metadata
dict
text
stringlengths
81
12k
embeddings
list
tags
list
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 1, "section": "abstract", "title": "" }
Inwardly rectifying potassium (Kir) channels are found in almost every cell type where they play key roles in controlling membrane potential, cellular excitability and K + fluxes. A large number of clones have now been identified which encode Kir channels and these can be divided into seven major subfamilies (Kir1.0-Ki...
[ 0.03263992443680763, -0.06829226762056351, 0.0097662890329957, -0.017370326444506645, 0.028278309851884842, 0.05431308224797249, 0.008181672543287277, 0.001122207730077207, -0.020251888781785965, 0.002915151184424758, -0.05685408040881157, 0.09317141771316528, 0.02843039482831955, -0.00030...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 2, "section": "abstract", "title": "" }
The functional role of these heteromeric Kir4.0-Kir5.1 channels remains unclear. However, recent studies have shown that Kir4.1-Kir5.1 heteromeric channels exist in vivo in renal tubular epithelia. In addition these heteromeric channels have been shown to be extremely sensitive to inhibition by protons within the physi...
[ 0.008842932991683483, -0.04541855305433273, 0.009876010939478874, -0.02671051025390625, 0.01782473362982273, 0.051349516957998276, 0.05610356107354164, 0.0087889414280653, 0.0455465242266655, -0.026460150256752968, -0.04844643548130989, 0.016277609393000603, -0.0003673760802485049, -0.0022...
[ "Kir4.1", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 3, "section": "abstract", "title": "" }
Extensive studies with Kir1.1, another pH-sensitive channel, have shown that the primary pH sensor is a lysine residue found within a highly conserved region of the proximal N-terminus. Lysine is normally fully protonated under physiological conditions. However, this lysine residue in Kir1.1 (K80) exhibits anomalous ti...
[ 0.009952262043952942, -0.044281814247369766, 0.014792063273489475, -0.029844842851161957, 0.0019032114651054144, 0.037238121032714844, 0.014030750840902328, 0.008401749655604362, 0.05088168382644653, -0.0025973247829824686, -0.04288821667432785, 0.044074248522520065, 0.0052578807808458805, ...
[ "Kir1.1", "Kir4.1", "Kir4.2" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 1, "section": "methods", "title": "" }
1. The inwardly rectifying potassium channel Kir5.1 appears to form functional channels only by coexpression with either Kir4.1 or Kir4.2. Kir4.1-Kir5.1 heteromeric channels have been shown to exist in vivo in renal tubular epithelia. However, Kir5.1 is expressed in many other tissues where Kir4.1 is not found. Using K...
[ 0.03057241626083851, -0.05323807895183563, 0.025908324867486954, -0.02533438615500927, 0.022658832371234894, 0.04094157740473747, 0.03349730744957924, 0.007013242691755295, 0.029892122372984886, -0.017264196649193764, -0.0482599176466465, 0.07976098358631134, -0.009470289573073387, -0.0293...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 2, "section": "methods", "title": "" }
2. Heteromeric Kir5.1-Kir4.1 channels are significantly more sensitive to intracellular acidification than Kir4.1 currents. We demonstrate that this increased sensitivity is primarily due to modulation of the intrinsic Kir4.1 pH sensitivity by Kir5.1.
[ 0.021579012274742126, -0.07041372358798981, 0.013019697740674019, -0.02828459069132805, 0.002104814862832427, 0.04819435253739357, 0.027113253250718117, 0.0077425334602594376, 0.05093904584646225, -0.017230039462447166, -0.05591488629579544, 0.06814325600862503, 0.014086509123444557, -0.01...
[ "Kir4.1", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 3, "section": "methods", "title": "" }
3. Kir4.2 was found to be significantly more pH sensitive (pK a = 7.1) than Kir4.1 (pK a = 5.99) due to an additional pH-sensing mechanism involving the C-terminus. As a result, coexpression with Kir5.1 does not cause a major shift in the pH sensitivity of the heteromeric Kir4.2-Kir5.1 channel.
[ 0.02449870854616165, -0.0925273597240448, 0.01735099032521248, -0.03987976163625717, -0.02828001230955124, 0.03240329772233963, 0.04277960583567619, -0.003061126684769988, 0.05764364078640938, -0.012971075251698494, -0.048387911170721054, 0.041526950895786285, 0.017209621146321297, 0.01360...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 4, "section": "methods", "title": "" }
4. Cell-attached single channel analysis of Kir4.2 revealed a channel with a high open probability (P o > 0.9) and single channel conductance of ›25 pS, whilst coexpression with Kir5.1 produced novel bursting channels (P o < 0.3) and a principal conductance of ›54 pS with several subconductance states.
[ 0.003062969073653221, -0.06406570971012115, -0.030204899609088898, 0.014661324210464954, -0.04438187554478645, 0.001703009707853198, -0.02080761082470417, -0.02634182572364807, -0.015542611479759216, 0.002302817301824689, -0.04450816661119461, 0.020263347774744034, 0.019640646874904633, 0....
[ "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 5, "section": "methods", "title": "" }
5. These results indicate that Kir5.1 may form heteromeric channels with Kir4.2 in tissues where Kir4.1 is not expressed (e.g. pancreas) and that these novel channels are likely to be regulated by changes in intracellular pH. In addition, the extreme pH sensitivity of Kir4.2 has implications for the role of this subuni...
[ 0.02713192254304886, -0.08714370429515839, 0.02219727821648121, -0.04773349687457085, -0.009021037258207798, 0.06272663921117783, 0.050404034554958344, 0.011222640052437782, 0.051280952990055084, -0.021344110369682312, -0.06784896552562714, 0.05718599259853363, -0.009670057334005833, -0.00...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 7, "section": "methods", "title": "" }
Several different studies have also revealed that there is a correlation between the intrinsic sensitivity of a Kir channel to intracellular pH and the presence of a lysine residue at the equivalent position to K80 in Kir1.1. One such example is Kir4.1, which also forms pH-sensitive homomeric channels. Like Kir1.1, the...
[ -0.0051350779831409454, -0.10340133309364319, 0.02066304348409176, -0.036024563014507294, -0.005826175678521395, 0.04809980466961861, 0.023074494674801826, 0.013335388153791428, 0.06402597576379776, 0.00011092348722741008, -0.06114552915096283, 0.058746930211782455, 0.001495035015977919, -...
[ "Kir1.1", "Kir4.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 8, "section": "methods", "title": "" }
We and others have recently shown that the intrinsic pH sensitivity of Kir4.1 can be modified by heteropolymerisation with Kir5.1. Coexpression of Kir4.1 with Kir5.1 produces novel K + channels with a significantly 'enhanced' pH sensitivity (pK a = 7.35). Inhibition of these channels by protons is direct and does not i...
[ 0.015484647825360298, -0.05541486293077469, 0.006682341452687979, -0.03475586697459221, 0.006423109211027622, 0.050757307559251785, 0.030232740566134453, 0.005455998238176107, 0.052010245621204376, -0.003191182389855385, -0.05192599445581436, 0.050949208438396454, 0.0006654858007095754, -0...
[ "Kir4.1", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 9, "section": "methods", "title": "" }
Although Kir4.1 and Kir5.1 have been shown to form heteromeric channels in vivo their tissue specific patterns of expression do not completely overlap. RT-PCR and Northern blot analysis have shown Kir5.1 to be expressed in several tissues where Kir4.1 is not, and vice versa. It is therefore highly likely that other sub...
[ 0.031241074204444885, -0.10466696321964264, 0.020317047834396362, -0.045822713524103165, -0.006617535371333361, 0.07213148474693298, 0.0372672900557518, -0.0030057451222091913, 0.04441169276833534, -0.006064675748348236, -0.07626059651374817, 0.0544608011841774, 0.0034562419168651104, 0.01...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 10, "section": "methods", "title": "" }
In this study we have used Kir5.1 specific antibodies to reveal abundant expression of Kir5.1 in the pancreas, a tissue where Kir4.2 (but not Kir4.1) is expressed. We have also further investigated the contribution of Kir5.1 to the pH sensitivity of Kir4.0-Kir5.1 heteromeric channels and have determined some of the pri...
[ 0.016358593478798866, -0.06596170365810394, 0.03219550475478172, -0.02446005493402481, 0.016134820878505707, 0.04532163590192795, 0.04108555614948273, 0.013153756968677044, 0.0802585706114769, -0.02500290796160698, -0.0540657676756382, 0.07427813112735748, -0.019840648397803307, -0.0167413...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 11, "section": "methods", "title": "" }
Procedures involving animals and their care have been conducted in conformity with the institutional guidelines that are in compliance with national and international laws and policies (EEC Council Directive 86/609,. In accordance with these institutional guidelines, 60-day-old male Sprague-Dawley rats were deeply anae...
