled to Western urbanization and industrialization. This expansion was synchronous with the modern demographic explosion of Homo sapiens and modern intercontinental movements. Evidence for strong phylogeographical structuring of the pathogen population and preferential sympatric combinations of pathogen populations with particular ethnic groups has indicated a close association between M. tuberculosis and its human host [3],[13],[37]. Our results indicate recent parallel demographic changes between the pathogen and its host and reveal the tell-tale dynamic dimension of this association. The coalescence approach may also be useful in the future to monitor demographic changes in emerging MDR M. tuberculosis strains.Some of the conclusions presented here on the basis of MIRU data have also been reached previously, e.g. data from comparative genomics [12] after the completion of M. bovis genome [31] indicated that the MTBC did not arise as a zoonosis [38]. In contrast, the validity of efforts to date the origins of the common ancestor of MTBC by using SNP-based methods [39],[40],[41], has remained questionable [42]. Furthermore, preliminary SNP-based phylogenetic reconstructions may have been affected by hitch-hiking, and ascertainment bias [43], because those SNPs were associated with genes involved in drug-resistance [44] or were selected from a non-representative set of available genomes [14],[17],[45]. Such markers evolve too slowly for recent pathogens, as is also the case for LSPs and their use often results in uninformative phylogenies that consist of multifurcated unresolved trees [13],[44]. Unlike previous studies, the novel analyses presented here rely on globally neutral markers with mutation rates that have been estimated from human M. tuberculosis infection cases, a descent-sampling scheme and multiple, convergent population genetic estimators. As they are based on intrinsically rare and stochastic VNTR changes in clonal populations, our mutation rate estimates do involve some special assumptions. The accuracy of the demographic and temporal estimates could be improved with long-term analyses, and we are aware that the use of a mean mutation rate for all loci is suboptimal, leading to an increase of the variance of parameters. However, our estimates were consistently corroborated by posterior Bayesian calculations in independent runs over different strain populations (ranging from 10−4.19 for LAM to 10−3.82 for EAI), ruling out the risk of some local maxima. To gain further insights into the host-pathogen interactions, it would certainly be important to account for the biogeographic history and distribution of the different M. tuberculosis lineages, because recent adaptations to local host populations might play a major role [13]. Furthermore, it is known, that genetic diversity can influence the transmission dynamics of drug-resistant bacteria [2],[46], and, in terms of vaccination, it would be advisable to scrutinize independently the highly polymorphic clade 2 EAI strains that markedly differ in their genetic structure from the other human tuberculosis strains.Materials and MethodsSampling and data collectionThe 355 M. tuberculosis and M. prototuberculosis isolates were genotyped by multiplex PCR amplification as described previously [8],[47]. The samples were subjected to electrophoresis using ABI 3100 and 3730 automated sequencers. Sizing of the PCR fragments and assignment of the VNTR alleles of the 24 loci was done using the GeneScan and customized Genotyper, as well as the GeneMapper software packages (PE Applied Biosystems).Genetic diversity estimationThe number of alleles (allelic richness) in each M. tuberculosis complex population was estimated and sample sizes were corrected by the rarefaction procedure using HP-RARE [23]. Comparison tests as well as P-values were estimated using the STATISTICA v.6.1 package.Phylogenetic inferencesNei et al.'s DA distance [48] was used to construct both isolate and population trees using a neighbour-joining algorithm as implemented in the software Populations version1.2.28. Support for the tree nodes was assessed by bootstrapping over loci (1, 000 iterations).Inferring population structure and recombination in the M. tuberculosis complexUsing the no-admixture model [18] (STRUCTURE version 2), three to ten parallel Markov chains were run for all models of K with a burn-in of 100,000 iterations and a run length of 106 iterations following the burn-in. For each run, the ln likelihood of each model was calculated. The full data set was analysed for all models from K = 1 through to 3 without specifying prior information concerning the geographical sources or former designations. For K = 3, a clear splitting solution was found in which the sampled populations clustered into two main tuberculosis groups plus the outgroup (M. prototuberculosis); a result fully consistent with the neighbour-joining population tree (Figure 1B). For further analysis the data set was sub-divided into clades 1 and 2, and these were subsequently tested for K = 1 through to 6. Using the linkage model [49] of STRUCTURE version 2, ten parallel Markov chains were run for each model with a burn-in of 100,000 iterations and a run length of 106 iterations following the burn-in. For each run, M. tuberculosis strains were specified as belonging to pre-determined source clusters. We estimated the ancestry in each source cluster and the proportion of each strain genome having ancestry in each cluster.Stepwise mutation model (SMM) and mutation rate estimatesTo estimate the validity of SMM model, we built a minimal spanning tree of all MTBC strains based on the degree of allele sharing, by using BIONUMERICS (Applied Maths, Belgium). We then evaluated the proportion of single-locus variants (i.e. strains that differed from their closest relative) that differed by one or by multiple repeat-changes. To further evaluate the validity of the SMM model and to detect a potential bias towards increase or decrease in repeat numbers, eBURST analysis was performed on a larger dataset from two population-based studies. The first one included 807 isolates from different TB cases notified in the Brussels-Capital Region (Belgium) from September 1st, 2002 to December 31st, 2005 [50], while the second one is an ongoing study including 1907 isolates from different TB cases notified in the Netherlands over 2004 and 2005 (Van Soolingen et al., unpublished). In total, the dataset included 1,733 MIRU-VNTR profiles, with no missing data or incomplete repeats. On this dataset, the differences in the number of repeats were calculated for each pair of ancestor/descendant genotypes along the evolutionary path inferred by eBURST analysis [51]. The occurrence of each value of repeat difference was recorded for each group (defined as groups of strains with at most one allelic mismatch with at least one other member of the group), and values were pooled over all eBURST groups. This analysis was performed using software Multilocus Analyzer (S. Brisse, unpublished), which is an independent implementation (coded in Python) of the eBURST algorithm, to which the SMM test function was added.MIRU mutation rates were estimated by using data on VNTR changes among large sets of serial or epidemiologically-linked isolates [11]. Single-locus mutation rates of 5 most variable loci were estimated from corresponding frequencies of observed repeat changes. Repeat changes among serial or epidemiologically-linked isolates were not detected among the remaining, less variable loci. Therefore, the relative frequencies of single-locus variations among closely related isolates in a global MTBC isolate dataset [11] and in the population based dataset (see above) were then used as a surrogate for estimating mutation rates of less variable markers relatively to these most variable loci.Coalescence, TMRCA and demographyIn a first step, we used a Bayesian approach [25] that assumes a stepwise mutation model and estimates the posterior probability distributions of the genealogical and demographic parameters of a sample using Markov chain Monte Carlo simulations based on MIRU data. This method permits to extrapolate important biological parameters like the TMRCA of a given sample in years, the past and present effective population size and the latest demographic changes (decline, constant population size or expansion). In order to assess the age of the main M. tuberculosis lineages, an alternative algorithm, YTime [24] was used to calculate the TMRCAs and their confidence intervals. For the MSVAR procedure [25],[52], we focused on lineages of which at least 30 isolates were available, in order to obtain a reliable coverage of the TMRCA and to avoid small sample size artefacts. The estimated parameters were scaled in terms of current population size, and two main demographic parameters were quantified: tf, which is a measure of time in generations, was defined as ta/N0, where ta denotes the number of generations that have elapsed since the decline or expansion began, and r, which was defined as N0/N1, where N0 is the current effective number of chromosomes, and N1 is the number of chromosomes at some previous point in time tf. For a declining population r<1, for a stable population r = 1 and for expanding populations r>1. The procedure also estimates θ, which is defined as N0μ, where μ is the mutation rate (mutation locus−1 generation−1). The analyses were performed assuming exponential demographic change. Three different chains were run for each analysis to confirm the convergence of the results. In the analyses, rectangular priors of the log parameter values have been used. The method was found to converge appropriately for both single and multilocus data sets and supported a model of population expansion for all MTBC populations. We present only the multilocus data in the present report. Expansion signatures were robust and were confirmed in runs where decline was assumed as a prior (10−2–10−3).YTime [24]: YTime is a Matlab function which calculates the TMRCA for haplotype linked loci under the assumption of an S-SSM, which allows for unbiased +/−1 steps. YTime calculates confidence intervals using a simulation approach and is independent of the shape of the genealogy. We used all available loci (N = 24) as an input. The strains were grouped according to their lineages (obtained by phylogenetic analyses). The ancestral genotype for every subgroup was calculated as the mean of every single locus in the particular subgroup. The mutation rate was 10−4 per year per locus. For the growth rate parameters we assumed a mean effective population size of 108 for every sub-population and a growth of 103 (the mean of the results is not affected by the growth rate, just the confidence intervals).Supporting InformationProtocol S1(0.06 MB DOC)Click here for additional data file.Table S1List of the MTBC isolates used in this study.(0.08 MB DOC)Click here for additional data file.Figure S1Bubble-graph representation of allele frequencies for the different MIRU loci. Allele size (number of repeats) on the y-axis, and source populations on the x-axis.(2.07 MB PDF)Click here for additional data file.Figure S2MIRU and region of deletion (RD) patterns of 176 random selected M. tuberculosis and M. prototuberculosis strains. A visualisation of MIRU and RD data was added to the rooted population neighbour-joining tree based on genetic distances (see Figure 1B). Representative results are shown for 89 isolates. The copy numbers of the 24 MIRU loci are displayed in blue shades ranging from 0 (white) to 13 (dark blue). For RD-analysis, black and white boxes correspond respectively to presence and absence of the considered region. The deletions distribution and the spolygotype patterns (data not shown) were in good congruence with the MIRU typing. Several clusters defined by MIRU typing also showed specific deletions such as RD726 for the Cameroon lineage or RD711 for West-African 1 strains. The presence or absence of the deletions also supported the dichotomy of the tree as all clade 1 strains are TBD1 negative and all clade 2 strains are TBD1 positive. However, it must be noted, that MIRU typing allowed a fin grain resolution, for example, several lineages e.g. West African 1a and West African 1b belong to two different lineages but remain undistinguishable by RD-typing. The presence or absence of the 16 Rds was determined by PCR as described previously [15],[16],[17],[18].(1.21 MB EPS)Click here for additional data file.Figure S3MTBC population structure. (A) Population structure of 355 M. tuberculosis and M. prototuberculosis isolates. Each strain is represented by a single vertical line divided into K colours, where K is the number of clusters assumed. Each colour represents one cluster, and the length of the coloured segment shows the strain's estimated proportion of membership in that cluster. Black lines separate the main lineages. (B) Population structure for K = 3, as in a, but with the implementation of the linkage model.(7.91 MB EPS)Click here for additional data file.Figure S4Evolution of repeat copy number among MIRU-VNTR single-locus variants. To evaluate the validity of the stepwise mutation model and to detect a potential bias towards increase or decrease in repeat numbers, EBURST analysis was performed on a large dataset comprising a total of 2714 isolates from two population-based studies. Genotypes from a selected clonal complex are represented as circles. Stepwise and non-stepwise allelic changes between genotypes, along with corresponding marker number, are highlighted in green and gray, respectively. Insets show examples of allelic identification by analysis of marker amplicons using GENEMAPPER. Gray ladders and axis in insets define amplicon size bins expected for MIRU-VNTR alleles and measured amplicon sizes in base pairs, respectively. Code numbers in the upper left of insets define sample and marker identity, respectively. M, marker (from 1 to 24).(2.07 MB EPS)Click here for additional data file.Figure S5Distribution of repeat copy number changes among MIRU-VNTR single-locus variants. The difference in the number of repeats was calculated for each pair of ancestor/descendant genotypes along the evolutionary path inferred by EBURST analysis, on a large dataset comprising a total of 2714 isolates from two population-based studies. The occurrence and nature of each repeat difference was recorded for each strain group (defined as groups of strains with at most one allelic mismatch with at least one other member of the group), and values were pooled over all EBURST groups.(0.96 MB EPS)Click here for additional data file.\n\nREFERENCES:\n1. OrganizationWH\n2006\nGlobal Tuberculosis Control, WHO Report\nGeneva\nW.H.O\n2. GagneuxSBurgosMVDeRiemerKEnciscoAMunozS\n2006\nImpact of bacterial genetics on the transmission of isoniazid-resistant Mycobacterium tuberculosis.\nPLoS Pathog\n2\ne61\ndoi:10.1371/journal.ppat.0020061\n16789833\n3. HirshAETsolakiAGDeRiemerKFeldmanMWSmallPM\n2004\nStable association between strains of Mycobacterium tuberculosis and their human host populations.\nProc Natl Acad Sci U S A\n101\n4871\n4876\n15041743\n4. LiuXGutackerMMMusserJMFuYX\n2006\nEvidence for Recombination in Mycobacterium tuberculosis.\nJ Bacteriol\n5. SupplyPWarrenRMBanulsALLesjeanSVan Der SpuyGD\n2003\nLinkage disequilibrium between minisatellite loci supports clonal evolution of Mycobacterium tuberculosis in a high tuberculosis incidence area.\nMol Microbiol\n47\n529\n538\n12519202\n6. GutierrezMCBrisseSBroschRFabreMOmaisB\n2005\nAncient origin and gene mosaicism of the progenitor of Mycobacterium tuberculosis.\nPLoS Pathog\n1\ne5\ndoi:10.1371/journal.ppat.0010005\n16201017\n7. OchmanHWilsonAC\n1987\nEvolution in bacteria: evidence for a universal substitution rate in cellular genomes.\nJ Mol Evol\n26\n74\n86\n3125340\n8. SupplyPAllixCLesjeanSCardoso-OelemannMRusch-GerdesS\n2006\nProposal for standardization of optimized Mycobacterial Interspersed Repetitive Unit-Variable Number Tandem Repeat typing of Mycobacterium tuberculosis.\nJ Clin Microbiol\n9. SupplyPMazarsELesjeanSVincentVGicquelB\n2000\nVariable human minisatellite-like regions in the Mycobacterium tuberculosis genome.\nMol Microbiol\n36\n762\n771\n10844663\n10. RosenbergNAPritchardJKWeberJLCannHMKiddKK\n2002\nGenetic structure of human populations.\nScience\n298\n2381\n2385\n12493913\n11. BrisseSSupplyPBroschRVincentVGutierrezMC\n2006\n“A re-evaluation of M. prototuberculosis”: continuing the debate.\nPLoS Pathog\n2\ne95\ndoi:10.1371/journal.ppat.0020095\n17009866\n12. BroschRGordonSVMarmiesseMBrodinPBuchrieserC\n2002\nA new evolutionary scenario for the Mycobacterium tuberculosis complex.\nProc Natl Acad Sci U S A\n99\n3684\n3689\n11891304\n13. GagneuxSDeRiemerKVanTKato-MaedaMde JongBC\n2006\nVariable host-pathogen compatibility in Mycobacterium tuberculosis.\nProc Natl Acad Sci U S A\n103\n2869\n2873\n16477032\n14. GutackerMMSmootJCMigliaccioCARicklefsSMHuaS\n2002\nGenome-wide analysis of synonymous single nucleotide polymorphisms in Mycobacterium tuberculosis complex organisms: resolution of genetic relationships among closely related microbial strains.\nGenetics\n162\n1533\n1543\n12524330\n15. BrudeyKDriscollJRRigoutsLProdingerWMGoriA\n2006\n\nMycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology.\nBMC Microbiol\n6\n23\n16519816\n16. GagneuxSSmallPM\n2007\nGlobal phylogeography of Mycobacterium tuberculosis and implications for tuberculosis product development.\nLancet Infect Dis\n7\n328\n337\n17448936\n17. GutackerMMMathemaBSoiniHShashkinaEKreiswirthBN\n2006\nSingle-nucleotide polymorphism-based population genetic analysis of Mycobacterium tuberculosis strains from 4 geographic sites.\nJ Infect Dis\n193\n121\n128\n16323140\n18. PritchardJKStephensMDonnellyP\n2000\nInference of population structure using multilocus genotype data.\nGenetics\n155\n945\n959\n10835412\n19. WirthTWangXLinzBNovickRPLumJK\n2004\nDistinguishing human ethnic groups by means of sequences from Helicobacter pylori: lessons from Ladakh.\nProc Natl Acad Sci U S A\n101\n4746\n4751\n15051885\n20. FalushDWirthTLinzBPritchardJKStephensM\n2003\nTraces of human migrations in Helicobacter pylori populations.\nScience\n299\n1582\n1585\n12624269\n21. WirthTFalushDLanRCollesFMensaP\n2006\nSex and virulence in Escherichia coli: an evolutionary perspective.\nMol Microbiol\n60\n1136\n1151\n16689791\n22. WirthTMorelliGKusecekBvan BelkumAvan der ScheeC\n2007\nThe rise and spread of a new pathogen: Seroresistant Moraxella catarrhalis.\nGenome Res\n17\n1647\n1656\n17895425\n23. KalinowskiST\n2005\nHP-rare: a computer program for performing rarefaction on measures of allelic diversity.\nMolecular Ecology Notes\n5\n187\n189\n24. BeharDMThomasMGSkoreckiKHammerMFBulyginaE\n2003\nMultiple origins of Ashkenazi Levites: Y chromosome evidence for both Near Eastern and European ancestries.\nAm J Hum Genet\n73\n768\n779\n13680527\n25. BeaumontMA\n1999\nDetecting population expansion and decline using microsatellites.\nGenetics\n153\n2013\n2029\n10581303\n26. VoglerAJKeysCNemotoYColmanREJayZ\n2006\nEffect of repeat copy number on variable-number tandem repeat mutations in Escherichia coli O157:H7.\nJ Bacteriol\n188\n4253\n4263\n16740932\n27. WierdlMDominskaMPetesTD\n1997\nMicrosatellite instability in yeast: dependence on the length of the microsatellite.\nGenetics\n146\n769\n779\n9215886\n28. MellarsP\n2006\nGoing east: new genetic and archaeological perspectives on the modern human colonization of Eurasia.\nScience\n313\n796\n800\n16902130\n29. LinzBBallouxFMoodleyYManicaALiuH\n2007\nAn African origin for the intimate association between humans and Helicobacter pylori.\nNature\n445\n915\n918\n17287725\n30. MonotMHonoreNGarnierTAraozRCoppeeJY\n2005\nOn the origin of leprosy.\nScience\n308\n1040\n1042\n15894530\n31. GarnierTEiglmeierKCamusJCMedinaNMansoorH\n2003\nThe complete genome sequence of Mycobacterium bovis.\nProc Natl Acad Sci U S A\n100\n7877\n7882\n12788972\n32. TroyCSMacHughDEBaileyJFMageeDALoftusRT\n2001\nGenetic evidence for Near-Eastern origins of European cattle.\nNature\n410\n1088\n1091\n11323670\n33. ZederMAHesseB\n2000\nThe initial domestication of goats (Capra hircus) in the Zagros mountains 10,000 years ago.\nScience\n287\n2254\n2257\n10731145\n34. DiamondJ\n2002\nEvolution, consequences and future of plant and animal domestication.\nNature\n418\n700\n707\n12167878\n35. WirthTMeyerAAchtmanM\n2005\nDeciphering host migrations and origins by means of their microbes.\nMol Ecol\n14\n3289\n3306\n16156803\n36. MostowySOnipedeAGagneuxSNiemannSKremerK\n2004\nGenomic analysis distinguishes Mycobacterium africanum.\nJ Clin Microbiol\n42\n3594\n3599\n15297503\n37. BrudeyKDriscollJRRigoutsLProdingerWMGoriA\n2006\nMycobacterium tuberculosis complex genetic diversity: mining the fourth international spoligotyping database (SpolDB4) for classification, population genetics and epidemiology.\nBMC Microbiol\n6\n23\n16519816\n38. SteadWWEisenachKDCaveMDBeggsMLTempletonGL\n1995\nWhen did Mycobacterium tuberculosis infection first occur in the New World? An important question with public health implications.\nAm J Respir Crit Care Med\n151\n1267\n1268\n7697265\n39. SreevatsanSPanXStockbauerKEConnellNDKreiswirthBN\n1997\nRestricted structural gene polymorphism in the Mycobacterium tuberculosis complex indicates evolutionarily recent global dissemination.\nProc Natl Acad Sci U S A\n94\n9869\n9874\n9275218\n40. SkuceRAMcCorryTPMcCarrollJFRoringSMScottAN\n2002\nDiscrimination of Mycobacterium tuberculosis complex bacteria using novel VNTR-PCR targets.\nMicrobiology\n148\n519\n528\n11832515\n41. HughesALFriedmanRMurrayM\n2002\nGenomewide pattern of synonymous nucleotide substitution in two complete genomes of Mycobacterium tuberculosis.\nEmerg Infect Dis\n8\n1342\n1346\n12453367\n42. OchmanHElwynSMoranNA\n1999\nCalibrating bacterial evolution.\nProc Natl Acad Sci U S A\n96\n12638\n12643\n10535975\n43. PearsonTBuschJDRavelJReadTDRhotonSD\n2004\nPhylogenetic discovery bias in Bacillus anthracis using single-nucleotide polymorphisms from whole-genome sequencing.\nProc Natl Acad Sci U S A\n101\n13536\n13541\n15347815\n44. BakerLBrownTMaidenMCDrobniewskiF\n2004\nSilent nucleotide polymorphisms and a phylogeny for Mycobacterium tuberculosis.\nEmerg Infect Dis\n10\n1568\n1577\n15498158\n45. FilliolIMotiwalaASCavatoreMQiWHazbonMH\n2006\nGlobal phylogeny of Mycobacterium tuberculosis based on single nucleotide polymorphism (SNP) analysis: insights into tuberculosis evolution, phylogenetic accuracy of other DNA fingerprinting systems, and recommendations for a minimal standard SNP set.\nJ Bacteriol\n188\n759\n772\n16385065\n46. GagneuxSLongCDSmallPMVanTSchoolnikGK\n2006\nThe competitive cost of antibiotic resistance in Mycobacterium tuberculosis.\nScience\n312\n1944\n1946\n16809538\n47. SupplyPLesjeanSSavineEKremerKvan SoolingenD\n2001\nAutomated high-throughput genotyping for study of global epidemiology of Mycobacterium tuberculosis based on mycobacterial interspersed repetitive units.\nJ Clin Microbiol\n39\n3563\n3571\n11574573\n48. NeiMTajimaFTatenoY\n1983\nAccuracy of estimated phylogenetic trees from molecular data. II. Gene frequency data.\nJ Mol Evol\n19\n153\n170\n6571220\n49. FalushDStephensMPritchardJK\n2003\nInference of population structure using multilocus genotype data: linked loci and correlated allele frequencies.\nGenetics\n164\n1567\n1587\n12930761\n50. Allix-BeguecCFauville-DufauxMSupplyP\n2008\nThree-year population-based evaluation of standardized Mycobacterial Interspersed Repetitive Unit-Variable Number of Tandem Repeat typing of Mycobacterium tuberculosis.\nJ Clin Microbiol\n51. FeilEJLiBCAanensenDMHanageWPSprattBG\n2004\neBURST: inferring patterns of evolutionary descent among clusters of related bacterial genotypes from multilocus sequence typing data.\nJ Bacteriol\n186\n1518\n1530\n14973027\n52. StorzJFBeaumontMA\n2002\nTesting for genetic evidence of population expansion and contraction: an empirical analysis of microsatellite DNA variation using a hierarchical Bayesian model.\nEvolution Int J Org Evolution\n56\n154\n166"
+}

batch_2/PMC2529290.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2529290",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2529290\nAUTHORS: Laurent G Glance, Yue Li, Turner M Osler, Dana B Mukamel, Andrew W Dick\n\nABSTRACT:\nBackgroundThe Agency for Healthcare Research and Quality (AHRQ) Patient Safety Indicators (PSIs) provide information on hospital risk-adjusted rates for potentially preventable adverse events. Although designed to work with routine administrative data, it is unknown whether the PSIs can accurately distinguish between complications and pre-existing conditions. The objective of this study is to examine whether the AHRQ PSIs accurately measure hospital complication rates, using the data with present-on-admission (POA) codes to distinguish between complications and pre-existing conditionsMethodsRetrospective cohort study of patients undergoing isolated CABG surgery in California conducted using the 1998–2000 California State Inpatient Database. We calculated the positive predictive value of selected AHRQ PSIs using information from the POA as the gold standard, and the intra-class correlation coefficient to assess the level of agreement between the hospital risk-adjusted PSI rates with and without the information contained in the POA modifier.ResultsThe false positive error rate, defined as one minus the positive predictive value, was greater than or equal to 20% for four of the eight PSIs examined: decubitus ulcer, failure-to-rescue, postoperative physiologic and metabolic derangement, and postoperative pulmonary embolism or deep venous thrombosis. Pairwise comparison of the hospital risk-adjusted PSI rates, with and without POA information, demonstrated almost perfect agreement for five of the eight PSI's. For decubitus ulcer, failure-to-rescue, and postoperative pulmonary embolism or DVT, the intraclass-correlation coefficient ranged between 0.63 to 0.79.ConclusionFor some of the AHRQ Patient Safety Indicators, there are significant differences in the risk-adjusted rates of adverse events depending on whether the POA indicator is used to distinguish between pre-existing conditions and complications. The use of the POA indicator will increase the accuracy of the AHRQ PSIs as measures of adverse outcomes.\n\nBODY:\nBackgroundThe Institute of Medicine (IOM) report To Err is Human [1] has fundamentally changed the landscape of American medicine by challenging us to examine and improve the safety and quality of the health care system in this country [2]. Seven years after the release of this seminal report, \"the quality chasm in health care remains wide [3].\" A recent study from RAND documented that adults in the United States receive only 55% of recommended care [4]. In its blueprint for \"Crossing the Quality Chasm\", the IOM recommended the development of performance and outcome measurements [5]. In response, the Agency for Healthcare Research and Quality (AHRQ) has constructed Patient Safety Indicators (PSI) [6] to serve as the \"state-of-the art in measuring the safety of hospital care through the analysis of inpatient discharge data [6].\"The AHRQ PSIs provide information on risk-adjusted rates for potentially preventable adverse events such as decubitus ulcers, postoperative hemorrhage, and postoperative sepsis. In theory, a hospital can benchmark its performance using these safety indicators and target specific areas of poor performance for improvement. This 'global' approach to quality improvement is more likely to be effective than the traditional approach of narrowly focusing on the unsafe actions of a few physicians [7]. Traditional quality assurance (QA) efforts, which are triggered by individual case reviews, may divert limited hospital resources to clinical areas where overall hospital performance is not problematic, while ignoring system-level problems. Using PSIs to guide QI efforts may force hospitals to focus their efforts on the development of systems which will reduce the incidence and mitigate the impact of dangerous medical errors [7].The Patient Safety Indicators were designed to be used with administrative data and are currently being used by public and non-public organizations to assess hospital quality of care [8]. Basing the PSIs on administrative data makes it possible for virtually any hospital to examine its safety performance. Hospitals can download the PSI software from the AHRQ web site and use their own administrative data to construct risk-adjusted PSI rates and compare themselves to a national benchmark. Because these indicators are based on administrative data, there is no added data collection burden. However, administrative data have well recognized limitations, including the lack of precise definitions and coding differences across hospital [9]. Several investigators have questioned the accuracy of using administrative data to identify complications [10,11], while others have concluded they may be useful for identifying surgical complications [12].One of the primary problems with using administrative data to identify adverse events is the failure of most ICD-9-CM codes to distinguish between pre-existing conditions and complications that occur after hospital admission. Counting pre-existing conditions as adverse events may falsely elevate adverse event rates and bias these safety indicators against hospitals which care for sicker patients. In designing the PSIs, AHRQ researchers attempted to exclude ICD-9-CM codes that could represent either a pre-existing condition or a complication [13]. In theory, the use of a present-on-admission (POA) modifier would have made it possible to avoid mis-classifying pre-existing conditions as adverse events. Several states (California, New York State, Florida, and Wisconsin) require hospitals to include a POA modifier in their administrative data. However, AHRQ researchers were initially constrained to develop a set of indicators which could be used by hospitals in all States, and thus were not able to incorporate the POA indicator in the PSI algorithms [6]. The latest version (2007) of the AHRQ PSIs incorporates the POA indicator and gives users the options of using this information to calculate the AHRQ PSIs [14].Using the POA modifier to differentiate pre-existing conditions from complications, we will examine the accuracy of the AHRQ PSIs using discharge abstracts for patients undergoing coronary artery bypass graft (CABG) surgery in the California State Inpatient Database. Previous studies have shown that the AHRQ PSIs over-estimate the number of patient safety events when pre-existing conditions are incorrectly counted as complications [15,16]. One of these studies, by Houchens and colleagues [16], specifically examined the impact of counting pre-existing conditions as complications on hospital PSI rates based on all patient admissions. However, both studies are based on a broad range of patient diagnoses and procedures. Although it is likely that there is some overlap in the care processes that prevent certain complications across different surgical procedures and medical conditions, it is also likely that specific best practices for preventing complications may be unique to different patient populations. For example, it is unlikely that one hospital-wide approach to preventing postoperative hemorrhage will be equally effective in patients undergoing hysterectomy compared to CABG patients, because the causes of postoperative hemorrhage in these two groups are so different. Just as procedure-specific mortality rates (e.g. CABG) are more informative, and possibly more useful, than overall hospital mortality rates, we believe that diagnosis-specific PSI rates may prove more useful that hospital-wide PSI rates.We have previously shown that the addition of date stamp information to administrative data has a substantial impact on the ranking of hospital quality based on risk-adjusted mortality rates [17,18]. In the current study, our goal is to examine whether the AHRQ PSIs accurately measure the rates of adverse events, using the data with the POA modifier as the gold standard for comparison. Under the Deficit Reduction Act of 2005, the Centers for Medicare and Medicaid Services will require hospitals to add POA indicators to Medicare claims starting in 2007 [19]. The results from this study will help to inform policy-makers as to the value of requiring the inclusion of the POA modifier in non-Medicare claims as well.MethodsDataThis analysis of patients undergoing isolated CABG surgery was conducted using the 1998–2000 California State Inpatient Database, which contains 100 percent of the state's inpatient discharge records. The data were obtained from the Healthcare Cost and Utilization Project (HCUP). Each patient record has ICD-9-CM coding slots for up to 30 diagnoses. Except for E-codes, each ICD-9-CM code is modified by a POA code that specifies whether a diagnosis was present at the time of hospital admission. Although not fully validated, previous work suggests that the POA field has clinical validity [17,19-23].The CABG study population was identified using ICD-9-CM codes 36.10 – 36.19 and 36.2. We excluded 557 patients with missing hospital identifiers, age less than 18 years, missing gender, or missing discharge status. In order to eliminate hospitals which may be coding the POA modifier inaccurately, we excluded 13 hospitals (n = 2593 patient discharges) that coded POA = yes or POA = no for every record, hospitals for which greater than 10% of the POA codes were missing, and hospitals whose percent of ICD-9-CM codes coded as present-on-admission was outside of the 95% confidence interval for the CABG patients in this data set (0.67, 0.91). The final patient population consisted of 82,063 patients from 111 hospitals.Identification of adverse eventsThe AHRQ Patient Safety Indicator (PSI) software [6] was used to calculate event rates for adverse events. These indicators were developed by the AHRQ Evidence-Based Practice Center at the University of California and Stanford [6]. The selection and grouping of ICD-9-CM codes into PSIs was based on the Complications Screening Program [24], developed by Iezzonni, and a comprehensive review of existing ICD-9-CM codes [6]. The validity of these indicators was evaluated using the RAND/UCLA Appropriateness method [25] and empirical analyses to assess the frequency, variance, and bias of these indicators [6]. Risk adjustment is performed by the PSI software using logistic regression models which are based on the 29 states in the 2000 HCUP State Inpatient Databases. These models adjust for differences in casemix as defined by age, sex, modified DRGs, and the AHRQ Elixhauser comorbidity diagnostic categories [26,27].We selected eight PSIs which had relatively high event rates and were clinically relevant for patients undergoing CABG surgery:Decubitus UlcerPatient records with secondary diagnosis of decubitus ulcer and length-of-stay greater than 4 days. Patient exclusions include any diagnosis of hemiplegia, paraplegia, or quadriplegia; and patients admitted from a long-term facility or transferred from an acute care facility [6].Failure-to-RescuePatient records in which the discharge disposition is death and which indicate a potential complication of care during the hospitalization (i.e., pneumonia, DVT/PE, sepsis, acute renal failure, shock/cardiac arrest, or GI hemorrhage). Patient exclusions include age greater than 75 years; and patients admitted from a long-term facility or transferred from an acute care facility [6].Infection due to Medical CarePatient records with secondary diagnosis of infectious complication of medical care; or infection due to other vascular device, implant or graft. Patient exclusions include length-of-stay less than 2 days, any diagnosis code for immunocompromised state or cancer, or cancer DRG [6].Postoperative Hemorrhage or HematomaRecords of patients with secondary diagnosis of postoperative hemorrhage or hematoma who required postoperative control of bleeding or a drainage procedure. Cases were excluded if a procedure for postoperative control of bleeding or a drainage procedure was the only procedure in the record, or occurred prior to the operative procedure [6].Postoperative Physiologic and Metabolic DerangementPatient records with secondary diagnosis of physiologic and metabolic derangements. Cases were excluded it the records included ICD-9-CM codes for chronic renal failure; acute renal failure where dialysis occurs prior to or on the same day as the operative procedure; or a primary diagnosis of diabetes and a secondary diagnosis code for ketoacidosis, hyperosmolarity, or coma [6].Postoperative Pulmonary Embolism (PE) or Deep Venous Thrombosis (DVT)Patient records with secondary diagnosis of DVT or PE. Cases were excluded if a procedure for interrupting the vena cava is (1) the only operative procedure or (2) occurs before or on the same day as the operative procedure [6].Postoperative SepsisPatient records with secondary diagnosis of sepsis. Cases were excluded if the principal diagnosis was infection, if any of the diagnoses included immunocompromised state or cancer, or if the length-of-stay was less than 4 days [6].Accidental Puncture of LacerationPatient records with secondary diagnosis of accidental cut, puncture, perforation, or laceration [6].Impact of POA indicatorIn order to analyze the impact of the POA indicator on the PSIs, we modified the AHRQ PSI algorithm to make use of the information from the POA indicator to exclude ICD9 codes that were present-on-admission and thus could not be complications. With the exception of the Failure-to-Rescue PSI, only the numerator for the PSIs was modified. For failure-to-rescue, only the denominator was modified since the numerator equals the number of deaths, whereas the denominator represents complications (only cases where the POA indicator indicated that the condition was not present on admission were included in the denominator for the modified PSIs). We also modified the AHRQ Elixhauser comorbidity algorithm by only including secondary diagnoses present-on-admission for risk adjustment. We then compared the PSI obtained using the \"modified\" PSI algorithms versus the \"standard\" PSI algorithm which ignored information contained in the POA modifier. This analysis was performed first at the level of individual patients, and then at the hospital-level. For the hospital level analysis, we calculated the intra-class correlation coefficient to assess the level of agreement between the point estimates of the risk-adjusted PSI rates obtained with and without the information contained in the POA indicator [28].The AHRQ PSI algorithms were run using SAS version 8.2 (SAS Corp., Cary, NC). This study was exempted from review by the University Of Rochester School Of Medicine Research Subjects Review Board.ResultsOverall, the false positive error rate for the PSIs, defined as one minus the positive predictive value, ranged between 7% for \"infection due to medical care\" to 41% for \"decubitus ulcer\" (Table 1). The false positive error rate was greater than or equal to 20% for four of the eight PSIs: decubitus ulcer, failure-to-rescue, postoperative physiologic and metabolic derangement, and postoperative pulmonary embolism or DVT. The observed rates per 1000 discharges at risk differed significantly (P-value ≤ 0.05) for six of the eight PSIs, and was marginally significant for one of the eight (P-value = 0.06).Table 1Impact of the POA indicator on observed rates of adverse events.Patient Safety IndicatorsNo. of EventsRisk Pool1-PPVObserved Rates per 1000 Discharges at RiskNo POAPOANo POAPOANo POAPOADecubitus Ulcer22813549,46349,4630.414.61†2.73†Failure to Rescue40332432982,0950.20122.2†154.7†Infection due to Medical Care37434972,95472,9540.075.134.78Postop Hemorrhage or Hematoma52445582,04682,0460.136.39†5.55†Postop Physiologic & Metabolic Derangement19115335,00335,0030.205.46†4.37†Postop Embolism or DVT51234382,04082,0400.336.24†4.18†Postop Sepsis24720730,05430,0540.168.22¥6.89¥Accidental Puncture or Laceration96184882,05082,0500.1211.71†10.34†† P-value ≤ 0.05¥ P-value = 0.06DVT – deep venous thrombosis, POA – present-on-admission indicator; PPV – positive predictive value; obs – observed; postop – postoperativeThe comparisons of the hospital risk-adjusted PSI rates obtained using the standard algorithm (does not use the POA field to distinguish pre-existing conditions from complications) and the modified algorithm (uses the POA field to distinguish between pre-existing conditions and complications) is shown in Figure 1. Pairwise comparison of these risk-adjusted PSI rates, with and without POA information, demonstrated almost perfect agreement for five of the eight PSI's (intraclass correlation coefficient: 0.81–1.00). In the case of \"decubitus ulcer\", \"failure-to-rescue\", and \"postoperative pulmonary embolism or DVT\", there was significant deviation of the regression line (standard versus modified risk-adjusted PSI rate) from the 45-degree line, and the intraclass-correlation coefficient ranged between 0.63 to 0.79 (Table 2 and Figure). With the exception of failure-to-rescue, adding the POA indicator generally decreases a hospital's PSI rates because the original PSI algorithm is flagging conditions as complications that were pre-existing conditions. In the case of failure-to-rescue (FTR), adding POA information lowers the PSI rate because the risk pool for FTR is made up of patients with complications, and fewer patients are flagged as having complications using the POA indicator.Figure 1Comparison of hospital risk-adjusted PSI rates based on the standard PSI algorithm versus modified PSI algorithm. standard PSI algorithm – does not use information from the POA field to distinguish pre-existing conditions from complications modified PSI algorithm uses information from the POA field to distinguish between pre-existing conditions and complications identity line is a 45-degree line which corresponds to perfect agreement for risk-adjusted PSI rates based on the 'standard' and 'modified' PSI algorithms.Table 2Extent of agreement of hospital risk-adjusted PSI rates based on 'standard' versus 'modified' PSI algorithm.Patient Safety IndicatorsIntraclass Correlation CoefficientDecubitus Ulcer0.666Failure to Rescue0.791Infection due to Medical Care0.988Postoperative Hemorrhage or Hematoma0.935Postoperative Physiologic & Metabolic Derangement0.871Postoperative Embolism or DVT0.628Postoperative Sepsis0.931Accidental Puncture or Laceration0.954DVT – deep venous thrombosisDiscussionIn this study we find that the present-on-admission (POA) indicator has a significant impact on some of the AHRQ Patient Safety Indicators (PSI) rates in patients undergoing CABG surgery. The PSIs are one component of the quality toolbox developed by AHRQ to facilitate quality improvement and provide hospitals with the opportunity to benchmark their performance [29,30].In practice, quality assurance is usually triggered by case reviews and focuses on the perceived failures of individual physicians and providers. Medical errors are attributed to \"aberrant mental processes such as forgetfulness, inattention, poor motivation, carelessness, negligence, and recklessness [7,31].\" Since individual cases selected for examination are often reviewed in isolation, as opposed to being reviewed as part of a cohort of similar cases, the critical role of health care systems in causing medical errors is frequently ignored. Because PSI rates are, by construction, a measure of global hospital performance, they shift the focus of error analysis from the individual provider to the level of the health care system. For example, a high rate of postoperative sepsis after CABG surgery across cardiac surgeons is more likely to improve with better adherence to patient safety practices, such as the use of maximum sterile barriers during catheter insertion or the use of antibiotic-impregnated catheters [32], than by the act of \"disciplining\" a single physician. Thus, PSIs may provide the impetus for a hospital's leadership to examine the \"latent conditions\" that lead to medical errors – production pressure, inadequate staffing, fatigue – and help set the stage for the adoption of a true \"systems approach\" to reducing medical error and improving health care quality.The AHRQ PSI rates have the advantage of being based on administrative data, which are collected by virtually all hospitals in computerized form, and thus is readily available at low cost. Furthermore, the availability of the AHRQ PSI software in the public domain provides all hospitals with the opportunity to benchmark and track their PSI rates. However, the use of administrative data to monitor complications also has important limitations. In particular, the under-reporting of complications using ICD-9-CM codes, in addition to variability in coding practices across institutions, raises questions regarding the validity of using ICD-9-CM codes to report complications [33] and creates concerns that public reporting of PSI rates may unfairly penalize those hospitals with more accurate reporting practices. The primary limitation of this study is the assumption that the POA indicator accurately distinguishes complications from pre-existing conditions. Parker and colleagues [23] recently examined the accuracy of administrative data from California, using the POA indicator to exclude complications, with a clinical registry for CABG patients. Using the clinical data as the gold standard, the sensitivity of the risk factors in the administrative data ranged between 22% to 95%, with most above 50%. For most risk factors, specificity exceeded 90%. AHRQ has recently released a report summarizing the evidence supporting the value and validity of the POA indicator [19].However, these well recognized limitations of administrative data for error reporting should not prevent individual hospitals or hospital systems from using non-public reports based on the AHRQ PSI to facilitate quality improvement. Despite the inherent limitations of risk-adjustment for \"leveling the playing field\" [34,35], public and non-public reporting of hospital mortality rates have been associated with significant decreases in mortality for cardiac [36,37] and non-cardiac surgery [38].Our findings in this study examine one of the known limitations of administrative data for error reporting, namely, the inability of administrative data to effectively distinguish between pre-existing conditions and complications. Despite the fact that the AHRQ PSI were designed to \"emphasize specificity over sensitivity\", we found significant numbers of false positives for some of the PSIs. The planned expansion of the use of the POA indicator to all Medicare claims, beginning in 2007, could improve the validity of the AHRQ PSIs if the AHRQ algorithm were revised to include the POA indicator. Recent research in the private sector has led to the development of a system to identify Potentially Preventable Complications (PPC) [21]. By incorporating the POA indicator into its algorithms for the PPC groups, it was possible to expand the number of diagnoses that could be considered complications without sacrificing specificity. This expansion in scope of error monitoring, predicated on the use of the POA indicator to distinguish complications from pre-existing conditions, may be the \"next step\" in the evolution of the AHRQ PSI. This \"next-generation\" complication reporting system may provide greater opportunities for reducing medical errors and improving health care quality. Our study, by showing significant number of false positives using the AHRQ PSIs, further reinforces the need for the widespread adoption of the POA indicator which will make it possible for revised PSI systems, such as the PPC system, to be widely adopted.Two recent studies have investigated the impact of the POA indicator on patient safety events. The first, by Naessens and colleagues [15], was based on hospital discharges from the Mayo Clinic Rochester hospitals. This study found that after eliminating secondary diagnoses that were present on admission, the overall rate of patient safety events decreased by nearly 50%. The second, by Houchens and colleagues [16], used data from California and New York State Inpatient Databases to examine the impact of the POA indicator. This study found that three of the 13 PSIs greatly over-estimated the number of patient safety events when information from the POA indicator was not used to differentiate pre-existing conditions from complications. For these three PSIs, there were significant discrepancies between hospital risk-adjusted PSI rates before and after excluding pre-existing conditions. Our study adds to the existing literature by focusing on a single medical condition, CABG surgery, as opposed to basing the analysis on all inpatient admissions. We believe that PSIs will be useful only insofar as they allow physicians and hospitals to identify problems and, then to focus QI efforts for specific hospital departments, as opposed to solely providing hospitals with a global measure of patient safety events. In this light, studies evaluating the validity of the AHRQ PSIs should assess disease-specific performance, in addition to global performance. In addition, our previous work has shown that the extent to which complications are mis-identified as pre-existing conditions varies substantially across patient populations (e.g. CABG, abdominal aortic aneurysm repairs, stroke patients) [22]. Thus, it is likely that the accuracy of PSIs would also vary across patient groups. The accuracy of the AHRQ PSI in CABG patients may be of particular interest to hospitals seeking to improve CABG outcomes that only have access to administrative data without the POA indicator.Increasingly, private payers and Medicare are promoting the use of financial incentives to improve the quality of care through pay for performance initiatives. Nationally, over fifty-percent of Health Maintenance Organizations covering greater than 80% of enrolled patients, have pay-for-performance programs in place [39]. Under the Deficit Reduction Act of 2005, the reduction in hospital Medicare payments to hospitals not reporting quality data will increase five-fold from 0.4 percent to 2 percent, and infectious complications will no longer entitle hospitals to higher reimbursement rates [40]. However, the actual impact of pay-for-performance on quality is largely unknown [41], although recent work suggests that financial incentives has a relatively modest effect on adherence to process measures [42]. Even if financial incentives were found to significantly improve adherence to process measures, recent work suggests that adherence to \"best practices\" has only a relatively modest impact on risk-adjusted 30-day mortality rates for patients with acute myocardial infarctions (0.6%), heart failure (0.1%) and pneumonia (0.1%) [43]. In light of the weak association between many processes of care and outcome, direct outcome measures, such as PSI and related measures of adverse events, may have an important role in future efforts to improve health care quality.ConclusionFor some of the Patient Safety Indicators, there are significant differences in the rates of adverse events depending on whether the POA indicator is used to distinguish between pre-existing conditions and complications. The use of the POA indicator will increase the accuracy of the AHRQ PSIs as measures of adverse outcomes, and will make the future implementation of more comprehensive measures of complications more feasible.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsLGG conceived and designed the study, performed the statistical analysis, and drafted the manuscript. YL modified the computer algorithm used to calculate the AHRQ PSIs and contributed to the drafting of the manuscript. TMO, DBM, and AWD participated in the design of the study and contributed to the drafting and revision of the manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2529295.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2529295",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2529295\nAUTHORS: Peter LaPan, Jing Zhang, Jing Pan, Andrew Hill, Steven A Haney\n\nABSTRACT:\nBackgroundHigh Content Screening has been shown to improve results of RNAi and other perturbations, however significant intra-sample heterogeneity is common and can complicate some analyses. Single cell cytometry can extract important information from subpopulations within these samples. Such approaches are important for immune cells analyzed by flow cytometry, but have not been broadly available for adherent cells that are critical to the study of solid-tumor cancers and other disease models.ResultsWe have directly quantitated the effect of resolving RNAi treatments at the single cell level in experimental systems for both exogenous and endogenous targets. Analyzing the effect of an siRNA that targets GFP at the single cell level permits a stronger measure of the absolute function of the siRNA by gating to eliminate background levels of GFP intensities. Extending these methods to endogenous proteins, we have shown that well-level results of the knockdown of PTEN results in an increase in phospho-S6 levels, but at the single cell level, the correlation reveals the role of other inputs into the pathway. In a third example, reduction of STAT3 levels by siRNA causes an accumulation of cells in the G1 phase of the cell cycle, but does not induce apoptosis or necrosis when compared to control cells that express the same levels of STAT3. In a final example, the effect of reduced p53 levels on increased adriamycin sensitivity for colon carcinoma cells was demonstrated at the whole-well level using siRNA knockdown and in control and untreated cells at the single cell level.ConclusionWe find that single cell analysis methods are generally applicable to a wide range of experiments in adherent cells using technology that is becoming increasingly available to most laboratories. It is well-suited to emerging models of signaling dysfunction, such as oncogene addition and oncogenic shock. Single cell cytometry can demonstrate effects on cell function for protein levels that differ by as little as 20%. Biological differences that result from changes in protein level or pathway activation state can be modulated directly by RNAi treatment or extracted from the natural variability intrinsic to cells grown under normal culture conditions.\n\nBODY:\nBackgroundRNAi has become a widely used method for conducting gene perturbation studies [1,2]. Studies using RNAi to investigate gene function can be highly specific as well as scalable, including whole-genome screens [3-10]. While RNAi can be robust, there are challenges inherent to any RNAi experiment [11,12]. These challenges arise from problems in predicting the specificity of an individual siRNA a priori, as well as directly linking the reduced target protein levels with the observed effects [13,14]. Despite these challenges, RNAi is the most versatile and robust method for broadly testing gene function in most eukaryotes [15].High content screening (HCS), or automated quantitative immunofluorescence, is being used to an increasing extent in the target validation stage of drug development, as well as in basic science [16,17]. Image analysis is used to identify, quantitate and track multiple measures of individual cells [18-20]. Usually, these data are averaged, which is analogous to whole-well assays such as caspase activity or reporter gene expression. The advantage of HCS even in analyses at the whole-well level is that cells can be individually screened for inclusion in the well average according to parameters such as the health of the cell, stage in the cell cycle or activation state of a signaling pathway.Single cell cytometry (or single cell analysis) has been used historically to analyze complex populations of cells, such as the study of differentiating immune cells by flow cytometry [21,22]. Recently, the use of flow cytometry and single cell analysis has been applied to signaling pathways within cancer cell lines [23-26]. These studies highlight two advantages to flow cytometry-based single cell analysis. First, the ability to integrate the study of more than one cell-signaling pathway into an assay allows the classification of cancer cells according to perturbation responses, rather than static pathway activation levels. This better recapitulates the complex stimuli cancer cells encounter in vivo. Furthermore, advanced solid-tumor cancers are comprised of multiple subpopulations of cells, based on their genetic fluctuations and their interactions with host cells and tissues. Single cell analysis is capable of measuring changes within each of these subpopulations [25,27-29]. The methods developed to analyze interrelationships between thousands of data points in each of multiple samples are advancing biological and pharmaceutical research beyond the study of single pathways, and towards the study of outcomes that arise from complex interactions between multiple pathways [24,30,31]. Such approaches are gaining favor because single-pathway studies show only limited correlations across cell lines or clinical samples, whereas the integration of multiple pathways and over complex sets of stimuli, enable more accurate understandings of cell signaling by addressing direct signaling as well as cross-pathway regulation [32].We have used HCS to characterize the effects of genetic and chemical perturbations on cells by single cell analysis. We find that the wide range of protein expression levels in unperturbed cells is a significant complication for RNAi experiments, but that this complication can be addressed directly by analyzing such experiments at the single cell level. These methods allow the study of protein function by measuring the response in distinct subpopulations of cells in culture that result from stochastic variability of a target protein in a culture of cells.ResultsAnalysis of RNAi-mediated knockdown of GFP at the whole-well and single cell levelsThe reduction of GFP levels in cells by the transfection of siRNAs targeting the GFP mRNA sequence is a common and robust system for the study of RNAi biology and mechanism [33]. Its intrinsic robustness notwithstanding, a high degree of variability is frequently observed in experiments modulating GFP expression. We have used this system to understand the extent of variability on experimental results by analyzing the knockdown of GFP levels at the whole well and single cell level. A prostate epithelial cell line (RWPE-1) that constitutively expressed GFP was treated with an siRNA that targets GFP. Despite carefully optimizing transfection efficiency, an appreciable level of heterogeneity was evident in the cells transfected with the GFP-targeting siRNA, the samples treated with an non-targeting control siRNA (NTC) and even in untreated samples. In all cases, a high range of GFP expression can be observed, despite clear overall differences in the samples treated with an siRNA that targets GFP. This heterogeneity is evident in the case of cells transfected with a rhodamine-labeled siRNA that targets GFP, shown in Figure 1A. As can be observed in the figure, siRNAs effectively transfected localize near the nucleus in P-bodies [34-36]. In these studies, the siRNA is labeled with rhodamine on the sense strand, which allows uptake to be monitored, but the label itself does not interfere with silencing, at least in part because the label is on the passenger, or non-targeting, strand. Instead, it allows uptake to be quantitated on a per-cell basis. Perinuclear accumulation of the sense strand is frequently observed in cationic liposome-mediated siRNA transfections [37], and its accumulation enables limiting the evaluation of GFP levels to only those cells that had been transfected effectively. Box plots were generated using eight independent transfections for each siRNA concentration, as shown in Figure 1B. More GFP expression remains in this experiment than in GFP knockdown experiments reported by others (which can report greater than 90% reduction in GFP levels, [11,38]), however these studies evaluated the effectiveness of targeting sequences in co-transfection experiments, which limits GFP expression to only those cells transfected with the RNAi reagents. Studies that examine RNAi knockdown in cell lines stably expressing GFP show knockdown levels consistent with the data in Figure 1B[39-41]. Some of the difficulties of working with RNAi can be observed in Figure 1B, where average effects of siRNA treatment are subject to limitations in transfection reagent concentrations. In particular, in the specific conditions as set up in the experiment, the higher concentrations produce a small reduction in functional knockdown. We have observed this in specific combinations of cell type, transfection reagent and conditions. Overall, transfection reagents have limited ranges of optimal effectiveness, but the exact ranges are highly dependent on the configuration of the experiment, including source of the cell line used. As such, each experiment needs to be individually optimized, as factors that limit the effective range can be either toxicity or siRNA:lipid and complex:cell number ratios that result in suboptimal introduction of the siRNA (Lapan, P. Zhang, J., Pan, J. and Haney, S.A., manuscript in preparation). In the results shown here, the higher siRNA levels are changing the siRNA:lipid ratio, which is the most likely source of diminished efficacy at the higher siRNA levels.Figure 1Single cell analysis of siRNA knockdown of GFP. siRNAs transfected at increasing doses into RWPE-1 cells stably transduced to constitutively express GFP, are correlated with the reduction of GFP expression, as determined by fluorescence intensity. A. GFP-siRNA accumulation and correlation with GFP levels observed by fluorescence microscopy. B. Average GFP fluorescence levels of wells treated with a GFP-specific siRNA or a non-targeting control siRNA, as indicated. Each box plot displays the median and intrerquartile range of 8 wells. C. For the transfection of siRNAs at a concentration of 3.13 nM, the cells of one well are plotted individually for both GFP and rhodamine fluorescence intensities.To investigate the extent to which transfection and other sources of variability play a role in the analysis of GFP knockdown by an siRNA, we analyzed the same data at the single cell level. The data for one well where the siRNA was transfected at 3.13 nM are presented in Figure 1C. These data are reported as single cell values that correlate the expression of GFP with the amount of siRNA taken up on a per-cell basis for the GFP siRNA, which was labeled with Rhodamine. The siRNA shows a clear ability to reduce GFP levels. It can also be readily observed that the sample treated with the NTC siRNA includes a significant numbers of cells that intrinsically express low levels of GFP. The number of cells that express low levels of GFP in the control sample affects the mean level of GFP for the pool of untreated cells, and therefore, the extent of knockdown of the treated sample. While the effectiveness of the siRNA in reducing GFP levels is scored as roughly 60% using a whole-well analysis, gating on data within GFP-positive regions (analogous to the gating of cell populations in flow cytometry), the experimental effect is 10-fold, or a 90% reduction in high GFP-expressing cells, with 457 GFP expressing cells in the NTC siRNA treated sample, and 48 in the GFP siRNA treated sample. Heterogeneity of GFP expression is observed by other investigators. In particular, it has been noted that a variety of factors contribute to the perception of stochastic effects on protein expression levels when individual cells are examined. These effects contribute to the observed variability in lines developed from clonally expanded isolates [42], and from constitutive promoters [43].Intrinsic target protein levels are highly variable on a per cell basisPrior to extending the results we observed using siRNA-mediated knockdown of GFP to endogenous proteins, we characterized protein abundance in cell culture populations at the single cell level. This analysis provides a context for understanding how changes in protein levels are measured at the single cell level, and how changes in protein levels affect cellular functions. Eight examples of frequently studied proteins are shown for two breast cell lines in Figure 2. A broad distribution is observed for the proteins indicated in the figure, as well as in other cell lines, including cell lines derived from human tumors (including MCF-7, MDA-MB-235, LnCaP, DU-145, and DLD-1), and epithelial cells that have been immortalized (including the prostate line RWPE-1, the chondrocyte line T/C-28a2 and the breast line 184B5). Proteins we have characterized include transcription factors (STAT1, STAT3, p53, Rb), protein kinases (CDC2, AKT1, ribosomal protein S6 kinase), and other signaling proteins (p16INK4A, PTEN). The inherent variability of these proteins is greater than what can be linked to changes resulting from changes in proliferation rates or the cell cycle (as determined by DNA content per cell). Average protein intensities for the indicated proteins are shown in Figure 2A. These data are reported in a manner similar to common methods for describing protein levels in cell lines (e.g. Western blotting and ELISA assays). The data shows that for many of the proteins, levels are higher in the cancer line T47D than they are for the immortalized breast line 184A1, particularly CDC2, STAT3 and p53. Such differences are frequently used to distinguish immortalized breast lines as being \"normal,\" although numerous studies have shown that such immortalized lines bear significant similarities to breast cancer cell lines at the phenotypic and transcriptional levels [44,45]. As such, increased similar levels of BIRC5, BRCA1 and c-Myc between the two lines are consistent with previous studies from this [46] and other laboratories [47,48] that these proteins are significantly affected by immortalization in breast cell lines. Of relevance to the current discussion, different protein levels in the immortalized and cancer cell lines do not exist as discrete examples of cells with high and low levels of a particular protein, but as broad and overlapping ranges of protein levels on a per cell basis (Figure 2B). The increased average levels of such proteins are reflected in these distributions, creating a significant \"weighting\" of the cells with higher abundances, as shown in Figure 2C (e.g. HDAC3 and p53), while at the same time including a portion of the sample with lower levels. Such broad distributions bear an impact on drug development, as these \"side populations\" for proteins involved in the cell cycle or DNA damage response may represent cells that are particularly important to disease progression. Subpopulations of cells may be more resistant to chemotherapeutics at the low end of antigen intensity, and may have little contribution to disease progression due to excessive stress and an increased proportion of dying cells at the high end. In such cases, focusing on the disease-relevant populations will have an important benefit to drug development.Figure 2Wide distributions are observed in endogenous protein levels for cultured cell lines. Antigen intensity was determined by high content screening following fixation and staining with antibodies that were specific for the indicated protein. Quantitation was achieved by a whole cell mask, which was dilated out from the nuclear region identified by DAPI staining. A. Endogenous expression levels of proteins are shown for two breast cell lines, the immortalized line 184B5 and the estrogen-sensitive breast cancer cell line T47D, shown as well or sample mean values of all of the cells. Proteins examined in this study, as indicated in the figure, were quantitated by indirect immunofluorescence and image analysis, and values for each cell are plotted as individual points. All graphs are to the same scale, indicated in the lower left. Approximately 7000 cells were quantitated per sample (antigen/cell line). B. Display of sample distributions for the proteins indicated in (A). Data is presented as histograms of cells with increasing levels (total fluorescence intensity, or the sum of all pixel intensities, per cell) of the indicated proteins. C. Contribution of cells stratified by antigen intensities on overall abundance measurements. Data is as in panel B, but calculated as the product of the number of cells per bin times the average antigen intensity for that bin. As such, the contribution of each bin to the total well mean response is represented. D-F. Correlations between two proteins in cell populations. Protein levels per cell are shown for T47D cells, as indicated in the graphs. Protein levels are mean average fluorescence intensities per cell, as indicated in the axes labels.We have examined the variability in intrinsic protein levels in cells, including a potential role for bias during the fixation and staining process, by dual-color staining (Figure 2D–2F). We observe that for many pairs, the extent of covariation is low, as observed for p53 and BRCA1 (r = 0.379) and Rb and HDAC3 levels (r = 0.353) in T47D cells. These data indicate that fixation and permeabilization do not play dominant roles in the distribution of antigen intensity. We do observe a higher correlation between c-MYC and BRCA1 levels (r = 0.814), in this particular case, the co-variation may reflect a biological correlation. In addition to the analytical comparison of co-staining patterns, we have examined several pairs of antigen staining to determine whether the staining patterns themselves are independent in cases where abundances are independent, by high-resolution confocal microscopy (results not shown). We find that in cases where two antigens are characterized in the same cells, the patterns are consistent for each antigen, regardless the level of staining for the second antigen. For example, the extent of nuclear staining and the degree of punctate staining observed were independent for the pairs examined (pairwise combinations of HDAC3, Rb and p53), further indicating that artifactual factors, such as uneven permeabilization or fixation, are not the cause of the wide range in antigen levels observed for these cells.RNAi-mediated knockdown of PTEN affects phosho-S6 levelsThe regulation of the AKT/mTor pathway represents several important and clinically relevant targets, particularly the inhibition of mTor through rapamycin-related compounds such as temsirolimus [49,50]. The relationship between sensitivity to temsirolimus, PTEN status and phospho-S6 levels have been studied closely for both pharmacogenomic indicators that can be used in patient selection, and in the case of phospho-S6 levels, as a phamacodynamic marker that can be used in drug dosing [51,52]. However, PTEN is only one contributor to activation of the AKT/mTor pathway. This is true in cell culture systems as well as in human tumor samples. We were interested in whether the analysis of RNAi knockdown of PTEN at the single cell level could elaborate on the relationship between its levels and activation of the AKT/mTor pathway. Phosphorylation of S6 is highly sensitive to the activation state of the pathway, both in cellular systems and clinically, where it is a validated biomarker of increased PI3K activity and is correlated with PTEN status. Knockdown results for PTEN are shown at the single cell level in Figure 3A. Testing a range of transfection conditions for PTEN knockdown (similar to Figure 1A) shows that this system is more robust to higher lipid concentrations that is observed for the immortalized chondrocyte line used in the GFP expression studies. The effect of PTEN depletion on pS6 phosphorylation is shown in Figure 3B, where the population of cells treated with the PTEN siRNA shows higher levels of pS6 phosphorylation. In Figure 3C, the levels of PTEN and phospho-S6 are compared for the same samples. The reduction of PTEN level and increase in phospho-S6 levels observed above can be seen as a shift in the PTEN siRNA treated sample.Figure 3siRNA-mediated knockdown of PTEN and its effect on phosphorylation of ribosomal protein S6. The breast carcinoma cell line MDA-MB-231 was treated with siRNAs to characterize the correlation between PTEN levels and ribosomal protein S6 phosphorylation levels. ~15,000 cells are presented. A. PTEN levels displayed as a histogram for samples treated with an siRNA targeting PTEN or a non-targeting control, as indicated. B. Ribosomal protein S6 phosphorylation for the same cells as in A, shown as a histogram of phosphorylation levels as reported by immunofluorescence intensities. C. Pairwise correlation for PTEN and phospho-S6 levels at the single cell level for data presented in A and B.Figure 3C also shows the complexity of the AKT/mTor pathway when each sample is examined at the single cell level. That is to say, the effect observed in the whole well analyses, a decrease in PTEN results in an increase in phospho-S6 levels, would be expected to cause a negative correlation between these two proteins at the single cell level. Instead, a moderate positive correlation is observed, similar to the correlation observed in the unperturbed endogenous protein levels studied in Figure 2. Although often depicted as a linear pathway that leads to the activation of transcription, translation and metabolic activity, this pathway is under multiple levels of positive and negative feedback regulation of PI-3 kinase, AKT, mTor and ribosomal protein S6 kinase [53-55], which complicates strict correlations between any two points that are separated by one or more of these additional regulatory channels (discussed below). The extensive number of interactions between the AKT/mTor pathway and other regulatory pathways means that cells in culture are in a large number of discrete states. This has been observed elsewhere by our laboratory [56], and has been noted as a complicating factor in therapies that target this pathway, including those that target Her-2NEU, PI3K and ERK [57,58]. The use of single cell analysis to track multiple signaling states presents a valuable advance in the study of current and novel theapeutics.Defining the role of STAT3 in colon carcinoma growth and survival by single cell analysis of RNAi-mediated reduction in STAT3 levelsTo further investigate the contribution of single cell analysis to cellular signaling studies, we turned to a less complex signaling pathway, the role of STAT3 in cancer cell proliferation and apoptosis suppression. Two examples are shown in Figure 4. In Figure 4A, knockdown of STAT3 in SW480 colon carcinoma cells are shown at the single cell level. Knockdown of STAT3 at the protein level is about 30%, based on average values for replicate wells (3 for each condition, data not shown). Although weakly separated when analyzed at the whole well level, the single cell distributions show a clear effect of treating with the STAT3 siRNA; a K-S test (the Kolmogorov-Smirnov statistic, [29,59]) shows a difference of 0.349 (p < 2.2e-16). Such reductions are typically too small to produce robust phenotypic differences in most whole-well assay formats. There are likely to be many cases where this is correct, but Figure 4A provides a different perspective that more accurately states the situation. It is clear that distribution of STAT3 levels in SW480 cells is too wide for an average reduction of 30% to effectively demonstrate a phenotype associated with STAT3 levels at the whole well level. The overall reduction can be observed in the shift of the distributions, but residual overlap is greater than 50%. If a 30% reduction in STAT3 level does in fact have an effect on these cells, an average change of 30% of STAT3 levels in these samples may not show such an effect because of the wide range in each sample.Figure 4siRNA mediated knockdown of STAT3. A. Histogram of STAT3 levels in SW480 colon carcinoma cells treated with STAT3 and NTC (non-targeting) siRNAs. Red bars denote STAT3 siRNA treated cells and blue bars represent NTC treated cells. Data presents ~22,000 cells for samples treated with STAT3 and NTC siRNAs each. A region of low-STAT3 expressing cells examined in panels (C) and (E) is indicated in the panel (top left corner). B. DNA histogram of cells treated with the STAT3 siRNA. C. DNA histogram of low-STAT3 expressing cells (cells are highlighted in panel A). D. Nuclear size as a function of DNA content for the entire dataset. E. Nuclear size as a function of DNA content for the low-STAT3 cells highlighted in part A, for both STAT3 and NTC treated cells. The measure of DNA content for panels B-E are identical, and therefore the comparison of nuclear size as a function of DNA content may be made directly to the fraction of cells in each phase of the cell cycle (panels C and D, respectively). Color schemes for panels D and E are as in A.While strong changes in average protein levels are required for experiments at the whole well level, analysis at the single cell level shows that STAT3 levels vary over a broad range under both control and STAT3 siRNA treatments. As such, comparisons between low and high STAT3 levels can be made by single cell analysis in cases where whole well differences are less dramatic. As an example, the effect of reducing STAT3 levels by RNAi can be analyzed in the experiment shown in Figure 4. Specifically, STAT3 is constitutively activated in many cancer cell lines, and reduction in STAT3 levels or activity (through RNAi or inhibitors of the JAK/STAT pathways) have been shown to result in growth arrest and apoptosis [60-62].Proliferation inhibition is the result of the essential role of the protein in growth, but the induction of apoptosis or other forms of cell death has been ascribed to more complex interactions, such as oncogene dependency [63] or oncogenic shock [64]. In these models, cancer cell death results from a release in apoptosis suppression mediated by the signal transduction pathway. The data in Figure 4A can be used to determine whether reducing STAT3 levels through RNAi results in a change in cell health that is distinct from cells with equivalent levels of STAT3 as a result of expression adjustments made during growth in standard culture conditions. This was done through comparing the distribution of cells through the cell cycle in the entire dataset versus a subset of cells where STAT3 levels were low in the STAT3 siRNA-treated sample. For the cells treated with the STAT3 siRNA, 22034 cells were analyzed in the complete dataset and 5471 cells were analyzed in the low-STAT3 population, as indicated in the annotation of Figure 4A. Samples were initially compared for DNA content, as a measure of cell cycle distributions. The data for the entire STAT3 siRNA-treated sample is shown in Figure 4B, and that for the low-STAT3 subset are shown in Figure 4C.The data in Figure 4B shows that the cells are proliferating, with a significant number of cells in the G2/M phases of the cell cycle. For the low STAT3-containing cells (Figure 4C), the distribution shows a reduction in cells in these phases of the cell cycle, and a majority of the cells in G1. The cell cycle distribution is similar for the low-STAT3 cells of the NTC treated samples, but there are fewer cells and the histogram is not as smooth (not shown). Looking at subgroups with higher levels of STAT3, the proportion of cells in G2 increases somewhat.In addition to measuring the effect on the cell cycle, the effect of lowering STAT3 levels through RNAi on cell stress and cell death can be determined as well. In this case, such effects would indicate a dependence on high STAT3 levels for survival, either through oncogene addiction or oncogenic shock, two models derived from observations that reduction in oncogene activity can induce cell death. Severe cell stress and cell death are manifest in several ways, including changes to the chromatin and nuclei [28,65-67], which can be quantitated in image-based assays. In the present example, an effect of lowering STAT3 levels on viability would manifest itself as a change in nuclear size in the STAT3 siRNA-treated cells as compared to the NTC siRNA-treated cells. This has been noted in cytometry-based profiling studies [28,68,69], and is shown for SW480 colon carcinoma cells as a function of etoposide treatment in Additional File 1 (details are provided in the Methods section). Nuclear size as a function of DNA content is shown in Figure 4D and Figure 4E for the entire dataset and for the low STAT3-expressing fraction of cells, respectively. Nuclear size increases as a function of DNA content through the cell cycle, as shown for both panels, with increasing nuclear size as cells progress into S phase and again in late G2, immediately prior to anaphase. For the data shown in Figure 4, the relationship between DNA content and nuclear size is essentially identical for the NTC siRNA-treated sample (in blue) and the STAT3 siRNA-treated sample (in red) in both analyses, indicating that cells that have had STAT3 levels reduced through RNAi treatment are not undergoing cell death to a greater extent than control cells. If STAT3 levels were critical to the suppression of apoptosis or necrosis, the nuclear diameter of the cells with low STAT3 abundance would change, relative to the control cells. They would increase in size as a general function of cell stress [27-29], but would typically shrink and become more variegated in classical apoptosis [65,70]. None of these changes are observed in any of the subsets. Taken together, these results suggest that STAT3 is playing an important role in the proliferation of SW480 cells, but is not acting as an essential oncogene through the suppression of apoptosis or necrosis, as would be evident if the nuclei were significantly different.p53 dependence on adriamycin sensitivity can be observed following p53 knockdown at the whole well level, and in naturally-occurring low p53-expressing cells at the single cell levelAs a final example of the value of single cell analysis, we characterized the effect of p53 levels on apoptosis and activation of the DNA damage response. The DNA damaging agent adriamycin is toxic to all cells, but the toxicity is more pronounced when p53 is either not expressed or non-functional [71]. We have looked at the dependence of p53 levels in DLD-1 colon carcinoma cells on adriamycin sensitivity at the single cell level. The sensitivity of p53-depleted cells to adriamycin is shown in Figure 5A, where the number of cells per well is reported as a function of adriamycin concentration and treatment with either an siRNA that targets p53 or a non-targeting control (NTC). Control cells shown as not treated with adriamycin were treated with DMSO at the same concentration as the cells treated with the highest concentration of adriamycin. Confidence limits for the data were 0.021 (standard error of 0.0044) for the NTC treated cells and 0.0053 (standard error of 0.0007) for the p53 siRNA treated cells. The levels of p53 for each sample are shown in Figure 5B. This data shows that transfection of an siRNA targeting p53 reduces p53 levels in DLD-1 cells prior to adriamycin treatment, as well as limiting the ability of these cells to fully recover p53 levels as a function of increasing adriamycin concentrations, despite the fact that the increase in p53 levels following DNA damage occurs through post-translational stabilization of p53 protein.Figure 5Dependence of p53 on the response to adriamycin is observed in both p53 siRNA treated cells and in untreated cells with low levels of p53. A. DLD-1 colon carcinoma cells treated with increasing doses of adriamycin as indicated in the figure. Cells were treated with an siRNA targeting GFP (blue) or an NTC (red). Cells not treated with adriamycin were treated with DMSO. B. p53 levels following siRNA treatment. An siRNA that targets p53 (blue) or a non-targeting control (red), are shown. siRNA treatments as described in A. C. The fraction of cells within each concentration of adriamycin for the NTC treated sample is shown. The fractions of cells with the highest and lowest 20% of the range of p53 levels (burgundy and teal, respectively) in the untreated sample are shown at each concentration of adriamycin. The range of p53 levels in each bin is 0–200 FU for the lowest bin and 800–1000 FU for the highest bin. D. p53 levels following p53 or NTC siRNA treatment for 48 hours, and adriamycin treatment for 6 hours. siRNA treatments as described in A E. Levels of γ-phosphorylated histone H2A-x levels as a function of p53 levels per cell and adriamycin treatment for 6 hours. Adriamycin doses are as shown in other panels, in a color range from yellow (no adriamycin) to orange (1.222 μM adriamycin). Each data point represents 200–400 cells. F. Same as (E), except cells were not treated with an NTC siRNA. Adriamycin concentrations are indicated in the panel.For the sample treated with the NTC siRNA, the amount of p53 per cell was used to divide the cells into groups, and the fraction of cells for each group as a function of adriamycin concentration is shown in Figure 5C. Cells with high levels of p53 are compared to cells with low levels of p53 for each dose of adriamycin. The data shows that cells expressing low levels of p53 are sharply reduced as adriamycin concentrations increase, and to an extent comparable to the reduction of the total cell numbers. This suggests that cells with low levels of p53 are particularly sensitive to adriamycin treatment. Since p53 levels can rise as a direct result of DNA damage, it is also possible that cells with low levels of p53 initially are actually stabilizing p53 and levels are increasing. Therefore, we sought to resolve these two factors in p53-mediated cell survival mechanisms.We have addressed the question of whether adriamycin sensitivity is affected by p53 levels at the time of DNA damage by looking at how cells respond to treatment prior to when cell death and increased p53 levels are observed. In Figure 5D, the level of p53 in cells treated with siRNAs targeting p53 and the NTC control are shown for cells treated with increasing concentrations of adriamycin for 6 hours. At this time, we do not observe cell death (as reported by the number of cells per well), or a significant increase in average p53 levels (as shown in the figure). However, DNA damage can be observed in these cells in a dose-dependent manner, as determined by changes in DNA and nuclear morphology (data not shown). We have binned these cells by p53 level for each concentration of adriamycin treatment, and measured the levels of γ-H2A-x phosphorylation for each group, as shown in Figure 5E. Phosphorylation of this variant histone occurs in cells following DNA damage [72] independently of changes in p53 level or modification [72,73]. The data shows that cells with higher levels of p53 show stronger DNA damage responses, as evidenced by increased γ-phosphorylated histone-H2A-x levels. Since these are independent responses to DNA damage, it suggests that cells with higher p53 levels may result from a stronger (or more activated) DNA damage response pathway prior to the onset of DNA damage itself, up until a point where the damage is beyond the ability of the cells to respond effectively (1.2 μM and higher concentrations). At high concentrations, significant cell death is observed for all cells (>85% cell killing), and no differential is observed between untreated cells and those treated with an siRNA targeting p53. At concentrations where the dependence of p53 status on adriamycin sensitivity can be observed, single cell analysis has been able to correlate the extent of the DNA damage response induction with p53 levels in cells where p53 levels have not been altered prior to DNA damage. The same general response can be observed in separate experiments using DLD-1 cells that have not been treated with any siRNA prior to that with adriamycin (i.e. no mock or control siRNA transfection at all), shown in Figure 5F. The cells are somewhat more resistant to adriamycin in general, possibly a result of no treatment with liposomes in a transfection, but the pattern of higher p53 levels correlating with higher DNA damage response is still evident.Discussion and conclusionWe have applied the general concept of multiparametric single cell analysis to the use of RNAi, and to the relationship between protein levels and chemotherapeutic response. High Content Screening is becoming an important and general approach to biological and therapeutic studies. In addition to increasing the options available for cell-based assays in general, it is opening up new approaches to biological processes and drug development, such as cytological profiling [28,29,66]. Inherent in the latter approaches is the use of single cell cytometry to analyze complex patterns in cellular responses [27]. We have generalized the use of single cell cytometry in several experimental systems and have found that it generally improves experimental analysis, and in some cases, enables challenging questions to be addressed directly. We have used single cell cytometry to address four biological problems: identifying the relevant cells in a knockdown of GFP, correlating the knockdown of PTEN with the increase in activity of pS6 kinase, the effect of knockdown of STAT3 on proliferation and death of colon carcinoma cells and the relationship between p53 levels and responsiveness to DNA damage (both as manipulated by RNAi and as occur intrinsically through standard cell culture conditions).For RNAi screening in general, there are two applications of single cell cytometry that are potentially valuable. First is a general analysis of knockdown phenotypes by number of cells showing an altered phenotype, rather than average phenotypic change for the two samples. This approach is more in line with other distribution-based methods such as sectoring samples in flow cytometry, and can present data in more biologically-relevant way than reporting as percent-of-control (discussed below). Rigorous analysis of RNAi screening data is currently challenging [15,74], and would benefit from clearer definitions of what constitutes a hit [9,75]. The second benefit of single cell cytometry is the capacity to score cells as a function of the amount of siRNA effectively introduced in cells, as evidenced by the accumulation of the (non-functional) sense strand in P-bodies following efficient transfection. Transfection of siRNAs are frequently associated with off-target effects [76-78], particularly at concentrations typically used for library-based screening (>20 nM) [79,80]. Off-target effects result in many false positive hits in RNAi screens, and impose a significant burden on the post-screening confirmation phase of a project [81]. Transfection at low concentrations (< 10 nM) has been shown to reduce such artifacts, however library screening is performed with many siRNAs that have not been well-validated, particularly for off-target effects. Library screening typically involves higher concentrations because a productive screen requires that cells be reliably transfected, and some balance between the efficiency of transfection and a lack of specificity can be tolerated in the initial screen [15], as long as an effective strategy exists for demonstrating authentic gene-phenotype connections [81,82]. Therefore, off-target effects resulting from high concentrations of siRNA transfections are a common and perhaps unavoidable complication of running siRNA screens. Reduced off-target effects have been associated with pooling or multiplexing siRNAs, particularly in highly complex pools such as are generated by enzymatic preparation of gene-specific siRNA pools (esiRNAs, [83]), at least in part because the concentration of any single siRNA is low.Reverse-transfection, including the live cell array [7,84,85], is frequently used in functional screens. This format spots the siRNA (or dsRNA for screens in Drosophila cells) onto a surface prior to use with cultured cells, and therefore cells are not transfected at a specific concentration, strictly speaking. Single cell analysis can be readily performed on assays following reverse transfection, since these explicitly require image-based readouts. Selecting a subpopulation with consistent siRNA uptake for each siRNA is computationally intensive, and therefore would be difficult to use directly in the primary screen endpoint, but could be used to analyze data from a primary screen that uses a high content (image-based) assay. The siRNAs need to be labeled directly or co-transfected with a labeled siRNA, in order for siRNA levels to be quantitated. However, the benefit of this is that knockdown phenotypes can be scored for cells within specific thresholds of siRNA accumulation, and these thresholds can be adjusted as the data is reviewed, rather than during image analysis. Scoring perturbations by fraction of responding cells (in the case of GFP knockdown at the single cell level) and by response magnitude as a function of target level (such as in the example of DNA damage response as a function of p53 levels) highlight important characteristics of biological samples, particularly in the development of human diseases such as cancer. Clinically important roles are played by minor populations within cell types, such as the growth of solid tumors through tumor-initiating cells (cancer stem cells) and the importance of regions within tumors that control angiogenesis and chemoresistance (the hypoxic core of cells within solid tumors). These properties can be observed in cell culture models, but this differentiation is lost in whole-well methods. Tracking effects of candidate therapeutics among rare cells or cells that have reduced proliferation rates can focus decisions on how well promising a strategy may be by limiting analysis to the cells that play the biggest role in disease progression.A similar situation occurs with pathway analyses. An assay that measures a change in a complex pathway, such as the PI3K/AKT/mTor pathway, cannot help but exclude important factors that contribute to a diverse set of outputs. This heterogeneity may be as much a part of the discordance between target inhibition and clinical response as widely cited factors, such as tumor heterogeneity as a result of genetic instability. In both cases, variability in the cells that constitute a tumor enable a significant number of cells to escape death. The difference between these two scenarios is that genetic instability suggests a somatic evolutionary process, whereas signaling heterogeneity suggests that insufficient control of the pathway results in escape from a therapeutic. In such cases, single cell analysis could improve the search for combination therapeutic strategies. mTor activity is subject to multiple levels of feedback regulation [86,87] and to cross-talk with other pathways, particularly the influence of amino acid and cellular energy levels on mTor activity [55]. As such these influences would need to be measured in a multiparametric assay system, to track changes between two points in such a complex pathway. Taken together, the results presented here suggest that pathways that are quiescent (such p53 during periods of low DNA damage) or truly linear (such as activation of STAT signaling by JAK kinases) should show correlations between two points at the single cell level. This correlation could be used to validate results from RNAi experiments by providing a separate method of linking protein levels to pathway function.Studies that integrate complex signaling interactions, as opposed to linear events within single pathways, are at the root of systems biology [31,32], and are better able to characterize pathway states in their biological contexts. Such approaches are being shown to be of direct relevance to signaling in disease biology [25,88]. HCS is a strong complement to flow cytometry as a method of single cell analysis because signaling pathway responses can be integrated with cytological dynamics, and as such will extend systems biology into areas such as cancer cell motility and invasion [27,29,89]. These approaches will lead to more innovative approaches to treating disease [90], including complex molecular studies which can be integrated with genetic and epidemiological studies that show subtle but important interactions between common disease loci.MethodsCell lines, cell culture and reagentsImmortalized breast cell lines 184A1, and 184B5 were generously provided by Martha Stampfer (LBNL, Berkeley, CA). The C19 derivative of T/C-28a2 was developed and generously provided by Manas Majumdar (Wyeth Research, Cambridge, MA). MCF-7, T47D, MDA-MB-235, DLD-1, RWPE-1 were obtained from ATCC (Mannasas, VA). RWPE-1-GFP was developed by transduction of a lentivirus that encodes the GFP gene under the control of the CMV promoter. Media used for each cell line were according to instructions from the source.Antibodies against γ-phosphorylated histone H2A-x, were obtained from Upstate Biotechnologies (Lake Placid, NY); antibodies against caspase-cleaved PARP and p53 were obtained from Cell Signaling Technologies (Beverly, MA). Fluorescent probes, including DAPI, and antibodies conjugated to Alexa dyes, were obtained from Molecular Probes/Invitrogen (Carlesbad, CA). Adriamycin, 16% paraformaldehyde, and Tween-20 were obtained from Sigma, Inc. (St. Louis, MO). siRNAs targeting p53 were obtained from Ambion, Inc (Austin, TX). Custom synthesized and unmodified siRNAs targeting GFP were obtained from Qiagen (Valencia, CA).siRNA transfectionssiRNAs were transfected as complexes with cationic liposomes from one of several manufacturers. For each experiment 3–5 commercially-available lipids were tested in a series of concentrations and siRNA:lipid ratios, according to manufacturers instructions. Transfections were four hours long and terminated by a change in media. For each cell line used in each experiment, the optimal lipid and siRNA:lipid ratios were determined using a test siRNA that targets GAPDH and GAPDH enzyme activity was measured for each condition, using the KD Alert kit from Ambion (Austin, TX). Optimal conditions were chosen as those that gave the greatest reduction in GAPDH activity when treated with the GAPDH-targeting siRNA, but minimal toxicity as identified by the NTC siRNA. Optimal conditions for each experiment are listed in Additional File 2.Quantitative immunofluorescenceCells labeled as described in the figures were fixed with 4% paraformaldehyde, washed, permeabilized with 0.2% Triton X-100 and stained with 300 nM DAPI, primary and secondary antibodies and washed again. Antibodies were titrated for optimal imaging, and the lowest concentration that gave a highly-specific labeling of the antigen was used. Sources, dilution levels and fluorescence conditions are listed in Additional File 2.Antigen intensities and localizations within cells following fixation and staining were imaged using an ArrayScan VTI (Cellomics, Pittsburgh, PA), using a 20 × 0.63 NA objective. Images were analyzed using the Target Activation and Compartmental Analysis image analysis applications from Cellomics. Cellular imaging was accomplished by first locating cell nuclei using DAPI-chromatin fluorescence and expanding the diameter of the nuclei to encompass the cytoplasmic region. Specific adjustments are required for each cell line. Cytoplasmic regions of neighboring cells were optimized in an iterative cycle of algorithm modifications and testing. Fluorescence intensity was captured and interpreted by one of several methods, typically mean fluorescence intensity per cell. Fluorescence measurements were well within the linear range of the image capture system (illumination, light filtering and detection using a cooled-CCD camera), so relative changes in protein levels could be made using relative changes in fluorescence between cells and samples. Non-specific detection is low, as shown in Additional File 3, and this enabled relative changes in protein levels to be determined from the fluorescence intensities.Nuclear morphology was used as an indicator of cell health. Specifically, changes in nuclear area are indicative of severe cell stresses that result in necrosis or apoptosis. The identification of cells lethally treated with etoposide using nuclear area as an indicator of imminent cell death has been used by several laboratories in both classical apoptosis studies without the use of automation and in cytological profiling approaches. The change in nuclear area following treatment with an inducer of apoptosis is shown in Additional File 1. SW480 cells were treated with 5 μM etoposide for 24 hr, fixed and stained as described above. Cells treated with 10 μM and 20 μM etoposide showed similar distributions of nuclear area.Quantitation and statistical analysesWe have used HCS to examine protein levels within cells, and how these levels are manipulated by RNAi, at the single cell level. Data extraction and processing were performed using the statistical programming language R . Data from individual cells were extracted directly from the Cellomics' STORE database using a custom R function getCellData(), which uses a SQL query provided by Cellomics. The getCellData() function allows single cell data to be queried by well, row, column, or plate, one feature at a time, and is described in Additional File 4.R scripts utilizing the getCellData() function are executed on a LINUX cluster. An auxiliary text file lists the plates and wells to be extracted, as well as the annotation associated with each well. The R script reads the auxiliary file 1nd replicates and merges the annotation with the single cell data as it is extracted from the database. Averaging, normalizations, and transformations are performed in R prior to export as a flat text file. Data is visualized either directly in R or imported into Spotfire for interactive analysis.Authors' contributionsPL codeveloped the data extraction and single cell analysis pipeline, and conducted the GFP knockdown experiments, analyzed data, and developed the manuscript; JZ conducted and analyzed the p53 knockdown experiments; JP conducted the antigen distribution, PTEN and STAT3 experiments; AH codeveloped the data extraction and single cell analysis pipeline; SH analyzed data and wrote the draft. All authors contributed to interpretation of data and manuscript revisions.Supplementary MaterialAdditional file 1Supplementary Figure 1 Effect of etoposide treatment on nuclear area of SW 480 colon carcinoma cells. SW480 cells were plated in a 96-well microtiter plate and cultured for 24 hr, at which time they were treated with 5 mM etoposide (shown in red) or a vehicle control (shown in blue). Nuclear size for each cell is shown as a histogram of the entire dataset after binning as shown in the figure.Click here for fileAdditional file 2Immunofluorescence and siRNA transfection conditions. Specific catalog and treatment conditions for siRNAs, transfection reagents and immunofluorescence microscopy.Click here for fileAdditional file 3Supplementary Figure 2 Representative specific and non-specific staining intensities for the primary and secondary antibodies. Box plots of antigen levels as detected by high content screening. Specific antigens were detected using antibodies as indicated in the panel and non-specific background staining was detected using specific isotypes, is indicated as well. IgG is from rabbit, IgG1 and IgG2a are from mouse.Click here for fileAdditional file 4Extracting high content single cell data for analysis. SWEAVE document describing the routine used to retrieve single cell data from the database.Click here for file\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2529311.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2529311",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2529311\nAUTHORS: Maria I Nino-Soto, Razi Jafari Jozani, Byram Bridle, Bonnie A Mallard\n\nABSTRACT:\nBackgroundThe Swine Leukocyte Antigen (SLA) system encodes molecules for self-nonself discrimination and is associated with immune responses and disease resistance. Three lines of pigs defined by their SLA-DRB1 alleles were developed at the University of Guelph for xenotransplantation and immune response studies. The aim of this project was to explore the potential association between defined SLA-DRB1 alleles and gene transcriptional patterns of other immune-related genes in blood mononuclear cells.FindingsThree SLA-DRB1 alleles were characterized using a RT-PCR-based sequencing method. The loci represented included a new allele, DRB1*04ns01. Next, microarray heterologous (bovine-porcine) hybridization together with qPCR were used to explore differential gene expression between SLA-DRB1-defined groups. Microarray analysis showed significant (p < 0.01) differential expression for 5 genes, mostly related to inflammation. Genes varied according to the comparison analyzed. Further testing with qPCR revealed the same trend of differential expression for 4 of the genes, although statistical significance was reached for only one.ConclusionA new SLA-DRB1 allele was characterized. A potential association was found between SLA-DRB1 alleles and inflammation-related genes. However, the influence of other genes cannot be ruled out. These preliminary findings agree with other studies linking MHC haplotypes and inflammation processes, including autoimmune disease. The study provides an initial view of the biological interactions between the SLA complex and other immune-related genes. Future studies will focus on characterization of SLA-haplotypes associated with these particular alleles and the dynamics of the immune response to antigenic challenges.\n\nBODY:\nFindingsThe highly polymorphic MHC-encoded molecules are crucial for self-nonself discrimination in vertebrates. They constitute the major barrier for transplantation, contain numerous genes involved in immunological and non-immunological functions and are associated with resistance or susceptibility to various diseases. The two main classes, I and II, are involved in antigen presentation to T-cells. However, a large number of the genes in the MHC, like class III genes, are not directly related to this function [1,2]. A total of 152 loci have been annotated within this region. In pigs, known as the SLA, the DRB genes show extensive polymorphism in exon 2 and the 135 available sequences identified to date are distributed into at least 10 confirmed allele groups [3].Different SLA haplotypes have been associated with variation in immune response and disease, as well as reproduction and production traits [4]. Therefore, SLA-defined pigs constitute an invaluable resource to study immune response, disease resistance and production traits, as well as an important large animal model for biomedical research [5,6]. Three lines of commercial Yorkshire pigs with defined SLA-DRB1 genotypes were produced at the University of Guelph for xenotransplantation and immune response research [7,8]. The aims of this study were to characterize the SLA-DRB1 alleles in these three pig lines and explore differential transcriptional activity between the three groups using heterologous (bovine probes – porcine targets) cDNA microarray and qPCR.Animals and samplesAnimal use was approved by the Animal Care Committee of the University of Guelph. Thirty-five pigs were included in the study (n = 6 for microarray analysis and n = 29 for qPCR). Pigs came from crossings of an outbred population selected for only by specific SLA-DRB1 alleles. Age of pigs ranged between 3–6 months and all pigs were in good general health at the time of sampling. Venous blood was collected in EDTA coated BD Vacutainer® collection tubes (BD – Canada, Oakville, ON, Canada) and processed immediately after collection. MNCs were isolated using Histopaque-1077 (Sigma-Aldrich Canada Ltd., Oakville, ON, Canada) and total RNA was extracted using TRIzol™ reagent (Invitrogen Canada Inc., Burlington, ON, Canada). Total RNA was treated with DNA-free (Ambion Inc., TX, USA) to eliminate genomic DNA contamination. Concentration and quality were assessed with an Agilent 2100 Bioanalyzer (Agilent Technologies Inc., Santa Clara, CA, USA).SLA-DRB1 alleles characterizationThe SLA-DRB1 alleles were characterized according to Ho et al. (2006). Briefly, total RNA was reverse transcribed with the ThermoScript™ RT-PCR system using oligo d(T) primers (Invitrogen). A specific SLA-DRB1 coding region was amplified with PfuUltra™ Hotstart High-Fidelity DNA Polymerase (Stratagene, La Jolla, CA, USA) using a final concentration of 3 mM of MgCl2 and annealing temperature at 55°C. PCR products were gel-extracted with the QIAquick Gel Extraction Kit (Qiagen, Mississauga, ON, Canada) and purified PCR products were cloned using the Zero Blunt® TOPO® PCR cloning kit (Invitrogen). At least 7 colonies per animals were sent for sequencing. Each allele was characterized by sequencing using both forward and reverse primers, from at least two pigs per litter. The complete coding sequence was obtained by overlapping the forward and reverse fragments. Comparison with currently available sequences (GenBank and EBI-IPD-MHC, SLA section databases) was performed using BLAST [9] and ClustalW [10]. Two lines carried the SLA-DRB1*0502 and SLA-DRB1*0701 alleles respectively (Smith et al, 2005) as determined by a 100% homology between the sequences obtained from test samples and the corresponding published sequences. The third line had a novel allele, differing in one bp at position +118 in exon 2 with SLA-DRB1*0403. This difference corresponds to a point mutation substituting a cytosine for a guanine, which translates in the substitution of an arginine for a glycine residue in the protein encoded by this new allele (Figure 1). Sequences were submitted to GenBank [Genbank: EU087426, EU087427 and EU087428] and the EBI IPD-MHC (SLA section) which resulted in the assignment of the SLA-DRB1*04ns01 provisional name to the new allele, approved by the MHC Nomenclature Committee.Figure 1Nucleotide and protein sequence alignment of SLA-DRB1 alleles. Multiple sequence alignment for (a) nucleotide and (b) protein of published SLA-DRB1*0403 alleles (designated by their GenBank accession numbers) and *04ns01 (new allele). The black arrows mark (a) the point mutation and (b) the corresponding amino acid residue substitution.cDNA Microarray experimentsComplete and detailed information on microarray experimental protocols, the datasets and the platform were submitted to GEO (accession number GSE7908). Experiments are described according to the MIAME standard [11]. Heterologous hybridizations (bovine probes – porcine targets) were performed to compare the three groups representing defined SLA-DRB1 alleles (n = 2 pigs per group). A loop design was used for reciprocal comparisons. Six comparisons with dye-swap on the same slide were performed for a total of 12 microarrays. Data was analyzed using Acuity 4.0 (Molecular Devices Corp., Sunnyvale, CA, USA) and normalized with the LOWESS algorithm [12]. After normalization, data was filtered based on flags, percentage of saturated pixels, background and intensity uniformity, and signal to noise ratio. The log-ratios of expression were calculated as the base 2 logarithm of the ratios of background-corrected intensity medians of red dye over green dye intensities. A gene was considered to be differentially expressed if it had an absolute value of log-intensity ratio higher or equal to 0.8, representing a fold-change of 1.7 in transcript quantity. Statistical analysis was performed using the Student's t-test with FDR correction for multiple comparisons [13]. Statistical significance was set at p = 0.01. We had previously validated the use of this in-house immune-endocrine bovine microarray with porcine targets [14]. In this study, hybridization resulted in ~90% positive signals (~170 features) in agreement with those previous observations. However, the presence of positive signals of hybridization does not imply that all spots will provide valid results. As previously mentioned, we performed careful filtering to ensure that only consistent data was subject to further analysis. Results from microarray data analysis are summarized in Table 1 and Figure 2. The *0502 allele group showed higher transcriptional activity for CCL4 and IL1B in all comparisons. The *0701 allele group showed less SLA-DQA transcripts in all comparisons. Transcripts amounts for TLR2 and CASP1 were higher in the *0502 and *0701 allele groups respectively, when compared to the *04ns01 group. The small number of genes consistently detected as differentially expressed reflects the tendency of heterologous hybridization to reduce the effective size of a given microarray. Although optimal results are obtained with homologous hybridizations, the use of heterologous microarray hybridization is still a valid approach to assess gene expression profiles given that measures are taken to preserve the quality of the data obtained [15]. In addition, results were verified using qPCR as stated in the next section.Figure 2Differential transcriptional activity detected by cDNA microarray hybridization and qPCR. Mean fold changes in transcript quantification obtained by cDNA microarray hybridization () and qPCR (□). a) Microarray (n = 2 per group) and qPCR (*0502, n = 9; *04ns01, n = 14) results for the comparison between SLA-DRB1*0502 and *04ns01. b) Microarray (n = 2 per group) and qPCR (*0502, n = 9; *0701, n = 6) results for the comparison between SLA-DRB1*0502 and *0701 alleles. c) Microarray (n = 2 per group) and qPCR (*0701, n = 6; *04ns01, n = 14) results for the comparison between SLA-DRB1*0701 and *04ns01.Table 1Summary of results from cDNA microarray and qPCR data analysisMICROARRAYqPCRGeneFold-change aRatiobp-value cFold-change aRatiop-valueComparison A: SLA-DRB1 alleles 0502/04ns01TLR22.761.468< 0.00013.101.650.0586CCL42.101.0750.00103.271.710.2880IL1B3.211.6830.002514.723.880.0322Comparison B: SLA-DRB1 alleles 0502/0701SLA-DQA2.461.3030.00381.80.850.3569CCL42.411.2710.01583.551.830.2926IL1B3.571.8370.00793.11.640.4168Comparison C: SLA-DRB1 alleles 0701/04ns01CASP11.790.8400.00103.561.830.0651SLA-DQA-2.52-1.3350.00352.021.020.4667a Fold change = 2 (Log-ratio) or (-1) 2 (Log-ratio); b Median of the lowess-normalized log-ratio of intensity; c p-value with FDR correction for multiple comparisons.Numerous associations have been established in swine between SLA haplotypes and features such as immune response and disease [16,17], reproduction [18] and production traits [19]. Many of these traits are not directly regulated by individual SLA genes but could rather be under the influence of non-classical MHC genes or controlled by downstream pathways yet to be described. The involvement of other closely linked genes, whose variants are in linkage disequilibrium (LD) can not be discarded [20,21]. For example, it has been found that differential expression of LTB (also known as TNF beta) in MHC class II-defined B cell lines is associated with certain MHC class II haplotypes but not others. This association could be explained by LD between LTB and MHC haplotypes or by the influence of polymorphism in the MHC class II molecules and their interactions on the control of gene expression [22]. Another example is represented by BRD2 in humans. This transcription factor, without an established immune function and located in the MHC class II region, is strongly linked to the MHC in most vertebrates [23].Although it is not possible from the results in this study to establish a direct causal relationship between particular SLA-DRB1 alleles and differential transcription of inflammatory genes observed, it is undeniable that there seems to be an association. These observations will be better explained by the characterization of the haplotypes linked to these alleles and further exploration of the immune response in animals with defined MHC haplotypes.Quantitative RT-PCRTo verify differential expression observed in the microarray data, qPCR calibrator-normalized relative quantification with efficiency correction in the LightCycler® 1.5 system and the Relative Quantification Software v. 1.0 (Roche Diagnostics, Laval, QC, Canada) were used. RPL19 was tested for variability among samples and selected as reference gene. Specific PCR conditions and primers are described in Table 2. Total RNA samples (*0502, n = 9; *0701, n = 6 and *04ns01, n = 14) were reverse transcribed using SuperScript III (Invitrogen). The qPCR was performed using LightCycler® FastStart DNA Master SYBR Green I (Roche). Relative standard curves for target and reference genes were created using dilution series with six 10-fold dilutions in triplicates. One of the dilutions was used as calibrator. Replicate determinations were performed using independent reverse transcription reactions. Results are reported as normalized ratio of target/reference concentrations. Data sets from qPCR were analyzed with a general linear model [24] using the SAS system for Windows v 9 (SAS Institute Inc., Cary NC, USA). A log transformation was used to normalize the data and directly model the ratios of transcript quantification. The ANOVA allowed analysis with unequal variances for CCL4. Statistical significance was set at p = 0.05. Results from the qPCR analysis are summarized in Table 2 and Figure 2. In general, qPCR results followed the trend observed by microarray analysis, except for of SLA-DQA, which showed a pattern opposite to the one expected for the *0701/*04ns01 comparison. It appears that differences were more consistent between the *04ns01 and the two other groups, with IL1B transcript quantity reaching statistical significance (p = 0.05) and TLR2 (p = 0.0586) and CASP1 (p = 0.0651) approaching statistical significance, warranting further investigation. It is worth mentioning that lack of statistical significance does not automatically imply lack of biological significance. Analysis of variance components indicated that the individual pig (p = 0.05) was an important random effect in transcript quantification. This innate variability of individual pigs is most likely behind the lack of statistical significance in spite of fold-changes higher than 3 being observed. It also points out to the importance of including as many individuals as possible for qPCR confirmation of microarray data, especially individuals that have not been used for the microarray analysis, in order to obtain results that more closely reflect the situation in the population. In the case of CCL4, even though it appeared to be significantly differentially expressed in two of the comparisons (fold change > 3), the differences got lost within the high variability showed by the gene transcript quantifications in the tested groups, indicating that the differences may not be consistent at the population level. This seems to be also the case for differences observed between the *0502 and *0701 allele groups, a fact that suggests that the gene expression profiles of these two groups are not really that distinctive.Table 2Gene-specific primers and PCR conditions for relative quantification in the Light Cycler systemGene nameGenBankaPrimers (5'-> 3') bProd. size (bp) cAnn. temp. (°C) dAcq. temp. (°C) eTLR2AB085935.1F TGCGAATCCTGAAAATAGGC3435984R CTTGCGTCAGTGATTTCTGCCCL4NM_001075147F GAAGCTCTGCGTGACTGTCC3915987R AGGAACAGGATCTGCTGAGGIL1BNM_214055.1F GCAGATGGTGTCTGTCATCG4446084R TTCTCCATGTCCCTCTTTGGSLA-DQAAY191777.1F TGTGGAGGTGAAGACATTGC3155983R CAGCATCACTGGAGACTTGGCASP1NM_214162.1F GAGAAAATCTCACCGCTTCG5725983R AGTCACTCTTTCGGCAGTGGRPL19AV600389F ATGAGACCAATGAAATCGCC5046087R CATGAGGATCCGCTTGTTTTa Sequenced used for primer design; b Sequence of forward (F) and reverse (R) primers in 5' to 3' orientation; c Size of the amplified PCR product; d Annealing temperature and e acquisition temperature for qPCR.List of abbreviationsLTB, Lymphotoxin beta (TNF superfamily, member 3); BRD2, Bromodomain containing 2; CCL4, Chemokine (C-C motif) ligand 4; IL1B, Interleukin 1 beta; SLA-DQA, SLA class II DQ alpha; TLR2, Toll-like receptor 2; CASP1, Caspase 1; RPL19, Ribosomal protein L19, EBI IPD, European Bioinformatics Institute Immuno-Polymorphism Database; BLAST, Basic Local Alignment Search Tool; RT-PCR, Reverse transcription – polymerase chain reaction; qPCR, quantitative PCR; SLA, Swine leukocyte antigen; MHC, Major histocompatibility complex; MNCs, Blood mononuclear cells; GEO, Gene Expression Omnibus; MIAME, Minimum information about a microarray experiment; LOWESS, Locally weighted scatter plot smoothing algorithm; FDR, False Discovery Rate.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsMINS participated in the conception and design of the study, carried out the qPCR confirmation, participated in the SLA-DRB1 allele characterization and drafted the manuscript. RJJ carried out the cDNA microarray hybridizations and helped draft the manuscript. BB established the SLA-defined lines of pigs and participated in the characterization of SLA-DRB1 alleles. BAM participated in the design and coordination of the project and helped to draft the manuscript. All authors read and approved the final manuscript.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2529323.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2529323",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2529323\nAUTHORS: Martin Kostka, Magdalena Uzlikova, Ivan Cepicka, Jaroslav Flegr\n\nABSTRACT:\nBackgroundSlow-fast analysis is a simple and effective method to reduce the influence of substitution saturation, one of the causes of phylogenetic noise and long branch attraction (LBA) artifacts. In several steps of increasing stringency, the slow-fast analysis omits the fastest substituting alignment positions from the analysed dataset and thus increases its signal/noise ratio.ResultsOur program SlowFaster automates the process of assessing the substitution rate of the alignment positions and the process of producing new alignments by deleting the saturated positions. Its use is very simple. It goes through the whole process in several steps: data input – necessary choices – production of new alignments.ConclusionSlowFaster is a user-friendly tool providing new alignments prepared with slow-fast analysis. These data can be used for further phylogenetic analyses with lower risk of long branch attraction artifacts.\n\nBODY:\nBackgroundThe long branch attraction (LBA) artifact [1] still remains one of important causes of biases and mistakes in phylogenetic analyses of sequence data [2]. LBA causes taxa with long branches to be artifactually grouped with or attracted to other long branched taxa (i.e., fast evolving taxa or taxa evolving for a long time separate from other groups, e.g. outgroups). An important source of LBA is substitution saturation of positions in alignment (the term \"mutational saturation\" is also used, although it is not correct in this context). It would be ideal to have positions that underwent a single or a few changes during evolution, but many positions in real alignments are subject to multiple substitutions. This subset of rapidly evolving positions is the source of stochastic noise rather than useful signal. However, these saturated positions are responsible for a major part of information used in phylogenetic analyses [3], which could confuse most of the tree-reconstructing methods. Because there are only four possible states for nucleic acid data (20 for amino acids), it is probable that a part of saturated positions will evolve randomly – convergently into the same state. It could then be erroneously judged as a synapomorphy. LBA can thus be a major problem especially in maximum parsimony, but occurs also in other analyses [4]. Maximum likelihood can, under an appropriate model of evolution, deal better with saturated positions, but datasets containing sites with different rates of substitution across the tree (covarion-like) may still be problematic [5]. Besides LBA, a high level of saturation in the dataset may cause signal simply to be overwhelmed by noise at least at some points of the tree topology. Such nodes could be resolved incorrectly or (at least) with a low statistical support.It has been shown that in real alignments, LBA can be a major problem [2]. An effective way to estimate and reduce the effect of substitution saturation and LBA is removal of fast-evolving data. One such method is slow-fast analysis of the dataset [6]. The positions of the alignment are divided into several classes according to their substitution rate (estimated within a priori defined monophyletic groups). Several new alignments are then created, which contain only positions with a substitution rate lower than several thresholds, ranging from maximum to minimum rate. Thus the signal/noise ratio of the alignments successively increases, however, on the expense of amount of positions included in the alignment. Technically, the Slow-Fast method needs some input tree topology to work with. The topology must be provided by primary phylogenetic analysis of the dataset or by another independent method. This topology is needed for recognition of some monophyletic groups (whose relative positions on the tree is not necessary to know before slow-fast analysis). Maximum parsimony is then used to determine the number of changes for each position within the monophyletic subgroups. Substitution rates assigned to positions are thus independent from interrelationships among the monophyletic groups, and therefore, these interrelationships may in turn be investigated without the fear of circularity. When each position is assigned its number of changes, those with the highest substitution rate are gradually omitted from new alignments. The following phylogenetic analyses of these new datasets (starting from the dataset containing the positions with the highest substitution rate) then provide results based on decreasing number of sequence data, however, with decreasing risk of artefactual groupings of long branches. There are several good examples of successful use of slow-fast analysis, see e.g. [6-11].Although the slow-fast analysis is relatively powerful and very simple in principle, it is quite demanding when one wants to determine the number of changes for individual alignment positions (e.g., with the help of PAUP [12], using the \"describetree\" command) and the manual procedure of deleting of positions by editing the dataset is especially very time consuming. We believe that this is one of the most important reasons why this method is used relatively scarcely. Clearly, a computer program that provides this evaluation of positions and which produces new alignments would be handy. To our knowledge, the only software providing slow-fast analysis have been MUST [13]. MUST is a complex package, yet it still does not provide a quick and easily operated tool for this type of analysis. This is what our program SlowFaster does. It is a user-friendly tool to conduct slow-fast analysis and produce a set of new alignments without fast evolving positions. It have several additional functions. Note that another program for slow-fast analysis was presented recently [11].ImplementationSlowFaster was programmed in Borland Delphi and runs under MS Windows. Both the executable file [see Additional file 1] and the source code [see Additional file 2] are available as supplements. The program leads the user in several steps through the process of generating new datasets. Original alignment is loaded in FASTA, Phylip or NEXUS format. The program works with both nucleic acid and amino acid alignments and supports usual ambiguity coding. The topology needed for the recognition of monophyla is loaded as a tree in the Newick (\"bracketed\") format (PAUP users can use \"savetree format = phylip\" command to obtain tree in Newick format). After choosing the monophyletic groups by simply clicking on the branches of the depicted tree, parsimony is used to count the number of changes of every alignment position within the selected groups. Finally, new alignments are produced (in FASTA, Phylip or NEXUS format). Each of the new datasets has a number which is a threshold: positions with greater number of changes were omitted from this dataset. As the threshold gets lower and lower, the datasets contain fewer and fewer data because the more saturated positions were deleted from them. These datasets can be then further analysed to obtain phylogenies with a lower risk of LBA. During the whole process, there are hints shown in a window, telling the user what to do in the given step.The software was tested thoroughly on several model datasets [see Additional file 3] and also on dataset of Hampl et al. [10]. In this latter case, we obtained the same new datasets with our program (Hampl et al. obtained them with the help of PAUP and through careful manual deletion of positions).An interesting alternative to slow-fast method is using substitution rates estimated with maximum likelihood (ML). Although ML estimates are not implemented in SlowFaster, this program enables production of alignments without positions with high rates through the \"Load changes\" button. The rates can be counted in another software. E.g. Tree-Puzzle [14], if rate heterogeneity is selected, gives information on the rate category of each position in its outfile under \"Combination of categories that contributes the most to the likelihood\". These data can be simply copied in a file which is then loaded in SlowFaster. New alignments are then produced directly from these data. More generally, any sequence of any (even real) numbers can be loaded and the software will divide positions in rate categories (their number is specified by the user) based on these values.The program also creates a log file which contains useful information, most notably groups used for changes counting, list of positions with certain number of changes and number of changes for all positions from the first one to the last.Results and discussionSample DataAs an example, we analysed an alignment of 34 SSU rDNA sequences of 31 isolates of Blastocystis + 3 outgroups. Blastocystis is an unusual protist, a sister group of slopalinids (used as the outgroup) within the group of stramenopiles. See e.g. [15,16] for a review of Blastocystis. Although these nonflagellated, multinucleated gut commensals comprise a single genus, their SSU rDNA phylogeny shows clearly that they are rather long branched taxa in comparison to other stramenopiles. Their branches are even longer than, for example, branches separating classes of autotrophic stramenopiles. This group is therefore suspected of a high level of substitution saturation. We sequenced SSU rRNA genes of five Blastocystis isolated from tortoises to improve taxon sampling by increasing the number of non-mammalian and non-bird isolates in the analysis (the vast majority of Blastocystis sequences available in GenBank are from bird or mammalian isolates). The accession numbers of the five new sequences (GERA3b, GERA3a, GECA2, KINIX2 and GEPA2) are [GenBank:EF209016], [GenBank:EF209017], [GenBank:EF209018], [GenBank:EF209019] and [GenBank:EF209020], respectively.The alignment was prepared with ClustalX [17] and ambiguous parts with many indels were deleted from the alignment in the program BioEdit [18]. The resulting alignment contained 1471 positions. PAUP 4.0β10 [12] was used to analyse the dataset employing maximum likelihood (ML), maximum parsimony (MP), the Fitch-Margoliash method with LogDet distances (LD) and maximum likelihood distances (MD). Appropriate models for maximum likelihood were chosen with the help of Modeltest [19]. The robustness of each obtained topology was tested by bootstrapping (1000 replicates for all methods except for ML, for which 100 replicates were used). Phylogenetic analyses resulted in the tree shown in fig. 1. Two deep nodes of the phylogeny were resolved with low bootstrap support and/or resolved differently by different methods and were therefore depicted and treated as unresolved trichotomies.Figure 1MP tree of 31 Blastocystis isolates and 3 outgroups based on SSU rDNA sequences. MP tree of 31 Blastocystis isolates (host in brackets) and 3 outgroups, based on SSU rDNA sequences. Bootstrap support values for four tree-reconstructing methods – ML, MP, LD and MD, respectively – are shown at the nodes. The symbol \"+\" is used for bootstrap support 99 and higher (in case only one \"+\" symbol is present, all methods scored such a high support). The effect of slow-fast analysis on nodes is represented by arrow symbols in the figure. Increase of an average bootstrap support by more than 10% of one and more than one tree-reconstructing method in two datasets (BlastS3 and S2) is marked with \"↑\" and \"↑↑\", respectively. Similarly, the decrease of bootstrap support is marked with \"↓\" and \"↓↓\" at the particular nodes. Bootstraps of other nodes did not change dramatically. Except for our five new isolates (GERA3A, GERA3B, GEPA2, GECA2, KINIX2), Blastocystis isolates are labeled with accession numbers of their SSU rRNA gene sequences.Use of SlowFasterAt this time, our SlowFaster program was employed to perform the slow-fast analysis. First, the alignment used in our analyses was loaded via the \"Load alignment\" button. Then the tree topology shown in fig. 1 was loaded via the \"Load tree\" button. In typical slow-fast analyses, several monophyletic subgroups are chosen in this step. We decided to select the single subtree of all Blastocystis isolates. This arrangement was enabled by the fact that we were mostly interested in resolving the two nodes represented in the input tree by trichotomies. Assigning substitution rates to alignment positions was thus independent from the true topology of these nodes. When the Blastocystis-containing subgroup was chosen in the tree window of SlowFaster program, new datasets in NEXUS format were created by clicking the \"New alignments\" button. Also, alignments of the same length as these new datasets, but shortened by random deletion of positions, were prepared by checking the \"jackknives\" checkbox on the program screen. These were used to test whether the loss of informative positions influences decrease of bootstrap support of the resulting tree topology more than shortening the datasets itself. We did not use the \"Weights\" feature of the program. When this checkbox is checked, the algorithm will assign different weights to changes within different chosen monophyletic groups. Changes within smaller groups would have assigned greater weight (if group A is twice as taxon-rich as group B, changes within it will have half the weight of the weight of changes in group B). The impact of large monophyla is then not dominant just because they contain more taxa.The maximum number of observed changes in a position of our alignment was 9. Thus, nine new alignments were created. They were labeled BlastoS8 down to BlastoS0, where the number is the threshold. BlastoS0 alignment was of course of no use in this particular case (the analysis with just one monophyletic group) as it contained only those positions that did not change during the evolution of Blastocystis. All other alignments were analysed phylogenetically by all four methods (ML, MP, LD, MD) and topologies of the 32 resulting trees were bootstrapped.It is highly probable that in some point of the slow-fast analysis, the profit from diminishing noise is lower than the loss from diminishing information. To roughly estimate the effect of the lack of information, we used average values of bootstraps as a measure of reliability of the alignments [10]. We found that this average value drops suddenly for the alignment BlastoS1 which is therefore likely to suffer from lack of information and the resulting trees obtained from this dataset were not taken into account. To further prove this decision, \"jackknifed\" datasets of the same length but shortened by random deletion of position were also analysed. For each of eight datasets (Blasto_S1 to S8), ten of these randomly shortened datasets were analysed (80 alignments on the whole: Blasto_J1_1 to J1_10, J2_1 to J2_10, ... J8_1 to Blasto_J8_10). Within each dataset, the average value of bootstraps was determined and average of these averages for ten dataset of the same length were compared to average bootstrap value of the respective dataset resulting from slow-fast analysis. This comparison showed that the bootstrap values does not change much when analysing J8_x down-to J1_x datasets (e.g. all these average values ranged from 84.76 to 86.36 in ML analyses or from 90.15 to 91.5 in LD). On the contrary, the downfall of bootstraps was much more prominent in Blasto_S1 dataset when compared to Blasto_S2 – BlastoS8 datasets (e.g. 87.19 for original dataset, 86.90 for Blasto_S2, but 81.13 for Blasto_S1 in ML analyses, or 91.29 and 88.03 vs. 79.13, respectively, for LD).Results concerning the two unresolved trichotomies are shown in Table 1. The isolate GERA3b grouped either with the basal branch of three reptile/amphibian isolates (1a, in fig. 1) or with the rest of Blastocystis (1b). In the original alignment, the former topology was very well supported by MP and LD, the latter was weakly supported by ML and MD. As the most saturated positions were deleted from alignment, the bootstrap support for topology \"1a\" decreased slightly in MP, but increased strikingly in MD and slightly in ML analysis (BlastoS1 not taken into account). The slow-fast analysis thus supports the \"1a\" topology. The second unresolved node concerned a branch of four reptile/amphibian isolates. Either it was basal to two major branches of mostly mammal/bird isolates (2b; weakly supported by ML and MP in the original alignment), or it grouped with one of them (2a; weakly supported by LD and MD). After the slow-fast method was applied, both LD and MD favored the first possibility with reasonable bootstrap support for S3 and S2 datasets. However, MP and ML were unable to decide on the two possibilities. We conclude that the \"2b\" topology is probably correct, although the certainty is not high. For other nodes, decrease/increase of their bootstrap support from datasets S3 and S2 is marked in fig. 1.Table 1Overview of results from slow-fast analysis of Blastocystis alignmentDatasetPosit.Length1a1b2a2bMLMPLDMDMLMPLDMDMLMPLDMDMLMPLDMDUntr.147112899299545850334635S8146712509399515445303443S7146011875796995442343637S6145211216296994848353838S5143810266191975554423435S414078446387997357364536S3137167459829785-386773-S2133052268759897-306464-S1125834349929071--9076--S01097124For each dataset (the first column) ranging from untreated initial alignment (Untr.) to alignment BlastoS0, the number of alignment positions (Posit.) and the length of the most parsimonious tree (Length) are noted in the second and third columns, respectively. In the remaining columns is given the bootstrap support from the four tree reconstructing methods for four topologies of interest. In some cases (marked with a dash) the method was unable to decide between the given node and its alternative.ConclusionOverall, the slow-fast analysis, provided by the program SlowFaster, proved to be a useful tool to solve uncertain phylogenies by increasing the signal/noise ratio. In the Blastocystis SSU rDNA tree it was able to make a choice among competing hypotheses and add more confidence in some other cases. Our software automates quite time-consuming slow-fast analysis.Availability and requirementsProject name: SlowFasterProject home page: Operating system: MS WindowsProgramming language: Borland DelphiAny restrictions to use by non-academics: noneThe software can be accessed through the project home page and its current version is included with the manuscript as an additional file.Authors' contributionsMK and JF designed the program and contributed bug fixes. MK developed the source code. IC and MU collected the data used as example and analysed them together with MK. These three authors contributed to writing the manuscript. All authors read and approved the final manuscript.Supplementary MaterialAdditional file 1SlowFaster. This is the executable file of the application.Click here for fileAdditional file 2Source code. Zip archive containing Delphi source code of the program and additional Delphi files.Click here for fileAdditional file 3Sample data. Zip archive containing sample data – alignments in Phylip, FASTA and NEXUS format and tree files in Newick format.Click here for file\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2529403.