File size: 20,089 Bytes
736e4a0 | 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 40 41 42 43 44 45 46 47 48 49 50 51 52 53 54 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 86 87 88 89 90 91 92 93 94 95 96 97 98 99 100 101 102 103 104 105 106 107 108 109 110 111 112 113 114 115 116 117 118 119 120 121 122 123 124 125 126 127 128 129 130 131 132 133 134 135 136 137 138 139 140 141 142 143 144 145 146 147 148 149 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 182 183 184 185 186 187 188 189 190 191 192 193 194 195 196 197 198 199 200 201 202 203 204 205 206 207 208 209 210 211 212 213 214 215 216 217 218 219 220 221 222 223 224 225 226 227 228 229 230 231 232 233 234 235 236 237 238 239 240 241 242 243 244 245 246 247 248 249 250 251 252 253 254 255 256 257 258 259 260 261 262 263 264 265 266 267 268 269 270 271 272 273 274 275 276 277 278 279 280 281 282 283 284 285 286 287 288 289 290 291 292 293 294 295 296 297 298 299 300 301 302 303 304 305 306 307 308 309 310 311 312 313 314 315 316 317 318 319 320 321 322 323 324 325 326 327 328 329 330 331 332 333 334 335 336 337 338 339 340 341 342 343 344 345 346 347 348 349 350 351 352 353 354 355 356 357 358 359 360 361 362 363 364 365 366 367 368 369 370 371 372 373 374 375 376 377 378 379 380 381 382 383 384 385 386 387 388 389 390 391 392 393 394 395 396 397 398 399 400 401 402 403 404 405 406 407 408 409 410 411 412 413 414 415 416 417 418 419 420 421 422 423 424 425 426 427 428 429 430 431 432 433 434 435 436 437 438 439 440 441 442 443 444 445 446 447 448 449 450 451 452 453 454 455 456 457 458 459 460 461 462 463 464 465 466 467 468 469 470 471 472 473 474 475 476 477 478 479 480 481 482 483 484 485 486 487 488 489 490 491 492 493 494 495 496 | {
"cells": [
{
"cell_type": "code",
"execution_count": 1,
"id": "f80836bc",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:56:31.548379Z",
"iopub.status.busy": "2025-03-25T06:56:31.548269Z",
"iopub.status.idle": "2025-03-25T06:56:31.712506Z",
"shell.execute_reply": "2025-03-25T06:56:31.712136Z"
}
},
"outputs": [],
"source": [
"import sys\n",
"import os\n",
"sys.path.append(os.path.abspath(os.path.join(os.getcwd(), '../..')))\n",
"\n",
"# Path Configuration\n",
"from tools.preprocess import *\n",
"\n",
"# Processing context\n",
"trait = \"Bladder_Cancer\"\n",
"cohort = \"GSE145261\"\n",
"\n",
"# Input paths\n",
"in_trait_dir = \"../../input/GEO/Bladder_Cancer\"\n",
"in_cohort_dir = \"../../input/GEO/Bladder_Cancer/GSE145261\"\n",
"\n",
"# Output paths\n",
"out_data_file = \"../../output/preprocess/Bladder_Cancer/GSE145261.csv\"\n",
"out_gene_data_file = \"../../output/preprocess/Bladder_Cancer/gene_data/GSE145261.csv\"\n",
"out_clinical_data_file = \"../../output/preprocess/Bladder_Cancer/clinical_data/GSE145261.csv\"\n",
"json_path = \"../../output/preprocess/Bladder_Cancer/cohort_info.json\"\n"
]
},
{
"cell_type": "markdown",
"id": "25dc6cb3",
"metadata": {},
"source": [
"### Step 1: Initial Data Loading"
]
},
{
"cell_type": "code",
"execution_count": 2,
"id": "4b5a561a",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:56:31.713956Z",
"iopub.status.busy": "2025-03-25T06:56:31.713817Z",
"iopub.status.idle": "2025-03-25T06:56:31.815053Z",
