text
stringlengths 0
868k
|
|---|
Necrobiosis lipoidica (nl) is a rare chronic granulomatous dermatitis first described in 1929 by oppenheim that usually appears in the lower extremities that affects about 0.31.2% of diabetic patients, the majority of whom have type 1 diabetes . We report a case of a 16 y old girl who developed lesions on the lower extremities and in the interscapular area, which is an unusual location . The patient, a caucasian 16-y - old girl, was born at term by non - consanguineous, healthy parents . Type 1 diabetes (t1 dm) had been diagnosed at one year of age . Our patient s medical history was otherwise unremarkable . Until the age of 12 she maintained an adequate glucose control with hba1c <34 mmol / mol . Thereafter her glucose control progressively worsened with a hba1c of 86 mmol / mol . At the age of 16, during a routine diabetes follow - up visit, the patient presented with erythematous subcutaneous nodular lesions which had appeared 4 mo earlier, initially in the pretibial area and subsequently in the interscapular area . Her hba1c was 64 mmol / mol and daily insulin requirements were 0.95 u / kg / day . In the suspect of necrobiosis lipoidica, a skin biopsy was performed (lower extremities and interscapular area) (figs . 1 and 2) the smaller lesions in the interscapular area showed signs of perivascular dermatitis which could be consistent with early stages of necrobiosis lipoidica (fig . It may initially be represented by erythematous circular papules which may gradually progress to yellowish - brown, telangectatic plaques with central atrophy and raised violaceous border . The etiology of nl is still currently elusive and few data exist regarding the pediatric population . However, due to the significant relationship with diabetes (7590% of patients with nl have or will develop t1 dm), many studies have proposed microangiopathy as leading etiological suspect . Immune - complex vasculitis and collagen abnormalities may also represent potential underlying causes . Previous studies have shown that glucose control does not appear to be correlated with nl onset and severity . However, a study by cohen concluded on the contrary, that nl is usually associated with poor glucose control and that a tighter glucose control, as currently practiced, might improve or prevent this disorder . Diagnosis of nl is mainly clinical, but a bioptic evaluation may be useful especially in the early stages of disease . Differential diagnosis include erythema nodosum, lupus panniculitis, granuloma annulare, sarcoidosis and amyloidosis . Microscopic evaluation usually shows degeneration of collagen, granulomatous inflammation of subcutaneous tissues and of blood vessels, capillary basement membrane thickening and obliteration of vessel lumen . Other therapeutic options are antiplatelet agents, cyclosporine, thalidomide, clofazimine, anti - tnf agents, fumaric acid esters, puva, photodynamic therapy, hydroxychloroquine, and tacrolimus . In patients with t1 dm, diagnosis of nl of the lower legs is usually unequivocal . However, diagnosis may be more challenging in the presence of lesions with recent onset and/or atypical clinical presentation and unusual site . In these cases, nl must always be taken in consideration in order to avoid misdiagnosis, wrong / late treatment decisions and progression to ulceration . Written informed consent was obtained from the patient and parents for publication of this manuscript and any accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal.
|
Primary immunoglobulin light chain amyloidosis (al amyloidosis) is a plasma cell disorder which mainly affects heart, kidneys, liver, and peripheral nervous system . Cases of atypical al amyloidosis presented as spontaneous vertebral compression fractures have been rarely reported, and data about the management and clinical outcomes of the patients are scarce . Herein, we present 3 new cases of al amyloidosis with spontaneous vertebral compression fracture and review 13 cases retrieved from the literature . Moreover, we observed overrepresentations of liver involvement and bone marrow involvement in al amyloidosis with spontaneous vertebral compression fracture . We believe that better awareness of the rare clinical presentation as spontaneous vertebral compression fracture of al amyloidosis can facilitate earlier diagnosis and earlier treatment . Primary immunoglobulin light chain amyloidosis (al amyloidosis) is a plasma cell disorder characterized by overproduction and accumulation of insoluble amyloid fibrils composed of immunoglobulin light chains . The most commonly affected organs are the heart, kidneys, liver, and peripheral nervous system, presenting as congestive cardiomyopathy, nephrotic - range proteinuria, hepatomegaly, and peripheral neuropathy, respectively . A spontaneous vertebral compression fracture is a rare clinical presentation in patients with al amyloidosis . Here we present 3 cases of al amyloidosis with spontaneous vertebral compression fractures, liver involvement, and bone marrow involvement, with a review of the literature . All patients provided signed, informed consent, and the study was approved by peking union medical college hospital institutional review broad . Case 1 was a 64-year - old man who had his thoracic spine fractured accidentally 5 years ago . A computed tomography scan was performed and suggested a vertebral compression fracture of t11 . He had a spontaneous lumbar compression fracture of l1 to l2 6 months later . Another 6 months later, he developed soy urine . An abdominal ultrasound showed that the liver edge was near the costal margin and 3.7 cm below the xiphoid process . The laboratory tests revealed the following: hemoglobin, 143 g / l (normal, 120160 g / l); gamma - glutamyl transpeptidase (ggt), 656 u / l (normal, 1060 u / l); alkaline phosphatase (alp), 477 u / l (normal, 50135 u / l); albumin, 34 g / l (normal, 3552 u / l); creatinine, 89 mol / l (normal, 59104 mol / l); 24-hour urine protein, 5.87 g (normal, 0.000.20 g); serum phosphate, 1.45 mmol / l (normal, 0.811.45 mmol / l); calcium, 2.17 mmol / l (normal, 2.132.70 mmol / l); serum cardiac troponin i (ctni), 0.02 g / l (normal, 00.04 g / l); n - terminal of the prohormone brain natriuretic peptide (nt - probnp), 213 pg / ml (normal, 0125 pg / ml); serum protein electrophoresis (spep), negative monoclonal protein; serum free light chain (flc) kappa, 51.6 mg / dl; serum flc lambda, 10.5 mg / dl; serum flc ratio (flc - r), 4.91; difference between involved and uninvolved serum immunoglobulin flc (dflc), 40.1 mg / l; bone marrow biopsy, amyloid deposits with 3.5% plasma cells; immune staining, predominant kappa light chains; and liver biopsy, amyloid degeneration with positive congo red staining . He was treated with 6 cycles of bortezomib, cyclophosphamide, and dexamethasone, and reached hematologic complete remission (cr). At the follow - up examination 2 years later, the organ response was documented with a negative 24-hour urine protein, an alp of 153 u / l, and a ggt of 322 case 2 was a 49-year - old woman who complained of progressive back pain for 5 years and was found to have multiple spontaneous vertebral fractures . Magnetic resonance imaging revealed old compression fractures involving t11 to t12 and l1 to l4 . The physical examination was notable for macroglossia and liver enlargement with a liver edge palpable 6 cm below the costal margin and 4 cm below the xiphoid process . Laboratory tests indicated the following: hemoglobin, 117 g / l (normal, 110150 g / l; creatinine, 72 mol / l (normal, 4584 mol / l); alp, 165 u / l; ggt, 261 u / l; nt - probnp, 309 pg / ml; ctni, 0.00 g / l; serum calcium, 2.30 mmol / l; serum phosphate, 1.4 mmol / l; serum parathyroid hormone, 31.7 pg / ml (normal, 12.065.0 pg / ml); 24-hour urine protein, 0.41 g; spep, no monoclonal protein; serum flc kappa, 43.2 mg / l; dflc, 30 mg / l; flc - r, 3.27; and bone marrow (plasma cells1%), gingival, and tongue biopsies, scattered interstitial amyloid deposition with positive congo red stain . The patient was treated with high - dose melphalan (200 mg / m) followed by autologous stem cell transplantation (asct). The alp was 153 u / l, and the ggt was reduced to 80 u / l . Case 3 was a 48-year - old man who presented with lower back pain and increasing abdominal girth over the past year . The physical examination revealed hepatomegaly with the liver edge palpable 7 cm below the costal margin and 12 cm below the xiphoid process . A chest x - ray revealed multiple spontaneous vertebral and old costal fractures involving the right third and fourth ribs, as well as the left eighth rib . G / l; creatinine, 75 mol / l; alp, 330 u / l; ggt, 445 u / l; serum calcium, 2.36 mmol / l; serum phosphate 1.35 mmol / l; parathyroid hormone, 14.5 pg / ml; nt - probnp, 108 pg / ml; ctni, 0.00 g / l; 24-hour urine protein, 0.36 g; spep, monoclonal protein (0 g / l); serum flc kappa, 70.6 mg / dl; serum flc lambda, 10.6 mg / dl; dflc, 60.0 mg / l; flc - r, 6.66; bone marrow biopsy, 0.50% plasma cells, with amyloid fibrils deposited near vessels; and liver biopsy, large amount of amorphous amyloid deposits between hepatic cells, which were positive in congo red stain . The patient was treated with melphalan, dexamethasone, and daily thalidomide . During the past 6 months since he completed treatment, he achieved a hematologic cr, with a decrease in ggt (233 u / l) and alp (224 u / l). The general functional status was largely improved with no additional vertebral fractures . Spontaneous vertebral compressions are rare manifestations in patients with al amyloidosis . In our case series, spontaneous vertebral compression fractures were one of the initial presenting signs of al amyloidosis . Interestingly, all 3 patients in this case series had liver involvement, as demonstrated by hepatomegaly and elevation in liver enzymes, especially alp and ggt, as well as bone marrow involvement . In addition, none of the 3 patients had severe cardiac problems or involvement of other major organs . We reviewed the literature and found 13 reported patients with al amyloidosis who presented clinically with spontaneous vertebral fractures; the characteristics of these cases are shown in table 1 . The median age of the 13 patients was 59 years (range, 2976 years). It is worth noting that of 11 reported cases, 8 (72.7%) also had liver involvement, 10 (90.9%) had bone marrow involvement, and 7 (63.6%) had both liver and bone marrow involvement, while only 1 patient had cardiac involvement, which was consistent with organ involvement in our case series . Al amyloidosis with presentation of vertebral compression fractures in the literature . In patients with al amyloidosis who presented with vertebral compression fractures, one possible explanation would be the potential kappa light chain dominance among the patients with vertebral bone involvement . According to table 1, of note, while kappa - predominance was observed in the patients with vertebral fractures and bone marrow involvement, the lambda - to - kappa light chain ratio in patients with al amyloidosis is 3.8 . This is in agreement with a former study indicating that the tropism of organ involvement in al amyloidosis can be influenced by the light chain variable region, which supports the hypothesis that patients with kappa light chains are more likely to have hepatic involvement . In another study, soft tissue and bone involvement was considered, the kappa - to - lambda ratio was 1, and the major soft tissue and bone involvement included macroglossia and vertebral compression fractures . The mechanism underlying spontaneous vertebral compression fractures in al amyloidosis has not been identified . In most cases with compression vertebral fractures, biopsies indicate nearly complete replacement of the bone marrow by amyloid fibrils . In addition, all patients reported with al amyloidosis presenting with vertebral fractures had normal serum calcium, serum phosphatase, and serum parathyroid hormone levels, which was the same as our 3 cases . A possible explanation is that neither osteolytic lesions nor disorders of calcium phosphate metabolism cause multiple vertebral fractures in patients with al amyloidosis . Instead, amyloid fibrils are first deposited near blood vessels supporting vertebrae, which may cause nutritional insufficiency in vertebrae, leading to progressive loss of bone density, and finally contributes to the compression fractures . Such a mechanism is different from that in amyloidosis associated with multiple myeloma, where lytic lesions are commonly associated and become the major cause of bone fractures . Treatment of the patients in this series was no more special than other cases with al amyloidosis, except that surgery using bone cement was often used in managing vertebral fractures . Melphalan, bortezomib, thalidomide, cyclophosphamide, dexamethasone, and asct were used to treat our patients . Fortunately, all 3 patients responded well, with an improvement in symptoms and functional status . Such a favorable prognosis is largely attributed to the early diagnosis and early treatment of al amyloidosis . During the past few decades, several patients with initial fractures in vertebrae have been reported to have died from al amyloidosis due to delayed diagnosis as well as inappropriate treatment . Given our results and the reports in the literature, even though vertebral compression fractures are rare in al amyloidosis, it is still important to consider al amyloidosis in the differential diagnosis of spontaneous vertebral compression fractures, especially in patients with hepatomegaly or elevated liver enzymes . Bone marrow biopsy is necessary, since most of the patients can have bone marrow infiltration of amyloid deposits . The functions of major organs are largely normal in most patients; thus, early diagnosis and early treatment are of great significance for such atypical cases of al amyloidosis.
|
Conduit artery flow - mediated dilation (fmd) is a widely used noninvasive method to assess endothelial function . Diminished fmd is widely assumed to reflect impaired dilator function of nitric oxide (no), based on several studies reporting the absence or substantial attenuation of fmd following infusion of the no synthase (nos) inhibitor n(g)-monomethyl - l - arginine (l - nmma) [26]. In support, a recent meta - analysis of 13 crossover studies utilizing l - nmma infusion and temporary distal ischemia found a substantial contribution of no (72%) to the conduit artery fmd response in healthy adults . However, other studies failing to significantly alter fmd with l - nmma [810] indicate potential involvement of additional vasodilators (such as vasodilator prostanoids (pn) and endothelium - derived hyperpolarizing factor (edhf) [12, 13]). Evidence of a concurrent or compensatory role of alternative dilators in health and disease [12, 14] suggests that these alternative vasodilators may be important for cardiovascular health . In support of this hypothesis, fmd following proximal cuff occlusion, which is only partially reduced by no blockade, predicts future cardiovascular events as effectively as fmd following distal occlusion . Consequently, interpreting conduit fmd as primarily mediated by no release and endothelial dysfunction as a loss of the no dilator system overlooks the relevance of redundant vasodilator systems for cardiovascular function and their potential as targets for therapies aimed at ameliorating cardiovascular risk with age and disease . We recently investigated the mechanisms underlying radial artery (ra) fmd in young men and women, finding that blocking no and pn reduced the vasodilator response to ischemia in some subjects but not in others . For example, individual variability in the fmd response following l - nmma and/or pn blockade by ketorolac was observed, and only half of the young subjects exhibited an observable (and fairly modest) effect of l - nmma on ra fmd . As discussed above, these data suggest that variable and redundant dilator pathways contribute to conduit artery fmd in healthy young men and women . Whether these redundant vasodilator pathways are impacted by aging is unknown, as previous work investigating the contribution of no and pn to rest and exercise limb hyperemia in aged humans has not been extended to fmd or has focused exclusively on the no system [1619]. Therefore, the present investigation extends our previous findings by examining differences due to healthy aging on the vasodilator pathways underlying ra fmd, a model utilized in previous infusion studies [3, 4, 6, 9]. Specifically, we sought to determine whether aging impairs the fmd response that persists following single and combined no and pn blockade . We hypothesized that blocking no and pn synthesis would more substantially reduce ra fmd in older adults, indicating impaired redundant vasodilator mechanisms with age that could deleteriously impact cardiovascular health . We enrolled healthy, nonsmoking older adults (n = 10, 5 men and 5 women, ages 6079). Data from young adults (n = 16, 8 men and 8 women, ages 2035) have been reported previously and were used for comparison purposes in the present study . Both young and older individuals were excluded if they met the criteria described previously . All participants provided written, informed consent as approved by the institutional review board at hartford hospital . Interested subjects reported to the laboratory following a 12 h fast in which data for inclusion / exclusion criteria were assessed . Next, a venous blood draw was performed for the analysis of whole blood viscosity, blood lipid levels, and hemoglobin (clinical laboratory partners, hartford, ct, usa) and resting blood pressure, heart rate, and anthropometrics were measured . On a separate day, enrolled participants reported to the laboratory for an invasive catheterization visit following a 8 h fast and abstinence from exercise, pain medications, and herbal supplements for 24 h. detailed methods for the local infusion of study drugs have been described previously . Briefly, to locally infuse saline and study drugs, a 20-gauge teflon catheter was inserted into the left brachial artery at the level of the antecubital fossa following anesthetization of the overlying skin . A three - port connector in series with a catheter - transducer system was used to administer saline and study drugs via the arterial catheter . One port was used to measure arterial pressure while the two remaining ports allowed for drug infusions and continuous saline administration for flushing . Following a 30 min supine rest period, saline was infused at 2 ml / min for 10 min to establish a control condition for any effects of infusate administration on fmd . Radial artery fmd was then performed . In brief, the ra was imaged ~10 cm distal to the antecubital fossa using a 512 mhz multifrequency linear - array transducer attached to a high - resolution ultrasound machine (terason t3000; teratech corp ., was also continuously measured using a 60 angle of insonation which remained constant throughout the study . Resting ra diameter and velocity were recorded for 1 min before the inflation (300 mmhg for 5 min) of a pneumatic occlusion cuff placed around the participant's wrist . Diameter and velocity were recorded continuously beginning 30 s before cuff deflation until 3 min after deflation . After a 10 min rest period and infusion of l - nmma (clinalfa, laeufelfingen, switzerland) for 10 min at 5 mg / ml, 2 ml / min, ra fmd was repeated to determine the impact of no blockade . Following another 10 min rest period, ketorolac (toradol; abbott labs, abbott park, il, usa) was infused for 5 min at 600 g / ml, 2 ml / min, immediately followed by a maintenance dose of l - nmma for 5 min (5 mg / ml, 2 ml / min). Drug doses equaled or exceeded those used in previous studies successfully blocking no and pn in the forearm [4, 6, 18, 2022]. Briefly, offline analysis of diameters and velocities was performed using brachial analyzer software (medical imaging applications llc, coralville, ia, usa). Only end diastolic diameters, triggered by the corresponding doppler waveform, were captured for diameter analyses . Radial artery fmd was expressed as percent change in dilation relative to baseline for each trial . Mean velocity matched to the corresponding diameter was used to calculate shear stress in dyn / cm [4 v / d; = blood viscosity (mpasec at 60 rpm); d = arterial diameter (cm); v = velocity (cm / sec)]. The postocclusion shear stress area under the curve (auc ss) was calculated from cuff release until the time of peak diameter [23, 24] and used to normalize fmd [fmd / auc ss]. Radial artery blood flow [rbf (ml / min) = blood velocity (cm / s) (radial diameter (cm)/2) 60] and mean intra - arterial blood pressure (map (mmhg)) measured at the baseline of each trial were used to calculate radial vascular conductance [rvc = rbf / map 100]. Two - way anova was used to analyze ra fmd responses with trial (drug infusion) as the within - subject (repeated measures) factor, group as the between - subject factor, and a group - by - trial interaction . Significance was determined at p 0.05 and a tukey post hoc adjustment was applied to significant main effect and interaction comparisons . A chi square test was used to compare the number of young versus older adults who exhibited decreased ra fmd from saline to l - nmma and then from l - nmma to ketorolac + l - nmma . Linear regression was performed to predict if the change in ra fmd from saline to l - nmma was explained by select independent variables . Characteristics for the young adults have been reported and are summarized in table 1 in comparison to older adults . Means for resting ra diameter, rbf, map, and rvc between age groups measured immediately following infusions of saline, l - nmma, and ketorolac + l - nmma are shown in table 2 . In older adults, ketorolac + l - nmma infusion increased (p <0.01) map compared with saline . The lack of a significant trial group interaction (p = 0.68) indicates that the map response to combined infusion did not differ from the increase (p <0.01) observed in young adults . One female participant in the older group was not included in the analysis between the l - nmma and ketorolac + l - nmma trials due to corruption of the video file during data acquisition . In older adults (n = 10) l - nmma infusion decreased ra fmd by 26.5 67.3% compared with saline (8.9 3.6% to 5.9 3.7%), although this was not statistically significant (p = 0.08) (figure 1(a)). Furthermore, the lack of a significant trial group interaction (p = 0.74) indicates that the ra fmd response to l - nmma infusion did not differ from the decrease (23.7 37.0%) observed previously in young adults (10.0 3.8% to 7.6 4.7%; p = 0.03) (figure 1(a)). Postocclusion auc ss did not differ between trials or age groups (figure 1(b)). Normalization to the shear stress stimulus abolished the effect of l - nmma in both groups (trial group: p = 0.75) (figure 1(c)). Individual ra fmd responses to l - nmma in young adults have been reported previously (figure 2(a)). Compared with saline, ra fmd in older adults was decreased (n = 6, range = 36123% decrease), augmented (n = 3, range = 10122% increase), or unaffected (n = 1, 0.4% increase) following l - nmma infusion (figure 2(b)). Relative to l - nmma, ketorolac + l - nmma infusion increased ra fmd by 1.0 70.1% (trial: p = 0.68) and 52.5 101.3% (trial: p = 0.52) for young and older adults, respectively (trial group: p = 0.38) (figure 1(a)). Shear stimulus normalization did not alter the effect of ketorolac infusion in either age group (trial group: p = 0.56) (figure 1(c)). Similar to the above, absolute ra fmd responses in older adults were no different (trial: p = 0.24) from saline (0.20 0.08 mm) following l - nmma (0.13 0.09 mm) and ketorolac + l - nmma infusion (0.14 0.13 mm). Individual ra fmd responses to combined infusion in young adults have been reported previously (figure 2(a)). Compared with l - nmma, ra fmd in older adults was decreased (n = 2, 83103% decrease), increased (n = 6, 34170% increase), or unaffected (n = 1, 2% decrease) following ketorolac + l - nmma infusion (figure 2(b)). Absolute ra fmd responses in young adults were decreased (trial: p = 0.01) from saline (0.21 0.08 mm) following l - nmma (0.15 0.07 mm) and ketorolac + l - nmma infusion (0.14 0.09 mm). There was no difference between age groups in the number of participants who exhibited decreased ra fmd from saline to l - nmma (p = 0.11) and l - nmma to ketorolac (p = 0.61). Linear regression, comparing the change in ra fmd from saline to l - nmma with select independent variables (i.e., age, total cholesterol, map, sbp, dbp, and bmi), did not reveal any statistically significant relationships when age groups were combined (all p> 0.15 for independent variables). The addition of age group into the model did not influence the results (all p> 0.27 for independent variables). The present findings agree with our previous observation that blocking no or pn synthesis does not uniformly reduce conduit artery ra fmd in healthy adults . Moreover, in older adults, substantial variability occurred in the magnitude and direction of shear stress - induced vasodilation in response to single and combined blockade of no and pn synthesis . The present ra data coincide with previous findings in healthy adults [8, 9], including recent data obtained in the brachial artery, further questioning the widespread assumption that conduit artery fmd following temporary distal ischemia is primarily no mediated [24, 6]. An age - related decline in fmd has been described in many studies [2527]. To our knowledge, our study is the first to investigate the impact of healthy aging on the contribution of no and pn to conduit artery fmd and adds to previous studies investigating the vasodilator pathways contributing to rest and exercise limb hyperemia in aged humans [1619]. We hypothesized that blocking no and pn would reduce ra fmd to a greater extent and more uniformly, in older versus younger adults indicating impairment of alternative or redundant vasodilator pathways however, in contrast to our hypothesis, blocking no and pn did not consistently reduce ra fmd in older adults . Specifically, only 22% (2 of 9) of older adults exhibited reductions in ra fmd to combined blockade (83103% decrease). In comparison, 44% (7 of 16) of adults ~40 years younger exhibited reduced ra dilation following ketorolac + l - nmma infusion (10115% decrease). Older adults exhibited substantial variability in the magnitude and direction of ra fmd responses following single and combined blockade of no and pn suggesting that redundant vasodilator pathways are present in healthy older adults and that aged arteries are able to compensate for loss of specific vasodilators . We observed that 9 of 16 young and 6 of 9 older adults exhibited an increase in ra fmd in response to combined pn and no blockade, indicating that non - no and pn mechanisms are able to compensate for the loss of these two vasodilators and further supporting the existence of redundant vasodilator pathways in humans . Alternatively, our observation of increased fmd in 6 of 9 older adults following combined no and pn blockade compared to l - nmma alone might suggest a vasoconstrictor role for pn which is consistent with previous findings . By inhibiting no and pn synthesis, it is assumed that the remaining dilatory response is attributable to edhf . However, the involvement of edhf was not directly tested in our study design . Furthermore, the contribution of additional vasodilators to endothelial responses in healthy adults, including cytochrome p (cyp)450 epoxygenases [30, 31], cannot be ruled out . Infusion of the specific cyp 2c9 inhibitor sulphenazole reduces ra fmd from 11.5% to 7.4%, demonstrating a role for cyp 2c metabolites in the fmd response . Single (l - nmma) and combined (sulphenazole + l - nmma) blockade lowered ra fmd to 6.0% and 3.9%, respectively, suggesting multiple, redundant pathways underlying shear stress - induced dilation . Redundancy occurs in the pathways contributing to the hyperemic response induced by ischemic exercise in young adults suggesting that redundant vasodilator systems are involved in the adequate delivery of blood to metabolically active tissues during exercise . Further support of the importance of redundant vasodilator pathways to cardiovascular function is demonstrated by the maintenance of resting and exercise - induced increases in coronary blood flow following administration of specific inhibitors of vasodilation in healthy men . The relatively robust ra fmd responses observed in healthy adults following no and/or pn blockade indicate that redundant vasodilator systems, which are likely beneficial for cardiovascular health [12, 14], compensate for the loss of specific vasodilators and that aging in the absence of additional cvd risk factors does not impair these vasodilator systems . Further research is warranted to determine if redundant vasodilator systems are impaired in clinical conditions associated with endothelial dysfunction . Currently, limited data exist regarding the mechanisms underlying endothelium - dependent dilation in individuals at increased risk for cvd . Patients with essential hypertension and heart failure, conditions characterized by the presence of endothelial dysfunction [34, 35], utilize edhf to maintain endothelium - dependent dilation through activation of the cyp450 epoxygenase pathway . However, edhf is insufficient in maintaining dilation to levels seen in healthy adults as evidenced by only partial compensation for impaired no bioavailability by edhf . Evidence that inhibition of cyp450 epoxygenases does not affect resistance vessel dilation in healthy older adults or conduit artery dilation in patients with essential hypertension suggests that partial compensation to impaired no bioavailability is dependent on the vascular bed and/or clinical condition studied . Whether the inability of the vascular system to compensate for the loss of specific vasoactive mediators, as observed in certain chronic disease states, underlies future vascular disease remains to be determined . We acknowledge that our observation of variable responses within individuals to drug infusion may be explained by factors other than the existence of redundant vasodilator pathways, including individual differences in drug sensitivity / metabolism, drug order effects, and the inherent variability of fmd testing . Furthermore, we cannot exclude the possibility that conduit artery fmd of older subjects may be altered by nonendothelium mediated mechanisms . In the present study, sodium nitroprusside was not infused to exclude potential differences in endothelium - independent dilation due to aging [25, 37], a finding not supported by others following administration of exogenous no donors [36, 38]. We did not perform an additional catheterization visit in older adults to test the effect of drug order on dilator responses due to a lack of statistically significant effects observed previously in young adults who participated in a reverse drug order trial (n = 8). Our existing data support the efficacy of the no and pn blockade in the present study . For example, we have previously reported that thromboxane b2, an indicator of platelet cyclooxygenase (cox) activity during whole blood clotting, dramatically decreased in a younger cohort following an identical combined infusion protocol demonstrating effective blockade of pn . Furthermore, doses of ketorolac were infused that equaled or exceeded those used previously to block pn [18, 20, 21]. Future studies should investigate whether infusion of a selective cox-2 inhibitor rather than our use of a nonselective cox inhibitor impacts endothelial function differently, an effect observed previously in hypertensives . Infusing acetylcholine would have directly confirmed the efficacy of nos inhibition . However, our infusion dose of l - nmma was equivalent or greater than the dose used in previous studies [4, 6, 18, 2022] and our observed decrease in ra vascular conductance following l - nmma infusion was similar to previous reports [4, 8, 9, 22, 4042] supporting that no synthesis was effectively blocked by l - nmma infusion in the present investigation . Future infusion studies are needed utilizing a larger number of participants and multiple trials with each drug to better understand the dependence of conduit artery fmd on specific vasodilators in humans and the impact that cardiovascular risk factors have on these vasoregulatory pathways . Single and combined blockade of no and pn synthesis did not consistently reduce ra fmd in older adults adding to the existing literature that no inhibition does not uniformly decrease conduit artery fmd in healthy humans . Rather, there is substantial variability in the individual ra response to nos inhibition suggesting a variable contribution of no to conduit fmd . Therefore, the persistent assumption that conduit fmd is primarily a no - dependent response limits our interpretation of findings regarding mechanisms both underlying and improving blunted fmd . Furthermore, a large proportion of older adults exhibited increased or minimally reduced ra fmd responses following combined no and pn blockade suggesting the existence of redundant vasodilator pathways and indicating that aging per se does not uniformly impair these pathways . Future studies are warranted to investigate if the collective influence of additional factors such as disease and/or lifestyle impacts the effect of age on conduit vasodilator pathways.
|
Bacterial activity has proved to be the main causative factor for placement and replacement of restorations . It was confirmed histologically that fermentative organisms remained viable under non - antispetic restorations for as long as 139 days and that only a portion of the tooth is sterile after termination of routine cavity preparation . Furthermore, bacteria present in the smear layer can multiply, allowing their toxins and degradation products to diffuse to the pulp resulting in irritation and inflammation . Bacterial penetration along the interface or nanoleakage is another concern, which was found to cause recurrence of caries . As infection beneath the restoration is considered a great threat to the pulp, the concept of toileting of the cavity is gaining wider acceptance with a variety of commercially available dentin disinfectants launched into the market . These dentin disinfectants are (amongst others) chlorhexidine (chx), benzalkonium chloride, iodine / copper sulfate, sodium hypochlorite (naocl) and/or antibiotic based . The ideal dentin disinfectant should combine the possession of a potent antimicrobial action and should not interfere with the bonding of the subsequently applied adhesive system . Furthermore, it should enhance the durability of the bond through the inhibition of the matrix derived enzyme (matrix - metalloprotease). The dental literature shows the association of dentin disinfectant application and bonding of subsequent applied adhesive system to be a controversial issue . Brackett et al ., and campos et al ., in their study have reported that the application of the dentin disinfectant did nt affect the initial bond strength, however it promoted the stability of the bond after 6 months service in vivo in bracket's et al . Thus, the selection of the disinfectant compatible with the bonding system is of great importance as any positive benefits would be negated if the antimicrobial action deteriorated the bonding efficacy . On the search on the most appropriate disinfectant to be applied prior to both etch - and - rinse and self - etch adhesive systems, this study was carried out to clarify the behavior of each of these antibacterial agents on the micro - shear bond strength (-sbs) of both etch - and - rinse and self - etch adhesive systems . The null hypothesis examined first; there is no differences in the -sbs between both etch - and - rinse and self - etch adhesives, second: there is no difference in the -sbs between control and differently disinfected dentin surfaces with both etch - and - rinse and self - etch adhesive systems . This study evaluated the effect of four contemporary dentin disinfectants; 5.25% naocl based; 2% chx based (consepsis, chx), 0.1% benzalkonium chloride based (tubulicid red, tr) and 3% doxycycline based (biopure, mtad) on the -sbs of both etch - and - rinse (adper single bond 2) and self - etch (clearfil s bond) adhesive systems . Materials used, composition, manufacturer and lot number one hundred sound human molars recently extracted and stored in physiologic saline at 4c for no more than 2 weeks, were used in the present study . After removal of the root portion, the molars, excluding the buccal surface, were embedded in self - curing acrylic resin (rapid repair, degudent gmbh, hanau, germany) by using a specially fabricated cuboidal teflon mold (3 cm 2 cm 1.3 cm). The buccal surfaces of the embedded molars were ground on a water cooled mechanical grinder (tf250, jeanwirtz, dsseldorf, germany) by using 180-grit abrasive paper to obtain flat superficial dentin surfaces with a clinically relevant smear layer . The specimens were randomly assigned to five groups according to the disinfectant used: group i: no disinfectant (control) the disinfectants were applied for 60 s then rinsed . Each group was further divided into two subgroups according to the adhesive system employed . In the first sub - group; the etch - and - rinse adhesive system, adper single bond 2, was used . The specimens were etched for 15 s with the phosphoric acid etchant followed by rinsing for 10 s then blotting excess water using a mini - sponge . Immediately after blotting, two consecutive coats of the bonding system was attempted for 15 s with gentle agitation using a fully saturated application followed by gentle air thinning for 5 s to evaporate the solvent . In the second sub - group; the self - etching adhesive system, clearfil s bond, was applied according to manufacturer's instructions which were the generous application of the bonding system for 20 s followed by drying with high pressure air flow for approximately 5 s. irises were cut from tygon tubing (r-3603, norton performance plastic co., cleveland, usa) with an internal diameter of 0.8 mm and a height of 0.5 mm . Light curing of the bonding resin was attempted for 10 s using elipar ii light curing unit (3 m espe, st . Resin composite, clearfil apx; shade a2, was packed into the cylinder lumen and a plastic matrix strip was placed over the resin composite and gently pressed flat and light - cured for 40 s. using a blade, the tygon tubes were removed after one hour storage at room temperature . This resulted in small cylinders of resin, approximately 0.8 mm in diameter and 0.5 mm in height bonded to the surface . After storage in distilled water for 24 h their -sbss were measured using a universal testing machine (lloyd instruments ltd . A wire of 0.2 mm diameter was looped around the resin composite cylinder, making contact through half its circumference and was gently held flush against the resin - dentin interface . The resin - dentin interface, the wire loop and the center of the load - cell were aligned as straight as possible to ensure the correct application of the shear force . Shear force was applied to each specimen at a cross - head speed of 0.5 mm / min until failure occurred . The two measured bond strength values obtained from each specimen were averaged to obtain one reading from each specimen (n = 10). Regression model with two - way analysis of variance (anova) was used to test the significance for the effect of bonding system and disinfectant and their interactions . Tukey's post - hoc test was used for pair - wise comparison between the means when anova test is significant . Statistical analysis was carried out using the spss 14.0 software (statistical package for scientific studies inc . After measuring the bond strength, each specimen was examined visually using a binocular stereomicroscope (nilson smz-10-japan) at 25 magnification to determine its mode of fracture . Failure modes were classified as adhesive: where the fracture site was located between the adhesive and the dentin, or mixed: where the fracture site included both adhesive failure at the interface and cohesive failure within the resin composite . This study evaluated the effect of four contemporary dentin disinfectants; 5.25% naocl based; 2% chx based (consepsis, chx), 0.1% benzalkonium chloride based (tubulicid red, tr) and 3% doxycycline based (biopure, mtad) on the -sbs of both etch - and - rinse (adper single bond 2) and self - etch (clearfil s bond) adhesive systems . One hundred sound human molars recently extracted and stored in physiologic saline at 4c for no more than 2 weeks, were used in the present study . After removal of the root portion, the molars, excluding the buccal surface, were embedded in self - curing acrylic resin (rapid repair, degudent gmbh, hanau, germany) by using a specially fabricated cuboidal teflon mold (3 cm 2 cm 1.3 cm). The buccal surfaces of the embedded molars were ground on a water cooled mechanical grinder (tf250, jeanwirtz, dsseldorf, germany) by using 180-grit abrasive paper to obtain flat superficial dentin surfaces with a clinically relevant smear layer . The specimens were randomly assigned to five groups according to the disinfectant used: group i: no disinfectant (control) the disinfectants were applied for 60 s then rinsed . Each group was further divided into two subgroups according to the adhesive system employed . In the first sub - group; the etch - and - rinse adhesive system, adper single bond 2, was used . The specimens were etched for 15 s with the phosphoric acid etchant followed by rinsing for 10 s then blotting excess water using a mini - sponge . Immediately after blotting, two consecutive coats of the bonding system was attempted for 15 s with gentle agitation using a fully saturated application followed by gentle air thinning for 5 s to evaporate the solvent . In the second sub - group; the self - etching adhesive system, clearfil s bond, was applied according to manufacturer's instructions which were the generous application of the bonding system for 20 s followed by drying with high pressure air flow for approximately 5 s. irises were cut from tygon tubing (r-3603, norton performance plastic co., cleveland, usa) with an internal diameter of 0.8 mm and a height of 0.5 mm . Light curing of the bonding resin was attempted for 10 s using elipar ii light curing unit (3 m espe, st . Resin composite, clearfil apx; shade a2, was packed into the cylinder lumen and a plastic matrix strip was placed over the resin composite and gently pressed flat and light - cured for 40 s. using a blade, the tygon tubes were removed after one hour storage at room temperature . This resulted in small cylinders of resin, approximately 0.8 mm in diameter and 0.5 mm in height bonded to the surface . After storage in distilled water for 24 h their -sbss were measured using a universal testing machine (lloyd instruments ltd . A wire of 0.2 mm diameter was looped around the resin composite cylinder, making contact through half its circumference and was gently held flush against the resin - dentin interface . The resin - dentin interface, the wire loop and the center of the load - cell were aligned as straight as possible to ensure the correct application of the shear force . Shear force was applied to each specimen at a cross - head speed of 0.5 mm / min until failure occurred . The two measured bond strength values obtained from each specimen were averaged to obtain one reading from each specimen (n = 10). Regression model with two - way analysis of variance (anova) was used to test the significance for the effect of bonding system and disinfectant and their interactions . Tukey's post - hoc test was used for pair - wise comparison between the means when anova test is significant . Statistical analysis was carried out using the spss 14.0 software (statistical package for scientific studies inc . After measuring the bond strength, each specimen was examined visually using a binocular stereomicroscope (nilson smz-10-japan) at 25 magnification to determine its mode of fracture . Failure modes were classified as adhesive: where the fracture site was located between the adhesive and the dentin, or mixed: where the fracture site included both adhesive failure at the interface and cohesive failure within the resin composite . The mean -sbs values and their respective standard deviations for the different groups are presented in tables 3 . Results revealed that the bonding system had a statistically significant effect on the mean values whereas the disinfectant had no statistical significant effect on the mean . The interaction between the two variables had an effect on the mean values [table 2]. Regression analysis for the different variables mean and standard deviations of micro - shear strength values in mpa of all tested groups in general, use of disinfectants increased the bond strength when clearfil s bond was used compared with the control specimens . Naocl prior to the use of clearfil s bond recorded the highest mean bond strength followed by the tr, chx and mtad . This is contrary to the use of disinfectants with adper single bond 2 which led to the decrease of the bond [table 3]. Chx and mtad in conjunction with adper single bond 2 recorded values that were lower than the control specimens bonded with adper single bond 2 only . Tr and the percentages of the fracture modes observed with all tested groups are presented in table 4 . The predominant mode of failure with adper single bond 2 adhesive system groups was adhesive . The clearfil s bond adhesive system groups showed mixed mode of failure, with the higher percentage with naocl . In the present study assessment the effect of application of four different disinfecting agents on bond strength of an etch - and - rinse and self - etch adhesive systems was carried out using -sbs testing . Micro - shear test generates less stress or damage during preparation of specimens compared to the micro - tensile alternative . In addition, this simple test allows conservation of teeth with regional and depth profiling of a variety of substrates . The results of this in vitro study support the rejection of the null hypothesis that there is no difference in the -sbs between the self - etch and etch and rinse adhesives when bonded to superficial dentin pretreated with various dentin disinfectants and extend to support the second null hypothesis that the bond strength is not affected by the use of disinfectants . The self - etching, clearfil s bond, showed no statistically significant difference compared to the etch - and - rinse, adper single bond 2, in the control group and significantly higher bond strength in all the rest groups . Furthermore higher percentage of mixed mode of failure was depicted in clearfil s bond groups . Clearfil s bond is a mild self- etch adhesive with a ph 2.7, thus the hybrid layer is comprised of partially naked collagen fibrils, allowing the remaining hydroxyapatite crystals to act as good candidates for additional intermolecular interaction with the 10-methacryloyloxydecyl dihydrogen phosphate (mdp) monomer creating a chemical bond, allowing for the two - fold bonding mechanism; micromechanical and chemical bonding . Thus deduction in the bonding efficacy resulting from the reduction in the micromechanical interlocking capacity was compensated with the chemical bonding capability . In addition, the calcium salt created by the phosphate monomer is highly insoluble, allowing more stable and intense molecular adhesion, according to the adhesion - decalcification concept . Accordingly, the superior bonding performance of functional monomers might be reflected in their actual capacity for adhesive bonding to dentin . Naocl is one of the most commonly used cavity disinfectant in clinical practice, not only to its well - known antibacterial action, but also to its wettability property . Naocl surface pretreatment enhanced the bond strength of self - etch adhesive clearfil s bond . This findings correlates with the results of fawzy et al ., who reported that pretreatment the dentin surface with naocl significantly increased the bond strength of the self - etching adhesive, adhes . This could be attributed to the non - specific proteolytic capability of naocl which can remove the organic components effectively at room temperature . Since the smear layer composition is similar to the originating tissue (50 volume% mineral and 30 volume% collagen), the application of the naocl over the smear layer covered dentin would eliminate its collagen phase resulting in reduction in the smear layer compactness . This property enhanced the bonding of the self - etching adhesive examined as it might have increased the diffusively of the acidic monomers, through water - filled channels between particles of smear layer enlarging them to reach and interact with the underlying dentin surface . As it is reported by several authors that the minimal aggressiveness of this ultra - mild self - etching adhesive makes it extremely sensitive in penetrating smear layers of different thickness and compactness . From a crystallographic view point, eliminating the organic component makes the dentin surface richer in hydroxyapatite crystals thus enhancing the chemical bonding component of this adhesive system . ., and santos et al ., who reported that naocl negatively affected the bond strength of clearfil se bond, the difference in the methodology, dentin substrate and bonding material generation could be the reason for dissimilar results . On the other hand, the use of naocl reduced the bond strength to the adper single bond 2 which could be due to the sensitivity of such adhesive system to the oxidizing effect of naocl . The results are again in contrary with ercan et al ., who found that naocl did not affect sbs of the etch and rinse adhesive, prime and bond nt . Benzalkonium chloride is a nitrogenous cationic surface - acting agent containing a quaternary ammonium group . It has three main uses; an antimicrobial agent, as a cationic surfactant and a matrix metalloprotease inhibitor . The results of the present study revealed that the use of tr enhanced the -sbs of the self - etch adhesive, clearfil s, compared with the control group, yet it did not reach that obtained by naocl . This could be attributed to its compositional constituent of edta, which might have led to the partial removal of the smear layer, which could have enhanced the interaction of the applied self - etch adhesive system with underlying dentin substrate . In contrary, it negated the bonding of etch - and - rinse adhesive, as its compositional constituent of benzalkonium chloride and sodium fluoride might have been incorporated in the remaining part of smear layer increasing it resistance to phosphoric acid etching, thus hindering the permeation of adper single bond 2 monomers ., whom found that tr negated the sbs of self - etching adhesive, clearfil se bond, whereas did not affect the bonding of the etch - and - rinse adhesive, prime and bond nt . The results of the present study revealed that chx pretreatment enhanced the bonding performance of the self - etch adhesive examined . This finding is in line with study by pilo et al ., who reported that pretreating the dentin surface with chx improved the bond strength of self - etch adhesive systems . Several theories can be hypothesized to explain the mode of action of chx; first; the changes encountered in the smear layer . Scanning electron microscope examination by meiers and kresin showed that chx modified the appearance of the smear layer by removal of the loose smear debris . This could have enhanced the penetration of the acidic monomers of the self - etch adhesive . Second; the strong positive ionic charge that ready binds to phosphate groups of dentin surfaces could have increased the surface energy of dentin, thus increasing dentin - wetting ability of primers . Third; this could be attributed to the possible stabilizing effect exerted on the smear layer turning it from a semi - permeable, loosely bound layer to a firmly bond layer, thus minimizing the convective and evaporative water fluxes from the underlying dentin, thus enhancing the bonding capacity of the self - etch adhesive . On the other hand, using chx before acid etching negated the bonding of the etch - and - rinse alternative . This is in agreement with grgan et al ., who found that application of chx before acid etching significantly reduced the bond strength . As any possible positive effect from its charge or composition would be negated by the etching and rinsing step . Furthermore that possible stabilizing effect which is considered pros for the self - etch adhesive is considered a con for the etch - and - rinse alternative, as the smear layer became resistant to the phosphoric acid etching . However, this result is in contrary with soares et al ., and brackett et al . Whom reported that using chx with etch - and - rinse adhesives either enhance or not affect the bonding mechanism . This contrary could be due to the difference in the protocol of applications, as in their studies chx was applied after the etching step . Mtad is a doxycycline based disinfectant, it has a potent antimicrobial and a matrix metalloproteinase inhibitory action . It contains both the doxycycline and citric acid, that remove the smear layer and demineralize the under lying dentin by a synergistic effect . The acidic doxycycline liberates calcium and phosphate ions, while the citric acid binds the calcium ions . Although the removal of the smear layer enhanced the bonding of the clearfil s bond compared to the control group, it showed significantly lower bond strengths compared with naocl group . This could be attributed to its mild demineralization effect allowing less calcium ions to be available for chemical bonding . However, the use of mtad negatively affected the bonding of the etch - and - rinse adhesive, as its mild etching effect followed by the phosphoric acid etching may have led to increase the depth of demineralization which was not compatible with the depth of resin monomer infiltration . This result is in agreement with stanislawczuk et al ., who found that 2% doxycycline jeopardize the bond strength and quality of hybrid layer of the etch - and - rinse adhesive systems, prime and bond nt and adper single bond 2 . Under the limitation of this in vitro study it can be concluded that: the self - etching adhesive, clearfil s bond, provide prompt bonding to dentin treated with different disinfectants compared with, adper single bond 2, the etch - and - rinse adhesive alternative.the use of the tested dentin disinfectants before the acid etching step negated the bonding performance of the tested etch - and - rinse adhesive . The self - etching adhesive, clearfil s bond, provide prompt bonding to dentin treated with different disinfectants compared with, adper single bond 2, the etch - and - rinse adhesive alternative . The use of the tested dentin disinfectants before the acid etching step negated the bonding performance of the tested etch - and - rinse adhesive.
|
Flurodeoxyglucose (f - fdg) positron emission tomography / computed tomography (pet / ct) has become the imaging modality of choice for initial staging, follow - up and treatment response assessment in patients with hodgkin's lymphoma and has proved superior to contrast enhanced ct (cect) in these settings . F - fdg pet / ct has accuracy of almost 100% in diagnosing primary splenic involvement during initial staging of lymphoma . However, in the post - therapy setting its role for evaluation of secondary splenic involvement is limited . One of the pattern of splenic activity that help to detect splenic involvement on pet / ct is diffusely increased f - fdg uptake greater than that in the liver and bone marrow with or without corresponding ct lesions . In this context, we report a case of a patient with hodgkin's lymphoma in remission presenting with f - fdg avid splenomegaly . The present case report is about a 22-year - old male patient who presented with enlarged right cervical lymph node . F - fdg pet / cect performed for staging revealed metabolically active lymph nodes on either side of the diaphragm [figure 1a, broken arrows], enlarged spleen with multiple hypodense hypermetabolic, lesions [figure 1a, arrow] (suvmax= 9.4; spleen suvmax / liver suvmax ratio = 3.76) and bone lesion . He was then given 6 cycles of chemotherapy and f - fdg pet / cect was done for response evaluation . Pet / ct showed complete metabolic response, with normal spleen uptake [figure 1b, arrow] (spleen suvmax= 2.5, liver suvmax= 2.6 s / l ratio = 0.96). At 1-year later routine follow - up the patient complained of mild fever, lethargy and listlessness . In view of previous history of hodgkin's lymphoma, pet / ct revealed enlarged spleen with diffusely increased fdg uptake [figure 2a c, arrow] (suvmax= 5.3; liver suvmax= 2.3 s / l ratio = 2.30). The first differential in the given clinical scenario was splenic relapse of lymphoma, however, a second differential diagnosis of some infective / inflammatory process was considered . On further evaluation, peripheral smear showed evidence of malaria parasite infection (plasmodium vivax). Follow - up pet / ct after 7 months revealed normalization of size and f - fdg uptake of spleen [figure 2d, arrow] (suvmax= 3.0; liver suvmax= 2.7 s / l ratio = 1.1). Hence, malaria and other relevant (endemic) infective possibilities (kala - azar etc .) Should be considered and further investigation, if warranted, should be advised . F - flurodeoxyglucose (f - fdg) positron emission tomography/ computed tomography (pet / ct) done for staging and response evaluation . (a) staging maximum intensity projection (mip) pet image showing multiple metabolically active lymph nodes in thorax, abdomen and pelvis (broken arrows) with splenic (arrow) and bone lesion (left femur). (b) mip pet image done for response evaluation demonstrates complete metabolic response with normal splenic fdg uptake (arrow). Physiological gastric fdg uptake noted (bent arrow) f - flurodeoxyglucose (f - fdg) positron emission tomography / computed tomography (pet / ct) done for recurrence detection and follow - up . (a - c) follow - up pet / ct performed 1 year after chemotherapy showing enlarged spleen with diffusely increased fdg uptake (arrow). (d) maximum intensity projection pet image performed after anti - malarial therapy, showing normalization of size and fdg uptake of spleen (arrow). (a and d) focal fdg uptake noted in the pelvis is due to urinary fdg activity in the left ureter (curved arrows) pet / ct is a useful modality for staging and restaging of hodgkin's lymphoma with high sensitivity and specificity . Furthermore, it is a sensitive modality for early detection of relapse in asymptomatic patients making surveillance f - fdg pet / ct clinically important . Splenic uptake on f - fdg pet can be due to a wide variety of causes such as lymphoma, anemia, granulocyte colony stimulating factor treatment, beta - thalassemia, inflammation and infections . Splenic uptake, greater than hepatic uptake, is a relatively reliable indicator of lymphomatous involvement of the spleen, in the absence of recent cytokine administration . In early stage hiv infection, diffusely increased splenic uptake is noted due to reactive stimulation of b - cells in the spleen . Post - therapeutic reactive splenic uptake is also noted after administration of granulocyte colony - stimulating factor for myelosuppression or high - dose interferon - alpha-2b adjuvant therapy for melanoma . Until date, only a single report by liu et al . Have demonstrated f - fdg uptake in spleen in case of malaria.
|
Superficial leiomyosarcomas are rare malignant tumors that account for only 510% of all soft tissue sarcomas . They can be subdivided into two types according to its primary site of origin: deep subcutaneous and superficial cutaneous types . Primary cutaneous leiomyosarcoma (pcl) is a rare subtype with few isolated case reports and occasional case series described in the literature . We report the clinical, histopathological and immunohistochemical findings in a 70-year - old male patient with pcl arising in the right leg . A 70-year - old male patient presented with a painful nodule in the right leg, which had been progressively increasing in size for 4 months . On palpation, an irregular, firm, tender exophytic swelling, measuring 5 cm 5 cm, with overlying skin showing ulceration was noted on the lateral aspect of the lower one third of the right leg [figure 1a]. His past history was significant of a trauma and subsequent non - healing ulcer formation at the same site in the right leg . (a) clinical photograph showing an irregular, exophytic swelling, measuring 5 cm 5 cm, with overlying skin showing ulceration on the lateral aspect of the lower one - third of the right leg . (c) gross photograph showing greyish white, solid, homogenous and fleshy cut surface of the irregular tumor mass measuring 5 cm 5 cm 2.5 cm systemic examination and investigations, including complete blood count, fasting blood sugar level, liver function test and renal function test, were within normal limits . Hepatitis b virus surface antigen and human immunodeficiency virus enzyme - linked immunosorbent assay were non - reactive . A clinical diagnosis of squamous cell carcinoma was considered and fine needle aspiration cytology of the swelling was requested . Fine needle aspiration cytology of the same was reported as a spindle cell neoplasm with suspicion of malignancy . The swelling was excised with a 5 cm resection margin and submitted for histopathological examination [figure 1b]. Gross inspection revealed a grey brown, irregular, nodular soft tissue mass, measuring 5 cm 5 cm 2.5 cm and partly covered with skin . The cut surface of the mass was greyish white, solid, homogenous and fleshy [figure 1c]. The neoplasm was composed of bundles of elongated spindle cells arranged in interlacing fascicles, with intensely pink, fibrillary cytoplasm and pleomorphic nuclei with coarse irregularly dispersed chromatin . Mitosis, including atypical, amounting to 22 mitotic figures per 10 high power fields and multinucleate tumor giant cells, was evident . (a) light microscopy revealed a dermal neoplasm with extension into the subcutaneous tissue (h & e, 40). (b) neoplasm composed of interlacing fascicles of elongated spindle cells (h & e, 100). (c) tumor cells are spindle shaped with intensely pink, fibrillary cytoplasm and pleomorphic hyperchromatic nuclei frequently exhibiting atypical mitosis (black arrow) (h & e, 400). (d) tumor cells with markedly pleomorphic nuclei and multinucleate tumor giant cell (inset) (h & e, 400) a provisional diagnosis of spindle cell malignant neoplasm of the skin, which typically includes a host of diagnostic possibility, namely fibrosarcoma, leiomyosarcoma, malignant peripheral nerve sheath tumor, monophasic synovial sarcoma, malignant fibrous histiocytoma and spindle cell variant of squamous cell carcinoma, was considered and immunohistochemistry was advised for confirmation . On immunohistochemistry, tumor cells showed strong immunopositivity for vimentin, muscle - specific actin (msa), smooth muscle actin (sma), caldesmon and desmin and negative for pancytokeratin, epithelial membrane antigen (ema), myogenin, cd34 and s-100 protein [figure 3]. Immunohistochemical staining: neoplastic cells showing positive immunostaining for (a) vimentin (vimentin, 400), (b) caldesmon (caldesmon, 400), (c) muscle - specific actin (msa, 400) and (d) smooth muscle actin (sma, 400) based on the immunophenotypic features, a final diagnosis of pcl was rendered . The patient is currently on periodic follow - up since 1 year and no recurrence or metastasis has been identified so far . Although pcl most commonly arises in the extremities, particularly hair bearing surfaces, it may occur at any anatomic site on the body . Most case series described in the literature report a predilection for the middle aged to elderly male . In a large case series reported by fields and helwig, 95% of the patients with pcl presented with a solitary nodule with a median size of 1.8 cm at presentation . Pain was reported by 24% of their patients at presentation, whereas pain could be elicited on pressure in an additional 27% of the patients . Histologically, pcl is characterized by a poorly circumscribed proliferation of interwoven fascicles of spindle shaped atypical myomatous cells that merge with a collagenous stroma . Mitosis, equivalent to one or more per 10 high - power fields, high cellularity and bizarre myomatous cells are the generally accepted criteria for malignancy . Described two growth patterns: a nodular pattern characterized by high cellularity, prominent nuclear atypia, conspicuous mitosis and a diffuse pattern that is less cellular, well differentiated and inconspicuous mitosis . Morphologic differential diagnosis includes a galaxy of other malignant spindle cell neoplasms, namely desmoplastic malignant melanoma, spindle cell synovial sarcoma, spindle cell angiosarcoma, fibrosarcoma, malignant fibrous histiocytoma and malignant peripheral nerve sheath tumor . Cutaneous leiomyosarcoma often exhibit immunophenotypic polymorphism, thereby mandating the use of a large panel of antibodies . However, none of these markers is absolutely specific for smooth muscle, and positivity for two of these markers is more supportive of leiomyosarcoma . Jensen et al . Identified several poor prognostic factors, namely tumor size 5 cm, acral location, deep localization with fascia involvement and high histological grade . Cutaneous leiomyosarcomas have fewer incidences of local recurrence (30 - 50%) and negligible potential for distant metastases (010%). In contrast, subcutaneous leiomyosarcomas may develop local recurrence in about 4060% and distant metastasis in 2060% of patients . A wide local excision with a 35 cm margin is usually an effective treatment for pcl ., pcl is a rare entity that must be borne in mind when encountered with a malignant spindle cell neoplasm of the skin and usually requires a panel of immunohistochemical markers to distinguish it from other cutaneous malignancies with spindle cell morphology.