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2529403",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2529403\nAUTHORS: Scott L. Page, Radhika S. Khetani, Cathleen M. Lake, Rachel J. Nielsen, Jennifer K. Jeffress, William D. Warren, Sharon E. Bickel, R. Scott Hawley\n\nABSTRACT:\nThe synaptonemal complex (SC) is an intricate structure that forms between homologous chromosomes early during the meiotic prophase, where it mediates homolog pairing interactions and promotes the formation of genetic exchanges. In Drosophila melanogaster, C(3)G protein forms the transverse filaments (TFs) of the SC. The N termini of C(3)G homodimers localize to the Central Element (CE) of the SC, while the C-termini of C(3)G connect the TFs to the chromosomes via associations with the axial elements/lateral elements (AEs/LEs) of the SC. Here, we show that the Drosophila protein Corona (CONA) co-localizes with C(3)G in a mutually dependent fashion and is required for the polymerization of C(3)G into mature thread-like structures, in the context both of paired homologous chromosomes and of C(3)G polycomplexes that lack AEs/LEs. Although AEs assemble in cona oocytes, they exhibit defects that are characteristic of c(3)G mutant oocytes, including failure of AE alignment and synapsis. These results demonstrate that CONA, which does not contain a coiled coil domain, is required for the stable ‘zippering’ of TFs to form the central region of the Drosophila SC. We speculate that CONA's role in SC formation may be similar to that of the mammalian CE proteins SYCE2 and TEX12. However, the observation that AE alignment and pairing occurs in Tex12 and Syce2 mutant meiocytes but not in cona oocytes suggests that the SC plays a more critical role in the stable association of homologs in Drosophila than it does in mammalian cells.\n\nBODY:\nIntroductionDuring meiosis, the diploid genome is segregated to form haploid nuclei through processes that include the close juxtaposition of homologous chromosomes and recombination between them. In most organisms, a proteinaceous structure called the synaptonemal complex (SC) forms between homologous chromosomes during meiotic prophase. The SC is required for synapsis, the intimate association of homologs along their entire length. The SC and its components are thought to play roles in regulating recombination and generally promoting the establishment of crossovers between the chromosomes [1],[2].Examination of SCs by electron microscopy (EM) has defined distinct structures present in the SCs of most organisms. During early prophase, axial elements (AEs) form along the longitudinal axis of each pair of sister chromatids using a cohesin-based chromosome core as a scaffold for assembly [3]. As prophase progresses, the AEs of homologous chromosomes become physically connected by perpendicular transverse filaments (TFs) that span the SC central region (CR), which occupies the ∼100 nm space between the two homologous AEs [1],[2]. AEs within the mature SC are referred to as lateral elements (LEs). Finally, a central element (CE) is often observed as a structure overlapping the middle of the TFs and positioned parallel to the two LEs.Although homologous chromosomes undergo presynaptic pairing and alignment in some organisms [4],[5], synapsis requires a fully formed CR that extends the length of the chromosomes. In this paper we will use the term “alignment” to describe the parallel association of homologs (or AEs) at a distance equal to or greater than the width of the SC and the term “pairing” to describe the close association of homologous sequences as determined by FISH.Components of TFs, such as ZIP1 (budding yeast), SYCP1 (mouse), SYP-1 (worms), and C(3)G (Drosophila), have been identified as proteins containing long coiled coil segments [6]–[11]. Although these TF proteins are similar in predicted secondary structure, they share very little similarity in amino acid sequence. Despite this lack of sequence conservation, the proteins are all thought to form TFs across the CR of the SC by binding of their C-termini to the AEs with head-to-head orientation of their N-termini at the center of the CE [12]–[16]. TFs are important for ensuring synapsis of homologs and normal levels of interhomolog exchange [6], [8], [10], [17]–[20].In Drosophila melanogaster oocytes, the TFs are formed by the C(3)G protein [8],[12]. Like other TF proteins, C(3)G is comprised of a central coiled coil-rich domain flanked by N- and C-terminal globular domains. As shown by Jeffress et al.\n[21], C-terminal deletion of C(3)G results in its failure to attach to the AEs of each set of homologs. Instead, this C-terminal deletion protein forms a large cylindrical polycomplex structure. EM analysis of this structure reveals a polycomplex of concentric rings with alternating dark and light bands, presumably corresponding to long arrays of polymerized TFs. However, deletions of N-terminal regions completely abolished both SC and polycomplex formation. To explain these data, Jeffress et al.\n[21] proposed that in Drosophila, the N- terminal globular domain of C(3)G is critical for the formation of anti-parallel pairs of C(3)G homodimers, and thus for assembly of complete TFs, while the C-terminus is required to affix these homodimers to the AEs.The question then arises as to how C(3)G molecules can be polymerized to form a linear array of TFs. The idea that such polymerization events are facilitated by the apposition of paired AEs seems unlikely given the finding that C-terminal deletions of C(3)G form polycomplexes [21]. The observation that the rat homolog of C(3)G (SYCP1) can form polycomplex-like structures in COS-7 cells [22] suggests that the process of TF polymerization may be self-promoting and sustaining, and thus requires no other components. However, in mice, significant extension of SYCP1 to form a full-length CR in meiotic cells requires the functions of the SYCE1, SYCE2, and TEX12 proteins, which localize to the CE of the SC [23]–[26]. SYCE1 and SYCE2 physically associate with each other and the N-terminus of the TF protein SYCP1, while TEX12 binds to SYCE2 [24],[25]. Mice lacking the SYCE2 protein display defects in the formation of the TFs (SYCP1 accumulation), and thus in SC formation [23]. They appear to form only short and, at least in the case of Tex12−/− mice, morphologically abnormal SCs [23],[26]. It remains to be determined whether or not functional homologs of SYCE2 and TEX12 might facilitate C(3)G polymerization, and thus CE formation in Drosophila oocytes.To discover additional components of the SC and genes involved in other critical processes in meiosis, we previously undertook a novel genetic screen for female meiotic mutants in Drosophila [27]. One of the genes identified in the screen, corona (cona), was found to have both a severe defect in meiotic recombination and a profound effect on the localization of C(3)G. Previous analyses of cona mutants demonstrated a failure of the SC protein C(3)G to localize correctly in the absence of CONA, demonstrating defective SC formation. As is the case for c(3)G mutants, the frequency of meiotic exchange in cona females was reduced 50- to 200-fold compared to wild-type [27] without a similar reduction in the number of DSBs [SLP and RSH, unpublished data]. Moreover, double mutants for c(3)G and cona displayed a defect in recombination that was comparable to either single mutant [SLP and RSH, unpublished data], and thus the two proteins likely function in a common pathway with respect to facilitating meiotic exchange. Like C(3)G, CONA protein is only conserved within the genus Drosophila, but CONA contains no predicted coiled coil domains or other characterized functional motifs [27].In this study, we show that CONA is a new SC protein that co-localizes with C(3)G in a mutually-dependent fashion. We found that CONA accumulation is required for C(3)G localization into wild-type SC structures and formation of polycomplexes, but is not necessary for the formation of either the AEs or the chromosome cores from which they arise. Our results indicate that CONA is crucial for the assembly of the CR of the SC in Drosophila and may have a function similar to that of the vertebrate CE proteins TEX12 and SYCE2. However, the observation that pairing and alignment of AEs occurs in Tex12 and Syce2 mutant meiocytes, but not in cona oocytes, suggests that the SC plays a more critical role in the stable association of homologs in Drosophila than it does in mammalian cells.ResultsCorona Protein Co-Localizes with the Synaptonemal ComplexWe previously showed that the cona gene corresponds to the transcription unit CG7676 on the basis of the presence of a Doc transposon in the 3′ untranslated region of CG7676 in conaA12 that was not present on the un-mutagenized parental chromosome and the isolation of a second allele, conaf04903, which bears a PiggyBac insertion in sequence flanking the 5′ end of CG7676\n[27]. Both conaA12 and conaf04903 drastically reduce the levels of meiotic recombination and produce high levels of nondisjunction (∼32–39%) [27, SLP and RSH, unpublished data].We raised an antibody against the CONA protein and used it to determine the localization of CONA in meiotic prophase cells in the germaria of Drosophila ovaries (see Materials and Methods). Evidence that this antibody is specific to CONA (i.e., that no signal is observed in pro-oocytes homozygous for conaf04903) is presented in Figure S1. In wild-type ovaries, anti-CONA localization was observed within a subset of nuclei in regions 2A and 2B of the germarium and within the oocyte nucleus in region 3 and early egg chambers within the vitellarium. The distribution of CONA within nuclei was distinctly thread-like and strongly co-localized with the SC protein C(3)G (Figure 1A). These results demonstrate that CONA localizes along the SC.10.1371/journal.pgen.1000194.g001Figure 1CONA protein co-localizes with C(3)G.(A) Wild-type pro-oocytes stained with anti-CONA and anti-C(3)G, showing CONA (green) and C(3)G (red) co-localization. (B) Images of a single deconvolved optical section of a pair of pro-oocytes showing that CONA::Venus (green) and C(3)G (red) co-localize extensively. (C) Maximum intensity projections of the entire nuclei from B. Scale bars, 5 µm.As an alternate strategy to localize the protein, we constructed a transgene, P{UASP-cona::Venus}, which expresses the full-length CONA protein fused to the yellow fluorescent protein Venus under the control of the GAL4/UAS system [28]. The CONA::Venus fusion protein was functional, as expression driven by nanos-GAL4::VP16 in the female germline rescued the nondisjunction phenotype in conaf04903 homozygotes. Control conaf04903 homozygotes lacking the P{UASP-cona::Venus} transgene showed 31.9% X chromosome nondisjunction, whereas conaf04903 homozygotes expressing CONA::Venus showed a nearly tenfold reduction in nondisjunction to just 3.4% (data not shown).We examined the pattern of nanos-GAL4::VP16-driven CONA::Venus localization during meiotic prophase. In a conaf04903 mutant background, strong Venus yellow fluorescent protein signal localized in a pattern very similar to that observed for CONA immunolocalization. Immunolocalization of C(3)G in these ovaries revealed extensive co-localization of CONA::Venus and C(3)G in thread-like patterns within nuclei (Figure 1B–C). Nuclear CONA::Venus fluorescence was strongest in a cona mutant background in which little or no wild-type CONA protein is present (Figure S1). When expressed in heterozygotes or homozygotes for a wild-type copy of the cona locus, CONA::Venus fluorescence was weaker in nuclei and increased diffuse fluorescence was often observed in the cytoplasm of germline cells in regions 1 and 2 of the germarium (data not shown). This may be the result of competition with wild-type CONA protein. A similar reduction in signal has been observed for localization of GFP-tagged ORD protein along the SC in the presence of wild-type ORD (RSK and SEB, unpublished data). These data confirm the immunolocalization of CONA and implicate CONA as a component of the SC.CONA Is Required for the Assembly of C(3)G into a Thread-Like SCWhen CONA::Venus was expressed under the control of a nanos-GAL4::VP16 driver in a conaf04903 heterozygote in which wild-type CONA protein was also present, C(3)G was detected as puncta and short threads within early prophase nuclei before CONA::Venus signal was detectable (Figure 2A–B). The spotty to thread-like pattern of C(3)G accumulation observed in Figure 2B is also observed in early region 2A in conaf04903/+ heterozygotes that lack the CONA::Venus transgene, and represents an early stage (zygotene) in SC assembly in which the short threads of C(3)G are associated with endogenous CONA (Figure S1C). As the intensity of CONA::Venus staining increased during the progression of meiotic prophase, CONA::Venus assumed a thread-like staining pattern that co-localized with C(3)G (Figure 2E–F, 2I–J).10.1371/journal.pgen.1000194.g002Figure 2CONA is required for the thread-like localization of C(3)G.Shown is the localization of CONA::Venus (green), C(3)G (red), and DAPI (blue) in region 2A of germaria from P{nos-GAL4::VP16}/+; P{UASP-cona::Venus}/+ ; conaf04903/+ (A, B, E, F, I, J, left) and P{nos-GAL4::VP16}/+ ; P{UASP-cona::Venus}/+ ; conaf04903 (C, D, G, H, K, L, right). The top, middle and bottom rows show pro-oocytes in which C(3)G was present but CONA::Venus was visible at very low to undetectable (A, B, C, D), moderate (mod.) (E, F, G, H), or high (I, J, K, L) levels. When one functional copy of the endogenous cona+ gene is present, the localization of C(3)G takes on a punctate to thread-like pattern (arrowheads) in very early cysts, even when CONA::Venus is not readily detected (A, B). The spotty to thread-like pattern of C(3)G accumulation observed in panel B is also observed in early region 2A in conaf04903/+ heterozygotes that lack the CONA::Venus construct, and represents an early stage (zygotene) in SC assembly (Figure S1C). When CONA::Venus is expressed in a cona homozygous mutant background and is the only functional CONA protein present, the initial localization of C(3)G resembles that of a cona mutant homozygote (C, D), with diffuse and spotty regions of C(3)G localization (arrowheads). C(3)G takes on a thread-like appearance only when CONA::Venus begins to be detected (G, H, K, L), showing that the assembly of C(3)G into a thread-like SC coincides with and requires the accumulation of CONA::Venus protein. Scale bars, 5 µm.A different pattern of C(3)G localization was observed when CONA::Venus was expressed in the conaf04903 homozygote, and therefore was the only form of functional CONA protein present. In nuclei that contained very low or undetectable levels of CONA::Venus signal (Figure 2C–D), C(3)G staining exhibited a more diffuse appearance similar to that previously described for cona mutant pro-oocytes [27]. However, as CONA::Venus staining became more visible at slightly later stages, CONA::Venus and C(3)G co-localized in short thread-like segments and the diffuse C(3)G signal was no longer observed (Figure 2G-H). Eventually, CONA::Venus and C(3)G co-localization resembled that observed in the conaf04903 heterozygote in pachytene nuclei with fully assembled SC (Figure 2K–L). These data further demonstrate that the assembly of C(3)G into a thread-like SC requires the accumulation of CONA and involves co-localization with the CONA protein.Corona Localization Mimics that of C(3)G when AE Components Are MutatedThe AEs are believed to form from chromosome core structures that contain sister chromatid cohesion proteins [3]. In mammals, AE-specific proteins such as SYCP2 and SYCP3 associate with components of the cohesin complex during the initial steps of SC assembly [13], [29]–[37]. Similarly, cohesin-based chromosomal cores/AEs form in Drosophila pro-oocytes [38]. Formation of the chromosomal core in Drosophila is dependent on the product of the c(2)M gene, which also localizes along this structure [12],[38],[39]. ORD protein also localizes along chromosome cores and is required for the maintenance of chromosome core integrity during meiotic prophase [38],[40]. Mutants in AE/LE proteins often result in recombination defects and the failure of synapsis, which indicates that properly formed AEs/LEs are required for the normal formation of the SC central region [31], [39], [41]–[44].To better understand the association of CONA with the SC, we examined the localization of the CONA protein in mutants that disrupt different components of the AE. Mutations in the c(2)M gene result in incomplete SC formation, as indicated by only very short segments of nuclear C(3)G localization, in contrast to the long, thread-like localization observed in wild-type [39]. In contrast, in ord mutants, the thread-like C(3)G staining appears to disassemble earlier than in wild-type due to the dissolution of cohesin-based chromosome cores along the chromosome arms [38],[40].Analysis of CONA localization in c(2)MEP2115 homozygous pro-oocytes demonstrated that CONA was localized in numerous short segments that corresponded to sites of C(3)G localization (Figure 3A). CONA was consistently co-localized with C(3)G and was not seen to localize elsewhere in the germarium except to the dot-like short segments of C(3)G. The observed localization of CONA in c(2)MEP2115 homozygotes could indicate a robust association with C(3)G and/or an inability to localize to abnormally formed AEs except at sites stabilized by C(3)G accumulation. Nonetheless, the dependency on AEs for localization is similar for both CONA and C(3)G.10.1371/journal.pgen.1000194.g003Figure 3CONA co-localizes with C(3)G in disrupted SCs and requires C(3)G for localization.(A) Wild-type control pro-oocytes stained with anti-CONA and anti-C(3)G, showing CONA and C(3)G co-localization. (B) c(2)MEP2115 homozygous pro-oocyte stained to detect CONA and C(3)G co-localization. (C) ord5/ord10 pro-oocytes from germarium region 2A showing CONA and C(3)G co-localization. (D) ord5/ord10 pro-oocytes from germarium region 2B (anterior tip of germarium oriented toward the top) stained to detect CONA and C(3)G co-localization in pro-oocytes experiencing early SC disassembly (arrowhead). (E) c(3)G68 homozygote germarium showing the absence of CONA signal in pro-oocytes (arrowheads) marked by high levels of cytoplasmic ORB protein. Scale bars, 5 µm.CONA localization was also analyzed in ord5/ord10 trans-heterozygotes, in which no ord activity is present [40]. In agreement with published data [40], we found that C(3)G formed extensive thread-like patterns of localization in pro-oocyte nuclei in region 2A (Figure 3B), but appeared as shorter segments in older germline cysts beginning in late region 2B (Figure 3C). Oocyte nuclei in region 3 displayed C(3)G signals that were further shortened or dot-like, indicating early SC disassembly. At all stages, CONA was always observed to co-localize with C(3)G within the germarium. The initial co-localization of CONA with C(3)G in region 2A was thread-like, similar to wild-type, but older germline cysts did not reveal differences in the extent of localization of the two proteins, suggesting that removal of CONA occurred contemporaneously with C(3)G removal. These results indicate that CONA and C(3)G behave similarly in both c(2)M and ord mutant backgrounds and suggest that CONA and C(3)G may comprise parts of the same SC sub-structure.CONA Requires C(3)G for Localization to the SCThe consistent co-localization of CONA and C(3)G in wild-type and mutant backgrounds and the requirement of CONA for proper C(3)G localization prompted the question of whether C(3)G is required for CONA localization. If CONA is a protein of the AE/LE that is required for C(3)G attachment, it would be expected to localize to chromosomes regardless of whether C(3)G is present or not. When CONA localization was examined in females homozygous for the null mutation c(3)G68, we found no evidence of CONA antibody staining in pro-oocyte nuclei (Figure 3D). This result is unlike that observed for the AE/LE component C(2)M [21],[39] and suggests that CONA does not act as an AE/LE component that localizes independently of C(3)G. Instead, these data are consistent with a role for CONA within the CR of the SC, which would not be expected to form in the absence of C(3)G.SMC1, ORD, and C(2)M Localize to Chromosome Cores in cona Mutant Pro-OocytesTo further investigate the role of CONA in SC formation, we investigated whether the SC protein C(2)M and the cohesion proteins ORD and SMC1 are able to localize normally in the absence of wild-type cona. All three proteins associate with the AEs/LEs of the SC in wild-type [12],[40]. In these experiments, we considered two aspects of ORD, SMC1, and C(2)M localization: first, whether the proteins localized to chromosomes and second, whether the localization appeared equivalent to that observed in wild-type in which normal SC is present. We utilized chromosome spread preparations in which soluble nuclear proteins are removed and only chromosome-associated proteins remain [38]. As shown in Figure 4A, SMC1 and ORD are able to stably associate with the meiotic chromosomes in cona mutant pro-oocytes. Both cohesion proteins accumulate normally at the centromeres as evidenced by the bright foci present in both wild-type and cona mutant nuclei. Although distinct thread-like staining along the chromosome cores is also visible, the threads of staining appear to be thinner and more numerous than those in wild-type. A similar pattern was also observed for C(2)M localization (Figure 4B). These data suggest that ORD, SMC1, and C(2)M localize to chromosomes and form chromosome cores/AEs in the absence of CONA. However, their localization does not appear equivalent to wild-type, most likely because the AEs do not align and pair. A similar localization pattern for AE/LE proteins has been reported for c(3)G mutant oocytes [38],[39].10.1371/journal.pgen.1000194.g004Figure 4Cohesion and AE proteins localize to chromosomes and form chromosome cores during early prophase in the absence of CONA activity.(A) Localization of SMC1, GFP-ORD, C(3)G and DNA (DAPI) on chromosome spread preparations from wild-type and conaA12/conaf04903 mutant ovaries. As in wild-type, SMC1 and GFP-ORD are enriched at centromeres (bright regions, arrows) and localize along the chromosome cores in the cona mutant. However, the threads of SMC1 and GFP-ORD localization appear thinner and more numerous than in wild-type, giving them a somewhat disorganized appearance. C(3)G is associated with the chromatin but does not form long thread-like stretches. Although the coincidence of the three proteins is less obvious than in wild-type, short stretches of C(3)G co-localization with the chromosome cores are visible (arrowheads). (B) Localization of SMC1, C(2)M, C(3)G and DNA (DAPI) on chromosome spread preparations of conaA12 ovaries. Like SMC1 and GFP-ORD, C(2)M localizes along the chromosome cores/AEs and co-localization of C(2)M with SMC1 and C(3)G is visible (arrows). The C(3)G signal in cona mutants is weaker than in wild-type and has been significantly enhanced to ensure that the details of the staining pattern are visible. The disorganized appearance of cores in both A and B is consistent with absence of AE alignment and synapsis and is similar to that observed for SMC1 and C(2)M localization in c(3)G mutant oocytes [38],[39]. All panels are single optical sections. Scale bars, 2 µm.We also examined C(3)G localization to determine whether C(3)G protein can associate with chromatin in the absence of CONA. Although the C(3)G signal on cona spreads is diminished compared to wild-type, and long continuous thread-like staining is absent, puncta and short fragments of chromosome-associated C(3)G are visible. In many cases, these short stretches coincide with C(2)M, SMC1, and ORD (Figure 4A–B). Together, these results argue that CONA is not required for the localization of ORD, SMC1, or C(2)M to chromosomes or for the formation of the AEs. However, our data suggest that in the absence of CONA activity, association of C(3)G with AEs is insufficient for assembly of a normal SC central region and the pairing/alignment of AEs.Corona Localizes to C(3)GCdel Polycomplexes and Is Required for Their FormationThe co-localization with C(3)G, the profound effect on C(3)G localization, and the minor effect on AE protein localization led us to postulate that CONA localizes within the CR of the SC rather than along AEs. Based on this hypothesis, we predicted that CONA would co-localize with C(3)G protein that is prevented from binding to AEs. C(3)G is thought to interact with AEs via its C-terminal globular domain, which is normally oriented toward the AEs [12]. Jeffress and colleagues [21] found that a deletion of amino acids 651–744 at the C-terminal end of C(3)G (known as C(3)GCdel) abolished the ability for C(3)G to form normal SC along chromosomes, but instead the protein accumulated into aggregates called polycomplexes (PCs). The PCs formed by the C(3)GCdel protein often take on a hollow cylindrical shape, and may form in either the presence or absence of wild-type C(3)G protein.We analyzed CONA localization in C(3)GCdel PCs by immunofluorescence in females expressing the C(3)GCdel protein in the absence of wild-type C(3)G. As expected, the C(3)GCdel protein was detected in sub-cellular bodies of varying size, which correspond to the PCs, and not in a thread-like pattern along chromosomes. Similarly, strong CONA immunofluorescence was detected on the PCs, but not along chromosomes (Figure 5A). This demonstrates that amino acids 651–744 at the C-terminus of C(3)G are dispensable for CONA co-localization and that CONA does not localize along AEs or chromosome cores in the absence of wild-type C(3)G.10.1371/journal.pgen.1000194.g005Figure 5CONA localizes to C(3)GCdel polycomplexes (PCs) and is required for their formation.(A) A y w/y w P{nos-GAL4::VP16}; P{UASP-c(3)GCdel}4/+; c(3)G68 pro-oocyte stained to detect CONA (green) and the coiled coil region of C(3)G (red) shows that CONA localization is restricted to the C(3)GCdel PC (arrowhead). (B) Maximum intensity projections of a wild-type pro-oocyte stained to detect SMC1 (green) and the coiled coil region of C(3)G (red), showing a wild-type pattern of SC. (C) Maximum intensity projections of a y w/y w P{nos-GAL4::VP16}; P{UASP-c(3)GCdel}4/+; c(3)G68 pro-oocyte stained to detect SMC1 (green) and the coiled coil region of C(3)G (red). Large arrowheads indicate the major C(3)GCdel PC visible in the nucleus. (D) Maximum intensity projections of a y w/y w P{nos-GAL4::VP16}; P{UASP-c(3)GCdel}4/+; c(3)G68 conaf04903 pro-oocyte stained to detect SMC1 (green) and the coiled coil region of C(3)G (red), demonstrating the lack of PC formation in the absence of CONA. (E) SMC1 localization (white) in a single optical section of the pro-oocyte shown in panel B. (F) SMC1 localization (white) in a single optical section of the pro-oocyte shown in panel C. (G) SMC1 localization (white) in a single optical section of the pro-oocyte shown in panel D. Small arrowheads in E–G indicate thread-like SMC1 localization. Scale bars, 5 µm.Since CONA is necessary for the assembly of wild-type C(3)G into normal SC, and CONA co-localizes with both C(3)G in wild-type and with C(3)GCdel in PCs, we tested whether CONA is required for the formation of the PCs. Using antibodies specific to the coiled coil region of C(3)G to detect both wild-type C(3)G and C(3)GCdel (Figure 5B and Figure S2A), we examined germaria from females expressing C(3)GCdel in a c(3)G68 conaf04903 double mutant background. Expression of the C(3)GCdel protein results in PC formation in a c(3)G68 single mutant background (Figure 5C and Figure S2B). However, when CONA was absent in the c(3)G68 conaf04903 double mutant, no anti-C(3)G immunofluorescence was visible above background levels, even though pro-oocyte nuclei could be detected by anti-SMC1 staining (Figure 5D and Figure S2D). The diffuse C(3)G staining observed in cona mutants was also not visible in this experiment, possibly due to differences in expression or stability of wild-type C(3)G compared to the C(3)GCdel protein. As a positive control to ensure that the transgenes encoding GAL4::VP16 and C(3)GCdel were both present and functioning in the experiment, and that the anti-C(3)G staining was successful, ovaries from sibling c(3)G68 conaf04903 heterozygote females were stained and analyzed at the same time. This control, in which both c(3)G and cona were heterozygous over wild-type alleles, revealed PC formation indicative of C(3)GCdel expression, as well as thread-like C(3)G staining expected for a c(3)G cona double heterozygote (Figure S2C and S2E).The failure to detect PC formation in cona homozygotes demonstrates that CONA is required for C(3)GCdel PC formation, similar to the requirement of CONA for SC formation. This observation and the localization of CONA to C(3)GCdel PCs support the hypothesis that CONA is involved in CR formation in SCs. In these experiments we observed the disorganization of chromosomal cores/AEs along chromosome arms when the CR is abrogated by mutations in c(3)G and/or cona. Chromosomal cores/AEs detected using anti-SMC1 antibodies in wild-type appeared long and thread-like, closely matching C(3)G localization (Figure 5E). In the absence of wild-type C(3)G or CONA, however, SMC1 was detected in less intensely stained linear segments that were more numerous (Figure 5F–G). As noted above, this suggests that assembly of chromosome cores/AEs occurs along the sister chromatids but disruption of the CR of the SC results in disorganization of these structures compared to wild-type.Corona Is Necessary for Meiotic Chromosome PairingThe SC is known to play a role in homologous chromosome pairing in Drosophila oocytes [19],[20], and defects in this process could contribute to the disorganization of AEs and the reduction in exchange in cona mutants. To determine whether cona is required for homologous chromosome pairing, we examined the association of homologous euchromatic DNA sequences in pro-oocytes and oocytes from germarium regions 2A, 2B and 3 using fluorescence in situ hybridization (FISH). Using a FISH probe that hybridizes near the middle of the X chromosome euchromatin, we found paired homologs in 97.7% (85/87) of the wild-type cells examined (Figure 6A). In contrast, paired homologs were detected in only 46.0% (40/87) of conaf04903 homozygous pro-oocytes and oocytes (Figure 6B). This demonstrates a dramatic decrease in the ability of homologous chromosomes to associate in the absence of CONA.10.1371/journal.pgen.1000194.g006Figure 6Homologous chromosome pairing is disrupted in cona mutants.Shown are pro-oocytes from wild-type (A), conaf04903 (B), c(3)G68 (C), and c(3)G68 conaf04903 (D) germaria identified by ORB localization (red) and hybridized with a FISH probe (green) specific for polytene bands 9F4-10B1 of the X chromosome. DAPI-stained DNA is shown in blue. In contrast to wild-type (A), in which the FISH signals usually appeared as a single focus or closely spaced foci, FISH signals in conaf04903 were often observed as widely separated foci (B), indicating a disruption in homologous chromosome pairing. Scale bars, 1 µm. (E) Quantified results of the FISH analysis on pro-oocytes and oocytes from germarium regions 2A, 2B, and 3 are shown as percent of nuclei with paired chromosomes (blue bars) and unpaired chromosomes (dark grey bars) in each genotype shown. The number of nuclei observed in each category is shown above each bar. (Nuclei containing a single hybridization focus or foci separated by 0.7 µm or less were defined as paired [33], while those with foci separated by more than 0.7 µm were defined as unpaired.)Testing for homolog pairing in females homozygous for c(3)G68 demonstrated that homologs were paired in only 36.5% (19/52) of cells examined (Figure 6C), which is consistent with previously published results that show a role for C(3)G, and thus the SC, in homolog pairing [19],[20]. In c(3)G68 conaf04903 double mutant females, homologs were paired in 29.8% (14/47) of the pro-oocytes and oocytes examined (Figure 6D), a figure not significantly different than that for c(3)G68 alone (χ2 = 0.506; p = 0.477). Since CONA is required for normal C(3)G localization, the pairing defect in the cona mutant may be a result of abnormal C(3)G localization. We noticed that there was a slight, but not significant (χ2 = 3.324; p = 0.068), elevation in pairing frequency in conaf04903 homozygotes compared to c(3)G68 conaf04903 double homozygotes, which could possibly be explained by a low level of homolog pairing promoted by the small amount of C(3)G that localizes to chromosomes in the conaf04903 single mutant (Figure 4). These data demonstrate that both c(3)G and cona are necessary for normal levels of homolog pairing, and are consistent with CONA functioning within the CR of the SC to promote synapsis.DiscussionCorona Is Critical for Polymerization of C(3)G to Form the Central Region of the SCWe have characterized Corona (CONA), a novel SC-associated protein that is critical for the higher-order assembly of TFs into the CR of the SC. The normal localization of CONA and C(3)G is mutually-dependent – in the absence of CONA, C(3)G is visible as only spots or short threads along meiotic chromosome cores, and in the absence of C(3)G, CONA appears to be absent from the meiotic nucleus. Three lines of evidence suggest that CONA plays a critical role in the stable assembly of C(3)G into the CR of the SC. First, cona mutant oocytes fail to form long stretches of continuous SC, and only short threads or spots of C(3)G are visible within the pro-oocyte nucleus (Figure 4 and Figure S1). Second, the dependence of SC assembly (as assayed by C(3)G polymerization) on CONA::Venus expression in the absence of endogenous CONA, as well as the co-localization of CONA and C(3)G in c(2)M and ord mutants (Figure 2 and Figure 3) suggest that CONA is required to polymerize C(3)G into long stretches required to form the CR. Third, the requirement for CONA to facilitate C(3)G polymerization is also demonstrated by the fact that CONA localizes to the C(3)G PCs created by expressing C(3)G proteins that lack their C-termini and thus cannot bind chromosomes (Figure 5). Moreover, CONA also is required for the formation of these PCs, demonstrating that CONA has a functional role necessary for the connection of C(3)GCdel molecules in PCs.The phenotypes of cona mutants make it clear that the CONA-mediated assembly of C(3)G into polymerized TFs is required for most, if not all, aspects of C(3)G function. Despite being present in cona mutants, C(3)G protein is unable to promote homolog synapsis or exchange. Defects in meiotic pairing, synapsis, and recombination are similar in cona, c(3)G and c(3)G cona mutant pro-oocytes (Figure 6, SLP and RSH, unpublished data).How Might CONA Function?In terms of its role in the formation of the CR of the SC, CONA may have a role similar to the mouse CE proteins SYCE1, SYCE2, and TEX12 [23]–[26]. These proteins co-localize extensively with the TF protein SYCP1, though SYCE2 and TEX12 were reported to have a more punctate appearance. Moreover, SYCE1 and SYCE2 also remain co-localized with SYCP1 when AEs/LEs are disrupted in Sycp3\n−/− spermatocytes and oocytes, and are unable to localize to meiotic chromosomes in the absence of SYCP1 [24],[25]. Mutation of SYCE2 or TEX12 disrupts synapsis and greatly reduces the amount of SYCP1 that localizes to chromosomes, yet AE proteins localize normally. In Syce2−/− and Tex12−/− meiotic cells, synapsis appears to be initiated at multiple sites along the paired homologs, but they fail to extend and form full-length SC [23],[26]. These findings are quite similar to the cona mutant phenotype, in which only a small amount of C(3)G is found on chromosomes, while the C(2)M, SMC1, and ORD proteins are still localized properly.SYCE1 has been proposed to stabilize head-to-head interactions between SYCP1 dimers, while SYCE2 and TEX12 have been proposed to connect SYCP1-SYCE1 complexes to form higher-order structures [23],[26]. Either of these roles of CE proteins is consistent with the activities of CONA, in that the N-terminus of C(3)G is localized to the CE and required for normal SC formation [12],[21] and the formation of higher order SC or PC structures fails in the absence of CONA. Moreover, the phenotype exhibited by cona mutants parallels that documented for N-terminal deletions of C(3)G [21]; only spots or short stretches of chromosomally-associated C(3)G are visible. These data suggest that either one large or multiple small domains deleted in these N-terminus-deficient C(3)G proteins may define regions of C(3)G that interact with CONA.\ncona and c(3)G Mutations Both Abolish Alignment of the AEsLocalization of C(2)M, SMC1, and ORD in cona mutant pro-oocytes indicates that chromosome core/AE structures are present, although they are more numerous and appear thinner than in wild-type. This disorganized pattern resembles that observed for C(2)M and cohesin SMC proteins when C(3)G is absent [38],[39] and argues that AEs cannot align in the absence of synapsis in Drosophila oocytes. In addition, FISH analysis demonstrates that pairing of homologous sequences is severely disrupted in cona (this study) and c(3)G oocytes [19],[20].Disruption of homolog pairing and alignment in cona and c(3)G mutants contrasts sharply with what is observed in mammalian meiocytes lacking the TF protein SYCP1 or CE proteins SYCE2 or TEX12. Although homologous chromosomes fail to synapse in Sycp1−/−, Syce2−/−, and Tex12−/− meiotic cells, AEs lie in close proximity along their entire length [18],[23],[26]. Presumably, the formation of DSBs at multiple sites along the chromosomes establishes axial associations and these are sufficient to hold homologous chromosomes in close proximity even when the SC fails to propagate [18],[23],[26]. Axial associations likely form the basis for the assembly of the short regions of SC observed in Syce2−/− and Tex12−/− meiotic cells, which could further secure the alignment of homologs. While we cannot rule out the possibility that similar short regions of “synapsis” exist in cona oocytes, it seems likely that even a small number of these along the length of the chromosome would result in at least some examples in which AEs lie as “parallel tracks” in chromosome spreads, a phenomenon that we did not observe.Our analysis of cona mutant oocytes suggests that, unlike mammals, the SC is critical for early events governing the pairing/alignment of homologous chromosomes in Drosophila. We can envision at least three different models that might explain why homolog alignment is dependent on SC in Drosophila. In the first model, homologous chromosomes enter meiotic prophase already paired and aligned as a result of the persistence of pairing established during preceding cell cycles and the rapid formation of SC is required to maintain these associations [4]. Although this model has been favored in the past, two published reports refute the argument that homologous chromosomes enter meiosis already paired and aligned. As noted by Fung and colleagues [45] as well as Csink and Henikoff [46], the pairing of homologous chromosomes in Drosophila somatic cells is disrupted during both replication and mitosis. Therefore, any pairing that exists prior to meiotic S phase would be lost and need to be re-established, most likely during meiotic prophase.The second model posits that the different effects on homolog pairing and alignment observed in flies and mammals reflect differences in the ability of CE proteins to stabilize short stretches of SC. In contrast to flies, DSBs are required for synapsis in mice [47]–[49]. The short stretches of SC resulting from the formation of DSBs and early recombination intermediates in mouse meiocytes lacking SYCE2 or TEX12 may maintain the alignment of AEs in the absence of full synapsis. If the requirement for CE function is sufficiently more stringent in flies than in mammals, then short regions of synapsis similar to those observed in Tex12−/− and Syce2−/− meiocytes may be unstable or never form in cona mutant flies. In the absence of such stretches of SC or DSB-induced axial associations, the Drosophila homologs would be expected to quickly dissociate.Our third model is based on the different temporal relationship between DSB formation and SC assembly in flies and mammals. In mammals, DSB formation and the formation of early recombination intermediates occur commensurate with, and are required for SC formation [47],[48]. In contrast, DSB initiation occurs after the completion of SC assembly in Drosophila and is not required for synapsis [49]–[51]. Because SC assembly in flies occurs via a DSB-independent pathway, pairing/alignment of AEs may be abolished in mutant oocytes in which higher-order assembly of TFs is prevented. According to this model, initial pre-synaptic associations of homologs may be maintained either by the formation of early recombination intermediates and axial associations that lead to the initiation of short stretches of SC (the mammalian paradigm), or by the establishment of extensive synapsis (the Drosophila paradigm). In both cases, the initial event (formation of recombination intermediates or SC formation) is eventually followed and perhaps ‘locked-in’ by the other. One could hypothesize that mammalian CE mutants can maintain alignments because of the earlier formation of recombination intermediates and axial associations. In contrast, lack of SC assembly in cona and c(3)G mutants would compromise the essential early step that maintains the alignment of homologous chromosomes in Drosophila oocytes. If the homologs are already apart by the time DSBs occur in cona and c(3)G mutants, DSBs would be too late to stabilize homolog associations and maintain AE alignment.In summary, our data demonstrate an essential requirement for CONA in the polymerization of C(3)G that is required for SC formation. Understanding the mechanism by which CONA performs that role will require the identification of CONA-interacting proteins, which we expect will include the N-terminal globular domain of C(3)G and perhaps other CE proteins as well. Elucidating the function of these proteins in SC assembly and the consequences of their loss by mutation may also help us understand the role of the SC in establishing or maintaining the pairing and alignment of homologs in early prophase.Materials and MethodsDrosophila Stocks and Genetic AnalysesDrosophila stocks and crosses were maintained on a standard medium at 25°C. Descriptions of genetic markers and chromosomes can be found at http://www.flybase.org/\n[52]. A w1118 stock was used as a wild-type stock for the immunofluorescence and FISH experiments, except for the experiment shown in Figure 1A, in which a Canton-S strain was used. Df(3R)JDP was constructed by FLP-mediated recombination essentially as described by Parks et al.\n[53] using FRT sequences in PBac{WH}conaf04903 and P{XP}d01968, inserted at coordinates 14,211,754 and 14,222,824, respectively, on the chromosome 3R genome map (Release 5.6). The entire cona protein-coding region is deleted in Df(3R)JDP.The transgene construct P{UASP-cona::Venus} was constructed using the plasmid pPWV (obtained from the Drosophila Genomics Resource Center, Bloomington, IN) and the Gateway system (Invitrogen, Carlsbad, CA) using methods as recommended by the manufacturer. pPWV is identical to pUASP except that it contains a Gateway cassette followed by the Venus yellow fluorescent protein coding region [54]. The cona open reading frame was amplified from the cona cDNA bs15d10 (obtained from Geneservice, Ltd., Cambridge, UK) using primers tailed with attB1 and attB2 sequences and inserted into the vector pDONR221 in a BP Clonase (Invitrogen) reaction to form pDONR-cona. The cona cDNA insert from pDONR-cona was then transferred into pPWV in an LR Clonase (Invitrogen) reaction to form pP{UASP-cona::Venus}, with an open reading frame encoding a CONA::Venus fusion protein. After confirming the construct by sequence analysis, it was introduced into Drosophila by standard germline transformation methods (Genetic Services, Inc., Cambridge, MA).To observe GFP-ORD in chromosome spread experiments, P{gc(2)M-myc}II.5 P{GFP::ORD}48I ord10 bw sp If/+; conaf04903 es ca /FRT82B conaA12 females were obtained by crossing y w/y+Y; (P{gc(2)M-myc}II.5 P{GFP::ORD}48I ord10 bw sp If; conaf04903 es ca)/T(2;3)CyO-TM3, P{GAL4-Hsp70.PB}TR1, P{UAS-GFP.Y}TR1: P{GAL4-Hsp70.PB}TR2, P{UAS-GFP.Y}TR2, Ser1 males to yd2 w1118 P{ey-FLP.N}2 P{GMR-lacZ.C(38.1)}TPN1/Y; FRT82B conaA12/TM6B, P{y+}TPN1, Tb1 females. For chromosome spread experiments to observe C(2)M, homozygous conaA12 females were selected from the stock yd2 w1118 P{ey-FLP.N}2 P{GMR-lacZ.C(38.1)}TPN1/Y; FRT82B conaA12/TM6B, P{y+}TPN1, Tb1.Antibody ProductionThe full-length cona open reading frame was amplified from the cona cDNA bs15d10 and cloned into pET-19b (Novagen, San Diego, CA). After the construct was verified by sequencing, the 6XHis-tagged CONA protein was expressed in E. coli BL21 cells. The bacterial expressed protein was purified using ProBond Nickel-Chelating Resin (Invitrogen). Polyclonal antibody production in guinea pigs using purified 6XHis-CONA as antigen was performed by Cocalico Biologicals (Reamstown, PA). Pre-immune sera from the immunized guinea pigs did not stain Drosophila ovaries (data not shown).The anti-CONA antibody was specific to the CONA protein, as anti-CONA signals were not detected in ovaries from conaf04903 females (Figure S1B). Similar observations were made using ovaries from conaA12/Df(3R)JDP females [SLP and WDW, unpublished data]. These observations suggested that little or no endogenous CONA protein is produced in the presence of the conaA12 or conaf04903 mutations.Immunofluorescence on Whole-Mount OvariolesImmunofluorescence on whole ovarioles was performed as described previously and the ovarioles were mounted on coverslips by embedding in polyacrylamide gel in most experiments [8]. Primary antibodies used for staining whole-mount preparations were guinea pig anti-CONA (1∶125), mouse monoclonal anti-C(3)G 1A8-1G2 [12] (1∶500), mouse monoclonal anti-C(3)G 1G5-2F7 and 5G4-1F1 [12],[21] (1∶500 each), mouse monoclonal anti-ORB 6H4 and 4H8 [55] (1∶50 each), and rat anti-SMC1 [56] (1∶500). Secondary antibodies were Alexa 546 anti-mouse IgG (1∶500), Alexa 488 anti-mouse IgG (1∶500), Alexa 488 anti-guinea pig IgG (1∶500), Alexa 488 anti-rat IgG (1∶500) (Invitrogen), and Cy3 anti-mouse IgG (1∶500) (Jackson Immunoresearch, West Grove, PA).Microscopy was conducted using a DeltaVision RT restoration microscopy system (Applied Precision, Issaquah, WA) equipped with an Olympus IX70 inverted microscope and CoolSnap CCD camera. Image data were corrected and deconvolved using softWoRx v.2.5 software (Applied Precision). For some experiments, confocal images were collected using a Bio-Rad Radiance 2000 laser scanning confocal microscope and Zeiss LaserSharp2000 software. Maximum intensity projections were produced from confocal data using Zeiss LSM Image Browser v.4.2 software.Immunofluorescence on Chromosome SpreadsChromosome spread experiments were performed as described previously [38]. Primary antibodies used for immunofluorescence on chromosome spreads were affinity-purified guinea pig anti-SMC1 [38] (1∶500), rabbit anti-C(2)M [39] (1∶500), rabbit anti-GFP (Invitrogen) (1∶500), and mouse monoclonal anti-C(3)G 1A8-1G2 [12] (1∶500). Secondary antibodies were Alexa 488 anti-rabbit IgG (1∶400), Alexa 488 anti-mouse IgG (1∶400) (Invitrogen), Cy3 anti-guinea pig IgG (1∶400), Cy5 anti-guinea pig IgG (1∶400), and Cy5 anti-mouse IgG (1∶400) (Jackson Immunoresearch).For chromosome spreads, images were captured and processed as described previously [38]. Because the signal intensity varies considerably for different nuclei on the same slide, wild-type and mutant images were enhanced to different degrees during processing to render details visible. In general, the C(3)G signal on chromatin in cona nuclei is significantly weaker than in wild-type.Fluorescence In Situ Hybridization (FISH)FISH on ovarioles was performed as described elsewhere [57] with simultaneous immunofluorescence detection of ORB protein. The probe for the FISH experiments was composed of three overlapping bacterial artificial chromosome (BAC) clones from the RP98 library [58] obtained from the BACPAC Resource Center, Children's Hospital Oakland Research Institute. The three BACs (and map locations on the X chromosome) were RP98-26N1 (9F4-10A2), RP98-17B23 (9F11-10A4), and RP98-26J12 (10A4-B1). BAC DNA was isolated using the Qiagen Midi Prep Kit. A DNA mixture containing 3.3 µg of DNA from each of the three BACs was labeled with Alexa 488 (Invitrogen) essentially as described by Dernburg [59] and purified using a Qiaquick column (Qiagen). Immunofluorescence with anti-ORB primary antibodies and Cy3 anti-mouse IgG secondary antibodies was performed after hybridization under the same conditions as described above for whole mount ovarioles. The ovarioles were mounted in Prolong Gold antifade mountant (Invitrogen) [60].Images were collected using a DeltaVision RT restoration microscopy system as described above. After image collection and processing, hybridization foci within pro-oocyte nuclei were scored for chromosome pairing. In nuclei with two foci, the distance between the pixels of highest fluorescence intensity within each focus was measured in three-dimensional image stacks using softWoRx Explorer software (Applied Precision). Nuclei containing a single hybridization focus or foci separated by 0.7 µm or less were defined as paired [19], while those with foci separated by more than 0.7 µm were defined as unpaired.Supporting InformationFigure S1CONA and C(3)G localization in cona mutant pro-oocytes. (A) Wild-type control pro-oocytes showing CONA and C(3)G co-localization. (B) conaf04903 homozygous pro-oocytes showing CONA is not detected and C(3)G localization is more diffuse than in wild-type nuclei with threads that are less distinct. Similar observations were made using ovaries from conaA12/Df(3R)JDP females (SLP and WDW, unpublished data). These observations indicate that little or no endogenous CONA protein is produced in the presence of the conaA12 or conaf04903 mutations. (C) conaf04903/+ pro-oocytes in early region 2A showing CONA is present and co-localizes with the polymerizing C(3)G in early zygotene stage pro-oocytes (arrow) that show spotty C(3)G localization. (D) conaf04903/+ pro-oocytes in late region 2A showing that CONA is present and co-localized with C(3)G, similar to wild-type. Pro-oocytes were stained with anti-CONA (green) and anti-C(3)G (red). Each image represents a single deconvolved optical section. Scale bars, 2.5 µm (A, C, D) and 5 µm (B).(5.2 MB TIF)Click here for additional data file.Figure S2CONA is required for C(3)GCdel polycomplex (PC) formation. (A) Maximum intensity projections of a wild-type germarium stained to detect SMC1 (green) and the coiled coil region of C(3)G (red). Arrowheads indicate pro-oocytes with thread-like C(3)G localization. (B) Maximum intensity projections of a y w/y w P{nos-GAL4::VP16}; P{UASP-c(3)GCdel}4/+; c(3)G68 germarium stained to detect SMC1 (green) and the coiled coil region of C(3)G (red). Arrowheads indicate PCs visible in pro-oocyte nuclei. (C) Maximum intensity projections of a y w/y w P{nos-GAL4::VP16}; P{UASP-c(3)GCdel}4/+; c(3)G68 conaf04903/TM3, Ser germarium stained to detect SMC1 (green) and the coiled coil region of C(3)G (red). Arrowheads indicate PCs visible in pro-oocyte nuclei that also have thread-like C(3)G localization due to heterozygosity for c(3)G68 and conaf04903. (D) Maximum intensity projections of a y w/y w P{nos-GAL4::VP16}; P{UASP-c(3)GCdel}4/+; c(3)G68 conaf04903 germarium stained to detect SMC1 (green) and the coiled coil region of C(3)G (red), which demonstrates the lack of PC formation in the absence of CONA. (E) Maximum intensity projections of a y w/y w P{nos-GAL4::VP16}; P{UASP-c(3)GCdel}4/+; c(3)G68 conaf04903/TM3, Ser pro-oocyte stained to detect SMC1 (green) and the coiled coil region of C(3)G (red). Large arrowheads indicate the major PC visible in the nucleus. Small arrowheads indicate thread-like C(3)G localization also present due to heterozygosity for c(3)G68 and conaf04903. Scale bars, 50 µm (A-D), 5 µm (E).(3.9 MB TIF)Click here for additional data file.\n\nREFERENCES:\n1. PageSLHawleyRS\n2004\nThe genetics and molecular biology of the synaptonemal complex.\nAnnu Rev Cell Dev Biol\n20\n525\n558\n15473851\n2. ZicklerDKlecknerN\n1999\nMeiotic chromosomes: integrating structure and function.\nAnnu Rev Genet\n33\n603\n754\n10690419\n3. RevenkovaEJessbergerR\n2006\nShaping meiotic prophase chromosomes: cohesins and synaptonemal complex proteins.\nChromosoma\n115\n235\n240\n16518630\n4. RoederGS\n1997\nMeiotic chromosomes: it takes two to tango.\nGenes Dev\n11\n2600\n2621\n9334324\n5. BurgessSM\n2002\nHomologous chromosome associations and nuclear order in meiotic and mitotically dividing cells of budding yeast.\nAdv Genet\n46\n49\n90\n11931237\n6. MacQueenAJColaiacovoMPMcDonaldKVilleneuveAM\n2002\nSynapsis-dependent and -independent mechanisms stabilize homolog pairing during meiotic prophase in C. elegans.\nGenes Dev\n16\n2428\n2442\n12231631\n7. MeuwissenRLOffenbergHHDietrichAJRiesewijkAvan IerselM\n1992\nA coiled-coil related protein specific for synapsed regions of meiotic prophase chromosomes.\nEMBO J\n11\n5091\n5100\n1464329\n8. PageSLHawleyRS\n2001\n\nc(3)G encodes a Drosophila synaptonemal complex protein.\nGenes Dev\n15\n3130\n3143\n11731477\n9. SymMEngebrechtJRoederGS\n1993\nZIP1 is a synaptonemal complex protein required for meiotic chromosome synapsis.\nCell\n72\n365\n378\n7916652\n10. HigginsJDSanchez-MoranEArmstrongSJJonesGHFranklinFC\n2005\nThe Arabidopsis synaptonemal complex protein ZYP1 is required for chromosome synapsis and normal fidelity of crossing over.\nGenes Dev\n19\n2488\n2500\n16230536\n11. OsmanKSanchez-MoranEHigginsJDJonesGHFranklinFC\n2006\nChromosome synapsis in Arabidopsis: analysis of the transverse filament protein ZYP1 reveals novel functions for the synaptonemal complex.\nChromosoma\n115\n212\n219\n16421735\n12. AndersonLKRoyerSMPageSLMcKimKSLaiA\n2005\nJuxtaposition of C(2)M and the transverse filament protein C(3)G within the central region of Drosophila synaptonemal complex.\nProc Natl Acad Sci U S A\n102\n4482\n4487\n15767569\n13. DobsonMJPearlmanREKaraiskakisASpyropoulosBMoensPB\n1994\nSynaptonemal complex proteins: occurence, epitope mapping and chromosome disjunction.\nJ Cell Sci\n107\n2749\n2760\n7876343\n14. DongHRoederGS\n2000\nOrganization of the yeast Zip1 protein within the central region of the synaptonemal complex.\nJ Cell Biol\n148\n417\n426\n10662769\n15. LiuJGYuanLBrundellEBjorkrothBDaneholtB\n1996\nLocalization of the N-terminus of SCP1 to the central element of the synaptonemal complex and evidence for direct interactions between the N-termini of SCP1 molecules organized head-to-head.\nExp Cell Res\n226\n11\n19\n8660934\n16. SchmekelKMeuwissenRLDietrichAJVinkACvan MarleJ\n1996\nOrganization of SCP1 protein molecules within synaptonemal complexes of the rat.\nExp Cell Res\n226\n20\n30\n8660935\n17. BörnerGVKlecknerNHunterN\n2004\nCrossover/noncrossover differentiation, synaptonemal complex formation, and regulatory surveillance at the leptotene/zygotene transition of meiosis.\nCell\n117\n29\n45\n15066280\n18. de VriesFAde BoerEvan den BoschMBaarendsWMOomsM\n2005\nMouse Sycp1 functions in synaptonemal complex assembly, meiotic recombination, and XY body formation.\nGenes Dev\n19\n1376\n1389\n15937223\n19. GongWJMcKimKSHawleyRS\n2005\nAll paired up with no place to go: pairing, synapsis, and DSB formation in a balancer heterozygote.\nPLoS Genet\n1\ne67\n16299588\n20. SherizenDJangJKBhagatRKatoNMcKimKS\n2005\nMeiotic recombination in Drosophila females depends on chromosome continuity between genetically defined boundaries.\nGenetics\n169\n767\n781\n15545646\n21. JeffressJKPageSLRoyerSKBeldenEDBlumenstielJP\n2007\nThe formation of the central element of the synaptonemal complex may occur by multiple mechanisms: the roles of the N- and C-terminal domains of the Drosophila C(3)G protein in mediating synapsis and recombination.\nGenetics\n177\n2445\n2456\n17947423\n22. ÖllingerRAlsheimerMBenaventeR\n2005\nMammalian protein SCP1 forms synaptonemal complex-like structures in the absence of meiotic chromosomes.\nMol Biol Cell\n16\n212\n217\n15496453\n23. Bolcun-FilasECostaYSpeedRTaggartMBenaventeR\n2007\nSYCE2 is required for synaptonemal complex assembly, double strand break repair, and homologous recombination.\nJ Cell Biol\n176\n741\n747\n17339376\n24. CostaYSpeedROllingerRAlsheimerMSempleCA\n2005\nTwo novel proteins recruited by synaptonemal complex protein 1 (SYCP1) are at the centre of meiosis.\nJ Cell Sci\n118\n2755\n2762\n15944401\n25. HamerGGellKKouznetsovaANovakIBenaventeR\n2006\nCharacterization of a novel meiosis-specific protein within the central element of the synaptonemal complex.\nJ Cell Sci\n119\n4025\n4032\n16968740\n26. HamerGWangHBolcun-FilasECookeHJBenaventeR\n2008\nProgression of meiotic recombination requires structural maturation of the central element of the synaptonemal complex.\nJ Cell Sci\n121\n2445\n2451\n18611960\n27. PageSLNielsenRJTeeterKLakeCMOngS\n2007\nA germline clone screen for meiotic mutants in Drosophila melanogaster.\nFly\n1\n172\n181\n18820465\n28. BrandAHPerrimonN\n1993\nTargeted gene expression as a means of altering cell fates and generating dominant phenotypes.\nDevelopment\n118\n401\n415\n8223268\n29. EijpeMHeytingCGrossBJessbergerR\n2000\nAssociation of mammalian SMC1 and SMC3 proteins with meiotic chromosomes and synaptonemal complexes.\nJ Cell Sci\n113\n673\n682\n10652260\n30. EijpeMOffenbergHJessbergerRRevenkovaEHeytingC\n2003\nMeiotic cohesin REC8 marks the axial elements of rat synaptonemal complexes before cohesins SMC1beta and SMC3.\nJ Cell Biol\n160\n657\n670\n12615909\n31. PelttariJHojaMRYuanLLiuJGBrundellE\n2001\nA meiotic chromosomal core consisting of cohesin complex proteins recruits DNA recombination proteins and promotes synapsis in the absence of an axial element in mammalian meiotic cells.\nMol Cell Biol\n21\n5667\n5677\n11463847\n32. PezziNPrietoIKremerLPerez JuradoLAValeroC\n2000\nSTAG3, a novel gene encoding a protein involved in meiotic chromosome pairing and location of STAG3-related genes flanking the Williams-Beuren syndrome deletion.\nFASEB J\n14\n581\n592\n10698974\n33. PrietoISujaJAPezziNKremerLMartinezAC\n2001\nMammalian STAG3 is a cohesin specific to sister chromatid arms in meiosis I.\nNat Cell Biol\n3\n761\n766\n11483963\n34. RevenkovaEEijpeMHeytingCGrossBJessbergerR\n2001\nNovel meiosis-specific isoform of mammalian SMC1.\nMol Cell Biol\n21\n6984\n6998\n11564881\n35. LammersJHOffenbergHHvan AalderenMVinkACDietrichAJ\n1994\nThe gene encoding a major component of the lateral elements of synaptonemal complexes of the rat is related to X-linked lymphocyte-regulated genes.\nMol Cell Biol\n14\n1137\n1146\n8289794\n36. OffenbergHHSchalkJAMeuwissenRLvan AalderenMKesterHA\n1998\nSCP2: a major protein component of the axial elements of synaptonemal complexes of the rat.\nNucleic Acids Res\n26\n2572\n2579\n9592139\n37. SchalkJADietrichAJVinkACOffenbergHHvan AalderenM\n1998\nLocalization of SCP2 and SCP3 protein molecules within synaptonemal complexes of the rat.\nChromosoma\n107\n540\n548\n9933407\n38. KhetaniRSBickelSE\n2007\nRegulation of meiotic cohesion and chromosome core morphogenesis during pachytene in Drosophila oocytes.\nJ Cell Sci\n120\n3123\n3137\n17698920\n39. ManheimEAMcKimKS\n2003\nThe synaptonemal complex component C(2)M regulates meiotic crossing over in Drosophila.\nCurr Biol\n13\n276\n285\n12593793\n40. WebberHAHowardLBickelSE\n2004\nThe cohesion protein ORD is required for homologue bias during meiotic recombination.\nJ Cell Biol\n164\n819\n829\n15007062\n41. ColaiácovoMPMacQueenAJMartinez-PerezEMcDonaldKAdamoA\n2003\nSynaptonemal complex assembly in C. elegans is dispensable for loading strand-exchange proteins but critical for proper completion of recombination.\nDev Cell\n5\n463\n474\n12967565\n42. YuanLLiuJGHojaMRWilbertzJNordqvistK\n2002\nFemale germ cell aneuploidy and embryo death in mice lacking the meiosis-specific protein SCP3.\nScience\n296\n1115\n1118\n12004129\n43. YuanLLiuJGZhaoJBrundellEDaneholtB\n2000\nThe murine SCP3 gene is required for synaptonemal complex assembly, chromosome synapsis, and male fertility.\nMol Cell\n5\n73\n83\n10678170\n44. ZetkaMCKawasakiIStromeSMullerF\n1999\nSynapsis and chiasma formation in Caenorhabditis elegans require HIM-3, a meiotic chromosome core component that functions in chromosome segregation.\nGenes Dev\n13\n2258\n2270\n10485848\n45. FungJCMarshallWFDernburgAAgardDASedatJW\n1998\nHomologous chromosome pairing in Drosophila melanogaster proceeds through multiple independent initiations.\nJ Cell Biol\n141\n5\n20\n9531544\n46. CsinkAKHenikoffS\n1998\nLarge-scale chromosomal movements during interphase progression in Drosophila.\nJ Cell Biol\n143\n13\n22\n9763417\n47. BaudatFManovaKYuenJPJasinMKeeneyS\n2000\nChromosome synapsis defects and sexually dimorphic meiotic progression in mice lacking Spo11.\nMol Cell\n6\n989\n998\n11106739\n48. RomanienkoPJCamerini-OteroRD\n2000\nThe mouse Spo11 gene is required for meiotic chromosome synapsis.\nMol Cell\n6\n975\n987\n49. McKimKSGreen-MarroquinBLSekelskyJJChinGSteinbergC\n1998\nMeiotic synapsis in the absence of recombination.\nScience\n279\n876\n878\n9452390\n50. JangJKSherizenDEBhagatRManheimEAMcKimKS\n2003\nRelationship of DNA double-strand breaks to synapsis in Drosophila.\nJ Cell Sci\n116\n3069\n3077\n12799415\n51. MehrotraSMcKimKS\n2006\nTemporal analysis of meiotic DNA double-strand break formation and repair in Drosophila females.\nPLoS Genet\n2\ne200\n17166055\n52. GrumblingGStreletsV\nThe FlyBase Consortium\n2006\nFlyBase: anatomical data, images and queries.\nNucleic Acids Res\n34\nD484\n488\n16381917\n53. ParksALCookKRBelvinMDompeNAFawcettR\n2004\nSystematic generation of high-resolution deletion coverage of the Drosophila melanogaster genome.\nNat Genet\n36\n288\n292\n14981519\n54. NagaiTIbataKParkESKubotaMMikoshibaK\n2002\nA variant of yellow fluorescent protein with fast and efficient maturation for cell-biological applications.\nNat Biotechnol\n20\n87\n90\n11753368\n55. LantzVChangJSHorabinJIBoppDSchedlP\n1994\nThe Drosophila orb RNA binding protein is required for the formation of the egg chamber and establishment of polarity.\nGenes Dev\n8\n598\n613\n7523244\n56. MalmancheNOwenSGegickSSteffensenSTomkielJE\n2007\nDrosophila BubR1 is essential for meiotic sister-chromatid cohesion and maintenance of synaptonemal complex.\nCurr Biol\n17\n1489\n1497\n17702574\n57. DernburgAF\n2000\nIn situ hybridization to somatic chromosomes.\nSullivanWAshburnerMHawleyRS\nDrosophila Protocols\nCold Spring Harbor, NY\nCold Spring Harbor Laboratory Press\n25\n55\n58. HoskinsRANelsonCRBermanBPLavertyTRGeorgeRA\n2000\nA BAC-based physical map of the major autosomes of Drosophila melanogaster.\nScience\n287\n2271\n2274\n10731150\n59. DernburgAF\n1999\nFluorescence in situ hybridization to whole-mount tissues.\nBickmoreWA\nChromosome Structural Analysis: A Practical Approach\nNew York\nOxford University Press\n125\n145\n60. PageSLHawleyRS\n2005\nThe Drosophila meiotic mutant mei-352 is an allele of klp3A and reveals a role for a kinesin-like protein in crossover distribution.\nGenetics\n170\n1797\n1807\n15965253"
+}

batch_2/PMC2529404.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2529404",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2529404\nAUTHORS: Cristianne R. M. Frazier, Peggy Mason, Xiaoxi Zhuang, Jeff A. Beeler\n\nABSTRACT:\nThe cause of the current increase in obesity in westernized nations is poorly understood but is frequently attributed to a ‘thrifty genotype,’ an evolutionary predisposition to store calories in times of plenty to protect against future scarcity. In modern, industrialized environments that provide a ready, uninterrupted supply of energy-rich foods at low cost, this genetic predisposition is hypothesized to lead to obesity. Children are also exposed to this ‘obesogenic’ environment; however, whether such early dietary experience has developmental effects and contributes to adult vulnerability to obesity is unknown. Using mice, we tested the hypothesis that dietary experience during childhood and adolescence affects adult obesity risk. We gave mice unlimited or no access to sucrose for a short period post-weaning and measured sucrose-seeking, food consumption, and weight gain in adulthood. Unlimited access to sucrose early in life reduced sucrose-seeking when work was required to obtain it. When high-sugar/high-fat dietary options were made freely-available, however, the sucrose-exposed mice gained more weight than mice without early sucrose exposure. These results suggest that early, unlimited exposure to sucrose reduces motivation to acquire sucrose but promotes weight gain in adulthood when the cost of acquiring palatable, energy dense foods is low. This study demonstrates that early post-weaning experience can modify the expression of a ‘thrifty genotype’ and alter an adult animal's response to its environment, a finding consistent with evidence of pre- and peri-natal programming of adult obesity risk by maternal nutritional status. Our findings suggest the window for developmental effects of diet may extend into childhood, an observation with potentially important implications for both research and public policy in addressing the rising incidence of obesity.\n\nBODY:\nIntroductionAlmost two-thirds of American adults are either overweight or obese and the incidence of childhood obesity is rising rapidly [1]–[4]. The cause of the recent and dramatic rise in obesity in western societies is not fully understood, but its appearance in a genetically stable population indicates that environmental factors play a critical role [5]–[7]. In western societies, the increased availability of tasty, energy-rich foods together with a reduced requirement for energy expenditure is believed to promote a net positive energy balance resulting in increased body mass and obesity [5], [8]. The availability of these foods, however, does not entirely account for their widespread (over-)consumption. Palatable, high-calorie foods are widely available because there is a demand for them, though marketing practices undoubtedly contribute to this, especially among children [9]–[11]. Moreover, the widespread availability of high fat and high sugar foods does not mean that healthier alternatives are unavailable, though this may vary by region and socioeconomic status [12]–[18]. Human beings, though influenced by environmental factors [7], respond to their environment with motivated, goal-directed behavior [19]–[21], often seeking out foods they know to be poor choices, sometimes even when they resolve to eat better or less. These adult behaviors are often resistant to change [22]. Understanding the factors that shape adult food-related motivation and its contribution to weight gain would greatly aid in the development of preventative measures in tackling the problem of obesity.Efforts to understand the recent rise in obesity focus on discerning the relative contributions of, or interactions between, genetic and environmental factors in adulthood [6], [7], [19], [23], [24]. Developmental contributions and interactions are only recently being investigated and have focused almost exclusively on maternal over- and under-nutrition affecting the fetal or neonatal nutritional environment. Arising from the fetal origins hypothesis, termed the ‘thrifty phenotype,’ first proposed by Hales, Barker and colleagues [25], [26], this work proposes that pre- and peri-natal nutritional status developmentally programs the organism's adult metabolism and energy balance to form a “predictive adaptive response” [27]. This work has clearly demonstrated that early nutritional status can alter later energy balance behavior and body weight [28]–[36]. The window during which such programming occurs, however, is not well defined. Whether a developmental window remains open during childhood and adolescence allowing nutritional experience during this time to substantively shape subsequent adult energy balance remains an open question. As children's diets in contemporary western society tend to be replete with high fat and sugar foods, such developmental effects could potentially compound the obesity epidemic or, alternatively, offer a potential approach to addressing it.Human studies examining childhood diet and obesity are equivocal, providing some evidence that childhood diet can contribute to obesity risk [37] but also showing that restricting children's diets increases obesity risk [38], though these studies generally do not examine adult outcome. Given the difficulty inherent in human studies, including the challenge of maintaining adequate experimental control and the expense and delay inherent in human longitudinal studies, an animal model would greatly facilitate investigations into the relationship between early dietary experience and adult obesity.Like many humans, C57BL/6 mice show a strong preference for sugar and fat and become obese and develop diabetes when given chronic access to a high-sugar/high-fat diet [39]–[42]. The C57BL/6 mouse shares with humans the ‘thrifty genotype,’ a putative genetic predisposition to store calories whenever food is readily available [8], [40]. Here we used C57Bl/6 mice to directly test the effect of early post-weaning experience on adult motivated behavior and obesity risk. We focused on sucrose exposure in early life since sucrose is a potent natural reinforcer [43] and because the complex mechanisms that have evolved to regulate sugar metabolism interact with motivational and reward systems [44]. We hypothesized that early experience with sucrose can alter adult motivated behavior and thereby may constitute an important factor determining adult feeding behavior and energy balance.We show that unlimited access to sucrose early in life reduces motivation to acquire sucrose, but only when work is required to obtain it. When high-sugar/high-fat foods were made freely-available, mice exposed to sucrose early in life preferred and consumed this food as much as non-exposed animals, but in this environment gained more weight than controls. These data provide clear empirical support for the often asserted but rarely demonstrated link between childhood diet and later adult feeding behavior and body weight and suggest that the impact of early diet on adult obesity risk may be contingent upon the adult environment. These findings additionally suggest that the window for developmental programming in response to nutritional environment extends beyond gestation and suckling.Materials and MethodsAnimalsTen breeding pairs of C57BL/6 mice (Jackson Laboratories, Ben Harbor) were set up and each litter was weaned at 21 days and distributed evenly between the experimental early environmental conditions (unlimited sucrose exposure and no sucrose exposure). Animals were housed under standard conditions throughout. The sucrose exposure group, upon weaning, had 20 mg sucrose pellets (Bio-Serv, Frenchtown, NJ) continuously and freely available within their homecage. There were two cohorts born 3 weeks apart. The sucrose was removed from all sucrose exposure mice at the same time, resulting in two cohorts with either 4 or 7 weeks exposure to sucrose. They were maintained on standard ad libitum chow thereafter, except during the dietary challenge in which they were offered a high sugar/high fat option in addition to standard chow. Both males and females were included and distributed approximately equally.Behavior TestsAll experiments were carried out during the light period (06:00–18:00). When food restriction was used, mice were given 2 hours per day access to food immediately following the behavior test. Water was available ad libitum.Open fieldEach mouse was placed in an acrylic open field chamber 40 cm long×40 cm wide×37 cm high (Med Associates, St. Albans, VT). Illumination was 21 lux. Infrared beams recorded the animals' locations and paths (locomotor activity) as well as the number of rearing movements (vertical activity). Data were collected in 5 minute bins during 60 min trials. The chambers were cleaned with 70% ethanol between all trials.Wheel runningMice were singly housed each with a 4.5″ wire mesh wheel (Mini Run-a-Round, Pets International, Ltd., Elk Grove Village, IL). Two counter-balanced magnets (Digi-key, Thief River Falls, MN) were placed on 3/8 inch stainless steel strips attached to the wheel (McMaster Carr Supply Co, Chicago, IL). The wheel was situated in the cage such that a magnetic switch closes (Digi-key) at every pass of a magnet. Data were collected using Vitalview acquisition software, QA-4 activity input modules, and DP-24 data ports, (Mini-mitter Co., Sun River, OR). Data were collected in minute bins throughout the one week experiment.Operant tasksThe progressive ratio (PR) operant task and the concurrent choice task were conducted in operant conditioning chambers (Med Associates, St Albans, VT), 5 days per week in 90 min sessions for the progressive ratio task and 30 min sessions for the concurrent choice task. In the PR experiment, mice were first trained under a fixed ratio one schedule (FR1, every press rewarded) with only the active lever extended. During the first two days of training, food pellets (20-mg sucrose pellets, Bio-Serv, Frenchtown, NJ) were also delivered into the food receptacle on a random interval 60 s schedule with intervals ranging between 0 and 120 seconds. When mice reached a criterion of 30 lever presses in less than 45 min on two consecutives days they were shifted to a PR3 schedule for two days before PR7 testing began. In progressive ratio, the number of lever presses required to earn a pellet is incremented by 3 (PR3) or 7 (PR7) after each reward so that each subsequent pellet becomes more costly. Mice were tested under both food-restricted and non-food-restricted conditions. Three parameters were recorded: the breakpoint, defined as the last ratio completed, and number of lever presses on the active and inactive levers. The concurrent choice task was adapted from the protocol used by Cousins and Salamone [45] in rats. Tests were conducted under food restriction. Mice had the choice between lever pressing for a more preferred food (FR35, every 35 lever presses delivers a 20 mg sucrose pellet) or consuming a less preferred standard rodent chow that was concurrently and freely available on the floor of the operant box. This experimental arrangement (“choice condition”) was used on day 1, 3 and 5 of each week; and on days 2 and 4, only the FR35 was available (“no choice condition”). Testing lasted 1 week. The number of lever presses, the total amount of food consumed (pellet and lab chow in g) and the percentage of food obtained by lever pressing were calculated.Sucrose preference and extinctionMice were singly housed in cages that included two identical water bottles (15 ml round bottom polypropylene tubes with rubber stopper on the mouth and a sipper tube with ball-bearing), one of which contained sucrose solution at varying concentrations in the course of the experiment (0%, 0.2%, 5%, 10% and 15%). Each concentration of sucrose was provided for four days. The positions of the bottles were rotated daily to counter-balance potential position preferences. The bottles were weighed daily and the amount consumed from each recorded. A cage without mice was maintained and weighed daily to track spillage, which remained minimal and is not reported. Preference as a percent was calculated by dividing the amount consumed from the sucrose bottle from the total amount consumed from both bottles. After the final 15% concentration, all bottles were washed thoroughly and water placed in all bottles and the test was continued for an additional two days to determine the rate of extinction of the preference for the previously sucrose filled bottle.Glucose ChallengeMice were fasted for 21 hours. Tail bleeds were used to sample blood glucose and measured using the Accu-Check Active Meter (Roche). After a baseline fasting glucose level was obtained, mice were challenged with 2 g/kg dextrose prepared in 0.9% saline and blood glucose checked at 30, 65 and 90 minutes.High-Sugar/High-Fat Dietary ChallengeMice were singly housed and provided both standard chow and equal amounts of various Nestlé® chips (butterscotch, milk chocolate, white chocolate, peanut butter) ad libitum. The mice were weighed and consumption measured weekly during the three week dietary challenge. Mice had ad libitum access to water. Subsequent to the challenge, mice were returned to the standard chow diet and group housing. Metabolic efficiency was calculated by dividing the total weight gained during the challenge by the kcal consumed to yield weight gain per kcal. Caloric content of chow and Nestlé® chips were obtained from the manufacturers' websites.All animal procedures were approved by the Institutional Animal Care and Use Committee at The University of Chicago.ResultsThirty male and female C57BL/6 mice were weaned onto standard chow and half of the animals were given concurrent exposure to unlimited amounts of sucrose (20 mg pellets) in their homecage for four weeks (n = 7) or seven weeks (n = 8; Figure 1a). This post-weaning period of development approximately corresponds to childhood through adolescence or early adulthood. Following this manipulation, there was no difference in weights between the two groups (4 wk group, F(1,9) = 2.96, p = 0.1; 7 wk group, F(1,12) = 0.35, p = 0.6) as expected since sucrose consumption alone does not generally cause weight gain in rodents [40], [46], [47] or humans [48]–[50]. Thereafter, all animals were maintained under standard conditions with ad libitum access to standard chow. The groups were tested as indicated in Figure 1a.10.1371/journal.pone.0003221.g001Figure 1Experimental timeline, progressive ratio and activity.(a) Timeline indicating the order of experimental manipulations and tests. Two cohorts of mice were used and administered the experimental manipulation and testing procedures as indicated above and below the timeline. Breakpoint in progressive ratio (PR7) for the sucrose exposed and non-sucrose exposed mice tested under (b) food restriction and (c) sated conditions (n = 8). (d) Total distance traveled in the open field (1 hr) (n = 7). (e) Total number of wheel turns in 1 week (n = 7, 8). Box plots: Middle lines represent the median values, the top and bottom of the boxes represent the 25th and 75th percentiles, the whiskers represent the 10th and 90th percentiles and the dots represent mean values ; * p = .05.Behavioral effects of early sucrose exposureFive weeks after the termination of sucrose exposure, adult animals were tested for their willingness to work to acquire sucrose rewards in the progressive ratio test. In this instrumental task, the number of active lever presses required to obtain a sucrose reward is increased incrementally after each sucrose pellet earned. The maximal number of presses for which the animal earned a reward is termed the breakpoint and reflects an animal's willingness to work for a reinforcer. Mice given unlimited access to sucrose early in life exhibited a lower breakpoint than animals not exposed to sucrose (Figure 1b; F(1,14) = 4.61, p = 0.05). This effect was only observed if mice were food-restricted (Figure 1c; sated condition: F(1,14) = 2.11, p = 0.2). Interestingly, though not statistically significant, the unlimited sucrose exposure group tended to press less on the inactive lever as well, which does not yield reward, than did the no sucrose exposure group (food- restricted condition, F(1,14) = 3.38, p = 0.09, data not shown). Inactive lever-pressing can be interpreted as either an indicator of general activity or as an expression of the animals' exploratory strategy; that is, how often they check the ‘other lever’ to see if reward contingencies have changed. Baseline locomotor activity measured in the open field test (Figure 1d; F(1,12) = 0.52, p = 0.5) or in homecage wheel-running (Figure 1e; F(1,13) = 0.28, p = 0.6) was not affected by sucrose exposure, suggesting no difference between the two groups in basal locomotion and goal-directed energy-expenditure (wheel running), although these activity measures were not taken under food restriction. Taken together, these behavior results indicate that mice given unlimited access to sucrose in early life exhibit reduced sucrose-seeking behavior in adulthood as indicated by a lower breakpoint.Given that unlimited sucrose exposure early in life reduced sucrose-seeking in adulthood, we asked how the mice would behave given a choice between freely available, standard chow and sucrose that had to be earned. In this concurrent choice paradigm, mice were tested in two conditions termed ‘choice’ and ‘no choice’ on alternating days. In the choice condition, mice could either work (lever-press) for sucrose pellets or eat standard chow freely available. In the no-choice condition, there was no freely available chow. There was no difference in total food consumption (chow plus sucrose) between the groups in the choice condition (Figure 2c; F(1,14) = 0.59, p = 0.5). Consistent with the results from the food-restricted progressive ratio test, mice exposed to unlimited sucrose in early life worked less to obtain sucrose in both the choice and no choice conditions (Choice Condition, Figure 2a; F(1,14) = 26.25, p<0.001; No Choice Condition, Figure 2b; F(1,14) = 5.67, p = 0.03) and showed enhanced preference for freely-available standard chow in the choice condition (Figure 2d; F(1,14) = 38.07, p<0.0001). Thus, unlimited access to sucrose early in life reduced motivation for sucrose rewards and preferentially enhanced consumption of freely-available food over more palatable food that required work to obtain.10.1371/journal.pone.0003221.g002Figure 2Concurrent choice.Average lever presses during (a) choice and (b) no choice conditions (n = 8). (c) Total food consumed (earned sucrose+freely available chow) during choice sessions (n = 8). (d) Percentage of total intake comprised of earned sucrose pellets during choice sessions (n = 8). Box plots: as described in figure 1; * p<.05; **p<.005; *** p<.0001.Following the concurrent choice test, we evaluated glucose metabolism in this cohort of mice. After 21 hours of fasting, there were no differences in weight between the groups (Figure 3a; F(1,14) = .011, p = 0.917) and no difference in either fasting glucose levels (Figure 3b; baseline, F(1,12) = .552, p = 0.472) or response to glucose challenge (Figure 3b; group X timepoint, F(3,36) = 1.15, p = 0.340). These results indicate that sucrose exposure early in life does not alter glucose tolerance when animals are maintained on standard chow in adulthood.10.1371/journal.pone.0003221.g003Figure 3Glucose challenge.(a) Weights after a 21 hour fast and prior to glucose challenge. (b) blood glucose levels at fasting baseline (timepoint 0) and following i.p. injection of dextrose (2 g/kg). N = 6 (no sucrose) and 8 (unlimited).Both the progressive ratio and concurrent choice tests evaluate motivation for sucrose when work is required to obtain the reward. We also tested baseline sucrose preference with no explicit work requirement. Singly-housed mice were presented with two bottles, one filled with sucrose and the other with water. Increasing concentrations of sucrose (0.2%, 5%, 10%, and 15%) were presented in one bottle for four days at each concentration. Each day, consumption was measured and the position of the bottles switched to control for position preferences. Across subsequent concentrations, mice exposed to sucrose early in life showed a reduced preference relative to mice raised without sucrose (Figure 4a; Treatment: F(1,30) = 6.0, p = 0.03). However, there were no significant differences in sucrose (Figure 4c; Treatment, F(1,33) = 1.60, p = 0.2) or water (Figure 4d; Treatment, F(1,36) = 1.0, p = 0.3) consumption between groups. Thus, in comparison with the no sucrose exposure group, the mice exposed to unlimited sucrose in early life show mildly reduced sucrose preference resulting in little change in overall consumption. To further assess sucrose-seeking behavior, we tested the mice in extinction conditions. Sucrose bottles were washed, refilled with water, and preference testing was continued for two days. While no overt cues were associated with either bottle, rodents can discriminate bottles based on tactile characteristics [51]. Although both groups showed preference for high doses of sucrose (10 and 15%), mice given unlimited access to sucrose early in life more readily extinguished their preference for the sucrose bottle than animals not exposed to sucrose when they were young (Figure 4b; F(1,12) = 11.54, p = 0.005). Together with the instrumental data described above, these results show a clear reduction in sucrose-seeking behavior in mice given early unlimited exposure. The expression of this effect, however, appears to be contingent upon the costs associated with obtaining the sucrose. In the instrumental tasks where the cost of food is relatively high due to an explicit work requirement and food scarcity, i.e., food-restriction, the effect of sucrose exposure early in life is robust. In contrast, in the sucrose preference test where the work requirement is low and food is freely available, the effect of early sucrose exposure on adult sucrose-seeking is diminished.10.1371/journal.pone.0003221.g004Figure 4Sucrose preference.(a) Average preference expressed as sucrose consumed (g) divided by total sucrose and water consumption (g) (n = 7). Dashed line indicates no preference. (b) Average preference for the bottle previously paired with sucrose during extinction (n = 7). (c) Average sucrose and (d) water consumption (n = 7) ±SEM; * p<.05, ** p = .005.Effects of sucrose exposure on weight gain in adulthoodTo directly assess vulnerability to obesity, we measured weight gain when mice had access to freely available high-sugar/high-fat (HS/HF) dietary options. Prior to testing, there was no difference in weight between the groups with no exposure and unlimited exposure to sucrose during early life (F(1,10) = 0.14, p = 0.72). We singly housed the mice and after a one-week acclimation period provided both standard chow as well as HS/HF options consisting of Nestlé® butterscotch, peanut butter, milk and white chocolate chips for three weeks. We found that mice that had unlimited exposure to sucrose when they were young gained more weight in this environment than those animals that did not have access to sucrose during development (Figure 5a; HS/HF weight gain, F(1,10) = 5.84, p = 0.0362; Figure 5b; group X week, F(3,30) = 3.78, p = 0.0206). Though both male and female mice exposed to unlimited sucrose gained more weight than controls in this condition, the effect may be more robust in females (17% and 12% increase over controls in females and males, respectively). While there was no difference between groups in consumption of either the HS/HF food (Figure 5d, dashed lines, F(1,10) = 1.0, p = 0.34) or standard chow (Figure 5d, solid lines, F(1,10) = 0.332, p = 0.577), the sucrose-exposed mice exhibited greater efficiency at storing energy as indicated by weight gained per kcal consumed (Figure 5c, F(1,10) = 5.326, p = 0.0437). Consistent with the sucrose preference test, in an environment where little cost was associated with acquiring the high sugar option, both sucrose exposed and non exposed groups equally preferred the HS/HF diet (as percentage of total consumption, unlimited, 67.1%; no sugar, 71.0%; F(1,10) = 0.551, p = 0.474). Singly housing mice during the dietary challenge is unlikely to have suppressed behavioral differences between the groups as mice were also singly housed during sucrose preference testing where they exhibited behavioral differences.10.1371/journal.pone.0003221.g005Figure 5High sugar/high fat dietary challenge.(a) Percent weight gain 3-weeks prior to (left) and during (right) the 3-week HS/HF exposure period in adulthood. (b) Body weight at the beginning and subsequent three weeks of HS/HF dietary options. (c) Metabolic efficiency as gram body weight increase per kcal consumed across the HS/HF dietary challenge. (d) Weekly consumption of standard chow (solid lines) and HS/HF options (dashed lines). N = 5–7; ±SEM, * p<.05.DiscussionOur data indicate that a single factor in early, post-weaning development– sucrose exposure– has persistent effects on adult motivated behavior and weight gain. A study in rats published in 1978 [52] found that early exposure to different concentrations of sucrose solution did not alter subsequent adult appetite for sweet foods. Although the authors drew a conclusion opposite ours— that early experience with sucrose does not significantly affect adult consumption and preference— their data are consistent with the present study. Like the Wurtman study, we did not observe an effect of early sucrose exposure on preference for and consumption of sweet food in adulthood when it was freely available. However, their study did not examine whether there was a difference in willingness to work to obtain sweet foods nor did it report the body weights of rats when given access to high-sugar food. Thus, although our study replicates their findings, the more extensive examination of behavior and inclusion of body weight measurement in this study yield a more complex picture of the impact of early experience on adult feeding behavior and body weight and demonstrate that early dietary experience does alter adult consumption and vulnerability to obesity.Current views on the cause of the recent increase in obesity center on an interaction between genetics and adult environment [5], [19], [24], [48]. The “thrifty genotype” hypothesis proposes that humans are predisposed to store calories in times of plenty in order to survive later times of scarcity. In contemporary society, however, where energy rich foods are readily available without intervening periods of scarcity, this genetic propensity is thought to result in obesity. This view does not consider the effect that dietary experience during development may have on expression of a putative thrifty genotype. In our study, four to seven weeks of exposure to sucrose post-weaning altered adult sucrose-seeking and weight gain among mice that shared an identical “thrifty genotype” and were exposed to identical environments as adults. These data emphasize the importance of a developmental perspective extending beyond gestation and nursing and suggest that children's diets can intensify or ameliorate the impact of a putative thrifty genotype.In human studies, unlimited soft drink consumption during childhood is correlated with an increase in obesity risk (see [37] for review), consistent with our finding in mice that unlimited access to sucrose early in life resulted in increased weight gain when exposed to freely available HS/HF dietary options. Importantly, however, our study shows that the impact of early sucrose exposure on adult obesity risk depends upon the dietary environment in which the adult finds itself. Sucrose-exposed animals do not seek out sucrose to the extent that naïve animals do when there is a significant cost associated with acquiring it; however, they are more vulnerable to weight gain in an environment with freely-available (low-cost), palatable, energy rich foods. Our study suggests that individuals exposed to sugary diets in early life will be less likely to seek these foods if there are costs associated with obtaining them in adulthood. Consequently, making high sugar and high fat foods less readily available within individual environments, such as the workplace, schools and home, may contribute to effective weight management. These results suggest that with a population raised on a diet high in sugar, environmental manipulation of the costs associated with energy-dense foods is likely to be an efficacious obesity-reducing intervention during adulthood.These data might suggest that reducing a child's intake of sucrose might diminish future obesity risk. However, human studies have also found that parental restriction of a child's diet also increases obesity risk (see [38] for review). Several potential explanations of these findings have been proposed, all suggesting that increases in sucrose/fat-seeking behavior and consumption follow restriction [38]. The increased motivation to obtain sucrose in the mice not exposed to sucrose in early life― an extreme form of restriction not possible in human studies― supports this notion. The differences in motivation we observe between groups in the behavior tests are not evident when the animals are sated. This, together with the observation of no weight difference while the mice are maintained on standard chow suggest that the motivational differences we observe between the groups reflect alterations in incentive motivation [53], [54] for preferred, sweet food rather than changes in primary motivation, hunger. This is demonstrated clearly in the concurrent choice test where both groups consumed the same amount of total food but the sucrose-exposed mice consumed less sucrose— available, but associated with a cost— showing that the sucrose-exposed mice exhibit less incentive motivation to work for sucrose. This suggests that early experience can alter the incentive motivational processes that determine goal-directed behavior in response to hunger resulting in different behavioral choices and consumption.The present study cannot determine the mechanisms underlying the observed effects of early sucrose experience. In the behavior tests, differences in sucrose-seeking may arise as a result of (a) different learned valuation of the preferred food arising from early exposure, (b) different metabolic responses to food restriction between sucrose-exposed and non-exposed animals, with the sucrose-exposed mice protecting energy stores to a greater extent or (c) different motivational responsiveness to metabolic signals such as leptin or insulin, which have been shown to interact with midbrain dopamine systems involved in reward-seeking behavior [44], [55], [56]. The glucose challenge data suggests that the two groups respond to acute food deprivation (21 hour fast) and acute glucose increases similarly when maintained on standard chow, consistent with the observation that sucrose-exposure does not effect weight gain when animals eat standard chow. However, differences in energy metabolism and storage may arise in response to chronic food deprivation which may contribute to the observed differences in sucrose-seeking. Similarly, sucrose-exposed and non-exposed mice likely have different metabolic and/or behavioral responses to HS/HF dietary options that promote weight gain, as evidence by their increased feed efficiency. The potential influence of sucrose exposure in early life on the interaction between metabolic signals and motivational systems are currently being investigated.Although our study indicates the importance of a developmental perspective in studying obesity, with obvious policy implications, many questions remain. If early experience shapes later food-seeking behavior and obesity risk, the question naturally arises as to the time window during which these developmental processes are active and how susceptible the developmental outcomes are to change after that window closes. Establishing and characterizing these developmental phenomena will facilitate investigation into their biological substrates increasing our understanding of how genes and environments interact to produce the current epidemic of obesity.\n\nREFERENCES:\n1. HedleyAAOgdenCLJohnsonCLCarrollMDCurtinLR\n2004\nPrevalence of overweight and obesity among US children, adolescents, and adults, 1999–2002.\nJama\n291\n2847\n2850\n15199035\n2. KostiRIPanagiotakosDB\n2006\nThe epidemic of obesity in children and adolescents in the world.\nCent Eur J Public Health\n14\n151\n159\n17243492\n3. OgdenCLFryarCDCarrollMDFlegalKM\n2004\nMean body weight, height, and body mass index, United States 1960–2002.\nAdv Data\n1\n17\n4. WangYBeydounMA\n2007\nThe obesity epidemic in the United States–gender, age, socioeconomic, racial/ethnic, and geographic characteristics: a systematic review and meta-regression analysis.\nEpidemiol Rev\n29\n6\n28\n17510091\n5. NeelJV\n1999\nThe “thrifty genotype” in 1998.\nNutr Rev\n57\nS2\n9\n10391020\n6. HillJOPetersJC\n1998\nEnvironmental contributions to the obesity epidemic.\nScience\n280\n1371\n1374\n9603719\n7. LevitskyDA\n2005\nThe non-regulation of food intake in humans: hope for reversing the epidemic of obesity.\nPhysiol Behav\n86\n623\n632\n16263145\n8. NeelJV\n1962\nDiabetes mellitus: a “thrifty” genotype rendered detrimental by “progress”?\nAm J Hum Genet\n14\n353\n362\n13937884\n9. HoekJGendallP\n2006\nAdvertising and obesity: a behavioral perspective.\nJ Health Commun\n11\n409\n423\n16720538\n10. KellyBSmithBKingLFloodVBaumanA\n2007\nTelevision food advertising to children: the extent and nature of exposure.\nPublic Health Nutr\n10\n1234\n1240\n17381920\n11. PowellLMSzczypkaGChaloupkaFJBraunschweigCL\n2007\nNutritional content of television food advertisements seen by children and adolescents in the United States.\nPediatrics\n120\n576\n583\n17766531\n12. DelvaJJohnstonLDO'MalleyPM\n2007\nThe epidemiology of overweight and related lifestyle behaviors: racial/ethnic and socioeconomic status differences among American youth.\nAm J Prev Med\n33\nS178\n186\n17884566\n13. DelvaJO'MalleyPMJohnstonLD\n2007\nAvailability of more-healthy and less-healthy food choices in American schools: a national study of grade, racial/ethnic, and socioeconomic differences.\nAm J Prev Med\n33\nS226\n239\n17884570\n14. DrewnowskiA\n2007\nThe real contribution of added sugars and fats to obesity.\nEpidemiol Rev\n29\n160\n171\n17591599\n15. MorlandKDiez RouxAVWingS\n2006\nSupermarkets, other food stores, and obesity: the atherosclerosis risk in communities study.\nAm J Prev Med\n30\n333\n339\n16530621\n16. MorlandKWingSDiez RouxAPooleC\n2002\nNeighborhood characteristics associated with the location of food stores and food service places.\nAm J Prev Med\n22\n23\n29\n11777675\n17. MooreLVDiez RouxAV\n2006\nAssociations of neighborhood characteristics with the location and type of food stores.\nAm J Public Health\n96\n325\n331\n16380567\n18. MooreLVDiez RouxAVNettletonJAJacobsDRJr\n2008\nAssociations of the Local Food Environment with Diet Quality–A Comparison of Assessments based on Surveys and Geographic Information Systems: The Multi-Ethnic Study of Atherosclerosis.\nAm J Epidemiol\n19. HillJO\n2006\nUnderstanding and addressing the epidemic of obesity: an energy balance perspective.\nEndocr Rev\n27\n750\n761\n17122359\n20. ZhengHBerthoudHR\n2007\nEating for pleasure or calories.\nCurr Opin Pharmacol\n7\n607\n612\n18037344\n21. BerthoudHR\n2007\nInteractions between the “cognitive” and “metabolic” brain in the control of food intake.\nPhysiol Behav\n91\n486\n498\n17307205\n22. WingRRGoldsteinMGActonKJBirchLLJakicicJM\n2001\nBehavioral science research in diabetes: lifestyle changes related to obesity, eating behavior, and physical activity.\nDiabetes Care\n24\n117\n123\n11194216\n23. EggerGSwinburnB\n1997\nAn “ecological” approach to the obesity pandemic.\nBmj\n315\n477\n480\n9284671\n24. RavussinEBogardusC\n2000\nEnergy balance and weight regulation: genetics versus environment.\nBr J Nutr\n83\nSuppl 1\nS17\n20\n10889787\n25. HalesCNBarkerDJ\n1992\nType 2 (non-insulin-dependent) diabetes mellitus: the thrifty phenotype hypothesis.\nDiabetologia\n35\n595\n601\n1644236\n26. HalesCNBarkerDJ\n2001\nThe thrifty phenotype hypothesis.\nBr Med Bull\n60\n5\n20\n11809615\n27. GluckmanPDHansonMAPinalC\n2005\nThe developmental origins of adult disease.\nMatern Child Nutr\n1\n130\n141\n16881892\n28. BellingerLLangley-EvansSC\n2005\nFetal programming of appetite by exposure to a maternal low-protein diet in the rat.\nClin Sci (Lond)\n109\n413\n420\n15992360\n29. BellingerLLilleyCLangley-EvansSC\n2004\nPrenatal exposure to a maternal low-protein diet programmes a preference for high-fat foods in the young adult rat.\nBr J Nutr\n92\n513\n520\n15469656\n30. BellingerLSculleyDVLangley-EvansSC\n2006\nExposure to undernutrition in fetal life determines fat distribution, locomotor activity and food intake in ageing rats.\nInt J Obes (Lond)\n30\n729\n738\n16404403\n31. ErhumaASalterAMSculleyDVLangley-EvansSCBennettAJ\n2007\nPrenatal exposure to a low-protein diet programs disordered regulation of lipid metabolism in the aging rat.\nAm J Physiol Endocrinol Metab\n292\nE1702\n1714\n17299084\n32. Langley-EvansSCBellingerLMcMullenS\n2005\nAnimal models of programming: early life influences on appetite and feeding behaviour.\nMatern Child Nutr\n1\n142\n148\n16881893\n33. ArmitageJATaylorPDPostonL\n2005\nExperimental models of developmental programming: consequences of exposure to an energy rich diet during development.\nJ Physiol\n565\n3\n8\n15695245\n34. McMillenICEdwardsLJDuffieldJMuhlhauslerBS\n2006\nRegulation of leptin synthesis and secretion before birth: implications for the early programming of adult obesity.\nReproduction\n131\n415\n427\n16514185\n35. McMillenICMuhlhauslerBSDuffieldJAYuenBS\n2004\nPrenatal programming of postnatal obesity: fetal nutrition and the regulation of leptin synthesis and secretion before birth.\nProc Nutr Soc\n63\n405\n412\n15373950\n36. MuhlhauslerBSAdamCLFindlayPADuffieldJAMcMillenIC\n2006\nIncreased maternal nutrition alters development of the appetite-regulating network in the brain.\nFaseb J\n20\n1257\n1259\n16684802\n37. MorenoLARodriguezG\n2007\nDietary risk factors for development of childhood obesity.\nCurr Opin Clin Nutr Metab Care\n10\n336\n341\n17414504\n38. ClarkHRGoyderEBissellPBlankLPetersJ\n2007\nHow do parents' child-feeding behaviours influence child weight? Implications for childhood obesity policy.\nJ Public Health (Oxf)\n29\n132\n141\n17442696\n39. LewisSRAhmedSDymCKhaimovaEKestB\n2005\nInbred mouse strain survey of sucrose intake.\nPhysiol Behav\n85\n546\n556\n15996693\n40. SurwitRSFeinglosMNRodinJSutherlandAPetroAE\n1995\nDifferential effects of fat and sucrose on the development of obesity and diabetes in C57BL/6J and A/J mice.\nMetabolism\n44\n645\n651\n7752914\n41. SurwitRSKuhnCMCochraneCMcCubbinJAFeinglosMN\n1988\nDiet-induced type II diabetes in C57BL/6J mice.\nDiabetes\n37\n1163\n1167\n3044882\n42. WestDBBoozerCNMoodyDLAtkinsonRL\n1992\nDietary obesity in nine inbred mouse strains.\nAm J Physiol\n262\nR1025\n1032\n1621856\n43. LenoirMSerreFCantinLAhmedSH\n2007\nIntense sweetness surpasses cocaine reward.\nPLoS ONE\n2\ne698\n17668074\n44. FiglewiczDPMacDonald NaleidASipolsAJ\n2007\nModulation of food reward by adiposity signals.\nPhysiol Behav\n91\n473\n478\n17137609\n45. CousinsMSSokolowskiJDSalamoneJD\n1993\nDifferent effects of nucleus accumbens and ventrolateral striatal dopamine depletions on instrumental response selection in rats.\nPharmacology, Biochemistry and Behavior\n46\n943\n951\n46. LevineASKotzCMGosnellBA\n2003\nSugars: hedonic aspects, neuroregulation, and energy balance.\nAm J Clin Nutr\n78\n834S\n842S\n14522747\n47. SumiyoshiMSakanakaMKimuraY\n2006\nChronic intake of high-fat and high-sucrose diets differentially affects glucose intolerance in mice.\nJ Nutr\n136\n582\n587\n16484528\n48. GibsonSA\n1996\nAre high-fat, high-sugar foods and diets conducive to obesity?\nInt J Food Sci Nutr\n47\n405\n415\n8889626\n49. PoppittSDKeoghGFPrenticeAMWilliamsDESonnemansHM\n2002\nLong-term effects of ad libitum low-fat, high-carbohydrate diets on body weight and serum lipids in overweight subjects with metabolic syndrome.\nAm J Clin Nutr\n75\n11\n20\n11756055\n50. SarisWHAstrupAPrenticeAMZunftHJFormigueraX\n2000\nRandomized controlled trial of changes in dietary carbohydrate/fat ratio and simple vs complex carbohydrates on body weight and blood lipids: the CARMEN study. The Carbohydrate Ratio Management in European National diets.\nInt J Obes Relat Metab Disord\n24\n1310\n1318\n11093293\n51. ElizaldeGSclafaniA\n1990\nFat appetite in rats: flavor preferences conditioned by nutritive and non-nutritive oil emulsions.\nAppetite\n15\n189\n197\n2281949\n52. WurtmanJJWurtmanRJ\n1979\nSucrose consumption early in life fails to modify the appetite of adult rats for sweet foods.\nScience\n205\n321\n322\n451607\n53. BerridgeKCRobinsonTE\n2003\nParsing reward.\nTrends Neurosci\n26\n507\n513\n12948663\n54. BindraD\n1974\nA motivational view of learning, performance, and behavior modification.\nPsychol Rev\n81\n199\n213\n4424766\n55. FultonSPissiosPManchonRPStilesLFrankL\n2006\nLeptin regulation of the mesoaccumbens dopamine pathway.\nNeuron\n51\n811\n822\n16982425\n56. HommelJDTrinkoRSearsRMGeorgescuDLiuZW\n2006\nLeptin receptor signaling in midbrain dopamine neurons regulates feeding.\nNeuron\n51\n801\n810\n16982424"
+}