[ 0.05227673053741455, -0.05768854543566704, 0.08148906379938126, -0.0016942804213613272, -0.0016626901924610138, 0.03240097686648369, 0.028449811041355133, 0.015376392751932144, 0.036445360630750656, -0.0038292319513857365, -0.034489408135414124, 0.06602435559034348, -0.028370633721351624, ...
[ "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 12, "section": "methods", "title": "" }
All channel subunits were subcloned into the oocyte expression vector pBF, which provides 5fi and 3fi untranslated regions from the Xenopus b-globin gene flanking a polylinker containing multiple restriction sites. In vitro mRNAs were generated using the SP6 polymerase. Kir subunits were joined in tandem as previously ...
[ 0.007261812221258879, -0.08044267445802689, 0.024920562282204628, -0.036022622138261795, -0.015110376290977001, 0.06638287752866745, 0.04422115907073021, 0.001033566426485777, -0.005871172994375229, -0.028150683268904686, -0.07459072768688202, 0.021622583270072937, 0.006798835005611181, 0....
[ "Kir4.1", "Kir4.2" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 1, "section": "results", "title": "" }
Due to the incomplete overlap in the tissue-specific distribution of Kir4.1 and Kir5.1 we chose to examine Kir5.1 expression in tissues where Kir4.2 is expressed but Kir4.1 is not. Using Northern blot analysis have previously shown Kir4.2 mRNA to be abundantly expressed in the pancreas but found no evidence of Kir4.1 e...
[ 0.034700121730566025, -0.042548924684524536, 0.038331449031829834, -0.016557713970541954, -0.010080646723508835, 0.04938586428761482, 0.06341074407100677, 0.029311301186680794, 0.08772853016853333, -0.022222869098186493, -0.027553243562579155, 0.0695066824555397, -0.022121576592326164, -0....
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 2, "section": "results", "title": "" }
We and others have recently shown that heteropolymerisation of Kir5.1 with Kir4.1 produces novel channels which have an enhanced sensitivity to inhibition by intracellular acidification. However, in addition to inhibition by acidification, Kir4.1-Kir5.1 channels also exhibit activation by alkalinisation. shows currents...
[ 0.003400329500436783, -0.10512039065361023, 0.012780632823705673, -0.03930699825286865, 0.018211636692285538, 0.048319797962903976, 0.04619387164711952, -0.019090645015239716, 0.03369462117552757, 0.00008263970084954053, -0.05950385704636574, 0.07278172671794891, 0.010987545363605022, -0.0...
[ "Kir4.1", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 3, "section": "results", "title": "" }
The primary determinant of the pH sensitivity of Kir4.1 is a lysine residue (K67) in the N-terminus. In order to monitor the response of these channels to intracellular acidification we utilised a well-established potassium acetate buffering system previously used to study these channels ). Whole-cell currents were the...
[ -0.006892532110214233, -0.11966408789157867, 0.022015785798430443, -0.024528736248612404, 0.0011453067418187857, 0.048762235790491104, 0.042004022747278214, -0.014618649147450924, 0.04942852631211281, 0.0019252205966040492, -0.07360824197530746, 0.019092774018645287, 0.010090678930282593, ...
[ "Kir4.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 4, "section": "results", "title": "" }
In agreement with the findings of the Kir4.1(K67M) mutation has profound effects on the pH sensitivity of both Kir4.1 and Kir4.1-Kir5.1 channels ; Table. Interestingly, we found that either subunit is capable of acting as the pH sensor. Wild-type Kir5.1 does not possess a lysine residue at the equivalent position withi...
[ 0.0033247782848775387, -0.07329046726226807, 0.012147876434028149, -0.03311070427298546, -0.01497290376573801, 0.04317788779735565, 0.019752640277147293, 0.0029277964495122433, 0.07093781232833862, -0.0006758866365998983, -0.06202772259712219, 0.057523615658283234, 0.00021599605679512024, ...
[ "Kir4.1", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 5, "section": "results", "title": "" }
The mechanism by which Kir5.1 enhances the pH sensitivity of the heteromeric channel remains unclear.
[ 0.02541470341384411, -0.07615050673484802, 0.016953634098172188, -0.029335487633943558, -0.012689301744103432, 0.052390389144420624, 0.025372739881277084, -0.0016831045504659414, 0.05283123627305031, -0.007464987691491842, -0.047138821333646774, 0.03493521362543106, 0.0195888914167881, 0.0...
[ "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 6, "section": "results", "title": "" }
We therefore attempted to determine the contribution of Kir5.1 to the enhanced pH sensitivity of the heteromeric channel. shows the effect of individually mutating all the intracellular histidines in the Kir5.1 subunit and coexpressing them with Kir4.1 as a tandemly linked dimer. These results clearly show that none of...
[ -0.0004058614722453058, -0.10399160534143448, 0.004830743186175823, -0.02349911630153656, -0.0076250373385846615, 0.04391060769557953, 0.03885558247566223, 0.00017791346181184053, 0.046202365309000015, -0.022115886211395264, -0.061938874423503876, 0.017376963049173355, 0.010229676961898804, ...
[ "Kir4.1", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 8, "section": "results", "title": "" }
The absence of Kir4.1 expression in certain tissues, for example pancreas , where Kir5.1 is expressed, means that other subunits are likely to permit functional expression of Kir5.1. Kir4.2 shares 65 % identity to Kir4.1 and is highly expressed in the pancreas. have previously shown that Kir4.2 also forms novel heterom...
[ 0.020226815715432167, -0.08918725699186325, 0.010641956701874733, -0.04199960082769394, 0.004608641378581524, 0.055374160408973694, 0.04872818663716316, 0.014211095869541168, 0.06715831905603409, -0.019408296793699265, -0.06045113503932953, 0.05683307722210884, -0.003188869683071971, -0.02...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 9, "section": "results", "title": "" }
We therefore attempted to identify the structural elements which define the pH sensitivity of Kir4.2. This subunit also possesses a lysine residue at the equivalent position to K67 in Kir4.1 and K80 in Kir1.1. As expected mutation of this residue almost completely abolished the pH sensitivity of both homomeric Kir4.2 a...
[ 0.0011069944594055414, -0.0996437817811966, 0.016459103673696518, -0.03010234609246254, -0.013836144469678402, 0.05359062924981117, 0.01709105633199215, -0.005728603340685368, 0.06810718774795532, -0.011728399433195591, -0.05987680330872536, 0.04519864171743393, 0.001671045203693211, -0.02...
[ "Kir1.1", "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 10, "section": "results", "title": "" }
We have also investigated the principal single channel properties of both homomeric Kir4.2 and heteromeric Kir4.2-Kir5.1 channels. Using cell-attached membrane
[ 0.02516349032521248, -0.11517956107854843, -0.010302823968231678, -0.024667588993906975, -0.015421038493514061, 0.040268152952194214, 0.048583004623651505, -0.027582885697484016, 0.015012688003480434, -0.007184355054050684, -0.07487989217042923, 0.05805474519729614, 0.0059623937122523785, ...
[ "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 11, "section": "results", "title": "" }
This study demonstrates that other subunits such as Kir4.2 are likely candidates to facilitate functional expression of Kir5.1 in tissues where Kir4.1 is not expressed and suggests a role for these channels in the pH-dependent regulation of K + fluxes. As well as determining some of the basic properties of Kir4.2 and K...
[ 0.03795221820473671, -0.05203865095973015, 0.011825504712760448, -0.04311452805995941, -0.01321199256926775, 0.048441532999277115, 0.02671658806502819, 0.018722116947174072, 0.05391485244035721, -0.01831541582942009, -0.032445408403873444, 0.05470026656985283, 0.0204657930880785, -0.000200...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 13, "section": "results", "title": "" }
As several previous studies have shown, Kir5.1 and Kir4.1 do not share perfectly overlapping patterns of tissue distribution. Kir5.1 expression in the pancreas is of particular interest. Kir4.1 expression is either low or absent in this tissue, but Kir4.2 is abundantly expressed. This suggests that in cases where Kir4....
[ 0.035581074655056, -0.05906087905168533, 0.026373542845249176, -0.02183227427303791, 0.025512879714369774, 0.04735798016190529, 0.037968698889017105, 0.024898711591959, 0.0692499503493309, -0.025950990617275238, -0.040385857224464417, 0.057029541581869125, -0.037449952214956284, -0.0038502...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 14, "section": "results", "title": "" }
Initially the dramatic effect of Kir5.1 on the intrinsic pH sensitivity of Kir4.1 suggested that Kir5.1 may possess additional pH-sensing mechanisms. However, as shown in , this is unlikely to be the case. Individual mutation of each intracellular histidine in Kir5.1 had no significant effect on the pH sensitivity of t...