|
In some beyond li - ion battery concepts, li metal is used as the anode, e.g., in li / air, li / sulfur, and some redox flow batteries . Li metal benefits from a high theoretical specific capacity (3860 ma h g), low density (0.59 g cm), and the lowest negative electrochemical potential (3.04 v vs the standard hydrogen electrode) leading to high theoretical energy densities . Nevertheless, safety issues related to the formation of li dendrites in cells with liquid electrolytes has stymied commercialization of rechargeable high energy batteries with li - metal anodes . Because of these safety issues, there is renewed interest in the use of solid electrolytes either in all solid - state devices with li - metal anodes or to protect the li - metal anodes in a hybrid system that also utilizes a liquid electrolytic solution . Garnets based on li7la3zr2o12 (llzo), which show high li - ion conductivities and excellent chemical and electrochemical stability including apparent stability against reduction by li metal, in particular, are exceptionally well suited for use as a protective layer to enable li - metal based battery concepts . Llzo garnets crystallize in a highly conductive cubic modification (sg: ia3d, no . 230) and a less conductive tetragonal polymorph (space group (sg): i41/acd, no . The former is stabilized at room temperature (rt) by supervalent substitution at the li, la, or zr position in llzo . The most promising, and extensively studied, supervalent cations are al and ga, generally substituted on the li sites . Much experimental and theoretical effort has been expended to elucidate the site preferences of al and ga and their influence on li - ion dynamics / conduction in llzo garnets . Additionally, it has been shown that the li - ion conductivity of llzo stabilized with ga is twice that compared to llzo stabilized with al . In order to understand this behavior better, cubic llzo was synthesized by simultaneous substitution of al and ga in different ratios . In the corresponding li nmr line shape measurements an increase in li - ion dynamics with increasing ga is observed, as yet the origin of this phenomenon remains, however, unexplained . A possible explanation was found by some recent investigations on single crystals of li73xalxla3zr2o12, with x = 0.10.4 and li73ygayla3zr2o12, with y = 0.10.6 by means of single crystal x - ray diffraction (sc - xrd). It was demonstrated that ga - stabilized llzo crystallizes in the acentric non - garnet cubic space group i43d, no . 220, in contrast to llzo (see figure 1 for structural details). (a) crystal structure of cubic llzo with space group ia3d (no . 230). Blue dodecahedra (24c), tetrahedrally coordinated (24d) sites represented by red spheres, octahedrally coordinated (48 g) sites represented by yellow spheres, and distorted 4-fold coordinated (96h) sites represented by orange spheres . (c) crystal structure of cubic llzo with space group i43d (no . 220). Blue dodecahedra (24d) are occupied by la, green octahedra (16c) by zr . Li are distributed over three sites, two tetrahedrally coordinated sites 12a and 12b (equivalent to 24d in ia3d)) represented by red and orange spheres, respectively, and octahedrally coordinated (48e) sites represented by yellow spheres . It was shown that the new space group provides a different li - ion diffusion mechanism leading to faster li - ion dynamics as shown by nmr relaxometry experiments, recently . The reasons for the phase transition and the relationship to the macroscopic electrochemical properties, such as bulk (bulk) and grain boundary (gb), li - ion conductivity, activation energy (ea), area specific resistance (asr), and microstructure, were, however, not fully understood . Toward this end, in this work we combine powder x - ray powder diffraction (pxrd), sc - xrd, and neutron powder diffraction (npd) to characterize samples through simultaneous refinement of the diffraction data . This combination of techniques helped us to obtain a detailed description of the crystal structure . Scanning electron microscopy (sem) was used to investigate the microstructure as a function of the al: ga ratio . Impedance spectroscopy (is) measurements using both nonblocking electrodes (li) and blocking electrodes (ti|pt) covering a wide temperature range (120 to 40 c) were used to characterize li - ion transport and to study solid - state electrochemical properties . Finally, we used density functional theory (dft) calculations to explain the decrease in activation energy observed with ga substitution by carefully examining changes in the energy landscape . We show that, via lattice engineering with ga substitution at optimized crystallographic sites, the activation energy of ionic conduction can be tailored for higher ionic conduction both in the bulk and at the interfaces . Synthesis of li6.4al0.2xgaxla3zr2o12 garnets, with x = 0.00, 0.05, 0.10, 0.15, and 0.20, was performed by a high - temperature sintering route according ref (18). The starting materials were li2co3 (99%, merck), la2o3 (99.99%, aldrich), zro2 (99.0%, aldrich), al2o3 (99.5%, aldrich), and ga2o3 (99.0%, aldrich). Carbonates and oxides in the stoichiometry of the desired composition with a 10% excess of li2co3 were intimately ground together using a hand mortar, a pestle, and isopropanol . This mixture was pressed uniaxially to form pellets, placed into a corundum crucible, and heated to 850 c for 4 h with a heating rate of 5 c / min . To avoid undesired contamination with al from the crucible afterward the furnace was shut down and the sample allowed to cool down naturally in the furnace to approximately 200 c . For the second and final step, the samples were milled in isopropanol in a fritsch pulverisette 7 ball mill for 2 h (12 times 800 rpm for 5 min + 5 min break). Finally, the powder was isostatically pressed (24 kbar) to form pellets and sintered at 1230 c for 6 h, with a heating rate of 20.5 c / min, and were allowed to cool down to rt . To avoid incorporation of al from the crucible, the samples were again placed on a pellet of pure llzo . To suppress formation of extra phases due to li loss during sintering after synthesis, samples were immediately packed under argon to avoid any contact with moisture from the air (for sc - xrd measurements only). Pxrd measurements were performed on powders from the crushed pellets used for sc - xrd with a bruker d8 davinci design diffractometer (280 mm goniometer radius, lynxeye solid state detector, primary and secondary side soller slits, cu k radiation, collection range 10120 2). For lattice parameter refinements using the program topas v2.1 (bruker axs), phase pure material was mixed with silicon as an internal standard (a = 5.43088). For pxrd studies the remaining samples used for scxrd were used . Sc - xrd data were collected on a bruker smart apex ccd - diffractometer using mo k radiation . Small single crystals up to 150 m were selected from the crushed pellets after synthesis and sealed into glass capillaries to avoid prolonged exposure to humidity . Intensity data were collected on samples within 48 h of their synthesis, using graphite - monochromatized mo k x - radiation (50 kv, 30 ma). The crystal - to - detector distance was 30 mm, and the detector was positioned at 30 and (for some points) at 50 2 using an -scan mode strategy at four different positions (0, 90, 180, and 270) for each 2 position . 630 frames with = 0.3 were acquired for each run . With this strategy, data in a large q - range up to minimum d - values d = 0.53 could be acquired . Three dimensional data were integrated and corrected for lorentz, polarization, and background effects using the apex2 software (bruker, 2012). Structure solution (using direct methods) and subsequent weighted full - matrix least - squares refinements on f were done with shelx-2012 (sheldrick, 2008) as implemented in the program suite wingx 2014.1 (farrugia, 2012). Several crystallographic positions show a mixed occupancy with li, al, and ga and vacancies . To overcome this ambiguity, special restrains were chosen: for the ga rich samples with space group i43d, al was put onto the 12a position, while ga was allowed to distribute over 12a and 12b positions, together with li; assuming full occupancy of 12a and 12b sites yields slightly to low ga contents, so vacancies were introduced until the refined ga content met the one obtained from edx analysis . A similar approach was used for samples with sg ia3d; however, here the ga and al were directly fixed onto 24d positions while the li content was freely refined . More details on single crystal structure refinements can be obtained from cifs with csd numbers: 430571 (llzo: al0.20ga0.00), 430574 (llzo: al0.15ga0.05), 430575 (llzo: al0.10ga0.10), 430576 (llzo: al0.05ga0.15), and 430603 (llzo: al0.00ga0.15). The densities of pellets are calculated from the diameter, thickness, and weight of the obtained pellets . Theoretical densities of pellets are calculated from the cell parameters from the sc - xrd measurement . The remaining samples used for sc - xrd were ground and used for npd studies . The neutron diffraction experiments were done at the institut laue - langevin, ill, in grenoble (france). Powder diffraction data were acquired in constant wavelength mode (= 1.5441) using the d20 diffractometer on 5 g batches contained in 14 mm diameter vanadium sample cans at 298 k. experiments were performed in the range 5.8 2 159.7, step width 0.04. an absorption correction was applied to the neutron diffraction data . Hastings pseudo - voigt function corrected for axial divergence, in conjunction with the d20 resolution function, was used to model peak shape . After satisfactorily refinement of neutron powder and sc - xrd data, the both data sets were joined together, and simultaneous refinements were performed, the results are discussed in text and tables . During mixed refinement, the ga content (when present) was fixed to the value obtained from edx analysis for all refinements, while the li and al content was allowed to freely refine for the ia3d structure . For sample llzo: al0.05ga0.15, both the ga and al contents were fixed to the edx values, assuming that they occupy the li1 site only as evidenced from sc - xrd data, while the li content was allowed to adjust unconstrained . For sample llzo: al0.00ga0.20 no stable refinements could be achieved putting al or ga onto the interstitial li3 site . In particular, we put emphasis on the investigation of the grain size, morphology, and phase composition, and the al and ga content using a backscattered electrons detector (bse) and energy - dispersive x - ray spectroscopy (edx) measurements, respectively . Is (impedance spectroscopy) measurements were carried out to investigate li - ion conductivities . Pt thin films were sputter deposited with a thickness of 200 nm on top of ca . 10 nm ti (used to improve the adhesion between the sample and the electrode). For the is measurements a novocontrol alpha analyzer was used in the frequency range of 3 10 to 10 hz . A julabo f-25 he circulator was used for cooling and partly also heating the samples under investigation . Set temperatures between 12 and 25 c (partly 40 c) were used, leading to true sample temperatures from ca . 8 to 36 c . In the following, true sample temperatures, measured by a thermocouple, an additional impedance spectrum was recorded for a li / garnet / li sample at room temperature in an ar glovebox . For this, metallic lithium was first applied on the surfaces of the pellet, and the pellet was sandwiched with two lithium foil disks in a swagelok type cell . Impedance data down to 120 c were recorded with a novocontrol concept 80 spectrometer that is connected to a quatro cryo system and equipped with a zgs active sample cell (novocontrol). A single ga or al ion was placed onto the 24d site of the ia3d crystal structure with parameters taken from sc - xrd measurements, and then an enumeration algorithm was used to generate structures with one li placed into each of the distinct remaining sites (i.e., 24d, and 96h). Ernzerhof (pbe) generalized - gradient approximation (gga), implemented in the vienna ab initio simulation package (vasp). The projector augmented - wave (paw) method is used for representation of core states . An energy cutoff of 520 ev and a k - point density of at least 1000/(number of atoms in the unit cell) was used for all computations, with a background charge added to compensate for the lack of li . During the relaxation the structures with the li in an octahedral site always relaxed to the nearest tetrahedral site in good agreement with previous calculations . The total energy difference between structures with li in the tetrahedral site closest to and farthest from the supervalent cation was calculated (see below). For the sake of simplicity, samples with formula li6.4al0.2xgaxla3zr2o12 are denoted llzo: al0.20xgax . First, the microstructure as a function of the al: ga ratio was investigated . Back scattered electron (bse)sem micrographs of the polished pellets are shown in figure 2 . Since bse is sensitive to the atomic number, phases with different compositions can be easily distinguished . No composition other than llzo was observed, which is in agreement with pxrd and npd data . The increase of ga in llzo: al0.20xgax is correlated with a denser studded microstructure with better connected grains and smaller pores . In contrast, the increase of al leads simultaneously to more pronounced separation of grains and increased grain sizes (up to 200300 m). The relative theoretical density for all samples is, however, almost the same and amounts to 85.0(3)% . The al and ga content (al: ga) of li6.4al0.2xgaxla3zr2o12, with x = 0.00, 0.05, 0.10, 0.15, and 0.20, measured by edx is 0.19:0.00, 0.14:0.05, 0.12:0.08, 0.07:0.14, and 0.00:0.21, respectively (see also table 1). Bse - sem image of polished embedded pellets of li6.4al0.2xgaxla3zr2o12; from left to right, x = 0.00, 0.05, 0.10, 0.15, and 0.20 . Lattice parameter a0 is given in; site occupation values in atoms per formula unit (pfu). Polycrystalline samples of llzo: al0.20xgax with x = 0.000.20 were obtained from the pellets and used for the structure determination (xrd, sc - xrd, npd). Analysis of systematic extinctions of bragg peaks in the single crystal data sets of the al - rich compositions unambiguously yield the common garnet space group ia3d for llzo: al0.20ga0.00, llzo: al0.15ga0.05, and llzo: al0.10ga0.10 . For compositions llzo: al0.05ga0.15 and llzo: al0.00ga0.20, the acentric space group i43d was observed as described in detail by wagner et al . The li - ion distribution as well as the lattice parameter as a function of the proportion of ga is illustrated in figure 3 . Lattice parameter (a0) (a) and li site distribution (b) in li6.4al0.2xgaxla3zr2o12, with x = 0.00, 0.05, 0.10, 0.15, and 0.20 . On the basis of single crystal structure refinements of samples synthesized under the specific conditions as set out in the experimental section it is assumed that in sg ia3d al and ga is enriched on the tetrahedral 24d sites in llzo; the 16a site is fully occupied by zr, and the 24c site contains la and a small amount of vacancies . With increasing ga content the amount of vacancies on 24c tends to decrease; there is, however, no clear picture from xrd data . In combined refinements,> 0.10 pfu a change in space group symmetry to i43d is observed . For the latter sg there is strong evidence that ga and al are enriched onto the tetrahedral 12a site; this is observed in both single crystal x - ray diffraction and data from combined refinement (sc - xrd and npd) and supported by dft calculations . The concentration of vacancies seems to be lower on 12a and 12b sites in i43d sg as compared to ia3d . In addition to the tetrahedral site(s), li is also found on 96h and 48e positions, respectively . Consequently, the overall content of li is right above the ideal value of 6.40 pfu for 0.20 pfu trivalent cations substituted . However, considering the lower la content (according to simultaneous refinement of diffraction data), the li content is in good agreement according charge neutrality . Moreover, an increase of li occupation at the 24d site is observed . This behavior was suggested to be responsible for the decrease in electrochemical performance . In the present study, however, electrochemical properties seem to be improved by the li occupation behavior observed (see below). The replacement of al by ga slightly increases the lattice parameter a0, and this finding is evident from the single crystal data . The change of symmetry, however, is not well pronounced in the variation of lattice parameters within the compositions . In order to investigate the influence of space group and microstructure on b, gb, and ea, impedance spectra were measured using blocking electrodes (ti|pt) for all compositions at temperatures between 120 and 40 c . Impedance spectra of li6.4al0.2xgaxla3zr2o12 (x = 0.00, 0.05, 0.10, 0.15, and 0.20) samples at 20 c (a), 80 c (b), and dotted fit / simulation lines (equivalent circuit: rb cpeb rel cpeel) are included . Data reflects resistivity (normalized to the sample area and thickness). At 20 c, all samples show a more or less complete high frequency semicircle followed by a strong increase of the imaginary part of the impedance toward low frequencies with an almost constant angle in the complex impedance plane . The semiarcs can be fitted by a constant phase element (cpeb) in parallel to a resistance element (rb). The capacitance cb calculated from the fit parameter qb and n (c = (rq)) is in the pf range (refined from the equivalent circuit) and the calculated relative permittivity is about 40 . Taken together these data suggest the high frequency arc is attributed to a bulk process . The low frequency spike is well separated from the high (or intermediate arc at lower temperatures see below) and can be attributed to the interface with electrodes . In a certain frequency range adding another rel - cpeel element (or cpeel only at lower temperatures) improves the fit . This electrode equivalent circuit helps with analysis of the sample - specific high frequency features but does not imply any mechanistic information . No indications of fast or resistive grain boundary contributions are observed at ambient temperatures . However, as the temperature decreased below 20 c a slightly depressed semiarc at intermediate frequencies was observed in the plots . In some cases this intermediate arc could be fitted by another serial rgb - cpegb element . Due to the large uncertainty in the capacitance cgb of the intermediate arcs (10 to 10 f), the calculated thicknesses cannot be used to determine accurate normalized gb values according to the brick - layer model . The capacitance obtained represents grain boundary processes, and the corresponding activation energy can be calculated using the arrhenius equation (ea, gb = 0.32(4) ev). The resulting equivalent circuits are shown in the inset of figure 4; they fit all measurement data acceptably well (see dotted lines in figure 4). The temperature dependencies of bulk (blocking electrodes) are shown in figure 5 for all samples . The obtained bulk, ea, and asr values are given in table 2 . In order to determine the asr as a function of the al: ga ratio, identically prepared samples of llzo: al0.20xgax sandwiched between li electrodes were used . Temperature dependent bulk conductivities for li6.4al0.2xgaxla3zr2o12 (x = 0.00, 0.05, 0.10, 0.15 and 0.20). At ambient temperatures, bulk of li ions in our llzo samples was determined from rb by using bulk = d / rba . Impedance spectra of li6.4al0.2xgaxla3zr2o12 (x = 0.00, 0.05, 0.10, 0.15 and 0.20). For the sake of comparison, the data are normalized to the geometry (= rad, with a = area and d = thickness). The solid lines represents the fit / simulation of llzo: al0.20xgax, with x = 0.00, 0.05, 0.10, and 0.15 using the equivalent circuit shown in the inset . For sample al0.00ga0.20 the nyquist plots of cells containing llzo: al0.20xgax, with x = 0.00, 0.05, 0.10, and 0.15 are composed of high frequency arcs, clearly visible intermediate frequency arcs, and a low frequency feature . As with the data obtained by fitting the spectra obtained on the cells with blocking electrodes, cpeb element for the cells containing samples with x = 0.000.15 . In the case of llzo with x = 0.20, due to the invisible high frequency arc, an r element only was used for the fitting procedure . Since any intermediate arc can represent grain boundaries or the interface, we used the real capacitance calculated based on the cpeint value to distinguish between these contributions . Since the cpeint values are about 0.1 f, typical of sample electrode interface values, and no grain boundary contributions were observed at rt in the blocking electrode experiments, we can assign the intermediate arc to interface processes . The very small low frequency feature corresponds to an electrode response, which is typical for li electrodes and will not be further considered in this study . The resulting equivalent circuit used for all samples is displayed in the inset of figure 6 . As shown in figure 7a, the total values (= bulk above 20 c) obtained by using blocking (blue circle) and ohmic (red squares) electrodes are in very good agreement and increase almost linearly as a function of the ga content (slope 4.4 10 s cm/0.1 ga pfu). The total values of llzo: al0.20ga0.00 are very similar to values reported previously . Significantly, the total value of llzo: al0.00ga0.20 is one of the highest values found for li - oxide garnets . Comparably high values were only reported by bernuy - lopez et al . As well as li et al . For li6.4ga0.2la3zr2o12 (total = 1.0 10 s cm at 25 c) and li6.4la3zr1.4ta0.6o12, (total = 1.3 10 s cm at 25 c), respectively (although the total values of samples studied herein are measured at 20 c). The values are very close to the li - ion conduction limit suggested by jalem et al . On the basis of force field based simulations (bulk = 1.7 10 s cm). Activation energy (ea) as a function of the al: ga portion in li6.4al0.2xgaxla3zr2o12 (x = 0.00, 0.05, 0.10, 0.15, and 0.20). A significant decrease in ea for x = 0.05 and 0.15 the gray areas at x = 0.00 and 0.20 indicate values obtained from experiment (exp .) And calculations (calc .) From literature . In this study, they have resolved the different contributions of li - ion conduction in bulk and grain boundaries in hot pressed llzo solid electrolytes and found that bulk resistance dominates at temperatures higher than 10 c . They also observed that the li - ion conductivity in llzo increases with decreasing grain size and increasing concentration of grain boundaries . As noted above, for total (bulk = total at ambient temperatures), the increase from llzo: al0.20ga0.00 to llzo: al0.00ga0.20 (see figure 7a) is almost linear, and no spontaneous increase in total, e.g., caused by a phase transition, was observed . On the other hand, changes in activation energy of the samples in this study (see figure 7b) show two distinct drops . Llzo: al0.20ga0.00 is characterized by an activation energy of 0.31 ev that is similar to values reported previously (about 0.260.37 ev). With the incorporation of 0.05 ga pfu into the llzo structure (sg: ia3d) a significant decrease of ea of about 0.03 ev was observed . A second drop in ea of 0.02 ev was seen at x = 0.15 . Llzo: al0.00ga0.20 is about 0.26 ev, which is lower than previously reported (0.300.37 ev) but similar to computed values (0.240.30 ev). To understand the first drop in activation energy we calculated site energy differences using dft . The migration pathway for li - ion motion involves a series of transitions between tetrahedral and neighboring octahedral sites . The low energy sites are tetrahedral, but as the li - ion concentration increases, the li ions occupy the higher energy octahedral sites . In order for the li ion to migrate throughout the crystal structure, they must pass through the tetrahedral site located close to the supervalent cation . We performed dft calculations on structures with a single al or ga cation and a single li with a compensating background charge and then computed the total energy difference in structures with the li ion close to, or far from, the cation as shown in figure 8a . (a) ia3d structures used for site energy difference calculations . (b) subtracting the difference of the total energy calculations for the nearest less the farthest configurations . It is evident that al is less repulsive than ga, and thus the ga acts to smooth the energy landscape more than al . Our results indicate that ga raises the site energy of the neighboring tetrahedral site by 10 mev more than al (figure 8b). In essence this increase in site energy acts to smooth the energy landscape by decreasing the site energy difference between the tetrahedral and octahedral sites . The rest of the improvement is likely associated with the increase in grain size and grains connectivity . The second decrease in activation energy coincides with a phase change to sg i43d at x = 0.15, similar to what was seen in recent nmr spectroscopy results of ga stabilized llzo with sg i43d . In that study, an additional diffusion - induced relaxation rate peak in spin - lock li nmr experiments at low temperatures indicated a further diffusion process for llzo stabilized with ga (x = 0.20, sg: i43d), in contrast to samples stabilized with al (x = 0.00, ia3d). Ab initio molecular dynamics support these findings showing more facile diffusion in the i43d structure . Furthermore, the ea values of ga stabilized llzo were slightly lower compared to al stabilized llzo . The area - specific resistance (asr) of llzo: al0.20ga0.00-containing cells turned out to be 77.8 cm, which is similar to values reported previously (see figure 7c). The lowest asr value of 37 cm was recently obtained by cheng et al . For cells containing samples with similar composition . They found a strong correlation between the asr and the microstructure of the llzo solid electrolyte; in particular, the asr was lower for samples in which the surfaces of the llzo has a finer - grained microstructure and more grain boundaries . On the basis of this circumstance the higher asr value obtained for llzo: al0.20ga0.00 herein might be attributed to the larger average grain size of the sample . The trend observed in this study, in which asr decreased for samples as ga content rose, may be in part due to changes in the microstructure . There was a significant decrease in asr of about 50 cm to values in the range of 24 to 28 cm for the samples containing ga, the lowest reported values for llzo solid electrolytes, as far as we know . In summary, a phase transition from ia3d to i43d occurs with a critical amount of 0.15 ga pfu in ga and al cosubstituted samples with general composition li6.4al0.2xgaxla3zr2o12 (0 x 0.2). The increase in ga does not change the lattice parameter and the site distribution of substituent cations significantly but leads to a preference of the li ions to occupy the 24d sites (or the equivalent sites in the i43d structure). The change in structure coincides with an increase in the bulk li - ion conductivity from 3.0 10 s cm for 0 ga pfu to 10 s cm for 0.20 ga pfu, with two significant drops in the activation energy at x = 0.05 and 0.15 . Dft calculations show that the first drop in activation energy is largely related to ga li repulsion, which acts to smooth the li - ion diffusion energy landscape compared to al; the second drop is due to the phase transition from ia3d to i43d . This, combined with the changes in microstructure, seems to be the explanation for the almost linear increase in li - ion conduction . An additional beneficial effect of the ga substitution is a decrease in the interfacial resistance to values that are, to our knowledge, the lowest ever reported values of llzo samples . The success in making a dense llzo sample with a li - ion conductivity above 10 s cm and an asr of about 20 cm described in this work bodes well for the fabrication of devices with lithium anodes and llzo solid electrolytes . The present study showed how important an in - depth understanding of the structure property relationships in this class of materials is if we want to advance in developing new electrochemical energy storage devices.
|
With the introduction of ovulation - inducing agents in the late 1960s and assisted - reproductive techniques in the 1970s, the frequency of multiple pregnancies and multiple birth have been increasing (1 - 5). In korea, the frequency of twins has recently been increased by three times for the past 20 yr (6). To date, however, no studies have been conducted to examine the triplets . In cases of multiples, as compared with singletons, the morbidity and mortality of fetus or newborns were relatively high . This has therefore been of increasing interest (5 - 8). Particularly in cases of multiples with the intrauterine growth retardation, the morbidity and mortality have been reported to be relatively high (9, 10). According to blickstein (9, 10) the author therefore noted that the differential criteria for birth weight depending on the gestational age should be established . In addition, criteria for birth weight depending on the gestational age vary depending on country, ethnicity and sex . Accordingly, the differential criteria for birth weight depending on the gestational age should be established . In korea, we conducted this study to establish the normal value of birth weight depending on the gestational age in korean triplets . Of the data about the population status, which was collected by the korean national statistics office, we used a raw data about birth records of a 10-yr period from january 1 1998 to december 31 2007 . Of these, excluding 20,519 newborns (0.4%) with unknown gestational age, birth weight or plurality, 840 triplets, aged between gestational weeks 27 and 38, were finally enrolled in the current study . The number of triplets, whose gestational age was shorter than 27 weeks, as present at an extremely small . Triplets whose gestational age was longer than 38 weeks were also not enrolled in the current study . We obtained mean birth weight, standard deviation and 10th, 25th, 50th, 75th, and 90th percentile values for each gestational age group by one week increment . Then, we investigated the birth weight distribution of each gestational age group by the normal gaussian model . To establish final standard value of birth weight distribution by gestational age, we used the finite mixture model to eliminate erroneous birth weights for respective gestational age (15 - 18). A baseline value of birth weight depending on the gestational age in triplets, which was established as described herein, was compared with 10th, 50th, and 90th percentile values in singletons and twins (12). A comparison was also made with criteria for triplets which have been established in other countries (19, 20)., college station, tx, usa) for an analysis and an estimation of finite mixture model . During a 10-yr period from 1998 to 2007, the total number of newborns who were born between gestational weeks 27 and 38 was 1,330,822 . Of these, the number of singletons, twins and triplets was 1,330,822, 90,245, and 840, respectively . A mean gestational age was 37.31.5 weeks, 36.02.0 weeks, and 33.32.4 weeks in the corresponding order . A mean birth weight was 3,071490 g, 2,414455 g, and 1,836454 g in the corresponding order . These results indicate that gestational age and birth weight decreased depending on the plurality (table 1). Mean age of mothers was 29.7 yr in cases of singletons, 30.2 yr in cases of twins and 30.5 yr in cases of triplets . These results indicate that age of mother increased significantly depending on the plurality (table 1). The birth rate of triplets was increased from 0.06% in 1998 to 0.1% in 2007 . A mean gestational age of male triplets was 33.32.6 weeks and that of female triplets was 33.32.3 weeks . However, mean birth weight of male babies was 1,872495 g and that of female babies was 1,799407 g. this difference reached a statistical significance (p=0.001). In addition, birth weight percentile for gestational age was compared between male and female triplets . This showed that male triplets had a significantly greater birth weight percentile for the gestational age as compared with female triplets in overall gestational age (table 3). Birth weight percentile for gestational age in triplets was compared with the normal value which we obtained using the same methods in singletons and twins in our previous study (12). According to this, in the overall gestational age ranging from gestational week 27 to 38, it was relatively smaller as compared with birth weight obtained from twins and singletons (table 4, fig . We compared 50th percentile curve of korean triplets with those of usa and norway, it was smaller than those in the usa and norway (fig . In korea, the birth rate has been annually decreasing . However, with the advancement of assisted reproductive techniques such as ovulation - inducing agents, the birth of multiples has been increased . With the well - trained neonatal intensive care unit personnel treating newborns and the well - equipped facility, the survival rate of premature birth has also been increased (6, 21). They also are associated with such problems as premature birth, intrauterine growth retardation and low birth weight (5 - 8). Although multiples have been of increasing interest, few studies have been conducted to examine triplets in korea . The current study was conducted using a raw data about birth records which was collected during the recent 10-yr period by the korean national statistics office . And it would be of significance in that it first obtained the normal value of birth weight depending on the changes in the plurality of triplets, mean gestational age, mean birth weight, mean age of mothers and gestational age . According to a review of english literature, triplets have been abruptly increased during the recent 20- to 30-yr period (1, 3 - 5). According to the current study, however, it was shown that triplets were increased by approximately two times during a 10-yr period from 1998 to 2007 in korea . Other studies have shown that the birth rate of multiples was increased as mothers' age was increased (1, 4). In korea, it has also been shown that mean age of mothers of singletons, twins and triplets was increased . These reports suggest that the increased birth rate of triplets originated from the increased age of mothers and the development of assisted reproduction technology . In the present study, birth weight was significantly greater in male triplets when compared with female triplets at the same gestational age . This implies that an intrauterine growth pattern may vary genetically between male and female triplets . Triplets had a lower birth weight as compared with singletons or twins, which was also in agreement with the previous reports (22, 24 - 26) in particular, from gestational week 32 on, there was a great different from singletons (table 3). In regard to this, other authors noted that no growth acceleration occurred during the third trimester of pregnancy due to the limitation of intrauterine space (9, 10, 22, 27). Other authors noted, however, that there was no significant difference in the birth weight between singletons, twins and triplets prior to the third trimester of pregnancy . According to the present study, however, there was a significant difference in mean birth weight from gestational week 27 . When 50th percentile of birth weight of korean triplets was compared with those of usa and norway (19, 20), it was smaller than those in the usa and norway during a period from gestational week 28 to 36 . . It might be due to an insufficient amount of the data, however, that the normal value was relatively greater during a period ranging from gestational week 37 to 38 in korea . In cases of triplets, however, the proportion of cases in which a delivery occurred at gestational week 36 or later was approximately 10% (28). Limitations of the current study are as follows: 1) in a statistical analysis of the birth records which were collected during a 10-yr period in korea, the number of triplets aged gestational week 27 or earlier was extremely small . 2) the data which was collected from triplets aged gestational week 37 or later was also problematic . Despite these limitations, the current results are of significance in that it first obtained the normal value of birth weight during a period ranging from gestational week 27 to 38, which is clinically important, in korean triplets . It is expected that the current results would be of help for the studies and treatment of triplets.
|
The sign of leser - trelat historically has been characterized as the sudden eruption of numerous seborrheic keratoses and considered an ominous sign of internal malignancy, as it is classically described before the diagnosis of malignancy . The seborrheic keratoses themselves are benign and, in some cases, have been reported to resolve with treatment of the underlying malignancy . The mechanism of this phenomenon has been ascribed to secreted cytokines and growth factors from tumors (e.g., elevated epidermal growth factor receptor [egf - r]-mediated signaling) leading to development of seborrheic keratoses (yamamoto, 2013). The malignancies classically implicated in the setting of sign of leser - trelat are gastric adenocarcinoma and other tumors of the digestive tract; additionally, other classes of malignant tumors, such as lymphoma and breast cancers, have been cited in association with the condition (husain et al ., 2013). Rare cases of gynecologic cancers (e.g., uterine leiomyosarcoma and ovarian adenocarcinoma) have been associated with the sign of leser - trelat (abakka et al ., 2013, holguin et al ., 1986). In general, with the exception of hypercalcemia and disseminated intravascular coagulation, paraneoplastic syndromes are not classically associated with gynecologic cancer (ashour et al ., 1997). This case illustrates eruptive seborrheic keratoses with atypical annular and gyrate erythema that occurred in the setting of endometrial adenocarcinoma, which resolved upon surgical removal of the malignant uterine tissue (lacey and chia, 2009). A 61-year - old post - menopausal caucasian female presented for an initial evaluation of numerous intensely pruritic scaly spots on her trunk . She reported that similar lesions had been diagnosed as seborrheic keratoses by another dermatologist; however, in the month before presentation in our clinic, the number of lesions on her trunk had dramatically increased . The patient was able to distinguish new lesions from her existing seborrheic keratoses because they were constantly pruritic and many had coalescing and concentric rings of erythema around them . She denied any history of cancer, but upon inquiry regarding her family history, she reported that her father had died of gastric cancer . The patient denied any constitutional symptoms or any uterine bleeding, and complete review of symptoms was significant only for depression . Her past medical history was significant for squamous cell carcinoma, uterine fibroids, dysmenorrhea, granuloma annulare (ga), and benign pulmonary nodules . Total body skin examination was notable for numerous brown papules that appeared to be attached to the surface of her skin as well as plaques consistent with inflamed seborrheic keratoses with surrounding annular and gyrate erythema with scaling at edges of rings some of which were concentric and had the appearance of targets on the face, neck, and trunk . There were no signs of acanthosis nigricans . Biopsy of an erythematous lesions surrounding a seborrheic keratosis on her trunk revealed multifocal intraepidermal langerhans cell microabscesses with eczematous dermatitis and superficial perivascular infiltrate containing scattered histiocytes and without granulomatous inflammation . This presentation of atypical, acute eruption of seborrheic keratoses and family history of gastric cancer, as well as the fact the patient had not yet had her age - appropriate cancer screenings, prompted concern that the eruption was a marker of internal malignancy, and screenings for malignancy were recommended . She initially declined colonoscopy and other first - line screenings and insisted that she would only accept a positron emission tomography scan, which highlighted focal intense uptake in the uterus; based on this, transvaginal ultrasound was recommended and revealed abnormally thickened endometrium . Dilatation and curettage also revealed complex focal atypical hyperplasia, which prompted the gynecology team to perform a hysterectomy, and the postoperative diagnosis was endometrial adenocarcinoma . Because of the significant, distressing pruritus associated with the lesions, the patient was treated symptomatically during the work - up period . Symptomatic treatment with cryotherapy, phototherapy, and topical steroids yielded some partial improvement; however, the patient experienced dramatic clearance of the erythematous skin lesions and marked improvement in her pruritus after surgical removal of the abnormal uterine tissue . At present, after the hysterectomy, she has developed no new seborrheic keratoses and is asymptomatic . Although seborrheic keratoses are a common benign skin finding in elderly people, a rapid and intensely pruritic eruption warrants suspicion for occult internal malignancy . Special care should be taken for patients with first - degree relatives of gastric cancer because it is the most commonly implicated cancer in paraneoplastic dermatoses (e.g., the sign of leser - trelat). The marked annular, gyrate, and targetoid erythema associated with seborrheic keratoses seen in our patient is not typical for the classic sign of leser - trelat . It is possible that this unusual morphology represents two coexistant paraneoplastic dermatoses similar to those seen in cases of prostate cancer and renal angiosarcoma (da rosa et al ., 2009, rubegni et al ., 2014) the possibility that the annular erythematous plaques could be a reactive granulomatous process was also considered, given the patient s history of ga . However, upon consultation with the pathologist, it was clarified that no granulomatous inflammation was seen . The notable presence of high numbers of langerhans cells seen on microscopy may have signified abnormal antigen presentation in these lesions, which also supports a paraneoplastic process . It was suspected that cytokines and hormone stimuli associated with the endometrial adenocarcinoma might have triggered the paraneoplastic dermatosis . As in this patient's case this case demonstrates a common gynecological cancer presenting with a paraneoplastic dermatosis rather than the classical signs of uterine bleeding, and serves to raise awareness of cutaneous manifestations as markers of malignancy in a women s health issue in which early detection can affect health outcomes . -a sudden eruption of numerous seborrheic keratoses should prompt a malignancy work - up in patients with risk factors and those who have not undergone age - appropriate cancer screenings .- although gastric adenocarcinoma is the malignancy most commonly associated with the sign of leser - trelat, the possible association of other malignancies may necessitate a thorough work - up for internal malignancy . A sudden eruption of numerous seborrheic keratoses should prompt a malignancy work - up in patients with risk factors and those who have not undergone age - appropriate cancer screenings . Although gastric adenocarcinoma is the malignancy most commonly associated with the sign of leser - trelat, the possible association of other malignancies may necessitate a thorough work - up for internal malignancy.
|
Thirty bilingual (english - malayalam) individuals (16 males and 14 females) diagnosed with alzheimer's disease in the age range of 65 - 88 years (mean 77.4, sd 6.6) participated in the study . Participants were diagnosed by a medical team including a neurologist, a neuropsychiatrist and experts in geriatrics . On the day of data collection, participants were assessed using the mini - mental state examination and clinical dementia rating (cdr) scale . Based on the cdr scores, participants were grouped into mild (n = 9), moderate (n = 12) and severe (n = 9) degree of dementia . Individuals with evidence for other neurological disorders such as traumatic brain injury, stroke, hydrocephalus, and encephalopathy as well as psychiatric disorders such as major depression or schizophrenia were excluded from participation . The study did not include any invasive procedures, and all procedures were strictly adhered to ethical considerations . Asha facs addresses functional communication across four domains: social communication; communication of basic needs; reading, writing, number concepts, and daily planning . Measurement of the 43 functional communication items is based on a 7-point scale, where 1 = does not do, 2 = needs constant assistance to perform a communicative behaviour, 3 = needs assistance very frequently, 4 = needs moderate assistance, 5 = needs assistance occasionally, 6 = rarely needs assistance, and 7 = totally independent to perform the communication behaviour . Information about the 43 items was obtained by direct observation, client and caretaker reporting . Although it is a general tool to assess the functional communication in adults, some studies attempted to classify the functional communication of adults with neurogenic disorders . Hughes and orange tried to profile functional communication in traumatic brain injury into the who icf framework by mapping the asha facs items . The current study made a similar attempt in the dat population by using asha facs as a tool to link with the various subdomains of the icf framework . Each item in asha facs was linked to the icf framework by assigning an icf code . Judge a was involved in the field testing phase of the icf in india and had 10 years of work experience with the icf, and judge b had 4 years of practical experience with the framework . Interrater agreement was statistically verified by using cohen's kappa (= 0.72). The severity rating scales used (cdr and the mini - mental state examination) were capable of addressing the impairment and severity of various body functions which are related to dat . Therefore, the current study excluded the body structures and function component from its main goal . All 43 asha facs items matched with the components under functioning and disability. Codes were selected from the various subdomains of the activity and participation domain . Selected icf domains were communication, learning and applying knowledge, interpersonal interactions and relationship, major life areas, domestic life and general task demands . Thirty - two of the 43 asha facs items were linked to various items under a communication subdomain . Five additional items were also added from icf subdomains such as domestic life (d6200), interpersonal interactions and relationships (d7104, d7701), domestic life (d6600) as well as community, social, and civic life (d9205). To address the specific communication barriers in environment, two items from the environment component of the icf were also included . Codes under the environment domain were added from the products and technology subsection (e1250) and the support and relationship subdomain (e310/e340). All 50 items (asha facs + icf) were identified as applicable to alzheimer's disease by five speech language pathologists with 6 years of experience . Interrater reliability was checked by using the weighted kappa analysis (w = 7.4). Thirty bilingual (english - malayalam) individuals (16 males and 14 females) diagnosed with alzheimer's disease in the age range of 65 - 88 years (mean 77.4, sd 6.6) participated in the study . Participants were diagnosed by a medical team including a neurologist, a neuropsychiatrist and experts in geriatrics . On the day of data collection, participants were assessed using the mini - mental state examination and clinical dementia rating (cdr) scale . Based on the cdr scores, participants were grouped into mild (n = 9), moderate (n = 12) and severe (n = 9) degree of dementia . Individuals with evidence for other neurological disorders such as traumatic brain injury, stroke, hydrocephalus, and encephalopathy as well as psychiatric disorders such as major depression or schizophrenia were excluded from participation . The study did not include any invasive procedures, and all procedures were strictly adhered to ethical considerations . Asha facs addresses functional communication across four domains: social communication; communication of basic needs; reading, writing, number concepts, and daily planning . Measurement of the 43 functional communication items is based on a 7-point scale, where 1 = does not do, 2 = needs constant assistance to perform a communicative behaviour, 3 = needs assistance very frequently, 4 = needs moderate assistance, 5 = needs assistance occasionally, 6 = rarely needs assistance, and 7 = totally independent to perform the communication behaviour . Information about the 43 items was obtained by direct observation, client and caretaker reporting . The scale can be administered in approximately 20 min . Although it is a general tool to assess the functional communication in adults, some studies attempted to classify the functional communication of adults with neurogenic disorders . Hughes and orange tried to profile functional communication in traumatic brain injury into the who icf framework by mapping the asha facs items . The current study made a similar attempt in the dat population by using asha facs as a tool to link with the various subdomains of the icf framework . Each item in asha facs was linked to the icf framework by assigning an icf code . Linking judge a was involved in the field testing phase of the icf in india and had 10 years of work experience with the icf, and judge b had 4 years of practical experience with the framework . Interrater agreement was statistically verified by using cohen's kappa (= 0.72). The severity rating scales used (cdr and the mini - mental state examination) were capable of addressing the impairment and severity of various body functions which are related to dat . Therefore, the current study excluded the body structures and function component from its main goal . All 43 asha facs items matched with the components under functioning and disability. Codes were selected from the various subdomains of the activity and participation domain . Selected icf domains were communication, learning and applying knowledge, interpersonal interactions and relationship, major life areas, domestic life and general task demands . Thirty - two of the 43 asha facs items were linked to various items under a communication subdomain . Five additional items were also added from icf subdomains such as domestic life (d6200), interpersonal interactions and relationships (d7104, d7701), domestic life (d6600) as well as community, social, and civic life (d9205). To address the specific communication barriers in environment, two items from the environment component of the icf were also included . Codes under the environment domain were added from the products and technology subsection (e1250) and the support and relationship subdomain (e310/e340). All 50 items (asha facs + icf) were identified as applicable to alzheimer's disease by five speech language pathologists with 6 years of experience . Interrater reliability was checked by using the weighted kappa analysis (w = 7.4). Thirty bilingual participants (english - malayalam) aged 65 - 88 years (16 males and 14 females) who met the selection criteria and whose responses (including caretaker) to the questionnaire were complete in all aspects were analysed . Table 1 shows the distribution of the number of participants with various levels of activity limitations and participation restrictions . It can be seen in table 1 that 10 individuals had moderate issues in the communication component and 20 individuals had severe issues . In the subdomain of learning and applying knowledge, 3 individuals had mild issues, 8 had moderate issues and 19 had severe issues . In the interpersonal interactions and relationship domain, 5 participants had mild level problems, 10 had moderate level issues and 15 had severe level issues . Two individuals had mild level issues in the major life areas subdomain, 7 had moderate level issues and 21 had severe issues . Participants in the subdomain of domestic life had issues ranging from mild to severe levels . Sixteen participants had severe difficulties, 9 had moderate difficulties and 5 had mild difficulties . The kruskal - wallis test results revealed that there is no significant difference (= 3.599, p = 0.165) between the mild, moderate and severe dat groups in the activity and participation components of the icf . Results are suggestive of an equal impact on the icf activity and participation domain, irrespective of the severity of dat (table 2). The comparison of three groups on the environmental component revealed a significant difference in the kruskal - wallis test (= 7.621, p = 0.022) (table 3). Since the kruskal - wallis test showed a significant difference, a post hoc evaluation was carried out by tukey's hsd test . Multiple comparison by post hoc analysis revealed a significant mean difference between mild and severe dat groups (p = 0.011) on the environment component of the icf . At the same time, multiple comparison indicated that there was no significant difference between the mild and moderate dat groups (p = 0.140) as well as in the moderate and severe groups (p = 0.351) (table 4). The kruskal - wallis test results revealed that there is no significant difference (= 3.599, p = 0.165) between the mild, moderate and severe dat groups in the activity and participation components of the icf . Results are suggestive of an equal impact on the icf activity and participation domain, irrespective of the severity of dat (table 2). The comparison of three groups on the environmental component revealed a significant difference in the kruskal - wallis test (= 7.621, p = 0.022) (table 3). Since the kruskal - wallis test showed a significant difference, a post hoc evaluation was carried out by tukey's hsd test . Multiple comparison by post hoc analysis revealed a significant mean difference between mild and severe dat groups (p = 0.011) on the environment component of the icf . At the same time, multiple comparison indicated that there was no significant difference between the mild and moderate dat groups (p = 0.140) as well as in the moderate and severe groups (p = 0.351) (table 4). Activity limitations and participation restrictions due to impairment in body functions and structure are highlighted as major criteria for the diagnosis of dementia . Memory and other cognitive impairments result in marked problems with social and occupational functioning . As a result of the interaction between the impairments of dat and contextual factors, all individuals with dat experience communication - related activity limitations and participation restrictions . Therefore, it was crucial to study the impact of dementia on multiple functional domains of individuals . Assessment of multiple domains of functions is essential to determine abilities as well as potential goals and outcomes of intervention programs . Hence, the current study included 48 items under various subdomains of activity and participation components of the icf . It addressed communication - related activity limitation and participation restrictions under various subdomains such as communication, learning and applying knowledge, interpersonal interactions and relationship, major life areas, domestic life, general task demands as well as community, social, and civic life . The results of the present study revealed that there was no significant difference across the mild, moderate and severe dat groups on the activity and participation component of the icf . Hence, it can be inferred from the current study that the severity of dementia is not a factor that predicts the functionality of the individual . In other words, even a mild degree of dementia can cause severe activity limitation and participation restriction in communication - related functional domains . It can be inferred from the study that the severity rating tools are insufficient enough to profile the activity limitation and participation restriction in dat . Machado investigated the influence of participation at a rehabilitation centre on the quality of life and alzheimer's disease . They concluded that combining pharmacological treatment with psychosocial intervention might prove to be an effective strategy to enhance the quality of life of persons with dat . Therefore, the current study highlights the utility of the icf framework in documentation of activity limitations and participation restrictions to set therapy goals of persons with dat . Post hoc analysis by tukey's hsd multiple comparison revealed that there is a significant difference in the environmental barriers for communication across the mild, moderate and severe dat groups . The mean difference suggested a continuum across the three different groups (mild <moderate <severe). The results are suggestive of minimal environmental barriers for the mild group when compared to the moderate and severe groups . This finding was consistent with those observations which indicated that persons with mild dat benefit from strategies to improve memory, and they continue to live relatively independent lives with a minimum of assistance . However, support from the caregiver or family members was minimal for communication enhancement . Byrne and orange identified caregivers lack of knowledge about how to communicate with older adults with dat as the major barrier to optimize functioning . In the present study, this can also be a major reason for the reported environmental barriers in functional communication . Family members and caregivers were not aware of the various communication strategies that could be used in persons with dat . . Emphasized caregiver education as a part of the evidence - based practice recommendations for dementia . Robinson et al . Found that inclusion of multiple caregivers in cognitive behavioural therapy for treating anxiety in persons with dementia is feasible and may be beneficial in maximizing treatment gains and increasing the family's participation in therapy . Caregiver - focused intervention is essential for the effective incorporation of communication strategies in the various phases of alzheimer's disease . Thus, the current study emphasizes the need for educating the caregivers to become a facilitator in functional communication . According to kinsella and phillips, individuals with dementia - associated communication problems the most common dementia - associated diseases are progressive in nature and in need of appropriate services that will benefit the individual and maximize cognitive - communication functioning at all stages of the disease process . The current study attempted to profile the communication - related activity limitations, participation restrictions and environmental barriers in persons with dat . It highlighted the implication of the icf in profiling the overall functionality of the individuals with dat irrespective of the severity of the disorder . This study has implications for making a management plan oriented towards functionality of persons with dat . The study will have implications for deciding the occupational status (back to work or continuing in work) of persons with dementia . The asha mandates the role of the speech language pathologist in the identification, assessment, intervention, counselling, collaboration, case management, education, advocacy and research of persons with dat . Since the current study focused on the overall functionality of the individual, it will be useful for the speech language pathologists to address the specific goals in the dat population on a broader perspective . Even though we did not address the outcome measurement, future studies can focus on the utility of a similar framework to document the functionality before and after treatment . Future studies extending the same methods for other adult communication disorders should also be conducted . Activity limitations and participation restrictions due to impairment in body functions and structure are highlighted as major criteria for the diagnosis of dementia . Memory and other cognitive impairments result in marked problems with social and occupational functioning . As a result of the interaction between the impairments of dat and contextual factors, all individuals with dat experience communication - related activity limitations and participation restrictions . Therefore, it was crucial to study the impact of dementia on multiple functional domains of individuals . Assessment of multiple domains of functions is essential to determine abilities as well as potential goals and outcomes of intervention programs . Hence, the current study included 48 items under various subdomains of activity and participation components of the icf . It addressed communication - related activity limitation and participation restrictions under various subdomains such as communication, learning and applying knowledge, interpersonal interactions and relationship, major life areas, domestic life, general task demands as well as community, social, and civic life . The results of the present study revealed that there was no significant difference across the mild, moderate and severe dat groups on the activity and participation component of the icf . Hence, it can be inferred from the current study that the severity of dementia is not a factor that predicts the functionality of the individual . In other words, even a mild degree of dementia can cause severe activity limitation and participation restriction in communication - related functional domains . It can be inferred from the study that the severity rating tools are insufficient enough to profile the activity limitation and participation restriction in dat . Machado investigated the influence of participation at a rehabilitation centre on the quality of life and alzheimer's disease . They concluded that combining pharmacological treatment with psychosocial intervention might prove to be an effective strategy to enhance the quality of life of persons with dat . Therefore, the current study highlights the utility of the icf framework in documentation of activity limitations and participation restrictions to set therapy goals of persons with dat . Post hoc analysis by tukey's hsd multiple comparison revealed that there is a significant difference in the environmental barriers for communication across the mild, moderate and severe dat groups . The mean difference suggested a continuum across the three different groups (mild <moderate <severe). The results are suggestive of minimal environmental barriers for the mild group when compared to the moderate and severe groups . This finding was consistent with those observations which indicated that persons with mild dat benefit from strategies to improve memory, and they continue to live relatively independent lives with a minimum of assistance . However, support from the caregiver or family members was minimal for communication enhancement . Byrne and orange identified caregivers lack of knowledge about how to communicate with older adults with dat as the major barrier to optimize functioning . In the present study, this can also be a major reason for the reported environmental barriers in functional communication . Family members and caregivers were not aware of the various communication strategies that could be used in persons with dat . . Emphasized caregiver education as a part of the evidence - based practice recommendations for dementia . Robinson et al . Found that inclusion of multiple caregivers in cognitive behavioural therapy for treating anxiety in persons with dementia is feasible and may be beneficial in maximizing treatment gains and increasing the family's participation in therapy . Caregiver - focused intervention is essential for the effective incorporation of communication strategies in the various phases of alzheimer's disease . Thus, the current study emphasizes the need for educating the caregivers to become a facilitator in functional communication . According to kinsella and phillips, individuals with dementia - associated communication problems are the fastest growing clinical population . The most common dementia - associated diseases are progressive in nature and in need of appropriate services that will benefit the individual and maximize cognitive - communication functioning at all stages of the disease process . The current study attempted to profile the communication - related activity limitations, participation restrictions and environmental barriers in persons with dat . It highlighted the implication of the icf in profiling the overall functionality of the individuals with dat irrespective of the severity of the disorder . This study has implications for making a management plan oriented towards functionality of persons with dat . The study will have implications for deciding the occupational status (back to work or continuing in work) of persons with dementia . The asha mandates the role of the speech language pathologist in the identification, assessment, intervention, counselling, collaboration, case management, education, advocacy and research of persons with dat . Since the current study focused on the overall functionality of the individual, it will be useful for the speech language pathologists to address the specific goals in the dat population on a broader perspective . Even though we did not address the outcome measurement, future studies can focus on the utility of a similar framework to document the functionality before and after treatment . Future studies extending the same methods for other adult communication disorders should also be conducted . The present study aimed to profile dat - based communication disorders on the icf framework and investigated the influence of the severity of dat on various icf components . Additional items were also added to obtain a complete picture of communication - related functionality of the individuals . The results highlighted the unique feature of the icf in profiling the activity limitations and participation restrictions of persons with dat irrespective of the severity . It also indicated a need for modification of the communication environment and caregiver - oriented intervention for persons with dat . Thus, the interactive icf model is highly useful for profiling a multifaceted condition like dat in an individualized and personalized way . The study has implication for facilitating communication - related quality of life in dat population.
|
Gastrointestinal stromal tumors (gists) are the most common type of mesenchymal tumors in the gastrointestinal tract . Their biological behavior correlates with clinicopathological parameters such as mitotic rate, tumor size and tumor location, as well as with the molecular alterations of kit and pdgfr . Imatinib is a potent, specific inhibitor of both the kit and pdgfr receptor tyrosine kinase . The drug has been approved for the treatment of advanced unresectable or metastatic gist . Since being approved for use in treatment most metastasis arises in the liver and peritoneum, which is the result of hematogenous spread and peritoneal seeding, respectively . In addition, metastasis of gist to the central nervous system is also extremely rare . A pubmed database search only found 7 reported cases of brain metastases from primary gist . Here, a 77-year - old woman presented in december 2009 with left hemiplegia and ptosis of her right eyelids . Magnetic resonance imaging (mri) of the brain revealed a 24 mm tumor in her right cerebral peduncle and a 20 mm tumor in her left occipital lobe, which was associated with brain edema (fig . 1). On the basis of the radiologic features of the computed tomography (ct) and mri procedures, she was initially diagnosed as having a malignant lymphoma in her brain . Since immunohistochemistry was positive for c - kit and negative for cd34, desmin and s-100 (fig . 2), she was diagnosed with metastasis of gist . After counting the proliferating cells that were immunostained by ki-67 (mib-1) antibody, 2). A positron emission tomography computed tomography (pet - ct) examination revealed the presence of another tumor in the small bowel (fig . 3a), which suggested small bowel gist associated with intracranial metastasis . Since capsule endoscopy revealed a tumor in the proximal jejunum, oral endoscopy using the double balloon technique was carried out . The proximal jejunum demonstrated a 3 cm oval - shaped mass which was consistent with the findings obtained by capsule endoscopy (fig . Subsequent pathological examination found a malignant spindle cell tumor with morphology that was similar to that of the brain tumor . Immunohistochemical staining demonstrated that the tumor cells were positive for c - kit while negative for cd34, desmin and s-100 . Therefore, the patient was diagnosed as having a primary jejunal gist associated with brain metastasis . Mutational analysis of the intestinal tumor was carried out and no mutations were found in the kit exons 11, 13, 17, 19 or for pdgfr. Postoperatively, the patient underwent whole brain radiation therapy in conjunction with administration of imatinib mesylate 400 mg / day in february 2010 . Unfortunately, she suffered from leucopenia 1 month after initiation of imatinib methylate administration and the drug had to be discontinued . The patient remained well until the end of march 2010, when she began to complain of abdominal pain . Ct examination revealed the development of ileus due to the jejunal primary tumor, leading to surgical resection of the intestinal lesion . Observation during the surgery revealed that the tumor in the proximal jejunum had not changed in size compared to the size observed during the previous double balloon endoscopy . Although there was minor enlargement of her right cerebral peduncle tumor, brain mri at that time showed no apparent recurrence in the left occipital lobe where tumor resection had been performed . The patient's condition gradually worsened and she died 4 months after the initial treatment . Gists arise from the precursor cells of the interstitial cells of cajal and express kit tyrosine kinase . Most gists express kit (94%), cd34 (82%), with 78% of gists positive for both kit and cd34 . Activating mutations of kit or pdgfr are found in the vast majority of gists, and the mutational status of these oncoproteins can be predictive of the clinical response to imatinib therapy [1, 3, 5]. Although kit exon 11 is the most common mutation found in gists (66.9%), other exons harboring mutations, such as exon 9 (18.1%) and exons 13 and 17 (1.6%), have also been described [3, 6]. The response and sensitivity to imatinib in gists that lack kit mutations has been reported to be due to the pdgfr mutations . It has also been shown that the reason why imatinib mesylate is not effective in treating metastatic gist in the brain is because of the presence of the blood brain barrier . Lower concentrations of imatinib mesylate in the central nervous system have been detected in both mice and humans . In addition, a small population of gists have been discovered that lack both the kit and pdgfr mutations, and when these populations are treated with imatinib, a very poor response is observed . Consistent with these reports, our patient also exhibited no mutations in either the kit exon 7, 9, 11, 13 or pdgfr, and she was resistant to imatinib mesylate treatment . While gist frequently metastasizes to both the liver and peritoneum, metastasis outside the abdomen is very uncommon . There have also been very few reports in the literature regarding concurrent gist and brain metastasis . A current review of the literature found only 7 case reports including the current case [4, 9, 10, 11, 12, 13]. To verify our present observations, we compared the findings presented for all of the reported cases in the literature (table 1). In all cases, patients underwent administration of imatinib mesylate, with only 1 out of the 7 cases exhibiting a response to the chemotherapy . However, since most of these cases primarily involved brain metastasis, the molecular features were not described . Mutational analysis was described in case report 5, in which a mutation in exon 9 of kit was detected in the original jejunal tumor, the liver and the cerebral metastases . However, the prognostic significance of kit mutations remains controversial, as cho et al . Reported that kit - mutation - positive gists exhibit more frequent liver metastases and a higher mortality than kit - mutation - negative gists . Found in 104 patients that 74% of the exon 11 kit mutations were associated with metastasis, as compared to only 5% of the wild - type gists . Pdgfr mutations rarely result in metastatic disease, and thus, to the best of our knowledge, this is the first report that found gist occurring without any kit or pdgfr mutations associated with the intracranial metastasis . Recently, it has been shown that the transcription factor etv1 is necessary for the survival and growth of gist cells in vitro and in vivo . Since all gist samples and gist cell lines express etv1, this transcription factor might very well be a new biomarker and therapeutic target for gist . Thus, in the absence of mutations in either kit or pdgfr, as was seen in our case, other factors such as etv1 might be involved in the promotion and metastasis of gist . Being able to elucidate the mechanism of tumorigenesis and to identify the responsible gene in gists that exhibit no detectable mutations of kit or pdgfr may lead to new insights into the nature of gist and potentially a novel diagnosis and therapy . In summary, we histologically confirmed the brain metastasis of small bowel gist in the current case, which is a rare and particularly unusual manifestation of this tumor.
|
Anterior cervical discectomy and fusion (acdf) is commonly performed to treat one- and two - level cervical spondylosis . Favorable fusion rates have been reported; nonunion rate i4% for single level plated acdf with allograft.1,2 however, fusion success declines with the number of treated levels.3 reported pseudarthrosis rates are as high as 18% and 37%, in two- and three - level acdf constructs, respectively.1,4,5 to achieve solid bony fusion, both a favorable bone healing environment and mechanical stability are required.6 these conditions become especially important in patients undergoing multilevel fusion in whom the risk of pseudarthrosis and revision surgery is more prevalent.7 fusion constructs using acdf supplemented with posterior fixation are more stable and have been shown to improve fusion rates.8,9 the most commonly used implants, lateral mass screw / rod constructs and transfacet screws, provide effective stabilization, but typically require an open posterior approach with considerable muscle retraction, which has been shown to be associated with significant blood loss, postoperative pain, and morbidity.7,913 fusion with expandable posterior cervical cages placed between the facet joints has been described for the treatment of radiculopathy with favorable results at 1 year.14,15 bilateral placement of similar devices have been shown to decrease the range of motion (rom) at the index level, increase foraminal area, and preserve cervical lordosis.1619 more recently, a nonexpandable titanium alloy posterior cervical cage has become available (dtrax posterior cervical cage, providence medical technology, walnut creek, ca, usa).15,20 to date, no studies have evaluated the biomechanical effects of this cage compared to acdf or assessed their contribution to stability when used as supplemental posterior fixation in plated acdf procedures . This study tested the following hypotheses: effectiveness of the dtrax posterior cervical cage stabilization in limiting motions in flexion extension (fe), lateral bending (lb), and axial rotation (ar) will be comparable to that of an acdf construct for a single - level fusion.supplemental posterior stabilization will significantly increase the effectiveness of the acdf construct in single- and two - level settings . Effectiveness of the dtrax posterior cervical cage stabilization in limiting motions in flexion extension (fe), lateral bending (lb), and axial rotation (ar) will be comparable to that of an acdf construct for a single - level fusion . Supplemental posterior stabilization will significantly increase the effectiveness of the acdf construct in single- and two - level settings . Seven fresh - frozen cadaveric cervical (c2t1) spine specimens were acquired from an accredited tissue bank . While institutional review board approval was not necessary, approval was obtained from the research and development committee at the edward hines jr va hospital, where testing was performed . Specimen mean age (standard deviation) was 41.19.1 years (three male, four female). After the skin and paravertebral muscles were dissected, individual specimens were potted in aluminum cups with polymethyl methacrylate bone cement . Each specimen was fixed to a kinematic testing apparatus at the caudal end only; the cephalad end was left unconstrained.21,22 the testing apparatus allowed continuous cycling of the specimen between specified maximum moment endpoints (1.5 nm) in flexion, extension, lb, and ar . Specimens were subjected to quasi - static flexibility testing at a loading rate of 2.5 nm / min . The angular motions of the c2 to c7 vertebrae relative to t1 were measured using an optoelectronic motion measurement system (optotrak certus, northern digital, waterloo, canada). Testing was performed in moment control mode by placing a six - component load cell (model mc3a-6 - 1000, amti inc ., newton, ma, usa) under the specimen to measure the applied moments . Load - displacement data were collected until two reproducible load - displacement cycles were obtained . Moment loading in fe and lb was performed using a force applied using a moment arm, while in ar a force couple was used to apply a pure moment (figure 1). Due to these long moment arms, the compressive load required to reach 1.5 nm wa2.7 n in fe and 3.0 n in lb . Each of the seven specimens was tested sequentially in the following six conditions: 1) intact (c2t1), 2) c5c6 bilateral posterior cages, 3) c6c7 plated acdf, 4) c6c7 plated acdf + c6c7 bilateral posterior cages, 5) c3c5 plated acdf, and 6) c3c5 plated acdf + c3c5 bilateral posterior cages (figure 2). This complex study design was intended to fully utilize the donated cadaveric tissue in order to investigate the effectiveness of the implants both in a stand - alone environment as well as in combination for single and two - level fusion constructs . A fluoroscopically guided posterior approach was used to place cages bilaterally between the cervical facet joints of the target level according to the manufacturer s surgical technique (figure 3).23 acdf was performed according to standard surgical procedure . After discectomy, a 5 mm intervertebral cage was inserted and an anterior locking semiconstrained plate was applied (depuy synthes, raynham, ma, usa). Segmental rom was analyzed using paired t - tests with bonferroni correction for multiple comparisons . The following four comparisons were conducted: intact versus c5c6 cages, c5c6 cages versus c6c7 acdf, c6c7 acdf versus acdf + cages, and c3c5 acdf versus acdf + cages . A stabilization intervention at any level is likely to alter rom from intact conditions at subsequent spinal levels . Therefore, rom values after each sequential step were compared to the rom at that level during the previous protocol step . For example, the c6c7 rom after the acdf (protocol step 3) was compared to the c6c7 rom after c5c6 cages (protocol step 2) rather than the intact c6c7 rom from step 1 . All comparisons were done separately for fe, lb, and ar, as no comparisons across load - types were intended . The statistical data analyses were performed with the use of the systat 10.2 software package (systat software, richmond, ca, usa). The load - displacement curves of both the c5c6 and c6c7 levels after instrumentation with acdf and bilateral posterior cervical cages can be well approximated by straight lines in all three loading modes (figure 4). As the relationship between angular motion and the moment curve after instrumentation is nearly linear, the stiffness of the segment is equal to the maximum moment divided by the rom . Thus, the assumption can be made that postinstrumentation comparison of rom at maximum moments used in the current study is equivalent to comparing segmental stiffness . Assessment of fusion in the clinical setting is determined by rom measurements, for example, on fe x - ray images, rather than stiffness calculations . Therefore, we report our results as rom at the index levels for each tested condition . Posterior stabilization with bilateral cervical cages at c5c6 significantly reduced the rom in all directions when compared to the intact condition: 10.72.6 to 2.51.3 in fe, 6.72.8 to 0.40.3 in lb, and 7.92.8 to 1.11.7 in ar (p<0.05) (table 1). Plated acdf at c6c7 significantly reduced rom at the treated level compared to the preoperative rom: 12.32.5 to 2.50.8 in fe, 8.91.5 to 1.60.7 in lb, and 7.11.2 to 1.70.4 in ar (all p<0.05) (table 1). A statistical analysis comparing posterior cages at c5c6 and acdf at c6c7 revealed no implant group effect for changes in rom; a similar reduction in rom was observed in each direction (fe, lb, and ar) for both constructs . However, the percent decreases in lb and ar were larger for the posterior cages compared to acdf (lb: 94%3.4% vs 82%6.1%, ar: 87.2% 17.8% vs 75.7%7.1%). Plated acdf at c6c7 significantly decreased rom compared to intact in fe, lb, and ar (all p<0.05) (table 1). Acdf supplemented with posterior cages further significantly reduced motion when compared to plated acdf alone: 2.50.8 to 0.60.3 in fe, 1.60.7 to 0.10.4 in lb, and 1.70.4 to 0.20.3 in ar (all p<0.005) (table 2). In two - level fusion, plated acdf alone significantly reduced rom at c3c5: values decreased from 25.48.1 to 1.70.9 in fe, 27.55.1 to 1.70.6 in lb, and 21.72.0 to 2.10.5 in ar (all p<0.001) (table 3). Supplemental stabilization with the cages at c3c5 further significantly reduced rom when compared to plated acdf alone: values decreased from 1.70.9 to 0.30.2 in fe, 1.70.6 to 0.20.1 in lb, and 2.1 0.5 to 0.30.2 in ar (all p<0.05) (table 3). Posterior stabilization with bilateral cervical cages at c5c6 significantly reduced the rom in all directions when compared to the intact condition: 10.72.6 to 2.51.3 in fe, 6.72.8 to 0.40.3 in lb, and 7.92.8 to 1.11.7 in ar (p<0.05) (table 1). Plated acdf at c6c7 significantly reduced rom at the treated level compared to the preoperative rom: 12.32.5 to 2.50.8 in fe, 8.91.5 to 1.60.7 in lb, and 7.11.2 to 1.70.4 in ar (all p<0.05) (table 1). A statistical analysis comparing posterior cages at c5c6 and acdf at c6c7 revealed no implant group effect for changes in rom; a similar reduction in rom was observed in each direction (fe, lb, and ar) for both constructs . However, the percent decreases in lb and ar were larger for the posterior cages compared to acdf (lb: 94%3.4% vs 82%6.1%, ar: 87.2% 17.8% vs 75.7%7.1%). Plated acdf at c6c7 significantly decreased rom compared to intact in fe, lb, and ar (all p<0.05) (table 1). Acdf supplemented with posterior cages further significantly reduced motion when compared to plated acdf alone: 2.50.8 to 0.60.3 in fe, 1.60.7 to 0.10.4 in lb, and 1.70.4 to 0.20.3 in ar (all p<0.005) (table 2). In two - level fusion, plated acdf alone significantly reduced rom at c3c5: values decreased from 25.48.1 to 1.70.9 in fe, 27.55.1 to 1.70.6 in lb, and 21.72.0 to 2.10.5 in ar (all p<0.001) (table 3). Supplemental stabilization with the cages at c3c5 further significantly reduced rom when compared to plated acdf alone: values decreased from 1.70.9 to 0.30.2 in fe, 1.70.6 to 0.20.1 in lb, and 2.1 0.5 to 0.30.2 in ar (all p<0.05) (table 3). The current study demonstrated that plated acdf and bilateral posterior cages offer comparable postoperative segmental stability; both techniques significantly decreased cervical rom in fe, lb, and ar . The percent reduction in lb and ar was higher for the posterior cage construct compared to the plated acdf . This is likely due to the more lateral position of the implants relative to the axis of rotation in lb and ar . The plated acdf is closer to the axis of rotation and as such has a lesser ability to resist the lb and ar motions . Supplementation of one- and two - level plated acdf constructs with bilateral posterior cervical cages further significantly decreased cervical rom in all tested modes . Acdf supplementation with transfacet screws was previously evaluated using a protocol similar to that reported herein.10 traynelis et al assessed fe, lb, and ar in eight cadaveric specimens before and after applying stand - alone plated acdf and with the addition of unilateral and bilateral transfacet screws . Reported reduction in rom values for the c6c7 segment with concurrent bilateral transfacet screws is similar to those reported for posterior cages in the current study . Kasliwal et al evaluated clinical and radiographic outcomes in patients who underwent revision surgery for pseudarthrosis following acdf using a cervical interfacet spacer similar to the device reported herein.24 the authors report a 20-month follow - up on 19 patients . Patient - reported outcomes using visual analog scale for neck and arm pain and neck disability index showed significant improvement from baseline based on improvement of at least three points on visual analog scale and 7.5 points on neck disability index . One previous study analyzed the biomechanics of a construct similar in concept to the cages investigated in the current study . Leasure and buckley evaluated foraminal decompression and segmental rom after posterior bilateral placement of an expandable screw and washer system between the facet joints.16 the results demonstrated a significant reduction in cervical rom in flexion, lb, and ar after implantation . Although the implant design differed from the one evaluated in the current study, these results show that distracting and mechanically locking the translation of the interarticular facet surfaces relative to each other contribute to reduction of cervical segmental rom . As with all biomechanical cadaveric studies, notably, kinematic evaluation of the tested constructs provides evidence for the immediate postoperative effects of the implants and does not reflect the possible consequence of long - term cyclical loading experienced in vivo . C5c6 and c6c7 segments are similar in their intervertebral disc anatomy and facet morphologies . Their kinematic behavior is similar as evidenced by the intact rom values of the two levels in fe, lb, and ar (fe: 10.7 vs 11.4, p=0.556; lb: 6.7 vs 8.2, p=0.235; ar: 7.9 vs 7.5, p=0.795). These two levels are a natural choice as controls for each other as they come from the same spine specimen and allow a paired comparison of construct data . Evaluating the two constructs at the same (c5c6 or c6c7) levels would have required a substantially larger number of specimens to account for the biologic variability between specimens . Furthermore, a sequential testing mode was employed in order to fully utilize each specimen . When evaluating biomechanical results, it is important to note that kinematics vary depending on the cervical level and so comparisons are best made before and after surgeries at the same level.10 the mean rom in fe after the two - level fusion (c3c5) was less than that of the mean single - level fusion at c6c7 . As the fe testing was not performed using pure moments, c6c7 could be subjected to a slightly higher (1.46 vs 1.5 nm) moment than the upper cervical levels . However, a more likely explanation deals with differences in location of the segmental center of rotation (cor) and facet joints between the upper and lower cervical spines . The distance between the segmental cor and the fusion implant has a great effect on the stability provided by the implant . At c6c7, the cor is positioned just posterior to the center of the upper endplate of c7 and coincident with the caudal surface of the interbody cage providing a poor mechanical advantage to resist fe motion . At c3c4 and c4c5, the cor is considerably more caudal providing improved mechanics for the acdf to resist fe motion.25 as with any implant system, it is important to understand how sagittal alignment may be affected by the use of single and multilevel instrumentation . The focus of this study was evaluation of motion reduction with both posterior cervical cages and acdf . As such, evaluation of sagittal alignment after each construct was beyond the scope of the study . Future analysis of biomechanical data and corroboration with clinical findings will provide insight into the effects of these fusion techniques on sagittal balance . This study is the first to evaluate the role of bilateral cervical cages placed between the facet joints as a posterior supplement to plated acdf at one and two levels . The results of the current study support the role of these implants to significantly increase stability in single and multilevel acdf constructs . This suggests a role for the use of these implants when added stability is required, such as in situations in which acdf has a higher risk of pseudarthrosis, or in the treatment of an established pseudarthrosis following acdf . The biomechanical effectiveness of bilateral posterior cages in limiting cervical segmental motion is comparable to single - level plated acdf . Supplementation of plated acdf with these implants further increases cervical spine stability in single and multilevel acdf constructs . These findings provide a biomechanical rationale for undertaking further studies to assess the performance of posterior cervical cages under repeated loading that simulates postoperative activity until biologic fusion occurs.
|
Nowadays, one - dimensional (1-d) nanomaterials (nanorods, nanowires, nanobelts and nanotubes) have been attractive due to their physical and chemical properties . These nanostructures, that have great potential applications in the next generation of nanodevices . Various methods such as chemical vapor deposition (cvd), laser ablation, thermal evaporation, hydrothermal process, and anodic aluminum oxide (aao) membrane - assisted synthesis method have been employed to prepare 1-d nanomaterials . Aao membrane - based assembling has been widely applied in recent years to produce nanowires with extremely long length and high aspect ratios, and it also provides a simple, rapid and cheap way for fabricating nanowires as aligned arrays . Indium sulphide (in2s3) is an iii - vi compound material, and it exists in three phases at normal pressure: (cubic), (tetragonal) and (trigonal). -in2s3, an ordered - defect superstructure of the defect - spinel -in2s3, is stable below 420 c, whereas -in2s3 is only stable above 754 c, unless by adding as or sb . -in2s3 crystal is known an n - type semiconductor with the band gap energy of 2.0 ev . Furthermore, its photoconductive properties make it a promising candidate for photovoltaic applications such as solar cells . Solar cell devices prepared by using -in2s3 as a buffer layer show 16.4% conversion efficiency, which is very close to that of the standard cds buffer layer . A variety of methods have been developed into synthesized in2s3 powder, thin films, and nanofibers . Powder of -in2s3 was synthesized using indium chloride (incl3) and thioacetamide (ch3csnh2) as precursors via the sonochemical route . -in2s3 thin films were prepared using the csp technique, and the spray solutions were mixtures of indium chloride (incl3) and thiourea (cs(nh2)2). In addition, -in2s3 nanofibers were prepared using indium chloride and thiourea as source precursors by hydrothermal method with aao membrane at 150 c for 15 h. . However, -in2s3 nanowires were fabricated within aao template synthesis, using the electrodeposition and sulfurizing methods that are not yet reported . To fabricate the -in2s3nanowires, an effective and economical technique - anodic alumina oxide (aao) membrane - assisted method was utilized in this study . Porous anodic aluminum oxide (aao) membrane with average channel diameter of 60 nm and thickness of 25 m was fabricated by two - step anodization process as described previously . First, high purity aluminum sheet (99.9995%) was anodized in the oxalic acid solution under constant voltage 40 v for several hours . Subsequently, the anodized al sheet was put into h3po4 solution to completely remove the alumina layer . The aao membrane can be fabricated by repeating the anodization process under the same conditions of the first step anodization . After the anodization, the aao membrane was obtained by etching away the underlying aluminum substrates with hgcl2 solution . Finally, the diameter of the nanochannel was about 60 nm . In order to prepare for pure indium (in) nanowires, a layer of pt was sputtered onto one side of the membrane acting as the working electrode in a standard two - electrode electrochemical cell . Pure indium (in) was electrodeposited inside the nanochannels of the aao membrane under constant voltage, using an electrolyte containing in(so4)3, h3bo3,and distilled water . The aao membrane with pure indium (in) nanowires was washed with distilled water and air dried, put into a glass tube and together with sulfur powder (99.99%). The glass tube was evacuated by using a pump, and it was placed into the furnace . The samples were then heated from room temperature (heating rate: 5 c / min) to 500 c and held at this temperature for 10 h to completely sulfurize the pure indium (in) nanowires . The morphologies of the as - prepared aao membrane and the -in2s3nanowires were analyzed by field emission scanning electron microscopy / energy dispersive spectrometer (fe - sem / eds, hitachi s-4800). The crystal structure of the nanowires was examined by x - ray diffraction (xrd, shimadzu xrd-6000) utilizing cu k radiation . More details about the microstructure of the -in2s3nanowires were investigated by the high - resolution transmission electron microscopy / corresponding selected area electron diffraction (hr - tem / saed, jeol jem-2010). For hr - tem and saed analysis, then, a few drops of the resulting suspension were dripped onto a copper grid . For optical analysis, the aao membrane was dissolved by naoh solution at room temperature and washed with distilled water to expose freely nanowires of -in2s3 . After the -in2s3nanowires are absolutely dispersed in distilled water using a supersonic disperser, the absorption spectra of the -in2s3nanowires were measured on an uv / visible / nir spectrophotometer (hitachi u-3501). 1a, it can be seen the surface of aao membrane was still kept clean after pure indium (in) nanowires were sulfurized at 500 c for 10 h. figure 1b shows a typical fe - sem image for the cross - section image of -in2s3nanowires . It can be clearly seen that the -in2s3nanowires were wellfilled in nanochannels of the aao membrane . The length of the -in2s3nanowires was in the average range 68 m with the aspect ratio around 117 . Figure 1c reveals the high - magnification fe - sem image, it can be observed that the -in2s3nanowires were independent and parallel to each other with the diameter, which is about 60 nm . The result of eds measurement reveals the atomic ratio of in and s with 41.79:58.21 and is very close to 1:1.5, which is in good agreement with the xrd result . After dissolving the aao membrane by thorough chemical etching and followed by rinsing with distilled water, the -in2s3nanowires are still on the conducting substrate surface (pt). When the aao membrane was dissolved away, the individual -in2s3nanowires were observed almost the same with the diameter of the channels of the aao membrane . Thus, it can be seen the dimension of the -in2s3nanowires was controlled by aao membrane . Fe - sem images ofaplane - view, bcross - section view of -in2s3nanowires arrays with the pore diameter of about 60 nm in the aao membrane, ccross - section view at high magnification of -in2s3nanowires arrays in the aao membrane, anddthe aao membrane was absolutely dissolved in naoh solution figure 2 shows the x - ray powder diffraction (xrd) spectra of the as - prepared -in2s3 nanowires without aao membrane, which makes the crystal structure of the -in2s3 nanowires convenient for characterization . All the peaks were indexed as the reported data for -in2s3 (jcpds card no . 32 - 0456). After the pure indium (in) nanowires were completely sulfurized, no diffraction peaks of in and s or other impurities have been found . Furthermore, the in peaks totally disappear and the -in2s3 peaks appear after sulfurize the pure indium (in) nanowires . Metal oxides such as in2o3 nanowires have been prepared by oxidation of pure indium (in) nanowires, and it is generally accepted that the chemical reaction of oxidation and sulfurization are similar to each other . Hence, the technique used here for formation of -in2s3 is understandable . The reaction equation of -in2s3 nanowires can be expressed as follows:(1) x - ray diffraction patterns of -in2s3nanowires without aao membrane in which the s atoms would react with in atoms at high temperatures to form -in2s3nanowires . The completeness of reaction is mainly dominated by time and temperature, long periods and high temperatures of the sulfurization process were needed to prepare the fine crystalline -in2s3nanowires . We observed that the -in2s3nanowires were completely formed when the sulfurization time reached to 10 h and the temperatures up to 500 c . Detailed information on the microstructure of as - prepared -in2s3nanowires was obtained by hr - tem . Moreover, the concentric diffraction rings could be indexed outwards as (2 2 12), (1 0 9), (0 0 12) and (1 0 3) lattice planes of tetragonal -in2s3 . The hr - tem image of the nanowires (fig . 3d) shows the parallel fringes with a spacing of 0.1913 nm, which can be assigned to the (2 2 12) plane of -in2s3 . Athe low - magnification hr - tem image of -in2s3nanowires, bthe high - magnification hr - tem image of an individual -in2s3nanowire, csaed pattern of an individual -in2s3nanowire, anddhr - tem image of a single -in2s3nanowire with lattice fringes figure 4 shows the uv / visible / nir absorption spectra of the as - grown -in2s3 nanowires, recorded in the wavelength range 200900 nm, which obviously reveals a broad absorption peak around 350 nm . Recently, shen et al . Reported that the bulk of in2s3 was prepared by in(no3)34.5h2o with h2s at 300 c for 3 h in the muffle oven . In addition, in2s3 colloidal thin films were synthesized by the spin - coating method . They prepared a yellow colloid suspension by adding h2s gas into an incl3 solution, containing a small amount of acetic acid as a stabilizer . The thin film was heated at 400 c for 30 min under a n2 atmosphere . Furthermore, flowerlike -in2s3 assembled with nanoflakes were synthesized by the hydrothermal method using incl34h2o and l - cysteine . In addition, in2s3 hollow spheres were prepared by dodecanethiol - assisted hydrothermal process at 180 c for 12 h, employing incl34h2o and l - cysteine as precursors . However, our value of absorption peak is between the largest value of bulk (650 nm) and the smallest value of hollow spheres (251 nm). Uv / visible / nir absorption spectra with -in2s3nanowires and (h)versushplot (inset) in order to determine the band gap energy (eg) of the -in2s3 nanowires, the optical absorption coefficient () at the absorption edge may be expressed as: (2) where hv is the photon energy, a is the optical transition dependent constant, eg is the optical band gap, and m is a constant that depends on the types of transitions involved . The values of m = 1/2, 3/2, 2, and 3 are for direct allowed, direct forbidden, indirect allowed, and indirect forbidden transitions, respectively . This equation gives band gap (eg), when straight portion of (h) against h plot is extrapolated to the point = 0 . The analysis of the absorption spectra obtained for our samples shows that the spectral variation of the absorption coefficient, within the fundamental absorption region can be fitted by eq . However, m = 3/2, 2, and 3, the band gap energies were found to be a negative number, which is not reasonable in physics . Relationship fitting to the absorption spectra of -in2s3 as m = 1/2, which is the allowed direct transition for these nanowires . In this inset figure, we observed that the curve has a very good straight line fit from 2.7 to 2.9 ev . We also observed that the curve has been breakaway this line range when the photon energy is above 2.9 ev . The band gap energy (eg) of -in2s3 nanowires with diameter of about 60 nm is estimated to be 2.40 ev as m = 1/2 for extrapolation . In literature, powder of -in2s3 was synthesized using incl3 and ch3csnh2 as precursors followed by annealing in ar atmosphere in the temperature range 5731,123 k. the grain size of powder varied in the range 0.401.48 m for different annealing temperatures . The band gap energy of -in2s3 powder for various grain sizes was between 2.12 and 2.14 ev . Moreover, thin films of in2s3 were prepared from in2s3 powder using vacuum evaporation with resistively heated graphite crucible . The optical band gaps of in2s3 thin film for different annealing temperatures and times were between 1.75 and 2.19 ev . -in2s3 films were prepared by rapid heating of metallic indium (in) films in h2s atmosphere . Consequently, our band gap energy of -in2s3 nanowires with 60 nm is between the largest band gap energy with grain sizes of 2230 nm (2.58 ev) and the smallest band gap energy with grain sizes around 0.22 m (1.75 ev). Our band gap energy of -in2s3 nanowires with 60 nm is acceptable with literature [19 - 21]. In summary, we have presented a simple, inexpensive, and reasonable method to fabricate -in2s3nanowires . The -in2s3nanowires were first fabricated by sulfurizing the pure indium (in) nanowires at 500 c for 10 h, which is embedded in an aao membrane . -in2s3nanowires have high wire packing densities with uniform wire diameters and lengths of about 60 nm and 68 m, respectively . The analysis of the hr - tem / saed revealed that the -in2s3nanowire is polycrystalline . The -in2s3nanowires exhibited a linear relationship at 2.72.9 ev asm = 1/2, indicating that the direct band gap energy is 2.40 ev.