batch_2/PMC2529406.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2529406",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2529406\nAUTHORS: Amy Murphy, Scott T. Weiss, Christoph Lange\n\nABSTRACT:\nFor genome-wide association studies in family-based designs, we propose a powerful two-stage testing strategy that can be applied in situations in which parent-offspring trio data are available and all offspring are affected with the trait or disease under study. In the first step of the testing strategy, we construct estimators of genetic effect size in the completely ascertained sample of affected offspring and their parents that are statistically independent of the family-based association/transmission disequilibrium tests (FBATs/TDTs) that are calculated in the second step of the testing strategy. For each marker, the genetic effect is estimated (without requiring an estimate of the SNP allele frequency) and the conditional power of the corresponding FBAT/TDT is computed. Based on the power estimates, a weighted Bonferroni procedure assigns an individually adjusted significance level to each SNP. In the second stage, the SNPs are tested with the FBAT/TDT statistic at the individually adjusted significance levels. Using simulation studies for scenarios with up to 1,000,000 SNPs, varying allele frequencies and genetic effect sizes, the power of the strategy is compared with standard methodology (e.g., FBATs/TDTs with Bonferroni correction). In all considered situations, the proposed testing strategy demonstrates substantial power increases over the standard approach, even when the true genetic model is unknown and must be selected based on the conditional power estimates. The practical relevance of our methodology is illustrated by an application to a genome-wide association study for childhood asthma, in which we detect two markers meeting genome-wide significance that would not have been detected using standard methodology.\n\nBODY:\nIntroductionRecent advances in mapping array technology and the increasing content from SNP databases [1],[2] have expanded the capacity for large-scale genotyping. With mapping arrays for more than one million SNPs now available [3],[4],[5],[6], genome-wide association studies carry the promise of identifying replicable associations between important genetic risk factors and complex diseases. One of the major hurdles that needs to be addressed in order to make genome-wide association studies successful is the multiple comparison problem. Hundreds of thousands of SNPs are genotyped and examined for potential associations with multiple phenotypes, resulting in possibly millions of statistical tests. The small number of SNPs that contain “true” signals must be identified among the thousands of false-positive results. The success of genome-wide association studies will depend upon whether it will be possible to overcome this obstacle and translate the increase in genotype information into the identification of novel disease loci, or whether the increased genetic information will be diluted by the multiple testing problem.A brute-force way to address the multiple comparison problem is to design studies with sample sizes large enough to test all genotyped SNPs with standard association tests and adjust for multiple comparison using the Bonferroni correction [7]. However, while sample sizes of several thousand subjects will certainly be feasible for common phenotypes (e.g., BMI, height), such a strategy carries the risk that the increase in sample size is accompanied by an increase in study heterogeneity, mitigating the positive effects of a larger sample size. Further, for many diseases, recruiting the theoretically required sample size may not be feasible, prohibited either by the costs for recruitment or phenotype assessment, or by the prevalence of the disease. An alternative approach is to develop novel statistical methodology to address the multiple comparison problem with realistic sample sizes.For the analysis of quantitative traits in family-based designs, Van Steen et al. [8] proposed a new class of two-stage testing strategies that uses the same data set twice, first for genomic screening and then for genetic association testing. The approach proved to be a very powerful way to address the multiple testing problem in genetic association studies [8],[9],[10],[11]. Van Steen type testing strategies take advantage of a unique property of family-based data in that it can be partitioned into two statistically independent components. By exploiting the information about the genetic association that is not used in the second stage when the association tests are computed, the first stage prioritizes “promising” SNPs for the second stage.Van Steen type testing strategies have three key advantages: 1.) The method achieves statistical power levels which can be substantially higher than those of standard approaches [8],[9], and is thereby able to establish genome-wide significance within one study [8],[9],[10],[11]. 2.) The Van Steen algorithm maintains the separation between the multiple testing problem and the replication process. Replication attempts in different studies are reserved for the generalization of the established associations and assessment of heterogeneity between study populations. 3.) Since genome-wide significance is established in the first data set, the number of SNPs that are pushed forward for replication testing in other populations is generally very small and does not require a large budget, which makes simultaneous replication attempts in multiple samples feasible.Although the approach has recently been significantly improved and now allows family studies to achieve power levels that are comparable to population-based studies with the same number of probands [9], its applicability is limited. While extensions of the testing strategy are available for arbitrary family structures and for case/control designs [10],[11], the approach cannot be applied in situations in which there is no phenotypic variation in the phenotypes of the probands, i.e., all probands are affected with the disease or trait of interest. This prevents the utilization of the approach in trio designs (i.e., affected probands and their parents). Since this original trio/TDT design is frequently used, this limitation of the testing strategy poses a major disadvantage for family-based designs.In this manuscript, we propose an extension of Van Steen type testing strategies to family-based designs in which all probands are affected. The strategy also uses the same data set for both stages, which we will refer to as the rank-weighting step and the testing step. In the first stage of the testing strategy, the genetic relative risk effect sizes are estimated for each SNP. We show that it is possible to derive four estimating equations that depend only on the observed parental mating types, but not on any unknown parameters. The estimating equations can be solved analytically, allowing for the construction of effect size estimators that do not depend on the marker allele frequency or offspring genotypes. This is in contrast to effect size estimators/association test statistics for study designs with only affected subjects in population-based studies [12],[13],[14], where the allele frequency must be specified.Based on the genetic effect size estimates obtained from the estimating equations, we compute the conditional power of the FBAT/TDT for all SNPs. The relative rank of the SNPs by conditional power is then used in a weighted Bonferroni approach [9] to assign each SNP an individually adjusted significance level. The weights are constructed so that the overall type-1 error is maintained. In the second step of the testing strategy, the FBAT/TDT statistic is computed for each SNP and genome-wide significance is established based on its individually adjusted significance level.Using extensive simulation studies, the statistical power of the testing strategy is assessed for over a range of genetic effect sizes, different numbers of trios, when the mode of inheritance is known and unknown, and in the absence and presence of linkage disequilibrium (LD). The practical relevance of the approach is illustrated by an application to a genome-wide association study of childhood asthma.MethodsAn Overview of Partitioning Family-Based Data into Independent ComponentsVan Steen testing strategies for genome-wide association studies partition the data set into two statistically independent, but overlapping parts [8],[9],[10],[11],[15],[16]. In family-based designs, the first component contains information about the SNP-trait association at a population level, which is assessed based on the proband's phenotype, Y, and the parental genotypes, P\n1, P\n2\n[15],[17]. In our application, we use the offspring phenotype and parental genotypes to construct effect size estimates of the genetic relative risk. The second component of the data characterizes the SNP-trait association at the family level, i.e., the allele transmissions from the parents to their offspring [18],[19],[20]. Family-based association tests such as the TDT or FBAT are therefore conditional tests that treat the offspring genotype, X, as random, conditioning upon the offspring phenotype, Y, and the parental genotypes P\n1, P\n2. The evidence for SNP-trait association is evaluated by comparing the observed offspring genotype with the expected offspring genotype, which are computed by conditioning upon the parental genotypes, assuming Mendelian transmissions. Since the offspring genotype is the only random component of the FBAT/TDT statistic, the implication is that other information in the FBAT/TDT statistic (i.e., the offspring phenotype and parental genotypes) may be used to assess the evidence for association without biasing the significance level of the FBAT/TDT statistic.Based on the two information sources about association in family-based designs, the density of the joint distribution for X, Y, and P\n1, P\n2 can then be partitioned into two statistically independent components [21],(1)Since the density for the first step of the testing strategy, the rank-weighting step, is given by p(Y, P\n1, P\n2), and the density of the second step, the FBAT/TDT testing step, is p(X|P\n1, P\n2, Y), likelihood decomposition (Equation 1) implies that the two steps of the testing strategy are independent. The “evidence of association” (i.e., the genetic effect size estimate) for each marker from the rank-weighting step can be utilized in the second stage without having to adjust the overall significance level for the estimation of the genetic effect size in the first stage. There are various ways in which the information from the rank-weighting step can inform the application of the FBAT/TDT statistic in the second step. The effect size estimate from the screening step can be used to select a small subset of “very promising” markers for FBAT/TDT testing [8] or to assign each marker with an individual significance level that reflects the rank of the marker's effect size estimate relative to the other markers [9]. Another possibility is to have the information from the screening step define the “tuning parameters” of the FBAT statistic [22],[23].The Rank-Weighting Step: Estimating the Power of the FBAT Statistic under HA When Trio Data Are Given and All Probands Are AffectedWe assume that trios are given (i.e., affected probands and parents), and that SNP data are analyzed. If the parental data are missing/unavailable, the parental genotypes can be replaced in all equations below by the sufficient statistic by Rabinowitz & Laird [18],[19]. The sufficient statistic for each nuclear family is defined by all family configurations that lead to consistent inference about the missing parents, given the observed genotypes. When parental data are given, the parental genotypes represent the sufficient statistic. Like the parental genotypes, the sufficient statistic allows for the computation of the offspring genotype distribution within each family, independent of the unknown allele frequency. For a more detailed discussion, we refer to the original paper [18].For each marker locus of interest, let xi be the coded genotype of the i\nth proband, counting the number of minor alleles for the SNP of interest. The variables pi\n1 and pi\n2 denote the parental genotypes for both parents at the locus. The phenotype of the i\nth proband is defined by yi. For trio samples in which all probands are affected, the phenotype is coded as “y = 1”. The FBAT statistic, , [19],[20] is then given by:(2)and has a chi-square distribution with one degree of freedom. Assuming an additive coding function for the genotype, this FBAT statistic and the original TDT statistic [20] are equivalent.In order to develop a Van Steen type testing strategy [15],[16] for the classical TDT design, the conditional power [22],[24] of the FBAT/TDT statistic, , has to be computed in the first step of the testing strategy. This requires the specification of the conditional marker density under the alternative hypothesis:(3)where affected probands are coded as “yi = 1”. The parameter fx denotes the penetrance probability (i.e., fx = Pr(yi = 1|x)), and Ψx, the genotype relative risk (i.e., Ψx = fx/f\n0). The probability Pr(x|pi\n1, pi\n2) is defined by Mendelian transmission and can be computed straightforwardly, conditional on parental genotypes, without any additional knowledge/assumptions. The penetrance probabilities  are unknown and have to be estimated based on the information that is available in the rank-weighting step, i.e., the offspring phenotype and the parental genotypes.In the original Van Steen approach [8], the parental genotypes are used to compute the expected/predicted marker scores of the offspring. By regressing the offspring phenotype on its expected marker score, an estimate for the genetic effect size is obtained that allows us to specify the penetrance probability, Pr(yi = 1|xi) [15],[16]. However, when there is no phenotypic variation in the data (i.e., all probands are affected), this approach is not applicable and an alternative approach has to be developed. In order to simplify the notation, our derivation will be based on the parameterization of the marker distribution (Equation 3) in terms of the genotype relative risks, Ψx.Due to the lack of variation in the phenotype, the only variation that can be utilized for the estimation of the relative risk probabilities are the parental genotypes. In the trio design, there are six distinct parental mating types: (p\n1 = 2, p\n2 = 2), (p\n1 = 2, p\n2 = 1), (p\n1 = 2, p\n2 = 0), (p\n1 = 1, p\n2 = 1), (p\n1 = 1, p\n2 = 0) and (p\n1 = 0, p\n2 = 0), where 0, 1, and 2 denote the number of copies of the minor allele for the marker of interest. The frequencies of the parental mating types in the ascertained sample (yi = 1) can be computed using Bayes' rule,(4)where the parameter, p, denotes the minor allele frequency for the marker in the general population, and again, as above, the probabilities  are defined by Mendelian transmissions. The probabilities Pr(p\n1 = k, p\n1 = l) are the paternal mating type frequencies in the general population, and k and l are given by one of the six distinct mating types defined above. Under the assumption of random mating and Hardy-Weinberg equilibrium at the marker locus in the general population, the probabilities Pr(p\n1 = k, p\n1 = l) will be defined by the actual mating type and the minor allele frequency, p.Based on these assumptions, the likelihood of the parental mating types in the ascertained sample is given by , where the probability of a mating type is denoted as  and the observed number of mating types is . In order to obtain maximum likelihood estimates for the genotype relative risks Ψ1 and Ψ2, one has to maximize the likelihood function l(Ψ1, Ψ2, p) over all unknown parameters, i.e., the genotype relative risks, Ψ1 and Ψ2, and the minor allele frequency of the marker, p. However, due to the structure of the likelihood function, the Fisher information matrix is ill conditioned [25] and a numerical solution of the likelihood maximization is non-trivial. This is particularly challenging in the context of genome-wide association studies in which the numerical implementation must be fast and reliable. In addition to the technical issues related to the likelihood maximization, the estimation of the allele frequency at the marker locus is also problematic in the presence of population admixture.To avoid issues related to the estimation of the allele frequency, we will construct estimators for the genotype relative risks, Ψ1 and Ψ2, that are independent of the minor allele frequency, p, and have a closed analytical form, facilitating a numerically fast and robust implementation in genome-wide association studies. We consider the following four possible ratios of parental mating types:(5)Under the assumption of Hardy-Weinberg equilibrium in the general population, using (Equation 4), the minor allele frequency, p, drops out of the mating type ratios, and one can show that the ratios R\n1, R\n2, R\n3, and R\n4 are given by:(6)\nIt is important to note that the four ratios R\n1, R\n2, R\n3, and R\n4 do not depend on the unknown minor allele frequency, p, and can be estimated based on the parental genotypes, e.g., . It is also important to note that, if a likelihood approach for the parental mating types had been implemented, the minor allele frequency, p, would have to be estimated.If a genetic model is specified (e.g., under an additive mode of inheritance, Ψ1 = (1+Ψ2)/2), each equation in (Equation 6) will depend only on one unknown genotype relative risk parameter. Each equation can then be solved for the unknown parameter and four estimates for the genotype relative risk are obtained. Alternatively, an overall effect size estimate can be constructed by averaging over all four estimates for the genetic effect size. The selected estimate for the genotype relative risk can then be used to calculate the marker distribution under the alternative hypothesis (Equation 3), which is the final component needed in calculating the conditional power of the FBAT/TDT statistic. Using simulation studies, we will assess which of the four ratios (or the average) for the proposed testing strategy generally achieves the highest and most stable power estimates.Since the proposed estimators for the genotype relative risk only depend on the parental genotypes, they fulfill the decomposition condition (Equation 1) and can be used in the rank-weighting step of the testing strategy without biasing the significance level of the FBAT/TDT statistic in the second stage. The independence of the mating type ratios from the allele frequency makes the approach particularly attractive in the presence of population admixture.While we have outlined the concept of genotype relative risk estimation in the context of ascertained family samples for the trio designs, the genetic effect size estimators can be constructed in the same way for more complex nuclear family structures. Using the algorithm by Rabinowitz & Laird [18], all possible parental mating types can be derived for nuclear families with missing parental information and/or multiple offspring. The mating type probabilities can then be computed based on Bayes' rule, as for the trio design (Equation 4). By examining all possible mating type ratios, the ratios that depend only on the genotype relative risk, but not on the allele frequency, can be identified and used to construct direct estimators of the genetic effect size. While we are not able to provide a general rule of thumb on how to construct mating type ratios that do not depend on the allele frequency other than to evaluate all possible ratios, such ratios appear to exist for most nuclear family-types. Since the identification process of the suitable mating type ratios can be automated by using software packages such as Maple and Mathematica, the proposed concept of genotype relative risk estimation is not specific to the trio design and should be applicable to general nuclear family-types.It is important to note that the proposed genetic effect size estimators are derived under the assumption of Hardy-Weinberg equilibrium at the marker locus in the general population, but not in the ascertained sample. Since it is common practice to filter out SNPs that are strongly out of Hardy-Weinberg equilibrium when the genotype data are cleaned prior to analysis, only SNPs with mild to moderate violations of the Hardy-Weinberg assumption will reach the association analysis step. The effects of SNPs with Hardy-Weinberg violations on the proposed testing strategy are thereby limited. However, the genetic effect size estimation in the first step will be biased for such SNPs. In the presence of SNPs that are out of Hardy-Weinberg equilibrium and that are not associated with affection status, the proposed testing strategy is likely to have reduced power. If the Hardy-Weinberg assumption does not hold at the disease susceptibility locus (DSL), the power of the proposed testing strategy can be either increased or decreased, depending on whether the signal that is caused by the true genetic effect at the DSL locus is amplified by the Hardy-Weinberg violation or not. Further, it is important to note that, while violations of the Hardy-Weinberg assumption will have an effect on the rank-weighting step, the validity of the FBAT/TDT-testing step and, consequently, the validity of the entire approach will not be affected by departures from Hardy-Weinberg.The Testing Step: Testing for Family-Based Association with Weighted Bonferroni Significance LevelsIn the first phase of the testing strategy, the genetic effect size estimates for each marker are used to compute the conditional power at each locus, and all markers are ranked by power. A weighted Bonferroni approach [9] is implemented that assigns individual significance levels, denoted as αi, to each marker locus based on its conditional power ranking. Essentially, αi is the type 1 error apportioned to the i\nth test on the basis of its power ranking relative to all of the other tests. The individual significance levels are selected so that the overall significance level is maintained, e.g., . Using the FBAT/TDT statistic, each marker is then tested in the second stage at the individual significance level αi, and its association with affection status is declared as genome-wide significant if its FBAT/TDT statistic p-value is less than the individual significance level αi.In order to determine the individual significance levels αi, we must select a weighting scheme to apply to the weighted Bonferroni method [9]. Essentially, the weighted Bonferroni method partitions the SNPs into bins and assigns each bin a weight, where the bin and weight sizes vary depending on the relative power ranking of the SNPs in the bin. Each SNP within a bin is assigned an equal weight, which represents a fraction (or individual significance level, αi) of the overall significance level, α. Many different weighting schemes to select bin/weight sizes may be applied, as long as α is maintained. We selected an exponential weighting scheme, which uses weights that decrease exponentially and bin sizes that increase exponentially as the power rankings decrease [9]. To define the exponential weighting scheme, let kj be the size of the jth partition, and let k and r be user-defined partitioning parameters with an integer value. Then the sizes of the subsequent partitions can be defined by k\n1 = k and kj = k*r\n(j−1). The exponential weight, wj, for the jth bin is given by , with . Finally, the individual significance level for the jth partition/bin is . With these parameter specifications, it is straightforward to see that , thus the overall alpha level is maintained. Further discussion of the weighted Bonferroni method and weighting schemes is given in Ionita-Laza et al. [9]. The optimal choices for the initial partition size k and the partitioning parameter r will be determined by simulation studies.Simulation StudiesUsing simulation studies, we compare the proposed testing strategy to the standard approach, FBAT/TDT testing with Bonferroni corrected p-values. Both approaches are contrasted under various scenarios with differing trio sample sizes and minor allele frequencies. We simulate trio data under the assumption that all offspring are affected and the genotypes of both parents are known. The minor allele frequencies are drawn from β distributions that resemble the 550 K Illumina HumanHap array.The data were simulated under two separate scenarios. In the first scenario, independence among all markers (i.e., no linkage disequilibrium (LD)) is assumed. In the second scenario, we simulated local LD between the SNPs. In order to obtain realistic local LD patterns, we utilized a 550 K scan in the CAMP study (see Data Analysis section) that consists of 400 trios. Based on the observed local LD patterns in CAMP, we simulated the correlated SNPs for the second scenario. Specifically, we applied a ‘moving window’ algorithm, where the observed correlation (r\n2) between the SNP to be simulated and the SNP immediately preceding the SNP that is simulated (in terms of physical location) was used to recapitulate local LD patterns on a genome-wide scale.In each simulation, one locus/SNP is assumed to be the DSL, while the other SNPs that are not in LD with the DSL are considered null loci. For the null loci, under the independence scenario, the parental genotypes are generated by drawing from a Binomial distribution with the selected marker's minor allele frequency. When SNPs are correlated, the moving window approach described above is used to generate parental genotypes. Based on the parental genotypes, the offspring genotype is obtained by simulated Mendelian transmissions from the parents. At the DSL, the configuration of genotypes in the proband and parents is simulated based on their theoretical distribution under the specified alternative hypothesis, as outlined in Knapp [26] and Lange & Laird [22],[24].For the considered scenarios, we assessed the performance of the proposed approach when the genetic effect size is estimated either based on one of four mating type ratios (R1–R4, Equation 6) or by the average of the four estimates. In simulation studies comparing the performance of the estimators (data not shown), we observed that the genotype relative risk estimator based on equation R4 consistently generated the highest power estimates (for minor allele frequencies (MAFs) >0.1), and was stable, even with modest effect sizes (e.g., OR = 1.25) and lower allele frequencies (e.g., MAF≤0.2). Thus, all estimated power levels for the proposed method that are shown here are based on the genotype relative risk estimator for mating type ratio R4.In the first set of simulations, we assume an additive mode of inheritance at the DSL. The genetic effect size is defined in terms of an odds ratio and ranges between 1.25 and 2.5, depending on the number of trios. A disease prevalence (K) of 10% is selected throughout the simulations. The trio sample size varies between 500–2000 trios. To accurately depict the degree of LD between markers, 500,000 markers are simulated. Under the independence scenario, the power was assessed as the proportion of replicates where the FBAT test statistic p-value was less than the required weighted Bonferroni alpha level, based on its power ranking from the rank-weighting step. Under the LD scenario, the power was computed in two ways. First, we defined a positive result identically to the procedure used for the independence scenario (i.e., a significant result for the DSL only). Secondly, we more broadly defined a positive result to include a significant finding in the DSL or in any markers in strong LD (r\n2>0.8) and within the same physical region, (i.e., within five SNPs) with the DSL. For the standard Bonferroni correction, power was defined as the proportion of replicates with an FBAT statistic p-value<10−7 (i.e., 0.05/500,000).Estimated Power Levels for n = 500–2000 Trios, under an Additive Genetic ModelThe results of the first set of simulations are displayed in Table 1. The number of trios is presented in column 1 and the odds ratio (OR) for the DSL is specified in column 2. The minor allele frequency (MAF) of the DSL is displayed in Column 3. Columns 4, 6, and 8, denoted as “Weighted,” present the power estimates using the weighted Bonferroni method by Ionita-Laza et al. [9], with an exponential weighting scheme and partitioning parameters of K = 7 and r = 2. The choice of K = 7 and r = 2 tended to have the highest power among a range of partitioning (K = 3–10, r = 2–5) parameters, although decreases in power were minimal within these ranges (data not shown). Columns 5, 7, and 9, denoted as “Standard,” display the results for the standard approach in which all SNPs are equally weighted when applying the Bonferroni correction, and a significance level of 10−7, (i.e., 0.05/500,000) is required for genome-wide significance. Columns 4–5 (Independence scenario”) reflect the scenario in which all markers are independent (i.e., adjacent r\n2 = 0). Columns 6–9 (“LD scenario”) display the power estimates when LD is present among markers, where the power represents either detecting the DSL only (Column 6–7), or the DSL/markers in strong LD with the DSL (Columns 8–9). The power estimates are based on at least 1,000 replicates for each (DSL) minor allele frequency and odds ratio.10.1371/journal.pgen.1000197.t001Table 1Power for 500–2000 trios and 500K markers, using mating type ratio equation R4, under an additive genetic model.NumberOddsMAFIndependence scenarioLD scenario (DSL only)LD scenario (DSL+)of TriosRatioWeightedStandardWeightedStandardWeightedStandard\n2000\n1.250.10.0660.0030.0420.0010.1270.0170.20.2410.0390.1680.0120.3910.1470.30.2950.0890.2030.0310.5130.3000.40.2700.1290.1650.0480.5040.3661.3750.10.2260.0780.1540.0330.3710.1950.20.5910.3880.4540.2120.8000.6650.30.7440.5910.5900.3970.9210.8570.40.7640.6660.5910.4650.9300.8931.50.10.5170.3570.3900.2250.7220.6040.20.9080.8460.8270.7030.9850.9640.30.9760.9520.9310.8740.9950.9920.40.9790.9690.9400.9020.9970.995\n1000\n1.50.10.1000.0320.0720.0180.1700.0840.20.3540.1890.2710.1130.5200.3520.30.4700.3360.3600.2200.6670.5550.40.4560.3710.3330.2480.6600.5711.750.10.4380.3240.3450.2360.5810.4880.20.8590.7770.7700.6580.9400.9010.30.9320.8960.8810.8190.9760.9600.40.9360.9040.8810.8390.9760.96420.10.8250.7590.7500.6690.9180.8760.20.9920.9850.9840.9700.9990.9970.30.9980.9960.9940.9901.0001.0000.40.9970.9950.9940.9890.9980.997\n500\n20.10.1840.1280.1320.0850.2760.2050.20.5730.4800.4900.3820.6930.6060.30.7110.6280.6350.5380.8050.7400.40.6650.5900.5910.5050.7710.7072.250.10.4470.3500.3670.2780.5510.4730.20.8490.7870.7970.7200.9160.8780.30.9050.8680.8690.8110.9540.9280.40.8940.8560.8490.8050.9340.9002.50.10.6940.6120.6240.5420.7930.7290.20.9570.9340.9350.8950.9810.9670.30.9780.9640.9660.9430.9910.9820.40.9650.9490.9450.9190.9830.975Estimated power levels to detect the DSL using 500–2000 trios, assuming a 10% disease prevalence and additive mode of inheritance. The significance level is set to 5%. For the weighted Bonferroni method (Weighted), the partitioning parameters are K = 7 and r = 2. MAF denotes minor allele frequency. The power reflects the proportion of times the p-value of the DSL (Independence scenario and LD scenario (DSL only)) or a SNP in LD with the DSL (LD scenario (DSL+)) met the weighted Bonferroni (Weighted) or standard Bonferroni corrected (Standard) significance level. The standard Bonferroni correction adjusts for 500 K comparisons.For genome screens of 500 K SNPs, regardless of the sample size or degree of correlation among markers, the use of power-driven weights from the rank-weighting step shows a considerable improvement in power over the standard methodology. For the lowest power estimates (<40% power for the standard Bonferroni), the power estimates for the weighted method are typically at least twofold greater than the standard approach. For low to moderate power estimates, (40–70% power for Bonferroni), the weighted method outperforms the standard correction by to 15–40%. For SNPs with greater than 70% power with the standard approach, the improvement ranges between 7 and 11%, unless the power estimates are near one. However, even in these scenarios, the power estimates for the weighted Bonferroni method are always higher, though the differences between the two methods are more modest.With respect to trio sample size, we note that even with smaller sample sizes (e.g., n = 500), there is still power to detect a DSL (or SNP in LD with the DSL), and the power gains over standard Bonferroni correction are maintained, although a more pronounced effect size is required (OR = 2.25–2.5) to achieve adequate power. Based on the results of our simulation studies, we would not recommend genome-wide association studies of fewer than 300 trios unless extremely large effect sizes (OR>3) were anticipated.To verify that the proposed testing strategy maintains the overall alpha level, the simulations were repeated under the null hypothesis of no linkage/no association, with a sample size of 500 trios. Based on over 10,000 replicates, the observed overall type 1 error rate was maintained at 4.66%.Finally, in examining the impact that LD has on power, when considering a positive finding to be the detection of the DSL only, the power of the approach was slightly reduced in comparison to the scenario in which the SNPs were independent. However, the proposed testing strategy still outperforms the standard approach by differences that are of practical relevance. When the definition of a positive finding is extended to those SNPs that are in LD with the DSL, the power estimates are higher than the independence scenario. This is a significant finding, given that some array platforms for genome-wide genotyping do not employ LD-tagging methods, and as chip density increases (i.e., one million SNP arrays), linkage disequilibrium will have a greater impact on the analysis of genome-wide association studies.Estimated Power Levels for n = 2000 Trios, When the Genetic Model Is UnknownSince in practice the underlying mode of inheritance is unknown, we ran a second set of simulations to reflect this reality and assess the impact on the power of the proposed method and the standard approach. In the data analysis step of the following simulation, the true genetic model was considered to be “unknown.” We simulated three scenarios, where the true (but unknown) generating model was either additive, dominant, or recessive, and conducted separate FBAT analyses under all three genetic models. To evaluate the power for the weighted Bonferroni method [9], we estimated the conditional power for each SNP under all three genetic models. For each SNP, the result for the genetic model with highest power was selected and the lower powered results (without evaluating the FBAT statistic p-value) were discarded. This resulted in 500,000 SNPs/power estimates across the three genetic models, that were ranked overall by power and evaluated for association using weighted Bonferroni significance levels. The weighted Bonferroni significance levels were computed in the same way as previously described. We then compared the power obtained from the weighted method to standard Bonferroni correction, which computed the FBAT statistic under all three genetic models at each SNP, thus requiring a correction for 1.5 million comparisons (500,000 markers * 3 genetic models) and an FBAT p-value <3.3×10−8 for significance (i.e., 0.05/1,500,000). For simplicity, we ran these simulations for 2000 trios.The results of the second set of simulations are displayed in Table 2. The data are presented in an identical format to the simulations under the additive model (including partitioning parameters of K = 7 and r = 2), except that column 1 reflects the “true” underlying genetic model rather than the number of trios.10.1371/journal.pgen.1000197.t002Table 2Power for 2000 trios and 500K markers, using mating type ratio equation R4, under an “unknown” genetic model.True Gen.OddsMAFIndependence scenarioLD scenario (DSL only)LD scenario (DSL+)ModelRatioWeightedStandardWeightedStandardWeightedStandard\nAdd.\n1.250.10.0330.0010.0190.0000.0740.0050.20.1400.0080.0850.0020.2650.0550.30.1750.0220.1090.0070.3200.1220.40.1370.0290.0830.0070.3050.1741.3750.10.1400.0260.0980.0080.2560.0920.20.4140.1710.3160.0850.6230.4300.30.5370.3320.3730.1660.7770.6440.40.5320.4040.3760.2410.7930.7111.50.10.3540.1830.2810.1070.5460.3850.20.7900.6460.6690.4660.9280.8760.30.9100.8440.8020.6940.9840.9670.40.9160.8780.8170.7420.9850.973\nDom.\n1.50.10.2070.0990.1350.0530.3600.2300.20.3760.2570.2710.1540.5970.4900.30.3060.2180.2000.1290.5220.4430.40.1450.1040.0720.0460.2630.2041.750.10.7600.6900.6420.5480.8960.8560.20.9370.9100.8620.8080.9880.9790.30.9060.8680.8210.7580.9670.9510.40.6930.6240.5770.5030.8300.78420.10.9890.9840.9700.9591.0000.9990.21.0000.9990.9990.9991.0001.0000.30.9970.9950.9930.9920.9990.9980.40.9650.9500.9350.9110.9870.982\nRec.\n20.10.0020.0000.0020.0000.0020.0000.20.0110.0050.0080.0030.0190.0070.30.2170.1650.1470.1040.3350.2670.40.7670.7230.6570.5980.8870.8672.250.10.0030.0000.0020.0000.0060.0000.20.0390.0140.0290.0100.0570.0290.30.5620.4630.4500.3730.7040.6200.40.9710.9590.9490.9270.9910.9852.50.10.0050.0000.0040.0000.0070.0000.20.1030.0530.0680.0360.1550.0870.30.8500.7840.7830.7090.9260.8840.40.9970.9950.9950.9911.0001.000Estimated power levels to detect the DSL using 2000 trios, assuming a 10% disease prevalence. The significance level is set to 5%. For the weighted Bonferroni method (Weighted), the partitioning parameters are K = 7 and r = 2. “Under True Gen. Model”, Add. refers to the scenario where the true (but “unknown”) model is additive (as the results are analyzed using all three genetic models). Similar scenarios are provided for the dominant (Dom.) and recessive (Rec.) genetic models. MAF denotes minor allele frequency. The power reflects the proportion of times the p-value of the DSL (Independence scenario and LD scenario (DSL only)) or a SNP in LD with the DSL (LD scenario (DSL+)) met the weighted Bonferroni (Weighted) or standard Bonferroni corrected (Standard) significance level. The standard Bonferroni correction adjusts for 1.5 M comparisons (500 K markers * 3 genetic models).For the additive model, in comparison to the simulations where the genetic model is known, the power estimates tend be slightly lower. In the independence scenario, for an odds ratio of 1.5 and MAF of 0.2, when the genetic model is known, the weighted Bonferroni method has 91% power versus 85% for the standard, whereas, when the genetic model is unknown, the power estimates are 80% and 57%, respectively. However, our new method seems much more robust to analysis under multiple models in comparison to the standard correction. For an effect size of 1.5, the power loss in the unknown model ranges from 7 to 15%, depending on MAF, while power loss under the standard method ranges from 15 to 63%. Similar observations are made for the power comparisons between the weighted and standard methods for the LD scenarios. The overall power is reduced relative to the situation where the generating genetic model is known, but the difference in power between the weighted and standard methods is more striking. In comparing the independence scenario to the LD scenarios, the patterns observed when the genetic model is known hold here as well: when LD is present and the DSL or SNPs in LD with the DSL are considered, the power is highest, followed by the independence scenario. The lowest overall power is noted when LD is present and only the DSL is examined for significant association. In summary, while the overall power drops, the benefits of our methodology versus the standard are more pronounced when the genetic model is unknown and multiple analyses are conducted.In comparing our method with weighted Bonferroni significance levels to the standard under dominant and recessive models, our procedure consistently demonstrates greater power, regardless of the degree of LD, effect size, or MAF. However, under a recessive model, a MAF of 0.3 or greater is required to achieve adequate power for the range of effect sizes that we examined (OR =���2–2.5).Overall, our new methodology has the greatest impact for the low to moderately powered markers. For SNPs with standard Bonferroni power estimates ranging between 40% and 70%, the new method generally boosts power by an absolute difference of 10–15%, potentially providing marginally powered SNPs with a better chance of detection.SummaryOur simulation studies illustrate that the application of the proposed testing strategy is not limited by the number of trios analyzed, the degree of correlation among SNPs, the genetic model, or the size of the genetic effect. When standard approaches fail to provide sufficient power, the proposed testing strategy maintains acceptable power levels for small to moderate effect sizes (n = 2000) for the additive generating models, and moderate effect sizes under the dominant or recessive models or designs with fewer trios (n = 500–1000). As a general rule of thumb, our simulation experiments suggest that the testing strategy achieves optimal power levels for partitioning parameters of K = 7 and r = 2 for 500,000 markers, though power estimates were similar for K = 5–10 and r = 2–3. A comparison of the achieved power levels for differing number of trios and various genetic models illustrates that the impact of the multiple testing problem on a genome-wide association study can be minimized by the use of the proposed testing strategy.Data Analysis: A Genome-Wide Screen of Children AsthmaticsAsthma is a complex respiratory disorder, likely due to both genetic and environmental influences that affect the developing respiratory system. Asthma has been shown to have substantial heritability [27],[28],[29] and a comprehensive review of the literature in 2003 reported more than 200 studies with an association between asthma and its related phenotypes [30].Thus, we applied our methodology to a family-based genome-wide association study of asthma. The families were originally recruited through the Childhood Asthma Management Program (CAMP) [31] Genetics Ancillary Study. All of the families were ascertained through asthmatic probands between 5 and 12 years old with mild to moderate asthma. All of the probands are affected, making it impossible to apply methodologies that require phenotype variation.SNP genotyping was performed using Illumina HumanHap 550v3 arrays. Of 547,645 SNPs, 2.5% were removed during data cleaning due to genotype completion rates <95%, parent-offspring Mendelian errors, or because the assay sequence could not be aligned to one genomic locus, which resulted in 534,290 autosomal markers for analysis. Genotyping was conducted on 1215 subjects in 422 families. After removing 43 subjects with inadequate data, 1172 subjects comprising 403 families were analyzed. We applied the new power rank-weighting methodology, under an additive genetic model, to all 534,290 SNP, using equation R4 (Equation 6) to estimate genetic effect sizes, which had consistently had the highest power in the simulation studies. The power rankings were used to individually weight the family-based association test (also assuming an additive model) for each marker, using the method of Ionita-Laza et al. [9]. Table 3 displays the results for the CAMP data analysis. Based on the results of the simulation studies, the partitioning parameters of K = 7 and r = 2 were used.10.1371/journal.pgen.1000197.t003Table 3CAMP results: SNPs meeting genome-wide significance at α = 0.05.MarkerMAFH-W Equil.Num. Info. FamiliesFBAT p-valuePower RankRequired Significance Levelrs108637120.4710.8132750.003210.005rs12944970.4900.8822760.004720.005Results of the CAMP analysis with 402 families, 534,290 SNPs, assuming an additive mode of inheritance. Num. Info. Families indicates the number of families that were informative (i.e., at least one parent was heterozygous) for the marker of interest, and MAF denotes minor allele frequency. Markers with fewer than 20 families were removed from the analysis, as the asymptotic properties required for the test statistic may not hold. The power ranks are obtained from the conditional power of the test, calculated using our new technique with mating type ratio equation R4. The required significance level is obtained using the Ionita-Laza method [9] with K = 7, r = 2, and α = 0.05.From the analysis, two SNPs were identified as genome-wide significant with a global alpha level of 0.05. These SNP were also the top two by power. Thus, the Top K Method by Van Steen et al. [8], with a modest choice of ‘Top’ markers selected for analysis, would have also detected these SNPs. However, the weighted Bonferroni method by Ionita-Laza et al. [9] allows for the evaluation of all SNP. Most strikingly, neither of these SNPs would have been detected after standard Bonferroni [7] or FDR-type [32] correction. These significant markers reside on chromosomes 1 (rs10863712) and 14 (rs1294497). In both markers, the minor allele is over-transmitted to the affected proband. These markers are currently under further study. These results provide proof of concept for our new method in that the top-ranked markers by power also showed evidence of association, strongly suggesting consistency of association in the independent population level and family level components of family-based data.DiscussionWith the current genotyping capabilities, genome-wide association studies have become a reality. In order to utilize the wealth of SNP data obtained in such studies to identify genes for complex diseases, new statistical approaches are needed that can handle the multiple comparisons problem on an increasingly large scale. For population-based studies, multi-stage designs have been suggested. In each stage of the design, the “most promising” SNPs (top 1–10% of all genotyped SNPs) are pushed forward to the next level in which they are genotyped in another sample. Overall significance is established by combining the evidence from all stages into a single analysis. While this is a cost-effective approach, it is not as powerful as genotyping all subjects [33].Testing strategies that use the same data set for genomic screening (i.e., rank-weighting) and testing [8],[9],[10],[11] establish genome-wide significance within one data set. They usually identify only a handful of SNPs (typically fewer than 20) which are then genotyped in other studies in order to generalize the significant findings [34],[35]. In contrast to multi-stage designs, genotyping the identified SNPs in other samples does not serve the purpose of establishing genome-wide significance. The effects of study heterogeneity are thereby limited. However, thus far, such testing strategies have only been available for the small subset of family-based studies in which the primary phenotype is quantitative, but not for the most popular family design, the classical trio design. The lack of phenotypic variation has prevented the genetic effect size estimation by the conditional mean model in the rank-weighting step.In this manuscript, we have developed an approach that makes such testing strategies available for the commonly used TDT design. Our simulation studies show that our method outperforms standard methodology substantially. The effect size estimators that we suggest allow for the assessment of the genotype relative risk at a population level in ascertained family samples. In contrast to association tests for affected-only designs in population-based studies [12],[13],[14], here it is possible to estimate the genetic effect size independent of the unknown allele frequency. While we have discussed only the construction of such effect size estimators for the trio design, the concept of identifying probability ratios of mating types that depend on the genetic effect size, but not on the unknown allele frequency, is generally applicable to all family-based designs.URLThe testing strategy as well as the corresponding power and sample size calculations has been fully implemented in the software package PBAT, which is freely available at http://www.biostat.harvard.edu/˜clange/default.htm\n[36],[37].\n\nREFERENCES:\n1. The International HapMap Consortium\n2005\nA haplotype map of the human genome.\nNature\n427\n1299\n1320\n2. The International HapMap Consortium\n2007\nThe international hapmap consortium: A second generation human haplotype map of over 3.1 million snps.\nNature\n449\n851\n861\n17943122\n3. MatsuzakiHDongSLoiHDiXLiuG\n2004\nGenotyping over 100,000 snps on a pair of oligonucleotide arrays.\nNat Meth\n11\n109\n11\n4. DiXMatsuzakiHWebsterTAHubbellELiuG\n2005\nDynamic model based algorithms for screening and genotyping over 100 k snps on oligonucleotide microarrays.\nBioinf\n21\n1958\n63\n5. GundersonKLKuhnKMSteemersFJNgPMurraySS\n2006\nWhole-genome genotyping of haplotype tag single nucleotide polymorphisms.\nPharmacogenomics\n7\n641\n8\n16768648\n6. WadmaM\n2006\nThe chips are down.\nNature Digest\n444\n256\n7\n7. BonferroniCE\n1937\nTeoria statistica delle classi e calcolo delle probability.\nVolume in Onore di Ricarrdo dlla Volta, Universita di Firenza\n8. Van SteenKMcQueenMBHerbertARabyBLyonH\n2005b\nGenomic screening and replication using the same data set in family-based association testing.\nNat Genet\n37\n683\n691\n15937480\n9. Ionita-LazaIMcQueenMBLairdNMLangeC\n2007\nGenomewide weighted hypothesis testing in family-based association studies, with an application to a 100 k scan.\nAm J Hum Genet\n81\n607\n14\n17701906\n10. FengTZhangSShaQ\n2007\nTwo-stage association tests for genome-wide association studies based on family data with arbitrary family structure.\nEur J of Hum Genet\n15\n1169\n75\n17653107\n11. ZhengGSongKElstonRC\n2007\nAdaptive Two-Stage Analysis of Genetic Association in Case-Control Designs.\nHum Hered\n63\n175\n186\n17310127\n12. FederJNGnirkeAThomasWTsuchihasiZ\n1996\nA novel MHC class I-like gene is mutated in patients with hereditary haemochromatosis.\nNat Genet\n12\n399\n408\n13. NielsenDMEhmMGWeirBS\n1998\nDetecting marker-disease association by testing for hardy-weinberg disequilibrium at a marker locus.\nAmer J Hum Genet\n63\n1531\n40\n9867708\n14. SongKElstonRC\n2003\nTests for a disease-susceptibility locus allowing for an inbreeding coefficient.\nGenetica\n119\n269\n81\n14686606\n15. LangeCDeMeoDSilvermanEKWeissSLairdNM\n2003b\nUsing the noninformative families in family-based association tests: A powerful new testing strategy.\nAm J Hum Genet\n79\n801\n811\n16. LangeCLyonHDeMeoDRabyBSilvermanE\n2003c\nA new powerful non-parametric two-stage approach for testing multiple phenotypes in family-based association studies.\nHuman Heredity\n56\n10\n17\n14614234\n17. LangeCSilvermanEKXuXWeissSLairdNM\n2003a\nA multivariate family-based association test using generalized estimating equations: FBAT-GEE.\nBiostat\n4\n195\n206\n18. RabinowitzDLairdNM\n2000\nA unified approach to adjusting association tests for population admixture with arbitrary pedigree structure and arbitrary missing marker information.\nHum Hered\n50\n211\n223\n10782012\n19. LairdNMHorvathSXuX\n2000\nImplementing a unified approach to family based tests of association.\nGenet Epi\n19\nS36\nS42\n20. SpielmanRSMcGinnisREEwensWJ\n1993\nTransmisson test for linkage disequilibrium: The insulin gene region and insulin-dependent diabetes mellitus (IDDm).\nAm J Hum Genet\n52\n506\n516\n8447318\n21. LairdNMLangeC\n2006\nFamily-based designs in the age of large-scale gene-association studies.\nNat Rev\n7\n385\n394\n22. LangeCLairdNM\n2002a\nOn a general class of conditional tests for family-based association studies in genetics: the asymptotic distribution, the conditional power and optimality considerations.\nGenet Epi\n23\n165\n180\n23. JiangHHarringtonDRabyBABertramLBlackerD\n2006\nFamily-based association test for time-to-onset data with time-dependent differences between the hazard functions.\nGenet Epi\n30\n124\n32\n24. LangeCLairdNM\n2002b\nAnalytical sample size and power calculations for a general class of family-based association tests: Dichotomous traits.\nAm J Hum Genet\n71\n575\n584\n12181775\n25. DeuflhardPHohmannA\n1993\nNumerische Mathematik I, Eine algorithmisch orientierte Einfuehrung.\nWalter de Gruyter\n26. KnappM\n1999\nA note on power approximations for the transmission/disequilibrium test.\nAm J Hum Genet\n64\n1177\n1185\n10090903\n27. TanHWalkerMGagnonFWenSW\n2005\nThe estimation of heritability for twin data based on concordances of sex and disease.\nChronic Dis Can\n26\n9\n12\n16117840\n28. Koeppen-SchomerusGStevensonJ, R P\n2001\nGenes and environment in asthma: a study of 4 year old twins.\nArch Dis Child\n85\n398\n400\n11668102\n29. MathiasRAFreidhoffLRBlumenthalMNMeyersDALesterL\n2001\nGenome-wide linkage analyses of total serum IgE using variance components analysis in asthmatic families.\nGenet Epi\n20\n340\n55\n30. WeissSTRabyBA\n2003\nAsthma genetics 2003.\nHum Mol Genet\n13\nR83\n89\n31. CAMP\n1999\nThe childhood asthma management program (CAMP): design, rationale, and methods. childhood asthma management program research group.\nControl Clin Trials\n20\n91\n120\n10027502\n32. BenjaminiYHochbergY\n1995\nControlling the false discovery rate: A practical and powerful approach to multiple testing.\nJ Royal Stat Soc B\n57\n289\n300\n33. SkolADScottLJAbecasisGRBoehnkeM\n2006\nJoint analysis is more efficient than replication-based analysis for two-stage genome-wide association studies.\nNat Genet\n38\n209\n13\n16415888\n34. HerbertAGerryNPMcQueenMBHeidIMPfeuferA\n2006\nA common genetic variant is associated with adult and childhood obesity.\nScience\n312\n279\n83\n16614226\n35. Lasky-SuJLyonHNEmilssonVThorleifssonGThorsteinsdottirU\n2008\nOn the replication of genetic associations: Timing can be everything!\nAm J Hum Genet\n82\n849\n58\n18387595\n36. LangeCDeMeoDSilvermanEKWeissSTLairdNM\n2004\nPBAT: Tools for family-based association studies.\nAm J Hum Genet\n74\n367\n369\n14740322\n37. Van SteenKLangeC\n2005a\nPBAT: a comprehensive software package for genome-wide association analysis of complex family based studies.\nHum Genomics\n2\n67\n6\n15814068"
+}

batch_2/PMC2531083.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2531083",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2531083\nAUTHORS: Miriam H Labbok, Paige Hall Smith, Emily C Taylor\n\nABSTRACT:\nThe annual Breastfeeding and Feminism Symposia aim to reposition breastfeeding as a valued part of women's (re)productive lives and rights. The symposia are designed to raise the profile of breastfeeding within the women's advocacy and feminist studies' communities, and to increase recognition among breastfeeding supporters that breastfeeding promotion could receive more socio-political support by partnering with those concerned with women's reproductive health, rights and justice, women's economic advancement, and the elimination of social, economic and health inequities. The third symposium (2007) sought to build dialogue and increase communications between and among these diverse communities. The nine articles presented in this thematic series were selected by the journal editors, and represent the core discussions at the symposium. This editorial presents the areas of synergy and strategies for action that emerged from the discussions. These strategies and this thematic issue are intended to reassert the momentum that evolved among participants, and to stimulate involvement among individuals and organizations not in attendance in promoting breastfeeding as a women's reproductive health, rights and justice concern.\n\nBODY:\nIntroductionThe annual Breastfeeding and Feminism Symposia were initiated with the aim to reposition breastfeeding as a valued part of women's reproductive rights and lives. Each year, the effort is made to raise the profile of breastfeeding within women's advocacy and feminist studies' communities. These symposia are also designed to increase recognition among breastfeeding supporters that breastfeeding promotion could receive more socio-political support by partnering with those concerned with women's reproductive health, rights and justice, women's economic advancement, and the elimination of social, economic and health inequities.The Third Annual Breastfeeding and Feminism Symposium, September 24 and 25, 2007, was held in Chapel Hill, North Carolina and was co-hosted by the Center for Women's Health and Wellness, University of North Carolina, Greensboro (founding organization), and Center for Infant and Young Child Feeding and Care, School of Public Health, University of North Carolina at Chapel Hill. This event included both presentations and working groups to build dialogue and increase communications between and among feminists, policymakers, researchers, breastfeeding advocates and practitioners to help promote breastfeeding as a woman's reproductive health, rights and justice concern.Although research on breastfeeding has established that it is a maternal and child health imperative, yielding optimal short and long term health outcomes for both mother and child, breastfeeding is not fully recognized as a feminist, women's rights or women's reproductive health concern. Most second wave feminist scholarship and activism has presented breastfeeding as an \"option\" or a \"choice\" that is generally presented as not very different from formula feeding. A limited number within the feminist community has recognized breastfeeding as a women's health issue or a reproductive right. In fact, global support for women's rights generally ignores the rights and importance associated with all of women's roles as mothers, opting instead to concentrate primarily on other important issues such as employment and reproductive freedom.The 2007 symposium on Breastfeeding and Feminism focused on reproductive health, rights and justice, and was intended to stimulate consideration and identification of areas of mutual interest across diverse groups, including feminists, health workers, public health planners, community members, mothers and breastfeeding specialists. It was also designed to serve as a catalyst to strengthen coalitions and synergy to further breastfeeding as a reproductive right, and to create the first steps in action planning.The presentations and working group discussions were based on the following principles:• Breastfeeding is a social and biological process wherein women must have the right of self-determination;• Breastfeeding is a maternal and child health imperative and reproductive right;• It is important to re-orient the paradigm from the current view that breastfeeding is a \"lifestyle choice,\" to a paradigm that views breastfeeding as a reproductive health, rights and social justice issue so as to ensure the social, economic and political conditions necessary to promote success;• Women's decisions to breastfeed should not result in the loss of their economic security or any rights or privileges to which they are otherwise entitled.The nine articles presented in this thematic series were selected by the journal editors from among the proceedings of this symposium and workshop, and cover the major areas of discussion. This series of articles provides a basis to understand the momentum that evolved among participants, and are presented to stimulate involvement among individuals and organizations not in attendance. The full proceedings of the symposium and working sessions are available for citation on the websites of the co-hosts [1,2].Outcomes and actions: transdisciplinary identification of common goals and multi-disciplinary discussion of feasible actionsTwo working group sessions were held, the first to explore areas of synergy and the second to begin the development of strategies for action. The first session grouped participants across disciplines, but with an interest in a) reproductive health, b) reproductive rights, or c) reproductive justice. During this session, groups were tasked with discovering areas of synergy between or among: a) breastfeeding, b) feminism, and c) reproductive health, rights or justice, in order to identify goals and areas of need.Working group outcomes and other discussions at the conference indicate that participants recognize the following goals:1) the economic, political and cultural connections between women's rights to have children, and their rights not to have children;2) that women place importance and value on being able to mother in ways that are consistent with their own values, and on being creatively and productively engaged in the labor force; and3) that the decision to breastfeed is not as yet a realistic \"choice\" for many women if not supported by policies and programs that provide all women, regardless of their socio-economic status, with education, opportunity, health system and socio-political support, and control over their bodies and lives.Conference participants identified the need for political, health care and cultural changes that support women's full participation in society as reproductive and productive beings, increase the value placed on women's reproductive abilities and secure their rights across a reproductive continuum that includes a full range of family planning services, clinical abortion, pregnancy and birth treated as part of a health continuum and breastfeeding.Four areas related to women's reproductive health emerged in this transdisciplinary discussion that could contribute toward these goals. These include the need to:(1) create a mother and breastfeeding friendly health care system that re-enforces breastfeeding as the normative approach to infant feeding;(2) train all health workers to support reproduction as health, not illness;(3) secure adequate regulation of infant formula marketing to health workers and to the public, and of pharmaceutical labeling as concerns the mother-child dyad; and(4) promote a culture and civil society that value women as whole beings.Four areas emerged from discussion that relates to women's reproductive rights, including the need to:(1) recognize the importance and value of women's rights across the reproductive continuum;(2) recognize the importance and value of women's reproductive and productive roles;(3) create mother-friendly workplaces, including paid maternity leave with guarantee of return; and(4) engage the US as a global partner in human rights efforts.The two identified areas related to women's reproductive justice were the need to: (1) secure economic justice for women; and (2) secure racial and ethnic equality.These areas of need that emerged as a result of transdisciplinary discussion, rather than sector-based discussion, serve as a starting point for formation of partnerships and coalitions for action to work together toward common goals.Participants self-selected by professional discipline into one of three groupings for the second set of working groups: a) academic/researchers, b) policy/legal expertise, or c) practitioners/service providers. These groups started with a brief review of the outcomes of the earlier discussions and went on to identify short and long term strategies for action.The working group participants identified numerous strategic actions intended to create change at different levels of the socio-ecological model. (See Labbok article in this thematic series for a discussion of the socio-ecological model).• Individual/family level: Support recognition of the cost-benefits of mother/child attentive reproductive health support and breastfeeding for the family, as well as for the mother and child.• Community/cultural level: The suggested actions include: (1) engage in broad-based breastfeeding education (targeting the public, students, clinicians, employers, unions and policymakers); (2) raise public awareness of infant formula companies' marketing strategies and influence on all sectors; (3) increasing all women's access to economic resources and opportunities to achieve reproductive goals based on unbiased information.• Organizational level: Overall, everyone interested in reproductive health, rights or justice must work together to secure the respect, rights and opportunities for women from \"the birthplace to the workplace\". Such actions related to health care organizations include the need to: (1) support the Baby Friendly Hospital Initiative; (2) improve women's access to midwifery care and other sources of woman-centered, holistic, integrative models of care. Necessary actions related to workplaces include: (1) secure workplace support including: paid maternity leave; onsite child care; flexible hours and home work; mothers' rooms; and separate paid infant feeding breaks in addition to other breaks; (2) dissemination of available documents related to costs and benefits of breastfeeding, and the costs and risks of alternate feeding, to appropriate policymakers, employers, consumers (e.g. the dissemination of the Business Case for Breastfeeding by the US Department of Health and Human Services). Actions suggested for universities and other research settings include: (1) reducing academic and professional \"silos\" in favor of transdisciplinary identification of problems and gaps, multi-disciplinary research to address these issues, evidence creation through translational and applied studies, knowledge dissemination, and professional practice; (2) examining and increasing understanding of the \"lived realities\" of diverse populations of women as related to mothering, breastfeeding and employment; (3) developing a scientific working group to clarify defensible, ethical and safe methods for research on the effects of medications on lactation, and to further understand the risks of not breastfeeding; and (4) supporting family practice within the health fields to increase attention to the reality of the mother/child dyad.• Policy level: There is a need to seek passage of currently proposed legislation in the U.S. such as the Breastfeeding Promotion Act, the Global Childhood Survival Act and the Emergency Contraceptive Education Act, and to work toward the development and passage of legislation to reduce aggressive and misleading infant formula industry marketing, to regulate and support growth of donor milk banking, to create equitable health insurance that is not employment-based, and to expand the Family and Medical Leave Act to address all maternal/child needs. To be part of the global community, work toward the US ratification of United Nations Convention on the Rights of the Child and the Convention to Eliminate Discrimination Against Women is needed.Table 1 summarizes the areas of synergy and strategies for action that emerged from these working sessions.Table 1Areas of synergy and strategies for action to improve women's reproductive health, rights and justiceSeeking Synergy through Transdisciplinary Discussion of Gaps and Needs: Overarching themes that emerged, connecting breastfeeding to women's reproductive health, rights and justice• There are the economic, political and cultural connections between women's rights to have children, and their rights not to have children• Women place importance and value on being able to mother in ways that are consistent with their own values, and on being creatively and productively engaged in the labor force• The decision to breastfeed is not a \"real choice\" for many women if not supported by policies and programs that provide all women, regardless of their social position, with education, opportunity, and control over their bodies and lives.Goals and Areas of NeedReproductive HealthReproductive RightsReproductive Justice• Create a mother-friendly health care system• Recognize the importance and value of women's reproductive and productive roles.• Secure economic justice for women• Value women as whole beings• Create a mother-friendly workplace• Secure racial and ethnic equality• Secure better governmental oversight over pharmaceutical labeling and infant formula• Engage the US as a global partner in human rights effortsStrategies for Action across the Socio-ecological LevelsIndividual/FamilySocio-CulturalOrganizational, by SectorPolicy• Support recognition by individuals and by families of the costs and benefits of mother/child attentive support throughout the reproductive health continuum.• Provide broad based education on benefits and practice of breastfeeding for:Health care system:Initiate and approve legislation to enable breastfeeding, including:• Ensure that families understand the potential impact of less than optimal infant feeding on the health and welfare of mothers, children and families.• Public• Baby Friendly Hospital Initiative• Breastfeeding promotion and incentives• Clinicians• Access to midwives and holistic care• Family planning access• EmployersWorksites:• Donor milk banking• Unions• Maternity leave• Health insurance coverage for lactation services• Policymakers• Onsite child care• Paid maternity, family and medical leave• Raise public awareness of infant formula companies' practices• Support for breastfeeding and pumpingEncourage US Government ratification of UN Conventions:• Increase women's access to resources and opportunities• Flexible hours and home work• Convention on the Rights of the Child• Continue Breastfeeding and Feminism Symposia• Part-time work with benefits• Convention for the Elimination of Discrimination against WomenUniversities/Research Centers:• Reduce academic \"silos\"• Collaborative partners• Evidence and knowledge based dissemination• Research on \"lived realities\" of diverse populations• Scientific working group on ethical and safe methods for researching impact of medications on lactationTracking progressIn the months that followed the Breastfeeding and Feminism Symposium, organizers continued to hear from enthusiastic participants. Some emails came simply in the form of high praise for the event, and expressions of high hopes for future partnerships, while others were searching for additional information to bring back to their organizations and communities. Many reported on progress made toward the goals and action steps identified at the meeting. Still others reported on progress made toward new objectives inspired by the ideas exchanged and the group work during the symposium.The following is a brief summary of the reports received by conference organizers:Actions taken in support of the individual and family• Local advocates and professionals working in family planning, pregnancy, childbirth, and breastfeeding gathered in Chapel Hill to celebrate the common location of their individual \"issues\" on the reproductive continuum. A listserv was created for sharing information between groups, in hopes of \"breaking down silos.\"• Many Lactation Consultants and nurses expressed a heightened awareness of the barriers to breastfeeding, leading them to be more supportive of mothers trying to overcome obstacles to breastfeeding, predominantly by counseling on possible barriers that they may face, and by supporting the actions needed and the strength and self-efficacy to overcome them.Actions taken in support of the community/societal/cultural level changeAcademic• Four participants created and presented, \"Disturbing the 'Public': Risks, Rights, Breastfeeding, and Feminism\" at the Southeastern Women's Studies Association at University of North Carolina, Charlotte.Health care• Two hospitals in North Carolina report being \"close to BFHI certification.\"• The North Carolina Breastfeeding Coalition launched a campaign to reduce infant formula companies' advertising through maternity centers. As of July 1, 2008, five hospitals will be acknowledged with \"Golden Bow Awards\" for eliminating all such advertising.• The Durham County Health Department has enhanced its programs to include breastfeeding goal setting and additional support for breastfeeding pairs with the objective of increasing breastfeeding rates among minority and low-income clients.Workplace• Two breakfast table discussions about employer recognition awards (ERAs) were held at the National Conference of State Breastfeeding Coalitions in January 2008. This was seen as an opportunity to find out what State Breastfeeding Coalitions are doing in this area, with the hope of developing replicable models for use in other states.• Participants participated in evaluating \"The Business Case for Breastfeeding,\" a toolkit developed by the Maternal and Child Health Bureau for training breastfeeding advocates to reach out to employers in support of women in the workplace.Actions taken in support of governmental/policy change• One group provided ongoing consultation to a state task force to ensure inclusion of breastfeeding in legislated Safe Sleep messaging in North Carolina.• Many individuals are engaging in grass roots advocacy for Carolyn Maloney's Family and Medical Leave Act.• The New Jersey Breastfeeding Task Force is participating in the Time to Care Coalition, a broad-based coalition campaigning for The Family and Medical Leave Act.• The New Jersey Breastfeeding Task Force is partnering with the Rutgers Center for Women and Work, New Jersey National Organization for Women (NOW) and Mothering-NOW, and mothers' organizations such as \"Mothers and More\" to advance The Family and Medical Leave Act.• Individuals and organizations in North Carolina, Pennsylvania, and Vermont report working on creating and advancing state-level legislation to support, promote and protect breastfeeding.• For the 2008 meeting of the UN's Commission on the Status of Women (CSW), UN Breastfeeding Action Team (UNBAT), the UN breastfeeding advocacy team made up of representatives from La Leche League International, International Lactation Consultants Association, Academy of Breastfeeding Medicine and World Alliance for Breastfeeding Action, prepared a statement on the theme for 2008, \"Financing for gender equality and the empowerment of women\". The purpose of the statement was to demonstrate, in a one-page format, the value of breastfeeding as food, health care and childcare. It was entitled, \"The Breastfeeding Budget,\" and was based on the publications of Australian economist Julie Smith and her colleagues. In order to increase attention to the statement, UNBAT placed an advertisement about it in the CSW program book.This list of actions is quite impressive, both in its content, and in the fact that it reflects a commitment to synergy across the reproductive health continuum and among the individuals and groups who came together at the Breastfeeding and Feminism Symposium. While Symposium objectives were achieved, there is still much work to be done. Plans are underway for the Fourth Breastfeeding and Feminism Symposium to be held in March 2009 at University of North Carolina, Greensboro, where our theme will be \"sustaining breastfeeding from the birthplace to the workplace in support of healthy mothers, healthy babies and healthy environments.\"Competing interestsThe authors declare that they have no competing interests.Authors' contributionsAll three authors shared in conceptualizing the themes and working group agendae for the symposium. PHS was responsible for writing the abstract and introduction, and created Table 1. ECT organized and reported on working group outcomes and progress reports from symposium participants. MHL edited the near-complete draft for clarity and uniformity of style.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2531084.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2531084",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2531084\nAUTHORS: Yvonne L Hauck, Lisa Summers, Ellie White, Cheryl Jones\n\nABSTRACT:\nBackgroundThere is limited evidence on the use of the Snoezelen concept for maternity clients. Snoezelen, a Dutch concept, initiated in the 1970s as a leisure activity for severely disabled people, involves creating an indoor environment using controllable stimuli to enhance comfort and relaxation. These specially designed rooms expose the user to multiple sensory stimulations combining vision, touch, sounds and aromas. The aim of this study was to provide insight into breastfeeding women's experience of using a Snoezelen room during hospitalisation.MethodsA qualitative exploratory design was chosen to reveal women's perceptions of using the Snoezelen room. Osborne Park Hospital, the study setting is the second largest public provider of obstetric services in Western Australia. A purposive sample was drawn from breastfeeding women who used the Snoezelen room during their postpartum stay from March 2006 to March 2007. Saturation was achieved after eleven breastfeeding women were interviewed six weeks post discharge. Data analysis involved the constant comparison method.ResultsParticipants entered the room feeling tired and emotional with an unsettled baby and breastfeeding issues aggravated by maternal stress and anxiety. All women indicated they were able to achieve relaxation while in the room and would recommend its use to other breastfeeding mothers. Two key themes revealed how the Snoezelen room facilitated maternal relaxation, which ultimately enhanced the breastfeeding experience. The first theme, \"Finding Relaxation for the Breastfeeding Mother\" incorporates three subthemes: 'Time out' for mother; Control in own personal space; and a Quiet/calm environment with homelike atmosphere. The second theme, \"Enabling Focus on Breastfeeding\", occurred after relaxation was achieved and involved four subthemes: Able to get one-on-one attention; Not physically exposed to others; Away from prying, judgemental eyes and Able to safely attempt breastfeeding alone knowing help is nearby.ConclusionInsight into how the Snoezelen room promoted relaxation also highlights what contributes to maternal anxiety during breastfeeding experiences in hospital. The findings offer health professionals the opportunity to consider adopting strategies such as a Snoezelen room in their hospital or being innovative in modifying the postpartum setting to promote relaxation for breastfeeding women.\n\nBODY:\nBackgroundBreast milk is recognised as the ideal nutrition for the human infant. Research continues to explore supportive strategies to enhance women's initiation and prevalence of breastfeeding. Although Western Australia had initiation rates as high as 84% in the mid 1990s [1], evidence suggests that initiation rates have continued to increase to 88% [2] and more recently to 94% [3]. Prevalence rates, however, are not as encouraging as rates decrease to 62% at 3 months and 50% at 6 months [2]. Western Australian data is comparable to national figures from the 2001 National Health Survey with 87% of infants receiving some breast milk, 48% being breastfed to six months, and 23% to 12 months [4]. Early cessation has been attributed to ineffective support from health care professionals and informal networks such as family and friends, unrealistic expectations, physical concerns with breastfeeding and faltering commitment by mothers [5]. The most common reason cited for stopping breastfeeding within the first two weeks post birth was an unsettled baby, which mothers interpreted as indicating insufficient milk supply [6].Adequate support for the breastfeeding woman is essential to promote initiation [7]. Support during breastfeeding initiation focuses upon ensuring that the woman can achieve correct attachment, understands the principles of supply and demand, and receives prompt treatment for any problems. Therefore, the support of a skilled, competent midwife during the initiation phase of breastfeeding cannot be underestimated.Snoezelen is a concept whereby an indoor environment using controllable stimuli is created to provide comfort. The specially designed room exposes the user to multiple sensory stimulations combining vision, touch, sounds and aromas. These rooms are credited with providing positive therapeutic or educational effects and positive emotions such as well-being, rest, satisfaction, poise and joy [8]. The original purpose of the Snoezelen concept was as a leisure activity for severely disabled people. Its popularity has grown since the 1980s beyond the original counties of Germany and the Netherlands, to Britain, Canada, the United States, Spain and Australia with use extending beyond mentally impaired clients. This environment has been used with adults with cerebral palsy [9]; multiple handicap clients [10]; nursing home and psychogeriatric clients [11-16]; palliative day-care clients [17]; end-stage Alzheimer's clients [18]; neonates [19]; critically ill children [20]; and chronic pain sufferers [21-23].There is limited evidence on the use of the Snoezelen concept with maternity clients. One study has reported how using the Snoezelen room enhanced the labour experience of Western Australian women by providing distraction, environmental control, comfort, relaxation, choice of complementary therapy features and safety in a non-clinical atmosphere [24]. Consequently, this research adds to a new body of knowledge by providing insight into the experience of using a Snoelezen room with maternity clients and specifically, breastfeeding women.MethodsResearch aimThe aim of this study was to provide insight into the experience of using a Snoezelen room for breastfeeding women in the early postpartum period.Research designA qualitative exploratory design was employed to obtain a rich description of the experience of using the Snoezelen room. Therefore, a small cohort of breastfeeding women was invited to participate in in-depth interviews after using this environment. The average length of hospital stay for maternity clients is 2.7 days and to conduct an interview during this limited hospital stay when clients are in the acute phase of recuperation was not feasible. Therefore a time period of 4 to 6 weeks was chosen to balance the need for initial recuperation from the birth process and potential concern with recall bias.Setting and contextOsborne Park Hospital (OPH), the setting for this study is the second largest public provider of obstetric services in Western Australia. The maternity setting at OPH is considered a low to moderate risk maternity unit with approximately 1600 births per year. Healthy women qualify to birth at OPH after they have reached 35 completed weeks gestation. The Snoezelen room at Osborne Park Hospital was designed especially for the maternity setting (Figure 1). The midwives, who introduced the concept into the maternity setting, took initial guidance from the website of the International Snoezelen Association [8] where the concept definition and aim is provided. However, Snoezelen rooms are unique as they are based upon a target audience. The room has polished floorboards and soft earthy colours of green, brown, terracotta and yellow. These colours were chosen as the midwives felt they represent the link between birthing and nature. The room provides a three-seater lounge with a chaise where a woman can lie and relax with a chair with a wrap-around backrest. There is a large soft rug and three-square ottomans for women to put their feet up while sitting on the lounge or chair. The main features of the room are the wheel projection that slowly rotates to display patterns on the wall and fibre optic lights that can be draped across a person or the room as it gradually changes colour. Finally, a tropical fish tank, music and aromatherapy were chosen to complete the room's ambience.Figure 1Snoezelen room at Osborne Park Hospital.RecruitmentThe sample for this study was drawn from breastfeeding women at Osborne Park Hospital (OPH) who chose to use the Snoezelen room for breastfeeding reasons during their hospital stay. Information about the Snoezelen room and its aim to promote relaxation is provided during hospital tours, antenatal classes, and via posters displayed in every birth room, the patient lounge and all postpartum rooms. All client requests to use the room are respected depending upon the room's availability. Midwives tend to encourage use of the room for relaxation for breastfeeding women, women in early labour, tired and anxious women needing a sleep and pregnant women with elevated blood pressure who are awaiting a blood pressure profile assessment. Only one client is able to use the room at a time and a midwife must unlock the door to provide access.All midwives on the postpartum ward at Osborne Park Hospital who put a woman in the Snoezelen room for breastfeeding issues were asked to enter the woman's name and date of the visit in a book. Three weeks after using the Snoezelen room an information letter was posted to 44 women who used the room for breastfeeding between March 2006 and March 2007. Potential participants replied to the letter by returning an expression of interest form to the researcher in a reply paid envelope. Twelve women replied to the invitation and eleven were interviewed. One woman had not used the room for breastfeeding but to gain some privacy and much needed sleep and was therefore not interviewed. The researcher contacted interested women to arrange an interview. This was to avoid perceptions of coercion should hospital midwives approach the women. Arrangements were made to conduct the interview in the privacy of the woman's home. The researcher who is a midwife but not involved in client care at the hospital conducted the interviews. This purposeful sampling method ensured that participants selected were appropriate and able to share perceptions of using the Snoezelen environment for breastfeeding issues [25]. Participants received an information letter and provided informed consent while being assured they could withdraw from the study at any time. An interview guide with five open-ended questions was used to encourage the women to share their experience: \"tell me about your breastfeeding while in hospital\"; \"tell me about using the Snoezelen room for breastfeeding\"; \"what did you like/dislike about the Snoezelen room\" and \"would you recommend the room to other mothers\". The interviews lasted between 45 minutes and 90 minutes (average of 60 minutes) as the questions facilitated a \"story telling\" atmosphere. Prompt questions were also used such as \"can you elaborate on that\" or \"tell me more about\". All interviews were audio-taped and transcribed verbatim. A demographic form was also completed to provide a brief profile of the participants (i.e. age, type of birth, education level, current breastfeeding pattern, number of children breastfed, breastfeeding intention). The final sample size of 11 participants was determined by data saturation as ongoing analysis revealed redundancy of information and no further concepts or themes were apparent [25].Data analysisThe constant comparison method modified from the grounded theory methodology was used to analyse the interview transcripts [25]. Categories drawn from the data were compared to reveal commonalities and variations in the experience [26]. Data analysis identified patterns or themes relevant to the mothers' experience of using the Snoezelen room. Initially team members conducted a separate data analysis with the transcripts and then came together for discussions to clarify, negotiate and refine the findings. Disagreements on interpretation were negotiated and although major disagreement did not occur, transcripts were referred back to for refinement of final themes. An audit trail was kept by the first author to provide transparency of the decisions and allow evaluation of how data were categorised into themes and subthemes [26]. To ensure trustworthiness by confirming validity of the findings, a summary of the identified themes was posted to participants inviting comment and discussion [26]. Due to changes in postal addresses and phone numbers over the course of the study period, four participants could not be contacted. The remaining seven participants confirmed that the themes were an accurate reflection of what the Snoezelen room offered a breastfeeding woman.Ethical considerationsEthical approval was obtained from the hospital and university human ethics and review committees. Data were coded with numbers to ensure confidentiality. Transcripts and demographic data forms were stored in a locked cabinet at the university. The person employed to transcribe the cassettes signed a confidentiality agreement to ensure they would not breach confidentiality and were aware of the seriousness of this issue. If participants become distressed during the interview process, a referral system was prearranged with appropriate counselling services. Referral was not undertaken as no women experienced any distress during the interviews.ResultsIt must be acknowledged that the sample was self-selecting and not representative as not all breastfeeding women chose to use the room. In addition, only 11 out of the 44 women invited agreed to participate in the study. All participants interviewed felt they benefited from using the Snoezelen room; however, we have no information regarding the women who chose not to participate. They may not have found the room helpful or had ceased breastfeeding when the invitations were posted, although the information letter stressed that their current infant feeding pattern was not relevant to the study. Finally, conducting an interview six weeks post birth could have resulted in recall bias, however, periods of less than three years for recall with infant feeding are considered acceptable [27].Eleven women shared their experience of using the Snoezelen room during the early stages of their breastfeeding. All women had a positive experience in the Snoezelen room and indicated they would not only use it again but would recommend it to other mothers. Seven women were first time breastfeeding mothers, with three women breastfeeding their second child and one breastfeeding her third. The age of the mothers ranged from 23 to 39 years with a mean of 31 years. The length of hospital stay during the postpartum period ranged from 1 to 8 days with a mean of 4 days. All participants were living with a partner. The time of the interview ranged from 4 to 11 weeks post birth with a mean of 6.5 weeks. Ten of the eleven participants were still breastfeeding their infant at the time of interview. The mother who was completely formula feeding at her 11-week interview had planned to breastfeed for between 4 to 6 months. Seven mothers used the Snoezelen room once during their hospitalisation, two used it twice and two used the room for three or more times. The time spent in the room ranged from 30 minutes to 8 hours with the majority of women using the room for 1 to 2 hours for each visit. Four mothers specifically asked to use the room and three of these women had used the Snoezelen room during their labour. The remaining women used the room on their midwife's recommendation. The majority (n = 9) used the room for an unsettled baby and/or breastfeeding issues. One woman, who used the room during labour and did not have an unsettled baby but enjoyed the room so much she used it for several visits during her hospital stay and for up to 8 hours for one visit. Finally, one woman was not having breastfeeding difficulties but was unwell after experiencing a postpartum haemorrhage. Her midwife encouraged use of the room for relaxation and the woman did use this opportunity for breastfeeding. Further demographic data are provided in Table 1.Table 1Demographic profileDemographic variablesParticipants (n = 11)Type of birth Spontaneous vaginal birth6 Forceps or vacuum birth1 Caesarean birth4Educational level University7 Technical and further education1 High school certificate2 Completed year 10 in high school1Feeding pattern during interview Completely breastfeeding8 Breastfeeding with occasional/regular bottle of expressed breast milk1 Breastfeeding with occasional/regular bottle of formula1 Completely formula feeding1Plans for breastfeeding < 1 month 1 to 3 4 to 63 7 to 91 10 to 123 > 123 Uncertain1The majority of women who chose to use the Snoezelen room by asking or following their midwife's recommendation were experiencing anxiety due to breastfeeding issues. Most were day two or three after their birth and were tired, emotional and having breastfeeding difficulties with attachment or pain with feeding. The majority of mothers had infants they described as unsettled. The three women who had used the Snoezelen room during labour asked to use the room earlier than the other participants. Although all postpartum rooms have a poster of the Snoezelen room only one mother who had not used the room in labour asked to use the room. The majority of women indicated that they would have never thought to ask about the room even though they were aware of it.All participants indicated that they were able to achieve some relaxation while in the room. Two key themes with seven subthemes were revealed during data analysis highlighting how the Snoezelen room enhanced relaxation for these breastfeeding mothers (Table 2).Table 2Key themes and subthemesTHEME: Finding Relaxation for the Breastfeeding Mother\"Time out\" for the motherControl in own personal spaceQuiet/calm environment with homelike atmosphereTHEME: Enabling Focus on BreastfeedingAble to get one-on-one attentionNot physically exposed to othersAway from prying, judgemental eyesAble to safely attempt breastfeeding alone knowing help is nearbyParticipant quotes will be provided to illustrate each of these themes. Participants are identified by a code P1 to P11 to demonstrate the depth and variety of experiences and illustrate how all women are represented. The first theme was \"Finding Relaxation for the Breastfeeding Mother\" which incorporated three subthemes: Time out for mother, Control in own personal space and Quiet/calm environment with a homelike atmosphere.Time out for motherBeing in the Snoezelen room was an escape from the ward environment and mothers appreciated being able to get away from the noise and activity. The room provided the opportunity to have a break from other mothers and their crying babies, visitors, and the hospital staff, no matter if they were doctors and midwives or the domestic staff doing their cleaning duties. Having private time meant having the freedom to do what she wanted such as put her feet up, listen to music or even have a cry in private. As one mother stated, \"I did sit there for a little while and have a good cry. I thought that I was doing it [breastfeeding] wrong, I thought it was a problem with me. I couldn't do it, I did sit there and have a little time out (P7).\" Having time out promoted relaxation for the women. Although all of the participants had their babies with them and were therefore not alone, they perceived that being in the room provided a haven or escape from being in the traditional maternity setting. One woman described how the room was not only a break for her but how her daughter enjoyed the lights in addition to breastfeeding well: \"She was just eyes wide open watching all the colours change; just really still and quiet and loved it; I fed her in there and I found it much nicer and just a break for me as well (P3).\"Three women had a midwife come in the room for some of the time to assist with breastfeeding. Four women had their partners in the room, but only one mother encouraged visitors to come into the room. Having time out for the mother illustrated how being in the room was seen to be an indulgence: \"Nice to just have that little bit of peace, no I don't think I would have tried with anybody else in there, maybe my mum but I don't think I would have taken the kids or anyone else, selfish, I save that for me (P8).\"Control in your own personal spaceThe second theme highlighting how relaxation was enhanced focused upon having control of personal space and who entered that space. Even being in a private room did not afford women control. Health care professionals and hospital domestic staff continuously entered women's rooms. Closed doors and drawn curtains were no guarantee of privacy. \"There were a few occasions where I was feeding and obviously the people would go 'Oh no don't mind me', I'm thinking you might not mind but actually this is quite a personal thing for me and I'm not really comfortable with it (P6).\" The Snoezelen room door requires a key to enter or the visitor to knock to be allowed in. Most women indicated that it was rare for anyone to disturb them while in the room and the sign on the door indicating the Snoezelen room was in use also contributed to respect for privacy. \"The room was a safe haven, the privacy to do what I needed to do and to not have to worry about conforming to what they wanted me to be like in the ward (P7).\"The modifiable features in the room such as movable furniture, music and lighting options were also a desirable feature that promoted control and therefore, relaxation. Traditional hospital rooms do not allow the flexibility of dimming lights or chairs with comfortable arms and footstools that can be moved to personal preferences. \"I was stunned because I think I just felt that as soon as I got in there and sat down and knew that I wasn't going to be bothered by anything, I wouldn't hear anybody else around me, I could set the environment how I wanted it, I just automatically felt myself relax and just chill out (P10).\"Quiet/calm environment with homelike atmosphereThe quiet and calming atmosphere in the Snoezelen room created feelings of safety plus the comfortable furniture was seen to provide a more homelike ambience. \"It was just so nice to have our own little room where you're warm and cozy and feel safe, I did feel safe in there (P7).\" The mothers commented on how their emotional and physical state of relaxation transferred to their unsettled babies whose behaviour improved. \"He [baby] seemed a lot more settled in there, I assume purely cause I was and I could get comfortable, I found the beds very uncomfortable for feeding and the chairs are ok, but it [Snoezelen room] was just really nice, you feel like you're at home (P5).\" The mean hospital stay for these women was 4 days, which is longer than the setting average of 2.7 days. Having the opportunity to go into a quiet and calm environment was welcomed by these women who accepted their need to stay in hospital for individual reasons but appreciated having a sanctuary from the ward. \"The privacy as well was a huge bonus to know that you didn't have the kids peeking in through the curtains or the person delivering your meal or the nurse coming in to check your bits and pieces, so it was good to be in that home environment (P11).\"The second key theme \"Enabling Focus on Breastfeeding\" occurred after the mother was able to achieve some relaxation and encompasses four subthemes: Able to get one-on-one attention; Not physically exposed to others; Away from prying, judgemental eyes; and Able to safely attempt breastfeeding alone knowing help is nearby.Able to get one-on-one focused attentionThose mothers who did require the support of a midwife in the Snoezelen room with breastfeeding commented how being in the room afforded them one-on-one focused attention. They felt that in a shared maternity room, they were not able to achieve this level of attention, due to the presence of other mothers and babies, partners, families and visitors. When a midwife joined the mother in the Snoezelen room there were no bells or buzzers around to distract the midwife or take her away and even if the time wasn't long, the undivided attention was valued. As one mother shared: \"It was really nice to go into a separate space and sit down with someone to really focus on trying to get the breastfeeding right... really good to have that special attention (P2).\" Being more relaxed in the room due to the privacy and atmosphere also contributed to the mother being better able to calmly listen and take in the advice being offered. \"If you needed one of the midwives to get them to come in there which was nice, cause you just sit and relax on the sofa as you would at home instead of sitting on the end of a bed or on a chair or something, so it was a lot easier and a lot calmer (P4).\"Not being physically exposed to othersNot all women feel comfortable having their breasts exposed as may occur when trying to initiate breastfeeding in a hospital setting. The women using the Snoezelen room indicated how they appreciated the privacy and not having to worry about \"covering up\" while attempting to breastfeed. The door to the Snoezelen room was locked and midwives tended to knock before they entered the room, even though they had a key. This respect for privacy was noted as being different from the traditional hospital room, even if the woman was in a private room. \"When the person next door came actually into our section, it was like 'Oh my God, I'm sitting here with my breast hanging out', which wasn't very nice (P4).\" The mothers commented that they felt confident that no one was going to come in unannounced while they were trying to breastfeed. This privacy was like being in your own home and was appreciated. \"The privacy of the breastfeeding which is a very intimate experience that I'm not that sort of outgoing that I would enjoy exposing myself publicly (P6).\"Away from prying judgemental eyesMany women commented upon their feelings of being judged by others regarding either difficulties with breastfeeding or just the fact that their baby was crying, unsettled and disturbing others. \"I did find that the room took away my tension and the stress of not being able to do it, it did relax me, there was no one to watch me and see how bad a job I'm doing (P7).\" The sensitivity to being seen and judged was not just with regards to other mothers, partners and visitors, it also included the evaluating and watchful gaze of health professionals: \"You don't want to be judged and it sounds a bit strange as helpful as the midwives were when you are trying even when I was feeding they'd come in and go 'Is she attached properly?' and then come and have a look and check (P6).\" Feeling like they had to perform in front of others placed added stress to an already anxious woman whose breastfeeding expectations were not being realised. Being away or not being under the scrutiny of others, did help to ameliorate some of this anxiety: \"Completely away from everyone else, because I found it very stressful trying to do things even though everybody's baby was crying and everybody's having issues you still think you're the only one and you think you're the problem and it's just nice to be able to go away and not have anyone listening to you (P9).\" The Snoezelen room provided a safe retreat: \"Somewhere where eyes aren't going to be looking at you and asking 'How are you going, can you do it right or can you not', it's just your little space (P1).\"Able to safely attempt breastfeeding alone knowing help is nearbyHaving an unsettled baby as a consequence of breastfeeding difficulties, meant that many of these women commented how their confidence was slowly eroding away. \"I'd gotten to a point where I was saying to my husband 'No that was it. I am not doing this. It's not worth it'. Thank goodness I didn't but I was losing confidence (P10).\" To regain confidence it was important to have a safe environment to try breastfeeding strategies for attachment as one example and know that help was available. Ultimately, the mothers wanted to be able to achieve a level of competency with their breastfeeding that could be transferred to their hospital room and home once discharged. The Snoezelen room provided this opportunity: \"I wanted to experiment and explore it on my own because I'm not a complete idiot, sometimes you just need a chance to try it for yourself. You want some time out to yourself to see if you can do it yourself and I knew that in that space I was just going to have some time to find out for myself and not have any interruptions (P6).\"ConsequencesUsing the Snoezelen room was described as a turning point for a number of participants during their early breastfeeding experience. The opportunity to use the room while initiating breastfeeding was described as a positive experience. Being able to achieve a degree of relaxation assisted most of the women in being able to have a positive breastfeeding experience. For some women, this one affirming experience contributed to a journey toward breastfeeding success. \"I just think knowing that I could do it and knowing what it felt like to have that right positioning and that feeling so that if she wasn't on properly I knew it (P11).\" A number of mothers said the positive experience increased their confidence in their ability to breastfeed and reinforced the idea that: \"I can do this.\" Prior to coming into the room, many women were emotionally and physically distressed. Their baby was unsettled and breastfeeding problems compounded the situation. \"I was losing confidence. I was definitely not doing it right. It was a turning point for me. I quite enjoy breastfeeding now. I am glad I didn't give it up (P10).\"As the mothers relaxed, so did their babies and the majority of women were able to breastfeed successfully in the room. One woman's baby was not interested in feeding in the room even though she tried but her previously unsettled baby did settle and was content in the room, which reinforced to the woman how important it was to relax. Still another woman who breastfed with continuing nipple pain was satisfied that the experience was worthwhile and has continued to receive specialist support from a community lactation consultant at six weeks postpartum. Having a relaxed baby was a key issue for these women who noted a difference in their baby's behaviour. \"Every time we were in there he was really calm, slept really well and breastfed really well and when we went down to the [hospital] room a few times he'd start howling so we went back down to the [Snoezelen] room and he'd calm down, we think that everybody should have a Snoezelen room at home (P4).\" All babies settled while in the room and some mothers and babies even managed to have a nap in the Snoezelen room before returning to their hospital room. Women commented how having a positive breastfeeding experience left them feeling refreshed and rejuvenated and most importantly better able to cope with the challenges that lay ahead. One woman's comment aptly highlights her summary of the Snoezelen room: \"It was just such a blissful place, just missing chocolate really (P9).\"DiscussionOur findings highlight what assisted breastfeeding mothers to achieve relaxation within a Snoezelen environment, which ultimately facilitated their early breastfeeding experience. It is anticipated that the rich description of these qualitative findings will enable the reader to determine the transferability of the findings to their own context [25,26]. Although limited maternity settings may actually have a Snoezelen room, application of how the room enhanced relaxation can be considered and addressed in other settings. A woman who is anxious, in considerable pain or distressed due to physical concerns may find it difficult to relax during breastfeeding. The milk ejection reflex is enhanced when the woman is comfortable, relaxed, and not experiencing undue pain or anxiety [28]. Measures to enhance relaxation such as adequate pain relief and the provision of a calming environment may be a complementary strategy to midwifery support for breastfeeding women. The provision of a calming environment that addresses issues such as ensuring privacy and a space for the mother to have \"time out\" and control, feeling safe from prying, judgemental eyes, and having the opportunity of one-on-one focused support could be creatively considered in different maternity settings.Findings revealed factors that were perceived as stressors for new mothers such as limited access to privacy, wanting to do their best by breastfeeding and being a 'good mother' but feeling vulnerable to being judged. The link between breastfeeding and being seen as a 'good mother' has been noted [29,30]. \"Heading toward the new normal\" has been described as the process women undergo in the early postpartum period while reorganising life as a mother [31]. Becoming competent and developing confidence are two components of the settling in to this \"new normal\". Dykes' [32] study also confirmed that gaining confidence in the skill of breastfeeding was regarded as a mother's primary goal and how having a discontented newborn resulted in the mother becoming anxious and doubtful of her abilities. Ideally, a focus of postpartum care should be to foster the confidence that new mothers are struggling to achieve in those early days of breastfeeding and not present obstacles that undermine this developing confidence.Participants indicated how their breastfeeding challenges were threatening their confidence but how having a positive breastfeeding experience assisted in boosting their faltering confidence. Uncertainty and threats to maternal confidence have been regarded as key concepts in women's breastfeeding experience [33]. However, building confidence and reducing uncertainty in being a 'good mother' by successfully breastfeeding is not a simple process. Uncertainty and vulnerability have been noted as key issues for women who encounter initial breastfeeding difficulties and reality isn't meeting expectations [33,34]. However, most women are not prepared to experience difficulties with breastfeeding, when in fact the evidence suggests that 83% of Perth women experience one or more problems during the early stage of their breastfeeding [6]. Therefore, encouraging women to have realistic expectations regarding initial difficulties while ensuring appropriate support is available to overcome these difficulties is recommended for health professionals advocating breastfeeding.Most participants in this study entered the Snoezelen room with an unsettled baby. Given the most common reason for stopping breastfeeding within two weeks post birth was an unsettled baby, interpreted as an inadequate milk supply, anxiety over supply is a serious issue as it is associated with early cessation of breastfeeding [6]. Postpartum anxiety has been associated with reducing breastfeeding confidence [35]. Physical challenges have also been noted as affecting a woman's relationship with her newborn with some women being reluctant to continue breastfeeding due to the feelings of physical vulnerability, pain and discomfort [36].Breastfeeding self-efficacy involves the mother's perception of her ability to breastfeed with higher self-efficacy being associated with longer duration [37,38]. The tendency to experience negative emotions, such as anxiety, depression and irritability, can impact cortisol regulation and vulnerability to stress [39]. In fact, breastfed infants exposed to higher cortisol levels in breast milk demonstrated temperament changes such as increased fear behaviours [40]. Therefore, strategies that focus upon addressing maternal anxiety, enhancing confidence and promoting breastfeeding self-efficacy have potential benefits to both mother and infant.ConclusionHealth professionals make a difference to breastfeeding. Their encouragement and support is associated with longer duration and greater exclusive breastfeeding rates [38]. Awareness of how early breastfeeding issues can influence maternal anxiety and breastfeeding confidence allows the health professional to better support vulnerable women experiencing anxiety due to early breastfeeding issues. Fostering maternal relaxation in an environment like a Snoezelen room is just one example that may be considered to accompany the support already provided by midwives working in postpartum settings. A comfortable, relaxed mother with adequate midwifery support is more likely to successfully initiate breastfeeding, have a settled infant and develop the confidence she needs to continue breastfeeding after leaving hospital.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsYH designed the study, recruited and interviewed participants, analysed data and drafted the manuscript. LS, EW and CJ assisted in analysis of the data and provided constructive feedback during revisions of the manuscript.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2531085.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2531085",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2531085\nAUTHORS: Malte Ludwig, Tomasz Zielinski, Dieter Schremmer, Klaus O Stumpe\n\nABSTRACT:\nBackgroundNon-invasive 3-dimensional (3D) ultrasound (US) has emerged as the predominant approach for evaluating the progression of carotid atherosclerosis and its response to treatment. The aim of this study was to investigate the quality of a central reading procedure concerning plaque volume (PV), measured by 3D US in a multinational US trial.MethodsTwo data sets of 45 and 60 3D US patient images of plaques (mean PV, 71.8 and 39.8 μl, respectively) were used. PV was assessed by means of manual planimetry. The intraclass correlation coefficient (ICC) was applied to determine reader variabilities. The repeatability coefficient (RC) and the coefficient of variation (CV) were used to investigate the effect of number of slices (S) in manual planimetry and plaque size on measurement variability.ResultsIntra-reader variability was small as reflected by ICCs of 0.985, 0.967 and 0.969 for 3 appointed readers. The ICC value generated between the 3 readers was 0.964, indicating that inter-reader variability was small, too. Subgroup analyses showed that both intra- and inter-reader variabilities were lower for larger than for smaller plaques. Mean CVs were similar for the 5S- and 10S-methods with a RC of 4.7 μl. The RC between both methods as well as the CVs were comparatively lower for larger plaques.ConclusionBy implementing standardised central 3D US reading protocols and strict quality control procedures highly reliable ultrasonic re-readings of plaque images can be achieved in large multicentre trials.\n\nBODY:\nIntroductionMeasurement of carotid atherosclerosis burden and progression is an important tool for research and patient management [1]. 2-dimensional (2D) B-mode ultrasound (US) has been shown to be a sensitive and reproducible method to detect pre intrusive thickening of artery walls and to measure intima-media thickness (IMT) in the carotid artery [2,3]. Ultrasonographically determined IMT has been used as a marker of atherosclerosis elsewhere in the arterial system and randomised imaging studies have examined the effects of blood pressure- and lipid-lowering therapies on carotid IMT changes [4]. The atherogenic nature of IMT, however, is uncertain, since 2D US does not measure medial and intimal thickness separately [5]. An increase in IMT may be the result of an adapted response of medial layer (remodelling) to tensile (hypertensive) stress or intimal thickening reflecting early atherosclerosis [6]. Atherosclerotic plaque volume assessed by 3-dimensional (3D) US [7] may represent a more reliable measure of atherosclerosis than IMT [8] and more recently non-invasive 3D US imaging has ermerged as the predominant approach for evaluating the progression of carotid atherosclerosis [1,9-12]. 3D US provides a precise and reproducible method for determining the change in atherosclerotic plaque volume during treatment [1,8,10]. A recent randomised trial in hypertensive patients using carotid 3D US has successfully investigated the effects of two different classes of antihypertensive agents on plaque volume changes and demonstrated the suitability of the 3D US method for tracking progression or regression of plaque volume over time [13].3D US measurement of PV within a multicentre clinical trial setting typically involves processing of data obtained at more than one investigational site. It is important to ensure that analysis of the data, and re-reading of the 3D US images of plaque is carried out in a centralised, standardised and reproducible manner. The primary aim of this study was to assess reliability of a central re-reading procedure implemented in a multinational 3D US trial by determining intra- and inter-reader variabilities and major factors influencing reading precision.Materials and methodsThe study was performed in accordance with the principles of the Declaration of Helsinki, and the regulatory requirements of the International Conference on Harmonisation Guidelines on Good Clinical Practice.The protocol was approved by the appropriate Institutional Review Board or Ethics Committee at each centre involved.All patients gave written informed consent for publication of this report and accompanying images.PatientsTwo data sets of 45 and 60 3D US carotid plaque images were obtained from 45 patients (32 men; mean [SD] age, 62.2 [6.9] years) and 60 patients (50 men; mean [SD] age, 61.3 [8.1] years), respectively, who had been followed up in the ACAT Inhibition Plaque Regression Study (APRES). The APRES was a multicentre European ultrasound trial, and participants were recruited at 31 clinical centers throughout the Czech Republic, Germany, Italy and Poland. The study assessed the effect of an ACAT-inhibitor as compared to placebo on carotid plaque volume (Data on file at Daiichi Sankyo, Munich, Germany). To be eligible for inclusion in the APRES, patients with defined cardiovascular risk had to have an increased common carotid artery (CCA) intima-media thickness (IMT) of > 0.8 mm, and at least one atherosclerotic plaque in the CCA or the carotid bulb without marked mineralisation (plaque volume between 20 and 500 μl).Ultrasound measurement of plaque volume (PV)Ultrasound measurements of PV had been carried out by trained and certified sonographers at 14 ultrasound referral centers using a high-resolution Voluson 530 D MT, 2D-/3D CFM-Ultrasound System (Kretz-Technik AG, Zipf, Austria; the equipment is commercially available from General Electric, GE Ultraschall Deutschland GmbH/D-42655 Solingen and named Logiq 7 BT07) equipped with a mechanical 10 MHz sector motor-driven 3D-probe that provided an axial resolution of 0.1 mm. An integrated 6.9 MHz Doppler system was used to determine the grade of possible stenoses.Small depth of Sweep Box for 3D image acquisition with an angle of 45° and slow acquisition time of volume scan were additional features of the ultrasound system. To measure PV, a longitudinal scan of the common carotid artery or bulb was carried out followed by volume acquisition. Volume acquisition used 3 orthogonal sectional planes (A, B, C) and started with the sectional image (A), which gave a 2D image showing the longitudinal view of the vessel. Images B and C showed the transverse and horizontal axes, respectively. The volume sweep was saved as raw data and stored on MODs and sent to the Reading Center for volume calculations. The volume of analysed plaque was calculated by delineating the plaque boundaries and the transverse plane (B) using the firmware of Kretz Ultrasound apparates. This \"manual\" method required the object to be manually traced by using the track ball of the Kretz device. In order to achieve volume measurement a manual trace was displayed on different planes of the plaque (Figure 1). The methodology for PV measurement has been validated previously [14-16].Figure 1Carotid plaque images obtained with 3D US. The plaque is presented in longitudinal and cross-sectional views. The 3D image has been sliced 6 times from one end to the other along the vessel axis in the scan direction.Quality assessment of central readingThe first set of data consisted of 45 3D US plaque images with PV ranging from 21 to 240 μl. This data set was used to compare the results of plaque volume measurements obtained by 3 trained and certified readers at the European Ultrasound Teaching and Reading Center (EUTARC; Feldafing, Germany) and to investigate intra- and inter-reader variability of the reading process. The second data set consisted of 60 plaque images (PV between 20 and 60 μl) and was used to explore the effect of plaque size and the number of slices (S) (5 vs. 10 S) in manual planimetry on the quality of the central reading procedure by a randomly assigned reader.Study protocol and statistical analysisSonographic images of the 45 plaques of the first data set were recorded on video tapes and MODs, and 6 identical blinded copies were prepared by an independent institution (Medizinische Software GbR [MESO], Mittweida, Germany) and named A to F. Three sets of the 45 MODs were then sent to the Reading Center EUTARC and randomly assigned to 3 appointed readers for subsequent evaluation. After the measurements from the first round of reading procedure had been returned to MESO, the remaining 3 sets of MODs were delivered to the 3 readers for a second round of readings. Thus, each reader performed two independent evaluations of the 45 MODs according to a randomized, pre-defined procedure. The mean of 3 individual readings was used for analysis.Inter-reader variability was evaluated by comparing the mean of the first and the second measurement of each reader between all 3 readers. Assessment of intra-reader variability was based on comparison between the first and the second set of measurements of each reader. The intraclass correlation coefficient (ICC) was applied to assess inter- and intra-reader variabilities [17]. The ICC is a measure of the proportion of variance that is attributable to the objects of measurements, and has emerged as a universal and widely accepted reliability index [18]. Furthermore, it allows the evaluation of the variability between more than 2 methods and readers, respectively. Calculation of the ICC was carried out by means of analysis of covariance (ANCOVA) using the SAS program (version 9.1). The three ICC values between the first and second set of measurements of each reader provide an estimation of intra-reader variability, and the ICC between all 3 readers is a measure of inter-reader variability. An additional analysis was performed after stratification by plaque size (PV < 60 μl versus PV > 60 μl) as determined in the APRES.The second data set was used to investigate the effect of the number of slices in manual planimetry on the quality of PV measurement. The results of the 5 S- and 10 S- method were compared by means of the repeatability coefficient (RC) based on the mean of 3 individual readings per plaque. The RC was calculated as follows [19]: RC = 1.96 SDDiff, where SDDiff denotes the standard deviation of the differences in PV measurements between both methods. If the differences follow a normal distribution, approximately 5 percent of differences between measurements are expected to lie outside the limits + RC. Variability of measurements was investigated by calculating the coefficient of variation (CV) for 3 individual assessments of each of the 60 plaques by either method. In order to analyse the effect of plaque size (PV) on the precision of measurement, CVs and RC were calculated separately for smaller plaques (PV between 20 and < 40 μl) and larger plaques (PV between 40 and 60 μl).ResultsIntra- and inter-reader variabilityThe results of the PV measurements obtained by the 3 readers for 45 plaques (first data set) are summarised in Table 1. Mean PV values ranged between 67.8 and 71.8 μl. The ICC for intra-reader variability were close to 1 (the highest possible value) for each of the 3 readers with values of 0.985, 0.967 and 0.969 for the first, second and third reader, respectively. The ICC value generated between the 3 readers was 0.964 indicating that inter-reader variability was small, too (Table 1). Intra- and inter-reader variabilities were smaller, i.e. ICCs were higher, for plaques with PV > 60 μl than for plaques with PV < 60 μl (Table 2).Table 1Inter- and intra-reader variabilities for re-reading plaque volume (PV) of 45 plaquesReader 1Reader 2Reader 3Intra-reader variabilityPV reading 1 (μl)71.8 (42.5)67.8 (42.8)70.1 (45.4)PV reading 2 (μl)71.6 (43.3)70.0 (43.0)71.5 (44.0)ICC0.9850.9670.969Inter-reader variabilityPV both readings (μl)71.7 (42.7)68.9 (42.2)70.8 (44.4)ICC0.964Values are mean (standard deviation); ICC, intra-class correlation coefficientTable 2Intra-class correlation coefficients for re-reading plaque volume (PV) of 21 plaques with PV < 60 μl and 24 plaques with PV ≥ 60 μlReader 1Reader 2Reader 3PV < 60 μlIntra-reader variability0.9290.7830.689Inter-reader variability0.805PV ≥ 60 μlIntra-reader variability0.9760.9600.960Inter-reader variability0.949Effect of number of slicesMean (SD) PV of the 60 plaques included in the second data set was 39.8 (11.3) μl for the 5 S-method and 40.1 (11.2) μl for the 10 S-method. Mean (SD) CV calculated from the 3 individual PV measurements per plaque were 3.4 (1.9)% and 3.1 (1.6)% for the 5 S- and 10 S-methods, respectively. The RC was 4.7 μl (Table 3). The corresponding differences in PV measurements between the two methods are depicted by means of a Bland-Altman plot in Figure 2. A stratified analysis of the 30 plaques with PV between 20 and < 40 μl and for the 30 plaques between 40 and 60 μl showed that the mean CVs for both the 5 S- and the 10 S-methods were lower for larger plaques (2.4% and 2.4%) than for smaller plaques (4.3% and 3.8%).Table 3Coefficients of variation (CV) and repeatability coefficients (RC) for 60 plaques comparing the 5S- and 10S- methodsPV (μL)NCV (%)RC (μl)5S method10S method5S vs. 10S20 to < 40304.3 (2.0)3.8 (1.9)3.940 to < 60302.4 (1.1)2.4 (0.9)5.320 to < 60603.4 (1.9)3.1 (1.6)4.7PV, plaque volumeCV was calculated from 3 individual measurements, values are mean (standard deviation)RC was calculated for mean of 3 individual measurements comparing 5S and 10SFigure 2Difference against average of PV measurements using the 5S- and 10S-methods (second data set, n = 60).DiscussionBecause carotid plaque progression is not limited to changes in one direction, it is important to measure progression in three dimensions. Plaques grow and regress circumferentially as well as in length and thickness. As a non-invasive technique, 3D imaging allows:- direct plaque visualization- quantification of plaque features- the possibility of investigating volume changes that occur in multiple dimensions, such as plaque surface morphology, plaque geometry, and plaque distribution.For these reasons 3D-ultrasound is becoming more important in serial monitoring of disease progression or regression. Sample sizes which are required to test the effects of new therapies might be smaller for measurements of plaque volume than for traditional 2D measurements.The present study aimed to assess the quality of a centralised reading procedure of 3D US recordings of carotid PV measured in a multinational clinical trial. The small intra- and inter-reader variabilities reported in the study validate the reproducibility and reliability of the centralised PV measurement reading technique. Any slight differences observed between the 3 appointed readers may have reflected a minor subjective element due to differences in practice; however, these differences were small and randomly distributed, and would not be expected to have a significant effect on results generated in a clinical trial setting. Individual deviations between the first and second measurement made by the same reader, and between participating readers, were comparable with the occurrence of outliers in other methods of measurement applied in clinical trials, with respect to magnitude and frequency.In the present study, variability of the re-reading procedure was dependent on plaque size. Both inter- and intra-reader variabilities were lower for larger than for smaller plaques. This finding is in agreement with previous PV variability studies which utilised 3D ultrasound [1,14,20,21] showing that the CV in the measurement of PV decreased with plaque size. Due to irregular shape of some of the atheromatic plaques an increase in the number of slices used for calculation in manual planimetry method by decreasing the distance between slices could possibly increase the accuracy of volume determinations. Therefore, in the present study additional analyses were undertaken on a sample of 60 plaques to assess the variability depending on plaque size and the number of slices used during the determination of plaque volume. Half of plaques were between 20 and < 40 μl and half were between 40 and < 60 μl. The results indicate that the 5S- and the 10S-method provided similar results in volume calculation. Subgroup analyses of the two tracing techniques demonstrated that for the smaller plaques (PV between 20 and < 40 μl), the 10S-method offered slightly greater reliability as indicated by a lower coefficient of variation. In contrast, there was no difference between reliability of the 5S- or 10S-method in the larger plaque group (PV between 40 and < 60 μl). Therefore, the reliability of measurements of smaller plaques (< 40 μl) may be improved by using the 10S-method.The small variability in 3D US PV measurements and re-readings is an important finding, given the fact that this approach may be useful for evaluating the progression of carotid atherosclerosis and its response to treatment and for targeting preventive therapy [12]. Poor reproducibility could lead to inappropriate clinical management of individual patients, particularly given that the ratio of random measurement error to the variability among progression rates is large, and repeated measures or longer follow-up would be required to sufficiently reduce the contributions of random error to allow individual diagnoses [22].In contrast to disease areas such as cancer, large-scale screening programs to identify at-risk individuals with atherosclerotic disease have not yet been introduced, despite the higher burden of associated morbidity and mortality, as highlighted by the recent SHAPE Task Force Report [23]. The present study has confirmed that a reliable, non-invasive technique for monitoring the progression or regression (Fig. 3) of carotid atherosclerosis is now available.Figure 3Carotid plaque images obtained with 3D US showing an example of plaque regression under therapy with a daily dose of 40 mg olmesartan: a) A fibrous non-calcified plaque of the carotid artery (bulb) presented in longitudinal and cross sectional views at the start of therapy (Mean volume: 384 μL). b) The same plaque during therapy six months later (Mean volume: 250 μL). c) The same plaque (no longer visible) 16 months later.It should be noted that a number of limitations can affect the 3D technique for measuring plaque volume. In a small number of cases, plaque boundaries might not be well defined due to dropouts and shadowing owing to attenuation of the US beam, and these might be present in the reconstructed 3D US images. Calcified plaques with marked shadowing are not measureable, and plaque identification at the carotid bifurcation and in areas of poor image resolution may in a few cases also create some difficulty in plaque identification. In addition, there is a higher variability in smaller plaques (< 40 μl), and the reliability of measurements of smaller plaques (< 40 μl) may be improved by using an increased number of slices (10 instead of 5 slices).In summary, the centralized reading procedure investigated in this study has been shown to be reliable and reproducible. Variability in the reading process increases with decreasing plaque volumes, and the 10S-method may offer greater reproducibility than the 5S-method for volume assessment of small plaques.ConclusionThe 3D US techniques combined with a well controlled centralised reading procedure described in this study are appropriate tools for monitoring progression of carotid atherosclerosis and its response to treatment. By implementing standardised central 3D US reading protocols and strict quality control procedures highly reliable ultrasonic re-readings of plaques images can be achieved in large multicentre trials.Competing interestsProf. Dr. M. Ludwig – consultant for Daiichi Sankyo, Munich, Germany.Prof. Dr. K.O. Stumpe has received research grants and lecture honoraria from Daiichi-Sankyo during the last five years.Prof. Dr. Tomasz Zielinski – consultant for Daiichi Sankyo, Munich, Germany.Authors' contributionsCarotid artery scans were carried out by TZ. Reading of scans was carried out by the reading centre EUTARC/Feldafing, Germany. Statistical analyses had been carried out by DS. ML and TZ provided expert input during the analysis and interpretation of the data. All authors provided input during the writing and editing of the manuscript.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2531090.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2531090",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2531090\nAUTHORS: Aldoph B Nanguzgambo, Martin Pike, Richard D Page, Grant F Benfield, Damian McKeon\n\nABSTRACT:\nMediastinal cysts have an unpredictable course but can cause complications such as infection or local pressure effects. Persons with mediastinal cysts can be asymptomatic for many years or can develop symptoms as a result of complications of the cyst. There is a lack of consensus on the best approach to managing those patients without symptoms. In this case report, a 56 year old woman with an indolent mediastinal cyst initially managed conservatively suddenly developed symptoms suggestive of an infected mediastinal cyst requiring surgical resection.\n\nBODY:\nIntroductionMediastinal cysts comprise 10–18% of radiologically detected masses in the mediastinum [1,2]. Foregut cysts including bronchogenic cysts are the most common and comprise 50% of all mediastinal cysts [2,3]. Complications of mediastinal cysts include infection (in about 30–36%), local pressure effects and malignant transformation [2-4]. The frequency of symptoms due to mediastinal cysts ranges from 35–90% and these include chest pain, dyspnoea, wheeze, cough, fever and hoarsenes of voice [2,4,5]. There is a lack of consensus on the best approach to managing those patients without symptoms. We present a case of a simple mediastinal cyst that was initially managed conservatively.CaseA 56 year old previously healthy Caucasian woman and non-smoker, presented to the outpatient chest department with symptoms of episodic bouts of dry cough associated with an occasional wheeze for 12 months and upper thoracic back pain for 3 months. She had no history of chest trauma. On examination, she was not breathless or wheezy and she had a normal temperature. The chest radiograph revealed an area of gas-filled tissue in the upper right mediastinum (fig. 1) and a Computer Tomography (CT) scan confirmed a loculated air-filled collection predominantly anterior to the trachea and extending below the carina with no evidence of fluid within the locules. There was no air tracking into the neck or the abdomen. (fig. 2). The patient had no recollection of having the cyst diagnosed in the past. The patient was stable and a wait and watch approach was taken, and the patient was to be reviewed in 3 months.Figure 1Chest radiograph showing the air-filled mediastinal mass.Figure 2Contrast enhanced axial CT-scan of the thorax showing the air-filled cystic mass both anterior and posterior to the carina (lung window setting).She was readmitted 2 months later with severe chest pain. On examination she was breathless with an expiratory wheeze and was febrile (37.5°C). The patient was not in shock. A repeat chest radiograph (fig 3) and CT scan (figs. 4 and 5) demonstrated a 9 × 5 cm loculated mass containing fluid and gas, encasing the lower trachea and the main proximal bronchi and extending from the innominate vein to the left atrium consistent with a mediastinal abscess. Bilateral pleural effusions were also present. The lungs were normal. The patient was treated with broad spectrum antibiotics and then had an open thoracotomy three days later with complete resection of the mass. The air-fluid level seen on the CT scans would suggest a tracheobronchial communication but no such communication was found during the operation. Histopathological examination of the mass revealed a collapsed thick walled cyst about 55 mm in diameter. The cyst wall consisted of fibrous and granulation tissue with heavy, chronic active inflammation. There were fragmented seromucinous glands on the inner surface of the cyst wall. These findings were consistent with an infected cyst likely to be bronchogenic in origin. Culture results of the cystic contents were however negative. The patient recovered from the surgical operation uneventfully and had no recurrence of her previous symptoms when reviewed 3 months laterFigure 3Chest radiograph showing the cystic mass, now with an air-fluid level (compare Fig 1).Figure 4Contrast enhanced axial CT-scan of the thorax showing the cystic mass, now containing fluid, at the level of the aortic arch (mediastinal window setting).Figure 5Contrast enhanced axial CT-scan of the thorax showing the cystic mass at the level of the carina, now with air-fluid levels, compare fig 2. Also shows bilateral pleural effusions worse on right side (lung window setting).DiscussionOur patient first presented to us when she already had symptoms. It is not clear how long she had been with the cyst. We can only assume that it could have been congenital. We can not explain the subsequent development of the pleural effusions, nor the lack of microbial growth in the cystic contents after resection. We however postulate that the pleural effusions could have been reactive and the lack of any microbial growth could be due to the pre-operative antibiotics she received. We acknowledge that we did not aspirate fluid from the pleural effusions for analysis.Initially we chose to manage her by observation. At the time of first presentation, she had symptoms of cough, wheeze and thoracic back pain which can be attributed to compression by the cyst on the tracheobronchial tree. This should have been the time to refer her to the thoracic surgeons for further management. Our conservative approach did not work and the patient susbsequently developed signs of an infected cyst that eventually required radical treatment. The current available treatment options for bronchogenic cysts, whether asymptomatic or symptomatic, include observation, fine needle aspiration, mediastinoscopic aspiration and biopsy, thoracoscopy, and mediastinoscopy or thoracotomy for resection [6]. Some authors advocate a conservative approach for small classic asymptomatic cysts [6-8]. Conservative management is defined by observation or minimal invasive procedures rather than open thoracotomy. The argument given is the lack of long term follow-up data on asymptomatic patients to know the natural history of the cysts, a very low risk of malignant transformation, the improved diagnostic radiological methods (CT scanning and MRI) and better diagnostic tools (thoracoscopy or transbroncial needle aspiration or mediastinoscopic aspiration) now available that can help avoid unnecessary surgical thoracotomies [6,7]. We are not sure whether such aspiration would have been the appropriate course for our patient at initial presentation to relieve her symptoms.Other authors however advocate a radical approach by complete resection of the cyst using an open thoracotomy [2,4,9,10]. The reasons forwarded for radical resection are threefold. Firstly, complete resection prevents future complications. Although the natural history of bronchogenic cysts is not known, majority of the cysts will eventually cause symptoms. In the study by St Georges et al, 43% of the patients eventually became symptomatic although they had been known to have the mediastinal cysts for periods ranging from 6 months to several years [4]. In the series by Patel et al, 3 patients followed up for periods between 1.5 to 10 years eventually required resection due to development of symptoms [10]. Secondly, despite the low risk of malignant transformation of the cyst, resection helps to definitely exclude malignancy. Resection also provides a definite diagnosis as to the nature of the lesion. Although CT scanning can outline the lesion & define the contents (low hounsefield units), the density of the cyst may vary and make precise diagnosis by imaging difficult [6,9]. CT scanning only correctly defined the benign cystic nature of 5 lesions out of 8 in one series (62.5%) [10]. St Georges and colleagues have also discouraged aspiration of the cystic contents as a diagnostic or therapeutic procedure because the aspirate does not provide specific data on the cyst epithelium, the aspirate may be insufficient to exclude malignancy, and needling the cyst may predispose it to being infected. Thirdly, complete resection of symptomatic mediastinal cysts seems to be associated with greater intra- or post-operative complications than performing surgery in asymptomatic patients. In the series by Patel et al, there was a trend towards increased post-operative complications in those operated at time of symptom presentation compared to asymptomatic patients (27% vs 14%) [10]. It is also noted that about 44% of patients with mediastinal bronchogenic cysts in the study by St Georges et al had major operative difficulties or intra-operative complications and all of them were symptomatic [4].Despite the lack of consensus on how to manage asymptomatic patients, there seems to be a general agreement that when the bronchogenic cyst increases in size or causes symptoms, intervention is warranted. Patients diagnosed with bronchogenic cysts should be referred to thoracic surgeons early so that the treatment options are explained to them to enable them make an informed choice on what intervention is appropriate at the time. However, the type of intervention will ultimately depend on the operating surgeon.Consent sectionWritten informed consent was obtained from the patient for the publication of this case report and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsABN coordinated and wrote the manuscript. MP reported, prepared and labelled the radiology images. RDP contributed to the surgical aspects of the case. GFB and DM suggested the writing up of this case and reviewed the manuscript. All authors read and approved the manuscript.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2531102.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2531102",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2531102\nAUTHORS: Sridhar Rathinam, Prakash Nanjaiah, Sivakumar Sivalingam, Pala B Rajesh\n\nABSTRACT:\nBackgroundVideo-Assisted Thoracoscopic Sympathectomy (VATS) is an established minimally invasive procedure for thoracic sympathetic blockade in patients with hyperhidrosis, facial flushing and intractable angina. Various techniques using clips, diathermy and excision are used to perform sympathectomy. We present our technique of excision of the sympathetic chain with histological proof and the analysis of the early and late outcomes.MethodsWe evaluated 200 procedures in 100 consecutive patients, who underwent Video Assisted Thoracoscopic Sympathectomy by a single surgeon in our centre between September 1996 to March 2007. All patients had maximum medical therapy prior to surgery and were divided into 3 groups based on indications, Group 1(hyperhidrosis: 48 patients), Group 2 (facial flushing: 26 patients) and Group 3(intractable angina: 26 patients). The demography and severity of symptoms for each group were analysed. The endpoints were success rate, 30 day mortality, complications and patient's satisfaction.Results99 patients had bilateral VATS sympathectomy and 1 had unilateral sympathectomy. The conversion rate to open was 1(1%). All patients had successful removal of ganglia proven histologically with no perioperative mortality in our series. The complications included pneumothorax (5%), acute coronary syndrome (2%), transient Horner's syndrome (1%), transient paraesthesia (1%), wound infection (4%), compensatory hyperhidrosis (18%), residual flushing (3%) and wound pain (5%). There were five late deaths in the intractable angina group at a mean follow up of 36.7 months. Overall success rates of abolishing the symptoms were 96.3%, 87.5% and 95.2% for Group 1, 2 and 3 respectively.ConclusionExcision of the sympathetic chain with histological confirmation during VATS sympathectomy is a safe and effective method in treating hyperhidrosis, facial flushing and intractable angina with good long term results and satisfaction.\n\nBODY:\nBackgroundThoracoscopic sympathectomy has established itself as a procedure for a thoracic surgeon since it was first reported by Hughues in 1942[1] and popularized by Kux [2]. This was first introduced in 1996 at our regional thoracic surgical unit for the treatment of 3 conditions namely hyperhidrosis, facial flushing and intractable angina. We report our experience of the first hundred patients who had resection of T2 – T4 sympathetic ganglia along with the rami communicantes performed by a single surgeon and their early and long term outcomes.MethodsA retrospective review of prospectively collected data was performed on Video Assisted Thoracoscopic Sympathectomies with histological proof of excision to review early and late outcomes. 100 patients underwent 200 VATS sympathectomy by a single surgeon in a tertiary thoracic centre between September 1996 and March 2007 There were 47 males(47%) with a mean age of 32 years (range 18–80) All patients had maximum medical therapy prior to surgery. They were classified into 3 groups based on indications, Group 1: hyperhidrosis, Group 2: facial flushing and Group 3: intractable angina. The distribution of the cases has been illustrated in figure 1. The study was approved by the department and discussed with the ethics committee which advised ethics approval was not required as this was an outcome audit. Diagnosis was made in all patients by history and examination. All patients who underwent the procedure had subjective symptoms affecting quality of life. The patients in the hyperhidrosis group had an unsuccessful trial of medical therapy. Their symptoms were scaled on the basis of symptoms and impact on quality of life (Grade 1: minimal impact on their QOL, Grade 2: caused significant impact on quality of life and Grade 3: severe impact on quality of life). Surgery was only offered to patients with grade 2 and grade 3 symptoms. In the angina group, patients were referred with angina refractory to maximal anti-anginal therapy and deemed unsuitable anatomically for coronary revascularisation. Initial assessment included a detailed history with regards to angina symptoms, degree of disability and effects on quality of life. Patients had a pre-study exercise tolerance test to assess exercise capacity and confirm objective evidence of ischaemia. MUGA scans or transthoracic echocardiogram was performed to determine the left ventricular function. Each patient's angiogram was reviewed by an independent cardiologist and cardiothoracic surgeon and confirmed to be unsuitable for coronary artery bypass grafting or percutaneous cardiological intervention.Figure 1The Distribution of cases in the various groups.Table 1Patient Satisfaction OutcomesGroupNo changeBetterVery satisfied% improvedHyperhidrosis (48)293796%Facial flushing (26)491385%Intractable angina (26)261892%ProcedureBilateral VATS sympathectomy was performed under general anaesthesia with single lung ventilation starting with the left side followed by right. We found this approach helpful in avoiding arrhythmias in patients with intractable angina. All the patients had electrocardiogram, pulse oximetry and blood pressure monitored during the procedure. In addition the patients undergoing it for angina had invasive arterial monitoring as well (in our initial practice we routinely placed a pulmonary artery floatation catheter in all patients undergoing sympathectomy for angina). A slight degree of cranial elevation and the lateral thoracotomy position helps the lungs to drop away from the operating site exposing the sympathetic chain. The first port was placed in the 5th intercostal space below and anterior to inferior angle of scapula. A 10 mm zero degree telescope was passed through this port. Two further ports were placed for instrumentation at the level of the 3rd and 4th intercostal spaces in the anterior axillary line. The parietal pleura was then incised to expose the sympathetic chain. An extensive thoracic sympathectomy was performed using electrocautery and excision of thoracic sympathetic chain from 2nd to 4th ganglia along with associated rami communicantes. In patients with hyperhidrosis and facial flushing the parietal pleura was cleared for 2 cm lateral to the sympathetic chain in the 2nd intercostal space. This was performed to identify the accessory nerve of Kuntz which was then ablated. The excised ganglia are confirmed histologically in each case. A redivac drain was placed in the apex through the anterior port. The wound was closed in layers with 2'0' vicryl on a 'J-shaped' needle for the intercostal muscle layer, 2'0' vicryl for the subcutaneous tissue and 3'0' monocryl for the skin. Local anaesthetic was infiltrated to the port sites. The patient was then repositioned and the procedure was repeated on the contra lateral side.All the patients were extubated on table and were nursed in the thoracic surgical ward except the angina patients who were nursed in the Coronary Care Unit. Patient controlled morphine analgesia was provided for pain relief. The redivac drains were removed the day after the operation if the lungs were satisfactorily expanded. Follow-up was made by outpatient visit, medical notes review, and a telephone interview of patients who were discharged from our care. Patients were asked to rate their operative outcome of the procedure as 1 for no change, 2 for satisfactory and 3 to denote a significant improvement and its impact on their quality of life.ResultsIn the time frame study 100 patients underwent 200 VATS sympathectomies. Ninety nine patients had bilateral procedures (one unilateral re operation after 4 years) and one patient had unilateral procedure. There were no post-operative deaths. There was conversion to thoracotomy in the angina group in one patient who had a previous decortication. The median post operative length of stay was 2.4 days for the facial flushing and hyperhidrosis groups and 5.1 days for the angina group. Early complications included acute coronary syndrome, pneumothorax, seroma, transient Horner's syndrome, transient paraesthesia and wound infection as detailed in Table 2. Compensatory hyperhidrosis occurred in 18 patients and was not severe enough to affect their quality of life.Table 2Early complicationsComplicationNumber of patients%Acute coronary syndrome22%Pneumothorax55%Transient Horner's Syndrome11%Transient Parasthesia11%Compensatory hyperhidrosis1818%Wound infection44%Seroma11%The patients were subjectively assessed for their symptoms in the out patients clinic at 4 weeks, 3 months and 6 months and the care was transferred to the referring clinician. Late outcomes were obtained through telephone-conducted patient interviews. All patients were graded for their improvement in the symptoms as 1 for no change, 2 for better and 3 for satisfied. In the hyperhidrosis group 46 patients (96%) were satisfied with the procedure. In the facial flushing group 22(85%) were satisfied with the procedure (Figure 2).Figure 2The patient satisfaction outcomes.The angina group were assessed by their pre and post procedure Canadian Cardiovascular score for angina, subjective angina score out of 10 and frequency of anginal episodes. Of the twenty five patients who underwent the procedure for relief of refractory angina only one patient (4%) did not feel any difference all the rest had an immediate relief in their symptoms. One patient had atrial fibrillation and two had a post operative myocardial infarction in the early post operative phase.Follow upFull follow-up was available for a mean 67.8 months. In the angina group there were 5 deaths at a mean of 28.75 +/- 13.7 months after procedure. Of these, 2 deaths were cardiac related deaths, one patient died of lung cancer, one patient due to perforated bowel and one died of terminal colonic cancer. The patients who died had symptomatic relief and were satisfied with the operation. On late follow-up 1 patient continued to have anginal symptoms and there was recurrence of angina in two patients at a follow up of 3 and 36 months. Of these patients with recurrence one patient the angina symptoms were present only on the right side and one patient had a dorsal spinal cord stimulator fitted which offered him relief.In the hyperhidrosis group one patient was noted to have unilateral persistence of sweating and he underwent a re do right sympathectomy after four years which abolished his symptoms. In the original operation the T 2 sympathectomy was not performed on the right due to the presence of large veins this was remedied in the second operation. 