[ 0.004438914358615875, -0.08058074116706848, 0.014742005616426468, -0.035485535860061646, -0.006946624722331762, 0.03680041432380676, 0.024575477465987206, 0.004252285230904818, 0.06112150475382805, -0.012699711136519909, -0.07739975303411484, 0.04783772677183151, 0.003527839435264468, -0.0...
[ "Kir4.1", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 15, "section": "results", "title": "" }
In addition to modulating the gating and single channel properties of Kir4.1 channels, heteropolymerisation with Kir5.1 causes a significant shift in the pH sensitivity bringing the pK a of Kir4.1-Kir5.1 channels into the physiological range. However, Kir5.1 has relatively little influence on the intrinsic pH sensitivi...
[ 0.012031923048198223, -0.07943332940340042, 0.006539364345371723, -0.04566636309027672, -0.003172149183228612, 0.04995620995759964, 0.028668977320194244, 0.0020039756782352924, 0.06258542835712433, 0.0006530284881591797, -0.05954083427786827, 0.05920255929231644, 0.007804433349519968, -0.0...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 16, "section": "results", "title": "" }
The ability of Kir5.1 to modulate the intrinsic pH sensor of Kir4.1 (K67) implies that the inter-subunit interactions produced by heteropolymerisation of Kir5.1 with Kir4.1 can influence the intra-subunit interactions which define the anomalous titration of the N-terminal lysine pH sensor. It is likely that even small ...
[ 0.01863507740199566, -0.06575119495391846, 0.014607470482587814, -0.009663984179496765, -0.00858643651008606, 0.03917013108730316, 0.027313323691487312, 0.004835649859160185, 0.07415081560611725, 0.004198682494461536, -0.05666562169790268, 0.04677702486515045, 0.011286875233054161, 0.00153...
[ "Kir4.1", "Kir5.1" ]
{ "authors": [ "Mauro Pessia", "Paola Imbrici", "Maria Cristina", "D ' Adamo", "Lorena Salvatore", "Stephen J Tucker" ], "id": "653", "paragraph_id": 17, "section": "results", "title": "" }
The ability of individual potassium channel subunits to heteropolymerise is of fundamental importance in generating diversity of function from a limited number of gene products. The ability of Kir5.1 to have a profound effect on the pH sensitivity of Kir4.1 may be important for the role of this channel in renal tubular...
[ 0.013697708025574684, -0.04028155282139778, 0.0014762836508452892, -0.038015589118003845, 0.009021883830428123, 0.052063196897506714, 0.06997979432344437, 0.0034024000633507967, 0.03804582357406616, -0.02396327815949917, -0.0341726616024971, 0.019407376646995544, -0.0007353554246947169, -0...
[ "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 1, "section": "abstract", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
Unlike other neostriatal neurons, cholinergic interneurons exhibit spontaneous, low-frequency, repetitive firing. To gain an understanding of the K ϩ channels regulating this behavior, acutely isolated adult rat cholinergic interneurons were studied using whole-cell voltage-clamp and single-cell reverse transcription-P...
[ 0.00841822475194931, -0.02905503287911415, 0.01967988722026348, -0.012863198295235634, 0.0033366866409778595, 0.04327117279171944, -0.008383619599044323, 0.0073961298912763596, 0.048014454543590546, -0.00519007071852684, -0.020945195108652115, 0.06686091423034668, 0.013590983115136623, -0....
[ "Kv1.1", "Kv1.4", "Kv3.4", "Kv4.1", "Kv4.2", "Kv4.3" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 3, "section": "methods", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predomi...
Slow ramp-like voltage trajectories of this sort often are governed by inactivating, A-type K ϩ currents. However, since their original description, physiological studies have revealed that A-type currents exhibit a wide range of biophysical and pharmacological properties, sometimes specializing them for other cellular...
[ -0.018977444618940353, -0.06153722107410431, -0.005306108854711056, -0.03264191746711731, 0.022390510886907578, 0.0260031595826149, 0.005426818039268255, 0.0053954399190843105, 0.020519178360700607, 0.0037642763927578926, -0.0189517792314291, 0.06172884255647659, 0.0020686588250100613, -0....
[ "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 4, "section": "methods", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predomi...
Based on these previous studies, it was our working hypothesis that the capacity of cholinergic interneurons to discharge at low rates was attributable to the expression of A-type K ϩ channels with features similar to those formed from Kv4.2 subunits. To test this hypothesis, whole-cell K ϩ currents in identified choli...
[ 0.0019647092558443546, -0.05148160457611084, 0.031150775030255318, -0.012554964050650597, 0.004906192887574434, 0.052772194147109985, 0.008731411769986153, 0.0036593435797840357, 0.030807482078671455, -0.006299381610006094, -0.05446920916438103, 0.07213958352804184, 0.011275292374193668, -...
[ "Kv4.1", "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 20, "section": "methods", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
For single-label immunohistochemistry, sections were incubated with 8% bovine serum albumin (BSA) in PBS, pH 7.4, for 1 hr at room temperature, and then, with the primary antibody diluted in PBS containing 1% BSA (PBSB), were incubated overnight at 4°C. These primary antibodies included mouse monoclonal anti-rat Kv1.4 ...
[ 0.0034019870217889547, -0.09922958165407181, 0.03497692942619324, -0.01873038522899151, -0.011362147517502308, 0.043246205896139145, 0.03008238412439823, 0.009736438281834126, 0.06500615179538727, -0.017691658809781075, -0.03335127234458923, 0.046242255717515945, -0.03800914064049721, -0.0...
[ "Kv1.4", "Kv4.2", "Kv4.3" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 11, "section": "results", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
One of the hallmarks of A-type currents is their sensitivity to 4-AP. In invertebrate neurons, 4-AP blocks A currents in a voltage-and time-dependent manner. This aspect of the 4-AP block has been reported much less commonly in vertebrate neurons. When applied to cholinergic interneurons, 4-AP reduced the peak current ...
[ -0.023242518305778503, -0.06672469526529312, -0.0016052721766754985, -0.021618947386741638, -0.006138418335467577, 0.00892560463398695, 0.0034019106533378363, -0.03073553368449211, 0.038805872201919556, -0.03549540042877197, -0.019587356597185135, 0.02743270993232727, 0.010889285244047642, ...
[ "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 13, "section": "results", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
To identify the channel subunits responsible for the A-like current seen in whole-cell recordings, single-cell RT-PCR experiments were performed. Five K ϩ channel subunits are known to form homomeric channels that have A-like properties: Kv1.4, Kv3.4, Kv4.1, Kv4.2, and Kv4.3. In addition, Kv1 family channels that norma...
[ -0.0019813417457044125, -0.04982469230890274, 0.005140930879861116, -0.03298444673418999, 0.0015647787367925048, 0.039410945028066635, -0.0012320069363340735, 0.013994255103170872, 0.010996573604643345, 0.0037321511190384626, -0.024225901812314987, 0.03055180050432682, 0.0312050674110651, ...
[ "Kv1.1", "Kv1.2", "Kv1.4", "Kv1.5", "Kv3.4", "Kv4.1", "Kv4.2", "Kv4.3" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 14, "section": "results", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
These experiments revealed that several of the subunits capable of forming A-like channels were coexpressed in interneurons. A photograph of an ethidium bromide-stained gel in which PCR amplicons from an individual cell have been separated by electrophoresis is shown in A. A summary of the expression patterns of indivi...
[ 0.02030450478196144, -0.06716237217187881, 0.015473143197596073, -0.012054412625730038, 0.03191765025258064, 0.05904807150363922, 0.02494913525879383, -0.020076049491763115, -0.006780239753425121, -0.064580537378788, -0.06259749829769135, 0.05253800377249718, 0.009679362177848816, -0.02994...
[ "Kv1.1", "Kv1.2", "Kv1.4", "Kv1.5", "Kv3.4", "Kv4.1", "Kv4.2", "Kv4.3" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 16, "section": "results", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
Distinguishing between biological and technical possibilities is particularly important for the interpretation of the Kv1.4 mRNA profiles. Kv1.4 transcripts were the only detectable non-Kv4 family subunit mRNAs that could produce A-type K ϩ channels with properties similar to those observed in interneurons. It was our ...
[ 0.02020932361483574, -0.04086071252822876, -0.004079368896782398, 0.004117210861295462, 0.001410595839843154, 0.05815065652132034, -0.013150190934538841, 0.019675856456160545, 0.004238815046846867, -0.002182058757171035, -0.01735725626349449, 0.08186908066272736, 0.005655280314385891, 0.00...