|
The idiopathic retinitis, vasculitis, aneurysms and neuroretinitis (irvan) syndrome is a retinal vascular disorder of unknown etiology characterized by three major criteria (multiple leaking aneurysmal dilations, retinal vasculitis and neuroretinitis) and three minor criteria (peripheral capillary nonperfusion, retinal neovascularization and macular exudation). Irvan syndrome may progress rapidly to severe visual loss, mainly due to the development of exudative maculopathy and/or retinal ischemia, and its neovascular sequelae such as vitreous hemorrhage and neovascular glaucoma [1, 2]. Retinal photocoagulation (rp) is the only treatment that has shown evidence to prevent the progression of the disease by acting on proliferative changes [1, 3]. Herein, we report a clinical case of irvan syndrome with both retinal neovascularization and macular exudation successfully managed with intravitreal ranibizumab (lucentis) as adjunctive therapy to rp . A 42-year - old man came to our department with a 1-month history of blurred vision in his right eye (re). Best corrected visual acuity (bcva) was 20/40 in the re and 20/20 in left eye (le). Slit lamp examination was bilaterally unremarkable . Fundus examination of the re evidenced the presence of numerous lipid and soft exudates within the macular area, accompanied by tortuous vessels with aneurysmal changes and marked papillary neovascularization (fig . Le funduscopy revealed asymptomatic papillary neovascularization, lipid and soft exudates in the vascular arcades, but no macular involvement (fig . Fluorescein angiography demonstrated bilateral aneurysmal changes of the retinal arteries with staining of their walls, papillary neovascularization with active leakage of the optical nerve head, and extensive areas of retinal ischemia not only in the periphery but also in the posterior pole (fig . 1c, d). Optical coherence tomography (oct; carl zeiss, dublin, calif ., usa) showed a subfoveal detachment of the neurosensory retina with prominent reflectance from the accumulation of lipid exudates in the outer retina of the re and a normal foveal contour in the le (fig . A complete ocular and systemic examination including chest x - ray, routine blood chemistry, erythrocyte sedimentation rate, angiotensin - converting enzyme, purified protein derivative, venereal disease research laboratory, fluorescent treponemal antibody absorption test, antiphospholipid antibodies, antinuclear antibodies and antineutrophil cytoplasmic antibodies was performed, and the mantoux and pathergy tests were within normal limits . Given the clinical findings optic nerve neovascularization and macular exudation dramatically regressed 1 month after the second injection, and bcva improved to 20/30 in the re (fig . Panretinal photocoagulation (prp) in the re and selective photocoagulation of the ischemic areas in the le were performed (fig . 2c f). At the 1-year follow - up, bcva was 20/20 bilaterally, with complete regression of neovascularization and exudation and no need for further retreatment . Irvan syndrome is a retinal vascular disease characterized by bilateral multiple leaking aneurysmal dilations, vasculitis, neuroretinitis and peripheral vascular ischemia . Very few cases have been reported in the literature since kincaid and schatz described the first 2 patients with bilateral retinal arteritis and multiple aneurysmal dilatations in 1983 . The disease usually presents in the third or fourth decade of life and there are no known systemic associations . Visual loss is caused by exudative maculopathy and/or neovascular sequelae of retinal ischemia so that the prognosis of irvan syndrome depends on prompt treatment [1, 2]. Although the best therapy has not yet been established, rp seems to be the most suitable option to control the disease and to prevent its progression [1, 2, 3]. Other treatments have been reported with variable results such as corticosteroids [1, 2, 3], pars plana vitrectomy [2, 5], anti - tnf alpha agents, antiangiogenic drugs [7, 8] or the direct application of laser on aneurysms . A functional staging system based on progressive ischemia and stage 1 includes macroaneurysms, exudation, neuroretinitis and retinal vasculitis; stage 2 includes angiographic evidence of capillary nonperfusion; stage 3 is characterized by the presence of posterior segment neovascularization and/or vitreous hemorrhage; stage 4 includes anterior segment neovascularization, and stage 5 includes neovascular glaucoma . Samuel et al . Published the most relevant case series of irvan syndrome, including 44 eyes of 22 patients . All eyes treated with laser in stage 2 maintained a vision of 20/20 without progression of the disease . Many of the treated eyes in stage 3 also maintained an acceptable visual acuity of 20/40 or better; however, 25% of the patients in this stage ended with a visual acuity of 20/200 or worse, with progression of the disease . Half of the patients treated in stages 4 and 5 progressed to a severe vision loss in spite of treatment . These results show the importance of an early diagnosis and treatment in patients with irvan syndrome; the treatment of stage 2 cases being the one that achieves better visual results . Vascular endothelial growth factor plays an important role in ocular neovascularization as ischemia is the main stimulus in its production . Antiangiogenic drugs have demonstrated a beneficial effect by controlling neovascularization and macular edema in diseases such as exudative age - related macular degeneration, diabetic retinopathy and retinal vein occlusion . The use of these drugs has also been described in retinal vascular diseases that share certain characteristics with irvan syndrome, such as retinal arterial macroaneurysms, eales disease and coats disease . Previous clinical case reports have shown the efficacy of intravitreal bevacizumab and ranibizumab therapy as adjunctive treatment for irvan syndrome; however, none of these cases had exudative maculopathy [7, 8]. We reported a clinical case of a stage 3 irvan syndrome with the presence of macroaneurysms, exudation, neuroretinitis, retinal vasculitis and bilateral retinal neovascularization . Prp in the re and selective laser application on the ischemic areas in the le were consecutively performed . After the 1-year follow - up, visual acuity remained 20/20 in both eyes, with no evidence of progression of the disease and no need for further retreatment . The case presented underlines that intravitreal ranibizumab alone can cause a reduction of the irvan - associated exudation . We conclude that ranibizumab constitutes an effective and safe adjunctive treatment for irvan syndrome, contributing to the control and disappearance not only of the neovascularization but also of the macular exudates.
|
Sinonasal teratocarcinosarcoma (sntcs) is a very unusual and aggressive neoplasm first characterized as a separate entity by heffner and hyams in 1984.1 it is currently defined by the world health organization as a complex malignant sinonasal neoplasm combining features of teratoma and carcinosarcoma that typically includes benign and malignant epithelial, mesenchymal, and neuroepithelial elements including immature tissue with blastomatous features.2 unlike other malignant mixed germ cell tumors (gcts), sntcs lacks embryonal carcinoma, yolk sac tumor, choriocarcinoma, and seminoma components . Based on an inadequate sample, this heterogenous tumor can be misdiagnosed as olfactory neuroblastoma, squamous cell carcinoma, undifferentiated carcinoma, adenocarcinoma, malignant salivary gland - type tumors, or adenosquamous carcinoma.2 a recent comprehensive review of the literature by wei et al revealed <60 cases reported in the english literature.3 the primary treatment in 82% of the cases reviewed was surgery, with or without adjuvant radiation therapy (rt). There were high rates of recurrence and metastasis overall, although no clear prognostic factors were identified . Overall, 1-year and 3-year survival rates were 36% and 25%, respectively, for those patients with reported outcomes.3 of all the reported cases of sntcs, only one has shown any hormone secretion: antidiuretic hormone, causing hyponatremia.4 in that case, sodium levels were a reliable marker of tumor control and were an early postoperative indicator of tumor recurrence . To date, no sntcs with elevated gct markers has been reported . We present a case in which a highly radiosensitive sntcs was associated with elevated -hcg . A 22-year - old african american woman presented to the emergency department at 16 weeks of gestation with a 2- to 3-month history of worsening headaches and a 3-week history of increasing somnolence, nausea, vomiting, weight loss, and personality changes . A magnetic resonance imaging (mri) of her head revealed an 11-cm right frontal mass with a 7-cm cystic component causing significant compression of the right frontal and temporal lobes, mild herniation of the right uncus, and mild hydrocephalus . The tumor extended through the anterior cranial base to the nasal cavity and paranasal sinuses (fig . Noncontrast magnetic resonance imaging of the head showing a large cystic mass in the paranasal sinuses and frontal lobe . On day 2 of admission, she had rapid mental status decline and underwent an emergent decompressive craniotomy . The tumor was extra - axial, and the cyst expressed a dark fluid similar to crankcase oil . The small biopsy specimen taken during this procedure revealed neoplastic cells with squamous and basaloid differentiation and necrosis, leading to the impression of basaloid squamous cell carcinoma . She subsequently underwent a combined endoscopic transnasal and cranial resection of the entire anterior cranial fossa and nasal cavity mass on day 28 of admission . The surgical specimen consisted of a 9.0 8.5 3.5-cm aggregate of tan - brown soft tissue and bony fragments . Histologically, the tumor consisted of a heterogeneous mixture of malignant epithelial, mesenchymal, and primitive neuroepithelial elements . Tumor infiltration of brain tissue was observed . The epithelial component included squamous and basaloid carcinoma features (fig . The mesenchymal component included areas of hypercellular smooth muscle, ranging from mildly anaplastic to overtly malignant, with focal areas of osteoid deposition (fig . 3). The neuroepithelial component included neuroblastoma - like and primitive neuroectodermal tumor - like areas (fig . Immunohistochemical staining revealed expression of vimentin, pancytokeratin, and 34e12, with focal positivity for cd99 and synaptophysin among the heterogeneous tumor components . (a) stromal smooth muscle with mitoses (hematoxylin and eosin [h&e]). (b) osteoid (lower right) admixed with epithelial component (upper left) (h&e). (b) primitive neuroectodermal tumor like area; hematoxylin and eosin; synaptophysin (inset). Postoperative rt was recommended after surgery but was delayed for 5 months due to a complicated hospital course and family concerns about her pregnancy . The radiation planning mri showed some residual soft tissue thickening and gyral enhancement in the floor of the craniotomy site but no gross tumor . After delivery of a healthy infant, she underwent a 2-month course of rt to the surgical bed to a total dose of 60 gy . The follow - up mris showed no evidence of recurrent disease for 18 months post - rt . Two years (27 months) after finishing her postoperative rt, she was admitted for evaluation through the emergency department following an alleged sexual assault by a family member . Her quantitative serum -human chorionic gonadotropin (hcg) was elevated (60 u / l; normal nonpregnant range: 03) but did not rise as would be expected for pregnancy . Mri of the head showed a recurrent intracranial mass in the right frontal lobe (fig . She was deemed a high surgical risk, so reirradiation of the tumor was recommended . Radiation was delayed by 45 days, and the planning mri showed significant interval growth of the tumor with further elevation of -hcg to 130 u / l (fig . (a) magnetic resonance imaging (mri) showing frontal lobe recurrence 27 months after radiation therapy . (b) mri showing tumor growth 45 days later, before reirradiation . (c) mri showing complete response of frontal lobe mass (and new posterior fossa disease) 1 month after reirradiation . Because of clinical concern over the origin of the serum -hcg elevation, the previous tumor tissue was examined with additional immunohistochemical staining for smooth muscle actin and -hcg expression . The patient received 48 gy (of a planned 50 gy) of rt to the recurrent mass in 24 fractions . She missed many appointments but finished most of her prescribed course in a 6-week period with no acute morbidity . Computed tomography scan after the 10th fraction showed significant tumor response, and the treatment was replanned to account for the smaller tumor volume . Her serum -hcg level dropped from a peak of 130 u / l, measured at the start of rt, to 6 u / l (almost within normal limits) at the end of treatment (fig . 7), serum -human chorionic gonadotropin levels before and after radiation therapy (rt) for recurrence in frontal lobe . One month later she was admitted to the hospital again for increasing ataxia and falls . 5c) but revealed at least five intracranial masses in the posterior fossa, outside of the prior rt fields . Serum -hcg level was in the normal range . The decision was made to palliate with 30 gy of rt to the posterior fossa in 10 fractions . By definition, sntcs do not contain areas of embryonal carcinoma, choriocarcinoma, yolk -sac tumor, or seminoma . They are hypothesized to arise from primitive pluripotent olfactory epithelial cells rather than germ cells . Thus they are traditionally believed to be incapable of producing gct markers including -hcg or -fetoprotein, although they have rarely been noted to produce pituitary hormones.4 these tumors comprise varying combinations of epithelial, mesenchymal, and neuroectodermal components exhibiting varying maturation . The mesenchymal component may appear along a continuum from benign to malignant and can include mature components such as cartilage, bone, and striated or smooth muscle . Malignant sarcomatous transformation is also documented.1 5 6 7 in this case, smooth muscle actin highlighted an anaplastic smooth muscle component in this heterogeneous tumor . There are rare reports of pure leiomyosarcomas secreting -hcg in the literature.8 9 10 in the absence of the gct components just mentioned, the neoplastic smooth muscle component of the tumor with expression of -hcg was the likely source for the elevated serum -hcg levels . Because this patient was pregnant on initial presentation, any tumor - related -hcg production at that time however, on recurrence, tumor production of -hcg was confirmed with elevation of serum -hcg, expression of -hcg on the smooth muscle component of the tumor tissue, and correlation of serum -hcg levels with changes in tumor size seen on imaging . This patient's recurrent tumor initially showed a complete response to rt by both serum marker and imaging criteria . Subsequent tumor growth outside of the rt field was not associated with elevation of serum -hcg . Sntcs is a rare and unusual neoplasm that lacks embryonal carcinoma, yolk sac tumor, choriocarcinoma, and seminoma components . The source of -hcg production was traced to a neoplastic smooth muscle component of the tumor . Serum levels of this hormone were a reliable tumor marker during the patient's first recurrence and subsequent rt.
|
An estimated 18.8 million adults in the united states are reported to have diabetes mellitus . . Studies with intensive glycemic control reveal significant reductions in microvascular complications and possible long - term reductions in macrovascular disease . Several professional organizations (american diabetes association, european association for the study of diabetes and american association of endocrinologists) have come out with position statements and guidelines regarding management options and goals in treating diabetes . Often these recommendations are driven by evidence supporting the use of a pharmacologic agent based on what is known about the pathogenesis of diabetes and pharmacodynamics of antidiabetic drugs (antihyperglycemic agents) chosen . A recent survey of goals in u.s diabetes care between 1999 and 2010 showed that almost half of the u.s adults with diabetes did not meet the recommended goals for diabetes care . While one can assign complex interactions among factors at various levels from patient level to provider and systems level, for difficulty in achieving desired goals, it should not be overlooked that despite best attempts goals may not be achieved because therapy chosen may not address the dominant underlying defect leading to dysglycemia / hyperglycemia . Key to success in treating disease lies in addressing the defect(s) that drives the pathological process in the first place . This is perfectly demonstrated in the treatment of infections that is driven by identifying the infectious agent responsible for the disease and then choosing appropriate antimicrobial therapy that leads to eradication of infection . Unfortunately in treating metabolic disorders, we are dealing with a chronic disorder, which is often unrelenting and physicians often struggle to contain the damage . It is quite possible that we may have been sidetracked by focusing on factors presumed to have a dominant role in the pathogenesis of diabetes and its complications . In recent history, diabetes mellitus type 2 has been considered a two hit disorder with insulin resistance playing a primary role followed by beta cell dysfunction leading to the clinical syndrome of diabetes with attendant hyperglycemia . Insulin resistance has been considered the evil force that drives the pathology and therapies have evolved attempting to address this defect with the hopes of improving outcomes . Insulin resistance has been considered to be a driver for pancreatic cell dysfunction as well based on studies designed to study autocrine effect of insulin on the cell . There are transgenic rodent models that invoke the need for many of the elements of insulin receptor substrate-2 signaling pathway for proper cell function and health . This does not necessarily mean that the ligand that drives this system is the insulin itself . Inferences drawn from cell insulin receptor knock out models, cell igf-1 receptor knock out or double knock out models have been recently questioned on technical grounds that these knock outs are unlikely to be cell specific . It is quite possible that insulin modulation of islet cells / beta cell function is orchestrated at central nervous system (cns) level or through modulation of other local / regional hormones / transmitters . Indeed fate of beta cell is intricately linked to health of cell that produces glucagon . Cells are a target for insulin action both though direct and cns mediated insulin effect resulting in reducing / restraining glucagon secretion by cells . The cell specific insulin receptor knock out mouse model manifests glucagon hypersecretion in the postprandial state accompanied by defective glucagon secretion in the fasting state recapitulating abnormalities seen in type 2 diabetes . Interestingly also these animals show expansion of cell mass indicating an important role for glucagon in regulating cell mas . The new cells seem to arise from alpha cells with resultant depletion of alpha cells . Centrally insulin restrains alpha cell glucagon response by acting at the level of ventromedial hypothalamus . The potential for cell to transdifferentiate into cell assigns cell role of guardian for repair and regeneration of injured cells . Not all patients with insulin resistance have diabetes and insulin resistance alone without cell insufficiency does not cause diabetes . Most often insulin resistance is accompanied by obesity and hyperinsulinemia . Obesity is often associated with adipocyte dysfunction leading to production a vast number of adipokines / cytokines which adversely impact insulin sensitivity . It could be argued sick adipocyte is the cause of insulin resistance rather than its consequence . Certainly insulin resistance places strain on the cell and contributes to its dysfunction possibly via glucotoxicity and lipotoxicity leading to hyperglycemia . The notion that insulin resistance is a key determinant of vascular damage in type 2 diabetes also deserves reconsideration in light of adverse outcomes reported with insulin sensitizers (rosiglitazone). Pioglitazone, another insulin sensitizer may not be free from adverse effects particularly in the elderly . This raises an important question that has intrigued clinicians for a long time - that is whether insulin resistance actually offers cardioprotection in patients with type diabetes . A fascinating longitudinal study involving evolution of type 2 diabetes, where the investigator used sophisticated personal omics, dysglycemia was not preceded by insulin resistance . It is not the intent here to dismiss insulin resistance as a lesser evil; a rich body of literature attests to its important role in evolution of diabetes, what remains questionable is its primacy as the chief instigator . The concept that cell failure as a consequence of lipotoxicity, glucotoxicity, glucolipotoxicity, oxidative / inflammatory injury or accelerated apoptosis have all been proposed and evidence proffered . Unloading glycemic and lipid load have all been shown to result in improved cell function even when the peripheral insulin resistance remains unchanged . Furthermore, regardless of the severity of insulin resistance, hyperglycemia does not develop as long as the cell is functioning appropriately . Consequently, the cell has come under sharp scrutiny in terms of strategies that would improve its function or prevent / decrease apoptosis . Hyperglycemia that beta cell failure begets further adversely affects the cell itself as well as other sites (liver, muscle and kidney) contributing to worsening hyperglycemia . Until very recently treatments were mostly geared towards either providing more insulin, augmenting insulin action or coaxing pancreas to produce more insulin . The ensuing hyperinsulinemia which would compound preexisting hyperinsulinemia seen in insulin resistance studies where insulin or insulin secretagogues were used with the hopes of reducing macrovascular complications by strict glycemic control were disappointing . Actually questions were raised about the safety of intensified control in patients with type 2 diabetes mellitus and preexisting cardiovascular disease (accord, vadt). Aggressive glucose lowering was shown to be of no benefit in type 2 diabetic patients undergoing cardiovascular surgery in recently reported nods study . Focus on cell and its products (mostly insulin) and glucose: insulin - glucose axis has possibly hindered considering other potential angles that are relevant to both etiology as well as treatment of diabetes . Attention to this was very tastefully articulated by late denis mcgarry in his article what if minkowski had been ageusic he argued that hyperglycemia and insulin resistance might be better explained when viewed in the context of underlying abnormalities in lipid metabolism . In recent years knowledge gained from these investigations raise hope for developing alternate forms of therapeutic regimen that would prevent cell loss and possible enhance its action . A more recent discovery that has somewhat caused a flutter is the trans differentiation of cell to cell in patients with type 2 diabetes which might explain progressive worsening of hyperglycemia in patients with diabetes . It is proposed that dedifferentiation trumps the endocrine cell death in the natural history of type 2 diabetes . Salvaging this dedifferentiation process might be an approach to treating cell dysfunction in diabetes . Conversion of mature human cell into glucagon producing cell can happen without any genetic modification . Review of evidence gathered over last 4 decades would argue that insulin centric view of metabolic homeostasis is incomplete and that glucagon is the other key regulator of normal fuel metabolism . Glucagon is the product of cell that lies in the immediate neighborhood of cell . Their proximity to each other argues for a mutual paracrine control . In type 1 diabetes, mellitus (t1 dm) administration of recombinant leptin to insulin - deficient mice with uncontrolled t1 dm reversed entire catabolic syndrome without replacement of any insulin . However, in intact subjects the function of suppressing glucagon secretion rests with insulin . Thus while insulin alone may not be the sole factor in regulating glucose metabolism, it is an important adjunct that exerts critical restraint over the cell . Therefore, in situations where the cell becomes sick / inefficient / dysfunctional, cells secretory product - glucagon makes matters worse . Thus, our focus on substituting insulin alone may not be sufficient since we may not be able to achieve safely insulin concentrations within islets that are necessary for glucagon suppression . Until recently glucagon's primary action was limited to the liver where it augments hepatic glucose output . Recently, it was shown that glucagon has an opposing action on liver (suppressing hepatic glucose output) brought about by acting through mediobasal hypothalamic region of the brain . High fat diet appears to induce resistance to this negative feedback loop contributing further to worsening hyperglycemia seen in obesity, diabetes or both . Reviewing evidence from various experimental models such as glucagon receptor knockout mice (glcar /), arx deficient mice, studies with noninsulin glucagon suppressors (amylin, glp-1 agonists), a persuasive case be made for the crucial role of dysregulated glucagon secretion in type 2 diabetes and beneficial effects from its amelioration . It incorporates both cell types of pancreatic islet operating in a reciprocal fashion, operating via a loop that that includes liver and the cns . While insulin operates outside this loop as well, glucagon's sphere of activity largely rests within this loop . Despite the appreciation of benefits of lowering glucagon secretion in hyperglycemic states, long - term effects of reduced glucagon signaling remain a concern . It must be appreciated as well that glucagon is the principal defender against hypoglycemia and blunting / abrogating glucagon signal might adversely impact recovery from hypoglycemia - a major concern in people with diabetes . Need to reconsider ways to mitigate insulin - glucagon dissonance stems from failure of insulin alone to provide safe effective control of diabetes in patients with long standing diabetes particularly in those with vascular complications . Furthermore, it is influenced by the recent discovery that hyperinsulinemia, often written off as benign consequence of insulin resistance, may not be that benign . Recent experiments in mice creating ins-1 haploinsufficiency lead to protection from diet induced obesity and reprogrammed white adipose tissue to express uncoupling protein 1 and increase energy expenditure . These observations would support the conclusion that hyperinsulinemia may actually contribute to expansion of fat mass that would then add all metabolic dimensions that one encounters in obese patients . In addition, treating insulin resistance with insulin at higher doses may be deleterious for tissues where insulin resistance may actually be offering protection against metabolic stress . Review of evidence gathered over last 4 decades would argue that insulin centric view of metabolic homeostasis is incomplete and that glucagon is the other key regulator of normal fuel metabolism . Glucagon is the product of cell that lies in the immediate neighborhood of cell . Their proximity to each other argues for a mutual paracrine control . In type 1 diabetes, mellitus (t1 dm) administration of recombinant leptin to insulin - deficient mice with uncontrolled t1 dm reversed entire catabolic syndrome without replacement of any insulin . However, in intact subjects the function of suppressing glucagon secretion rests with insulin . Thus while insulin alone may not be the sole factor in regulating glucose metabolism, it is an important adjunct that exerts critical restraint over the cell . Therefore, in situations where the cell becomes sick / inefficient / dysfunctional, cells secretory product - glucagon makes matters worse . Thus, our focus on substituting insulin alone may not be sufficient since we may not be able to achieve safely insulin concentrations within islets that are necessary for glucagon suppression . Until recently glucagon's primary action was limited to the liver where it augments hepatic glucose output . Recently, it was shown that glucagon has an opposing action on liver (suppressing hepatic glucose output) brought about by acting through mediobasal hypothalamic region of the brain . High fat diet appears to induce resistance to this negative feedback loop contributing further to worsening hyperglycemia seen in obesity, diabetes or both . Reviewing evidence from various experimental models such as glucagon receptor knockout mice (glcar /), arx deficient mice, studies with noninsulin glucagon suppressors (amylin, glp-1 agonists), a persuasive case be made for the crucial role of dysregulated glucagon secretion in type 2 diabetes and beneficial effects from its amelioration . It incorporates both cell types of pancreatic islet operating in a reciprocal fashion, operating via a loop that that includes liver and the cns . While insulin operates outside this loop as well, glucagon's sphere of activity largely rests within this loop . Despite the appreciation of benefits of lowering glucagon secretion in hyperglycemic states, long - term effects of reduced glucagon signaling remain a concern . It must be appreciated as well that glucagon is the principal defender against hypoglycemia and blunting / abrogating glucagon signal might adversely impact recovery from hypoglycemia - a major concern in people with diabetes . Need to reconsider ways to mitigate insulin - glucagon dissonance stems from failure of insulin alone to provide safe effective control of diabetes in patients with long standing diabetes particularly in those with vascular complications . Furthermore, it is influenced by the recent discovery that hyperinsulinemia, often written off as benign consequence of insulin resistance, may not be that benign . Recent experiments in mice creating ins-1 haploinsufficiency lead to protection from diet induced obesity and reprogrammed white adipose tissue to express uncoupling protein 1 and increase energy expenditure . These observations would support the conclusion that hyperinsulinemia may actually contribute to expansion of fat mass that would then add all metabolic dimensions that one encounters in obese patients . In addition, treating insulin resistance with insulin at higher doses may be deleterious for tissues where insulin resistance may actually be offering protection against metabolic stress . Oral antihyperglycemic agents alone often fail to bring patients to target goals and use of insulin might not always be a safe option . Future therapies should be directed at countering effects of glucagon at the hepatic level without countering its central role at the cns level . At present it remains a concept, but nothing stands in a way of exploring this possibility . Such therapies must be safe and free from any worrisome adverse effects (cellular hyperplasia, adverse hepatic effects etc . ). There is a dire need to avoid the use of insulin beyond limits of safety.
|
Epilepsy affects 12% of the population worldwide and can be considered one of the most prevalent neurological illnesses . Furthermore, between 20 and 25% of epileptic patients are resistant to drug treatment . The most common type of drug - resistant epilepsy is temporal lobe epilepsy (tle); however, patients with this form of epilepsy might be candidates for surgical resection of the epileptic focus [3, 4]. Before surgical resection, patients undergo a battery of tests during presurgical evaluation, including noninvasive ancillary tests such as video - electroencephalography (v - eeg), magnetic resonance imaging (mri), single photon emission - computed tomography (spect), and positron emission tomography (pet) [35]. On occasion, invasive recordings are required, among which are foramen ovale (foe), subdural, or depth electrodes . Spect is a technique that measure the regional cerebral blood flow (cbf) using radio - tracers [6, 7], and it can be used during ictal or interictal phases . Ictal spect is considered useful for identifying the epileptic zone (ez, defined as the anatomical area necessary and sufficient for initiating seizures, and whose removal or disconnection is necessary for abolition of seizures), which is usually associated with regional hyper perfusion . On the other hand, the interictal spect is not performed regularly, but when performed the epileptogenic area shows hypoperfusion . Alternatively, a pharmacological approach can be taken to identify the ez . For this purpose, several different drugs have been used, including methohexytal, clonidine, etomidate, pentylenetetrazol, thiopental, and the opiates fentanyl and alfentanyl . However, the search for an appropriate pharmacological agent for ez identification is far from complete because nonspecific responses often result and because poorly tolerated side - effects preclude the safe use of many drugs (e.g., the stiffness induced by opiates). An ideal drug for eeg activation should have the following features: (1) it should be well tolerated by the patient, with a fast onset and rapid decline of activity, as well as a low level of side - effects, (2) it should produce selectively increased activity in the epileptic zone, implying no new interictal epileptiform discharges (ieds) emerging, and (3) it should specifically distinguish between the interictal zone (iz, the area showing interictal epileptiform discharges or ied) and ictal onset zone (ioz, where seizures in fact start). Etomidate is a rapidly - inactivating imidazol derivative [sulphate - r-(+)-ethyl-1-(-1-phenylethyl)-1-h - imidazol-5-carboxylate] with a peak effect at 1 min and a duration of 35 min . It is a nonbarbiturate hypnotic agent without analgesic properties but does activate gamma - aminobutyric acid a (gabaa) receptors . One important benefit of etomidate is its safety; the lethal dose is 30 times greater than the effective dose . Although etomidate has been sporadically used for eeg activation [17, 18], to date the central aims of this study were to analyze changes in regional cbf in patients with tle in response to administration of etomidate and to examine its possible utility for diagnosis during presurgical evaluation . The present study included 11 patients (5 women, 6 men) who were diagnosed with intractable epilepsy of the mesial temporal lobe . Informed consent was obtained from all patients and were studied according to an approved protocol used by the epilepsy surgery unit at la princesa hospital [3, 4]. The mean age of the patients was 28.8 2.8 years (x sem) for men and 33.6 3.0 years for women, and men and women had a history of epilepsy for 14.3 4.7 years and 23.2 5.4 years, respectively . Patients were evaluated presurgically using the following: (1) 19-channel scalp eeg according to the 1020 international system, (2) interictal spect using tc - hmpao, (3) 1.5 t mri, and (4) v - eeg with 19 scalp electrodes positioned according to the international 1020 system and complemented with foes . In all patients, the ioz was defined as the region where the seizures originated according to the v - eeg + foe recording . In this study, the ez (especially when assessed with spect) and ioz were equivalent (i.e., we do not differentiate between irritative and ictal onset zone in spect studies). During the v - eeg recording, antiepileptic drugs were removed from the second to the fourth day of the test . To evaluate etomidate, the drug was administered intravenously (i.v .) Between the second to the third day in the v - eeg unit . Etomidate (janssen - cilag, spain) was administered i.v . At a dose of 0.1 mg / kg under quiescent conditions, with the patient resting supine in bed while under continuous supervision by an expert anaesthesiologist (mlm, jlm - ch, ed). The electrocardiogram (ekg), capillary oxygen saturation (sao2), and respiration rate (rr) were continuously monitored during the evaluation . A bolus of tc - hmpao (740 mbq) was intravenously injected immediately after etomidate administration (see pastor et al ., 2008). Studies were performed using a low - energy high - resolution collimator, a simple - head camera (starcam 3200, general electric), and 96 projections of 22 s each, using a 64 64 matrix . Slices were reconstructed by filtering back projections using a butterworth filter (order 10 with a 0.6 cut - off). The brain spect images were acquired in the 30 min following the complete recovery of the patient after etomidate administration . Quantitative analysis of brain perfusion was performed using neurogam software (general electric) to compare several areas of interest, including the frontal, temporal, parietal, and occipital lobes, the putamen, globus pallidus, and thalamus, as defined by default by the software . Moreover, we defined the following areas according to the talairach - tournoux atlas (1998): the latero - basal temporal cortex, amygdaloid body, anterior hippocampus, and posterior hippocampus . To evaluate changes in cbf, we defined the as (1)=cbfetomcbfbasal, where cbfetom and cbfbasal are measures of regional cbf after etomidate administration and under basal conditions, respectively . Basal spect was performed approximately either one week previous or one week after the etomidate activated one . Statistical comparisons between groups were performed using the student's t - test (parametric samples) or the mann - whitney rank sum test (nonparametric samples) if normality failed . Significant changes in regional cbf () were assessed using the z - score, according to the following (null and alternative) hypotheses: (2)h0:1=0 h1:10 . The significance level was set at p <.05 . Results are shown as mean sem unless otherwise indicated . Intravenous administration of etomidate to awake patients was performed over a period of 32.4 2.8 s. progressive drowsiness occurred in 5 patients, while only 1 patient showed severe and rapid drowsiness . In 4 patients, no clinical signs of sleep were observed . In the majority of patients (7), mild myoclonus was observed, especially in the mouth, eyelids, and distal muscles of the upper extremities . One patient showed severe myoclonus in the right arm, which was not associated with ictal activity . In 3 patients all patients recovered in less than 10 min and did not require any special care . Administration of etomidate produced no changes in sao2, heart rate measured by ekg, or rr . Shortly after completion of etomidate administration, small increases in the amplitude and frequency were observed in the scalp eeg (stage 1), followed by generalized, large - amplitude delta activity (stage 2). This pattern was similar to that described previously for nonepileptic subjects [20, 21]. High - voltage spikes and sharp - waves (clearly different from the background activity) increased their frequency (spikes / min) in mesial and, in a lesser degree, in temporal lateral areas, compared with basal activity . It is important to consider that ied only appeared in those areas where spikes were recorded under basal conditions (figure 1). Taking into account the short latency of changes in eeg and the dynamics of brain activity after etomidate injection, we can assume that almost a 40% of tc - hmpao is in the brain when the eeg activity is in stage 2 . Therefore, etomidate induced a specific pattern of brain activity, which included nonirritative activity on the majority of scalp leads, in addition to irritative activity specifically over those areas where ieds previously were observed . We observed a significant increase in the regional cbf in the thalamus (p <.05, z - score, n = 22), the posterior hippocampus (p <.05), and putamen (p <.05), and these changes occurred bilaterally . However, the only brain structure in which the regional cbf differed between epileptic and nonepileptic hemispheres was the posterior hippocampus (figure 2). In this area, a cbf was significantly increased in the nonepileptic lobe compared with the epileptic lobe (p <.05, paired student's t - test). It is interesting to consider the activation mediated by etomidate in the mesial temporal region because we would expect to find an increase in cbf associated with increased interictal activity . In this study, we have shown that administration of etomidate is a safe and efficient pharmacological method potentially useful in patients suffering from tle during presurgical evaluation . However, the changes observed in regional cbf, specifically in areas associated with the ez, have been unexpected . Traditionally, several different drugs are used to induce brain activity . As stated previously, it is clinically important that side effects induced by a drug be well tolerated by the patient . The primary side effects observed were myoclonus and moderate pain . The appearance of myoclonus following etomidate perfusion has previously been described . Although these events are not associated with epileptic activity measured by scalp recordings, a medullar origin for myoclonic movements has been proposed [22, 23]. In fact, no significant hemodynamic effects have been observed, although higher doses (0.35 0.17 mg / kg) have been shown to induce tachycardia and increase mean arterial pressure . As previously reported [17, 21, 25], etomidate leads to a brief increase in amplitude and frequency of brain activity, recorded by scalp eeg, followed by generalized high - voltage delta activity . The latter activity resembles that seen during nonrapid eye movement (nrem) delta sleep . Etomidate is a potent gaba agonist, and gaba plays an important role in nrem delta sleep [26, 27]. We cannot exclude, however, that increases in cbf in the basal ganglia might be related to ictal patterns in epileptic patients . Traditionally an intense increase in regional cbf is one of the hallmarks of partial - onset seizures . This is probably due to an increase in regional synaptic activity and changes in neurotransmission . During the ictal spect, the tc - hmpao infusion is performed briefly after the seizure starts and, moreover, a delay must be overcome before the radiotracer gets to the brain . So, ictal spect, probably shows an increase in regional cerebral perfusion that is surely related to the seizure but is almost certainly indicating propagation from the area of ictal onset . The relative decrease in regional cbf observed in the posterior hippocampus of ez was a surprising result . Instead, we expected an increase in regional cbf in the ioz, taking into account the significant increase in the ied induced by etomidate . Recently, it has been demonstrated that in the sclerotic hippocampus there is a consistent and highly significant reduction of micro - blood vessels, particularly in the ca1 field . This reduction could be related to the relative inability of the epileptic posterior hippocampus to increases cbf locally in response to etomidate . On the other hand, one could also hypothesize that etomidate increase the cbf more significantly in the structures spared by epileptic discharges . Although we are conscious of the necessity for further experiments in order to fully elucidate the mechanisms underlying etomidate - induced increases in cbf and brain activity, from a clinical point of view, our findings can be significant methods of presurgical evaluation . In contrast to other anaesthetics, etomidate has a very specific target at clinical concentrations . In fact, etomidate almost exclusively acts on the 2 and 3 subunits of the gabaa receptor . The exact mechanism by which etomidate activates the irritative area is not completely understood . However examination of slices obtained from epileptic patients has revealed a decrease in the reversal potential for cl anions . This change could induce a depolarization instead of hyperpolarization following gaba release, thereby driving irritative activity . On the other hand, studies in cultured astrocytes have shown that etomidate can inhibit glutamate uptake, increasing the extracellular glutamate concentration to such a level that can spill out of the synaptic cleft and activate extra - synaptic receptors . As a consequence, irritative activity would be increased . We conclude that activation of bioelectrical activity and measurement of regional cbf in patients during presurgical evaluation could be of great utility in epilepsy units as a complementary test to increase the accuracy of diagnosis in patients being evaluated for tle.
|
Hcv infection is a major concern for human health with an estimated 3% of the world's population infected . Hcv primarily infects hepatocytes in the liver culminating in serious and progressive liver disease including chronic hepatitis, cirrhosis, and hepatocellular carcinoma . However, only a fraction of patients respond to this treatment; moreover side effects including fatigue and depression are commonplace . More recently, two ns3 protease inhibitors boceprevir and telaprevir have been licensed for hcv treatment [2, 3]; however, there are reports of virus resistance to both inhibitors . In cases of hcv - associated liver failure, transplant is the only therapy, making hcv a leading indicator for liver transplantation in the developed world . However, circulating virus in the blood results in reinfection of the newly transplanted liver in all cases consistent with an aggressive course of accelerated hepatic histological changes . Hcv - related graft complications are associated with a significant reduction in patient survival and is the leading cause of liver failure in many transplant centres . Hcv resembles the flaviviridae family of viruses and is the sole member of the hepacivirus genus . Virus particles range between 50 and 60 nm in diameter; each virion is comprised of a lipid bilayer envelope bearing the e1e2 glycoprotein complex that facilitates particle and host cell interactions . The envelope surrounds a capsid that contains a positive sense single - stranded rna genome approximately 9,600 nucleotides long encoding a 3000-amino - acid polyprotein . The polyprotein is posttranslationally modified by host and viral proteases into three structural proteins (core, e1, and e2), which are the capsid and envelope glycoproteins, respectively, a small ion channel (p7) and six nonstructural proteins (ns2, ns3, ns4a, ns4b, ns5a, and ns5b). The structural proteins comprise the building blocks for the virion and the nonstructural proteins replicate the viral rna . Following an initial association with a series of attachment factors, including c - type lectins, lipoprotein receptors, and heparan sulfate (reviewed in) these are the tetraspanin cd81, scavenger receptor class b member i (sr - bi), and the tight junction proteins claudin-1 and occludin [912]. Hcv enters the cell via clathrin - mediated endocytosis followed closely via viral envelope uncoating and release of the rna genome into the cytoplasm where translation and replication occur on specialized endoplasmic reticulum (er) membrane webs . Virion assembly and secretion are associated with the lipoprotein pathway accounting for the lipid - rich nature of serum - derived hcv particle; the hcv lifecycle is reviewed in . To study hcv replication, lohmann and colleagues created mini - hcv genomes called replicons (genetic elements that can replicate autonomously) from the liver rna of a chronically infected patient . Hcv replicon constructs were able to replicate autonomously when introduced into several hepatoma cell lines allowing for the identification of permissive cell types and adaptive mutations that promote hcv replication in vitro [1416]. The replicon system made it possible to study host and viral signaling necessary for virus replication and echoed a new dawn in hcv research . However, the process of viral entry and assembly could not be studied using this in vitro model . One approach employed by researchers to realize how hcv interacts with host cells was to express the viral encoded glycoproteins (e1e2) in isolation from other viral encoded proteins . However, high - level expression of e1e2 resulted in misfolded aggregates . To overcome this, researchers expressed chimeric glycoproteins incorporating transmembrane regions of e1e2 known to be expressed at the plasma membrane or truncated glycoproteins lacking transmembrane domains . Deletion of the hcv e2 transmembrane domain resulted in the secretion of a soluble form of e2 (se2); se2 was used to identify two putative hcv receptors (sr - bi and cd81). The identification of two putative receptors using se2 indicated that e2 is the major glycoprotein responsible for receptor binding . However, e1e2 exists as heterodimers suggesting that se2 was unlikely to recapitulate functional hcv glycoproteins . The development of infectious hcv pseudoparticles (hcvpp) enabled studies of the entry aspect of the virus lifecycle . Pseudoparticles take advantage of the ability of retroviruses to incorporate heterologous glycoproteins in their membrane during budding . Hcvpp infection of hepatoma cells was ablated by specific e1 and e2 neutralizing reagents to confirm that both e1 and e2 are indispensable for hcv entry [2022] and provided the first functional assay to screen the effects of neutralizing antibodies on virus entry . Hcvpp can also infect primary hepatocytes with infectivity measureable utilizing various reporter systems, yet the levels of infection are usually lower than hepatocarcinoma cell lines and are subject to interdonor variation . The hcvpp system was critical in the identification of hcv coreceptors claudin-1 and occludin and to date continues to aid in our understanding of hcv binding, attachment, and internalization . Several laboratories reported an hcv strain that replicates and releases infectious particles in cell culture (hcvcc) [2325]. The strain was cloned from a genotype 2a virus isolated from a japanese patient with severe acute hcv infection . Unlike all previous hcv genomes tested, jfh-1 infection of hepatoma cells resulted in the release of progeny virus capable of infecting naive cells . Hcvcc confirmed major findings made using hcvpp including the identification of hcv co - receptors and continues to increase our understanding of the hcv lifecycle . The successful isolation of jfh-1 paved the way for the development of several chimeric hcvcc constructs representing diverse genotypes [2729]. Clinical manifestations of hepatitis, such as cirrhosis and hepatocellular carcinoma, are typically associated with genotype 1 hcv, which is more prevalent than genotype 2 and relatively resistant to ifn therapy . A fully replicating hcvcc system from a genotype 1a virus has been developed (h77-s) and was also infectious for chimpanzees, yet this isolate was not as infectious as jfh-1 in vitro . In conclusion, our understanding of hcv has been hindered for many years primarily because of a lack of robust model systems to study the virus lifecycle . The development of in vitro systems has greatly enhanced our understanding of key aspects in the virus lifecycle . Since the identification of the viral genome 23 years ago, significant progress has been made in delineating model systems to study the viral lifecycle in vitro . However, our understanding of hcv pathogenesis is still in its infancy; to date, the search continues for physiologically relevant cell culture models to study authentic host response to virus infection . This has been compounded by difficulties in developing cell lines that recapitulate the intricacy of the liver microenvironment . Attempts to propagate hcv in vitro have proven difficult; initial studies capitalized on the hypothesis that virus infection was dependent on host factors expressed in highly differentiated hepatic cells . Hepatocytes in vivo are quiescent and primary hepatocytes in culture demonstrate minimal cell division . As such, primary hepatocyte cultures from humans or chimpanzees chronically infected with hcv were utilized for hcv studies . However, the use of primary cell cultures were inadequate for several reasons; they supported low levels of hcv replication, heterogeneous virus populations and hcv - specific antibodies in the sera of infected patients impaired the levels of infection, and the system suffered from poor data reproducibility (reviewed in [32, 33]). In many cases hcv replication was assessed by reverse transcriptase polymerase chain reaction (rt - pcr) to detect hcv rna levels which was indicative of virus replication . This technique proved useful in detecting low levels of hcv rna; however, it also presented new challenges including the potential for random priming by cellular nucleic acids, contamination of rna samples, and lack of strand specificity due to rna self - priming [35, 36]. As such additional criteria were introduced to validate hcv replication, these included treatment of infected cells with interferon- (ifn) to cure from viral rna and sequence analysis to demonstrate genome variability . More recently key aspects of the hcv lifecycle have been delineated in primary hepatocytes, including ph - dependent virus entry using the hcv pseudoparticle system (hcvpp) and clathrin - mediated endocytosis [37, 38]. A study by podevin et al . Importantly, secreted particles demonstrate a low buoyant density and high specific infectivity, which is similar to hcv particles produced in vivo . These findings suggest that primary hepatocytes represent a physiological in vitro model to study hcv infection . Despite the successes with primary hepatocyte cultures their lifespan in culture researchers have employed a number of techniques to maintain liver - specific functions in isolated hepatic cells in vitro . These parameters include 3d cell culture to increase cell - cell interactions, extracellular matrix deposition, and coculture of different cell types [3941]. To study hcv infection of normal hepatocyte biology ploss and colleagues utilized a microscale model of the human liver that maintained hepatic phenotypic for several weeks in culture . The so - called micropatterned co - culture model supported the entire hcv lifecycle with sustained viral rna replication for several weeks . Importantly, the model formed polarized cell layers, which is a key feature of hepatocyte physiology . This system may therefore provide a platform for the assessment of anti - hcv therapeutics; nevertheless, micropatterned co - culture is not widely available and primary hepatocytes in general are difficult to obtain due to shortages in donor liver specimens . Furthermore, inherent donor liver variations may affect the hcv lifecycle making it difficult to reproduce findings with primary cells . Several reports have utilized human pluripotent stem - cell - derived hepatocytes to study various aspects of the hcv lifecycle . Pluripotent stem cells have the ability to produce an unlimited source of nontransformed differentiated cells . Indeed, hepatocytes from this system demonstrate liver metabolic activity and hepatocyte phenotypic markers and are an attractive alternative for primary hepatocytes . Stem - cell - derived hepatocytes express all four hcv receptor molecules and support persistent hcv infection including the complete replication cycle and the release of progeny infectious virus . Importantly, hcv infection of stem - cell - derived hepatocytes induced an antiviral inflammatory response including the production of interferon genes . It is believed that stem cell hepatocytes offer a physiologically relevant system to study hcv biology . Nevertheless, despite the demonstration of liver metabolic activity, it is important to point out that they are not hepatocytes per se; they are perhaps best described as hepatocyte - like since they were induced from either an embryonic lineage or via reprogramming with various factors . Even so, they represent an important breakthrough in hcv studies offering new opportunities for the identification of signaling pathways required for virus infection . Furthermore, apart from primary hepatocytes they are arguably the best alternative approach for an in vitro model that mimics hepatocytes in vivo . Lzaro et al . Reported hcv replication in nontransformed human fetal hepatocytes, which maintained and secreted hcv particles for 2 months after transfection . Similarly, two recent reports have shown hcv infection of primary human fetal liver cells (hflcs) [47, 49]. The authors reported the induction of interferon - stimulated genes (isgs) in response to hcv infection and concluded that this model provides a useful surrogate to study hcv gene induction in vivo . However, there were significant variations in isg expression and hcv infection of the different donor fetal cells . Due to the aforementioned difficulties using primary cell types, ph5ch and hus - e cells were generated by immortalizing primary hepatocytes with the t antigen of simian virus 40 and the e6/e7 genes of the human papillomavirus, respectively [50, 51]. Although these cells supported hcv replication, the production of virus particles was restricted and the levels of rna replication were low, making them nonviable for long - term studies . The hcv replicon system made it possible to identify permissive hepatoma cell lines that support efficient hcv replication . Blight and colleagues transfected huh-7 hepatoma cells with subgenomic replicons and selected cells containing replicating rna for prolonged interferon- treatment to cure cells of the viral rna . Sustained interferon- treatment resulted in clonal populations that were tested for their ability to support hcv replication after retransfection with hcv replicons . One cell clone in particular, denoted huh-7.5, showed a significant enhancement in hcv replication compared to other clones . Efficient virus replication in huh-7.5 cells was partly attributed to a defective retinoic - acid - inducible gene - i (rig - i) pathway, which is essential for an antiviral immune response [52, 53]. The discovery of huh-7 clones (huh-7, huh-7.5, and huh-7.5.1) echoed a new dawn in hcv research . To date, much of our understanding of hcv biology is shaped through the use of these cells . The hcvpp and hcvcc systems are capable of infecting huh-7 cells at significantly high levels and key events including virus entry, replication, and secretion have been deduced . These cells continue to be widely used as they are of hepatic origin, highly susceptible to virus infection, and are arguably the best available in vitro host for hcv to date . They are poorly differentiated, display abnormal proliferation, aberrant gene regulation, and altered signaling pathways raising questions about their physiological relevance to the in vivo environment . As discussed, hepatocytes in vivo are nondividing and huh-7 cells in culture demonstrate asynchronous cell division . To impair cell division and improve the differentiation status of huh-7 cells, sainz and chisari treated huh-7 cells with dimethyl sulfoxide (dmso), which has been reported to inhibit cell growth and improve hepatocyte differentiation . Dmso treatment resulted in cytogenetically differentiated huh-7 cells that were non - dividing, characterized by increased expression of hepatocyte differentiation markers . Moreover, cells were capable of supporting persistent hcv infection . Differentiated cells supported infection in the presence of type i and type iii interferon antiviral treatment, resembling persistence in patients . Dmso - treated hepatoma cells may therefore more accurately mimic hcv infection of the in vivo environment . Hep3b cells are derived from a hepatocellular carcinoma and express all four major hcv receptor proteins . Huh-6 cells are derived from a hepatoblastoma and express low levels of claudin-1 making them nonpermissive for hcv infection . However, ectopic expression of claudin-1 induced susceptibility to virus entry with limited replication suggesting that intrinsic cellular factors may be anti - viral at a postentry level in these cells . Interestingly, one study has shown that nave huh-6 cells support efficient viral rna replication when transfected with hcv replicons . Furthermore, huh-6 cells are highly resistant to interferon- treatment making them a potential tool to study anti - viral compounds in vitro . Plc / prf/5 cells were obtained from a primary liver carcinoma and support hcvpp entry that was 3 times higher compared to huh-7 cells [60, 61]. Unfortunately, plc / prf/5 cells were not permissive for hcvcc infection in the same study . More recently, sainz and colleagues assembled a panel of hepatic cell lines to compare their ability to support hcv infection . The authors reported comparable hcvpp entry into hep3b, plc / prf/5, and huh-7 cells . However, later steps in the viral lifecycle including replication were impaired to different degrees in hep3b and plc / prf/5 cultures compared to huh-7 cells . Notably, there was a significant increase in isg56 expression in hep3b and plc / prf/5 cells in response to virus infection . Taken together, these studies suggest that the majority of hepatoma cell lines support hcvpp entry an innate immune response may reduce hcv activity at a post entry level to varying degrees in the different cell types . Furthermore, it is possible that cellular factors including micorna-122 which is important for hcv replication demonstrate reduced endogenous expression in most hepatoma cell lines compared to highly permissive huh-7 clones . Our understanding of the hcv lifecycle would benefit from the identification of additional permissive cells and further studies to address the endogenous expression of cellular factors important for the hcv lifecycle may prove enlightening . A list of commonly used in vitro models to study the biology of hcv is listed in table 1 . The discovery of claudin-1 and occludin as hcv entry factors highlighted the importance of studying hepatocyte polarity in hcv infection . Hepatocytes in vivo demonstrate a complex polarity with tight junction proteins separating the apical canalicular domain from the basolateral sinusoidal membrane . Each membrane is associated with a specific protein and lipid profile that is crucial to the correct functioning of the liver . Unfortunately, there are limited polarized cell types of hepatic origin that support efficient hcv infection . As such, there is a real need for cells that demonstrate hepatocyte - like polarity and support high levels of hcv infection . Cultured primary hepatocytes demonstrate a simple epithelial polarity similar to the phenotype seen in most polarized epithelial cell lines including caco2 and mdck (unpublished observations). Moreover, they rapidly lose this phenotype accompanied by a loss of tight and adherens junctions . Micropatterned co - cultures of primary hepatocytes developed polarized membranes and the localization of hcv entry factors was similar in human liver tissue . In our experience cells fail to polarize in culture suggesting that they are unlikely to reflect polarized hepatocytes in vivo . This is in contrast to a report by yang et al . Showing that huh-7 cells display transepithelial resistance, consistent with a polarized phenotype . The differences may simply reflect variations between laboratory clones of huh-7 cells, as previously shown . Recently, a 3d matrigel - embedded huh-7 cell culture system has been described . In this system huh-7 cells developed so - called proto - bile canaliculi structures indicative of hepatocyte polarization and supported hcv infection . Utilized the polarized caco2 cells, which express all four hcv receptors and supported hcv infection, to study the effects of polarity on virus infection . Tight junctions create a barrier that restrict hcv entry into caco2 cells and disruption of these junctions increased virus infection suggesting that polarity may reduce hcv infection of hepatocytes . Indeed, a follow - up study by the same authors studied the effect of polarity on hcv entry in the polarized hepatoma cell line hepg2 . Hepg2 cells are derived from a human hepatoblastoma and express liver - specific metabolic proteins such as the canaliculi marker mrp2 (multi - drug - resistant protein 2) and bsep (bile salt export protein). They form polarized cell membranes over time in culture consistent with the development of apical lumens that constitute the apical bile canaliculi . Nave hepg2 cells do not express cd81; however, complementation with exogenous cd81 (hepg2-cd81) induces susceptibility to hcv infection, although the level of infection in these cells is 724-fold reduced compared to huh-7.5 cells . Nevertheless, hepg2-cd81; cells allowed detailed study on the effects of polarization of virus entry, whereby there is an inverse correlation between virus entry and increasing polarity . Importantly, the pattern of hcv receptor distribution in these cells is similar to observations made in human liver specimens . One of the greatest challenges since the discovery of hcv is to ascertain the effects of hcv infection on hepatocyte biology . Studies utilizing hepg2 cells have provided insights into the functional consequences of virus infection on hepatocellular biology . Hcv infection of hepg2-cd81 cells induced a loss of polarity and tight junction integrity in a vascular - endothelial - growth - factor-(vegf-) dependent manner . We have recently reported that hcv infection of hepg2-cd81 cells induces a cellular dedifferentiation state reminiscent of epithelial to mesenchymal transition (emt) via a hypoxia - inducible - factor-1-(hif-1-) dependent perturbation of cellular homeostasis . The mechanism(s) by which hcv promotes liver injury are unclear, as the virus does not integrate with the host dna . Vegf, emt, and hif-1 signaling are intrinsically liked with tumorigenesis including hepatocellular carcinoma . Therefore, the use of hepg2 cells has aided in our knowledge of the pathways underlying hcv - induced liver injury . In the pursuit of experimental models that represent physiological and pathological conditions that support hcv infection . The authors demonstrated for the first time the ability of liver tissue to support de novo virus replication and the production of infectious hcv particles . Furthermore, viral infection was neutralized with anti - cd81 or anti - e2 antibodies in a dose - dependent manner to demonstrate an hcv - specific effect . The system provides a close match to the hepatic microenvironment and may prove useful to study virus spread in the liver parenchyma . Ex vivo liver slices have been previously used to validate in vitro experiments in a noninfectious context . Disadvantages of the use of liver slices for hcv research include restricted availability and short - term viability of the samples . Nevertheless, this ex vivo model is the closest we have approached to mimicking authentic liver function for the study of hcv and can be amenable to the study of antivirals . The restricted tropism of hcv and lack of small animal models have necessitated the development of in vitro model systems for the study of the full virus cycle . Since the virus was first cloned over 20 years ago, in vitro replicating clones have become available and with these coevolved novel permissive in vitro platforms to enable investigation of infection, transmission, and therapeutic interventions . The routine culture of patient - derived viruses remains elusive and novel approaches are required to achieve this ultimate goal . We recently demonstrated that nonpermissive b lymphocytes can act as vehicles for hcvcc transmission to hepatoma cell lines, delivering . This mode of transmission, utilizing vector cells as trojan horses for the infection of target cells, has been described previously for other viruses [80, 81]. Despite the lack of evidence for in vivo significance, these models are advantageous for in vitro infection . Further advances in the development of in vitro and ex vivo models for the study of hcv infection in a manner that closely mimics the liver are greatly anticipated, especially to evaluate the efficacy of promising new direct acting antiviral treatments and host - targeted agents currently in the pipe line.