"shell.execute_reply": "2025-03-25T06:56:31.814728Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Background Information:\n",
"!Series_title\t\"Urothelial-to-Neural Lineage Plasticity Drives Progression to Small Cell Bladder Cancer\"\n",
"!Series_summary\t\"This SuperSeries is composed of the SubSeries listed below.\"\n",
"!Series_overall_design\t\"Small cell carcinoma (SCC) of the bladder displays a high propensity for distant metastasis and is associated with short survival. We report a comprehensive molecular analysis of 34 cases of SCC and 84 cases of conventional urothelial carcinoma (UC)\"\n",
"Sample Characteristics Dictionary:\n",
"{0: ['subject age: 72 years', 'subject age: 76 years', 'subject age: 79 years', 'subject age: 60 years', 'subject age: 65 years', 'subject age: 41 years', 'subject age: 67 years', 'subject age: 71 years', 'subject age: 57 years', 'subject age: 34 years', 'subject age: 62 years', 'subject age: 90 years', 'subject age: 58 years'], 1: ['subject gender: male', 'subject gender: female'], 2: ['tissue: bladder'], 3: ['tissue type: small cell carinoma (SCC)']}\n"
]
}
],
"source": [
"from tools.preprocess import *\n",
"# 1. Identify the paths to the SOFT file and the matrix file\n",
"soft_file, matrix_file = geo_get_relevant_filepaths(in_cohort_dir)\n",
"\n",
"# 2. Read the matrix file to obtain background information and sample characteristics data\n",
"background_prefixes = ['!Series_title', '!Series_summary', '!Series_overall_design']\n",
"clinical_prefixes = ['!Sample_geo_accession', '!Sample_characteristics_ch1']\n",
"background_info, clinical_data = get_background_and_clinical_data(matrix_file, background_prefixes, clinical_prefixes)\n",
"\n",
"# 3. Obtain the sample characteristics dictionary from the clinical dataframe\n",
"sample_characteristics_dict = get_unique_values_by_row(clinical_data)\n",
"\n",
"# 4. Explicitly print out all the background information and the sample characteristics dictionary\n",
"print(\"Background Information:\")\n",
"print(background_info)\n",
"print(\"Sample Characteristics Dictionary:\")\n",
"print(sample_characteristics_dict)\n"
]
},
{
"cell_type": "markdown",
"id": "da4a235f",
"metadata": {},
"source": [
"### Step 2: Dataset Analysis and Clinical Feature Extraction"
]
},
{
"cell_type": "code",
"execution_count": 3,
"id": "d545fee7",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:56:31.816154Z",
"iopub.status.busy": "2025-03-25T06:56:31.816042Z",
"iopub.status.idle": "2025-03-25T06:56:31.837459Z",
"shell.execute_reply": "2025-03-25T06:56:31.837159Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Clinical data preview:\n",
"{'GSM4310302': [1.0, 72.0, 1.0], 'GSM4310303': [1.0, 76.0, 1.0], 'GSM4310304': [1.0, 72.0, 1.0], 'GSM4310305': [1.0, 79.0, 1.0], 'GSM4310306': [1.0, 60.0, 1.0], 'GSM4310307': [1.0, 65.0, 1.0], 'GSM4310308': [1.0, 41.0, 1.0], 'GSM4310309': [1.0, 76.0, 0.0], 'GSM4310310': [1.0, 76.0, 0.0], 'GSM4310311': [1.0, 67.0, 1.0], 'GSM4310312': [1.0, 71.0, 1.0], 'GSM4310313': [1.0, 65.0, 1.0], 'GSM4310314': [1.0, 71.0, 1.0], 'GSM4310315': [1.0, 72.0, 1.0], 'GSM4310316': [1.0, 57.0, 1.0], 'GSM4310317': [1.0, 71.0, 1.0], 'GSM4310318': [1.0, 67.0, 1.0], 'GSM4310319': [1.0, 34.0, 1.0], 'GSM4310320': [1.0, 62.0, 1.0], 'GSM4310321': [1.0, 90.0, 0.0], 'GSM4310322': [1.0, 72.0, 1.0], 'GSM4310323': [1.0, 58.0, 1.0]}\n",