[ "Kv1.4" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 17, "section": "results", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
Serial dilution profiles for Kv4.2 and Kv1.4 mRNAs in two interneurons are shown in. A summary of these experiments is shown in D. It is evident that the threshold densities for both Kv4.2 and Kv1.4 mRNAs were unimodal, suggesting that the interneuron population was homogeneous with regard to these two mRNAs.
[ -0.00027695202152244747, -0.0665421411395073, 0.011279304511845112, -0.00620859581977129, -0.006056568585336208, 0.029772473499178886, 0.04226246103644371, 0.0008517302921973169, 0.020391060039401054, -0.03692855313420296, -0.019887620583176613, 0.03325733542442322, -0.0020895989146083593, ...
[ "Kv1.4", "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 19, "section": "results", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
Despite the fact that their mRNA was present, Kv1.1 and ␤1 subunit-containing channels are unlikely to have made a significant contribution to somatodendritic currents, because their 4-AP affinity is considerably higher than the channels responsible for the observed currents. Moreover, their inactivation rates are much...
[ -0.014509827829897404, -0.09338235855102539, 0.007031918503344059, -0.00889948382973671, 0.0063056605868041515, 0.03690916672348976, 0.0007155495113693178, -0.030467072501778603, 0.03801035135984421, -0.03130524605512619, -0.06268399953842163, 0.06311660259962082, -0.01807740516960621, -0....
[ "Kv1.1", "Kv1.2", "Kv1.4", "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 20, "section": "results", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
To ensure that a slow component of recovery was not missed, an additional experiment was performed. First, the A-type current was inactivated by holding at Ϫ60 mV. Then, the cell was stepped to Ϫ95 mV for either 1.5 or 25 sec before the delivery of a test step to Ϫ20 mV. As shown in , C and D, the currents evoked by th...
[ -0.035522960126399994, -0.08121753484010696, 0.0005554967792704701, -0.011768324300646782, 0.006379945669323206, 0.012641050852835178, -0.007494306657463312, -0.009161257185041904, 0.020737653598189354, -0.005816069897264242, 0.018267370760440826, 0.013065427541732788, 0.026786839589476585, ...
[ "Kv1.4", "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 21, "section": "results", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Predom...
Although these results strongly implicate Kv4.2-and Kv4.1containing channels, they depend on the assumption that the properties of heterologously expressed channels are similar to those in native expression systems. To provide an additional test of our hypothesis, immunocytochemical studies were performed using a monoc...
[ 0.01657738722860813, -0.06438276916742325, 0.016285281628370285, -0.009365104138851166, 0.00605388730764389, 0.06923604011535645, 0.003532957285642624, 0.0030913918744772673, 0.006726877763867378, -0.019078047946095467, -0.07840650528669357, 0.07641935348510742, -0.015136892907321453, 0.00...
[ "Kv1.4", "Kv4.2", "Kv4.3" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 3, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pred...
The properties of the A current are consistent with channels composed of Kv4.2 and Kv4.1 subunits Insights into the molecular architecture of the A-type channels in cholinergic interneurons is of clear value to understanding how these channels contribute to interneuron physiology and signaling. Molecular cloning and he...
[ -0.007027436047792435, -0.049908678978681564, 0.0007028395193628967, -0.016528233885765076, 0.005570998415350914, 0.0543389730155468, 0.007605090271681547, 0.0027396671939641237, 0.02273968793451786, -0.026468556374311447, -0.012923046946525574, 0.07635832577943802, 0.013367487117648125, -...
[ "Kv1.1", "Kv1.2", "Kv1.5", "Kv4.1", "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 4, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pred...
Our studies suggested that Kv1.5, Kv3.4, or Kv4.3 subunits are not expressed at significant levels in cholinergic interneurons, despite their ready detection in other cell types and in wholebrain cDNA (data not shown). However, these experiments did reveal the presence of With the exception of Kv4.2 mRNA, not all of th...
[ 0.03983653336763382, -0.009615357033908367, 0.021833356469869614, 0.0015026694163680077, -0.0018827988533303142, 0.06791753321886063, -0.005195537582039833, 0.02537923865020275, 0.03293398767709732, -0.004036866594105959, -0.028244728222489357, 0.07663067430257797, -0.01849689707159996, -0...
[ "Kv1.1", "Kv1.2", "Kv1.4", "Kv1.5", "Kv3.4", "Kv4.1", "Kv4.2", "Kv4.3" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 5, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pred...
If we assume that all these subunit mRNAs are present in interneurons, do they all contribute to channels underlying the somatodendritic currents? Several observations strongly argue against this scenario. Because subunits from Kv1 and Kv4 gene families do not coassemble to form heteromeric channels , it is necessary o...
[ -0.01693262904882431, -0.07513695955276489, 0.01983158476650715, -0.008630108088254929, -0.010857044719159603, 0.05381523072719574, 0.019089505076408386, -0.014444325119256973, 0.017754394561052322, -0.02793409861624241, -0.06459066271781921, 0.056684043258428574, -0.015436826273798943, -0...
[ "Kv1.1", "Kv1.2", "Kv1.4" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 6, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pred...
If channels composed of Kv1 family subunits do not underlie the A current, then do channels containing Kv4.2 and Kv4.1 subunits? The pharmacological properties of the Kv4.2 and Kv4.1 channels are very similar to interneuronal A-type channels. In heterologous expression systems, Kv4.2 and Kv4.1 channels are potently blo...
[ -0.014066694304347038, -0.07609286159276962, 0.0006330570322461426, -0.026342421770095825, 0.010498527437448502, 0.04402934014797211, -0.007062118500471115, -0.035569995641708374, 0.005162251181900501, -0.031555891036987305, -0.03721851855516434, 0.05863527953624725, -0.008844247087836266, ...
[ "Kv4.1", "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 7, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pred...
The inference that Kv4.2 subunits are major constituents of K ϩ channels in the proximal somatodendritic membrane of cholinergic interneurons and that Kv1.4 subunits are not is in agreement with immunocytochemical studies of the subcellular localization of these subunits shown here and in studies in other cell types. L...
[ 0.013294335454702377, -0.055940210819244385, 0.04447874799370766, 0.007004403509199619, 0.00961619708687067, 0.06890790909528732, -0.012926881201565266, -0.00680933240801096, -0.005974298808723688, -0.0435367189347744, -0.093279629945755, 0.10253754258155823, -0.007233618758618832, -0.0657...
[ "Kv1.4", "Kv4.1", "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 8, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pred...
One of the first cellular functions attributed to A-type currents was the slowing of interspike depolarization. This slowing enabled neurons to discharge at very slow rates, a capacity that was absent in early Hodgkin-Huxley models based on axonal currents. To accomplish this goal, the A-type conductance needs to open ...
[ -0.0352882482111454, -0.06762086600065231, -0.00876713264733553, -0.02454269491136074, 0.012102849781513214, 0.01418354269117117, -0.01041078008711338, -0.033662740141153336, 0.024906011298298836, -0.012959113344550133, -0.009435731917619705, 0.04519715905189514, -0.0033105688635259867, -0...
[ "Kv4.1", "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 11, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pre...
J. Neurosci., May 1, 1998, 18(9):3124-3137 Song et al. • Kv4.2 Channels in Cholinergic Interneurons
[ 0.029795164242386818, -0.027073876932263374, 0.03086194023489952, 0.0029892143793404102, -0.005741329863667488, 0.04711437597870827, -0.007321770302951336, 0.01634332165122032, 0.03304019570350647, 0.01349849533289671, -0.015418296679854393, 0.05438360571861267, -0.034725774079561234, 0.00...
[ "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 12, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pre...
J. Neurosci., May 1, 1998, 18(9):3124-3137 Song et al. • Kv4.2 Channels in Cholinergic Interneurons
[ 0.029795164242386818, -0.027073876932263374, 0.03086194023489952, 0.0029892143793404102, -0.005741329863667488, 0.04711437597870827, -0.007321770302951336, 0.01634332165122032, 0.03304019570350647, 0.01349849533289671, -0.015418296679854393, 0.05438360571861267, -0.034725774079561234, 0.00...
[ "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 13, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pre...
J. Neurosci., May 1, 1998, 18(9):3124-3137 Song et al. • Kv4.2 Channels in Cholinergic Interneurons
[ 0.029795164242386818, -0.027073876932263374, 0.03086194023489952, 0.0029892143793404102, -0.005741329863667488, 0.04711437597870827, -0.007321770302951336, 0.01634332165122032, 0.03304019570350647, 0.01349849533289671, -0.015418296679854393, 0.05438360571861267, -0.034725774079561234, 0.00...