|
The increase in atmospheric co2 concentrations has led to a continuous increase in the partial pressure of co2 and decrease in ph in the oceans since pre - industrial times, a process called ocean acidification (oa). Since then, the ocean water ph has declined from approximately 8.2 to 8.1, and will reach ph 7.8 by the year 2100 if we continue on the current and predicted co2 emissions trajectories (ipcc 2013). Such changes in the carbonate chemistry can have dramatic effects on marine organisms, e.g. Reducing biogenic calcification (hofmann et al . 2010), modifying fish sensory perception (munday et al . 2014), and enhancing seagrass and macroalgal growth (koch et al . Marine microbial populations are also expected to respond to oa . As key players in nutrient cycling and remineralization of organic matter, changes in marine microbial communities and in the services they provide have the potential for far - reaching consequences (liu et al . 2010; joint, doney and karl 2011). Previous work on the effects of oa on marine microbes focused mostly on planktonic microbes, and has so far reported rather variable and inconsistent outcomes . Several incubation experiments documented a change in bacterial community composition, involving e.g. Gammaproteobacteria and flavobacteria, as well as function under decreased ph conditions, e.g. Increased nitrogen fixation rates and decreased nitrification (beman et al . 2011; kitidis et al . There is also evidence that oa may increase microbial carbon degradation rates by increasing enzyme activity (piontek et al . 2010). On the other hand, in many mesocosm studies the composition of the planktonic microbial community was mostly stable over varying ph levels without changes in biogeochemical functions (newbold et al . Similarly divergent results were obtained from incubation experiments with microbial biofilms or marine sediments, which predicted either rapid responses of the microbial community to oa (witt et al . 2014), or only minor impacts of oa on community composition and function (tait and laverock 2013; gazeau et al . 2014). To venture beyond the limited scope of incubation experiments and to assess long - term oa effects on microbial community composition and functions in their natural environment, previous observations on microbial communities in sediments at naturally co2-rich sites focused mostly on sites in the mediterranean sea and in papua new guinea (kerfahi et al . However, studies disagreed on the direction of the change in microbial richness: kerfahi et al . Furthermore, reports on the prevalence of dominant microbial taxa in marine sediments (i.e. Gammaproteobacteria, alphaproteobacteria, bacteroidetes) under acidified conditions were inconsistent, with evidence pointing towards both increases and decreases as well as no changes in relative abundances (kerfahi et al . Many naturally co2-rich sites are associated with hydrothermal activity, which is the primary source of co2 at these sites (hall - spencer et al . However, the hydrothermal character often introduces confounding factors that make it difficult to specifically assess the impact of high pco2 and reduced ph (vizzini et al . For instance, most co2-rich sites exhibit increased levels of methane, sulfide, temperature and various trace elements (wenzhfer et al . 2000; meyer - dombard et al . 2012; vizzini et al . 2013; burrell et al . Especially the sediments at naturally co2-rich sites may be strongly affected as they are influenced from above by the acidified water as well as from below by the hydrothermal fluids (wenzhfer et al . The increased temperatures and altered chemical composition of hydrothermal fluids compared with seawater can change pore water geochemistry and affect geochemical gradients in the sediment (wenzhfer et al ., sediments at naturally co2-rich sites constitute a highly complex system with a multitude of environmental parameters that shape microbial habitats and influence microbial community composition and associated functions . In general, research on microbial communities at shallow - water hydrothermal seeps, including naturally co2-rich sites that were used as oa analogues, is very limited (giovannelli et al . 2013) and often environmental measurements are not paired spatially and temporally with microbiological characterizations . (unpublished), previous conclusions were based on a limited number of samples and recorded environmental parameters (kerfahi et al . In several instances, water column parameters were used to describe microbial communities without comprehensively assessing the environmental conditions in the sediment, which the microbes were subjected to (kitidis et al . Insufficient environmental characterization and subsequent poor selection of naturally co2-rich sites as oa analogues may constitute a potential cause for the diverging results regarding the impact of oa on sediment microbial communities . Here, we quantified the impact of oa on sediment microbial communities at hydrothermal co2 seeps, while taking the complex environment associated with the co2 seepage into account . For this, we investigated natural shallow - water co2 seeps in papua new guinea, which have been extensively used in oa research (fabricius et al . We used molecular community fingerprinting (automated ribosomal intergenic spacer analysis) of more than 100 samples as well as next generation amplicon sequencing of the 16s rrna gene to assess bacterial and archaeal community composition . We accompanied the molecular analyses with a comprehensive characterization of environmental conditions, including bottom and pore water chemistry, sediment permeability as well as carbon and nitrogen content . Through these analyses we further identified microbial taxa that may constitute losers and sediment samples were collected at two co2 seeps at upa upasina, normanby island (reef 1: s 9.82, w 150.82) and dobu island (reef 2: s 9.74, w 150.86), papua new guinea (supplementary fig . Both reefs were characterized by a ph gradient created by hydrothermal co2 seepage and have been previously used as oa analogues to study sediment microbial communities (raulf et al . 2015). Along this ph gradient, 14 sites were sampled at reef 1 and six sites at reef 2 . At each site three independent replicate cores (diameter: 2.5 cm) were taken and the sediment of the first 2 cm (02 cm) and the next lower 2 cm (24 cm) was preserved in rnalater solution (ambion) for molecular analysis . To characterize the environmental conditions in the sediment along the ph gradient at reef 1 the following parameters were measured: in situ oxygen concentrations, temperature, redox potential and ph using microsensor profiles (temperature sensor: ust umweltsensortechnik gmbh, gschwenda, germany; ph sensor: microelectrodes inc ., bedford, nh, usa; http://doi.pangaea.de/10.1594/pangaea.858091); total organic and inorganic carbon and total nitrogen content of the sediment; grain size, porosity and permeability (http://doi.pangaea.de/10.1594/pangaea.858091); and pore water geochemistry analysed from 6 ml pore water (http://doi.pangaea.de/10.1594/pangaea.858033). Sediment parameters. Additionally, bottom water samples were collected approximately 5 cm above each of the sediment cores at reef 1 and 2 to measure carbonate chemistry (ph, dissolved inorganic carbon (dic), total alkalinity (ta)) and nutrient concentrations (sio4, po4, nox, nh4). Data on bottom water carbonate chemistry and nutrient concentrations will further be referred to as bottom water parameters and are available in the pangaea database (http://doi.pangaea.de/10.1594/pangaea.854018). An overview of the sampling design and the measured parameters is provided in supplementary table s1 . From each sample dna was extracted from 1 g of sediment using the ultraclean soil dna extraction kit according to the manufacturer's instructions (mobio laboratories inc ., the dna was eluted in te buffer (100 mmol l tris - hcl, 10 m mmol l edta) and quantified photometrically with a nanoquant (tecan, crailsheim, germany). To screen for changes in microbial community structure we used the community fingerprinting technique automated ribosomal intergenic spacer analysis (arisa) with universal bacterial primers (fisher and triplett 1999). As previously described in ramette (2009), triplicate reactions of the arisa - pcr were run for each sample in an eppendorf mastercycler using the peqlab pcr kit (peqlab biotechnology gmbh, erlangen, germany). Each pcr reaction contained 1015 ng dna, 1 buffer s, 0.25 mmol l dntps, 0.1 g l bovine serum albumin (bsa), 0.4 mol l fluorescently labeled forward primer (itsf: 5-gtcgtaacaaggtagccgta-3) and reverse primer (itsreub: 5-gccaaggcatccacc-3), an additional 1 mmol l mgcl2 and 0.05 u l taq polymerase in a total reaction volume of 25 l . Pcr conditions were 3 min at 94c followed by 30 cycles of 45 s denaturation at 94c, 45 s annealing at 55c, and 90 s elongation at 72c, with a final elongation step for 5 min at 72c . Fragments between 100 base pairs (bp) and 1000 bp were binned into operational taxonomic units (otus) using custom r scripts available at http://www.mpi-bremen.de/en/software_4.html . To taxonomically classify the microbial community, we sequenced the hypervariable regions v3v4 and v4v6 of the bacterial and archaeal 16s rrna gene, respectively, using the bacterial primers s - d - bact-0341-b - s-17 (5-cctacgggnggcwgcag-3) and s - d - bact-0785-a - a-21 (5-gactachvgggtatctaatcc-3), and the archaeal primers arch349f (5-gygcascagkcgmgaaw-3) and arch915r (5-gtgctcccccgccaattcct-3; amann et al . The community of the upper sediment layer of one replicate core was sequenced from 13 sampling sites at reef 1 . Sequences were generated on the illumina miseq platform (cebitec bielefeld, germany), in a 2 300 bp paired - end run . Primer sequences were removed from the raw paired - end reads with cutadapt (martin 2011). Sequences were quality trimmed with a sliding window of 4 bases and a minimum average quality of 15 with trimmomatic v0.32 (bolger, lohse and usadel 2014), merged with pear v0.9.5 (zhang et al . 2014), clustered into otus using swarm v2.0 (mah et al . 2014) and taxonomically classified with sina (silva incremental aligner) v1.2.10 using the silva rrna project reference database (release 119) at a minimum alignment similarity of 0.9 and a last common ancestor consensus of 0.7 (pruesse, peplies and glckner 2012). Otus that were unclassified on domain level as well as those matching chloroplast and mitochondrial sequences were excluded from the analysis . Are used to designate sequence affiliation to the respective taxon and abundance of bacterial and archaeal taxa refers to the sequence abundance of illumina amplicons . Principal component analysis (pca) was used to classify the sampling sites at reef 1 into categories of hydrothermal influence based on observed sediment parameters . To assess the covariation among environmental parameters, pairwise pearson correlation coefficients were calculated . -diversity indices were calculated based on repeated random subsampling of the amplicon data sets to assess richness and evenness of the microbial community, namely otu number, chao1 and abundance - based coverage estimator, inverse simpson, percentage of absolute (occurring only once in the complete data set) and relative singletons (occurring only once in the sample) as well as absolute doubletons (occurring twice in only one sample in the complete data set). Significant differences in -diversity indices between hydrothermal influence categories were determined by analysis of variance (anova) using permutation tests . Hochberg (bh; benjamini and hochberg 1995) correction procedure at the significance level of p = 0.05 . The change in community structure (-diversity) between samples was quantified by calculating bray the former was used to produce non - metric multidimensional scaling (nmds) plots and to test for community similarity between hydrothermal influence categories (anosim tests); the latter was used to calculate the number of shared otus between samples . For the amplicon data sets, we excluded the rare biosphere by retaining only those otus that were present with more than two sequences in more than 10% of the samples . This reduction of the data sets did not change -diversity patterns (mantel test, r> 0.9, p <0.001). The contribution of environmental parameters to explaining the variation in community structure was calculated using redundancy analysis (rda) and variation partitioning of centered log - transformed relative otu abundances . Prior to significance testing, parameters were excluded using forward model selection until the minimum akaike information criterion (aic) value was reached . 2014) at a significance threshold of 0.05 for bh - adjusted parametric and non - adjusted non - parametric p - values . The significance threshold for planned parametric post - hoc tests was 0.1 (bh - adjusted). All statistical analyses were conducted in r using the core distribution with the additional packages vegan (oksanen et al . 2015), compositions (van den boogaart, tolosana and bren 2014), aldex2 (fernandes et al . 2014) and factominer (husson et al . 2015). The bottom water ph gradients created by the co2 seeps at normanby and dobu island ranged from approximately 6.8 to 8.3 at both reefs (table 1). In addition to the changes in ph, bottom water silicate concentrations increased with decreasing distance to the main co2 seepage area from approximately 4 mol l at reference sites to more than 1050 mol l at the seep sites . Reef 2 was further characterized by the presence of microbial mats in close proximity to the co2 seeps and by a strong sulfidic smell emanating from the co2 seeps . The presence of sulfide at the co2 seeps at reef 2 convinced us to focus our sampling effort on reef 1 as a more likely oa analogue . Environmental conditions at the sampling sites on normanby and dobu island, papua new guinea . For ph, oxygen concentration and temperature microprofiles mean values per hydrothermal influence category were calculated based on median values per sediment layer (02 cm, 24 cm). At reef 1, the median pore water ph in the first 2 cm of the sediment and the following 2 cm calculated from in situ microprofiles ranged from 8.1 at reference sites to 5.9 at seep sites . Generally, median sediment ph was lower than bottom water ph and declined more rapidly when moving towards the main co2 seepage area . However, at a seagrass patch influenced by co2 seepage this relationship was reversed with a bottom water ph (7.1) that was lower than the median pore water ph (7.8). With decreasing sediment ph, median permeability dropped from approximately 8 10 to 3 10 m. temperature profiles further showed increased temperatures at some of the seep sites, especially in the sediment layer from 2 to 4 cm, where maximum temperatures of more than 34c were reached compared with approximately 30c at the majority of the sites (table 1). Pore water geochemistry of sediments with active fluid seepage showed increases in cations that are typically present in hydrothermal fluids, such as lithium, silicon and manganese, and decreases in cations that are typically depleted in hydrothermal fluids such as magnesium . Sediment parameters were used to conduct a pca to identify sampling sites at reef 1 with similar characteristics based on all of the following parameters: ph, ta, oxygen concentration (o2), redox potential (redox), temperature, porosity, grain size, permeability, total nitrogen (tn), total organic carbon (toc), total inorganic carbon (tic), nutrients (nh4, nox), anions (cl, br, so4) and cations (na, li, si, b, mg, k, fe, mn, sr, rb, ba, ca, cs). We identified three main clusters of sampling sites: reference and seep sites were separated along principal component 2 (pc2). The seep sites were further separated along pc1 . The parameters contributing to pc1, which accounted for 40% of the variation in the data, were mostly concentrations of signature elements for hydrothermal activity such as lithium, silicon and manganese . Permeability, grain size, ph, nitrogen and organic carbon content of the sediment were among the parameters that contributed to pc2 (16% of the total variance in the data; fig . 1 and supplementary fig . S2). Based on the pattern in the pca the sampling sites were classified into three categories: (i) reference sites characterized by ambient ph, (ii) sites characterized by low ph and low hydrothermal influence, (iii) and sites characterized by low ph and high hydrothermal influence, including pronounced temperature increases . Sampling sites falling within these three hydrothermal influence (hi) categories will be referred to as medium hi and high hi sites thereafter . Principal component analysis (pca) of the environmental conditions in the sediment at the sampling site at reef 1 on normanby island to classify the sampling sites according to hydrothermal influence . The data are available at pangaea (http://doi.pangaea.de/10.1594/pangaea.858033, http://doi.pangaea.de/10.1594/pangaea.858091). For oxygen, ph, temperature and redox potential microprofiles, missing values were replaced by the mean of the respective parameter for the calculation of the pca . The arrows show the loadings of the environmental parameters scaled to 4 times their value for better visualization . Dic, dissolved inorganic carbon; ta, total alkalinity; tic, total inorganic carbon; tn, total nitrogen; toc, total organic carbon . Only sediment parameters where data were available for at least eight of the 14 sampling sites at reef 1 were included in the rda models to explain the variation in microbial community structure . Together with bottom water parameters and spatial information these were reef, position along the reef, water depth, bottom water silicate, phosphate, nitrate, nitrite, ammonium concentrations, ta and ph, sediment porosity, permeability, temperature, ph, redox potential, and oxygen concentrations . Pairwise linear correlations among environmental parameters that were used for the rda models revealed a complex pattern of covariation . Several parameters were highly correlated, e.g. Bottom water silicate concentrations and bottom water ph or permeability and the position of the sampling sites along the reef where absolute correlation coefficients were approximately 0.8 . On the other hand, bottom water and sediment ph did not show any linear correlation (supplementary fig . A total of 117 sediment samples were analysed with arisa to identify overall changes in microbial community structure (fig . 2). Those clusters were confirmed to be significantly different from each other by anosim (supplementary table s2). Whereas the microbial community structure of reference samples from both reefs was quite similar, there was a divergent trend at each of the two reefs from reference to medium to high hi sites . The microbial communities at the seep sites at reef 1 and 2 were significantly different from each other (anosim, r> 0.8, bh - adjusted p <0.05). Furthermore, there was no apparent influence of sediment layer on the microbial community composition (fig . 2). The average number of shared otus between samples from different hydrothermal influence categories at each reef was in most cases less than 40% . Generally more otus were shared between reference and medium hi sites or between medium and high hi sites compared with reference and high hi sites (supplementary table s2). Even among samples within hydrothermal influence categories, the microbial community was very heterogeneous with about 50% shared otus between any two samples . The patterns of change in bacterial and archaeal community composition in the first 2 cm of the sediment based on 16s sequences were very consistent with arisa results (supplementary table s2). The number of shared 16s otus was slightly lower with on average 1228% shared otus between hydrothermal influence categories and about 3050% within categories . Curtis dissimilarity matrix of the microbial community based on automated ribosomal intergenic spacer analysis (arisa). Larger symbols mark the subset of samples that was used in the redundancy analysis (rda) models with sediment parameters (table 2). To estimate and compare the contribution of different sets of environmental parameters to explaining the patterns in microbial community composition, the arisa data were analysed with several rda models: (i) the complete arisa data set using bottom water parameters, (ii) a subset of the arisa data set from reef 1 where sediment parameters were available that was also analysed with (iii) bottom water parameters for comparability, (iv) the complete data set, and (v) the arisa subset using solely hydrothermal influence categories as explanatory variable (table 2). Contribution of observed environmental parameters to explaining the variation in microbial community structure based on redundancy analysis (rda)-based variation partitioning . To compare the explanatory power of different sets of environmental parameters, several rda models were tested: the complete arisa data set was analysed using bottom water parameters and hydrothermal influence categories; a subset of the arisa data was analysed using bottom water, sediment parameters and hydrothermal influence categories . The akaike information criterion (aic) is given for each model as goodness - of - fit statistic . Only the significance of the whole model (all) and the pure effects of the respective parameters (accounting for the effects of all other factors in the model) were tested . Covariation constitutes the amount of variation that can be explained by more than the parameter of interest . Bottom water silicate concentrations were used as proxy for pore water concentrations, because of a high correlation based on point measurements of selected samples . All arisa rda models as well as their individual factors significantly explained variation in microbial community structure, with the exception of bottom water nitrite concentration in the complete arisa model, which was not significant but retained in the model selection procedure . The total amount of explained variation (r) varied from 20% to 44% between the rda models based on the arisa dataset . The models based only on hydrothermal influence categories explained approximately 10% less variation than the models based on numeric environmental parameters . The model with the arisa subset from reef 1 and bottom water parameters explained more variation than the model with the complete arisa data set that also included samples from reef 2 with an r of 35% compared with 28% . Including sediment parameters further increased the total amount of explained variation resulting in by far the best model with a r of 44% and the lowest aic of the models with the arisa subset . Ph alone was able to explain 4.5% (total r) in the bottom water models and almost 9% when pore water ph was used . Accounting for the variation explained by the other parameters in the models (pure r), ph explained much less of the changes in community structure due to covariation with the other parameters in the model . Despite the high degree of covariation, the contribution of ph to explaining the microbial community composition was significant in all models (table 2). The variation explained by the other factors in the models was similar to that of ph ranging from an r of 1.1 to 11.7% . Water depth, silicate concentrations, temperature and permeability were among the factors with the highest effects on community changes . For the amplicon data sets, only the significance of hydrothermal influence categories was tested due to the reduced number of samples . For both bacterial and archaeal communities, hydrothermal influence significantly explained the variation in community structure with an r of 38% and 27%, respectively (table 2). The sediment at the co2 seeps hosted a very diverse community: estimated species richness based on 16s otus ranged from 13 000 to 48 000 for bacteria and 475 to 4100 for archaea (supplementary fig . Median chao1 richness was highest in samples from reference sites with 42 000 for bacteria and 2700 for archaea followed by 35 000 and 2000 at medium hi sites and 14 000 and 960 at high hi sites, respectively . However, within each hydrothermal influence category, chao1 estimates varied considerably over a range of more than 20 000 bacterial and 2000 archaeal species, without significant difference between groups . Bacterial and archaeal inverse simpson index showed a weak decreasing trend from reference to medium and high hi sites . Both bacterial and archaeal communities consisted of a large proportion of rare otus, which made up approximately 40% (absolute singletons), 25% (relative singletons) and 10% (absolute doubletons) of all otus in each sample (supplementary fig . The bacterial community was dominated by gamma- and deltaprotobacteria with a total relative abundance of 18% and 17%, respectively (fig . The next most abundant bacterial phyla were bacteroidetes (9%), actinobacteria (9%) and chloroflexi (7%). Even at low taxonomic resolution levels, the number of differentially abundant bacterial taxa increased as higher taxonomic resolution levels were considered (supplementary table s3). Generally between 20 and 70% of the sequences per sample belonged to differentially abundant bacterial taxa . In the next sections the full list of the differentially abundant bacterial taxa is provided in supplementary table s4 . Taxonomic composition of the 10 most abundant bacterial phyla (a) and archaeal genera (b) per sample at reference, medium and high hi (hydrothermal influence) sites . For proteobacteria class - level resolution is shown; for taxa that were unclassified on the respective level of resolution, the next higher level classified taxonomic rank is shown . Scg: soil crenarchaeotic group, mhvg: marine hydrothermal vent group, dhveg-6: deep sea hydrothermal vent group 6 . Among the dominant differentially abundant phyla, chloroflexi, chlorobi and deferribacteres increased at medium and high hi sites compared with reference sites . The changes in relative abundance within the chlorobi and chloroflexi were caused by several taxa within these phyla, i.e. Of the classes ignavibacteria for chlorobi and anaerolineae, ardenticatenia and caldilineae for chloroflexi . The genus caldithrix was mostly responsible for the increase of deferribacteres towards the seep sites . The difference in the relative abundance of chloroflexi was most apparent towards high hi sites and was not statistically significant between reference and medium hi sites . Although not detected as differentially abundant at the phylum level, cyanobacteria, predominantly of the subsections i and ii were significantly less abundant at the seep sites than at reference sites . In all cases, the genus pleurocapsa of subsection ii showed the strongest decrease among the cyanobacteria from on average 2.3% at reference sites to disappearing almost completely at the seep sites . This decrease was not uniform in all differentially abundant taxa of the alphaproteobacteria, e.g. Rhodobacteriaceae increased from on average 1.7 to 3.4% at medium and high hi sites, whereas rhodospirillaceae decreased from 8 to 3% and 1.5%, respectively . Flavobacteria were most abundant at reference and medium hi sites with on average 6% and 4%, respectively, and decreased toward high hi sites (1.8%). Similar to the case of alphaproteobacteria this trend was not uniform, e.g. Zeaxanthinibacter already decreased significantly from reference sites (1.7%) to about 0.3% at medium and high hi sites . Within the deltaproteobacteria several subgroups were differentially abundant, exhibiting divergent trends: whereas the order desulfuromonadales (reference: 0.6%, medium hi: 1.1%, high hi: 2.9%) increased towards the seep sites with the strongest increase towards high hi sites, the family desulfobacteraceae decreased severely towards high hi sites with an average relative abundance of 1.4% as compared with 6% at both reference and medium hi sites . Additionally, a large number of differentially abundant otus belonged to the actinobacterial om1 clade (15 otus) and the gammaproteobacterial family jtb255 (25 otus) with a total relative abundance of 4% and 1.4%, respectively . Yet, these otus did not follow a consistent trend with highest relative abundance at sites of any of the three hydrothermal influence categories . The archaeal community was dominated by the marine group i archaeon candidatus nitrosopumilus, which accounted for 36% of the total number of sequences in the archaeal 16s data set (fig . The next most abundant groups were deep sea hydrothermal vent group 6 (18%), other marine group i archaea (15%), marine benthic group e (10%) and the genus cenarchaeum (9%) also of the marine group i. the candidate genus nitrosopumilus was generally more abundant at high hi sites where they reached maximum relative abundances of more than 60% . At reference and medium hi sites, they were much less abundant with on average 21% and 13%, respectively . A full list of the differentially abundant archaeal taxa is proved in supplementary table s5 . We used sampling sites at the co2 seeps in papua new guinea (png) as analogues for oa research . The detailed characterization of the sediment based on 29 different environmental parameters showed that carbonate chemistry alone, specifically the ph gradient, was insufficient to describe the environmental conditions at these sites . Whereas some of the observed environmental parameters, e.g. Sediment permeability, grain size, and nitrogen, organic and inorganic carbon content, supported the classification of sites along the ph gradient, mainly pore water element concentrations varied among sampling sites with comparable ph . The enrichment or depletion of certain elements in the pore water can be used as an indicator of hydrothermal activity (german and von damm 2003). Here, the increased concentrations of lithium, manganese and silicon pointed towards a stronger hydrothermal influence in several of the sampling sites associated with the co2 seeps, which were therefore termed high hi sites . The hydrothermal character of natural co2 seeps has been recognized before as a potentially confounding influence for oa research (vizzini et al . (2013) suggest referring to natural co2 seeps as low ph environments rather than analogues for oa . Here, the distinction between medium and high hi sites allowed us to define a level of hydrothermal influence that may still be considered a reasonable oa scenario . Because of their strong hydrothermal character, we propose that high hi sites exhibit conditions that are less likely to occur under future oa than those at medium hi sites . Consequently, changes in the microbial communities that were only specific to high hi sites should be interpreted with caution because they may bias the assessment of oa impacts . Especially in cases where the community analysis is based on categories and not numerical environmental variables, accounting for the hydrothermal influence at naturally co2-rich sites is of paramount importance . Because of logistic constraints, environmental data in oa studies on sediment microbial communities is often collected from the water column and rarely from the pore water and sediment directly (kerfahi et al . 2014; raulf et al . 2015). Here, particularly at the co2 seep sites, we observed strong deviations of the same parameters, such as ph, between bottom and pore water measurements . Additionally, we detected pronounced differences in pore water element concentration between sampling sites, which were not recorded in previous observations on water column chemistry (fabricius et al . Such deviations question the usage of bottom water measurements as a proxy for conditions in the sediment at such sites, and will strongly affect our ability to accurately assess the driving environmental forces behind patterns of microbial richness and community composition in marine sediments . In this study, the divergence between bottom water and pore water parameters is evident in their explanatory power regarding the variation in microbial community composition . Noteworthy, basing the description of the microbial community on sediment rather than bottom water parameters increased the model fit and the percentage of explained variation of the microbial community composition by approximately 25% . In both bottom water and sediment models, ph was among the factors significantly explaining changes in microbial community composition, which in the case of bottom water ph was also observed previously in png (raulf et al ., many of the other observed parameters were statistically equally important, e.g. Temperature and permeability . Furthermore, as commonly found in natural systems, it was difficult to account completely for confounding factors and to isolate the effects of interest due to a high degree of covariation among environmental parameters (sunagawa et al . 2015) therefore, it is possible that changes in the microbial community that were related to ph, as observed by rda, could also be related, directly or indirectly, to silicate concentrations or organic carbon content, since these factors were strongly correlated . Only a small, although significant, percentage of explained variation was attributed to ph alone when accounting for covariation . These circumstances make the interpretation of the data in a biological context more difficult because changes in microbial community structure can often be assigned to several factors (hanson et al . Long - term acidification may reduce the accumulation of coarse carbonate sediments, resulting in finer sediments composed of silicate sands (artur fink, personal communication). The lower permeability of finer sediments may limit water circulation and the supply of oxygen and organic matter into the sediment and may thus change the microbial habitat immensely, e.g. In terms of energy availability (schttner et al . Therefore, changes in the microbial community attributed to permeability may constitute indirect ph effects . The interdependencies of environmental factors may also help to explain the contrasting results regarding the effects of reduced ph on sediment microbial communities from different natural co2-rich sites: before the onset of ph decrease, the initial conditions in the sediment may have varied among naturally co2-rich sites even if present ph values are similar . To improve the comparability of naturally co2-rich sites and to reconcile divergent microbiological results from different naturally co2-rich sites, knowledge of sediment parameters such as permeability is therefore required . As an alternative to the detailed analysis based on measured environmental parameters, the analysis of sediment microbial communities can be based on acidification categories, which summarize the conditions at the sampling sites (kerfahi et al . This approach was implemented here by using hydrothermal influence categories to describe the sediment microbial community . Although hydrothermal influence categories had generally less explanatory power than numeric environmental parameters, we were still able to explain about 2038% of the total variation in microbial community composition . Values within this range of explained variation are not uncommon in microbial ecology (hanson et al . The present study constitutes the second time the same sampling area in png was investigated to assess oa impacts on sediment microbial communities, with the initial exploration taking place in 201011 (raulf et al . 2015). By using a larger sample size and a more comprehensive environmental characterization, we were able to confirm the general observations made in the previous study, thus underlying the reproducibility of the results obtained under natural conditions . Indeed, we found a similar overall taxonomic composition of the bacterial and archaeal communities as well as consistent shifts in microbial community composition and similar turnover rates of arisa otus from reference to seep sites (raulf et al . 2015). However, we showed that the composition of the microbial community at the seep sites was not comparable between reef 1 and reef 2, which was not detected previously (raulf et al . Furthermore, trends in -diversity of the microbial community here and from raulf et al . (2015) estimated bacterial richness and the percentage of rare bacterial otus increased as ph decreased, whereas here we detected a decreasing trend in richness that was, however, not statistically significant . A decrease in microbial richness would be consistent with similar observations in the mediterranean (taylor et al . 2014). Whether those contrasting results from png were caused by technical biases or by natural temporal variation we used differential sequence abundance of bacterial and archaeal taxa to identify potential winners and losers under low ph conditions . In many samples, the relative abundance of differentially abundant taxa accounted for the majority of sequences in the sample, suggesting a large impact of hydrothermal influence on the microbial community . Among potential winners were the bacterial phyla chloroflexi, chlorobi and deferribacteres . Isolates of the three dominant differentially abundant classes anaerolineae, ardenticatenia and caldilineae have been shown to prefer ph conditions around 7 or below (yamada et al . 2013), which were observed at the seep sites . Unlike other chloroflexi, these three classes most likely do not photosynthesize, and grow chemoheterotrophically (yamada et al . 2006; kawaichi et al . 2013). Chloroflexi have also previously been found to be more abundant at decreased ph in sediments and associated with corals and sponges in png (morrow et al . Chlorobi, which are also known as green sulfur bacteria, have previously been detected at shallow - water hydrothermal seeps exhibiting decreased ph (maugeri et al ., representatives of the class ignavibacteria, which contained the most dominant differentially abundant otu in our data set, were characterized as chemoheterotrophic, strictly anaerobic bacteria lacking genes for photosynthesis and sulfur oxidation (iino et al . Bacteria of the deferribacteres, specifically the genus caldithrix, are most likely anaerobic chemoorganotrophs known to be associated with hydrothermal seeps and decreased ph (miroshnichenko et al . Rhodobacteraceae, also called purple sulfur bacteria, have previously been reported to increase in abundance at the seep sites in png as well as other naturally co2-rich sites (taylor et al . The most abundant otu of the rhodobacteraceae was closely related to rhodovulum species, which are able to oxidize iron and reduced sulfur compounds for anoxygenic photosynthesis preferably around ph 7 or lower (straub, rainey and widdel 1999). Both dissolved iron and sulfide were present at the seep sites in png, although elevated sulfide concentrations were only detected in sediment layers deeper than 3 cm (artur fink, personal communication). These conditions might have facilitated the increased abundance of rhodobacteraceae in general and rhodovulum in particular . In coral reef ecosystems rhodobacteraceae have been implicated in coral and seaweed diseases and their abundance in these associations was even higher at lower ph, supporting the hypothesis of a decline in reef health under oa (meron et al . Rhodospirillaceae, an alphaproteobacterial family known as purple non - sulfur bacteria, were among the potential losers at decreased ph, with some otus disappearing completely already at medium hi sites . Rhodospirillaceae constitute a physiologically very diverse bacterial family with many uncultured types, complicating the functional classification of the rhodospririllaceae in general . Among the otus that could be classified at the genus level, defluviicoccus is a chemoheterotroph that grows at temperatures below 30c and at a variable ph range (maszenan et al . 2005), which suggests that temperature might be the limiting factor for this genus at the seep sites . Although oa is expected to boost photosynthesis, cyanobacteria in general are expected to benefit less from the increased availability of co2 when co - occurring with eukaryotic photosynthetic organisms (koch et al . Preliminary data indicated that bulk net photosynthesis did not vary significantly between sampling sites in png (artur fink, personal communication), suggesting that there might be a replacement of cyanobacterial photosynthetic taxa at the seep sites by other photosynthetic organisms . Given the increased silicate concentration, diatoms are likely to dominate primary production at the seep sites . The genus pleurocapsa is further capable of calcification (krumbein and giele 1979; rippka et al . Desulfobacteraceae reduce sulfate to degrade organic carbon anoxically (kuever, rainey and widdel 2005). Although desulfobacteraceae are expected to be able to adapt to decreased ph (koschorreck 2008), they have been shown to decrease at co2 seeps (raulf et al . This decrease was also observed here in the abundance of desulfobacteraceae with the strongest decrease towards high hi sites . Measurements of sulfate reduction rates further documented a strong decline in sulfate reduction from reference to high hi sites (artur fink, personal communication). The decrease in desulfobacteraceae is accompanied by an increase in desulfuromonadales, which can reduce iron or manganese as alternative electron acceptors to sulfate (vandieken and thamdrup 2013). Since iron and manganese other bacterial taxa did not show a consistent trend, either in the monotony of the trend from reference to medium to high hi sites, or when considering the trends at higher taxonomic resolution levels . Flavobacteria, with otus mostly related to aerobic carbon degraders (bernardet, nakagawa and holmes 2002), were most abundant at reference and medium hi sites and decreased severely towards high hi sites . At higher taxonomic resolution levels, divergent trends emerged between reference and medium hi sites with several flavobacterial taxa either increasing or decreasing . The strong decrease at high hi sites was common to most differentially abundant flavobacterial taxa and may be attributed to the lower oxygen availability at these sites resulting from a shallower oxygen penetration depth as compared with reference sites . The flavobacterial genus zeaxanthinibacter was among the taxa that displayed a continuous decrease from reference to medium and high hi sites . The decrease in zeaxanthinibacter may also be related to decreased zeaxanthin pigment concentrations at the seep sites (artur fink, personal communication; asker, beppu and ueda 2007). Members of this genus are characterized as strictly aerobic bacteria, which grow at a range of ph values and can degrade long - chain carbohydrates (asker, beppu and ueda 2007). Their aerobic lifestyle supports the hypothesis that oxygen may be the limiting factor restricting the distribution of at least some flavobacteria . At high hi sites, flavobacteria might be replaced by chlorobi, chloroflexi and deferribacteres as major carbon degraders under anoxic conditions . Our results were only partially consistent with previous studies at naturally co2-rich sites, which have so far unanimously supported an increase in flavobacteria at decreased ph potentially linked to an increased availability of organic matter (kerfahi et al . 2014; taylor et al . However, in our study the organic carbon content of the sediment was lower at the seep sites (artur fink, personal communication), which may contribute to explaining these divergent findings . The dominant archaeal taxon, candidatus nitrosopumilus, has previously been described in png to increase in abundance as ph decreases (raulf et al . Its role as ammonia oxidizer may contribute to maintaining nitrification in reef sediment under reduced bacterial ammonia oxidation (laverock et al . We also detected an increase in candidatus nitrosopumilus at decreased ph, which was, however, restricted to high hi sites and may therefore be less likely to occur under future oa . In summary, we were able to confirm the majority of the trends in differentially abundant taxa, which were previously observed either in png or at other naturally co2-rich sites . However, in specific instances, we detected taxa that have not been identified in oa research before, or which did not display the same trends as reported previously . (i) the distinction between medium and high hi sites allowed us to identify taxa only changing in abundance towards sites exhibiting conditions that may be less likely under future oa scenarios . The most drastic changes in microbial community composition were observed at the high hi sites and thus are likely correlated with parameters other than ph . (ii) in many instances, ph may not be the primary factor limiting the distribution of a microbial taxon even at medium hi sites . Other factors such as oxygen availability, temperature, organic carbon content and the presence of alternative electron acceptors may be equally or more likely to explain the differential abundance of microbial taxa between hydrothermal influence categories . (iii) it is important to consider the taxonomic resolution when analysing microbial communities . Especially in physiologically highly diverse taxa, a comparison at low taxonomic resolution levels might be insufficient to recover more detailed patterns in microbial community composition . (iv) as already suggested by raulf et al . (2015) the sampling area in png may be subject to a large temporal variation in microbial community composition . To better account for this phenomenon and to resolve inconsistencies with previous results, repeated monitoring studies, as conducted here we conclude that naturally co2-rich sites such as the co2 seeps in png may continue to be used for oa research on sediment microbial communities under the premise that the environmental conditions in the sediment are well documented . Furthermore, we recommend caution in attributing changes in microbial communities to acidification without a careful consideration of other environmental parameters . Thus, for future research on the impact of oa on sediment microbial communities, we strongly recommend performing a detailed assessment of the environmental conditions in the sediment and of other parameters than those of the carbonate system . This will enable a more reliable selection of naturally co2-rich sites as analogues for oa scenarios and will also improve the comparability between studies from different naturally co2-rich sites . This work was part of the bioacid ii project that was supported by the german federal ministry of education and research [fkz 03f0655].
|
Probiotics are defined as live microorganisms which when administered in adequate amounts confer a health benefit to the host . In acute infections, probiotics may boost the protection afforded by commensal microbiota through competitive interactions and direct antagonism of pathogens due in part to the production of antimicrobial factors . In other clinical conditions, such as chronic infections and immuno - suppression, microbe - host signalling is probably more relevant to effective probiotic action . And beneficial microbiota, requires continual signalling from bacteria within the gut lumen, maintaining the mucosal barrier while at the same time priming the gut for responses to injury . Given these health - promoting benefits, improving probiotic stress tolerance and ability to grow and survive in foods prior to ingestion and subsequently within the animal host is an important clinical goal . This is particularly relevant given that many potentially beneficial probiotics often prove to be physiologically fragile; a significant limitation in clinical applications . The patho - biotechnology concept [57] seeks to attain this goal, ultimately leading to the development of improved probiotic strains . A primary focus of this approach involves equipping probiotic bacteria with the genetic elements necessary to overcome the many stresses encountered during the probiotic life cycle (both external and internal to the host) as well as enabling probiotics to better deal with invading pathogens [8, 9]. The first tackles the issue of probiotic storage and delivery by cloning and expression of pathogen specific stress survival mechanisms (facilitating improved survival at extremes of temperature and water availability), thus countering reductions in probiotic numbers which can occur during manufacture and storage of delivery matrices (such as foods and tablet formulations). The second approach aims to improve host persistence by expression of host specific survival strategies (or virulence associated factors such as the ability to cope with bile; an important component of the bodies physicochemical defence system) thereby positively affecting the therapeutic efficacy of the probiotic . The final approach involves the development of the so - called designer probiotics; strains which specifically target invading pathogens by blocking crucial ligand - receptor interactions between the pathogen and host cell . The most common stresses encountered during the production of probiotic delivery matrices (food and/or tablet formulations) are temperature and water availability (aw). The ability to cope with such stresses is a particularly desirable trait in the selection of commercially viable probiotic strains . Common strategies employed by a variety of microbes to deal with both low aw and temperature stress include the synthesis of chaperone proteins as well as the accumulation of protective compounds, termed compatible solutes, including betaine, carnitine, and proline . These protective mechanisms help to stabilise protein structure and function, thus helping to maintain optimal metabolic output under a variety of stressful conditions . Improving a strain's ability to synthesize chaperone proteins and/or accumulate compatible solutes is thus an obvious first step in the development of more robust probiotic strains . Bacteria have evolved sophisticated mechanisms for compatible solute accumulation, including both uptake and synthesis systems . Indeed, the foodborne pathogen listeria monocytogenes (an extensively well studied pathogen in terms of compatible solute accumulation) possesses three distinct uptake systems (betl, gbu, and opuc) and at least one compatible solute synthesis system (proba). By placing the betl gene (encoding the betaine uptake system betl) under the transcriptional control of the nisin inducible promoter pnisa, it was possible to assess the role of betl (and thus betaine accumulation) in contributing to probiotic growth and survival under a variety of stresses likely encountered during food and/or tablet manufacture . Our probiotic of choice, lactobacillus salivarius ucc118, exhibits significantly lower betaine accumulation levels than l. monocytogenes and is correspondingly less physiologically robust than the pathogen . As expected, the l. salivarius betl strain showed a significant increase in betaine accumulation compared to the wild type . Indeed, sufficient betl was produced to confer increased salt tolerance, with growth of the transformed strain occurring at significantly higher salt concentrations than the parent . This is particularly significant given that high pressure processing is gaining increasing popularity as a novel nonthermal mechanism of food processing and preservation [16, 17]. Focusing on chaperone proteins, as opposed to compatible solutes as a means of improving cell viability under stress, corcoran et al . As with our probiotics engineered to accumulate compatible solutes corcoran's groesl overproducing strain exhibited significantly improved technological robustness; resulted in a ~10-fold and 2-fold better survival following spray and freeze drying, respectively, when compared to the wild type unmodified strain . As well as the stresses encountered during processing and storage, probiotic bacteria must also overcome the physiochemical defences of the host in order to reach the gastrointestinal tract in sufficient numbers to exert a beneficial effect . Recent work in our laboratory revealed that betl significantly improved the tolerance of the probiotic strain bifidobacterium breve ucc2003 to gastric juice . Interestingly, in support of this observation, termont et al . Also reported similar results for an l. lactis strain expressing the e. coli trehalose synthesis genes, thus suggesting a novel protective role for compatible solutes in the gastric environment . Furthermore, inline with our previous observations with l. salivarius ucc118, a significant osmoprotective effect was observed following the introduction of betl into b. breve, allowing significantly improved growth of the probiotic in conditions similar to those encountered in vivo (1.5% nacl; equivalent to the osmolarity of the gut). In addition, b. breve strains expressing betl were recovered at significantly higher levels than the wild type in the faeces, intestines, and caecum of inoculated animals . Finally, in addition to improved gastric transit and intestinal persistence (figure 2(a)), the addition of betl improved the clinical efficacy of the probiotic culture; mice fed b. breve ucc2003 (betl) exhibited significantly lower levels of systemic infection compared to the control strain following oral inoculation with l. monocytogenes (figure 2(b)). Furthermore, in vitro bile tolerance of b. breve was significantly enhanced by heterologous expression of the l. monocytogenes bile resistance mechanism bile (figure 3(a)), a phenotype which most likely explains why the bile strain was recovered at significantly higher levels than the control strain from the faeces and intestines of mice, following oral inoculation (figure 3(b)). In addition, the bile strain demonstrated increased clinical efficacy; by causing a reduction in l. monocytogenes recovered after oral inoculation (figure 4). In addition to using pathogens as a source of host specific stress adaptation systems, certain probiotic (or gras) strains may also represent a less hazardous reservoir of stress survival genes . Indeed, deou et al ., using a combination of genomics and transcriptome analysis, identified a number of key genes affecting the long gut residence time of the probiotic strain lactobacillus johnsonii ncc533 (which persists for up to 12 days in the gut as opposed to 5 days for the type strain atcc 33200). When atcc 33200 dna was hybridized against a microarray of ncc533, 233 genes were identified that were specific for the long - gut - persistence isolate . Furthermore, whole - genome transcription analysis of ncc533 identified 174 genes consistently expressed in the jejunum of mice monocolonized with this strain . Fusion of the two microarray data sets identified three loci that were both expressed in vivo and specific to the long - gut - persistence isolate . The identified genes included two glycosyltransferase genes in the exopolysaccharide synthesis operon; genes encoding a sugar phosphotransferase system (pts) transporter annotated as mannose pts; and a gene whose product shares 30% amino acid identity with immunoglobulin a proteases from pathogenic bacteria . Knockout mutants of all three genetic loci were tested in vivo revealing an important role for the pts and immunoglobulin a like protease in increasing gut residence time . These genes thus may represent important stress adaptation systems for the generation of pharmabiotics with improved gastrointestinal persistence . Collectively, the data indicates that rational genetic manipulation of selected probiotic strains can significantly improve delivery to and persistance within the gi tract . However, despite the potential benefits of such rationally designed pharmabiotics, there are also some significant limitations which still need to be addressed, not least of which are the safety concerns surrounding the development of genetically modified cultures . Natural acquisition of horizontally encoded virulence factors, for example, phage - encoded toxins or acquisition of antibiotic resistance markers, in combination with the modified ability of the microorganism to survive the innate immune defences of the gastrointestinal tract (low ph, elevated osmolarity, and bile salts) could conceivably result in the emergence of a potentially deadly strain rather than the expected beneficial one . It is hoped that some of these concerns may be allayed by proper adherence to rigid biological containment and safety procedures as discussed later . In addition to an already existing array of useful pathogen derived stress survival systems, it may be possible to artificially engineer improved systems using a directed evolution approach . One such approach involves the use of the e. coli mutator strain xl1-red; deficient in three of the primary dna repair pathways (muts, mutd, and mutt), plasmid replication in this strain results in a mutation rate ~5000-fold higher than that of the wild type . Thus, with each successive generation, random point mutations (some of which are beneficial) are introduced into the gene of interest, creating a bank of mutant genes from which the most effective can be selected based on an improved phenotype (e.g., increased osmotolerance, etc . ). We employed this technique to engineer proline hyperproducing strains of e. coli with a significantly increased ability to tolerate elevated osmolarities (figure 5). Bacterial proline synthesis from glutamate occurs via three enzymatic reactions, catalyzed by -glutamyl kinase (gk) (prob product), -glutamyl phosphate reductase (gpr) (proa product), and -pyrroline-5-carboxylate reductase (p5c) (proc product). For both prokaryotic and eukaryotic systems proline synthesis from glutamate is regulated by feedback inhibition of the first enzyme in the pathway (gk). Thus, it is possible to isolate proline hyperproducing strains by screening for isolates exhibiting reduced proline - mediated feedback inhibition of gk activity (as a consequence of single - base - pair substitutions in the prob gene). This was achieved by passaging the listerial proba operon through e. coli xl1-red thus creating a bank of randomly mutated proba operons . The resulting gene bank was then transformed into e. coli csh26 (a proline auxotroph) and successful transformants were screened for proline hyperproduction . Three independent proline overproducing mutants were obtained (each carrying point mutations at a different location within the prob gene). These strains, heterologously expressing the mutated listerial proba operon, were shown to be considerably more osmotolerant than strains expressing the wild - type listerial proba . Thus, while complementation with wild - type listerial proba offers a significant degree of osmoprotection, the bioengineered proba operon is far more effective, proving that the directed evolution approach provides a new dimension to the patho - biotechnology concept . It is of course entirely likely that this directed evolution approach may well dispense with the need for pathogens altogether as a source of stress survival systems in favour of selectively enhancing the probiotic's own gene complement . Faced with an emerging pandemic of antibiotic resistance, clinicians and scientists alike are now struggling to find viable therapeutic alternatives to our failing antibiotic wonder drugs . Many disease - causing bacteria exploit oligosaccharides displayed on the surface of host cells as receptors for toxins and/or adhesins, enabling adherence to the host and entry of the pathogen or secreted toxins into the host cell . Blocking this adherence prevents infection, while toxin neutralization ameliorates symptoms until the pathogen is eventually overcome by the host's immune system . Designer probiotics have been engineered to express receptor - mimic structures on their surface which fool the pathogen into thinking that the administered probiotic is in fact their target host cell [10, 2426]. When administered orally, these engineered probiotics bind to and neutralize toxins in the gut lumen and interfere with pathogen adherence to the intestinal epithelium thus essentially mopping up the infection . One such construct consists of an e. coli strain expressing a chimeric lipopolysaccharide (lps) terminating in a shiga toxin (stx) receptor . One milligram dry weight of this recombinant strain has been shown to neutralize> 100 g of stx1 and stx2 . [25, 26] have also constructed probiotics with receptor blocking potential against enterotoxigenic e. coli (etec) toxin lt and cholera toxin (ctx). Designer probiotics have also been developed to combat hiv, in addition to treating infections . Rao et al . Recently described the construction of a probiotic strain of e. coli, engineered to secrete hiv - gp41-haemolysin a hybrid peptides which block hiv fusion and entry into host cells . When administered orally or as a rectal suppository, this live microbicide adheres the gut mucosa and secretes the peptide in situ, thereby providing protection in advance of hiv exposure for up to a month . Other anti - hiv probiotics currently in development include a genetically engineered streptococcus gordonii which produces cyanovirin - n, a potent hiv - inactivating protein originally isolated from cyanobacterium, and a natural human vaginal isolate of lactobacillus jensenii modified to secrete two - domain cd4 which inhibits hiv entry into target cells . Notwithstanding in vitro and in vivo efficacy in animal models, further refinements to the receptor - mimic probiotics might be necessary before initiating phase i clinical trials . Patho - biotechnology, the introduction of genes to improve resistance to stomach acid, or otherwise promote adherence and survival in the gut, for example, would enable dose regimes to be substantially lowered thus providing greater efficacy and further cost benefits . In addition to infection control probiotics (and other nonpathogenic bacteria) are also being engineered to function as novel vaccine delivery vehicles which can stimulate both innate and acquired immunity but lack the possibility of reversion to virulence which exists with more conventional pathogenic platforms . Recently described the construction of an l. lactis strain expressing inla, encoding internalin a, a surface protein related to invasion in l. monocytogenes . In this instance, the otherwise noninvasive l. lactis strain is now capable of invading the small intestine and delivering molecules (dna or protein) into mammalian epithelial cells, making it a safer and more attractive alternative to attenuated l. monocytogenes as an antigen delivery vehicle . However, while undoubtedly safer than using attenuated pathogens, equipping probiotic strains with the ability to traverse the epithelium introduces a unique set of safety concerns which need to be addressed . Probiotic vaccine carriers administered by the mucosal route mimic the immune response elicited by natural infection and can lead to long lasting protective mucosal and systemic responses . Mucosal vaccine delivery (those administered orally, anally, or by nasal spray) also offers significant technological and commercial advantages over traditional formulations including reduced pain and the possibility of cross - contamination associated with intramuscular injection as well as the lack of a requirement for medically trained personnel to administer the vaccine . Despite their obvious clinical potential, the use of genetically modified organisms in food and medicine raises legitimate concerns about their propagation in the environment and about the dissemination of antibiotic markers or other genetic modifications to other microorganisms . At least some of these concerns might be allayed by the implementation of stringent biocontainment measures . Recently, steidler et al . Identified the thymidylate synthase (thya) gene as a target gene that combines the advantages of passive and active containment systems . Thymine auxotrophy involves activation of the sos repair system and dna fragmentation, thereby constituting an indigenous suicide system . Thymine and thymidine growth dependence differs from most other auxotrophys in that absence of the essential component is bactericidal in the former and bacteriostatic in the latter . Firstly, no resistance marker is required to guarantee stable inheritance of the transgene(s), thus overcoming any potential problems associated with dissemination of antibiotic resistance . Second, accumulation of the genetically modified organism in the environment is highly unlikely given that rapid death occurs upon thymidine starvation . Finally, should an intact thya be acquired from closely related bacteria by means of homologous recombination then the transgene(s) would be lost? Engineered probiotics thus have the potential to alleviate the symptoms of chronic gastrointestinal disorders and associated sequelae, to fight infection, modulate the immune system, and act as delivery vehicles for bioactive molecules . Notwithstanding these impressive health benefits, probiotic research has really only begun to achieve scientific credibility over the last decade, this despite the fact that yakult launched the first probiotic fermented food drink in japan in 1935; long before the appearance of the first commercially available antibiotics . However, the increasing emergence of antibiotic resistance, coupled with a significant decline in production of new antibacterials, means that probiotics are finally coming of age, representing a real alternative to traditional drug based therapies [33, 34].
|
Congenital adrenal hyperplasia (cah) is the commonest cause of adrenal insufficiency (ai) in childhood and 21-hydroxylase deficiency is the most frequently occurring form, accounting for approximately 95% of cases and having an incidence of between 1 in 9,000 and 1 in 20,000 births [13]. 21-hydroxylase deficiency is autosomal recessive, with patients inheriting inactivating mutations of varying severity in both cyp21a2 alleles, resulting in impaired synthesis and secretion of cortisol and aldosterone in combination with elevated levels of adrenal androgens [35]. Patients, particularly those with the more severe forms, are at risk of a salt - wasting crisis in infancy and an adrenal crisis (ac) at any age, when circulating cortisol levels are lower than physiologically required, especially in conditions of physiological stress such as infection [1, 3, 4]. Treatment of cah involves glucocorticoid (gc) administration to provide gc replacement and to suppress acth stimulation, thereby reducing excess adrenal androgen production . Fludrocortisone is also used to treat aldosterone deficiency . To suppress the production of adrenal androgens, gc doses are often required in excess of physiological replacement, which may impair growth and produce manifestations of gc excess [37]. Importantly, affected children are also at increased risk of developing an ac, which may be fatal [4, 810], either due to reduced cortisol synthesis or as a result of suppression of the hypothalamic - pituitary axis due to therapeutic gc exposure . Neonatal screening for 21-hydroxylase deficiency by measurement of 17-hydroxyprogesterone, a steroid precursor directly proximal to the 21-hydroxylase block, aims to prevent acs, which may be fatal, especially in males, but also in females with mild or unrecognized genital virilization [1, 3, 11]. While screening programs are established in a number of countries, screening is not available in australia, nor is there a national register of patients from which health outcome data on patients affected by cah can be extracted and analysed . Hospital administrative datasets, however, are accessible repositories of information on aspects of morbidity in these patients and are particularly useful as a source of data on serious morbidity in affected children beyond the early infant period . The aim of this study, therefore, was to provide further information on the burden of illness experienced by cah patients by examining patterns of hospitalisation for acute medical (nonsurgical) problems in children with cah in australia and to identify any factors that may be associated with such hospitalisation in affected children . New south wales (nsw) is a region with a population of over 7 million people . All documented diseases and procedures for each patient in nsw hospitals (public and private) are coded according to the australian modification of the international statistical classification of diseases and related problems (diagnoses) and are stored by the nsw ministry of health . Cases were selected from all admissions between 2001 and 2013, in patients aged up to 18 years, where the principal diagnosis (main reason for the admission) or any comorbid diagnosis was cah (e25.0). A second random sample of all children (n = 3120), whose record did not contain any codes for primary or secondary adrenal insufficiency (ai) (non - ai group) and who had an admission for an acute medical problem, was selected as a comparison sample of patients . In both datasets, each record included patient age (in years); sex; principal diagnosis; all secondary diagnoses and procedures; admission to an intensive care unit (icu); and mortality . Exclusion criteria included malignant disease, a principal diagnosis of psychiatric illness, or an obstetric or gynaecological problem; admission for rehabilitation or for planned day - only treatments or investigations such as dialysis or endoscopy; patients awaiting transfer to another hospital; admission for treatment of injuries; treatment of a surgical complication; and admissions in which a surgical procedure was performed . Infection was classified as any diagnosis caused by an organism such as a urinary tract infection (uti), pneumonia, or where an infectious agent was coded . Specifically, a virus was identified where a viral agent was coded or where a code indicated a virus (such as viral gastroenteritis). Respiratory tract illness was classified as any code relating to an acute problem in the respiratory tract . The study was approved by the human resource ethics committee of the university of notre dame, australia . Chi square and fisher's exact tests were used to assess the differences in frequencies of categorical variables between groups and t - tests were used to determine the difference in continuous variables ., ibm spss statistics for windows, version 22.0 ., armonk, ny, ibm corp . ). During the thirteen - year study period, there were 573 admissions for acute medical problems in children and adolescents with cah (corresponding to an average annual admission rate of 44.1 admissions / year). Half (n = 286, 49.9%) of the admissions were in males (table 1). Overall, there were 236 (41.2%) episodes of hospitalisation for treatment of symptomatic hypoadrenalism in this group, as either a principal diagnosis of cah (35.8%, n = 205) or a record of an ac (5.4%, n = 31) but with an alternate principal diagnosis other than cah . Infants aged up to 12 months contributed one - quarter (26.0%, n = 149) of the admissions, with the number of admissions decreasing with the increasing age of the children with cah (figure 1). Children in the preschool (1 to 5 years) age group contributed 207 admissions (36.1%) and there were 129 (22.5%) admissions in patients aged 6 to 11 years with the remaining 15.4% (n = 88) aged 12 to 18 years . Infants had the highest number of admissions with a principal diagnosis of cah (n = 83, 55.7%) (figure 1). By comparison, children aged between 1 and 5 years contributed the highest number of acs that were recorded (n = 21, 56.8%). In contrast to the cah children, a significantly greater proportion of the random sample of non - ai children was male (n = 1703, 54.6%; p <0.05) but the mean ages of the two groups were equal (mean (sd) cah: 5.1 yrs (5.2), non - ai: 5.1 yrs (5.8)). The characteristics of the cah and comparison samples are shown in table 1 . The proportion of admissions with an infection was significantly higher in the non - ai sample (51.7%, n = 1613) than in the cah patient group (43.5%, n = 249) (p <0.001). Viruses affected one - fifth of both groups but cah patients had fewer bacterial infections than the comparison sample (cah: n = 34, 5.9%; non - ai n = 295, 9.5%; p <0.01). Respiratory tract illness and diabetes mellitus were significantly more common in the non - ai sample (both p <0.001). In contrast, gastroenteritis was significantly more common among the children with cah (n = 96, 16.8%) than in the comparison group (n = 247, 7.9%) (p <0.001). Among the admissions of infants with cah, 52.3% (n = 78) were in males (table 2). An ac was recorded in six (4.0%) admissions (four males) and a principal diagnosis of cah was present in 55.7% (n = 83) of the infants, suggesting that symptomatic hypoadrenalism was the main reason for admission in more than half the children in this age group . Nearly one - fifth (n = 28, 18.8%) of the infants with cah had an admission to icu, which was significantly more than the proportion of infants in the random sample group in which there were 18 (2.2%) icu admissions (p <0.001). In addition, icu admission was significantly more common among male than female infants in the cah group (m: n = 20, 25.6%; f: n = 8, 11.3%; p <0.05). An infection was present in a third of the admissions of infants in the cah group (table 2). In this age group, males had significantly more infections (m: n = 36, 46.2%; f: n = 15, 21.1%; p <0.001) and respiratory tract illnesses (m: n = 13, 16.7%; f: n = 4, 5.6%; p <0.05) than females . There were twenty - one (10.1%) acs (13 females) identified in the 207 admissions in children with cah who were aged 1 to 5 years (table 2). Half (50.7%, n = 105) of these children had an infection recorded, with 29.5% (n = 61) having a viral and 3.4% (n = 7) having a bacterial infection (table 2). One - fifth (21.7%, n = 45) of the cah children in this age group were diagnosed as having gastroenteritis (table 2). By comparison, among the 129 children aged between 6 and 11 years, there were only 5 (3.9%) acs (4 males) recorded (table 2). An infection was noted in 44.2% (n = 57) of these children, and a viral infection (20.2%, n = 26) was more than three times as common as a bacterial infection (6.2%, n = 8). In contrast, there were fewer patients (n = 88) admitted to hospital in the 12 to 18 years age group and in this group there were five acs (5.7%) recorded (4 males) (table 2). A diagnosis of infection was found in 40.9% (n = 36) of this age group, and like the situation in the younger children, viruses (18.2%, n = 16) were more common than bacterial (6.8%, n = 6) infections . The results of the present study, which covered thirteen years of admissions to both private and public hospitals in a large geographic area for medical treatment of children with cah, demonstrated that infants had the highest admission rate among the age groups; episodes of hospitalisation decreased with increasing age; 6.5% of the admissions included a record of an ac but if all cases of admission for hypoadrenalism were included, almost 50% were due to some degree of ai; there was a lessening of the risk of ac beyond age of five; comorbid viral infections were more common than bacterial infections; and there were no in - hospital deaths . Among all the cah patient admissions, 149 were in infants, which corresponded to an average of 11.5 admissions in the infant age group for each year of the study . A pilot study of neonatal screening, conducted in the same geographic area between 1995 and 1997, found an incidence of 6 to 7 cases of classic cah per year, suggesting that the infants in the present study had, at most, an average of two medical admissions each in their first year of life . Only six acs were recorded in these children's admissions, which was lower than the number expected from studies in other unscreened populations [2, 8, 14]. However, more than half (55.7%) had a principal diagnosis of cah, suggesting that a substantial proportion of infants in this population had symptomatic hypoadrenalism or salt - wasting coded as the reason for admission rather than an ac or that virilization was identified postnatally in an infant that had not yet exhibited salt - wasting or an ac and that this resulted in hospital admission . Nearly one - fifth (18.8%) of these infants required icu admission, indicating that a substantial proportion of patients were significantly unwell during the admission . Although there were slightly more admissions among male (52% of the total) than female infants, it was not possible in this analysis to assess whether the observed sex ratio reflected the true incidence of cah . Differences in detection, morbidity at presentation (particularly the likelihood of presentation with an ac), and mortality risk between male and female infants with cah have been identified in a number of incidence studies [1, 11, 1417]. While there was no significant difference between the sexes in the proportion of admissions with either an ac or a principal diagnosis of cah in this study, male infants with cah appeared to suffer greater levels of morbidity, as they had approximately twice the number of infections, had three times the number of admissions for respiratory problems, and were twice as likely to be admitted to an icu compared to female infants . In this analysis, children in the one- to five - year age category had the highest proportion of acs of the four age groups . While the reasons for the higher incidence of acs at this age are uncertain, the children with cah in this age group had more infections than children in other age categories, as was the case in the comparison group . Viral infections, respiratory tract illness, and gastroenteritis were the most common comorbid illnesses recorded, suggesting that management of stress dosing during intercurrent infection may have been associated with the need for parenteral gc administration and hospitalisation . The higher level of infections in both the cah and non - ai subjects may be a reflection of an increased exposure to infection, especially viruses, as children in this age group move into childcare and start formal education, a phenomenon that may be confounded by the cessation of breastfeeding at this age, and possibly highlighting the need for increased vigilance around the management of cah in the context of intercurrent illness at this time . Infections are a common reason for admission to hospital in childhood, and at least one infectious illness was reported in 43.5% of all the episodes of hospitalisation for children with cah included in this study, which was lower than the proportion of admissions with an infection in the control sample (51.7%). Infections are a known precipitant of an ac in treated ai [18, 19]. In the children with cah, viral illnesses were much more frequent than bacterial infections, while, among adults with ai, it has been demonstrated that bacterial infections predominate [2022]. In addition, gastroenteritis and fever are frequently identified as precipitating factors for an ac in patients with ai, but these were reported in only 15.7% and 3.1% of the children, respectively . Despite this, in the present study, admission with a comorbid condition of gastroenteritis was significantly more common among children with cah than among those without ai . This is most likely due to the need for hospitalisation in children with cah who are vomiting or have a diarrhoeal illness and who are unable to absorb appropriate gc pharmacotherapy . Patient and caregiver education about the need for stress dosing, parenteral gcs, and hospital attendance in the event of intercurrent illness are regarded as a mainstay of sick day management in ai . However, recent evidence suggests that patient education does not necessarily prevent the occurrence of an ac . In adolescence, the provision of clinical services to cah patients changes, with the development of greater patient autonomy and the move from the pediatric service environment with parental oversight to an adult service [24, 25]. In this study, adolescents had the lowest annual admission rate, but more than one - quarter of the admissions were for a principal diagnosis of hypoadrenalism, either as an ac (n = 5) or for a principal diagnosis of cah, indicating that severe illness related to ai remains an issue for some cah patients into adolescence and adulthood . While adolescents with cah who are receiving gc pharmacotherapy are at risk of an ac, there are a number of other problems that may emerge in this age group such as poor attendance at medical reviews, reduced medication adherence, and the development of testicular adrenal rest tumours in males [6, 24, 25]. The new information arising from this study illustrates the benefit of using available administrative data to evaluate the morbidity experienced by patients with chronic diseases, such as cah . The dataset used in this analysis represents all the acute medical admissions of patients with cah to all hospitals in a large geographic area and is not, therefore, affected by problems with selection bias and generalisability that are an issue in many studies . The analysis was enhanced by the inclusion of a randomly selected sample of admissions in children without ai . In both the cah and non - ai groups, the clinical information that was used in the analysis represented the diagnosis conferred by the treating clinician and was obtained from the medical record . These data are subjected to regular audits at both the hospital and departmental level to ensure accuracy . By using data from all hospitals in this way, this study demonstrated the utility of such analyses in determining the burden of severe illness in rare diseases and provided information on the changes in serious morbidity experienced by children with cah from diagnosis to the end of childhood . However, these data also have some limitations . Both the type and severity of cah were not captured in the dataset, nor was the exact age (in days) at presentation of infants, as the patient's age at the time of admission was included in terms of years of age . Moreover, these data are based on episodes of care rather than on individual patient histories and it is likely that some children were admitted more than once for symptomatic ai or an ac, as has been demonstrated in previous studies . Further, patients in the cah group were selected on the basis of that diagnosis appearing as a condition in the medical record, and some patient treatment episodes may have been omitted if the diagnosis was not recorded . While the data include all patients treated in nsw hospitals, it is possible that some patients, especially those living near state borders, were treated at interstate hospitals and were, therefore, not included in the analysis . In addition, although there were no deaths recorded in hospital, it is possible that there were deaths that were attributable to an ac that occurred outside hospital . In summary, the results of this population - based study suggest that ac events occur in cah with a frequency that is up to that of ai in adults, with the 15-year age group at particular risk, perhaps due to frequent viral infections . It is possible that higher doses of glucocorticoids given to control androgen excess may induce secondary ai and heighten the risk of ac among some children . The low incidence of ac in infants is unexpected but may be related to differences in coding in this age group . In addition, this large study did not identify any in - hospital ac related deaths in this child / adolescent population without screening.
|
Situs inversus totalis (sit) is a rare congenital anomaly with an incidence of 1 in 10,00050,000 persons . Sit refers to complete right - left transformation or a mirror image of the normal arrangement of body organs . The anatomic arrangement in a patient with sit is complete transposition of all viscera in the thoracic and abdominal cavities . Although this condition does not affect normal health or longevity, its recognition is very important for treating many diseases, particularly those requiring surgical intervention . Herein, we report a patient with gastric cancer and sit who was treated with radical subtotal gastrectomy . A 50-year - old man was admitted to our hospital for treatment of early gastric cancer (egc), which was diagnosed during a screening esophagogastroduodenoscopy (egd) at a local clinic . His height was 171 cm, weight was 64.8 kg, and his body mass index was 22.2 . He had no anemia (red blood cell count, 4.25 10/l; hemoglobin, 13.4 g / dl; hematocrit, 43.6%). The serum carcinoembryonic antigen concentration was not elevated (3.16 ng / ml; reference range, 04.3). A chest radiograph showed dextrocardia and a right subphrenic gas pattern in the stomach (fig . 2). Abdominopelvic computed tomography (ct) showed complete transposition of the abdominal viscera, confirming sit (fig . 3). An f - fluoro2-deoxyglucose - d - glucose - positron emission tomography (fdg - pet) scan revealed no abnormal uptake and also noted a complete mirror image of the intrathoracic and abdominal viscera (fig . 4). We decided to perform a laparotomy and found complete transposition of the viscera; the stomach and spleen were located on the right side of the abdomen, and the gall bladder, liver, cecum, and appendix were located on the left side . The macroscopic biopsy report revealed a 2.0 1-cm egc type iic located at the gastric angle with 2 and 6.8 cm proximal and distal safety margins, respectively . Pathological examination showed tubular adenocarcinoma, moderately differentiated with depth of invasion into the muscularis mucosa . We followed the patient for 78 months in the outpatient department without recurrence of cancer . Sit is transmitted as an autosomal recessive trait, but the exact genetic cause remains unknown . Suggested that immobility of nodal cilia inhibits the flow of extraembryonic fluid during embryogenesis, leading to the development of sit . Sit has various manifestations; dextrocardia with complete reversal of the heart chambers can be seen . The stomach and spleen are located in the right side and the liver and gallbladder are located in the left side of the midline . Cardiovascular abnormalities (septal defects, pulmonary arterial stenosis, tetralogy of fallot, or transposition of great arteries) and problems with the alimentary tract (atresia or stenosis of the duodenum) can also occur . No significant cardiac or respiratory abnormalities were detected in our patient at the preoperative screening . About 60% of patients with sit have other congenital anomalies of the gastrointestinal tract, including rotational anomalies, biliary atresia, splenic agenesis, small bowel atresia, duplication, and colon aganglionosis . The initial diagnosis and surgical intervention for diseases, such as cholelithiasis, reversed side liver dullness, an apical beat in the right fifth intercostal space, a chest radiograph revealing dextrocardia, and abdominal x - ray film demonstrating stomach gas on the right side can be diagnostic clues of sit . An fdg - pet scan was obtained as a whole body image in a single picture for the stomach cancer stage workup . Many different cancers have been reported in patients with sit, including pancreatic, hepatocellular, colorectal, and gastric cancers . Fabricus reported the first case of mirror image transposition in a man in 1600 [8, 9]. Allen first reported a gastrectomy on a 30-year - old patient with gastric cancer and sit who died 3 weeks after surgery in 1936 . The symptoms of kartagener's syndrome, including bronchiectasis, chronic sinusitis, and male infertility is a disease that is associated with sit . Surgery in a patient with sit and gastric cancer could be difficult due to the anatomic anomalies, including perigastric major vessels . Although the incidence of intra - abdominal malignancies in a patient with sit is very rare, the surgeon must anticipate the complexity of the surgical procedure in patients with sit and cancer . Advanced surgical skill is required to perform a precise lymphadenectomy in a patient with sit by visualizing the exact mirror image of the anatomy during the operation . Visualizing the mirror image of the anatomy therefore, preoperative recognition of the anatomic variations might be needed when operating on a patient with sit . It might be helpful to perform a three - dimensional ct angiography reconstruction prior to the operation . In conclusion, surgery in a patient with gastric cancer and sit can be safely performed by paying attention to the inverted anatomic structures during the operation . Written informed consent was obtained from the patient for publication of this case report and any accompanying images.
|
Laceration of the lumbar artery during renal biopsy has been reported only in four instances . A 58-year - old lady presented with swelling of face that progressed to involve abdomen and feet, along with oliguria, cola colored urine and breathlessness on minimal exertion . On examination, she had puffiness of eyelids and swelling of feet . Cardiovascular examination revealed left ventricular third sound and respiratory system examination revealed bilateral crackles in infrascapular areas . Investigations showed hemoglobin of 12.1 g / dl, platelet count 2.57 lakhs / cumm, random blood glucose 82 mg / dl, blood urea 88 mg / dl, serum creatinine 5.63 mg / dl, total serum proteins 7.8 g / dl, and albumin 4.0 g / dl . Urinalysis revealed albumin: +, red blood cells: 1012/hpf, and red blood cell casts . The 24 h urine protein was 1.1 g, total cholesterol 258 mg / dl, antistreptolysin o> 400 u / l, complement 3 435 mg / l (reference range: 10321495 mg / l), and complement 4 150 mg / l (reference range: 167385 mg / l). Patient was subjected to a renal biopsy with a 16 gauge automated spring - loaded biopsy gun with length for sample notch being 1.6 cm and a possible penetration depth of 22 mm (bard biopty systems, usa). After second pass, the patient complained of pain from the biopsy site to the left flank and anterior abdomen . The radiologist noticed the appearance of an echogenic band around left kidney and in the muscular planes . A computerized tomography scan of abdomen revealed left perinephric collection of 1200 ml and heterogenous collection in left lumbar region [supplementary figure 1]. Angiogram revealed a focal active contrast extravasation from arcuate or interlobular artery in lower pole of left kidney and from lumbar artery at third lumbar vertebra [supplementary figure 2]. Her blood pressure fell to 80/60 mmhg from the pre - biopsy reading of 140/100 mmhg, and the hemoglobin dropped to 8.1 g / dl . Right femoral artery was cannulated with a cordis 6.0f femoral sheath, into which a judkin's diagnostic catheter 5.0f was passed . Into this catheter, floppy percutaneous transluminal coronary angioplasty guidewire, 0.014 inch in diameter and 300 cm in length the bleeding site was approximately 10.5 cm away from the vertebral column [figure 1 and supplementary figure 3]. Over this guidewire, a micro catheter, 2.25f and 130 cm in length (asahiintecc) gelfoam was injected so as to occlude the bleeding site [supplementary figure 5]. Computed tomography scan abdomen: bleeding from lumbar artery ct showing angiogram: bleeding from lumbar artery angiogram: bleeding from lumbar artery renal angiogram: no bleeding in the kidney 2.25f micro catheter introduced into lumbar artery lumbar artery embolized with gelfoam usually, four on each side [figure 2], they arise posterolaterally from the aorta opposite the lumbar vertebrae . A fifth, smaller pair occasionally from the median sacral artery but lumbar branches of the iliolumbar arteries usually takes their place . The lumbar arteries posterolaterally on the four upper lumbar vertebral bodies, behind the sympathetic trunks, to intervals between the lumbar transverse processes and continue into the abdominal wall . The right arteries pass posterior to the inferior vena cava; the upper two right and first left are also posterior to the corresponding crus . Arteries of both sides pass under tendinous arches (which span the lateral cavities of the vertebral bodies) for attachment of psoas major, proceeding posterior to the muscle and the lumbar plexus . They then cross the quadratus lumborum, the upper three posterior, the last usually anterior to it . At its lateral border, they pierce the posterior aponeurosis of the transversus abdominis, advancing between it and the internal oblique . They anastomose with one another and the lower posterior intercostal, subcostal, iliolumbar, deep circumflex iliac and inferior epigastric arteries . As the upper three pairs of lumbar arteries pass behind the quadratus lumborum, they are at risk injury from the renal biopsy needle . Anatomy of lumbar arteries (14) in the two previous reports [table 1], the presence of bleeding sites and arteriovenous fistula in kidney has misled and the laceration of the lumbar artery was missed . There was a delay of 20 h and 48 h in these two patients respectively before the laceration of the lumbar artery was recognized . Previous reports of hemorrhage from lumbar artery following percutaneous renal biopsy embolization of lumbar artery is fraught with the risk of infarction of the spinal cord . The artery of adamkiewicz (or great anterior radiculomedullary artery or arteria radicularis anterior magna) is the dominant thoracolumbar segmental artery that supplies the spinal cord . This artery has a variable origin; but most commonly arises on the left (~80%) at the level of 912 intercostal artery (~70%). It arises from the radiculomedullary branch of the posterior branch of the intercostal or lumbar artery, which arises from the thoracic or abdominal aorta respectively . The variations of its origin include from lumbar arteries at the level of l1 or l2 (10%), intercostal arteries at the level of t5 to t8 (15%) and arises on the right (20%). The injection of gelfoam and placement of coils should be done only after considering all these variations in the origin of this artery . The use of liquid embolization materials is also contraindicated due to higher risk of spinal cord injury . The lumbar artery embolization has been reported to have caused infarction of paraspinal muscles in two patients . Bleeding from lumbar artery is a rare complication but can be successfully managed with prompt recognition and intervention.