"Clinical data saved to ../../output/preprocess/Bladder_Cancer/clinical_data/GSE145261.csv\n"
]
}
],
"source": [
"# 1. Gene Expression Data Availability\n",
"# Based on background information, this is a study on bladder cancer with molecular analysis,\n",
"# likely to contain gene expression data\n",
"is_gene_available = True\n",
"\n",
"# 2. Variable Availability and Data Type Conversion\n",
"# 2.1 Data Availability\n",
"# For trait: Based on sample characteristics dict, tissue type is indicated in key 3\n",
"trait_row = 3\n",
"# For age: Age information is in key 0\n",
"age_row = 0\n",
"# For gender: Gender information is in key 1\n",
"gender_row = 1\n",
"\n",
"# 2.2 Data Type Conversion\n",
"def convert_trait(value):\n",
" \"\"\"Convert bladder cancer type to binary (0=not SCC, 1=SCC)\"\"\"\n",
" if pd.isna(value) or value is None:\n",
" return None\n",
" \n",
" # Extract value after colon if present\n",
" if ':' in value:\n",
" value = value.split(':', 1)[1].strip()\n",
" \n",
" # Convert to binary\n",
" if 'small cell' in value.lower() or 'scc' in value.lower():\n",
" return 1 # SCC bladder cancer\n",
" else:\n",
" return 0 # Not SCC bladder cancer\n",
"\n",
"def convert_age(value):\n",
" \"\"\"Convert age value to continuous numeric\"\"\"\n",
" if pd.isna(value) or value is None:\n",
" return None\n",
" \n",
" # Extract value after colon if present\n",
" if ':' in value:\n",
" value = value.split(':', 1)[1].strip()\n",
" \n",
" # Extract numeric age value\n",
" import re\n",
" match = re.search(r'(\\d+)', value)\n",
" if match:\n",
" return int(match.group(1))\n",
" else:\n",
" return None\n",
"\n",
"def convert_gender(value):\n",
" \"\"\"Convert gender to binary (0=female, 1=male)\"\"\"\n",
" if pd.isna(value) or value is None:\n",
" return None\n",
" \n",
" # Extract value after colon if present\n",
" if ':' in value:\n",
" value = value.split(':', 1)[1].strip()\n",
" \n",
" # Convert to binary\n",
" value = value.lower()\n",
" if 'female' in value:\n",
" return 0\n",
" elif 'male' in value:\n",
" return 1\n",
" else:\n",
" return None\n",
"\n",
"# 3. Save Metadata\n",
"# Trait data is available if trait_row is not None\n",
"is_trait_available = trait_row is not None\n",
"\n",
"# Save initial filtering info\n",
"validate_and_save_cohort_info(\n",
" is_final=False,\n",
" cohort=cohort,\n",
" info_path=json_path,\n",
" is_gene_available=is_gene_available,\n",
" is_trait_available=is_trait_available\n",
")\n",
"\n",
"# 4. Clinical Feature Extraction\n",
"if trait_row is not None:\n",
" # Use the library function to extract clinical features\n",
" clinical_df = geo_select_clinical_features(\n",
" clinical_df=clinical_data,\n",
" trait=trait,\n",
" trait_row=trait_row,\n",
" convert_trait=convert_trait,\n",
" age_row=age_row,\n",
" convert_age=convert_age,\n",
" gender_row=gender_row,\n",
" convert_gender=convert_gender\n",
" )\n",
" \n",
" # Preview the data\n",
" print(\"Clinical data preview:\")\n",
" print(preview_df(clinical_df))\n",
" \n",
" # Save the clinical data\n",