[ "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 15, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pre...
J. Neurosci., May 1, 1998, 18(9):3124-3137 Song et al. • Kv4.2 Channels in Cholinergic Interneurons
[ 0.029795164242386818, -0.027073876932263374, 0.03086194023489952, 0.0029892143793404102, -0.005741329863667488, 0.04711437597870827, -0.007321770302951336, 0.01634332165122032, 0.03304019570350647, 0.01349849533289671, -0.015418296679854393, 0.05438360571861267, -0.034725774079561234, 0.00...
[ "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 16, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pre...
J. Neurosci., May 1, 1998, 18(9):3124-3137 Song et al. • Kv4.2 Channels in Cholinergic Interneurons
[ 0.029795164242386818, -0.027073876932263374, 0.03086194023489952, 0.0029892143793404102, -0.005741329863667488, 0.04711437597870827, -0.007321770302951336, 0.01634332165122032, 0.03304019570350647, 0.01349849533289671, -0.015418296679854393, 0.05438360571861267, -0.034725774079561234, 0.00...
[ "Kv4.2" ]
{ "authors": [ "W.-J Song", "T Tkatch", "G Baranauskas", "N Ichinohe", "S T Kitai", "D J Surmeier" ], "id": "37", "paragraph_id": 17, "section": "discussion", "title": "Somatodendritic Depolarization-Activated Potassium Currents in Rat Neostriatal Cholinergic Interneurons Are Pre...
J. Neurosci., May 1, 1998, 18(9):3124-3137 Song et al. • Kv4.2 Channels in Cholinergic Interneurons
[ 0.029795164242386818, -0.027073876932263374, 0.03086194023489952, 0.0029892143793404102, -0.005741329863667488, 0.04711437597870827, -0.007321770302951336, 0.01634332165122032, 0.03304019570350647, 0.01349849533289671, -0.015418296679854393, 0.05438360571861267, -0.034725774079561234, 0.00...
[ "Kv4.2" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 1, "section": "abstract", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
Action potential conduction velocity increases dramatically during early development as axons become myelinated. Integral to this process is the clustering of voltage-gated Na + (Nav) channels at regularly spaced gaps in the myelin sheath called nodes of Ranvier. We show here that some aspects of peripheral node of Ran...
[ -0.06414862722158432, -0.01455974392592907, -0.002774375258013606, 0.02781696617603302, 0.026767967268824577, 0.03520630672574043, 0.008230936713516712, -0.052766382694244385, -0.005068132653832436, 0.010090800933539867, 0.006302443332970142, 0.0010927406838163733, 0.014771323651075363, -0...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 3, "section": "introduction", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
The notion that myelinating glia actively regulate neuronal properties is supported further by experiments examining the subtypes of Nav channels found in myelinated and demyelinated axons. For example, show that during early development, Nav1.2 channels are detected at newly forming nodes of Ranvier in both the PNS an...
[ -0.024435529485344887, -0.01117617730051279, 0.0016875533619895577, 0.020199479535222054, -0.003524771425873041, 0.054458849132061005, 0.02087780088186264, -0.05104389786720276, 0.003915173467248678, -0.030651597306132317, -0.013614101335406303, 0.013964998535811901, -0.005862350109964609, ...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 5, "section": "introduction", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
In the present study, to determine if ion channel subtype localization is regulated in the PNS in a manner similar to that seen in the CNS, we have examined the localization of Nav1.2 and Nav1.6 channels in the PNS during myelination and remyelination. Additionally, we have determined the localization of glial and neur...
[ -0.04305948317050934, -0.021169818937778473, 0.009056046605110168, 0.028802232816815376, 0.0007350938976742327, 0.04470432549715042, 0.022481117397546768, -0.037684254348278046, -0.005643622484058142, -0.001337689347565174, -0.04898878186941147, 0.025477658957242966, 0.03407388925552368, -...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 2, "section": "methods", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
The monoclonal anti-pan Nav channel (K58/35), anti-Nav1.2 (K69/3) and anti-pan neurofascin (L11A/41.6) antibodies have been described previously. The polyclonal anti-Nav1.2, anti-Nav1.6 and anti-caspr antibodies have been described previously and were kindly provided by Dr. James Trimmer. The polyclonal anti-neurofasci...
[ 0.012897243723273277, -0.054805610328912735, 0.04227029159665108, 0.028448820114135742, 0.01740708388388157, 0.053047921508550644, 0.015590278431773186, -0.01692878268659115, 0.022526804357767105, -0.004296748898923397, -0.060151420533657074, 0.046598028391599655, 0.022003596648573875, 0.0...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 5, "section": "methods", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
Nodal or node-associated clusters were counted from 10 fields of view (>P1) or entire nerves (<P1). These raw data were then summed. For comparing Nav channel subtypes to total pan-Nav positive clusters, sum totals of clusters positive for either Nav1.6 or Nav1.2 were calculated as a percentage of total clusters positi...
[ -0.02626287378370762, -0.042911797761917114, 0.02682550624012947, 0.010626384057104588, -0.01661507971584797, 0.03549167513847351, 0.02355406992137432, -0.001324291923083365, 0.022775692865252495, 0.001577171846292913, -0.06721976399421692, 0.05776827037334442, 0.0047590299509465694, -0.01...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 1, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
In the developing CNS, Nav1.2 is initially expressed at all newly forming nodes of Ranvier. Upon maturation, nodal Nav1.2 is downregulated and replaced by Nav1.6. also detected Nav1.2 during PNS-node formation, which suggested that switching of Nav-channel subtypes is a general phenomenon in both the CNS and PNS. Howev...
[ -0.04069964960217476, -0.031454917043447495, 0.016141077503561974, 0.007838915102183819, -0.02548835799098015, 0.034943051636219025, 0.016152942553162575, -0.028951609507203102, 0.0044565885327756405, -0.0001925668038893491, -0.017247235402464867, 0.040307577699422836, -0.003074824344366789,...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 2, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
The results described above indicate that a substantial fraction of newly forming nodes contained both Nav1.2 and Nav1.6. To examine this directly, we double-labeled nodes using polyclonal antibodies specific for Nav1.6 and a mouse monoclonal antibody specific for Nav1.2. At each age, nodes were characterized as immuno...
[ -0.04366561397910118, -0.05734655261039734, 0.022800395265221596, 0.007159476634114981, -0.030093559995293617, 0.020946800708770752, 0.007430344354361296, -0.02554337866604328, 0.048150572925806046, 0.03253483772277832, 0.0012777503579854965, 0.060411885380744934, -0.008720001205801964, -0...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 3, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
To confirm that early clusters of Nav1.2 and Nav1.6 channels are destined to become nodes of Ranvier, we immunostained developing nerve with antibodies against caspr, a component of the paranodal axoglial junction. Early clusters of Nav1.2 and Nav1.6 form adjacent to casprlabeled paranodes. For example, we observed Nav...
[ -0.05171108618378639, -0.022801296785473824, -0.002923112828284502, 0.02001744695007801, 0.0023849341087043285, 0.04664166644215584, 0.026794221252202988, -0.035061679780483246, -0.0249027032405138, -0.026486927643418312, -0.028188638389110565, 0.02860104851424694, 0.012168535962700844, -0...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 4, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
Recent experiments have shown that CNS demyelination results in the loss of Nav1.6 channel clusters and a dramatic upregulation of Nav1.2 in axons. These data indicate that oligodendrocytes actively regulate the complement and localization of Nav channels expressed in CNS axons. Consistent with this idea, reported, usi...
[ -0.04248004034161568, 0.018007516860961914, 0.002373966621235013, 0.02354358322918415, 0.006136263255029917, 0.05840674042701721, 0.02154598757624626, -0.04204537719488144, -0.017108410596847534, -0.015236479230225086, -0.008747214451432228, 0.020852962508797646, 0.00714818574488163, -0.03...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 5, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
To compare node formation during remyelination in the PNS to events during PNS developmental myelination, we used an intraneural injection of lysolecithin to induce an acute, focal demyelinated lesion in the sciatic nerve. In this model, PNS myelin in the area of injection is lost within 1 week. Thereafter, Schwann cel...
[ -0.04078768566250801, -0.014369969256222248, 0.03543483093380928, 0.026737483218312263, -0.001040519098751247, 0.03764861077070236, 0.011463462375104427, -0.010471460409462452, -0.0054268063977360725, -0.0024516042321920395, -0.011623996309936047, 0.0424480214715004, 0.01289565209299326, -...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 6, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
Neurofascin is reported to be the first protein to accumulate at newly forming nodes of Ranvier, and to provide the nucleation site for attachment of ankyrinG, Nav channels and other nodal proteins. The recent identification of the Schwann cell microvilli protein gliomedin as the likely glial binding partner of axonal ...