|
A genome - wide approach opens up the possibility of obtaining new information in the field of genome instability . Nevertheless, every method has its own restrictions . In our comments, we compare cytological, genetic and genome - wide molecular analyses of mobile element transposition rates in hybrid genomes . The mobility of transposable elements (tes) is one of the factors that induce spontaneous genetic instability . The transposition rate of tes is difficult to study due to the rarity of events and polymorphic tes locations, even in inbred strains . Aflp and fish were used by vela et al . To estimate the tes transposition rate in interspecies hybrids between d. koepferae females and d. buzzatii male after subsequent 3 backcrosses between a fertile hybrid female and a d. buzzatii male . It was found a big difference in number of tes insertions by using different techniques . Tes osvaldo, helena and galileo were detected by fish as several hybridization sites on the salivary gland polytene chromosomes (12 hybridization site for helena, no one for osvaldo and one for galileo in the case of d. koepferae; one hybridization site for galileo, 5 for helena and 4 for osvaldo in the case of d. buzzatii), whereas the molecular method aflp detected 25 dozen insertions per genome . The authors supposed that the difference in the tes copy number studied by different methods appeared because fish detects only euchromatic sites while aflp can also detect heterochromatic sites . It means that we should find another explanation of discrepancy in data obtained by fish and aflp . The difference in the tes copy number found in hybrid genomes by fish and aflp approach can be explained by different sensitivities of these methods . The fish analysis of the hobo, mdg1, dm412 and i - element transposition rates in the reference d. melanogaster genome can only realize usually sequences that have a base pair length of more than 1,000, although in this genome, there are several dozen smaller te derivatives that were annotated . Te localized in chromocenter usually represented by short defective copies and can be recognized by fish only if they are highly repeated . As usually hybridization of te in chromocenter region aflp - based technique allows the simultaneous amplification of the te insertions from a particular element which are identified by a ligation - mediated nested pcr that starts within the transposon and amplifies part of the flanking sequence . The polymorphic length of pcr products in aflp analysis is a reflection of the polymorphism of adjacent tes sequences . Aflp allows for the registration of short defective tes variant, but most of short defective tes variants cannot be recognized and moved by transposase, because most of them do not have both terminal repeats . An example of the instability of gene singed in intraspecies hybrids is presented in vela et al . 's article as a reflection of the rate of p - element transposition because of the excision of the p - element introduced in this gene . Meanwhile, it was found that mutations in the unstable sn were caused by the introduction of 2 p - elements oriented end - to - end or head - to - head . Another explanation of sn instability is as follows: homologous recombination or slippage of a replication fork between these repeats, perhaps during attempted transposition, would also produce the observed structures . Thus, singed instability may not be a reliable indicator of p - element transposition . It was shown also that the instability in notch and yellow-2 was caused by recombination between 2 tes . Hypermutability in yellow2 coincided with the multiplication of inversion appeared in the regulatory region between 2 hobo transposable elements and recombination between repeats . Recombination frequency increases also in heterozygote in pericentromeric regions where defective tes and other repeats are concentrated . As was mentioned by authors of commented article new aflp hybrid markers detected in amaranthus hybrids have homology with tes associated to the mobilization of repetitive dna . We found an example of distribution of 3 kb degenerative repeat between tes in annotated y; cn bw sp d. melanogaster genome (fig . 1). The members of this degenerative family are divided into 2 groups according to there's similarity and are distributed between different couples of short defective tes (jockey and rt1; stalker and invader). Members of one group are situated mainly between jockey and rt1 couples, but members of other group are localized mainly between stalker and invader couples . Appearance of such structure and multiplication of tes could be result of recombination between these 3 kb repeats . Figure 1.distribution of 3 kb repeats between couples of tes (jockey and rt1 in oval; stalker and invader in poligon) on the x - chromosome of y; cn bw sp d. melanogaster genome (in silico data was obtained from flybase). Distribution of 3 kb repeats between couples of tes (jockey and rt1 in oval; stalker and invader in poligon) on the x - chromosome of y; cn bw sp d. melanogaster genome (in silico data was obtained from flybase). Changes in the number of bands in the aflp analysis in interspecies hybrids can be caused not only by te transpositions, but also by conversion, multiplication or recombination between defective tes repeats or between their repeated neighbors . If this is the case, then recombination between repeats adjacent to te or recombination between different tes can simulate tes movement recognized by aflp . By the way, osvaldo is the most movable te according to aflp technique and the only te that strongly hybridizes with chromocenter . A difference in the number of aflp markers between the different flies of parental lines in spite of the fact that both stocks correspond to inbred lines maintained by brother the number of total galileo insertions in 2 different families was 41, 43 and 42, 45 in the case of d. buzzatii and d. koepferae respectively (table 5). According to figure 1 from vela et al . Article paternal insertion sites are nearly summarized in hybrids because aflp markers are not coincide in analyzed species . The biggest number (52) of total galileo insertions was found in family 40 . It is not clear, what is the impact of polymorphic pattern of parental tes in aflp result if backcross1 was carried out by mass crossing . A similar divergence between the genome - wide and cytological data in the analysis of the rate of te transposition was found in drosophila melanogaster intraspecies crosses . Authors directly mapped new transposon insertions by paired - end deep sequencing of ovarian dna . By contrast, genome sequence analysis of dysgenic ovaries devoted viable eggs, revealed approximately 15 new insertions in a single generation . The length of p - elements was not determined as in the vela et al . The rate of p - element transposition was about 10 and 10 according to hybridization in situ and genome - wide analysis respectively . The frequency of tes transpositions in interspecies hybrids varies from 10 to 10 per genome per generation according to aflp - based technique . Genome - wide methods identify increases in genome instability in inter - and intra - species hybrids, but overestimate tes transposition rates by at least one order of magnitude in comparison with fish . This is because genome - wide methods can recognize not only movable te, but also short defective derivatives, which have lost the potential to change positions . Instability which is recognized by aflp technique can reflect changes of tes position that happens mainly without transposase participation . The genome instability in intraspecies crosses is at least one order of magnitude higher than in interspecies hybrids if take into account genome - wide approaches . This work is supported partially by grant rfbr 14 - 04 - 00929 and base project vi.53.1.2.
|
The success of endodontic treatment is based on the effective decontamination of the root canal system, whereas microbial agents are essential for the development and maintenance of pathological processes that damage the pulp and periapical region . Despite technological and scientific advances in endodontics, the persistence of endodontic infections depends on the ability of microorganisms to adapt to environmental changes . Many different mechanisms are used by bacteria, such as: biofilm formation, physiological modifications, exchange of genetic material, and creation of cell subpopulations . One challenge that has motivated many researchers in recent years is to develop new technologies to eliminate these persistent microorganisms . Among the new technologies, photodynamic therapy (pdt), also known as photoactivated disinfection or photochemotherapy, has demonstrated to be a great ally to conventional endodontic treatment in eliminating microorganisms that remain viable in root canal system . This treatment is based on the use of a nontoxic dye sensitive to light, followed by irradiation with a visible light source with a suitable wavelength in the presence of oxygen . Given the above, the purpose of this paper is to review the dental literature that describes the main factors involving antimicrobial effects of pdt combined with conventional endodontic treatment in the total disinfection of the root canal system . The databases pubmed, isi web of knowledge and medline were used with specific indexing of the following terms: pdt, photoactivated disinfection, photochemotherapy, endodontics and root canal, and a subsequent search with specific limits and criteria were performed . The first reports that the association between dye and light could generate antimicrobial effect date back over 100 years . In 1900 oscar raab and hermann von tappeiner realized that red acridine could absorb ambient light and cause toxic effect on cultures of protozoa . Years later, von tappeiner and dermatologist jesionek realized that it was possible to treat skin cancer lesions using a combination of topical eosin and white light . In 1904, von tappeiner and jodlbauer demonstrated that the presence of oxygen was required for the photosensitizing reaction to occur . However, in the decades of 80 and 90, due to the rapid increase in the appearance of antibiotic - resistant bacteria, a number of researchers regained interest in the first study of raab and von tappeiner, studying elimination of microorganisms by pdt . Currently, it is known that various microorganisms can be eliminated by activating a nontoxic photosensitizing using a resonant light source . The mechanism of action of pdt occurs when dye, acting as a photosensitizing agent, absorbs photons from the light source, and their electrons enter an excited state, also known as triplet state . In the presence of a substrate, such as oxygen, the photosensitizer, when return to its basic state, transfers the energy to substrate, forming free radicals of high cytotoxicity, such as superoxides and singlet oxygen . These highly reactive species can cause serious damage to microorganisms through irreversible oxidation of cellular components, causing damage to the cell membrane, to mitochondria, to nucleus, and to other microbial cell components . There are two mechanisms that explain how photosensitizer in the triplet state can react with biomolecules . The type i reaction involves the transfer of electrons from excited photosensitizer molecules of the substrate, leading to production of free radicals that react rapidly with oxygen, resulting in the production of superoxide, hydroxyl radicals and hydrogen peroxide . In the type ii reaction, the excited photosensitizer transfers energy to oxygen, leading to the production of electronically animated molecules known as singlet oxygen . In pdt the reaction of type ii; however, is accepted as the main means of microbial cells destruction . Due to its selective antimicrobial action, pdt appears as a promising therapy to eradicate pathogenic bacteria, since, in low concentrations, it kills microorganisms without causing injury to human normal cells . Several studies have shown that the dose required to cause bacterial death is lower the dose needed to cause damage to keratinocytes and fibroblasts . Xu et al . Suggested that pdt can be used as an adjunct to endodontic disinfection without damaging the cells of periapical region in their evaluation of the in vitro effects of methylene blue at 50 g / ml and irradiation with diode light amplification by stimulated emission of radiation (laser) at 665 nm for 5 min on human gingival fibroblasts and osteoblasts . One of the advantages of photosensitization compared to traditional antimicrobials is that as the interaction of highly reactive oxygen with organic molecules is not specific, any macromolecule within microbial cell may become a potential target, thus hindering the development of mechanisms of microbial resistance . Furthermore, the procedure can be repeated several times, as it there are no reports of cumulative effects . Photodynamic therapy has other attributes that make it an excellent tool in intracanal bacterial reduction, such as: it is safe for human tissues, it has the ability to eradicate pathogens in biofilms, it is easy to apply, painless, and cheap when compared to high - intensity laser . Bonsor et al . Evaluated the antimicrobial efficacy of pdt as an adjunct to disinfect root canals of patients with symptoms of irreversible pulpitis or periradicular periodontitis . The authors concluded that the use of toluidine blue o dye at 12.7 mg / l irradiated for 120 s using a diode laser at 100 mw connected to a delivery fiber was effective to remove completely the remaining microorganisms of the chemomechanical preparation . Garcez et al . Evaluated the antimicrobial action of pdt combined with endodontic retreatment and intracanal medication in anterior teeth with periapical lesions in patients who had undergone antibiotic therapy . The total elimination of intracanal microbial load was observed when pdt was used with a conjugate between polyethylenimine and chlorin (e6), and diode laser irradiation at a wavelength of 660 nm and 40 mw of power associated with a fiber optics . Ok et al . Evaluated the in vitro effect of pdt on the bond strength of ah plus sealer to dentin in root canals obturated with lateral condensation technique . The authors concluded that the final disinfection using pdt (0.01% toluidine blue o and light - emitting diode (led) irradiation with 625 - 635 nm wavelength) did not affect negatively the bond strength of the cement to root dentin . In order for pdt be successful, it is essential that the selected photosensitizer possesses particular characteristics such as it must be biologically stable, minimally toxic to healthy tissues, photochemically efficient, and resonant with the wavelength emitted by the light source ., the applicability of each dye is conditioned to its characteristics, such as maximum absorption of wavelength and intensity of light absorption . The photosensitizing agents used in pdt belong to different groups of compounds and most of them are activated by light between 630 nm and 700 nm . In the literature, photosensitizers derived from group of phenothiazines, such as toluidine blue and methylene blue dyes have been the most used in research involving antimicrobial action in root canals . According to fimple et al . Increasing the concentration of methylene blue and the light energy fluence (j / cm), causes an increase in the antibacterial capacity of pdt . Used freshly extracted teeth with pulp necrosis to compare the intracanal microbial reduction obtained by conventional chemomechanical debridement using sodium hypochlorite 6% only or added to pdt . Methylene blue was used at a concentration of 50 g / ml and irradiation with diode laser with a power of 100 mw / cm and wavelength of 665 nm connected to an optical fiber . The results indicated that chemomechanical debridement followed by pdt was able to eliminate microorganisms totally in 86.5% of the canals, compared to 49% when pdt was not used . Verified that the combination of sodium hypochlorite at 2.5% and pdt using toluidine blue at a concentration of 15 g / ml and diode laser with 200 mw / cm of power and a wavelength of 625 nm was able to eliminate totally enterococcus faecalis in single - rooted canals of freshly extracted teeth . Komine and tsujimoto evaluated the relation between the amount of singlet oxygen generated by different concentrations of activated methylene blue and the bactericidal effect of pdt in suspensions of e. faecalis . They concluded that methylene blue at a concentration of 0.01%, when activated by diode laser with a wavelength of 660 nm and 200 mw of power, was able to generate the greatest amount of singlet oxygen and consequently result in a large reduction in the number of colony - forming units of the micro - organism . The use of encapsulated nanoparticles with photoactive drugs has also been tested to improve the ability of antimicrobial pdt . Pagonis et al . Verified that irradiation of poly (lactic - co - glycolic acid) nanopaticles loaded with methylene blue (50 g / ml) showed elimination of approximately 1log10 colony - forming units of e. faecalis in experimentally infected root canals . Dentin staining caused by photosensitizing agents has been indicated as one of the main inconveniences of the use of pdt in root canals . The effectiveness of some chemical compounds have been evaluated in an attempt to overcome this disadvantage . Concluded that the use of 2.5% of sodium hypochlorite, associated or not to endo - ptc cream, was effective in preventing tooth stains caused by the use of methylene blue during pdt . In pdt, light must be of a specific wavelength to ensure maximum effectiveness of the treatment . Low - power lasers, such as helium - neon (he - ne) and diodes are the most used sources of radiation in pdt for microbial reduction of various cultures of bacteria and fungi in the oral cavity . Helium - neon lasers show positive results in the microbial reduction of various cultures of microorganisms using toluidine blue and methylene blue dyes . Currently, diode lasers have been the most used because are more compact and easier to handle, less costly, more versatile and well absorbed by biological tissues . This latter is an advantage, because in pdt the effects obtained are not due to increase in temperature, but by photochemical reactions between photosensitizer, light source, and substrate . Evaluated the antimicrobial action of pdt in deciduous teeth with pulp necrosis after chemomechanical instrumentation of root canals . Pdt was performed using toluidine blue in a concentration of 0.005% mg / l and diode laser irradiation at 100 mw of power and a wavelength of 660 nm . The results demonstrated that chemo - mechanical instrumentation has led to a reduction of 82.59% of viable cells, and after pdt, the significant microbial reduction observed was 98.37% . Recently, sources of nonlaser light, such as leds, have been successfully applied as alternative energy sources in pdt because of their low cost, flexibility, and light weight . Rios et al . Observed that the association between sodium hypochlorite at 6% and pdt (using toluidine blue o and led lamp at 628 nm) resulted in low survival rate of e. faecalis (0.1%) in root canals of extracted teeth . When sodium hypochlorite or pdt was employed separately, light amplification by stimulated emission of radiation light used in pdt can be directed through an optical fiber . When employed in the elimination of microorganisms from root canal, this is due to the capacity of optical fiber to distribute light evenly 360 around the root canal system with minimal losses, and compatible with the dimensions of the root canal . With the aid of the fiber, the effect of laser can be extended to areas of difficult access, and can easily reach the apical third, even in curvatures of molars, as well as to external biofilm of the root apex . Is important that during use of optical fiber, helical movements be performed from apical third toward cervical, allowing the irradiation beam to reach the full extent of the canal during activation of the photosensitizer dye . After comparing the antimicrobial effects of pdt against e. faecalis in root canals, garcez et al ., suggested that the use of an optical fiber / diffusor, when used for endodontic treatment, had better results than when laser light was used directed to access of the pulp cavity . Another important factor for the success of pdt is the elapsed time between application of the photosensitizer and its activation by light . At the moment of activation, photosensitizer must be next to its target so that the formation of toxic species occurs at the desired local . In antimicrobial pdt applications, it is important that at the moment of activation by the light source, the dye be attached to microorganism or has overtaken the barrier of its cell membrane . It is imperative that in this period the photosensitizer does not undergo degradation before it can be activated by the light source . Evaluated in vitro the efficacy of pdt to eliminate suspensions of candida species using methylene blue (300 g / ml) and irradiation with diode laser (660 nm, 40 mw) employing three energy dosages (60 j / cm, 120 j / cm, 180 j / cm)., and the dose of 180 j / cm was the most effective, reducing about 78% of the number of colony - forming units . The microbial reduction by photodynamic effect faces different challenges when used against gram - positive bacteria, gram - negative bacteria and fungi . In general, the literature shows that gram - positive bacteria are more susceptible to pdt action compared to gram - negative . This is due to differences in the physiology of these microorganisms, because gram - positive bacteria have a relatively porous outer membrane, formed by a thick layer of peptidoglycan and lipoteichoic acid . This characteristic allows a greater diffusion of the photosensitizer into the bacterium, so that various types of dyes and lower doses of irradiation can remove it . On the other hand, the outer membrane of gram - negative bacteria is thinner and more complex, formed by a heterogeneous composition that includes proteins with a porin function, lipopolysaccharides and lipoproteins, which act as an effective barrier limiting the penetration of some substances . The photosensitization of bacteria is related to the photosensitizer charge . Because it has characteristics such as a positive charge, low molecular weight and hydrophilicity, methylene blue is capable of interacting with anionic lipopolysaccharide macromolecules and penetrate the outer membrane of gram - negative bacteria . As regards the fungi, these have a cell wall constituted by a thick layer of beta glucan and chitin, which promotes an intermediate permeability barrier between gram - positive and gram - negative bacteria . Investigated the effects of pdt in root canals of extracted teeth experimentally infected with endodontic pathogens . Methylene blue was used at a concentration of 25 g / ml and exposure to diode laser with a wavelength of 665 nm and energy fluence of 30 j / cm coupled to an optical fiber . Following this protocol, all bacterial species were completely eliminated, except for e. faecalis (53% of death). However, by increasing the energy fluence to 222 j / cm, they eliminated 97% of e. faecalis is also possible to observe differences in susceptibility of pdt when microorganisms are organized in the form of biofilm and when they are arranged as isolated cells . The challenge is greater when microorganisms are organized in biofilms, because they are then protected within a matrix, showing, thus, less susceptibility to antimicrobial therapy . Tested the bactericidal effect of pdt on strains of streptococcus anginosus, e. faecalis and mixed cultures containing e. faecalis and fusobacterium nucleatum inoculated in root canals of extracted teeth . The authors verified that when microorganisms were organized in individual cells or monolayers, pdt easily eliminated them . Whereas when microorganisms were arranged in biofilm, the bacterial eradication was substantially reduced in the deeper layers . Upadya and kishen compared the efficacy of pdt in planktonic suspensions and mono - species biofilms containing pseudomonas aeruginosa and e. faecalis . The authors concluded that modifications in the formulation of the photosensitizer increased the antibacterial efficacy of pdt in biofilms . The reduced susceptibility of biofilms to pdt is attributed to the low penetration of the photosensitizer . Accordingly, various methods have been studied aiming to increase the potential penetration of the photosensitizer in biofilms . According to george and kishen the inclusion of an oxidant and an oxygen carrier in the formulation of methylene blue enables an increase in the potential of photo - oxidation and generation of singlet oxygen of pdt, facilitating the disruption of the biofilm matrix of e. faecalis in root canals in vitro . Kishen et al . Concluded that the use of a specific microbial efflux pump inhibitor added to methylene blue was able to increase the efficacy of pdt in eliminating biofilms formed by e. faecalis in polystyrene plates . Compared the in vitro efficacy of conventional pdt (methylene blue at 15 mol / l and irradiation with diode laser with 40 mw and 660 nm) and modified pdt (methylene blue at 100 mol / l, hydrogen peroxide at 0.5%, ethylenediaminetetraacetic acid at 0.05%, chlorhexidine at 0.05% and laser irradiation) in the elimination of e. faecalis and mixed bacterial plaque in suspensions and biofilms . The authors concluded that modified pdt was able to remove up to twenty times more bacterial biofilms than conventional pdt . Thus, research protocols on laser light intensity, photosensitizers concentrations and activation methods are still being developed, showing different results and susceptibilities of microorganisms to treatment . It could be concluded that pdt is presented as an important auxiliary tool to antimicrobial substances commonly used in endodontic treatment . However, this therapy presents different challenges regarding its susceptibility to different microorganisms, according to their physiology . Thus, for pdt to be employed with maximum effectiveness is important that further studies be performed in order to determine appropriate parameters for energy dosage used, photosensitizer concentration, time of preirradiation, and exposure . The mechanism of action of pdt occurs when dye, acting as a photosensitizing agent, absorbs photons from the light source, and their electrons enter an excited state, also known as triplet state . In the presence of a substrate, such as oxygen, the photosensitizer, when return to its basic state, transfers the energy to substrate, forming free radicals of high cytotoxicity, such as superoxides and singlet oxygen . These highly reactive species can cause serious damage to microorganisms through irreversible oxidation of cellular components, causing damage to the cell membrane, to mitochondria, to nucleus, and to other microbial cell components . There are two mechanisms that explain how photosensitizer in the triplet state can react with biomolecules . The type i reaction involves the transfer of electrons from excited photosensitizer molecules of the substrate, leading to production of free radicals that react rapidly with oxygen, resulting in the production of superoxide, hydroxyl radicals and hydrogen peroxide . In the type ii reaction, the excited photosensitizer transfers energy to oxygen, leading to the production of electronically animated molecules known as singlet oxygen . In pdt the reaction of type ii; however, is accepted as the main means of microbial cells destruction . Due to its selective antimicrobial action, pdt appears as a promising therapy to eradicate pathogenic bacteria, since, in low concentrations, it kills microorganisms without causing injury to human normal cells . Several studies have shown that the dose required to cause bacterial death is lower the dose needed to cause damage to keratinocytes and fibroblasts . Xu et al . Suggested that pdt can be used as an adjunct to endodontic disinfection without damaging the cells of periapical region in their evaluation of the in vitro effects of methylene blue at 50 g / ml and irradiation with diode light amplification by stimulated emission of radiation (laser) at 665 nm for 5 min on human gingival fibroblasts and osteoblasts . One of the advantages of photosensitization compared to traditional antimicrobials is that as the interaction of highly reactive oxygen with organic molecules is not specific, any macromolecule within microbial cell may become a potential target, thus hindering the development of mechanisms of microbial resistance . Furthermore, the procedure can be repeated several times, as it there are no reports of cumulative effects . Photodynamic therapy has other attributes that make it an excellent tool in intracanal bacterial reduction, such as: it is safe for human tissues, it has the ability to eradicate pathogens in biofilms, it is easy to apply, painless, and cheap when compared to high - intensity laser . Bonsor et al . Evaluated the antimicrobial efficacy of pdt as an adjunct to disinfect root canals of patients with symptoms of irreversible pulpitis or periradicular periodontitis . The authors concluded that the use of toluidine blue o dye at 12.7 mg / l irradiated for 120 s using a diode laser at 100 mw connected to a delivery fiber was effective to remove completely the remaining microorganisms of the chemomechanical preparation . Evaluated the antimicrobial action of pdt combined with endodontic retreatment and intracanal medication in anterior teeth with periapical lesions in patients who had undergone antibiotic therapy . The total elimination of intracanal microbial load was observed when pdt was used with a conjugate between polyethylenimine and chlorin (e6), and diode laser irradiation at a wavelength of 660 nm and 40 mw of power associated with a fiber optics . Ok et al . Evaluated the in vitro effect of pdt on the bond strength of ah plus sealer to dentin in root canals obturated with lateral condensation technique . The authors concluded that the final disinfection using pdt (0.01% toluidine blue o and light - emitting diode (led) irradiation with 625 - 635 nm wavelength) did not affect negatively the bond strength of the cement to root dentin . In order for pdt be successful, it is essential that the selected photosensitizer possesses particular characteristics such as it must be biologically stable, minimally toxic to healthy tissues, photochemically efficient, and resonant with the wavelength emitted by the light source . Various types of photosensitizers may be associated to the laser . According to wainwright, the applicability of each dye is conditioned to its characteristics, such as maximum absorption of wavelength and intensity of light absorption . The photosensitizing agents used in pdt belong to different groups of compounds and most of them are activated by light between 630 nm and 700 nm . In the literature, photosensitizers derived from group of phenothiazines, such as toluidine blue and methylene blue dyes have been the most used in research involving antimicrobial action in root canals . According to fimple et al . Increasing the concentration of methylene blue and the light energy fluence (j / cm), causes an increase in the antibacterial capacity of pdt . Used freshly extracted teeth with pulp necrosis to compare the intracanal microbial reduction obtained by conventional chemomechanical debridement using sodium hypochlorite 6% only or added to pdt . Methylene blue was used at a concentration of 50 g / ml and irradiation with diode laser with a power of 100 mw / cm and wavelength of 665 nm connected to an optical fiber . The results indicated that chemomechanical debridement followed by pdt was able to eliminate microorganisms totally in 86.5% of the canals, compared to 49% when pdt was not used . Verified that the combination of sodium hypochlorite at 2.5% and pdt using toluidine blue at a concentration of 15 g / ml and diode laser with 200 mw / cm of power and a wavelength of 625 nm was able to eliminate totally enterococcus faecalis in single - rooted canals of freshly extracted teeth . Komine and tsujimoto evaluated the relation between the amount of singlet oxygen generated by different concentrations of activated methylene blue and the bactericidal effect of pdt in suspensions of e. faecalis . They concluded that methylene blue at a concentration of 0.01%, when activated by diode laser with a wavelength of 660 nm and 200 mw of power, was able to generate the greatest amount of singlet oxygen and consequently result in a large reduction in the number of colony - forming units of the micro - organism . The use of encapsulated nanoparticles with photoactive drugs has also been tested to improve the ability of antimicrobial pdt . Pagonis et al . Verified that irradiation of poly (lactic - co - glycolic acid) nanopaticles loaded with methylene blue (50 g / ml) showed elimination of approximately 1log10 colony - forming units of e. faecalis in experimentally infected root canals . Dentin staining caused by photosensitizing agents has been indicated as one of the main inconveniences of the use of pdt in root canals . The effectiveness of some chemical compounds have been evaluated in an attempt to overcome this disadvantage . Concluded that the use of 2.5% of sodium hypochlorite, associated or not to endo - ptc cream, was effective in preventing tooth stains caused by the use of methylene blue during pdt . In pdt, light must be of a specific wavelength to ensure maximum effectiveness of the treatment . Low - power lasers, such as helium - neon (he - ne) and diodes are the most used sources of radiation in pdt for microbial reduction of various cultures of bacteria and fungi in the oral cavity . Helium - neon lasers show positive results in the microbial reduction of various cultures of microorganisms using toluidine blue and methylene blue dyes . Currently, diode lasers have been the most used because are more compact and easier to handle, less costly, more versatile and well absorbed by biological tissues . This latter is an advantage, because in pdt the effects obtained are not due to increase in temperature, but by photochemical reactions between photosensitizer, light source, and substrate . Evaluated the antimicrobial action of pdt in deciduous teeth with pulp necrosis after chemomechanical instrumentation of root canals . Mg / l and diode laser irradiation at 100 mw of power and a wavelength of 660 nm . The results demonstrated that chemo - mechanical instrumentation has led to a reduction of 82.59% of viable cells, and after pdt, the significant microbial reduction observed was 98.37% . Recently, sources of nonlaser light, such as leds, have been successfully applied as alternative energy sources in pdt because of their low cost, flexibility, and light weight . Rios et al . Observed that the association between sodium hypochlorite at 6% and pdt (using toluidine blue o and led lamp at 628 nm) resulted in low survival rate of e. faecalis (0.1%) in root canals of extracted teeth . When sodium hypochlorite or pdt was employed separately, light amplification by stimulated emission of radiation light used in pdt can be directed through an optical fiber . When employed in the elimination of microorganisms from root canal, this is due to the capacity of optical fiber to distribute light evenly 360 around the root canal system with minimal losses, and compatible with the dimensions of the root canal . With the aid of the fiber, the effect of laser can be extended to areas of difficult access, and can easily reach the apical third, even in curvatures of molars, as well as to external biofilm of the root apex . Is important that during use of optical fiber, helical movements be performed from apical third toward cervical, allowing the irradiation beam to reach the full extent of the canal during activation of the photosensitizer dye . After comparing the antimicrobial effects of pdt against e. faecalis in root canals, garcez et al ., suggested that the use of an optical fiber / diffusor, when used for endodontic treatment, had better results than when laser light was used directed to access of the pulp cavity . Another important factor for the success of pdt is the elapsed time between application of the photosensitizer and its activation by light . At the moment of activation, photosensitizer must be next to its target so that the formation of toxic species occurs at the desired local . In antimicrobial pdt applications, it is important that at the moment of activation by the light source, the dye be attached to microorganism or has overtaken the barrier of its cell membrane . It is imperative that in this period the photosensitizer does not undergo degradation before it can be activated by the light source . Evaluated in vitro the efficacy of pdt to eliminate suspensions of candida species using methylene blue (300 g / ml) and irradiation with diode laser (660 nm, 40 mw) employing three energy dosages (60 j / cm, 120 j / cm, 180 j / cm). The dose of 180 j / cm was the most effective, reducing about 78% of the number of colony - forming units . The microbial reduction by photodynamic effect faces different challenges when used against gram - positive bacteria, gram - negative bacteria and fungi . In general, the literature shows that gram - positive bacteria are more susceptible to pdt action compared to gram - negative . This is due to differences in the physiology of these microorganisms, because gram - positive bacteria have a relatively porous outer membrane, formed by a thick layer of peptidoglycan and lipoteichoic acid . This characteristic allows a greater diffusion of the photosensitizer into the bacterium, so that various types of dyes and lower doses of irradiation can remove it . On the other hand, the outer membrane of gram - negative bacteria is thinner and more complex, formed by a heterogeneous composition that includes proteins with a porin function, lipopolysaccharides and lipoproteins, which act as an effective barrier limiting the penetration of some substances . Because it has characteristics such as a positive charge, low molecular weight and hydrophilicity, methylene blue is capable of interacting with anionic lipopolysaccharide macromolecules and penetrate the outer membrane of gram - negative bacteria . As regards the fungi, these have a cell wall constituted by a thick layer of beta glucan and chitin, which promotes an intermediate permeability barrier between gram - positive and gram - negative bacteria . Investigated the effects of pdt in root canals of extracted teeth experimentally infected with endodontic pathogens . Methylene blue was used at a concentration of 25 g / ml and exposure to diode laser with a wavelength of 665 nm and energy fluence of 30 j / cm coupled to an optical fiber . Following this protocol, all bacterial species were completely eliminated, except for e. faecalis (53% of death). However, by increasing the energy fluence to 222 j / cm, they eliminated 97% of e. faecalis is also possible to observe differences in susceptibility of pdt when microorganisms are organized in the form of biofilm and when they are arranged as isolated cells . The challenge is greater when microorganisms are organized in biofilms, because they are then protected within a matrix, showing, thus, less susceptibility to antimicrobial therapy . Bergmans et al . Tested the bactericidal effect of pdt on strains of streptococcus anginosus, e. faecalis and mixed cultures containing e. faecalis and fusobacterium nucleatum inoculated in root canals of extracted teeth . The authors verified that when microorganisms were organized in individual cells or monolayers, pdt easily eliminated them . Whereas when microorganisms were arranged in biofilm, the bacterial eradication was substantially reduced in the deeper layers . Upadya and kishen compared the efficacy of pdt in planktonic suspensions and mono - species biofilms containing pseudomonas aeruginosa and e. faecalis . The authors concluded that modifications in the formulation of the photosensitizer increased the antibacterial efficacy of pdt in biofilms . The reduced susceptibility of biofilms to pdt is attributed to the low penetration of the photosensitizer . Accordingly, various methods have been studied aiming to increase the potential penetration of the photosensitizer in biofilms . According to george and kishen the inclusion of an oxidant and an oxygen carrier in the formulation of methylene blue enables an increase in the potential of photo - oxidation and generation of singlet oxygen of pdt, facilitating the disruption of the biofilm matrix of e. faecalis in root canals in vitro . Concluded that the use of a specific microbial efflux pump inhibitor added to methylene blue was able to increase the efficacy of pdt in eliminating biofilms formed by e. faecalis in polystyrene plates . Mol / l and irradiation with diode laser with 40 mw and 660 nm) and modified pdt (methylene blue at 100 mol / l, hydrogen peroxide at 0.5%, ethylenediaminetetraacetic acid at 0.05%, chlorhexidine at 0.05% and laser irradiation) in the elimination of e. faecalis and mixed bacterial plaque in suspensions and biofilms . The authors concluded that modified pdt was able to remove up to twenty times more bacterial biofilms than conventional pdt . Thus, research protocols on laser light intensity, photosensitizers concentrations and activation methods are still being developed, showing different results and susceptibilities of microorganisms to treatment . It could be concluded that pdt is presented as an important auxiliary tool to antimicrobial substances commonly used in endodontic treatment . However, this therapy presents different challenges regarding its susceptibility to different microorganisms, according to their physiology . Thus, for pdt to be employed with maximum effectiveness is important that further studies be performed in order to determine appropriate parameters for energy dosage used, photosensitizer concentration, time of preirradiation, and exposure.
|
Severe congenital neutropenia (scn) is a disorder of neutrophil production predisposed to recurrent and severe bacterial infection from early infancy . Although many genetic aberrations responsible for this condition were reported, scn largely derives from elane gene mutations which are known to be correlated with more severe neutropenia and serious clinical manifestations in scn . Although types of elane mutation largely differ among these diseases, specific mutations were associated with both scn and cn in unrelated patients and in patients with a shared haplotype by a sperm donor, but not in the same family (1, 2). We described inherited scn cases showing different disease severity with the same mutation of the elane gene in a korean family . A 17-month - old korean girl (patient 1) was admitted to the department of otolaryngology, gachon university gil medical center, with mild fever and neck swelling in january 2013 . On admission, laboratory findings were as follows: leukocytes 7,600/l (segment neutrophil 7%, lymphocyte 55%, monocyte 35%), absolute neutrophil count (anc) 532/l, hemoglobin 12.4 g / dl, platelet 459,000/l, and c - reactive protein 3.06 mg / dl . The computed tomography of her neck showed multiple enlarging lymph nodes with some necrotic changes in her left neck lymph node level ii and v involving overlying skin, subcutaneous tissues and paraspinal muscles on the left (fig . She was treated by incision and drainage under local anesthesia and by empirical antibiotics . On the 10th hospital day, she showed fever and persistent swelling on her neck, and methicillin - resistant staphylococcus aureus was isolated on the pus drained from cervical lymph node . She was born by cesarean section delivery with a birth weight of 3.38 kg at full term . She had a history of admission and operation because of peritonitis complicating perforated appendicitis with pseudomonas aeruginosa sepsis at 8-months of age . Her ancs have been lower than 500/l, and generally lower than 200/l since then . In her family history, her second elder sister (patient 2) was getting evaluations due to persistent neutropenia in our pediatric hematology clinic . Her mother (patient 3) had had severe recurrent oral ulcers until her early 20s but had not known about her neutropenia . Her eldest sister and her father had not had any oral ulcers, lymphadenitis or netropenia (fig . Patient 2, a 37-month - old korean girl, had a medical history of recurrent oral ulcers and persistent neutropenia (<200/l) and several times of hospitalization for treatment of cervical lymphadenitis, pneumonia and oral ulcers with fever . She underwent bone marrow aspiration and biopsy three days before her sister's admission (patient 1). Her anc was also low (162/l) on the day of the bone marrow examination, and serum immunoglobulin g, a, and m levels were normal, and chromosome analysis showed normal female karyotype (46, xx). Her bone marrow finding showed myeloid hypoplasia with maturation arrest at the promyelocyte stage (fig . 3). Patient 3, a 32-yr - old korean woman, had also showed neutropenia (anc 329/l). However, her stomatitis has no longer recurred after her marriage . Considering the clinical courses and hereditary patterns of the two young girls and their mother direct dna sequencing analyses of the elane gene on chromosome 19p13.3 were performed on this family . The mutational analyses demonstrated substitution of the 597th base (g to a) in intron 4 (c.597 + 1g> a) on patients 1, 2, and 3, with negative study on their father and their eldest daughter (fig . 4). Despite administration of vancomycin for 7 days to patient 1, enlarged lymph nodes and inflammatory changes around lymph nodes did not improve . From the 17th hospital day, we started administration of subcutaneous 5 - 10 g / kg / day granulocyte colony stimulating factor (g - csf). Although we gradually increased the dose of g - csf up to 25 g / kg / day, her lesion remained unchanged until excision under general anesthesia . After her discharge, she needed hospitalization twice more for 5 months due to stomatitis and severe acute otitis media, respectively . Patient 2 had three episodes of stomatitis with fever for 5 months . Despite administration of g - csf 5 - 10 g / kg, her anc was also lower than 500/l . Her mother has had no fever and oral ulcer since then . Severe congenital neutropenia (scn) refers to a variety of disorders of neutrophil production characterized by recurrent and severe bacterial infections, with anc consistently below 200/l (3). Severe bacterial infections frequently occur during the first year of life in children with scn . Omphalitis, beginning directly from birth, may be the first symptom, but otitis media, pneumonitis, infections of the upper respiratory tract, and abscesses of skin or liver are also common . Most patients suffer from frequent aphthous stomatitis and gingival hyperplasia, leading to early loss of permanent teeth . The most common pathogens causing infections in neutropenic patients are s. aureus and gram - negative bacteria . The absence of pus in scn is a characteristic feature because of the inability to form pus (4). Patient 1 in this report showed prolonged local inflammation on adjacent muscles, overlying skin and soft tissues instead of significant abscess formation as the ct finding previously demonstrated (fig . 1). Scn is a genetically heterogeneous syndrome associated with mutations of elane (ela2), hax1, gfi1, was, csf3r or g6pc3, etc . Genetic transmission may be either autosomal dominant or recessive, with many more sporadic than inherited cases reported (2). In recent studies, it is reported that 60%-80% of inherited or sporadic cases are attributable to mutations in the elane gene, which encodes neutrophil elastase (ne) (2, 3). Neutrophil elastase is a chymotryptic serine esterase synthesized early in myeloid development, during myeloblast - to - promyelocyte transition (6). One of the proposed mechanisms to accelerate apoptosis of granulocytic precursors is cytoplasmic accumulation of a nonfunctional misfolded ne protein in the endoplasmic reticulum (er), subsequent activation of the unfolded protein response, and cell death from er stress - induced apoptosis (7, 8). Therefore, bone marrow examination characteristically shows maturation arrest of neutrophil precursors at the promyelocyte / myelocyte stage of development . The elane gene is located in chromosome 19p13.3 and consists of five exons and four introns, spanning approximately 5,000 base pairs of genomic dna (9). The mutations of elane gene have been found in scn cases, but more often in cyclic neutropenia (cn) cases as well (2). Cyclic neutropenia is characterized by regular oscillations of peripheral blood neutrophils from near normal to severely low levels, generally with 21-day periodicity . While scn and cn are currently classified as two distinct diseases, some authors suggest that scn and cn represent phenotypes on a disease spectrum and cn is generally considered milder than scn (2). Although studies have suggested a relationship between individual elane mutations and disease severity, a more general genotype - phenotype correlation has not been established . Rather, some authors have reported that patients with a shared elane mutation by sperm donor had scn and cn phenotypes (2). More than 100 mutations in the elane gene have been found in scn patients (10). The mutation detected in our cases was a substitution of the 597th base (g to a) in intron 4 (c.597 + 1g> a) of the elane gene . This splice site mutation leads to deletion of val190-phe199, which is the mutation firstly reported in cn patients (11). Three patients in this report had the same mutation of the same gene in the same family but revealed different degrees of the disease severity . Patient 1 had two distinct episodes of bacterial infection including life - threatening sepsis and peritonitis despite with moderate neutropenia, while patient 2 has had only recurrent oral ulcers and cervical lymphadenitis with more severe neutropenia below 200/l . Patient 3 has not had any stomatitis, lymphadenitis or other significant infection despite with severe neutropenia since her early 20s . For treatment of scn, the severe chronic neutropenia international registry (scnir) reported that more than 95% of patients responded to g - csf treatment with an increase in ancs to 1,000/l . Most scn patients responded to a dose between 3 and 10 g / kg / day . There were some reports of korean children with scn treated with g - csf, while shim et al . Reported a scn infant with an elane mutation unresponsive to g - csf (12 - 14). For patients who do not respond to g - csf, hematopoietic stem cell transplantation is the only currently available treatment (3). In addition, approximately 20% of patients with scn develop myelodysplasia (mds) or acute myeloid leukemia (aml) (15). The risk for mds / aml was correlated with disease severity rather than with occurrence of an elane mutation (10). In recent analyses, the influence of the g - csf dose required to achieve neutrophil response (anc> 1,000/l) in the risk of developing acute myeloid leukemia (aml) has been reported . Less responsive patients, defined as those requiring greater than 8 g / kg / day of g - csf, had a cumulative incidence of mds / aml of 40% after 10 yr, compared to 11% of more responsive patients (16). Since patients 1 and 2 did not respond to g - csf, even at some high dose, we could consider stem cell transplantation as their treatment . However, because they are very young and patient 2 has had only recurrent stomatitis even with severe neutropenia near zero, we will closely follow them up . In this report, the patients revealed different clinical phenotypes from life - threatening infections to no symptoms regardless of ancs despite the same elane mutation in the family . It is suggested that the disease phenotype is not determined by the mutation alone and other factors can contribute to clinical features of patients . Further studies are needed to define the influence of genetic, epigenetic, or environmental factors.
|
Improving the effectiveness and efficiency of the informed consent process is a critical health policy issue . Informed consent is an essential element of ethical biomedical research, with federal regulatory requirements that are intended to ensure autonomy of the research participant s decision to engage in research after a balanced discussion . However, a growing body of evidence suggests that the informed consent process does not fully satisfy the needs of clinical research participants, with a recent survey finding that nearly 19% of prospective participants considered the informed consent document difficult to understand and that 15% were not satisfied that their questions had been answered during the consent process . It has been more than 20 years since the last substantive revision of federal regulations for human subjects protection, including informed consent . In 2011, the us department of health and human services issued an advance notice of proposed rulemaking with proposed reforms . Although this led some to expect that revision of human subjects protection regulations was imminent, major reform has yet to occur . Recognizing deficiencies in the current informed consent process, the clinical trials transformation initiative (ctti) launched the informed consent project . Initial project activities revealed that although an extensive body of literature on informed consent exists, there is little published information examining the observations and recommendations of experts with long - standing experience with the informed consent process . Accordingly, a ctti work group (the expert interviews team) conducted interviews and analyzed information from 25 highly experienced observers of the informed consent process who represented multiple sectors of the us clinical trial enterprise . The expert interviews team nominated interview candidates considered as having extensive knowledge of and experience with informed consent in the united states and representing a diverse set of stakeholders . Interviews were conducted by the center for information and study on clinical research participation (ciscrp) between april and june 2014 . The 1-h telephone interviews were conducted individually with each participant and followed a pre - specified interview guide designed to gather opinions on the current informed consent process, barriers to modification, and recommendations for actionable change . Transcribed interviews were analyzed for themes with the goal of identifying consensus opinions and recommendations . The project, including the interview guide, was approved by the duke university institutional review board (irb), and each participant gave verbal informed consent prior to the interview (see supplementary appendix for detailed methods and a description of the interviewees). Although all interviewees agreed that informed consent is essential to the protection of research participants, most also agreed that the informed consent process in the united states has evolved into a rigid and cumbersome process that requires serious attention and reform . From the interviewee recommendations, three major themes emerged with broad consensus: reform of the informed consent document, enhancing participant understanding of the clinical research, and modification of irb review . The most frequent recommendation for a single actionable change was reform of the informed consent document that is required for federally regulated research specifically, making it simpler, shorter, and more understandable . Interviewees observed that an unintended consequence of excessively long and complex informed consent documents is that research participants may not read or comprehend the information and simply sign the document . Half of the interviewees believed that the informed consent document was a deterrent to participation in clinical trials . Some of the proposals could be implemented within the current regulatory framework, such as using modified formatting and graphics, ensuring that documents are written at the appropriate grade and health literacy level, and explaining technical terms in clear language . However, interviewees called attention to confusion around the extent of written information that must be provided to potential research participants under federal regulations . These regulations require that informed consent documents include eight mandatory elements (basic elements of informed consent) and six additional elements, if applicable (additional elements of informed consent). Interviewees specifically raised concerns about excessively lengthy and detailed information related to the required disclosures of the procedures to be followed in the study, any benefits to the subject or to others which may reasonably be expected from the research, and any reasonably foreseeable risks or discomforts to the subjects . Interviewees found the required description of any reasonably foreseeable risks to be particularly problematic . In recent draft guidance, the us food and drug administration (fda) recommended, all possible risks do not need to be described in detail in the informed consent form, especially if it could be overwhelming for subjects to read . Information on risks that are more likely to occur and those that are serious should be included . Despite this regulatory guidance, the acceptable format and depth of how any reasonably foreseeable risks are presented to research participants may require future policy debate and potential modification of the federal regulations . The importance of reforming the document to better inform research participants and increase participation in clinical research has been identified in other national policy forums, including those conducted by the institute of medicine . In the advance notice of proposed rulemaking cited above, the federal government also identified the improvement in informed consent documents, including addressing their excessive length and legalistic language, as one of eight major objectives . The second most frequent recommendation from the interviews centered on creating a more interactive and ongoing process to enhance research participant understanding . The interviewees proposed multiple interventions that would not require national policy change and could be adapted to meet the needs of the specific study population (figure 1). Examples included improving research staff training on the conduct of an informed consent discussion, conducting the process with adequate time and in a setting conducive to participant privacy and comfort, and providing an opportunity for prospective research participants to speak with other participants as a resource for information . The interviewees also emphasized the need for integration of the patient s voice by including patients in the design of the informed consent process, including the informed consent document . Enhancing research participant understanding of a clinical trial . There was consensus regarding a lack of evidence - based information about participant decision - making in clinical research . The interviewees also identified a lack of evidence - based tools and metrics to gauge participant comprehension specific to the informed consent process for clinical research . Among many scholars in this area, brehaut et al . Conducted research that supports the notion that current informed consent documents and processes do not meet validated standards for promoting a decision - making process that allows people to make explicit choices among clearly described options . Several interviewees proposed that research participants should be tested to demonstrate a certain level of comprehension about the clinical investigation, but there was no consensus on this issue . Notably, although federal regulations generally require that a written consent document that embodies the required elements be signed by the participant or legally authorized representative, the regulations only require that the investigator shall give either the subject or the representative adequate opportunity to read it before it is signed . Thus, current federal regulations do not require evidence of comprehension, and reform in this area is likely to be controversial . A third consensus issue from the interviews was the need for modification of practices in irb review of clinical research . For example, several interviewees proposed that processes be implemented to help ensure that irbs do not require the addition of language in informed consent documents that is intended to protect institutions from liability rather than enhance research participants understanding . The most substantive recommendation was the transition to use a single irb of record for multi - site clinical trials . A related ctti project has recommended the use of a single irb of record to improve the quality and efficiency of multi - center clinical trials and is working toward addressing barriers to adoption . The national institutes of health recently developed a model of a single irb of record for multi - site translational clinical research . In the advance notice of proposed rulemaking, the department of health and human services observed that the current multiple irb review system may actually be leading to weaker protections for subjects and proposed streamlining of irb review of multi - site studies . However, a federal statutory barrier exists for the use of a single irb of record in fda - regulated multi - site medical device clinical trials, unless a local irb does not exist or its review is determined to be inadequate . The most frequent recommendation for a single actionable change was reform of the informed consent document that is required for federally regulated research specifically, making it simpler, shorter, and more understandable . Interviewees observed that an unintended consequence of excessively long and complex informed consent documents is that research participants may not read or comprehend the information and simply sign the document . Half of the interviewees believed that the informed consent document was a deterrent to participation in clinical trials . Some of the proposals could be implemented within the current regulatory framework, such as using modified formatting and graphics, ensuring that documents are written at the appropriate grade and health literacy level, and explaining technical terms in clear language . However, interviewees called attention to confusion around the extent of written information that must be provided to potential research participants under federal regulations . These regulations require that informed consent documents include eight mandatory elements (basic elements of informed consent) and six additional elements, if applicable (additional elements of informed consent). Interviewees specifically raised concerns about excessively lengthy and detailed information related to the required disclosures of the procedures to be followed in the study, any benefits to the subject or to others which may reasonably be expected from the research, and any reasonably foreseeable risks or discomforts to the subjects . Interviewees found the required description of any reasonably foreseeable risks to be particularly problematic . In recent draft guidance, the us food and drug administration (fda) recommended, all possible risks do not need to be described in detail in the informed consent form, especially if it could be overwhelming for subjects to read . Information on risks that are more likely to occur and those that are serious should be included . Despite this regulatory guidance, the acceptable format and depth of how any reasonably foreseeable risks are presented to research participants may require future policy debate and potential modification of the federal regulations . The importance of reforming the document to better inform research participants and increase participation in clinical research has been identified in other national policy forums, including those conducted by the institute of medicine . In the advance notice of proposed rulemaking cited above, the federal government also identified the improvement in informed consent documents, including addressing their excessive length and legalistic language, as one of eight major objectives . The second most frequent recommendation from the interviews centered on creating a more interactive and ongoing process to enhance research participant understanding . The interviewees proposed multiple interventions that would not require national policy change and could be adapted to meet the needs of the specific study population (figure 1). Examples included improving research staff training on the conduct of an informed consent discussion, conducting the process with adequate time and in a setting conducive to participant privacy and comfort, and providing an opportunity for prospective research participants to speak with other participants as a resource for information . The interviewees also emphasized the need for integration of the patient s voice by including patients in the design of the informed consent process, including the informed consent document . Enhancing research participant understanding of a clinical trial . There was consensus regarding a lack of evidence - based information about participant decision - making in clinical research . The interviewees also identified a lack of evidence - based tools and metrics to gauge participant comprehension specific to the informed consent process for clinical research . Among many scholars in this area, brehaut et al . Conducted research that supports the notion that current informed consent documents and processes do not meet validated standards for promoting a decision - making process that allows people to make explicit choices among clearly described options . Several interviewees proposed that research participants should be tested to demonstrate a certain level of comprehension about the clinical investigation, but there was no consensus on this issue . Notably, although federal regulations generally require that a written consent document that embodies the required elements be signed by the participant or legally authorized representative, the regulations only require that the investigator shall give either the subject or the representative adequate opportunity to read it before it is signed . Thus, current federal regulations do not require evidence of comprehension, and reform in this area is likely to be controversial . A third consensus issue from the interviews was the need for modification of practices in irb review of clinical research . For example, several interviewees proposed that processes be implemented to help ensure that irbs do not require the addition of language in informed consent documents that is intended to protect institutions from liability rather than enhance research participants understanding . The most substantive recommendation was the transition to use a single irb of record for multi - site clinical trials . A related ctti project has recommended the use of a single irb of record to improve the quality and efficiency of multi - center clinical trials and is working toward addressing barriers to adoption . The national institutes of health recently developed a model of a single irb of record for multi - site translational clinical research . In the advance notice of proposed rulemaking, the department of health and human services observed that the current multiple irb review system may actually be leading to weaker protections for subjects and proposed streamlining of irb review of multi - site studies . However, a federal statutory barrier exists for the use of a single irb of record in fda - regulated multi - site medical device clinical trials, unless a local irb does not exist or its review is determined to be inadequate . While we recognize that modifying the informed consent process is a complex policy issue, our findings from interviews of a diverse group of experts not only solidify the recognition of major problems that require reform but also provide a framework for meaningful change at both the local and national levels . Several of the recommendations proposed by interviewees with broad consensus are feasible for rapid implementation within the current regulatory framework.
|
Denture lining materials are widely used for the base of a denture to reduce pain or to improve the fit between the denture and mucous membrane.1 they act as a cushion and provide an even distribution of functional load onto the stress - bearing mucosa.2 application of a soft lining material to the dentures can also increase the patient s masticatory performance, biting force and improve the chewing rhythm.3 denture lining materials can be classified as provisional or permanent, silicone rubber or acrylic resin, and can be either chemically or heat polymerized.4 a provisional liner is the one used intraorally for up to 30 days and a long - term liner is categorized as the one that maintains its softness and elasticity for more than 30 days.5 furthermore, in a study, a long term liner was classified to be the one used for 1 year or longer.6 silicone based lining materials are basically dimethylsiloxane polymers and do not contain plasticizer to produce softening effect.7 these lining materials are hydrophobic; this reduces water sorption, but simultaneously inhibits good affinity to the supporting tissues.8 acrylic based lining materials are composed of the powder consisting of a higher methacrylate polymer (usually poly ethyl methacrylate) and a liquid of a higher methacrylate monomer (e.g. Ethyl, n - butyl), in addition a plasticizer, commonly a phythalate.9,10 when immersed in water, these materials undergo 2 processes; leaching of plasticizers and other soluble materials into water and water imbibition by the polymer . Eventually, the physical and mechanical properties of the materials change with time in the patient s mouth.9 an ideal processed denture liner should be resistant to imbibing oral fluids or releasing compounds into the saliva . High water sorption and solubility of lining material decrease mechanical properties such as hardness, transverse strength and fatigue limit . Discoloration, dimensional change and separation from a denture base can also appear because of the high values of sorption and solubility parameters.3,11 thus, sorption, solubility and discoloration properties are important to evaluate the longevity of a liner.6 denture relining materials often show changes in mechanical properties with aging.12 their longevity was evaluated by immersion in water, accelerated weather testing and thermocycling.13 - 16 the use of accelerated aging process has increased in dental researches recently.17 - 20 this process simulates the effects of long - term exposure to environmental conditions through an accelerated weathering process that involves ultraviolet light exposure, temperature and humidity changes.21 besides, previous studies have shown the effect of accelerated aging on the physical and mechanical properties of the liner materials.12,22 color stability is an important property of a denture liner to retain its color in specified environment, especially in long term use . Besides, color assessment and its reproduction is one of the most challenging aspects of dentistry.23 visual color matching is still the primary method for evaluating the color and may cause dissatisfying results.20,24 photoelectric tristimulus colorimeters have the potential to remove some of the variables found when the visual method is used exclusively and provide accurate and repeatable measurements . 25,26 color changes in the oral environment need to be investigated further in order to predict which materials will provide the best clinical service in long term use . According to ansi / ada specification no . 12, the denture liner should pass the color stability test, which requires that the specimen show no more than a slight color change after an exposure of 24 hours.27 this requirement might be difficult to achieve because most of the liners show noticeable color changes when exposed to ultraviolet light.28 hence, the purpose of this in vitro study was to compare the effect of accelerated aging on the color stability of silicone and acrylic denture liners by using a colorimeter . Two silicone and three acrylic based lining materials used in this study are listed in table 1 . Sixty disc - shaped samples, with uniform size of 10 mm diameter and 2 mm in thickness, were prepared for each lining material according to the manufacturers instructions . All of the samples were stored in distilled water (dw) at 371c for 24 hours before color measurement . Six samples from each tested liner material served as control groups and these samples were immersed in dw at 371c in a dark room for 900 hours . The remaining 6 samples from each group were subjected to accelerated aging in wheather - ometer instrument (quv accelerated weathering tester, the q - panel company 26200 first st ., sn: 92 - 7475 - 44, cleveland, ohio, usa .) And exposed to continuous ultraviolet and visible - light, at a temperature of 110f and intermittent dw spray was used for a period of 18 minutes within each 2-hours period . The manufacturer of the weathering instrument estimates that 300 hours of aging intraorally is equivalent to 1 year of clinical service.17,29 the samples were kept for 900 hours either in weathering machine or immersed in dw (equal to 3 years of service). Before and after either aging or immersion in dw, color measurements of the samples were evaluated with the colorimeter (spectrometer, gretag machbeth, sn: kh 1435, regensdolf, switzerland). Before each measurement session, the colorimeter was calibrated with its white reference tile according the manufacturer s instructions . The color change values of all samples were calculated by measuring the mean and standard deviation of e * values with the use of cielab color system.20,30 the critical remark of color change (e *) were quantified by the national bureau of standards (nbs) rates the way that a color change is evaluated by the human eye (table 2). As such, the color change values of all liner materials were multiplied by a factor of 0.92 to obtain the nbs values . 22,31 a kruskal - wallis, nonparametric one - way analysis of variance (anova) followed by a multiple comparisons test were used to analyze the k - independent group of data from this investigation . In addition, for two - independent samples comparisons mann - whitney u tests were used . The mean color measurements (l *, a *, and b *) of five liner materials recorded from the colorimeter are given in table 3 . The mean and standard deviation of color change (e *) values and their corresponding nbs values after subjecting them to dw and aging are shown in table 4 . The discoloration occurred after aging was significant when compared to the control samples stored in dw (except uh). The highest discoloration in all conditions was apparent with dl (e*aging = 16.30) (change to other color) and the least discoloration was found with up (e*dw = 0.41) (extremely slight change) after immersion in dw . After aging treatment only dl showed color change to other color (table 4). The liner materials were compared with anova and then pairwise comparisons were done by using kruskal - wallis nonparametric tests . The results of anova and pairwise comparisons indicated that there were significant differences among the materials after immersion in dw (except up and dl; mp and tr) (for dw h=25.455; p<.001) and after aging (except up and mp) (for aging h=25.974; p<.001) (table 5). The effects of treatments dependent to each material were examined by using mann - whitney u tests (tables 6 and 7). As seen in table 6, the most discoloring treatment was aging (e*dl = 16.30, p=.004) and the least discoloring treatment was dw (e*up = 0.41, p=.004). Comparisons between these two treatments showed that there were differences in samples of up, dl, mp, and tr, but indifferences in samples of uh after immersion in dw and aging . Control and aging groups were compared based on materials by using two - independent - samples mann - whitney u tests (table 7). Comparisons between these two subgroups showed that there were not differences in samples of acrylic and silicone based liner materials after immersion in dw, but differences in them after aging . The color instability of the lining materials that may affect the patient s acceptance, have often been reported in clinical studies and may lead to a clinical decision to replace the lining.32,33 even though the properties of lining materials have been much improved, they still have disadvantages including water sorption, solubility and obvious color changes.34 the best liner materials available today do not demonstrate an extended service life of more than a few years.6,22 the technology for dental color matching has changed over the past several decades . In the previous studies, colorimeter measurements have been compared with spectrophotometer readings and deemed as reliable and accurate as spectrophotometer for color difference measurements.23,35 the colorimeter used in this study is new, easy to use, portable, offers accurate measurements, the spectral range is 380730 nm and for illumination it uses d65 gas filled tungsten . Cielab color space is commonly used in perceptual studies and dental color assessment because of its uniform coverage of the color space . In this system there are three coordinates: l *, a *, b*. L * indicates lightness, which ranges from 0 (black) to 100 (white). The quantities a * and b * are chromacity coordinates that indicate color directions: positive a * corresponds to red direction, whereas negative a * indicates the green direction; positive and negative b * values correspond to yellow and blue directions, respectively.20,35,36 in the present study, a * values of the tested materials decreased (to green) either after aging or immersion in dw (except mp after immersion in dw). L * values of all the tested materials (except uh and mp) increased (to white) after immersion in dw, while these values (except dl and tr) decreased (to black) after aging . B * values of the materials (except dl after immersion in dw) increased (to yellow) both after immersion in dw and aging . The national bureau of standards (nbs) established a rating system to describe color differences by nbs units.20 e * values of this in vitro study were converted to nbs units to facilitate comparison with clinical studies . According to the nbs units; dl showed change to other color (e*dl = 16.30), while up and mp revealed marked change (e*up = 3.46, e*mp = 4.78) after aging . As a result, up showed the highest color stability after immersion in dw and aging . This property may be of advantage to its long - term serviceability in severe oral cavity environment . An accelerated aging process has been used in this study in order to simulate the oral environment . Even if the oral environment is more complex, this aging treatment is still useful for the comparison of different lining materials as the closest simulation of oral environment.17 it has been reported that water spray and visible ultraviolet light have a direct effect on the properties of liners and cause them to swell.19 the changes that may occur in polymers as a result of this process are; scission of the polymer chains by uv light, oxygen cross - linking, leaching of plasticizers and absorption of water.37 previous studies have shown the effectiveness of accelerated aging in evaluating the color stability of soft denture liners.17,22 similarly, in the current study, significant color changes were seen in all of the tested materials after aging . The clinical color stability behavior or performance of acrylic and silicone based lining materials would be different due to their different structures.38 water sorption and solubility can dramatically affect stain resistance, dimensional stability, physical and mechanical properties.6 when immersed in saliva during clinical use and may be soaked in water or cleansing agents when not in use; plasticizers and other soluble may leach out over extended periods while water is absorbed until equilibrium is reached.16 at 1 week, water sorption value should not be more than 0.8 mg / cm and the solubility should not be more than 0.04 mg / cm for different liners.27 water sorption depends on the degree of hydrophobicity and porosity of the liner.3 acrylic resin liners have high water sorption and solubility . On the other hand, silicon liners considered to be stable in aqueous environments for variable lengths of time and the hydrophobicity of them reduces water sorption.8,39 these liners might be expected to possess more stain resistant than would the acrylic materials tested . Kawano et al6 investigated the sorption and solubility of 12 soft denture liners and reported that mp had sorption values (0.230.01) less than 0.8 mg / cm after 1 year and this met the 1 week sorption requirements of ada specification 12 . In the current study, mp had low color change value after immersion in dw (e * = 1.75) and after aging (e * = 4.78). Shotwell et al22 investigated the color stability of long term soft liners after accelerated aging and showed the appreciable (marked change) nbs unit of mp (nbs unit, 3.3). Anil et al12 compared the color stability of five denture reline materials and found the lower nbs unit of mp (nbs unit, 1.94) than tr (nbs unit, 3.8) and up (nbs unit, 56.05). However, up was the most color stable liner material in this study (nbs unit, 3.18) and tr showed extremely marked change (nbs unit, 11.96) after aging . The differences in color measurements of these two studies might be explained by the variations in the properties of the instruments used . This effect should be kept in mind while comparing the results of the researches about the color stability . In the present study, acrylic and silicone based liners exhibited significantly different color change values after aging . Silicone based liners (up, mp) seemed to be more resistant to staining than acrylic based liners (uh, tr, dl). Furthermore, comparing acrylic based liners, uh showed marked change than the other acrylic based liners (tr, dl) after immersion in dw . This might lead us to associate this result with the chemical composition of uh, porosity formed by the air inclusions during mixing powder and liquid, surface roughness and water absorption . 34 residual monomer is a well - known plasticizer which remains in polymerized resin as free or unreacted monomer and it affects physical and mechanical properties of acrylics.40 according to the previous research by urban et al,40,41 comparisons between the residual monomer in hard acrylic relining resins (dl, tr, uh, kooliner) and heat - polymerized denture base resin (lucitone 550) in 55c water bath resulted in an arrangement as kooliner (1.52%)> dl (0.85%)> uh (0.45%)> lucitone 550 (0.24%)> tr (0.14%). In the present study, dl showed poor color stability after aging (e*=16.30). This result might be related to the amount of leaching residual monomer with color stability . Several studies have been done about the color measurements by using colorimeters21,22 and usually these studies have been compared directly . The present results cannot be compared directly with previous studies because of the variations in the instruments used, sample sizes and conditioning of the samples . Although the system of color change is not known exactly, it could be guessed by investigating how aging changes the physical and mechanical properties of denture liners.17,19 test conditions used for in vitro studies do not subject the materials to the aqueous environment, microorganisms, abrasion, thermocycling, material thickness and cyclic loading . The properties of liner materials in the clinical situations still differ from laboratory testing.42 there also seems to be a need for extra researches to understand the effect of aging on color change mechanism . The measurements showed that up and mp are clinically reliable denture liner materials . From a clinical aspect, for long - term clinical serviceability, it seems reasonable to recommend the use of silicone based instead of acrylic based liner materials.
|
Respiration is the exchange of blood and oxygen via the lungs, which are the essential part of the ventilation system1 . The major inspiratory muscles that engage during inspiration are the diaphragm and external intercostal muscles . Meanwhile, the accessory inspiratory muscles that engage spine movement are the sternocleidomastoid, scalene, trapezius, and serratus anterior muscles2 . Among the methods for improving respiratory function, inspiratory muscle training improves the strength and endurance of the diaphragm and accessory inspiratory muscles3 . Moreover, it improves ventilation function even when the inspiratory muscles are damaged by neurological or non - neurological lesions4 . Self - stretching of the inspiratory muscles not only improves pulmonary function, but can also increase joint mobility in the thoracic cage, further improving respiratory function5 . Although the self - stretching of accessory inspiratory muscles improves respiratory function, most previous studies involve interventions targeting respiratory muscles or exercises for thoracic cage mobility6 . Furthermore, few studies have investigated the effects of cervical muscle (i.e., accessory inspiratory muscle) stretching on the respiratory function . Therefore, this study examined the effects of cervical muscle self - stretching on pulmonary function, especially slow vital capacity . The study sample consisted of 30 subjects (10 males and 20 females) who were studying at a university in busan, korea . All subjects were informed of the purpose and methods of the study beforehand and voluntarily agreed to participate . This study complied with the ethical standards of the declaration of helsinki, and written informed consent was obtained from all subjects . The inclusion criteria were as follows: no lung disease, history of respiratory dysfunction, or cervical injury; ability to perform cervical stretching without difficulty; no experience with any exercise program aiming to promote pulmonary function; and agreement to not take any drugs or perform other exercise during the study period . The subjects were randomly divided into 2 groups of 15 each: the experimental group performed stretching, while the control group received no treatment . For the stretching program, the muscle was stretched slowly and gently without pain, and each posture was held for 30 seconds . The stretching was performed twice per day, 4 times per week for 4 weeks . The main self - stretching exercise consisted of 4 types of muscle exercises targeting the sternocleidomastoid, upper trapezius, scalene, and levator scapulae muscles were performed 3 times for 30 seconds each . Cervical flexion and rotation were performed again as a cool - down exercise . Meanwhile, the control group did not perform the stretching program and was merely revaluated after 4 weeks . Before measuring slow vital capacity, the subject breathed normally 4 times; the machine subsequently beeped, and the subject inhaled slowly as much as possible . The items of slow vital capacity include expiratory vital capacity (evc), expiratory reserve volume (erv), inspiratory reserve volume (irv), expiratory minute ventilation (ve), and inspiratory capacity (ic). The wilcoxon signed - rank test was used to examine the effects of cervical muscle self - stretching on pulmonary function . The changes of pulmonary function were determined by subtracting the data after self - stretching from those before self - stretching . Furthermore, the mann - whitney u - test was used to analyze differences between groups . In the experimental group, evc increased significantly from 2.71 to 3.18 after self - stretching (p <0.05). Ve decreased from 8.25 to 8.08 after self - stretching, but the difference was not significant (p> 0.05). Although ic increased from 1.74 to 1.85, the difference was not significant (p> 0.05) (table 1table 1.pulmonary function changes in the experimental grouppre - exercisepost - exercisemean rankrank sumslow vital capacityevc (l)*2.71 0.683.18 0.5510.0010.007.86110.00erv (l)*0.98 0.421.41 0.461.001.008.50119.00irv (l)*1.31 0.341.64 0.672.678.009.33112.00ve (l / min)8.25 4.118.08 3.887.8863.008.1457.00ic (l)1.74 data are mean sd, * p <0.05 meanwhile, in the control group vc decreased significantly from 3.15 to 2.99 (p <0.05). Erv decreased from 1.15 to 1.05, although the difference was not significant (p> 0.05). Ve increased from 9.12 to 9.38, but the difference was not significant (p> 0.05). Ic decreased significantly from 2.03 to 1.88 (p <0.05) (table 2table 2.pulmonary function changes in the control grouppre - exercisepost - exercisemean rankrank sumslow vital capacityevc (l)*3.15 0.812.99 0.828.58103.005.6717.00erv (l)1.15 0.341.05 0.288.8088.006.4032.00irv (l)*1.50 0.511.29 0.488.69113.003.507.00ve (l / min)9.12 3.129.38 2.568.0056.008.0064.00ic (l)*2.03 0.601.88 data are mean sd, * p <0.05 comparison of the changes in pulmonary function between groups showed evc, erv, irv, and ic were significantly higher in the experimental group (p <0.05). Ve was lower in the experimental group than the control group, although the difference was not significant (p> 0.05) (table 3table 3.comparison of pulmonary function between groupsgroupvaluesmean rankrank sumslow vital capacityevc (l)*experimental0.47 0.4821.67325.00control0.16 0.219.33140.00erv (l)*experimental0.43 0.3721.80327.00control0.10 0.189.20138.00irv (l)*experimental0.33 0.6522.20333.00control0.21 0.188.80132.00ve (l / min)experimental0.18 1.9614.97224.50control0.26 2.3316.03240.50ic (l)*experimental0.12 thus, improving thoracic cage movement and respiratory muscle strengthening can improve pulmonary function . Kim7 found that lumbar stabilization movement and trunk muscle stretching significantly increase vc, fvc, and mvv . Meanwhile, choi and oh8 report that chest mobilization exercise improves the pulmonary functions of stroke patients . These studies demonstrate that it is vital to promote thoracic cage mobility in order to improve pulmonary function . Joint mobilization and stretching are effective interventions for this purpose . However, previous studies only investigated the effects of interventions targeting the respiratory muscles (e.g., intercostal muscles and diaphragm) on pulmonary function . On the other hand, although thoracic cage movement is known to be affected by cervical muscles, studies about the effects of interventions targeting the cervical muscles on pulmonary function are insufficient . Hence, the present study determined if self - stretching of the accessory inspiratory muscles can improve pulmonary function . The self - stretching program targeted the sternocleidomastoid, upper trapezius, scalene, and levator scapulae muscles . The origins of the sternocleidomastoid are the clavicle and sternum, and its insertion is the mastoid process of the temporal bone and superior nuchal line9 . The upper trapezius originates from the occipital bone and inserts at the clavicle, acromion, and scapular spine10 . The scalenes originate from the second to seventh transverse process and the costal process of the cervical vertebra and insert at the first and second ribs11 . The levator scapulae originate from the first to fourth transverse process of the cervical vertebra and insert at the scapular superior angle12 . As these 4 muscles are not only involved in cervical movements, but also thoracic cage movement, we hypothesized thoracic cage movement would increase after self - stretching, thus improving pulmonary function . Indeed, self - stretching improved evc, erv, and irv . These findings are very similar to those of han et al.13, who found that stretching and strengthening exercises targeting the cervical muscles improved pulmonary function in 18 patients with allergic rhinitis patients . Han et al.13 also report that the cervical muscle intervention improved thoracic cage movement, which consequently improved pulmonary function . This phenomenon also explains the results of the present study . In other words, self - stretching of the accessory inspiratory muscles improved chest muscle length and thus improved pulmonary function . In conclusion, self - stretching of the accessory inspiratory muscles should be included in intervention programs aiming to strengthen pulmonary function.