" os.makedirs(os.path.dirname(out_clinical_data_file), exist_ok=True)\n",
" clinical_df.to_csv(out_clinical_data_file, index=True)\n",
" print(f\"Clinical data saved to {out_clinical_data_file}\")\n"
]
},
{
"cell_type": "markdown",
"id": "9ef51899",
"metadata": {},
"source": [
"### Step 3: Gene Data Extraction"
]
},
{
"cell_type": "code",
"execution_count": 4,
"id": "4698d57b",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:56:31.838487Z",
"iopub.status.busy": "2025-03-25T06:56:31.838382Z",
"iopub.status.idle": "2025-03-25T06:56:31.957539Z",
"shell.execute_reply": "2025-03-25T06:56:31.957174Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Index(['ILMN_1343291', 'ILMN_1343295', 'ILMN_1651199', 'ILMN_1651209',\n",
" 'ILMN_1651210', 'ILMN_1651221', 'ILMN_1651228', 'ILMN_1651229',\n",
" 'ILMN_1651230', 'ILMN_1651232', 'ILMN_1651235', 'ILMN_1651236',\n",
" 'ILMN_1651237', 'ILMN_1651238', 'ILMN_1651249', 'ILMN_1651253',\n",
" 'ILMN_1651254', 'ILMN_1651259', 'ILMN_1651260', 'ILMN_1651262'],\n",
" dtype='object', name='ID')\n"
]
}
],
"source": [
"# 1. Use the get_genetic_data function from the library to get the gene_data from the matrix_file previously defined.\n",
"gene_data = get_genetic_data(matrix_file)\n",
"\n",
"# 2. Print the first 20 row IDs (gene or probe identifiers) for future observation.\n",
"print(gene_data.index[:20])\n"
]
},
{
"cell_type": "markdown",
"id": "ae538d6b",
"metadata": {},
"source": [
"### Step 4: Gene Identifier Review"
]
},
{
"cell_type": "code",
"execution_count": 5,
"id": "7cb15dc6",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:56:31.958798Z",
"iopub.status.busy": "2025-03-25T06:56:31.958675Z",
"iopub.status.idle": "2025-03-25T06:56:31.960546Z",
"shell.execute_reply": "2025-03-25T06:56:31.960248Z"
}
},
"outputs": [],
"source": [
"# These are Illumina BeadArray identifiers (ILMN_*), not human gene symbols\n",
"# They need to be mapped to proper gene symbols for analysis\n",
"\n",
"requires_gene_mapping = True\n"
]
},
{
"cell_type": "markdown",
"id": "4b169b6f",
"metadata": {},
"source": [
"### Step 5: Gene Annotation"
]
},
{
"cell_type": "code",
"execution_count": 6,
"id": "4e4ea583",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:56:31.961662Z",
"iopub.status.busy": "2025-03-25T06:56:31.961558Z",
"iopub.status.idle": "2025-03-25T06:56:34.603507Z",
"shell.execute_reply": "2025-03-25T06:56:34.603139Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene annotation preview:\n",
"{'ID': ['ILMN_1343048', 'ILMN_1343049', 'ILMN_1343050', 'ILMN_1343052', 'ILMN_1343059'], 'Species': [nan, nan, nan, nan, nan], 'Source': [nan, nan, nan, nan, nan], 'Search_Key': [nan, nan, nan, nan, nan], 'Transcript': [nan, nan, nan, nan, nan], 'ILMN_Gene': [nan, nan, nan, nan, nan], 'Source_Reference_ID': [nan, nan, nan, nan, nan], 'RefSeq_ID': [nan, nan, nan, nan, nan], 'Unigene_ID': [nan, nan, nan, nan, nan], 'Entrez_Gene_ID': [nan, nan, nan, nan, nan], 'GI': [nan, nan, nan, nan, nan], 'Accession': [nan, nan, nan, nan, nan], 'Symbol': ['phage_lambda_genome', 'phage_lambda_genome', 'phage_lambda_genome:low', 'phage_lambda_genome:low', 'thrB'], 'Protein_Product': [nan, nan, nan, nan, 'thrB'], 'Probe_Id': [nan, nan, nan, nan, nan], 