[ -0.035322155803442, -0.045628469437360764, 0.018686270341277122, -0.003942454233765602, 0.022943370044231415, 0.04802858084440231, 0.040012821555137634, -0.05699974298477173, 0.023565849289298058, 0.02290838211774826, -0.03124977834522724, 0.026950476691126823, 0.019656386226415634, 0.0066...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 9, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
• In contrast to the CNS, Nav1.6 is localized to all newly forming nodes of Ranvier in the PNS.
[ -0.00983903557062149, -0.06493575870990753, 0.012236576527357101, -0.01246569212526083, -0.02939729019999504, 0.025758346542716026, -0.003622005693614483, -0.012031016871333122, 0.006206747144460678, 0.0018360756803303957, 0.0012497163843363523, 0.014889372512698174, 0.048731040209531784, ...
[ "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 10, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
• Similar to the CNS, Nav1.2 is initially localized to forming nodes but is lost subsequently.
[ -0.02301269955933094, -0.06908541172742844, -0.008301963098347187, -0.023149287328124046, -0.023135380819439888, 0.02723747119307518, -0.02211221493780613, -0.03290877491235733, 0.016076574102044106, 0.04154158756136894, 0.023603610694408417, 0.00043054562411271036, 0.03879990428686142, -0...
[ "Nav1.2" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 11, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
• In the lysolecithin model of PNS demyelination/ remyelination Nav1.6, but not Nav1.2, is detected at newly forming nodes of Ranvier.
[ -0.06456861644983292, -0.07419214397668839, 0.020416824147105217, 0.021356424316763878, -0.0184763353317976, 0.025349991396069527, -0.0007088763522915542, -0.011176920495927334, 0.03346404805779457, -0.012941578403115273, 0.027679119259119034, -0.015475469641387463, 0.004523075185716152, -...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 14, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
In the present study we describe early events in node of Ranvier formation including the temporal localization of the Nav channels Nav1.2 and Nav1.6 to PNS nodes of Ranvier, and of two splice variants of neurofascin; NF-155 to paranodes and NF-186 to nodes. The analysis of the localization of Nav channels and their dif...
[ -0.036302704364061356, -0.0033773109316825867, 0.015480419620871544, 0.023556163534522057, 0.011444677598774433, 0.03660164028406143, 0.015757758170366287, -0.02739124186336994, 0.013709546998143196, -0.003674033796414733, -0.005665704607963562, 0.05109965056180954, 0.036295853555202484, -...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 15, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
The first analyses of the clustering of Nav channels at PNS nodes of Ranvier during development and remyelination were performed by and , respectively. In each study, Nav channels were found to accumulate at the tips of (re)myelinating Schwann cells. Importantly, when myelination was blocked, Nav channels failed to clu...
[ -0.038662102073431015, -0.07383794337511063, 0.0032978984527289867, 0.015562466345727444, -0.0008114993688650429, 0.04782490059733391, 0.0405137799680233, -0.04760638251900673, -0.0044207642786204815, -0.003191502997651696, -0.03745177388191223, 0.004905045963823795, 0.005601783283054829, ...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 16, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
Analysis of the localization of Nav1.2 and Nav1.6 subunits in the CNS has shown that Nav1.2 occurs mainly on unmyelinated axons and Nav1.6 is located at nodes of Ranvier and axon initial segments. Thus, a simple model might be that myelination regulates the kind of Nav channels that are expressed by axons. Consistent w...
[ -0.007026332896202803, -0.015210673213005066, 0.0010737843113020062, 0.0257993396371603, -0.020580703392624855, 0.040124256163835526, 0.022366078570485115, -0.05395160987973213, 0.010520095936954021, -0.01361533161252737, -0.010892347432672977, 0.046202998608350754, 0.01344845537096262, -0...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 17, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
With respect to demyelination and remyelination, experiments in several different mutant mouse lines have also revealed the importance of CNS myelination in regulating Nav channel expression and localization. For example, Shiverer mice have a mutation in the gene that encodes myelin basic protein that results in a seve...
[ -0.03176434338092804, -0.003554961644113064, 0.01046910509467125, 0.017583176493644714, -0.00554497167468071, 0.06706833094358444, 0.002038706326857209, -0.012392707169055939, 0.007780294865369797, -0.003900039242580533, 0.0030247350223362446, 0.04281449690461159, -0.00033004741999320686, ...
[ "Nav1.2", "Nav1.6" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 18, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
In contrast to the results described above, mice with peripheral dysmyelinating or demyelinating phenotypes (e.g. Trembler-J and P0-null) retain nodal Nav1.6 localization, fail to upregulate Nav1.2 at nodes, but do show an increase in Nav1.8 localization to the node. One potential complication when interpreting these s...
[ -0.039593763649463654, 0.024152062833309174, 0.01604423299431801, 0.02514779195189476, -0.00857517309486866, 0.03123738244175911, 0.02836630865931511, -0.038382451981306076, -0.012827910482883453, -0.014360037632286549, -0.005074569955468178, 0.02716950513422489, 0.012330622412264347, -0.0...
[ "Nav1.2", "Nav1.3", "Nav1.6", "Nav1.8" ]
{ "authors": [ "Dorothy P Schafer", "Andrew W Custer", "Peter Shrager", "Matthew N Rasband" ], "id": "840", "paragraph_id": 19, "section": "results", "title": "Early events in node of Ranvier formation during myelination and remyelination in the PNS" }
In support of the idea that paranodes are important for regulation of Nav channels, showed that caspr-null mice have many CNS nodes that retain Nav1.2 channels. However, in other paranodal mutants Nav1.2 was not detected at PNS nodes of Ranvier. Thus, the function of paranodes in the PNS might not extend to regulation ...
[ -0.016558606177568436, -0.009952557273209095, 0.00034559969208203256, -0.015435789711773396, -0.005514968652278185, 0.061102814972400665, -0.00023421569494530559, -0.020693156868219376, -0.057743579149246216, -0.04045944660902023, -0.039767198264598846, 0.06458618491888046, 0.020576646551489...
[ "Nav1.2" ]
{ "authors": [], "id": "1232", "paragraph_id": 1, "section": "abstract", "title": "" }
Heteromeric channel assembly is a potential source of physiological variability. The potential significance of Kir2 subunit heterotetramerization has been controversial, but recent findings suggest that heteromultimerization of Kir2.1-3 may be significant. This study was designed to investigate whether the recently des...
[ 0.0062533472664654255, -0.07842600345611572, 0.012005876749753952, -0.017310000956058502, 0.003404422430321574, 0.07533792406320572, 0.07174170017242432, -0.004352937452495098, 0.007081671617925167, 0.00044733990216627717, -0.08931665122509003, 0.019330115988850594, 0.010526537895202637, -...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 2, "section": "abstract", "title": "" }
Kir2.1 or Kir2.4 subunits in Xenopus oocytes with either wild-type Kir2.1 or 2.4 strongly decreased resulting current amplitude. To examine physical association between Kir2.1 and Kir2.4, Cos-7 cells were co-transfected with a His 6 -tagged Kir2.1 subunit (Kir2.1-His 6 ) and a FLAG-tagged Kir2.4 subunit (Kir2.4-FLAG). ...
[ -0.0181712806224823, -0.10709283500909805, 0.019944366067647934, -0.03650324419140816, -0.004634476732462645, 0.05838777497410774, 0.026335854083299637, -0.02749047428369522, 0.03483523055911064, -0.01152860652655363, -0.08798014372587204, 0.04850498214364052, 0.03011195734143257, -0.03929...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 1, "section": "methods", "title": "" }
Inward rectifier potassium channels play a key role in setting the membrane potential and regulating excitability in various tissues including the central nervous system and the heart. Despite their obvious importance, little is known about the molecular basis of native inward rectifier currents. Subunits of the Kir2 f...
[ 0.012874146923422813, -0.07082872837781906, 0.01055200770497322, -0.024231791496276855, 0.005544118583202362, 0.04875420033931732, -0.033715859055519104, 0.012907185591757298, -0.0019036473240703344, -0.004701727069914341, -0.05275441333651543, 0.0763477310538292, 0.044367410242557526, -0....
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 2, "section": "methods", "title": "" }
Biochemical and electrophysiological experiments on cardiac myocytes support the theory of the diversity of inward rectifier K + channels contributing to cardiac I K1. During myocardial development, different I K1 channels with distinct unitary conductances and properties are present. Kir2.1 transcripts are about 10 ti...