|
Perceptual learning involves relatively long - lasting changes to organism's perceptual systems that improve its ability to respond to its environment . In an experimental setting, this generally translates to an improvement in performance on a perceptual task with training . One of the defining characteristics of perceptual learning is its specificity to the physical parameters of the stimuli used for training . For instance, when learning to discriminate between different directions of motion, the improvement does not fully generalize to other directions of motion the subjects were not trained on . Similarly, listeners who are trained to discriminate between different pitch sensation - inducing amplitude modulated noises showed no more improvement than untrained listeners at discrimination between pure tones or noise bursts with different amplitude modulation rates . Perceptual learning also leads to marked cortical plasticity within sensory cortex showing a similar level of specificity (see). One well - known example in the animal auditory system is the finding of spatially enlarged frequency representations that are specific to tone frequencies that owl monkeys were trained to discriminate . Similarly, within the visual system, orientation discrimination training has been shown to produce sharper tuning curves in v1 neurons, but again only for the trained orientations . A growing body of evidence has suggested that perceptual learning and its associated cortical plasticity can also be boosted by neuromodulation . The cholinergic system in particular, which uses acetylcholine (ach) as a neurotransmitter, has been shown to be a potent neuromodulatory system that plays critical roles in cortical plasticity, attention, and learning . Indeed, neurochemically boosting cholinergic transmission [911] and stimulating the basal forebrain from which the cholinergic neurons project to the cortex [1214] have both been shown to have a significant effect on both learning and the cortical processing of stimuli . Consequently, the activation of the cholinergic system during perceptual training leads to a long - lasting shaping of cortical circuits that forms the basis of learning . The cholinergic system is also known to undergo significant changes with aging . For instance, the basal cholinergic cells tend to degenerate with advancing age [15, 16], which in turn has been shown to affect afferent cortical projections [17, 18]. These age - related changes have often been thought to contribute to the attentional and cognitive deficits observed during aging [19, 20]. Consequently, it has been hypothesized that boosting brain function through cholinergic enhancement during rehabilitation paradigms might help individuals with cognitive or sensory deficits related to aging with the hope of not only recovering sensory abilities, but also promoting brain plasticity . Indeed, the pharmacological potentiation of cholinergic neurotransmission has been shown to improve performance on cognitive tasks in the elderly [2123] and chronic treatment with drugs that enhance cholinergic function has been used to ameliorate cognitive dysfunction [24, 25]. What remains particularly unclear at this point is whether this potentiation effect is modulated by age, and if so in what manner? While it is already established that young and old individuals learn sensory tasks at different rates [2629], it remains to be determined whether cholinergic potentiation will provide similar behavioral gains for both age groups . Furthermore, it is equally unclear whether enhancing cholinergic transmission in both age groups will differentially affect cortical sensory representations . Consequently, the purpose of the present study was to investigate the potentially differential effect of a cholinesterase inhibitor (rivastigmine tartrate) on both brain function and behavior in young and old adult rats . Cholinesterase inhibitors are a class of drugs that raise the level of ach in the brain by inhibiting the activity of the cholinesterase enzyme that metabolizes ach, thus providing a potent cholinergic enhancement by increasing both the level and duration of the neurotransmitter action . Here, we used the rat primary auditory cortex (a1) as it has repeatedly proven to be an excellent model to study brain plasticity where perceptual learning is often reflected in the training - specific refinement of auditory cortical representations in both young and aging brains [29, 31, 32]. We hypothesize that while both cholinergic - boosted age groups compared to controls treated with saline placebo will show increased learning rates when performing a two - tone discrimination task, the improvement might be greater in the older rats given the greater room for improvement . Similarly, we expect that the neural representations of auditory cortical neurons in the older rats will show more plastic training - induced changes and that these same neurons will display young - adult functional properties to a greater extent following training (see). All experimental procedures used in this study were approved by the montreal neurological institute animal care committee and follow the guidelines of the canadian council on animal care . Eighteen old (o: 2430 months) and nineteen young (y: 1214 months) brown - norway rats were used for this study . Within each age group, rats were divided into one of three groups: untrained (y - ut (n = 8) and o - ut (n = 8)), trained while being orally given rivastigmine tartrate (y - tr (n = 6) and o - tr (n = 4)), and trained in combination with saline administration (y - ts (n = 4) and o - ts (n = 5)). All rats had unrestrained access to water and were housed in an environment with a 12-hour light / dark cycle . Rats were trained to make a nose poke response to obtain a food reward . During the second phase, rats were trained to make a nose poke only after presentation of an auditory stimulus . During the third phase, the actual training program, rats were trained to make a nose poke only for the target stimulus (a 5 khz pure tone) and not for a foil nontarget stimulus (10 khz pure tone). The tones were presented at 60 db spl, stimulus presentation was randomized, and the probability of a target stimulus presentation was set at 20% . Training was performed in an acoustically transparent operant training chamber (60 45 35 cm, length width height) contained within a sound - attenuated chamber . Sound presentation and response recording were performed using the openex software and rz6 auditory processing hardware from tdt (tucker - davis technology, alachua, fl) and delivered in a free field manner through a calibrated loudspeaker . The intertrial interval was selected at random from a range of 4 to 6 s. a rat's behavioral state at any point in time was classified as either go (producing a nose poke behavior) or no - go . For a given trial, the rat could elicit one of four reinforcements produced by the combinations of responses (go or no - go) and stimulus properties (target or nontarget). Go responses within 5 s of a target were scored as a hit; a failure to respond within this time window was scored as a miss; a go response within 5 s of a nontarget stimulus was scored as a false positive; the absence of a response was scored as a withhold . Period during which time the house lights were turned off and no stimuli were presented . Psychometric functions and stimulus target recognition indexes (d - prime) were calculated for each training session by plotting the percentage of go responses as a function of the total number of target stimuli (i.e., hit ratio) and the percentage of false positives as a function of the total number of foils (i.e., false positive ratio). Learning curves were reconstructed by plotting the d - prime measure reached over successive days of training . Thirty minutes prior to each training session, rats were orally given either a 0.2 mg / kg dosage of the cholinesterase inhibitor rivastigmine tartrate (y - tr and o - tr groups) or an equal quantity of saline (y - ts and o - ts groups). The specific timing of the administration of the drug was selected so that the entire training session was completed by the elimination half - life time of the drug (1.5 hrs). The duration of each behavioral training session lasted one hour and all animals were trained five days per week . All behaviorally trained animals had completed between 9 and 12 training sessions (phase 3) prior to undergoing electrophysiological recordings . The average number of training sessions did not differ between groups (y - tr: 11.5 0.55, y - ts: 11.75 0.5; o - tr: 11.75 0.5, o - ts: 11 1.41; f = 0.789, p = 0.518). For a1 mapping, the rats were premedicated with dexamethasone (0.2 mg / kg) to minimize brain edema . They were then anesthetized with ketamine / xylazine / acepromazine (65/13/1.5 mg / kg, i.p .) Followed by a continuous delivery of isoflurane 1% in oxygen delivered via tracheostomy intubation (after a tracheotomy was performed) and mechanical ventilation . Vital signs were continuously recorded using a mouseox device (starr life sciences, holliston, massachusetts). Body temperature was monitored with a rectal probe and maintained at approximately 37c with a homeothermic blanket system . The rats were placed in a custom designed head holder, holding the rat by the orbits, leaving the ears unobstructed . The right temporalis muscle was reflected, auditory cortex was exposed via craniotomy, and the dura was resected . Cortical responses were recorded with 64-channel tungsten microelectrode arrays (tdt, alachua, fl). The microelectrode array was positioned above auditory cortex and was lowered orthogonally into the cortex to a depth of approximately 500650 m (layers 4/5), where vigorous stimulus - driven responses were obtained . The extracellular neural action potentials were amplified, filtered (0.35 khz), and monitored on - line . A combination of multi- and single - unit activities was used to reconstruct characteristic frequency maps . For response bandwidths 20 db above threshold (bw20), spike sorting was performed with an automated algorithm using principal component analysis (opensorter; tucker - davis technology, alachua, fl). Acoustic stimuli were generated using tdt system iii (tucker - davis technology, alachua, fl) and delivered in a free field manner to the right ear through a calibrated speaker (tdt). A software package (openex; tucker - davis technology, alachua, fl) was used to generate acoustic stimuli, monitor cortical response properties on - line, and store data for off - line analysis . The evoked spikes of a single neuron or a small cluster of neurons were collected at each site in the hemisphere (left) contralateral to the stimulated ear . Frequency - intensity receptive fields (rf) were reconstructed by presenting pure tones of 63 frequencies (148 khz; 0.1 octave increments; 25 ms duration; 5 ms ramps) at eight sound intensities (070 db spl in 10 db increments) at a rate of one tone per second . The characteristic frequency (cf) of a cortical site was defined as the frequency at the tip of the v - shaped tuning curve . For flat - peaked tuning curves, for tuning curves with multiple peaks, the cf was defined as the frequency at the most sensitive tip (i.e., with lowest threshold). Response bandwidths 20 db above the threshold of tuning curves (bw20) were measured for all sites . The cf, threshold, and bw20 were determined using an automated routine developed in the matlab environment (the mathworks inc ., natick, ma). Primary auditory cortex (a1) was identified based on its rostral - to - caudal tonotopy, reliable short - latency tone - evoked neuronal responses, and relatively sharp v - shaped rf . To generate a1 maps, voronoi tessellation (a matlab routine; the mathworks inc .) Each polygon was assigned the characteristics (i.e., cf) of the corresponding penetration site . In this way, every point on the surface of the auditory cortex was linked to the characteristics experimentally derived from its closest sampled cortical site . The boundaries of the primary auditory cortex were functionally determined using the following criteria: (1) primary auditory neurons generally have a continuous, single - peaked, v - shaped receptive field and (2) cfs of the a1 neurons are tonotopically organized with high frequencies represented rostrally and low frequencies represented caudally . To test how the mean firing rates of each neuron were modulated by the target and nontarget test stimuli, signal - detection theory was applied to generate receiver operating characteristic (roc) curves . For each a1, two distributions of average neuronal firing rates were constructed . One distribution contained the average firing rate from each a1 neuron during the presentation of the target stimulus and the other contained the same information but for the nontarget stimulus . The area under this curve represented the probability that an ideal observer could differentiate between the two distributions . An roc value of 0.5 indicates that the two distributions overlap completely and that an ideal observer can only differentiate between these distributions by chance . An roc value of 1.0 indicates that the two distributions do not overlap and that an ideal observer can perfectly differentiate between the firing rates elicited by the target and nontarget stimulus . Following electrophysiological recordings, all rats received a high dose of ketamine / xylazine / acepromazine (130/26/3 mg / kg, i.p .) And were perfused intracardially with phosphate buffered saline (ph 7.4, pbs) followed by paraformaldehyde (4%) in 0.1 m pbs . Their brains were removed from the skulls, postfixed in the same fixative overnight, transferred to a 30% sucrose solution, snap - frozen, and stored at 80c until sectioning . Fixed material was sectioned on a freezing microtome at a 40 m thickness in the coronal plane along the tonotopic axis of a1 . The cortical borders were defined according to the cell size, density, and depth as in: layer i (0175 m), layers ii - iii (175500 m), layer iv (500700 m), and layers v - vi (7001200 m). Brain slices were treated with pbs 0.1 m 3 5 min followed by a mixture of gelatine (2%) and triton x-100 (0.25%) in pbs (pbs - gt) for 4 10 min, transferred into primary antibody solution containing pbs - gt, and incubated overnight . After incubation, the sections were washed in blocking buffer pbs - gt and incubated for one hour in dilutions of secondary antibody conjugated with different fluorophores . All primary and secondary antibodies used (see below) were tested for optimal conditions for single and double labeling . We used the following antibodies to label the brain tissue: (1) rabbit anti - som (peninsula laboratories #t-4103, 1: 2000), (2) goat anti - chat (chemicon #ab144p, 1: 200), (3) donkey anti - goat (conjugated to alexa fluor (af647), 1: 800, jackson immunoresearch, west grove, pa), and (4) donkey anti - rabbit (af488, 1: 800, jackson). Stained sections were mounted on 1% gelatin - coated slides, air - dried, and cover - slipped with mowiol solution (tris 0.2 m, 30% glycerol, and 12% mowiol). Brain tissue was immunostained in pairs to limit variability related to antibody fixation, incubation time, and postsectioning condition of tissues . A zeiss lsm 510 meta confocal microscope equipped with filter for green cy2/af488, red cy3, and infrared cy5/af647 was used to assess fluorescence in the immunostained sections . To locate a1 in nonfunctionally mapped animals, we used the stereotaxic coordinates (paxinos): interaural between 5.76 and 2.16 mm and bregma between 3.24 and 6.84 mm (see the above section on determination of a1 borders). To quantify the positive cells, 21 digital images of a1 cortical sections were taken with a 40x objective (zeiss lsm 510) at random locations within each a1 of each hemisphere for each animal . All quantifications were assessed in 400500 m wide a1 sectors (the approximate width of a1 on coronal sections) per hemisphere extending from layer 1 to the underlying white matter . Confocal images were thresholded and adjusted for brightness to maximize the dynamic range of each channel using imagej (http://rsb.info.nih.gov/ij/) and adobe photoshop cs5 (adobe, san jose, ca). We determined the number of immune - labeled cells in each section of a1 using the optical dissector method (stereo investigator software, mbf bioscience, williston, vt) to avoid biased sampling . These counts were then pooled and adjusted to reflect what would have been counted in the whole 40x field . Data were then recorded as an averaged value per high power field (hpf) for each animal and group . All cells displaying labeling above background levels were counted, regardless of their staining intensity . Unless specified otherwise, statistical significance was assessed using unpaired two - tailed t - tests . To first confirm the effect of aging on the cholinergic system, we compared the density of choline acetyl transferase (chat) staining obtained from both young and old nave untrained rats (see figure 1). We found that the chat density was significantly reduced in older rats compared to young ones (t = 3.23, p = 0.002), consistent with the finding of degenerating cholinergic cells in the basal forebrain of the aging brain [15, 16] and in afferent cortical projections [17, 18]. We next investigated the effect of aging on a correlate of cholinergic activity: the gamma power obtained from local field potential (lfp) signals during the presentation of tone pips of various frequencies and intensities . In good agreement with the previous result, we found a significant reduction in gamma () power (3060 hz) in older rats (t = 9.30, p <0.001) that was accompanied by a significant increase in theta () power (312 hz) (t = 2.60, p = 0.009; also see figure 1). This is consistent with previous reports showing that an increase of cholinergic activity is associated with a decrease of theta power and an increase in gamma power within rat auditory cortex [38, 39]. Overall, we found that aging is associated with a reduction in chat density and with an increase in the theta / gamma power ratio within auditory cortex . The performance of both young and old rats improved steadily over 9 to 12 one - hour sessions (see figure 2). The administration of the cholinesterase inhibitor rivastigmine tartrate had a significant effect on the learning rates of both young (t = 7.04, p = 0.03) and old rats (t = 10.61, p = 0.01) by reducing the amount of sessions required to reach a criterion of d - prime> 1, usually considered a marker of successful discrimination between target and nontarget stimuli . While both age groups showed overall improvement in the task, the specific manner in which they did so differed . Cholinergic enhancement in the young rats led to a significant increase in the hit rate (hr) (t = 4.91, p = 0.05) without affecting the average false positive rate (fpr) (t = 1.04, p = 0.34). In marked contrast, cholinergic enhancement in the older rats had the opposite effect where the fpr was significantly reduced compared to saline treated animals (t = 16.70, p = 0.005) without affecting the average hit ratio (t = 0.39, p = 0.55). The effect of rivastigmine on the fpr in older rats seemed to be stronger at the onset of training and during the initial learning phase more so than once the task was learned, as evidenced by the significant difference between groups for the first four sessions pooled together (p = 0.03) and for the middle four sessions (p <0.001), and by the absence of a significant difference for the last four sessions (p = 0.14). To summarize, rivastigmine improved the learning rates in both age groups, but it did so in different manners for each group . In the young group, it improved the detection of the target stimulus, whereas it reduced responses to the nontarget in the old group . Rats in the experimental groups were all trained to discriminate between a target tone (5 khz) and a nontarget (10 khz) tone . To examine the effects of training and cholinergic enhancement on the cortical representation of each frequency, we first compared the number of a1 neurons whose characteristic frequency (cf) was within 0.3 octaves of either the target or the nontarget frequency (see figure 3(a)). Compared to young untrained rats, both trained young groups showed an increase in the number of neurons with a target cf (y - ts (trained with saline): 16.4% increase in the proportion of neurons responding to the tone, p = 0.004; y - tr (trained with rivastigmine): 21.7% increase, p = 0.003) while showing a decrease in the number of neurons with the nontarget cf (y - ts (10.6% decrease, p = 0.02), y - tr (8.4% decrease, p = 0.04)). Both old trained groups showed an increase in the number of neurons with a target cf compared to the untrained group (o - ts (12.7% increase, p = 0.02), o - tr (18.8% increase, p = 0.01)). However, while the o - tr group showed a decrease in the number of neurons with a nontarget cf (9.7% decrease, p = 0.02), the o - ts group showed an increase (10.5% increase, p = 0.04). We next investigated the percentage of a1 that was activated by every frequency - intensity combination used for mapping (see figures 3(c)3(e)). When directly comparing the rivastigmine and saline old groups, we observed a significant increase in the percentage of a1 responding to frequencies between 8.04 and 16.2 khz for sound intensities between 10 and 70 db spl (8% to 27% difference, 0.04 <p <0.008, with bonferroni correction) combined with a significant decrease for frequencies between 18.6 and 30.3 khz for sound intensities between 10 and 70 db spl (10% to 30% difference, 0.03 <p <0.01, with bonferroni correction). The same comparison in the young only revealed a small reduction in the percentage of neurons responding to frequencies between 1.6 and 2.1 khz at a sound intensity of 70 db for the rivastigmine group (6% decrease, p = 0.04, with bonferroni correction). Overall, training alone increased the ratio of neurons having a cf corresponding to the target frequency compared to the nontarget frequency in the young rats, whereas it only increased the neural representation of the target frequency in the older rats . The administration of rivastigmine was sufficient to reduce the neural representation of the nontarget frequency in the old rats . We next investigated the proportion of a1 that responded to 60 db tones for either the target frequency, the nontarget frequency, or both of them, regardless of the cf . Figures 4(a)4(c) illustrate the overlap in a1 area that was responsive to both tones and how training and the administration of rivastigmine tended to reduce the overlap area and increase the area that responded to neither of the training tones . In the young, both training alone (p = 0.04) and training with rivastigmine (p = 0.008) significantly reduced the area of overlap compared to untrained animals, while significantly increasing the map area not responsive to either of the training tones (y - ts: p = 0.05; y - tr: p = 0.05). The reduction of overlap area was equally observed in the older groups (o - ts: 0.04; o - tr: p <0.001), whereas the increase in area not responsive to training tones was only significant in the rivastigmine group (o - ts: p> 0.2; o - tr: p = 0.02). To further investigate the ability of a1 to discriminate between both tones, we performed receiver operating characteristic (roc) analyses that allowed us to characterize the performance of a binary classifier system . More precisely, the area under the roc curve quantifies the overall ability of a1 to discriminate between both tones (presented at 60 db). Compared to the untrained groups (see figure 4(d)), all trained groups showed an increase in the area under the roc curve (y - ut versus y - ts: p = 0.05, y - ut versus y - tr: p = 0.04, o - ut versus o - ts: p = 0.004, and o - ut versus o - tr: p = 0.05; anova with post hoc tukey tests) that corresponded with enhanced discriminability between the training tones . No differences were found between old and young rats of the same training / ach condition . In contrast, when comparing the discriminability between the nontarget tone and an untrained tone (10 khz and 20 khz), training caused a reduction in the area under the curve for the o - ts group compared to the o - tr, y - tr, y - ts, and y - ut groups (all p> 0.05) and also for the o - ut group compared to the y - ut group (p> 0.05), suggesting that for all other trained groups the training did not alter the ability of a1 to discriminate between the nontarget frequency and a distinct untrained frequency . Finally, to relate the behavioral performance of the trained rats with a1's ability to discriminate between the target and the nontarget, we correlated the individual roc area under the curve values (using the 5 and 10 khz tones) with the maximal performance achieved by each animal (maximal d - prime value measured over the course of the training). When all groups were pooled together, the area under the roc curve explained 54% of the variance found in the maximal performance reached by the trained animals (see figure 4(e)). Importantly, we found that the relationship between both variables appeared to be consistent across all groups (i.e., all followed a similar trend line) and that, regardless of group membership, the better the discriminability of a1 neurons' firing rates, the better the behavioral performance . In addition to changes at the level of the tonotopic map (in terms of both cf and frequency - response patterns at 60 db), training was found to have significant effects on the tuning bandwidths of a1 neurons (by comparing the response bandwidth at 20 db above threshold (bw20); see figure 5). In young rats, training both with and without rivastigmine led to a widening of the tuning bandwidth of neurons with a cf corresponding to the target frequency (y - ts: p = 0.02; y - tr: p = 0.03) in combination with a narrowing of the tuning bandwidth for the nontarget frequency (y - ts: p = 0.03; y - tr: p = 0.02). In old rats, however, training was not sufficient to significantly alter the tuning bandwidth of neurons with a cf corresponding to the target frequency (o - ts: p = 0.26; o - tr: p = 0.1), whereas only training with rivastigmine narrowed the tuning bandwidth of neurons with a cf corresponding to the nontarget (o - ts: p = 0.69; o - tr: p = 0.03). Finally, both training and the administration of rivastigmine did not have an effect on the auditory thresholds required to evoke a cortical response in either the young or the aged rats . It should also be noted that there was no significant difference in cortical thresholds between younger and older groups (p> 0.2). Somatostatin positive (som+) cells, a class of gabaergic interneurons, are the primary target of cortical cholinergic projections and play an important role in the neuromodulation of sensory processing and learning [4043]. For this reason, we performed quantitative analysis of the average number of som immunoreactive cells per a1 high power field (hpf) performed for all experimental groups (see figure 6). In the young, while training alone did not have an effect on som+ cell count (p = 0.1), training with rivastigmine significantly increased the number of som+ cells compared to the untrained group (p = 0.01) and the y - ts group (p = 0.005). In the old rats, not only did both trained groups show an increase in the number of som+ cells (o - ts: p <0.001; o - tr: p <0.001), but also those having received rivastigmine had an even greater number of som+ cells than the other trained group (p = 0.006). The purpose of the present study was to investigate the effect of a cholinesterase inhibitor (rivastigmine tartrate) on both brain function and behavior and how these effects might differ in young and old rats given the important cholinergic deficit observed in older rats (see figure 1). While it is clearly established that cholinergic enhancement boosts perceptual learning in young adults, little is known about whether boosting a deficient cholinergic system in the elderly would help reduce the gap that exists between young and aged adults in terms of their perceptual learning rates . Furthermore, we also wanted to document how cholinergic enhancement differentially affects the expression of auditory cortical plasticity mechanisms associated with perceptual learning in both young and older adults . Behaviorally, the administration of rivastigmine 30 minutes prior to each training session significantly improved the performance of both young and old adult rats compared to control groups of the same age who were only given a saline solution (see figure 2). However, the means by which both age groups improved differed . In the young rats, boosting the cholinergic system significantly improved their overall hit rate (correct detection of target stimulus), which led to better discrimination performance . In the old rats, while cholinergic enhancement had little effect on the hit rate, it significantly reduced the false positive rate (incorrectly responding to the nontarget stimulus), which led to a similar improvement in discrimination performance to that observed in the young adults . This reduction was particularly evident during the middle four training sessions when those having received rivastigmine showed a significant jump in performance (as indicated by the d - prime measure). Aging is associated with deficits in the ability to suppress task - irrelevant distracting information in combination with the inability to sustain focus on goal - relevant target information, which disrupts the successful accomplishment of task - relevant goals [44, 45]. While previous work has shown that operant behavioral auditory training paradigms significantly reduce the false positive rate in aged adult rats, the present findings indicate that directly acting on the cholinergic system further accentuates the drop in false positives . The increase in performance in both young and aged rats further supports previous findings that have shown that ach can improve stimulus discrimination [13, 46, 47], whereas the finding of a reduction of false positives in the aged rats supports the literature demonstrating the fundamental role played by ach in attentional mechanisms of cognitive control [48, 49]. Both behavioral training and the daily administration of rivastigmine behavioral training alone led to an overrepresentation of the target tone and an underrepresentation of the nontarget tone in the primary auditory cortex of young adult rats, whereas it led to an overrepresentation of both tones in the aged rat (see figure 3). The addition of rivastigmine produced similar effects to training alone in the young rats (while producing a 5.3% increase of the representation of the target tone compared to the training alone), whereas it significantly reduced the representation of the nontarget tone in a1 of the aged rats compared to both the untrained and the trained a1 . The increase in the representation of a behaviorally relevant auditory target stimulus is a plasticity mechanism that is directly linked to perceptual learning and is consistent with several previous reports [6, 33, 50]. The further increase in representation in the young rats following cholinergic enhancement is, at least in part, likely responsible for their significant increase in the correct detection of the target stimuli . The underrepresentation of the nontarget is consistent with previous reports and likely constitutes a processing strategy that aids in ignoring the nonrelevant stimuli . Moreover, the fact that behavioral training alone was not sufficient to produce this underrepresentation in the elderly rats suggests that the cholinergic system is necessary for the development of this specific plasticity mechanism within a1 and further supports the notion that the cholinergic system plays a key role in our ability to inhibit the processing of and ignore nonrelevant stimuli [5254]. Furthermore, not only did training alone in the old rats prevent an underrepresentation of the nontarget tone, but also it in fact led to an overrepresentation of it . This overrepresentation likely explains the higher false positive rate observed in this group and is consistent with previous findings showing that while behavioral training in old rats improves many aspects of auditory processing, it has limited success in improving distractor processing . Auditory training and cholinergic enhancement also had a significant effect on two other measures of auditory cortical processing . The first relates to the area size of a1 that responds to both the target and the nontarget tone when presented at a moderately high intensity (60 db). In untrained rats, slightly more than half of a1 was responsive to both tones at 60 db in the young whereas the same could be said for just over two - thirds of a1 in the older rats . However, auditory training produced a dramatic reduction in the overlapping area (by 30% in the young and 36% in the old), and this reduction was further increased by the administration of rivastigmine (by another 30% in the young and 37% in the old). In the younger groups, this reduction in overlap area was also accompanied by a significant increase in the map area not responding to both training tones likely due to the reduction in a1 area responsive to the nontarget . This effect was not observed in the older training group that received saline in which only a relatively small fraction (18%) of a1 remained responsive to nontraining tones after training . The combination of training and cholinergic enhancement in the end reduced the overlapping area (i.e., that is responsive to both tones) to 26% in the old rats and to 21% in the young rats . This suggests that when combined with operant training paradigms, the administration of rivastigmine leads to substantial plastic changes within a1 where the areas that are responsive to either tone become better segregated . In turn, this better segregation is likely to lead to a better discriminability of the two training tones and other irrelevant nontrained tones by a1 . This hypothesis was further confirmed by performing roc discriminant analyses that estimated the average ability of a1 neurons to properly discriminate between both trained tones and a trained tone and one irrelevant tone (10 versus 20 khz) (see figure 4). Briefly, the roc curve is a graphical plot that illustrates the performance of a binary classifier system and the area under the roc curve (auc), in this specific instance, represents the average probability that a1 as a whole will be able to discriminate between both tones . Here, we showed that the auc associated with both training alone and in combination with rivastigmine was significantly increased compared to control groups for both old and young rats . Interestingly, no difference was observed between old and young rats of the same training / ach condition, suggesting that cholinergic enhancement did not add much to the average ability of a1 neurons to discriminate between the target and nontarget for both young and old adult rats . Furthermore, when pooling the roc data from all groups together, we show that the auc is a great predictor of the behavioral performance of both old and young rats and explains 56% of the variance seen in the performance level reached by each rat . In other words, there is a good correspondence between the average a1 neuronal firing rate patterns in response to the two tones and the performance of the animal following auditory discrimination training . The other measure that was significantly modulated by training and cholinergic enhancement is the frequency tuning bandwidth of neurons, which is generally considered to be a good measure of frequency selectivity of a1 neurons (i.e., the degree to which a neuron responds to frequencies other than its cf). Training alone was sufficient to drive bandwidth changes for neurons tuned to either the target or the nontarget tone in the young; the addition of rivastigmine did not lead to any further changes . Auditory training caused a widening of the bandwidth for neurons tuned to the target tone, whereas it led to a narrowing of the bandwidth for neurons tuned to the nontarget . These tuning changes likely occurred to enhance the detection of tones near the target frequency and to reduce neuronal responses to the nontarget frequency . A similar widening of the tuning bandwidth for neurons tuned to the target frequency was observed in the old rats (though the effect did not reach statistical significance). However, the administration of rivastigmine was necessary to narrow the bandwidth of neurons tuned to the nontarget in the old rats . This is consistent with other above - highlighted measures of auditory processing of the nontarget, in that cholinergic enhancement is necessary to induce cortical changes that increase the ability of old rats to ignore nontarget stimuli . Finally, although the bandwidth for neurons tuned to the target frequency was similar between young and old rats (see figure 5), it was substantially higher for neurons tuned to the nontarget in the older rats, consistent with previous reports showing that, in general, a1 neurons are more broadly tuned in older rats [29, 55]. The finding of broadened tuning bandwidths in a1 neurons tuned to the target tone was partially surprising given that auditory training on frequency discrimination tasks usually leads to a narrowing of the tuning bandwidth, thereby increasing the frequency selectivity of auditory neurons [29, 56]. Indeed, broader tuning curves lead to wider stimulus - induced cortical activation, making sensory discrimination more based on spatial activation of the cortex and therefore generally less reliable [6, 57]. However, the task used here was a two - tone frequency discrimination that is relatively easy to perform compared to previous adaptive staircase procedures that are geared towards improving perceptual resolution [29, 56]. Indeed, here rats need not develop better frequency resolution to be positively reinforced for the present task; they simply need to learn to recognize one tone and to ignore the other . Consequently, discrimination based on spatial activation of a1 is therefore likely appropriate in this specific training context, especially given the additional finding of a decreased spatial overlap of a1 areas that are responsive to the target and nontarget tone following training . This coding strategy, however, is likely somewhat unique and specific to the type of discrimination that was used and would not be efficient in a different context where, for example, the target and nontarget would have varied between training sessions . Similarly, the bandwidth effects observed here are likely to be highly dependent on the type of task / training performed and are not generalizable to all contexts . As highlighted above, an overall reduction in bandwidth across all frequencies in a1 was observed for training paradigms that involved roving nontargets or combined roving targets and nontargets . Consequently, the plastic tuning changes in a1 that result from behavioral training seem to be tightly linked to the relevant sensory information required to perform the task . Lastly, behavioral training and cholinergic enhancement also led to marked structural changes within a1 . While both caused a significant increase in the number of som+ cells in the old rats, only the addition of rivastigmine led to an increase in som+ numbers in the young . Som+ cells are a class of inhibitory interneurons that, among other functions, play a key role in the neuromodulation of sensory processing and learning [4143]. They are also the main target of cholinergic projections in the cerebral cortex . Within auditory cortex, som+ cells have been shown to decline in number with advancing age . However, here we show that both auditory training and cholinergic enhancement during auditory training can rescue this decline in numbers observed in old rats . The relationship between behavioral training and somatostatin has been scarcely investigated, though there is some evidence that sensory training in the tactile modality in mice can increase the number of som+ cells within somatosensory cortex and that boosting somatostatin levels can improve learning and memory . Interestingly, the latter finding was only observed in aged mice, and not younger ones, consistent with our own findings . Finally, how boosting the cholinergic system directly affects the number of som+ cells within auditory cortex remains unclear to this point . While we do know that somatostatin cells contain cholinergic and muscarinic receptors and can be depolarized by cholinergic agonists [6163], further studies should aim to identify whether a clear causal link exists between increased cholinergic activity and somatostatin cell density . In conclusion, we show here the powerful potentiating effect of acetylcholine on perceptual learning in both young and old adult rats . Cholinergic enhancement was shown to accelerate the learning rate for discrimination between target and nontarget tone in both age groups, although this perceptual benefit was achieved in a different manner by each group . The benefit in young rats was achieved by increasing the correct detection of the target, whereas it was achieved by reducing the incorrect responses to the nontarget in the older rats . The latter finding is consistent with the notion that acetylcholine is an effective agent for reducing distractibility in older individuals . Cholinergic enhancement also had significant plastic changes on auditory cortical processing mechanisms within a1 when compared with behavioral training alone, particularly in the older group . In general, the combination of auditory training and cholinergic enhancement was found to restore many cortical processing features that are typical of the young brain, which highlights the great potential that combining behavioral and cognitive training with cholinergic neuromodulation has in recovering or preventing age - related cognitive and sensory deficits.
|
Micrornas (mirnas) are genome - encoded single - stranded rna molecules of ~22 nt in length, which play a significant role in regulation of gene expression in eukaryotes . Many details on biogenesis and interactions of mirnas are known (see recent reviews, e.g., [1, 2]). Briefly, mirnas can be encoded by mirna genes, but also be generated from different rna transcripts (e.g., from introns of protein - coding genes). Plant and animal mirnas differ to some extent with respect to biogenesis and structural characteristics but also in their mode of action . In plants, most if not all mirnas are transcribed from genes by rna - dependent rna polymerase ii (polii) into primary transcripts called pri - mirna; these transcripts fold into (possibly imperfect) stem - loop structures . From the pri - mirna dicer - like (dcl) enzymes process the stem - loop structure (pre - mirna), which is usually longer (~130 nt; see below) than nonplant pre - mirna (~86 nt), and finally a mirna / mirna * duplex . In the cytoplasm, the mirna is incorporated into the rna - induced silencing complex (risc), and base - pairing of the mirna with complementary messenger rna (mrna) regions leads to mrna degradation or to inhibition of mrna translation . Most plant mirnas base - pair with their respective target mrnas in the coding region with perfect or near - perfect complementarity leading to cleavage (and degradation) of the mrnas; animal mirnas usually base - pair with 3 untranslated regions through imperfect complementarity leading to translation repression . Finding of mirna genes either needs costly experimental approaches for example, genetics, which led to the detection of the first animal mirnas [3, 4], cloning and sequencing of cdna, or deep sequencing or computational prediction methods, which facilitate subsequent experimental verification or falsification . The different properties of mirnas in plants and animals gave rise to different computational approaches (for reviews see [57]). Most of these tools, however, rely on the following features: the mirna resides in a stem - loop structure, which possess a high thermodynamic stability and does not contain large internal loops or asymmetric bulges at least in the region of the mature mirna . In addition, many tools take into account a phylogenetic conservation of the pre - mirna structure and mirna sequence, which limits the chance to detect non - conserved, evolutionary new mirna genes . For example, dezulian et al . Identify plant mirna homologs in a set of sequences, given a query mirna, by a sequence similarity search step and a set of structural filters; pfeffer et al . Identify dna - viral pre - mirnas, which show neither detectable conservation to other viral pre - mirnas nor to host pre - mirnas, by a search for stable stem - loops and scoring of these according to free energy of folding, base composition, and number of base pairs; wang et al . As well as jones - rhoades and bartel search for putative mirna / mirna * complexes in the intergenic regions of arabidopsis thaliana and filter these according to gc content, mismatches in the stem, conservation in the rice genome, and the characteristic stem - loop structure . To our knowledge, the only tools for de novo prediction of pre - mirnas in plants are hhmmir and triplet - svm . Hhmmir calculates first the mfe structure of sequence regions (using rnafold in a scanning window approach with window length of less than 500 nt), extracts stem - loops that possess at least 10 base pairs, a minimum length of 50 nt, a loop of less than 20 nt and no multiloop(s), and finally classifies via a hierarchical hidden markov model (hhmm). (96 sequences taken from mirbase 5) and 0.973 for a. thaliana (75 sequences). Triplet - svm calculates by rnafold the mfe structure of sequences, rejects those with junction(s), too few base pairs, and a high free energy (i.e., low structural stability), parses the remaining structures in triplets (type of nucleotide plus paired or unpaired state of the nucleotide and its two neighbors), and finally classifies these features with a support vector machine (svm). The sensitivity of triplet - svm is published to be 0.948 for oryza sativa and 0.92 for a. thaliana using the same sequences from mirbase 5 as in the test with hhmmir . In the following, we describe our tool, called novomir, to detect pre - mirna and mirna / mirna * sequences in a plant genome . For this purpose novomir uses a series of filter steps, similar to those mentioned above, followed by a statistical model to discriminate a pre - mirna from all other rnas and by another statistical model to locate the mirna / mirna * complex in a putative pre - mirna . Thresholds and statistical values are learned from sets of true positive sequences (plant pre - mirnas taken from mirbase;) and true non - mirna sequences (trnas, 5 s rrna, 5.8 s rrna, mrnas, etc . ). For detection, novomir relies neither on comparative genomics nor on prior knowledge of a mirna target; thus novomir allows for searches in single plant genomes as well as in viral or viroid genomes . Sequences of plant pre - mirnas were obtained from different versions of mirbase [15, 16]: version 10.0 contains 1,247 sequences; the recent version 14 contains 2,030 sequences . The mean and median length of plant sequences are about (150 73) nt and 130 nt, respectively (see figure s1 in supplementary material available online at doi:10.4061/2010/495904); the shortest pre - mirna is 54 nt in length (mirbase i d: gma - mir2107) and the longest is 932 nt (cre - mir916). The mean and median length of nonplant sequences are about (88 14) nt and 86 nt, respectively; the shortest pre - mirna is 44 nt in length (hsa - mir-1973) and the longest is 215 nt (dme - mir-997). That is, most plant pre - mirnas are longer than animal pre - mirnas and their size range is more diverse . The sequences of pre - mirnas and mature mirnas are slightly enriched in u and u plus g, respectively (see figure s2). The four nucleotides are not equally distributed at each position along the mirna sequences (see figure s3): for example, a u is the preferred 5 nucleotide (f1,u = 0.65), a g on position 8 (f8,g = 0.44), and a c on position 19 (f19,c = 0.52). The minimum free energy g37c of the secondary structures of pre - mirnas, as calculated by rnafold using default parameters, is in a wide range due to the different lengths l and g+c contents fgc of the sequences (see figure s4); normalization of g37c to length and fgc results in g37c / l = (0.45 0.12) kcal / mol / nt and g37c / l / fgc = (1.02 0.26) kcal / mol / nt; the latter value is significantly lower than that of other rna according to zhang et al . . We used the 184 pre - mirnas and mature mirnas of a. thaliana as listed in mirbase version 10 as the true - positive data set for establishing all thresholds and parameters of novomir . Sequences containing nucleotides other than a, c, g, u(t) were discarded . For evaluation of sensitivity we used in addition the plant pre - mirnas and mature mirnas from mirbase version 14 (190 from a. thaliana and 1,853 from other plants). The sensitivity of novomir was nearly identical for both data sets (and also with sequences from version 14 minus those from version 10; see supplemental table s1); thus we refrained from training with different data sets . As the true - negative data set, we assembled rna sets from the following sources: 710 mrna sequences randomly selected from a. thaliana 631 trna sequences from a. thaliana 63 5.8 s rrna sequences from rfam version 7.0 602 5 s rrna sequences from rfam version 7.0 one randomly selected rna sequence from each of the 455 noncoding rna families from rfam version 7.0 (except mirna families); 2,760 shuffled pre - mirna sequences (each of the 184 a. thaliana sequences from mirbase 10 was shuffled 5 times using shuffle preserving (a) the mononucleotide content, (b) mono- and dinucleotide content, and (c) mononucleotide content in a window of 20 nt, resp .) Repetitive genomic elements from a. thaliana from the repeatmasker library (in total 134,000 nt) 8,000 pseudohairpin sequences from homo sapiens 10,000 pseudohairpin sequences from a. thaliana; these were selected using rnalfold from the tair cdna library to have a minimum stem - loop length of 50 nt in a base pair span of 400 nt 10 5,000 sequences of a length between 80 and 800 nts randomly selected from the five chromosomes of a. thaliana . It relies on rnashapes [24, 25] and rnalfold (which is part of the vienna rna package) for secondary structure calculations . Rnalfold finds subsequences of a long rna sequence that fold into locally stable (i.e., thermodynamically favorable) rna secondary structures; the computational effort is (nl) with length n of the long rna sequence and maximal base - pair separation l of the subsequences . For an rna sequence, rnashapes computes shapes, which are classes of similar secondary structures, and a representative structure shrep of minimal free energy within each shape . In the following, we describe the workflow of novomir (see supplemental figure s5). A typical plant pre - mirna consists of a relatively short sequence (with median length ~130 nt and mean length ~150 73 nt) that is able to fold into a stable stem - loop structure . Thus, we search in the genomic sequence for subsequences with locally stable secondary structure(s) via rnalfold . In case the genomic sequence is longer than 1000 nt, we subdivide it into 1000 nt fragments overlapping by 400 nt . This limit excludes only a few exceptionally long pre - mirnas; that is, only 8 of 1356 plant pre - mirna sequences in mirbase 10 and 14 of 2030 in mirbase 14, respectively, are dismissed due to this restriction for the sake of a fast first step . From the output of rnalfold, the five subsequences with best locally stable structures are treated further as individual sequences . The original sequence (with length 1000 nt) or a subsequence (with length 400 nt) selected by rnalfold is discarded if the sequence has a base composition not typical for pre - mirnas; that is, the sequence is only retained if the fraction of each nucleotide is above 0.1 . This filter rejects 9 and 21 plant pre - mirna sequences from mirbase 10 and 14, respectively . Rnashapes is used to predict the thermodynamically optimal secondary structure (minimum free energy (mfe) structure with gmfe) and the optimal secondary structure of up to three shapes with energies less favorable than that of the mfe shape class by 0.1 kcal / mol . The shapes have to differ in their nesting pattern for all loop types but positions of unpaired regions are not of relevance (rnashapes's option t 3). In general, it is assumed that the mfe structure of pre - mirnas is the conformation adequate for further processing by dicer . In our case, however, we do not know the true 5 and 3 ends; thus, the unrelated termini of the respective sequence, which do not belong to the true pre - mirna, might cause the pre - mirna structure to be thermodynamically suboptimal . Moreover, the restriction by rnashapes to the shrep prediction avoids prediction (and further processing) of the immense number of suboptimal structures . Any sequence that is not able to fold into a structure (as predicted in step (3)) with g37c / l / fgc 0.75 kcal / mol / nt is rejected . Next, each retained secondary structure is reformatted from the bracket - dot notation used by rnashapes into an alignment - like format (for an example see figure 1), which eases handling during the following steps: at each multiloop, the structure is divided into the respective stem - loop structures, which are separately processed further; 5 and 3 dangling ends are removed; a hairpin loop is removed; and asymmetric loops are made symmetric by introduction of gap symbols . Afterwards each (sub)structure consists of the following states: base pairs (match states m symbolized by + +), loop (mismatched states n,--), and insertion (i) and deletion (d) states (-| and |-, resp . ). A stem - loop shorter than 30 states in the alignment - like format is deleted . For efficiency of this filter, next, a window of length 25 states is moved (in steps of (1) state) along the structure in the alignment - like format, and the fraction of base - paired states is determined for each window . A stem - loop is deleted unless at least a mean fraction of 0.65 base - paired states is present in five different windows, which might overlap . For efficiency of this filter see figure 2(b). A stem - loop is deleted if it does not contain a helix with at least 8 consecutive base pairs . For efficiency of this filter a stem - loop is deleted if the ratio of its sequence length (as predicted by rnalfold) and the length of the stem - loop in the alignment - like format is above 6; that is, the structure contains too many junctions and/or large, unstructured hairpin loops . For efficiency of this filter if a sequence (and structure) remains after the filter steps, novomir decides on its possibility to be a pre - mirna using a paired hidden - markov model identical to that described by nam et al . . Briefly, the joint probability p(x,) of an observed sequence x and a state sequence is (1)p(x,) = t01i=1lei(xi)ti,i+1, with transition probabilities tkl = p(i = l | i1 = k) between the four states k, l {m, n, i, d}, emission probabilities ek(b) = p(xi = b | i = k) of the different nucleotide and gap pairs b, window size l = 21, and the probability of starting in state k defined as t01 . In contrast to nam et al ., we use four hidden states (is_mirna, is_mirnais_not_mirna, is_not_mirnais_mirna, is_not_mirna; see figure s6). For the decision that the sequence is a pre - mirna or not, the values for the j is_mirna, is_not_mirna} states are normalized and summed up (2) pj=i = 1lei, j(xi, j)ti, j,i+1,jj=14ei, j(xi, j)ti, j,i+1,j . The squared ratio (3)r1 = (pis_mirnapis_not_mirna)2, as well as the mean of the nine highest values of the difference (4)r2 = max k = ll+20pis_mirnapis_not_mirna, are compared to thresholds for the pre - mirna decision . In case of a positive decision in the previous step, the values that lead to the six highest values of r2 are predicted as positions of probable mirna / mirna * duplices (see figure 1(c)). Our programnovomir uses a set of heuristic filters and a statistical model to discriminate a mirna precursor from all other rnas (see figure s5). The data for this model are collected based on a set of true positive sequences (mirna precursors from a. thaliana as in mirbase 10) and a set of true non - mirna sequences (for details, see section 2.3). All thresholds for the filter steps and the probabilities for the hidden - markov model were selected on the basis of receiver operating characteristic (roc) curves like those shown in figure 2 . For these, the set of true positive a. thaliana pre - mirna sequences was taken from mirbase version 10 . Sensitivity values for the enlarged set of pre - mirnas from mirbase version 14 (190 a. thaliana and 1,840 sequences from other plants) are compared to those obtained from mirbase version 10 (184 a. thaliana and 1,063 sequences from other plants) in table 1 . The sensitivity values of novomir for a. thaliana pre - mirna sequences of both mirbase versions are very close to each other (0.837 and 0.832, resp . ). The values for all plant pre - mirna sequences are slightly lower (0.791 and 0.792, resp . ), but show no clear trend that sequences of mirbase 14 (not present in mirbase 10) are different from those of mirbase 10 or that sequences from a certain taxonomic group might be different from those of others (see supplemental table s1). The sensitivity of novomir in predicting the position of the mirna / mirna * complex is also high (0.73 for a. thaliana and 0.82 for all plants; see table 1). For this, a position is counted as correctly predicted if it matches exactly the annotated mature mirna or overlaps by five or fewer nucleotides . We tested hhmmir and triplet - svm for sensitivity with the sequences from mirbase 10 and 14 (see table 1). The filtering steps of both tools reject already many sequences (hhmmir more than 80% and triplet - svm more than 22%). For the sequences remaining after the filtering steps, the sensitivity of the hhmm and svm is at maximum 0.79 and 0.60, respectively, which is also lower than that of novomir with a sensitivity of at least 0.80 (using all filter steps). These data sets should not contain any true (pre-)mirna . For example, we used well - annotated rnas (mrna, noncoding rna) and sets of pseudohairpins from h. sapiens and a. thaliana . Similarly, the chance is negligible that the data set of 10 5,000 sequences randomly selected from the a. thaliana genome contains a true mirna . The most difficult data set consisted of a. thaliana mrnas; with these novomir reached a specificity of 0.975 (see table 2). With we wanted to test the program with a more realistic scenario, given the satisfying sensitivity and specificity values of novomir with our test data (see tables 1 and 2). We selected all intergenic and intronic regions of the a. thaliana genome from the arabidopsis information resource (tair), removed all pre - mirna sequences, and searched within the remaining sequences for potential pre - mirnas via novomir . Novomir classified 828 sequences from the 30,413 intergenic sequences and 649 sequences from the 148,558 intronic sequences, respectively, as potential pre - mirnas . Despite this pleasingly low numbers of hits, however, an interpretation of this outcome is not easy . To get an impression on the hits, we searched with these potential pre - mirna sequences with blast for any annotation and for the mirna - typical expression pattern in the arabidopsis small rna project database (asrp) [28, 29]; such a typical expression pattern of a pre - mirna includes sequences for the mirna as well as for the mirna * (for an example see supplemental figure s7). To our surprise, we detected that some of the predicted candidates are already described as true pre - mirnas . An example of such a sequence, predicted by novomir as a potential pre - mirna, is located on a. thaliana chromosome 3 in the region between genes at3g09280 and at3g09290 . Its secondary structure and its support by expressed small rnas are shown in figure 3 and figure s8, respectively . It is already known as pre - mir2111a [30, 31], but not present in mirbase 14 . The sequences of the mature mir2111a and of mir2111a * predicted by novomir also coincide with the sequences given in . In the following, we mention shortly three further candidate hits, for which we found some support by small - rna expression in the asrp but no explicit annotation . One novomir hit is located on chromosome 4 between at4g22760 and at4g22770 close to the 3 terminus of the latter, but on the opposite strand; for further details, see figure 3 and figure s9 . The next hit (see figure 3 and figure s10) is located in between at5g52689 and at5g52690 . The last mentioned hit is located in an intron of at1g01650, which encodes for an aspartic - type endopeptidase / peptidase; the structure of this sequence is shown in figure 3 and the expression pattern of the genomic region in figure s11 . It is known that many mirnas are induced by biotic and abiotic stress [3638]. Thus, a lack of small rnas might either point to a false - positive prediction or to a stress condition not analyzed for expression of small rnas . Further candidate hits are located in regions showing expression patterns similar to those of repetitive elements . A recently published review discussed the possibility that some mirnas could be evolved from repetitive genomic elements and/or duplication of genomic regions . Viroids are plant - infectious, noncoding, unencapsidated, circular rnas that are transcribed in a rolling - circle mechanism either in nuclei (pospiviroidae) or in chloroplasts (avsunviroidae) of infected plants . Viroids cause the production of viroid - specific small rnas (vsrna) similar in size to small interfering (sirna) and mirnas, but they do escape the cytoplasmic silencing mechanism . A positive (or negative) novomir prediction of viroids as potential pre - mirnas would point to the genesis of vsrnas . For further details, see recent reviews [4043]. Potato spindle tuber viroid (pstvd) is the type strain of pospiviroidae . Because of its high self - complementarity the circular pstvd rna folds into a rod - like secondary structure of high thermodynamic stability (see figure 4). This structure can be divided into five structural domains on the basis of homology between different pospiviroids . Most sequence variants or strains of pstvd differ by mutations in the pathogenicity - modulating (p) domain and/or variable (v) domain . Only a few nucleotide changes in the p domain are sufficient to exhibit remarkably different symptoms in infected tomato plants solanum lycopersicon cv rutgers . If this p domain would be the source of mirna - like vsrnas, these could interfere somehow with the host's metabolism leading to symptom production . For an rna with pstvd sequence from positions 263359/196, which is one of the structural elements present during processing of (+) -strand replication intermediates to circles, novomir predicted mirna / mirna * complexes in the p domain of pstvd; for an rna from positions 103255, which is also a structural elements during processing, novomir predicted a further mirna / mirna * complex in the tr domain, but only after lowering the normalized energy threshold from the default value tg / l / fgc = 0.75 to 0.69 . Novomir predicted identical positions for complexes in a full - length, linear pstvd (1359). Especially the prediction of vsrnas derived from the p domain supports an involvement of vsrnas in symptom production via vsrna - induced (mis)regulation of plant - endogenous rnas like mrnas coding for transcription factors . This hypothesis is supported by deep - sequencing of pstvd - derived vsrnas in pstvd - infected tomato plants (diermann, matouek, teune, riesner and steger, submitted) and sequencing of vsrnas produced in vitro by dcl processing of pstvd which showed clusters of vsrnas derived from the p domain . In contrast, [45, 46] found only vsrnas in pstvd - infected tomato plants that clustered in regions outside of the p domain . This discrepancy is unresolved but might be based for example on different purification procedures of the vsrnas . Plant pre - mirnas are more heterogeneous in size and structure than animal pre - mirnas but still show sufficient characteristic features such as relative thermodynamic stability of their structure, length of helices, and number and size of loops to be differentiated from other rnas . Based on several of these features, we developed a series of filter steps and a statistical model that together are able to detect pre - mirnas with a sensitivity of about 0.8 and a specificity of about 0.99 . Thus, the program, which we call novomir, is well suited to search on a genomic scale for new pre - mirnas that are not necessarily evolutionarily conserved . As an example, we searched with novomir for pre - mirnas in nontranslated regions of the a. thaliana genome and detected among the high - scoring sequences experimentally verified pre - mirnas, which were not annotated in the recent version of mirbase . Additionally, novomir recognizes viroids as pre - mirnas, which supports the hypothesis that viroid - specific small rnas are generated in a mirna - like pathway.
|
In a 2009 review paper, puhl and heuer documented the incredible scope of discrimination faced by overweight individuals, including in health care settings, the workplace, and media . In addition, they discuss the relatively sparse data on interventions aiming to eradicate these conditions (puhl and heuer, 2009). Indeed, the few effective studies that have been published describe approaches primarily delivered to university students . Similarly, the broader literature on curbing rates of victimization and bullying indicate that school - based approaches are most successful (rigby and slee, 2008; ttofi and farrington, 2011; vreeman and carroll, 2007). Overall, it appears that intervening in secondary schools or universities may be an opportune time to target body dissatisfaction and discrimination related to weight more globally . Large - scale, school - based interventions have been promising in regard to decreasing victimization among pre - adolescents and adolescents (busch et al ., 2012;, the utrecht healthy school (uhs) program aimed to comprehensively improve healthy behaviors including eating habits, physical activity, and substance abuse, as well as decreasing bullying (busch et al ., 2012). The uhs approach emphasizes involvement of students, teachers, parents, and administrators, as well as building external connections with an overall goal of health promotion for all members of the school community . With advisement from these stakeholders, uhs was rolled out from 2007 to 2010, and outcome assessment consisted of comparisons from two cohorts of students reporting in 2007 and 2010 . Results showed improvements in many of the target behaviors, including increased physical activity and lower rates of bullying and victimization (busch et al ., 2012). A social and emotional learning (sel) curriculum aiming to improve mental health and related outcomes like victimization was developed and tested in sweden (kimber et al ., 2008). Sel, based on cognitive and behavioral methods, focuses on helping students to develop the following five skills: self - awareness, managing one s emotions, empathy, motivation, and social competence . Using a quasi - experimental design, after 2 years of the program, results showed some important differences between outcomes for students in experimental and control schools including decreases in victimization (kimber et al ., 2008). Importantly, puhl and colleagues (puhl et al ., 2013) surveyed adolescent recipients of weight - related victimization for their perspectives on intervention for example, the importance of teaching student bystanders how to prevent rather than reinforce bullying behavior appears to be a desirable strategy that has also been shown to be effective (rigby and slee, 2008; salmivalli et al ., 2011). It may also be useful to consider strategies that have been employed directly to victims or those at risk . For example, vessey and oneill (2011) used materials from the us health services resources administration s stop bullying now campaign to develop a group intervention for children with disabilities, who are at high risk for experiencing victimization . Results showed that group members were less bothered by teasing afterwards and also experienced improved self - concept . Similarly, in hong kong, a 10-week cognitive behavioral program was delivered to 68 victims of bullying (fung, 2012). The program yielded mixed results with students reporting decreased victimization although parents and teacher reports did not echo these findings . Overall, these programs offer some suggestions for strategies that psychologists can draw from when addressing victim - blaming in therapy . It may also be useful to consider strategies that have been employed directly to victims or those at risk . For example, vessey and oneill (2011) used materials from the us health services resources administration s stop bullying now campaign to develop a group intervention for children with disabilities, who are at high risk for experiencing victimization . Results showed that group members were less bothered by teasing afterwards and also experienced improved self - concept . Similarly, in hong kong, a 10-week cognitive behavioral program was delivered to 68 victims of bullying (fung, 2012). The program yielded mixed results with students reporting decreased victimization although parents and teacher reports did not echo these findings . Overall, these programs offer some suggestions for strategies that psychologists can draw from when addressing victim - blaming in therapy . As marks (2015) states, the media promotes an unhealthy body image, in which most women seen in magazines and billboards are visibly underweight (ahern and hetherington, 2006). Specifically, the media reinforces the perpetuation of the thin - ideal through the glorification of ultra - thin models, causing those who look to the media for information to internalize this ideal (thompson and stice, 2001). The perceived discrepancy between people s ideal and actual body image, as well as the unrealistic nature of the ideal, can lead to body image dissatisfaction (bessenoff and snow, 2006; gluck and geliebter, 2002). One particularly illuminating study demonstrated that after introducing prolonged television access in fijian adolescent girls, those with exposure to western television demonstrated significantly more disordered eating attitudes and behaviors than those without exposure (becker et al ., 2002). Buys into socially defined ideals of attractiveness and engages in behaviors designed to approximate those ideals (ahern and hetherington, 2006) and is one of the most important risk factors for the development of eating pathology (stice and shaw, 1994). The body project, the most successful eating disorder prevention program, is a 4-session group - based intervention that utilizes the principle of cognitive dissonance . It requires participants to explore the costs of and to reject the thin - ideal, thereby reducing their thin - ideal internalization . Extensive research on the body project has demonstrated a decrease in thin - ideal internalization that has led to significant and clinically meaningful reductions in body image dissatisfaction and negative affect (two parts of the cod), as well as 60 percent reductions in diagnostic and statistical manual of mental disorders (4th ed . ; dsm - iv) eating disorders at 3-year follow up compared to controls (stice et al ., 2013a, 2013b). A large body of research has demonstrated the efficacy of the body project in reducing thin - ideal internalization, body image dissatisfaction, and negative affect in female college (e.g. Stice et al ., 2011) and high school students (stice et al ., 2011), although it has been less successful among middle school girls (rohde et al ., 2014). Given its efficacy, efforts have been focused on improving the translatability of this intervention . Recent research has demonstrated support for a train - the - trainer approach to body project dissemination . Specifically, when master trainers trained novice trainers to train undergraduate peer leaders, participants showed significantly reduced levels of thin - ideal internalization, body dissatisfaction, and disordered eating at post - treatment and 5-month follow up (grief et al ., 2015). 2014) found that effects of the intervention were not related to facilitator s age, sex, education level, or body mass index (bmi) or the size of the group, which is encouraging for dissemination . Other efforts to disseminate the intervention have included an internet - dissonance - based program, which demonstrated similar efficacy to an in - person group intervention at post - test, but improvements were not as well maintained at 1- and 2-year follow ups (stice et al ., 2014). Although the majority of dissonance - based prevention programs have been geared toward the prevention of eating disorders, this recent study of the internet - based program (ebody project) also demonstrated large weight gain prevention effects, significantly more so than the body project, which were comparable to other obesity prevention programs (stice et al ., 2014). Thus, at least for women and girls, these cognitive - dissonance - based programs can reduce body image dissatisfaction, and in some contexts, prevent weight gain . Working toward eliminating obstacles to dissemination of this program may help to break the cod . The most obvious and likely effective way of devalorizing the thin - ideal is on a societal level, by diversifying representations of individuals of varying weights in the media and expanding access to larger sized clothing, for example . As these societal concerns are tackled, clinicians can also help to devalorize the thin - ideal on a more individual level . Although not designed to target the thin - ideal directly, mirror exposure therapy is currently used to promote body image acceptance and reduce body image dissatisfaction . During exposure, patients are asked to look at themselves in a mirror while describing their physical appearance in a neutral manner . Studies of mirror exposure have demonstrated significant reductions in body image dissatisfaction among adults with binge eating disorder (hilbert et al ., 2002), as well as overweight and obese adolescents (jansen et al ., 2008). In conclusion, it is important for psychologists to be aware of effective approaches available to intervene stemming from marks (2015) novel homeostatic theory . Indeed, the literature has shown that there are both systemic and individual empirically supported interventions that can be employed by psychologists . In particular, such services can be feasibly and acceptably delivered to adolescents and young adults in school settings . It seems reasonable to suggest initiating large - scale programs in secondary schools and universities that perhaps can even be packaged together to most impactfully address circumstances intertwined with weight gain . Overall, informed by theory, such culture changes may be an ideal way to focus prevention and intervention efforts . Thin - ideal internalization is defined as the extent to which an individual buys into socially defined ideals of attractiveness and engages in behaviors designed to approximate those ideals (ahern and hetherington, 2006) and is one of the most important risk factors for the development of eating pathology (stice and shaw, 1994). The body project, the most successful eating disorder prevention program, is a 4-session group - based intervention that utilizes the principle of cognitive dissonance . It requires participants to explore the costs of and to reject the thin - ideal, thereby reducing their thin - ideal internalization . Extensive research on the body project has demonstrated a decrease in thin - ideal internalization that has led to significant and clinically meaningful reductions in body image dissatisfaction and negative affect (two parts of the cod), as well as 60 percent reductions in diagnostic and statistical manual of mental disorders (4th ed . ; dsm - iv) eating disorders at 3-year follow up compared to controls (stice et al . A large body of research has demonstrated the efficacy of the body project in reducing thin - ideal internalization, body image dissatisfaction, and negative affect in female college (e.g. Stice et al ., 2011) and high school students (stice et al ., 2011), although it has been less successful among middle school girls (rohde et al ., 2014). Given its efficacy, efforts have been focused on improving the translatability of this intervention . Recent research has demonstrated support for a train - the - trainer approach to body project dissemination . Specifically, when master trainers trained novice trainers to train undergraduate peer leaders, participants showed significantly reduced levels of thin - ideal internalization, body dissatisfaction, and disordered eating at post - treatment and 5-month follow up (grief et al ., 2015) 2014) found that effects of the intervention were not related to facilitator s age, sex, education level, or body mass index (bmi) or the size of the group, which is encouraging for dissemination . Other efforts to disseminate the intervention have included an internet - dissonance - based program, which demonstrated similar efficacy to an in - person group intervention at post - test, but improvements were not as well maintained at 1- and 2-year follow ups (stice et al ., 2014). Although the majority of dissonance - based prevention programs have been geared toward the prevention of eating disorders, this recent study of the internet - based program (ebody project) also demonstrated large weight gain prevention effects, significantly more so than the body project, which were comparable to other obesity prevention programs (stice et al ., 2014). Thus, at least for women and girls, these cognitive - dissonance - based programs can reduce body image dissatisfaction, and in some contexts, prevent weight gain . Working toward eliminating obstacles to dissemination of this program may help to break the cod . The most obvious and likely effective way of devalorizing the thin - ideal is on a societal level, by diversifying representations of individuals of varying weights in the media and expanding access to larger sized clothing, for example . As these societal concerns are tackled, clinicians can also help to devalorize the thin - ideal on a more individual level . Although not designed to target the thin - ideal directly, mirror exposure therapy is currently used to promote body image acceptance and reduce body image dissatisfaction . During exposure, patients are asked to look at themselves in a mirror while describing their physical appearance in a neutral manner . Studies of mirror exposure have demonstrated significant reductions in body image dissatisfaction among adults with binge eating disorder (hilbert et al ., 2002), as well as overweight and obese adolescents (jansen et al ., 2008). In conclusion, it is important for psychologists to be aware of effective approaches available to intervene stemming from marks (2015) novel homeostatic theory . Indeed, the literature has shown that there are both systemic and individual empirically supported interventions that can be employed by psychologists . In particular, such services can be feasibly and acceptably delivered to adolescents and young adults in school settings . It seems reasonable to suggest initiating large - scale programs in secondary schools and universities that perhaps can even be packaged together to most impactfully address circumstances intertwined with weight gain . Overall, informed by theory, such culture changes may be an ideal way to focus prevention and intervention efforts.