4 (15%) patients of facial flushing group had residual facial flushing. 18 patients (18%) had compensatory hyperhidrosis but none found this complication to adversely affect their quality of life. Five patients had post thoracoscopic pain of which one had chronic pain needing referral to the pain clinic. The patient satisfaction results are tabulated in table 1/figure 2.DiscussionVATS sympathectomy is an established therapeutic option for hyperhidrosis [3], facial flushing [4], Raynaud's disease [5] and ischaemic heart disease [6].Primary or essential Hyperhidrosis is a functionally, professionally, and socially disabling condition. It is a pathological condition characterized by excessive secretion of the eccrine glands resulting in overpespiration disproportionate to the requirements of thermoregulation and dissipation of body heat [7]. The current medical treatment modalities for hyperhidrosis include topical application of aluminium salts, tap water iontophoresis, botulinum toxin injections, behavioural and psychotherapy with limited success [8]. The pathophysiology of facial flushing is uncertain, but it is thought to involve vasomotor and sudomotor imbalances [4].In patients unsuitable for surgical intervention but with intractable angina therapeutic options included long-term intermittent urokinase, spinal cord stimulation and Trans Myocardial Revascularisation. Wettervik showed that VATS sympathectomy had encouraging early results in this group of patient [9]. Benefit is thought to be related to pain anaesthesia of the upper thoracic sympathetic afferent and efferent fibres[10] and vasodilatation following coronary blockade of alpha adreno receptor mediated sympathetic vasoconstriction [11].Several groups have adopted a single or two port technique for VATS sympathectomy [7,12,13]. In our series we performed the procedure with the 3-port technique, since it allows accurate, safe and reproducible dissection of the thoracic sympathetic chain. We use conventional Thoracoscopic instruments (i.e. no articulating instruments) and training residents is much easier with the three port technique.Excision of the appropriate sympathetic ganglia is essential for effective post operative outcomes. Excision of the lower third of the stellate ganglia increases the risk of Horner's syndrome [14]. Removal of ganglia between T2 – T4 is optimal for sympathetic denervation of the upper limb [15]. In the treatment of intractable angina we have shown that T2 – T4 sympathectomy was sufficient to alleviate symptoms without risking undue hypotension and Horner's syndrome associated with more extensive excision. Excision of the second to fourth sympathetic ganglia as opposed to clipping [16] or electro coagulation [17] may reduce the incidence of recurrence. In patients with hyperhidrosis and facial flushing, the nerve of Kuntz was excised to reduce recurrence[18,19].The cause for late recurrence after a successful sympathectomy involves sensitization produced by section of postganglionic fibres. In our study the recurrence of hyperhidrosis was 2% which is comparable to that reported in the literature 6.5% reported in literature [20]. The most common complication of thoracic sympathectomy is transient compensatory sweating probably due to thermoregulatory imbalance. This occurred in 18% of the patients in our study which is consistent with the reported incidence of 20% to 86% [21-23]. We feel the major adverse complications in our series are less due to the three port technique and better visualisation. We did not have any vascular injuries, reexplorations for bleeding, permanent Horner's syndrome or chylothorax which are reported in the literature [22].We have demonstrated that patients with intractable angina treated with VATS sympathectomy, had a decrease in angina score and frequency of angina as well as an improvement in exercise tolerance [6]. One of the concerns with this procedure was that the denervation of the heart might result in silent ischaemia and mortality, which has not been the case. The other concern was if denervation leads to symptom relief why this was not a complete abolition of symptoms. We feel the benefits are individualised because the sympathetic innervation is collateralised from the aortic plexus which derives its fibres from the cervical plexus. In this current study, we have studied the long term outcomes of the same and noted persistent benefit in symptom alleviation. VATS sympathectomy is a durable palliation for symptoms of angina in a group with few other reliable therapeutic options.It is our policy to send the excised sympathetic chain for histological confirmation as a quality control measure. We feel this is a good practice in the current medico legal climate so that the surgeon can demonstrate the chain was excised.ConclusionVideo assisted thoracoscopic sympathectomy with histological proof of excision is a safe and effective procedure attended by low complications. It is an effective treatment for hyperhidrosis and facial flushing with good long term benefits and patient satisfaction. It offers lasting relief from angina and improves quality of life in patients with intractable angina without options of conventional revascularisation. Histological confirmation of the excised sympathetic chain is valuable for medico-legal documentation.AbbreviationsVATS: Video assisted Thoracoscopic surgery; QOL: Quality of LifeCompeting interestsThe authors declare that they have no competing interests.Authors' contributionsSR was involved with study design, performed the data analysis and authored the manuscript, PN was involved in data collection and follow up, SS designed the study, collected the data and performed data analysis and PBR devised the study, performed all the operations and co authored the manuscript. All authors have read and approved the manuscript.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2531125.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2531125",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2531125\nAUTHORS: Tahsin Turunc, Baris Kuzgunbay, Tuba Canpolat\n\nABSTRACT:\nIntroductionFibroepithelial polyps of the ureter are benign tumors arising from the mesodermal tissue in the ureteral wall. Their etiology remains unknown. Hematuria and obstructive urinary symptoms are the most common findings. The treatment of choice is endoscopic resection, and the prognosis for patients with these lesions is excellent.Case presentationWe present three cases of fibroepithelial polyps associated with calculi in the distal part of the ureter. The patients were all women, aged 20, 45 and 52 years. Two patients were suffering from flank pain and dysuria while one patient was asymptomatic at the time of diagnosis. The patients were fully treated with endoscopic resection. To the best of our knowledge, this is the fourth report of adult ureteral fibroepithelial polyps associated with ureteral calculi in the English literature. The etiology, clinical features, diagnosis, and management of fibroepithelial polyps are discussed in this report.ConclusionWhenever polypoid lesions are detected especially at the distal part of the ureter, benign fibroepithelial polyps should be kept in mind for differential diagnosis. Additionally, although rarely seen, the co-existence of ureteral calculi with fibroepithelial polyps should be borne in mind.\n\nBODY:\nIntroductionFibroepithelial polyps (FEPs) are the most common benign lesions of the ureter. Most occur in the ureter and renal pelvis in adult patients, while a few occur in the posterior urethra or bladder, generally in children [1]. However, FEPs of the ureter accompanied by calculi are rare. We review our experiences with three patients having FEP associated with calculi in the distal ureter to define this entity more clearly and its outcome following treatment.Case presentationCase 1A 20-year-old woman presented to our clinic with intermittent right flank pain and dysuria. She had undergone an extracorporeal shockwave lithotripsy for a kidney stone 5 months before the current admission. Urine analysis showed mild microscopic hematuria. Intravenous urography demonstrated a 12-mm calculus in the right distal ureter, focal ureteral dilatation in the proximal part of the ureter, smoothly marginated tubular filling defects, and mild hydronephrosis. Also, there was another irregular filling defect at the level of the right ureteral orifice (Fig. 1). On cystoscopic examination of her bladder, there were two polypoid masses, grayish-white in color, about 2 cm long and 0.5 cm wide, prolapsing into the bladder from the right ureteral orifice with a thin stalk (Fig. 2). A urine sample was taken for immediate cytology and the polyps were grasped with forceps for traction and resected over the root area through the ureteroscope and manipulated for frozen biopsy. The results of the urine cytology were negative, and the analysis of the frozen section demonstrated a benign FEP. Then the ureteroscope was inserted into the right ureter through the guide wire and the calculus was fragmented by pneumatic lithotripsy and fragments were extracted with a basket. About 1 cm proximally to the calculi, multiple millimetric polypoid structures were exposed and all of them were resected as described above. The bases of the polyps were coagulated with an electrode to stop bleeding and prevent recurrences. A ureteral stent was placed to provide urine drainage and to avoid probable obstruction caused by edema, then removed 24 hours later.Figure 1Intravenous urographic demonstration of fibroepithelial polyps in distal ureter with filling defects.Figure 2Cystoscopic visualization of fibroepithelial polyps prolapsing into the bladder from the right ureteral orifice.The final pathology report showed FEP. Histologically, the polyps had a core of loose fibrovascular stroma covered by a layer of normal transitional uroepithelia, associated with edema, congestion, and mononuclear cell infiltration. No significant cellular atypia or cytologic abnormality was observed.Case 2A 45-year-old woman presented to our clinic with left flank pain, dysuria, and hematuria. Escherichia coli was detected in a urine culture and treated with levofloxacin (500 mg PO q.d.) for 2 weeks. An intravenous urogram (IVU) showed two 0.6 cm calculi in the left distal ureter, a tubular filling defect proximal to the calculi, and moderate hydronephrosis.A left ureteroscopy showed a polypoid mass, grayish in color, about 1 cm long and 0.3 cm wide, with a thin stalk that projected into the lumen in the distal ureter. A urine sample was obtained for cytology, and then the polyp was grasped with forceps for traction and resected over the root area through the ureteroscope and manipulated for frozen biopsy. Urine cytology was negative and frozen biopsy results were in favor of benign FEP. The base of the polyp was coagulated by an electrode to stop bleeding and prevent recurrences. Then, pneumatic lithotripsy was performed, the resultant fragments were extracted, and double J stents were inserted for 4 weeks. The final pathology report revealed a FEP (Fig. 3).Figure 3Fibroepithelial polyp of ureter that has a loose fibrovascular stroma (A) (hematoxylin and eosin, ×40) and covered by transitional epithelium (B) (hematoxylin and eosin, ×200).Case 3A 52-year-old woman presented to our clinic with an asymptomatic left distal ureteral stone diagnosed incidentally. IVU showed a calculus 12 mm long and located in her left distal ureter without any ipsilateral urinary drainage, indicating no renal dysfunction and right renal calculi. On cystoscopic examination, 2 polyps were detected, 5 mm in diameter and prolapsing into the bladder from the left ureteral orifices. The polyps were resected in the same way as described above and the calculus was managed with ureteroscopic lithotripsy. The final pathology report revealed a FEP.IVU was performed in all three patients 2 months after the operation; no pathological finding was detected except focal dilation in the distal ureter in Case 1 and residual dilatation in the ureter and the kidney in Cases 2 and 3.All patients subsequently underwent annual radiographic follow-ups with IVU, and no recurrences were detected.ConclusionUreteral FEP was first reported in 1932 [2], and since then, there have been approximately 236 scientific papers on fibroepithelial polyps. Fibroepithelial polyps are rare, benign, mesodermal tumors of the urinary tract that are histologically composed of fibrous stroma covered with a transitional urothelium. They are considered the most common benign lesions of the ureter among other benign lesions such as leiomyomas, lymphangiomas, and neurofibromas. They are often smoothly marginated and cylindrical, sessile, or even frond like [1]. Because of their histologic organization, FEPs are classified as benign hamartomas; however, malignant degeneration and cystic transformation have also been reported [3,4].Fibroepithelial polyps commonly present in adults in the third to fifth decades with a male-to-female ratio of 3:2. In adults, most FEPs occur in the ureter; 62% of these polyps are located in the upper ureter or uretero-pelvic junction, 15% are in the renal pelvis, and a small percentage is in the bladder or posterior urethra [1]. Fibroepithelial polyps of the lower urinary tract usually occur in the posterior urethra, most often in children. They usually appear as solitary polyps; however, rare cases of multiple and bilateral appearances have been reported [3,5].Although the etiology of FEPs is unclear, they are thought to be either congenital slow-growing lesions or lesions that develop as a result of chronic urothelial irritants, such as infection, inflammation, calculi, or obstruction. The most significant signs and symptoms of the polyps are hematuria and flank pain [1]. The pain is characteristically intermittent and colicky due to partial obstruction. Urinary frequency, dysuria, and pyuria are other less common findings [1].On IVU or retrograde urograms, FEPs appear to be long, smooth ureteral filling defects; their position may change between images; and they are associated with varying degrees of hydronephrosis [6]. It is important to distinguish FEPs from upper urinary tract carcinomas because management and prognosis can be significantly different. Debruyne and associates reported that unnecessary nephroureterectomies were performed in 42 of 112 patients (37%) with FEP because of an uncertain pre-operative diagnosis [7].In the past, management of FEP was excision of the polyp and reanastomosis with an open procedure. Recently, with the advent of ureteroscopes, minimally invasive endoscopic treatment has become more popular. Usually, the polyps are grasped with forceps for traction and resected over the root area through the ureteroscope, and the base is fulgurated to prevent recurrence. The holmium:YAG laser is another modality for endoscopic resection. Carey and Bird successfully ablated multiple polyps in one ureter by using the holmium laser, and removed each polyp from the ureteral wall with grasping forceps. Also, ureteral stones are removed concurrently with a basket and a ureteral access sheath is used to facilitate the multiple passes of the ureteroscope and the removal of the polyps and stones from the proximal ureter [8]. Percutaneous antegrade excision should be available for treating polyps in the renal pelvis and the upper ureter [3]. Laparoscopic surgery might be preferred over open surgery when the polyps are too large to be fully cleaned by endoscopic surgery.Although close follow-up was recommended in the literature because of the risk of recurrence, the duration and frequency of follow-up are not clear. Although some studies have suggested cytological evaluation of urine in the postoperative follow-up, we do not agree with this because of the benign nature of FEP. Some studies have suggested control ureteroscopy associated with IVU in the follow-up [8]. We think that yearly IVU should be helpful in the follow-up after the initial IVU 2 to 3 months after the endoscopic resection of FEP. However, the follow-up period might be changed depending on the clinical progression, signs and symptoms of the disease. Interestingly, although fibroepithelial polyps were solitary in children, in the cases presented here they were multiple, located in the distal part of the ureter and associated with an adjacent ureteral calculus; however, this scenario has rarely been reported in the literature. There have only been three prior case reports of ureteral FEP with adjacent urolithiasis in adults [[8,9], 10], and long-term or repeated inflammation of ureteral tissue by urinary crystals, calculi, stents, and infections has been implicated.Since chronic irritation has been reported to be an etiological factor in fibroepithelial polyps, calculi in the ureter may be responsible for the formation of FEP; however, the opposite might also be true. In the cases presented here, urinary retention and chronic irritation due to the obstruction formed by the ureteral stones might have been responsible for the ureteral polyps, but the accepted theory in the literature is stone formation due to urinary retention caused by FEP. In both situations, endoscopic management of FEP and calculi is safe, effective, and minimally invasive. We reviewed our experience in cases of FEP associated with calculi in the distal ureter and attempted to define this entity and its outcome more clearly after treatment. When a calculus and an accompanying polypoid mass are detected in the ureter, FEP, which is histologically benign in nature, should be kept in mind in differential diagnosis and both polyps and calculi should be managed at the same time, if possible.AbbreviationsFEP: Fibroepithelial polyp; IVU: Intravenous urography.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsTT reviewed the literature, conceived and drafted the manuscript. BK and TC examined the patient, helped to record the data and prepare the manuscript. All of the authors read and approved the final manuscript.ConsentWritten informed consent was obtained from the patients for publication of this case series and accompanying images. A copy of the written consent is available for review by the Editor-in-Chief of this journal.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2531172.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2531172",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2531172\nAUTHORS: Costa Healy, Mohamed Hobeldin, Anies Mahomed\n\nABSTRACT:\nThe expectant management of high grade renal injuries in hemodynamically stable children has gained increasing acceptance amongst paediatric surgeons. However, patients with grade 1V injury with complete renal transection have been identified as a subgroup with a poor outcome that may benefit from early operative intervention.Interestingly, both internal and external drainage have been independently utilised as part of the expectant approach. The former is more widely practiced and was first suggested by Haas et al who used it successfully in 5 patients with grade 1V renal trauma. Yet to be clearly established in this context is the value and timing of external drainage, particularly, when used in combination with internal stenting.Described is a child with complete renal transaction who was successfully managed with a combination of internal and external drainage.\n\nBODY:\nCase presentationA 5 year old Caucasian male patient was admitted to a tertiary paediatric surgical centre within 1 hour of coming off a quadbike, sustaining blunt trauma to the right chest and the right upper quadrant of abdomen. Initial assessment confirmed hypovolaemic shock which responded to aggressive resuscitation as well as a tender right flank with macroscopic haematuria. Once stabilised a Computarised Tomography (CT) scan and IVP were performed which confirmed contusion of the right lower lung, fracture of several overlying ribs and complete right renal fracture with distraction of upper and lower poles (Grade1V), (Figure 1). Also documented were contrast extravasation from the pelvico-calyceal system and a substantial perinephric haematoma. Significantly, some contrast was noted in the distal right ureter confirming ipsilateral pelvico-ureteric continuity.Figure 1Polar diastasis and urinary extravasation as seen on IVP.The patient was subsequently admitted to the intensive care unit where he was managed with bed rest, broad spectrum antibiotic cover and regular haemoglobin checks with transfusion top ups as necessary.Over the next day the patient developed an ileus with progressive abdominal distended and an ultrasound scan was performed. This confirmed an expanding right perinephric collection which was managed by sonar guided placement of a percutaneous pigtail catheter – maintained on free drainage.Twenty four hours later with worsening abdominal distension and high output drainage from the pigtail catheter, the child was taken to theatre where under a general anaesthetic and fluoroscopic guidance a 4.5 French double J stent was passed retrogradely into the right renal pelvis. (Fig 2) This had the immediate effect of diverting urine from the pigtail catheter whose output dropped significantly. Macroscopic haematuria and the ileus improved gradually over the next 10 days allowing for the resumption of oral feeding and withdrawal of total parental nutrition.Figure 2Concomitant percutaneous pigtal and internal double J drainage of right kidney.The pigtail catheter was removed on cessation of urine drainage at 3 weeks. A duplex scan at this point demonstrated resolution of the perinephric collection with greater approximation of the renal poles. A repeat ultrasound scan at 5 weeks with the double J stent still in situ showed radiological evidence of a reconstituted kidney. The patient was discharged at this stage and readmitted 3 weeks later for removal of the ureteric stent.His subsequent recovery was uneventful and at 4 years post injury he remains normotensive with equitable renal function noted on Dimecaptosuccinic acid (DMSA) scan (Fig 3)Figure 3DMSA Scan demonstrating a slightly elongated but otherwise normally functioning right kidney.DiscussionThe kidneys in children are proportionally larger and have much less perirenal fat and costal protection than in adults which predisposes them to injury after blunt abdominal trauma (10% of cases) [1,2]. Prompt attention to these injuries is vital to allow for optimal recovery and to minimise long term sequelae. The management of renal trauma ranges from an emergency laparotomy for haemodynamic compromise to observation without intervention in minor lacerations. As with all solid organ injuries in children there has been a shift to conservative management where possible [1,2]. Increasingly minimally invasive techniques are being adopted to manage significant renal trauma where there is no haemodynamic compromise [2-5]. This approach results in a lower incidence of nephrectomy and has few long term complications.However the management of grade IV renal injury in children is controversial, particularly with regard to the management of urinary extravasation. Grade IV trauma is defined as parenchymal laceration extending through the corticomedullary junction and into the collecting system [6]. This results in urinary extravasation with the potential for large urinomas. Traditionally these injuries have been treated aggressively with open surgery with the justification that urinomas may lead to perirenal fibrosis with complications of obstruction, infection and hypertension. However much of this evidence is from the adult population and is not necessarily applicable to paediatric practice [6]. The options for treating urinomas are; open drainage, with or without surgical repair, ureteric stents, percutaneous drains or just observation.Grade 1V renal injuries with complete fracture and separation of the poles but with intact blood supply constitutes a special group with a decreased likelihood of spontaneous resolution and where early intervention may be necessary [1]. Endourological stenting or percutaneous drainage and failing this, open surgery, are options described in the management these patients. Endourological stenting on its own has not gained widespread popularity because stent calibre is not thought to be sufficient for optimal drainage [1].There is currently no consensus on the optimal timing of these interventions. However from the experience of this case where a policy of early aggressive management with a combination of internal and external drainage was successfully utilised would lead us to support this approach to improve renal salvage. It would appear that reconstitution of the distracted but viable renal poles into a solitary functioning unit is possible provided the urinoma is adequately managed. Successful drainage also ensured that there was no significant residual scarring on late DMSA scanning.The expectant management of isolated high grade renal injuries with complete fracture in the haemodynamically stable patient is evolving and both internal and percutaneous drainage are crucial to the success of this approach. It seems the advances in interventional radiology are facilitating a less invasive approach to the management of these significant injuries in the paediatric population. The experience of this case reinforces a strategy which is leading to kidney salvage with minimal complications and is advocated.ConsentConsent was obtained from both parents and the involved institutions for publication of the case report.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsCH prepared the manuscript, MH provided the clinical details of the case, AM managed the case and edited the paper.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2531202.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2531202",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2531202\nAUTHORS: Kai Tobias Block, Martin Uecker, Jens Frahm\n\nABSTRACT:\nThe finite sampling of k-space in MRI causes spurious image artifacts, known as Gibbs ringing, which result from signal truncation at the border of k-space. The effect is especially visible for acquisitions at low resolution and commonly reduced by filtering at the expense of image blurring. The present work demonstrates that the simple assumption of a piecewise-constant object can be exploited to extrapolate the data in k-space beyond the measured part. The method allows for a significant reduction of truncation artifacts without compromising resolution. The assumption translates into a total variation minimization problem, which can be solved with a nonlinear optimization algorithm. In the presence of substantial noise, a modified approach offers edge-preserving denoising by allowing for slight deviations from the measured data in addition to supplementing data. The effectiveness of these methods is demonstrated with simulations as well as experimental data for a phantom and human brain in vivo.\n\nBODY:\n1. INTRODUCTIONIn MRI, spatial information is obtained from the\nobject using magnetic field gradients, which link the Larmor frequency of the\nexcited spins to their spatial location. Thus, the received signal is the\ncontinuous Fourier transform of the object's proton density(1)S(k→) =∫ρ(x→) e−ik→⋅x→ dx→ ,where the k-space position k→ can be calculated from the time course of the\napplied gradients. In practice, the proton density is further modulated by spin\nrelaxation, off-resonance effects, and other mechanisms all neglected here.It is well known that objects with compact support\nhave a Fourier transform with nonlimited support. For example, the Fourier\ntransform of a rectangle is composed of sinc functions in each dimension.\nBecause only a single location of the Fourier space can be measured at a time,\nit is impossible to fully sample such Fourier transform by travelling the MRI\nk-space with magnetic field gradients. Hence, there are two experimental\nrestrictions for MRI. First, the continuous Fourier transform is sampled\ndiscretely, which can be seen as a multiplication with a comb-function in frequency\nspace. In image space, this corresponds to a convolution with a reciprocally\nspaced comb-function and leads to periodic object copies with a spacing inverse\nto the sample distance in k-space. Second, the Fourier transform is sampled\nonly within a finite region around the k-space center with all other\ninformation missing.In the conventional case, a discrete Fourier\ntransformation of the finitely measured data is performed to reconstruct an\nimage. This strategy implicitly assumes that the Fourier transform is zero\neverywhere outside the sampled region. It is clear that the assumption is not\nvery appropriate for finite objects, although the corresponding reconstruction\ntotally complies with all data measured. In fact, any solution that coincides\nat the sampling positions is a valid reconstruction, because the finite\nsampling pattern opens degrees of freedom from the null space of the projection\nevoked by finite sampling. Setting this null space to zero is a simple and\nconvenient solution. Unfortunately, however, the procedure corresponds to a\nmultiplication of the true object's Fourier transform with a rect-function (in\ncase of Cartesian sampling) which, in image space, results in a convolution of\nthe true object with a sinc-function. This effect is well known as truncation\nartifact or Gibbs ringing and mainly appears\nas an oscillating overshoot of the image intensity near\ndiscontinuities [1, 2]. Although the problem may be\nreduced by increasing the measured k-space, many practical applications still\nrely on acquisitions with a relatively low-matrix resolution in at least one\nimage dimension, and therefore suffer from respective artifacts.So far, various methods have been developed to\nameliorate image disturbances due to finite sampling [2–5]. However, in the majority of\nMRI applications and, in particular, for most commercially available MRI\nsystems, only a simple data filtering is routinely employed. In this case,\nvisual reduction of the ringing artifacts is achieved by a smearing of the\nintensity oscillations, which leads to an undesired loss of image resolution.\nAlternative methods attempt to extrapolate the measured data and thereby avoid\na sharp cut-off in k-space [6–9]. A key difference to the filtering approach is that\nthe actually measured data is not changed but supplemented with synthetic data—a reasonable strategy as the measured data is not incorrect but only\nincomplete. This can be achieved by exploiting a priori knowledge about the\ntrue object and, consequently, all extrapolation techniques rely on certain\nassumptions, where the existing methods follow different strategies. In this\nregard, the present work demonstrates that also the very unspecific assumption\nof a piecewise-constant object can be utilized to successfully extrapolate data\nin k-space and concomitantly reduce the ringing artifacts without compromising\nimage resolution.2. THEORY\nFigure 1 compares the one-dimensional profile of a\nrectangle reconstructed by Fourier transformation from only 96 Fourier samples\nto that of the original function. It clearly illustrates severe ringing\nartifacts, although the true function is piecewise constant and free of any\noscillations. Such oscillations can be quantified using the total variation\n(TV), which sums the modulus of jumps between all neighboring pixels of a\nreconstructed image I(x,y)(2)TV(I) =∑y=0N ∑x=0N|I(x, y)−I(x−1, y)| + |I(x, y)−I(x, y−1)|.The TV concept was initially\nintroduced to image processing by Rudin et al. [10] for denoising applications\nbecause noise patterns create a high TV value relative to that of a noise-free\nimage, and they become particularly reduced when modifying the image in such a\nway that the TV value is minimized. As a specific property, edges are preserved\nduring this procedure, and thus TV minimization emerged as one the most popular\ndenoising techniques. In recent years, the TV concept is attracting strong\ninterest in the field of compressed sensing [11] because for specific sampling techniques, the TV\nvalue can be utilized to identify and to remove artifacts from undersampling,\noffering a remarkable reduction of the measurement time [12]. In a similar manner,\ntruncation artifacts lead to an increased TV value relative to that of the true\nobject, so that the TV may also be taken as a measure of the artifact strength\nfor finite k-space sampling, which has been recognized by Landi et al. as\nwell [13]. Therefore,\nthe proposed idea is to add a set of synthetic frequencies v→ to the measured data y→,\nwhich is specifically chosen such that the TV value of the image reconstructed\nfrom the combination of the measured and synthetic data is minimized(3)v→ = argminv→  TV(ℱ{v→⊕y→}) ,where ℱ denotes the discrete Fourier transformation.\nInterestingly, by searching for the set of synthetic frequencies v→,\nthe unmeasured k-space data is recovered to a certain degree if the assumption\nof a piecewise-constant object is appropriate.Estimation of the synthetic data can be achieved by\nminimizing (3) with a nonlinear numerical optimization technique. The present\nproof-of-principle implementation used the CG-Descent algorithm [14], which is a recent variant\nof the nonlinear conjugate gradient method that allows to rather efficiently\nsolve large-scale problems. The algorithm can be used in a black-box manner,\nrequiring only the evaluation of a cost function and its gradient for given\nestimate vectors v→.\nThe cost function is needed to quantify the goodness of a given estimate (i.e.,\nit is small for a good estimate and large otherwise), and for the problem\ndefined in (3) it simply has the form(4)Φ(v→) = TV(ℱ{v→⊕y→}) .The gradient of the cost\nfunction corresponds to the derivative of this function with respect to all\ncomponents of the estimate vector v→.\nBecause the discrete Fourier transformation is a unitary operation, it can be\nevaluated conveniently by calculating the gradient of the TV term in the image\ndomain (i.e., estimating a vector that describes how the TV value changes for\nmodifications of the individual pixels), followed by an inverse Fourier\ntransformation to the frequency domain.2.1. Extended TV formulationCalculation of the TV value according to (2) uses only\nthe first-order derivative of the image with respect to its x- and\ny-directions. This value is minimized if an image consists of areas with\nconstant signal intensity, so that the extrapolation procedure yields a\nsolution primarily with constant areas. While desirable for truly flat objects\nlike numerical phantoms, it tends to create images with a slightly blocky or\npatchy appearance for real-world objects. Therefore, it is advisable to\nadditionally include second-order derivatives into the TV term, which then\nallows for intensity gradients in the images and yields more naturally looking\nsolutions(5)TV2(I) =  ∑y=0N  ∑x=0N σ⋅(|I(x, y)−I(x−1, y)| + |I(x, y)−I(x, y−1)|)     ⁢    +(1−σ)⋅(|I(x−1, y)−2⋅I(x, y) + I(x + 1, y)|        +|I(x, y−1)−2⋅I(x, y) + I(x, y + 1)|        +|I(x, y)−I(x−1, y)−I(x, y−1)         +I(x−1, y−1)|).Here, σ∈[01] is a weighting factor which can be used to\ntune the images between a slightly more blocky looking and a slightly smoother\nappearance. For the reconstructions presented, it was set to σ = 0.77 based on the considerations by Geman and Yang [15].2.2. Edge-preserving denoisingIn practice, experimental MRI data can be\nsignificantly contaminated by Gaussian noise. While the aforementioned approach\nis still able to reduce visible truncation artifacts under these circumstances,\nit does not reduce image noise because the measured k-space data remains\nunchanged. On the other hand, an additional denoising may be achieved by\nloosing the fixed bound on the measured data, that is by introducing a data\nfitting term. In this case, the algorithm not only adds synthetic frequencies\nto obtain a TV minimization, but is also allowed to find a solution that\nslightly diverges from the measured data, which yields an effective\nedge-preserving denoising. Therefore, the estimate vector v→ has to be extended such that it contains both\nsynthesized frequencies as well as frequencies from the measured part of\nk-space, which is indicated by writing v→d instead.In the denoising case, the cost function takes the\nform(6)Φ(v→d) = λ⋅∥v→d⊖y→∥22 + TV(ℱ{v→d}) ,where ⊖ denotes an operation that calculates the\nresidual between the measured values and the corresponding entries of the\nestimate, which are now contained in the vector v→d.\nFurther, λ is a weighting factor that allows to select\nthe desired denoising strength. While a low weight permits considerable\ndivergences from the measured values and, thus, leads to an effective removal\nof noise, it can also cause a loss of object detail if selected too low.\nTherefore, the weight has to be adjusted with respect to the signal-to-noise\nratio of the measurement sequence, where a reasonable strategy is to estimate a\nfixed value once for each protocol by computing a set of test images with\ndifferent λ values and selecting the value yielding the\ndesired degree of denoising.2.3. Phase variationsAlthough the basic physical quantity measured by MRI,\nthat is, the spin-density modulated by relaxation or saturation effects, should\nbe real-valued and nonnegative in theory, inherent experimental phase\nvariations usually cause the observed object to be complex-valued. Moreover,\nmodern MRI systems often use multiple receive coils with complex-valued\nsensitivity profiles, yielding differently modulated views of the object. As a\nconsequence, spatially varying transitions between the real and imaginary\ncomponent occur as well as local intensity changes, which conflict with the\nassumption of a piecewise-constant quantity and prevent a direct application of\nthe TV constraint. Therefore, some mechanism is required to cope with the phase\nvariations and the multicoil scenario.In this proof-of-principle study, phase variations\nwere removed in a preprocessing step by performing a Fourier transformation of\nthe data from each coil and calculating the sum-of-squares of all channels in\nthe image domain. Subsequently, an inverse Fourier transformation of the sum-of-squares\ndata was performed to obtain a combined data set with real-valued and\nnonnegative values in the image domain, which enables a calculation of the TV\nvalue using only the real part of the image. While this simple technique turned\nout to be sufficient for demonstrating a removal of truncation artifacts by\nTV-constrained data extrapolation, routine applications will probably require a\nmore sophisticated procedure, in particular when combined with advanced\ntechniques such as parallel imaging and when using complex coil configurations\nwith more localized sensitivities of the individual receiver elements.3. METHODSSimulations were performed with the Shepp-Logan\nphantom, which is composed of several ellipses. Because the Fourier transform\nof a single ellipse is given by a Bessel function, an analytical Fourier\ntransform of the phantom is obtained by a superposition of respective Bessel\nfunctions. Truncation artifacts can be studied by evaluating the noncompact\nanalytical transform at the sampling positions along the trajectory, here\nyielding a matrix of 96 × 96 Fourier samples. All simulations and\nprocessing of experimental data were done offline using an in-house software\npackage written in C/C++.MRI experiments were conducted at 2.9 T (Siemens\nMagnetom TIM Trio, Erlangen, Germany) with use of a receive only 12-channel\nhead coil equipped with hardware signal combiners, yielding four receiver\nchannels with different combinations of the coil elements. Measurements were\nperformed for a water phantom and human brain in vivo, where written informed\nconsent was obtained from all subjects prior to each examination. For\ndemonstration purposes, the image acquisitions were done with a simple\nslice-selective spin-echo sequence at a 200 × 200 mm2 field of view, covered by a 96 × 96 acquisition matrix. Different sequence\nsettings were used to obtain data sets with low and high level of noise, where\nthe latter was achieved by reducing the flip angle and slice thickness while\nincreasing the receiver bandwidth. Further, one data set was acquired with a\nslice-selective gradient-echo sequence, which allowed for the rapid measurement\nof a full 288 × 288 acquisition matrix.All images were reconstructed on a 288 × 288 matrix corresponding to an extrapolation\nfactor of 3. The proposed algorithm was run for a fixed number of 3000\niterations, which takes about 2-3 minutes on a standard microprocessor. In\ncases where an additional data fitting term was used, the weighting factor λ was adjusted manually to yield a reasonable\nsolution as judged by visual inspection. Zero-padded solutions with and without\nfiltering were calculated for comparison. Here, a simple Lanczos sigma filter,\nthat is, multiplication with a sinc-function, was applied, where the window\nwidth was selected such that the sinc-function's first null coincides with the\nborder of the measured k-space. Although other filters might perform better, it\nserves to demonstrate the general problem related to data filtering. In\naddition, a two-dimensional version of the extrapolation method described by\nConstable and Henkelman [6] was implemented with a window width of P = 2 for the edge-preserving sigma filter. In our\nimplementation, the filter parameter Δ was selected according to Δ = c · I,\nwhere I denotes the intensity of the pixel to be\nfiltered and c is a global coefficient that was set to c = 0.1 based on visual inspection. Finally, all\nimages were magnified and cropped to improve the visibility of the artifacts.4. RESULTS\nFigure 2 shows different reconstructions of the\nShepp-Logan phantom (left column) together with the respective Fourier\ntransforms (right column). It is clearly visible that the zero-padded solution\n(zero) suffers from severe ringing artifacts around all edges of the phantom.\nThe extent of the measured k-space can be seen in its Fourier transform. Most\nringing artifacts disappear after filtering (filter), however, at the expense\nof a significant loss of image resolution. In contrast, the image reconstructed\nwith the proposed method (TV) is neither affected by ringing artifacts nor by\nblurring, and it presents with considerably\nsharper edges relative to the zero-padded solution. Its Fourier transform\nreveals that the measured data has been properly extrapolated into the\nuncovered areas of k-space. For comparison, a full reconstruction from 288 × 288 samples is shown in the bottom row (full).\nFigure 3 demonstrates the application of the method to\nexperimental data obtained for a phantom (left column) and a human brain in\nvivo (right column) in comparison to zero-padded (zero) and filtered\nzero-padded solutions (filter). Again, the ringing artifacts obtained for zero\npadding (indicated by arrows) are significantly reduced when using\nTV-constrained data extrapolation with only first-order (TV) or additionally\nsecond-order derivatives (TV2). The blocky appearance of the TV reconstruction\nbecomes much more smoother for the TV2 approach, although both solutions (TV\nand TV2) look somewhat more blocky than the zero-padding solution.In Figure 4, the proposed approach (TV2) is compared\nto a 2D version of the extrapolation method by Constable and Henkelman (comp)\nfor the Shepp-Logan phantom (left column) and an experimental study of the\nhuman brain in vivo (right column). It can be seen that the performance of the\nproposed extrapolation method is slightly better for the simulated data, while\nboth approaches yield an effective suppression of ringing artifacts for the\nexperimental data (note that the alternative method leads to a slight denoising\nof the image). However, in our implementation, the algorithm by Constable and\nHenkelman tends to be sensitive to the parameter selection for the initial\nfilter that is used to detect true edges of the object, whereas a selection of\nrespective parameters is not needed in the TV-based approach.\nFigure 5 shows reconstructions of the Shepp-Logan\nphantom from noisy data using zero-padding (zero), the proposed extrapolation\napproach (TV), and its combination with denoising (TVdns). While the basic\nextrapolation approach leads to a reduction of truncation artifacts also for\nnoisy data, it does not reduce the noise patterns. However, when extending the\nTV penalty to the measured data, the method effectively flattens noise patterns\nin addition to the suppression of ringing artifacts.Finally, corresponding reconstructions from\nexperimental data with a high degree of noise are shown in Figure 6. Here, a\ncombination of first- and second-order derivatives was used for the TV\ncalculation. As in the simulations, the proposed method leads to a reduction of\ntruncation artifacts (TV2), while the extension to data fitting yields an\nadditional edge-preserving denoising (TV2dns).5. DISCUSSION5.1. Accuracy and limitationsBoth simulations and experiments demonstrate that\nTV-constrained data extrapolation effectively reduces truncation artifacts due\nto finitely sampled MRI acquisitions. Usually, the images exhibit a more blocky\nappearance compared to zero-padding. However, it should be noted that the\nsmoothness observed for zero-padding originates to a significant degree from\nthe convolution with the sinc-function. As a consequence, a sharp edge of the\nobject is mapped as a rather smooth pattern, which might appear more familiar\nto the viewer than a blocky image, but strictly represents an image artifact.\nHence, the extrapolation technique may even lead to a slight gain of resolution\ndue to a sharpening of the point-spread function, following from the\nreciprocity property of the Fourier transformation. This effect can be best\nseen in Figure 6 when comparing the borders of the dark brain vessels obtained\nfor zero padding (zero) with the proposed method (TV2).Residual image artifacts are explained by multiple\nreasons. First, the method is based on the assumption that the true object is\npiecewise constant, which is only approximately valid for real-world objects.\nIn the presence of additional experimental effects like flow artifacts, the\nassumption might be even less appropriate. Hence, the extrapolation performance\ndepends on the object's conformance with the assumption that it is\npiecewise-constant. Moreover, if the true object contains strongly varying\npatterns, the algorithm may erroneously soften such patterns by supplementing\nrespective high frequencies. On the other hand, in the majority of cases, the\nassumption of a piecewise-constant object seems to be more appropriate than\nthat of all conventional reconstructions, namely, a Fourier transform of the\nobject that is zero outside the sampled k-space area.Second, the proposed method synthesizes only a finite\nnumber of additional frequencies, whereas an infinite number of k-space samples\nwould be required to completely eliminate all truncation effects. In practice,\nhowever, it turned out that there is no perceivable benefit of extrapolating by\na factor of higher than three. The reason is that the method yields an implicit\nfiltering of the extrapolated data: assuming that the extrapolation procedure\nwould recover the unmeasured k-space samples exactly, then a new truncation\neffect would arise at the extended border and again lead to ringing artifacts\nin image space (though with a higher oscillation frequency). Because this would\nincrement the TV value, the method automatically lowers outer frequencies during\nthe extrapolation procedure to prevent the upcoming of new ringing artifacts.\nHence, the extrapolated values diverge categorically from the true frequencies\nwhich, in this case, is a rather desirable feature as the prime target is to\nreduce visually annoying ringing artifacts rather than to gain\nsuper-resolution.Third, if a completely artifact-free reconstruction of\nthe object would be available, then respective frequency samples could be\ncalculated with a discrete Fourier transformation of the given image.\nInterestingly, these samples would diverge from the experimentally measured\nfrequencies, because image pixels are discrete and, thus, the Fourier transform\nof the image is periodic such that outer frequencies from neighboring copies\n(of the true object's noncompact Fourier transform) overlap. This is different\nfrom the experimental situation where the object is continuous and the outer\nfrequencies are missing instead of overlapping. Consequently, an artifact-free\ndiscrete reconstruction can only be obtained if the samples used for the\nreconstruction specifically diverge from the measured frequencies. A complete\nartifact removal, therefore, requires to alter the measured frequencies instead\nof keeping them unchanged. Unfortunately, the\ninformation how the samples have to\nbe adjusted is not available, so that in practice a data fitting term might be\nthe best solution when a complete removal of ringing artifacts is needed.\nHowever, this might cause a loss of object detail as described in the theory\nsection.5.2. Implementation issuesThe modulus function in the TV formula (2) has a\nfundamental role for the success of TV-based image processing. Because\nsubtraction of neighboring pixels—performed before taking the modulus—can\nbe seen as applying a difference operator to the estimate, TV minimization\nyields a solution with minimum L1-norm in the difference basis. Due to the\nspecific character of the modulus function, this solution tends to be sparse in\nthe difference basis: it has few large jumps and most differences between\nneighboring pixels are near zero, which directly translates into a\npiecewise-constant image (and explains the edge preserving character of\nTV-based denoising). If the modulus would be replaced by a square function,\nthen the optimizer would try to find a minimum L2-norm solution with minimal\njumps between all neighboring pixels. This corresponds to a globally smooth\nimage, which is usually undesired due to a loss of sharp edges. While it is\nrather simple to obtain a minimum L2-norm solution as its cost function is\nstrictly convex, finding a minimum L1-norm solution is much more challenging;\nand many optimization algorithms fail if directly applied to the TV problem.\nOne major reason is that the derivative of the modulus function is just ± 1,\nwhich does not help to guess a reasonable step size toward the function's\nminimum. However, it turned out that the CG-Descent algorithm is capable to\nhandle the problem as it comprises a powerful line-search procedure, but it is\nprobably not the optimal method for finding the solution. In particular, the\nconvergence tends to be somewhat sensitive to the scaling of the data. In order\nto ensure convergence, it was, therefore, necessary to introduce a scaling\nfactor that limits the modification strength for each iteration and to run the\nalgorithm in turn for a high number of iterations (e.g., 3000 iterations as\narbitrarily chosen here). Nevertheless, this issue should not be seen as a\ndrawback of the proposed extrapolation approach itself, but rather as a\ntechnical aspect of the optimization method utilized in this proof-of-principle\nstudy. Employing a dedicated algorithm for TV minimization should render a\nscaling factor unnecessary and significantly improve the convergence rate.\nAlthough such enterprise promises reconstructions in a fraction of the current\nprocessing time, it is outside the scope of the present study.6. CONCLUSIONThe present work demonstrates that the simple\nassumption of a piecewise-constant object can be exploited to extrapolate\nmeasured data in k-space. This allows for a significant reduction of ringing\nartifacts that arise from data truncation in k-space. In contrast to commonly\nused filtering approaches, the method does not degrade the spatial resolution\nof the reconstructed image and rather leads to a mild resolution enhancement\ndue to sharpening of the point-spread function. If the measured data is\nseriously contaminated by noise, an extended approach offers edge-preserving\ndenoising by slightly altering the measured data in addition to supplementing\nsynthetic data. Both variants can be implemented as a pure postprocessing\nprocedure and are also applicable for partial Fourier acquisitions. Therefore,\nno modification of the MRI sequence is required. While the current\nimplementation suffers from a relatively high computational load, the use of a\ndedicated TV optimization algorithm promises a processing speed suitable for\nroutine applications.\n\nREFERENCES:\n1. LiangZ-PLauterburPCPrinciples of Magnetic Resonance Imaging2000New York, NY, USAIEEE PressIEEE Press Series on Biomedical Engineering\n2. LiangZ-PBoadaFBConstableRTHaackeEMLauterburPCSmithMConstrained reconstruction methods in MR imagingReviews of Magnetic Resonance in Medicine19924267185\n3. SmithMRNicholsSTA comparison of models used as alternative magnetic resonance image reconstruction methodsMagnetic Resonance Imaging1990821731832338898\n4. ArchibaldRGelbAA method to reduce the Gibbs ringing artifact in MRI scans while keeping tissue boundary integrityIEEE Transactions on Medical Imaging200221430531912022619\n5. CallaghanMFLarkmanDJHajnalJVPadé methods for reconstruction and feature extraction in magnetic resonance imagingMagnetic Resonance in Medicine20055461490150216254953\n6. ConstableRTHenkelmanRMData extrapolation for truncation artifact removalMagnetic Resonance in Medicine19911711081182067388\n7. AmarturSHaackeEMModified iterative model based on data extrapolation method to reduce Gibbs ringingJournal of Magnetic Resonance Imaging1991133073171802144\n8. AmarturSLiangZ-PBoadaFHaackeEMPhase-constrained data extrapolation method for reduction of truncation artifactsJournal of Magnetic Resonance Imaging1991167217241823178\n9. TsaoJExtension of finite-support extrapolation using the generalized series model for MR spectroscopic imagingIEEE Transactions on Medical Imaging200120111178118311700743\n10. RudinLIOsherSFatemiENonlinear total variation based noise removal algorithmsPhysica D1992601–4259268\n11. DonohoDLCompressed sensingIEEE Transactions on Information Theory200652412891306\n12. BlockKTUeckerMFrahmJUndersampled radial MRI with multiple coils. Iterative image reconstruction using a total variation constraintMagnetic Resonance in Medicine20075761086109817534903\n13. LandiGPiccolominiELZamaFA total variation-based reconstruction method for dynamic MRIComputational and Mathematical Methods in Medicine2008916980\n14. HagerWWZhangHA new conjugate gradient method with guaranteed descent and an efficient line searchSIAM Journal on Optimization2005161170192\n15. GemanDYangCNonlinear image recovery with half-quadratic regularizationIEEE Transactions on Image Processing19954793294618290044"
+}

batch_2/PMC2532995.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2532995",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2532995\nAUTHORS: Emmanuel P Prokopakis, Constantinos A Bourolias, Argyro J Bizaki, Spyros K Karampekios, George A Velegrakis, John G Bizakis\n\nABSTRACT:\nEctopic internal carotid artery (ICA) is a very rare variation. The major congenital abnormalities of the ICA can be classified as agenesis, aplasia and hypoplasia, and they can be unilateral or bilateral. Anomalies of the neck artery may be vascular neoplasms or ectopic position. Carotid angiograms provide absolute confirmation of an aberrant carotid artery, while EcoColorDoppler (ECD) gives also important information about the evaluation of carotid vassels. Nevertheless Computed Tomography (CT) and Magnetic Resonance Imaging (MRI) of the neck provide spatial information about the adjacent pharyngeal anatomy and are less invasive than angiogram. Injuries to the ICA during simple pharyngeal surgical procedures can be catastrophic due to the risk of massive bleeding. We report a case of a 56 year-old male patient suffering from dysphagia associated with aberrant ICA manifesting itself as a pulsative protruding of the left lateral wall of the oropharynx.\n\nBODY:\nBackgroundThe congenitally tortuous internal carotid artery (ICA) is an uncommon but important anomaly for the otolaryngologist, to recognize. Numerous descriptions of the anomalies of the greatest vessels of the head and neck, as well as of the ICA have been presented in the literature. The deformities of the ICA have been reported with a large variability of pattern and degree. Some of them determine a dislocation of the ICA that can be found at the level of the pharyngeal wall in some cases. Because of this dislocation, the ICA may cause a widening of the retropharyngeal and lateropharyngeal soft tissues. The ectopic ICA poses a risk during both major oropharyngeal tumor resection and less extensive procedures, such as tonsillectomy, adenoidectomy, and uvulopalatopharyngoplasty. We report a case of a 56 year-old male patient suffering from dysphagia associated with aberrant ICA manifesting itself as a pulsative protruding of the left lateral wall of the oropharynx.Case presentationA 56 year-old male patient was admitted to our service with dysphagia, and malaise that had progressed over the last week. Oral examination revealed an edema at the gingival and the soft palate area, as well as a redness and pulsative protruding of the left lateral wall of the oropharynx. The rest clinical evaluations, as well as the blood tests were normal. Because of the palatal edema, he was administered methylprednisolone per os. No other medication was given.A Computed Tomography (CT) of the neck was then performed, which revealed the helicoids, ectopic course of the right internal carotid artery (ICA) at the level of the oropharynx (figure 1a). Multiplanar reconstruction at the coronal plane demonstrates an angiographic appearance of the vessels of the neck, showing the ectopic portion of the right ICA (figure 1b).Figure 1a. CT scan of the neck, following contrast administration. Axial section of the level of the oropharynx, demonstrates the horizontal extension of the right ICA towards the midline and behind the oropharynx. b. Multiplanar reconstruction at the coronal plane demonstrates an angiographic appearance of the vessels of the neck, showing the ectopic portion of the right ICA.The abnormal extension of the ICA subsequently was confirmed by Magnetic Resolution Angiography (MRA) of the neck (figure 2). This abnormal course of the ICA was responsible for the gross appearance at the posterior wall of the oropharynx.Figure 2Magnetic Resolution Angiography after gadolinium administration shows the helicoids-ectopic course of the right ICA, immediately after the carotid bulb. Notice also, the significant stenosis of the controlateral left ICA.ConclusionEctopic internal artery is a very rare variation. The venous anomalies are relatively more frequent than arterials [1]. The ICA originates from the third aortic arch, and it remains controversial whether the common and external carotids have the same third aortic arch origin or they originate from the aortic sac [2-5]. The ICA irrigates most of the cerebral hemispheres and the orbits, and contributes with ramifications to the frontonasal area.The ICA ascends within the carotid sheath towards the scull base. It is first crossed laterally by the hypoglossal nerve as this nerve passes forward from its position behind the internal carotid. ICA then crosses the occipital artery, as this artery passes posteriorly from its origination of the external carotid artery. Near the skull base the ICA crosses laterally towards the posterior belly of the digastric muscle and the muscle attached to the styloid process. Laterally to the carotid canal is the deep lobe of the parotid gland. Medially to the carotid are the retropharyngeal space and the superior constrictor muscle.Other vital structures located close to the ICA, are the internal jugular vein, the cranial nerves IX to XII, and the external carotid artery. Inferiorly the internal jugular vein lies laterally to the ICA. The glossopharyngeal nerve passes forward between the internal and external carotid artery at the bifurcation. The hypoglossal nerve passes forward laterally to the internal carotid artery just above the bifurcation. The external carotid artery travels anterior to the ICA throughout its entire course.The major congenital abnormalities of the ICA can be classified as agenesis, aplasia and hypoplasia, and they can be unilateral or bilateral. Absence of the ICA is referred to as agenesis or aplasia [6].Anomalies of ICA in the neck may be vascular neoplasms or ectopic position. Vascular neoplasms are more common in children, but two relatively rare neoplasms that occur in the adults are the angiosarcoma and hemangiopericytoma.The ectopic carotid artery usually occurs in the temporal bone [1]. Angulations of the ICA is a rare condition, while the variations in the course of the carotid artery are divided into two distinct categories: tortuosity and kinking [7]. Elongation, redundancy, undulation, and a S-shaped curve are classified as tortuosity, while any sharp bend in the vessel is classified as kinking. The causes of this malformation are atherosclerosis as observed in our patient, and congenital deformity. The mean age at diagnosis is 58 years, and the patients are usually asymptomatic.While the reports of fatal posttonsillectomy hemorrhage and the dissections of Kelly clearly describe the unusual laterally placed of the ICA, midline carotid arteries are even less commonly reported [8]. Kelly noted that only four of his 150 patients had posterior pharyngeal wall pulsation. In addition, there are two reports of cases of profuse postadenoidectomy hemorrhage due to laceration of a midline ICA. Mc Kenzie et al described two fatal cases coarsening ICA injuries during adenoidectomy, one of which resulted in complete arterial ablation [9]. Bergqvist described a visible ICA in the nasopharynx that had not been detected preoperatively but was seen intraoperatively after an adenoidectomy had been performed [10].Ectopic ICAs should be differentiated from other vascular lesions, such as angiosarcoma and hemangiopericytoma. Peritonsillar abscess, masses as lymphomas, and other tumors must be take under consideration, when a panicula in the oropharynx is detected.We prefer the use of CT or MRI since they are less invasive than angiogram and provide spatial information about the adjacent pharyngeal anatomy. In MRA the resolution of details is not as precise as in angiograms and imaging artifacts due to turbulent flow or patient movement may be a major limitation. Another one examination for the evaluation of carotid vessels is the EcoColorDoppler (ECD), which is easy to perform, and gives quick and important information that MRI and CT do not provide (velocimetry, haemodynamics) [11].Transposition of the ICA bulging the posterior pharyngeal wall constitutes a risk factor for impressive intraoperative and postoperative hemorrhage in surgical procedure such as adenoidectomy, tonsillectomy, uvulopalatopharyngoplasty and incision of peritonsillar abscess, which are often performed by young and inexperienced ENT doctors. The surgeon should be careful in performing routine surgical procedures in the area of the upper pharynx, which generally represent the most frequent interventions carried out by inexperienced surgeons as the first steps of their surgical training. The hidden presence of an asymptomatic anomaly of the internal carotid artery may cause impressive and life-threatening hemorrhage. In the literature is reported a massive blood loss during tonsillectomy in a child with congenital vascular malformation of the lips and the oropharynx [12].In our case the referring physician thought that panicula in the lateral wall of oropharynx was edema. The otolaryngologists surgeons must use caution in evaluating patients with masses in the pharynx and augment a careful and complete head and neck examination with appropriate imaging studies before operating. A thorough ocular and digital exploration of the pharynx for arterial pulsations should never be omitted.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2532999.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2532999",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2532999\nAUTHORS: Teun P Saltzherr, PH Ping Fung Kon Jin, Fred C Bakker, Kees J Ponsen, Jan SK Luitse, Mark Scholing, Georgios F Giannakopoulos, Ludo FM Beenen, C Pieter Henny, Ger M Koole, Hans B Reitsma, Marcel GW Dijkgraaf, Patrick MM Bossuyt, J Carel Goslings\n\nABSTRACT:\nBackgroundTrauma is a major source of morbidity and mortality, especially in people below the age of 50 years. For the evaluation of trauma patients CT scanning has gained wide acceptance in and provides detailed information on location and severity of injuries. However, CT scanning is frequently time consuming due to logistical (location of CT scanner elsewhere in the hospital) and technical issues. An innovative and unique infrastructural change has been made in the AMC in which the CT scanner is transported to the patient instead of the patient to the CT scanner. As a consequence, early shockroom CT scanning provides an all-inclusive multifocal diagnostic modality that can detect (potentially life-threatening) injuries in an earlier stage, so that therapy can be directed based on these findings.Methods/designThe REACT-trial is a prospective, randomized trial, comparing two Dutch level-1 trauma centers, respectively the VUmc and AMC, with the only difference being the location of the CT scanner (respectively in the Radiology Department and in the shockroom). All trauma patients that are transported to the AMC or VUmc shockroom according to the current prehospital triage system are included. Patients younger than 16 years of age and patients who die during transport are excluded. Randomization will be performed prehospitally.Study parameters are the number of days outside the hospital during the first year following the trauma (primary outcome), general health at 6 and 12 months post trauma, mortality and morbidity, and various time intervals during initial evaluation. In addition a cost-effectiveness analysis of this shockroom concept will be performed.Regarding primary outcome it is estimated that the common standard deviation of days spent outside of the hospital during the first year following trauma is a total of 12 days. To detect an overall difference of 2 days within the first year between the two strategies, 562 patients per group are needed. (alpha 0.95 and beta 0.80).DiscussionThe REACT-trial will provide evidence on the effects of a strategy involving early shockroom CT scanning compared with a standard diagnostic imaging strategy in trauma patients on both patient outcome and operations research.Trial registrationISRCTN55332315\n\nBODY:\nBackgroundTrauma is the most common cause of death in people younger than 50 years of age and accounts for more years of life lost than cancer, heart disease, and stroke combined. Injuries cause 5 million deaths every year worldwide (9% of global mortality).[1] In Europe alone injuries account for approximately 800,000 deaths (10% of all deaths) and 14% of all disability-adjusted life years (DALY).[2] Injuries are an important source of medical costs, economic losses, and immaterial losses. Trauma can therefore be regarded as a neglected epidemic.For improving the trauma care specialized trauma centers are designated and specialized trauma care protocols, like the worldwide used ATLS® guidelines, were developed.[3] Because there is a narrow window of opportunity between the moment that a patient deteriorates and actually dies, the ATLS guidelines prioritize care and focus on (potentially) life-threatening injuries rather than distracting but less important injuries. As a consequence a systematic approach of clinical examination and diagnostics is developed to recognize the most life-threatening injuries first. These should be treated immediately and preferably within 'the golden hour'.[3]The imaging studies most frequently used in trauma patients include conventional X-rays, ultrasonography (FAST), and computed tomography scanning (CT). Although conventional X-rays and ultrasonography are widely used and easily accessible for many institutions, they have a limited sensitivity for injuries such as spine fractures,[4] pulmonary contusion, rib fractures, pneumothoraces or vascular injuries to the mediastinum, [5-8] and intra-abdominal, pelvic and retroperitoneal injuries.[9,10] Also, the amount of time necessary to obtain an overview of all the injuries is limited.Recent improvements in CT technology with respect to image quality and speed have led to an increasingly important role of CT scanning in management of severely injured patients. However, the biggest problem with CT scanning is that this technique is frequently time-consuming due to logistical (location of CT scanner in other departments of the hospital) and technical issues. This implies that CT can only be used in hemodynamically stable patients where time to OR for surgical stabilization is a less critical factor. Furthermore, the fact that the same CT scanner is scheduled for elective patients as well as trauma patients means that an unplanned, prioritized trauma patient will disrupt the scheduled patient care and logistics and will lead to increased waiting times.In order to improve patient care and workflow in acute trauma patients, the Academic Medical Center (AMC) in Amsterdam, the Netherlands, has initiated a project together with Siemens Inc. A new and revolutionary concept was developed in which the CT scanner is transported to the patient instead of the patient to the CT scanner. Main feature is a radiolucent trauma resuscitation table and a CT scanner that slides over the patient in the trauma resuscitating room. In addition there are also possibilities for conventional X-ray imaging and ultrasonography. With this concept the most important diagnostic modalities for trauma evaluation are available in the shockroom and CT scanning is possible at any moment during initial trauma evaluation. Furthermore, no further transport and patient transfers are required which can endanger the patient itself during the diagnostic phase (potentially leading to dislodgement of tubes, lines, cables, etc). Overall this concept will likely result in a faster and improved workflow and diagnostic imaging of trauma patients.Methods/designStudy objectivesThe primary objective is to prove the beneficial effects of early shockroom CT scanning on trauma patients by comparing the effects of a strategy involving early shockroom CT scanning with a standard diagnostic imaging strategy on patient outcome. In the latter strategy the CT scan is not located in the shockroom, but elsewhere in the hospital. The secondary objectives are to document the impact of introducing shockroom CT-scanning on logistics, capacity utilization, waiting times, economies of scale, substitution patterns, and investments.Study designThe REACT-trial is a prospective, patient-randomized study that will compare the clinical work-up of trauma patients in a setting where the CT scanner is located in the shockroom (AMC) with the standard situation where CT scanning takes place at the Radiology Department (VUmc).Setting/Participating centersThe Trauma Center North-West Netherlands is one of 10 designated Level-I trauma centers in the Netherlands. It is constituted by the 'Vrije Universiteit' medical center (VUmc) and the Academic Medical Center (AMC), which are both located approximately 8 kilometers apart from each other in Amsterdam. Each of these two hospitals, together with the surrounding affiliated hospitals, is responsible for the care of trauma victims in its region (2.7 million inhabitants in total) that are distributed over these hospitals. In both hospitals, patients are evaluated by a multidisciplinary team in the trauma resuscitation room ('shockroom'), which is fully equipped for initial management of trauma patients, including conventional X-rays and ultrasonography.The initial evaluation of trauma patients after arrival is according to ATLS guidelines and the same in both hospitals. After the primary survey, standard X-rays (i.e. thorax, pelvis and cervical spine) and sonography will be done according to the ATLS guidelines.In the VUmc the CT scanner (64-slice) is located in the Radiology Department on the second floor. This requires transportation of the patient with at least 4 patient transfers from trolley to the CT table and vice versa.In the AMC a concept was developed in which the CT scanner is transported to the patient instead of the patient to the CT scanner. Main feature is a radiolucent trauma resuscitation table and a 4-slice CT scanner (SOMATOTOM Sensation 4, Siemens) placed on a rail which enables the scanner to slide over the patient. Because of a mirrored design of a second shockroom that is separated by radiation shielded sliding doors the CT scanner can be transferred over the rails into the second room after the imaging is finished. The first advantage of this design is that no interference is experienced from the CT scanner during trauma resuscitation. Secondly, the design allows simultaneous use of the mirrored trauma rooms, with the sliding CT scanner accessible to both rooms.Both trauma resuscitating settings are equipped with a conventional X-ray installation and ultrasound. As a result of the AMC concept no further patient transport or transfers are necessary for obtaining a CT scan and all radiography can be performed in the trauma room. In addition, at any time during trauma resuscitation CT imaging can be performed.EndpointsThe primary outcome criterion used is the number of days spent outside the hospital in the first year following the trauma. This outcome is responsive to differences in mortality (no additional days outside hospital), to differences in hospital stay for the initial admission and to differences in readmission rate.The secondary outcome parameters include general health outcome at 6 and 12 months after the shockroom admission (using the EuroQol and HUI-3 questionnaires), morbidity and mortality during the first year following the trauma and various time intervals and process of care parameters of the initial admission (time to intervention, time to active bleed management, ICU and total hospital stay, etc.). Furthermore the radiation dosage is calculated in both strategies based on the actual number and type of radiological examinations related to the initial trauma performed in each patient during the first year.Study groupAll acute trauma patients are eligible for inclusion for the REACT trial when transported by the ambulance or helicopter to the AMC or VUmc shockroom according to the current pre-hospital triage system based on: Injury mechanism, Revised Trauma Score (RTS) and presence of traumatic brain injury. These factors determine the level of care that has to be present in the facility to which patients are transported.The exclusion criteria for subsequent follow-up and analysis are patients younger than 16 years of age and patients who die during transport to the hospital.The start of the study was scheduled for 1-11-2005.RandomizationRandomization will be performed at the \"Meldkamer Ambulancezorg Amsterdam\" (MKA), the organization in charge of the coordination and distribution of ambulances and patients. Randomization will be performed using a computer program on a 1:1 basis with varying block sizes of 8, 12, and 16. Ambulance personnel will receive instructions according to the outcome of the randomization. Each eligible patient involved in a specific accident will be randomized. After each randomization, there is a pre-specified time interval of 1 hour in which eligible patients will be automatically transported to the other trauma center in order to minimize peak pressure in the study centers and guarantee optimal utilization of the two trauma centers. These patients are included in the trial, but are not formally randomized. In extreme cases, prehospital ambulance personnel can decide to waive the outcome of randomization, if they deem that the status of the patient requires the immediate attention of the closest hospital and death is imminent.Because the distance between the two hospitals is relatively short (8 km) no significant delay in treatment by patient transport is encountered regardless of the outcome of the randomization.Sample sizeBased on the primary outcome criterion for both strategies, it is estimated that the common standard deviation is a total of 12 days. To detect an overall difference of 2 days in the number of days spent outside the hospital within the first year between the two strategies, 562 patients per group are needed for a two-sided significance level of 0.05 with a power of 0.80.Based on historical data, we expect around 500 shockroom patients to be admitted on a yearly basis at each of the two participating centers. Therefore, the total number of eligible patients per year would be 1000 patients. We expect that a quarter of these patients will be excluded for various reasons (age < 16 yrs, lost to follow up, etc.) leading to a total of 750 inclusions per year. Consequently, a 1 1/2-year period should be sufficient to include the necessary total number of 1124 (2 × 562) patients.Ethics and informed consentThe research protocol was primarily submitted to both the local Medical Ethics Committee (MEC) of the AMC and the VUmc to be reviewed. Both committees have been accredited to judge studies for the Central Committee on Research Involving Human Subjects and determined that the proposed study is not subject to the Medical Research Involving Human Subjects Act (WMO) and that therefore no further judgment is required for the study. Informed consents are not required from patients.Data analysisThe main analyses of primary and secondary outcomes will be conducted for all randomized patients according to the result of the randomization (intention-to-treat). Additional analyses include:(1) Per-protocol analysis excluding patients that are transported to a different hospital rather than the result of the assignment procedure.(2) Analysis of included patients treated either in the AMC or the VUmc independent of the randomization through the assignment procedure.We will conduct both unadjusted and adjusted analyses. We will use gender, mechanism of trauma (sharp/blunt), initial Glasgow Coma Scale (GCS), RTS score and the presence of intubation to adjust for possible differences in severity of trauma between the AMC and VUmc patients.For subgroup analysis the following analyses will be performed:Hemodynamically unstable patients (non-responders (SBP < 90) vs. transient responders (SBP > 90 with continuous fluid requirement)); Sharp vs. blunt trauma patients; Patients prehospitally treated by Mobile Medical Teams; Neurotrauma patients; Presence or absence of a seatbelt sign; Torso trauma vs. isolated extremity trauma; Intubated vs. spontaneously breathing.For final analysis standard statistical techniques will be used to compare the different outcomes between the two hospitals.DiscussionThe REACT trial is a multicentered, prospective randomized trial that evaluates the effect of the newly introduced Amsterdam Trauma Workflow concept on trauma care. The main goal of the Amsterdam Trauma Workflow concept is to minimize the total diagnostic work-up time of the initial trauma evaluation by integrating all diagnostic modalities in the trauma resuscitating room. This concept makes it possible to perform CT imaging earlier during the trauma evaluation without the need to transport the patient to the radiology department. This adjustment will likely result in a faster and improved workflow of trauma patients, that leads to a more complete diagnostic workup in the early phases of trauma resuscitation. This could potentially change therapeutic management options and eventually lead to a better outcome in severely injured trauma patients. The direct availability of CT scanning during the entire trauma resuscitation phase could mean that this could become available for even hemodynamically unstable patientsA second advantage of this concept is the reduction in the number of patient manipulations, patient transfers and transports. Generally, these actions can have the aforementioned, adverse effects, which could expose the already critically ill patients to extra dangers. However, the introduction of the multifunctional radiolucent patient treatment table, that is suitable for resuscitation, conventional diagnostic imaging and CT scanning, minimize these actions and their additional risks.While the REACT study design enables us to describe the diagnostic and therapeutic procedures following initial CT scanning on an individual patient level, the REACT trial also gives us the opportunity to evaluate its effect on an institutional level.Because of the additional CT scanning capacity that was created by adding the sliding CT scanner that services the two mirrored trauma rooms, logistics for the radiology department will be influenced for both acute (trauma) patients and elective CT scanning. By potentially eliminating the need to reckon with unplanned acute CT imaging, the regular elective CT scans can be planned better and more efficient, possibly leading to a reduction of waiting times and waiting lists. Critically ill patient groups (i.e. trauma patients and patients with intracranial bleedings, acute aneurysms or abdomens, ICU patients, etc.) who need CT scanning can have their total diagnostic work-up completed in the shockroom before transport to their destination of treatment. In some cases the diagnostic work-up can even be completed simultaneously for two patients because of the mirrored shockroom design.Furthermore, the REACT study design enables us to describe in detail the diagnostic and therapeutic procedures following initial CT scanning of trauma patients in the shockroom or at the Radiology Department. We may be able to demonstrate a trade-off in the volume and cost of health care use between early detection of injuries and timely therapeutic management on one hand and late detection by additional diagnostic testing and subsequent therapies on the other.Another possible institutional effect might be that a shockroom CT scan may be used as an attractive alternative to other imaging procedures or to sequential diagnostic testing strategies in other patient groups (for instance stroke patients, patients with acute abdominal pain, etc), since it remains an all-inclusive multifocal diagnostic modality. As a consequence substitution of diagnostic modalities or changes in patient groups presenting for CT scanning may occur as a result of joint production.Finally, the total costs of realizing this concept are of substantial amount and therefore this shockroom design has to be assessed during the study period in a cost-effectiveness analysis.ConclusionThe REACT trial is a prospective randomized multicenter trial that compares the effects of a new and revolutionary concept with a sliding CT scanner located in the trauma resuscitating room with a conventional setting, respectively a CT scanner located in the Radiology department. Results are expected early in 2009.AbbreviationsREACT: Randomized study of Early Assessment by CT scanning in Trauma patients, AMC: Academic Medical Center, VUmc: 'Vrije Universiteit' medical center. CT: Computed Tomography, FAST: Focused Assessment with Sonography in Trauma, SBP: systolic blood pressure, HUI-3: Health Utility Index 3, MKA: Meldkamer Ambulancezorg AmsterdamCompeting interestsT.P. Saltzherr is a research fellow at the Trauma Unit Department of Surgery, employed by the AMC Medical Research B.V. and supported by a grant from Siemens Medical Solutions, Den Haag, the Netherlands.Authors' contributionsTPS drafted the manuscript. PHPFKJ and JCG co-authored the writing of the manuscript. All other authors participated in the design of the study and are local investigators at the participating centers.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533002.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533002",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533002\nAUTHORS: George Pados, John Tympanidis, Menelaos Zafrakas, Dimitrios Athanatos, John N Bontis\n\nABSTRACT:\nScar or incisional endometriosis is a rare, often misdiagnosed, pathologic condition of the abdominal wall. Two cases of incisional endometriosis are presented. Both patients presented with atypical cyclic pain and palpable nodules on scars of previous cesarean sections. In both cases, the mass was totally excised, after accurate preoperative evaluation with 2-D ultrasound, power Doppler and MRI. Microscopic examination confirmed the preoperatively presumed diagnosis of cutaneous endometriosis. In cases of suspected scar endometriosis, preoperative diagnostic imaging is valuable in determining the extent of disease, thus enhancing accurate and total excision.\n\nBODY:\nIntroductionExtraperitoneal endometriosis, i.e. the presence of ectopic, functional endometrium outside the peritoneal cavity is exceedingly rare. Cutaneous endometriosis is a form of extraperitoneal endometriosis, sometimes associated with previous laparoscopic or open abdominal operative procedures [1]. Diagnostic imaging may be used for accurate preoperative diagnosis and evaluation of the extent of cutaneous endometriosis lesions, but publication of such images in the medical literature has been scarce, due to the rarity of this condition. We present herein two cases of cutaneous endometriosis following cesarean section, both systematically evaluated preoperatively with 2-D ultrasound, power Doppler, and MRI.Case presentationCase 1A 28 year-old white woman, G2P1, presented with atypical cyclic pain on a small, firm lump at the outer margins of the scar of a previous cesarean section, performed five years earlier. Patient history details were as follows: Occupation: housewife; Ethnicity: Greek; Weight 75 Kg; Height: 165 cm; Medical history: one previous cesarean section, otherwise unremarkable; Family history: unremarkable; Patient habits and medications: non-smoker, no alcohol consumption, no current medications. Sonographic examination of the abdominal scar showed a hypoechoic mass, with internal echoes, infiltrating the subcutaneous fat, extending up to the sheath of the rectus abdominis muscle (Figure 1A). Power Doppler showed internal vascularity within the lesion (Figure 1B). MRI showed that the lesion was isodense to muscle and confirmed its localization in subcutaneous fat tissue (Figure 2A). The lesion was removed surgically and diagnosis of endometriosis was confirmed histologically.Figure 12-D and power Doppler sonographic views of scar endometriosis nodules. Using 7.5 MHz transducers, scar endometriotic lesions appeared hypoechoic, with internal echoes on 2-D ultrasound (A, C), and with internal vascularity on power Doppler (B, D). A and B: Case 1; C and D: Case 2.Figure 2MRI of scar endometriosis nodules. Endometriotic lesions (arrows) appear isodense to muscle on transverse (A, B) and axial (C) T1-weighted spin-echo MRI. A: Case 1; B and C: Case 2.Case 2A 29 year-old white woman, G2P1, presented complaining of atypical cyclic pain on the scar of a previous cesarean section, performed six months earlier. Patient history details were as follows: Occupation: Secretary; Ethnicity: Greek; Weight: 65 Kg; Height: 167 cm; Medical history: one previous cesarean section, otherwise unremarkable; Family history: unremarkable; Patient habits and medications: non-smoker, no alcohol consumption, no current medications. On clinical examination, a firm lump was found on the abdominal scar. Ultrasound scan showed a large hypoechoic mass with internal echoes, measuring approximately 10 mm, located at the lateral margin of the scar (Figure 1C). Power Doppler sonography showed increased vascularity within the mass (Figure 1D). On static MRI the mass appeared isodense to muscle (Figure 2B and 2C), while T2-weighted imaging showed increased signal-intensity within the lesion. After total surgical excision, histological examination showed that the mass consisted of endometrial tissue and stroma, suggesting cutaneous endometriosis.DiscussionCutaneous endometriosis developing on scars of previous operations is a rare condition. Scar or incisional endometriosis is usually confined in superficial layers of the abdominal wall, but it may sometimes infiltrate deeper layers and present in exceptional cases even as a uterocateneous fistula [2]. Various theories have been proposed concerning the etiopathogenesis of endometriosis in general, including retrograde menstruation, metaplasia, and venous or lymphatic dissemination [3,4]. Many patients with scar endometriosis do not have any signs or prior history of peritoneal endometriosis, suggesting that this condition might be probably caused by endometrial cell dissemination into the wound at the time of surgery. Since the proliferative capacity of end-differentiated cells is limited, transfer of endometrial stem cells to incisions of the abdominal wall at the time of uterine surgery, followed by proliferation at the new site, seems to be the most plausible explanation for development of scar endometriosis.Incisional endometriosis presents typically as a firm, palpable lump at the site of a surgical scar, usually accompanied by cyclic pain and swelling during menses. Cyclic bleeding may also occur. Cyclic symptoms and signs should alert to clinical diagnosis of endometriosis. Macroscopically, the mass is usually non-discrete, rubbery and often multiloculated, containing chocolate cysts. Differential diagnosis includes hernias, lipomas, hematomas, abscesses, cheloids, suture granulomas, sebaceous cysts, as well as malignant tumors, including desmoid tumors, sarcomas, lymphomas or primary malignancies of the skin and metastatic tumors [5].Due to the rarity of incisional endometriosis, there is no data available concerning cost-effectiveness of different diagnostic methods. At a first glance, the simplest and less costly approach would be excisional biopsy followed by histological examination of the lesion, without prior imaging evaluation. However, this may lead to inadequate excision, and subsequently disease recurrence, necessitating re-excision. On the other hand, preoperative evaluation with imaging techniques can facilitate total surgical excision. On 2-D sonography, scar endometriosis lesions may appear as cystic or multicystic, mixed or solid masses, with internal vascularity on power Doppler. Though these findings are not specific [6], 2-D sonography allows preoperative evaluation of the extent of such lesions. If 2D- and Doppler-ultrasound studies seem inadequate, the extent and biologic behaviour can be further evaluated by MR-imaging. T1-weighted MRI shows lesions isodense to muscle, while T2-weighted images show high signal intensity with marked enhancement [7]. Thus, operative resection can be planned accurately and safely, particularly in recurrent and extensive lesions infiltrating deeper layers of the abdominal wall.Combined oral contraceptives, progestogen-only therapy and GnRH-analogues have been used in the therapeutic management of cutaneous endometriosis, but recurrence is common after discontinuation of treatment. On the other hand, wide excision of the whole lesion, even if this necessitates fascial excision, leads to permanent cure. Recurrence is rare following surgical treatment, and is usually attributed to inadequate excision [8].ConclusionIn conclusion, use of diagnostic imaging, including 2-D ultrasound, power Doppler sonography and MRI, in the preoperative assessment of suspected scar endometriosis lesions is very helpful for accurate determination of the extent of disease. This approach enhances total surgical excision, which is crucial for definitive diagnosis and avoidance of disease recurrence.Abbreviations used2-D: Two-dimensional; MR(I): Magnetic Resonance (Imaging); G: Gravida; P: para; GnRH: Gonadotropin Releasing Hormone.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsGP conceived the study and participated in patient management acquisition of data, interpretation of data, and was a major contributor in writing the manuscript. JT participated in patient management, acquisition of data, and drafting of the manuscript. MZ revised critically the manuscript adding substantial intellectual content. DA participated in patient management, acquisition of data, and drafting of the manuscript. JB coordinated the study and patient management and revised critically the manuscript. All authors have read and approved the final manuscript.ConsentWritten informed consent was obtained from both patients – in their native language – for publication of this case report and accompanying images. Copies of the written consent are available for review by the Editor-in-Chief of this journal\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533017.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533017",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533017\nAUTHORS: Seema Srivastava, Natalia Ciapryna, Iñaki Bovill\n\nABSTRACT:\nIntroductionDysphagia is a common presentation in older people. Diffuse idiopathic skeletal hyperostosis affecting the cervical spine is an uncommon cause of dysphagia and may be overlooked.Case presentationWe present the case of an 88-year-old man with dysphagia and weight loss. Initial investigation with upper gastrointestinal endoscopy was inconclusive. A diagnosis of diffuse idiopathic skeletal hyperostosis as a cause for dysphagia was eventually made using video fluoroscopy. This showed a bony prominence impeding swallow at the level of C3. The patient was unfit for surgical management so a percutaneous endoscopic gastrostomy tube was inserted for feeding.ConclusionThe diagnosis of diffuse idiopathic skeletal hyperostosis involving the cervical spine often goes unrecognised as a cause of dysphagia despite its prevalence in the elderly population. Diagnosis is made using cervical radiographs, barium swallow and computed tomography. There is a risk of perforation with endoscopy in patients who have cervical diffuse idiopathic skeletal hyperostosis. Conservative management includes non-steroidal anti-inflammatory medications and a modified diet. Surgery may be considered in certain patients where conservative management fails.\n\nBODY:\nIntroductionDiffuse idiopathic hyperostosis was first described in 1950 by Forestier and Rotes-Querol [1]. It is characterised by excessive ligamentous calcification and ossification at spinal and extraspinal locations. When the cervical spine is involved large osteophytes may form, causing symptoms of dysphagia. We describe the case of an 88-year-old man with dysphagia and weight loss secondary to diffuse idiopathic skeletal hyperostosis (DISH).Case presentationAn 88-year-old man presented with a 6-month history of dysphagia for solid foods and significant weight loss. He denied any symptoms of odynophagia. He denied any hoarseness of the voice, neck pain or breathlessness. There was no change in bowel habit or blood in the stools. His calorific intake was solely dependent on protein supplement drinks. His previous medical history was of type 2 diabetes, hypercholesterolaemia, hypertension, atrial fibrillation and glaucoma.On examination he was cachetic and pale. His weight was 54 kg. The rest of his physical examination was unremarkable. His full blood count showed a normocytic anaemia (10.3 g/dl) with a normal ferritin level. Liver function was normal apart from an albumin of 28 g/l. Erythrocyte sedimentation rate and thyroid stimulating hormone were normal. An endoscopy was performed to exclude an intrinsic cause for the patient's symptoms. This showed chronic atrophic gastritis but no cause for the dysphagia. Video fluoroscopy was performed which showed a bony prominence impeding swallow at the level of C3. A lateral cervical spine radiograph showed anterior osteophyte formation, most marked at the C3/C4 vertebrae and consistent with DISH (Figure 1).Figure 1Lateral radiograph of the cervical spine showing anterior osteophyte formation most marked at the C3/C4 vertebrae and calcification of the anterior longitudinal ligaments.He was commenced on nasogastric feeding, as there was evidence of aspiration on video fluoroscopy. He was referred to the spinal surgeons but they did not feel surgery was appropriate due to the patient's frail condition and comorbidities. A percutaneous endoscopic gastrostomy tube was placed 3 weeks later. The patient died 6 weeks after admission, from complications secondary to an unrelated septic arthritis of the shoulder.DiscussionDISH is a common but overlooked condition seen in the elderly. It is characterised by new bone formation into axial and peripheral enthesial regions. The prevalence of DISH has been reported to be 10% in patients over the age of 70 (see [2]). The aetiology of DISH has not been defined but there are associations with diabetes, obesity [3], hypercholesterolaemia and gout. DISH most commonly affects the thoracic spine although cervical involvement is found in 76% of those affected [4]. Dysphagia related to DISH affecting the cervical spine has a reported prevalence of 28% [5]. Dysphagia caused by DISH may be due to several factors: direct mechanical compression of the oesophagus by large anterior osteophytes; smaller osteophytes located at sites of oesophageal fixation such as at the level of the cricoid cartilage; inflammation of the peri-oesophageal soft tissue in contact with overlying osteophytes; or oesophageal spasm caused by painful osteophytes [6].The diagnosis of DISH is radiological. Plain radiographs of the cervical spine typically show flowing calcification and ossification along the anterior surface of at least four contiguous vertebrae. Large anterior osteophytes are commonly found between C4 and C7 [7]. Computed tomography is another useful imaging modality in the diagnosis of DISH as the size and shape of the osteophytes are shown in relation to the oesophagus and other important structures. Barium swallow or video fluoroscopy will confirm oesophageal compression and obstruction in relation to large anterior osteophytes. Endoscopy in these patients carries a risk of perforation but may be necessary to exclude other intrinsic causes of dysphagia such as oesophageal strictures, oesophagitis, oesophageal webs, motility disorders, tumours and candidiasis [8]. Other clinical manifestations associated with cervical DISH are hoarseness, stridor, aspiration pneumonia, myelopathy, thoracic outlet syndrome and sleep apnoea [7]. Treatment is divided between conservative and surgical. Conservative management includes modification of diet, non-steroidal inflammatory medications, corticosteroids and muscle relaxants [9,10]. In severe cases surgical management may be the only option and involves osteophytectomy. The surgical approach may be anterolateral, posterolateral or transpharyngeal when C2 to C4 vertebrae are involved. Complications include laryngeal nerve damage, stroke, Horner's syndrome and cervical instability [11].ConclusionDysphagia is a common presentation seen in older people. The diagnosis of DISH involving the cervical spine often goes unrecognised as a cause of dysphagia despite its prevalence in the elderly population. Diagnosis is established with plain cervical radiographs and barium swallow especially when endoscopy has excluded an intrinsic cause for dysphagia.AbbreviationsDISH: Diffuse idiopathic skeletal hyperostosis.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsThe authors were involved in the writing of the manuscript or patient clinical care. All authors read and approved the final manuscript.ConsentWritten informed consent could not be obtained in this case since the patient's next-of-kin were untraceable. We believe this case report contains a worthwhile clinical lesson which could not be as effectively made in any other way. We expect the patient's next-of-kin not to object to the publication since every effort has been made so the patient remains anonymous.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533025.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533025",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533025\nAUTHORS: Wilfried Haerty, Carlo Artieri, Navid Khezri, Rama S Singh, Bhagwati P Gupta\n\nABSTRACT:\nBackgroundMuch of the morphological diversity in eukaryotes results from differential regulation of gene expression in which transcription factors (TFs) play a central role. The nematode Caenorhabditis elegans is an established model organism for the study of the roles of TFs in controlling the spatiotemporal pattern of gene expression. Using the fully sequenced genomes of three Caenorhabditid nematode species as well as genome information from additional more distantly related organisms (fruit fly, mouse, and human) we sought to identify orthologous TFs and characterized their patterns of evolution.ResultsWe identified 988 TF genes in C. elegans, and inferred corresponding sets in C. briggsae and C. remanei, containing 995 and 1093 TF genes, respectively. Analysis of the three gene sets revealed 652 3-way reciprocal 'best hit' orthologs (nematode TF set), approximately half of which are zinc finger (ZF-C2H2 and ZF-C4/NHR types) and HOX family members. Examination of the TF genes in C. elegans and C. briggsae identified the presence of significant tandem clustering on chromosome V, the majority of which belong to ZF-C4/NHR family. We also found evidence for lineage-specific duplications and rapid evolution of many of the TF genes in the two species. A search of the TFs conserved among nematodes in Drosophila melanogaster, Mus musculus and Homo sapiens revealed 150 reciprocal orthologs, many of which are associated with important biological processes and human diseases. Finally, a comparison of the sequence, gene interactions and function indicates that nematode TFs conserved across phyla exhibit significantly more interactions and are enriched in genes with annotated mutant phenotypes compared to those that lack orthologs in other species.ConclusionOur study represents the first comprehensive genome-wide analysis of TFs across three nematode species and other organisms. The findings indicate substantial conservation of transcription factors even across distant evolutionary lineages and form the basis for future experiments to examine TF gene function in nematodes and other divergent phyla.\n\nBODY:\nBackgroundThe growing availability of the whole-genome sequences of eukaryotes has accelerated large-scale functional studies to understand the mechanisms of animal development and evolution [1-4]. Many of these studies have highlighted the importance of regulatory evolution and the fundamental role that transcription factors (TFs) play in this process. Alterations in TF function and regulation are linked to phenotypic variation [5-7] as well as numerous pathologies, including cancers [8,9]. Therefore, a detailed analysis of sequence and function of TFs across animal phyla will provide important information about their evolutionary patterns, thereby increasing our ability to understand the molecular basis of diseases and organismal complexity. The nematode Caenorhabditis elegans serves as a powerful model organism to unravel TF function due to the wealth of available resources and the ease with which it can be reared, maintained, and manipulated in the laboratory [10]. The completion of its genome sequence has aided in the design of large-scale experiments that are beginning to elucidate the complexity of transcriptional regulation and gene interaction networks in multicelllular eukaryotes [11,12]. The recent releases of the genome sequence of two other Caenorhabditid species, C. briggsae [13] and C. remanei [14], provide an excellent opportunity for genome-wide study of the conservation and evolution of transcription factors across nematodes. These three species are estimated to have shared a common ancestor between 20–120 million years ago [13-15] and while they are morphologically similar, studies have shown differences in development and behavior [16].As a first step in facilitating the comparative study of TFs in nematodes, we have compiled an updated list of putative TF genes in C. elegans and used it to identify orthologs in C. briggsae and C. remanei. Our results show that two-thirds of all C. elegans TF genes have 3-way one-to-one best reciprocal orthologs in the other two species, whereas the remaining third are either species-specific paralogs or too divergent to assign proper orthologous relationships. We observed that among Caenorhabditid species, although TF genes have a greater sequence divergence than the non-TF genes, they exhibit significantly more detectable interspecific orthologs than non-TF genes. We also identified 150 best reciprocal orthologs of the TF genes conserved among nematodes in fruit fly (Drosophila melanogaster), mouse (Mus musculus), and human (Homo sapiens) many of which are associated with known disorders. We also examined the relationship between gene function and interactions, the results of which demonstrate that conserved TF genes exhibit a significantly greater number of interactions and are more likely to be associated with mutant phenotypes when compared to those that lack detectable orthologs. Our findings provide a framework for future studies of nematode TFs and facilitate the development of resources allowing us to study morphological and developmental diversity in metazoans.ResultsThe C. elegans TF gene setAs a first step in the identification of TFs in Caenorhabditid species, we generated an updated list of putative C. elegans TF genes by searching its annotated genome sequence (Wormbase WS173 release) [17] for gene ontology (GO) terms associated with transcription factors. This led to the identification of 1271 putative TF genes (Table 1). Since our criteria for selecting a TF was the presence of a well-defined DNA binding domain that selectively modulates gene transcription (for example, bHLH or homeobox), we manually inspected the above list of putative TFs. This allowed us to reject 564 genes as false positives since these encode factors that are associated with the basal transcriptional apparatus (for example, DNA polymerases), chromatin alterations, DNA packaging (histones), as well as entries that were incorrectly curated in Wormbase (Additional files 1, 2, 3). To the remaining genes (707), we added 281 TF encoding genes found in published literature and other public database entries that were not identified in our initial search (See Materials and Methods). The final C. elegans TF set included a total of 988 genes (Table 2 and additional file 4), of which 917 are shared with the previously annotated C. elegans TF set (wTF2.0, 934 genes) [18]. The 17 genes in the wTF2.0 set that are not shared in our updated set either lack a known DNA binding domain or are annotated as pseudogenes (Additional file 5). The increased number of genes in the present TF set likely results from the availability of annotations published since the compilation of wTF2.0.Table 1GO term-based searches of TF genes in C. elegans.GO IDTermTF genesUnique0003700Transcription Factor activity61460043565DNA binding, sequence specific51560003677DNA binding8583520030528Transcription regulator activity7590006355Regulation of transcription, DNA dependent768780045449Regulation of transcription199190000122Negative regulation of transcription from RNA pol II promoter84004544Positive regulation of transcription from RNA pol II promoter2410The table lists numbers of all TF genes as well as those uniquely identified by each of the terms.Table 2The breakdowns of TF genes in each of the nematode species genomes based on various search categories.Search methodNumber of TF genesC. elegansC. briggsaeC. remaneiGO term-based707NDNAOrthologs (InParanoid and reciprocal BLAST)ND713703Manual curation281NANAHMM alignmentsND282390TOTAL:9889951093NA: not applicable, ND: not done.Identification of transcription factors in nematodes and other phylaWe used the newly defined C. elegans TF set to search for homologs in the fully sequenced genomes of C. briggsae (CB3 release) and C. remanei (11/29/2005 release) [17,19,20]. We used InParanoid [21] to identify 713 and 703 best reciprocal hit orthologs in C. briggsae and C. remanei, respectively (Table 2, see Material and Methods). To these lists, we added 282 C. briggsae and 390 C. remanei putative TF genes that were identified through Hidden Markov Model (HMM)-based searches [22]. Altogether, a total of 995 and 1093 potential TF encoding genes were identified in C. briggsae and C. remanei, respectively (Table 2 and additional files 6 and 7). Among the TF orthologs in the three nematode species, we identified 652 genes that exhibit a 3-way best reciprocal BLAST orthologous relationship (hereafter referred to as the nematode TF set) (Figure 1). The proportion of C. elegans TF genes with detectable orthologs in C. briggsae (713/995, 71.7%) is significantly higher compared to the proportion of all conserved genes between the two species (12858/20621, 62.4%) [13] (χ2 = 7.56, df = 1, p = 6.0 × 10-3), which may indicate strong selective pressure to maintain these genes.Figure 1TF-encoding genes in C. elegans, C. briggsae and C. remanei. The total number of TF genes in each of the species is given inside the brackets. The numbers of divergent TF genes and those conserved among the three nematode species are shown along the vertices and inside of the triangle, respectively.To examine the evolutionary conservation of the nematode TF set of genes in other phyla, we searched for their orthologs in the genomes of fruit fly(D. melanogaster), mouse (M. musculus), and human (H. sapiens). Using the InParanoid database [23] we identified a total of 150 TFs that exhibit reciprocal orthologous relationships between three nematode species and are conserved in fly, mouse, and human (Additional files 4 and 8).Coding sequence divergence in nematode TF genesBest-hit reciprocal orthologs could not be identified for 215 TF genes in C. elegans, 211 in C. briggsae, and 310 in C. remanei (Figure 1 and additional files 4, 6, and 7). It should be pointed out that C. briggsae and C. remanei TF genes are based on computational predictions and that the C. remanei genome has yet to be assembled; hence while many of the TF genes without detectable orthologs may have arisen by lineage-specific gene duplication, others could result from incomplete annotation of the C. briggsae and C. remanei genomes. Therefore, the actual number of divergent TF genes in these species is likely to be smaller than the numbers we have estimated. To further study this set of genes in C. briggsae (211), we searched for their closest homologs in C. elegans. This revealed 30 genes with weak sequence similarity (BLASTP E-value > 10-10) suggesting that these most likely represent candidate C. briggsae-specific TF genes (Additional file 9). The remaining 181 appear to be species-specific paralogs, of which 69 are zinc finger-C4/nuclear hormone receptor (ZF-C4/NHR) family members (see below).Previous studies in humans and other organisms have shown that TF genes tend to evolve more rapidly than non-transcription factor (non-TF) genes [24-26], therefore we performed a similar analysis in nematodes by analyzing their coding sequence divergence and comparing it to non-TF genes. Due to the large divergence times between the three species [13,15], the rate of synonymous substitution per synonymous site (dS) for many genes is likely to be saturated (dS > 3, Figure 2A). Therefore we restricted our analysis to the rate of non-synonymous substitution per non-synonymous site (dN), which does not show such saturation [27]. We found a significantly higher dN for TF genes conserved among nematodes (652) when compared to 3-way conserved non-TF gene orthologs (10,827 genes; Kruskal-Wallis rank sum test, p < 2.2 × 10-16; Figure 2B), whereas no difference was detected between TF genes with orthologs in nematodes, fly, mouse, and human (150) and non-TF genes (Kruskal-Wallis test, p = 0.3498).Figure 2Sequence divergence of transcription factors in C. elegans. Rates of synonymous substitutions per synonymous site (dS) (A) and non-synonymous substitutions per non-synonymous site (dN) (B) as calculated under model 0 in PAML (Yang) for non-TF (10,827), TF genes conserved in nematodes, fly, mouse, and human (150) and TF genes conserved among the three nematode species (652) are shown. The boxplot indicates the first and third quartiles and the dotted lines the 5th and 95th percentiles. The notches indicate the level of uncertainty associated with the median.Distribution of TF families in C. elegansWe studied the distribution of protein families among C. elegans TFs based on known DNA binding domains. This analysis revealed more than 50 distinct families of which 30 were found to contain 5 or more members (Figure 3). No significant difference was observed in the representation of various families between the C. elegans set and the set conserved among three nematodes (χ2 = 35.05, df = 30, p = 0.2408), indicating that the distributions of TF families in these species may be similar. The majority of genes in C. elegans and nematode TF sets (28.6% and 20.5%, respectively) were found to encode the nuclear hormone receptors (NHRs), a C4-type sub-family of zinc finger proteins that play key roles in development and homeostasis [28]. The NHR genes was previously shown to have undergone extensive lineage-specific expansion in C. elegans [29]. Besides NHR, HOX genes that regulate cell fate specification and embryogenesis [30] are also among the largest TF families in nematodes (11% of C. elegans TF genes, and 11.6% of nematode TF genes) (Figure 3A, C). In contrast, the distribution of TF families among the divergent C. elegans gene set (215 genes) differs significantly from that observed among the entire C. elegans TF set (χ2 = 83.91, df = 30, p = 5.33 × 10-7) due to its high proportion of NHR genes (52.6%, Figure 3B). Likewise, the representation of different families among TF genes with orthologs in nematodes, fly, mouse, and human also differs from that of the C. elegans TF set (χ2 = 152.27, df = 30, p = 0, Figure 3D). Interestingly, the single largest conserved family represented among the orthologs in three different phyla is HOX (17.3%), supporting multiple previous studies indicating the importance of this family among all metazoans [18,30,31].Figure 3Distribution of TF gene families in C. elegans. The pie charts show distributions of all (A), divergent (B), nematode-conserved (C), and nematode-fly-mouse-human-conserved (D) TF genes in C. elegans. For details on various gene families please refer to Materials and Methods.Chromosomal distribution of TF genes in C. elegans and C. briggsaeStudies in C. elegans as well as other organisms have shown that genes that are co-expressed and/or functionally related are frequently clustered together on chromosomes [32-36]. To investigate whether TF genes in nematodes exhibit a similar pattern, we plotted the physical locations of C. elegans and C. briggsae TF genes using non-overlapping windows of 200 kb (the genome of C. remanei has not yet been assembled and therefore was not used in this analysis). Figure 4 shows that TF genes in C. elegans and C. briggsae as well as those that are conserved among nematodes are non-randomly distributed on chromosomes. A total of 183 C. elegans TF genes were found to be located in 25 distinct clusters (marked with stars in Figure 4A, Table 3). A similar pattern was observed in C. briggsae (184 genes in 27 clusters) (Figure 4B and Table 3). Chromosome V carries highest number of clusters (and genes) in both species (C. elegans: 97 genes in 10 clusters; C. briggsae: 64 genes in 7 clusters) (Table 3) that are primarily composed of NHR family members (92% in C. elegans and 84% in C. briggsae, red bars in Figure 4).Figure 4Chromosomal distribution of TF genes in C. elegans (A) and C. briggsae (B). The maps have been plotted by taking all TF genes in non-overlapping 200 kb windows. The color codes are as follows. Red: NHR genes, blue: non-NHR TF genes, green: TF genes conserved among the three nematode species. Gene clustering was analyzed by comparing the numbers of TF and non-TF genes located in each window using a χ2 test. Gene clusters that are significantly enriched have been marked with stars (*: P < 0.05; ** P < 0.01; ***: P < 0.0001).Table 3Chromosome-wise breakdown of TF gene clusters in C. elegans and C. briggsae.ChromosomeC. elegansC. briggsaeNumber of clustersNumber of genesNumber of clustersNumber of genes12123192424534315317452942151097764X316529TOTAL2518327184The analysis of the chromosomal distribution of TF genes also revealed that many members of the large TF families, such as ZF-C4/NHR, ZF-C2H2, T-box and HOX are arranged in perfect tandem arrays (defined as having a contiguous repetition of TF genes) (267 C. elegans genes in 103 arrays, 235 C. briggsae genes in 107 arrays), the largest of which consists of 8 NHR genes in C. elegans and 6 NHR genes in C. briggsae (Figure 5 and additional files 10 and 11). Although the majority of such arrays consists of genes of the same TF family (76.7% in C. elegans and 67.3% in C. briggsae), less than half of all genes found in such arrays have best-reciprocal hit orthologs between the two species (31.6% in C. elegans, 47.2% in C. briggsae) (Additional files 10 and 11) suggesting significant lineage-specific duplication and expansion of the tandem arrays.Figure 5Tandem arrays of NHR genes in C. elegans and C. briggsae. The snapshots of the genomic regions, visualized by Wormbase genome browser, show 8 genes in C. elegans and 6 in C. briggsae. The colors of the open reading frames indicate their orientation (blue: leftward, pink: rightward).Evolution of the Nuclear Hormone Receptor family in nematodesOur findings extend Robinson-Rechavi et al.'s analysis of the extensive lineage-specific expansion of NHR genes in C. elegans [29] to the other two Caenorhabditid species (283, 232, and 256 NHR genes in C. elegans, C. briggsae, and C. remanei, respectively). The sequence analyses revealed a total of 134 NHR genes having 3-way best-reciprocal orthologs among the nematode species (Additional files 4, 6, and 7). The remaining NHRs are composed of what appear to be lineage-specific paralogs and those that have diverged sufficiently in sequence such that orthologous relationships could no longer be assigned.We constructed a phylogenetic tree of the nematode NHR family members (437 genes, see Materials and Methods) to study their inter– as well as intra-specific relationships. The most striking feature of the phylogeny is the frequent presence of several closely related NHRs located tandemly on the same chromosome (Additional file 12). Such groupings suggest the presence of extensive tandem duplications, which could explain the mechanism behind the expansion of the NHR gene family, and perhaps the independent occurrence of some NHR genes in the lineages of each of these species. In the case of C. elegans NHRs, we found at least 15 distinct groups on chromosome V including 7 that are located in one large cluster of the phylogeny (Additional file 12).The presence of NHRs in chromosomal clusters prompted us to study their distribution in further detail. We identified a total of 47 tandem arrays composed of contiguous repetitions of NHR genes in C. elegans, which are found on all chromosomes with the exception of chromosome III (Additional file 10). These include 10 arrays that are comprised of 5 or more genes, all of which are located on chromosome V. A similar analysis in C. briggsae identified 30 NHR arrays having 6 or fewer genes (Additional file 11). In total, 9 NHR arrays were partially or completely conserved between C. elegans and C. briggsae. One of these arrays, for instance, consists of 7 genes in C. elegans (nhr-136, nhr-153, nhr-154, nhr-206, nhr-207, nhr-208, and nhr-209) and the corresponding 4 in C. briggsae (CBG23383/Cbr-nhr-136, CBG23380/Cbr-nhr-153, CBG23380/Cbr-nhr-154 and CBG23379/Cbr-nhr-209). This suggests that either the array has expanded in C. elegans or perhaps lost 3 of the genes in C. briggsae. Examination of the C. remanei TFs revealed the presence of best reciprocal hit orthologs for all array members found in C. elegans with the exception of nhr-206 leading us to propose that nhr-207 and nhr-208 were most likely lost in the C. briggsae lineage. This analysis, however, carries a caveat in that the annotations of the C. briggsae and C. remanei genomes are based on computational predictions and lack experimental validation.Finally, we found that 7 tandem arrays in C. briggsae are composed of NHR genes that lack best reciprocal hit orthologs in C. elegans and C. remanei (Additional file 11). The largest of these is comprised of 6 NHR genes (CBG01243, CBG01244, CBG01245, CBG01246, CBG01247, CBG01248) (Figure 5). These C. briggsae-specific arrays may be caused by lineage-specific expansion although the possibility of a selective loss of their orthologs in other species cannot be ruled out.Comparison of TF gene sequence conservation and function in C. elegansWe investigated the relationship between sequence conservation and function of TF genes in C. elegans. From a comprehensive list of 13,647 RNAi phenotypes associated with 4,351 genes [14], we identified 281 TFs that exhibit one or more mutant phenotypes (Additional file 13). These consist of more than half of all TF genes conserved among nematodes, fly, mouse, and human (52.7%, 79 of 150), over one-third of genes conserved among the three nematode species (36.5%, 238 of 652), and one-fifth of the TF genes in C. elegans that did not have identifiable orthologs in the other nematode species (20%, 43 of 215). We also determined the number of distinct mutant phenotypes associated with TF genes in each of the above three groups as well as with non-TF genes. This analysis revealed that TF genes conserved among nematodes, fly, mouse, and human are linked to a significantly greater number of mutant phenotypes in C. elegans when compared to the other sets (4.38 ± 2.31, 3.36 ± 2.09, 2.91 ± 1.82 and 3.19 ± 1.84 phenotypes per gene for TF genes conserved across phyla, conserved in nematodes, C. elegans TF genes without detectable orthologs in the other nematode species and non-TF genes, respectively; Kruskal-Wallis rank sum test, p = 8.58 × 10-3, 1.8 × 10-3, 1.32 × 10-15, respectively, after Bonferroni correction). No difference was found in pairwise comparisons between the other gene sets (Kruskal-Wallis rank sum test p = 1, in all comparisons after Bonferroni correction).To further analyze the roles of C. elegans TF genes in specific tissues and developmental processes, RNAi phenotypes were sorted into six broad categories: viability (embryonic and post-embryonic growth and survival), fertility (germline and germ cells), sex (sex determination and reproductive system), vulva (vulval cell proliferation and morphogenesis), body (cuticle, size, and morphology), and behavior (movement and feeding) (Additional files 13 and 14). Among the six categories, \"viability\" ranks highest in terms of the proportion of TF and non-TF genes (Figure 6). However, it is important to keep in mind that this may be linked to a greater interest in identifying transcription factors that are involved in growth and survival of C. elegans. A further sub-classification of this category into \"embryonic viability\" and \"post-embryonic viability\" (based on the phenotype when lethality occurs in RNAi-treated animals) revealed that among the \"embryonic viability\" class TF genes conserved among nematode species are significantly under-represented when compared to the non-TFs (χ2 = 7.39, df = 1, p = 6.56 × 10-3) (Figure 6), while no difference was observed among the datasets for genes affecting post-embryonic viability (χ2 = 0.77, df = 1, p = 0.38). By contrast, the TF genes conserved among nematodes, fly, mouse, and human showed no enrichment for any of these two categories (χ2 = 3.59 and 0.39, df = 1, p = 0.059 and 0.53, respectively). Among other categories, we observed an over-representation of mutant phenotypes for nematode-conserved as well as nematode-fly-mouse-human-conserved TF gene sets associated with vulval development (χ2 = 8.24 and 11.75, df = 1, p = 4.1 × 10-3 and 6.08 × 10-4, respectively) and sex determination and reproductive system-related processes (χ2 = 9.51 and 8.78, df = 1, p = 2.04 × 10-3 and 3.59 × 10-3, respectively) when compared to the non-TF gene set.Figure 6Functional classification of C. elegans TF genes. The six broad categories are based on the mutant phenotypes in RNAi studies. Non-TF genes have been plotted for comparison. Viability-E and viability-PE are based on the embryonic and post-embryonic stage lethality phenotypes in RNAi assays, respectively. Refer to text for the description of other categories.Phenotypes associated with nematode TF orthologs in fly, mouse, and humanThe above findings that more than half of C. elegans TF genes conserved across phyla are associated with RNAi phenotypes prompted us to examine their mutant phenotypes in other organisms. We found that 69 (46%) of TF genes conserved among nematodes, fly, mouse, and human are associated with lethal phenotype in fly (Additional file 15). In the case of mouse, out of a total of 81 orthologs for which knock out and mutant phenotypes are described (see Materials and Methods), 75 (92.6%) exhibit defects ranging from mild to gross abnormalities, including lethality (Additional file 15). A similar analysis in human revealed 35 TF genes linked to various diseases and genetic disorders (Table 4). In total, 44 (29.3%) TF genes regulating C. elegans development and behavior are also essential either in mouse or human or both. These include 30 genes that control viability in the fruit fly. Overall, 121 (80.7%) TF genes conserved among nematodes, fly, mouse, and human play important roles in at least one of these organisms. This is likely an underestimate due to technical limitations of RNAi experiments (e.g., strains, redundancy of factors or pathways) and that comparisons between organisms involve different experimental approaches (e.g., RNAi in C elegans and chromosomal mutations in D. melanogaster). Thus, functional studies of conserved TFs in C. elegans promise to elucidate mechanisms involved in biological processes conserved across phyla.Table 4Genetic disorders linked to human TF genes conserved among nematodes, fly, mouse, and human.C. elegans geneHuman orthologHuman disordervab-3Pax6Aniridia type II, Peters anomaly with cataract, foveal hypoplasiaY38H8A.5FEZF1Beckwith-Wiedemann syndromeceh-33SIX1Branchiootic syndrome 3mab-9TBX20Cardiomyopathy, atrial septal defect 1tag-192CHD7CHARGE syndromeceh-24TITF1Congenital hypothyroidism, neonatal respiratory insufficiencydve-1SATB2Cleft palate isolatedceh-14LHX3Combined pituitary hormone deficiency 3unc-86Pou4f3DFNA15 syndromeelt-1GATA1Dyserythropoietic anemia with thrombocytopeniaK02H8.1MBNL2Dystrophia myotonica 1fax-1Nr2e3Enhanced s-cone syndromeceh-17PHOX2ACongenital fibrosis of the extraocular muscles 2ceh-32SIX3Holoprosencephaly 2sbp-1Srebf1Hypercholesterolemia, familiallin-28LIN28BHypomyelination and cataractalr-1ARXLissencephaly, X-linked, with ambiguous genitaliahmg-5TfamKearns-Sayre syndromecnd-1NEUROD1Maturity-onset diabetes of the younglim-6LMX1BNail patella syndrome NPS1grh-1GRHL2Neurosensory deafness 28sma-4Smad4Pancreatic cancer, Hemorrhagic Telangiectasia Syndrome (HTT)nhr-6NR4A2PARK14ceh-6POU3F3Perilymphatic gusher-deafness syndromezag-1ZEB1Posterior polymorphous corneal dystrophy 3eor-1MYNNPromyelocytic leukemiaR07E5.3Smarcb1Rhabdoid tumorcbp-1CREBBPRubinstein-taybi syndrome, acute myeloid leukemiaceh-43DLX5Split-hand/foot malformationing-3ING3Squamous cell carcinomaast-1FLI1Thrombocytopenia, Paris-Trousseau typenhr-64HNF4AMaturity-onset diabetes of the youngtbx-2Tbx2Ulnar mammary syndromeK02D7.2SNAI2Waardenburg syndrome, piebaldismF53F8.1KLF3Wilms tumorAnalysis of TF interaction networks in C. elegansTo further explore the mechanism of transcription factor function in metazoans, we generated an interaction map of C. elegans TF genes based on known physical and genetic interactions [37,38]. The map consists of 1594 interactions involving 277 TF genes and their direct non-TF interactors (Figure 7A and additional file 16). The network appears to be scale free as seen by the presence of several nodes with high degree of connectivity (such as lin-35, which shows the highest number of interactions and is connected to more than one-third of all existing nodes; 521 of 1340) (Figure 7B). lin-35 is an ortholog of the human Retinoblastoma (Rb) gene which plays an important role in cell proliferation [39,40]. Among the lin-35 interacting genes, 43 (8%) encode TFs, of which 18 have best reciprocal hit orthologs in mouse and human. Other prominent hubs include pal-1 (conserved among nematode species), as well as other TF genes with orthologs in nematodes, fly, mouse, and human: tag-331, eya-1, and sma-4 (Figure 7B). Each of these genes plays important role in C. elegans development, and RNAi-mediated knock-downs cause defects such as slow growth (pal-1), lethality (pal-1, tag-331), larval arrest (eya-1, tag-331), uncoordinated movement (eya-1), and small size (sma-4) [41-44]. Interestingly, the subnetwork comprising of the hub gene tag-331 (human ortholog RNF113A) and its 32 direct interactors appears to be largely isolated. A closer examination revealed that two-thirds of these 22 genes are conserved in nematodes yet lack best reciprocal hit orthologs in fly, mouse, or human genomes. The remaining third includes four genes conserved in nematodes, fly, mouse, and human (zfp-1, R11F4.1, apl-1 and fcd-2) and whose human homologs are linked to disorders (AF10/MLLT10: leukemia, Glycerol kinase: hyperglycerolemia, APP: Alzheimer's, and FANCD2: Fanconi anemia). It remains to be determined if the human genes interact with RNF113A as well as whether RNF113A is involved in any of these diseases. Among the remaining hub genes, the eya-1 mammalian orthologs promote development of tissues and organs [41,45,46] whereas the sma-4 ortholog SMAD4/DCP4 acts as a tumor suppressor [47-49].Figure 7The interaction network of C. elegans TF genes. (A) The breakdowns of TF nodes, non-TF nodes and gene interactions in the network for each of the TF categories. The C. elegans-divergent category refers to TF genes that lack unique reciprocal orthologs in other nematode species. (B) The network exhibits several high degree nodes, five of which – tag-331, eya-1, lin-35, sma-4, and pal-1 – are boxed and shown at high magnification on the right (marked by arrows). The node colors mark different TF genes (red: conserved among nematodes, fly, mouse, and human; yellow: conserved among the three nematode species; green: C. elegans-divergent). The network was visualized by using Cytoscape [81].In addition to analyzing the prominent hubs in the interaction network, we also examined the relationship between connectivity of TFs, sequence conservation, and known function. The results revealed a significantly greater number of interactions among C. elegans TFs that are conserved in nematodes, fly, mouse, and human, as compared to those that are not (Kruskal-Wallis rank sum test, p = 0.0207, after Bonferroni correction). We also found that TF genes associated with mutant phenotypes in RNAi assays exhibit significantly more interactions when compared to those that lack a detectable phenotype (Kruskal-Wallis rank sum test, p = 0.0069). These results are consistent with previous studies showing that highly connected hubs tend to be enriched in essential genes [50,51].DiscussionThis paper presents the first genome-wide comparative study of TF genes in nematodes and their orthologs in fly (D. melanogaster), mouse (M. musculus), and human (H. sapiens). We took both computational and manual curation approaches to compile sets of TF genes in three Caenorhabditid species, leading to the identification of 988 genes in C. elegans, 995 in C. briggsae and 1093 in C. remanei. A comparison of these data sets has revealed 652 3-way best reciprocal orthologs among these species. Furthermore, using currently available genome annotations, we identified 150 TF gene orthologs shared among nematodes, fly, mouse, and human and shown that according to mutant phenotypes or associated disorders, many of these genes are functionally important. It should be noted that many of the TF genes identified in C. elegans as well as most of those identified as orthologs, paralogs, and divergent in the other two nematode species are based entirely on computational predictions, and thus await experimental validation. However, the results of our study suggest the most likely group of candidate genes from which further experimental tests of TF activity can be designed. In contrast, the majority of the orthologs identified in the two other phyla are annotated as TF genes themselves, owing to the extensive experimental validation performed in these organisms.The sequence comparison of orthologs among nematodes has revealed that TF genes conserved among the three nematodes species (652 genes) are evolving more rapidly than non-TF genes, which is in agreement with earlier reports from other species in which TF genes have been shown to be evolving more rapidly than the coding genome average, and that significantly more TF genes have been found to be evolving under positive selection when compared to the rest of the genome [24,25,52,53]. While our observation of a greater number of conserved orthologs among all three nematode species, coupled to an accelerated rate of divergence may seem paradoxical, it may be suggestive of widespread positive selection, and thus divergence, acting on genes that are otherwise functionally important. Given the wide estimates of the divergence time between the three nematode species considered in this study, it is unsurprising that the rate of synonymous substitution (dS) is saturated, and is therefore not amenable for use in analyses that could test the hypothesis of widespread positive selection among TF genes. Additional data, such as a large-scale polymorphism analysis among multiple Caenorabditid nematodes could provide the sensitivity to test for evidence of differential selective pressure affecting specific gene groups.The analysis of TF families in nematodes has revealed several interesting features, such as the high proportion of C2H2 and C4/NHR class of zinc-finger family members relative to the other TF families in all three species (see Figure 3). It was previously shown that the NHR family has undergone significant lineage-specific expansion in C. elegans and C. briggsae [53]. Considering, for example, that Drosophila and humans carry less than 50 identified NHR genes (21 and 48, respectively) [54], the presence of more than 200 genes in Caenorhabditid species is striking. Although it remains to be seen whether all of these have important roles to play, studies in C. elegans have shown that roughly 10% of NHRs mediate diverse processes including molting (nhr-23, nhr-25, nhr-67), neuronal differentiation (unc-55, fax-1), sex determination (sex-1), and dauer formation (daf-12) [54]. We found that roughly half of all NHRs in each of the Caenorhabditid species are conserved as 3-way best reciprocal orthologs and another 10% exhibit 2-way orthologous relationships with at least one of the other nematode species. The remaining NHRs are likely to have arisen from lineage-specific gene duplications, suggesting that this class of TF may have a significant role in many of those differences that make individual nematode species unique. While the expansion of the NHR family in nematodes is certainly unusual, other TF families show interesting lineage-specific features as well. Previous studies as well as results presented here indicate that TF families such as ZF-C2H2, HOX and T-box have also diverged between the C. elegans and C. briggsae lineages (see Figure 3B and additional file 9) [31].Our work demonstrates that TF genes are non-randomly distributed in the genomes of both C. elegans and C. briggsae. We found that members of gene families such as NHR, HOX, and T-box are frequently clustered and present in tandem arrays. A subset of the rapidly evolving NHR family of TF genes in C. elegans was previously shown to be located on chromosome V [53,55,56]. We have shown not only that C. briggsae exhibits a similar pattern, but also that the majority of the chromosome V NHRs in both species is tandemly arrayed. Our finding that many NHRs appear to be lineage-specific paralogs suggests that gene duplication has played a significant role in the expansion of this gene family in nematodes. The phenomenon of gene clustering has been observed not only in C. elegans, but also in other species such as D. melanogaster and mouse [32-34,55,57], and in some cases these clusters are composed of genes that are co-expressed [32,34]. While the precise mechanism of the origin of such clusters remains to be determined, these may be caused by small-scale regional translocations and illegitimate recombination events leading to tandem gene duplications [58,59].Our study has revealed that C. elegans TF genes conserved across multiple phyla are more likely to be associated with mutant phenotypes when compared to the remaining TF and non-TF genes. Likewise, the fly, mouse, and human orthologs of C. elegans TF genes are enriched in essential genes when compared to C. elegans TF genes without detectable orthologs (46%, 50% and 23.3%, respectively). The analysis of the relationship between gene function and interactions revealed that TF genes conserved across phyla exhibit greater number of interactions and mutant phenotypes when compared to those that are divergent. Among the TFs with described interactions, lin-35 (human Rb ortholog) appears to have an exceptionally large number of interactions. lin-35 is known to interact with cell cycle-related and chromatin remodeling factors to regulate tissue growth and morphology [60,61]. We found that among the lin-35 interacting genes, 43 (8%) encode TFs, of which 18 have best reciprocal hit orthologs in mouse and human. It is important to keep in mind that conservation in sequence does not indicate the roles of orthologous genes in regulating similar biological processes. Instead, it simply means that genes that are evolutionarily conserved are very likely to play important roles in the development and functioning of the organism. Our results are also consistent with studies in other organisms that have found a significant correlation between connectivity, rate of evolution and gene dispensability (according to lethal or sterile phenotype), even across multiple metazoan phyla. In general, hubs with high degree of connectivity tend to be enriched in essential genes and appear to evolve relatively slower than genes with lower connectivity [27,50,62-64].ConclusionThis study describes a genome-wide analysis of TF genes in three Caenorhabditid nematode species (C. elegans, C. briggsae and C. remanei) as well as their orthologs in fruit fly (D. melanogaster), mouse (M. musculus) and human (H. sapiens). We observed a significantly higher conservation of orthology for the TF genes among Caenorhabditid species, while also noting that the coding sequence of TF genes diverges more rapidly than the coding genome average. Finally, the analyses of sequence conservation, gene interactions, and function revealed that TF set conserved in nematodes, fly, mouse, and human is significantly more enriched in essential genes compared to those that lack orthologs in other phyla. Our findings will serve as a resource in aiding us to understand transcriptional networks and their conservation and divergence among metazoa. The compilation of the TF sets also serves as a stepping-stone in generating various resources such as knock-out mutants, cDNA and promoter clones, and reporter gene expressing lines, with the intent of systematically mapping and studying TF function in nematodes. In parallel with many of ongoing initiatives in C. elegans these resources will provide foundation for future studies of the conservation of TF function and interaction across the breadth of biodiversity.MethodsC. elegans, C. briggsae and C. remanei TF gene setsThe C. elegans TF-encoding genes were searched using 8 GO terms (Table 1) within WS173 release of Wormbase. The C. briggsae and C. remanei TFs were identified using the HMMER [22,65] and InParanoid programs [21]. The complete genome sequences of each of the three Caenorhabditid species were downloaded from WormBase (C. elegans release WS173, C. briggsae release WS173 and C. remanei release 11/29/2005) [17]. As the C. remanei predicted peptide dataset is known to contain redundant copies of genes due to heterozygosity in the sequenced genome, (E. Schwartz, personal communication) we used the CD-HIT program (version 2007-0131) [66] in order to cluster and remove all additional transcripts that had greater than or equal to 98% sequence similarity to other transcripts at the protein level. The original dataset of 25,948 transcripts was truncated down to 24,267 non-redundant transcripts that were used in further analysis [27].InParanoid was run with default values, using blastall version 2.2.14 with –VT emulation, on all three complete genome predicted peptide datasets in pairwise comparisons. The results were collected and placed into species-specific paralogs, 2- and 3-way best-hit reciprocal ortholog categories using custom PERL scripts. Each category was searched for genes from the C. elegans TF set and the number of TFs in each category was identified (Additional files 6 and 7). HMM alignment-based searches were carried out on the C. briggsae and C. remanei predicted peptides using previously established techniques [22,67]. The HMMER signature files (profiles) of known DNA binding domains were retrieved from Pfam [68]. In most cases, a cut-off score of 0.1 was used. If a HMMER predicted TF gene in non-elegans species lacked a homolog in C. elegans, it was considered false positive and therefore removed creating the final, conservative datasets that were used in the study.The C. elegans orthologs of D. melanogaster, M. musculus and H. sapiens TFs were retrieved using the data available on the InParanoid database [23,69].Identification of the TF gene familiesGenes were grouped into different families based on the presence of known DNA-binding domains according to the WormBase [14], Pfam [68], and InterPro [70] databases. Only well defined and unambiguous domains that are known to be involved in transcriptional regulation were considered. Families with fewer than 5 members were placed together in a miscellaneous category. The TF families shown in Figure 3 are as follows. AP2: Activator protein-2 family; AT hook: AT hook DNA binding motif (preference to A/T rich region) family; bHLH: basic helix-loop-helix family; bZIP: basic leucine zipper family; CBFB/NF-YA: CCAAT binding factor family; CSD: Cold shock DNA binding domain family; HMG box: High mobility group box family; HOX: Homeobox family; MADF: Myb DNA binding domain family; SAND: DNA binding domain family named after Sp100, AIRE-1, NucP41/75, DEAF-1; SANT: Myb-like DNA binding domain; SMAD: SMAD (Mothers against decapentaplegic (MAD) homolog) domain family; T-box: T-box family; WH: Winged-helix family; WH-FH: Winged-helix and Forkhead domain family; WH-ETS: Winged-helix and ETS domain family; ZF-C2H2: C2H2-type zinc finger protein family; ZF-C2H2-BED: C2H2 and BED-type zinc finger protein family; ZF-BED: BED-type zinc finger family; ZF-C2H2-RING: C2H2 and RING-type zinc finger protein family; ZF-C4/NHR: C4-type zinc finger/Nuclear hormone receptor family; ZF-CCCH: C-x8-C-x5-C-x3-H class of zinc finger family; ZF-DHHC: DHHC-type zinc finger family; ZF-FLYWCH: FLYWCH-type of zinc finger family; ZF-GATA: GATA class of zinc finger family; ZF-PHD: C4HC3 zinc-finger-like motif family; ZF-others: zinc finger family members not listed above; ZF-DM: DM (dsx and mab-3) zinc finger family; ZF, AT hook: AT hook and zinc finger domain family; ZF, SANT: SANT and zinc finger domain family; Misc: Miscellaneous TF family not listed above.Generation of the chromosomal mapThe physical locations of C. elegans and C. briggsae TF and non-TF genes were retrieved from Wormbase (WS173 release) and grouped into non-overlapping windows of 200 kb (similar to the 250 kb used by [33]). A 400 kb window analysis was also performed and the conclusions remain the same (data not shown). Since many genes are alternatively spliced, we eliminated transcript-specific bias by focusing on single open reading frame for each transcription factor. In the case of C. briggsae, a total of 1329 genes were not assigned to any of the chromosomes and hence were excluded from the analysis. For simplicity, we only used the average between the start and end positions as a proxy for the gene position. The significance of TF clustering on chromosomes was determined by comparing their frequency with the overall frequency of genes in a given window using a χ2 test [33]. Clusters with p value less than 0.05 were considered significant.Phylogenetic analysis of the nematode NHR genesThe predicted C. elegans NHR gene dataset (283 genes) was used to identify orthologs and paralogs in C. briggsae and C. remanei using the complete genome INPARANOID datasets (see above). 