[ -0.0010172297479584813, -0.10716299712657928, 0.007609352935105562, -0.020173287019133568, 0.01476878672838211, 0.06100107356905937, 0.011742895469069481, -0.024496717378497124, -0.01904008537530899, -0.004285803064703941, -0.05831190571188927, 0.04056502506136894, 0.04878932237625122, -0....
[ "Kir2.1", "Kir2.2", "Kir2.3", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 3, "section": "methods", "title": "" }
Co-localization between the important subunit Kir2.1 and the recently cloned Kir2.4 occurs in various tissues. The goals of our study were (1) to determine whether Kir2.4 can co-associate with Kir2.1, (2) to assess whether channels formed by co-assembled Kir2.1 and 2.4 subunits are functional and (3) to compare Ba 2+ -...
[ 0.012851359322667122, -0.09449564665555954, 0.00013878544268663973, -0.02713688835501671, -0.02764143981039524, 0.06427911669015884, 0.04566825181245804, -0.033763814717531204, 0.028768789023160934, -0.019574763253331184, -0.07615768164396286, 0.040372028946876526, 0.014802543446421623, -0...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 4, "section": "methods", "title": "" }
A PCR-based approach was used to engineer Kir2.4 subunits with the GYG motif important for ion selectivity and permeability replaced by three alanine residues (AAA). A 5‚ and a 3‚ fragment were generated and combined by overlap extension. Primers used to synthesize the 5‚ fragment were: ACAGAATTCAGCATGGGCTTGGCCAGGGCCCT...
[ 0.055754102766513824, -0.07431059330701828, 0.010846292600035667, -0.010720535181462765, -0.026843812316656113, 0.04857403412461281, 0.010398616082966328, 0.0015114503912627697, 0.0729401633143425, -0.0022129290737211704, -0.025576571002602577, 0.04985891282558441, 0.013639146462082863, 0....
[ "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 7, "section": "methods", "title": "" }
The sequence and the presence of the mutation were verified by sequencing. Dn-Kir2.1 was a generous gift from Dr Andrew Tinker, Centre for Clinical Pharmacology, Rayne Institute, London.
[ 0.04317617788910866, -0.03396863862872124, 0.0002126275940099731, -0.015257126651704311, -0.012171132490038872, 0.05532102659344673, 0.0036567621864378452, -0.013574449345469475, 0.04131655767560005, 0.037744078785181046, 0.03880670666694641, 0.06032237783074379, 0.021600592881441116, 0.01...
[ "Kir2.1" ]
{ "authors": [], "id": "1232", "paragraph_id": 8, "section": "methods", "title": "" }
To evaluate potential physical association between Kir2.4 and Kir2.1 a His-pulldown approach was used. A six-histidine tag was engineered to the N-terminus of Kir2.1 as previously described , allowing high affinity specific purification by a His 6 -binding resin. Kir2.1-His 6 was generously provided by Dr A. ACAGGCGCT*...
[ 0.051553916186094284, -0.05114942416548729, 0.013343758881092072, 0.007760243955999613, -0.0529993399977684, 0.017349950969219208, 0.027352070435881615, 0.017845749855041504, 0.08738214522600174, 0.011272811330854893, -0.02356046438217163, 0.048167284578084946, 0.014557664282619953, -0.000...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 9, "section": "methods", "title": "" }
Cos-7 cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM) supplemented with 10 % heat-inactivated fetal bovine serum (FBS) and 100 units ml _1 sodium penicillin-G-100 mg ml _1 streptomycin sulfate. Cells (2 w 10 5 ) were plated into 35 mm culture dishes with DMEM for 24 h (37 °C, 5 % CO 2 ) to reach ~70 % ...
[ 0.010940933600068092, -0.06475826352834702, 0.016108568757772446, -0.05212479829788208, -0.0343349315226078, 0.049611352384090424, 0.06532133370637894, -0.004394247196614742, 0.02316724881529808, 0.003115468192845583, -0.06487273424863815, -0.0008020740933716297, 0.043494075536727905, 0.03...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 11, "section": "methods", "title": "" }
The solubilized membrane proteins were fractionated on 8 % SDS-polyacrylamide gels. The proteins were electrophoretically transferred to Immobilon-P polyvinylidene fluoride membranes (Millipore Ltd) in 25 mM Tris-base, 192 mM glycine and 5 % methanol at 0.07 A for 16 h. The membranes were blocked using 5 % non-fat dry ...
[ 0.019615545868873596, -0.09798436611890793, 0.046494010835886, 0.007017057854682207, 0.0025752708315849304, 0.01134331151843071, 0.05446033924818039, -0.004611709620803595, 0.09664204716682434, -0.00695379450917244, -0.04323809966444969, 0.02050860971212387, -0.021088525652885437, 0.016382...
[ "Kir2.1" ]
{ "authors": [], "id": "1232", "paragraph_id": 12, "section": "methods", "title": "" }
A BamHI and a SacII restriction enzyme site were introduced at the N-terminus and after 10 amino acids of the 5‚-untranslated region of Kir2.4 by PCR. A XhoI restriction enzyme site was introduced at the C-terminus. A stop codon in the 5‚-untranslated region was mutated to glycine by site-directed mutagenesis. The PCR ...
[ 0.036469463258981705, -0.061493273824453354, 0.04037163034081459, 0.0011146297911182046, 0.015175025910139084, 0.025200579315423965, 0.005037838127464056, -0.008456469513475895, 0.03892715275287628, -0.033230219036340714, -0.047477904707193375, 0.018020110204815865, 0.030591439455747604, 0...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 13, "section": "methods", "title": "" }
The stop codon of Kir2.1 was mutated by site-directed mutagenesis to GGA (glycine;). The PCR product and the previously obtained Kir2.4-pcDNA3.1+ construct were digested with BamHI. The Kir2.1 sequence was then introduced upstream of the Kir2.4 sequence into pcDNA3.1+. The correct orientation of Kir2.1 was verified by ...
[ 0.0359528549015522, -0.06015418842434883, 0.04065793752670288, -0.006845420226454735, 0.007775831967592239, 0.05739802122116089, -0.0036377115175127983, -0.018855471163988113, 0.05360113084316254, -0.0683145523071289, -0.049382615834474564, 0.055597543716430664, 0.03428638353943825, -0.004...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 14, "section": "methods", "title": "" }
The primers for tandem construction were: GGATCCAGCATGGGCAGTGTGMGAAC (Kir2.1, sense), GGATCCCCGCGGTCCTATCTCCGAYTCTCGCCG (Kir2.1, antisense), GGATCCCCGCGGGGACAAATCGGGAAGGGGTCTCC (Kir2.4, sense), and: CTCGAGTCATGGAGGCAGGGTCAGTGC (Kir2.4, antisense).
[ 0.03437930345535278, 0.01253535971045494, -0.0009840894490480423, -0.03359388932585716, -0.05064060166478157, 0.008913158439099789, 0.11263728886842728, -0.021934662014245987, -0.055130209773778915, -0.002757434034720063, -0.007605003658682108, -0.04875022545456886, 0.042599279433488846, 0...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 15, "section": "methods", "title": "" }
For heterologous expression in Xenopus oocytes the Kir2.1-2.4 tandem was subcloned into the polyadenylation transcription vector pSGEM. The BamHI site between Kir2.1 and Kir2.4 was removed by restriction enzyme digestion with SacII. After purification on a 1 % agarose gel with the QIAquick Gel Extraction Kit (Qiagen In...
[ 0.01583671383559704, -0.08191419392824173, -0.006852907594293356, -0.017021700739860535, 0.008368178270757198, 0.04481910914182663, 0.0671430230140686, -0.003482628846541047, 0.016220923513174057, 0.027355404570698738, -0.04697825387120247, 0.009997663088142872, 0.043999552726745605, 0.003...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 16, "section": "methods", "title": "" }
We then investigated the properties of channels formed by spontaneous Kir2.1 and Kir2.4 co-assembly. To ensure comparable expression of Kir2.1 and 2.4, a sequence based on the tandem construct but containing a stop codon in place of glycine at the distal end of Kir2.1 was used.
[ -0.005894796457141638, -0.08425282686948776, 0.030871763825416565, -0.007990102283656597, -0.02487041987478733, 0.06740522384643555, 0.018227392807602882, -0.050657931715250015, -0.009442811831831932, -0.0491219088435173, -0.060933683067560196, 0.03035554848611355, 0.002937518758699298, 0....