'Array_Address_Id': [5090180.0, 6510136.0, 7560739.0, 1450438.0, 1240647.0], 'Probe_Type': [nan, nan, nan, nan, nan], 'Probe_Start': [nan, nan, nan, nan, nan], 'SEQUENCE': ['GAATAAAGAACAATCTGCTGATGATCCCTCCGTGGATCTGATTCGTGTAA', 'CCATGTGATACGAGGGCGCGTAGTTTGCATTATCGTTTTTATCGTTTCAA', 'CCGACAGATGTATGTAAGGCCAACGTGCTCAAATCTTCATACAGAAAGAT', 'TCTGTCACTGTCAGGAAAGTGGTAAAACTGCAACTCAATTACTGCAATGC', 'CTTGTGCCTGAGCTGTCAAAAGTAGAGCACGTCGCCGAGATGAAGGGCGC'], 'Chromosome': [nan, nan, nan, nan, nan], 'Probe_Chr_Orientation': [nan, nan, nan, nan, nan], 'Probe_Coordinates': [nan, nan, nan, nan, nan], 'Cytoband': [nan, nan, nan, nan, nan], 'Definition': [nan, nan, nan, nan, nan], 'Ontology_Component': [nan, nan, nan, nan, nan], 'Ontology_Process': [nan, nan, nan, nan, nan], 'Ontology_Function': [nan, nan, nan, nan, nan], 'Synonyms': [nan, nan, nan, nan, nan], 'Obsolete_Probe_Id': [nan, nan, nan, nan, nan], 'GB_ACC': [nan, nan, nan, nan, nan]}\n"
]
}
],
"source": [
"# 1. Use the 'get_gene_annotation' function from the library to get gene annotation data from the SOFT file.\n",
"gene_annotation = get_gene_annotation(soft_file)\n",
"\n",
"# 2. Use the 'preview_df' function from the library to preview the data and print out the results.\n",
"print(\"Gene annotation preview:\")\n",
"print(preview_df(gene_annotation))\n"
]
},
{
"cell_type": "markdown",
"id": "c3add7e5",
"metadata": {},
"source": [
"### Step 6: Gene Identifier Mapping"
]
},
{
"cell_type": "code",
"execution_count": 7,
"id": "58050e01",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:56:34.604905Z",
"iopub.status.busy": "2025-03-25T06:56:34.604687Z",
"iopub.status.idle": "2025-03-25T06:56:34.749805Z",
"shell.execute_reply": "2025-03-25T06:56:34.749440Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Gene expression data after mapping (first 5 rows, 5 columns):\n",
" GSM4310302 GSM4310303 GSM4310304 GSM4310305 GSM4310306\n",
"Gene \n",
"A1BG 18.653255 18.667788 18.862924 18.728951 18.664749\n",
"A1CF 27.961683 28.422059 27.961613 27.960573 27.959180\n",
"A26C3 27.959176 29.677706 28.149562 28.236884 27.964586\n",
"A2BP1 37.291573 38.591834 37.474717 38.672140 41.538859\n",
"A2LD1 9.361814 9.418669 9.316703 9.596790 9.376270\n",
"Shape after mapping: (21464, 22)\n"
]
}
],
"source": [
"# 1. Identify the relevant columns in gene_annotation for mapping\n",
"# From the previous output:\n",
"# - 'ID' is the column with the same identifiers (ILMN_*) as in gene_expression data\n",
"# - 'Symbol' contains the gene symbols we need to map to\n",
"\n",
"# 2. Create a gene mapping dataframe using get_gene_mapping function\n",
"# The function extracts and processes these two columns\n",
"gene_mapping = get_gene_mapping(gene_annotation, 'ID', 'Symbol')\n",
"\n",
"# 3. Apply the gene mapping to convert probe-level measurements to gene expression data\n",
"# This function handles the many-to-many relationships between probes and genes\n",
"gene_data = apply_gene_mapping(gene_data, gene_mapping)\n",
"\n",
"# Show a preview of the new gene expression data\n",
"print(\"Gene expression data after mapping (first 5 rows, 5 columns):\")\n",
"preview_cols = min(5, len(gene_data.columns))\n",
"print(gene_data.iloc[:5, :preview_cols])\n",