204 and 152 potential homologs were identified in C. briggsae and C. remanei, respectively. The peptide dataset was aligned using Dialign 2.2 [71] and then manually inspected. We identified two large conserved blocks within most predicted peptides and removed all sequences that did not align within these blocks. The remaining sequences were then realigned with Dialign 2.2 and truncated only to retain the two conserved domains. As per Robinson-Rechavi et al. [29] we chose to use only ungapped sites and removed first sequences missing significant portions of the conserved domains and finally excluded all gapped sites. In the end, we retained 437 sequences (213 C. elegans, 106 C. briggsae and 118 C. remanei) for phylogenetic analysis.The phylogeny was constructed using a maximum likelihood based method as implemented in PhyML [72] using the JTT substitution model [73] with the default proportion of invariable sites (0.0) and rate heterogeneity between sites corrected by a gamma law (using the default gamma parameter of 1.0 and eight rate categories). The phylogeny was then bootstrapped by generating 1000 randomized datasets using SEQBOOT and assessing the percentage of consensus trees using CONSENSE, both in the PHYLIP package [74].Calculation of TF divergenceDNA sequences from C. elegans, C. briggsae and C. remanei were aligned according to their protein alignment using Dialign 2.2 [75] and RevTrans 1.4 [76]. Rates of synonymous substitutions per synonymous site (dS) and non-synonymous substitutions per non-synonymous site (dN) were estimated using codeml from PAML [77]. Evolutionary rates between TF and non-TF data sets were compared using a permuted Kruskal-Wallis rank sum test using 10,000 permutations.Curation of the mutant phenotypes of TFsThe RNAi phenotypes of all known C. elegans genes were retrieved from Wormbase (WS170 release). A total of 13,648 phenotypes associated with 4,351 genes were analyzed and sorted into 82 different categories (Unc, Dpy, Vul etc.) (Additional files 13 and 14).For phenotypes associated with C. elegans TF orthologs in fly, mouse, and human, we searched Flybase [78], NCBI OMIM [79], PubMed [80], and other public databases (, , , ). Only those phenotypes that were unambiguous and did not show discrepancy between different published sources were included. In order to reduced any effect linked to a differential amount of genes annotated as involved in particular mutant phenotypes, all the analyses were performed within each phenotypic class by comparing the distribution of genes with mutant phenotypes among the different sets (non-TF genes, TF genes, C. elegans TF genes, TF genes conserved among the three nematode species, and TF genes with orthologs in nematodes, fly, mouse, and human).Construction of TF interaction networkThe C. elegans gene network was built using the genetic and protein-protein interaction data for transcription factors curated by BioGRID (version 2.0.27 release) [37,38]. The network was visualized by using Cytoscape [81].AbbreviationsdN: non-synonymous substitutions per non-synonymous site; dS: synonymous substitutions per synonymous site; NHR: Nuclear hormone receptor; TF: Transcription factor; ZF: Zinc finger.Authors' contributionsThe laboratories of BPG and RSS contributed to this publication. BPG and NK identified the C. elegans TF set, protein families, chromosomal maps, and mutant phenotypes. WH identified nematode TF orthologs in fly, mouse, and human and carried out most of the sequence alignments, and interaction network analysis. CA performed the InParanoid orthology searches creating the C. briggsae and C. remanei TF gene sets and constructed NHR phylogenetic tree. BPG, WH and CA drafted the manuscript. BPG conceived and coordinated the study. All authors read and approved the final manuscript.Supplementary MaterialAdditional file 1List of 314 incorrect entries (non-TFs) in C. elegans.Click here for fileAdditional file 2List of 167 genes that encode chromatin remodeling, general transcription and DNA/RNA binding factors in C. elegans.Click here for fileAdditional file 3List of 83 histone-encoding genes in C. elegans.Click here for fileAdditional file 4List of 988 TF genes in C. elegans.Click here for fileAdditional file 5List of 17 false positives in wTF2.0.Click here for fileAdditional file 6List of 995 TF genes in C. briggsae.Click here for fileAdditional file 7List of 1093 TF genes in C. remanei.Click here for fileAdditional file 8List of 150 TF orthologs in Drosophila melanogaster, M. musculus, and H. sapiens.Click here for fileAdditional file 9BLASTP hits of C. briggsae-divergent TFs in C. elegans genome.Click here for fileAdditional file 10Tandem arrays of TF genes in C. elegans.Click here for fileAdditional file 11Tandem arrays of TF genes in C. briggsae.Click here for fileAdditional file 12Phylogenetic tree of NHR genes in Caenorhabditid nematode species. Colors mark NHR genes in different species (blue: C. elegans, red: C. briggsae and light green: C. remanei). Tandemly along chromosomes and phylogenetically clustered genes are indicated by vertical bars. Chromosomes carrying NHR clusters are indicated by roman numerals. The sub-branch comprised of seven groups of NHR genes on chromosome V has been marked by a star (*). Scale bar represents 0.5 substitutions per site.Click here for fileAdditional file 13C. elegans genes and their mutant phenotypes in RNAi assays.Click here for fileAdditional file 14RNAi phenotypes sorted into six broad categories.Click here for fileAdditional file 15List of the worm (C. elegans) fly (D. melanogaster) and mouse (M. musculus) mutant phenotypes associated with conserved TF genes.Click here for fileAdditional file 16List of TF genes and their interactors. The columns A and B merely list gene pairs that interact with each other and do not indicate the direction of regulation.Click here for file\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533040.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533040",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533040\nAUTHORS: Oleg Vasiliev, Simon J. Rhodes, David C. Beebe\n\nABSTRACT:\nPurposeTo identify transcripts expressed late in lens fiber cell maturation that might regulate fiber cell fusion, organelle degradation, or other events associated with the maturation of lens fiber cells.MethodscDNA libraries were prepared from microdissected regions of chicken embryo lenses using a PCR-based method. Subtractive hybridization was used to identify transcripts expressed exclusively in fiber cells that had detached from the lens capsule. Database searches and PCR amplification with degenerate primers were used to identify human, mouse, rat, rabbit, and bovine orthologs of one such sequence and to confirm its expression in the lenses of these animals. The ability of in vitro-transcribed and translated protein to bind DNA was assessed by mobility shift assays. The locus encoding this transcript and an area about 6 kb upstream of the translation start site were sequenced. The microscopic morphology of lenses from mice in which the locus encoding this protein had been disrupted by the insertion of a nuclear-targeted bacterial lacZ sequence were analyzed. Gene expression was analyzed by PCR, in situ hybridization, and by staining for β-galactosidase activity in lenses expressing lacZ in place of the coding sequence. Knockout lenses expressing green fluorescent protein in a mosaic pattern were sectioned in the equatorial plane and viewed with a confocal microscope to assess the presence of cell-cell fusions during fiber cell maturation.ResultsSubtractive hybridization identified transcripts encoding Hop, a short, atypical homeodomain-containing protein that had previously been shown to be an important regulator of gene expression in the heart and lung. Chicken Hop did not bind to known homeodomain-binding sequences in DNA. In chicken embryos, Hop transcripts were first detected at E6. At all stages analyzed, Hop mRNA was only detected in cells that had detached from the lens capsule. Mice in which the Hop coding sequence was replaced with nuclear-targeted β-galactosidase showed that Hop was expressed in the mouse lens in a similar pattern to the chicken lens. Characterization of lenses from mice lacking Hop revealed no morphological phenotype and no apparent defects in the degradation of nuclei or fiber cell fusion during fiber cell maturation.ConclusionsThe expression pattern of Hop provides the first evidence that new transcription is initiated in lens fiber cells after they detach from the capsule. Hop may be the first of a class of genes with this pattern of expression. Although lens abnormalities have yet to be identified in mice lacking Hop, the genomic sequences that regulate Hop expression in the lens may be useful for expressing exogenous transcripts selectively in fiber cells just before they fuse with their neighbors and degrade their organelles.\n\nBODY:\nIntroductionThe lens is composed of two types of epithelial cells: A sheet of cuboidal cells, the lens epithelium, covers its anterior surface, and post-mitotic, elongated fiber cells comprise the bulk of the lens (Figure 1). Stimulation by factors present in the vitreous body causes epithelial cells near the lens equator to withdraw from the cell cycle and differentiate into lens fiber cells. Differentiating fiber cells elongate and initiate the transcription of genes that encode a distinct array of abundant membrane, cytoskeletal, and cytoplasmic proteins. The accumulation of high concentrations of cytoplasmic proteins (crystallins) in fiber cells is important for the transparency and refractive power of the lens. Some crystallins, cytoskeletal, and membrane proteins are found primarily in lens cells, or are present only at very low levels in non-lens tissues [1-7].Figure 1Diagram of lens regions. Diagram representing a section through the center of a lens showing the regions of the fiber mass that were dissected to produce region-specific cDNA libraries. Fiber cells in the cortex region are still in the process of elongation and are attached at their basal ends to the lens capsule, the lens basement membrane. Cells in the middle region have completed the process of elongation and have detached from the capsule. The apical and basal ends of these cells abut the ends of fiber cells from the other side of the lens at the anterior and posterior sutures. Cells in the core region have degraded their nuclei and other membrane-bound organelles.Lens fiber cells undergo remarkable morphological changes during their differentiation. Fiber cells first elongate to many times their original length, extending to over 140 μm per day in the chicken embryo [8]. As they elongate, the anterior and posterior ends of the fiber cells extend beneath the lens epithelium and along the posterior lens capsule toward the optical axis. When the ends of these cells approach the anterior and posterior poles of the lens, they meet elongating fiber cells extending from the other side, resulting in the formation of the anterior and posterior sutures (Figure 1). Once the cells stop elongating, they become buried beneath the next group of elongating fiber cells. Soon after the fiber cells detach from the posterior capsule, the composition of their cell-cell adhesion proteins changes [9], their lateral membranes become interdigitated [8] and partially fuse with the membranes of neighboring fiber cells [8,10], and all intracellular, membrane-bound organelles are degraded [11-17]. Mature fiber cells persist in this state for the life of the organism.Many of the genes that are preferentially expressed in lens fiber cells have been identified, cloned, and sequenced, and their promoters used to express foreign genes in the lenses of transgenic animals [18,19]. The products of all these \"fiber-specific\" genes are detected at or soon after the initiation of fiber cell differentiation. To date, only a few transcripts have been identified that are preferentially expressed late in fiber cell differentiation [9,20], and no mRNAs have been identified that are expressed only at this stage.To identify molecules that might regulate or be required for the final stages of fiber cell differentiation, we used subtractive hybridization between cDNA libraries created from chicken embryo lens fiber cells before and after they detached from the lens capsule. The open reading frame of one of the transcripts that was selectively expressed after fiber cells detached from the capsule consisted of 73 amino acids, 60 of which had strong sequence similarity to the homeodomain consensus. This gene was previously named Hop, for \"homeodomain-only protein\" [21,22].MethodsAnimals and surgical proceduresAnimals were treated in accordance with the guidelines of the U.S. Public Health Service under a protocol approved by the Washington University Animal Studies Committee. Mice were maintained in an animal facility accredited by the Association for Assessment and Accreditation of Laboratory Animal Care (AAALAC). Fertile chicken eggs were obtained from CBT Farms (Chestertown, MD) and incubated in a humidified, forced-draft incubator at 38 °C. Embryos at different stages of development were removed, their lensers were fixed, and sectioned at 500 μm with a tissue slicer (OTS-4000; Electron Microscopy Sciences, Warrington, PA), and examined for the distribution of Hop mRNA by in situ hybridization. Mice in which the Hop coding sequence was replaced with DNA encoding a nuclear-targeted form of E. coli β-galactosidase [22] were genotyped by PCR. Whole lenses were stained for β-galactosidase activity according to directions described in reference [23], embedded in glycol methacrylate, and sectioned at 1 μm. Hop knockout mice were mated with TgN(GFPU)5Nagy strain of mice, which express green fluorescent protein (GFP) in a mosaic pattern, to determine whether lens cells lacking Hop fused with their neighbors during fiber cell maturation [24]. Lenses lacking Hop were fixed in 10% formalin and sectioned perpendicular to the long axis of the fiber cells. GFP fluorescence was viewed with a Zeiss LSM 510 confocal microscope.Overview of the subtractive hybridization methodThe procedures used were modified from previous reports [25,26]. RNA was prepared from microdissected regions of the lens fiber cells and region-specific cDNA pools were synthesized. The cDNAs were amplified by PCR, made single-stranded (tester), and annealed with excess biotinylated, single-stranded cDNA prepared from a different region of the lens (driver). The biotinylated complex was removed with magnetic streptavidin beads and the remaining cDNA was cloned into a bacterial plasmid. Bacterial clones were screened with labeled probes prepared from both regions of the lens to confirm the effectiveness of the subtraction.Preparation of region-specific librariesIn chicken embryos, organelle degradation in the central fiber cells begins at E12 [11]. After this age, lenses contain elongating fiber cells, fiber cells that have stopped elongating and detached from the capsule but not yet degraded their organelles, and mature fiber cells with no organelles (Figure 1). To isolate mRNA from these populations, we removed E15-16 lenses from the eye, embedded them in 4% agar, and cut 500 μm slices parallel to the optic axis with a tissue slicer. Slices that included the center of the lens were dissected into three regions: \"cortex,\" which contained elongating fiber cells, \"middle,\" which contained fiber cells that had detached from the capsule yet still contained organelles, and \"core,\" which contained the fiber cells that had already lost their organelles (Figure 1). The following primer sequences for PCR reactions were used: T primer: 5'-GTG CCT CTA GAT TTT TTT TTT-3'; TC primer: 5'-GTG CCT CTA GAT TTT TTT TTT GGA TCC CCC CCC CC-3'; C primer: 5'-TTT TCA CGG ATC CCC CCC CCC-3'; X primer: 5'-GTC CGG CCA ACG GTA TGG TG-3'; XT primer: 5'-GTC CGG CCA ACG GTA TGG TGC CTC TAG ATT TTT TTT TT-3'; and XC primer: 5'-GTC CGG CCA ACG GTA TGG TGC ACG GAT CCC CCC CCC C-3'.Total RNA from these regions was extracted using the standard guanidine thiocyanate procedure as described in reference [27]. Total RNA (0.25-1 μg) was heat-denatured at 65 °C for 5 min and annealed at room temperature for 5 min with 5 pM of T-primer in a total volume of 20 μl containing 1X RT buffer (50 mM Tris-HCl, pH 8.3, 6 mM MgCl2, 75 mM KCl, 1 mM dithiothreitol, 1 mM of each dATP, dTTP, dCTP, and dGTP), and 1 U RNase inhibitor (Promega, Madison, WI). After addition of 200 units of Moloney murine leukemia virus reverse transcriptase (SuperScript II; Life Technologies, Gaithersburg, MD), incubation was continued at 42 °C for 1 h, followed by 94 °C for 5 min, using a programmable thermal cycler (PTC-100TM; MJ Research, Watertown, MA). The tube was spun briefly and the cDNA was purified from the T-primer and dNTPs by ultrafiltration through a Microcon-100 concentrator (Millipore, Billerica, MA). Purified cDNA (5 μl aliquots) was oligo-dG-tailed at 37 °C for 0.5-1.5 h in a total reaction volume of 15 μl containing 1X terminal deoxynucleotidyl transferase (TdT) buffer (50 mM sodium cacodylate, pH 7.2, 0.1 mM 2-mercaptoethanol, 1 mM CoCl2), 400 mM dGTP and 2 U TdT. Higher TdT concentration (5-20 U) as well as longer time of incubation can significantly reduce the amount of DNA available for subsequent amplification with TC- and T-primers. For this reason, 4 μl aliquots of DNA were removed every 30 min of incubation and submitted to 18 cycles of \"hot-start\" PCR in 50 μl of 1X PCR buffer (40 mM Tricine-KOH, pH 9.2, at 20 °C; 10 mM potassium acetate, 3 mM MgCl2; 50 mg/ml BSA, 200 mM of each dATP, dTTP, dCTP, and dGTP), 5 pM TC primer, 20 pM T primer and 1.5 U Taq Polymerase. The first cycle of PCR was 94 °C for 30 s, 52 °C for 1 min, 72 °C for 1.5 min, followed by 16 cycles (94 °C for 10 s, 56 °C for 20 s, and 71 °C for 1.5 min). The final cycle had 5 steps: 94 °C for 10 s, 56 °C for 20 s, 71 °C for 2 min, 56 °C for 20 s, and 71 °C for 2 min. The five-step PCR was used during the last cycle for converting single-stranded \"pan-like\" DNA to double-stranded products. Full-length TC-T cDNA was prepared using the same conditions and cycle parameters except the elongation time was extended to 5 min and 0.05 U of Pfu polymerase was added to the PCR mix [28].Preparation of biotinylated T-C cDNATo obtain biotinylated \"middle\" and \"cortex\" T-C cDNA, 10 ng of the original TC-T cDNA was amplified through 10 cycles of PCR with 5'-end biotinylated T- and C-primers (Integrated DNA Technologies), the product purified from the primers and unincorporated nucleotides with a PCR purification kit (Promega), ethanol precipitated and resuspended in 12 μl of deionized water.Driver preparationAbout 7 μg of sense and antisense cDNA (driver) were prepared from 5 μl (2 μg) of biotinylated T-C cDNA (Integrated DNA Technologies) by five cycles of asymmetric amplification with 100 pM of biotinylated C-primer (for sense) or biotinylated T-primer (for antisense) in five tubes with a total volume 250 μl. The PCR reaction was stopped by the addition of 2 μl of 0.5 M EDTA, pH 8.0, and frozen at -20 °C.Tester (tracer) preparationSense and antisense tracer cDNA were prepared from 1 μl of biotinylated T-C cDNA by additional 5 cycles of asymmetric PCR with 20 pM of un-biotinylated XC-primer (for sense) or XT-primer (for antisense) in 50 ml of PCR buffer. The PCR reaction was stopped by addition 1 μl of 0.5 M EDTA pH 8.0 and frozen at -20 °C.Subtractive hybridizationFor each subtraction, two samples were prepared: one containing 5 μg of sense driver and 250 ng of antisense tracer and the second containing antisense driver and sense tracer. After undergoing phenol-chloroform extraction and precipitation with ethanol, each cDNA sample was dissolved in 400 μl of deionized water and purified from the primers by 5X filtration with Microcon-100 filters. Purified cDNA was precipitated with ethanol and resuspended in 4 μl of hybridization buffer (50 mM HEPES, pH 8.3; 0.5 M NaCl; 0.05 mM EDTA, pH 8.0), overlaid with mineral oil, heated 2 min at 95 °C and incubated overnight at 68 °C. The hybridization mix was diluted in 400 μl of NTE buffer (10 mM Tris-HCl, pH 8.0, 0.5 M NaCl, and 1 mM EDTA) and the aqueous phase was transferred to a fresh tube with 100 μl of streptavidin-beads (Dynal Biotech, Lake Success, NY) in NTE buffer (the beads were washed 3X in NTE buffer before use). After 5 min incubation at room temperature, the beads and bound DNA were removed with a magnet, and the remaining cDNAs were subjected to a second round of purification with streptavidin beads. After purification, the two samples were combined, mixed with 1 μg of each sense and antisense driver, precipitated with ethanol, dissolved in 4 μl of hybridization buffer and used for second step of hybridization at 68 °C, overnight. The second hybridization mix was purified twice with streptavidin beads. PCR was performed with 2 μl of the remaining cDNA in 50 μl of PCR buffer containing 10 pM of X-primer using the following parameters: 72 °C for 3 min, then 25-30 cycles of 94 °C for 12 s; 56 °C for 20 s; 72 °C for 2 min. The PCR reaction mixture was diluted 500 times and subjected to additional 15-17 rounds of PCR with T- and C-primers. Purified product of this secondary PCR was digested with Xba I and Bam HI endonuclease (Roche Applied Science, Indianapolis, IN) and inserted into a pcDNA3.1(-) vector (Invitrogen, Carlsbad, CA). For differential screening, 96 individual clones from the subtracted \"middle\" library were replicated and hybridized with DIG-labeled probes synthesized by PCR from \"cortex\" and \"middle\" subtracted cDNA. Plasmids from clones that reacted only or preferentially with the \"middle\" library were sequenced.Genomic sequencingSequencing of the region upstream of the Hop translation start site was accomplished by genomic walking. Chicken genomic DNA was extracted and digested with one of several restriction enzymes that generate 5' overhangs. The genomic fragments were ligated to double-stranded anchor primers with the appropriate 3' overhangs using the Rapid DNA Ligation Kit (Roche Applied Science), and PCR products were amplified with primers designed against the Hop coding sequence and the sequence of the anchor primer. The longest PCR fragments were cloned and sequenced using standard methods. Potential transcription factor binding sites in the genomic sequence upstream of the translation start site were identified with P-Match, a public version of Match (Biologische Datenbanken GmbH, Wolfenbüttel, Germany), using the stringency cutoff selection to minimize the identification of false positive matches.Tests of Hop DNA bindingElectrophoretic mobility shift assays (EMSA) were performed as described [29]. Radiolabeled Hop protein was synthesized in vitro using TNT Quick Coupled rabbit reticulocyte lysate reagents (Promega, Madison, WI) and 35S-methionine (Amersham Pharmacia, Piscataway, NJ). Substrate DNA was 0.5 mg of a plasmid containing Hop cDNA. 32P-labeled oligonucleotides representing binding sites for transcription factors were as follows: LHX3 LIM-class homeodomain site, 5'-GAT CCC AGA AAA TTA ATT AAT TGT AA-3' (LBC) [29]; paired-class homeodomain site, 5'-TCC GAC TAA TTG AAT TAG CGA GA-3' (PRD) [30]; bicoid-class homeodomain site, 5'-GAT CCG CAC GGC CCA TCT AAT CCC GTG GGA TC-3' (BIC) [31]; Pit-1 POU-class homeodomain site, 5'-GAT CCT ATG TGC TCA AAG TTC AGG TAT GAA TAT AAA GGA TC-3' (PIT) [32]; and a MyoD basic helix-loop-helix site, 5'-GGG AAA GGA TCT GAC AGG TGG CCC CAG CCC TCG G-3' (MD).Amplification of Hop sequences using degenerate PCR primerscDNA prepared from the lenses of several species was amplified with degenerate primers based on the sequence of chicken Hop. The primers were: 5'-GAT TCC ACC ACG CTG TGY CTN ATY GC-3' and 5'-CCA CTT BGC CAG NCG YTG YTT-3' where Y is C or T, N is A,G,T or C and B is C, G, or T. PCR products were cloned and sequenced by standard methods.Northern blottingTotal RNA from E15 lens fiber masses was separated by agarose gel electrophoresis, transferred to nylon membranes (Roche Applied Science, Indianapolis, IN), and probed with digoxigenin-labeled antisense riboprobes derived from the chicken Hop sequence by following directions given in the manual provided with the riboprobe kit. Bands were visualized with a peroxidase-labeled antibody to digoxigenin and chemiluminescent detection (Roche Applied Science).In situ hybridization was performed using standard techniques for whole mount staining [33] on whole lenses (E6-E8) or about 500 μm-thick sections of formaldehyde fixed lenses (>E8). Lenses were fixed for about 1 h, washed in PBS, and stained whole or sectioned using an OTS-4000 tissue slicer. Sections were stained with antisense or sense digoxigenin-labeled riboprobes derived from the full length chicken Hop cDNA sequence. An alkaline phosphatase-conjugated antibody to digoxigenin and 5-bromo-4-chloro-3-indolyl phosphate/Nitro blue tetrazolium were used for color development (Roche Applied Science).ResultsTo identify genes expressed late in fiber cell maturation we used a PCR-based method to prepare cDNA libraries from microdissected regions of E15-16 chicken lenses (Figure 1) and performed subtractive hybridization to identify cDNAs that are selectively expressed in fiber cells that had detached from the lens capsule, yet still contained organelles. Several clones were identified that were enriched or were expressed exclusively in mature fiber cells. One of these cDNAs encoded vinculin (GenBank NM_205441), a transcript that we had previously found to increase after fiber cells detach from the lens capsule [9]. Most other clones from this library encoded genes that were differentially, but not exclusively, expressed in mature fiber cells. One clone encoded a sequence that was expressed selectively in detached fiber cells but at low levels. A few ESTs for this transcript have been identified, the longest being GenBank accession number CN228064. Since this transcript was expressed at a low level in the lens, it was not examined further. Another transcript was expressed at high levels only in fiber cells that had detached from the capsule. It contained a short open reading frame encoding 73 amino acids with sequence similarity to the homeodomain transcription factors (GenBank NM_204556). The mouse ortholog of this gene (Hop) was recently shown to be expressed in heart development and to modulate the activity of other transcription factors [21,22,34].Sequence analysis and database searches revealed that chicken Hop differs at several locations from the homeodomain consensus and is not sufficiently similar to any of the known homeodomain sequences to be grouped in one of the homeodomain \"superclasses\" [35]. The greatest similarity of Hop to a characterized homeodomain is 47% amino acid identity with the Pitx homeoprotein of the cephalochordate Branchiostoma belcheri [36], although it is nearly as closely related to many other homeodomains of the \"paired\" superclass. The Hop homeodomain is 61 amino acids, containing a valine between the first and second helix, a characteristic sometimes present in diverged homeodomains [35].Because amino acids thought to be critical for DNA binding are altered in the Hop sequence, Hop protein was tested for its ability to bind DNA by electrophoretic mobility shift assay (EMSA). 35S-radiolabeled Hop protein was synthesized by in vitro transcription/translation and then incubated with 32P-radiolabeled DNA probes representing LIM-, paired- bicoid-, and POU-class homeodomain binding sites, or a MyoD basic helix-loop-helix protein binding site. In a parallel positive control, the LIM class site was bound by M2-LHX3 [37]. In agreement with other studies on mouse Hop [21,22], interaction between chicken Hop and DNA was not observed (Figure 2). DNA binding also was not observed in similar experiments using bacterially expressed Hop protein (data not shown).Figure 2Hop does not bind to homeobox sequences. Electrophoretic mobility shift assay using radiolabeled oligonucleotide probes representing transcription factor binding sites. Probes were incubated with the indicated 35S-labeled in vitro translated proteins, and the bound complexes (B) were separated from the free probe (F) by electrophoresis. Unprogrammed lysate was used as a negative control (lysate). Bacterially expressed M2-LHX3 was used as a positive control [37]. Abbreviations: LBC=LHX3 LIM-class homeodomain site, PRD=paired-class homeodomain site, BIC=bicoid-class homeodomain site, PIT=Pit-1 POU-class homeodomain site, MD=MyoD basic helix-loop-helix site. The upper panel shows the input Hop protein (35S-labeled); the lower panel shows the migration of 32P-labeled DNA.Sequencing Hop PCR products and over 6 kb of the chicken Hop genomic locus identified a 226 bp intron in the 5' untranslated region and a second intron of about 2,000 bp located between the regions coding for the first and second alpha helical regions of the Hop homeodomain. This is consistent with our northern blot analysis of lens RNA, which detected two transcripts of about 1 and 1.2 kb (Figure 3A). Sequencing of several Hop clones revealed that some Hop transcripts lack the first intron, while others may be initiated within the first intron. However, it is possible that these clones represent unspliced transcripts that did not extend to the 5' end of the cDNA. Alternative splicing of the first intron was later confirmed by examination of the chicken genomic sequence using the UCSC genome browser, which shows that some Hop ESTs from the chicken genome initiative include the first intron while others do not [38]. This analysis also demonstrates that Hop maps to chicken chromosome 4 [38]. The structure of the chicken Hop locus is shown in Figure 3B.Figure 3Splicing of Hop transcripts in the lens. A: Northern blot of total RNA extracted from E15-E16 lens fiber masses and probed with a digoxigenin-labeled Hop riboprobe. Two bands were detected that were the approximate predicted size of the Hop mRNA, with or without the inclusion of the first intron. B: Diagram showing the chicken Hop gene structure. The dimensions of the different regions of the gene are not to scale. The numerals above the line diagram mark the number of nucleotide pairs in each region. Introns are represented by thin solid lines and exons by boxes. Filled boxes represent translated regions of the mRNA and unfilled boxes are the untranslated regions.The genomic sequence of Hop was analyzed using a search program that identifies putative transcription factor binding sites (P-Match). The sites upstream of the translation start site that were identified in this search are shown in Figure 4A.Figure 4Analysis of the Hop gene and protein. The upstream genomic sequence of Hop and alignment of the Hop protein sequences from several species. A: About 6 kb of DNA sequence upstream of the Hop protein coding sequence, including the first intron (lower case, light blue letters), was annotated with potential transcription factor binding sites, as determined using the P-Match search tool. Settings for the search were adjusted to reveal only the most conservative matches (to minimize false positives). Because Nkx2.x factors regulate Hop expression in the heart and lung, we also show potential Nkx2.x binding sequences (in red), although these motifs were not detected by P-Match when set to minimize false positive matches. The transcription start site of the longest spliced form of Hop mRNA is marked by a vertical bar followed by an arrow. The initial methionine codon is shown in green. B: Alignment of the Hop protein sequences from several species. GenBank accession numbers are shown after each sequence. The chicken protein sequence obtained by conceptual translation of the cDNAs sequenced in this study was identical to that in GenBank. The partial rabbit sequence was determined using degenerate PCR primers, since this sequence was not determined previously.To determine whether Hop was expressed in the lenses of other species, we used specific or degenerate PCR primers to amplify cDNA prepared from human, mouse, rat, rabbit, and bovine lens fiber cells. The PCR products were sequenced to confirm that Hop transcripts were detected in the lenses of each of the species examined. Hop cDNA or genomic DNA has not previously been sequenced from rabbits. The sequence of partial Hop transcripts from the rabbit lens was submitted to GenBank (accession number EF154428). An alignment of all known Hop protein sequences is shown in Figure 4B.The expression and distribution of Hop transcripts in the chicken embryo lens were examined using RT-PCR and in situ hybridization. Hop sequences were first detected by PCR in cDNA prepared from E6 (Hamburger-Hamilton Stage 28-30) lenses and were readily detected in the fiber cells from older lenses (Figure 5A). A previous study found that primary fiber cells detach from the lens capsule between E5 and E6 [39]. Hop mRNA was first detected by situ hybridization at E7.5 in the central fiber cells (Figure 5B). After E7, an increasing number of cells in the central region of the fiber mass expressed Hop mRNA. Examination of lens sections suggested that, independent of the age of the lens, Hop transcripts were first detected in fiber cells soon after they detached from the lens capsule (Figure 5B).Figure 5Hop expression during lens development. A: PCR amplification of Hop sequences in RNA extracted from chicken lenses from E5 through E10. Hop transcripts were first detectable at E6. Transcript levels increased at later stages. B: Hop is expressed soon after primary and secondary fiber cells detach from the capsule. In situ hybridization showing the distribution of Hop transcripts during lens development in chicken embryos. Sections are from lenses at E7.5, E8.5, E12, and E19. The decreased staining in the center of lenses at E12 and E19 probably reflects a decrease in probe penetration, not a decrease in Hop transcripts, because PCR analysis of microdissected lens cores from lenses at these stages revealed no obvious decrease in Hop sequences.Mouse lenses in which both alleles of Hop had been disrupted by insertion of a nuclear-targeted lacZ sequence appeared normal in size (Figure 6A) and were transparent throughout adult life (not shown). When stained for β-galactosidase activity, these lenses revealed a similar pattern of Hop expression as seen in chicken embryo lenses. β-Galactosidase staining was not present in superficial fiber cell nuclei, but was detected in the nuclei of fiber cells that were deep in the fiber mass (Figure 6B-D). β-Galactosidase continued to be present in these nuclei until they were degraded during organelle deletion.Figure 6Appearance of Hop knockout lenses. Hop is expressed in maturing secondary fiber cells in the mouse lens. A: Hop wild type and null lenses from P3 mice. Both lenses have cold cataracts, as expected of lenses at this age. No consistent variations were detected in the size of the wild type and knockout lenses or in the extent of the cold cataracts. B: Polar view of a whole, Hop null lens stained for β-galactosidase activity. The superficial zone of the lens has no stained nuclei. The \"trefoil\" pattern of stained nuclei in the deeper fiber cells is due to the displacement of the nuclei in a more anterior or posterior direction as a result of differences in the extension of the fiber cells toward the anterior and posterior sutures [58]. C: The displacement of β-galactosidase-stained nuclei as viewed from the lens equator. D: A 1 μm plastic section of the equatorial region of a mouse lens in which both Hop alleles were disrupted by the insertion of the sequence encoding nuclear-targeted β-galactosidase [22]. The lens was stained for β-galactosidase activity, embedded in glycol methacrylate, and sectioned. The section was viewed using differential interference contrast optics to show the location of the nuclei of the fiber cells. Only the nuclei of the deeper fiber cells are stained blue, indicating that Hop expression is initiated late in fiber cell maturation. β-Galactosidase activity was still present in the fragments of nuclei remaining after organelle loss. The morphology of the cells of the Hop knockout lenses appears similar to wild type.The TgN(GFPU)5Nagy strain of transgenic mice was used to determine whether, during their maturation, fiber cells fused with their neighbors. Mice of this strain express GFP in a mosaic pattern in superficial, elongating fiber cells [24]. When fiber cells fuse during maturation, all cells become uniformly fluorescent, since GFP can now diffuse between neighboring cells. Our results demonstrated that elongating fiber cells of Hop knockout lenses showed mosaic expression of GFP, but fiber cells deeper in the lens were uniformly fluorescent (Figure 7). This indicates that the maturing fiber cells of Hop null lenses fused with their neighbors during their maturation in a manner that closely resembled that seen in lenses that contained both wild type Hop alleles (Figure 7) [24].Figure 7Fiber cell fusion in a Hop null lens. During their maturation in Hop knockout lenses, fiber cells fuse with their neighbors. This section of a TgN(GFPU)5Nagy; Hop-/- lens is cut perpendicular to the long axis of the fiber cells. GFP fluorescence is seen in a mosaic pattern in the peripheral fiber cells, similar to the pattern described previously for TgN(GFPU)5Nagy lenses that are wild type for Hop [24]. Deeper in the fiber mass, GFP fluorescence abruptly spreads to all cells, an indication of fiber cell fusion. This result shows that Hop is not required for the cell-cell fusion of fiber cells during their maturation.DiscussionWe postulated that the proteins that are encoded by transcripts that first appear after lens fiber cells detach from the capsule might be important for fiber cell maturation as well as denucleation. We and others identified transcripts that are differentially accumulated late in fiber cell differentiation [9,20]. It is not known whether these transcripts change in abundance due to increased rates of synthesis or decreased degradation. Vinculin and paxillin mRNAs increase markedly in fiber cells after they detach from the capsule, compared to fiber cells that were still elongating and were attached to the capsule [9]. However, the expression of vinculin and paxillin is not unique to mature fiber cells; these transcripts are expressed at lower levels in elongating fiber cells.To identify transcripts that are expressed only in fiber cells that have detached from the capsule, we prepared libraries from microdissected lens regions and performed subtractive hybridization. One of the transcripts detected in this screen encoded chicken Hop, an unusual homeodomain-containing protein. Other labs found that Hop is prominently expressed in the heart [21,22,34]. Based on its unusual coding sequence, these groups named it \"homeodomain only protein\" (Hop) [21,22] or \"odd box\" (OB1) [34]. Hop is the first gene to be identified that is not expressed in elongating fiber cells but is transcribed after fiber cells detach from the lens capsule. This pattern of gene expression demonstrates that there are mechanisms to initiate transcription at this critical stage of lens fiber cell differentiation and raises the possibility that other genes may be similarly regulated.Hop transcripts appear in fiber cells soon after they detach from their basal lamina, the lens capsule. There is ample precedent for the activation of a new gene expression program in other types of epithelial cells after they separate from their basal laminae. For example, when keratinocytes detach from the epidermal basal lamina and move out of the germinative layer of the epidermis, they initiate a complex program of differentiation that is related to the ability of superficial keratinocytes to protect the body surface from desiccation, injury and infection [40]. Thus, Hop expression in maturing fiber cells may be regulated by signals from integrins or other matrix-binding proteins [41,42] that are altered following detachment from the capsule.Previous studies found that Hop positively and negatively modulates gene expression in the heart and lung. In heart muscle [34], Hop reduces transcriptional activation by serum response factor by recruiting histone deacetylases (HDACs) to the promoters of several heart muscle-specific genes [21,22,43]. Hop also functions prominently in the atrium and in the cardiac conduction system, where loss of Hop function results in an abnormal electrocardiogram, associated with a marked and selective reduction in the expression of connexin40 [44]. In the airway epithelium, Hop suppresses surfactant production in type II pneumocytes, again by recruiting HDACs to surfactant protein genes [45]. Hop may function in a similar manner in the lens, perhaps by regulating the expression of crystallin or connexin genes.In the heart and lung, the expression of Hop is regulated by members of the Nkx2.x and GATA families of transcription factors [21,22,45]. Of the several members of these families, none was detectable in whole, adult mouse lens fibers by microarray analysis (Vasiliev, Wang, and Beebe, unpublished). Whether these proteins are expressed at sufficient levels to contribute to Hop expression in the lens remains to be tested.Analysis of the genomic sequence upstream of the Hop coding sequence identified few potential binding sites for transcription factors considered to be key for regulating gene expression during lens fiber cell differentiation (Pax6, c-maf, L-maf, Prox1, Sox1-3, RAR/RXR) [46-49]. There is a potential Pax6 binding element 3.4 kb upstream of the translation start site. However, Pax6 levels decline sharply during fiber cell differentiation [50,51], making it unlikely that Pax6 contributes to the regulation of Hop late in fiber cell differentiation. Since Hop is the first gene known to be expressed exclusively during the latest phase of fiber cell differentiation, it is not surprising that it may not be regulated in the same manner as genes expressed early in fiber cell formation.In spite of the paucity of binding sites for these \"core\" lens fiber cell transcription factors, a CP2 binding site is located at position -2876. CP2 is a ubiquitous factor that was shown to be essential for lens-specific expression of α-crystallin in the chicken [52]. Similarly, USF1, which is expressed in lens cells and regulates the expression of the chicken and mouse αA-crystallin genes [53,54], may regulate Hop expression by binding the USF site at -2042. The HAND1/E47 E2 boxes at -559 and -2352 bind basic helix-loop-helix transcription factors and might be negatively regulated by the δ-crystallin enhancer-binding protein, δEF1, which competes for E2 sites [55]. In addition, there are two CHOP10 (C/EBP homologous protein 10) binding sites beginning at position -5184. These are of interest because CHOP10 dimerizes with other members of the C/EBP family of transcription factors to inhibit their activity. C/EBP family members can heterodimerize with ATF4 (CREB2), which is required for the differentiation of secondary lens fiber cells [56]. In a preliminary microarray study, CHOP10 transcripts were decreased tenfold in Hop knockout mice, compared to wild type (Vasiliev, Wang, and Beebe, unpublished). This raises the possibility that CHOP10 and Hop are mutual regulators of their respective genes. Since CHOP10 is most often a negative regulator of transcription, it may serve as a feedback regulator of Hop expression. The importance of these cis-binding elements in regulating Hop expression in the lens and the basis of CHOP10 regulation by Hop will have to be evaluated in future experiments.Examination of EST databases and staining with specific antibodies showed that, in addition to the cardiac and pulmonary systems, Hop is expressed in many tissues [34,57]. However, other than in the heart and lungs, no defects have been described in Hop knockout mice. We observed no obvious phenotype in the lenses of Hop null mice. Hop null lenses were clear and of normal size and their cellular morphology appeared normal. Fiber cells lacking Hop fused with their neighbors and degraded their nuclei in a manner that was morphologically indistinguishable from wild-type lenses. Although Hop does not appear to have an essential function in maturing lens fiber cells, it may be possible to use Hop regulatory sequences to target the expression of exogenous genes to fiber cells at the stage just before they fuse and degrade their nuclei.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533123.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533123",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533123\nAUTHORS: Dhanasekaran Vijaykrishna, Justin Bahl, Steven Riley, Lian Duan, Jin Xia Zhang, Honglin Chen, J. S. Malik Peiris, Gavin J. D. Smith, Yi Guan\n\nABSTRACT:\nThe highly pathogenic avian influenza (HPAI) H5N1 virus lineage has undergone extensive genetic reassortment with viruses from different sources to produce numerous H5N1 genotypes, and also developed into multiple genetically distinct sublineages in China. From there, the virus has spread to over 60 countries. The ecological success of this virus in diverse species of both poultry and wild birds with frequent introduction to humans suggests that it is a likely source of the next human pandemic. Therefore, the evolutionary and ecological characteristics of its emergence from wild birds into poultry are of considerable interest. Here, we apply the latest analytical techniques to infer the early evolutionary dynamics of H5N1 virus in the population from which it emerged (wild birds and domestic poultry). By estimating the time of most recent common ancestors of each gene segment, we show that the H5N1 prototype virus was likely introduced from wild birds into poultry as a non-reassortant low pathogenic avian influenza H5N1 virus and was not generated by reassortment in poultry. In contrast, more recent H5N1 genotypes were generated locally in aquatic poultry after the prototype virus (A/goose/Guangdong/1/96) introduction occurred, i.e., they were not a result of additional emergence from wild birds. We show that the H5N1 virus was introduced into Indonesia and Vietnam 3–6 months prior to detection of the first outbreaks in those countries. Population dynamics analyses revealed a rapid increase in the genetic diversity of A/goose/Guangdong/1/96 lineage viruses from mid-1999 to early 2000. Our results suggest that the transmission of reassortant viruses through the mixed poultry population in farms and markets in China has selected HPAI H5N1 viruses that are well adapted to multiple hosts and reduced the interspecies transmission barrier of those viruses.\n\nBODY:\nIntroductionOutbreaks of highly pathogenic avian influenza (HPAI) H5N1 virus were first recorded in Guangdong, China in 1996 [1]. Since its emergence, the A/goose/Guangdong/1/96 (Gs/GD) virus lineage has become the longest recorded HPAI virus to remain endemic in poultry [2]. The ecological success of this virus in diverse avian and mammalian species [3] with frequent introduction to humans suggests this virus is the most likely candidate of the next human pandemic [4]. Therefore, the evolutionary and ecological characteristics of its emergence from wild birds into poultry are of considerable interest.The virus gradually became endemic in poultry in different regions of China, developing into genetically and antigenically distinct sublineages [5],[6]. The geographic spread of these sublineages outside China is also unprecedented, with two sublineages spreading to Southeast Asia in late 2003, and another westwards to Central Asia, Europe, Africa, the Middle East and the Indian subcontinent in mid-2005 [1], [5]–[9]. During mid-2005, one sublineage (Fujian-like or clade 2.3.4) became dominant in China and subsequently spread to Laos, Thailand and Vietnam [2],[10].Influenza surveillance in southern China has revealed that the Gs/GD virus lineage underwent extensive genetic reassortment to generate many different reassortant viruses (or genotypes) between 1997 and 2006 [5],[6]. The non-reassortant Gs/GD-like viruses were prevalent only from 1996 to 2000 [11]. Afterwards, all H5N1 viruses detected were reassortant genotypes. Amongst all recognized reassortants, only genotypes B, X0, W, Z, G and V, were persistent for more than two years or predominant at different time points, while many genotypes were only detected occasionally [5],[6].While the genetic and antigenic evolution and geographic spread of the HPAI H5N1 panzootic viruses are well documented after the initiation of systematic surveillance in 2000 [5], little is known about the source and early evolutionary dynamics of H5N1 virus. In particular, it is still unknown whether the Gs/GD virus itself was a reassortant virus or introduced wholly from migratory waterfowl. Even though the internal gene sources for most genotypes have been identified from aquatic birds [12], the order of emergence and reassortment events that generated these genotypes remains to be answered.Recently, Dugan et al. [13] described an evolutionary dynamics of avian influenza virus (AIV) in wild bird populations. They found that the viruses exist as a large pool of functionally equivalent genes, under strong purifying selection, and reassort without overall loss of virus fitness resulting in many transient genotypes. Other studies have shown that all eight gene segments of the HPAI H5N1 viruses exhibit rapid nucleotide and amino acid substitution rates in comparison to other subtypes and that reassortment with the wild bird AIV gene pool has increased H5N1 genotype diversity, producing both persistent and transient genotypes [5],[12],[14]. However, the mechanism behind the population behavior of H5N1 viruses has still not been investigated. Here we aim to address these gaps in our knowledge of the evolutionary dynamics of HPAI H5N1 viruses through the estimation of divergence times of gene segments of major reassortants and population dynamics analyses of H5N1 viruses in poultry.ResultsStudy designIn the present study, all H5N1 influenza viruses with a hemagglutinin gene derived from A/goose/Guangdong/1/96 were designated as belonging to the “Gs/GD lineage”. The H5N1 reassortants from the Gs/GD lineage were referred to by their genotype designation, such as B, X0, Z, V, W and G, as described previously [5],[6]. Non-reassortant viruses with all eight gene segments closely related to A/goose/Guangdong/1/96 were referred to as “Gs/GD-like”.Our results are presented in four parts: 1) estimation of the time of emergence of the Gs/GD-like virus; 2) estimation of the dates of emergence of genotypes; 3) estimation of the dates of emergence of H5N1 clades; and 4) description of the evolutionary dynamics of HPAI H5N1 viruses in poultry in China. Phylogenetic analysis was conducted using relaxed clock and Bayesian skyline coalescent models [15],[16] as implemented in the BEAST software package version 1.4.7 [17].First, dates of divergence of the H5-hemagglutinin (HA) and N1-neuraminidase (NA) genes of representative Eurasian viruses were estimated. Due to the large number of Gs/GD-like H5N1 virus sequences available, a representative subset of H5N1 sequences were aligned with all publicly available avian H5-HA and N1-NA sequences. The final datasets consisted of 116 H5-HA and 89 N1-NA genes of 1,014 and 1,356 nucleotides in length, respectively, and are referred to as “Eurasian” datasets. Because the exact isolation dates of many viruses were not available, the mid-years of virus isolation were used as calibration points.For dating the emergence of the internal genes of the GsGD-like virus and of the H5N1 genotypes, we used internal gene datasets (referred to as “Asian” datasets) that included representative viruses of all identified H5N1 genotypes, plus viruses of other subtypes from poultry and wild aquatic birds. The mid-years of virus isolation were used as calibration points to estimate the time of incorporation of novel gene segments into Gs/GD-like genotypes. Because the non-structural (NS) genes of Gs/GD-like viruses (allele A) and most of its reassortants (allele B) are highly divergent [1], the time of most recent common ancestor (TMRCA) for each allele were calculated separately.To estimate the dates of emergence of different Gs/GD-like H5N1 clades, H5-HA datasets were recruited that contained representative viruses of known H5N1 variants. The final dataset consisted of the complete HA gene (1,733 nucleotides in length) of 192 viruses, and is also referred to as the “Asian” H5-HA dataset. The exact dates of sampling were known for most of these samples and were used as calibration time points. For those sequences for which exact virus isolation dates were not available, the mid-month date (either the 14th or 15th) was used as the calibration point. However, in some instances, only the date of initial detection of an H5N1 outbreak was available and this was used for calibration [18].Finally, to examine changes in genetic diversity during the evolution of the Gs/GD lineage in China, we constructed Bayesian skyline plots of the virus population described by a modified Asian H5-HA dataset [19]. This dataset consisted of HA genes of viruses isolated from chicken (n = 54), duck (n = 52), goose (n = 15), pheasant (1) and Guinea fowl (1) in China.Rates of nucleotide substitutionOur analyses showed that the mean substitution rates for the H5 and N1 datasets were 4.77×10−3 and 5.19×10−3 substitutions per site, per year (subst/site/year), respectively, which were significantly higher than the rates of the internal gene segments (1.84–2.62×10−3 subst/site/year) (Table 1). These rates are similar to those previously described for avian, human, equine and swine influenza viruses [14],[20],[21].10.1371/journal.ppat.1000161.t001Table 1Best-fit relaxed clock model and mean nucleotide substitution ratesDatasetGeneUncorrelated relaxed clock modelMean substitution rate (×10−3)Substitution rate HPD (×10−3)EurasianH5exponential4.773.88–5.74N1exponential5.194.17–6.17AsianPB2lognormal2.411.92–2.90PB1lognormal2.592.13–3.04PAexponential2.621.9–3.2NPexponential2.471.9–3.03Mexponential1.841.3–2.30NSexponential2.511.77–3.44H5exponential4.233.58–4.93N1exponential4.273.27–5.25Emergence of the Gs/GD virusAnalysis of the Eurasian H5-HA dataset revealed four distinct H5 lineages currently circulating in Eurasia: the Gs/GD lineage plus two lineages exclusively of European virus isolates (groups A and B) and one containing isolates from throughout Eurasia (group C) (Figure 1A, S1A). The time of divergence of these four lineages (node I) was Jul 1989 (95% highest posterior density Jul 1986–Jun 1992) (Figure 1A; Table 2). The TMRCA for the Gs/GD lineage (node IV) was estimated to be Jan 1994 (95% highest posterior density (HPD) Apr 1992–Nov 1995) (Figure 1A; Table 2). The TMRCAs of the remaining groups are presented in Table 2.10.1371/journal.ppat.1000161.g001Figure 1Dated phylogeny of the surface genes of H5N1 viruses isolated in Eurasia.The HA gene (A) and N1 gene (B) trees scaled to time (horizontal axis) generated using the SRD06 codon model and uncorrelated relaxed clock model. Nodes correspond to mean TMRCAs and blue horizontal bars at nodes represent the 95% HPDs of TMRCAs. Red branches indicate Gs/GD lineage H5N1 viruses. Identical phylogenetic trees with virus names are shown in Figure S1. TMRCAs and HPDs for each of the nodes marked with Roman numerals are given in Table 2.10.1371/journal.ppat.1000161.t002Table 2Estimated TMRCAs for the Eurasian H5-HA and N1-NA datasetsDatasetNode1\nDescriptionMean TMRCA (95% HPD)2\nH5 HA datasetICurrent Eurasia1989.51 (1986.52–1992.42)IIGs/GD+out-group1991.69 (1989.06–1993.83)IIIHokkaido/Singapore1994.21 (1992.19–1995.91)IVGs/GD H5N11994.04 (1992.27–1995.84)VEurope A1995.64 (1993.64–1997.06)VIEurope B1997.88 (1995.47–1999.39)VIIEurasia C1992.48 (1992.71–1993.49)N1 NA datasetICurrent Eurasia1985.83 (1980.32–1989.67)IIEurasia1989.21 (1986.30–1991.01)IIIEurasia1991.40 (1988.73–1993.94)IVEurasia1992.59 (1990.45–1994.71)VGsGD1994.81 (1993.23–1996.02)VIGsGD with 20 AA deletion1999.42 (1997.05–2001.23)VIIHK971994.08 (1990.61–1996.79)VIIIEurasia A1995.33 (1992.10–1998.08)IXEurasia B1994.03 (1992.04–1995.75)XEurasia C1996.19 (1993.68–1998.49)1Nodes indicate TMRCAs of major H5 and N1 lineages, as shown in Figures 1A, B.2The dates are presented as year followed by proportion of days.Similarly, multiple N1-NA lineages were also recognized in Eurasia (Figure 1B, S1B). The TMRCA for the Gs/GD lineage NA (node V) was estimated to be Oct 1994 (HPD Mar 1993–Jan 1996) (Figure 1B; Table 2). It was noted that the N1 gene of the HK/97-like H5N1 virus clustered along with the NA genes of H6N1 viruses from poultry (node VII), with an estimated TMRCA of Jan 1994 (HPD Aug 1990–Oct 1996) (Figure 1B; Table 2). The TMRCA for each of the internal gene segments of the Gs/GD-like viruses were estimated using the Asian datasets and ranged from Jul 1993 for the polymerase acidic (PA) gene to May 1995 for the NS gene (Figure 2 and Table 3).10.1371/journal.ppat.1000161.g002Figure 2Dated phylogeny of the internal genes of viruses isolated in Asia.The NP (A), PA (B) and PB2 (C) gene trees scaled to time (horizontal axis) generated using the SRD06 codon model and uncorrelated relaxed clock model. Nodes correspond to mean TMRCAs and blue horizontal bars at nodes represent the 95% HPDs of TMRCAs. Red branches indicate Gs/GD lineage H5N1 viruses. Identical phylogenetic trees with virus names are shown in Figure S2. TMRCAs and HPDs for each of the major H5N1 genotype internal genes are given in Table 3.10.1371/journal.ppat.1000161.t003Table 3TMRCAs of internal gene segments of H5N1 virusesGsGD (Gs/GD/1/1996)X (Dk/ST/4912/2001)B (Ck/HK/YU562/01)W (Dk/Zhejiang/52/00)Z (Ck/HK/YU22/02)V (B.bird/Hunan/1/04)G (Dk/Guangxi/13/04)PB21994.34 (1992.01–1995.95)1996.04 (1991.11–1999.75)1997.58 (1995.63–1999.39)1996.96 (1993.12–2000.19)B*\nBWPB11994.77 (1993.62–1995.71)2000.41 (1999.37–2001.26)1995.84 (1993.1–1998.27)BBBBPA1993.52 (1989.21–1996.05)1999.16 (1996.56–2000.88)1997.29 (1994.73–1999.29)BB2002.18 (2001.03–2003.06)BNP1993.67 (1990.46–1995.94)1992.29 (1988.19–1996.43)1995.32 (1991.69–1998.41)1995.08 (1992.21–1997.06)1999.94 (1998.67–2001.06)X0X0M1994.23 (1990.7–1996.36)1999.49 (1997.42–2001.08)1997.83 (1995.58–1999.7)BBBBNS1995.35 (1992.33–1997.29)1999.31 (1997.25–2001.14)1996.88 (1993.7–1999.46)BBBB*: Refers to the gene being derived from an earlier H5N1 genotype.Bayes factor (BF) tests showed no significant difference between TMRCAs of all eight gene segments of the Gs/GD viruses (Table S1). These results indicate that the common ancestor of the Gs/GD-like virus was generated, probably in wild waterfowl, approximately 2 years before it was first detected in poultry in 1996.Generation of H5N1 reassortant virusesThe TMRCAs of the internal gene segments for each major H5N1 genotype (B, X0, W, Z, G and V) were estimated using the Asian datasets from which we inferred the dates of emergence of these genotypes (Figures 2 and 3; Table 3). The mean TMRCAs for the internal genes of genotype B virus ranged from Apr 1995 to Nov 1997 (Table 3). Bayes factor tests showed that the internal genes of genotype B were incorporated from three different sources (Table S1). This suggests that the three internal gene segments of genotype B virus (polymerase basic 2 (PB2), polymerase basic 1 (PB1), polymerase acidic (PA)) were derived from the same virus (mean TMRCA range Nov 1995–Jul 1997), while the NP and NS genes (mean TMRCA range Apr 1995–Nov 1996) was from a different source (Table 3), while the M gene (mean TMRCA Nov 1997) was from an independent sources. Therefore, genotype B virus was generated from viruses of four independent sources, i.e. it contains surface genes from Gs/GD and internal genes from three other sources. The mean TMRCA of the last incorporated sources (M gene) was Nov 1997. This date represents the earliest possible time when all genotype B internal gene segments co-circulated in the poultry gene pool in China. Therefore, genotype B virus was generated after mid-1997 (Figure 3).10.1371/journal.ppat.1000161.g003Figure 3Diagram representing the emergence of major H5N1 reassortant viruses.Virus particles outlined in black represent donor viruses (with mean TMRCAs above the particle) and those outlined in red represent characterized H5N1 genotypes placed at the year of first detection. Gene segments are ordered PB2, PB1, PA, HA, NP, NA, M and NS from top to bottom within the virus particle diagram. Arrows represent possible reassortment pathways of genotype development. The start of the black arrows (filled circles) indicate the earliest possible time of corresponding genotype generation. Colored arrows represent reassortment between existing H5N1 genotypes.Both genotypes B and W appear to have emerged during the same period, i.e. after mid-1997 (Figure 3). Genotype W shares four internal gene segments (PB1, PA, M and NS) with genotype B, while its PB2 and NP segments are from two different aquatic sources (Figures 2 and S2). The TMRCAs for the PB2 and NP genes were estimated at Dec 1996 (HPD Feb 1993–Mar 2000) and Jan 1995 (HPD Mar 1992–Jan 1997), respectively, and these dates were significantly different (Tables 3 and S1). These results suggest that genotype W has been generated through a reassortment of viruses from six different sources.However, the estimated number of gene sources for genotypes B and W should be treated with caution. As the mid-year of isolation (e.g. 2000.5) was used to calibrate the internal gene datasets, the extension of confidence intervals to account for this error indicates that the three internal gene sources for genotype B may not be significantly different. The availability of the date of isolation for viruses would be needed to estimate the age of gene sources for genotypes B and W with greater confidence.Genotype X0 does not share any internal genes with genotypes B and W, and has incorporated internal genes from two different sources, i.e. the PB1, PA, M and NS genes were from one source, and while PB2 and NP genes are from another (Figures 2 and S2). For genotype X0 virus, the mean TMRCA range of the internal genes was Apr 1992 to May 2000 (Table 3). The TMRCAs of the PB1, PA, M and NS genes were not significantly different (Table S1). However, the TMRCAs of the NP and PB2 genes were significantly earlier than the other genes, but without significant difference between them, suggesting a common source. The averaged TMRCA means of the five most recent internal genes (Jul 1999) indicates that genotype X0 was generated after mid 1999 (Table 3 and Figure 3).The predominant genotype Z virus was derived from genotype B, with which it shares five internal genes (PB2, PB1, PA, M and NS). The NP gene has a common source with genotype X0 viruses. The TMRCA of the NP gene (Figure 2A) was estimated at Dec 1999 (HPD Sep 1998–Jan 2001), indicating that genotype Z emerged late 1999/early 2000 (Figure 3 and Table 3). Genotype V virus shares all internal genes with genotype Z except for the PA gene. The PA gene of genotype V viruses are most closely related to viruses isolated from the aquatic gene pool and therefore is most likely derived from an aquatic source (Figure 2B). The TMRCA for the PA gene was estimated as Mar 2002 (HPD Jan 2001–Jan 2003), suggesting genotype V was generated after early-2002 (Table 3). Genotype G viruses have five internal genes (PB2, PB1, PA, M and NS) in common with genotype W, while the NP gene groups with those from genotype Z and V viruses (Figures 2 and 3). Therefore, it was not possible to estimate the date of emergence of genotype G virus.Geographical expansion of H5N1The introduction to Indonesia occurred approximately 3–4 months before the introduction to Vietnam and Thailand (Figure 4 and Table 4). The TMRCA for viruses isolated from Vietnam, Thailand and Malaysia (clade 1, node VI) was estimated at Mar 2003 (HPD Oct 2002–Aug 2003), while the TMRCA for the Indonesia viruses (clade 2.1, node VIII) was estimated at Nov 2002 (HPD Jul 2002–Feb 2003) (Figure 4). A BF test indicated these dates were significantly different. Both of these TMRCAs are approximately 3–6 months before the first observed H5N1 outbreaks in the field in these countries.10.1371/journal.ppat.1000161.g004Figure 4Dated phylogeny of the HA gene of H5N1 viruses isolated in Asia.The tree is scaled to time (horizontal axis) and was generated using the SRD06 codon model and uncorrelated relaxed clock model. Nodes correspond to mean TMRCAs and blue horizontal bars at nodes represent the 95% HPDs of TMRCAs. TMRCAs and HPDs for each of the major H5N1 lineage are given in Table 4.10.1371/journal.ppat.1000161.t004Table 4Estimated TMRCAs for H5N1 HA cladesNodesDescriptionTMRCA (95% HPD)IGsGD1993.75 (1992.50–1994.96)IIX-series2000.70 (2000.11–2001.18)IIIClades 1, 2, 8, 92000.74 (2000.06–2001.36)IVClade 12001.16 (2000.57–2001.66)VVietnam, Thailand, Malaysia (VTM)+precursor2000.74 (2000.06–2001.36)VIVTM2003.22 (2002.80–2003.62)VIIIndonesia+precursor2002.52 (2002.09–2002.84)VIIIClade 2.1 (Indonesia)2002.87 (2002.58–2003.12)IXClade 2.2 (Qinghai lineage)2004.93 (2004.59–2005.14)XClade 2.32002.64 (2002.06–2003.16)XIClades 2.3.1, 2.3.22002.88 (2002.39–2003.29)XIIClades 2.3.3, 2.3.42003.91 (2003.11–2004.70)XIIIClade 2.3.4 (Fujian-like)2004.68 (2004.17–2005.09)The TMRCA of the Qinghai-like HA variant (clade 2.2, node IX) was estimated as Dec 2004 (HPD Aug 2004–Feb 2005), while the Fujian-like HA TMRCA (clade 2.3.4, node XIII) was estimated as Sep 2004 (Mar 2004–Feb 2005) (Figure 4). These TMRCAs were not significantly different (Table S1), indicating that these two variants arose during the same period.Estimation of genetic diversity and selection pressureCoalescent reconstruction using a HA-H5 dataset of poultry isolated in China revealed a rapid increase in the relative genetic diversity of Gs/GD lineage viruses from mid-1999 to 2000 (Figure 5A). It was during this period, preceding the current epizootic, that each of the major HA lineages were generated and subsequently became widespread in poultry throughout China (Figure 5B).10.1371/journal.ppat.1000161.g005Figure 5Population dynamics of genetic diversity of H5N1 viruses isolated from poultry in China.Bayesian skyline plot of the HA gene (A) showing changes in genetic diversity of H5N1 viruses. A measure of genetic diversity is given on the y-axis with the 95% HPD shown in blue. The red dashed line indicates the mean TMRCA of the Gs/GD lineage; the blue dashed line represents the time of the first detected H5N1 outbreak China. HA gene tree (B) scaled to time (horizontal axis) generated using the SRD06 codon model and uncorrelated relaxed clock model. Nodes correspond to mean TMRCAs and blue horizontal bars at nodes represent the 95% HPDs of TMRCAs. Numbers to the right of the HA tree indicate H5N1 clades based on the World Health Organization nomenclature system [36]. An identical phylogenetic tree with virus names is shown in Figure S3. The red vertical bar in both panels indicates the period of divergence of major H5N1 lineages in poultry.Analysis of selection pressures show that the HA of all the major H5N1 sublineages (or clades) were subject to strong purifying selection (mean ratio of rates of nonsynonymous to synonymous substitutions per site, d\nN/d\nS = 0.272). However, four amino acid sites (positions 138, 140, 141 and 156) were under positive selection (P<0.05), consistent with previous results for AIV [14],[22],[23].DiscussionWe used extensive sequence data and relaxed clock models to date each of the eight gene segments of the Gs/GD-like H5N1 virus. Previously, phylogenetic analyses have shown that the gene segments of Gs/GD-like viruses were most closely related to those viruses from migratory birds [12]. However, the time of introduction into poultry was not established. We have shown that the prototype virus was likely introduced into poultry as a non-reassortant low pathogenic avian influenza H5N1 virus, rather than being generated by reassortment within poultry. We have also shown that the reassortment events that generated these H5N1 genotypes occurred locally in domestic duck after the Gs/GD-like virus introduction (Figure 3).Our data help provide insights into the sequence of events that led to each of the three H5N1 transmission waves. Previously, the earliest records of H5N1 wave 1 outbreaks in Vietnam and Indonesia were August and October 2003, respectively [22]. However, estimation of the TMRCAs of these two lineages indicates that H5N1 virus introduction to Indonesia occurred approximately 3–4 months before the introduction to Vietnam. Furthermore, both of these estimated dates of introduction are approximately 3–6 months before the first observed H5N1 outbreaks in these countries. This may represent the time for disease development and under reporting once outbreaks occurred. In contrast, the TMRCAs of the wave 2 and 3 H5N1 viruses indicated that these HA variants arose during the same period in late 2004.Analysis of virus population dynamics revealed a rapid increase in the genetic diversity of Gs/GD lineage in poultry in China from mid-1999 to early 2000. This corresponds with the period when each of the major Gs/GD-like H5N1 variants or sublineages diverged and subsequently became widespread in poultry throughout China [6]. It is likely that combined strong ecological and evolutionary factors led to this rapid increase in diversity, namely, the spread of the virus through large, immunologically naive poultry populations consisting of diverse species coupled with relatively high rates of nucleotide substitution and selection pressure in the HA. Interestingly, the first detection of current H5N1 reassortants occurred in early 2000, some time after the 1997 Hong Kong ‘Bird Flu’ outbreak in poultry occurred [11]. This leads us to hypothesize that these reassortant viruses, particularly genotypes B, X0, W and Z, were also generated during this period. This hypothesis is supported by our field data in which different H5N1 genotype viruses have been isolated from the same market on the same sampling occasion [24],[25].We also explored a possible mechanism to explain the population behavior of this virus, particularly the generation and maintenance of multiple H5N1 reassortants. The frequent reassortment of the polymerase complex (PB2, PB1, PA and NP) and matrix genes observed in H5N1 viruses indicates that the fitness landscape is similar to that observed for AIV in their natural gene pools, wherein little or no change in fitness is associated with frequent reassortment of functionally equivalent gene segments [5],[6],[13]. The presence of most of these internal genes in domestic duck before their detection in H5N1 genotypes suggests that reassortment occurred in these hosts [11].We propose a specific mechanism to explain observed patterns of genetic drift and reassortment in H5N1. First, AIV (of different subtypes) from the natural gene pool in wild birds are introduced into domestic duck. In domestic duck, these viruses undergo regular reassortment with endemic H5N1 viruses. Subsequently, transmission of these reassortant viruses within large highly connected populations of duck and other poultry species results in frequent interspecies transmission and genetic drift. Therefore, it is likely that this process selects for relatively fit viruses with a broad host range which are subsequently exported to other geographical regions. It is interesting to note that further reassortment has not been observed once those H5N1 viruses were transmitted out of China. We suggest that host population structures elsewhere may not result in the same intense multi-species transmission we observe in southern China.MethodsVirus and viral sequence dataWe sequenced the full genome of 31 low pathogenic avian influenza H5 viruses plus 135 HPAI H5N1 viruses isolated from our surveillance program in southern China or otherwise available in our repository (GenBank accession numbers CY028924–CY029507, CY030878–CY031006, EF597247–EF597498). A further 114 partial gene sequences from 29 H5N1 and other subtype viruses isolated from 2000–2005 were also resequenced to provide full-length genomes. These sequences were analyzed together with all publicly available sequence data, including genes from 93 H6 and 279 H9 viruses that were also recently sequenced in our laboratories. Viral genome sequencing was conducted as previously described [2],[24].Phylogenetic reconstruction and Bayesian skyline plotsTo estimate the times of divergence, a total of nine full-length datasets were analyzed: two Eurasian datasets for the H5-HA and N1-NA, and seven Asian datasets for each of the influenza gene segments, except the NA gene. To examine changes in genetic diversity during the evolution of the Gs/GD lineage, we constructed Bayesian skyline plots using a modified Asian HA dataset. This modified dataset consisted of only HA genes of viruses isolated from chicken (n = 54), duck (n = 52), goose (n = 15), pheasant (1) and Guinea fowl (1) in China.To estimate the rates of nucleotide substitution and TMRCAs, we used a Bayesian Markov chain Monte Carlo (MCMC) method as implemented in the program BEAST v1.4.7 [17],[26]. Each gene was analyzed with the codon based SRD06 nucleotide substitution model [27]. For each analysis the Bayesian skyline coalescent model was used [16]. Three clock models were compared statistically for each dataset using a Bayes factor test in Tracer v1.4 [28],[29]: the strict clock that assumes a single evolutionary rate along all branches, and the uncorrelated lognormal relaxed (UCLD) clock and uncorrelated exponential relaxed (UCED) clock that allow evolutionary rates to vary along branches within lognormal and exponential distributions, respectively [15]. A Bayes factor test of clock models showed that the UCED clock was most appropriate for datasets other than PB2 and PB1, for which the UCLD clock most appropriately described the data. For each dataset, three to five independent Bayesian MCMC runs were conducted for 10–20 million generations sampled to produce 10,000 trees. Convergence of the runs was confirmed using Tracer v1.4 [29] and effective sample size values of >500 indicated a sufficient level of sampling. The results of the multiple runs were then combined using LogCombiner v1.4.7 [17]. Mean evolutionary rates and divergence times were calculated using TreeAnnotator v1.4.7 and TreeStat v1.1 after the removal of an appropriate burnin, 10–20% in most cases, and phylogenetic trees were visualized with FigTree v1.1.2 [17],[30],[31].Finally, to evaluate if the TMRCAs of each of the gene segments of a given genotype were significantly different or not, the TMRCA of each gene segment was compared to the remaining genes of the genotype using a Bayes factor test [28]. This test was calculated in as follows; given a genotype, the probability of any gene (e.g. PB2) being older than any other segment (e.g. PB1) divided by the probability of PB1 being older than PB2 given the data (tree estimates of TMRCA) multiplied by the inverse estimation for the priors (PB1 being older than PB2 divided by PB2 being older that PB1 of the priors) was calculated for each Bayesian MCMC run [19].Detection of selection pressureTo determine selection pressures on the HA of Gs/GD-like H5N1 viruses in poultry the modified Asian H5-HA dataset was analyzed using the single-likelihood ancestor counting (SLAC) [32] and genetic algorithm (GA) methods [33] available in DataMonkey [34] and HYPHY [35]. The SLAC method calculates global and site-specific nonsynonymous (d\nN) and synonymous (d\nS) nucleotide substitution rate ratios (ω = d\nN\n/d\nS) based on the BEAST generated phylogenetic tree and the best-fit nucleotide substitution model. The GA method assigns four ω classes to each lineage in search of the model of lineage-specific evolution that best fits the data [33]. The probability (≥95%) of ω being >1 along a specific lineage was calculated from the averaged model probability of all models rather than by inference from the single best-fitting model [33]. This approach does not require any a priori hypothesis of lineage-specific evolution.Supporting InformationFigure S1The HA gene (A) and N1 gene (B) trees scaled to time (horizontal axis) generated using the SRD06 codon model and uncorrelated relaxed clock model. Nodes correspond to mean TMRCAs and blue horizontal bars at nodes represent the 95% HPDs of TMRCAs. Red branches indicate Gs/GD lineage H5N1 viruses.(1.33 MB PDF)Click here for additional data file.Figure S2The PB2 (A), PB1 (B), PA (C), NP (D), M (E) and NS (F) gene trees scaled to time (horizontal axis) generated using the SRD06 codon model and uncorrelated relaxed clock model. Nodes correspond to mean TMRCAs and blue horizontal bars at nodes represent the 95% HPDs of TMRCAs. Red branches indicate Gs/GD lineage H5N1 viruses.(1.65 MB PDF)Click here for additional data file.Figure S3HA gene tree of H5N1 viruses isolated from poultry in China, scaled to time (horizontal axis) generated using the SRD06 codon model and uncorrelated relaxed clock model. Nodes correspond to mean TMRCAs and blue horizontal bars at nodes represent the 95% HPDs of TMRCAs.(0.43 MB PDF)Click here for additional data file.Table S1(0.07 MB PDF)Click here for additional data file.\n\nREFERENCES:\n1. XuXSubbaraoKCoxNJGuoY\n1999\nGenetic characterization of the pathogenic influenza A/Goose/Guangdong/1/96 (H5N1) virus: similarity of its hemagglutinin gene to those of H5N1 viruses from the 1997 outbreaks in Hong Kong.\nVirology\n261\n15\n19\n10484749\n2. SmithGJDFanXHWangJLiKSQinK\n2006\nEmergence and predominance of an H5N1 influenza variant in China.\nProc Natl Acad Sci U S A\n103\n16936\n16941\n17075062\n3. ThiryEZicolaDAddieHEgberinkKHartmannH\n2007\nHighly pathogenic avian influenza in cats and other carnivores.\nVet Microbiol\n122\n25\n31\n17250978\n4. World Health Organization\n2008\nCumulative number of confirmed human cases of Avian Influenza A (H5N1) reported to WHO (WHO, Geneva).\nAvailable: http://www.who.int/csr/disease/avian_influenza/country/en/. Accessed 11 August 2008\n5. LiKSGuanYWangJSmithGJDXuKM\n2004\nGenesis of a highly pathogenic and potentially pandemic H5N1 influenza virus in eastern Asia.\nNature\n430\n209\n213\n15241415\n6. ChenHSmithGJDLiKSWangJFanXH\n2006\nEstablishment of multiple sublineages of H5N1 influenza virus in Asia: Implications for pandemic control.\nProc Natl Acad Sci U S A\n103\n2845\n2850\n16473931\n7. ChenHSmithGJDZhangSYQinKWangJ\n2005\nH5N1 virus outbreak in migratory waterfowl.\nNature\n436\n191\n192\n16007072\n8. BragstadKJørgensenPHHandbergKHammerASKabellS\n2007\nFirst introduction of highly pathogenic H5N1 avian influenza A viruses in wild and domestic birds in Denmark, Northern Europe.\nVirol J\n4\n43\n17498292\n9. DucatezMFOlingerCMOwoadeAADeLandtsheerSAmmerlaanW\n2006\nIntroductions of H5N1 in Nigeria.\nNature\n442\n37\n16823443\n10. NguyenTDNguyenTVVijaykrishnaDGuanYPeirisJSM\n2008\nMultiple lineages of influenza A (H5N1) viruses in Vietnam (2006–2007).\nEmerg Infect Dis\n14\n632\n636\n18394281\n11. GuanYPeirisJSMKongKFDyrtingKCEllisTM\n2002\nH5N1 influenza viruses isolated from geese in Southeastern China: evidence for genetic reassortment and interspecies transmission to ducks.\nVirology\n292\n16\n23\n11878904\n12. DuanLCampitelliLFanXHLeungYHCVijaykrishnaD\n2007\nCharacterization of low pathogenic H5 subtype influenza viruses from Eurasia: Implications for the origin of highly pathogenic H5N1 viruses.\nJ Virol\n81\n7529\n7539\n17507485\n13. DuganVGChenRSpiroDJSengamalayNZaborskyJ\n2008\nThe evolutionary genetics and emergence of avian influenza viruses in wild birds.\nPLoS Pathog\n4\ne1000076\ndoi:10.1371/journal.ppat.1000076\n18516303\n14. ChenRHolmesEC\n2006\nAvian Influenza exhibits rapid evolutionary dynamics.\nMol Biol Evol\n23\n2336\n2341\n16945980\n15. DrummondAJHoSYWPhillipsMJRambautA\n2006\nRelaxed phylogenetics and dating with confidence.\nPLoS Biol\n4\ne88\ndoi:10.1371/journal.pbio.0040088\n16683862\n16. DrummondAJRambautAShapiroBPybusOG\n2005\nBayesian coalescent inference of past population dynamics from molecular sequences.\nMol Biol Evol\n22\n1185\n1192\n15703244\n17. DrummondAJRambautA\n2007\nBEAST: Bayesian evolutionary analysis by sampling trees.\nBMC Evol Biol\n7\n214\n17996036\n18. Food and Agriculture Organization\n2008\nAvian influenza disease emergency news.\nAvailable: http://www.fao.org/avianflu/en/AIDEnews.html. Accessed 11 August 2008\n19. RambautAPybusOGNelsonMIViboudCTaubenbergerJK\n2008\nThe genomic and epidemiological dynamics of human influenza A virus.\nNature\n453\n615\n619\n18418375\n20. FitchWMBushRMBenderCACoxNJ\n1997\nLong term trends in the evolution of H(3) HA1 human influenza type A.\nProc Natl Acad Sci U S A\n94\n7712\n7718\n9223253\n21. LindstromSEndoASugitaSPecoraroMHiromotoY\n1998\nPhylogenetic analyses of the matrix and non-structural genes of equine influenza viruses.\nArch Virol\n143\n1585\n1598\n9739336\n22. SmithGJDNaiposposTSPNguyenTDde JongMDVijaykrishnaD\n2006\nEvolution and adaptation of H5N1 influenza virus in avian and human hosts in Indonesia and Vietnam.\nVirology\n350\n258\n268\n16713612\n23. ObenauerJCDensonJMehtaPKSuXMukatiraS\n2006\nLarge-scale sequence analysis of avian influenza isolates.\nScience\n311\n1576\n1580\n16439620\n24. GuanYPeirisJSMLipatovASEllisTMDyrtingKC\n2002\nEmergence of multiple genotypes of H5N1 avian influenza viruses in Hong Kong SAR.\nProc Natl Acad Sci U S A\n99\n8950\n8955\n12077307\n25. GuanYPoonLLMCheungCYEllisTMLimW\n2004\nH5N1 influenza: a protean pandemic threat.\nProc Natl Acad Sci U S A\n101\n8156\n8161\n15148370\n26. DrummondAJNichollsGKRodrigoAGSolomonW\n2002\nEstimating mutation parameters, population history and genealogy simultaneously from temporally spaced sequence data.\nGenetics\n161\n1307\n1320\n12136032\n27. ShapiroBRambautADrummondAJ\n2006\nChoosing appropriate substitution models for the phylogenetic analysis of protein-coding sequences.\nMol Biol Evol\n23\n7\n9\n16177232\n28. SuchardMAWeissRESinsheimerJS\n2001\nBayesian selection of continuous-time Markov chain evolutionary models.\nMol Biol Evol\n18\n1001\n1013\n11371589\n29. RambautADrummondAJ\n2007\nTracer v1.4: MCMC trace analyses tool.\nAvailable: http://beast.bio.ed.ac.uk/Tracer. Accessed 20 June 2008\n30. RambautADrummondAJ\n2007\nTreeStat v1.1: Tree statistic calculation tool.\nAvailable: http://tree.bio.ed.ac.uk/software/treestat/. Accessed 20 June 2008\n31. RambautA\n2008\nFigTree v1.1.1: Tree figure drawing tool.\nAvailable: http://tree.bio.ed.ac.uk/software/figtree/. Accessed 20 June 2008\n32. Kosakovsky PondSLFrostSDW\n2005\nNot so different after all: a comparison of methods for detecting amino acid sites under selection.\nMol Biol Evol\n22\n1208\n1222\n15703242\n33. Kosakovsky PondSLFrostSDW\n2005\nA genetic algorithm approach to detecting lineage-specific variation in selection pressure.\nMol Biol Evol\n22\n478\n485\n15509724\n34. Kosakovsky PondSLFrostSDW\n2005\nDatamonkey: rapid detection of selective pressure on individual sites of codon alignments.\nBioinformatics\n21\n2531\n2533\n15713735\n35. Kosakovsky PondSLFrostSDWMuseSV\n2005\nHyPhy: hypothesis testing using phylogenies.\nBioinformatics\n21\n676\n679\n15509596\n36. WHO/OIE/FAO H5N1 Evolution Working Group\n2008\nTowards a unified nomenclature system for the highly pathogenic avian influenza virus (H5N1).\nEmerg Infec Dis\n14\ne1\ndoi:10.3201/eid1407.071681"
+}

batch_2/PMC2533294.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533294",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533294\nAUTHORS: Beverley Lucas, Neil Small, Peter Greasley, Andrew Daley\n\nABSTRACT:\nBackgroundWithin the United Kingdom, a developing role for primary care services in cancer and palliative care has resulted in an increase in palliative home care teams. The provision of professional care in the home setting seeks to provide necessary services and enhanced choice for patients whose preference is to die at home.A mismatch between patient preference for home death and the actual number of people who died at home was identified within Bradford, the locality of this study. In response to this mismatch, and reflecting the policy environment of wishing to enhance community service provision, the four Primary Care Trusts (PCTs) in the city sought to offer support to patients who wished to remain in their own homes through the final stages of a terminal illness. To offer this support they set up a dedicated hospice at home team. This would provide services and support for patients in achieving a dignified, symptom free and peaceful death, allowing families to maximise time spent together. The aim of the study was to evaluate the Bradford hospice at home service from the perspective of carers, nurses and General Practitioners.MethodsPostal questionnaires were sent to carers (n = 289), district nurses (n = 508) and GP's (n = 444) using Bradford's hospice at home service. Resulting quantitative data was analysed using the Statical Package for Social Sciences (SPSS) and qualitative data was analysed using grounded theory techniques.ResultsThe data from carers, district nurses and GPs provide general support for the Bradford hospice at home service. Carers valued highly the opportunity to 'fulfil a promise' to the individual who wished to be cared for at home. District nurses and GPs cited the positive impact of access to specialist expertise. This was a 'reassuring presence' for primary healthcare teams and offered 'relief of carer anxiety' by providing prompt, accessible and sensitive care.ConclusionCarers and health professionals welcomed the increased possibility of patients being cared for at home. The study identified the need to focus on improving skill levels of staff and on ensuring continuity of care.\n\nBODY:\nBackgroundThe provision of professional care in the home setting has become an integral component of healthcare delivery in most western countries [1]. This mode of care is evident in UK palliative care and is consistent with an emphasis on the pivotal role of primary care services in cancer and palliative care [2], enhanced support for family carers [3] and a commitment to honour more patient choice [4]. The White Paper Our health, our care, our say [5] commits the National Health Service (NHS) to a shift in focus to provide integrated health and social care services in local communities, closer to people's homes.There is an established body of evidence which identifies dying at home as the preferred choice of both the general public and primary healthcare professionals [6-9], although there is also a recognition that preferences may change during the course of an illness [10]. However, the patient's preferred place of death is not always achieved [11] and thus there is a failure to fulfil this aspect of people's end-of-life care wishes [12].In recent years there has been an increase in the numbers of palliative home care teams and, in consequence, enhanced choice for some patients who wish to remain at home [13-15]. The effectiveness of home care interventions have been considered in a number of studies, each with different emphases.• A review of UK palliative care literature identified some evidence of efficacy of home care when considered from the patient point of view [16].• District nurses' working alongside hospice at home teams reported a favourable impact in enabling patients with advanced progressive disease to be cared for at home [15].• Exley and Tyrer [17] found, in the main, positive responses from bereaved carers commenting on the end of life care from a hospice at home service.• King et al [18] focused on a rapid-response service and assembled views from service providers and carers, again finding high levels of satisfaction.• Grady and Travers [19] reported high levels of satisfaction with the rapid response service they evaluated as well as significant improvement in some areas of pain and symptom management.• Grande et al [20] evaluated the impact on place of death of a hospital at home service. Their randomised controlled trial could not show that hospital at home allowed more patients to die at home (neither did the study refute this).Local contextAn internally circulated local audit, undertaken in Bradford in 2000, identified a mismatch between patient preference for dying at home and actual place of death. Seventy percent of patients with cancer indicated that they would like to die at home whilst only 23% did so. Issues identified by patients and health professionals to explain this disparity included: a) carer fatigue, b) difficulties in providing nursing care within the home setting, c) lack of appropriate staff skills in palliative support, d) problems in ensuring continuity of care, e) lack of team-working between agencies, and f) overall lack of availability of staff. Since the 2000 audit the specialist palliative care services in Bradford and Airedale have recorded patients' preferences, identified how many achieved their choice and sought to clarify reasons why an expressed preference was not met [21].In July 2001 a hospice at home service began in the city. (For details of the service see Fig 1). The service proposal that formed the basis for obtaining financial support both from the government's New Opportunities Fund and from Marie Curie Cancer Care included a commitment to seek a dignified symptom free and peaceful death, whilst allowing families to maximise time spent together.Figure 1Description of the service at the outset of this study (2001).We report results of an independent evaluation of Bradford hospice at home Service, addressing the following key questions:• What were carers' perceptions of the value of the service?• How did district nurses evaluate the contribution of the hospice at home team?• How did GPs perceive the value of the support provided by the hospice at home team in facilitating patient choice to die at home?MethodsProcess evaluation [22] offers an opportunity for evaluators to give information and assistance to service providers through feedback [23]. It is an approach that views relationships with practitioners as a priority [22]. Throughout this study the independent evaluators engaged with stakeholders to examine how the development of the hospice at home service impacted on care provision. The identification of areas of strength and issues for consideration informed service development so that the service would get nearer what was seen to be best practice by stakeholders.The identified caregiver, district nurse and GP involved in the care of all patients referred to the service were eligible for inclusion in this study. Data was collected from the inception of the service in July 2001 to June 2006. The criteria for referral of patients to this City wide service met the Bradford District Continuing Care Criteria (2001) and the West Yorkshire Continuing Care Criteria (2002) at Level 6 (Continuing Care Funding).A questionnaire, generated by the service delivery team and used within practice as part of clinical audit, was considered by the hospice at home steering group for inclusion in this evaluation. The questionnaire was proving to be acceptable to service providers and to carers. There appeared to be a satisfactory level of completion and an absence of critical comments about either the included content or about any omissions. The steering group decided that given that this tool worked in practice this should be considered as having constituted, in effect, an appropriate pilot for the evaluation study re the appropriateness and acceptability of the questionnaire. When the questionnaire was presented for ethical approval there were no revisions required. However the Ethics Committee did require additional safeguards to be added for the carer, specifically in the form of an informed consent form and a letter offering support for bereaved caregivers if required.Exclusion criteria for this study were:• When patients/carers changed their decision about taking up referrals resulting in no hospice at home input, e.g. they remained in hospital• Patient had no identified carer (e.g. lived on their own)• Patient transferred to alternative services, e.g. Marie Curie Service, nursing home or hospitalOf these three exclusion criteria, patient transfer appeared to be the most significant, followed by patient/carer changes of decision and the balance could be attributed to patients with no identified carer. However clinicians had not always recorded the criteria for exclusion and consequently this breakdown must be considered as an indicative rather than definitive finding.Seven weeks after the death of a patient each identified main caregiver received a letter and informed consent form. If individual consent was given twelve weeks after the patients death they received a 15 item postal questionnaire. This sought carers' perceptions of:* Quality of nursing* Medical support* Sense of dignity and respect* Satisfaction with responsiveness of the hospice at home service* Carer participation in the care package and emotional support.* Place of deathThe questionnaire included an invitation to add comments on any aspect of the health and social care services.Following the death of a patient referred to the service and eligible for this study, a 12 item postal questionnaire was sent to the district nurse responsible for the care of the individual concerned. Questions were on the following themes:* Setting up of care packages* Shared approaches to care* Communication with the hospice at home team* Support offered to carers.GP's of every eligible hospice at home patient who had died were sent a 3 item questionnaire to comment on perceptions of:* Extent of patient and carer support* Awareness of any patient or carer anxieties that were not addressed* Management of death within the patients' home.Data analysisBoth quantitative and qualitative data were obtained from the questionnaires. The quantitative data were analysed using Statistical Package for Social Sciences (SPSS) frequency analysis.The qualitative comments were typed verbatim and, given the modest allocation of space within the questionnaire for general comments, one aspect that surprised the team was the richness of free text feedback. In some examples, carers had appended extra typescript or hand written pages and others provided copious handwritten response both in the limited space allowed on the questionnaire and in the questionnaire margins. Many respondents clearly felt a need to expand on their experiences in areas not covered enough for them by the straightforward options of the questionnaire itself. There are many analytic procedures that can be used for qualitative data and this study adopted open and axial coding and memo-writing techniques drawn from the principles of grounded theory [24,25] to assist category generation. In practice, this necessitated the process of breaking down, examining and labelling data, then making connections between a category and sub-categories. To keep track of this process, written records of analysis were documented including summarising memos. Despite the laborious and time consuming implications of the decision to use this procedure this was considered worthwhile by the team because it would allow for the development of emergent rather than imposed categories from the data. This was necessary because this rich free text material suggested that issues were being engaged with and views expressed that moved beyond the pre-determined categories of the questionnaire. The team felt that this approach would also provide material to explore aspects of the data not used in this evaluation in subsequent papers, perhaps concentrating on specific understandings as to the nature of the care experience. Deciding upon open and axial coding and memo-writing also allowed us to generate in vivo codes that consisted of words and phrases used by participants themselves. These words and phrases included vivid imagery [26] such as 'fulfilling a promise' and 'reassuring presence' which we have used as key concepts in what follows.The decision to use grounded theory techniques for data analysis within this study (rather than adoption of the grounded theory approach) links with a more general debate about technique versus method within grounded theory and with the importance of not claiming more in the terminology describing the procedures used than was actually carried out in practice [27]. These data analysis techniques are only one aspect of grounded theory and it was not the intention of the team to utilise a grounded theory approach (e.g. there was no theoretical sampling to saturation). Full application of grounded theory is unlikely to be used in small-scale evaluation, but the basic process of ordering codes into categories which are empirically related in the data as well as theoretical justified can be applied [22]. Codes were also independently analysed to examine fit.Ethical approvalResearch governance approval was obtained from the Research and Development Unit Bradford South and West Primary Care Trust and ethical approval from Bradford Research Ethics Committee.ResultsCarer QuestionnaireDuring this study 1023 patients were referred to the hospice at home service. After applying the study exclusion criteria 453 carers were excluded. Of the 570 eligible for the study 289 (50.7%) of bereaved carers returned questionnaires.Summary of results from yes or no questions in questionnaire to Carers: See Table 1Table 1Summary of results from yes or no questions in questionnaire to CarersYesNoTotalQuestionN%N%Q2. Could you have done with more nursing help?572023080287Q3. Did you feel that the nurses knew enough about X condition and how to care for him/her?26292238285Q5: Do you recall any difficulties the nurses experienced in obtaining medical support or medication for X?511823182282Q6. Were agency staff used to support the care package?211766524276Q7: Did the doctor from the Out of Hours Deputising Service visit at any time?1374914351280Q11. Did you have any difficulties contacting the Hospice at home Team?21726593286Q13. Did X die at home?250873913289In this article, we will focus on three key themes identified in carer data; quality of nursing care, medical support and, place of death.1) Quality of the nursing careThe first question to carers asked them to rate how they felt about the quality of nursing care in the last days of life on the following scale: 'very poor', 'poor', 'fair', 'good', 'very good'. Virtually all carers were positive about the quality of nursing care: 97% (n = 277) rated this as 'very good' (77%), or 'good (20%). Five carers rated it as 'very poor' or 'poor'.The majority of carers 92% (n = 262) agreed that the nurses knew enough about the patients condition and how to care for him/her. Whilst carers were not asked to provide qualitative comments, a small number (3) wrote on the questionnaire about 'nurses helpfulness, understanding and patience'. However, 8% (n = 23) did not agree and free text comments (from 20) identified lack of 'understanding of condition' and lack of 'continuity of care'. As one carer commented:It would have been more helpful to (patient) if more of the nurses had understood and known more about lymphodema and been able to help him with exercises and putting stockings on etc. [Comment number 111]Problems identified relating to the continuity of care included this comment:Continuity would have helped ..at first (they) did know how to move him without hurting him and what he needed. Some who didn't know him didn't understand the condition and what was happening therefore were not so careful with movement, etc. Also everything had to be explained every time. [Comment number 111]Whilst 80% (n = 230) of carers felt that there was sufficient nursing help, 20% (n = 57) would have liked more. Qualitative comments (from 47) highlighted a belief that additional practical help with difficulties associated with patient immobility would have been welcome both in the form of more people being available, extra 'pairs of hands', and visits being more frequent :Let me say initially that this service was a Godsend to me. Certain times when it was necessary to move (patient) more help would have been appreciated. [Comment number 304]One particular problem relating to the quality of nursing care that was highlighted by carers was the use of agency staff. Seventy six per cent of carers (n = 211) identified that agency staff were used to support care delivery. There were a number of qualitative comments on this aspect of care (107) and a limited number of these (39) identified positive aspects of agency staff support such as 'friendly', 'good help in a trying situation'. In two cases agency staff was rated as 'excellent':Agency staff were very caring and helped all they could to make X comfortable at home. [Comment number 279]The majority of comments (68), however, were critical, commenting on a resulting 'variability' of care, including a perceived 'lack of confidence' in some agency staff abilities and in some cases 'lack of availability' of care staff.All the time it was 24/7 – hardly ever the same staff -some were good – some not. I only had one agency girl who I wasn't keen with. She had the TV on all night, no ID. No uniform etc. I asked just for hospice girls. [Comment number 81]Three were very poor, one bitched about her work saying she was packing it in. One wouldn't sit with [patient] and her husband came early for her (12.45 pm Sat) but claimed time till 1.00 am. One night sitter lectured me on God saying it was his will that [patient] should suffer.' [Comment number 89]Three times they did not turn up. Once she rang in sick and we were told, but twice they just did not appear and one was on the night she died. [Comment number 122]We will consider service attempts to address these serious problems with agency staff below. These attempts underline the process nature of this evaluation in that reported observations from the evaluation contributed to a realisation of the imperative to implement service changes.2) Medical SupportThe majority of carers, eighty two percent (n = 231), reported no difficulties in obtaining medical support. The eighteen percent (n = 51) who experienced difficulties were invited to provide additional comments. There were 39 of these and they identified, most typically, 'lack of medical support' and 'lack of availability of drugs within the locality'.The doctor on duty refused to visit or issue prescription, our son was in agony from 10 pm until 6.0.am. This was disgusting, unprofessional and cruel and was only slightly relieved by the care and concern shown by the nurses. [Comment number 104]Insufficient morphine at chemists even though they confirmed enough by phone. [Comment number 100]As with agency staff we will see below how observations such as these were acted upon prompting changes in service during the periods of this evaluation.Forty nine per cent (n = 137) of carers had accessed medical support from the Out of Hours Deputising Service. In terms of frequency of access, the majority, 77% (n = 96), on one (n = 51) or two occasions (n = 45). Thirteen percent (n = 16) had three visits and four percent had either four visits (n = 5) or five (n = 5). There were two carers who had accessed the service on six and eight occasions respectively. Most people did not see the same deputising service doctor twice. There were a number of qualitative comments (36) that identified positive comments in relation to 'efficient caring service' and in the following example support under difficult circumstances:All doctors were extremely supportive and worked hard to achieve the level of care in very difficult circumstances – [Patient] symptoms were very hard to treat. [Comment number 286]Other responses (54) identified variability including perceptions of 'unacceptable delay in visits' and communication difficulties:Before Mum was admitted to hospital we called the doctor which was Out of Hour's service – the call was 12.30. The doctor arrived at the following 9.30 – called ambulance – hospital 10.30. Not very happy with service (own doctors called on Mum every other day and were great). [Comment number 176]Our own doctor visited when (patient) came home – this was during normal times. But through some lack of communication eight or nine hours elapsed before a doctor came to certify my husband's death. [Comment number 129]District Nurse QuestionnaireDistrict Nurses returned 508 (89%) of questionnaires (no reminder questionnaires were sent).In 95% (n = 463) of cases the district nurses identified that there had been a shared approach to care with the hospice at home team. Table 2 provides more detail of this relationship in practice. (Not all returned questionnaires were fully completed). There is evidence here that this shared approach is manifest in planning services and in the collaboration that continues throughout the delivery of care. But the provision of such care remains a source of considerable strain on the District Nurses, 38% (n 157) reported \"undue strain\" in supporting the patient to die at home.Table 2Summary of results from questionnaire to District NursesYesNoTotalQuestionN%N%Setting up the PackageQ1. Did you set up the initial package of care?2965821242508Q2. Were the hospice at home team involved in the initial planning of care?399828618485Q3. Did hospice at home Team change input of care package?2224526755489Shared approach to care/CommunicationQ4. Do you feel that you contributed to the design of care?48697173503Q5. Evidence of a shared approach?46395265489Q6. Were you kept updated by hospice at home?436904710483Q7. Was the care package delivered as you understood it would be?45393357488Levels of supportQ9. Was your perception that the family coped well with the level of support offered?413885712470Q11. Could you have supported the patient to die at home without hospice at home?1022333377435Impact on district nurse workloadQ12. Did supporting the patient at home cause undue strain on the District Nurse team?1573825362410Place of deathQ10. Death at home?404866714471Was the place of death the appropriate one?45097143464Summary of results from questionnaire to District Nurses: See Table 2A small number of comments reported the burden on caregivers, where 24 hour cover was problematic and carers were struggling to cope with meeting the patient's wishes.[Patient] had needs during the night when the family found it most difficult to cope and on several consecutive occasions sitters did not attend. [Comment number 203]It soon became apparent that family could not cope. [Comment number 237]The family found the whole situation physically and mentally difficult. [Comment number 243]Not a reflection of the support offered, but the carer would not have coped as she didn't really want her husband to stay at home but was trying to respect his wishes. [Comment number 371]There were many comments added to the questionnaire thanking the hospice at home team for 'good work', 'expertise' and for being a 'reassuring presence' for other health professionals. There was general recognition that the service was crucial in terms of being able to support individuals in their preference for dying at home.We would not have been able to nurse [patient] at home without input from hospice at home. Their input was vital, to the family, both day and night and to the district nurse team. Because of [patient] his young wife and two children, the hospice at home team gave them support, physical and emotional day and night. [Patient] was comforted by their presence in the house as was [patient's] parents. I would also like to thank you all for the help and support you gave me and my team, it was much appreciated. [Comment number 266][Patient] was in retention of urine – the GP or myself did not pick this up as the family stated (patients) pads were wet. The hospice at home nurses palliative care experience and knowledge was paramount in this particular incident and we were grateful to the input. The collaborative approach proved to be very positive. [Comment number 353]Areas of concern identified included the importance of both availability of staff (including access to 24 hour/bank holiday cover) and concerns about appropriately educated and trained staff (with particular reference to agency health care assistants). These concerns were of importance because they could bring about a mismatch between patient and carer expectations and the actual service received.Sometimes the service is let down by the lack of staff – families feel let down when they have been promised sitters and then there aren't any [Comment number 438].Main carer very upset initially as patient unfortunately died the first night a sitter was arranged. Apparently the sitter informed the carer that patient had died without waking her when his condition deteriorated. Upset not to have been with him at the time of death [Comment number 106].General practitioner questionnaireGPs returned 444 (78%) of distributed questionnaires (no reminder questionnaires were sent).GP's comments underlined the benefit of the service in respecting the wishes of patients and/or carers for home to be the place of death.Summary of results from questionnaire to General Practitioners: See Table 3Table 3Summary of results from questionnaire to General PractitionersYesNoTotalQuestionN%N%Q1. Overall did you feel that the patient and family were sufficiently supported?42796174444Q2. Were you aware of any family/patient anxieties, which were not addressed?38940191439Q3. Did you feel managing this death at home caused any additional concerns within the practice?471139489441The general practitioner responses to their questionnaire revealed an overwhelmingly positive perception that the patient and family were sufficiently supported (96%: n = 427). Free text comments included:Was accepted for treatment quickly and seen quickly – initiated promptly and were able to respect patients/family's wishes of dying at home. [Comment number 410]The main thing was that (patient) wanted to die at home. Without the support of the team she would have needed to go into hospital or hospice care. [Comment number 205]GP's also outlined the key importance of the service in terms of providing emotional support for patient and carers and support for the primary healthcare team.