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 17, "section": "methods", "title": "" }
The primers were: GGATCCAGCATGGGCAGTGTGMGAAC (Kir2.1 sense), CCGCGGTCCTATCTCCGAYTCTCGCCG (Kir2.1 antisense), GGATCCCCGCGGGGACAAATCTAGAAGGGGTCTCC (Kir2.4 sense), and: CTCGAGTCATGGAGGCAGGGTCAGTGC (Kir2.4 antisense).
[ 0.06138577312231064, -0.02258106879889965, 0.0019968338310718536, -0.006660414393991232, -0.04172515496611595, 0.038095805794000626, 0.03525380417704582, 0.011099960654973984, -0.018969200551509857, 0.031429722905159, 0.006006021052598953, 0.018528122454881668, 0.030436135828495026, 0.1076...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 19, "section": "methods", "title": "" }
The constructs transfected and antibody probes used are indicated at the bottom. + indicates construct transfected, _ indicates construct not present. Primary antibodies are designated by F for anti-FLAG, 2.1 for anti-Kir2.1 and H for anti-His. Arrows on the left indicate molecular masses of specific bands detected by ...
[ 0.01687961257994175, -0.15377426147460938, 0.0528799369931221, -0.02617691643536091, -0.06880827248096466, 0.03426503762602806, 0.0867253914475441, -0.027013588696718216, 0.06319307535886765, 0.03976818174123764, -0.019841641187667847, 0.023721886798739433, 0.0006454992108047009, 0.0222706...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 20, "section": "methods", "title": "" }
) by guest on May 15, 2013 jp.physoc.org Downloaded from J Physiol ( differences in the post-translational modification of Kir2.1 in HEK versus Cos-7 cells. Incubation and probing with the anti-FLAG antibody of the cell lysate of co-transfected cells after His-pulldown (lane 4) detected a band with a molecular mass of ...
[ 0.06171637773513794, -0.12989187240600586, 0.026071177795529366, -0.045900311321020126, -0.038308508694171906, 0.03464191034436226, 0.033214934170246124, 0.007893410511314869, 0.05539792403578758, 0.03725592792034149, -0.020901411771774292, 0.04918976128101349, -0.004248954355716705, 0.025...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 21, "section": "methods", "title": "" }
Lane 6 was obtained with His-pulldown of lysate from cells transfected with Kir2.4-FLAG alone, followed by probing with FLAG antibody. The lack of a signal indicates that association with His-tagged Kir2.1 is essential for FLAGtagged Kir2.4 to be detected in the sample obtained by Hispulldown. Furthermore, the results ...
[ 0.03591371700167656, -0.11484064161777496, 0.04467078298330307, -0.03426593542098999, -0.02981507033109665, 0.03144505247473717, 0.07376622408628464, 0.005809096619486809, 0.079551100730896, 0.0434860959649086, -0.036495059728622437, 0.04716198891401291, -0.027310112491250038, 0.0145508870...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 22, "section": "methods", "title": "" }
The experiments shown in Figs 1-3 strongly suggest coassembly of Kir2.1 and 2.4, but provide no information about the ability of heteromeric channels to carry current. We therefore addressed the issue of whether co-assembled channels can conduct current by studying the results of expression of a covalently linked Kir2....
[ -0.027158614248037338, -0.12444918602705002, 0.01422870997339487, -0.03424632549285889, -0.021901361644268036, 0.06179570034146309, 0.04562325030565262, -0.06372793763875961, 0.0040342235006392, -0.02757231704890728, -0.08292833715677261, 0.0029104154091328382, 0.022623812779784203, 0.0021...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 23, "section": "methods", "title": "" }
We have previously shown that the concentration and voltage dependence of Ba 2+ blockade is a signature ) by guest on May 15, 2013 jp.physoc.org Downloaded from J Physiol ( property of various Kir2.x clones and native I K1 channels. We therefore determined the voltagedependent Ba 2+ -blocking properties of Kir2.1 and K...
[ -0.020373785868287086, -0.13321784138679504, 0.0006748858722858131, -0.04053843021392822, -0.016651276499032974, 0.050266243517398834, 0.05482909083366394, -0.037456169724464417, 0.051472295075654984, -0.009110610000789165, -0.05037303641438484, -0.00033628815435804427, -0.00525997020304203,...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 25, "section": "methods", "title": "" }
where B is the Ba 2+ -block at a concentration C. The Ba 2+ IC 50 at _120 mV for Kir2.1 (15.9 mM, , middle panel) is about one-quarter of the value for Kir2.4 (72.3 mM, other hand, the values for the Kir2.1-2.4 tandem and co-expressed Kir2.1 and 2.4 are of the same order, in the range of 4-5 mM, a value one-third that ...
[ -0.0028363261371850967, -0.13076961040496826, -0.020181380212306976, -0.005508253816515207, -0.02217847667634487, 0.05771519988775253, 0.10152070969343185, 0.007504626177251339, 0.07679110765457153, -0.024681631475687027, -0.060096051543951035, -0.004062988795340061, 0.01701262965798378, 0...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 26, "section": "methods", "title": "" }
In the present study, we showed that Kir2.4 associates with Kir2.1 subunits, that heteromeric Kir2.1-2.4 channels conduct robust inward rectifying currents and that they have Ba 2+ -blocking properties different from those of homomeric channels resulting from expression of either individual subunit alone.
[ 0.0005402390379458666, -0.1135065034031868, -0.005192789249122143, -0.015802307054400444, -0.018294399604201317, 0.04957148805260658, 0.012506724335253239, -0.00575611786916852, 0.040546122938394547, -0.007343932520598173, -0.04526609554886818, 0.04351597651839256, 0.014358111657202244, 0....
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 28, "section": "methods", "title": "" }
Co-assembly in the inward rectifier group is less well understood. Heteromultimerization of inward rectifier K + channels has been shown to occur and to be functionally important in the Kir3 group. The molecular basis of the G-protein-gated inward rectifier potassium and acetylcholine-dependent current (I K,ACh ) is a ...
[ -0.013800745829939842, -0.1146324872970581, 0.019698573276400566, -0.030434738844633102, 0.011871219612658024, 0.07271384447813034, 0.031877920031547546, -0.034084025770425797, 0.02433019131422043, -0.01479818020015955, -0.07690122723579407, 0.05438564345240593, 0.030724337324500084, -0.02...
[ "Kir1.1", "Kir2.1", "Kir3.1", "Kir3.2", "Kir3.4", "Kir4.1", "Kir4.2", "Kir5.1" ]
{ "authors": [], "id": "1232", "paragraph_id": 29, "section": "methods", "title": "" }
Conflicting data have been reported for heteromultimerization within the Kir2 family. addressed the regions responsible for homo-and heteromultimer formation among Kir2.1, Kir2.2 and Kir2.3 subunits. Their results indicate that the formation of homomultimers is by far the preferred reaction when Kir2.1 and Kir2.2 or Ki...
[ 0.020095989108085632, -0.10311396420001984, 0.04239114746451378, -0.014708250761032104, -0.02559710294008255, 0.06985712796449661, 0.0344124361872673, -0.01201543491333723, 0.01147516444325447, -0.0128569221124053, -0.08565102517604828, 0.025376660749316216, 0.03970831632614136, -0.0017945...
[ "Kir2.1", "Kir2.2", "Kir2.3", "Kir3.2" ]
{ "authors": [], "id": "1232", "paragraph_id": 30, "section": "methods", "title": "" }
Our findings were similar to those of , in that we found that Kir2.1 can co-assemble with Kir2.4 to form functional heterotetramers and that channels consisting of different subunits may have specific properties different from those of homomeric channels composed of either subunit alone. Furthermore, we found that co-a...
[ -0.005815696902573109, -0.11960048973560333, -0.0025297158863395452, -0.010004102252423763, -0.011415299028158188, 0.08561558276414871, 0.06222084164619446, -0.015507731586694717, 0.029467610642313957, -0.020124850794672966, -0.09051644057035446, 0.03889036923646927, 0.026348790153861046, ...
[ "Kir2.1", "Kir2.4" ]
{ "authors": [], "id": "1232", "paragraph_id": 31, "section": "methods", "title": "" }
Heteromultimerization is a potentially important contributor to the functional diversity of K + channels. The native I K,ACh current, an ionconducting pathway of central importance to parasympathetic nervous system effector pathways, is composed of heteromultimeric Kir3.1 and Kir3.4 subunits. There is evidence that the...
[ -0.033128730952739716, -0.10437115281820297, 0.008785138837993145, -0.008169785141944885, 0.025871917605400085, 0.038645774126052856, -0.03365484997630119, -0.007646302692592144, -0.03003433719277382, 0.010793371126055717, -0.031950999051332474, 0.03818513825535774, 0.03235038369894028, -0...
[ "Kir2.1", "Kir3.1", "Kir3.4" ]