|
A diagnostic colonoscopy can be performed safely without prior consultation with a gastroenterologist, which increases efficiency and reduces delays and costs 2 3 4 . This practice of open access endoscopy (oae) has gained popularity, particularly in the western world . Despite these benefits, concerns exist about improper referrals or patients referred for colonoscopy in whom the possible risks outweigh the benefits such as patients with serious comorbidities, those who are frail, and those with a limited life expectancy . In addition, improper referrals for colonoscopy may increase complications, average waiting time for services, and health care costs 5 . In many centers, standardized referral letters (srl) are screened by gastroenterologists to evaluate whether patients should be referred for colonoscopy, medications, and comorbidities . Unfortunately, srls do not always provide accurate information; therefore, we introduced a 7.5 min outpatient consultation (oc), performed by a gastroenterologist, to ascertain key features about patients to determine if colonoscopy is warranted before authorizing the procedure . In this study, we prospectively evaluated the srl and the oc to define the differences in outcomes regarding regarding recommendations for or against colonoscopy and patient priority scheduling . In addition, the patients use of medications (in particular, insulin and coumarin) and comorbidities were recorded . This prospective, observational, single - center study was performed at the department of gastroenterology, deventer hospital, the netherlands . Formal ethics committee review or approval was not required . Between may 2012 and july 2012, all consecutive patients referred for surveillance and diagnostic colonoscopy were de - identified and included in the analysis . Two methods of identifying patients for colonoscopy were evaluated: the standardized referral letter (srl) and the outpatient consultation (oc). Standardized referral letter: the srl is a predefined list of approved indications and symptoms that warrant colonoscopy . This includes patients use of anticoagulants, a diagnosis of diabetes, with or without insulin therapy, and contagious diseases . All srls were scrutinized by an independent gastroenterologist who was instructed to use only the srl for authorization of colonoscopies . In instances where authorization for a colonoscopy was approved, the gastroenterologist determined the patient s priority for undergoing the colonsocopy: a, within one week; b, within two weeks; and c, first regular opportunity (usually within 3 4 weeks). Gastroenterologists were selected using a day - by - day rotation system, ensuring that they had no previous contact with the study patients or their medical records . Outpatient consultation: every outpatient referred for colonoscopy had a standard 7.5 min face - to - face consultation with a gastroenterologist who verified the data in the patient s srl . The outpatient consultation occurred before and in addition to colonoscopy, but without a physical examination . Additional information regarding patient symptoms, comorbidities, and use of medications was obtained from the patient and the electronic medical record system . When a colonoscopy was authorized, a priority level was given for that patient, and the patient met with a nurse for additional information about the procedure . When colonoscopies were not authorized for a patient, both the patient and the referring physician were informed by the gastroenterologist that the patient did not meet the criteria for the procedure . Secondary outcomes were the differences in the patient s priority for colonoscopy, the number of malignancies identified, the number of advanced neoplastic lesions identified, and the number of new diagnoses of inflammatory bowel disease (ibd). In addition, the completeness of the srl with respect to the patient s use of medications (insulin and coumarins) and their important comorbidities were recorded . Important comorbidities were defined as previous abdominal surgery, cardiac disease, chronic obstructive pulmonary disease, malignancies, and coagulation disorders . The number of patients in this study (255) was determined by the following calculation (because no data were available in the literature): power of 90%, <0.05, and an estimation of 3% of patients not authorized for colonoscopy using srl and 10% of patients not authorized for colonoscopy using oc . Mcnemar s test was used for nominal data, which is suitable for matched data pairs . For categorical data, the wilcoxon signed - rank test was used, a p - value less than 0.05 was considered to be statistically significant . This prospective, observational, single - center study was performed at the department of gastroenterology, deventer hospital, the netherlands . Formal ethics committee review or approval was not required . Between may 2012 and july 2012, all consecutive patients referred for surveillance and diagnostic colonoscopy were de - identified and included in the analysis . Two methods of identifying patients for colonoscopy were evaluated: the standardized referral letter (srl) and the outpatient consultation (oc). Standardized referral letter: the srl is a predefined list of approved indications and symptoms that warrant colonoscopy . This includes patients use of anticoagulants, a diagnosis of diabetes, with or without insulin therapy, and contagious diseases . All srls were scrutinized by an independent gastroenterologist who was instructed to use only the srl for authorization of colonoscopies . In instances where authorization for a colonoscopy was approved, the gastroenterologist determined the patient s priority for undergoing the colonsocopy: a, within one week; b, within two weeks; and c, first regular opportunity (usually within 3 4 weeks). Gastroenterologists were selected using a day - by - day rotation system, ensuring that they had no previous contact with the study patients or their medical records . Outpatient consultation: every outpatient referred for colonoscopy had a standard 7.5 min face - to - face consultation with a gastroenterologist who verified the data in the patient s srl . The outpatient consultation occurred before and in addition to colonoscopy, but without a physical examination . Additional information regarding patient symptoms, comorbidities, and use of medications was obtained from the patient and the electronic medical record system . When a colonoscopy was authorized, a priority level was given for that patient, and the patient met with a nurse for additional information about the procedure . When colonoscopies were not authorized for a patient, both the patient and the referring physician were informed by the gastroenterologist that the patient did not meet the criteria for the procedure . Secondary outcomes were the differences in the patient s priority for colonoscopy, the number of malignancies identified, the number of advanced neoplastic lesions identified, and the number of new diagnoses of inflammatory bowel disease (ibd). In addition, the completeness of the srl with respect to the patient s use of medications (insulin and coumarins) and their important comorbidities were recorded . Important comorbidities were defined as previous abdominal surgery, cardiac disease, chronic obstructive pulmonary disease, malignancies, and coagulation disorders . The number of patients in this study (255) was determined by the following calculation (because no data were available in the literature): power of 90%, <0.05, and an estimation of 3% of patients not authorized for colonoscopy using srl and 10% of patients not authorized for colonoscopy using oc . Mcnemar s test was used for nominal data, which is suitable for matched data pairs . For categorical data, the wilcoxon signed - rank test was used, a p - value less than 0.05 was considered to be statistically significant . Secondary outcomes were the differences in the patient s priority for colonoscopy, the number of malignancies identified, the number of advanced neoplastic lesions identified, and the number of new diagnoses of inflammatory bowel disease (ibd). In addition, the completeness of the srl with respect to the patient s use of medications (insulin and coumarins) and their important comorbidities were recorded . Important comorbidities were defined as previous abdominal surgery, cardiac disease, chronic obstructive pulmonary disease, malignancies, and coagulation disorders . The number of patients in this study (255) was determined by the following calculation (because no data were available in the literature): power of 90%, <0.05, and an estimation of 3% of patients not authorized for colonoscopy using srl and 10% of patients not authorized for colonoscopy using oc . Mcnemar s test was used for nominal data, which is suitable for matched data pairs . For categorical data, the wilcoxon signed - rank test was used, a p - value less than 0.05 was considered to be statistically significant . Consecutive patients (255; 51% men; mean age, 61 years; range, 19 88 years) were included in the study . Eighty - three percent of the patients were referred by a general practitioner, the others were referred by internists and surgeons . After oc, 226 patients (89%) were authorized for colonoscopy; two patients cancelled their colonoscopies, and 224 colonoscopies were performed (87%). In 211 (94%) patients, after srl, 239 (93.7%) consecutive patients were authorized for colonoscopy . Fewer colonoscopies were authorized by oc (11.4% of patients were not authorized for a colonoscopy) than by srl (6.3% of patients were not authorized for a colonoscopy; p = 0.02). Abbreviations: oc = 7.5 min outpatient consultation; srl = standard referral letter . These patients did not have a colonoscopy as shown in table 1, seven of sixteen patients that were not authorized for colonscopy using the srl, were authorized for colonoscopy using oc, because of incomplete information on the srl (eg . For example, one patient underwent a colonoscopy a year previously, which was sufficient reason to decline the colonoscopy using the information in the srl . Using oc, however, it was noticed that the prior colonoscopy of this patient was incomplete because of fecal contamination, and the colonoscopy for this patient was then authorized . In five of the seven patients, these lesions were symptom - related and included hemorrhoids, colonic diverticular disease, and adenomatous polyps . Table 2 shows the reasons why colonoscopies were not authorized, which included symptoms related to irritable bowel syndrome (using the rome - iii - criteria), recently performed colonoscopy, incorrect surveillance (early referral or no reason for colonoscopy according to the guidelines), or a patient s choice for a second consultation or diagnostic tests (upper endoscopy, sigmoidoscopy, laboratory tests, or imaging) instead of colonoscopy . Other reasons why colonoscopies were not authorized included changes in patients medications and referrals to other specialists . More colonoscopies were prioritized when gastroenterologists use the srl (30% level a, 14% level b) than when they used the oc (18% level a, 8% level b). Wilcoxon signed - rank test revealed a significant difference in priority assignments (p <0.001). Colorectal cancer was detected in 5.8% (13/224) of patients who underwent a colonoscopy . 1 shows that although fewer colonoscopies were prioritized using oc (level a + b), more patients were diagnosed with malignancies (10.8% versus 6.3%, p <0.001). When colonoscopies were not prioritized, malignancies were detected in 4.7% and 3.7% of patients using srl and oc, respectively . The accuracy of prioritization was demonstrated in that the number of patients in level a and b decreased while the number of patients with colorectal cancer in those levels increased . Data from 16 (srl) and 29 (oc) subjects who were not recommended for colonsocopy . Some of the patients were not recommended for more than one reason, causing the total number of reasons that patients were not recommended for colonoscopy (srl, n = 18 and oc, n = 30) to be higher than the total number of patients who were not recommended for colonoscopy (srl, n = 16 and oc, n = 29).abbreviations: srl = standard referral letter screening; oc = 7,5 min outpatient consultation; ibd = inflammatory bowel disease . Significance (p <0.05) the assessment of the priority of outpatient colonoscopy based on srl and oc plotted against the number of malignancies found at colonoscopy . Abbreviations: srl = standard referral letter; oc = 7.5 min outpatient consultation . The most dangerous medications (insulin, coumarins, and platelet inhibitors) were reported in 1.6% of the srls . Medications that patients take are less relevant for colonoscopy than for other procedures, but antihypertensives, beta - blockers, and proton pump inhibitors were missing on the srls . Of all patients, 63.5% had a past medical history, which included abdominal surgery (35.8%) cardiac disease (15.4%), copd (3.1%), prior malignancy (3.7%), diabetes mellitus (3.0%), and coagulation disorder (0.6%). In the netherlands, 191,339 colonoscopies were performed in 2009 6 . In the current study, srl, which is current practice, revealed that 16 patients (6.3%) did not require colonoscopy whereas oc revealed that 29 patients (11.4%) did not require colonoscopy . In the netherlands, 191,339 colonoscopies were performed in 2009 6 . Extrapolating the results from this study to the 2009 data revealed that slr and oc would result in 12,058 and 21,812 fewer annual colonoscopies nationwide, respectively . After the introduction of the screening program for colorectal cancer (crc) in the netherlands, the benefits of the oc will increase, because the number of patients authorized for colonoscopies will increase by 66,000 annually in the long term 7 . Reducing the number of non - screening colonoscopies by using oc reduces the workload and the financial consequences . Nearly half of of those who were not recommended for colonoscopy by gastroenterologists using srl alone were authorized for colonoscopy using oc, and many of these patients had lesions that were identified during colonoscopy . Thus, there are two problems with srl; first, fewer patients were authorized to undergo colonoscopy, and, second, patients who were not originally authorized by srl were ultimately diagnosed with a lesion when the procedure was authorized after oc . This supports the importance of oc for maintaining high quality and safety for patients . Relying on srl we found oc is better than srl for establishing patient priority for colonoscopy and that fewer referrals were assessed as urgent (level a or b). Although the number of urgent patient referrals was lower for oc, the number of diagnoses of malignancies was comparable to srl . This is supported by ramsay et al ., who reported high numbers of urgent patient referrals by general practioners and that in 92.2% of these no malignancies were found 8 . A long patient waiting period for a colonoscopy is common for most hospitals . When the number of referrals assessed as urgent is too high, it could cause problems scheduling colonoscopies that actually are urgent . In particular, previous abdominal surgery was not reported and it is a factor known to contribute to the difficulty of a colonoscopy 9 10 . In 2006, an american study reported inaccurate relevant information in 8.8% of patient referrals in an assessment of the srl 11 . In the current study, the incomplete information on the srls was revealed upon ocs and the colonoscopies were subsequently approved . We performed a prospective study, with blinded evaluation of srl and oc to determine if patients would be recommended for colonoscopy or not . Patients who were not recommended for colonoscopy by oc, did not receive colonoscopy, which is a limitation of this study . However, that determination was not the purpose of this study, and the number of patients in this group was small relative to the total number of patients . Furthermore, these patients were evaluated by an experienced gastroenterologist who concurred with the decision made by oc . Prioritization of colonoscopies at the deventer hospital may be relatively easy because of a short waiting period and this could have influenced the percentages of prioritized patients in our study . However, both srl and oc were evaluated using the same conditions so the differences noted remain statistically valid . Patients recommended for a colonoscopy using oc met with a nurse for additional procedural information.this has a positive impact on the quality of bowel preparation, however, the impact of this meeting was not evaluated in this study . The study shows that the implementation of oc to authorize pateint referrals for colonoscopy reduced the number of authorizations for patients with improper indications . Furthermore, it reduced the number of procedures that were not authorized from the srl, provided a better prioritization of patients for colonoscopies, and provided important additional information that was lacking on the srl . These findings show that oc provides important health care benefits for patients referred for colonoscopies, a reduced of risk of colonoscopies that are not justified or among patients that are too frail, and reducted costs and patient waiting times.
|
The ghna nutrition survey was administered online and included 3030 participants from the united states (n = 1022), germany (n = 1002), and the united kingdom (united kingdom; n = 1006) using a convenience - based sample with recruitment completed by instantly (formerly usamp), a marketing and research firm . The sample consisted of adults (aged 18 - 66 years) who represented the age, gender, and geographic composition within each country and were comparable across countries . The survey consisted of 20 questions with dichotomous, ordinal, and likert scale response options, all of which were close ended, and took approximately 10 minutes to complete (see appendix, supplemental digital content 1, http://links.lww.com/nt/a4). Descriptive statistics were used to summarize the data, and t tests were used to compare means between subgroups . Statistical significance was set a p <.05 . When country - level data were pooled, 72% of respondents thought they had a more than half of the sample (52%) believed they consume all the key nutrients needed for optimal nutrition through food sources alone, as opposed to the 35% who thought dietary supplements were needed to achieve the daily recommended intake of key nutrients and the 13% who were unsure . We found a significant difference by gender and age for the perception that an optimal diet could be achieved through diet alone: fewer women (48%) than men (57%) and fewer middle - aged adults (48%) than younger (18 - 34 years [56%]) and older (55 years [54%]) adults agreed an optimal diet could be achieved through diet alone . The gender and age composition of the global nutrition and health alliance survey by country (n = 3030), 2014 . More than half of adults (55%), regardless of country, recognized that optimal nutrition is important to health, whereas 32% believed there is a value to using dietary supplements . Most adults thought that both omega-3s and vitamin d play a significant role in overall health (figure 2). A significantly higher proportion of adults in both the united states and germany felt both nutrients were important for health when compared with adults in the united kingdom, but a much lower proportion of adults report using dietary supplements containing these nutrients across all countries (figure 3). Overall, 32% reported using omega-3s (45% in united states, 29% in united kingdom, and 24% in germany), and 42% reported using vitamin d dietary supplements (62% in united states, 32% in united kingdom, and 31% in germany); significant differences by country and age are noted . Consumers cited many different health reasons for the use of omega-3 and vitamin d supplements . Most adults (92%) listed overall wellness, heart health (90%), and bone and joint health (84%) as important or very important; there was an overall trend for these factors to increase in importance as age increased (data not shown). More than half of adults (59%) associated omega-3s with heart health; this was higher in the united states than in the united kingdom and germany, higher in females when compared with males, and higher in adults older than 35 years than in younger adults (table). Vitamin d was most highly associated with overall wellness (49%); more adults in the united states felt vitamin d was important for wellness than in the united kingdom or germany, and more females than males overall (table). Percentage (%) of adults who believe omega-3 fatty acids and vitamin d can improve specific components of health: results from the global nutrition and health alliance survey, 2014 percentage of adults who agree that omega-3 fatty acids and vitamin d play an important role in overall health . (the united kingdom reports significantly lower percentage in agreement than the united states or germany for both omega-3s and vitamin d). The prevalence (%) of use of omega-3 fatty acid and vitamin d dietary supplements by age and country: results from the global nutrition and health alliance survey, 2014 . No significant age group prevalences were noted for the united states or germany . In the united kingdom, the 18- to 34-year - olds had a higher prevalence of use for both nutrients than the 35- to 54-year - olds and those 55 years or older . Overall, 78% of the sample agreed that omega-3 fatty acids are beneficial for heart health: united states (81%), germany (80%), and united kingdom (72%). Given the high prevalence, it is interesting to note that only 40% thought that their diet was adequate in omega-3 fatty acids, whereas another 32% were unsure, and there was a large discrepancy about perceived importance of omega-3s for heart health and use of omega-3 dietary supplements (figure 4). Similar to omega-3s, a high percentage of respondents agreed that vitamin d was beneficial to overall health (84%). More than half of adults (55%) from all countries were unsure or did not think they consume enough vitamin d in their diet . The prevalence (%) of use of omega-3 fatty acid dietary supplements and proportion (%) of adults who believe omega-3 fatty acids are important for heart health by gender and country: results from the global nutrition and health alliance survey, 2014 . Approximately one - third of adults (34%) perceived that there were deficiencies of omega-3s in their country, with the united states (42%) reporting significantly higher than the united kingdom (28%) or germany (32%). More adults overall thought vitamin d deficiency exists in the country (40%), again with the united states reporting significantly more (49%) than the united kingdom (37%) and germany (33%). Most adults, regardless of country, felt they had an optimal diet and were adequate in both omega-3s and vitamin d. while we do not have an estimated average requirement level for omega-3s, we know that the dietary data indicate approximately 70% of us children and adults fail to meet the estimated average requirement for vitamin d, even with the use of dietary supplements.6 very little is known about the omega-3 intakes of americans, but on average, us adults consume 3.5 oz of fish per week, less than half the recommended amount (8 oz) from the 2010 dietary guidelines.16 fish and seafood consumption at recommended levels to obtain adequate omega-3s can be quite costly, and cost has been associated with achieving healthy eating index recommendations for these foods.18 furthermore, concerns about mercury may limit the intakes of fish for certain population groups such as children and pregnant and lactating females . The results of the gnha nutrition survey are consistent with nationally representative survey data in the united states (nhanes 20072010) that have indicated people choose supplements because they believe they will help promote overall health.3 currently in the united states, omega-3 dietary supplements are the third most common product choice,3 whereas the nutrition business journal lists fish and animals oils as the seventh highest in dietary supplement sales in 2013 (sales at $1168 million annually).19 cardiovascular disease remains the leading cause of mortality in all 3 of the countries sampled in this report.20 the american heart association recommends that individuals with signs of coronary heart disease consume 1000 mg of omega-3 fatty acids per day one in 3 women and 1 in 4 men older than 50 years will experience a bone fracture.21 given the rapid global aging of our population, modifiable factors that contribute to maintaining bone health are of utmost public health importance.15 vitamin d is critical to maintain bone health and has consistently been identified as a nutrient of public health concern . Our data indicate that most adults (84%) understand the importance of vitamin d for bones but that many are not actively using supplements to achieve recommended levels, particularly in the united kingdom and germany . Vitamin d can be synthesized from uv radiation (ie, sunlight); however, public health professionals caution against extended sun exposure because of the increased likelihood of cancer . For most findings in our study, us adults reported more dietary supplement use and had stronger perceptions about the health effects of omega-3s and vitamin d than did their counterparts in the united kingdom and germany . Nevertheless, the consistent findings across all countries were that adults are aware of the importance of nutrition, and most adults believe their diet is optimal for health . The widespread burden of chronic diseases across all countries sampled, such as obesity, diabetes, and cardiovascular disease, does not suggest that adults are indeed consuming optimal diets as they may believe . Our data serve to alert dietitians and other health professionals that consumers may have an elevated sense of the healthfulness of their own diets and may require guidance and education to achieve optimal diets . The gnha nutrition survey had equal representation from 3 large, developed countries with documented extensive use of dietary supplements from previous reports . As such, we cannot be sure of the extent of bias associated with the reporting . The use of an electronic format automatically eliminates anyone from participating without an e - mail address and those who are illiterate.
|
Microglia - mediated neuroinflammation and t cell infiltration constitute major hallmarks for neurodegeneration, yet the molecular and cellular crosstalk between microglia and t cells is poorly understood . Lipopolysaccharide (lps) from rhodobacter sphaeroides (lps - rs) is a potent tlr4 antagonist in both human and murine cells and prevents tlr4 mediated inflammation . Lps - rs is a penta - acylated lipid a and utilizes two distinct mechanisms to block lps / tlr4 signaling . The mechanism involves direct competition between underacylated lipid a and hexa - acylated lipid a for binding on md-2, whereas another mechanism implies the ability of penta - acylated lipid a: md-2 complexes to inhibit hexa - acylated endotoxin: md-2 complexes and tlr4 functions [25]. A critical question is asked whether lps - rs can be employed to fine - tune the major hallmarks of microglia - mediated inflammation, phagocytosis, and t cell activation . In resting state, microglia performs maintenance and immune surveillance but activation either by injury or immune stimuli triggers neuroinflammation resulting in neurotoxicity . Microglia expressed toll - like receptors (tlrs) trigger or resolve inflammation and injury and tlr4 is reported to exacerbate microglial activation, neuroinflammation, and lymphocyte infiltration resulting in neurodegeneration [7, 8]. Tlr4 functions as receptor for bacterial lipopolysaccharide (lps) and other endogenous molecules like hsp 70, hsp60, amyloid beta, -synuclein, and so forth . In the study, lps is taken as an exemplary ligand for tlr4 to elucidate immune regulation at molecular and cellular levels . Involvement of the receptor is known in alzheimer's disease (ad) and parkinson's disease (pd) [10, 11] and deficiency protects mice against neurodegeneration following injury [12, 13]. Receptor ligation on antigen presenting cells including microglia would present the processed antigen to the cells of adaptive immune response including the t cells . The microenvironment generated during the course of antigen presentation and inflammation dictates the outcome of t cell response . The event leads to the priming and recruitment of t cells through a series of coordinated events . The infiltrating t cells can critically influence the outcome of neurodegeneration that is either resolving it and/or exacerbating it through microglia activation and/or suppression . The inflammatory subset of t cells including th1 and th17 strongly contributes to chronic neuroinflammation, perpetuating neurodegenerative processes, whereas the immunosuppressive tregs decrease inflammatory functions with neurosupportive microenvironment . Realizing the fact that t cell response can govern the fate of neurodegeneration progression or resolution, in this regard, the fate of t cell subset differentiation by lps - rs was explicated in detail . Bv2 microglia is used as an in vitro model to dissect molecular mechanism of lps - rs mediated tlr4 antagonism . Lps - rs has been reported to be nontoxic in rodents [4, 17]. The study gains insight into the mechanisms of lps - rs mediated regulation of signaling pathways, prevention of neuroinflammation, and subsequent decrease of neuronal loss following aberrant apoptosis and phagocytosis . Anirban basu, nbrc, india and mouse neuro2a cell line obtained from national centre for cell science (nccs), pune, india were used . The cell lines were maintained in dmem, 10% heat inactivated fetal bovine serum (fbs), and supplements under appropriate conditions . For the experiments, cells were washed twice and pretreated with ultrapure lps - rs (invivogen), sb202190-p38 mapk inhibitor (10 m), pd184352-erk1/2 inhibitor (5 m), sp600125-jnk inhibitor (10 m), and curcumin - nf-b signaling inhibitor (10 m) (all from sigma - aldrich) in 1% fbs containing dmem for 2 hrs followed by lps - tlr4 ligand (1 g / ml) (sigma - aldrich). Total rna was extracted and quantified and 1 g of total rna was used for cdna synthesis . The cdna for indicated genes were amplified using gene specific primers (see supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2015/361326) under following conditions: 95c for 5 min, 95c for 30 seconds, annealing at 5560c for 45 seconds, and 72c for 1 minute for a total of 2030 cycles (for different genes) followed by final extension at 72c for 10 minute and each sample was amplified for -actin to ensure equal cdna input . Expression and phosphorylation of the proteins were assayed by western blot as described using specific primary antibodies: rabbit anti - tlr4, mouse anti - phospho - p38, rabbit anti - phospho - erk1/2, rabbit anti - phospho - jnk1/2, rabbit anti - p38, rabbit anti - erk1/2, mouse anti - jnk1/2, mouse anti - p - nf-b, rabbit anti - bax, rabbit anti - bcl2, and mouse anti--actin at 1: 1000 dilution . The nitrite production was examined using griess reagent (sigma - aldrich) as described previously . Cell viability was measured using mtt assay (sigma - aldrich) as per manufacturer's guidelines . Briefly, neuro2a cells were plated and differentiated on coverslips as previously described . Bv2 microglia cells were plated simultaneously in 24-well culture plates and pretreated with lps - rs (5 g / ml) and then stimulated with lps (1 g / ml) for 48 hrs . Then, the neuron - containing coverslips (cell - side down) were moved into the microglia - seeded well, allowing neurons and microglia to share the same culture media, but without direct cell - cell contact (using three equally spaced small paraffin feet). The coverslips were moved out and neuronal viability was assessed using mtt assay . Morphologic examination of neurons was done under inverted phase - contrast microscope (olympus). Briefly, bv2 cells were grown for 24 hrs and then treated as indicated followed by 1 g / ml lps treatment for 60 min . After washing, cells were fixed with 1% paraformaldehyde for 5 min at room temperature and then permeabilized with pbst (pbs containing 0.2% triton x-100). After blocking in the blocking buffer (2% bsa in pbst) for 2 hrs the cells were sequentially incubated with mouse anti - nf-b p65 antibody (invitrogen) and secondary antibody anti - mouse igg (alexa fluor 488). 4,6-diamidino-2-phenylindole (dapi 1 g / ml) was used to visualize nucleus and cells were examined under fluorescence microscope (olympus). Measurement of intracellular e. coli dh5 was used to determine the phagocytosis ability as described . Briefly, bv2 cells were pretreated with lps - rs or cyto - d for 2 hrs followed by lps treatment for 24 hrs . Cells were washed twice and infected with e. coli for 30 minutes and the extracellular bacteria were washed and killed with gentamicin (100 g / ml). The cells were washed, lysed, and plated overnight on luria - bertani agar and colony forming unit (cfu) was calculated . In parallel experiment, phagocytic activity was evaluated by fluorescence microscopy . In brief, for staining of e. coli dh5 with dapi, the e. coli dh5 were incubated with dapi (1 g / ml) for 5 min and extracellular dapi was removed by 4 times washing at 12,000 g for 3 min at 25c . Then microglial cells were infected with dapi stained e. coli dh5 for 30 min followed by three washes with pbs and phagocytosis was evaluated by fluorescence microscopy at 40x magnification . We examined the role of tlr4 in microglia - mediated neuroinflammation and neuronal cell death . Briefly, bv2 microglia were transfected under serum - free conditions with tlr4 sirna or control sirna (1 g / ml). Tlr4 sirna sequence (sense 5-gga acu ugg aaa agu uug-3) and control sirna (sense 5-gug cac aug agu gag au uu-3) in psilencer 4.1-cmv neo sirna expression vector were used as described previously and transfected using lipofectamine 2000 (invitrogen), according to the manufacturer's instructions . After overnight incubation the medium was replaced and the cultures were continued for 48 hrs before the assays were performed . The experiments of splenocytes from c57bl/6 mice were performed as per the guidelines and protocol approval by committee for the purpose of control and supervision of experiments on animals (cpcsea). Rbc depleted splenocytes were pretreated either with or without lps - rs followed by lps treatment for 72 hrs . The cells were then analysed for proliferation using mtt assay, treg population using flow cytometry, and cytokines using elisa . For rt - pcr cd4 t cells were isolated following negative selection using streptavidin - imag beads . To confirm the immunosuppressive function of treg cells, cd4 t cells were treated with recombinant (r) il-2 in presence or absence of ril-10 and the supernatants were used for pretreatment of microglia followed by stimulation with lps, and the inflammatory function of microglia was determined by measurement of tnf- and no . Mouse regulatory t cell staining kit was used for staining as per the manufacturer's instructions (ebioscience). Cd4cd25 cells were gated and the expression of treg specific marker foxp3 was determined using cellquest software . Cytokines in the culture supernatants were detected using elisa for the indicated cytokines as per manufacturer's guideline (ebioscience). Each individual experiment was repeated a minimum of three times and the statistical significance of differences between groups was determined by one - way anova followed by tukey's post hoc multiple comparison tests . The data were expressed as mean sem from three independent experiments . A statistical p value less than 0.05 (p 0.05) was considered significant (p 0.05 versus untreated control and p 0.05 versus cells treated with lps). We investigated the effect of lps - rs mediated regulation of lps induced microglia activation, expression of tlr4, and inflammatory cytokines . Bv2 microglial cells were pretreated with lps - rs (0.55 g / ml) for 2 hrs followed by treatment with lps (1 g / ml) and expression of tlr4 was analyzed by rt - pcr (6 hrs) (figure 1(a)) and tlr4 western blot (24 hrs) (figure 1(b)). The concentrations of lps - rs used did not induce cytotoxicity and no and tnf- production (figures 1(c) and 1(d)). Lps - rs significantly decreased tlr4 induced cytokines tnf-, il-1, and il-6 (figure 1(e)) and inflammatory genes inos and cox-2 (figure 1(f)) accompanied with decreased no and tnf- production (figures 1(g) and 1(h)). Microglial morphology data provides evidence that lps - rs ameliorate microglia activation as ramified morphology was regained (supplemental figures s1a, s1b, and s1c). These data indicate that lps - rs exhibited a broad spectrum of inhibitory effects on microglia activation and production of inflammatory mediators . Nf-b phosphorylation and nuclear translocation are important events that trigger transcription of inflammatory genes [18, 24]. Lps - rs significantly inhibited lps induced phosphorylation and nuclear translocation of p-65 nf-b in a dose dependent manner (figures 2(a) and 2(b) and supplemental figure s2). Mapks, playing an important role in the microglia activation and inflammation, are considered potential targets for treatment of neuroinflammatory diseases [18, 20, 2527]. We examined the regulatory effects of lps - rs on mapk pathways in dose and time dependent manner . Lps - rs inhibits lps - induced phosphorylation of jnk 1/2 and p38 mapks but left erk 1/2 unaltered (figures 2(c) and 2(d)). Consequent to the above observations, the essentiality of these pathways was determined using inhibitors and the nf-b and jnk1/2 were found to be indispensable for lps induced no and tnf- secretion (figures 2(e) and 2(f)). Collectively, the results suggest that lps - rs prevents neuroinflammation through negative regulation of nf-b and/or mapks . It is well documented that activated microglia significantly contributes neuronal apoptosis and subsequent clearance [10, 28]. Aberrant activation of microglia initiates a series of inflammatory cascades that leads to deregulated apoptosis . In neuro2a - bv2 microglia coculture, lps activated microglia induces neuronal cell death which was inhibited significantly by lps - rs (figures 3(a) and 3(b)). Lps - rs, did not induce neuronal cell death in the differentiated neuro2a cells (data not shown). Lps activated microglia - induced abnormal neuronal morphology together with fragmentation of neurites and shrunken cell bodies, which were significantly inhibited by lps - rs affirming its neuroprotective functions (figure 3(c)) including neurite length and cell perimeter (figures 3(d) and 3(e)). The effect of lps - rs on the intrinsic apoptotic pathway was investigated by determination of the bax: bcl-2 ratio . Exposure of differentiated neuro2a cells to supernatant from differentially treated microglia accounted for threefold decrease in the ratio that was significantly high during lps treatment (figure 3(f)) suggesting inhibition of apoptotic cell death . To examine and confirm the functional role of tlr4 in microglia - mediated neurotoxicity, the expression was silenced using sirna and expression level confirms silencing (figure 3(g)). Tlr4 silencing attributes to decreased production of inflammatory mediators tnf- and no after lps treatment (supplemental figure s4). Exposure of differentiated neuro2a cells to the supernatant from control sirna and tlr4 sirna transfected lps stimulated microglia showed increased neuronal cell death in the control while the effect was significantly inhibited in tlr4 sirna transfectants . Cell viability: tlr4 sirna + lps: 75% 3.5, control sirna + lps: 30% 3, p <0.005 (figure 3(h)). To extrapolate our findings with an in vitro model of ad, we confirmed the potential role of lps - rs in rescuing amyloid induced neuroinflammation and neuronal loss (supplemental figure s5). Collectively, lps - rs and/or tlr4 silencing inhibits lps induced microglia - mediated neuronal apoptosis via inhibition of inflammation in the neuro2a - bv2 microglia coculture system . Microglia plays crucial role in phagocytosis of apoptotic or dead neurons, studies have demonstrated that the mechanisms involve either eat - me signal on the target cell or coreceptor on the microglia cell surface . Modulation of phagocytosis is important to prevent neurodegenerative processes; hence, we examined whether phagocytic activity of microglia can be regulated by lps - rs . Unstimulated cells ingested low number of bacteria (10 10 cfu / ml) while lps activated microglia ingested highest number of bacteria (80 10 cfu / ml; p <0.0002). Microglia pretreated with lps - rs phagocytosed significantly less number of bacteria (25 10 cfu / ml; p <0.0002) and the phagocytic inhibitor cytochalasin d pretreatment acted as a positive control with least number of ingested bacteria (8 10 cfu / ml; p <0.0002) (figure 4(a)). Microscopic analysis of labeled bacteria confirms the inhibitory potential of lps - rs for phagocytosis which is otherwise aberrantly activated upon tlr4 activation (figure 4(b)). The data indicates that lps - rs inhibits lps induced microglial phagocytic activity that may serve as a key and sole strategy to prevent neurodegeneration . Appropriate antigen processing and presentation are the key governing factors that orchestrate the t cell response . During the neuroinflammatory burden the t cells are biased to be activated, aggravating the problem . The governing factors deciding the fate of t cell differentiation are expression of costimulatory molecules and chemokine receptors accompanied with release of cytokines: the releases of chemoattractants, chemokines, and guide t cells infiltration to the site of injury / infection . Lps induced elevated levels of the key costimulatory molecules and activation markers cd80, cd86, and cd40 were negatively regulated upon pretreatment with lps - rs (figure 5(a)). Lps - rs however did not show significant modulation in the expression of mhc - ii gene . Researchers have highlighted the fact that tlr4 is indispensable for leukocyte recruitment into brain in response to lps and upregulated expression of ccr5 in neurological diseases is often immunolocalized in microglia . We report similar observation that lps stimulation results in significantly elevated expression of ccr5 which was downregulated by lps - rs . The chemokines, including mip-1 and ccl5, are the major activator and chemoattractants for monocytes and t cells and were significantly inhibited by lps - rs (figure 5(b)). Our finding indicates that lps - rs mediate inhibition of gene expression of these costimulatory molecules, chemokines, and chemokines receptor which may govern microglia - t cell interaction and t cell infiltration into the brain . The activation state (activated or tolerogenic) of the antigen presenting cells and subsequent events dictate adaptive immune functions . Tolerogenic apcs can be potential target to design and direct effective strategy to regulate inflammatory and pathogenic t cells . We have tried to understand the activating / tolerogenic effect of lps - rs in splenocyte cultures that may regulate the t cell outcome . Lps - rs resulted in approximately 3-fold lesser proliferation as compared to the cells activated by lps (figure 6(a)). To further correlate reduced proliferation with functional markers for the t cells, lps remarkably induced transcription factors and cytokines for th1 (tbet and ifn-) and th17 (ror- and il-17) cells . Interestingly, pretreatment with lps - rs demonstrated that t cells differentiated to treg lineage as evidenced by its signature transcription factor and cytokines (foxp3, tgf-, and il-10) (figures 6(b)6(f)). To confirm the phenotype, the cells from parallel experiment were analysed for treg surface marker (foxp3) using flow cytometry . Lps - rs pretreatment significantly enhanced foxp3 expression (40%) on cd4cd25 gated cells as compared to lps stimulation alone (figure 6(g)). The generation of t regulatory cells during lps - rs pretreatment can be a possible reason for reduced proliferation [33, 34]. Taken together, the data suggest that lps treatment directs th1/th17 differentiation while pretreatment with lps - rs confers induction of tregs cells . T regulatory cells are known to potent suppressors of the adaptive immune system and also modulate innate immune cells through induction of alternative activation of macrophages . Studies have shown that foxp3cd4 treg cells play crucial role in maintenance of immunological homeostasis and tolerance in t lymphocytes and macrophages . Several studies have shown that alternative (anti - inflammatory / tolerogenic) activation of microglia is a beneficial response to cns injury [36, 37]. Cellular factors influencing microglial fate include cns infiltrating t cells amongst others . Infiltrating cd4 t - cells participate and influence microglial activation and consequent neuronal damage . Microglia may acquire inflammatory neurotoxic phenotype or immunosuppressive neurosupportive phenotype [15, 38]. To examine whether immunosuppressive and/or tolerogenic potential of treg cells manipulate activation state of microglia, we used anti - cd3/cd28 stimulated cd4 t cells and treated them in presence or absence of ril-10 along with ril-2 . The cells treated with ril-2 in absence of ril-10 showed enhanced proliferation and absence of treg phenotype while the cell treated with r - il-2 in presence of ril-10 demonstrated reduced t cell proliferation and expressed treg marker (foxp3) (data not shown). The supernatants from the experiment were collected and were used to pretreat microglia followed by lps stimulation . The supernatant from ril-10 induced treg cells significantly decreased secretion of no and tnf- from microglia as compared to control (figures 7(a) and 7(b)). The results indicate that ril-10 induced treg cells negatively regulate inflammatory function of microglia and render them to gain immunosuppressive or tolerogenic functions . In brain pathology, inflammation causes bystander injury that is typically irreversible followed by sustained neuronal and cognitive function loss . The cns exhibits tlrs, including tlr4, has predominant expression on microglia, and initiates typical response to cns infection or injury [10, 12, 28, 39]. However, in some cases activation of microglia contributes to neurodegeneration by releasing inflammatory and cytotoxic factors, including nitric oxide and tnf- as in ad and pd [18, 40]. Reports highlight the fact that upregulated tlr4 initiates inflammation and increases phagocytic activity of microglia followed by neuronal loss in ad and pd [10, 12, 39]. Tlr4 deficiency protects mice against neurodegeneration and showed increased survival of neurons confirming the involvement of the receptor . Mutation in the receptor decreases microglial activation and preserves cognitive functions in mouse model of ad . Thus, tlr4 activation is the major culprit for microglia - mediated neuronal loss as demonstrated by many leading groups . In the same context, our study using a tlr4 antagonist, lps - rs, reveals that lps - rs markedly inhibits tlr4 expression with substantial and subsequent decrease of inflammatory mediators including il-1, tnf-, il-6, inos, and cox-2 . Our findings are supported by studies that highlighted the deficiency and mutation in tlr4 benefits in preserving cognitive functions and better neuronal well - being [13, 14]. Elevated activation of nf-b and mapks is directly involved in pathogenic events of ad and pd [18, 20, 2427, 41]. Nf-b exists in the cytosol as a dimer of p-65 nf-b and ib, an associated inhibitory protein . Upon activation the phosphorylated p-65 nf-b translocates to the nucleus inducing a cascade of inflammatory genes [42, 43]. In addition to nf-b, mapks, playing an important role in the microglia activation and secretion of inflammatory mediators, are considered potential targets for treatment of neuroinflammatory diseases [26, 27]. In this regard, our findings indicate that lps - rs significantly blocks lps induced phosphorylation of mapks and nf-b p65 . Thus, lps - rs can be exploited as possible mechanisms for better treatment regimes . Activated microglia through inflammation influences neuronal apoptosis and progression of neurodegenerative diseases [6, 12, 28, 44]. Using neuro2a - bv2 microglia coculture we report that lps induced microglial neurotoxicity was significantly inhibited by lps - rs and the protective effects might be due to its inhibitory action on aberrant neurotoxic activation . Pretreatment with lps - rs neuro2a cells exposed to supernatant from lps activated microglia resulting in better neuronal survival . To confirm the role of tlr4 in microglial activation and neurodegenerative processes silencing of tlr4 was sufficient to confirm its role in inflammatory neuronal loss and was confirmed with amyloid as well . Our findings are consistent with the evidence that reports neuroprotective effects of tlr4 antagonism in spinal cord and mouse model of neurodegeneration . We have exemplified with a strong background that lps - rs is a potential candidate to recover tlr4 mediated neuronal damage . Damaged, dead, or dying neurons are phagocytosed by microglia to maintain homeostasis in the cns but aberrantly activated microglia fails to discriminate between live and damaged / dead neurons, resulting in phagocytic removal of live neurons, contributing to significant neurodegeneration [8, 18, 44]. Recent study has shown that loss of neurons during inflammation, executed by microglial phagocytosis and its inhibition, is sufficient to prevent inflammatory neuronal death . In this regard, we have explored the potential of lps - rs as phagocytic inhibitor and demonstrate that it significantly blocks phagocytosis of e. coli dh5 in lps activated microglia, as analysed by fluorescent microscopy and cfu of ingested e. coli dh5. The results provide a novel mechanism of lps - rs antagonism which has never been explored earlier and may provide excellent therapeutic strategy . Furthermore, cns infection and/or injury initiates leukocyte trafficking in the brain that has earlier been reported to worsen disease outcome . However, there are still discrepancies in the reports [15, 31, 46, 47]. The cd4cd25 regulatory t cells have neuroprotective activities through regulation of microglia activation and t cell functions by secreting immunosuppressive cytokines [48, 49]. In this regard our data we demonstrate that tlr4 antagonism by lps - rs not only rescues microglia - mediated inflammatory events but also results in treg induction, and the findings are also supported by other studies . Naturally occurring treg cells express foxp3, the key regulator of treg cell development and function; studies using treg therefore, t reg cells can mediate their actions by attenuating inflammatory responses, thus ameliorating neuronal degeneration, yet the exact mechanism of their actions in the injured cns is poorly understood . To provide a better understanding in this context, using the conditioned cytokines we have shown that tregs can transfer their tolerogenic functions to microglia as evidenced by decreased tnf- and no production . Our data strongly recommend that tlr4 antagonism can be a strategy providing neuroprotection through regulation of microglia as well as the t cells . Conclusively, the study reports that lps - rs prevents tlr4 induced neuroinflammation and microglia activation via negative regulation of nf-b and mapks signaling pathways conferring decreased neuronal apoptosis and subsequent phagocytosis by the microglia . Lps - rs through tlr4 antagonism not only regulates microglial function but also may serve to induce treg cells that support the tolerogenic microenvironment and further strategies may be designed and implemented not only for cns diseases but also for other disease regimens.
|
In today's cost - conscious health care environment, equity and efficiency are becoming increasingly important considerations in managing and evaluating health care systems, especially as pressure to contain further growth in health care expenditures increases . Equity and efficiency are an integral and essential part of a well functioning health care system . Equitable and efficient health care systems will identify those in need of care, allow timely access to appropriate providers for adequate level of care, and protect service users against the risk of high expenditures . An efficient health care system will also induce proper and cost - effective provider and consumer behaviors through appropriate payment and benefit design . Among many sectors of health care, the mh / sa care system has been particularly challenged with problems in equity and efficiency . Studies have documented that access in mh / sa remains a serious problem . Not only is mh / sa care manpower concentrated in certain areas, but also the geographic distribution of mh / sa care facilities is very uneven in the united states . In terms of service use, many studies raise concerns over an inefficient and inequitable pattern; underutilization of services among the severely ill and vulnerable population and potential overutilization of care among the less serious may indicate problems in the system (frank and lave, 1986, lave and frank, 1988). Faced with many challenges, players in the mh / sa care system have searched, and continue to search, for ways to enhance the system's equity and efficiency . Significant legislative progress toward a more equitable provision of mh / sa care recently took place at the federal level through the mental health parity act of 1996 (public law 104 - 204). Taking effect on january 1998, the act requires that mental benefit provisions be no more restrictive than medical / surgical benefits in group health plans with 50 or more employees . At the state level, 13 states had already enacted a statewide mental illness parity laws, while three additional states enacted a parity law applicable only to state employees (american managed behavioral healthcare association, 1997a). Another notable activity in the current mh / sa market is the proliferation of new delivery and payment models, i.e., managed behavioral health care . Nearly absent a couple of decades ago, the managed behavioral health industry is estimated to cover approximately 170 million americans for their mh / sa care in 1997 (american managed behavioral healthcare association, 1997b). And growth is expected to continue as more state medicaid programs adopt a managed behavioral care model . In such a dynamic and evolving market, we need to appraise the impact of new developments on access, use, and financing of mh / sa care . Concomitant with the health care financing review's interest in mh / sa care research, this issue disseminates research findings on access, use, and financing of mh / sa care for vulnerable populations . From 1980 - 85, a comprehensive mh / sa epidemiological survey was conducted by the national institute of mental health (nimh). Known as the epidemiological catchment area (eca) study, the survey revealed a surprisingly high prevalence of mh / sa disorders in america . In a given month, about one in six adults are found to have a mh / sa disorder, and approximately one in four adult americans meet the criteria for mh / sa disorder during a year . Equally surprising was that, of the population with mh / sa disorders, only one - half of them received mh / sa care at all, and less than one in three receive care within 1 year (reiger et al ., 1993). Mental disorders encompass a broad range of conditions with different degrees of debilitating effects . As such, prevalence alone does not adequately depict the problems in mh / sa care need in america . Based on the eca study conducted between 1980 and 1985, the nimh estimates some five million adults are suffering from often incapacitating severe mental disorders, such as schizophrenia, manic - depressive illness, major depression, panic disorder, and obsessive - compulsive disorder . It was reported that about 60 percent of the persons with severe mh / sa disorders received care (goodwin et al ., 1993). A recent nationally representative survey, the national comorbidity survey reconfirmed this figure (kesseler et al . Prevalence of severe mh / sa disorders among children are not as well understood . However, according to a recent survey, mental disorders in child and adolescent populations (meca), 3.2 percent of the sample adolescent population had a severe mh / sa disorder (national institute for mental health, 1993). Accurate assessment of the need for hm / sa care is an essential guide in formulating a policy that allocates resources efficiently and equitably . Especially in today's changing health care market, we have to know what the current need is and to what extent these vulnerable population receive care . Changing population characteristics and family and social structures necessitate continuous tracking of trends in need for mental health care . In an effort to assess the need and treatment in substance abuse care, this issue features an article by woodward and colleagues . This article presents new estimates of the numbers of persons in this country who need and receive substance abuse treatment . Additionally, a summary of mental health data from the medicare current beneficiary survey (mcbs) round 13 is featured . As previously discussed, the epidemiological evidence clearly indicates we have serious problems with unmet needs among vulnerable populations . More than any other factors, the unequal provisions of mental health benefits in health insurance seems to have perpetuated this problem . Rightfully fearing that generous mh / sa benefit would draw unfavorable selection, many private health insurance plans limited their mh / sa care benefits over time (schuttinga, falik, and steinwald, 1985). If the mental health parity act can restore equity in the provision of mh / sa benefits, it would considerably alleviate the inequity problem . With the rising concern over the health care expenditure inflation, we need to be more resourceful in planning and allocating resources . (1990) estimated the total expenditure for mh / sa in this country to be as much as $67 billion in 1990 . This amounts to approximately one - tenth of the total national expenditure on health care for the same year . Studies indicate evidence of an inefficient pattern of service utilization in mh / sa care: underutilization of services among the severely ill and potential overutilization of care among the less serious . To enhance equity and efficiency in the system, it is important to monitor patterns of service utilization . In this issue of the review, there are a number of articles related to mh / sa service utilization in medicare and medicaid . Rosenbach and ammering analyze medicare's impact of mental health outpatient coverage expansion on utilization and expenditure between 1987 and 1992 . Ettner and hermann examine the pattern of mental health specialist use in medicare, and report the factors that influence specialist use . An article by slifkin and colleagues proposes a reimbursement system for the care of the mentally retarded in intermediate care facilities . An article by cano, hennessy, warren, and lubitz presents information on demographic, diagnostic, utilization, and expenditure characteristics associated with inpatient psychiatric care among medicare beneficiaries in 1995 . The most sweeping change in the recent mh / sa system is the proliferation of managed mental health care . Survey data show that the industry nearly doubled in covered lives between 1993 and 1997; the latest estimate puts the enrollment figure at approximately 170 million in 1997 (american association for marriage and family therapy, 1996,american managed behavioral healthcare association, 1997b). This means approximately two - thirds (68 percent) of the insured population are enrolled in a managed mh / sa care plan . This industry's phenomenal expansion was driven, in part, by implementation of medicaid waivers in many states, a trend which seems certain to persist for the next several years . A total of 28 states and the district of columbia have implemented some form of managed mh / sa care waiver . Nine states already received approval on their waiver requests, and ten additional states have pending waiver requests with various managed mh / sa care provisions . The managed mh / sa care contracts typically feature such characteristics as carved - out mh / sa benefits, person - level capitated budgets, risk sharing arrangements, and case management . Compared with the incentives in indemnity insurance, each feature of the managed care contract can differently impact the utilization, financing, and outcome of the mh / sa care . At a time when the managed behavioral health system is emerging as the dominant mh / sa care delivery model, timely evaluation of its performance the third group of articles in this issue address this issue both empirically and theoretically . An article by stoner and colleagues evaluates a capitation payment demonstration in the community mental health centers (cmhcs) in the utah medicaid program . The authors report how capitation affected utilization and expenditures in three cmhcs . Using afdc carve - out experience from massachusetts, norton, lindrooth, and dickey investigate whether the managed mh / sa care vendor shifted costs to the medical care sector . The findings from this relatively mature managed public program will be of great interest to other states that are at an early stage of managed behavioral care contracting . Based on economic theory, frank and colleagues address the problem of adverse selection in the context of behavioral health care, and offers an explanation of why carve - out and cost sharing two key features of managed behavioral contracts offer a solution to this problem . The mh / sa care system in america is undergoing a sweeping transformation . While shifting demographics and social and family structure affect the need for mh / sa care, new financing and delivery models are emerging in both the private and public sector . In this highly dynamic and often uncertain era the articles presented in this issue of the review describe, analyze, and evaluate the transformations that are taking place in the mh / sa care system . It is our hope that such research activities ultimately help shape a more equitable and efficient mh / sa care system.
|
The marketing, distribution, prescription and use of drugs in a society, with special emphasis on resulting medical, social and economic consequences is known as drug utilization research . It is an important tool to study the clinical use of drugs in populations and its impact on health - care system . The critical care unit (ccu) is a setting where the multiple medications are prescribed to patients . The costs of hospitalization and treatment are high in ccu as patients are seriously ill and often suffer from the chronic critical illnesses . Ccu services use higher economic resources due to frequent use of high priced drugs and antimicrobial agents . Due to availability of limited funds in developing countries, drugs should be prescribed rationally so that the available funds can be utilized optimally . The ccu is considered as the epicenter of antimicrobial resistance and it is an important problem influencing patient outcomes . Incidence of poor treatment response and adverse reactions increase due to critical conditions of patients and use of multiple medications with altered pharmacokinetic and pharmacodynamic conditions . Periodic evaluation of drug utilization in the ccu is necessary for optimization of health care system, proper use of resources and making prescription policy . The assumed average maintenance dose per day for a drug used for its main indication in adults is called defined daily dose (ddd). Use of ddd is an important tool to compare the drug utilization among different clinical setups within a country and between different countries . Ddd/100 bed - days provide a rough estimate of drug consumption in hospital inpatients and it is a fixed unit of measurement independent of formulation and price . In the present study, we have evaluated the drug utilization pattern and calculated the ddd for the drugs used in ccu of a tertiary care hospital . A retrospective study was carried out, after the permission from institutional review board, government medical college, bhavnagar, gujarat, india . Indoor case papers of the patients admitted in ccu between january 2008 and december 2010 were collected from the medical record section of sir takhtsinhji general hospital, bhavnagar, gujarat, india . Data were collected for age, gender, diagnosis, duration of ccu stay, laboratory investigations and treatment provided during the stay in ccu . Culture and sensitivity reports and adverse drug reaction if mentioned in case papers were also noted . Data were analyzed for demographic variables; indication of admission in ccu and systems involved; duration of ccu stay; total number of drugs prescribed per patient; proportion of common group and particular drugs used; the total number of antimicrobials and inotropes used per patient; use of fixed dose combinations (fdcs); use of generic and brand drugs; use of oral and parenteral formulations; use of the five most costliest drugs; organisms isolated and their antimicrobial sensitivity and outcome of the patient . Total cost of drugs per patient was calculated from the indian drug review (2010). Total cost of laboratory investigations per patient was calculated according to the price list of bhavnagar pathologist association . The drugs were classified according to the anatomical therapeutic chemical classification based on their chemical, pharmacological and therapeutic properties . Ddd/100 bed - days were calculated using the following equation: in our ccu, bed strength was 10 and average bed occupancy rate was 0.6 during the study period . Data were expressed as proportions and mean (95% confidence interval [ci]). Comparisons of the total number of drugs prescribed per patient; duration of ccu stay; and cost of total treatment, antimicrobials and inotropes per patient were performed using the kruskal - wallis test followed by dunn's multiple comparison test between patients admitted with medical, surgical and medical + surgical indications . Same parameters were compared between survived and expired patients using mann - whitney u - test . Data were expressed as proportions and mean (95% confidence interval [ci]). Comparisons of the total number of drugs prescribed per patient; duration of ccu stay; and cost of total treatment, antimicrobials and inotropes per patient were performed using the kruskal - wallis test followed by dunn's multiple comparison test between patients admitted with medical, surgical and medical + surgical indications . Same parameters were compared between survived and expired patients using mann - whitney u - test . 2 (0.5%) patients were below 12 years; 221 (55.67%) patients were between 12 and 49 years and 174 (43.83%) patients were above 49 years of age group . The mean age of admitted patients was 44.62 years (95% ci: 42.56 - 46.69 years). A total 246 (61.96%) patients were male and 151 (38.04%) were female . Total 278 (70.03%), 71 (17.88%) and 48 (12.09%) patients were admitted with medical, surgical and medical + surgical indications respectively . The common indications for the admission were septicemia (35.37%), head injury (32.39%), complicated acute abdomen (25.35%), cardiovascular emergencies (21.94%) and organophosphate poisoning (17.27%). Total 170 (42.82%), 119 (29.97%) and 108 (27.21%) patients had one, two and more than two system involvement respectively . Cardio vascular (37.28%) was the most commonly involved system followed by gastro intestinal (36.52%), central nervous system (31.49%), respiratory (24.69%), renal (20.91%), hematology (17.63%), endocrine (8.82%) and genitourinary (2.77%). The average duration of ccu stay was 4.15 days (95% ci: 3.79 - 4.51 days). A total of 5377 drugs (86.57% parenteral and 9.60% oral formulations) were prescribed in all patients . The minimum and maximum number of drugs prescribed to a single patient was 2 and 28, respectively . The average number of drugs prescribed per patient was 13.54 (95% ci: 13.05 - 14.04). Total drug utilization in ccu during the study period in terms of ddd/100 bed - days was 226.27 . Metronidazole, cefotaxime, atropine, adrenaline, dopamine, dobutamine, etofylline + theophylline hydrate, ranitidine, metoclopramide and furosemide were prescribed in more than 30% of patients . Ceftriaxone, ciprofloxacin, noradrenaline, hydrocortisone, aspirin and pantoprazole were used in 10 - 30% of patients . Utilization pattern of various drugs and ddd/100 bed - days has been shown in table 1 . The commonly prescribed fdcs are described in table 2 . Among all the prescribed drugs, 18.48% were antimicrobials and 11.94% were inotropes . The antimicrobials and inotropes were used in 375 (94.45%) and 285 (71.79%) patients respectively . The average number of antimicrobials prescribed per patient was 2.50 (95% ci: 2.37 - 2.66). The average number of antimicrobials prescribed was significantly higher in expired than survived patients (2.80 [95% ci: 2.61 - 2.30] vs. 1.84 [95% ci: 1.7 - 2.06]; p <0.05). The average number of inotropes prescribed per patient was 1.62 (95% ci: 1.49 - 1.75). Cefotaxime + metronidazole (26.70%), ceftriaxone + metronidazole (16.88%), cefotaxime + gentamicin (7.81%) and ceftriaxone + gentamicin (3.78%) were the commonly used empirical regimens . Change in antibiotic was performed in 10 cases (58.82%) based on isolated organisms and their sensitivity pattern . Isolated organisms were klebsiella (40%), pseudomonas (20%), escherichia coli (10%), staphylococcus aureus (10%), candida (10%), proteus vulgaris (5%) and acinobactum (5%). Among 50% cases, s. aureus was sensitive to penicillin, oxacillin, cefazoline, ciprofloxacin, roxithromycin, tobramycin, amoxicillin + clavulanic acid, chloramphenicol and rifampicin . The sensitivity pattern of gram - negative organisms to various antimicrobials is shown in figure 1 . Utilization pattern of various drugs in ccu, atc code and ddd/100 bed - days most commonly prescribed fdcs sensitivity pattern of gram - negative organisms to various antimicrobial drugs the average total cost of treatment per patient was rs . Human - albumin, meropenem, methylprednisolone, piperacillin + tazobactum and enoxaparin sodium were the most costly drugs used in ccu . The total cost of treatment in medical + surgical indications was significantly higher than patients with medical and surgical indication alone (p <0.05). The comparison of the total number of drugs administered per patient, duration of ccu stay, cost per patient for total drugs, antimicrobials and inotropes in medical, surgical and medical + surgical indications are shown in table 3 . The mortality rate for patients admitted with medical, surgical and medical + surgical indications were 71.58%, 52.11% and 79.17%, respectively . Total number of drugs administered per patient, duration of ccu stay and total cost per patient for survived and expired patients are shown in table 4 . Comparison of the total number of drugs, duration of ccu stay in days, total cost per patient, antimicrobials cost per patient and inotropes drugs cost per patient between patient admitted with medical, surgical and medical+surgical indications comparison of the total number of drugs, duration of ccu stay in days, total cost per patient, antimicrobials cost per patient and inotropes drugs cost per patient between survived and expired cases male preponderance (61.96%) is observed and male: female is in accordance with the previous reports . Patients were admitted for medical and surgical indications due to unavailability of separate intensive care units in our hospital . The most common indication for admission septicemia is in contrast to previous studies, which had reported cancer, cardiovascular emergencies and chronic obstructive pulmonary disease . Head injury (32.39%), complicated cases of acute abdomen (25.35%) and cardiovascular emergencies (21.94%) were the other causes for admission in accordance with the previous studies . Total 57.18% patients were having more than one illness, which is similar to other published report . The average duration of ccu stay (4.15 days) is similar to shankar et al . Use of brand names (45.77%) and fdcs (7.21%) are comparatively lower in our study . However, use of parenteral drugs (86.57%) is higher than previous studies . The average total number of drugs prescribed per patient is higher than the reported in other studies . Use of the total number of drugs and parenteral formulations may be related with the general condition of the admitted patients in different ccu settings . Antimicrobial drugs (94.45%), antipeptic ulcer drugs (89.67%) and inotropes (71.79%) were the commonly utilized groups similar to john et al atropine was used in patients of organophosphate poisoning, as a premedication and for bradycardia in late stages of septic shock . In critical care setting, it does not prevent all episodes of bradycardia and vasodilation when used before intubation . Use of atropine is appropriate to counter bradycardia, cardiac hypo - oxygenation and hypoperfusion in septic shock . Dopamine, dobutamine and noradrenaline were used in combination with intravenous fluids for the patients of septic and cardiogenic shock . Inotropes are mainly effective in early stages of shock . Their late application for a prolonged period may harm the patient . There is no significant difference in mortality in patients of shock treated with dopamine and noradrenaline . Cephalosporins (73.30%), metronidazole (55.67%) and penicillins were the most commonly prescribed antimicrobials similar to previous studies . However, aminoglycosides, meropenom, fluoroquinolones and piperacillin + tazobactum were the most utilized antimicrobials in other setup . In our study, linezolid, meropenam, vancomycin, netilmycin and tobramycin were used as second line antimicrobials . Other studies had reported pseudomonas, e. coli and s. aureus . Our study showed lower utilization of antibiotic sensitivity testing than shalini et al . It is difficult to suggest the empirical antimicrobials for admitted patients due to underutilization of antibiotic sensitivity testing . The antimicrobial combination form the different classes should be considered for the septicemia due to high mortality . The empirical combination antibiotic regimen directed against gram - negative bacteria (carbapenem plus aminoglycoside or fluoroquinolone) reduces the initial inappropriate selection as compared to monotherapy alone . Amoniglycosides offer broader coverage than fluoroquinolones as combination agents for patients with this serious infection . The combination of carbapenems and aminoglycosides can be preferred in patients with severe sepsis and septic shock . There is an urgent need to enhance the utilization of antibiotic sensitivity testing for the better selection of antimicrobials and reduction of the mortality . Avoiding the use of unnecessary antibiotics helps to improve patient outcomes . In the present study preparation of antibiotic use policy helps in reduction in nosocomial infections and have a positive impact in the form of costs reductions . The average cost of treatment prescribed per patient [rs . 3225.7 ($57.74)] is higher in comparison with two studies by shankar et al . In nepal . However, cost of treatment was lower than the biswal et al . From india and inan et al . From turkey . Difference in the mean cost of treatment in our study than other studies may be due to variation in type and severity of the admitted patient, indications for the admission, different prescribing pattern or change in currency differences of various countries . This is due to the higher number of drugs used and duration of ccu stay . This may be because of a higher number of patients with septicemia, head injury, poisoning and unavailability of the separate intensive care units for medical and surgical patients . Being a retrospective nature it was not possible to assess the rationality and quality of prescriptions . However, it helps to create drug utilization database in a tertiary care teaching hospital of developing country lacking separate medical and surgical intensive care units . These data provides no direct link with the outcomes associated with the use of the various categories of drugs . Line of treatment and selection of drugs varied by the physician - to - physician and it provide no data for the same . Prescribing guideline is required to reduce the prevalent poly - pharmacy and to promote appropriate use of antimicrobial drugs based on the culture and sensitivity report.