(Patient) did not live long after her diagnosis but I know that her daughter and son felt supported by hospice at home and found her easier to manage. [Comment number 256](A strength was) knowing I had expert advice available if I needed it. [Comment number 313]The importance of working together for better care featured in comments:Obvious moral, medical and psychological support to the patient and family. Communication line was efficiently kept between GP/care people and patient and family. [Comment number 386]Good teamwork between hospice at home, nurses and GPs [Comment number 442]Enabled a very sick woman to come home from hospital and die comfortably at home with her family [Comment number 304].Of the 4% (n = 17) who identified lack of sufficient support, GP's echoed carer responses in terms of problems with the 'sitting service' (particularly overnight and weekend) and three comments suggested communication between primary and secondary services could have been improved. These comments included:We were told no staff available to offer patient support over weekend as waiting list – this resulted in patient's emergency admission to hospital. [Comment number 255]The communication from secondary and tertiary care was poor. (This is not a criticism of hospice at home service, which was fine but not started soon enough). [Comment number 151]Ninety one percent (n = 401) of GPs were not aware of any unaddressed family or patient anxieties. Of the comments received 9% (n = 38) of GPs remarked on the difficulties of caring, often in rapidly deteriorating circumstances, for individuals within the home;Her son panicked at the time of death, although death was expected, and dialled 999 that led to a chain of undesirable events, which probably [patient] didn't want. [Comment number 266]This man [patient] and his wife needed a little more help to face directly the issue of death. [Comment number 116]Not a good death 'unexpected collapse' paramedics attempted to resuscitate. But mostly due to patients refusal to discuss how he saw things going when he became unwell towards the end. [Comment number 365]Death at homeThe primary aim of establishing the hospice at home service was to support, with best quality care, patient choice to die at home. Here, reflecting the importance of this aspect of the service, we present further data from all three groups in the study specifically addressing this aspect of care.Carer questionnaires reported that 87% (n = 250) of patients had died within the home. There were prolific carer comments (211) about the importance of 'patient choice', the 'reassuring presence' of the hospice at home service and the importance of 'fulfilling a promise' in terms of the individuals preferred place of death.I couldn't have gone through the whole thing without them, it was my wife's desire to die at home and I'm so grateful for the support to enable her wish to be fulfilled. [Comment number 234]He, I and our family, found this to be a very precious time. A time to say things he needed to say, get his affairs settled, his wishes made known and for myself and our family to give him our love [Comment number 80]A key strength identified by carers was the importance of their active participation in cares, thereby, 'fulfilling a promise' to individuals who had expressed a preference to die at home. There were many general comments (117 recorded) on questionnaires thanking the team.Mum passed in the best way possible; at home, pain free with all her family around her. I will be forever grateful to the district nurses and hospice at home team for allowing this and for helping her to die with dignity. [Comment number 16]My husband wished to have his care up to his death at home, it was also my wish. His passing was dignified and peaceful with his family at his side in his own bed in accordance with his wishes – wholly appropriate in our case. [Comment number 121]The overwhelming experience of District Nurses was that in hospice at home cases place of death was appropriate even where the place of death was not the home.He [patient] was admitted to ward – he asked to go into hospital rather than at home, it was his wish. [Comment number 467](Patient) was admitted to hospice for symptom control – her death was sudden. [Comment number 507]District Nurses also suggested that it would not have been possible to support the client within the home without the hospice at home service. For example:The hospice at home team is a must if we are to nurse the dying at home. The district nurses can only give limited time on visits due to their caseloads. The hospice at home team can provide the care and support the patient and family require whilst going through this difficult situation. [Comment number 348]Eighty nine per cent of GPs (n = 394) reported no additional concerns in terms of managing death within the home, and welcomed the support from the hospice team.I think we feel adequately supported by good access to the palliative care team. Overall we have found this an excellent service for our patients. [Comment number 443]Eleven percent (n = 47) reported that managing death at home had caused additional concerns. These related to practical matters around the challenge of symptom control, repeated visits and out of hour's medical cover:This caused a lot of strain in the practice due to the amount of time we needed to spend there, the difficulty in controlling the symptoms and the awfulness of the whole situation. [Comment number 251]We had concerns re out-of-hours doctor (previous concerns with other patients). Practice doctors provided additional support at weekends. [Comment number 434]DiscussionWe will organise our discussion of study results in two sections. First we will comment on methodological and interpretive aspects of the study and then we will consider key features of the hospice at home service as identified by our respondents.Methodological and interpretive issues1) The challenge of positive findingsReplies that are overwhelmingly positive can be difficult to deconstruct in ways that are useful for service providers to translate into guides for service improvements [28]. Further, asking about satisfaction with care in palliative care is especially challenging. In the absence of an easy outcome measure of cure or remission and in the likelihood that care is provided in the context of worsening symptoms and more complex care demands, it is a challenge to conceptualise clear expectations about what services might even consist of let alone realistically achieve. Satisfaction needs to be related to both expectations and aspirations [29]. These challenges are likely to be evident in all three of our respondent groups but to be particularly pronounced in our carer respondents. Whilst carers could only compare hospice at home support with either their expectations or any service they had received before the introduction of hospice at home to their situation the district nurses and GPs had a broader range of comparative experiences to draw on. Offering three different but contemporaneous perspectives on the Bradford hospice at home service is a particular strength of this study.Wilkinson et al [30] have commented on difficulties exploring consumer opinion on, and satisfaction with, specialist models of palliative care. These difficulties further underline the methodological problems of data collection within a palliative care environment. Even so, they suggest that consumer perspectives of the quality of communication, access to care, problem areas and valued aspects of care are important in terms of the development of future models and as such should not be overlooked by funding agencies or managers of palliative care services.2) Using findings to improve careOur use of qualitative comments is designed to move beyond the reassurance that questionnaires on satisfaction with care can generate to illustrate the care experience in the more nuanced way that qualitative analysis permits. Relative to the proportion of negative comments offered overall in the study we have presented in our results section a disproportionate number of critical qualitative comments. These comments highlight the points of tension in service delivery and give a focus for considering interventions to improve the overall quality of care. Two specific areas can be explored further, the shortcomings of agency staff and, in the next section, the impact of the service on rates of death at home.Our use of both questionnaire and qualitative data does facilitate the identification of shortcomings in terms of the depth of expertise available to the team, when staff, outside of the core team were utilised problems increased. This has significant resource and training implications not just for increasing the quality of end-of-life care in the home but also for broadening the range of this service and of similar services elsewhere.The experience of having agency staff involved in care in the home is the reason for a considerable number of the critical comments elicited in this study. A significant number of these criticisms appear to be of major concern; our quotes presented above illustrate how distressing some of these avoidable experiences were. It is essential to address how these shortcomings might be overcome.In the early days of the hospice at home service in Bradford there were few core staff employed and a reliance on agency staff resulted. Over time this situation has changed, as has the degree of scrutiny exercised by the hospice at home team over those agency staff who continue to be involved. Crucial to the shift from agency towards core staff was a successful funding bid, in 2003, to expand the team and the Marie Curie nursing budget. This allowed a reduction in the use of agency staff. There had also been a more systematic process of recording problems with particular agency staff and feeding these back to the appropriate agency via the PCT Contracts Manager. Educational and training opportunities were made available to specific agency staff. Further, as the team became better supported financially those agencies with whom problems were most evident were dropped. Contract specifications and minimum service requirements were strengthened within the contracting process for those agencies that remain involved.As well as these attempts to address the problems of agency staff this evaluation has encouraged other quality of care improvements to be made; a) in enforcing the need for and acceptability of setting a standard for maximum waiting time before visit to palliative care patients by an out-of-hours doctor. This has largely been adhered to by the new 'Out of Hours' provider, b) demonstrating the need for a robust system of providing injectable palliative care drugs out of hours (including opioids). Again, this is now largely in place locally, with all doctors' cars carrying an agreed list of drugs.3) The complexity of planning for death at homeOne of the main aims of the introduction of a hospice at home service in Bradford was to increase the home death rate. In the period of this evaluation this was not achieved. The relationship between service innovation and home death rates is a complex one. Gomes and Higginson [31] undertook a systematic review of 58 studies and identified a complex mix of 17 factors that impacted on place of death and preferences for death at home being met. These factors included patient specific factors, including their functional status, preferences and patterns of available family support; patterns of service provision including the intensity of home care. They concluded that future policies and clinical practice should focus on ways of empowering families and public education, as well as intensifying home care, risk assessment and training for practitioners in end of life care.Even within an overall policy context supportive of home care, services are vulnerable to changes within primary healthcare teams that arise for other agendas relevant to this area of practice, for example changes in GPs out of hour's contracts [32] and access to drug dispensing [33].Key features of the service1) Sensitivity to carer support needsA key strength identified by the majority of carers was the importance of their active participation in care, thereby, 'fulfilling a promise' to individuals who had expressed a preference to die at home. Whilst Cantwell et al [34] found the main predictive factor of a home death was the agreement between the patient desiring a home death and the caregiver supporting a home death a relatively small minority of carers in our study reported the high level of stress involved in caring for someone until they died at home, even with the support of the hospice at home team. It is important to recognise that patient preference may not always be the choice for carers. A disparity like this presents a challenge for families and also for healthcare professionals that must be acknowledged and addressed.Despite there being carers who reported such a high level of stress the 'reassuring presence' of the Bradford hospice at home service provided much needed support for the majority. Healthcare professionals also reported on the value of the service in building carer trust and facilitating patient choice. Factors associated with continuity of care and the importance of effective team-working are paramount if patients, carers and healthcare professionals are to have overall confidence in a home care service.2) Team-working: continuity of careWhilst team work is considered a central component of palliative care [35] findings from other hospice at home team evaluations have suggested problematic areas in communication between district nurses and hospice at home teams [36,15]. In terms of providing continuity of care, results of one multi-centre evaluation suggested the advantages of all components of care being offered by one service [14]. Carers of patients referred to another hospice at home service have also reported the importance of accessibility of primary care professionals, which becomes more acute within the home with lay carers often on their own looking after individuals while experiencing the anxiety and strain surrounding impending death [37]. Thomas et al [38], exploring change in planned and actual location of death, identified carer anxiety and lack of confidence as important determinants as to why place of death is often different from patients preferred option.Within our study, carers, district nurses and GP's cited examples of working together for better care within the home with co-ordination viewed as a priority. In a small number of cases, where difficulties with providing 24-hour care were encountered, e.g. sitters not turning up or perceptions of inappropriate night cover, this impacted negatively on carers and healthcare professionals confidence in the service.3) Problems in prognosisThe considerable majority of patients seen by this hospice at home team had cancer and it may be that challenges in prognosis contribute to the exclusion of people with other conditions. Anecdotally, we identified that in some cases GPs were referring people with non-cancer diagnosis and claiming a prognosis of six weeks or less in order to give their patients access to the enhanced services hospice at home could offer. In effect the inexact science of prognosis is being used in two ways – one to exclude some people and one to include them in this sought after service even when GP's may not have an evidence based judgement to reassure all parties that the six week prognosis was realistic. In effect the six week rule was manipulated to maximise care for individual patients. Subsequent to the period considered in this evaluation there has been further encouragement to increase the scope of the hospice at home service to offer palliative care services to patients with life limiting conditions other than cancer who expressed a preference for home death.Study limitationsThere are limitations in this study arising from its focus on one health community. The study provides an insight into the views of caregivers, district nurses and GP's. It does not include direct patient views of home care provision nor does it monitor the quality of palliative care within the home using measures of, for example, pain and other symptom relief [39]. The anonymous data does not allow matching of carer, district nurse and GP opinion. There may be a disproportionate tendency of those who are satisfied with services to reply to questionnaires. The requirements imposed on the study by the research ethics committee included sending an information letter and informed consent form seven weeks after the death of the patient. If consent was given, the carer received a questionnaire five weeks later. The time scale was chosen to balance the likelihood of accurate recollection with the emotional and practical impact of the bereavement. It may have had an adverse impact on carer recruitment.The study was carried out within a service context that saw the hospice at home service experience high staff turnover, considerable pressure of work and the absence of effective administrative support in its early years. This real world context is not untypical of much health and social care research and the shortcomings, like less than ideal response rates and incomplete data sets should be viewed in this context.However there are also advantages in this close involvement of the research process with service delivery. Much health service research is essentially evaluative and the alliance between researcher and practitioner is predicated on an assumption that the orientation of research is to help service improvement, to have an impact, to make a difference [40]. What then can become a sense of shared endeavor helps to ensure continued enthusiasm for the research. It also offers a route for the rapid transmission of research findings to service providers and their managers. Close involvement of research also provides a spur for improvements in the quality of routine data collection. Much of the data that is collected by practitioners is often not of sufficient quality to be used to provide or underpin research findings and can even be of little value for audit or service planning.ConclusionThe study provides an independent evaluation of the Bradford hospice at home service and reports positive responses from patients informal carers', district nurses and general practitioners. However while there was only a small number of times that care was not seen positively when this did occur the level of distress at such a crucial point in carers lives can be considerable. In end-of-life care if one does not get things right first time it is not likely that a less than optimal situation can be remedied. Even where 97% of carers rate care as good or very good for the small numbers who reported poor or very poor care it was for 100% of their relatives end-of-life experience. This puts considerable pressure on end-of-life care to get it right every time. It is a pressure that needs to be acknowledged by commissioners, trainers and managers.One of the main aims of the introduction of a hospice at home service in Bradford was to increase the home death rate. It is regrettable that this aim was not fulfilled. Given the range of factors that impact on home death rates [20,31] it was ambitious to think the introduction of this service would realise this aim.It does emerge from all parties that the sensitive and reliable care of high quality provided by the hospice at home service offered a reassuring presence and it was this that defined the quality of the end-of-life experience. While a hospice at home service does have a responsibility to engage with its broader public health impact and so needs to consider the impact it has on the proportion of those people who choose and then experience their death at home we have observed above that factors that bear upon this are wider than the remit of hospice at home. What is within its direct remit is the process of care delivery and it is this and not, more narrowly, just the place of death that determines the success of the service for those who received it.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsNS: Conceived the study, acquired the funding, and participated in design, co-ordination of the research and analysis of data. BL: Undertook data collection and managed, liaison with the service, undertook analysis and contributed towards the full report to the funders. AD: Contributed towards the design and links with the clinical service. PG: Analysed quantitative data.  All authors contributed to the final manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533296.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533296",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533296\nAUTHORS: Filipe Dantas-Torres\n\nABSTRACT:\nCanine vector-borne diseases (CVBDs) are highly prevalent in Brazil and represent a challenge to veterinarians and public health workers, since some diseases are of great zoonotic potential. Dogs are affected by many protozoa (e.g., Babesia vogeli, Leishmania infantum, and Trypanosoma cruzi), bacteria (e.g., Anaplasma platys and Ehrlichia canis), and helminths (e.g., Dirofilaria immitis and Dipylidium caninum) that are transmitted by a diverse range of arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies. This article focuses on several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance) of CVBDs in Brazil and discusses research gaps to be addressed in future studies.\n\nBODY:\nBackgroundCanine vector-borne diseases (CVBDs) constitute an important group of illnesses affecting dogs around the world. These diseases are caused by a diverse range of pathogens, which are transmitted to dogs by different arthropod vectors, including ticks, fleas, lice, triatomines, mosquitoes, tabanids, and phlebotomine sand flies.CVBDs are historically endemic in tropical and subtropical regions and have increasingly been recognized, not only in traditionally endemic areas, but also in temperate regions [1]. This may be attributed to several factors, including the availability of improved diagnostic tools, higher public awareness about CVBDs, dog population dynamics, and environmental and climate changes [2], which directly influences the distribution of arthropod vectors and the diseases they transmit.CVBDs have long been recognized in Brazil [3]. At the beginning of the 21st century, CVBDs are prevalent in all regions of the country and some of them have increasingly been recognized in previously free areas, as it is the case of canine leishmaniasis in São Paulo, Southeast Brazil [4-11]. Despite their recognized importance, many aspects concerning epidemiology and public health significance of CVBDs in Brazil are still poorly known and data have not been comprehensively discussed.This article summarizes several aspects (etiology, transmission, distribution, prevalence, risk factors, diagnosis, control, prevention, and public health significance) of CVBDs in Brazil and discusses research gaps to be addressed in future studies.Protozoal diseasesCanine babesiosisCanine babesiosis has been recognized in Brazil since the beginning of the 20th century [12]. This disease is caused by Babesia vogeli (= Babesia canis vogeli) (Piroplasmida: Babesiidae) (Fig. 1), which has recently been molecularly characterized in Brazil [13]. Cases of Babesia gibsoni infection in Brazilian dogs have also been reported [14]. The only proven vector of B. vogeli in Brazil is Rhipicephalus sanguineus (Fig. 2), which is also the suspected vector of B. gibsoni [15].Figure 1Babesia vogeli. Two Babesia sp. trophozoites in a blood smear from a naturally infected dog.Figure 2Rhipicephalus sanguineus. A dog heavily infested by Rhipicephalus sanguineus ticks.Canine babesiosis is prevalent in virtually all Brazilian regions [12,16-24]. The prevalence of infection ranges from 35.7 [24] to 66.9% [16] in serological surveys and from 1.9 [23] to 42% [21] by cytology on blood smears. The incidence of disease seems to be higher among adult dogs [24], although young dogs are also highly susceptible to infection [22]. Apparently, there are no breed or sex predilections [16,21,24-26].The diagnosis of canine babesiosis is usually based on the presence of suggestive clinical signs (e.g., apathy, fever, anorexia, weigh loss, pale mucous membranes, and jaundice) and patient history. The infection by Babesia spp. is confirmed by the examination of Giemsa-stained peripheral blood smears. A detailed review of all aspects, including diagnosis and treatment, of canine babesiosis in Brazil can be found elsewhere [22].Canine leishmaniasisCanine leishmaniasis was firstly recognized in Brazil during the 1930s [27]. This disease is mainly caused by Leishmania infantum (Kinetoplastida: Trypanosomatidae) (Fig. 3), sometimes referred to as Leishmania chagasi or Leishmania infantum chagasi [28]. Infection by other Leishmania species (e.g., Leishmania amazonensis) have also been reported [7,10] and cases of co-infection by two species (e.g., L. infantum and Leishmania braziliensis) as well [29]. The main vector of L. infantum in Brazil is Lutzomyia longipalpis (Diptera: Psychodidae). Other modes of transmission, including by Rh. sanguineus ticks, are suspected to occur [30,31], particularly in foci where suitable phlebotomine sand fly vectors are absent (e.g., Recife, Northeast Brazil) [32]. The vectors of L. amazonensis and L. braziliensis vary from region to region and several species may eventually be involved, including Lutzomyia whitmani (Fig. 4) and Lutzomyia intermedia (reviewed in [33]).Figure 3Leishmania infantum. Several Leishmania infantum amastigotes in a bone marrow smear from a naturally infected dog.Figure 4Lutzomyia whitmani. External genitalia of a male of Lutzomyia whitmani, which contains structures of major taxonomic importance.Canine visceral leishmaniasis by L. infantum is endemic in all Brazilian regions [34-47], except in South where the disease is seldom recognized [44,48,49]. Canine cutaneous leishmaniasis by L. braziliensis is also prevalent in all regions [7,10,38,50-58], except in Center-West. The only two cases of L. amazonensis infection in dogs reported so far were diagnosed in Southeast Brazil [10]. The prevalence of Leishmania spp. infection in dogs varies widely [38,47,59,60] and may be as high as 67% in highly endemic foci [61]. Risk factors associated with canine leishmaniasis have extensively been studied in Brazil. There appears to be no sex predilection [35,60]. Although the prevalence of infection is often higher among males [47], this seems to be a matter of exposition rather than sex-related susceptibility. The prevalence is also higher in young dogs [47]. Some breeds (e.g., boxer and cocker spaniel) are apparently more susceptible to L. infantum infection [60]. Short-furred dogs are at a higher risk of infection [60] and this has been attributed to the fact that their short-hair makes them more exposed to phlebotomine sand fly bites.The diagnosis of canine leishmaniasis is based on the presence of suggestive clinical signs (e.g., weight loss, dermatitis, hair loss, mouth and skin ulcers, enlarged lymph nodes, onychogryphosis, and conjunctivitis) (Fig. 5) and on a positive serological response to Leishmania antigens [47,62]. Detailed information on several aspects of canine leishmaniasis, including diagnosis and treatment, can be found elsewhere [31,63,64].Figure 5Canine visceral leishmaniasis. A dog displaying a typical clinical picture of visceral leishmaniasis.The treatment of canine leishmaniasis is not routinely practiced in Brazil. Until the middle of the 1980s, most attempts to treat Brazilian dogs affected by leishmaniasis were unsuccessful [65]. Nowadays, there is scientific evidence supporting the treatment of canine leishmaniasis in Brazil [66-69]. However, although the available protocols are effective in promoting clinical improvement, a parasitological cure is seldom achieved [66-71]. Hence, considering the importance of dogs in the epidemiology of zoonotic visceral leishmaniasis, the Ministry of Health and the Ministry of Agriculture, Livestock and Food Supply have recently prohibited the treatment of canine visceral leishmaniasis in Brazil [see Addendum].Canine hepatozoonosisCanine hepatozoonosis was firstly diagnosed in Brazil during the 1970s [72]. This disease is caused by Hepatozoon canis (Apicomplexa: Hepatozoidae) (Fig. 6), which has recently been molecularly characterized in Brazil [73-75]. Dogs become infected by ingestion of a tick containing mature H. canis oocysts. Ticks involved in the transmission of H. canis in Brazil include some Amblyomma species, particularly Amblyomma aureolatum, Amblyomma ovale (Fig. 7), and Amblyomma cajennense [76-78]. Rhipicephalus sanguineus, which is a known vector of H. canis in the Old World, may also play a role in the transmission of this pathogen in Brazil.Figure 6Hepatozoon canis. A gamont of Hepatozoon canis in a blood smear from a naturally infected dog.Figure 7Amblyomma ovale. A female of Amblyomma ovale firmly attached to and feeding on a dog.Canine hepatozoonosis is prevalent in Center-West, Northeast, South, Southeast [72-82], and much probably in the North region. The prevalence of infection may be as high as 39% in some rural areas [76]. Little is known about the risk factors associated with H. canis infection in Brazil. The infection is more prevalent in rural areas [76], where dogs are more exposed to Amblyomma ticks. However, this association is not fully understood, because dogs from urban areas are highly exposed to Rh. sanguineus [83], a major vector of H. canis in the Old World [84].The diagnosis of canine hepatozoonosis is based on the presence of suggestive clinical signs (e.g., apathy, anorexia, pale mucous membranes, fever, weight loss, diarrhoea, vomit, and muscle pain) and on the observation of H. canis gamonts in leucocytes in Giemsa-stained blood smears [79,84-87]; the sensitivity is higher if peripheral blood is used [78]. More information on diagnosis and treatment of canine hepatozoonosis can be found elsewhere [84,86].Canine trypanosomiasisCanine trypanosomiasis has been studied in Brazil since the beginning of the 20th century [88]. This disease is caused by protozoa of the genus Trypanosoma (Kinetoplastida: Trypanosomatidae) and has sporadically been recognized in Brazil. Trypanosoma species known to infect dogs in Brazil are Trypanosoma evansi [89-96], Trypanosoma cruzi [97-100], and possibly Trypanosoma rangeli [101], the latter species is normally nonpathogenic.The vectors of T. cruzi (a stercorarian species) are triatomines of the genera Panstrongylus, Rhodnius, and Triatoma (Hemiptera: Triatominae). Rhipicephalus sanguineus ticks feed on dogs infected by T. cruzi can acquire the infection [102], but there is no evidence supporting the development and subsequent transmission to naïve dogs. Trypanosoma cruzi infection in dogs is prevalent in all regions, except in South [103]. In areas where American trypanosomiasis (or Chagas disease) is endemic, it is estimated that around 15–50% of the dogs are exposed to T. cruzi infection [97-100,104,105]. Clinically, the infection is of minor significance; that is, infected dogs are often asymptomatic carriers. In an experimental model, only sporadic febrile episodes were noted during the first weeks post inoculation [106]. Some dogs developed chronic focal and discrete myocarditis, which was only noticed during necropsy [106].The vectors of T. evansi (a salivarian species) are hematophagous flies of the genera Tabanus (Diptera: Tabanidae) and Stomoxys (Diptera: Muscidae) (Fig. 8). Trypanosoma evansi infection in dogs is found predominately in Center-West and South regions [89-96,107,108]. In Mato Grosso (Center-West Brazil), for instance, the prevalence of T. evansi infection is serologically estimated to be around 30% [90]. Dogs are regarded as efficient reservoirs of T. evansi, which is the causative agent of a severe disease affecting horses, commonly known as mal de cadeiras or surra. The infection in dogs is also severe and potentially fatal [93]. Clinical signs include edema of the hind limbs, anorexia, apathy, dehydration, pale mucous membranes, fever, and weight loss [93,108-110].Figure 8Stomoxys calcitrans. Several stable flies (Stomoxys calcitrans) feeding on a dog.Vectors of T. rangeli are triatomines of the genus Rodnius. While T. cruzi is transmitted through the feces of triatomines, T. rangeli is can be transmitted through both feces and saliva. Trypanosoma rangeli is widely spread in Brazil and has been found on a large number of hosts, including marsupials, rodents, and humans [101,111-114]. While nonpathogenic neither to dogs nor to humans, T. rangeli can be confounded with T. cruzi, which poses a challenge for the diagnosis of Chagas diseases, particularly in areas where both species are endemic. The distinction between T. rangeli and T. cruzi can be done by several biological, immunological, biochemical and molecular assays. The characteristic biological behavior in the invertebrate host is considered the best method for their differentiation [115].NambiuvúNambiuvú (in English, bloody ears) or peste de sangue (bleeding plague) was firstly recognized in Brazil in 1908 [116]. This little known disease is caused by Rangelia vitalli (Piroplasmorida), a protozoan whose current taxonomic position is uncertain. The infection is thought to be transmitted by ticks [117]. Cases of Nambiuvú have been recognized in Center-West, South, and Southeast regions [117-120]. The diagnosis of Nambiuvú is based on the presence of suggestive clinical signs (e.g., anemia, jaundice, fever, splenomegaly, and persistent bleeding from the nose, oral cavity, and tips, margins and outer surface of the pinnae) (Fig. 9) and on the observation of the parasites within endothelial cells of blood capillaries in necropsy samples. Recent information on several aspects of Nambiuvú can be found elsewhere [117,121].Figure 9A dog with clinical signs of the so-called Nambiuvú. Massive bleeding from the skin covering the dorsal surface of the pinna.Bacterial diseasesCanine monocytic ehrlichiosisCanine monocytic ehrlichiosis was firstly recognized in Brazil in the 1970s [122]. This disease is caused by Ehrlichia canis (Rickettsiales: Anaplasmataceae) (Fig. 10), which was firstly isolated in Brazil in 2002 [123]. The agent of canine monocytic ehrlichiosis is well characterized in Brazil [124-128], where it is transmitted by Rh. sanguineus [124]. Other Ehrlichia species found in Brazil – e.g., Ehrlichia chaffeensis; [129] – are also suspected to infect dogs. In fact, there is serological evidence of E. chaffeensis infection in Brazilian dogs [130].Figure 10Ehrlichia canis. A morula of Ehrlichia canis in a bone marrow smear from a naturally infected dog.Canine ehrlichiosis is prevalent in virtually all regions of Brazil [24,124-127,131,132]. This disease affects around 20–30% of the dogs referred to veterinary clinics and hospitals in Brazil [24,124,131], but the prevalence of infection vary widely from region to region [23,76,126,128,131-135]. The prevalence of infection can be as high as 46.7% in asymptomatic [128] and 78% in symptomatic dogs [132]. The risk of E. canis infection is higher for dogs that live in houses when compared to dogs living in apartments [23]. This is expected because dogs that live in houses with backyards are theoretically more exposed to ticks than those living in apartments. Seroepidemiological studies revealed that male adult dogs are more likely to present antibodies to E. canis, particularly those infested by ticks [24,134].The diagnosis of canine ehrlichiosis is usually based on clinical signs (e.g., fever, pale mucous membranes, apathy, anorexia, lymphnode enlargement, and weight loss) and on the observation of E. canis morulae in Giemsa-stained peripheral blood smears. More information on diagnosis and treatment of canine ehrlichiosis can be found elsewhere [136].Canine anaplasmosisCanine anaplasmosis is caused by Anaplasma platys (formerly Ehrlichia platys) (Rickettsiales: Anaplasmataceae) and has been recognized sporadically in Brazil. There are different A. platys strains circulating in Brazilian dogs, as revealed by analysis of partial sequences of the 16S rRNA gene [137]. The vector of A. platys is still unknown or unproven. Ticks of various genera (e.g., Rhipicephalus, Dermacentor, and Ixodes) have been found naturally infected by A. platys around the world [138-142]. The suspected vector of A. platys in Brazil is Rh. sanguineus.Canine anaplasmosis has been found in all regions of Brazil, although few cases have been formally published in the literature [124,127,143-145]. The prevalence of A. platys infection ranges from 10.3 [146] to 18.8% [145]. Little is known about risk factors associated with canine anaplasmosis in Brazil. The infection by A. platys is seldom associated with clinical disease, except in cases of co-infection with other organisms (e.g., E. canis and B. vogeli), which is common in Brazil [19,21,127,134]. Typically, dogs infected by A. platys display only a cyclic thrombocytopenia, but no hemorrhagic events are noted. The laboratory diagnosis is based on the observation of A. platys inclusions in platelets in peripheral blood smears stained with ordinary hematological staining methods. Serological studies have never been performed and molecular techniques are currently restricted to research.Canine Rocky Mountain spotted feverCanine Rocky Mountain spotted fever is caused by Rickettsia rickettsii (Fig. 11) and has been associated with significant morbidity and occasional mortality in the United States [147,148]. Serological surveys conducted in Brazil have shown that dogs from some Rocky Mountain spotted fever-endemic areas (e.g., Minas Gerais and São Paulo) are exposed to R. rickettsii infection [129,149-154]. The vectors of R. rickettsii are Amblyomma ticks, mainly Am. cajennense [155] (Fig. 12) and Am. aureolatum [156]. Additionally, Rh. sanguineus ticks have the potential to be involved in the R. rickettsii transmission cycle in areas other than Mexico and United States, including Brazil [157]. Serological surveys in Minas Gerais, Espírito Santo, Rondônia, and São Paulo revealed that the prevalence of anti-R. rickettsii antibodies in dogs ranges from 4.1 to 64% [129,149-154,158]. However, it is difficult to estimate the actual prevalence of R. rickettsii infection in dogs using serological tests, because of their low specificity [157].Figure 11Rickettsia rickettsii. Rickettsia rickettsii growing in Vero cells.Figure 12Amblyomma cajennense. Amblyomma cajennense ticks feeding on a horse.Little is known about the risk factors associated with R. rickettsii infection in Brazilian dogs. In a study conducted in São Paulo, the proportion of dogs positive to anti-R. rickettsii antibodies increased with age [158]. Although there is no information about clinical cases of Rocky Mountain spotted fever in dogs in Brazil, veterinarians working in areas where human cases have been reported must consider the possibility of this disease to request laboratory tests that will allow a proper diagnosis.Canine haemobartonellosisCanine haemobartonellosis has been sporadically recognized in Brazil, but little is known about this disease in this country, because few reports have been formally published in the literature. This disease is caused by Mycoplasma haemocanis (formerly Haemobartonella canis) (Mycoplasmatales: Mycoplasmataceae), which is transmitted by Rh. sanguineus [159]. Mycoplasma haemocanis infection in dogs has been recognized in South and Southeast Brazil [17,144,160-162]. Clinical disease in immunocompetent animals is uncommon. On the other hand, immunosuppressed dogs (e.g., splenectomized dogs) are particularly susceptible to infection [161,163].Clinical signs include pale mucous membrane, weight loss, apathy, anorexia, and fever [164]. The diagnosis of M. haemocanis infection is based on microscopic examination of blood smears stained with ordinary hematological staining techniques. Serological and molecular assays have also been used [164].Canine borreliosisA Lyme-like illness has been recognized in humans in Brazil since 1989 [165], although the true identity of the causative agent has not yet been determined. Serological surveys conducted in Southeast Brazil confirmed that dogs are often exposed to infection by Borrelia burgdorferi (sensu lato). Borrelia-like spirochetes have been detected in Ixodes ticks in the State of São Paulo [166], but the possible vectors of B. burgdorferi s. l. in Brazil are largely unknown. Amblyomma ticks are also suspected to be involved in transmission [167].The prevalence of anti-B. burgdorferi s. l. antibodies in Brazilian dogs ranges from less than 1 up to 20% [130,132,168,169]. The infection in dogs is usually asymptomatic and there appears to be no correlation between seropositivity and sex or age of the animals [169]. As expected, the seropositivity correlates with history of previous contact with ticks [169]. At present, there is no information about the treatment of dogs with suspected B. burgdorferi s. l. infection in Brazil.Helminthiasis (heartworm and tapeworm)Canine dirofilariasisCanine heartworm was firstly recognized in Brazil in 1878 [3]. The disease is caused by Dirofilaria immitis (Nematoda: Onchocercidae), which is transmitted by many mosquito species. Aedes scapularis and Aedes taeniorhynchus are implicated as the primary vectors, while Culex quinquefasciatus is a secondary vector [170-174]. Another filarid nematode commonly found infecting dogs in Brazil is Acanthocheilonema reconditum (formerly Dipetalonema reconditum) (Nematoda: Onchocercidae), whose intermediate hosts are fleas (Ctenocephalides canis and Ctenocephalides felis) (Fig. 13) and lice (Heterodoxus spiniger and Trichodectes canis) [175,176]. Acanthocheilonema reconditum infection usually causes no clinical signs in dogs. Despite this, it is important to distinguish the microfilaria of A. reconditum from that of D. immitis, as these filarid nematodes are often found in sympatry.Figure 13Ctenocephalides felis female. (a) Flea's head, exhibiting the characteristic genal (arrow) and pronotal (arrowhead) combs. (b) Spermatheca (arrow). (c) Chaetotaxy of tibia (arrow) of leg III.Dirofilaria immitis is prevalent in virtually all regions of Brazil [3,172,177-185]. The prevalence of D. immitis infection in dogs varies widely and can be higher than 60% in highly endemic foci [185]. The countrywide prevalence has decreased from 7.9% in 1988 to 2% in 2001 [186]. The possible reasons for this decrease include the reduction of transmission as a result of effective chemoprophylaxis and/or reduction of microfilaremic dog populations due to the off-label use of injectable ivermectin [187]. The risk of D. immitis infection is grater in dogs living in coastal regions [170,172,182,187] and in dogs older than two years [185]. Apparently there is no sex or breed predisposition [172,182]. In some areas, the prevalence of infection is higher among males [177,185], although this is likely to be a matter of exposure rather than sex-related susceptibility. Likewise, the prevalence of infection seems to be higher among mixed-breed dogs [188].The diagnosis of canine heartworm is based on clinical signs (e.g., coughing, exercise intolerance, dyspnea, weight loss, cyanosis, hemoptysis, syncope, epistaxis, and ascites). The infection is confirmed by the observation of microfilariae in blood samples using the modified Knott's test or the detection of antigens produced by adult heartworms using commercial enzyme-linked immunosorbent assay kits [189].Dipylidiasis (tapeworm infection)Dipylidiasis is caused by Dipylidium caninum (Cestoda: Dipylidiidae), whose intermediate hosts include fleas (C. felis and C. canis) and lice (T. canis and H. spiniger). Dogs become infected by ingestion of intermediate hosts containing infective cysticercoids (i. e., the adult tapeworm encysted in the intestinal wall of an intermediate host) [190]. In a recent study on endosymbionts of C. felis felis collected from dogs in Minas Gerais, of 1,500 fleas examined, six (0.4%) were infested by D. caninum [191]. Not surprisingly, the infestation by D. caninum in dogs (and also in cats) is commonly found in all regions of Brazil [192-198]. The infestation is usually asymptomatic. Some dogs may be seen scooting or dragging the rear end across the floor. This behavior is a consequence of the intense perianal pruritus caused by the rice grain-like proglottids, which can be eventually seen crawling around the anus.Control and prevention of CVBDs in BrazilVaccinationAt present, only two CVBDs are preventable by vaccination in Brazil. A vaccine (Leishmune, Fort Dodge Animal Health Brazil) against canine visceral leishmaniasis was recently licensed in Brazil [199]. This vaccine is only recommended for healthy, seronegative dogs at the minimum age of four months. The vaccine is well tolerated, although some dogs display transient mild adverse events (e.g., pain, anorexia, apathy, local swelling reactions, vomit, and diarrhea) [200]. Its efficacy is around 80% [43]. However, it is important to state that this vaccine protects dogs against the disease (i. e., appearance of clinical signs), but not against L. infantum infection [199].Until recently, there was no vaccine against canine babesiosis in Brazil [22]. A vaccine (Nobivac® Piro, Intervet Brazil) was recently licensed for commercialization in Brazil, but no information about efficacy and safety of this vaccine in preventing canine babesiosis in Brazil is currently available.ChemoprophylaxisThe chemoprophylaxis of canine heartworm is usually undertaken in Brazil, using different microfilaricides, such as ivermectin, milbemycin oxime, and selamectin [189]. The chemoprophylaxis of canine babesiosis has been recommended in Brazil [22]. Imidocarb can protect dogs from B. canis infection for 2–6 weeks [201], whereas doxycycline is effective in preventing clinical disease, but not infection [202].Vector controlVector control is the only effective measure for the control of most CVBDs in Brazil. The strategies currently used for the control of ticks in Brazil have recently been reviewed elsewhere [22,203]. The control of vectors other than ticks (i. e., fleas, lice, mosquitoes, triatomines, and phlebotomine sand flies) is performed by using insecticides under different formulations (pour-on, spot on, spray, etc.). The use of insecticide-impregnated collars limits the exposure of dogs to phlebotomine sand flies. However, it has been demonstrated that the impact of such intervention is dependent on collar coverage and loss rate [204]. Moreover, experience shows that this approach is of limited impact, mainly because most dog owners living in endemic areas cannot afford the costs such collars.Other control measuresWhile not universally accepted, the culling of dogs positive to anti-Leishmania antibodies is still practiced in Brazil [70,72]. This control measure has been subject of intense, ongoing debate in Brazil. Many dog owners, veterinarians, and non-governmental organizations have opposed the culling of seropositive dogs, both for ethical reasons and due to the lack of scientific evidence supporting the effectiveness of this strategy.From 1990 to 1994, more than 4.5 million dogs were screened and more than 80,000 were culled in Brazil [205]. In the same period, there was an increase of almost 100% in the incidence of human visceral leishmaniasis [205]. Actually, China is probably the only country where the culling of seropositive dogs seems to have been effective [206]. The possible reasons for the failure of the culling of seropositive dogs in Brazil include: high incidence of infection, limited sensitivity and specificity of available diagnostic methods, the time delays between diagnosis and culling, rapid replacement of culled dogs by susceptible puppies or already infected dogs, and owner's unwillingness to give up asymptomatic seropositive dogs [11,70,206,207]. A recent study conducted in Southeast Brazil suggests that the dog culling as a control measure for human visceral leishmaniasis in Brazil should be re-evaluated [11].CVBDs from the public health standpointCVBDs constitute a group of diseases of great interest because some vector-borne pathogens affecting dogs in Brazil (e.g., L. infantum,T. cruzi, and E. canis) are potentially zoonotic (see Tables 1, 2, and 3). Despite this, in some instances, there is little research-based evidence supporting the role of dogs in the transmission to these pathogens to humans in Brazil.Table 1Vector-borne protozoa affecting dogs in Brazil.AgentVector(s)Distribution aZoonotic potentialBabesia vogeliRhipicephalus sanguineusCenter-West, North,Northeast, South,  SoutheastYes (but low)Babesia gibsoniRh. sanguineus?Southeast, SouthNoHepatozoon canisAmblyomma spp., Rh. sanguineusCenter-West,Northeast, South,  SoutheastNoLeishmania amazonensisLutzomyia spp.SoutheastYes bLeishmania braziliensisLutzomyia spp.North, Northeast, South, Southeast,Yes bLeishmania infantumLutzomyia longipalpis,Lutzomyia spp.Center-West, North,Northeast, South,  SoutheastYesRangelia vitalliAmblyomma spp.?, Rh. sanguineus?Center-West, South, SoutheastNoTrypanosoma cruziPanstrongylus spp.,Triatoma spp.,Rhodnius spp.Center-West,North, Northeast,  South, SoutheastYesTrypanosoma evansiTabanus spp.,Stomoxys spp.Center-West, SouthNoa Includes some reports not formally published.b Dogs are unlikely to be important reservoir hosts for human infection.Table 2Vector-borne bacteria affecting dogs in Brazil.AgentVector(s)Distribution aZoonotic potentialAnaplasma platysRhipicephalus sanguineus?Center-West, North,Northeast, South,  SoutheastYes (but low)Borrelia burgdorferi s.l.Amblyomma spp.?, Rh. sanguineus?Center-West, Northeast, SoutheastYes bEhrlichia canisRh. sanguineusCenter-West, North, Northeast, South, SoutheastYesMycoplasma haemocanisRh. sanguineusSouth, SoutheastNoRickettsia rickettsiiAmblyomma spp., Rh. sanguineus?SoutheastYes ba Includes some reports not formally published.b Dogs are unlikely to be important reservoir hosts for human infection.Table 3Vector-borne helminths affecting dogs in Brazil.AgentVector(s)Distribution aZoonotic potentialAcanthocheilonema reconditumCtenocephalides spp.,Heterodoxus spiniger,Trichodectes canisCenter-West, Northeast, South, SoutheastYes (but low)Dipylidium caninumCtenocephalides spp.,H. spiniger, T. canisCenter-West, North,Northeast, South,  SoutheastYesDirofilaria immitisAedes spp., Culexspp.Center-West, North,Northeast, South,  SoutheastYesa Includes some reports not formally published.Dogs are implicated as important reservoirs of L. infantum in Brazil [206-211]. It is interesting to note that in some areas a high proportion of dogs are exposed to L. infantum infection [47], but human cases of visceral leishmaniasis are only sporadically notified [210]. In these areas, the low incidence of visceral leishmaniasis may be because of the difficulties in diagnosing and notifying the human cases [207,210], but it also indicate that the role of dogs in the epidemiology of visceral leishmaniasis may vary from region to region [211].Near a century after its discovery, Chagas disease is still a serious public health concern in Brazil. Dogs are considered to be an efficient source of T. cruzi infection and are thought to play a role in the peridomestic transmission cycle [212,213]. However, Southern Cone countries (e.g., Brazil) have experienced significant changes in the epidemiology of Chagas disease in recent years [214]. New studies to understand the current role of dogs in the cycle of transmission of T. cruzi in Brazil are needed.Human ehrlichiosis is an emerging zoonosis that has been suspected to occur in Brazil since 2004 [215,216]. The suspected causative agent is E. chaffeensis [216], but tick vectors are completely unknown. Cases of natural infection by E. chaffeensis in dogs are suspected to occur in Brazil [129], but this has not yet been confirmed [126]. Cases of human ehrlichiosis caused by E. canis infection have been reported in Venezuela [217]. This raises a number of questions about the risk of E. canis infection in humans in Brazil as the main vector (i. e., Rh. sanguineus) of this rickettsial agent is already known to parasitize humans in this country [218,219]. Further molecular studies are urgently needed to characterize the cases of human ehrlichiosis in Brazil.Human pulmonary dirofilariasis, a zoonosis that has been diagnosed in Brazil since 1887 [220], has been reported in Rio de Janeiro, São Paulo, and Santa Catarina [179,220-227], where the prevalence of D. immitis infection in dogs is moderate to high [183,186]. Cases of human dipylidiasis have also been reported in Brazil [228-230]. Dogs play a major role in the transmission of D. caninum for humans, and thus must be periodically evaluated for the presence of gastrointestinal helminths and treated accordingly.Little is known about human babesiosis in Brazil, where clinical cases of are seldom recognized [231-233]. As B. canis is rarely involved in cases of babesiosis in humans [234], dogs are unlikely to play a role in the epidemiology of human babesiosis in Brazil. Although dogs are also unlikely reservoirs of R. rickettsii [157], they may play a role in bringing ticks to human dwellings, particularly if ticks like Am. aureolatum and Rh. sanguineus are involved in the transmission.Research gapsRhipicephalus sanguineus is potentially involved in the transmission of at least nine pathogens affecting dogs in Brazil. Despite this, little is known of the relationship between the ecology of Rh. sanguineus and the dynamics of CVBDs in Brazil. Further research is needed to clarify the role of Rh. sanguineus in the transmission of A. plays, B. gibsoni, H. canis, R. rickettsii, and L. infantum in Brazil.Considering that dogs and humans live in close contact and that both dogs and humans are susceptible to infection by L. infantum and L. braziliensis, it is reasonable to imagine that in areas where dogs are exposed to these pathogens, humans are exposed as well. However, the finding of a dog infected by a given Leishmania species should be analyzed carefully to avoid misinterpretation. While the role of dogs in L. infantum transmission is well known, their role as reservoirs of other Leishmania species is probably minor [208]. The epidemiology of the leishmaniases is complex and varies from region to region and even within each region. The pattern of transmission of Leishmania parasites is intimately linked to the behavior of hosts and vectors involved. Local studies are crucial to understand the dynamics of transmission and to provide information for the establishment of vector control programs.Most information on CVBDs in Brazil has been informally presented in scientific meetings, which makes it difficult to access the actual distribution and prevalence of these diseases across the different geographical regions of the country. For instance, only five CVBDs have been formally reported to occur in the North region, while 13 CVBDs have been recognized in Southeast Brazil. Indeed, this situation reflects the limited number of studies on CVBDs carried out in North in comparison with Southeast Brazil, where there is a large number of researchers working in this field. Further studies to access the countrywide distribution and prevalence of CVBDs should be encouraged. It is also important to evaluate the impact of environmental changes and human behavior on the prevalence and zoonotic potential of CVBDs in Brazil. CVBDs are likely influenced by climate variations and environmental changes. Also, the zoonotic potential of these diseases is probably greater in remote areas where the access to education and healthcare services is limited.Co-infection by vector-borne pathogens is a common condition among Brazilian dogs [19,21,29,94,127,134,235]. This is expected because these pathogens often share the same arthropod vector. The occurrence of mixed infections is of great practical importance. Just to give an example, the use of serological tests with low specificity to access L. infantum infection may lead to an unnecessary culling of dogs infected by L. braziliensis or even by T. cruzi [236,237], in areas where both species occur. The use of contemporary techniques to distinguish the species of Leishmania infecting dogs [7] is highly desirable, particularly where L. infantum and L. braziliensis occur in sympatry. The burden of co-infections in Brazilian dogs should be investigated and better molecular tools should be developed to improve the accuracy of the diagnosis.ConclusionIn this review, it became clear that CVBDs in Brazil should be faced as a priority by public health authorities. Certain vector-borne pathogens infecting dogs in Brazil are of great significance for human health, as it is the case of L. infantum and T. cruzi. In this scenario, veterinarians play a key role in providing information to owners about what they should do to reduce the risk of infection by zoonotic vector-borne pathogens in their dogs and in themselves.CVBDs are prevalent in all geographical regions of Brazil and have been increasingly recognized in recent years. In part, this is a result of the improvements achieved in terms of diagnostic tools. On the other hand, factors such as deforestation, rapid urbanization, climate changes, and the indiscriminate use of chemicals may cause a significant impact on the dispersion of arthropod vectors and on the incidence of CVBDs. The impact of such factors on CVBDs in Brazil has not yet been fully addressed and deserves further research.Today, the use of molecular biology techniques is contributing to the knowledge on the etiology and epidemiology of CVBDs in Brazil. A better understanding about the ecology of the arthropods involved in the transmission of pathogens to dogs in Brazil is essential to reduce the burden of CVBDs, whose magnitude is probably much greater than is actually recognized.AddendumAfter this manuscript was submitted, the Ministry of Health and the Ministry of Agriculture, Livestock and Food Supply have published an ordinance prohibiting the treatment of canine leishmaniasis in Brazil [238]. Indeed, this ordinance will enhance the debate around the treatment of canine leishmaniasis in Brazil, in the years to come.Note added in proofAfter the provisional PDF of this review was available, Dr. Michele Trotta (Laboratorio d’Analisi Veterinarie “San Marco,” Padova, Italy) asked me whether there are cases of canine bartonellosis in Brazil. Cases of Bartonella spp. infection in dogs have been reported worldwide. It was, however, only recently that antibodies to and DNA of  Bartonella henselae and Bartonella vinsonii subspecies berkhoffii were detected in dogs from Southeast Brazil [132,239]. Further studies are needed to assess the clinical and zoonotic significance of Bartonella spp. infection in dogs from different Brazilian regions.Competing interestsThe author declares that they have no competing interests.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533322.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533322",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533322\nAUTHORS: Michelle Kermode, Alexandra Devine, Prabha Chandra, Bernice Dzuvichu, Thomhood Gilbert, Helen Herrman\n\nABSTRACT:\nBackgroundHIV prevalence in north-east India is high and injecting drug use (IDU) is common. Due to HIV-related deaths there are increasing numbers of IDU widows, many of whom are HIV infected, and experiencing poor health, social isolation, discrimination and poverty, all factors likely to be compromising their mental health. There is increasing recognition of the links between HIV and mental health.MethodsThe aim of this study was to pilot a peer-facilitated, participatory action group (PAG) process and assess the impact of the intervention on the mental health of participants. The intervention consisted of 10 PAG meetings involving 74 IDU widows. Changes in quality of life (WHOQOL-BREF), mental health (GHQ12) and somatic symptoms were assessed. The value of the intervention from the perspective of the participants was captured using a qualitative evaluation method (Most Significant Change).ResultsParticipants' quality of life, mental health and experience of somatic symptoms improved significantly over the course of the intervention, and the women told stories reflecting a range of 'significant changes'.ConclusionThis pilot intervention study demonstrated that a participatory approach to mental health promotion can have a positive impact on the lives of vulnerable women, and the potential to contribute to HIV prevention. Further investigation is warranted.\n\nBODY:\nBackgroundThe north-east Indian states of Manipur and Nagaland are characterised by political instability, unemployment, and easy availability of heroin from across the Myanmar border. They are classified by the National AIDS Control Society [1] as high prevalence states for HIV, and intravenous drug use is an important route of HIV transmission [1,2]. The injecting drug user (IDU) population in these states constitutes 1.9–2.7% of the adult population [2]. In 2005, the HIV prevalence among IDUs in Manipur and Nagaland was reported to be 24% and 5% respectively, representing an increase in both states from the previous year [1]. However, much higher rates have also been reported: in a sample of IDUs from north-east India, 75% were found to be HIV positive [2]. Most IDUs in north-east India are men, an estimated 40% are married [3], and death rates have been high in the last five years, consequently the number of widows of IDUs has increased.Widows in India are socially and economically disadvantaged, and the situation for widows of IDUs is often worse. They are frequently stigmatised on three levels – for being a woman, being a widow, and being HIV positive [4]. In 2004, a situation assessment of widows of IDUs conducted in Manipur found that they were faced with a range of psycho-social, economic and health problems. Many IDU widows and their children were HIV-infected and experiencing poor health, social isolation, grief, loneliness, discrimination, and poverty; all factors likely to be compromising their mental health [5]. Some widows reported engaging in HIV risk behaviours including alcohol and drug misuse, sex work and unprotected sex. Accessing HIV prevention services was not a priority for these women who were predominantly concerned about livelihood and their children's future [5].Mental health is more than simply the absence of mental illness; it is the foundation for well-being and effective functioning for individuals and communities [6]. Mental illness is associated with indicators of poverty including low levels of education, poor housing and low income [7], and with other illnesses such as HIV infection [8]. Substance misuse, violence and health problems such as HIV and depression are more prevalent and more difficult to cope with in conditions of low income, limited education and unemployment [9].The nexus between gender and mental health is well recognised. Socio-cultural beliefs about gender roles often diminish women's control over their own lives and restrict their access to economic resources and power within the society, and this in turn has a significant effect on their mental health status and the risk of mental illness especially depression [10-12].The influence of gender on women's mental health is most evident in relation to depression. Globally, including in India, women are approximately twice as likely as men to experience depression and widows in India are more likely to suffer from mental illness than single or married women [10-12]. There is a need to promote the mental health of women in general and of widows in particular, both in India and further a field [12].Mental health is associated with HIV in a range of ways. In relation to engagement in HIV risk behaviours, individuals with poor mental health as a group and including those with untreated mental illness and substance misuse problems, have a greater chance of exposure to HIV related risk behaviours. Many have less control over their lives than other populations, are more likely to find themselves in situations of risk, and have diminished ability to negotiate safe behaviours [13,14]. Interactions between drug and alcohol use and depression are common, and studies in India indicate that the former is associated with engagement in HIV risk behaviours, especially among those with mental health problems [15,16]. People living with HIV and AIDS have an increased risk of developing mental health problems including depression and substance misuse [13-15]. These conditions adversely affect HIV and AIDS treatment adherence, contribute to risk behaviours and exacerbate social difficulties associated with stigma and discrimination. These considerations raise the possibility that promoting the mental health of vulnerable groups may reduce the risk of engagement in HIV risk behaviours and thereby contribute to HIV prevention.Emerging evidence indicates that mental health can be promoted by public health actions with vulnerable groups [6]. Just as physical health can be promoted, so too can mental health. A recent WHO report draws on a public health framework proposed initially by the Victorian Health Promotion Foundation [17] that identifies three key social and economic determinants of community and individual mental health: (1) social inclusion; (2) freedom from discrimination and violence; and (3) access to economic resources. This framework recognises that psychosocial and economic factors influence (protect or negate) a number of health-related behaviours such as substance misuse and risky sexual behaviours, that in turn affect all areas of health, including mental health [16,17].While the health benefits of community participation are well understood in development work, health policy does not always reflect this, partly because the published evidence related to this approach is limited. Our intervention drew on participatory action research (PAR) approaches to health development that seek to empower target communities to actively identify problems and develop solutions in relation to particular research questions. This enhances their self-confidence and leadership skills, and assists them to address their own health and social needs [18,19]. For example, a study in Nepal demonstrated that community based participatory action had a significant positive impact on maternal and infant mortality [20]. Studies such as these and the one described in this paper help to narrow the evidence gap on the effectiveness of community participation to contribute to changes in health status.This pilot intervention study began with the hypothesis that the implementation of structured and peer-facilitated participatory action groups (PAGs) among widows of IDUs in Manipur and Nagaland, with a focus on promoting mental health and well-being and informed by a strengths-based approach [21], would be associated with: (1) improved mental health; and (2) a reduced likelihood of engagement in HIV risk behaviours.The objectives of the study were to: (1) learn about the women's perspectives on mental health and well-being and the links between mental health and HIV; (2) assess changes in the women's quality of life and mental health during the course of the intervention; (3) assess changes in engagement in HIV risk behaviours; (4) describe the process and outcome of the intervention from the perspective of the women; (5) document the process of establishing and conducting the intervention so it can be repeated or adapted in the future. This paper reports on the findings in relation to objectives 2, 3 and 4. A full description of the background, the intervention and the methods for this study has been published elsewhere [22], so the following methods section is brief.MethodsSix groups of IDU widows were established (three in each state) in mid 2006, with 9–16 widows in each group. The women were recruited through partnerships with local non-government organisations (NGOs) working in the field of HIV prevention. The NGOs contacted IDU widow's known to them, and through these women's networks, contacted other widows. All interested widows attended a meeting where the nature of the study and intervention were explained, and those women interested in participating were recruited. The districts covered by the participating NGOs were Imphal and Churachandpur in Manipur and Dimapur and Kohima in Nagaland. The intervention is described elsewhere [22] and more information is available from the authors on request. In brief, the intervention was based on the framework for mental health promotion [17], and consisted of ten peer-facilitated PAG meetings that were held every fortnight for half a day over a twenty week period. All meetings were participatory, strengths-based and comprised of a combination of structured activities and open discussion (Table 1). Two peer facilitators were trained and supported for each group, and were provided with flexible written guidelines for each session. The women's travel and childcare costs were covered, refreshments were provided, and the activities deliberately engendered fun and enjoyment for the women. Each group participated in an action planning process to develop strategies for promoting mental health and the sustainability of the groups. A range of quantitative and qualitative data was collected to assess the impact of the intervention on the lives of the women.Table 1Outline of the ten PAG meetings for widows of IDUsSessionOutlineData Collection1 • Introduction to the PAG process • Baseline questionnaires: • Identifying members' expectations  - WHO QOL-BREF • Highlighting individual strengths and skills  - GHQ12  - Health Risk Questionnaire • Meeting summary report2 • Concepts and determinants of mental health for widows of IDUs • Focus Group Discussion • Meeting summary report3 • Mental health and mental health promotion • Meeting summary report4 • Envisioning a positive future • Meeting summary report • Promoting social inclusion5 • Addressing stigma and discrimination • Meeting summary report • Relaxation techniques6 • Improving access to work and resources • Meeting summary report • Prioritising ideas for action plan development7 • Developing action plans • Meeting summary report8 • Developing action plans • Collection of MSC stories • MSC approach • Meeting summary report9 • Mental health and HIV • Focus Group Discussion • Feedback of MSC stories • Meeting summary report10 • Finalising action plans • Post-intervention questionnaires: • Celebration  - WHO QOL-BREF  - GHQ12  - Health Risk Questionnaire • Meeting summary reportQuality of life, mental health, somatic symptoms and HIV risk behavioursThree brief questionnaires were completed by the women during the first and last PAG meetings:1. The short version of the WHO Quality of Life questionnaire (WHOQOL-BREF): Quality of life is a broad ranging concept and is assessed on a person's perceptions of various factors divided into four domains: (i) Physical health domain including pain and discomfort, energy and fatigue, mobility, sleep and work capacity; (ii) Psychological domain including spirituality, body image and appearance, thinking and learning and self-esteem; (iii) Social domain including personal relationships, sexual activity and social support; (iv) Environment domain including physical safety and security, physical environment (pollution, climate), financial resources, participation in recreation, home environment, transportation, and access and quality of health and social care [23,24]. Cronbach alpha values for each of the domain scores in the WHOQOL range from 0.71 to 0.86, demonstrating good internal consistency [25].2. The General Health Questionnaire (GHQ12): The GHQ12 is a screening instrument for common mental disorders suitable for use in community, primary care and medical settings. It is used in many different countries and although the original version consisted of 60 items; shorter versions have been subsequently developed and validated [26]. The Cronbach's alpha for the GHQ12 is estimated to be between 0.82 – 0.86 [26]. Analysis of the GHQ12 data used a cut-off of three points, greater than three indicating potential presence of a common mental disorder such as depression or anxiety. The selection of this cut-off was based on findings from an earlier study using the GHQ12 in an Indian setting [27].3. A Health and Well-being Questionnaire; Women in India who experience mental health problems such as depression often express their distress as somatic symptoms [28-30], so this questionnaire was adapted from an existing somatic symptom scale [31]. It asked participants to select how often they experience pain, various bodily sensations (e.g. weakness, trembling), disturbances of body functions (e.g. sleep, appetite), and reproductive symptoms (e.g. menstrual disturbance, vaginal discharge), as an indication of mental health. The second part of the questionnaire consisted of a small number of questions about sexual partners and drug and alcohol use adapted from a widely used Behavioural Surveillance Survey [32].The WHOQOL-BREF and the GHQ12 are usually self-administered but assisted administration is possible for people with low literacy. All questionnaires were translated into the local languages, back translated and piloted with literate and non-literate women. The research teams and peer facilitators assessed the sensitivity and appropriateness of all questions before they were included in the study. Special attention was given to the more sensitive questions seeking information about sexual and substance use behaviours.Data were analysed using SPSS 10. Individual assessment scores were summarised using frequency distributions and mean and standard deviations. Comparisons between baseline and follow up scores were done using paired t-test for continuous scores (WHOQOL-BREF and Health and Well-being Questionnaire) and McNamara Chi-square test for categorical variables (GHQ12). Data were analysed with the two states combined and separately.Value of the intervention from the participant and NGO perspectivesThe Most Significant Change (MSC) method was used to evaluate the intervention from the perspectives of the participants and the partnering NGOs. MSC is a qualitative, participatory approach to monitoring and evaluation used in development projects [33]. In this study, we collected 'stories of change' from participants during the eighth PAG meeting, and involved different stakeholders in systematic selection of the stories that best captured what they considered to be the 'most significant change'. Reasons for selecting particular stories were also documented. The point of MSC is that both the content of the selected stories and the reasons for choosing them make the values of the different stakeholders explicit, and this can be used to foster dialogue between potentially competing perspectives, in this case that of the IDU widows and the NGOs. As the MSC approach tends to elicit positive stories (in relation to the intervention), this method is not used as an evaluation tool in isolation.Initially, stories of change were collected from all participants who were willing and able to provide them. The stories were told to the state-based research officers (BD, TG) in private and were recorded and subsequently transcribed and translated. Two panels were convened in each state: one participant panel consisting of two peer facilitators, two widows, and an NGO liaison worker from each group (three groups in each state), and one NGO panel consisting of two senior staff from each of four NGOs connected to the project. The story selection process involved reading all of the stories from the relevant state to the panel members who were given time to reflect on each story and then, through a collective process, select the four stories that, in their view, best represented the 'most significant change'. The two panels met and made their selections independent of each other (Figure 1). Panel members were encouraged to discuss the reasons why they selected these particular stories and this discussion was recorded, transcribed and translated. We were interested in the similarities and the differences between the stories selected by the participant and NGO panels, as well as similarities and differences in their reasons for selection. Additionally all of the stories were thematically analysed. This is an inductive approach that involves systematically coding and recoding the data in order to identify and organise both explicit and implicit patterns embedded in the data.Figure 1Process of Most Significant Change story selection.Ethics and fundingThis intervention study was funded by the United Kingdom's Department for International Development (DFID) through the Research and Learning Fund. Ethics approval was obtained from the University of Melbourne Human Research Ethics Committee (Australia) and the Emmanuel Hospital Association Institutional Review Board (India) in early 2006. Participation in the study was entirely voluntary, all participants provided informed consent and confidentiality was assured.ResultsParticipation and demographicsSeventy-four women participated in the first PAG meeting, and 59 women completed the intervention (80% retention). The level of participation varied between NGOs (p = 0.04) and states (p = 0.002) (Table 2). The women were relatively young (mean age 32.5 years) and came from diverse ethnic and religious backgrounds (Table 3). The average length of widowhood was 4.3 years and the average number of children was 2.4. The majority of participants (81%) were not currently employed. Sources of income for those not formally employed included small businesses, support from family, sex work, and making handicrafts. Slightly more than half of the participants (53%) had completed secondary school and 30% had undergone some form of tertiary education. Nine percent of participants reported receiving no education. Although we did not systematically collect information regarding the participants' HIV status and drug use history, many of the women revealed their HIV positive status in the course of the intervention, and a small proportion had a history of injecting drug use.Table 2Retention in the intervention and reasons for dropping outGroupNo. startedNo. finishedRetention (%)Reasons for attritionManipur 1161487.5• Attending detoxification program• Language barriersManipur 2141392.8• IllnessManipur 31111100N/ANagaland 112758.3• Returned to home village• Death of participant• Death of children• Re-marriage• Drug useNagaland 29555.5• Ineligibility (not a widow)• Decided not to participate• IllnessNagaland 312975.0• Childbirth• IllnessTOTAL745979.7Table 3Demographics of the participants attending first PAG meetingVariableManipur n = 41Nagaland n = 33Total n = 74Average age (range)33 yrs (23–46)32 yrs (20–52)32.5 yrs (20–52)Average length of widowhood (range)4.5 yrs (3 mth-12.8 yrs)4.2 yrs (1 mth-11 yrs)4.3 yrs (1 mth-12.8 yrs)Average no. children (range)2.2 (1–4)2.7 (0–7)2.4 (0–7)Ethnicity – n (%) Naga2 (5)26 (79)28 (38) Meitei26 (63)026 (35) Other11 (27)7 (21)18(24) Missing2 (5)02 (3)Religion – n (%) Christian14 (34)30 (91)44 (59) Hindu25 (61)2 (6)27 (37) Muslim01 (3)1 (1) Missing2 (5)02 (3)Employment – n (%) Employed2 (5)10 (30)12 (16) Unemployed37 (90)23 (70)60 (81) Missing2 (5)02 (3)Education – n (%) None-7 (21)7 (9) Primary5 (12)1 (3)6 (8) Secondary15 (37)24 (73)39 (53) Tertiary21 (51)1 (3)22 (30)Changes in quality of life, mental health and somatic symptomsIn both states, all four Quality of Life domain scores increased across the course of the intervention indicating a general trend towards improvement in their quality of life (Table 3). The women experienced significant improvements in their physical and psychological health, and their interaction with the environment was more positive after participating in the intervention (p ≤ 0.05). While there was an increase in the social domain score, this did not reach statistical significance. The Quality of Life results in Manipur mirrored those for the group as a whole, but those in Nagaland were somewhat different as even though they all improved, none reached statistical significance (Table 4).Table 4Mean scores (SD) for Quality of Life domains at the beginning and end of the intervention by stateDomainManipur (n = 38)Nagaland (n = 21)Total (n = 59)PrePostp valuePrePostp valuePrePostp valuePhysical42 (15.1)58 (13.7)<0.0155 (16.1)57 (11.4)NS47 (16.7)57 (12.8)<0.01Psychological51 (18.5)59 (15.5)<0.0153 (12.2)57 (9.9)NS52 (16.5)59 (13.7)<0.01Social43 (20.3)49 (23.2)NS52 (12.8)53 (17.2)NS46 (18.3)51 (21.2)NSEnvironmental34 (18.1)45 (12.1)<0.0145 (14.0)47 (13.5)NS38 (17.5)46 (12.5)<0.01The results from the GHQ12 indicate that almost three-quarters of the group (70%, 49/70) were possibly experiencing a common mental disorder such as depression or anxiety at baseline compared with 42% (24/57) at the end of the intervention (Table 4). This represents a significant decrease in the proportion likely to be experiencing a common mental disorder (p < 0.01). Similar improvements were noted in both states. Those who dropped out of the intervention compared to those who remained were no different at baseline in relation to their GHQ12 scores and a range of demographic measures (ethnicity, religion, education, employment and marital status).In both states, the women experienced fewer somatic symptoms across the course of the intervention (as indicated by lower scores). However, pain was the only symptom that significantly decreased for the two states combined (p < 0.01).In summary, these results indicate an overall improvement in several quality of life and mental health parameters across the course of the intervention, although the patterning of these improvements varied by state. Unfortunately, data were insufficient to conduct a complete analysis of the effect of the intervention on participants' engagement in HIV risk behaviours as too many of the respondents left the relevant questions blank. Only a handful of participants openly engaging in sex work responded adequately to these questions. This is discussed further in the Discussion section of the paper.Thematic analysis of the Most Significant Change storiesStories of change were collected from 33 participants in Manipur and 22 in Nagaland. Analysis of the stories uncovered a range of themes, most of which aligned with the socio-economic determinants of mental health i.e. social inclusion, freedom from discrimination, and economic participation. This is not surprising as the intervention was somewhat structured around these themes. Two additional themes were physical health and future orientation. A sample story from each state can be found in Figure 2.Figure 2Two stories selected as representing the 'most significant change'.Social inclusionMany participants described how joining the group helped them overcome social isolation and provided them with a sense of belonging that was previously absent. The benefits of meeting and building relationships with other women in the same situation were frequently highlighted and the group became a source of nurturance and support for many of the women, and a stepping stone into the wider society for some.I felt that others discriminated against me as my husband died from drugs. This made me ashamed and I never wanted to attend any social gatherings. I didn't want to interact with others and this resulted in depression and stress and a feeling that life had no value. Since I attended this meeting, it has encouraged me to interact socially. I have even begun to attend the church and other social gatherings. It has been good meeting other widows like me, who I never knew before, but now they have become my friends with whom I can share my problems. (Manipur 11)A lot of participants gained confidence in their own abilities as a result of having to interact in a group setting.Before I attended this PAG, I could never stand in a group and speak but during the PAG sessions I had many opportunities to share my opinion and speak in the group, which has helped me to realise some of my potentials. (Manipur 33)Family conflict (mainly with in-laws) was one of the major sources of stress for the women. Many felt that the intervention had provided them with skills to better manage anger, thus enhancing their relationships with family.My relationship with my family and in-laws has improved. Earlier I used to fight with them because I have very negative thoughts about them. Now I understand that this will only increase our worries and affect my mental health. I have been able to handle my anger. After I stopped shouting, I have observed that even my children have stopped fighting amongst themselves. This has helped me to strengthen my relationship with my family and friends as well. (Nagaland 1)The PAG meetings deliberately incorporated activities that were fun such as games and singing, and this provided many of the women with a rare opportunity to experience joy and pleasure.The fun and laughter during the PAG has also helped me a lot. It is only here that I experience fun and laughter. (Nagaland 20)Finally, several of the participants said that they were inspired to help others.I have been able to meet other people like me and have started thinking of helping other people like me as well. I have been able to learn how to access resources and this is helping me to manage my plans and finances better. I have already started sharing my experiences and benefits with other widows. Now I have some peace of mind. (Nagaland 12)DiscriminationThe theme of discrimination against people with HIV and AIDS generally, and IDU widows in particular, was evident in many of the women's stories. They described intense feelings of anger in relation to perceived discrimination from both family and society. Several of the women reported that learning to manage their anger allowed them to better cope with this source of adversity.Prior to joining the PAG, I had a strong resentment fermenting inside me for a very long time. I would not be able to eat, sleep or do anything... nor take care of my children... People do not respect us because we were are widowed very young. They think that we do not have any other means of earning except by selling our body... Thinking about these things made my resentment grow from bad to worse. It has been about four months since I began attending this PAG meeting. I have realised that these problems will not go away... I can not hope nor expect any of them to change, but I can adjust with them. I need not brood over their attitude and let it affect my life and my relationship with my children. I can control my anger and seek my own course in life. Now I keep my priority concern on my children's welfare, so I've started attending the parents meetings at my children's school. (Manipur 20)Economic participationThis theme was connected to both an appreciation of the allowance received as compensation for their travel and childcare costs, and a growing awareness of their collective ability to form self help groups for income generation.Our allowances are very helpful because most of us are income-less at home. It is no longer necessary to demand money from the family as we can meet some of our needs now. With this allowance I buy Raja [tobacco] and sell it to get some profit... and I spend that on my other essential needs. With this allowance we have a sense of ownership in the family. (Manipur 1)There are changes in my work also. I go to the agricultural field and forest to earn my livelihood. I was very shy and could not even think of doing something in the town. But now I have the confidence and I have started selling vegetables in the market and also go house to house. (Nagaland 9)We do not have a voice, so we can become strong if we come together... We can start income generation and share our problems. If we are able to generate income it will help us. (Nagaland 13)Improved physical healthMany women reported feeling much better physically and several had initiated contact with service providers as a result of participation in the group. Additionally, the relationship between physical and mental health was recognised by some women.After coming to the meeting I realised that I am not alone and that has encouraged me to become more productive. I have also started accessing free medical services and medicines, which I never did even if I knew there were facilities available. I attended a free health camp for the first time last month. (Nagaland 11)Even my physical health has improved in the last two to three months. I used to have severe gastric problems but now that has reduced. Being able to share and discuss my problems with friends has lightened my mental worries. (Nagaland 9)Future orientationMany of the women commented that the intervention contributed to renewed feelings of hope for the future and several appreciated the opportunity to create personal goals.Before all my hope was gone but this meeting has given me new hope. I was like a dead soul, but now with this new hope I can carry on my life and my responsibility. This way it improves my mental health. (Manipur 11)Reasons for selecting storiesAll stories were considered by the participant and NGO panels in each state, and each panel selected the four stories that best represented the 'most significant change'. The participant and NGO panels selected stories that were similar in thematic content, although the emphasis given to the reasons for the significance of the stories varied. The reasons the participant and NGO panel members give for selecting particular stories make explicit the type of changes valued by the different stakeholders. The emphasis given to different types of changes was reflected by the number of times they were mentioned in the course of the discussion. From the perspective of the storytellers, changes took place within themselves, and in relation to their interactions with the group, their families, and the broader community. The changes in these four spheres are summarised in Figure 3.Figure 3Categories of valued changes identified using the Most Significant Change method.The participant panels particularly valued changes in the intra-personal, group and familial spheres, while the NGO panels tended to focus a lot more on the importance of changes located in the societal sphere.DiscussionThis participatory intervention study to promote the mental health of widows of IDUs apparently had a positive impact on the widows' quality of life and their mental health. However, the sustainability of the improvement and the links between this and their engagement in HIV risk behaviours remain to be demonstrated.While the physical, social and environmental domain scores of the quality of life measure improved significantly, the change in the social domain score did not. Qualitative findings, however, demonstrated improvements in social connectedness for the women. Had the sample sizes been larger, the change in the social domain scores may also have achieved statistical significance. For the women in Nagaland, the change in the scores for all four domains was not significant. The Quality of Life scores at baseline were higher among participants from Nagaland, and this together with the smaller sample size may account for the non-significant change observed in that state.While the intervention's positive impact on mental health as assessed by the GHQ12 is encouraging, identifying a high proportion of the group (70%) as potentially having a common mental disorder (anxiety or depression) is a matter for concern. An overestimation of this proportion is possible for technical reasons. The GHQ12 includes questions about the presence of physical symptoms; as some of the women were HIV positive and experiencing physical illness, their resulting higher scores may have resulted in some instances of (mis)classification as 'cases'. On the other hand, the level of distress among this vulnerable group is evident to those familiar with their situation, and this finding is not surprising.Given that women in India often express psychological distress as somatic symptoms [28,29], the observed reduction in the proportion of IDU widows reporting pain raises the possibility that this is connected to improved mental health, although the same improvements were not apparent in relation to the other somatic domains.During the MSC process the participant and NGO panels gave differing emphasis to the reasons for selecting particular stories as representing the 'most significant change'. The former tended to value changes in the intra-personal, group and familial spheres, while the latter gave more focus to changes in the broader community sphere, perhaps reflecting their focus on sustainability of programs. This has implications for the design and evaluation of interventions. These will ideally meet the needs of both program participants and implementers if the contribution to HIV prevention is to be valued at all levels. The funding organisation is another stakeholder that could be involved in the MSC process, and they may well have a different perspective again. The MSC approach facilitates organisational learning for all connected to programs that aim to create change for participants.The intervention generally, and the MSC process specifically, enhanced awareness among the NGO leadership of the struggles faced by IDU widows, especially those infected with HIV. Many of the NGOs providing HIV-related services in north-east India are male-dominated because the epidemic initially affected male IDUs predominantly. Prior to the intervention, IDU widows were isolated and powerless, and struggled to gain access to the few NGO programs relevant to them. Providing an opportunity for the widows to come together around the theme of mental health promotion has helped them to mobilise. Additionally, awareness of mental health as an important health issue for all people, including those with HIV infection, has increased.While the number of women participating in the intervention was relatively small and the intervention relatively brief, these findings contribute to knowledge and understanding about the use of participatory interventions to improve the mental health of vulnerable women, and demonstrate the potential of this approach to contribute to HIV prevention.The study has several limitations. As no control group met without receiving the structured program designed to promote mental health, we cannot know to what extent the observed improvements were related to the program content. The act of coming together may in itself have induced the changes. The attrition in some groups was disappointing but not unexpected given the stressful and at times unpredictable nature of the widows' lives, and an overall retention rate of 80% is high in this context. The linguistic and ethnic diversity and different literacy levels of the participants presented challenges during the intervention and data collection (see below). While most of these were overcome successfully with extra time, effort and research, we recommend that the participants in future groups be relatively homogenous. In relation to the intervention, we would also recommend that some HIV prevention education be included as even though these women's husbands had mostly died from AIDS, their level of HIV knowledge was poorer than expected. Extending the intervention to include training in advocacy and community mobilisation is also worth considering.A relatively generous allowance was paid to the women to cover travel and childcare costs. This was important in motivating and recruiting women to participate in the intervention at the outset. While we do not know the extent to which the allowance influenced participation, six months after the last PAG meeting most of the groups are still meeting and some have expanded their activities. No allowance is now paid to the women, but support for the meetings is being given by NGOs.Capturing sensitive information such as engagement in HIV risk behaviours proved to be challenging. North-east India is characterised by deeply felt conservative values, which are likely to have made it difficult for the widows to respond to questions about paid or unsafe sex, even though we had processes in place to assure confidentiality. The impact of improved mental health on engagement in HIV risk behaviours is therefore difficult to assess. Further work is required to develop sensitive and valid measures of sexual behaviour among groups such as these: including exploration of the women's perspectives on non-threatening methods for data collection about sexual behaviours, and trying other approaches such as participatory methods or individual narrative interviews with a trusted peer interviewer. Developing more effective methods for gathering information about sexual risk behaviours is essential for future research into the relationship between mental health and engagement in HIV risk behaviours.Finally, the data collection tools had to be translated into the local language and back-translated. The meaning of individual questions in questionnaires such as the WHOQOL-BREF are nuanced and therefore not easy to exactly translate into languages that do not have the spectrum of words to communicate subtle differences in meaning. Imphal and Churachandpur in Manipur are only two hours apart by vehicle, but they do not share a common language, and two different translations were required for that state. Some people are able to read Manipuri when it is written in Manipuri script, while others can only read it in Bengali or transliterated Roman script. Nagamese is a spoken language with no official written form. Accurate translation of the data collection tools was an arduous task and further refinement and validation is warranted. This is typical of the many challenges encountered when trying to undertake quality research in remote settings.ConclusionThis pilot intervention study used a range of innovative approaches to program design, implementation and evaluation in order to reach a vulnerable group of women in a complex development setting with high HIV prevalence. The findings demonstrate that a participatory approach to mental health promotion can have a positive impact on the health and quality of life of vulnerable women. The intervention would benefit from further trialling and refinement and could be made available to other groups such as women living with HIV, the wives of IDUs, and specific sub-groups of widows such as sex workers and IDUs. Further research to evaluate the impact of the intervention on the lives of vulnerable women and to investigate the role of mental health promotion as a strategy for HIV prevention is warranted.AbbreviationsAIDS: Acquired Immune Deficiency Syndrome; DFID: Department of International Development; GHQ12: General health Questionnaire 12; HIV: Human Immunodeficiency Virus; IDUs: Injecting Drug Use/Users; MSC: Most Significant Change; NGO: Non Governmental Organization; PAG: Participatory Action Group; PAR: Participatory Action Research; WHO: World health Organization; WHOQOL BREF: WHO Quality of Life Abbreviated tool.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsHH, AD and MK were involved in conception of the study. HH, AD, MK and PC were involved in design, implementation and data analysis of the study. BD and TG were involved in the implementation and data analysis of the study. MK drafted the paper with contributions from AD, HH and PC. All authors read and approved the final manuscript.Table 5Proportion of participants with a possible common mental disorder as assessed by GHQ12 (using 3/4 cut-off) at the beginning and end of the intervention by stateManipurNagalandTotalPrePostp valuePrePostp valuePrePostp value70%49%NS70%30%0.0470%42%<0.0126/3718/3723/336/2049/7024/57Table 6Somatic complaints at the beginning and end of the interventionSomatic symptom groupManipurNagalandTotalPre (SD)Post (SD)p valuePre (SD)Post (SD)p valuePre (SD)Post (SD)p valuePain8.6 (2.9)7.4 (3.2)NS n = 2610.0 (1.7)8.7 (2.4)= 0.04 n = 169.3 (2.5)7.9 (3.0)<0.01 n = 42Sensory sensations16.9 (6.1)15.6 (5.4)NS n = 1616.0 (4.7)12.0 (3.5)= 0.01 n = 816.7 (5.6)14.5 (5.1)NS n = 24Bodily functions7.0 (2.9)6.2 (2.5)NS n = 237.5 (3.6)7.6 (1.9)NS n = 87.1 (3.0)6.6 (2.4)NS n = 31Reproductive health3.3 (2.4)5.4 (4.1)= 0.02 n = 274.4 (2.7)3.0 (2.5)NS n = 113.7 (2.5)4.7 (3.8)NS n = 35NS = not significant at p < 0.05.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533323.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533323",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533323\nAUTHORS: Bonaventura Bolíbar, Clara Pareja, M Pilar Astier-Peña, Julio Morán, Teresa Rodríguez-Blanco, Magdalena Rosell-Murphy, Manuel Iglesias, Sebastián Juncosa, Juanjo Mascort, Concepció Violan, Rosa Magallón, Javier Apezteguia\n\nABSTRACT:\nBackgroundPreventive activities carried out in primary care have important variability that makes necessary to know which factors have an impact in order to establish future strategies for improvement. The present study has three objectives: 1) To describe the variability in the implementation of 7 preventive services (screening for smoking status, alcohol abuse, hypertension, hypercholesterolemia, obesity, influenza and tetanus immunization) and to determine their related factors; 2) To describe the degree of control of 5 identified health problems (smoking, alcohol abuse, hypertension, hypercholesterolemia and obesity); 3) To calculate intraclass correlation coefficients.DesignMulti-centered cross-sectional study of a randomised sample of primary health care teams from 3 regions of Spain designed to analyse variability and related factors of 7 selected preventive services in years 2006 and 2007. At the end of 2008, we will perform a cross-sectional study of a cohort of patients attended in 2006 or 2007 to asses the degree of control of 5 identified health problems. All subjects older than16 years assigned to a randomised sample of 22 computerized primary health care teams and attended during the study period are included in each region providing a sample with more than 850.000 subjects. The main outcome measures will be implementation of 7 preventive services and control of 5 identified health problems. Furthermore, there will be 3 levels of data collection: 1) Patient level (age, gender, morbidity, preventive services, attendance); 2) Health-care professional level (professional characteristics, years working at the team, workload); 3) Team level (characteristics, electronic clinical record system). Data will be transferred from electronic clinical records to a central database with prior encryption and dissociation of subject, professional and team identity. Global and regional analysis will be performed including standard analysis for primary health care teams and health-care professional level. Linear and logistic regression multilevel analysis adjusted for individual and cluster variables will also be performed. Variability in the number of preventive services implemented will be calculated with Poisson multilevel models. Team and health-care professional will be considered random effects. Intraclass correlation coefficients, standard error and variance components for the different outcome measures will be calculated.\n\nBODY:\nBackgroundThe Spanish National Health Service (NHS) provides universal cover and is financed, essentially, by general taxes. The system is divided into primary and secondary care. Primary care (PC) is organized as a network of primary health care teams (PHCT) that behave as geographical and administrative units where PC services are planned, managed and provided for a population ranging from 5,000 to 25,000 citizens. The PHCT staff includes: general practitioners (GPs), paediatricians, nurses, social workers, dentists and ancillary staff. GPs care for individuals older than 14 years (except in rural areas where they look after all members of the local population) and paediatricians look after those between 0 and 14 or 16 years, depending on the region. These clinicians act as gate-keepers for the rest of the public health care system. The PHCT works usually in a single health care centre but in rural areas there may have other small offices.Secondary care includes out-patient and in-patient hospital care and out-patient care in multi-disciplinary clinics.The Spanish NHS has been strongly decentralized into 17 Autonomous Communities or regions that configure the Spanish State. Each of these regions has its own governmental structure which, among other responsibilities, provides health-care services to the population. There are minor differences between them with respect to structure and administration. For example, in Aragon and Navarra all services are provided by the State-funded regional service while in Catalonia, the provision of primary care services is offered by different providers (state and non-state funded) among which the Catalan Health Institute (ICS) manages almost 80% of all PHCT. According to latest census of the year 2002, Aragon had a population of 1,209,888 inhabitants while Navarra had 560,235 inhabitants and Catalonia 6,418,387.Preventive services in Primary CarePC is the most accessible health-care level to the general population. In Spain, more than 95% of the population visit their GP at least once in every 5 years. No other health-care level is in a better position to evaluate the global health status of the individual and to decide when to act and what are the ideal measures to take in each specific situation [1].There is an increasing evidence of the health benefits achieved from the implementation of preventive measures in normal clinical practice. In the last quarter of the century several groups of experts such as the Canadian Task Force on Periodic Health Examination in 1979 [2] and the US Task Force in 1980 [3,4] have published evidence-based recommendations regarding the relevance and the outcomes of the implementation of preventive interventions. Prestigious institutions such as WHO and the Royal College of General Practitioners [5] have highlighted the valuable role of health-care professionals within PCHTs in developing these services.In Spain, the Spanish Society of Family and Community Medicine [Sociedad Española de Medicina de Familia y Comunitaria; semFYC] launched in 1988 the Preventive Activities and Health Promotion Program [Programa de Actividades Preventivas y de Promoción de la Salud; PAPPS] that have as main objective promoting the implementation of preventive and health promotion services in PC [6]. The EUROPREV (European Network for Prevention and Health Promotion in Family Medicine and General Practice) was created to extend and coordinate the experiences from this program and to promote preventive services at the European level.In the period between 1989 and 2003 PAPPS program carried out biennial evaluations of a representative sample of patients attending the PHCTs participating in the program (671 PHCT since the beginning of the program). These evaluations have been the only evaluations of preventive services carried out nation-wide and provide information on the progress and effectiveness of the program over its 15 years of existence [7-9]. From the studies we know that the best-implemented group of preventive services is the minimum package of the adult sub-program which includes screening for hypertension, smoking status and alcohol consumption (done in 92.8% of patients), followed by a second group that includes anti-influenza vaccination, screening for hypercholesterolemia and obesity and anti-tetanus vaccination (done in more than 70% of patients) [8].However, the progressive implementation of systematic evaluations of primary care performance promoted by the Autonomous health administrations and the progressive computerization of clinical records has brought-about a re-thinking of this evaluation model. The computerization of clinical records provides rich information based on individual data (not centre aggregated data) on a wider and more representative sample that avoids manual and voluntary recording of data. This allows a better study of the clinical practice variability (CPV) and its determining factors.Clinical practice variability in preventive services in Primary CareIn Spain, there have been few nation-wide population studies evaluating CPV in PC. This has been due, in part, to the lack of reliable information systems. These studies have often been performed at a hospital level because of the existence of minimum basic data sets (MBDS) provided on discharge from hospital. Nevertheless, from the existing evaluations, PAPPs studies [8,9] and other national [10-13]and international [14-16] studies it is clear that there are important difficulties with respect to the correct implementation of preventive services and health promotion interventions and there is a high variability in their implementation. There is extensive literature on factors related to prevention of specific diseases but less related to implementation of a combination of preventive services as routine clinical practice in PC that may have a profound effect on different diseases. These factors vary considerably, depending on the type of study, the country and type of preventable disease. There are different factors associated with the supply and demand of services that result in elevated variability between and within centres: patient-related factors (socio-demographic and clinical factors), health professional associated factors (specialty, training and professional competence, number of years working with the PHCT), team related factors (existence of specific registries, workload, frequency of doctors encounters, teaching centre) and other health-care provision system characteristics [12].High CPV translates into problems of clinical effectiveness and social efficiency in health-care provision and, as such, is of concern to health-care providers and to Society in general [17,18]. An analysis of CPV is therefore essential in decision making in the health-care provision politics and prioritization in clinical management (e.g. to generate guidelines for implementation in those areas of high clinical variability).Hence, it is essential to have studies that include a territory-wide sampling in order to achieve greater representativeness and which take into account methods of design and statistical analysis (e.g. cluster-based analyses) to obtain valid estimates and to explore the influence of patient, health-care professional and PHCT characteristics on the CPV of preventive services in Spain.Sources of information in Primary Care: the computerization of clinical recordsPrimary Care uses electronic clinical records (ECRs) to monitor health problems and to register preventive care services. Although information collection intends to be comprehensive, the ECR systems are different for each region.Routinely-collected data have undisputed advantages in the study of CPV; they are available almost instantaneously and provide information on a large number of patients. The creation of registries or databases of health-care interest in PC was given a considerable boost with the computerization of clinical records. Spain, contrary to other countries [19-23], has little experience in the use of nation-wide databases containing electronic clinical records in PC. Recently, projects such as the BIFAP project in pharmacoepidemiological research [24] have been initiated in Spain.However, there are certain difficulties in their use: 1) The data was originally collected for a function different from current research requirements; 2) ECR systems are different in each region, with different standards and computer programs; 3) The heterogeneous degree of implementation in PHCTs; and 4) The degree of exhaustivity of data recorded (for example, some activities are carried out but are not registered). Nevertheless, the potential of this type of registry has been confirmed by different European experiences mentioned earlier [25-27]. As such, the advantages associated to computerization of clinical records are beginning to be appreciated by the different regions and the richness of information provides enormous potential for the study of CPV in primary care.Intraclass correlation coefficientReports of cluster randomised studies [28] should include sample size calculations and statistical analyses that take clustering into account. The intraclass correlation coefficient (ICC) is a measure of the relatedness of clustered data [29]. Compared with individual randomisation, cluster randomisation may substantially increase the sample size required to maintain adequate statistical power [30].One of the problems that needs to be faced in designing cluster-based studies (area or organization-based studies) is that estimates of ICC and components of variance for the outcomes of interest need to be obtained from previous studies in order to determine the required sample size for the cluster design [30-32]. There have been repeated calls for publication of ICCs for these types of studies to help others who are planning cluster-based studies [29,33-35].The differences [30] in ICCs among potential outcome variables, the paucity of appropriate information [36] concerning components of variance or ICC and the lack of data obtained from PC settings reinforce the need for valid estimates that would ensure proper study design.Study objectivesThe planned objectives in the present study are:- To describe the variability in the performance of 7 preventive services (detection of smoking status and excessive alcohol consumption; screening for hypertension, obesity and hypercholesterolemia; anti-influenza and anti-tetanus immunization) in a population older than 16 years of age receiving attention in years 2006 or 2007 and to analyse factors related to their implementation.- To analyse the evolution of 5 identified health problems (decrease in consumption or abstention from tobacco and alcohol and degree of control of hypertension, hypercholesterolemia and obesity) up to December 2008 in the population older than16 years of age attended by the reference PHCT at least once between 2006 and 2007 and followed up during 2008.- Estimate the ICC, together with the within-cluster and between-cluster components of variance for each of the outcome measures of interest at the PC level.Methods/DesignDesignThis is a multi-centered cross-sectional study of a randomised sample of PHCT stratified by region to describe the variability in the implementation of 7 preventive services and their related factors in the period of 2006 or 2007. In 2008, using another cross-sectional study, the evolution or degree of control of 5 of the identified health problems will be assessed, together with the determinants of variability. We use a longer period of study because we need more time to evaluate the impact on the degree of control of these health problems due to changes on life styles.SettingThe study is set in PHCTs computerized prior to 1st of January 2005 in the regions of Aragón, Navarra, and Catalonia. So far computerization had occurred in 19% of 121 PHCTs in Aragón, 76% of 54 PHCTs in Navarra, and 97.5% of 278 PHCTs in Catalonia (at the Catalan Health Institute).Study population: PHCT and patientsWe performed random cluster sampling stratified by region with computerized PHCT used as unit of randomisation.The inclusion criteria of the PHCT are: 1) computerization of the clinical records before the 1st of January 2005 to ensure familiarity with the system's use; 2) wide use of ECR, and 3) agreement to participate in the study by most of the health-care professionals working in each PHCT (> 80%).For each computerized PHCT we select the ECRs of all subjects older than16 years as the unit of data collection. For the assessment of variability, the ECR of subjects receiving attention at least once in each of the study years will be extracted from the database. It is estimated that the average number of subjects receiving attention per year is around 70%. Thus in a PHCT in Aragon this figure would be around 10,000 patients, in Navarra around 7,500 and in Catalonia around 12,000. For the analysis of the evolution of health problems and related factors, subjects visited at least on one occasion during the 2006–2007 period and on a further occasion in 2008 will be included.Sample size and randomisationTo achieve the equivalent power of a patient-randomised design, in a cluster randomised design the effective sample size will need to be the standard sample size of a single random sampling multiplied by the design effect [31,37,38]. The design effect is a function of the average cluster (computerized PHCT) size and the (intraclass correlation coefficient (ICC) of the outcome:design effect = 1 + (n-1)*ICCwhere n is the average number of individuals sampled per cluster [38].sWith the cluster design we set an ICC of 0.05 on the assumption that the ICCs estimated for outcome variables from PC are less than 0.05 [28,36,39] and that the average number of individuals sampled per centre is at least of 2,500. Therefore 20 computerized PHCTs are necessary from each region to guarantee a statistical power of 80%, assuming a 50% event rate with an alpha two-tailed significance level of 0.05. Finally, to allow any of the randomised computerized PHCTs declining our offer to participate, we increased the number of computerized PHCTs selected from each region to 22. As such, the total number of subjects included will be more than 300,000 in Aragón, 200,000 in Navarra and 350,000 in Catalunya i.e. more than 850,000 subjects in total. This volume of subjects ensures a good estimate of the different outcome measures in the sub-groups of each cluster.The selection of computerized PHCT to participate in the study is by a simple random sample within each region. Sample size calculation and computerized PHCT selection is performed with Epidat 3.1.Outcomes and others measuresPrimary outcome measuresThe primary outcome measures relating to objective 1 include the description of the implementation of preventive services according to the PAPPS criteria [6].Screening for smoking status: if there is information on the consumption of tobacco over the last two years in members of the population who previously were non-smokers.Screening for excessive alcohol consumption: if there is information on the consumption of alcohol over the last two years in members of the population who previously were not high consumers of alcohol.Screening for obesity: if there have been measurements of height and weight or body mass index (BMI) over the last 4 years in members of the population who previously were non-obese.Screening for hypertension: if there is information on systolic blood pressure (BPS) and diastolic blood pressure (BPD) during the last 4 years in members of the population aged between 16 and 40 years who previously did not have the diagnosis of hypertension; or over the past 2 years in members of the population older than 40 years who previously did not have the diagnosis of hypertension.Screening for hypercholesterolemia: if there is information on total blood cholesterol corresponding to the following criteria of age and gender: 1 measurement in males between 16–35 years old; 1 measurement in females between 16–45 years old; 1 measurement every 5 years in males between 35–75 years old; 1 measurement every 5 years in females between 45–75 years old; 1 measurement if there has not been a previous measurement in those older than 75; all of these performed in population that previously did not have the diagnosis of hypercholesterolemia.Anti-tetanus vaccination (ATV): if there is a registry of anti-tetanus vaccination over the previous 10 years.Anti-influenza vaccination (AIV): if there is a registry of annual anti-influenza vaccination in those older than 59 years of age.The primary outcome measures relating to objective 2 describes the clinical follow-up of the five health problems identified up to December 31st 2007 and evaluated up to December 31st 2008:Evolution of tobacco consumption: quit smoking or remaining an ex-smoker.Evolution of excessive alcohol consumption: cessation of consumption or decrease below the definition of excessive consumption (28 alcohol units/week in males and 17 alcohol units/week in females, where 1 alcohol unit = 10 grams of alcohol).Evolution of obesity: decrease in BMI to <30 kg/m2 or change in the diagnosis to non-obese.Evolution of hypertension: mean of the last 2 determinations of systolic BP/diastolic BP registered as being ≤ 130/80 mmHg in patients of high risk (diagnosed with diabetes, renal or cardiac insufficiency) and ≤ 140/90 mmHg in the rest of the population.Evolution of hypercholesterolemia: last measurement of LDL cholesterol registered as being ≤ 100 mg/dL in high-risk patients (diagnosed with diabetes, ischaemic heart disease or cerebrovascular accident) and ≤ 130 mg/dL in the rest of the population.Secondary outcome measuresNumber of different preventive services (among the 7 of the study) registered for each individual during the 2006 and 2007 year periods.Other measuresWe assess the following factors related to the outcome measures according to the levels of analysis:Computerized PHCT: variables of structure and organization of the PHCT (number of GPs and nurses, presence of specialists), adherence to PAPPS, training centre for family doctors, ECR system and starting year, assigned population.Health-care professionals (GPs, nurses): gender, age, specialty, years of employment in PC and in the PHCT, workload (mean number of visits/day), years of experience with ECR.Subjects: gender, age, comorbidity according to the Adjusted Clinical Groups grouper [40,41], frequency of consultations (visits/year).Information sourceThe individual data will be extracted directly from the central computer servers of the ECRs of the subjects included in the study. In Navarra and Aragón the system used is OMI-AP and in Catalonia the eCAP system. The data related to health-care professionals and to PHCT will be obtained from an on-line database for health-care professionals and from a person responsible in each centre.Data extraction and processingUsing the specific interface for each specific computer system (OMI-AP and eCAP), each region will extract the study data and transfer them to a central database where they will be homogenized and processed into a specially-constructed final database.Confidentiality of dataData confidentiality will be assured during and subsequent to the extraction using encryption and dissociation of the individual's identification, health-care professionals, and of PHCTs.Ethical aspectsThe study has been favourably evaluated by the Research Committee of the IDIAP Jordi Gol.Quality controlQuality controls will be carried out in the 2 extractions of data comparing agreement between the central database and the original data of some centres as for: number of patient, visits and diagnoses as well as data of prevalence of certain diseases. It will also be checked if the population data is appropriate by comparing it with data from the census and other official sources. In the case of items related to clinical activities (for example blood pressure measurement), any register with missing values will be considered as not performed.Statistical analysesFor the first two objectives all the analyses will be performed on a global level and each region separately. Cluster level analysis (computerized PHCT and health-care professional) will be performed using standard parametric or non-parametric analytical methods, with cluster means or proportions as observations [37,42]. For the adjusted analysis we will perform regression analysis of individual level data using methods for clustered data, multilevel, hierarchical or random effects models [37,43]. This methodology facilitates simultaneous analyses of the effects of individual and cluster variables in order to evaluate whether the relationship between variables at the individual level varies in accordance with the characteristics of the cluster and whether the individual and cluster variability can be attributed to factors of the cluster and/or to the factors related to the individual. Analysis will be performed at 3 levels: PHCT, health-care professional and individual subjects.Multilevel linear (for continuous outcome variables) or logistic (for dichotomous outcome variables) regression analyses will be performed for the first two objectives. The analyses will be adjusted for explanatory factors at individual, health-care professional and PHCT level and for other variables that are clinically relevant. We will also adjust for possible confounders checking whether they will affect the outcomes. A nested or hierarchical structure will be considered: the attended individuals are nested within the health-care professional and the health-care professional within PHCT. The PHCT and the health-care professional will be considered random effects.Multilevel Poisson regression models will be used to evaluate the number of preventive activities recorded for each individual.For the third objective, the ICCs, their standard errors and the components of variance [36,37,42,43] for the different outcome measures will be calculated using methods that enable adjustment for covariables, together with random effect methods (health-care professionals and PHCT). Initially, we will estimate the coefficients of variance and ICCs using the outcome as the dependent variable and the health-care professional/PHCT as random effects. Subsequently, we will perform an adjusted analysis for the characteristics of the individual, the health-care professional and the PHCT.We will study interactions and collinearity. The collinearity of the maximal models will be evaluated using the criteria proposed by Belsley [44]. We will set the significance level at 1% (two-tailed).Analysis will be carried out using the SPSS statistical package for Windows, version 15 (SPSS Inc., Chicago, IL) and the SAS package 9.1.3 for Windows (SAS Institute Inc., Cary, NC, USA).DiscussionThe project results will provide very useful information on the degree of registration and performance of the 7 preventive services selected. These 7 activities have been widely implemented and have a high impact on the health of our population [2-6]. The large population database of the study, with more than 850,000 people recorded, will increase considerably the external validity of the results and will reflect usual clinical practice at the Primary Care settings in the Spanish NHS.This fact may help to overcome the current limitations and to investigate CPV and the factors that have an impact on the implementation of preventive services.Certainly the source of information used and the ECRs may have limitations. The heterogeneity of current computer systems may complicate the extraction of outcomes and of variables. However, the design of the data extraction interfaces and data transfer will minimize the problems. The lack of exhaustivity in data recording may introduce some distortions in the information. Nevertheless, stability of computer systems at the centres will help to minimize this problem and the quality control measures will help to identify the magnitude of the problem.Studies based on cluster sampling allow important reduction in costs and greater easiness in administration but require knowledge of the ICCs. For this study ICCs has been estimated from studies conducted in other countries. In our study we will provide information concerning the magnitude of the ICC, evaluate factors that influence their magnitude, estimate within-cluster and between-cluster components of variance for the outcome measures under consideration and determine the sample size; all of these factors will aid the design and statistical analysis of future cluster-based studies set in PC.In conclusion, the present study will provide new knowledge in:- The identification of factors related to the variability in the implementation of preventive services, which will facilitate the design of strategies for improvement in the planning and administration of services in PC.- The assessment of the evolution of the detected health problems will improve the degree of existent evidence taking into account the results of screening and the control of those problems. This will be very useful for the evaluation of the PAPPS and other studies based on this source of information.- The estimation of the ICC will be of considerable help in the design, calculation of sample size and analysis of future studies based on the randomisation of clusters in our environment.- Finally, although not being an aim of the project, information will be obtained on the characteristics of the different computer systems and this information will generate recommendations for the standardization of systems for future applications.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsBB and CP are the principal investigators responsible for the conception of the project and drafting the manuscript. TR was in charge of the design of sample calculation and statistical analyses.  MPA, JM, MR, CV, MI, RM, SJ, JMP, and JA contributed to the description of the background, general design and definition of the different study variables and their adaptation to the different computerized clinical records systems.All authors have read and approved the final manuscriptPre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533332.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533332",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533332\nAUTHORS: Simon R Ellwood, Huyen TT Phan, Megan Jordan, James Hane, Anna M Torres, Carmen M Avila, Serafín Cruz-Izquierdo, Richard P Oliver\n\nABSTRACT:\nBackgroundThe development of genetic markers is complex and costly in species with little pre-existing genomic information. Faba bean possesses one of the largest and least studied genomes among cultivated crop plants and no gene-based genetic maps exist. Gene-based orthologous markers allow chromosomal regions and levels of synteny to be characterised between species, reveal phylogenetic relationships and chromosomal evolution, and enable targeted identification of markers for crop breeding. In this study orthologous codominant cross-species markers have been deployed to produce the first exclusively gene-based genetic linkage map of faba bean (Vicia faba), using an F6 population developed from a cross between the lines Vf6 (equina type) and Vf27 (paucijuga type).ResultsOf 796 intron-targeted amplified polymorphic (ITAP) markers screened, 151 markers could be used to construct a comparative genetic map. Linkage analysis revealed seven major and five small linkage groups (LGs), one pair and 12 unlinked markers. Each LG was comprised of three to 30 markers and varied in length from 23.6 cM to 324.8 cM. The map spanned a total length of 1685.8 cM. A simple and direct macrosyntenic relationship between faba bean and Medicago truncatula was evident, while faba bean and lentil shared a common rearrangement relative to M. truncatula. One hundred and four of the 127 mapped markers in the 12 LGs, which were previously assigned to M. truncatula genetic and physical maps, were found in regions syntenic between the faba bean and M. truncatula genomes. However chromosomal rearrangements were observed that could explain the difference in chromosome numbers between these three legume species. These rearrangements suggested high conservation of M. truncatula chromosomes 1, 5 and 8; moderate conservation of chromosomes 2, 3, 4 and 7 and no conservation with M. truncatula chromosome 6. Multiple PCR amplicons and comparative mapping were suggestive of small-scale duplication events in faba bean. This study also provides a preliminary indication for finer scale macrosynteny between M. truncatula, lentil and faba bean. Markers originally designed from genes on the same M. truncatula BACs were found to be grouped together in corresponding syntenic areas in lentil and faba bean.ConclusionDespite the large size of the faba bean genome, comparative mapping did not reveal evidence for polyploidisation, segmental duplication, or significant rearrangements compared to M. truncatula, although a bias in the use of single locus markers may have limited the detection of duplications. Non-coding repetitive DNA or transposable element content provides a possible explanation for the difference in genome sizes. Similar patterns of rearrangements in faba bean and lentil compared to M. truncatula support phylogenetic studies dividing these species into the tribes Viceae and Trifoliae. However, substantial macrosynteny was apparent between faba bean and M. truncatula, with the exception of chromosome 6 where no orthologous markers were found, confirming previous investigations suggesting chromosome 6 is atypical. The composite map, anchored with orthologous markers mapped in M. truncatula, provides a central reference map for future use of genomic and genetic information in faba bean genetic analysis and breeding.