"print(f\"Shape after mapping: {gene_data.shape}\")\n"
]
},
{
"cell_type": "markdown",
"id": "df0d3a86",
"metadata": {},
"source": [
"### Step 7: Data Normalization and Linking"
]
},
{
"cell_type": "code",
"execution_count": 8,
"id": "68867eb4",
"metadata": {
"execution": {
"iopub.execute_input": "2025-03-25T06:56:34.751094Z",
"iopub.status.busy": "2025-03-25T06:56:34.750970Z",
"iopub.status.idle": "2025-03-25T06:56:41.119679Z",
"shell.execute_reply": "2025-03-25T06:56:41.119371Z"
}
},
"outputs": [
{
"name": "stdout",
"output_type": "stream",
"text": [
"Normalized gene data saved to ../../output/preprocess/Bladder_Cancer/gene_data/GSE145261.csv\n"
]
},
{
"name": "stdout",
"output_type": "stream",
"text": [
"Quartiles for 'Bladder_Cancer':\n",
" 25%: 1.0\n",
" 50% (Median): 1.0\n",
" 75%: 1.0\n",
"Min: 1.0\n",
"Max: 1.0\n",
"The distribution of the feature 'Bladder_Cancer' in this dataset is severely biased.\n",
"\n",
"Quartiles for 'Age':\n",
" 25%: 62.75\n",
" 50% (Median): 71.0\n",
" 75%: 72.0\n",
"Min: 34.0\n",
"Max: 90.0\n",
"The distribution of the feature 'Age' in this dataset is fine.\n",
"\n",
"For the feature 'Gender', the least common label is '0.0' with 3 occurrences. This represents 13.64% of the dataset.\n",
"The distribution of the feature 'Gender' in this dataset is fine.\n",
"\n",
"Data was determined to be unusable and was not saved\n"
]
}
],
"source": [
"# 1. Normalize the obtained gene data with the 'normalize_gene_symbols_in_index' function from the library.\n",
"normalized_gene_data = normalize_gene_symbols_in_index(gene_data)\n",
"os.makedirs(os.path.dirname(out_gene_data_file), exist_ok=True)\n",
"normalized_gene_data.to_csv(out_gene_data_file)\n",
"print(f\"Normalized gene data saved to {out_gene_data_file}\")\n",
"\n",
"# 2. Load the previously saved clinical data and link with genetic data\n",
"clinical_df = pd.read_csv(out_clinical_data_file, index_col=0)\n",
"linked_data = geo_link_clinical_genetic_data(clinical_df, normalized_gene_data)\n",
"\n",
"# 3. Handle missing values in the linked data\n",
"linked_data = handle_missing_values(linked_data, trait)\n",
"\n",
"# 4. Determine whether the trait and some demographic features are severely biased, and remove biased features.\n",
"is_trait_biased, unbiased_linked_data = judge_and_remove_biased_features(linked_data, trait)\n",
"\n",
"# 5. Conduct quality check and save the cohort information.\n",
"is_usable = validate_and_save_cohort_info(True, cohort, json_path, True, True, is_trait_biased, unbiased_linked_data)\n",
"\n",
"# 6. If the linked data is usable, save it as a CSV file to 'out_data_file'.\n",
"if is_usable:\n",
" os.makedirs(os.path.dirname(out_data_file), exist_ok=True)\n",
" unbiased_linked_data.to_csv(out_data_file)\n",
" print(f\"Linked data saved to {out_data_file}\")\n",
"else:\n",
" print(\"Data was determined to be unusable and was not saved\")"
]
}
],
"metadata": {
"language_info": {
"codemirror_mode": {
"name": "ipython",
"version": 3
},
"file_extension": ".py",
"mimetype": "text/x-python",
"name": "python",
"nbconvert_exporter": "python",
"pygments_lexer": "ipython3",
"version": "3.10.16"
}
},
"nbformat": 4,
"nbformat_minor": 5
}
|