\n\nBODY:\nBackgroundFaba bean (Vicia faba L.) is currently the third most important cool-season food legume in the world. Faba bean provides an important source of dietary protein in human diet, edible oil and animal feeds. Like other grain legumes, faba bean contributes to sustainable agriculture in the management of soil fertility and plays an essential role in crop rotation. Faba bean is a diploid with 2n = 2x = 12 chromosomes [1,2], is partially cross-pollinated ranging from 4 to 84% [3], and possesses one of the largest genomes among crop legumes (~13000 Mb). The development of saturated linkage maps as well as the identification and map-based isolation of important qualitative traits or quantitative trait loci is therefore complex and expensive.A saturated genetic linkage map provides an invaluable tool in plant genetic studies and practical breeding. One of the first genetic linkage maps of faba bean was constructed by Van de Ven et al. [4] with only 17 markers; followed by successively more detailed genetic maps by Torres et al. [5] with 51 markers, Satovic et al. [6] with 157 markers, Vaz Patto et al. [7] with 116 markers, Roman et al. [8] with 121 markers, Roman et al. [9] with 192 markers and Avila et al. [10] with 103 markers. To date, faba bean genetic maps have been restricted to morphological, isozyme, RFLP, RAPD, a few seed protein genes and four SSR markers. These markers have been limited either in number, transferability or in their ability to provide syntenic information with other legume species.The recent generation of abundant genomic and genetic resources focussed around the model species Medicago truncatula and Lotus Japonicus has opened up abundant opportunities for creating gene-based molecular markers that are ideal for genetic mapping in general and comparative mapping in particular [11-16]. In this approach, oligonucleotide primers were designed from sequences of conserved regions in gene exons that flank polymorphic regions such as introns or microsatellites. This PCR-based, codominant marker system has remarkably increased the efficiency of transferring genetic information across species. Examples include the comparison of M. truncatula with alfalfa, pea, chickpea, soybean, mung bean, lentil and lupins [12-18].Comparative genomic studies can expose and confirm phylogenetic relationships among species and determine patterns of chromosomal evolution and syntenic relationships. More importantly, comprehensive comparative genomics can facilitate back-and-forth use of genomic resources between different legumes species, and help to reduce cost and increase efficiency in genetic research as well as crop breeding. The use of conserved genome structure to assist in transferring knowledge among related plant species is well established in grasses [19,20] where synteny greatly assists in gene identification among related species.In this paper we report: (1) the application of gene-based markers in faba bean; (2) the development of the first exclusively gene-based genetic and comparative map for the species; (3) analysis of syntenic relationship between faba bean and M. truncatula; and (4) the levels of homology existing between faba bean, M. truncatula and lentil, a closely related species to faba bean.MethodsGenetic mapping populationA gene-based genetic map of faba bean genome was constructed using a population of 94 F6 RILs generated from a cross between faba bean line Vf6 (equina type) as the pollen recipient and line Vf27 as pollen donor (paucijuga type). These accessions have been widely used in previous genetic studies [7,9,21] and the population was developed at IFAPA, Centro Alameda del Obispo, in Córdoba, Spain, using diploid parental individuals. Total genomic DNA was isolated from each parent and F6 individual as previously described [22].Primer designA total of 796 intron-targeted amplified polymorphic markers (ITAPs) were used for this study. These were composed of four sets of ITAPs; 340 ML and Lup primers developed from alignment of M. truncatula and Lupinus spp. database EST sequences; 160 MLG primers based on alignments between M. truncatula, Lupinus albus, and Glycine max ([15], with a subset of these denoted AtMtL-); 143 cross-species makers (MP) developed by the Department of Plant Pathology, University of California, Davis, USA [12]; and 140 GLIP markers created by the European Grain Legumes Integrated Project (GLIP) based on primarily on M. truncatula and pea (Andrea Seres, pers. comm.). The majority of the ITAPs markers could be positioned to a physical location in the M. truncatula psuedogenome since most primers were designed from genes in characterized chromosomal regions.Polymorphism detectionEach primer pair was screened on V. faba parental DNA. PCR conditions were optimised to produce clear single amplicons, and single PCR products of the same size were purified and directly sequenced. Different detection methods were used to genotype the F6 population dependent on the type of polymorphism [15]. Details of each marker are given in Additional file 1.Map constructionChi-squared analysis (P < 0.05) was applied to test the segregation of the mapped markers against the expected Mendelian segregation ratio for co-dominant inheritance in the faba bean F6 RIL population. Genetic linkage mapping was conducted with MultiPoint v 1.2 software [23], with a recombination fraction (rf) of 0.29 (LOD = 9.0) using 5000 bootstraps. Map distances were calculated in cM by applying the \"Kosambi\" function. Groups of linked markers that were similarly distorted were accepted for linkage mapping. Independent markers showing significant segregation distortion and markers with missing data (> 10%) were rejected for linkage to avoid bias and false linkages. Genetic maps were drawn with the software program MapChart v 2.1 [24].Establishment of macrosyntenic relationships between faba bean, lentil and M. truncatulaMarkers mapped in faba bean were located on the M. truncatula map by aligning the ESTs originally used to design the ITAPs primers with M. truncatula BACs in the Medicago pseudogenome Mt2.0 build 8/10/2007. Alignments with a BLAST E values < 1e-20, hsp identity ≥ 60%, and hsp length > 50 nt were retained. Precise positions of markers were obtained by aligning the ITAP primer sequences with M. truncatula BACs using BLASTN with an expected value < 1e-4 (primer length varied from 18bp to 28bp). Approximate positions of markers that had been genetically mapped in M. truncatula but not yet positioned on the physical map were obtained from the M. truncatula genetic map [25].Loci dot plot created via Grid MapGrid Map [26] was used to compare the genetic maps of faba bean and M. truncatula. Ordered loci from faba bean and M. truncatula linkage groups were listed vertically and horizontally, respectively, and dots were positioned on the diagram at the intersection of the locations of the corresponding markers in the two genetic maps.ResultsGene-based marker developmentOf the 796 markers screened for amplification in genomic faba bean DNA, 19% produced two or more amplicons of different sizes. Five hundred and seven were selected and optimised for single-locus amplification. Fifty percent (254) of these produced clear single band amplicons (Table 1). Seven markers that produced two amplicons (AIGP, GLIP172, GLIP429, GLIP621, GLIP651, Lup226 and MMK1) and one that produced three amplicons (LG34) were also mapped as they exhibited convenient length polymorphisms. One hundred and sixty-five polymorphic markers were identified (Table 1), of which 151 markers were used to genotype the 94 individuals of the F6 RIL population (supplementary Table 1). Apart from the GLIP markers which were selected for their ability to amplify faba bean genomic DNA before this study, 'MLG' and 'MP' markers worked equally well in faba bean (83% and 84%, respectively) but 'MP' markers produced fewer polymorphic amplicons. Amplification rate of the 'ML' markers was the poorest (34%), less than half the rate of the 'MLG' and 'MP' groups (Table 1). Likewise, the polymorphism level of the 'ML' markers was the lowest. Both 'MLG' and 'GLIP' markers produced very high levels of polymorphism in the mapping parents (70%; Table 1). DNA sequences of markers have been submitted to Genbank under accession codes FH893713 – FH937528.Table 1Efficiency of gene-based markers used to construct the comparative genetic linkage map of faba beanMarker typeScreenedAmplificationaLength polymorphismSequencedbCAPS/SNPcMappedMP143120 (84%)675 (63%)45 (60%)36ML340115 (34%)930 (26%)16 (53%)25MLG160132 (83%)573 (55%)50 (70%)42GLIP140140676 (54%)54 (71%)48Total79650726254165151aFigures in parentheses are percentages of amplified markers of the total markers screened.bFigures in parentheses are percentages of sequenced markers of the total amplified markers.cFigures in parentheses are percentages of polymorphic markers of the total sequenced markers.Nineteen mapped markers (> 12%) deviated significantly (P < 0.05) from the expected Mendelian inheritance ratio of 1:1. About half of these markers (9) were highly distorted (P < 0.01). Fifty percent of the distorted markers segregated in favour of the Vf6 parent and fifty percent in favour of Vf27. Nine of the 12 faba bean LGs contained one to four of these distorted markers, which tended to be scattered throughout the faba bean genome. However, it is noteworthy that distorted markers grouped together in chromosomes FB-1, 7 and 8 (Figure 1).Figure 1A gene-based genetic linkage map of faba bean (Vicia faba L). Marker distance is given in cM. *indicates markers with distorted segregation.The first gene-based and comparative map of Faba beanA total of 151 genic markers were used to generate the first gene-based and comparative map of faba bean. This map was constructed with a recombination fraction of 0.29 [LOD = 9.0, 27]. The map consists of seven main linkage groups (FB-1 to FB-7) and 5 fragments (FB-8 to FB-12), which varied in length from 23.6 to 324.8 cM, and spans a total of nearly 1686 cM (Figure 1 and Table 2). The number of markers per LG ranged from three to 30 markers. In addition, there was one pair and thirteen unlinked markers. Eight markers co-segregated at four loci, (three loci in FB-1, one in FB-3; Figure 1 and Table 2). The maximum distances between markers ranged from 13.8 cM in FB-12 to 40.2 cM in FB-3 with an overall mean gap distance of 14.6 cM (Table 2).Table 2Properties of the faba bean comparative mapLinkage groupLength of LGs (cM)No of markersNo of lociAverage marker spacinga (cM)Largest distance between markers (cM)LG-1324.8302712.532.5LG-2313.1272712.031.8LG-3238.5181714.940.2LG-4210.7131317.629.8LG-5151.9121213.826.8LG-6120.78817.236.9LG-7119.27719.935.9LG-849.96610.029.5LG-964.15516.022.6LG-1041.83315.430.7LG-1127.53313.819.9LG1223.63311.813.8Total1685.8135131aCalculated by dividing the length of the chromosome (cM) by the number of space/distance between markers/loci.Of the 135 genic markers that mapped to the 12 faba bean LGs in Figure 1, 127 were assigned to the M. truncatula genetic or physical maps [25]. One hundred and four of these (82%) were in syntenic regions. Clear evidence of a simple and direct macrosyntenic relationship between the V. faba and M. truncatula is presented in the dot matrix in Figure 2. The formation of clear isoclinic diagonal lines along the linkage groups provides a strong indication of the conservation of gene order in the two legume genomes. The extensive colinearity was particularly prevailing between FB LG 1, 2, 3, 4 and Mt LG 8, 1, 4, 5 where syntenic regions accounted for 90%, 86%, 50% and 47% of the M. truncatula pseudogenome, respectively (Table 3).Figure 2Matrix plot of common gene-based markers mapped in faba bean and M. truncatula. The faba bean and M. truncatula loci are listed vertically and horizontally, respectively, according to their linkage group order.Table 3Colinearity between the faba bean and M. truncatula genomesFB LGNo. of markersNo. of non-orthologous markersNo. of unassigned markersCurrent Mt genetic coverage (LG: cM, No. colinear markers)1,2Current Mt pseudogenome coverage (bp)1Current faba bean genetic coverage (cM)2FB-130628: 0 – 68.2, 118: 736241 – 32433863 (90%)0 – 324.8 (100%)FB-227421: 0 – 58.5, 9 7: 58.4 – 60, 31: 59849 – 26963044 (86%) 7: 25725918 – 26383168 (2%)152.6 – 313.1 (51.3%) 157.1 – 210.7 (25.4%)FB-318134: 48.1 – 59, 114: 14544831 – 34128326 (50%)0 – 238.5 (100%)FB-413205: 0 – 32, 6 2: 12.7 – 37.9, 35: 594897 – 17960204 (47%) 2: 8491236 – 15201671 (24%)0 – 142 (67%) 250.5 – 256.3 (1.9%)FB-512113: 28 – 70.3, 93: 10888141 – 28213807 (46%)0 – 140.3 (92%)FB68401: 2 – 2.2, NA1: 4942324 – 5151182 (0.7%)-FB-77007: 22.6 – 52.8, 47: 9999559 – 22150020 (38%)0 – 58.9 (49%)FB-86102: 48 – 57.8, 52: 17523205 – 20646361 (11%)0 – 49.9 (100%)FB-95003: 62 – 72.5, 53: 19000000* – 30712150 (31%)0 – 64.1 (100%)FB-103104: 0 – 7.4, NA4: 537530 – 3489843 (8%)-FB-11330NANA-FB-123004: 60.4 – 61.1, NA4: 36664007 – 38186081 (4%)-NA: not applicable1Data was either based on information from M. truncatula genome sequencing website [25] or from Choi et al. [12].2Data is provided for three or more colinear markers and excludes markers on the same chromosome rearranged relative to the order in M. truncatula.However, chromosomal rearrangements were also evident at a moderate level. For example, M. truncatula chromosomes 1 and 7 together with 5 and 2 merged to form the faba bean LGs 2 and 4, respectively. Similarly, M. truncatula chromosome 2 splits into FB- 4 and 8 and M. truncatula chromosome 3 into FB-5 and 9 (Table 3 and Figure 2). Inversions and translocations were also notable among the orthologous markers within each syntenic pair of faba bean and M. truncatula LGs (Figure 2).Evidence of macrosynteny among faba bean, lentil and Medicago truncatulaA high level of co-linearity was found between the faba bean, lentil and M. truncatula genomes based on the macro-synteny established between faba bean and M. truncatula (this study) or lentil and M. truncatula [15] using only common orthologous markers which mapped in all three species (Figures 3 and 4). The pattern of homology between faba bean and M. truncatula was similar to that between lentil and M. truncatula: for example, two linkage groups FB-1 and Len-II were exclusively syntenic to M. truncatula LG_8 and shared seven markers in common. Common markers were evenly distributed in all the three corresponding LGs suggesting that FB-1 and Len-II are essentially co-linear (Figure 3A). Likewise, FB-2 and Len-III were both syntenic to Mt-1 and orthologous to each other with nine markers in common (Figure 3B). Other examples are FB-3, Len-I and Mt-4; and FB-4, Len-V and Mt-5 (Figure 2, 4A and Phan et al., 2007 [15]). FB-5 and FB-9 were co-linear with lentil Len-VII and LenVI, respectively, and both pairs of these linkage groups were colinear with Mt-3 (Figure 4B). This suggests shared ancestral chromosomal changes in faba bean and lentil compared to M. truncatula and confirms their phylogenetically closer relationship.Figure 3Evidence of shared macrosynteny between V. faba chromosomes FB-1 and FB-2, L. culinaris and M. truncatula. Common orthologous markers are depicted by dashed lines and marker distances are provided in centi-Morgans for M. truncatula only. The figures exclude markers that could not be positioned in the M. truncatula psuedogenome. A ~ indicates markers that map distally in the corresponding M. truncatula chromosome relative to faba bean, and markers suffixed a, b or c denotes derivation from primer pairs that produced multiple PCR products.Figure 4Evidence of shared macrosynteny between V. faba chromosomes FB-3 and FB-5, L. culinaris and M. truncatula. Common orthologous markers are depicted by dashed lines and marker distances are provided in centi-Morgans for M. truncatula only. The figures exclude markers that could not be positioned in the M. truncatula psuedogenome. Markers highlighted * were previously mapped [18] but not positioned in the M. truncatula psuedogenome. # indicates markers orthologous between lentil and faba bean but unmapped in M. truncatula and markers suffixed a, b or c denotes derivation from primer pairs that produced multiple PCR products.Evidence of fine scale macrosynteny on individual BACs between faba bean, lentil and Medicago truncatulaSeveral ITAP markers used in this study were designed from different genes on the same M. truncatula BACs. These markers often mapped in clusters in two or more species and in common syntenic regions of corresponding linkage groups. An example is shown in Figure 3A with markers LG89-LG98 designed from M. truncatula BAC AC140032 and LG83-LG88 from M. truncatula BAC AC138131 in M. truncatula chromosome 8. Similarly, with the exception of LG34c, markers LG31-LG43 designed from M. truncatula BAC AC152751 in Mt chromosome 1 were located in one area of FB-2 and Len-III as shown in Figure 3B; markers AnMtL6-AnMtL8 and LG102-LG112 from M. truncatula BAC AC147712 and AC135800 in Mt chromosome 3 were grouped together on corresponding pairs of LGs i.e. FB-5 and Len-VII and FB-9 and Len-VI; respectively (Figure 4B).Discussion and conclusionThe first genetic map of faba bean composed exclusively with gene-based co-dominant molecular markers was constructed using a F6 RIL population between lines Vf6 and Vf27. The map is also the first to enable the establishment of syntenic relationships between faba bean and the model legume M. truncatula, comparison with other legume species, and integration with genetic maps available in faba bean.The map is composed of 12 linkage groups and 151 genetic markers. Although the number of chromosomes in faba bean has been reported as 2n = 12 [2], the number of linkage groups in recent genetic maps in the species range from 13 to 18 [7-10] and previously as many as 48 have been reported [6]. The high number of linkage groups compared to the number of chromosomes may be due to the fact that faba bean possesses one of the largest genomes among cultivated legumes (~13000 Mb). This compares with other well-characterised species such as M. truncatula, chickpea, soybean, lentil and pea which have genomes of ~450 Mb, ~740 Mb, ~1200 Mb, ~4000 Mb and ~4000 Mb respectively [28].Of the 24 non-orthologous markers found in this study, eight were from primer pairs where more than one PCR gel band was present and where two or more such amplicons were mapped. In each case, at least one amplicon mapped syntenically. The percentages of markers sequenced in faba bean were lower compared to lentil (63%, 26% and 55% compared to 93%, 69% and 65% for MP, ML and MLG markers respectively, Table 1). This was due to higher proportion of markers amplifying multiple bands in faba bean compared to lentil (data not shown), which may imply duplication. Differences in amplification, sequencing and polymorphism rates among different types of markers used for this study reflect the mode of design of the markers. Since 'MP' and 'MLG' markers were often based on the homology of more than two phylogenetically distant species, they are more likely to work in different legume lineages. The same observation was reported for these primer sets in lentil [15].Despite the large differences in genome sizes between M. truncatula and V. faba, a simple and direct relationship between the two genomes was identified in this study. Given the number of markers used (151), the syntenic regions cover a large proportion of M. truncatula pseudogenome with 90%, 87%, 66%, 62% and 47% for M. truncatula chromosomes 8, 1, 3, 4 and 5, respectively (Table 3). The appearance of clear isoclinic diagonal lines along the linkage groups in Figure 2 also demonstrates strong evidence for the extensive co-linearity between linkage group pairs of the two species. Similar high levels of conservation have also been reported between L. culinaris ssp. culinaris and M. truncatula [15] and other closely related legumes such as L. culinaris ssp. culinaris and P. sativum [29], M. sativa and P. sativum [30], M. truncatula and P. sativum [17], M. truncatula and M. sativa [11]. This study also shows markers originally designed from genes on the same BAC clustered in corresponding syntenic areas in lentil and faba bean. The mapping populations were too small to resolve marker order in lentil and faba bean but extensive conservation of gene order,(and microsynteny) has been shown in previous studies between other legume species at similar or greater phylogenetic distances [12,31-34], and to some extent between M. truncatula and Arabidopsis [33-35].A higher level of homology between V. faba and L. culinaris ssp. culinaris compared to that between V. faba and M. truncatula could be inferred from this study based on the common markers mapped in the two genomes, common homology with M. truncatula and similar pattern of rearrangements (Figures 3, 4 and Phan et al., 2007 [15]). This finding agrees with phylogenetic studies that place the genera Vicia, Lens and Pisum within the tribe Viceae while Medicago and Melilotus form a parallel tribe Trifolieae within the Galegoid or cool season legumes [36], and is consistent with different levels of macrosynteny observed between M. truncatula, P. sativum, V. radiata, G. max, and Phaceolus vulgaris dependent on phylogenetic distance [12]. However, chromosomal rearrangements were evident (Figures 2 and 3).Rearrangements involving Mt6 and Mt3 in particular may explain the differences in chromosome number between the two species (M. truncatula: n = 8; V. faba: n = 6). Mt6 might be considered unusual and is largely composed of heterochromatic DNA [37], contains few transcribed genes [11] and a large proportion of resistance gene analogues [38]. In this study no corresponding linkage group was detected in faba bean, as found previously in pea [12] and lupin [13,14], together with less than five percent estimated coverage by the L. japonicus genome [34]. In faba bean FB5 and FB9 appear to correspond to Mt3. This configuration is supported by a similar pattern in lentil (Figure 4B and Phan et al., 2007 [15]), although a larger number of markers are needed to confirm this.The faba bean comparative map constructed here is consistent with the pattern of chromosome conservation previously observed, where different levels of conservation were found to be relatively consistent between M. truncatula and other legume species i.e. high conservation of M. truncatula chromosomes 1, 5 and 8; moderate conservation in the M. truncatula chromosomes 2, 3, 4 and 7 and lowest conservation in the M. truncatula chromosome 6 (Figures 3, 4 and [39]). As described above, no homology was identified with M. truncatula chromosome 6 in this study. The alignment of this faba bean map with lentil and the current M. truncatula genome based on M. truncatula genome assembly Mt2.0 is slightly different to that based on an earlier assembly [15]. The changes can be observed in Figure 3B where orthologous markers which were syntenic to M. truncatula chromosome 6 in lentil are now co-linear with M. truncatula chromosome 1 in common with faba bean.Genome studies have demonstrated different factors are responsible for genome size variation and speciation. These include ancient polyploidisation events in the case of the Brassicas [40]; segmental or region-specific duplication [41]; and genetic rearrangements, transposable element amplification, or combination of different genome modifications [42]. Large scale rearrangements, duplications, or polyploidisation were not apparent in this study, possibly as a result of the focus on single locus markers, however differences in non-coding repetitive DNA or transposable elements provide a possible explanation for the large differences in genome size. Retroelements are known to account for substantial proportions of these Viceae genomes as shown by extensive studies in pea, for example [43,44], and more recently Vicia [45,46]. Local genic rearrangements similar to that in found in the grasses (duplications, translocations, and insertions or deletions) may explain multiple PCR amplicons [19,20].The shared macrosynteny among the three species demonstrated here and even higher level of homology between L. culinaris and V. faba will undoubtedly facilitate the identification of markers closely linked to traits of interest in V. faba. Alignment of this map with existing faba bean maps containing important traits with polymorphic SSR markers and/or markers developed in this study, coupled with cross-reference to the abundant genetic information from the Medicago genome sequencing and extensive EST libraries available for the model legume species, will undoubtedly assist this process. As the parental line Vf6 has been used in a number of genetic and QTL mapping projects [6,7,9], this map can serve as a central reference map. This study has provided a number of significant outcomes for faba bean genomics and legume genomics in general.Authors' contributionsSE and RPO designed the research. HTTP and SE wrote the manuscript. HTTP, SE and MG performed marker polymorphism discovery and population genotyping in Perth. JH assisted with informatics procedures. AMT, CMA and SC-I were involved in developing recombinant inbred lines and marker polymorphism discovery of GLIP markers in Córdoba. All authors read and approved the final manuscript.Supplementary MaterialAdditional file 1Supplementary table 1. Orthologous PCR markers developed in this study and genetically mapped in a F6 faba bean population between lines Vf6 and Vf27.Click here for file\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533650.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533650",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533650\nAUTHORS: Kyriacos N Felekkis, Panayiota Koupepidou, Evdokia Kastanos, Ralph Witzgall, Chang-Xi Bai, Li Li, Leonidas Tsiokas, Norbert Gretz, Constantinos Deltas\n\nABSTRACT:\nBackgroundAutosomal Dominant Polycystic Kidney Disease (ADPKD) is characterized by the formation of multiple fluid-filled cysts that destroy the kidney architecture resulting in end-stage renal failure. Mutations in genes PKD1 and PKD2 account for nearly all cases of ADPKD. Increased cell proliferation is one of the key features of the disease. Several studies indicated that polycystin-1 regulates cellular proliferation through various signaling pathways, but little is known about the role played by polycystin-2, the product of PKD2. Recently, it was reported that as with polycystin-1, polycystin-2 can act as a negative regulator of cell growth by modulating the levels of the cyclin-dependent kinase inhibitor, p21 and the activity of the cyclin-dependent kinase 2, Cdk2.MethodsHere we utilized different kidney cell-lines expressing wild-type and mutant PKD2 as well as primary tubular epithelial cells isolated from a PKD transgenic rat to further explore the contribution of the p21/Cdk2 pathway in ADPKD proliferation.ResultsSurprisingly, over-expression of wild-type PKD2 in renal cell lines failed to inactivate Cdk2 and consequently had no effect on cell proliferation. On the other hand, expression of mutated PKD2 augmented proliferation only in the primary tubular epithelial cells of a rat model but this was independent of the STAT-1/p21 pathway. On the contrary, multiple approaches revealed unequivocally that expression of the cyclin-dependent kinase inhibitor, p57KIP2, is downregulated, while p21 remains unchanged. This p57 reduction is accompanied by an increase in Cdk2 levels.ConclusionOur results indicate the probable involvement of p57KIP2 on epithelial cell proliferation in ADPKD implicating a new mechanism for mutant polycystin-2 induced proliferation. Most importantly, contrary to previous studies, abnormal proliferation in cells expressing mutant polycystin-2 appears to be independent of STAT-1/p21.\n\nBODY:\nBackgroundAutosomal Dominant Polycystic Kidney Disease is the most common hereditary renal disorder with a prevalence of at least 1:1000 and accounts for 8%–10% for all end-stage renal failure [1]. The disease is characterized by the formation of large fluid-containing renal cysts that grow over time and destroy the renal parenchyma.It is believed that cysts originate from tubular epithelial cells that exhibit increased proliferation and reduced differentiation. This may happen after a second somatic hit occurs that inactivates the PKD1 or the PKD2 allele inherited from the healthy parent [2-4]. Microdissection of cystic kidneys revealed that cyst growth is due to an increase in cell number and not to the stretching of the cyst wall. In addition, tubular epithelial cells cultured from ADPKD cysts display augmented levels of proliferation and upregulation of proliferation-associated genes such as c-Myc, Ki-67 and PCNA [5-8]. The role of polycystin-1 (PC-1), the protein product of PKD1, in the proliferation of tubular epithelium has been documented. Polycystin-1 has been implicated in a variety of pathways tied to proliferation, including G-protein signaling, Wnt signaling and AP-1. [9-12]. Direct evidence about the involvement of PC-1 in cell cycle regulation was demonstrated by the observation that PC-1 overexpression activates the JAK2/STAT-1 pathway, thereby up regulating p21waf1 and inducing cell cycle arrest in G0/G1 in a process requiring functional polycystin-2 (PC-2). Based on these results it was postulated that mutations in either gene could result in deregulated growth [13].Polycystin-2 has been implicated in cell cycle regulation mainly through its calcium channel activity and its ability to activate transcription factor AP-1 [14-16]. However, there was little direct evidence linking polycystin-2 to cellular proliferation. Recently, PC-2 was directly tied to cell cycle regulation through direct interaction with Id2, a member of the helix-loop-helix (HLH) proteins that are known to regulate cell proliferation and differentiation. Overexpression of wild-type PC-2 in kidney cell lines induced cell cycle arrest at G0/G1, through upregulation of p21 and subsequent inhibition of Cdk2 kinase activity. This process was dependent on both PC-2-Id2 interaction and PC-1-dependent phosphorylation of PC-2. Although inhibition of Id2 expression corrected the hyperproliferative phenotype of mutant cells, the contribution of p21/Cdk2 pathway on the abnormal cell proliferation was not clearly addressed [17]. In an independent study, PC-2 was shown to regulate proliferation and differentiation of kidney epithelial cells and suggested that its calcium channel activity may play an important role in this process [18].In this study, we examined the contribution of the JAK2/STAT-1/p21/Cdk2 pathway on PC-2-dependent kidney epithelial cell proliferation. We utilized cell lines HEK293 and NRK-52E expressing wild-type and mutant PC-2 as well as primary tubular epithelial cells from a PKD2-mutant transgenic rat [19]. Interestingly, expression of mutant PC-2 had an effect on the aforementioned pathway only in the primary epithelial cells expressing mutant PKD2, but this was independent of p21. On the contrary multiple approaches provided unequivocal evidence that a different cyclin-dependent kinase inhibitor, p57, is reduced in these cells. These results suggest that p57 might be the end-point of an alternative pathway that regulates PC-2-induced proliferation in ADPKD.MethodsCell culture and isolation of renal primary epithelial cellsHuman embryonic kidney 293 cells, PC-2 overexpressing cells and the rat epithelial cell line NRK-52E were maintained in DMEM medium supplemented with 10% (HEK293) or 5% (NRK-52E) fetal bovine serum (FBS).Renal primary epithelial cells were isolated from a 7.5 week-old PKD2 mutant trangenic rat (TGR (CMV-hPKD2/1–703)), abbreviated in the text as: PKD2(1–703) [19]. There were two transgenic rat lines created initially, 111 and 247, expressing a truncated PC-2, owing to a STOP codon at postion 704. Of the two models 247 was chosen for further work owing to a more severe phenotype. Line 111 is not maintained at the moment [19]. The primary cells were isolated by a sequential filtration method as follows: Normal Spraque-Dawley rats and PKD2(1–703) rats were sacrificed following standard procedures; kidneys were extracted and minced under sterile conditions. The cell mixture was passed through a 180 μm metal sieve (Retsch, Germany) followed by filtration through a 40 μm nylon cell strainer (BD Biosciences). The retained cells were collected and passed through a second 100 μm cell strainer. The filtrate of this step comprises the tubular epithelial fraction of the kidney homogenate. Tubular epithelial cells were cultured on laminin-coated tissue culture plates and maintained in Endothelial Cell Growth Medium (PromoCell, Germany) supplemented with 5%FBS, ECGS, EGF, Hydrocortison, Amphotericin B and Gentamycin. Under these conditions the cells maintained their epithelial phenotype for at least 4 passages.AntibodiesThe following antibodies were used in this study: mouse anti-HA, goat anti-p21, goat anti-Cdk2 (Santa Cruz, Biotechnology), rabbit-anti phospho STAT1 (Cell Signaling), rabbit anti-p57 (Santa Cruz). The rabbit polyclonal anti-PC2 (epitope corresponds to amino acids 679–742 of PC2) was previously described[20]PlasmidsHA-PKD2 (WT) was generated by cloning wild-type human PKD2 in pcDNA 3 (Invitrogen) plasmid. HA-PKD2/1–702 contains almost the entire of PKD2 (aa 1–702) and was constructed by the addition of a stop linker in the PKD2 sequence. Finally, HA-PKD2/R742X contains amino acids 1–742 of PKD2. Both, HA-PKD2/1–702 and HA-PKD2/R742X were cloned in pcDNA3 vector.Transient transfection and Western blot analysisPlasmids were transfected into HEK293 and NRK-52E cells using Lipofectamine 2000 (Invitrogen) reagent according to the manufacture's instructions. Western blot analysis was performed as mentioned before [21]. Briefly, cells were lysed in Nonipet P-40 (NP40) buffer (0.1% NP40, 200 mM NaCl, 50 mM TrisCl (pH 7.4) and protease inhibitors). After centrifugation at 14,000 rpm for 5 minutes, the supernatants were collected. Total amount of protein was determined using the BCA kit (Pierce). Equal amount of protein was denatured by addition of equal volume of 2 × SDS loading buffer and heating for 30 min at 50°C. Proteins were separated on an SDS-PAGE gel. After transfer to a PVDF membrane, Western blots were developed by ECL following the vendor's protocol (Amersham).Cdk2 Kinase AssayCdk2 assay was performed as previously described [22]. Briefly, 250–500 μg of the total cellular protein was immunoprecipitated with 1 μg of Cdk2 antibody for 2 hours at 4°C. After extensive washing, the precipitate was subjected to the kinase assay in the presence of 50 mM HEPES, 7.5 mM MgCl2, 0.5 mM EDTA, 20 mM β-glycerophosphate, 1 mM NaF, 5 mM dithiothreitol, 100 μM ATP and 10 μCi of [γ-32P] ATP in a total volume of 30 μl. As a substrate, 2 μg of histone H1 (Calbiochem) were added to the reaction. The reaction was carried out at 30°C for 30 min. After elution, the supernatant was fractionated by SDS-PAGE, transferred onto a PVDF membrane and autoradiographed.ElectrophysiologyThe conventional whole-cell voltage-clamp configuration was used to measure transmembrane currents in single cells as described previously [20]. Briefly, patch-clamp recordings were obtained from single cells at room temperature using a Warner PC-505B amplifier (Warner Instrument Corp., Hamden, CT) and pClamp 8 software (Axon Instrument, Foster City, CA). Glass pipettes (plain, Fisher Scientific, Pittsburgh, PA) with resistances of 5–8 MΩ were prepared with a pipette puller and polisher (PP-830 and MF-830, respectively, Narishige, Tokyo, Japan). After the whole-cell configuration was achieved, cell capacitance and series resistance were compensated (~70%) before each recording period. From a holding potential of -60 mV, voltage steps were applied from -100 to 100 mV in 20 mV increments with 200 ms duration at 3 s intervals. Current traces were filtered at 1 kHz and analyzed off-line with pClamp 8. The pipette solution contained (in mM): 100 K-aspartate, 30 KCl, 0.3 Mg-ATP, 10 HEPES, 10 EGTA, and 0.03 GTP (pH 7.2). The extracellular solution contained (in mM): 135 NaCl, 5.4 KCl, 0.33 NaH2PO4, 1 MgCl2, 1.8 CaCl2, 5 HEPES, 5.5 glucose (pH 7.4) or 130 KCl, 1 MgCl2, 10 HEPES, 0.1 CaCl2, and 5 glucose (pH 7.4).Cell Cycle AnalysisCells were seeded in six-well plates in triplicates. Upon attachment, cells were synchronized by serum starvation for 24 h followed by addition of 10% serum-containing medium for the HEK293 or 2% serum-containing medium for the primary cells, for 24 hours. Cells were harvested, fixed with 80% cold ethanol followed by treatment with 25 μg/ml Ribonuclease A (SIGMA) and 50 μg/ml propidium iodide (SIGMA) for 30 min at 37°C. After incubation the cells were analyzed by FACS.Gene Expression Profiling with MicroarraysGene expression profiles of primary tubular epithelial cells (TECs) isolated from PKD2(1–703) rats and SD rats were compared. RNA isolation, cDNA and cRNA synthesis and hybridization to arrays of type Rae230A from Affymetrix (Santa Clara, CA, USA) were performed according to the recommendations of the manufacturer. Microarray data was analysed based on a mixed model analysis using JMP Genomics, version 3.0 (SAS Institute, Cary, NC, USA). Standard settings were used, except the following specifications[23]: log-linear mixed models [24], were fitted for values of perfect-matches, with probe and rat group considered to be constant and the array-id random. Custom CDF, [25] with Unigene based gene/transcript definitions different from the original Affymetrix probe set definitions was used to annotate the arrays. Microarray data were submitted to NCBI GEO , sample number [GSE11500].Quantitative RT-PCRTotal RNA (1 μg) was isolated from cultured cells using the Rneasy Mini kit (Qiagen) and was reverse transcribed with the Protoscript reverse transcription kit (New England Biolabs) using the VN(dT)23 primer as recommended by the manufacturer. As a standard for relative RNA quantification (Calibrator), 1 μg of all sample RNAs was pooled together and reverse transcribed as mentioned above. Quantitative RT-PCR (qRT-PCR) amplifications were performed with a LightCycler (Roche Molecular Biochemicals) using the same starting amount and LightCycler® FastStart DNA MasterPLUS SYBR Green I reagents in a standard volume of 20 μl. Real-time detection of fluorimetric intensity of SYBR Green I, indicating the amount of PCR product formed, was measured at the end of each elongation phase. Fluorescence values measured in the log-linear phase of amplification were considered using the second-derivative-maximum method of the LightCycler Data Analysis software (Roche Molecular Biochemicals). Relative quantification was performed using serial dilutions of the Calibrator cDNA to provide a standard curve for each run. For all experiments, the standard curve had an error of below 5% and extended over the relative quantities of all individual samples.Genes whose differential expression was tested by gene-specific qRT-PCR analysis were rat p57 (forward primer: TGATGAGCTGGGAGCTGAG and reverse primer: TGGCGAAGAAGTCAGAGATG) and Cdk2 (forward primer: TGTGGCGCTTAAGAAAATCC and reverse primer: CCAGCAGCTTGACGATGTTA). Differences in the quantity of starting material were compensated by normalization with the housekeeping genes HPRT (forward primer: CTCATGGACTGATTATGGACAGGAC and reverse primer: GCAGGTCAGCAAAGAACTTATAGCC) and GAPDH (forward primer: GTATTGGGCGCCTGGTCACC and reverse primer: CGCTCCTGGAAGATGGTGATGG). Normalized fold-changes between mutant and normal samples were calculated by the REST XL software.Data Analysis and StatisticsData are reported as means ± SEM. Comparisons between multiple groups were performed using single-factor ANOVA, and secondary comparisons were performed using the Tukey test. Statistical analysis was performed using the SPSS statistical software package. For electrophysiology experiments, statistical analysis was employed with the SigmaStat (Chicago, IL) software. Data were reported as means ± SEM. Due to high variability in cells transfected with wild type PKD2, statistical significance was determined by the Mann-Whitey Rank Sum test. Differences were considered significant at p < 0.05 if not stated otherwise (patch clamp and gene expression profiling. Gene expression statistical analysis is described above.ResultsGeneration of stable clones expressing wild-type and mutant PKD2 in HEK293 cellsTo test the role of PKD2 in renal cell proliferation and specifically on the p21/Cdk2 pathway, we generated a series of HEK293 cell lines with stable expression of hemaglutinin (HA)-tagged wild-type human PKD2 (WT PKD2), HA-tagged mutant PKD2 (R742X PKD2) and a selectable marker (Vector). The R742X PKD2 encodes for a truncated PC-2 lacking the polycystin-1 (PC-1) interacting region at the carboxy-terminal of the protein. R742X, is a disease-causing PC-2 mutant firstly identified in a Greek-Cypriot family with Polycystic Kidney Disease type 2 [26-28]. Three individual clones were isolated from each transfectant and used for further experimentation. Immunoblotting of whole cell lysates from the selected clones with an HA antibody, showed good expression of HA-tagged WT PKD2 and HA-tagged R742X PKD2 (Figure 1A). The same lysates were immunoblotted with anti-PC-2 antibody to demonstrate that we indeed have PC-2 overexpression in these clones. As seen in figure 1A, endogenous PC-2 is barely detectable by Western blot analysis in vector-only and R742X PKD2 transfectants. The lower molecular weight band detected most likely represents a non-specific band detected with the anti-PC-2 antibody, since it is detected on vector-only transfectants and untransfected cells (Figure 1A and data not shown).Figure 1Expression of wild-type or mutant PC-2 does not affect proliferation or STAT-1/p21/Cdk2 activity in HEK293 cells. (A) Whole cell lysates containing equal amounts of protein from three stable individual clones of each transfectant (Vector-only, HA-WT PKD2 and HA-R742X PKD2) were analyzed by Western blotting for expression of p21, phosphorylated STAT-1, PCNA, β-tubulin, HA and PC-2. (B) Cdk2 immunoprecipitates from two clones of each transfectant were subjected into an in vitro Cdk2 kinase assay using Histone 1A as substrate. Equal amount of Cdk2 was confirmed by immunoblotting the precipitates with anti-Cdk2 antibody. Data are representative of five independent experiments.We used these tools to test the effect of wild-type and mutant PC-2 expression on the JAK2/STAT-1/p21/Cdk2 pathway, as it was previously implicated in its regulation by showing that overexpression of wild type PKD1 activates JAK2 kinase, which in turn phosphorylates STAT-1 [13]. Lysates from synchronized clones were immunoblotted with an anti-phospho-STAT-1 antibody, which detects the expression of serine phosphorylated STAT-1, and an anti-p21 to detect endogenous p21 expression. As shown in figure 1A, p21 levels and STAT-1 phosphorylation were unaffected by wild-type or mutant PKD2 expression. Equal loading was confirmed by re-probing the same membrane with anti-β-tubulin.Similarly, endogenous Cdk2 activity was equivalent among the different clones as judged by the kinase assay performed on Cdk2 immunoprecipitates from two selected clones of each transfectant. Western blot analysis demonstrated that similar amount of Cdk2 was precipitated from each clone (Figure 1B). Cell cycle analysis performed by propidium iodide (PI) staining revealed that expression of wild-type or mutant PC-2 does not alter the cell cycle profile of these cells (Figure 2). Furthermore, proliferating cell nuclear antigen (PCNA) levels were equal among the different clones (Figure 1A). Collectively, the results suggest that expression of wild-type and mutant PKD2 has no effect on the proliferation of HEK293 cells.Figure 2Cell cycle profile of HEK293 clones is unaffected by expression of wild-type or mutant PC-2. Three different clones of each transfectant were synchronized and subjected to propidium iodide cell cycle analysis by flow cytometry. The percentage of cells in each phase of the cell cycle was determined. The results are presented as mean of triplicate counts for each clone ± SEM. No statistically significant difference was detected. Analysis of serum-starved cells demonstrated that more than 90% of the live cells were arrested at G0/G1 phase confirming successful synchronization of the cells cultured (data not shown).To determine whether mislocalization of exogenous WT and R742X PC-2 is responsible for their inability to regulate cellular proliferation, we compared the sub-cellular localization of HA-tagged WT or R742X PC-2 with endogenous PC-2 by immunofluoresence. Both HA-tagged WT and R742X PC-2 were detected at the same subcellular compartments (endoplasmic reticulum and plasma membrane) as the endogenous PC-2 (data not shown).ER-localized PC-2 is known to function as a Ca2+-activated intracellular Ca2+ release channel while plasma membrane-associated PC-2 is believed to function as a nonselective cation channel [29-31]. Previous work has demonstrated that PKD2 overexpression augmented the amplitude of whole cell currents in renal epithelial cells [20]. To test the effectiveness of the expressed WT PKD2 in HEK293 cells we performed whole cell current measurements in vector-only, WT PKD2 and R742X PKD2 clones. Functional expression of transfected wild type PKD2 in HEK cells has been shown [32]. Figure 3 shows that stable expression of wild type PKD2 in HEK cells resulted in a significant increase in the current amplitude of whole cell inward currents recorded either in normal extracellular tyrode solution or symmetrical K+ (Figure 3). Outward currents were larger in WT PKD2 expressing cells compared to untransfected, mock-transfected, or R742X PKD2-transfected cells in symmetrical K+. PKD2-mediated K+ currents were larger compared to Na+/Ca2+ currents as was expected for PKD2 which shows higher permeability to K+ compared to Na+ or Ca2+ [16,20]. Overexpression of R742X PKD2 did not have a significant effect on whole cell inward or outward currents in HEK293. Collectively, the electrophysiology data show that transfection of wild type PKD2 resulted in functional expression in HEK293 cells. However, PKD2 has no effect on the STAT-1/p21/Cdk2 pathway or on the proliferation status of these cells.Figure 3Functional expression of PKD2 in HEK293 cells. Whole cell step currents in vector-only (A and F), wild type PKD2- (B and G), or PKD2(742X)-stably transfected HEK293 cells (C and H) in normal extracellular tyrode solution (130K+:135Na+/2 Ca2+/5.4 K+) (A-C) or symmetrical K+ (130K+:130K+) (F-H). Current-voltage (I–V) curves derived from a step protocol in untransfected (black squares), mock-transfected (vector control) (black circles), WT PKD2- (red circles), or PKD2 (R742X)-stably transfected HEK293 cells (green circles) in normal extracellular tyrode solution (D) or symmetrical K+ (I). ''*'': p < 0.05.Examination of the effect of wild-type and mutant PKD2 on the JAK2/STAT-1/p21/Cdk2 pathway in NRK-52E cellsHEK293 cells were generated by transformation of human embryonic kidney cell cultures with sheared adenovirus 5 DNA [33]. The cell line has an epithelial morphology and is widely used as a kidney epithelial model. Nevertheless, there is controversy as to whether these cells are of true kidney origin, since expression studies have demonstrated that HEK293 cells have an unexpected relationship with neurons [34]. For these reasons we decided to perform the same experiments in a different cell line system more closely resembling mature kidney epithelial cells, NRK-52E.The rat kidney epithelial cell line, NRK-52E was transiently transfected with vector-only (CT), WT PKD2, R742X PKD2 and 1–702 PKD2 (a PKD2 mutant lacking the entire carboxy-terminal region of the protein). At 48 hours after transfection, cells were synchronized by serum starvation. Whole cell lysates were immunoblotted with anti-p21 and anti-phospho-STAT-1 antibodies. Neither p21 levels nor STAT-1 phosphorylation is affected by expression of wild-type or mutant PKD2 (Figure 4A). Similarly, the levels of active Cdk2 were comparable among the four transfectants. In addition to the JAK2/STAT-1/p21/Cdk2 pathway, the proliferation capacity of NRK-52E transfected with WT, R742X and 1–702 PKD2 appeared unaltered compared to vector only transfectants as judged by PCNA Western blot analysis. Good expression of the wild-type PC-2 and of the two truncated proteins was achieved as judged by anti-HA and anti-PC2 blotting. In summary, these results duplicate the observation in HEK293 that wild-type or mutant PKD2 expression do not modify the activity of the JAK2/STAT-1/p21/Cdk2 pathway.Figure 4Expression of wild-type or mutant PC-2 does not affect proliferation or STAT-1/p21/Cdk2 activity in NRK-52E cells. (A). Whole cell lysates containing equal amounts of protein from NRK-52E cells trasnsiently transfected with vector-only, HA-WT PKD2, HA-R742X PKD2 and HA-1–702 PKD2 were analyzed by Western blotting for expression of p21, phosphorylated STAT-1, PCNA, tubulin, HA and PC-2. A non-specific band is detected in vector-only and WT PKD2 lanes in the HA blot and co-migrates with mutated PC-2 in this cell line. (B) Cdk2 immunoprecipitates from each transfectant were subjected into an in vitro Cdk2 kinase assay using Histone 1A as substrate. Equal amount of Cdk2 was confirmed by immunoblotting the precipitates with anti-Cdk2 antibody. Data are representative of three independent experiments performed. No statistically significant difference was detected.Renal tubular epithelial cells from PKD2(1–703) transgenic rat display augmented proliferation independent of the JAK2/STAT-1/p21/Cdk2 pathwayThe unexpected but significant results above, prompted us to utilize primary renal epithelial cells obtained from a 7.5 week-old mutant PKD2 transgenic rat (1–703) [abbreviated PKD2(1–703)], expressing a truncated form of PC-2 lacking the C-terminal region of the protein. The transgenic animals manifest a cystic phenotype characterized by the formation of multiple cysts in the kidneys [19]. Tubular renal epithelial cells were isolated by sequential filtration of renal cells and cultured in low serum-containing medium. The epithelial character of the isolated cells and the absence of contaminating fibroblasts were confirmed by cadherin and vimentin expression respectively (Figure 5A).Figure 5Primary tubular epithelial cells (TECs) isolated from the kidneys of a PKD transgenic rat expressing a truncated PC-2 (PKD2(1–703)) display higher proliferative activity compared with TECs isolated from normal Sprague-Dawley rats. (A). Whole cell lysates containing equal amounts of protein from TECs isolated from normal Sprague-Dawley rat (SD) and TECs isolated from PKD transgenic rat (Mut) were analyzed by Western blotting for expression of p21, phosphorylated STAT-1, PCNA, tubulin, PC-2, cadherin, vimentin and megalin. All blots are representative of experiments performed on at least two different transgenic animals. Endogenous PC-2 can be seen on long exposures that also bring out high background (not shown) (B). Cell cycle profile of normal (SD) or mutants (Mut) TECs. The results are presented as mean of triplicate counts (three independent cultures) for each animal. ± SEM (ANOVA p < 0.01. * = significant difference). The data are representative of two experiments performed using two different pairs of animals.In contrast to the cell lines examined, primary tubular epithelial cells (TECs) isolated from PKD2(1–703) transgenic rat, demonstrated an increase in cellular proliferation compared with their normal counterparts. Specifically, Western blot analysis on whole cell lysates demonstrated that TECs isolated from the PKD2(1–703) rat have significantly higher levels of PCNA than TECs isolated from normal Sprague-Dawley rats (Figure 5A). In addition, the percentage of cells in the G0/G1 phase of the cell cycle was lower in the mutant cells than in normal cells as judged by cell cycle analysis (90.6 ± 0.93 to 84.1 ± 1.28). In concert, the percentage of G2/M-phase mutant cells was higher than G2/M-phase normal cells (5.06 ± 0.31 to 12.9 ± 1.37) (Figure 5B). Despite the higher proliferative activity of mutant cells, p21 levels and STAT-1 phosphorylation remain unaltered (Figure 5A), suggesting that PKD2-induced proliferation is STAT-1/p21-independent.We then hypothesized that alternative pathways might be responsible for PKD2-induced proliferation in this system. To this end, we performed a genome-wide gene expression analysis on TECs isolated from two normal Sprague Dawley rats and three PKD2 (1–703) rats. Differentially expressed genes were identified with ANOVA. We concentrated only on genes involved in the cell cycle regulation (Figure 6A). From all the cell cycle genes listed in figure 6A, only two differ significantly in expression between normal and mutant cells, those being Cdk2 and cyclin-dependent kinase inhibitor 1C or p57KIP2. On the contrary, p21 did not show any significant difference, confirming the Western blot results (Figure 6A and 5A).Figure 6Genome-wide expression analysis reveals differential expression of Cdk2 and p57 in TECs isolated from transgenic rat (PKD2(1–703)). (A). List of cell cycle-related genes examined by microarray analysis. The (*) denotes statistical significance after Bonferroni correction. (B). Each data point on the volcano plot stands for one gene. The cutoff of p-value after Bonferroni correction is shown by the red line. Only the two significantly differentially expressed genes are labeled with their gene symbol.The chip data were verified by quantitative real-time PCR analysis after normalization using two housekeeping genes, HPRT and GAPDH. In agreement with the chip data, p57 mRNA levels were downregulated in the mutant animals as compared with their normal counterparts (normalized fold change 4.7 ± 0.19). Similarly, Cdk2 mRNA levels were augmented in the mutant cells (normalized fold change 1.2 ± 0.015) (Figure 7A). Cdk2 protein upregulation and p57 protein downregulation were also verified by immunoblotting. Consistent with the microarray data, Cdk2 protein levels were significantly elevated in mutant primary cultures (normalized fold change 2.2 ± 0.06). Similarly, p57 levels were downregulated in mutant TECs (normalized fold change 1.9 ± 0.2) (Figure 7B). On the contrary, Western blot analysis demonstrated, as expected, that p57 protein levels remain unchanged in HEK293 stable clones and NRK-52E transfectants (Figure 7C). It should be noted that p57 levels in the cell lines examined is expressed at very low levels and it was barely detectable by Western blot. Given that in the PKD2(1–703) transgenic rat the cysts originate predominantly from the proximal tubule segment of the nephron, we wanted to exclude the possibility that proximal tubule cells are overrepresented in the primary mutant TECs culture, thus confounding the interpretation of the results. In order to do that, lysates from normal and mutant TECs were immunobloted with anti-Megalin antibody, a proximal tubule marker [35]. As shown on figure 5A, Megalin protein levels were equivalent among normal and mutant TECs suggesting that the proportion of cells of proximal origin was comparable among the different cultures and did not create a sampling bias.Figure 7Tubular epithelial cells (TECs) isolated from the PKD2(1–703) rat (Mut) have reduced p57 and augmented Cdk2 mRNA and protein compared with TECs isolated from normal rat (SD). (A). Real-time PCR of p57 and Cdk2 in isolated TECs. Data represent the mean of normalized fold change from three independent samples ± SEM (ANOVA p < 0.01. * = significant difference). Data were normalized using two housekeeping genes, HPRT and GAPDH. (B). Protein levels of p57 and Cdk2 represented as the mean of normalized fold change of two independent Western blot experiments ± SEM (ANOVA p < 0.05. * = significant difference). Data were normalized by β-tubulin expression. (C). p57 protein levels were determined by western blot analysis in HEK293 stable clones and in NRK-52E transfectants. As expected, protein level of p57 is not perceptibly altered.DiscussionVarious studies on renal cystic tissues and cell lines demonstrated that altered regulation of tubular epithelial cell proliferation is a key factor in the pathogenesis of ADPKD. What remains unclear is the timing of the misregulated growth as well as the pathways involved. Recently, in an attempt to answer these questions a number of groups provided evidence for the involvement of Cdk2 in the process of cystogenesis. Progression through the cell cycle is regulated by a family of cyclin-dependent kinases (CKs) whose activities are controlled by the relative ratio of cyclins and Cdk inhibitors (CKIs) [36,37]. There are two classes of CKIs in mammals, the p21CIP1 and p16INK4 families. Members of the p16NK4 family bind and inhibit only Cdk4 and Cdk6 kinases [38]. In contrast, members of the p21CIP1 family (p21CIP1, p27KIP1 and p57KIP2) inhibit all G1/S phase CDKs. The transition of cells from the G0/G1 into the S phase of the cell cycle involves the activities of Cdk2, Cdk4 and Cdk6 [37].Bhunia et. al. were the first to address the role of CDKs in PKD-induced proliferation. Specifically, they demonstrated that one of the functions of the polycystin-1/2 complex is to regulate the JAK/STAT pathway and consequently control cellular proliferation. They showed that overexpression of wild-type polycystin-1 can activate JAK2/STAT-1, a process that resulted in upregulation of the CKI p21waf1. As expected, increase in p21 levels led to inhibition of Cdk2 and cell cycle arrest. The ability of polycystin-1 to modulate Cdk2 activity was dependent on polycystin-2. These results implied that compromised polycystin-1 activity is expected to have the opposite effect, thus explaining the abnormal proliferation observed in ADPKD cystic cells.An independent study addressed directly the role of PC2 in cell cycle regulation and Cdk2 activity. It was demonstrated that PC2 could directly interact with Id2, a member of the HLH family that is known to control cell proliferation and differentiation. The direct association of PC2 with Id2 was shown to regulate the nuclear translocation of Id2 and thus modulate the cell cycle through the Id2/p21/Cdk2 pathway [17]. Based on these results a model was proposed according to which PC1 can increase PC2 phosphorylation leading to enhanced Id2/PC2 interaction and reduced Id2 nuclear import. This in turn, prevents Id2 repression of E-box-dependent activation of transcription of genes such as p21. Increased p21 will inhibit Cdk2 activity and arrest the cells at G0/G1 phase of the cell cycle. At the same time PC1 can lead to Cdk2 inhibition independent of Id2 through the JAK/STAT pathway. Based on this model mutations in either PC1 or PC2 can disrupt these pathways leading to abnormal cell proliferation [17]. A recent report also demonstrated reduced levels of p21 in human and animal PKD tissues as well as in affected cell lines implying a role of p21/Cdk2 in cystogenesis [39].In this study we attempted to examine further this hypothesis. We generated stable clones expressing either wild-type or mutant R742X PKD2 in HEK293. To our surprise, overexpression of wild-type PC2 did not affect proliferation of these cells. Cell cycle profile analysis, PCNA, p21 expression levels and Cdk2 activity remained unchanged among different transfectants. The reason for this discrepancy remains unclear given that the same cell line and similar experimental conditions were used in the previous studies [13,17]. In order to eliminate the possibility that the exogenously expressed wild-type PKD2 was not functional, we performed whole cell current measurements in vector-only, WT PKD2 and R742X PKD2 clones. As expected, HEK293 clones expressing wild-type PKD2 displayed an increase in the current amplitude of whole cell inward and outward currents recorded either in normal extracellular tyrode solution or symmetrical K+. Such result excludes the possibility that an inactive PC-2 was expressed in HEK293 cells. In addition, absence of phenotype could not be attributed to the mislocalization of the expressed protein as determined by immunofluorescent analysis.In an attempt to clarify these contradictory results we utilized a different cell line system. The NRK-52E cells are \"normal\" rat tubular epithelial cells, thus we hypothesized that this is a more appropriate system to study PC-2-induced proliferation and STAT-1/p21/Cdk2 activation. Nevertheless, similar results were obtained with the NRK-52E cells (Figure 4). The disparity of our results compared to previous studies is puzzling. Li et. al [17], observed cell cycle arrest and Cdk2 inhibition in HEK293T cells after expression of wild-type PC-2, and not in HEK293 cells used in our study. HEK293T cell line is a derivative of HEK293 that stably expresses the large T-antigen of SV40. In these cells transfected plasmids that contain the SV40 origin are replicated to a copy number of 400–1000 plasmids/cell and therefore express the transgene at higher levels. However, this is unlikely to be the reason for the discrepancy given that high expression of wild-type and mutated PC-2 was achieved in our HEK293 clones (Figure 1) and in NRK-52E cells (Figure 4) after transient transfection.One of the unwanted side effects of cellular immortalization might be the alteration of basal proliferation rate in cells. This can be highly significant in proliferation studies. As a result we decided to switch to a primary cell culture system. We examined the ability of mutated PC-2 (1–703) to activate the STAT-1/p21/Cdk2 pathway in primary renal epithelial cells isolated from PKD2(1–703) transgenic rat [19].Isolation of TECs from the transgenic animals was performed using a sequential filtration method. Using this method we avoided any potential activation of surface receptors taking place during antibody-based isolation techniques. Purified tubular epithelial cells were cultured in low serum medium and on laminin-coated plates to avoid differentiation. The epithelial character of the cells was regularly evaluated by measuring epithelial (cadherin) and fibroblastic (vimentin) markers. TECs isolated from different animals showed augmented PCNA levels, a decrease of the G0/G1 phase cells and increase of the G2/M phase cells. This was the first time in our hands that we observed a higher proliferation activity in cells overexpressing a mutated PC-2. These results indicated that indeed PC-2 can alter cellular proliferation in renal epithelial cells, but it also suggests that such process is complicated and possibly multifactorial and can not be easily recapitulated in in vitro cell line systems [40]. In support of this, a recent report focused on the dynamics of cyst formation by utilizing an inducible Pkd1 mouse model, demonstrated that proliferation was not appreciably higher in cystic specimens than in aged matched controls. Based on their results, the authors suggested that the relationship between cellular proliferation and cyst formation may be indirect [41]. Similar data were obtained from Zebrafish studies where it was shown that increased cell number in cyctic phenotype is a secondary consequence of tubule dilation rather than the leading cause of cyst formation [42]. In our study, it appears that mutated PC-2-induced proliferation in primary cells proceeds independently of the STAT-1/p21 pathway since there is no change in the levels of p21 or on STAT-1 phosphorylation. Based on these results it is clear that in the rat system we investigated, PC-2-induced proliferation proceeds through an alternative pathway other than STAT-1/p21.Using gene expression profiling we were able to identify a candidate that may mediate the PC2-induced proliferation in PKD2(1–703) rat. Among all the cell cycle related genes, only two showed misregulation in TECs isolated from diseased rats, cyclin-dependent kinase inhibitor 1C (p57kip2) and Cdk2. The p57 kip2 belongs to the p21WAF/Cip1 family. Studies have shown that p57 binds tightly to the G1 and S phase kinases, cyclin E/Cdk2, cyclin D2/Cdk4, cyclin A/Cdk2 and to a lesser extent to cyclin B/Cdc2 and effectively inhibits their activity [43]. An important difference between p57 and the other members of the family, is that p57 is not regulated by p53 but by p73 [44-46].We observed a downregulation of p57 at both mRNA and protein levels in mutant cells with the absence of any change in p21 levels. This possibly signifies that PC-2 might alter cellular proliferation through p57/Cdk2 in these cells. It is possible that expression of mutant PC-2 can result in p57 downregulation by augmenting Id2 nuclear import and subsequent inhibition of p57 transcription [17]. This hypothesis is in agreement with experiments in neural cells where it was shown that Id2 could regulate cell cycle through p57 [47].In addition to p57 downregulation, we observed an increase in Cdk2 protein level. This is interesting since it appears that Cdk2 activity might be augmented simultaneously in two different ways (downregulation of the inhibitor and upregulation of the kinase). Whether Cdk2 increase is part of a positive feedback loop is still not known. Nevertheless, this simultaneous alteration in p57 and Cdk2 levels might result in a rapid increase in Cdk2 activity and subsequently to higher proliferation rate. A concern regarding our results might arise from the possibility that the isolated TECs are not equally representative of the various nephron segments in healthy and mutant rats, a concern however that cannot easily be addressed within the scope of this work. More specifically though, we addressed the issue of over-representation of the TECs from the proximal cysts by showing similar levels of a proximal tubule marker, megalin expression in normal and mutant TECs (Fig. 5A).In conclusion, the level of p57 contribution in the PC-2-induced proliferation in renal epithelial cells is still unclear. Future experiments will focus on identifying the pathways leading to p57 reduction and whether this decrease is necessary for PC-2-induced proliferation in renal tubular epithelial cells. We consider it of particular significance that no matter how these experiments pan-out, our study introduces a new pathway in ADPKD, through which PC-2 might lead to Cdk2 activation and increase in cellular proliferation, which is independent of STAT-1/p21. Also, once again it should be emphasized that biological systems are unpredictably complex and may exert similar effects and end results through more than one pathway. Finally a word of caution should be expressed as regards the interpretation of experiments performed on genetically grossly modified established cells lines, which are far from representing the complexity of whole organs or organisms.ConclusionWe have shown that p57KIP2, a cyclin-dependent kinase inhibitor is downregulated and cyclin-dependent kinase 2 (Cdk2) is upregulated in primary tubular epithelial cells isolated from a PKD2 transgenic rat. In addition, primary cells expressing mutant PKD2 exhibit increased proliferation compared to their normal counterparts. On the contrary, expression of mutant PKD2 in two kidney cell lines failed to alter cellular proliferation and p57KIP2 protein levels. Most importantly, although exogenous expression of mutant PKD2 ablated current activity, compared to wild-type, however in cell lines or primary TECs had no effect on the STAT-1/p21/Cdk2 pathway. In conclusion this report highlights the probable involvement of p57KIP2 on epithelial cell proliferation in ADPKD implicating a new mechanism for mutant polycystin-2 induced proliferation.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsAll authors have read and approved the manuscript. KNF and PK performed most of the experiments. KNF also helped in the conception of the experimental plan and in the writing of this manuscript. EK helped in the establishment of HEK293 stable clones. RW and NG created and maintained the transgenic PKD rat. NG provided the PKD transgenic rats. LT and C–XB provided the cDNA constructs and performed the electrophysiology experiments. NG and LL designed and performed the microarray experiments. Finally CD conceived the study, supervised the work and helped in the writing of this manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2533657.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2533657",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2533657\nAUTHORS: Michel LA Dückers, Cordula Wagner, Peter P Groenewegen\n\nABSTRACT:\nBackgroundIn quality improvement collaboratives (QICs) teams of practitioners from different health care organizations are brought together to systematically improve an aspect of patient care. Teams take part in a series of meetings to learn about relevant best practices, quality methods and change ideas, and share experiences in making changes in their own local setting. The purpose of this study was to develop an instrument for measuring team organization, external change agent support and support from the team's home institution in a Dutch national improvement and dissemination programme for hospitals based on several QICs.MethodsThe exploratory methodological design included two phases: a) content development and assessment, resulting in an instrument with 15 items, and b) field testing (N = 165). Internal consistency reliability was tested via Cronbach's alpha coefficient. Principal component analyses were used to identify underlying constructs. Tests of scaling assumptions according to the multi trait/multi-item matrix, were used to confirm the component structure.ResultsThree components were revealed, explaining 65% of the variability. The components were labelled 'organizational support', 'team organization' and 'external change agent support'. One item not meeting item-scale criteria was removed. This resulted in a 14 item instrument. Scale reliability ranged from 0.77 to 0.91. Internal item consistency and divergent validity were satisfactory.ConclusionOn the whole, the instrument appears to be a promising tool for assessing team organization and internal and external support during QIC implementation. The psychometric properties were good and warrant application of the instrument for the evaluation of the national programme and similar improvement programmes.\n\nBODY:\nBackgroundIn the past fifteen years enormous progress has been made in monitoring quality of care in the United States and several European countries. Monitoring may serve several purposes. It is often considered a prerequisite for organizational learning and a driver for ongoing development. The Continuous Quality Improvement (CQI) techniques that were introduced into health care in the 1980s, for instance, fit within this line of reasoning, as does the 'Breakthrough Series', launched in 1995 by the Institute for Healthcare Improvement (IHI) [1,2]. Both CQI and Breakthrough offer a baseline for realizing changes, but where the first one emphasizes that most quality problems are a result of system failures, the second approach regards them as problems with individual practitioners. In the Breakthrough view, change processes depend greatly on the role of individual professionals within the complex system of their working environment. The core technology of the approach involves the identification of deficiencies in quality, repeated implementation of small-scale interventions and measuring of changes, followed by refinement and expansion of the interventions to improve care processes [2].Breakthrough is an example of a quality improvement collaborative (QIC). It is a means to stimulate improvement and an intentional spread strategy. A QIC brings together groups of practitioners from different healthcare organizations to work in a structured way to improve one aspect of the quality of their service. It involves them in a series of meetings to learn about best practice in the area chosen, about quality methods and change ideas, and to share their experiences of making changes in their own local setting [3]. Given the popularity of collaboratives, Øvretveit et al. urged for more research into the different types of QICs and their effectiveness, as well as linking QIC-practices explicitly to organizational and change management theory. Indeed, further study of processes and outcomes of QICs is desirable. QICs are complex, time consuming interventions and hard evidence on their effectiveness is limited [4-6]. The current study is conducted to contribute to a theory driven understanding of the process and effects of QIC implementation. Our purpose is to develop and test a measuring instrument for three central elements of QIC-implementation: 1) the organization of teams who join a QIC, 2) the degree of support these teams get from their own organization, and 3) the support given by the external consultants or change agents facilitating the QIC and its meetings.The study is part of an independent evaluation of a national improvement and dissemination programme for hospitals in the Netherlands. Objectives of the programme are to enhance patient safety and logistics in 24 hospitals. Three groups of eight hospitals receive programme support for two years. In the first year multidisciplinary teams implement projects that are to be disseminated throughout their hospitals in later years [7,8]. The programme is a combination of six types of QICs, each with their own topic, programme targets and specific interventions (table 1). Implementation of each project type is supported by an external change agency staffed by change experts and consultants.Table 1QIC-projects and programme targetsQuality domainQIC-projectProgramme targetsPatient logisticsworking without waiting lists (WWW)- Access time for clinical consultation is less than a weekoperating theatre (OT)- Increasing the productivity of operation theatres by 30%process redesign (PRD)- Decreasing the total duration of diagnostics and treatment by 40–90%- Reducing length of in-hospital stay by 30%Patient safetymedication safety (MS)- Decreasing the number of medication errors by 50%pressure wounds (PW)- The percentage of pressure wounds is lower than 5%postoperative wound infections (POWI)- Decreasing postoperative wound infections by 50%Besides the scientific goal, this study serves a more practical purpose. Knowledge on team organization and supportive conditions is of considerable value for parties involved in QIC-efforts. Hospital managers, project teams, change agents and public stakeholders may benefit from gathering tangible information for real-time adjustments. Furthermore, anticipating on future events, it is important to guarantee the applicability of the instrument for evaluation purposes in other collaborative programmes. This requires measuring the instrument's basic psychometric properties, such as reliability and validity, by testing it in a representative sample of project leaders of the multidisciplinary hospital teams.The measuring instrument in the current study is based on team organization and internal and external support. Before going deeper into the methods we will elaborate some more on the nature of the three dimensions.Three dimensions and their characteristicsTeam organization affects the teams joining a QIC. Cohen and Bailey defined a team as 'a collection of individuals who are interdependent in their tasks, who share responsibility for outcomes, who see themselves and who are seen by others as an intact social entity embedded in one or more larger social systems (for example, business unit or corporation), and who manage their relationships across organizational boundaries' (p. 241).[9] There is a general consensus in the literature that a team consists of two or more individuals, who have specific roles, perform interdependent tasks, are adaptable, and share a common goal.[10] To increase the effectiveness of teams it is important to establish timely, open and accurate communication among team members.[11] The notion that QIC-teams are responsible and in charge of the progress of the project [3] is in line with literature suggesting that operational decision making during implementation processes should be devolved to teams.[12]Internal supportOther imperatives for team success are strong organizational support and integration with the organization's key values.[13] Within QICs internal or organizational support has to do with leadership, support and active involvement by top management.[12,14,15] There should be regular contact between team and organization leaders, and the innovation must fit within the goals of the management.[15] Øvretveit et al. even state that the topic should be of strategic importance to the organization.[3] Besides the presence of necessary means and instruments [16] many of the internal support tasks are to be executed by the strategic management in particular. Executives have to communicate a vision, or at least key values, throughout the organization. [17,18] They must also stimulate the organization's and employee's willingness to change.[19] Tasks such as these fall within the priority setting areas as defined by Reeleeder et al. i.e. foster vision, create alignment, develop relationships, live values and establish process.[20]External supportThe involvement of external change agents, arranging group meetings for teams of different organizations, is a typical QIC feature. Team training is a success factor for team based implementation.[13] Team training can be more effective than individual training especially when the learning is about a complex technology.[21] The purpose of a QIC is that teams are empowered and motivated to implement new working methods in order to alter a quality aspect of their care delivery. External change agents should provide teams with an applicable model together with high performance expectations.[22] This implies and requires a gap between a perceived and an actual situation, as well as outlining the potential added value of the innovation to the teams.[3] A second prerequisite is that teams joining the QIC have to gain information and skills that are new to them, otherwise an important argument for joining the QIC is void. The external support dimension is connected to the other two dimensions. The central topics of the collaboratives organized by the external change agents can be seen as the innovations that will determine team focus during the implementation process. The nature of these innovations should be congruent with the organizational key values as mentioned before. Although highly simplified, this is the mechanism by which new working methods are brought into the home organizations of the QIC-teams via the external change agents.MethodsInstrument developmentThe study goal is to design an efficient instrument to gather information on the three dimensions. The instrument is designed to be filled out by the project leader of the multidisciplinary team joining the QIC in the middle or at the end of the project. The project leader is most likely to be confronted with internal and external support aspects. Furthermore, the project leader is acquainted with the functioning of the multidisciplinary team running the project.Item content is based on the three dimensions and their characteristics. To enhance content validity, nine experts in human resource management, organizational psychology, patient safety, logistics and operations management, social medicine and health care management reviewed the first draft of the instrument. They were asked to judge the questions for appropriateness, clarity, completeness, question sequence, completion time and overall appearance. Questions with potential overlap in construct, others that were vague, ambiguous and redundant and some, which appeared irrelevant to the objectives of the study, were removed, resulting in a 15 item instrument. Questions are displayed in table 2, divided into team organization (TO), external change agency (EX), hospital organization (HO).Table 2Item descriptive statisticsItemDescription*Valid (%)Mean (SD)MedianDistribution of valid responses (%)Team organization (TO)12345671there is good communication and coordination100.05.55 (1.09)6.00.01.83.010.922.446.715.22the division of tasks is perfectly clear100.05.31 (1.07)5.00.00.65.513.934.533.312.13everyone is doing what he or she should do99.45.05 (1.35)5.01.21.214.014.026.230.912.24is responsible for progress of project99.45.30 (1.23)6.00.61.87.312.823.841.512.25is in charge of project implementation100.05.37 (1.23)6.00.61.87.97.927.939.414.5External change agent support (EX)6is properly trained99.44.32 (1.38)4.01.29.816.528.021.319.53.77at collaborative meetings I always gain valuable insights99.44.24 (1.48)4.02.411.620.117.126.218.93.78external change agents provide sufficient support and instruments99.44.52 (1.27)5.00.66.712.826.829.320.13.79external change agents raised high expectations about performance and improvement potential98.84.83 (1.25)5.00.63.710.422.727.630.14.910external change agents made clear from the beginning what the goal of the project is and the best way to achieve it99.44.76 (1.24)5.01.23.79.823.831.126.24.3Support from hospital organization (HO)11we see that the project is important to the strategic management97.65.08 (1.49)5.00.06.811.21324.225.519.312we see that the strategic management supports the project actively98.24.75 (1.60)5.04.36.29.321.022.822.813.613the hospital gives the support we need in the department(s) to make the project a success99.44.36 (1.49)5.05.57.311.625.625.021.33.714does everything in its power to increase the willingness to change99.44.18 (1.55)5.05.510.416.523.222.018.34.315the board pays attention to the activities of the project team95.84.66 (1.67)5.04.49.510.817.715.831.610.1* 1–6: '(In) the project team...' 11–12: 'In the department(s) where the project is implemented...'Items were designed based on a 7-point Likert scale in which 1 corresponds to 'strongly disagree', 2 to 'disagree', 3 to 'slightly disagree', 4 to 'neutral', 5 to 'slightly agree', 6 to 'agree' and 7 to 'strongly agree'. The choice for a 7-point scale is based on the notion that this scale offers maximum information, discriminates well between respondent perceptions and is easy to interpret.After the draft version was tested by five researchers it showed that the instrument was simple and straightforward to complete and not time consuming (approximately 10 minutes). The instrument also contains a standard set of socio demographic and job related questions addressing age, sex, education, position, date of birth. Extra background information was added in the form of two questions, addressing the number of team members and meetings since the start of the project.Sample and data collectionTo investigate the suitability of the instrument in a QIC in Dutch hospital care, all the project leaders of the teams participating in the improvement programme were included as participants in the study. The testing fields were 24 hospitals spread all over the country. The central change agency granted permission to approach the project leaders in the programme hospitals. The project leaders of one hospital decided not to participate in the study because of the expected time burden.All questionnaires were assigned a unique code to distinguish between organizations, project types and respondents. In the first group, comprised of eight hospitals, the study was conducted between July and September 2005, 77 questionnaires were sent by mail to the project leaders. In the second group, consisting of seven hospitals, the study was conducted between December 2006 and February 2007 and this time 71 questionnaires were sent by mail to the project leaders. The third group filled out the questionnaire between September 2007 and December 2007 89 questionnaires. The overall response rate was 71%, (168 out of 237 questionnaires). Instructions were provided via an accompanying letter describing the purpose of the study and stating that the participation was anonymous.AnalysesThe sample was analyzed as a whole. Descriptive statistics and the response distribution for each item were calculated, in order to examine central tendency, variability and symmetry. Reliability and validity were investigated as main psychometric properties. Reliability i.e. how well items reflecting the same construct yield similar results, was tested via Cronbach's alpha coefficient. This is the most frequently used estimate of internal consistency. The higher the score, the more reliable the generated scale is. A minimum score of 0.70 is preferred.[23]Content validity was addressed in the development stage to enlarge confidence that the instrument measures the aspects it was designed for. To support construct validity, principal component analysis was used to determine the underlying constructs, which explain significant portions of the variance. The factor loadings, i.e. the correlation coefficients between the items and the factors, were examined in order to explain the meaning of each construct. Tests of scaling assumptions, according to the multi trait/multi-item matrix [37], were used to confirm the structure found. This approach extends the logic of the multi-trait-multi-method technique [24] from the level of traits to the level of items.[25] To test item-internal consistency items were correlated with their scale corrected for overlap (a correlation corrected for overlap is the correlation of an item with the sum of the other items in the same scale; the bias of correlating an item with itself is thus removed). High item convergent validity was indicated if the item correlated considerably with the relevant scale. A threshold of 0.40 was used, proposed by Karlsson et al.[25] Low item divergent validity was indicated if an item correlated higher with any other scale than with the own scale. A matrix was computed with item-scale correlations and correlations were thereafter compared across scales. The criterion for significant difference was two standard errors.[26] All analyses were performed using SPSS 14.0.ResultsNearly half of the respondents (48%) consisted of medical professionals (mostly physicians, nursing staff and paramedics). Two other dominant function groups in the sample are: managers, department heads or team leaders (29%) and a third group of advisors, policy makers and administrative and quality personnel (23%). The majority was female (60%) and the mean age was 43 years. The projects are divided into pressure ulcers 17% (n = 28), medication safety 23% (n = 38), postoperative wound infections 7.9% (n = 16), operation theatre productivity 7.9% (n = 16), process redesign 21.2% (n = 35) and waiting lists 19.4% (n = 32). Response information is provided in table 2, which displays the items descriptive statistics.Table 3Rotated component matrices: 15 itemsItemDescriptionPattern matrixStructure matrix12312312strategic management supports project actively0.935-0.086-0.0220.8980.2400.23014does everything to increase willingness to change0.911-0.0500.0230.9000.2820.27911project is important to strategic management0.843-0.0810.0920.8410.2480.31813hospital gives the support needed in department(s) to make project successful0.8340.058-0.0190.8490.3500.24715pays attention to team activities0.7320.140-0.0920.7540.3720.1696proper team training0.4660.2760.1030.5950.4740.3284responsible for progress0.0230.808-0.0730.2900.7940.1852clear division of tasks-0.0360.7860.1660.2940.8250.3991good communication and coordination-0.1150.7790.1010.1930.7690.3083everyone is doing what he or she should do0.0910.776-0.0500.3530.7930.2185in charge of implementation0.0610.768-0.1550.2880.7410.1018sufficient support and instruments external change agents-0.1010.0480.8450.1680.2740.8307gain valuable insights at collaborative meetings-0.0280.0010.7990.2100.2390.79110external change agents made goal and clarified way to achieve it0.0350.1230.7150.2920.3570.7639external change agents raised high expectations about performance and improvement potential0.151-0.2040.7080.2890.0690.690Notes: Extraction method: Principal Component Analysis. Rotation method: Promax with Kaiser normalization. Rotation converged in five iterations.Valid responses are high for all items, providing evidence that items and response choices are clear and unambiguous. Three respondents had filled in less than half of the total number of items and were excluded from further analyses. When a respondent had given more than one option, this item was marked \"missing\". There were no items with 80% of the answers falling in one category. No items were excluded based on the percentage of missing responses.The suitability of the data for component analysis was tested via the Kaiser-Meyer-Olkin measure of sampling adequacy, which tests the partial correlations among the items. Its value should be higher than 0.5 for a satisfactory analysis to proceed [27]. The KMO measure in this study was 0.82. Next, Bartlett's test of sphericity verified that the inter-item correlations were sufficient (X2 = 1211.8; df = 105; P < 0.001). The correlation matrix is thus not an identity matrix, which would indicate that the factor model is inappropriate because variables only correlate with themselves and all other correlation coefficients are close to zero.[28] Principal Component Analysis (PCA) was chosen as the approach to establish which linear components exist within the data and how particular variables contribute to that component.A decision to be made is the number of linear components or factors. A typical approach is the Kaiser-Guttman rule which states that an eigenvalue (i.e. the variance accounted for by each underlying factor) must be greater than one. However this approach usually produces many factors along with the inherent difficulty of properly interpreting them. Another eigenvalue-based approach is to examine Cattell's scree plot; a two dimensional graph with factors on the x-axis and eigenvalues on the y-axis. Based on the scree plot in figure 1 and the Kaiser-Guttman rule three factors can be identified.Figure 1Cattell's scree plot; a two dimensional graph with factors on the x-axis and eigenvalues on the y-axis.Rotation maximizes the loading of each variable on one of the extracted components whilst minimizing the loading on all other components. The exact choice of rotation depends on the answer to the question whether or not underlying factors are related. When on theoretical grounds the components should be independent an orthogonal rotation like varimax is recommended. However, if theory suggests that factors might be correlated, then an oblique rotation is to be selected. DeVellis provides specific guidance for when an orthogonal rotation should be used. He suggests that when the correlations among the factors are less than .15, the orthogonal approach is best, but otherwise the oblique rotation is a better option.[29] Since we assume that the three dimensions in our study are related to each other, we prefer an oblique promax rotation over an orthogonal rotation. PCA demonstrated three factors cumulatively accounting for 65% of variation in all components. The first accounts for 37% of the variance, the second for 15% and the third for 13%.Oblique rotation generates a pattern matrix with factor loadings and a structure matrix with correlations between items and components in a structure matrix. Table 3 contains both matrices. The structure matrix differs from the pattern matrix in the sense that shared variance between components is not ignored. The pattern matrix contains standardized regression coefficients (weights) which reflect the relative and independent contribution of each factor to the variance of the item on which it loads.[30] The structure matrix loading is a measure of the association (Pearson's correlation coefficient) between each item and the factor on which it loads, when the factors are correlated there is overlap among the loadings, which make structure matrix loadings biased estimates of the independent relationship between item and factor.[30] It is for this reason that our interpretation of the factors is based on the pattern matrix coefficients rather than the structure matrix loadings.A cut-off point of 0.50 for factor loadings was adopted, i.e. only those items scoring higher than this threshold were retained for further analyses [31]. Item 6 \"team is properly trained\" was dropped based on this criterion. It was not necessary to apply a second criterion; none of the remaining items loaded higher than 0.4 on more than one factor.[28]In table 4 the pattern and the structure matrix following from the component analysis are presented again, this time without item 6 and values < .40. The three components are labelled 'organizational support', 'team organization' and 'external change agent support'. For each component the reliability is assessed using Cronbach's alpha. Coefficients range from 0.77 to 0.91, higher than the preferred 0.70 level. In the right column the alpha value is shown for each component per item if that item would be deleted. Removing items does not lead to an improvement of the scale reliability of the components. In table 2 item 6 was distributed into external change agent support. Cronbach's alpha of the third component incorporating item 6 is 0.74. Adding item 6 does not improve scale reliability.Table 4Rotated component matrices and Cronbach's alpha: 14 itemsItemDescriptionPattern matrixStructure matrix123123Scale if item removed1st FACTOR: organizational support (5 items; alpha = 0.91)12strategic management supports project actively0.9320.9100.8714does everything to increase willingness to change0.8970.8970.8711project is important to strategic management0.8400.8500.8913hospital gives the support needed in department(s) to make project successful0.8210.8440.8915pays attention to team activities0.7260.7550.912nd FACTOR: team organization (5 items; alpha = 0.84)4responsible for progress0.8110.8050.812clear division of tasks0.7800.8190.803everyone is doing what he or she should do0.7760.7950.811good communication and coordination0.7730.7690.815in charge of implementation0.7670.7470.823d FACTOR: external change agent support (4 items; alpha = 0.77)8sufficient support and instruments external change agents0.8420.8300.677gain valuable insights at collaborative meetings0.7970.7910.7110external change agents made goal and clarified way to achieve it0.7140.7620.729external change agents raised high expectations about performance and improvement potential0.7040.6940.76Notes: Extraction method: Principal Component Analysis. Rotation method: Promax with Kaiser normalization. Rotation converged in five iterations.The 14 items were used to create the multi trait/multi-item matrix shown in table 5. The matrix helps to examine the relationship of each item with its own scale, as well as its correlations with other scales. Item-scale convergent validity is tested by checking the range of item-scale correlations. Item-internal consistency is satisfactory and the inclusive criterion of a correlation of 0.40 or higher is met for all items. The multi trait/multi-item correlation matrix also allows examination of the assumption that items are stronger measures of their constructs than of the other constructs. In order to be significant the item-scale correlation for a scale should be at least two standard errors higher. The standard error of the correlation coefficient is approximately equal to 1 divided by the square root of the sample size. In our case two standard errors is equal to: 2(1/√165) = 0.16. For all three factors the divergent validity test demonstrated significant success.Table 5Summary of results of multi-trait/multi-item scalingItem-scale convergent validity Criterion 1 (inclusive criterion)Item-scale divergent validity Criterion 2 (exclusive criterion)Scaling fulfilmentScaleRange of item-scale correlations1Number of item-scale correlations2Range of correlations with other scales3Number of items higher correlation with other scale4Number of items that meet criterion 1 but not 21. Organizational support0.646–0.8335/50.165–0.3710/50/52. Team organization0.601–0.7015/50.096–0.3920/50/53. External change agent support0.471–0.6574/40.070–0.3500/40/51 Pearson correlations between items and hypothesized scale (corrected for overlap).2 Number of item-scale correlations that meet minimum standard for convergent validity (≤ 0.40).3 Pearson correlations between items and other scales.4 Correlations higher between items and other scales in comparison with hypothesized scale (by two standard errors or more; ≤ 0.16)DiscussionBefore going deeper into the interpretation and implication of the components found, the steps taken so far will be summarized. The theoretical framework of this study is built on literature about QICs, team based implementation and the dissemination of innovations within health service organizations. Appropriateness, clarity and completeness of the items in a draft version of the instrument was revised by experts who also judged the appearance, question sequence and completion time. This step was an important exercise for supporting content validity and resulted in a 15 item questionnaire that was administered by project leaders of a national hospital care improvement programme, 165 of the returned questionnaires (70%) were included in the study. Principal component analysis was performed and three components were extracted, accounting for 65% of the variance of the items. Item-scale criterion was not satisfied in the case of one item, which was eventually excluded from the instrument. Construct validity was supported by the overall success of the convergent and discriminant validity tests of item-scale correlations, according to the multi trait/multi-item correlation matrix approach. Reliability of the three components was addressed using Cronbach's alpha coefficient, which was well above the recommended minimum value for each individual construct.The first factor contains five organizational support items. The second factor also consists of five items, now affecting the organization of the project team. The four items of the third factor relate to the support given by external change agents. The factor structure found in the data is almost identical to the three subcategories in table 2 (left column). However, instead of what we expected 'proper team training' loaded on organizational and not on external change agent support.A few remarks must be made with regards to the sample size. In the literature different standards are applied for the number of items-number of cases ratio for a factor or principal component analysis. Kass and Tinsley recommend five to ten cases for each item.[32] Nunnally is more restrictive and recommends at least ten, a threshold met in this study.[33] A second point is the total sample size. There is no real consensus in the literature on this criterion. Several authors consider 300 cases as comforting [34,35], 100 as poor and 1000 as excellent [35]. Nevertheless, according to MacCallum et al. samples between 100 and 200 can be good enough provided that communalities are higher than .5 and there are relatively few factors each with only a small number of indicator variables.[36] The lowest communality in this study was .52 with a minimum factor size of four. Guadagnoli and Velicer state that the most important issues in determining reliable factor solutions are the absolute sample size and the absolute magnitude of factor loadings. In short, they argue that if a factor has four or more loadings greater than .6 then it is reliable regardless of sample size.[37]A limitation of this study is that we could not assess Test-Retest Reliability due to an agreement made between the funding organization, hospitals, programme makers that the questionnaire burden for hospital staff was to be minimized. Another possible limitation is that the instrument was tested for its overall psychometric properties using the combined sample of project leaders. The respondents differ in position, type of project, hospital organization and time period – the first year of the first group, took place a year before the first year of the second group and two year before the first year of the third group. Despite these differences, it is likely that the instrument is suitable for the evaluation of other collaborative health care improvement programmes. The instrument was tested for its overall psychometric properties using the combined sample of project leaders. Notwithstanding functional and other differences the study results show that the respondents could very well make a distinction between the three dimensions. The three components form a basic measuring instrument and a promising step towards a better understanding of QIC-implementation. Combined with the qualitative methods that are indispensable for a programme evaluation, the quantitative data gathered using the instrument can potentially add more detailed information on the relations between the components and narrative data collected by interviews or observations.This study reported on the development and psychometric testing of a measuring instrument. A short term benefit from measuring the conditions during the implementation is that it may be helpful in identifying those project teams with deficiencies in the areas measured by the instrument, in order to provide them with additional resources and support. Yet, more fundamental questions may be answered using data from this questionnaire. Insight into team organization and support during the implementation may help in understanding how process features affect the actual or perceived amount of success. There is, nonetheless, something to gain by adding supplementary questions, i.e. on the complexity, relative advantage and the nature of the specific interventions that are implemented by the teams, as well as the indicators used to monitor the project targets. Other relevant questions affect scales measuring the learning climate within the implementation area, activities taken on behalf of sustaining new working methods, the quantitative spread of the projects throughout the organization and so on. Extensions like these can be rewarding in an a priori fashion, since they potentially illuminate the complexity and advantage brought by a project in relation to the types of interventions and the measuring efforts that are part of applying rapid cycle improvement. At this moment knowledge on these matters is limited but very welcome.ConclusionThis study resulted in the development of a measuring instrument for team organization and supportive conditions for the implementation of QIC projects. After psychometric testing it demonstrated acceptable levels of internal consistency reliability and content and construct validity. This evidence warrants application of the instrument for the evaluation in the hospital improvement programme and similar QICs in health care. Linking outcome data on performance indicators to the state of the conditions during the implementation may be helpful in explaining, perhaps even predicting, the amount of success.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsMLAD was responsible for designing the study, conducting the literature review, developing the questionnaire, acquiring, analyzing and interpreting the data and drafting the manuscript. As research manager of the independent evaluation study of the hospital improvement programme CW was responsible for designing the study and developing the questionnaire. CW and PPG assisted in interpreting the results and revising the manuscript for intellectual content. All authors have read and approved the final manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2535565.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2535565",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2535565\nAUTHORS: Antonina Y. Alexandrova, Katya Arnold, Sébastien Schaub, Jury M. Vasiliev, Jean-Jacques Meister, Alexander D. Bershadsky, Alexander B. Verkhovsky\n\nABSTRACT:\nDynamic actin network at the leading edge of the cell is linked to the extracellular matrix through focal adhesions (FAs), and at the same time it undergoes retrograde flow with different dynamics in two distinct zones: the lamellipodium (peripheral zone of fast flow), and the lamellum (zone of slow flow located between the lamellipodium and the cell body). Cell migration involves expansion of both the lamellipodium and the lamellum, as well as formation of new FAs, but it is largely unknown how the position of the boundary between the two flow zones is defined, and how FAs and actin flow mutually influence each other. We investigated dynamic relationship between focal adhesions and the boundary between the two flow zones in spreading cells. Nascent FAs first appeared in the lamellipodium. Within seconds after the formation of new FAs, the rate of actin flow decreased locally, and the lamellipodium/lamellum boundary advanced towards the new FAs. Blocking fast actin flow with cytochalasin D resulted in rapid dissolution of nascent FAs. In the absence of FAs (spreading on poly-L-lysine-coated surfaces) retrograde flow was uniform and the velocity transition was not observed. We conclude that formation of FAs depends on actin dynamics, and in its turn, affects the dynamics of actin flow by triggering transition from fast to slow flow. Extension of the cell edge thus proceeds through a cycle of lamellipodium protrusion, formation of new FAs, advance of the lamellum, and protrusion of the lamellipodium from the new base.\n\nBODY:\nIntroductionCell migration involves coordination of protrusion at the cell front, adhesion of the newly protruded domains to the substrate, pulling of the bulk of the cell towards new adhesion sites, and breaking of adhesion and retraction at the cell rear. These events are largely based on actin microfilament system: protrusion is believed to be driven by assembly of actin network at the leading edge, while generation of the tension force to pull the cell body and retract the tail depends, at least in part, on the contraction of actin network by motor protein myosin II [1], [2]. Adhesion of actin network through plasma membrane to the extracellular matrix is mediated by specialized protein complexes termed focal adhesions (FAs) [3]–[5], which also serve as signal transduction sites where the cell gathers information about the mechanical and chemical properties of the environment [3], [6].The interaction between FAs and actin network is complex, in particular due to the fact that actin network in most migrating cells is not stationary with respect to the substrate, but moves away from the leading edge of the cell in a process known as retrograde flow [7], [8]. Retrograde flow is thought to be a consequence of the same forces that drive cell migration: the pressure of actin assembly against the membrane and contractile forces in the actin network [9], [10]. FAs in some instances have been observed to move themselves [11]–[13], but the majority of FAs at the leading edge of the cell is stationary [14]. To rationalize the relationship between adhesion and retrograde flow, a hypothesis has been put forward likening adhesion to a clutch [9], [11], [15], [16]. When the clutch is not engaged (no adhesion), actin machinery runs idle resulting in retrograde flow but no net advance of the cell; conversely, establishment of adhesion converts actin network flow into a productive advancement of the cell. Consistent with this hypothesis, inverse correlation between cell advance and retrograde flow rate was indeed demonstrated in some cases [11], [17], but not in other cases [17], [18]. In most cases, retrograde flow coexists with adhesion, suggesting that FA components form a slipping interface with the actin network. Recent studies demonstrated various degrees of correlation between motion of filamentous actin and various adhesion components, establishing a hierarchical order of interaction within this interface [19], [20]. However, a more general question of how FAs arise in the midst of flowing actin network and if and how their formation influences the flow remains unanswered.The relation between actin network and FAs is further complicated by the existence of two different types of actin network at the leading edge of the cell, each having its characteristic composition, dynamics and flow velocity [21], [22]. The more peripheral network domain, the lamellipodium, is characterized by faster actin turnover and retrograde flow than the inner domain, the lamellum. Signature components of the lamellipodium include Arp2/3 and ADF/cofilin, involved in formation and turnover of branching actin network, while the lamellum contains tropomyosin and myosin II, proteins characteristic of contractile bundles of actin filaments. Mature FAs which are associated with contractile actin bundles, are also abundant in the lamellum [19], [22].The relative roles of the lamellipodium and the lamellum in the cell are controversial. One point of view is that lamellipodium is the “organ of protrusion” and the factory of actin filaments in the cell [23]. Other studies suggest that most of the actin filaments assembled in the lamellipodium disassemble locally and do not become incorporated into other actin structures in the cell, and that productive advance of the cell correlates with the advance of the lamellum rather than the lamellipodium [22], [24]. However, the mechanism of the advance of the lamellum is not clear. While the lamellipodium displays a zone of intense actin assembly at its outer edge, consistent with the lamellipodial protrusion being powered by actin assembly, the lamellum is characterized by a distributed pattern of actin turnover [22]. Consequently, it is not clear if the expansion of the lamellum proceeds via local assembly of the lamellar actin network at its outer edge, or via acquisition of actin filaments from the lamellipodium. Importance of the lamellipodium actin assembly emerged from the analysis of the origin of actin filament bundles in the lamellum [25]. This study suggested that transverse actin arcs formed in Arp2/3-depended mechanism characteristic of the lamellipodium, while dorsal stress fibers arised in the arp2/3-independent, formin-dependent manner. Thus, one population of actin filaments in the lamellum may be inherited from the lamellipodium, while another population may arise locally. Recent analysis of the dynamics of cell spreading [26], [27] suggested that edge extension is a cyclical process involving expansion and retraction of the lamellipodium, and that the lamellipodial actin provides a transient link between myosin II and adhesion sites. Irrespective of the eventual fate of the lamellipodial actin filaments, it is unclear how the position of the lamellipodium/lamellum boundary is defined and why this boundary moves during cell spreading and migration.In this report, we analyze the correlative dynamics of FAs and the boundary between the lamellum and the lamellipodium in spreading cells. We find that formation of FAs depends on actin flow and at the same time controls the dynamics of flow the by triggering the transition from fast to slow flow and defining the position of the lamellipodium/lamellum boundary.ResultsTwo types of retrograde flow visualized by enhanced phase contrast microscopy at the periphery of spreading cellsEnhanced phase contrast microscopy [28] allows detection of small contrast differences in the peripheral cytoplasm. It was previously used to analyze the organization [28] and dynamics [29] of the actin network in the lamellipodium of migrating fish keratocytes. Here, we applied this technique to visualize retrograde flow and the lamellipodium/lamellum transition in spreading fibroblasts and melanoma cells (Fig. 1). Comparison of enhanced phase contrast images and fluorescence actin images demonstrated that all the actin structures (lamellipodial network, filopodial-type small filament bundles, and stress fibers terminated at adhesion plaques) that were visualized in the fluorescence images were also clearly detectable in the enhanced phase contast images (Figure 1B, C). We followed the dynamics of these features in time-lapse movie sequences of the phase contrast images and fluorescence images. Two distinct zones of retrograde flow from the cell edge to its center were clearly distinguishable in time-lapse sequences and resolved by kymograph analysis (Figure 1 and Supporting Movies S1 and S2). The peripheral (faster) zone of flow coincided with the lamellipodial network of actin (Figure 1, arrowheads), while the more central (slower) zone encompassed the region of the cytoplasm containing stress fibers and commonly defined as the lamellum. Flow velocity varied depending on the type and state of the cell (0,5–7 µm/min for the lamellipodium and 0,05–2,5 µm/min for the lamellum, with faster flow typically observed at the early stages of spreading), but in the same cell flow velocity in the lamellipodium was always higher than that in the lamellum. Interestingly, the flow of the phase contrast features along the radial stress fibers in the lamellum and in the space between the stress fibers proceeded with exactly the same velocity, while the positions of the peripheral ends of the stress fibers did not change with time (Figure 1A). The lamellum and the lamellipodium were previously distinguished by their kinematics and dynamics using fluorescence speckle microscopy [21], [22].10.1371/journal.pone.0003234.g001Figure 1Retrograde actin flow in spreading cells visualized by enhanced phase contrast and fluorescence microscopy.Individual images of the time-lapse sequences are shown at the left, kymographs, at the right. Arrowheads indicate zones of fast flow (lamellipodia) , dashed lines on images indicate the regions used to generate kymographs, arrows in kymographs indicate the slope of the isointensity lines reflecting the velocity of flow. (A) Swiss 3T3 fibroblast at 1.5 h of spreading displays wide lamellipodium, which is distinguishable from the lamellum by its density and texture (left image) and the velocity of retrograde flow (see Supplementary Data, Movie S1A). Kymographs are generated along the phase-dense fiber (second from the left) and along the line between the fibers (second from right). The isointensity line in kymograph was traced manually (white line) and analyzed in Matlab to generate the plot of velocity versus distance from the edge of the cell (right), which shows an abrupt change of velocity from approximately 6.2 µm/min to 2.4 µm/min at the lamellipodium/lamellum boundary. (B) REF-52 fibroblast at 5 h of spreading injected with rhodamine-actin and visualized with double mode microscopy: phase contrast (left) and fluorescence (second from left). The lamellipodium is distiguishable from the lamellum by its high actin concentration and the density and texture in the phase contrast images. The width of the lamellipodium in late spreading was smaller than in recently plated cells (compare with A). Small fibers in the lamellum are apparent in both fluorescence and phase contrast images. Kymographs generated from the phase contrast (second from right) and fluorescence (right) image sequences show identical flow velocities (0.8 µm/min in the lamellipodium, and 0.06 µm/min in the lamellum). See also Supplementary Data, Movie S1B. (C) Spreading B16 melanoma cell expressing GFP-actin imaged in double phase contast/fluorescence mode and analyzed with kymographs as in (B). Dashed line marked “CD” on kymograph indicates the time of addition of cytochalasin D (2 µM). Addition of cytochalasin D resulted in the immediate arrest of spreading and the decrease of the velocity of the lamellipodial flow (from 2.6 µm/min to 0.4 µm/min), which thus became equal to the velocity of the lamellar flow. (D) Enhanced phase contrast image (left) and kymograph (right) of spreading Swiss 3T3 cell. Dashed line on kymograph indicate the time of addition of 30 µM HA1077, which results in the decrease of velocity of the lamellar flow (from 1 to 0.4 µm/min) with no change in the lamellipodial flow (4.5 µm/min). Scale bars on images, 5 µm; on kymographs, vertical bars, 2 µm, horizontal bars, 2 min.Consistent with the previous reports [10], [22], our phase contrast microscopy analysis revealed that two types of retrograde flow had different inhibitor sensitivities and therefore were likely driven by different mechanisms. The lamellipodial flow was instantly inhibited upon treatment with cytochalasin D (Figure 1C, and Supporting Movie S3). At the same time, up to two-minute treatment with cytochalasin D did not affect the velocity of flow in the lamellum. Inhibition of cell contractility with the rho-kinase inhibitor HA1077 [30] (Figure 1D and Supporting Movie S4) and the protein kinase inhibitor H7 [31] (not shown), on the other hand, reduced the velocity of lamellar flow and did not affect lamellipodial flow.Kymograph analysis indicated that the flow velocity changed abruptly at the boundary between the two zones of flow (Figure 1A). This boundary was distinct based on both velocity analysis and the change of density and texture of the actin network seen in fluorescence as well as in phase contrast images (Figure 1A–D). Interestingly, the boundary was not smooth, but often consisted of several segments, convex in the inside direction, forming a festooned line. The apexes of this line coincided with the termini of the radially oriented stress fibers, which likely corresponded to the FAs (Figure 1A). Thus, it appeared that the position of the boundary between the two flow zones was related to the positions of FAs. Next, we analyzed the relationship between flow and adhesion sites in more detail.Formation of nascent adhesions locally blocks the lamellipodial flowWe investigated simultaneous dynamics of FAs and retrograde flow using YFP-paxillin as a marker of adhesion sites. Time-lapse sequences recorded in double enhanced phase contrast /fluorescence mode demonstrated that the boundary between the fast and slow flow zones coincided with the line connecting the outmost FAs at the cell periphery (Figure 2A and Supporting Movie S5). During cell spreading, new paxillin-positive sites (nascent FAs) always appeared outside of the area bordered by this line (194 events of new adhesion formation observed in 8 spreading cells), indicating that they originated within the lamellipodia. In the double-mode image sequences, nascent FAs were indeed initially detected within the lamellipodial flow zone. Within seconds of the detection of the nascent adhesion, phase contrast microscopy revealed irregularity of rapid lamellipodial flow manifesting as an accumulation of phase dense material at the site of adhesion and an abrupt reduction of the flow velocity in the zone immediately behind the adhesion site (Figure 2B, C and Suppurting Movies S6 and S7). This disturbance of flow may be the cause for previously noted phenomenon of “ruffling” at the new adhesion sites [32]. As the new adhesion increased in size, the new boundary between the lamellipodial and the lamellar flow zones appeared, passing through the site of the newly formed adhesion (Figure 2B, C). The multiple events of the formation of new adhesions in the lamellipodial flow zone eventually resulted in the gradual anterograde movement of the boundary between the lamellum and the lamellipodium. Advance of the boundary was often associated with a transient decrease in the width of the lamellipodial zone, but the lamellipodium subsequently re-grew to its original width due to the protrusion at its outer boundary (Figure 2C, and Supporting Movie S7). Thus, anterograde movement of the boundary between the flow zones in combination with the lamellipodial protrusion contributed to the overall spreading of the cell. The coupling between the formation of new adhesions and the advance of the lamellipodium/lamellum boundary was evident both in the enhanced phase contrast/YFP-paxillin double imaging mode and in the rhodamine-actin/YFP-paxillin double fluorescence mode (Supporting Movie S8).10.1371/journal.pone.0003234.g002Figure 2FAs define the boundary between fast and slow flow.(A) Superimposition of the enhanced phase contrast and fluorescence images (left) and kymographs (right) of spreading REF-52 cell expressing YFP-paxillin. Phase contrast image is represented in gray scale, and YFP-paxillin fluorescence image, in red. FAs marked by YFP-paxillin coincide with the boundary between the lamellipodium and the lamellum (see also Supplementary Data, Movie S2A). Kymographs (phase contrast on top, fluorescence in the middle, and merge at the bottom) demonstrate that the fast flow did not penetrate behind the FAs and that the zone of slow flow advanced concomitantly with the formation of new FA. Arrows on kymographs are drawn parallel to isointensity lines indicating the velocity of fast flow (4.5 µm/min), slow flow (0.5 µm/min), and the velocity of the sliding of FAs (0.15 µm/min). (B, C) Selected frames from the time-lapse sequence showing two instances of the formation of the new FAs and associated dynamics of the boundary between the two flow zones; time is indicated in minutes:seconds. Sequence (B) represents dynamics of the region boxed in (A). New FAs (paxillin-positive spots indicated with arrowheads) form within the lamellipodia at 30 s in (B), and 20 s in (C). Disturbance of the flow is simultaneously seen in the phase contrast image as a dark zone in front of the FA. Formation of FAs is followed next by the advance of the lamellum (dark boundary between the lamellipodium and the lamellum is visible in the phase contrast mode). In (B) the lamellipodium persists throughout the sequence, while in (C) formation of the new FA is followed by the ruffling and withdrawal and then re-growth of the lamellipodium. See Supplementary Data, Movies S2B and S2C. (D) REF-52 cells were plated in the serum-free media onto the coverslips coated with poly-L-lysine (1 h with 10 mg/ml aqueous solution), kymograph generated along the dashed line at the left is shown at the right. Kymograph demonstrates uniform flow velocity (1.6 µm/min) throughout the spread part of the cell. See also Supplementary Data, Movie S2D. Scale bars, 5 µm; in kymographs vertical bars, 2 µm, horizontal bars, 2 min.The advance of the boundary between fast and slow flow did not always coincide with the maturation of small dot-like adhesions into large streak-like structures. In some cases, nascent adhesions did not mature into large adhesions, but still marked the boundary between the fast and slow flow. Advance of the boundary was associated with apparent rapid turnover of these adhesions (Supporting Movie S9).Slow retrograde flow persisted behind the adhesion zone and, as noted above, was observed by phase contrast microscopy not only within the bulk of the lamellum, but also along the phase-dense cables likely representing the stress-fibers terminating in focal adhesion sites. Consistent with recent reports [25], [33], this was confirmed by double fluorescence imaging of the markers of stress fibers and focal adhesions. We used myosin II as one of the markers of stress fiber dynamics, because it was previously shown that myosin II is distributed in the lamellum and along the stress fibers in the form of distinct clusters of bipolar minifilaments [34]. Double florescence imaging with microinjected rhodamine-myosin II and YFP-paxillin demonstrated a flow of myosin-positive spots to the center of the cell away from the adhesion sites with velocities similar to the velocity of the lamellar flow component (Figure 3A, and Supporting Movie S10). Focal adhesions remained stationary or moved at velocities much smaller than that of the myosin flow. This flow depleted myosin from the area immediately behind the adhesion, but new myosin spots continuously appeared there, so that the overall myosin density remained virtually constant. The flow along the fibers with respect to their associated adhesion sites was also confirmed using fluorescence imaging of the cells either injected with fluorescent actin probe or expressing GFP-actin probe. Distinct specific features along the fiber (e.g. bifurcations) and non-uniformity of actin density served as reference points (Figure 3B and Supporting Movie S11).10.1371/journal.pone.0003234.g003Figure 3Flow of the components of stress-fibers with respect to FAs.(A) Double fluorescence image (left) and kymograph (right) of YFP-paxillin (red) and rhodamine-myosin II (cyan) in REF-52 cell. Myosin flow velocity is 1 µm/min, FAs move at 0.05 µm/min (arrows). See Supplementary Data, Movie S3A. (B) Double fluorescent image (left) and kymograph (right) of YFP-paxillin (red) and GFP-actin (cyan) in REF-52 cell. Actin flow velocity in the stress fiber is 0.75 µm/min, FAs move at 0,12 µm/min (arrows). See Supplementary Data, Movie S3B. Scale bars, 2 µm; in kymographs vertical bars, 2 µm, horizontal bars, 2 min.The above findings suggested that FAs defined the position of the boundary between two flow zones. To analyze the organization of the flow in the absence of FAs, we plated the cells on poly-L-lysine-coated surface in the absence of serum and extracellular matrix proteins. In these conditions, the cells attach and spread, but the specific FA complexes and stress fibers do not develop [35]. The cells initially spread rapidly on poly-L-lysine, but subsequently arrested in a “fried-egg” state with the bulk of the cytoplasm remaining in the center. The spreading domain appeared uniform in its organization and dynamics from the edge to the perinuclear cytoplasm. It exhibited retrograde flow with the velocity either uniform or gradually decreasing towards the cell center and intermediate in value between typical fast and slow flow velocities (Figure 2D and Supporting Movie S12). Thus, two zones of flow did not develop in the absence of FAs, suggesting that the boundary between these zones not only coincided with, but indeed depended on FAs.Inhibition of the lamellipodial flow blocks the formation of nascent adhesionsIn the previous section, we have demonstrated that nascent adhesions formed exclusively in the fast flow zone. Next, we investigate if the experimental inhibition of fast flow affects the formation of nascent adhesions. We studied paxillin dynamics during a short-term treatment with cytochalasin D, which, as shown in the first section, rapidly abolished the fast flow. We did not observe formation of any new nascent adhesions at the cell periphery, moreover, the small peripheral adhesions present before addition of the drug disappeared after approximately two minutes of treatment (Figure 4A). At the same time, large mature adhesions remained unaffected.10.1371/journal.pone.0003234.g004Figure 4Effect of the inhibitors of retrograde flow on FAs.FAs were visualized with YFP-paxillin. FA distribution is shown just before (top panels in A–C), and after the addition of the inhibitor (bottom panels in A–C, and middle panel in C), time after the addition is indicated in minutes. (A) Cytochalasin D treatments (2 µM) abolished small nascent adhesions; (B) H7 treatment (30 µM) abolished large mature adhesions and increased the number of small adhesions; (C) cytochalasin D treatment of the cells preincubated for 1 h with H7 abolished small adhesions which were present after treatment with H7. Bar, 5 µm.In contrast to the inhibition of fast flow, inhibition of slow flow with the inhibitors of cell contractility increased the number of small dot-like adhesions (Fig. 4B). This can be explained by the inhibition of maturation of these small adhesions into large ones upon block of contractility as was previously reported in several studies [31], [36], [37]. Consistent with the results of the same studies, rho-kinase inhibition also led to disassembly of previously existing mature adhesions (Figure 4B). Finally, combined treatment with rho-kinase inhibitors and cytochalasin D resulted in total disappearance of both types of adhesions (Figure 4C).DiscussionIn this study, we analyzed comparative dynamics of actin retrograde flow and focal adhesions at the leading edge of the cell. Many previous studies investigated actin dynamics at the leading edge and the dynamics of focal adhesions separately [10]–[14], [21], [22], [38]. A few recent studies also analyzed simultaneous dynamics of actin and the FA components [19], [20], but did so in a steady state situation where the formation of new FAs was not observed. In contrast to these studies, we concentrated on the changes of actin flow associated with the formation of new FAs during cell spreading and on the interaction between actin dynamics and adhesion dynamics.Two zones of retrograde flow at the cell periphery were previously observed with fluorescent speckle microscopy technique [21], and distinguished using automated analysis of speckle dynamics [22]. Here we visualized flow using enhanced phase contrast microscopy [28], [29]. The advantages of this technique are that no exogenous markers for actin network need to be introduced into the cell, and that the flow is analyzed in the phase contrast images that simultaneously show overall cell morphology. Enhanced phase contrast microscopy clearly visualized two types of the flow. The boundary between two flow zones was clearly distinguishable in our images both morphologically and with kymograph analysis, which demonstrated an abrupt change of the flow velocity typically by a factor of two or more at the boundary. The velocities of flow varied significantly, with the maximum values (7 µm/min for fast flow, and 2,5 µm/min for slow flow) being higher than previously reported (e.g., 0.5–2 µm/min for fast flow, and 0.1–0.3 µm/min for slow flow in [21], [22]), suggesting that flow velocities in both zones may depend on the type and/or physiological state of the cell. In particular, high flow velocities may be associated with the early state of radial cell spreading. Interestingly, velocities of the fast retrograde flow in spreading cells measured here are of the same order of magnitude as the migration velocities of rapidly migrating cells, e.g., fish epidermal keratocytes [17], [39]. This finding indicates that maximal actin assembly rates may be similar in different types of cells, while the difference in protrusion rate between the “slow” cells (fibroblasts) and “fast” cells (keratocytes) may be due to the difference in retrograde flow rate (high in spreading fibroblasts and low in migrating keratocytes).We have correlated the patterns of retrograde flow with the dynamics of FAs in the same cells and found that 1) positions of FAs at the cell periphery coincided with the boundary between the fast and slow flow; 2) nascent adhesions first appeared in the fast flow zone; 3) the boundary between the fast and slow flow advanced to the new adhesion sites within seconds of the formation of new adhesions; and 4) in the absence of FAs (on polylysine-coated substrate) flow was apparently homogeneous and not separated in two zones. Thus, FAs not only appeared necessary for the formation of the lamellipodium/lamellum boundary, but their location seemed to define the position of the boundary. Since formation of new FAs was a transient event and was followed by rapid advance of the lamellum to the new FA sites, static observations demonstrated co-localization of the lamellipodium-lamellum boundary with the most peripheral row of Fas. This co-localization was also noted in a previous study [19], although the relation of the movement of the lamellum/lamellipodium boundary to the formation of new adhesions was not analyzed. Also consistent with our findings, sharp boundary between the two zones of flow was not observed in sea urchin coelomocytes cultured on polylysin-coated surfaces [10], , although inhibitor analysis revealed two different components of flow velocity. Taken together, these findings strongly suggest that the formation of FAs is the critical event controlling the transition from the fast to the slow flow type and that FAs define the position of the boundary between the lamellipodium and the lamellum.How FAs influence the flow and what exactly are the features of FAs that trigger the formation of the boundary between the fast and slow flow is a question for future research. Our observations that the boundary advances within seconds of the formation of FAs and that small FAs that turn over at the edge of the cell and do not mature into larger long-living Fas (see Supporting Movie S9) are sufficient for the formation of the boundary suggest that maturation of FAs is not necessary for the effect on actin flow. The simplest hypothetical mechanism of how nascent adhesions modulate the flow is the mechanical resistance due to the anchoring of actin filaments to nascent adhesion complexes. Similar event may have been previously observed in an artificial situation: arrest of the flow upon anchorage to a synthetic bead on the apical cell surface [40]. One can imagine that at first a few filaments become anchored, than more filaments arrive with the flow and become entangled and anchored, and eventually the network flow is locally arrested. However, initial mechanical arrest of the flow may represent just a first step in the formation of the lamellipodiam/lamellum boundary and may be by itself not sufficient for the demarcation of the two types of actin network. Initial mechanical events may trigger a signaling cascade resulting in a change in the overall organization and composition of the actin network, which could me mediated by a change of activity of actin-interacting proteins, e.g. controlling actin filament stability such as cofilin and tropomyosin [41].Another open question is how the discrete FAs create continuous boundary for the network flow. One possibility is that the continuous barrier forms due to the cross-linking and entanglement of the filament network between discrete pin-down points of individual FAs. In this mechanism, one could expect that the segments of the boundary between adjacent FAs would bend inward due to the exterior pressure from the fast flow, apparently consistent with the observed shape of the boundary (convex inward between FAs, see Fig. 1A). Quantitative analysis of the stress distribution pattern around FAs in the moving actin network is a challenge for biophysical modeling and may help to understand the nature of the lamellipodium/lamellum boundary.Several recent studies [22], [27] suggested a partial overlap between the lamellum and the lamellipodium. In our experiments, the boundary between the two zones always appeared distinct, except immediately after the formation of new adhesion, when the boundary shifted its position. Further time-resolved analysis is necessary to determine whether the overlap between the two zones is limited to the phases of cell protrusion when the boundary is shifting, or exists continuously.While formation of FAs apparently creates a barrier for the fast flow, actin network inside the area bordered by FAs is not completely immobilized, but undergoes slower flow characteristic of the lamellum and probably driven by myosin-dependent contraction. The flow of the components of stress fibers away from the stationary FAs associated with their tips suggests that stress fibers grow at these tips. The growth may represent either a de novo assembly of actin filaments, or an association with the fiber tip of the pre-assembled actin filaments delivered by flow. In any case, the growth mechanism should allow for continuous connection and force transmission between the growing stress fiber tip and focal adhesion complex. Recent study [25] suggested that formin-family proteins that form leaky cups at the barbed ends of actin filaments [42], [43] may be responsible for assembly of at least a part of the population of actin filaments in filament bundles in the lamellum.Our results suggest that protrusion at the leading edge of the cell could be considered as a cycle of alternating steps of protrusion of the lamellipodium and advance of the lamellum, with the formation of FAs linking these steps together (Fig. 5). This cycle may be related to the recently described periodic lamellipodial contractions in spreading epithelial cells [26], [27]. However, unlike [27], we do not find a correlation between the retraction phase of the cycle and the formation of new FAs. In our experiments, new FAs appeared during lamellipodial advance as well as during its temporal retraction.10.1371/journal.pone.0003234.g005Figure 5Diagram of the multi-step protrusion process at the leading edge of the cell.Fast and slow flow zones are shown with different shading; nascent and mature FAs are shown as ellipses of different sizes; and stress fibers are shown as sticks. Formation of nascent FAs within the fast flow zone locally interferes with flow, and eventually results in the advance of the boundary between the fast and slow flow zones. Therefore, the width of the slow flow zone (the lamellum) increases, while the width of the fast flow zone (the lamellipodium) decreases. Subsequently, the lamellipodium re-establishes its width, resulting in the overall advance of the cell edge.Ponti et al. [22] argued that the advance of the cell edge is correlated with the advance of the lamellum rather than the lamellipodium. These authors considered actin dynamics in the lamellum autonomous from the lamellipodium, with very little material transfer between the two. However, single speckle tracking techniques may tend to underestimate the transfer of polymer mass at the lamellipodium/lamellum transition where the speckle velocity changes abruptly and individual speckles may be difficult to follow. Part of the actin filaments of the lamellum may originate in the lamellipodium [25]. Irrespective of whether any actin filaments from the lamellipodium are transferred to the lamellum or not, our findings indicate important role of the lamellipodium in the protrusion cycle. The lamellipodium emerges as the site where nascent adhesions arise. Moreover, we found that the inhibition of the lamellipodial actin flow abolishes nascent adhesions, suggesting that flow is necessary for their formation and maintenance. What are the specific features of the actin dynamics in the lamellipodium that promote the initiation of adhesions? One of the possibilities is that intensive actin polymerization in the lamellipodium creates conditions where the adhesion formation is favored. DeMali et al. [43] suggested that Arp2/3 complex involved in branching actin assembly may recruit FA component vinculin and promote its association with actin. Alternatively, the flow itself may stimulate adhesions mechanically, e.g. promote clustering of the adhesion molecules or trigger hypothetical mechanical sensors activating the adhesion process. We find the last possibility especially intriguing, as it would suggest a peculiar symmetry between the initiation and maturation of the focal adhesions. It is well established that the maturation of focal adhesions is promoted by applied tension, suggesting a stretch-activated sensor mechanism [45]–[48]. We propose that nascent adhesions may also depend on force, but instead of myosin-dependent contraction force involved in maturation, nascent adhesions may depend on force associated with fast network flow in the lamellipodium. Displacement of adhesion components with respect to extracellular matrix was proposed as a key element of mechanosensing [49]. Analogously, relative movement of adhesion proteins and lamellipodial actin network may be involved in maintenance of nascent adhesions and their maturation. The specificity of the chemical and mechanical environment in the lamellum and the lamellipodium may define specific force- and/or displacement-triggered responses. Interestingly, “young” adhesions at the lamellipodium/lamellum boundary may experience both the compression due to the external “push” of the lamellipodial flow and stretching due the “pull” of the lamellar flow, possibly explaining strong traction at the substrate [50]. Irrespective of the specific molecular mechanisms of force-triggered responses that remain a challenge for the future, our study elucidates the essential reciprocal relation between dynamics of actin flow and FAs.Materials and MethodsCell cultureSwiss 3T3 mouse fibroblasts, REF-52 rat fibroblasts and B16 mouse melanoma cells were cultured in DMEM supplemented with 10% fetal bovine serum and antibiotics. For microscopy, the cells were plated at low density in 35 mm Petri dishes with heated glass bottom (Bioptechs, Butler, PA), or into the home-made Petri dishes with coverslip glued over the hole in the bottom. Before the observation, the culture medium was replaced with fresh DMEM with 25 mM HEPES, 10% fetal serum and antibiotics. 1–1.5 ml per dish of mineral oil was then applied to the surface to avoid evaporation on the microscope stage. The temperature was maintained during observation using the Bioptechs (Butler, PA) dish and objective heaters, or an infrared lamp.Cytoskeletal markersRhodamine-actin and rhodamine-myosin II were prepared and microinjected as described [34], [51]. To produce YFP-paxillin construct, paxillin cDNA (kindly provided by K. Nakata, S. Miyamoto and K. Matsumoto, National Institute of Dental and Craniofacial Research, NIH, Bethesda, MD) was cloned into EYFP-C1 (Clontech Laboratories, Palo Alto, CA, USA). GFP-actin construct [52] was kindly provided by G. Marriott (Max-Plank-Institute for Biochemistry, Martinsried, Germany). To achieve transient expression of YFP-paxillin and GFP-actin Swiss 3T3 and REF-52 cells were transfected with either one or both of the constructs by nuclear microinjection.Stable GFP-actin expressing B16 melanoma cell line [53] was a generous gift of Christoph Ballestrem (Weizmann Institute of Science) and Bernhard Wehrle-Haller (University of Geneva). Stable YFP-paxillin expressing REF-52 cell line was produced using retroviral infection. To produce vector for retroviral infection, DNA encoding YFP-paxillin was cut from pEYFP-paxillin expression vector and ligated into a retroviral vector, pBabeNeo [54]. The vector was expressed in packaging cell line, as described [54], and supernatant containing viral particles was used to infect REF-52 cells. Following infection, cells were selected with G418 and were further cultivated in the G418-containing medium (1 mg/ml).MicroscopyOptical microscopy was performed using a Nikon Eclipse TE300 inverted microscope with CFI Plan 100x phase objective (NA 1.25) and 100 W halogen and 100 W HBO light sources for phase contrast and epifluorescence microscopy, respectively. Images were captured with a Roper Scientific (Tucson, AZ) MicroMAX-1300PB cooled CCD camera operated with Metamorph software (Universal Imaging, West Chester, PA). To switch automatically between phase contrast and multicolor epifluorescence microscopy modes, shutters in the transmitted and epifluorescence light paths and exitation and emission filter wheels were operated with Ludl Electronic Products Ltd. (Hawthorne, NY) MAC 2000 and MAC 5000 controllers driven with Metamorph software. XF52-1 Pinkel filter set (Omega Optical, Brattleboro, VT) was used to separate rhodamine and YFP fluorescence, and JP3 filter set (Chroma Technology Corp., Rockingham, VT) was used to separate GFP and YFP fluorescence.Enhanced phase contrast microscopy was performed as described [28] (Verkhovsky et al., 2003): briefly, single frame exposures of 500–800 ms were used to achieve intensity readout of about 50% saturating level of the camera. Background images of the cell-free areas of the same dish were subtracted from the cell images (a constant was added to the result to avoid negative intensity values), and the resulting images were scaled to a narrow contrast range for optimal visualization of the structure of the lamellum and the lamellipodium.Image acquisition rate was one frame per 4 to 6 s for enhanced phase contrast microscopy and 1 frame per 4 to 30 s for fluorescence microscopy. To estimate the velocity of retrograde flow, time-lapse image sequences were analyzed using kymograph function of Metamorph software. This function copies selected narrow regions from the sequential frames of the time-lapse sequence and pastes them side-by-side in a time-montage. Moving features are visualized in kymographs as diagonal streaks with a slope depending on the velocity of movement.Supporting InformationMovie S1Enhanced phase contrast image sequence of spreading Swiss 3T3 cell (corresponds to Fig. 1A). Field of view, 46 µm×31 µm, images taken at 4 s intervals, total elapsed time, 3 min 20 s.(0.82 MB MOV)Click here for additional data file.Movie S2Enhanced phase contrast and fluorescence microscopy image sequence of spreading REF-52 cell injected with rhodamine-actin (corresponds to Fig. 1B). Field of view, 14 µm×23 µm, images in each mode are taken at 8 s intervals, total elapsed time, 10 min.(1.09 MB MOV)Click here for additional data file.Movie S3Enhanced phase contrast and fluorescence microscopy image sequence of spreading B16 melanoma cell expressing GFP-actin treated with cytochalasin D (corresponds to Fig. 1C). Cytochalasin D-treatment results in the immediate arrest of protrusion and the inhibition of the retrograde flow in the lamellipodium, while the overall actin organization remains virtually unchanged up to 2 min after the addition of the drug. Field of view, 29 µm×44 µm, images in each mode are taken at 10 s intervals, total elapsed time, 8 min 30 s, cytochalasin D is added at 6 min 20 s.(0.82 MB MPG)Click here for additional data file.Movie S4Enhanced phase contrast image sequence of spreading Swiss 3T3 cell treated with rho-kinase inhibitor HA-1077 (corresponds to Fig. 1d). Addition of HA-1077 results in overall spreading of the cell, disappearance of stress fibers in the lamellum and the inhibition of retrograde flow in the lamellum, while the lamellipodium dynamics is not affected. Field of view, 51 µm×38 µm, images are taken at 6 s intervals, total elapsed time, 15 min 30 s, HA-1077 added at 5 min 40 s.(2.58 MB MOV)Click here for additional data file.Movie S5Merged enhanced phase contrast and fluorescence microscopy image sequence of spreading REF-52 cell excpressing YFP-paxillin (corresponds to Fig. 2a). Field of view, 75 µm×55 µm, phase contrast images are taken at 5 s intervals, fluorescenece images, at 20 s intervals, total elapsed time, 6 min.(1.19 MB MOV)Click here for additional data file.Movie S6Zoomed region of merged enhanced phase contrast and fluorescence image sequence of spreading REF-52 cell excpressing YFP-paxillin shows two instances of the formation of new FAs and the associated advance of the lamellum/lamellipodium boundary (corresponds to Fig. 2b). Field of view, 16.3 µm×12.5 µm, phase contrast images are taken at 5 s intervals, fluorescenece images, at 20 s intervals, total elapsed time, 1 min 40 s.(0.38 MB MOV)Click here for additional data file.Movie S7Zoomed region of merged enhanced phase contrast and fluorescence image sequence of spreading REF-52 cell excpressing YFP-paxillin shows an instance of the formation of new FAs and the associated ruffling of the lamellipodium and the advance of the lamellum/lamellipodium boundary (corresponds to Fig. 2c). Field of view, 12.6 µm×8.7 µm, phase contrast images are taken at 5 s intervals, fluorescenece images, at 20 s intervals, total elapsed time, 5 min.(0.96 MB MOV)Click here for additional data file.Movie S8Double fluorescence image sequence of spreading REF-52 cell expressing YFP-paxillin (shown in red) and microinjected with rhodamine-actin (shown in cyan). Numerous new FAs form in the lamellipodium followed by the advance of the lamellipodium/lamellum boundary to the sites of FAs. Field of view, 25 µm×19 µm, total elapsed time, 8 min.(0.74 MB MOV)Click here for additional data file.Movie S9Fluorescence (left) and merged fluorescence and enhanced phase contrast image sequence (right) of spreading REF-52 cell expressing YFP-paxillin (shown in yellow). The moving boundary between the lamellum and the lamellipodium coincides with the row of small FAs in the process of continuous turnover. Field of view, 12.2 µm×16.7 µm, phase contrast images are taken at 6 s intervals, fluorescenece images, at 18 s intervals, total elapsed time, 10 min(1.30 MB MOV)Click here for additional data file.Movie S10Enhanced phase contrast image sequence of REF-52 cell spreading on poly-L-lysin-coated glass surface shows uniform retrograde flow at the cell periphery. Field of view, 41 µm×31 µm, images are taken at 5 s intervals, total elapsed time, 12 min.(2.34 MB MOV)Click here for additional data file.Movie S11Movie S11. Double color fluorescence image sequence of spreading REF-52 cell expressing YFP-paxillin (red) and microinjected with rhodamine-myosin II (cyan) (corresponds to Fig. 4a). Field of view 34 µm×24 µm, images in each channel are taken at 30 s intervals, total elapsed time,12 min.(0.38 MB MOV)Click here for additional data file.Movie S12Double color fluorescence image sequence of REF-52 cell expressing YFP-paxillin (red) and GFP-actin (cyan) (corresponds to Fig. 4b). Field of view 16 µm×4 µm, images in each channel are taken at 20 s intervals, total elapsed time, 8 min.(0.19 MB MOV)Click here for additional data file.\n\nREFERENCES:\n1. RidleyAJSchwartzMABurridgeKFirtelRAGinsbergMH\n2003\nCell migration: integrating signals from front to back.\nScience\n302\n1704\n1709\n14657486\n2. MogilnerAOsterG\n2003\nPolymer motors: pushing out the front and pulling up the back.\nCurr Biol\n13\nR721\n733\n13678614\n3. GeigerBBershadskyAPankovRYamadaKM\n2001\nTransmembrane extracellular matrix–cytoskeleton crosstalk.\nNat Rev Mol Cell Biol\n2\n793\n805\n11715046\n4. KaverinaIKrylyshkinaOSmallJV\n2002\nRegulation of substrate adhesion dynamics during cell motility.\nInt J Biochem Cell Biol\n34\n746\n761\n11950592\n5. WebbDJBrownCMHorwitzAF\n2003\nIlluminating adhesion complexes in migrating cells: moving toward a bright future.\nCurr Opin Cell Biol.\n15\n614\n620\n14519397\n6. SastrySKBurridgeK\n2000\nFocal adhesions: a nexus for intracellular signaling and cytoskeletal dynamics.\nExp Cell Res\n261\n25\n36\n11082272\n7. HarrisAK\n1994\nLocomotion of tissue culture cells considered in relation to ameboid locomotion.\nInt Rev Cytology\n150\n35\n68\n8. CramerLP\n1997\nMolecular mechanism of actin-dependent retograde flow in lamellipodia of motile cells.\nFront Biosci\n2\nd260\n270\n9206973\n9. SuterDMForscherP\n2000\nSubstrate-cytoskeletal coupling as a mechanism for the regulation of growth cone motility and guidance.\nJ Neurobiol\n44\n97\n113\n10934315\n10. HensonJHSvitkinaTMBurnsARHughesHEMacPartlandKJ\n1999\nTwo components of actin-based retrograde flow in sea urchin coelomocytes.\nMol Biol Cell\n10\n4075\n4090\n10588644\n11. SmilenovLBMikhailovAPelhamRJMarcantonioEEGundersenGG\n1999\nFocal adhesion motility revealed in stationary fibroblasts.\nScience\n286\n1172\n1174\n10550057\n12. ZamirEKatzMPosenYErezNYamadaKM\n2000\nDynamics and segregation of cell-matrix adhesions in cultured fibroblasts.\nNat Cell Biol\n2\n191\n196\n10783236\n13. AndersonKICrossR\n2000\nContact dynamics during keratocyte motility.\nCurr Biol\n10\n253\n260\n10712904\n14. SmallJVGeigerBKaverinaIBershadskyA\n2002\nHow do microtubules guide migrating cells?\nNat Rev Mol Cell Biol.\n3\n957\n64\n12461561\n15. MitchisonTKirschnerM\n1988\nCytoskeletal dynamics and nerve growth.\nNeuron\n1\n761\n772\n3078414\n16. JayDG\n2000\nThe clutch hypothesis revisited: ascribing the roles of actin-associated proteins in filopodial protrusion in the nerve growth cone.\nJ Neurobiol\n44\n114\n125\n10934316\n17. JuradoCHaserickJRLeeJ\n2005\nSlipping or gripping? Fluorescent speckle microscopy in fish keratocytes reveals two different mechanisms for generating a retrograde flow of actin.\nMol Biol Cell\n16\n507\n518\n15548591\n18. TheriotJAMitchisonTJ\n1992\nComparison of actin and cell surface dynamics in motile fibroblasts.\nJ Cell Biol\n119\n367\n377\n1400580\n19. HuKJiLApplegateKTDanuserGWaterman-StorerCM\n2007\nDifferential transmission of actin motion within focal adhesions.\nScience\n315\n111\n115\n17204653\n20. BrownCMHebertBKolinDLZarenoJWhitmoreL\n2006\nProbing the integrin-actin linkage using high-resolution protein velocity mapping.\nJ Cell Sci\n119\n5204\n5214\n17158922\n21. SalmonWCAdamsMCWaterman-StorerCM\n2002\nDual-wavelength fluorescent speckle microscopy reveals coupling of microtubule and actin movements in migrating cells.\nJ Cell Biol\n158\n31\n37\n12105180\n22. PontiAMachaceMGuptonSLWaterman-StorerCMDanuserG\n2004\nTwo distinct actin networks drive the protrusion of migrating cells.\nScience\n305\n1782\n1786\n15375270\n23. SmallJVStradalTVignalERottnerK\n2002\nThe lamellipodium: where motility begins.\nTrends Cell Biol\n12\n112\n120\n11859023\n24. GuptonSLAndersonKLKoleTPFischerRSPontiA\n2005\nCell migration without a lamellipodium: translation of actin dynamics into cell movement mediated by tropomyosin.\nJ Cell Biol.\n168\n619\n631\n15716379\n25. HotulainenPLappalainenP\n2006\nStress fibers are generated by two distinct actin assembly mechanisms in motile cells.\nJ Cell Biol\n173\n383\n394\n16651381\n26. GiannoneGDubin-ThalerBJDobereinerHGKiefferNBresnickAR\n2004\nPeriodic lamellipodial contractions correlate with rearward actin waves.\nCell\n116\n431\n443\n15016377\n27. GiannoneGDubin-ThalerBJRossierOCaiYChagaO\n2007\nLamellipodial actin mechanically links myosin activity with adhesion-site formation.\nCell\n128\n561\n575\n17289574\n28. VerkhovskyABChagaOYSchaubSSvitkinaTMMeisterJJ\n2003\nOrientational order of the lamellipodial actin network as demonstrated in living motile cells.\nMol Biol Cell\n14\n4667\n4675\n13679520\n29. VallottonPDanuserGBohnetSMeisterJJVerkhovskyAB\n2005\nTracking retrograde flow in keratocytes: news from the front.\nMol Biol Cell\n16\n1223\n1231\n15635099\n30. UehataMIshizakiTSatohHOnoTKawaharaT\n1997\nCalcium sensitization of smooth muscle mediated by a Rho-associated protein kinase in hypertension.\nNature\n389\n990\n994\n9353125\n31. VolbergTGeigerBCitiSBershadskyAD\n1994\nEffect of protein kinase inhibitor H-7 on the contractility, integrity, and membrane anchorage of the microfilament system. Cell Motil.\nCytoskeleton\n29\n321\n238\n32. RinnerthalerGGeigerBSmallJV\n1988\nContact formation during fibroblast locomotion: involvement of membrane ruffles and microtubules.\nJ Cell Biol\n106\n747\n760\n3126193\n33. EndlichNOteyCAKrizWEndlichK\n2007\nMovement of stress fibers away from focal adhesions identifies focal adhesions as sites of stress fiber assembly in stationary cells.\nCell Motil Cytoskeleton\n64\n966\n76\n17868136\n34. VerkhovskyABSvitkinaTMBorisyGG\n1995\nMyosin II filament assemblies in the active lamella of fibroblasts: their morphogenesis and role in the formation of actin filament bundles.\nJ Cell Biol.\n131\n989\n1002\n7490299\n35. HotchinNAHallA\n1995\nThe assembly of integrin adhesion complexes requires both extracellular matrix and intracellular rho/rac GTPases.\nJ Cell Biol\n131\n1857\n1865\n8557752\n36. RottnerKHallASmallJV\n1999\nInterplay between Rac and Rho in the control of substrate contact dynamics.\nCurr Biol\n9\n640\n648\n10375527\n37. Chrzanowska-WodnickaMBurridgeK\n1996\nRho-stimulated contractility drives the formation of stress fibers and focal adhesions.\nJ Cell Biol\n133\n1403\n1415\n8682874\n38. ZichaDDobbieIMHoltMRMonypennyJSoongDY\n2003\nRapid actin transport during cell protrusion.\nScience\n300\n142\n145\n12677069\n39. LeeJIshiharaAJacobsonK\n1993\nThe fish epidermal keratocyte as a model system for the study of cell locomotion.\nSymp Soc Exp Bio.\n47\n73\n89\n8165580\n40. SuterDMErranteLDBelotserkovskyVForscherP\n1998\nThe Ig superfamily cell adhesion molecule, apCAM, mediates growth cone steering by substrate-cytoskeletal coupling.\nJ Cell Biol\n141\n227\n240\n9531561\n41. IwasaJHMullinsRD\n2007\nSpatial and temporal relationships between actin-filament nucleation, capping, and disassembly.\nCurr Biol\n17\n395\n406\n17331727\n42. ZigmondSHEvangelistaMBooneCYangCDarAC\n2003\nFormin leaky cap allows elongation in the presence of tight capping proteins.\nCurr Biol\n13\n1820\n1823\n14561409\n43. GoodeBLEckMJ\n2007\nMechanism and function of formins in the control of actin assembly.\nAnnu Rev Biochem\n76\n593\n627\n17373907\n44. DeMaliKABarlowCABurridgeK\n2002\nRecruitment of the Arp2/3 complex to vinculin: coupling membrane protrusion to matrix adhesion.\nJ Cell Biol\n159\n881\n891\n12473693\n45. RivelineDZamirEBalabanNQSchwarzUSIshizakiT\n2001\nFocal contacts as mechanosensors: externally applied local mechanical force induces growth of focal contacts by an mDia1-dependent and ROCK-independent mechanism.\nJ Cell Biol\n153\n1175\n1186\n11402062\n46. BershadskyADBalabanNQGeigerB\n2003\nAdhesion-dependent cell mechanosensitivity.\nAnnu. Rev. Cell Dev Biol\n19\n677\n695\n14570586\n47. TamadaMSheetzMPSawadaY\n2004\nActivation of a signaling cascade by cytoskeleton stretch.\nDev Cell\n7\n709\n718\n15525532\n48. NicolasAGeigerBSafranSA\n2004\nCell mechanosensitivity controls the anisotropy of focal adhesions.\nProc Natl Acad Sci USA\n101\n12520\n12525\n15314229\n49. BruinsmaR\n2005\nTheory of force regulation by nascent adhesion sites.\nBiophys J\n89\n87\n94\n15849245\n50. BeningoKADemboMKaverinaISmallJVWangYL\n2001\nNascent focal adhesions are responsible for the generation of strong propulsive forces in migrating fibroblasts.\nJ Cell Biol\n153\n881\n888\n11352946\n51. VerkhovskyABSvitkinaTMBorisyGG\n1997\nPolarity sorting of actin filaments in cytochalasin-treated fibroblasts.\nJ. Cell Sci\n110\n1693\n1704\n9264457\n52. ChoidasAJungbluthASechiAMurphyJUllrichA\n1998\nThe suitability and application of a GFP-actin fusion protein for long-term imaging of the organization and dynamics of the cytoskeleton in mammalian cells.\nEur J Cell Biol\n77\n81\n90\n9840457\n53. BallestremCWehrle-HallerBImhofBA\n1998\nActin dynamics in living mammalian cells.\nJ Cell Sci\n111\n1649\n1658\n9601095\n54. MorgensternJPLandH\n1990\nAdvanced mammalian gene transfer: high titre retroviral vectors with multiple drug selection markers and a complementary helper-free packaging cell line.\nNucleic Acids Res\n18\n3587\n3596\n2194165"
+}

batch_2/PMC2535622.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2535622",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2535622\nAUTHORS: Chit-Ming Wong, Nuntavarn Vichit-Vadakan, Haidong Kan, Zhengmin Qian\n\nABSTRACT:\nBackground and objectivesAlthough the deleterious effects of air pollution from fossil fuel combustion have been demonstrated in many Western nations, fewer studies have been conducted in Asia. The Public Health and Air Pollution in Asia (PAPA) project assessed the effects of short-term exposure to air pollution on daily mortality in Bangkok, Thailand, and in three cities in China: Hong Kong, Shanghai, and Wuhan.MethodsPoisson regression models incorporating natural spline smoothing functions were used to adjust for seasonality and other time-varying covariates that might confound the association between air pollution and mortality. Effect estimates were determined for each city and then for the cities combined using a random effects method.ResultsIn individual cities, associations were detected between most of the pollutants [nitrogen dioxide, sulfur dioxide, particulate matter ≤ 10 μm in aerodynamic diameter (PM10), and ozone] and most health outcomes under study (i.e., all natural-cause, cardiovascular, and respiratory mortality). The city-combined effects of the four pollutants tended to be equal or greater than those identified in studies conducted in Western industrial nations. In addition, residents of Asian cities are likely to have higher exposures to air pollution than those in Western industrial nations because they spend more time outdoors and less time in air conditioning.ConclusionsAlthough the social and environmental conditions may be quite different, it is reasonable to apply estimates derived from previous health effect of air pollution studies in the West to Asia.\n\nBODY:\nTime-series studies of daily mortality in several Asian cities can contribute significantly to the world’s literature on the health effects of air pollution. First, they provide direct evidence of air pollution effects in areas for which there are few studies. Second, because they involve different exposure conditions and populations, mortality studies of Asian cities can shed light on factors that may modify the effects of air pollution on health. In addition, multicity collaborative studies conducted within Asia, especially when analyzed using a common protocol, can generate more robust air pollution effect estimates for the region than those from individual studies and provide relevant and supportable estimates of the local impacts of environmental conditions for decision makers. Finally, they can determine the appropriateness of applying the results of health effects of air pollution studies conducted in North America and Western Europe to regions where few studies, if any, have been conducted.Recent reviews (Anderson et al. 2004; Ostro 2004) suggest that proportional increases in daily mortality per 10-μg/m3 increase in PM10 (particulate matter ≤ 10 μm in aerodynamic diameter) are generally similar among North American and Western European regions and the few developing countries where studies have been undertaken. However, the relatively few studies that have been conducted in Asia are not geographically representative and have used different methodologies, making it difficult to compare results in Asian cities with each other or with the broader literature. In addition, the worldwide data have not been appropriately analyzed for real differences in the magnitude of the effects of short-term exposure and the possible reasons for such differences, such as sources of air pollution or population characteristics.Efforts to bring the world’s data together for such analyses are under way with funding from the Health Effects Institute (HEI) in the PAPA (Public Health and Air Pollution in Asia) project and the APHENA (Air Pollution and Health: A European and North American Approach) project. These efforts can provide important insights to the time-series literature in terms of variability in air pollution, climate, population, and city characteristics involved.The first phase of the PAPA study was carried out using data from Bangkok, Thailand, from 1999 to 2003, Hong Kong, China, from 1996 to 2002, and Shanghai and Wuhan, China, both from 2001 to 2004 (Figure 1) (HEI 2008). A common protocol (available from the authors) for the design and analysis of data from multiple Asian cities and a management framework to conduct the coordinated analysis were established. These were designed to provide a basis for combining estimates and for isolating important independent factors that might explain effect modification in the city-specific estimates. It is anticipated that the results will not only contribute to the international scientific discussion on the conduct and interpretation of time-series studies of the health effects of air pollution but will also stimulate the development of routine systems for recording daily deaths and hospital admissions for time-series analysis.Materials and MethodsMortality dataWe focused on mortality from all natural causes in all ages, ≥ 65 years, and ≥ 75 years, and for cardiovascular and respiratory disease at all ages. The International Classification of Disease, Ninth Revision [ICD-9; World Health Organization (WHO) 1977] and Tenth Revision (ICD-10; WHO 1992) rubrics of the health outcomes were as follows: all natural causes, ICD-9 codes 001–799 or ICD-10 codes A00–R99; cardiovascular, ICD-9 codes 390–459 or ICD-10 codes I00–I99; and respiratory, ICD-9 codes 460–519 or ICD-10 codes J00–J98.The sources of health data were the Ministry of Public Health, Bangkok; the Census and Statistics Department, Hong Kong; the Shanghai Municipal Center of Disease Control and Prevention, Shanghai; and the Wuhan Centre for Disease Prevention and Control, Wuhan.Air pollutant and meteorological dataAir quality indicators included nitrogen dioxide, sulfur dioxide, PM10, and ozone. For NO2, SO2, and PM10, daily data were 24-hr averages and an 8-hr average was used for O3 (1000–1800 hours). Each city maintains several fixed-site air monitoring stations—dispersed throughout the metropolitan areas—that met the quality assurance and quality control procedures of local governments. The air pollutant concentrations were measured in Bangkok by the Pollution Control Department, Ministry of Natural Resources and Environment (n = 10 air monitoring stations); in Hong Kong by the Environmental Protection Department (n = 8); in Shanghai by the Shanghai Environmental Monitoring Center (n = 6); and in Wuhan by the Wuhan Environmental Monitoring Center (n = 6). The measurement methods for NO2, SO2, and O3 were similar for the four cities based on chemiluminescence, fluorescence, and ultraviolet absorption, respectively, whereas for PM10, the Chinese cities used tapered element oscillating microbalance and Bangkok used beta gauge monitors.The calculation of 24-hr average concentrations of NO2, SO2, and PM10, and 8-hr average concentrations of O3 required at least 75% of the 1-hr values on that particular day. If > 25% of the daily values were missing for the whole period of analysis, the entire station was not included for that particular pollutant. Missing data were not imputed.Statistical analysisThe analytical methods were developed and adopted by all four teams in a common protocol. The protocol includes the specifications for selection of monitoring stations, as well as quality assurance and quality control procedures for data collection and for health outcomes and air pollutants to be included in the analysis. Generalized linear modeling was used to model daily health outcomes, with natural spline smoothers (Burnett et al. 2004; Wood 2006) for filtering out seasonal patterns and long-term trends in daily mortality, as well as temperature and relative humidity. We also included an adjustment for the day of the week and dichotomous variables relevant to individual cities if available, such as public holidays (Hong Kong) and extreme weather conditions (Wuhan). In an attempt to minimize autocorrelation, which would bias the standard errors, the aim of the core model was for partial autocorrelation function plots to have coefficients in absolute values < 0.1 for the first 2 lag days. Randomness of residuals was also considered in selecting the most appropriate models. If these criteria were not met, other methods were used to reduce autocorrelation, such as the inclusion of explanatory variables to model influenza epidemics and the addition of autoregression terms. If there were special periods with extra variations for which the core model could not account, an additional spline smoother was included. Air pollutant concentrations were entered into the core model to assess the health effects of specific pollutants. Exposure at the current day (lag 0), a 2-day average of lag 0 and lag 1 days (lag 0–1), and a 5-day average of lag 0 to lag 4 days (lag 0–4) were examined. For each pollutant, the excess risk of mortality with the 95% confidence interval (CI) per 10-μg/m3 increase in average concentration at lag 0–1 was calculated. However, for brevity’s sake, point estimates with p-values could be used to describe sets of effects.Because several differences were observed in effect estimates among cities, we conducted additional sensitivity analyses to attempt to explain these differences and to determine the robustness of the initial findings. We focused on PM10, given the wealth of worldwide findings of effects from this pollutant, and used the average concentration of lag 0–1 days. In these analyses we aimed to explore the impact of the following: higher concentrations of PM10 that might be dominated by the coarse fraction and therefore have differential toxicity; monitors that might be overly affected by proximity to traffic; effects of different seasonality patterns among the cities; different controls for temperature; and different ways in aggregating daily concentration data and differences in spline models. We regarded a change of excess risk > 20% from that of the analysis as an indication of sensitive results. Specifically, the sensitivity analysis included the following items:Exclude the daily concentration of PM10 > 95th percentileExclude the daily concentration of PM10 > 75th percentileExclude the daily concentration of PM10 > 180 μg/m3Exclude monitoring stations with high traffic sources (highest nitric oxide/nitrogen oxides ratio)Assess warm season effect with dummy variables of seasons in the core modelAdd temperature at average lag 1–2 days or 3–7 days into the modelUse a centered daily concentration of PM10 (Wong et al. 2001)Use natural spline with degrees of freedom (df) of time trend per year, temperature, and humidity fixed at 8, 4, and 4, respectivelyUse penalized spline instead of natural spline.Combined estimates of excess risk of mortality and their standard errors were calculated using a random-effects model. Estimates were weighted by the inverse of the sum of within-and between-study variance.Concentration–response curves for the effect of each pollutant on each mortality outcome in the four cities were plotted. We applied a natural spline smoother with 3 df on the pollutant term. We assessed nonlinearity by testing the change of deviance between a nonlinear pollutant (smoothed) model with 3 df and linear pollutant (unsmoothed) model with 1 df.The main analyses and the combined analysis were performed using R, version 2.5.1 (R Development Core Team 2007). We also used mgcv, a package in R.ResultsTable 1 summarizes the mortality data for the four cities, and Table 2 summarizes the pollution and meteorological variables. The daily mortality counts for all natural causes at all ages for each city showed more marked seasonal variations in the cities farther north. Shanghai (mean daily deaths, 119; population, 7.0 million) and Bangkok (95; 6.8 million) had higher daily numbers of deaths than Hong Kong (84; 6.7 million) and Wuhan (61; 4.2 million). The ratios for causes of death due to cardiovascular disease relative to respiratory disease were the highest in Wuhan (4:1) followed by Shanghai (3:1), Bangkok (2:1), and Hong Kong (1.5:1). The proportion of total cardiorespiratory mortality was also the highest in Wuhan (57%) followed by Shanghai (49%), Hong Kong (48%), and Bangkok (23%) [Table 1; Supplemental Material, Table 1 (available online at http://www.ehponline.org/members/2008/11257/suppl.pdf)]. Deaths occurring at ≥ 65 years of age were less frequent in Bangkok (36%) than in the three Chinese cities (72–84%).As indicated in Table 2 and Figure 2, Wuhan showed the highest concentrations of PM10 and O3, whereas Shanghai had the highest concentrations of NO2 and SO2. The latter was probably due to the significant local contribution of power plants in Shanghai’s metropolitan area. To provide an indication of the relative magnitude of the pollution concentrations in these four large Asian cities, we compared them to the 20 largest cities in the United States using data from 1987 to 1994 from the National Morbidity, Mortality, and Air Pollution Study (NMMAPS) (Samet et al. 2000). Generally, in the PAPA cities, the concentrations of PM10 and SO2 were much higher than those reported in the United States (PM10 means of 52–142 μg/m3 in the cities of the PAPA study vs. 33 μg/m3 in NMMAPS, and SO2 means of 13–45 μg/m3 vs. 14 μg/m3); comparisons of NO2 and O3 showed a fairly similar pattern.We demonstrated the adequacy of the core models with partial autocorrelation function plots of the residuals in the previous 2 days, all within |0.1| [Supplemental Material, Figure 1 (available online at http://www.ehponline.org/members/2008/11257/suppl.pdf)].In individual cities, for all natural causes at all ages (Table 3) the percentage of excess risk per 10-μg/m3 associated with NO2 ranged from 0.90 to 1.97 (all p-values ≤ 0.001); with SO2, from 0.87 to 1.61 (all p-values ≤ 0.05); with PM10, from 0.26 to 1.25 (all p-values ≤ 0.001); and with O3, from 0.31 to 0.63 (all p-values ≤ 0.05), but the effect in Wuhan was not significant. The excess risk showed trends of increasing risk with increasing age for all four pollutants. The trends for the age-specific effects were the strongest in Bangkok, less strong in Hong Kong and Wuhan, but absent in Shanghai (Figure 3). For all four pollutants, the excess risk in Bangkok was higher than those in the three Chinese cities. When the pollutant concentrations were expressed as the interquartile range (IQR; i.e., 75th percentile–25th percentile), Bangkok estimates were comparable to those of the three Chinese cities, particularly in all ages. Within cities, the effect estimates of different pollutants were also comparable to each other (data not shown).In all cities, there was heterogeneity in effect estimates for NO2 and PM10 on all natural-cause mortality and for PM10 on cardiovascular mortality (Table 3). For all natural-cause mortality, the combined random effects excess risk were 1.23, 1.00, 0.55, and 0.38% for NO2, SO2, PM10, and O3, respectively (all p-values ≤ 0.05). The results for cardiovascular mortality (Table 3) followed a generally similar pattern, with the highest excess risk per 10-μg/m3 in Bangkok for PM10 and O3, and in Wuhan for NO2 and SO2. All of the cities demonstrated significant associations for each pollutant except SO2 in Bangkok and O3 in Wuhan, whereas all of the combined estimates were statistically significant. A similar pattern was shown for respiratory mortality, for which the highest estimates were found in Wuhan for NO2 and SO2 and in Bangkok for PM10 and O3. All the random effects estimates were statistically significant at the 5% level except for O3.For the lag effects in the three Chinese cities, with a few exceptions, the average lag 0–1 days usually generated the highest excess risk. However, for Bangkok the longer cumulative average of lag 0–4 days generated the highest excess risk for all of the pollutants except SO2. For the combined estimates, effects at the lag 0–1 days showed the highest excess risk, except O3, for which the effect at lag 0–4 days was the greatest (data not shown).Sensitivity analyses for PM10 showed that, in general, the results were fairly robust for various concentrations, monitors, specifications for temperature, methods of aggregating daily data, df used in the smoothers, and alternative spline models. In all cases, the effect estimates were statistically significant. In all cities, the effect estimates for PM10 were sensitive to exclusion of the higher concentrations. For the Chinese cities, this increased the excess risk > 20% for PM10, but in Bangkok the effect estimate decreased, with the excess risk changing from 1.25% to 0.73% per 10-μg/m3 increase in average concentration of lag 0–1 days (Table 4). Examination of the warm season (which varied for each city) resulted in significant increases in effect estimates for Bangkok and Wuhan but decreases in Hong Kong and, to a lesser extent, in Shanghai (excess risk changed from 0.26% to 0.24%). Adjusting for temperature through use of longer-term cumulative averages tended to decrease the PM10 effect.The smoothed concentration-response (CR) relationship, between all natural-cause mortality and concentration of each pollutant, appeared to be positive. Most CR curves showed linear relationships over the IQR of the concentrations (Figure 4). At all ages, tests for nonlinearity for the entire curve showed that linearity could not be rejected at the 5% level for most of the associations between air pollution and mortality (data not shown).DiscussionReview of PAPA project resultsIn the city-specific main effects for the five main health outcomes under study, there were variations in effect estimates between cities. For NO2 the estimates were similar in magnitude and precision for Bangkok and Wuhan, and for Hong Kong and Shanghai. The effects for Bangkok and Wuhan were higher but less precise (as reflected by a wider 95% CI) than for Shanghai and Hong Kong. For SO2 the estimates for Bangkok were higher but less precise than for the three Chinese cities. For PM10 the estimates in the three Chinese cities were very similar, but estimates were higher and less precise in Bangkok. For O3 the effect estimates and the precision among the four cities were similar, although estimates in Bangkok were higher. However, when expressed by IQR increase in concentrations, the effect estimates for each pollutant were similar in the four cities.In the combined four-city analysis, the excess risks per 10-μg/m3 increase in NO2 were 2–3 times greater than those derived from the APHEA (Air Pollution and Health: A European Approach) project (Samoli et al. 2006) for mortality at all ages due to all natural causes, cardiovascular disease, and respiratory disease (1.23% vs. 0.3%, 1.36% vs. 0.4%, and 1.48% vs. 0.38%, respectively). For SO2, the estimate (random effects) of 1.00% for mortality due to all natural causes derived from the present study was higher than the 0.52% previously reported from the other Asian cities studied (HEI 2004) and higher than the 0.40% from the APHEA project (Katsouyani et al. 1997) [Supplemental Material, Table 2 (available online at http://www.ehponline.org/members/2008/11257/suppl.pdf)]. For PM10, the excess risk of 0.55% for all natural causes of death at all ages was comparable to 0.49% from all Asian cities (HEI 2004), 0.5% from NMMAPS (Samet et al. 2000), and 0.6% from the APHEA project (Anderson et al. 2004). A meta-analysis of Chinese studies found that each 10-μg/m3 increase in PM10 concentration was significantly associated with 0.3% increase in all natural-cause mortality, 0.4% increase in cardiovascular mortality, and 0.6% increase in respiratory mortality (Aunan and Pan 2004). For O3, the estimate from the present study was significant and higher than that from APHEA (Anderson et al. 2004) and NMMAPS (Bell et al. 2004) for all natural causes (0.38 vs. 0.20 and 0.26, respectively) and similar for cardiovascular causes (0.37 vs. 0.4 and 0.32); however, the estimates for respiratory disease (0.34 vs. −0.1 and 0.32%) were similar to those of the NMMAPS, but negative and statistically not significant (p > 0.05) in APHEA [Supplemental Material, Table 2).Review of estimates from previous Asian studiesFor NO2, we found few time-series studies, and these were mainly from South Korea (Hong et al. 1999) and Hong Kong (Wong et al. 2001). The variation of effects was large compared with other pollutants for all natural-cause mortality, respiratory mortality, and cardiovascular mortality. For SO2, most time-series studies in China showed significant association with all natural-cause mortality, even at levels below the current WHO Air Quality Guideline (Chen et al. 2004; WHO 2005). A review of Asian studies (HEI 2004) also found that SO2 was associated with all natural-cause mortality either from random-effects models or fixed-effects models. For PM10, although fewer time-series studies were published from Asia than from other regions, most studies found a significant association with all natural-cause mortality, but only respiratory and cardiovascular mortality were examined in Bangkok (Ostro et al. 1999). However, significant associations with respiratory and cardiovascular mortality were not found in Seoul, Korea (Hong et al. 1999), or Hong Kong studies (Wong et al. 2001). For O3 studies using different time-average concentrations such as 1, 8, and 24 hr, the estimates varied greatly between studies (HEI 2004).In the four individual cities included in the PAPA project, consistent with other studies for Asia, air pollution effects were found in each city and for all the disease-specific outcomes under consideration. The results provide important information on air pollution–related health effects in Asia, especially for areas known to have high exposures but are under-represented in the literature.Robustness of the resultsOur sensitivity analyses indicated that most of the PM10 effect estimates did not deviate from the main analysis > 20%. The PM10 effect estimates were insensitive to different methods adopted, the use of higher df, and the replacement of the smoothing function by the penalized spline. However, across the four cities, additional adjustment for the average temperature at 3–7 lag days showed that the estimates for effects of PM10 were attenuated, indicating possible residual confounding due to uncontrolled lag effects of temperature. Studies (Schwartz et al. 2004; Medina-Ramón and Schwartz 2007) show that different cumulative lag days of temperature have effects on both morbidity and mortality estimates. However, in the present study, current day temperature was specified a priori in the core model and was determined to be sufficient to adjust for temperature effects at the beginning of the study. On the other hand, we found high correlations between temperatures at each lag 1–7 days and at the current day, which suggest problems of multicollinearity if we make further adjustment to these lag temperature effects in the model of the main analysis.Scientific issues derived from PAPA study resultsFor all natural-cause, cardiovascular, and respiratory mortality, the effect estimates of PM10 and O3 are relatively similar among the three Chinese cities. However, there are some differences in the PM10 effect estimates in that Shanghai is consistently lower, by almost half, than Hong Kong and Wuhan. These differences in effect estimates may be related to differences in the location of the monitoring stations and differences in the actual ambient levels of exposure of the population.Estimates for PM10 in Bangkok were higher, and the effect estimates much higher, than those of the three Chinese cities (1.25 vs. 0.26–0.53; 1.90 vs. 0.27–0.61; and 1.01 vs. 0.27–0.87). The reasons might be related to consistently higher temperature, a population that spends a longer time outdoors, and less availablity and use of air conditioning in Bangkok than in the other cities (Ostro et al. 1999). With relatively higher mortality due to infectious diseases [Supplemental Material, Table 1 (available online at http://www.ehponline.org/members/2008/11257/suppl.pdf)] and with more deaths at younger ages, it is also likely that the Bangkok population is exposed to a larger number of other risk factors and may be more susceptible to the risks associated with air pollution. Tsai et al. (2000) reported that exposure levels for indoor and outdoor particulates in shopping areas were underestimated by the ambient monitoring stations in Bangkok, and therefore that the excess risk per air pollutant concentration would be higher than if it were a well-calibrated measurement. The higher ratio of PM2.5 (PM ≤ 2.5 μm in aerodynamic diameter) to PM10 may suggest that the proportion of smaller particles in the PM10 composition in Bangkok is more important and might be more strongly related to adverse health effects than in the other cities (Jinsart et al. 2002).In all the three Chinese cities, the maximum effects always occurred at lag 0–1 days, except for O3 in Shanghai, where maximum effects were recorded at longer lags. The lag pattern is consistent with other reports in demonstrating a maximum at lag 1 day for most pollutants (Samoli et al. 2005, 2006). However, for O3, the effect estimates are maximal at longer lags, showing that the pattern is also consistent with the literature (Goldberg et al. 2001; Wong et al. 2001). The lag patterns of SO2 and O3 in Bangkok are consistent with those of the three Chinese cities; however, the Bangkok lag patterns for NO2 and PM10, with greater effects at longer lags, are different from those of the three Chinese cities. For the traffic-related pollutants NO2 and PM10, the effects appear to be stronger, and they also seem to last longer in Bangkok than in the three Chinese cities.In all cities in the PAPA study, the effects of air pollution are stronger for cardiopulmonary causes than for all natural causes. This is consistent with results from most North American and Western European studies (Anderson et al. 2004; Samet et al. 2000) and supports the validity of the estimates from the present study. In addition, the effects of the four single pollutants appear to be stronger at older ages than at younger ages, particularly in Bangkok, which may have a more susceptible population than the three Chinese cities. The stronger effects at older ages for these pollutants support the validity of our estimates.As expected, the exclusion of high levels of PM10 concentrations from the analysis affects the effect estimates. In the present study, consistent with the literature from North America and Western Europe, exclusion of PM10 concentrations greater than the 75th or 95th percentile produces larger estimates in all three Chinese cities. These results suggest that the CR curves might be curvilinear, with the slope less steep at higher concentrations. We cannot explain the opposite findings noted in Bangkok; however, they may be related to the exclusion of readings from one monitor located in a region with both high particulate levels and a fairly susceptible population.The health effects estimates during the warm season are higher than those with all seasons combined in both Bangkok (excess risk 2.16 vs. 1.25%) and Wuhan (0.81 vs. 0.43%), but those in Hong Kong (0.37 vs. 0.53%) and Shanghai (0.24 vs. 0.26%) were similar or lower. These observations support the hypothesis that the populations in Bangkok and Wuhan, which are less affluent than the other two cities, may be more exposed and susceptible because of less use of air conditioning in summer; this may also explain the generally higher air pollution effects observed in Bangkok and Wuhan than in the other two cities (Long et al. 2007). The lower effect in Hong Kong may also be explained by air mass movements and southerly winds prevalent in the summer. In Wuhan the higher effect may be due to extremely high temperatures in summer. There may also be synergistic effects between PM10 and extremely high temperatures on mortality. Nevertheless, further study will be important in understanding how results derived from hotter climates could be extrapolated to cooler climates.Understanding the shapes of the CR curves is important for environmental public health policy decision making and setting of air quality standards. Comparison across geographic regions is also important in demonstrating causality and how effects estimated from one location can be generalized to others. The CR curves for PM10 effects on all natural-cause mortality derived from the present study clearly show that the relationship is linear without a threshold in most of the cities studied, although some nonlinear relationships appear in Shanghai. Thus our estimates are consistent with a linear model without threshold, a finding in most North American and Western European studies (Daniels et al. 2000; Pope and Dockery 2006; Samoli et al. 2005). The CR relation of a pollutant would be affected by the method used, the susceptibility of the population being investigated, the toxicity of the pollutant, and the weather and social conditions with which the pollutant may interact.In the present study, effect estimates for PM10 are comparable, whereas those for gaseous pollutants, particularly for NO2, are higher than those in the West. One postulation for the higher effect estimates may be related to their correlation with particulate pollutant [correlation between PM10 and NO2 ranging from 0.71 to 0.85; Supplemental Material, Table 3 (available online at http://www.ehponline.org/members/2008/11257/suppl.pdf)]. However for the three Chinese cities, the estimates for effects of NO2 remain robust after adjustment for PM10 (Supplemental Material, Figure 2A); whereas those of the PM10 effects were attenuated (Supplemental Material, Figure 2B). But for Bangkok, the change in effect estimates for the two pollutants after adjustment for the other as a copollutant are opposite of those for the three Chinese cities. Thus in Asian cities, the observed effects of gaseous pollutants may not necessarily be related to their covariation with a particulate pollutant. Further research is needed to clarify the effects of copollutants.LimitationsAmong the major limitations of our study was the difference in monitoring locations among the cities. In densely populated cities such as Hong Kong and Shanghai, the monitors tend to be close to major roadways, whereas in Bangkok and Wuhan the monitors are located farther from major pollutant sources. Thus, it is difficult to determine the true effects and to compare our results both within the PAPA cities and with previous studies. In addition, the specific components of particulate responsible for the observed health effects have not been elucidated. Such identification will aid in targeting and prioritizing future pollution control efforts. Also, information about potential effect modifiers (e.g., time spent outdoors, use of air conditioning, residential distance to roadways, housing construction, comorbidity in the population) varied in its availability and quality among the cities, making it difficult to explain quantitative differences among the PAPA cities.ConclusionEffects of particulate pollutants in Asian cities are similar to or greater than those observed in most North American and Western European cities in spite of large differences in concentrations; similarly, effects of gaseous pollutants in Asian cities are as high or higher. The methodology adopted and developed in the PAPA study could be used for other countries preparing to conduct air pollution studies. In addition, results from PAPA studies can be used in Asian and other cities for health impact assessment. Finally, further efforts are needed to understand the socioeconomic and demographic factors that might modify the effects of air pollution.\n\nREFERENCES:\n1. AndersonHRAtkinsonRWPeacockJLMarstonLKonstantinouK2004Meta-analysis of Time-series Studies and Panel Studies of Particulate Matter (PM) and Ozone (O3)Report of a WHO Task GroupBonn, GermanyWorld Health Organization\n2. AunanKPanXC2004Exposure-response functions for health effects of ambient air pollution applicable for China—a meta-analysisSci Total Environ32931615262154\n3. BellMLMcDermottAZegerSLSametJMDominiciF2004Ozone and short-term mortality in 95 US urban communities, 1987–2000JAMA2922372237815547165\n4. BurnettRTStiebDBrookJRCakmakSDalesRRaizenneM2004Associations between short-term changes in nitrogen dioxide and mortality in Canadian citiesArch Environ Health5922823616201668\n5. ChenBHongCKanH2004Exposures and health outcomes from outdoor air pollutants in ChinaToxicology19829130015138055\n6. DanielsMJDominiciFSametJMZegerSL2000Estimating particulate matter-mortality dose-response curves and threshold levels: an analysis of daily time-series for the 20 largest US citiesAm J Epidemiol15239740610981451\n7. GoldbergMSBurnettRTBrookJBailarJCValoisMFVincentR2001Association between daily cause-specific mortality and concentrations of ground-level ozone in Montreal, QuebecAm J Epidemiol15481782611682364\n8. HEI2004Health Effects of Outdoor Air Pollution in Developing Countries of Asia: A Literature ReviewHealth Effects Institute Special Report 15\n9. HEI (Health Effects Institute)2008Public Health and Air Pollution in Asia: Science Access on the NetAvailable: http://www.healtheffects.org/Asia/papasan-home.htm[accessed 21 May 2008]\n10. HongYCLeemJHHaE-HChristianiDC1999PM10 exposure, gaseous pollutants, and daily mortality in Inchon, South KoreaEnviron Health Perspect10787387810544154\n11. JinsartWTamuraKLoetkamonwitSThepanondhSKaritaKYanoE2002Roadside particulate air pollution in BangkokJ Air Waste Manag Assoc521102111012269671\n12. KatsouyanniKTouloumiGSpixCSchwartzJBalducciFMedinaS1997Short-term effects of ambient sulphur dioxide and particulate matter on mortality in 12 European cities: results from time series data from the APHEA project. Air Pollution and Health: a European ApproachBMJ314165816639180068\n13. LongWZhongTZhangB2007China: The Issue of Residential Air ConditioningAvailable: http://www.iifiir.org/en/doc/1056.pdf[accessed 11 May 2007]\n14. Medina-RamónMSchwartzJ2007Temperature, temperature extremes, and mortality: a study of acclimatization and effect modification in 50 United States citiesOccup Environ Med10.1136/oem.2007.033175[Online 28 June 2007]\n15. OstroB2004Outdoor Air Pollution: Assessing the Environmental Burden of Disease at National and Local LevelsEnvironmental Burden of Diseases Series, No. 5GenevaWorld Health OrganizationAvailable: http://www.who.int/quantifying_ehimpacts/publications/ebd5.pdf[accessed 25 July 2008]\n16. OstroBChestnutLVichit-VadakanNLaixuthaiA1999The impact of particulate matter on daily mortality in Bangkok, ThailandJ Air Waste Manage Assoc49100107\n17. PopeCAIIIDockeryDW2006Health effects of fine particulate air pollution: lines that connectJ Air Waste Manag Assoc561368138017063860\n18. R Development Core Team2007R: A Language and Environment for Statistical Computing, Version 2.5.1ViennaR Foundation for Statistical Computing\n19. SametJMZegerSLDominiciFCurrieroFCoursacIDockeryDW2000The National Morbidity, Mortality, and Air Pollution Study. Part II: Morbidity and mortality from air pollution in the United StatesRes Rep Health Eff Inst94570\n20. SamoliEAgaETouloumiGNisiotisKForsbergBLefrancA2006Short-term effects of nitrogen dioxide on mortality: an analysis within the APHEA projectEur Respir J271129113816540496\n21. SamoliEAnalitisATouloumiGSchwartzJAndersonHRSunyerJ2005Estimating the exposure–response relationships between particulate matter and mortality within the APHEA multicity projectEnviron Health Perspect113889515626653\n22. SchwartzJSametJMPatzJA2004Hospital admissions for heart disease: the effects of temperature and humidityEpidemiology1575576115475726\n23. TsaiFCSmithKRVichit-VadakanNOstroBDChestnutLGKungskulnitiN2000Indoor/outdoor PM10 and PM2.5 in Bangkok, ThailandJ Expo Anal Environ Epidemiol10152610703844\n24. WHO1977Manual of the International Statistical Classification of Diseases, Injuries, and Causes of Death, Ninth RevisionGenevaWorld Health Organization\n25. WHO1992International Statistical Classification of Diseases and Related Health Problems, Tenth RevisionGenevaWorld Health Organization\n26. WHO2005Air Quality Guidelines for Particulate Matter, Ozone, Nitrogen Dioxide and Sulfur Dioxide - Global Update 2005GenevaWorld Health OrganizationAvailable: http://whqlibdoc.who.int/hq/2006/WHO_SDE_PHE_OEH_06.02_eng.pdf[accessed 26 July 2008]\n27. WongCMMaSHedleyAJLamTH2001Effect of air pollution on daily mortality in Hong KongEnviron Health Perspect10933534011335180\n28. WoodSN2006Generalized Additive Models: An Introduction with RBoca Raton, FLChapman & Hall/CRC"
+}

batch_2/PMC2535642.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2535642",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2535642\nAUTHORS: Graeme Stemp-Morlock\n\nABSTRACT:\nNo Abstract\n\nBODY:\nCompact fluorescent lamps (CFLs) are about 75% more energy efficient than incandescent light bulbs and last 10 times longer, and thus have quickly become a modern-day environmental icon. The U.S. Environmental Protection Agency (EPA) estimates that about 290 million CFLs were sold in 2007. But CFLs do have one dim spot on their otherwise bright green image: the mercury that makes the bulbs’ inner phosphor coating fluoresce and produce light. A new study from a group of researchers at Brown University characterizes for the first time how elemental mercury vapor escapes from broken CFLs and offers a real-world solution for capturing escaping mercury.According to a June 2008 fact sheet issued by the EPA Energy Star program, the use of CFLs results in a net reduction in mercury entering the environment because their lower energy draw means less mercury-emitting coal needs to be burned. The EPA estimates that using a 13-W CFL saves 376 kWh over its 8,000-hour lifespan, preventing 4.5 mg of mercury from being emitted by a coal-burning power plant. Each small, curly tube contains about 3–5 mg of mercury—significantly less than the 500 mg in older thermometers, but enough that environmental and human health concerns remain.The research group headed by Robert Hurt, director of the Institute for Molecular and Nanoscale Innovation, broke a series of new and used CFLs to measure the release of mercury vapor into the air. In the hour immediately after each breakage, the team recorded mercury gas concentrations near the bulb shards between 200–800 μg/m3. For comparison, the average 8-hour occupational exposure limit allowed by the Occupational Safety and Health Administration is 100 μg/m3. Within 4 days a new 13-W CFL released about 30% of its mercury, with the remainder appearing to remain trapped in the bulb debris; picking up the glass shards after breakage reduced mercury release by 67%. Used bulbs followed similar patterns but with lower rates. The study, which was funded by the NIEHS Superfund Basic Research Program, was reported in the 1 August 2008 issue of Environmental Science & Technology.“The amount of mercury gas coming off [broken CFLs] is over a milligram over a few days. If you put that milligram into a poorly ventilated room, the concentration can be over the recommended limit for children [of 0.2 μg/m3],” says Hurt. “The overall risk is low, but it’s not zero risk, and there is definitely an opportunity to do better.”This kind of information could help regulators provide better information on how to handle broken CFLs. In 2007 the Maine Department of Environmental Protection performed one of the only other studies evaluating mercury exposure from broken CFLs. The EPA’s current recommendation to leave the room for at least 15 minutes immediately after breaking a CFL derives from that study. The EPA also recommends that broken CFL pieces be scooped up and placed in a plastic bag.However, Hurt’s research suggests that the peak for escaping mercury vapor lasts a few hours. The group also found that plastic bags leaked mercury vapor. “This new information may allow for modeling of airborne mercury concentrations following breakage, thus providing the capability to more fully assess the effectiveness of cleanup,” says Roxanne Smith, a press officer for the EPA.Hurt’s group also tested 28 sorbents for their ability to capture the released mercury gas. Because a sorbent’s surface area can affect how well it captures mercury, the team chose to test nanoscale formulations, which provide large surface area. One type of nanoselenium was found to be the most effective, removing 99% of the mercury vapor when impregnated in a cloth that was draped over a broken CFL or sprinkled over the breakage as a powder. When the mercury vapor reacted with nanoselenium, it formed mercury selenides, which are insoluble and metabolically inactive, according to a report in the November 2004 issue of the Seychelles Medical and Dental Journal. These compounds are also believed to be stable under landfill conditions (with the caveat that the environmental disposition and health effects of nanomaterials are still largely unknown).There are CFL recycling programs across the country at major retailers such as The Home Depot, but the Association of Lighting and Mercury Recyclers estimates that 98% of CFLs currently end up in landfills. Hurt’s group has therefore developed prototype packaging and disposal bags that can act as a barrier to prevent mercury from escaping as well as neutralize it. “Development of technology or material to more effectively clean up or capture mercury vapor may potentially minimize worker exposures during transport and disposal and, if readily available to consumers, may potentially minimize future inhalation exposures in residential settings,” says Smith.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2535649.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2535649",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2535649\nAUTHORS: Harvey Black\n\nABSTRACT:\nNo Abstract\n\nBODY:\nIt’s happened again. For the third time in 15 years the Mississippi River massively burst its banks this spring, inundating tiny Missouri towns such as Winfield (population 720) and Foley (population 178), causing potentially billions of dollars’ worth of destruction—although the damages are still being assessed—and hiking corn prices to $8.00 a bushel in the wake of the lost crop. On 22 April 2008 scientists with the U.S. Geological Survey (USGS) measured the largest water volume on the lower Mississippi River since 1973, with a flow of 1.8 million ft3/sec, enough to fill more than 20 Olympic-size swimming pools in 1 second.The environmental fallout from the 2008 floods is still being assessed. The danger of floodwater is not simply that its level is too high, says Robert Criss, a geologist at Washington University. “Floodwaters are heavily polluted with sewage and filth, commonly bearing counts of coliforms, fecal Streptococcus, and other bacteria of many thousands per deciliter,” he explains. “The waters are laden with contaminants including agrochemicals, oils, detergents, and toxic metals. They are highly turbid, typically bearing particulate loads a hundredfold or more higher than normal river waters.” Those pollutants, contaminants, and sediments can be carried into homes, where the lingering dampness promotes mold growth. Moreover, floodwater pools trapped behind failed levees serve as breeding grounds for mosquitoes, flies, and other disease vectors.Meanwhile, observers are asking how such devastating floods could have occurred again so soon. The massive flooding is attributed largely to torrential spring rains in the Upper Mississippi Valley, which Paul Rydlund, a supervisory hydrologist with the USGS Missouri Water Science Center, says were even greater than those preceding the record-breaking 1993 Midwest flood. But as heavy as those rains were, the question in the minds of some is whether they were made worse by structures such as levees and other man-made interventions wrought upon the Mississippi River over time.The Hand of ManChanges to the river are hardly a latter-day phenomenon. John Anfinson, a historian with the National Park Service’s Mississippi National River and Recreation Area, notes that the early French explorers of the sixteenth and seventeenth centuries recognized that to capture the economic potential of the Mississippi “you have to harness the river; you have to make it behave.” That harnessing began with the settlement of New Orleans in the early 1700s, where the first levees were thrown up to create a city that actually lies below sea level. Thereafter, Anfinson says, “The levee system started growing upriver and the navigation system [i.e., dredging and channeling endeavors] started growing downriver.”In the centuries that followed, shipping and agricultural interests pressed Congress to allow alteration of the river. Deepening channels made shipping easier, and construction of levees permitted farming and the establishment of towns and cities along the river’s banks.Many experts point to levees as a major culprit in flood devastation. Levees narrow the flow of the water, preventing it from spreading out into the floodplain and forcing it to move faster, explains geologist Jeffrey Mount, who directs the Center for Watershed Sciences at the University of California, Davis. As a bolus of floodwater moves down a river, levees can get overwhelmed in their work. “The dark secret that no one wants to share is that there are two kinds of levees: those that have failed and those that will fail,” Mount says. And when that levee fails with a massive wall of water pressing on it, the water rushes with great force onto the land behind the levee. “The power of water is a function of the difference in elevation between the top of the water and the adjacent land,” Mount explains. “So the greater that difference, the more powerful the flow that comes out onto that land in terms of its velocity and its power to erode.”Wing dams on the river are another factor in exacerbating floods, says Criss. These rock jetties, situated roughly perpendicular to the riverbank, aid shipping by preventing the accumulation of sediment so the river channel stays deeper. Deeper water moves faster, meaning the impact of floods can be greater.Criss points to another problem: “There are general changes to the land that decrease the permeability of soils. As we convert our forests and prairies and fields to subdivisions, we increase the rate of runoff [into the river]—that’s the ubiquitous footprint of man.” According to geologist Nicholas Pinter of Southern Illinois University Carbondale, one particular land use change is quite serious—tile drainage. Because many agricultural soils are too poorly drained to naturally serve as good farmland, farmers install subsurface drains (“tiles”). “When it rains,” Pinter says, “the water comes out of farm fields faster than it would otherwise.”Ripe for Disaster?Land development in floodplains is a perilous exercise, according to Gerald Galloway, a professor of engineering at the University of Maryland and former commander of the U.S. Army Corps of Engineers (USACE). For one thing, he says, developers rely heavily on floodplain maps issued by the Federal Emergency Management Agency (FEMA) that demarcate where we can expect so-called 100-year floods—the sort of flood that can be expected once every 100 years. People erroneously believe if they are outside that demarcation they are safe. However, Galloway cautions, such maps are estimates only. Moreover, he says, “The records of the past don’t necessarily match the pattern we’re in right now in terms of the weather.”Criss agrees, saying that the rivers of today are not the rivers of the past, and that there is simply not enough historical information on which to base the notion of a 100-or 500-year flood. Besides, at many places, he argues that what have been called 100-year floods are now 10-year floods due to a combination of changing conditions over time.Larry Buss, who chairs the USACE National Nonstructural/Flood Proofing Committee, says that when a levee is built in compliance with the requirements of the National Flood Insurance Program, there is no longer any floodplain management in the area behind the levee. All kinds of new development can then occur in the area landward of the levee as if the floodplain no longer exists—when in fact it does.“Politically, it’s more acceptable if politicians come to people and say ‘I’m going to remove the flood threat from you by supporting building a levee so you can live in that floodplain as if the floodplain no longer existed even though flood risk remains,’” Buss says. “That’s more politically acceptable than telling them ‘I’m supporting a buyout’ or ‘I’m supporting a relocation plan where we’ll move you to high ground and have you safe from floods forever.’” However, when the levee does have a problem, the damages are much greater than they might have been because of the increased development in vulnerable areas.Buss says the U.S. approach to levees has been too focused on what he calls short-term economic/political gain that is ultimately transformed into long-term economic/political loss when major flooding results in levee failure or overtopping and then catastrophic flood damages and perhaps loss of life. In these cases, he says, there is a major disconnect between those who make land use decisions (i.e., local communities) and those who pay for the ill-starred consequences of those decisions (i.e., state and federal taxpayers).The Role of the CorpsNoting the impact of man-made modifications of the river, critics question the judgment of the USACE in carrying out such modifications. “The Corps comes in with a community-by-community project with measures like levees, and it looks at that levee; it doesn’t look at the whole Mississippi as a system. And that’s a problem,” says Larry Larson, executive director of the Association of State Floodplain Managers.Pinter charges that the USACE has failed to examine the possibility of elevated flood risk in many navigational engineering projects, including a $5.3 million project in 2007 to construct three arc-shaped chevrons and other structures in the St. Louis Harbor area. The chevrons work much like wing dams, but they are located wholly in the river rather than extending from the shore. Composed of rock, they are designed to lessen the need for continual dredging of St. Louis Harbor, deepen the river bottom, and straighten the flow of the river. “The benefit of those structures was calculated versus their cost,” says Pinter.“The benefit was reduced dredging to help maintain the navigation channel. The cost was the construction cost with no calculation whatsoever of the additional financial cost in terms of elevated flood risk.”But Robert Davinroy, chief of river engineering at the Corps’ St. Louis office, says the USACE did examine the question of elevated flood risk. “We know how these structures work,” he says. “They’re submerged by about twelve feet when the river gets to flood stage—they have no effect on flood heights.” He adds there are no data to show the chevrons have any effect on the height of floods.As far as levees go, Galloway argues that the USACE is quite interested in understanding the impact of these structures on floods. “In the greater St. Louis area the Corps has been asking [Congress] for money for a study to see what is the cumulative effect of a lot of little levees. So far they haven’t gotten the money. People are not as much interested in learning that sort of information as they are in building levees,” says Galloway, referring to those legislators and constituents who view levees as flood protection. For example, a 20 September 2007 article in Time magazine that sharply criticizes a USACE flood control project in Missouri notes that Senator Kit Bond (R–MO) and Representative Jo Ann Emerson (R–MO) were responsible for pushing the project through.Politics and pressure do play significant roles in the selection of which projects to fund, notes Representative Eddie Bernice Johnson (D–TX), who chairs the Water Resources and Environment Subcommittee of the House Transportation and Infrastructure Committee. For instance, she says the USACE might initially say that a given project is not necessary. “The next time around they’ve been under so much pressure, they’ll go along with it. I’ve seen that happen,” she asserts. She says the pressure comes from local citizens through their representatives for projects that “shouldn’t be funded,” and the prospects for changing the system are dim.Moreover, Galloway observes that when Congress authorizes a USACE project, the money for it is quickly appropriated. But when it comes to appropriating money to remedy any environmental problems resulting from the project, Congress is very slow to allocate funds, an observation Johnson says is “probably true.”A 2005 Government Accountability Office report titled Wetlands Protection: Corps of Engineers Does Not Have an Effective Oversight Approach to Ensure That Compensatory Mitigation Is Occurring took the Corps’ mitigation efforts to task when it comes to restoring wetlands as part of mitigation efforts, labeling USACE guidelines as “vague and internally inconsistent.” However, by the time the same office issued the 2008 report Compensatory Mitigation for Losses of Aquatic Resources, mitigation efforts had reportedly improved and the USACE was meeting mitigation requirements except for the stipulation that any concern voiced about a project receive a 60-day review.A New Approach to Managing FloodsFrom the perspective of the USACE, attitudes toward floods have been evolving into what Buss describes as a more “holistic” approach focused on reducing flood risk with the realization that floods will occur. This approach considers all flood risk reduction tools including not just levees but also buyouts and relocations. Buss says many professional flood risk experts believe the nation should consider levees only as a last resort after first considering measures such as buyouts, relocations, elevation, and zoning.Using floodplains for any development other than farms is simply asking for trouble, asserts Criss. “Floodplain development should be recognized as geologically stupid, economically unwise, environmentally harmful, and pernicious to mankind,” he says.Agriculture, however, can make valuable use of the floodplain. Farms in the bottom-lands of rivers tend to be quite productive, says Galloway, whereas “when you start farming in hill country, you’re back to the erosion problems we had in the thirties.” However, some farms are located at especially precarious points along the river—for example, in the former channel of the river. He proposes that such farms be bought out and the levees taken down. But that of course depends on whether the owner of the farmland is willing to sell.Galloway also proposes changing levees that protect farms so they are open to the river at certain times, as a way to reduce flood damage. It’s an idea that Peter Rabbon, program director of the Corps’ National Flood Risk Management Program, says has merit. One way to implement this idea would be to build an overflow system (or “flowage easement”) into a levee, which Rabbon says would allow water to flow onto farmland in a controlled way.“This idea has been talked about for ages,” says Mount. “The wisest and best use of these floodplains is farms, rather than cities, because during the hydrologic emergencies [floods] you can store water on those farms, creating a modest amount of dislocation rather than catastrophe. A wise society compensates the farmer for saving it billions of dollars in damages,” he says. Flowage easements are gradually being introduced, he says.One of the most celebrated buyouts recently was that of Valmeyer, Illinois. The community of 900 souls was devastated by the 1993 Mississippi flood, the latest in a series of inundations endured by that community since 1910. The community moved to higher ground nearby, an effort involving 22 government agencies and a cost in the range of $28 million. In the process of rebuilding, the people of Valmeyer incorporated several sustainable design elements into their new town, including energy-efficient construction and passive solar technology. But such efforts, says Buss, demand strong community leadership with long-term vision—something that can be hard to find.Whether relocations such as Valmeyer’s will be seen as a result of this year’s flood is still uncertain. Money and leadership are both needed. But recent and future legislation may force at least partial change.Representative James Oberstar (D–MN), who chairs the House Transportation and Infrastructure Committee, notes that the 2007 $ 23 billion Water Resources Development Act “requires that national water resources planning avoid the unwise use of floodplains and flood-prone areas and requires the President to report by 2010 on national vulnerability to flood damages.” The 2007 legislation also addresses the funding of mitigation efforts by stipulating that if mitigation is required for a particular construction project, then it must be carried out before or concurrently with that project.This year’s proposed water resource legislation also includes a number of other provisions to reduce flood damage, such as creating incentives to limit development in flood-plains, investing in natural buffers such as wetlands, and pursuing technology for improved understanding of flooding threats. “As we move forward with the next [Water Resources Development Act] bill, we will continue to look for ways to better ensure that mitigation is carried out where and when it is required,” Oberstar says.\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2535773.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2535773",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2535773\nAUTHORS: John B Malcolm, Ithaar H Derweesh, Reza Mehrazin, Christopher J DiBlasio, David D Vance, Salil Joshi, Robert W Wake, Robert Gold\n\nABSTRACT:\nBackgroundThere is no consensus on the role of routine follow-up imaging during nonoperative management of blunt renal trauma. We reviewed our experience with nonoperative management of blunt renal injuries in order to evaluate the utility of routine early follow-up imaging.MethodsWe reviewed all cases of blunt renal injury admitted for nonoperative management at our institution between 1/2002 and 1/2006. Data were compiled from chart review, and clinical outcomes were correlated with CT imaging results.Results207 patients were identified (210 renal units). American Association for the Surgery of Trauma (AAST) grades I, II, III, IV, and V were assigned to 35 (16%), 66 (31%), 81 (39%), 26 (13%), and 2 (1%) renal units, respectively. 177 (84%) renal units underwent routine follow-up imaging 24–48 hours after admission. In three cases of grade IV renal injury, a ureteral stent was placed after serial imaging demonstrated persistent extravasation. In no other cases did follow-up imaging independently alter clinical management. There were no urologic complications among cases for which follow-up imaging was not obtained.ConclusionRoutine follow-up imaging is unnecessary for blunt renal injuries of grades I-III. Grade IV renovascular injuries can be followed clinically without routine early follow-up imaging, but urine extravasation necessitates serial imaging to guide management decisions. The volume of grade V renal injuries in this study is not sufficient to support or contest the need for routine follow-up imaging.\n\nBODY:\nBackgroundNonoperative management has become the rule for the majority of blunt renal injuries, with higher rates of renal salvage and decreased morbidity compared to primary surgical management [1]. The nonoperative management scheme is not standardized amongst all urologists, but typically involves a period of bed rest, monitoring of vital signs and serial hematocrit measurements, with either selective or routine use of early follow-up imaging. Our center has previously advocated routine follow-up imaging 2 to 4 days after blunt renal trauma to identify patients that may require intervention for delayed complications [2]. However, noting in recent years that the vast majority of follow-up CT scans do not alter clinical management, we have elected to reevaluate our previously proposed management strategy. We reviewed our contemporary experience with nonoperative management of blunt renal injuries in order to reassess the utility of routine early follow-up imaging.MethodsAfter receiving approval from the Institutional Review Board of the University of Tennessee Health Science Center, Memphis, Tennessee, we performed a retrospective chart review of all patients admitted with blunt renal injury and primary nonoperative management at the Elvis Presley Memorial Trauma Center between 1/2002 and 1/2006. Data collected from chart review included patient age and gender, race, body mass index (BMI, kg/m2), Glascow coma score (GCS), mechanism of injury, side of injury, grade of injury, vital signs, serial hematocrit measurements, results of follow-up imaging, complications, and delayed interventions.All injuries were diagnosed at the time of admission using contrasted CT imaging in the cortical and delayed excretory phases. Imaging for the diagnosis of renal trauma was obtained based on standard indications for the adult trauma patient: gross hematuria, microscopic hematuria with hypotension, or high suspicion of renal injury based on the mechanism of trauma [3,4]. Injuries were graded by a staff radiologist according to the American Association for the Surgery of Trauma (AAST) organ injury scale [5]. Injuries were also independently evaluated and graded by the managing urologist. Where discrepancies in grading were noted on chart review, the imaging studies were reread to verify accurate injury grading. However, all films were not uniformly reread at the time of chart review.Our renal trauma database captured all patients admitted with blunt renal injury and primary nonoperative management. It did not include the rare patient who underwent primary operative management or those with grade I injuries that were deemed appropriate for outpatient management by the trauma service. Patients who were hemodynamically stable at the time of presentation were managed according to a nonoperative protocol with bed rest, serial measurement of vital signs and hematocrit every 6 hours until stable over a 24-hour period or until gross hematuria resolved, and follow-up CT imaging 24–48 hours after admission.After compiling data from chart review, we noted the rate of clinically significant new findings on repeat imaging and attempted to correlate clinical outcomes with repeat imaging results. Student's t-test was used to compare demographic subsets in our series. Fisher's exact test was used to compare re-imaging outcomes between patients with low-grade (I,II,III) and high-grade (IV,V) injuries.ResultsPatient demographics are shown in Table 1. 207 patients (mean age 35 years, 120 male/87 female) were admitted for nonoperative management of 210 blunt renal injuries (3 bilateral) between 1/2002 and 1/2006. Table 2 shows radiographic findings and clinical outcomes. AAST grades I, II, III, IV, and V were assigned to 35 (16%), 66 (31%), 81 (39%), 26 (13%), and 2 (1%) renal units, respectively. Among grade IV injuries, 19 (73%) were renovascular injuries (segmental infarcts) and 7 (27%) involved collecting system injury (urinary extravasation). Average BMI among patients with low-grade injury (grades I, II, and III) was 26.6, compared to 27.0 among patients with high-grade injury (grades IV and V) (p = 0.81). 177 (84%) renal injuries underwent routine follow-up imaging 24–48 hours after admission. Among the 33 (16%) renal injuries that were not re-imaged, 17 (52%), 9 (27%), and 6 (18%) were of injury grades I, II, and III, respectively. One patient with a grade V renal injury was not stable enough for transport to radiology for follow-up imaging, and he ultimately succumbed to multiple traumatic injuries.Table 1Demographics and clinical presentationsVariableNumber of patients207Age (years) Mean (range)35 (15–80)BMI (kg/m2) Mean (range)26.7 (17.8–45.6)Gender Female87 (42%) Male120 (58%)Glascow Coma Score (GCS) Mean (range)13.6 (3–15)Mechanism of Injury MVA173 (84%) Pedestrian Struck15 (7%) Fall13 (6%) Assault6 (3%)Race African American79 (38%) Caucasian/other128 (62%)Side of Injury Left108 (52%) Right96 (46%) Bilateral3 (2%)Table 2Radiographic and clinical outcomesGradeN (%)F/U ImagingInjury D/G*Injury U/G**%D/G*%U/G**ComplicationsInterventionsLow GradeI35 (16)19 (54%)4 (21%)012%3%00II66 (31)57 (86%)5 (9%)2 (4%)00III81 (39)75 (93%)9 (12%)2 (3%)1 (1%)0High GradeIV26 (13)25 (96%)1 (4%)04%P = 0.32***0P = 1.00***3 (12%)3 (endoscopic ureteral stent)V2 (1)1 (50%)001 (50%)0Total210177 (84%)19 (11%)4 (2%)5 (2.4%)3 (1%)* D/G = Downgrade** U/G = Upgrade*** Fisher's exact testWe noted low rates of altered injury grading after follow-up imaging. After early re-imaging, renal injuries were downgraded in 4 (21%), 5 (9%), 9 (12%), 1 (4%), and 0 cases of grade I, II, III, IV, and V injury, respectively. Grade I injuries were downgraded when subcapsular hematoma was not evident on follow-up imaging; higher grade injuries were downgraded when lacerations appeared smaller or fewer in number on follow-up imaging compared to initial imaging. Renal injuries were upgraded in 0, 2 (4%), 2 (3%), 0, and 0 cases of grade I, II, III, IV, and V injury, respectively. Overall, the rate of injury downgrading was 12% for low-grade injury and 4% for high-grade injury (p = 0.32). The rate of injury upgrading was 3% for low-grade injuries and 0% for high-grade injuries (p = 1.00). There was no significant difference in the rates of altered injury grading on follow-up imaging between low and high-grade injuries.Of note, two cases of grade III injury were upgraded to grade IV on follow-up imaging. In the first case, the initial CT was performed with suboptimal delayed excretory phase imaging; urinary extravasation that was not apparent on the initial CT was demonstrated on the follow-up CT with appropriately timed delayed excretory phase imaging. The second case of grade III injury upgrade involved a patient with two devascularized segments on follow-up imaging in addition to a stable 1.5 cm laceration noted on the initial CT scan. This patient was managed without surgical intervention, and there were no delayed urologic complications.Complications and delayed interventions were uncommon in this series. In three cases of grade IV renal injury with collecting system insult, a ureteral stent was placed after serial imaging demonstrated persistent extravasation; endoscopic management proved definitive in these patients. One patient with a grade III renal injury developed a febrile urinary tract infection that was successfully managed with IV antibiotics. There were no cases in which repeat imaging results independently prompted urologic intervention. There were no urologic complications among cases for which follow-up imaging was not obtained.DiscussionThe incidence of traumatic renal injuries in the United States is approximately 5 per 100,000 persons [6], or 15,000 per year nationwide. The majority of renal injuries can be managed nonoperatively, with few absolute indications for surgical intervention [7]. CT imaging results factor prominently in the initial management strategy for blunt renal trauma, allowing for reliable injury grading that has been shown to correlate well with the need for surgical intervention [8,9]. However there is little consensus on the role of routine re-imaging once a nonoperative management course has been selected.Our institution previously reported a retrospective review of 48 cases of blunt renal injury and primary nonoperative management, noting that one in ten patients with a grade II or higher blunt renal injury had a delayed urologic complication detected by follow-up CT scan that ultimately required invasive intervention [2]. Following publication of our previous institutional experience, we have maintained a protocol of nonoperative management that includes routine re-imaging of all blunt renal injuries 24–48 hours after admission. We elected to reevaluate this protocol because in our contemporary experience it has seemed that few, if any, routine re-imaging studies have independently altered clinical management. At a cost of approximately $700.00 per imaging evaluation (based on Medicare 2005 reimbursement rate for CT abdomen w/wo contrast [74170] and CT pelvis w/wo contrast [72194]), more selective use of CT imaging in the nonoperative management of blunt renal trauma could offer substantial cost-containment benefit. In the series presented, routine use of early re-imaging amounted to a cost of $121,800 (174 × $700), which proved to be, by and large, an unnecessary expense. If early re-imaging had been used selectively (only grade IV collecting system injuries and grade V injuries), as is our current practice, the cost would have been $7700 (11 × $700), realizing a cost reduction of almost 94%. Furthermore, the clinical benefit of reducing unnecessary radiation exposure is likely to be significant.Our contemporary retrospective review includes 175 patients (177 renal units) who underwent routine early follow-up imaging during nonoperative management of a blunt renal injury. The majority of these renal units (151/85%) suffered a grade I, II, or III injury. It is noteworthy that the proportion of grade I injuries was significantly smaller than other published blunt renal trauma series (16% vs. 64% [6] and 86% [8]). It is probable that a significant proportion of patients with grade I renal injuries were deemed appropriate for outpatient management by the trauma surgery service, and were therefore not captured in our database. Among patients with low-grade renal injury, there were no instances where early re-imaging detected or prevented a urologic complication. Of some concern, a single patient was found to have urinary extravasation on follow-up imaging not appreciated on initial CT. However, in this case the initial CT scan was of suboptimal diagnostic quality due to poorly timed delayed excretory phase imaging. This illustrates the importance of high-quality imaging from the outset of patient management, particularly in a management scheme that excludes routine early re-imaging. Nevertheless, after demonstration of limited urinary extravasation on follow-up imaging, this patient was managed nonoperatively and additional imaging 5 days later revealed resolution of the urine leak.The goals of nonoperative management of blunt renal injury are to identify, manage, and limit associated complications – including urinary extravasation, urinoma, infection, bleeding, and, most importantly, loss of renal function or unnecessary nephrectomy. Such complications have been reported in 3% to 33% of patients after renal trauma [10]. Clinical management of such complications is directed primarily by objective clinical signs and symptoms (i.e., hemodynamic instability, increasing pain, fever and leukocytosis, decreasing hematocrit and blood transfusion requirement) and not by imaging results [11]. Even in cases where imaging results demonstrate known harbingers of urologic complications (devascularized segments, urinary extravasation), continued nonoperative management has proven practicable, with intervention based on clinical rather than radiographic criteria [11]. It is our contention that the optimum screening protocol for urologic complications in nonoperatively managed blunt renal injury should rely primarily on objective clinical signs and symptoms to the exclusion of routine, repeat, radiographic imaging.Our series of 207 patients (210 renal units) includes 32 patients (33 renal injuries) who did not undergo repeat imaging. The majority of patients in this subset had a grade I or grade II injury that was managed by the trauma surgery service without consultation by the urology service. Excluding one patient with a grade V renal injury (early mortality), there were no urologic complications among these patients. Admittedly, this group has limited statistical significance given its diminutive power.We are prospectively evaluating a revised management strategy (Figure 1), and future study will test our current conclusion that routine re-imaging of grade I-IV renal injuries is unnecessary. Since reviewing our experience with blunt renal trauma management from 2002 to 2006, we have abandoned routine early re-imaging for blunt renal injuries of grades I-III and grade IV renal injuries without urinary extravasation. We now use re-imaging studies selectively for patients with grade IV injuries with demonstrated urinary extravasation, patients with multiple comorbidities who are putatively at increased risk for complications from renal trauma, patients with severe injuries involving multiple organ systems, and patients with clinical signs (hemodynamic instability, decreasing hematocrit, fever) that may herald progressing complications from blunt renal injury. We continue to routinely re-image the rare patient who meets criteria for nonoperative management of a grade V renal injury. Our experience with this management algorithm will be reported as a sizeable experience accrues.Figure 1Blunt renal injury management algorithm.Weaknesses of this study include its retrospective design, with the inherent limitations and biases of a retrospective analysis. Furthermore, we do not have long-term follow-up data for the majority of the patients in this cohort, so we are unable to evaluate the impact of routine re-imaging on long term renal functional outcomes, development of hypertension, or other renal injury sequellae. We suspect that the impact of routine re-imaging on such parameters is minimal. Additionally, we have reviewed the use of routine re-imaging 24–48 hours after blunt renal injury. It has been shown that many of the delayed complications from blunt renal trauma (delayed bleed, AVF, infected urinoma, abscess) occur at least 1–3 weeks after the injury occurs [7], so it is possible that routine re-imaging of blunt renal injuries would yield more clinically useful results if performed at a longer time-interval post injury, i.e. 1–3 weeks. Ultimately, we feel that such a management scheme is not practicable, and if 2–3 week follow-up is achievable we feel that more cost-effective and efficient screening for delayed complications can be achieved by physical exam, vital signs, and simple laboratory tests (hematocrit and serum creatinine). One additional complication of this study lies in the grading system used for blunt renal injuries. The AAST renal injury scale is straightforward and has proven reliability. However we commonly encounter renal injuries that are not explicitly accounted for in the AAST Organ Injury Scale, e.g., renal injuries with segmental devascularization (segmental artery injuries without main renal artery injuries) or multiple cortical lacerations >1 cm in a single renal unit. Such injuries are classified as grade IV at our trauma center; it is these types of grade IV injuries for which we have abandoned routine repeat imaging, and we continue to re-image grade IV injuries with demonstrated urinary extravasation.ConclusionRoutine follow-up imaging is unnecessary in the nonoperative management of blunt renal injuries of grades I-III. Grade IV renovascular injuries can be followed clinically without routine follow-up imaging, but urine extravasation necessitates serial imaging to guide management decisions. The volume of grade V renal injuries in this study is not sufficient to support or contest the need for routine follow-up imaging, however we maintain a practice of routine follow-up imaging of nonoperatively managed grade V renal injuries. Ongoing prospective study will test these conclusions.Competing interestsThe authors declare that they have no competing interests.Authors' contributionsJM and ID conceived of the study, participated in design and coordination, and drafted the manuscript. RM and DV participated in study design, data acquisition and analysis. SJ and RG oversaw interpretation of radiographic information. CD and RW helped with manuscript drafting and critical revision. All authors read and approved the final manuscript.Pre-publication historyThe pre-publication history for this paper can be accessed here:\n\nREFERENCES:\nNo References"
+}

batch_2/PMC2535823.json

@@ -0,0 +1,4 @@
+{
+    "id": "PMC2535823",
+    "text": "This is an academic paper. This paper has corpus identifier PMC2535823\nAUTHORS: Bianca C. Wittmann, Nathaniel D. Daw, Ben Seymour, Raymond J. Dolan\n\nABSTRACT:\nSummaryThe desire to seek new and unfamiliar experiences is a fundamental behavioral tendency in humans and other species. In economic decision making, novelty seeking is often rational, insofar as uncertain options may prove valuable and advantageous in the long run. Here, we show that, even when the degree of perceptual familiarity of an option is unrelated to choice outcome, novelty nevertheless drives choice behavior. Using functional magnetic resonance imaging (fMRI), we show that this behavior is specifically associated with striatal activity, in a manner consistent with computational accounts of decision making under uncertainty. Furthermore, this activity predicts interindividual differences in susceptibility to novelty. These data indicate that the brain uses perceptual novelty to approximate choice uncertainty in decision making, which in certain contexts gives rise to a newly identified and quantifiable source of human irrationality.\n\nBODY:\nIntroductionHumans and other animals are naturally inquisitive and, in many circumstances, have a characteristic tendency to explore novel and unfamiliar stimuli and environments (Daffner et al., 1998; Ennaceur and Delacour, 1988; Hughes, 2007). Indeed, this tendency is exploited in marketing strategies whereby manufacturers of everyday consumable goods regularly remarket identical, or near-identical, products with novel packaging or advertising (Steenkamp and Gielens, 2003). Consumers' vulnerability to such manipulation may reflect the fact that, in naturalistic environments, novelty seeking can be strongly adaptive: because unfamiliarity normally tends to imply uncertainty, subsequent exploration carries with it the opportunity to discover unknown and potentially valuable outcomes.Economic and computational models have formalized the adaptive value of information gathering, and, equally important, how this can be traded off against the substantial costs and risks entailed. A fully rational solution (in the sense of maximizing expected utility; e.g., Sanfey et al., 2006) quantifies the value of exploration in terms of uncertainty reduction and the beneficial effects of this knowledge on future choices (Gittins and Jones, 1974). In practice, this optimal approach is computationally laborious, and researchers in robotics and computer science have often employed a shortcut that encourages exploratory behavior in artificial agents by assigning a fictive “bonus” reward value to novel options (Brafman and Tennenholtz, 2003; Gittins and Jones, 1974; Kaelbling, 1993; Ng et al., 1999), that is, by treating novel stimuli as themselves rewarding. Here, we investigate the possibility that human brains employ a similar heuristic. Note that insofar as novelty does not perfectly signal an unknown option—as with the example of repackaged goods—this approach departs from that prescribed by a rational analysis, for instance by exploring unnecessarily.The idea that novelty engages brain systems involved in appetitive reinforcement learning is supported by evidence that novel stimuli excite dopaminergic neurons in animals and also activate putatively dopaminergic areas in humans (Bunzeck and Duzel, 2006; Horvitz, 2000; Schultz, 1998). Computational theorists have interpreted these findings in terms of novelty bonuses (Kakade and Dayan, 2002). Furthermore, in a novelty paradigm modeled after classical conditioning procedures (Wittmann et al., 2007), a familiar cue trained to predict subsequent novelty itself activated midbrain, a response pattern that is reminiscent of dopaminergic responses to cues predicting reward as well as being characteristic of reinforcement learning (Dayan and Balleine, 2002; Schultz and Dickinson, 2000).These data suggest that stimulus novelty might enhance exploratory choices in humans through engagement of circuits within a putative reward system, which encompasses midbrain, striatum, amygdala, orbitofrontal cortex, and mesial prefrontal cortex (cf. Knutson and Cooper, 2005). Nevertheless, despite this strong suggestive evidence, no functional links have been demonstrated between a biological “novelty bonus” signal and actual novelty-seeking behavior.To investigate these links, we studied novelty-related decision making and associated brain activity in 15 healthy adults using functional magnetic resonance brain imaging (fMRI). We sought to test a computational hypothesis that brain systems associated with choice behavior, which are well described within reinforcement learning models, use novelty bonuses to encourage exploration of unfamiliar options. Participants performed a “four-armed bandit” choice task, in which the options were represented by four simultaneously presented landscape (“postcard”) images per trial (Figure 1). Each image, repeated over an average of 20 trials, was associated with a random, constant probability of winning money (one pound sterling). It was then replaced with another image with a new payoff probability. Subjects could only discover an option's reward probability by repeatedly sampling it, inducing a classic exploration/exploitation dilemma for subjects striving to maximize their earnings. Critically, we manipulated the novelty of images independently of reward value and uncertainty by familiarizing the subjects with half of the pictures (though not their associated reward probabilities) in a separate task before the scanning session. The images then used in the choice task were drawn pseudorandomly from the pre-exposed and novel sets; the associated payoff probabilities were also allocated pseudorandomly but with the same distribution for each set. This design ensures that novel options are no more uncertain, nor on average more valuable, than familiarized ones, allowing us specifically to examine a hypothesized mechanism of exploration directed toward perceptual novelty.ResultsBehavioral Novelty PreferenceWe fit participants' choices using a temporal-difference learning model (Sutton and Barto, 1998) similar to those used to account for choice behavior and neural signals in previous studies (Daw et al., 2006; Li et al., 2006; Tanaka et al., 2004). The model assumes that participants learn the value of each option and direct their choices toward those options predicted to be most valuable. In similar algorithms in artificial intelligence, novelty bonuses are often incorporated by “optimistically” initializing the starting value of new options to a higher level, encouraging exploration to determine their true value (Brafman and Tennenholtz, 2003; Ng et al., 1999).To test for such bonuses, we included two parameters, representing the initial value attributed to novel and prefamiliarized pictures. The best-fitting parameters over subjects are shown in Table 1. We first tested whether this model accounted better for the subjects' choices than a simpler model that initialized both sets of pictures with the best shared initial value; it did (likelihood ratio test, 15 d.f., p < 0.005). Adopting the model with separate initial values, we found that novelty significantly enhanced exploration, as evidenced by the fact that, for the best-fitting parameters, the average expected value attributed to novel pictures (Qn) on their first introduction was significantly higher than the corresponding expected value for familiar pictures (Qf; mean Qn = 0.41 ± 0.076 pounds over subjects; mean Qf = 0.37 ± 0.071 pounds; paired t test p = 0.01). Put simply, this quantified the monetary value of novelty at approximately 4 pence.Average reaction time (RT) for all choices was 1458 ± 80 ms. RTs did not differ between novel and familiar stimuli chosen on the trial when they were first introduced (1692 ± 110 ms and 1774 ± 126 ms, respectively). Scores on the novelty-seeking subscale of the TPQ ranged from 24% to 69% of the maximal score (mean = 52% ± SE 3.4). Individual participants' novelty bonuses, measured as a fraction relative to Qf, i.e., (Qn - Qf)/Qf, ranged from −0.17 to 0.53 (mean = 0.12 ± SE 0.05).Striatal Reward and Novelty SignalsIn terms of brain activity, we hypothesized that novelty bonuses would affect “prediction error” signals believed to influence learned value prediction and choice (Kakade and Dayan, 2002; McClure et al., 2003; O'Doherty et al., 2003; Pessiglione et al., 2006; Schultz, 1998; Tobler et al., 2006). To formally test this in our neuroimaging data (using SPM5), we ran two versions of the model to generate trial-by-trial prediction error signals for each subject. The first version was the novelty bonus model described above, while the second model applied the initial value of familiar stimuli to all stimuli, thus eliminating any impact of a novelty bonus. This second version was used to identify brain regions responding to a standard prediction error, and the difference between both prediction errors was then used to characterize areas in which neural activity was additionally correlated with a further error due to the novelty bonus. If neuronal prediction error activity is influenced by novelty bonuses, then it follows that it should correlate in the same brain area with both signals. We confined our analyses to ventral striatum and midbrain areas corresponding to our prior hypothesis (Kakade and Dayan, 2002).Anticipation of reward has been shown to be associated with striatal activity in both active and passive tasks (Aron et al., 2004; Berns et al., 2001; Delgado, 2007; Knutson et al., 2000; Pagnoni et al., 2002; Samejima et al., 2005; Tanaka et al., 2004; Yacubian et al., 2007), a response that is correlated with prediction errors determined in temporal-difference learning models (Daw et al., 2006; McClure et al., 2003; O'Doherty et al., 2003; Rodriguez et al., 2006). Consistent with these findings, the standard prediction error generated by assuming identical initial expected values for novel and familiar stimuli correlated with activity in the ventral striatum (Figure 2A). Additionally, the component of prediction error due to the novelty bonus also correlated significantly with ventral striatal activity (Figure 2B). Figure 2C shows the significant overlap in the spatial expression of both activation maps. This finding is consistent with the computational model, which predicts that the full error signal is the sum of both components. Time courses from the peak voxel correlating with the bonus signal (Figure 2D) illustrate that the response to choice of novel (relative to familiarized) pictures has a biphasic shape. Note that a similar pattern is seen in the responses of dopaminergic neurons to novel stimuli in tasks not involving reward (Horvitz et al., 1997; Kakade and Dayan, 2002; Schultz, 1998) and is characteristic of the novelty bonus scheme in prediction error models, because more optimistic predictions lead to more negative prediction error when the actual reward is revealed.Measures of Individual Novelty SeekingFinally, we reasoned that, if the identified striatal neural signals are indeed involved in novelty-seeking behavior, then we would also expect them to track interparticipant variability in this trait. Accordingly, we investigated whether the strength of the neural novelty bonus correlated with two behavioral measures of individual differences in novelty seeking. First, participants with higher novelty bonuses determined through model fits to their behavior in our task showed stronger novelty-bonus-related activation of the right ventral striatum and midbrain than did participants with lower behavioral novelty bonuses (Figure 3). By masking this analysis anatomically within the area activated on average by the novelty bonus in the group (Figure 2B), we verified that the striatal modulation of this activation indeed lies within the same region. Also, individual scores on the novelty-seeking subscale of Cloninger's Tridimensional Personality Questionnaire (TPQ) correlated with the degree of novelty-bonus activity in the left ventral striatum (see Figure S1 available online). These modulations (and the midbrain correlation with novelty seeking from the choice fits) lie outside the mask generated from the novelty-bonus group average but within areas that are known to be involved in reward and novelty processing (Wittmann et al., 2007, 2005). As predicted, there was no correlation of striatal or midbrain novelty signals with the harm-avoidance and reward-dependence subscales of the TPQ and no correlation of activations for the base component of the prediction error with any of the novelty-seeking measures.DiscussionOur data show that novelty enhances behavioral exploration in humans in the context of an appetitive reinforcement learning task. Participants' actual choices were best captured in a model that introduced higher initial values for novel stimuli than for prefamiliarized stimuli. This computationally defined novelty bonus was associated with activation of ventral striatum, suggesting that exploration of novelty shares properties with reward processing. Specifically, the observed overlap of novelty-related and reward-related neural components of prediction error signals supports this interpretation. The observation that activation by novelty bonuses in both striatal and midbrain areas correlated with individual novelty-seeking scores points to a functional contribution of the mesolimbic system to novelty-related enhancement of choice behavior.All of these findings are consistent with a specific computational and neural mechanism (Kakade and Dayan, 2002), namely that a dopaminergic prediction error signal for reinforcement learning reports a novelty bonus encouraging exploration. Such a model had been originally advanced to explain dopaminergic neuron responses to novel stimuli in passive, nondecision tasks (Horvitz et al., 1997; Schultz, 1998), a response pattern that has also been suggested in humans (Bunzeck and Duzel, 2006; Wittmann et al., 2007). By linking a bonus-related neural signal to actual novelty-seeking behavior, the present study provides evidence to support a model of dopamine-driven novelty exploration. While it is not possible to identify definitively the neural source underlying fMRI signals, recent results support an inference that striatal prediction error signals have a dopaminergic basis, because they are modulated by dopaminergic drugs (Pessiglione et al., 2006; Yacubian et al., 2006). Also, given that fMRI does not allow inference of causality from correlations of brain activity with behavior, alternative explanations for our findings are possible. For instance, areas outside of the mesolimbic system could mediate the exploration effect of novelty, and the striatal activations might then reflect these choices. However, in directly contrasting exploratory to exploitative choices (as in Daw et al., 2006), we did not find novelty- or exploration-related activity in frontopolar cortex, a candidate region outside the midbrain (Daw et al., 2006).Computational models stress the necessity to overcome exploitative tendencies in order to optimize decision making under uncertainty (Gittins and Jones, 1974). One solution to this is the introduction of an exploration bonus to guide decisions toward uncertain options (Gittins and Jones, 1974; Kaelbling, 1993). Here, we provide evidence for a specific version of such a bonus that uses novelty as a signal for uncertainty (Brafman and Tennenholtz, 2003; Kakade and Dayan, 2002; Ng et al., 1999). Notably, a bonus directed toward uncertainty per se was not evident, either neurally or behaviorally, in a previous study of gambling involving an n-armed bandit task, in which uncertainty arose due to a gradual change in the unknown payoffs but without accompanying perceptual novelty (Daw et al., 2006). The differences between the tasks may explain why, in the previous study but not the present one, exploratory choices were found to be accompanied by BOLD activity in frontopolar cortex, a region broadly associated with cognitive control. Psychologically, exploration in a familiar context, as in the earlier study, requires overriding not only a tendency to exploit known highly rewarding stimuli but also a tendency to avoid previously low-valued stimuli. However, novel options, like those used here, may not only be attractive due to a novelty bonus, but crucially have no history of negative feedback, perhaps reducing the demand for cognitive control to encourage their exploration.Computationally, the present findings point to the likelihood that humans use perceptual novelty as a substitute for true choice uncertainty in directing exploration. This would explain why they had a greater tendency to explore perceptually novel options even when no more uncertain and also why our previous study (Daw et al., 2006) did not detect exploration directed toward uncertainty without perceptual novelty. Such a scheme is common in artificial intelligence (Brafman and Tennenholtz, 2003; Ng et al., 1999), because it is so easily implemented by optimistic initialization. Additionally, it seems to be a plausible neural shortcut, because novelty is likely to be a reliable signal for uncertainty in the natural world. Physiologically, this appears to be implemented by using the same system to process the motivational aspects of standard reward.To be sure, on a rational analysis, the degree to which exploration is net beneficial depends on a number of circumstantial factors, including for instance how dangerous unexplored alternatives are likely to be. Computationally, this points to an important requirement that the degree of novelty seeking needs to be carefully tuned to appropriate levels (there are some proposals for the neural substrates for similar “metalearning” processes; Doya, 2002). Behaviorally, this point resonates with the fact that animals' novelty preferences exhibit a great deal of subtle contextual sensitivity (Hughes, 2007). Rats, for instance, avoid novel foods (presumably due to serious risk of illness), and fear-promoting stimuli such as electric shocks can also promote novelty avoidance on some tasks. Such phenomena are not inconsistent with our account of novelty seeking in the present (safe) context; indeed, we would infer that our approach could easily be extended to quantify the effects of factors such as fear.Finally, while the novelty bonus may be a useful and computationally efficient heuristic in naturalistic environments, it clearly has a downside. In humans, increased novelty seeking is associated with gambling and addiction (Hiroi and Agatsuma, 2005; Spinella, 2003), disorders that are also closely linked to dopaminergic pathophysiology (Chau et al., 2004; Reuter et al., 2005). More generally, the substitution of perceptual novelty for choice uncertainty represents a distinct, albeit slight, departure from rational choice that, as in our task, introduces the danger of being sold old wine in a new skin.Experimental ProceduresParticipantsTwenty healthy adults participated in the experiment, four of which had to be excluded for technical problems with stimulus presentation and scanner sequence software and another for electing to leave the experiment before it was complete. Fifteen right-handed participants (mean age, 26.1 ± 1.2; seven male) remained in the analysis. All participants gave written informed consent to participate, and the study was in accordance with the guidelines of the local ethics committee.Behavioral ParadigmFamiliarization ProcedurePrior to scanning, participants underwent two familiarization sessions that included 32 pictures from a set of 64 grayscale landscape photographs with normalized luminance and contrast. Each picture was presented four times per session in randomized order. In the first session, participants were asked to look at the pictures attentively without responding, while in the second session they were asked to respond to each picture per button press, indicating whether there was a building in the picture.PrescanningParticipants received written instructions on the decision-making task, including the information that they would receive 20% of their winnings at the end of the experiment. They also completed a short button response training to ensure that their responses reflected their choices and a short training version of the task (Figure 1).Scanning TaskParticipants engaged in three sessions of 17.5 min length, each containing 100 trials of 8.5–11.5 s duration. On each trial, participants were presented with four pictures (visible on a screen reflected in a head coil mirror) and selected one depending on its location on the screen (top left, top right, bottom left, bottom right), using a button box with their right hand. If they did not choose a picture within 3.5 s, the feedback “No response” was presented on the screen for 6.5 s to signal an invalid trial. On valid trials, a frame was shown around the chosen picture, and feedback (£1 on a green square background or £0 on a blue square background) was presented 3 s later, superimposed on the chosen picture. A variable fixation phase (1–4 s) followed. Participants received either £1 or nothing, depending on the reward probability associated with the chosen picture. Each picture had been assigned a random reward probability (mean value: 0.33) that was not changed in the course of the experiment.Each picture was repeated for an average of 20 trials (range: 5–35). The location of pictures was changed randomly on each trial, so that a decision could not be based on habitual responding with the same finger. In 20% of trials, one of the pictures was exchanged for another picture that had either been familiarized or was novel (=30 switches to either category in total).After scanning, participants completed Cloninger's Tridimensional Personality Questionnaire (Cloninger et al., 1991), which tests for personality differences in three dimensions defined as novelty seeking, reward dependence, and harm avoidance.Behavioral AnalysisWe characterized each subject's trial-to-trial choices using a temporal-difference learning model with four free parameters. The model assumes that the probability of choosing picture c (out of the four available options) on trial t is P(c(t)=c,t)∝exp(β⋅Q(c,t)); that is, softmax in Q(c,t), the presumed value of the option on that trial. The inverse temperature parameter β controls the exclusivity with which choices are directed toward higher-valued options.According to the model, the values Q were learned from experience using a standard delta rule, Q(c(t),t+1)=Q(c(t),t)+ν⋅δ(t). Here, the value of the chosen option is updated according to the error signal δ(t)=r(t)−Q(c(t),t), which measures the mismatch between the reward delivered, r(t) (i.e., 1 or 0) and the value expected. ν is a learning rate parameter (values for options not chosen were not changed).The initial values of each picture, Q(c,0), are set to Qf (a free parameter) if the picture had been pre-exposed during the familiarization phase, and to parameter Qn if not. The difference Qn−Qf therefore confers differential initial value for non-pre-exposed pictures when first presented; if this difference is positive (a “novelty bonus”; Kakade and Dayan, 2002; Ng et al., 1999), it favors the choice of novel items when they first become available.We optimized the parameters for each subject individually to maximize the likelihood of his or her observed sequence of choices, ∏tP(c(t),t), where the underlying values Q(c,t) were computed using the model and the preceding sequence of actual observed choices c(1…t−1) and rewards r(1…t−1). We also, separately, fit a nested model in with the initial values constrained to be equal, i.e., Qn=Qf, and compared the two models on the entire data set (pooled over all subjects) using a likelihood ratio test.The best-fitting estimates for each parameter were then treated as a random variable instantiated for each subject (equivalently, we treated all parameters as random effects and estimated the moments of the group distribution using the summary statistics procedure [Holmes and Friston, 1998]). Because of a degeneracy in the model in some regimes (specifically, when ν is very small and consequently the Qs are consistently very far from asymptote), it was not possible to obtain reliable parameter estimates for one subject, who was therefore excluded from the estimates of the average parameters. Because the degeneracy manifests through poorly constrained but at the optimum aberrantly large and small (respectively) values of β and ν, the exclusion or inclusion of this subject had no appreciable effect on the reported hypothesis tests involving Qf and Qn, or on the model comparison.To generate model-based regressors for the imaging analysis, the learning model was simulated using each subject's actual sequence of rewards and choices to produce per-subject, per-trial estimates of the values Q(c,t) and error signals δ(t). The free parameters were taken to be top-level mean estimates from the random-effects model (i.e., the mean of the individual parameter estimates; this regularizes the individual estimates, which we have previously found to be noisy for these purposes, e.g., Daw et al., 2006).To study the effects of the novelty bonus on the prediction error, we repeated the simulations, but taking Qn=Qf—that is, eliminating any bonus for non-pre-exposed pictures. This generated a second sequence of values Qbase(c,t) and prediction errors δbase(t), reflecting baseline values without the additional effects of the novelty bonus. For the purpose of regression, we decomposed the values Q(c,t) and δ(t) into the sums Qbase(c,t)+Qadd(c,t) and δbase(t)+δadd(t) of the baseline values plus additional increments for the effects of the bonus. We computed Qadd(t)=Q(t)−Qbase(t) and δadd(t)=δ(t)−δbase(t). Together with a standard general linear analysis, this additive decomposition allowed us to study the contribution of baseline and bonus-related components of the prediction error signal to BOLD activity and to test the hypothesis that both components summate to produce the full error signal. Note that the bonus has a characteristic pattern of effects on the values and errors, which is not wholly confined (for instance) only to trials when a novel picture is first offered. For instance, if Qn>Qf then Qadd>0andδadd<0 whenever a nonfamiliarized option is chosen.fMRI ProceduresThe functional imaging was conducted using a 1.5 Tesla Siemens Sonata MRI scanner to acquire gradient echo T2∗-weighted echo-planar images (EPI) with blood oxygenation level dependent (BOLD) contrast. We employed a special sequence designed to optimize functional sensitivity in OFC and medial temporal lobes. This consisted of tilted acquisition in an oblique orientation at 30∗ to the AC-PC line, as well as application of a preparation pulse with a duration of 1 ms and amplitude of −2 mT/m in the slice selection direction. The sequence enabled 36 axial slices of 3 mm thickness and 3 mm in-plane resolution to be acquired with a repetition time (TR) of 3.24 s. Coverage was obtained from the base of the orbitofrontal cortex and medial temporal lobes to the superior border of the dorsal anterior cingulate cortex. A field map using a double echo FLASH sequence (64 oblique transverse slices, slice thickness = 2 mm, gap between slices = 1 mm, TR = 1170 ms, α = 90°, short TE = 10 ms, long TE = 14.76 ms, BW = 260 Hz/pixel, PE direction anterior-posterior, FOV = 192 × 192 mm2, matrix size 64 × 64, flow compensation) was recorded for distortion correction of the acquired EPI images. Participants were placed in a light head restraint within the scanner to limit head movement during acquisition. Functional imaging data were acquired in three separate 332 volume runs. A T1-weighted structural image, local field maps, and an inversion recovery EPI (IR-EPI) were also acquired for each subject. Scanning parameters were the same as for the EPI sequence but with full brain coverage.fMRI AnalysisPreprocessing and data analysis were performed using Statistical Parametric Mapping software implemented in Matlab (SPM5; Wellcome Department of Imaging Neuroscience, Institute of Neurology, London, UK). Using the FieldMap toolbox (Hutton et al., 2002, 2004), field maps were estimated from the phase difference between the images acquired at the short and long TE. The EPI images were corrected for distortions based on the field map (Hutton et al., 2002) and the interaction of motion and distortion using the Unwarp toolbox (Andersson et al., 2001; Hutton et al., 2004). EPI images were then spatially normalized to the Montreal Neurological Institute template by warping the subject's anatomical IR-EPI to the SPM template and applying these parameters to the functional images, transforming them into 2 × 2 × 2 mm sized voxels, smoothed using an 8 mm Gaussian kernel.For statistical analysis, the data were scaled voxel-by-voxel onto their global mean and high-pass filtered. Each trial was modeled with impulse regressors at two time points: the time of the presentation of the pictures, which was taken to be the time of the decision, and the time of presentation of the outcome (3 s after key press). These events were modulated by parametric regressors simulating the baseline prediction error signal and the additional component to the error due to the novelty bonus. The baseline prediction error was defined as Qbase(c(t),t) at the time the pictures were presented on trial t (Morris et al., 2006) and as δbase(t) at the time the outcome was revealed. The novelty bonus contribution was modeled as Qadd(c(t),t) and δadd(t) at the same time points.These regressors were then convolved with the canonical hemodynamic response function and its temporal derivative (Friston et al., 1998) and entered as separate orthogonalized regressors into one regression analysis against each subject's fMRI data using SPM, allowing independent assessment of the activations correlating with each model's predictions. The six scan-to-scan motion parameters produced during realignment were included as additional regressors in the SPM analysis to account for residual effects of scan-to-scan motion. To enable inference at the group level, the coefficient estimates for the two model-based regressors from each individual subject were taken to allow second-level, random-effects group statistics to be computed. To investigate how individual variation in novelty seeking impacted bonus-related BOLD activity, we included the normalized per-subject novelty bonus (Qn − Qf)/Qf (computed using the individual estimates of these parameters from the behavioral analysis) as a second-level regressor.Results are reported in areas of interest at p < 0.001 uncorrected. The predicted activations in the ventral striatum were further tested using a spherical small-volume correction (SVC) centered on the peak voxel, with a radius of 9 mm, corresponding to the 3.43 cm3 volume of the putamen (Anastasi et al., 2006). All behavioral averages are given as mean values ± SE. To better localize midbrain activity, the relevant activation maps were superimposed on a mean image of 33 spatially normalized magnetization transfer (MT) images acquired previously (Bunzeck and Duzel, 2006). On MT images, the substantia nigra can be easily distinguished from surrounding structures (Eckert et al., 2004).To illustrate time courses, we conducted an additional regression analysis on the voxel of peak activation for the bonus regressor using a flexible basis set of 1 TR duration finite impulse responses. Impulses were aligned according to the time of outcome reveal. Four trial types were modeled separately: the first two choices of a novel image, the first two trials of a familiar image, and (as effects of no interest) the remaining trials divided into two groups according to win versus loss.\n\nREFERENCES:\n1. AnastasiG.CutroneoG.TomaselloF.LucernaS.VitettaA.BramantiP.Di BellaP.ParentiA.PorzionatoA.MacchiV.De CaroR.In vivo basal ganglia volumetry through application of NURBS models to MR imagesNeuroradiology48200633834516568299\n2. AnderssonJ.L.HuttonC.AshburnerJ.TurnerR.FristonK.Modeling geometric deformations in EPI time seriesNeuroimage13200190391911304086\n3. AronA.R.ShohamyD.ClarkJ.MyersC.GluckM.A.PoldrackR.A.Human midbrain sensitivity to cognitive feedback and uncertainty during classification learningJ. Neurophysiol.9220041144115215014103\n4. BernsG.S.McClureS.M.PagnoniG.MontagueP.R.Predictability modulates human brain response to rewardJ. Neurosci.2120012793279811306631\n5. BrafmanR.I.TennenholtzM.R-MAX - A general polynomial time algorithm for near-optimal reinforcement learningJ. Mach. Learn. Res.32003213231\n6. BunzeckN.DuzelE.Absolute coding of stimulus novelty in the human substantia nigra/VTANeuron51200636937916880131\n7. ChauD.T.RothR.M.GreenA.I.The neural circuitry of reward and its relevance to psychiatric disordersCurr. Psychiatry Rep.6200439139915355762\n8. CloningerC.R.PrzybeckT.R.SvrakicD.M.The tridimensional personality questionnaire: U.S. normative dataPsychol. Rep.691991104710571784653\n9. DaffnerK.R.MesulamM.M.ScintoL.F.CohenL.G.KennedyB.P.WestW.C.HolcombP.J.Regulation of attention to novel stimuli by frontal lobes: an event-related potential studyNeuroreport919987877919579666\n10. DawN.D.O'DohertyJ.P.DayanP.SeymourB.DolanR.J.Cortical substrates for exploratory decisions in humansNature441200687687916778890\n11. DayanP.BalleineB.W.Reward, motivation, and reinforcement learningNeuron36200228529812383782\n12. DelgadoM.R.Reward-related responses in the human striatumAnn. N Y Acad. Sci.11042007708817344522\n13. DoyaK.Metalearning and neuromodulationNeural Netw.15200249550612371507\n14. EckertT.SailerM.KaufmannJ.SchraderC.PeschelT.BodammerN.HeinzeH.J.SchoenfeldM.A.Differentiation of idiopathic Parkinson's disease, multiple system atrophy, progressive supranuclear palsy, and healthy controls using magnetization transfer imagingNeuroimage21200422923514741660\n15. EnnaceurA.DelacourJ.A new one-trial test for neurobiological studies of memory in rats. 1: Behavioral dataBehav. Brain Res.31198847593228475\n16. FristonK.J.FletcherP.JosephsO.HolmesA.RuggM.D.TurnerR.Event-related fMRI: characterizing differential responsesNeuroimage7199830409500830\n17. GittinsJ.C.JonesD.M.A dynamic allocation index for the sequential design of experimentsGaniJ.Progress in Statistics1974North-HollandAmsterdam241266\n18. HiroiN.AgatsumaS.Genetic susceptibility to substance dependenceMol. Psychiatry10200533634415583701\n19. HolmesA.P.FristonK.J.Generalizability, random effects, and population inferenceNeuroimage71998S757\n20. HorvitzJ.C.Mesolimbocortical and nigrostriatal dopamine responses to salient non-reward eventsNeuroscience96200065165610727783\n21. HorvitzJ.C.StewartT.JacobsB.L.Burst activity of ventral tegmental dopamine neurons is elicited by sensory stimuli in the awake catBrain Res.75919972512589221945\n22. HughesR.N.Neotic preferences in laboratory rodents: Issues, assessment and substratesNeurosci. Biobehav. Rev.31200744146417198729\n23. HuttonC.BorkA.JosephsO.DeichmannR.AshburnerJ.TurnerR.Image distortion correction in fMRI: A quantitative evaluationNeuroimage16200221724011969330\n25. KaelblingL.P.Learning in Embedded Systems1993MIT PressCambridge, MA\n26. KakadeS.DayanP.Dopamine: generalization and bonusesNeural Netw.15200254955912371511\n27. KnutsonB.CooperJ.C.Functional magnetic resonance imaging of reward predictionCurr. Opin. Neurol.18200541141716003117\n28. KnutsonB.WestdorpA.KaiserE.HommerD.FMRI visualization of brain activity during a monetary incentive delay taskNeuroimage122000202710875899\n29. LiJ.McClureS.M.King-CasasB.MontagueP.R.Policy adjustment in a dynamic economic gamePLoS ONE12006e10317183636\n30. McClureS.M.BernsG.S.MontagueP.R.Temporal prediction errors in a passive learning task activate human striatumNeuron38200333934612718866\n31. MorrisG.NevetA.ArkadirD.VaadiaE.BergmanH.Midbrain dopamine neurons encode decisions for future actionNat. Neurosci.920061057106316862149\n33. O'DohertyJ.P.DayanP.FristonK.CritchleyH.DolanR.J.Temporal difference models and reward-related learning in the human brainNeuron38200332933712718865\n34. PagnoniG.ZinkC.F.MontagueP.R.BernsG.S.Activity in human ventral striatum locked to errors of reward predictionNat. Neurosci.52002979811802175\n35. PessiglioneM.SeymourB.FlandinG.DolanR.J.FrithC.D.Dopamine-dependent prediction errors underpin reward-seeking behaviour in humansNature44220061042104516929307\n36. ReuterJ.RaedlerT.RoseM.HandI.GlascherJ.BuchelC.Pathological gambling is linked to reduced activation of the mesolimbic reward systemNat. Neurosci.8200514714815643429\n37. RodriguezP.F.AronA.R.PoldrackR.A.Ventral-striatal/nucleus-accumbens sensitivity to prediction errors during classification learningHum. Brain Mapp.27200630631316092133\n38. SamejimaK.UedaY.DoyaK.KimuraM.Representation of action-specific reward values in the striatumScience31020051337134016311337\n39. SanfeyA.G.LoewensteinG.McClureS.M.CohenJ.D.Neuroeconomics: cross-currents in research on decision-makingTrends Cogn. Sci.10200610811616469524\n40. SchultzW.Predictive reward signal of dopamine neuronsJ. Neurophysiol.8019981279658025\n41. SchultzW.DickinsonA.Neuronal coding of prediction errorsAnnu. Rev. Neurosci.23200047350010845072\n42. SpinellaM.Evolutionary mismatch, neural reward circuits, and pathological gamblingInt. J. Neurosci.113200350351212856479\n43. SteenkampJ.-B.E.M.GielensK.Consumer and market drivers of the trial probability of new consumer packaged goodsJ. Consum. Res.292003368384\n44. SuttonR.S.BartoA.G.Reinforcement Learning: An Introduction1998MIT PressCambridge, MA\n45. TanakaS.C.DoyaK.OkadaG.UedaK.OkamotoY.YamawakiS.Prediction of immediate and future rewards differentially recruits cortico-basal ganglia loopsNat. Neurosci.7200488789315235607\n46. ToblerP.N.O'DohertyJ.P.DolanR.J.SchultzW.Human neural learning depends on reward prediction errors in the blocking paradigmJ. Neurophysiol.95200630131016192329\n47. WittmannB.C.SchottB.H.GuderianS.FreyJ.U.HeinzeH.J.DuzelE.Reward-related FMRI activation of dopaminergic midbrain is associated with enhanced hippocampus-dependent long-term memory formationNeuron45200545946715694331\n48. WittmannB.C.BunzeckN.DolanR.J.DuzelE.Anticipation of novelty recruits reward system and hippocampus while promoting recollectionNeuroimage38200719420217764976\n49. YacubianJ.GlascherJ.SchroederK.SommerT.BrausD.F.BuchelC.Dissociable systems for gain- and loss-related value predictions and errors of prediction in the human brainJ. Neurosci.2620069530953716971537\n50. YacubianJ.SommerT.SchroederK.GlascherJ.KalischR.LeuenbergerB.BrausD.F.BuchelC.Gene-gene interaction associated with neural reward sensitivityProc. Natl. Acad. Sci. USA10420078125813017483451"
+}