|
Leishmania parasites are obligatory intracellular protozoa living in macrophages of humans and many other vertebrates . L. major is one of the main causes of the cutaneous form of the leishmaniasis in the world (1). Most of leishmania studies have yet been focused on leishmania itself or the immunogenicity and pathogenicity of the parasite when characterization of the lesion produced in cutaneous form of the disease is rarely addressed in these studies . Identifying the pro - inflammatory genes preferentially expressed during the parasite infection would help to elucidate the mechanisms controlling gene regulation and intracellular survival of the parasite where identifying and characterizing the expressed genes and the molecular mechanisms underlying their regulation can be considered as therapeutic targets (2). Studies using biopsy samples from human cases have suggested different chemokine patterns linked to the phenotype of leishmaniasis (3). In mice, various inflammatory mediators such as tnf-, il-1 and cc and cxc chemokines have been detected in in vitro and in vivo studies during l. major infections (4) however, it is still little known about the expression profiles of these mediators in leishmania infection . The profile of gene expression in macrophages varies in leishmania infection, entirely related to mechanisms applied by the macrophages to control the parasite (5). In leishmania lesions, pro - inflammatory cytokines such as il-1beta, ccl3 and ccl4 activates macrophages enhancing parasite killing (6) where the expression of pro - inflammatory genes is shown to be associated with time evolution of the lesions (7). On the other hand, neutrophils also play a crucial role in inflammatory responses and leishmania - specific immune responses to control the infections (8) and there is no report on the expression of pro - inflammatory genes in neutrophils in leishmania cases . In the present study, the expression of pro - inflammatory genes in leishmania infected mice in the lesion and neutrophils compared to see whether the situation of the lesion in leishmania cases can be predicted by determining the expression of these genes for therapeutic purposes . The standard iranian l. major promastigotes (mrho / ir/75/er) were obtained from pasteur institute of iran and cultured in biphasic nicol mac nalneavy (nnn) culture at 25 c and ph 5.5 for 47 d. the culture supernatant containing parasite promastigotes was transferred into rpmi- 1640 containing 100 u / ml of penicillin, 100 g / ml of streptomycin and 200 l / ml of fbs . Specific primers for ten proinflammatorygenes including ccl4, ccl3, tnf-, il-1, il-12p35, il-12p40, ccl5, ccr5, il-1 and ifn- were designed using the gene bank primer software . Sequence of primers designed for pro - inflammatory genes 812 week female balb / c mice were obtained from pasteur institute of iran and bred at bu - ali sina university animal house . All animals were housed in accordance with bu - ali sina university codes of practice for the housing and care of animals (code number 92385). Eight - weeks balb / c mice were purchased from pasteur institute of iran and housed in bu - ali sina university animal house according to the standard of ethical agreement for keeping inbred animals . L. major promastigots strain mhom/76/ir obtained from pasteur institute of iran and cultured in rpmi-1640 medium supplemented with 10% fcs . 1 10 leishmania promastigotes were intradermaly injected onto the base of the tail and the animals were divided into two groups of five mice . The first group was treated with 20 mg / kg glucantime half in the lesions and half intramuscularly . The size of the lesions was calculated using the following equation: p=(d+d)/2 (d = the large diameter, d = the small diameter, p = the average size of the lesion) haparinized blood samples taken from the heart of the mice were diluted with the equal volumes of nacl 0.85% . Meglumine compound (megluminediatrizoate 66%, sodium diatrizoate 10%) was diluted in 3 times of volume of nacl 0.85% and used for isolation of neutrophils . Five ml of the diluted blood were slowly added to 4ml of the diluted meglumine compound being careful not mixing the two phases of the blood and the meglumine compound . The samples were centrifuged for 15 min at 250 g and the supernatant was replaced with 0.5ml of pbs . Two 25-seconds hypotonic lyses were applied with distilled water and nacl 2.55% and the cells were then centrifuged for 5min at 200 g replacing the super - natant with nacl 0.85% . Total cell rna was isolated using denazist total rna isolation kit according to the manufacturer s instruction with modification . One ml of g1 lysing buffer was added and the sample was vortexed for 15 sec followed by incubation at room temperature for 5 minutes and centrifugation at 12,000 g for 10 minutes at 4 c . The supernatant was then transferred into a new tube and 200 l chloroform was added and vortexed for 15 sec . The tubes were incubated at room temperature for 3 min and then spined at 12,000 g for 15 min at 4 c . The top phase was transferred into a new tube and an equal volume of isopropanol was added . An equal volume of g2 buffer was added, mixed and incubated at room temperature for 10 min and then centrifuged at 10000 g for 10 min at 4 c . The supernatant was discarded and 1 ml of 70% ethanol was added to the pellet . After a quick vortex, the tubes were spined at 10000 g for 5 min at 4 c . The supernatant was then discarded and 30100 l of nuclease - free water was added . Rt - pcr was performed using denazist kit according to the manufacturer s instruction with slight modification . Rna - primer mixtures (total rna 10g, oligodt primer 1l, dntp 1l, nuclease - free water top up to 10l) was prepared and mixed . The mixture was incubated at 65 c for 5 min and chilled on ice for 2 min . The cdna synthesis mixture (10x buffer m - mulv 2l, m - mulv reverse transcriptase 100 unit, nuclease - free water top up to 10l) was prepared and 10l of the cdna synthesis mixture was added to each rna - primer mixture and incubated at 42 c for 60 min . The tubes were then incubated at 85 c for 5 min and chilled on ice . The pcr was programmed as 40 cycle of denaturation at 95 c for 30s, annealing temperature in accordance with melting temperature, lasted for 30sec, extension at 72 c for 20sec . An initial denaturation step at 95 c for 10 min before the cycles and a final extension step at 72 c for 20sec after the cycles were also applied . The standard iranian l. major promastigotes (mrho / ir/75/er) were obtained from pasteur institute of iran and cultured in biphasic nicol mac nalneavy (nnn) culture at 25 c and ph 5.5 for 47 d. the culture supernatant containing parasite promastigotes was transferred into rpmi- 1640 containing 100 u / ml of penicillin, 100 g / ml of streptomycin and 200 l / ml of fbs . Specific primers for ten proinflammatorygenes including ccl4, ccl3, tnf-, il-1, il-12p35, il-12p40, ccl5, ccr5, il-1 and ifn- were designed using the gene bank primer software . 812 week female balb / c mice were obtained from pasteur institute of iran and bred at bu - ali sina university animal house . All animals were housed in accordance with bu - ali sina university codes of practice for the housing and care of animals (code number 92385). Eight - weeks balb / c mice were purchased from pasteur institute of iran and housed in bu - ali sina university animal house according to the standard of ethical agreement for keeping inbred animals . L. major promastigots strain mhom/76/ir obtained from pasteur institute of iran and cultured in rpmi-1640 medium supplemented with 10% fcs . The first group was treated with 20 mg / kg glucantime half in the lesions and half intramuscularly . The size of the lesions was calculated using the following equation: p=(d+d)/2 (d = the large diameter, d = the small diameter, p = the average size of the lesion) haparinized blood samples taken from the heart of the mice were diluted with the equal volumes of nacl 0.85% . Meglumine compound (megluminediatrizoate 66%, sodium diatrizoate 10%) was diluted in 3 times of volume of nacl 0.85% and used for isolation of neutrophils . Five ml of the diluted blood were slowly added to 4ml of the diluted meglumine compound being careful not mixing the two phases of the blood and the meglumine compound . The samples were centrifuged for 15 min at 250 g and the supernatant was replaced with 0.5ml of pbs . Two 25-seconds hypotonic lyses were applied with distilled water and nacl 2.55% and the cells were then centrifuged for 5min at 200 g replacing the super - natant with nacl 0.85% . Total cell rna was isolated using denazist total rna isolation kit according to the manufacturer s instruction with modification . Briefly one ml of g1 lysing buffer was added and the sample was vortexed for 15 sec followed by incubation at room temperature for 5 minutes and centrifugation at 12,000 g for 10 minutes at 4 c . The supernatant was then transferred into a new tube and 200 l chloroform was added and vortexed for 15 sec . The tubes were incubated at room temperature for 3 min and then spined at 12,000 g for 15 min at 4 c . The top phase was transferred into a new tube and an equal volume of isopropanol was added . An equal volume of g2 buffer was added, mixed and incubated at room temperature for 10 min and then centrifuged at 10000 g for 10 min at 4 c . The supernatant was discarded and 1 ml of 70% ethanol was added to the pellet . After a quick vortex, the tubes were spined at 10000 g for 5 min at 4 c . The supernatant was then discarded and 30100 l of nuclease - free water was added . Rt - pcr was performed using denazist kit according to the manufacturer s instruction with slight modification . Rna - primer mixtures (total rna 10g, oligodt primer 1l, dntp 1l, nuclease - free water top up to 10l) was prepared and mixed . The mixture was incubated at 65 c for 5 min and chilled on ice for 2 min . The cdna synthesis mixture (10x buffer m - mulv 2l, m - mulv reverse transcriptase 100 unit, nuclease - free water top up to 10l) was prepared and 10l of the cdna synthesis mixture was added to each rna - primer mixture and incubated at 42 c for 60 min . The tubes were then incubated at 85 c for 5 min and chilled on ice . The pcr was programmed as 40 cycle of denaturation at 95 c for 30s, annealing temperature in accordance with melting temperature, lasted for 30sec, extension at 72 c for 20sec . An initial denaturation step at 95 c for 10 min before the cycles and a final extension step at 72 c for 20sec after the cycles were also applied . Leishmania lesions were produced in two groups of balb / c mice by injecting standard iranian l. major . To evaluate the characterization of the lesions during the progressive and healing periods in terms of the lesion size and expression of pro - inflammatory periods, one group treated with glucantime (group test)and the other group with pbs (group control) (fig . Leishmania lesions in balb / c mice 1 10 l. major promastigotes were intradermaly injected onto the base of the tail of balb / c mice . The first group was treated with 20mg / kg glucantime and the second group was injected with pbs for three weeks . A) balb / c mice with leishmania lesions in group test, treated with glucantime b) balb / c mice with leishmania lesions in group control, injected with pbs a week after injection of the parasites, lesions were appeared on the site of injection . The size of the lesions were measured and compared every two days in both groups . The results clearly showed an expansion in the size of lesions in group control but in group test, the lesions became smaller over the time until disappeared (fig . 2). Comparison of the size of lesions caused by l. major balb / c mice treated with glucantime or pbs the size of leishmania lesions in two groups of five mice was measured every two days for three weeks . After three week, all mice in group test cured and all mice in group control died . The expression of ten pro - inflammatory genes (ccl4, ccl3, tnf-, il-1, il-12 p35, il-12 p40, ccl5, ccr5, il-1, ifn-) in leishmania lesions and neutrophils were evaluated in balb / c mice infected with l. major and treated with either glucantime or pbs (fig . No sign of expression in pro - inflammatory genes was observed in the lesions and neutrophils . However, in early stages of infection (before treatment) or in the group received pbs in the lesions, ifn- and in neutrophils, ccl3, il-12 p35, il-12 p40, ccl5, ccr5, il-1, ifn- were expressing . In the first week after treatment in the group test (the group received glucantime), the pro - inflammatory genes started expressing in both lesions and neutrophils where in the lesions, exceptil-1, ccr5 and il-1 and in neutrophils except il-1, ccr5 neutrophils ccl5, ccl4 other genes were expressing . In the last week in this group, in the lesions except il-1, ccr5 other genes were highly expressed but in neutrophils il-1, il-1 and ccl4 were switched off and the other genes were expressing (table 2). Expression of pro - inflammatory genes in mice infected with l. major (lesion & neutrophils) expression of pro - inflammatory genes in mice infected with l. major (lesion & neutrophils) the thickness of bands shown in the gel electrophoresis was marked from 1 to 3 plus balb / c mice were injected with 110 l. major promastigotes and the expression of pro - inflammatory genes in the lesions and neutrophils was evaluated by rt - pcr . The figure shows the expression of pro - inflammatory genes in lesions and neutrophils in leishmania infected mice treated with glucantime (group test) after two weeks of treatment . Bands 18 shows the expression of tnf-, il-1, il-12p35, il-12p40, ccl5, ccr5, il-1, ifn- in the lesions, band 9 negative control, band 10 standard dna, 1119 the expression of ccl4, ccl3, tnf-, il-1, il-12p35, il-12p40, ccl5, il-1, ifn- in neutrophils leishmania lesions were produced in two groups of balb / c mice by injecting standard iranian l. major . To evaluate the characterization of the lesions during the progressive and healing periods in terms of the lesion size and expression of pro - inflammatory periods, one group treated with glucantime (group test)and the other group with pbs (group control) (fig . Leishmania lesions in balb / c mice 1 10 l. major promastigotes were intradermaly injected onto the base of the tail of balb / c mice . The first group was treated with 20mg / kg glucantime and the second group was injected with pbs for three weeks . A) balb / c mice with leishmania lesions in group test, treated with glucantime b) balb / c mice with leishmania lesions in group control, injected with pbs a week after injection of the parasites, lesions were appeared on the site of injection . The size of the lesions were measured and compared every two days in both groups . The results clearly showed an expansion in the size of lesions in group control but in group test, the lesions became smaller over the time until disappeared (fig . 2). Comparison of the size of lesions caused by l. major balb / c mice treated with glucantime or pbs the size of leishmania lesions in two groups of five mice was measured every two days for three weeks . After three week, all mice in group test cured and all mice in group control died . The expression of ten pro - inflammatory genes (ccl4, ccl3, tnf-, il-1, il-12 p35, il-12 p40, ccl5, ccr5, il-1, ifn-) in leishmania lesions and neutrophils were evaluated in balb / c mice infected with l. major and treated with either glucantime or pbs (fig . No sign of expression in pro - inflammatory genes was observed in the lesions and neutrophils . However, in early stages of infection (before treatment) or in the group received pbs in the lesions, ifn- and in neutrophils, ccl3, il-12 p35, il-12 p40, ccl5, ccr5, il-1, ifn- were expressing . In the first week after treatment in the group test (the group received glucantime), the pro - inflammatory genes started expressing in both lesions and neutrophils where in the lesions, exceptil-1, ccr5 and il-1 and in neutrophils except il-1, ccr5 neutrophils ccl5, ccl4 other genes were expressing . In the last week in this group, in the lesions except il-1, ccr5 other genes were highly expressed but in neutrophils il-1, il-1 and ccl4 were switched off and the other genes were expressing (table 2). Expression of pro - inflammatory genes in mice infected with l. major (lesion & neutrophils) expression of pro - inflammatory genes in mice infected with l. major (lesion & neutrophils) the thickness of bands shown in the gel electrophoresis was marked from 1 to 3 plus balb / c mice were injected with 110 l. major promastigotes and the expression of pro - inflammatory genes in the lesions and neutrophils was evaluated by rt - pcr . The figure shows the expression of pro - inflammatory genes in lesions and neutrophils in leishmania infected mice treated with glucantime (group test) after two weeks of treatment . Bands 18 shows the expression of tnf-, il-1, il-12p35, il-12p40, ccl5, ccr5, il-1, ifn- in the lesions, band 9 negative control, band 10 standard dna, 1119 the expression of ccl4, ccl3, tnf-, il-1, il-12p35, il-12p40, ccl5, il-1, ifn- in neutrophils the main goal of this study was to examine the expression of ten pro - inflammatory genes including il-12p35, il-1, ccl4, ccl3, ccl5, il-12p40, ccr5, il-1, tnf- and ifn- in lesions and neutrophils of balb / c mice infected with l. major to see whether or not there is a relation between the expression of the genes in the lesion and neutrophils in leishmania infection . The results clearly showed that in uninfected mice, none of the pro - inflammatory genes was expressed in healthy tissues and blood derived neutrophils . Similar figure was in the lesions of infected mice with no treatment at early stages of the infection where except ifn- other pro - inflammatory genes were not expressed in the lesions however, in the neutrophils, ccl3, il-12p35, il-12p40, ccl5, ccr5, il-1 and ifn- were expressed . At late stages of the infection in this group, tnf- and il-1 were also expressed where the expression of ifn- in the lesions and ccr5 in neutrophils stopped . Recent studies have shown a down - regulation in ifn- and tnf- produced by nk cells in diffuse cutaneous leishmaniasis caused by l. mexicana (9). Down - regulation of ifn- is also reported in l. braziliensis cases co - infected with mycobacterium leprae (10). Another study indicated an inhibition of il-12 through cr3 engagement by l. major (11). We have also already showed the down regulation of mhc i in dcs infected with l. mexicana (in press). Lack of expression of the pro - inflammatory genes was in - line with other studies indicating a similar potency for l. major in managing the immune response and controlling the expression of not only il-12 but also the other pro - inflammatory genes including ifn-. We already showed that early expression of ifn- has direct relation and key role in with leishmania immunity in balb / c mice (12) therefore, down - regulation of ifn- in leishmania infection results in exacerbation of the disease . The role of neutrophils in inducing resistance against leishmania parasites have been reviewed already (13). To the best of our knowledge, there is no report on the relation between the expression of pro - inflammatory genes in the lesion and blood neutrophils in leishmania infection . The expression of pro - inflammatory genes in blood neutrophils indicates that the neutrophils are primed by the parasite before migrating to the infected tissue . Various cytokines and chemokines including il-17, il-8, ifn-, tnf-, gm - csf and ccl5 play prominent roles in the recruitment, activation and survival of neutrophils at the site of inflammation (1415). Ccl5 has also negative effect on the extravasation of neutrophils and monocytes into the peritoneal cavity (16). It is known that most of neutrophils in the leishmania lesion migrate from the blood . The difference between the expression profile of pro - inflammatory gene in lesions and blood neutrophils of leishmania infected mice indicated that interaction of neutrophils with the parasite affects the expression profile of the genes in neutrophils migrated to the infected tissue . After treatment with antileishmanial drugs, a high level of expression in most of the pro - inflammatory genes including ccl4, ccl3, tnf-, il-12p35, il-12p40, ccl5 and ifn- in leishmania lesions was observed confirming the inhibitory effect of leishmania infection on the expression of the pro - inflammatory genes in the leishmania lesions . On the other hand, il-1 expressed in untreated or control mice only in neutrophils but not the lesion and after beginning of treatment with antileishmanial drug, the expression was down regulated . Amastigotes are capable to induce il-1 in pbmcs in l. (v.) braziliensis (17) where production of il-1 promotes host resistance to leishmania infection (18). Our results for the first time demonstrate that l. major similar to l. (v.) braziliensis directly stimulates production of il-1in neutrophils . None of the control mice was expressed ccl4 and tnf- either in the lesion or neutrophils . However the gene was only expressed in groups received treatment and when the lesions began healing, ccl4 in the lesions and tnf- in both lesions and neutrophils started expression . Therefore, tnf- can be candidate as an indicator for the healing of leishmania lesions . L. major can strongly suppress the expression of pro - inflammatory genes in the lesions . This may help the parasite control the immune responses induced by the host . The expression of pro - inflammatory genes in the lesions restarted when the lesions were treated with anti - leishmanial drugs . Expression of pro - inflammatory genes in peripheral neutrophils was not suppressed by the parasite indicating the important role of these cells in leishmania infections . The expression of tnf- in the lesions and down - regulation of il-1 in neutrophils were only observed after treatment with anti - leishmanial drugs and could be accounted as an indication for healing of cutaneous leishmaniasis.
|
Osteoporosis is defined by the who as a bone mineral density (bmd) of 2.5 standard deviations or more below the young normal mean . On this basis 26 million people in america are osteoporotic.1, 2 most of the fractures in the osteoporotic individuals occur in the proximal humerus, distal forearm, vertebrae, pelvis, hip and tibial condyles . However diaphyseal fractures are also common . With nearly 120,000 osteoporotic humerus fractures occurring annually, it is important to understand the methods of treatment and indications for such treatments of these fractures.3, 4 nonunion of the humerus is an uncommon complication of diaphyseal fractures . Its reported rate in the literature is quite variable, ranging from 1% to 10%.5, 6 it can be successfully managed by various surgical methods with the principles being open reduction, freshening of edges and stabilization using plate and screws, interlocking nails, or an external fixator . Nonunion in the osteoporotic bone is an even bigger surgical challenge as the degree of osteoporosis increases during the period of immobilization and can complicate osteosynthesis significantly . Reports about the management of nonunion of the humeral diaphysis in severely osteoporotic bone are uncommon . The purpose of this study is to highlight the use of a combination of a locking plate and an intramedullary fibula in the management of nonunion of the humerus in a severely osteoporotic bone . We included 5 patients in the study due to the relative rarity of this type of combination in patients . The average age of the patients in our study was 57 years (range, 5167). All the patients had a midshaft involvement and radiologically the nonunion could be classified as atrophic . All patients had mild pain, tenderness and gross abnormal mobility at the nonunion site, and limitation of activities of daily living . The average delay at presentation from the time of injury was 14 months (range, 1218 months). Preoperative disability of arm, shoulder and hand (dash) score averaged 84 5 (range, 7991). The preoperative assessment included a dual energy x - ray absorptiometry (dexa) scan and a radiogrammetric measurement of the humerus for osteoporosis assessment . However we were aware that disuse would have worsened the condition of the humerus even further . We added the thickness of the two cortices and divided it by the width of the bone at a relatively unaffected level of the humeral diaphysis . In all cases the five cases had been operated on at least once with an average of 1.2 (range 13 times). Fracture fragments were freshened and debridement carried out until bleeding bone ends, and the medullary canal were exposed . Both fragments were then reamed progressively using serial hand reamers gently to open the canal for the placement of the fibula . The mid - shaft of the fibula was harvested and shaped to fit the medullary canal . The length of the fibula harvested was equal to the length of the plate that was planned to be used preoperatively . The graft was slid up the medullary canal of one fragment and then slid backwards down the other fragment after the fragment was held in slight distraction in an aligned position . All patients were protected in an arm sling for a period of three weeks after the surgery . Lifting of weights using the operated limb was deferred for a period of three months or until osseointegration of the fibular ends or fracture healing . At final follow - up, fractures were considered united if at least three of the cortices on radiographs showed evidence of bony trabeculae crossing the fracture site . All fractures had solid clinicoradiologically evident fracture union by the six month follow - up . This was assessed when 3 of the four cortices on seen on 2 plane radiographs showed bridging . The average arm shortening was 2 cm (range, 13 cm). None of the patients had pain over the fracture site and the dash score at the last follow - up averaged 27 . Interestingly 2 patients complained of some amount of discomfort at the graft harvest site in the immediate postoperative period only due to peroneal muscle movement . One patient continued to have significant stiffness of the shoulder at final follow - up . In the other four there was minimal restriction in shoulder rotation at final follow - up in these four cases . All the patients had a full range of motion at the elbow at final follow - up (fig . 1, fig . 2, fig . Nonunion of long bones is likely to be related to the severity of initial injury, transverse pattern of fracture, or soft - tissue interposition . Failure to unite after surgical treatment may be due to poor contact between the bone ends, inadequate stabilization, devitalization of bone, osteopenia, and bone defects . Obesity, alcoholism, and method of treatment may also be contributory factors . The lack of mechanical stability due to a flail arm may interfere with personal hygiene, dressing, and simple activities of daily living . The goal of surgery is to achieve a stable fixation and institute early mobilization of stiff joints . While a number of methods of managing atrophic fracture nonunion have been suggested, each has its drawbacks . Most surgeons favour the use of an interlocking nail, ilizarov external fixator, or locking compression plate (lcp) for stabilization and vascularised fibular graft or cancellous iliac crest bone graft for enhancement of fracture union . Disadvantages of ilizarov fixation include the presence of a bulky implant on the arm, pin track infection; painful impingement of the frame on the chest wall and the possibility of neurovascular injury due to the wires . The use of a long compression plate requires extensive tissue stripping in the upper arm causing considerable impairment of blood supply and a significant risk of radial nerve injuries . Double plating using two dynamic compression plates at right angles to each other has been described . On - lay grafts and double plating entail more extensive soft tissue stripping and devascularization of the humerus locking plates are designed with screws that thread into the plate creating fixed - angle anchorage of the screws into the plate . Locking plates behave mechanically more like external fixators in that they achieve stability without the need for direct contact with the periosteal surface . In addition, the screws act in concert gaining purchase in regions of bone rather than individual sites as with traditional screws . In locking plates, screw failure is an all or nothing event . Locking plate designs do provide enhanced fixation in fragile bone but cannot be expected to perform in situations where the applied loads to the fracture repair exceed the strength of the host bone . Locking - plate technology has renewed interest in plate fixation for treating proximal humerus fractures . Complications associated with these devices, including loss of reduction, screw cutout, and intra - articular penetration, are frequent . Laboratory studies have also shown that locking plate constructs were superior to unlocked plate and screw constructs in osteoporotic diaphyseal humeral fracture models tested in vitro using cyclical torsional loading . The primary mode of failure of internal fixation in osteoporotic bone results from bone failure rather than implant breakage . Since bone mineral density correlates linearly with the holding power of screws, osteoporotic bone often lacks the strength to hold plates and screws securely . Optimal management of osteoporotic proximal humeral fractures has evolved and may now include use of locking plates and augmentation with intramedullary fibular grafts, calcium phosphate or sulfate cement, and iliac crest bone graft . It also has some osteogenic potential in addition to acting like a strut across the fracture site when used as an intramedullary bone graft . Fibula is probably the most suitable donor bone for reconstruction of defects in a long bone because of its length, geometrical shape, and mechanical strength . However grafts of cortical bone revascularise slowly and incompletely . In our series of five cases we included cases the radiogrammetry methodology of the humeral bone cortices also was supportive of the fact that the affected bones had severe osteoporosis . Immobilization of the humerus in itself tends to cause disuse osteoporosis in all the nonunion cases . However in all our cases it can be safely said that disuse osteoporosis is an addition to the already existent osteoporosis . Our results show that this combination is useful and reproducible for the management of nonunion of the humerus in a severely osteoporotic bone.
|
Ocular siderosis (os) is a severe sequel of retained iron - containing intraocular foreign body (iofb). A ferrous iofb undergoes dissociation resulting in the deposition of iron in the intraocular epithelial structures, notably the lens epithelium, iris and ciliary body epithelium, and the sensory retina, where it exerts a toxic effect on cellular enzyme systems, with resultant cell death . Pigmentary retinopathy followed by atrophy of the retina and retina pigment epithelium (rpe) can have a profound effect on vision and result in a subnormal electroretinogram (erg). Management of os depends on the successful detection of an occult iofb as well as the determination of the need and optimum timing for its surgical removal [3, 4]. The aim of this study was to review the presentation, management, and outcome of this relatively rare disorder at our centre . This was a retrospective study of os seen at the retina clinic from january 2009 to march 2015 . The study was conducted in accordance with the declaration of helsinki and ethical approval was obtained from the institutional review board of the hospital . Eyes with a metallic iofb with clinical and/or erg features of os that underwent iofb removal were included in the study . Exclusion criteria included eyes with clinical features of os without an erg, eyes with os that did not undergo iofb removal, and eyes with erg features of os that had undergone iofb removal before presentation at our clinic . The following information was then extracted from the case files and analysed: demographic data, duration of time from ocular injury to diagnosis of os, clinical findings, method of iofb localization, erg readings at presentation and at 6 months, surgical treatment, complications of treatment, and visual outcome . All the patients had detailed ocular examination including visual acuity (va) assessment and refraction, slit lamp examination of the anterior segment, dilated indirect fundus examination, and intraocular pressure measurement . Radiological investigations including ocular ultrasonography with or without plain radiographs of the orbit and orbital computed tomography (ct) scan were done to localize the iofb . Ergs done at presentation and posttreatment were analysed . When carrying out the erg, the patient was first fully dilated and dark adapted for 20 minutes . The patient was then asked to sit with his / her chin on the chin rest of the ganzfeld bowl with the eye being tested wide open . A contact lens electrode was then placed on the cornea after instilling topical anaesthetic drops . The right eye was tested first with the left occluded . A rod (scotopic) erg the mixed cone - rod erg and oscillatory potentials were elicited by a single flash of red light at maximum intensity of 0 decibels . To record the photopic responses from the cone system, the patient underwent 10 minutes of light adaptation by switching on the background light in the ganzfeld bowl . The cone erg and 30 hz flicker erg were then recorded with a stimulus intensity of 0 decibels . These were 8 males and 1 female with a mean age of 31.6 years (range: 1747 years). All the patients gave a history of sustaining ocular injury while hitting a piece of metal on metal . Trauma occurred from 3 months to 12 years (mean: 2.9 years) before the diagnosis of os was made at our clinic (table 1). One patient (case 6) had a history of previous intraocular surgery following trauma to the eye but an iofb was not found then . Best corrected visual acuity (bcva) at presentation ranged from 1/60 to 6/9 and the most common features of os were cataract and pigmentary retinopathy seen in 6 (67%) and 4 (44%) eyes, respectively . In four of the cases of cataract, the other 2 cases had a yellow - brown hue but a histological examination for the presence of iron particles in the lens epithelium was not done . Other features of os seen were heterochromia, anisocoria, and corneal endothelial dusting (figure 1). Posterior subcapsular cataract was the most common type of cataract encountered accounting for 5 (83%) of the 6 cases of cataract . Other findings on ocular examination not related to siderosis included corneal scars, iris defects, iridodonesis, dislocated lens, and macular scar . The intraocular pressures were within normal limits in all the patients . Ocular ultrasonography was done in all the eyes with successful localization of the iofb in every case . A plain radiograph of the orbit was performed in 4 patients and ct scan in 1 patient with an iofb demonstrated in each case . Surgical treatment included pars plana vitrectomy (ppv) for iofb removal alone (4 eyes) or in combination with cataract extraction and intraocular lens (iol) implantation (5 eyes) (table 2). The erg was subnormal in all the eyes with 7 (78%) eyes showing improvement following surgery (table 2). Seven (78%) eyes gained 2 or more lines on va assessment after surgery . Complications encountered postoperatively included retinal detachment, retinal tears, and cataract progression . Retinal detachment (rd) the first was at 2 months after iofb removal following which rd surgery was done with anatomical reattachment achieved . Multiple horse shoe tears were seen in case 9 and these were successfully barraged with laser . Case 2 had cataract progression and phacoemulsification with iol implantation was done at 1 year after iofb removal . Os is an uncommon condition and may appear from 18 days up to many years after a penetrating ocular injury with retention of a metallic foreign body . The longest duration between the ocular injury and the diagnosis of os was 12 years in this series . Sneed and weingeist and hope - ross et al . Reported shorter duration of 40 months and 24 months, respectively . The time between ocular trauma and development of os may be related to the severity of intraocular toxic reactions . This varies depending on the shape and size of the foreign body, its iron content, and the amount of time it remains within the eye . Heterochromia which had a similar incidence to cataract in other studies was, however, only documented in two patients in our series . The aetiopathogenesis of secondary open - angle glaucoma related to os has often been ascribed to trabecular fibrosclerosis, probably because of the direct toxic effect of iron ions . Reported a case of an encapsulated iron - containing iofb situated on the retina of an 84-year - old man for 53 years, which did not lead to the expected os . Presentation with os months after an ocular injury may suggest that the iofb had been missed by the physician or ophthalmologist that attended to the patient following the ocular trauma . All primary care physicians as well as ophthalmologists should be aware of the possibility of a retained iofb in a penetrating ocular injury particularly when there is a history of high - velocity metallic injury . It should be assumed that ocular injuries sustained in these types of settings potentially harbor an iofb until proven otherwise . The diagnosis of an iofb is often made by direct visualization on slit lamp examination or ophthalmoscopy . Dilated fundus examination can reveal a foreign body in the vitreous or the retina if the media is not opaque . If the suspected iofb is not seen, then further evaluation using imaging studies is necessary . Where an iofb is visualized, confirming the clinical finding with these investigations is also important as the iofbs may be multiple and may not all be picked up on clinical evaluation . Imaging studies for the detection of a metallic iofb include plain radiograph, ct scan, and ocular ultrasonography . Ultrasonography has been shown to be a very valuable tool that can augment the information obtained from other imaging modalities . It should therefore be performed in all cases of os when an iofb is suspected . Ultrasound biomicroscopy of the anterior segment in eyes with secondary glaucoma may show an anomalous high reflectivity in the deep angular layers . These alterations could be due to metallic particles imprisoned in the trabecular meshwork or indirectly on the consequent fibrotic reaction . Full - field erg is the most common means for detecting os and all patients should have this prior to surgical intervention . Iron retinotoxicity leads to a dysfunction of all the layers of the retina with more severe damage occurring in the inner retina than in the outer retina in the late stages of the disease . In the early phase, both the a - wave and the b - wave, though more commonly the former, can be transiently increased . As siderosis progresses, the b - wave decreases, causing the b - wave / a - wave ratio to fall . Rod - dominated responses are predominantly affected as they have a greater susceptibility to iron toxicity compared to the cone system . All the patients that had an erg done in these present series had electrophysiological features of siderosis with improvement in erg amplitudes following successful removal of the iofb in 7 patients . Improvement in erg with removal of an iofb has been documented by several authors [4, 14, 16, 17]. Contrary to our finding, however, erg amplitudes remained subnormal in the series by hope - ross et al . Vision may be excellent in siderosis with erg amplitudes of up to 50% and complete reversal is possible following successful removal of the iofb in the early stages of the disease and with amplitudes of up to 40% [4, 14]. Over this limit, macrophagic activity may be overwhelmed by the amount of iron load leading to direct cellular toxicity . Full - field erg also remains the reference follow - up exam in cases of delayed iofb removal and embedded iofb with likely difficulty with surgical removal and also following iofb removal [13, 15]. Small iron particles can still be released at the inner retinal surface following surgical removal potentially inducing further toxicity . Os with subnormal erg has been reported 3 years after removal of a metallic iofb . Removal of the iofb should be strongly entertained in eyes with diminished ergs and a mobile foreign body in the vitreous or a nonencapsulated foreign body on the retina . Surgical technique for removal of the retained iofb is dependent on the site and nature of the iofb, the clarity of the lens, and whether or not the iofb is embedded in the retina . The removal may be done via an external approach (sclerotomy with large electromagnet) or an internal approach (vitrectomy followed by forceps or internal magnet use). If the foreign body is located in the posterior vitreous or embedded in the retina, then a ppv is the preferred surgery . Iron - containing foreign bodies may lose their magnetic properties over time and a ppv with removal using intraocular forceps may be necessary . A ppv also has the advantage of providing direct viewing and controlled removal of the iofb . However, if the lens is clear and the foreign body is not embedded in the retina, then a sclerotomy with magnet extraction or intraocular forceps can be employed to extract the foreign body, particularly if it is located more anteriorly . This lies between 25% reported by hope - ross and colleagues and 79% reported by sneed and weingeist . The visual potential in eyes with os may be excellent if the siderotic changes stabilize or improve and if the optic nerve and macula have not been injured . Pollack and oliver reported an excellent visual outcome in a patient with os following iofb removal despite an abnormal erg . Removal of a cataract at the time of iofb removal may also lead to significant improvements in vision as was recorded in this series . Cases may not have been captured if they were inaccurately diagnosed or coded . In conclusion, a retained iron - containing iofb can manifest itself after several years with clinical and electrophysiological features of os . Careful clinical and radiological evaluation is essential following a penetrating ocular injury if this condition is to be prevented.
|
Positive peritoneal washings are considered to be an important factor in management of patients with gynecological malignancies . Patients with positive peritoneal washings have been found to have worse prognosis than patients without malignant cells in cytology . Positive peritoneal washing in endometrial cancer is associated with an increased risk of recurrence and poor survival . Factors that can lead to false negative peritoneal cytology include inadequate volume of peritoneal fluid examined, obscuration of the tumor cells by florid mesothelial reaction, blood, excessive dilution of malignant cells, or small foci of peritoneal metastasis such that the tumor cells are not easily identified . Conventional smear may display cell clumping in one corner of the smear, obscuring of cells by mucus, haemorrhage, inflammatory cells, and debris along with multilayering of cells which will hamper cytological interpretation of the smear . Liquid - based cytology (lbc) uses the principle of cell filtration (thinprep) or cell enrichment (surepath). Consequently, the smears are homogenously stained, circular smears of 22 mm diameter in thinprep and 13 mm diameter in surepath, which contain 5070000 well - preserved cells per smear . The cells are uniformly distributed throughout the circular smear, which is devoid of background debris and obscuring by red blood cells (rbcs) or inflammatory cells . Because of uniform staining and absence of background debris, the nuclear morphology is clear on lbc smear . Thus, lbc preparations can overcome the shortcomings of conventional smears to a large extent and improve the diagnostic accuracy . A similar study in the english literature has explored the efficacy of thinprep lbc technique . The aim of the present study was to evaluate gynecological cancers causing positive peritoneal cytology and to evaluate diagnostic accuracy of lbc using bd surepath lbc technique in peritoneal cytology . An audit of peritoneal fluid / washing / lavage (january 2012 to july 2013) was performed with identification of corresponding gynecologic specimens . The samples were centrifuged and the smears were prepared from the sediment using a conventional technique; the samples were then processed as per the manufacturer's instructions for surepath lbc technique . However, suspicious cases at the time of initial reporting were reported in the light of corresponding histopathologic diagnosis to categorize all cytology samples as positive or (it is the standard practice in our department that smears with equivocal features on cytology are reported after examining the corresponding histopathological sections). All the positive peritoneal wash samples were reviewed by two cytopathologists (rt, ng) to analyze cytological features in various gynecological malignancies and to study the difference in cytomorphology in conventional versus surepath lbc technique . Peritoneal fluid / washings comprised a total of 393 samples out of 12971 samples of exfoliative cytology (excluding cervical pap samples) received in the department during the study period . Age range for ovarian epithelial neoplasms (1573; mean 46.6 years), germ cell tumors (1456; mean 27 years), sex - cord stromal tumors (1970; mean 48 years), and uterine malignancies (2685; mean 57 years) was noted . A total of 83/393 (21.1%) were positive and 310/393 (78.9%) were negative for malignancy on peritoneal cytology . Out of the 393 samples of peritoneal washes, corresponding histology was available in 352 cases only . Rest of the cases either did not undergo surgery or were lost to follow - up . Out of 83 positive peritoneal washings, 69 samples had ovarian malignancies and 5 had uterine causes . No record of histopathology of the remaining 9 cases with positive peritoneal cytology was available . Out of a total of 84 histopathologically diagnosed ovarian serous carcinoma cases, 55 (65.5%) cases had positive peritoneal cytology [figure 1a and b]. Only 3 cases had a few clusters in conventional smears and the diagnosis was based mainly on lbc samples . Tumor cells were seen in peritoneal cytology in 1/8 (12.5%) cases of borderline serous tumor (atypical proliferative serous tumor) with a few tiny papillaroid clusters of tumor cells . This case four out of 9 cases (44.4%) of mucinous adenocarcinoma were positive [figure 1c and d] with clusters as well as scattered tumor cells with mild nuclear atypia embedded in abundant mucinous material . Chicken - wire type of capillary network associated with mucin was also appreciated in 3 out of 4 cases . Lbc helped to identify malignant cells in 2 cases, which were darkly stained and embedded in thick mucin in conventional smears . Pseudomyxoma peritonei was seen in two cases of ovarian mucinous cystadenoma with mucinous neoplasm involving the appendix . The tumor was present in ovary as well as the appendix; hence, ovarian involvement was not secondary . Thick mucinous material along with benign mesothelial cells were seen in these cases . Mucinous material was seen metachromatically staining in conventional smears; however, the same was also represented as thick greenish mucin pools in lbc smears . Three out of 4 (75%) cases of dysgerminoma, squamous cell carcinoma in teratoma (n = 1) [figure 2a and b], 2/4 (50%) yolk sac tumor, and 1/13 (7.7%) granulosa cell tumor had positive peritoneal cytology . Cytology samples revealed dispersed population of intermediate - sized tumor cells with high n / c ratio, coarse chromatin, prominent nucleoli, and scanty vacuolated cytoplasm in cases of dysgerminoma . These were better seen in conventional mgg smears as compared to lbc samples due to even smaller size and intense staining in lbc smear . The case of squamous cell carcinoma showed tumor cells having squamoid differentiation and marked variation in size and shapes of the tumor cells . Cases of yolk sac tumor showed obviously malignant cell clusters admixed with florid mesothelial cell proliferation . The main clue to diagnosis of a germ cell tumor in fluid cytology was round - to - oval tumor cells with very prominent nucleoli and vacuolated cytoplasm . The case of granulosa cell tumor revealed classic morphology with dispersed population of round - to - angulated tumor cells and a few tumor cells arranged in acinar - like arrangement around pink staining bodies . The cases of dysgerminoma, yolk sac tumor, and granulosa cell tumor were initially reported as positive for malignancy on cytology . Positive peritoneal washing in ovarian serous carcinoma (a) cps (mgg 40); (b) corresponding lbc (pap stain 40); positive peritoneal washing in ovarian mucinous carcinoma (c) cps (mgg 100); (d) corresponding lbc (pap stain 100) positive peritoneal washing in squamous cell carcinoma arising in ovarian teratoma (a) cps (mgg 100); (b) corresponding lbc (pap stain 100); positive peritoneal washing in ovarian serous carcinoma (c) cps showing only mesothelial cells (mgg 40); (d) corresponding lbc showing a cluster of malignant cells (pap stain 100) uterine causes included 2/45 (4.4%) cases of endometrioid adenocarcinoma, (25%) cases of clear cell carcinoma, (50%) cases of carcinosarcoma, and 1/4 (25%) cases of cervix carcinoma [tables 1 and 2]. On review, 14 cases were identified in which peritoneal washings were reported as negative, both on conventional smear as well as the lbc smear, whereas histopathological examination of the omentum revealed tumor deposits . Further review of the smears (both conventional and lbc smears) of these cases failed to reveal any tumor cells . Distribution of ovarian neoplasms distribution of uterine neoplasms there were 2 cases of sertoli leydig cell tumor, 3 cases of fibroma thecoma, 15 cases of mature cystic teratoma of ovary, and 5 cases of leiomyosarcoma, where the peritoneal cytology was negative . The histopathological diagnoses of other cases with negative peritoneal washings included leiomyoma, adenomyosis, follicular, endometriotic and simple cyst of ovaries, serous cystadenomas, mucinous cystadenoma, cervicitis, salpingitis, etc . Distribution of cases with negative peritoneal cytology all the positive cases (n = 83) were reviewed by two cytopathologists mainly concentrating on cytologic features, which were different in two techniques (conventional and lbc sure path). Lbc smears were easier to study, small circular smears of 13 mm diameter, with uniformly distributed, concentrated cells . All the lbc smears were devoid of hemorrhagic background and debris, which was a confounding feature in conventional smears of 257 out of 393 cases . In our department, conventionally, after that, conventional smear stained with papanicolaou stain is examined, followed by lbc smear . Thus, it was observed that conventional smears of 4 cases had no cells, however, lbc smears showed presence of tumor cell clusters . These cases on follow - up histopathology were diagnosed as ovarian high - grade serous carcinoma with omental metastases . There were 6 cases whose conventional smears had low cellularity (less than three tumor cell clusters in the entire smear), however, lbc smears displayed uniformly present tumor cells [figure 2c and d], indicating a better diagnostic accuracy of the lbc technique . Peritoneal wash cytology helps in the management of gynecological malignancies by identifying microscopic intraperitoneal metastatic deposits and helps in the surgical staging of these tumors . During second - look laparotomy with negative peritoneal cytology, the patient may be considered disease free and chemotherapy may be discontinued accordingly . Serous ovarian carcinoma was found to be the most common gynecological malignancy resulting in positive peritoneal cytology in the present study . We also observed positive peritoneal cytology in 3 cases of dysgerminoma, 2 cases of yolk sac tumor, and 1 case of granulosa cell tumor . One case showed squamous cell carcinoma arising in teratoma, which led to shedding of malignant squamoid cells in the peritoneal wash fluid . Jacques et al . In 1991 studied multiple peritoneal cytologies collected during laparotomy for gynecologic malignancies and showed 23/61 cases of positive peritoneal cytology due to ovarian causes . Positive peritoneal cytology is associated with high recurrence rate and decreased survival in endometrial cancer . (1981) found that stage i endometrial carcinoma cases with negative peritoneal cytology did not recur, whereas tumor recurrence at shorter interval was observed in cases with positive peritoneal cytology . However, according to yazigi et al . (1983), positive peritoneal cytology did not influence prognosis in stage i endometrial carcinoma . Tubal transportation, exfoliation from extrauterine tumor deposits, contamination from manipulation during endometrial sampling or intracavitary therapy or other procedures, and lymphatic spread have been proposed as factors contributing to the spread of malignant cells in the peritoneal cavity . One out of two cases of carcinosarcoma of the uterus also showed positivity for malignant cells in peritoneal lavage in the present study . Tumor cells are commonly observed from the carcinomatous component of carcinosarcoma because this component is less cohesive and is easily shed into washing samples . Selvaggi and jacques (1991) reported negative peritoneal cytology in all 33 cases of cervical carcinoma in their study . False positive peritoneal washings, where peritoneal washings are reported as positive in absence of any known tumor in the patient has been described previously . We did not observe any such case with false positive peritoneal cytology, similar to ziselman et al . This observation may be explained by the fact that all the suspicious cases were reported along with corresponding gynecologic specimens . There were 14 false negative cases (negative peritoneal washings but had omental tumor deposits on histology) in the present study . . This could be because of dilution of sample with blood and less number of malignant cells in fluid . Four cases in the present study had only blood in conventional smears, and malignant cells could be identified on lbc smears only . In another 6 cases, conventional smears had less than three clusters of malignant cells, whereas lbc smears helped to concentrate and better delineate the tumor cells . The negative peritoneal cytology may be explained by poor distribution or infrequent exfoliation of tumor cells . This shortcoming is overcome in lbc technique where preservative solution lyses the rbcs and cell enrichment process results in uniform homogenous concentration of cells within the circular smear . The excessive amount of fluid may also dilute the tumor cells, making their identification difficult in conventional preparations . These factors may result in false negative peritoneal cytology which can be detrimental to the patient's clinical outcome . Lbc preparation offers advantage in hemorrhagic and paucicellular samples improving the diagnostic accuracy of peritoneal washings . Residual material from lbc samples can also be utilized for ancillary techniques such as immunocytochemistry (icc). Icc can directly be done on lbc smears . However, in our study, we did not perform immunocytochemistry on lbc sample for diagnosis . Lbc smears also reduce the time of observer to hunt for tumor cells because cells are uniformly distributed and concentrated in the circular smear . These factors result in improved productivity by reducing the inadequate rate and increasing the diagnostic accuracy of peritoneal cytology . In conclusion, papillary serous carcinoma is the most common ovarian malignancy leading to positive peritoneal cytology and presenting at advanced stages . Endometrioid adenocarcinoma rarely leads to positive peritoneal cytology, especially when myometrial invasion is more than 50% and/or with parametrial involvement . Lbc technique leads to concentration of tumor cells causing reduction in false negative cases, especially in hemorrhagic and paucicellular cases, thereby improving the diagnostic accuracy of peritoneal washings . The correct identification of malignant cells in peritoneal wash fluids is essential for the proper management of gynecological cancer, especially early stage carcinomas.
|
Vitamin d is a hormone with multiple physiological actions, many effects of which have been found to occur outside its classical role in calcium homeostasis . We now know that vitamin d receptors (vdrs) are expressed in many cell types, including various immune cells, suggesting the role of vitamin d on immune system . These recent findings have increased interest in vitamin d status and its link to several nonskeletal diseases . The main source of vitamin d in humans is solar uv - b (290315 nm wavelengths) radiation, which influences the formation of previtamin d in the skin (cholecalciferol). Cholecalciferol from the skin or derived from nutrition is metabolized in the liver to 25-hydroxyvitamin d (25-oh - d). This is the major circulating form; thus it is usually used to measure serum vitamin d levels . 25-oh - d is then transported to the kidneys where it is metabolized to its active form calcitriol (1,25(oh)d,1,25-dihydroxyvitamin d) (figure 1) [2, 3]. Although thresholds of serum 25(oh)d are still debated, guidelines from the institute of medicine (iom) for bone health define vitamin d deficiency as serum 25(oh)d levels below 30 nmol / l (<12 ng / ml), while sufficient vitamin d levels should be considered serum levels of at least 50 nmol / l (20 ng / ml). Due to evidence of vitamin d insufficiency on allergic disease prevalence, many researchers categorized vitamin d sufficiency as> 75 nmol / l (30 ng / ml). Since 1999, when wjst and dold were the first scientists to hypothesize a link between vitamin d and allergic diseases, two conflicting hypotheses are raised . The first hypothesis tries to correlate high serum vitamin d levels with the rise in prevalence of allergies and asthma . The authors suggest that the geographic trend of higher disease prevalence in more developed countries runs in parallel with vitamin d exposure . The first study that investigated this possible connection was a birth cohort study conducted in finland . The authors found that higher risk for atopy, allergic rhinitis, and asthma was associated with increase in vitamin d supplementation for newborns in order to prevent infantile rickets . A second hypothesis developed later suggested that vitamin d deficiency may contribute to the recent increase in allergies in western countries [7, 8]. There is an increasing body of evidence to support the hypothesis that this widespread vitamin d deficiency correlates with atopy, asthma, and food allergy [812]. Prevalence of hypovitaminosis d varies among different countries and among different population groups within a given country and for each population over time . In many industrialized countries, up to 50% of the population has insufficient vitamin d . Based on one study, vitamin d insufficiency in the united states increased from 55% to 77% between data collection ranges of 19881994 to 20012004 . There is a combination of different factors which determine 25(oh)d serum levels and vitamin d deficiency like skin pigmentation, low sun exposure, more time spent indoors, obesity, higher latitudes, and winter season [13, 14]. Other secondary causes that could affect vitamin d serum levels are diseases including rheumatoid arthritis, cystic fibrosis, ulcerative colitis, crohn's disease, celiac disease, rickets, and medications . In this review, we outline the basic metabolism of vitamin d and its effects on the immune system . In addition, we discuss recent findings regarding vitamin d status and its relation to allergy, specifically throughout europe and mediterranean countries . We also considered the effects of vitamin d supplementation in allergic disease, highlighting the recent recommendations . There is plenty of evidence to show that vitamin d has significant effects on both of them . Its immunomodulatory role has been recognized recently with the discovery of vitamin d receptor (vdr) and the hydroxylation of 25(oh)d on distinct cell types . Vdrs have been identified in many tissues and cells in the human body, including nearly all cells of the immune system (t cells, b cells, neutrophils, macrophages, and dendritic cells). Vitamin d inhibits the expression of tlr (toll - like receptor) on monocytes, inhibits proinflammatory cytokine production, and induces antimicrobial peptide synthesis [17, 18]. Vitamin d also impacts the adaptive immune system, specially affecting t - cell activation and antigen - presenting cells function . In recent studies, vitamin d is associated with reduction of th1 cytokine secretion and inhibition of t cells proliferation . The association of vitamin d and th2 cells is less clear and contradictory, with report of both increased and decreased expression of the th-2 cytokines il-4, il-5, and il-10 in adult peripheral blood cell cultures [19, 20]. In conclusion, it seems that vitamin d has a key role in th1-th2 balance, which could be relevant in allergic disease . Vitamin d deficiency has been blamed as a cause of increased incidence of asthma and allergy symptoms . In a study conducted by hollams et al . In australia, this study showed that vitamin d levels at ages 6 and 14 years were predictive of allergy / asthma outcomes at both ages, but more importantly, vitamin d levels at age 6 years were predictive of subsequent atopy and asthma - associated phenotypes at age 14 years . This is the first study which demonstrates the association between vitamin d and asthma in older children, comparing with the early - life birth cohort studies . In addition to the relationship between vitamin d status and asthma, there is considerable interest in assessing whether this vitamin protects against or reduces asthma morbidity . It is now well known that there is a significant association between vitamin d deficiency and infections . A recent clinical trial showed that vitamin d supplementation (500 iu / day) given as adjuvant therapy to inhaled corticosteroids in children with asthma reduced the risk of asthma exacerbation triggered by respiratory tract infections . Other researchers in costa rica studied vitamin d levels in children with asthma and demonstrated that lower vitamin d levels were associated with increased airway responsiveness, higher eosinophilic counts and total ige levels, and increased risk of severe asthma exacerbations . This finding suggests that sufficient vitamin d levels may help to control infections and reduce inflammatory responses, resulting in viral infections causing less severe symptoms . The same authors conducted a longitudinal study based on childhood asthma management program and showed that the group with the lower risk of exacerbations was the group with 25(oh)d 30 ng / ml and who were receiving inhaled corticosteroids . The hypothesis that vitamin d supplementation might potentiate the anti - inflammatory function of corticosteroids is intriguing because glucocorticoid resistance is an important obstacle to effective treatment in some patients with asthma . Searing et al . In their study of asthmatic children demonstrated a significant association between lower vitamin d levels and greater use of inhaled or oral corticosteroids and total steroid dose . Demonstrated the same association in vitro by using cell cultures obtained from steroid sensitive and steroid - resistant asthmatic subjects . Adding vitamin d to cd4 + t - cell cultures from steroid - resistant patients enhances the response to dexamethasone by inducing the production of il-10 . Furthermore, they showed that oral administration of vitamin d in severe asthmatics inverted steroid resistance through induction of il-10-secreting tregs (regulatory t - cells). These observations, together with clinical and experimental studies, justify the use of vitamin d in the treatment of severe asthma, particularly to enhance action of steroids . Another aspect involved in the relationship between vitamin d deficiency and asthma relates to lung function impairment . Consistent with the role of vitamin d on enhancing steroid responsiveness, several studies of children and adults have shown that a low vitamin d level is associated with impaired lung function . Children with insufficient vitamin d levels were found to have a slightly lower mean fev1 than children with sufficient vitamin levels . Other studies in adults show a strong relationship between serum concentrations of vitamin d, forced expiratory volume in 1 second (fev1), and forced vital capacity, where decreasing pulmonary function is associated with vitamin d deficiency [26, 28]. It has been found that different gene polymorphisms of the vitamin d receptor (vdr) and vitamin d binding protein (vdbp) have variable associations with asthma . Together with different serum levels of vitamin d, also vdr and vdbp variants seem to represent a risk factor for asthma . The vitamin d receptor is present in bronchial smooth muscle cells which are associated with active protein synthesis . It has been demonstrated that vitamin d inhibits bronchial smooth muscle proliferation induced by platelet - derived growth factor and it also influences the microarray gene expression signature in bronchial smooth muscle cells [3032]. This finding suggests a role of vitamin d in cell growth and survival and morphogenesis and airway remodeling, which may be important in asthma pathophysiology and treatment . Of the different allergic disorders, perhaps asthma has been the most closely examined in the context of vitamin d. although the underlying mechanisms of how vitamin d modulates the pathogenesis of asthma have not been completely understood, the available data suggest an association between vitamin d deficiency and asthma . On the other hand, there is insufficient and weak evidence for an association between vitamin d status and atopic disease other than asthma . In a cross - sectional study, hyppnen et al . Showed a u - shaped relation between serum vitamin d and total ige in adults, at 45 years of age . Thus, ige concentrations were higher for participants with low (<25 nmol / l) and with very high vitamin d serum levels (> 135 nmol / l) compared with a reference group (100125 nmol / l). Correcting serum concentrations of 25(oh)d to physiological levels reduced the ige level significantly, further supporting an allergy - protective role for vitamin d in adults . Following patients with chronic rhinosinusitis (crs), current clinical studies have shown that crs patients had serum vitamin d levels 4050% lower than the serum levels in the control group [34, 35]. In a study performed in iran, vitamin d levels were assessed in 50 patients with allergic rhinitis and the study results were compared with vitamin d status in normal population . The prevalence of severe vitamin d deficiency was higher in patients with allergic rhinitis than in normal population, 30% and 5.1%, respectively . The relationship between vitamin d status and asthma has been the subject of several studies in the last decade . As mentioned in the introduction according to isaac phase three (19992004) prevalence of asthma symptoms in children aged 6 - 7 years and 13 - 14 years was, respectively, from <5% to 14.5% and <5% to 11.2% for the east europe and for west europe 5.4%20.9% and 4.1%27.8%, respectively . On the other hand, the prevalence of allergic rhinoconjunctivitis symptoms in children aged 6 - 7 years and 13 - 14 years was <5%7.1% and 5%19.3% for each group, respectively, at east europe and 6.2%11.1% and 7.1%22.2% at west europe . In addition, a similar north - south gradient has been observed in europe for atopic diseases, with countries like albania and greece presenting the lowest prevalence . This remarkable variation suggests that environmental factors play an important role in the pathogenesis of allergic diseases . Factors like geographical latitude and mediterranean diet with fresh fruits, vegetables, and nuts are protective factors which may determine the beneficial role of vitamin d in our region . There has been growing interest in the influence of maternal vitamin d intake during pregnancy on the development of allergic diseases in children . As the insufficiency of this vitamin is high in pregnant woman several studies tried to examine the associations between a mother's vitamin d intake and the allergy risk in her child . Et al . Conducted a birth cohort study and in early 2006 they published results of their 2- and 3-year follow - ups . The authors reported that higher maternal intake of vitamin d was associated with a lower incidence of wheeze in the child . For each 2.5 g / day (100 iu) incremental increase in vitamin d intake the authors found a 10% decrease in risk of wheeze [8, 37]. A similar inverse association was also reported by other cohort studies [38, 39]. In addition erkkola et al . Found similar association between maternal intake of vitamin d and risk of developing asthma and allergic rhinitis in 5-year- old children . All of these studies did not measure vitamin d directly but looked at maternal vitamin d intake, mostly from supplements . During pregnancy the fetus is exposed to vitamin d through cord blood supply and the ability of 25(oh)d to cross the placenta . In a recent study camargo jr . Et al . Measured cord blood 25(oh)d and found an inverse association with the risk of respiratory infections and childhood wheezing, but not with incident asthma . Vitamin d deficiency is very common in pregnant women globally, but until now very little information is available on the impact of this deficiency on neonatal immune function and future risk of allergic disease . The prevalence of vitamin d deficiency among pregnant women was found to be 21.2% in uk, 44.6% in belgium, and 83.6% in china [4042]. On a molecular level, maternal vitamin d intake during pregnancy increases the mrna levels of the immunoglobulin - like transcripts ilt3 and ilt4 in umbilical cord blood . As these receptors are critical for the generation of t suppressor cells, this finding may point towards an early induction of immunological tolerance by maternal vitamin d intake in the developing child . Future studies with longitudinal cohorts are needed to light on the vitamin d hypothesis in fetal life . A randomized trial supported by the us nih has already started on vitamin d supplementation in pregnant women (4000 iu / day) and onset of asthma in their children; the results will be available by june 2014 . Still, high vitamin d intake during pregnancy might also be harmful with respect to allergic disease development: children whose mothers had a 25(oh)d concentration during pregnancy greater than 75 nmol / l had an increased risk of atopic eczema on examination at 9 months and asthma at the age of 9 years compared with children whose mothers had a concentration of <30 nmol / l . Future research should differentiate oral intake from endogenous contributions to 25(oh)d status in order to explain the immunological effects of each . While the incidence of asthma appears to have reached a plateau in some developed nations, many of these regions are now facing a second wave of the allergy epidemic, which, according to jones et al ., appears to be the rising incidence of food allergy . Based on epidemiological data, the recent increase in food allergen factors like obesity and race, which are risk factors for vitamin d deficiency, are associated with food allergy . Although the precise biological mechanism for these epidemiologic associations is not yet known, there are hypotheses that this hormonal deficiency contributes to food allergy risk . Several studies have described higher rates of food allergy among children born in seasons of low uv - b intensity (autumn / winter), associated with lower vitamin d levels [45, 46]. Other authors reported a negative association of maternal vitamin d intake during pregnancy with the risk of food allergen sensitization in early childhood . Accordingly, vitamin d deficiency might contribute to early - life sensitization by further compromising the immaturity of the infant immune system . Multiple - hit model in which vitamin d deficiency, in addition to compromising immune tolerance, increases susceptibility to infections and alters microbial ecology at the gastrointestinal tract, contributing to abnormal intestinal barrier permeability . These factors might synergistically promote maladaptive allergic responses to food antigens, which manifest as food allergy in genetically susceptible subjects . The authors suggest that correction of vitamin d deficiency during pregnancy and childhood might promote immunologic tolerance, suppress proallergic immune responses, improve mucosal defenses, optimize microbial flora, and thereby limit food allergy epidemic in children . As mentioned previously humans acquire most of their vitamin d through sun exposure and about 10% via ingested food . Vitamin d is absorbed through the gut as either vitamin d2 (ergocalciferol) or vitamin d3 (cholecalciferol). Natural sources of vitamin d include a few foods such as fatty fish (e.g., salmon, eel, and sardine), fish liver, or cod liver oil . Animal foods such as fatty fish, liver, fish liver oils, cheese, and egg yolks contain vitamin d3 . In some industrial countries, other sources of vitamin d are fortified foods (most often milk, margarine and/or butter, and breakfast cereals) and dietary supplements . According to european food safety authority (efsa), mean intake of vitamin d in european countries varies according to sex, age, and supplementation habits . In adults, mean intake of vitamin d from foods varied from 1.1 g / day in spain to 8.2 g / day in finland . The range of vitamin d intake reported from 14 european countries is considerable . In high consumers (95th percentile), intake from foods is up to 16 g / day and about 1.5-fold this value in those that consume supplements in addition to foods . For infants, mean intake from foods and supplements was available from finland (8.9 g / day) and the netherlands (12.5 g / day). In children 15 years, mean intake from foods varied from 1.7 g / day, in denmark, to 5.6 g / day, in greece . In older children, mean or median intake from foods only varied from 1.4 g / day in spain and ireland to 2.7 g / day in the netherlands . The main factors which determine 25(oh)d serum levels are skin pigmentation, sun exposure, age, gender, latitude of residence, winter season, dietary habits, and dietary vitamin d fortification . Below latitude of approximately 35 north, uv - b radiation is sufficient for vitamin d3 synthesis all year round . At higher latitudes many countries recommend the intake of supplements with vitamin d usually containing 525 g (2001000 iu) cholecalciferol or ergocalciferol . Cholecalciferol is more effective than ergocalciferol in elevating total 25(oh)d concentrations and maintaining those levels for a longer time . Currently, efsa proposed a daily intake of 100 g (equal to 400 iu) vitamin d for adults including pregnant and lactating women . Vitamin d intake in children and adolescents was adapted to 100 g / day for ages of 1117 years, considering the phases of rapid bone formation and growth in this age group . For children aged 110 years, the upper limit dose of 50 g / day was suggested, taking into account their smaller body size . For infants, the upper limit dose of 25 g / day was recommended . In the uk, elderly people (> 65 years) are recommended to take 10 g (400 iu) of vitamin d as a supplemental dose . The nordic dietary vitamin d recommendation for children of 3 years to adults of 60 years is 7.5 g / day (300 iu) vitamin d. infants younger than 3 years and adults over 65 years old are recommended to take 10 g / day (400 iu). The institute of medicine's committee (iom) in the new 2011 report on dietary requirements for vitamin d concludes that dietary reference intake for this nutrient can only be established according to bone health outcomes . The report estimated that children over 1-year old need at least 600 iu of vitamin d a day, with a maximum upper limit of 2500 iu for children aged 13 years, 3000 iu for children from 4- to 8-year old, and 4000 iu / day for children aged 9 or more years old . According to extraskeletal outcomes (e.g., respiratory health) clinical trial results are needed to make definitive recommendations about the optimal dose of vitamin d for immune system functioning, for asthma prevention, and for the use of vitamin d with inhaled corticosteroids to prevent steroid resistance . Several trials are under way for asthma prevention (clinicaltrials.gov, identifiers nct00920621 and nct00856947), for steroid efficacy (nct01248065), or for prevention of exacerbations (nct00978315). In recent years, many studies have been published on the effects of vitamin d and its role in various diseases . Furthermore, several studies have sought to determine the effect that vitamin d has on the immune system and specifically allergic diseases . It is worth noting that different in vivo and in vitro human studies have shown effects of vitamin d on allergy, asthma, lung function, airway responsiveness, and bronchodilator response . It seems that this hormone might lead to an innovative treatment of these increasingly common conditions . An essential issue for any vitamin d intervention concerns its dosage . The currently recommended levels of circulating serum 25(oh)d are thought to be the minimum needed for bone health, but the optimal levels for immune system function, prevention of atopy, and defense against respiratory infections are still not known . It seems that maternal supplementation during pregnancy may prevent asthma and allergy and vitamin d supplementation after birth will also probably be necessary to maintain normal immune function in the long term . The remarkable variation in prevalence of allergic diseases and asthma between european countries suggests that geographical latitude and mediterranean diet are important factors which determine the beneficial role of vitamin d in our region . It would be advisable to measure the vitamin d serum level in children and adults who are part of high risk groups for vitamin d deficiency . Another group would be children with respiratory viral infections and atopy in early life which are at high risk for asthma in later childhood . Vitamin d supplementation is only recommended for patients who have serum level less than 20 ng / ml . Randomized clinical trials regarding treatment with vitamin d supplementation will help determine the effects on the immune system and any potential role in preventing allergic disease.
|
Il-18 is a pleiotropic proinflammatory cytokine that stimulates production of ifn-, tnf-, il-1, il-2, adhesion molecules and apoptosis factors, increasing t - lymphocyte proliferation, and enhancing the lytic activity of nk - cells . It participates in the cellular and humoral immune response, both innate and adaptive . It has been shown that il-18 is involved in the pathogenesis of various diseases including type - i diabetes, rheumatoid arthritis, crohn's disease, and liver cirrhosis . Allelic variants of cytokine genes associated with promoter gene region polymorphisms do not influence the protein amino acid sequence but can result in changes in cytokine production . In consequence, they may alter the immune responses mediated by the cytokine in question and could be associated with various immunological diseases . Three single nucleotide polymorphisms (snps) are found in the il-18 gene promoter in positions 656 gt, 607 ca, and 137 gc . Two of these, 607 ca and 137 gc, are located at the binding sites for creb transcriptional factors (camp response - element binding proteins) and the h4tf-1 nuclear factor, respectively, therefore mutation at these two sites could influence il-18 expression and change the production of the cytokine . Recent studies have investigated the relationship between il-18 gene polymorphisms and predispositions to various diseases . It has been shown that individuals carrying the 607c 137c haplotype are prevalent in rheumatoid arthritis cases among the populations of germany and scotland . Women carrying the c - allele at 137 have a heightened risk of developing ovarian carcinoma . The presence of such a genotype in patients with nasopharyngeal carcinoma of an undifferentiated type worsens the prognosis for the disease and is associated with earlier metastasis . The g - allele at 137 is associated with the development of bronchial asthma and dermal allergic reactions . In patients with hepatitis b from the chinese population, the 137gg and 607ca allele variants of the il-18 gene promoter are consistently more frequent; conversely, hepatitis b is encountered consistently more rarely in persons with the c - allele at 137 . Nevertheless, the impact of one or other il-18 allele variant on the level of protein production has not been adequately studied . The aim of our study was therefore as follows: to investigate the distribution of il-18 allele variants at positions 607ca and 137gc within a population of healthy donors from southwestern siberia, and the influence of these allele variants on the level of il-18 production by their peripheral blood mononuclear cells (mncs). Dna was obtained from pbmc from adult (2050 years of age) healthy donors (n = 146) to study polymorphisms in the promoter region of the il-18 gene and the production il-18 protein . All subjects gave written informed consent for enrolment in the study, which was approved by the local ethics committee . Genomic dna was extracted from pbmc by a set test - na (dna - technology, russia). Allele - specific amplification was assessed by fluorescent detection of the products of real - time pcr . Four primers were used for amplification, two specific for each polymorphism at positions 607 and 137 . Products were detected using the intercalating dye sybr - green i. pcr was performed using an iq4 cycler (bio - rad, usa). The reaction mixture (15 l final volume) contained 0.3 m specific and control primers; pcr buffer (16 mm tris - hcl, ph 8.9, 2.4 mm mgcl2, 65 mm (nh4)2so4); 0.2 mm dntp; 1 sybr - green i; 1 unit taq - polymerase; and 5 ng dna . The pcr conditions were as follows: denaturation (95c, 3 minutes) followed by 5 cycles of amplification at 95c for 10 seconds, 57c for 10 seconds, and 72c for 10 seconds; then 30 cycles at 95c for 3 seconds, 59c for 3 seconds, 72c for 3 seconds, 78c for 10 seconds (plate read), and 82c for 10 seconds (plate read). A melting curve analysis was then performed: 60 cycles starting at 65c with temperature increments of 0.5c, the plate being read at each cycle . The data obtained were interpreted on the basis with the increase in fluorescence, and the melting curve was used to assess specificity . The specific primers used were 137 c 5-taatgtaatatcactattttcatgaaatc-3137 g 5-aatgtaatatcactattttcatgaaatg-3607 c 5-gttgcagaaagtgtaaaaattattac-3607 a 5-gttgcagaaagtgtaaaaattattaa-3. 137 c 5-taatgtaatatcactattttcatgaaatc-3 137 g 5-aatgtaatatcactattttcatgaaatg-3 607 c 5-gttgcagaaagtgtaaaaattattac-3 607 a 5-gttgcagaaagtgtaaaaattattaa-3. The internal control primers wereltm 1 tgggtgctagaggtataatcgltm 2 ttagaggaagctgggtaagag . As we used two pairs of allele - specific primers, we studied the reactions in four test tubes simultaneously for each sample to detect any of the four possible haplotypes . Pbmc were isolated from heparinized blood using ficoll - urografin density gradients and were cultured (1 10 cells / ml) for 48 hours in a 48-well plate (beckton dikkinson, usa) in the presence or absence of lps (055/b5, sigma, usa) at a final concentration of 10 g / ml . The level of il-18 protein in the conditioned medium was determined by elisa (bender med systems, austria). All snps were in hardy - weinberg equilibrium in investigated population.for statistical analysis of the data, we used the nonparametric mann - uitni's test employing the statistica 6.0 program . To identify quantitative differences in il-18 production levels, we used quantile rank classification according to the mosteller - tewkee algorithm . To analyze the il-18 concentrations, we determined the probability limits of the empirical distribution quantiles(x(qi)). A number of quantile ranges (k), into which the total amplitude of variation of the il-18 level was split, were calculated starting from a minimal sample size (nmin) by sturges's formula . -criterion (p) and fisher's precise method for small samples (ptmf) were used to judge the reliability ofoccurrence for qualitative features and frequencies of events within different ranges of il-18 variation . The distribution of the susceptibility / resistance gene alleles responsible for resistance to or risk of developing immunopathological diseases is unique to each population . This could be one reason for the diversity of immune responses to an antigen . This study of two snps in the il-18 gene was conducted on a group of healthy persons (n = 146). The relative frequencies of the c / c, c / a, and a / a variants in the 607ca polymorphism were 39.2%, 44.7%, and 16.1%, respectively . The c and a alleles occurred at frequencies of 64.5% and 35.5%, respectively . Analysis of the il-18 gene polymorphism at the 137g position gave the following results: the frequency of the homozygous variant (g / g) was 45.5%, and that of the heterozygous variant g / c was 42.7%; the c / c genotype was found in 11.8% of cases, and the g and c allele frequencies were 66.8% and 33.2%, respectively . The frequencies of the ac (607/137) haplotype were 22%, ag 14.6%, cg 55.9%, and cc 7.5% . We next investigated the il-18 concentration in media conditioned by the pbmc from healthy donors . The median levels of il-18 protein were 21.86 pg / ml [9.83; 57.60 (quartiles)] for spontaneous production and 72.44 pg / ml [32.96; 103.07 (quartiles)] for lps - stimulated production . We further studied the correlation between il-18 production and the polymorphic variants 607ca in the il-18 gene promoter (see figure 2). Il-18 production by lps - stimulated pbmc was significantly greater in healthy donors carrying the ca genotype than in those with the cc genotype at the 607 position of the promoter . We analyzed the relationship between genotype frequency distributions and il-18 production, dividing the cytokine concentrations into low, medium, and high classes . Concentrations in the 1585% quantile range (3.593.5 pg / ml) for spontaneous production were classed as medium . Production levels outside these limits were classed as low or high we found a higher frequency of a - allele carriers among persons with a high level of spontaneous il-18 production . We studied the correlation between il-18 production by pbmc from healthy donors and variants of the il-18 genotype 137 at the position, and we obtained the following data (see figure 1). Il-18 production by lps - stimulated pbmc was significantly less in persons carrying the cc genotype than in those with the gg genotype at the 137 position . To investigate this further, we analyzed the relationship between the genotype frequency distribution and levels of il-18 production . The limits of three primary ranges of variation in il-18 production levels were determined by quantile rank analysis which is tolerant of random statistical surges and critical deviations of a sign from normal distribution . In accordance with common practice, concentrations in the range 1585% (25.6114.3 pg / ml) for lps - stimulated production were classed as medium . Concentrations outside the limits of these quantiles, that is, less than 25.6 pg / ml and more than 114.3 pg / ml, were classed as the frequency of the c allele at the 137 position was significantly higher in donors with low lps - stimulated il-18 production than in those with medium or high production . Thus, lps - stimulated production of il-18 is lower in persons with the cc genotype than in donors with the gg genotype at the 137 position of the promoter . The c allele frequency is greater in the group with a low level of stimulated il-18 production . As these two polymorphisms, 137 g / c and 607 c / a, were in strong linkage disequilibrium, all possible combinations of alleles 607 ca and 137 gc have been investigated . There has been shown increased spontaneous production of il-18 associated with haplogenotypes 607cn/137gn in comparison with 607aa/137gn and 607cn/137cc . Thus alleles 607c and 137 g are associated with increase of spontaneous production of il-18 . Increased lps - stimulated production of il-18 is associated with a haplogenotype 607cn/137gn in comparison with 607cn/137cc (see figure 3). This study showed that the frequencies of il-18 genotypes in healthy donors from novosibirsk city (southwestern siberia) were as follows: 607cc, 32.2%; 607ac, 44.7%; 607aa, 16.1%; 137gg, 45.5%; 137gc, 42.7%; and 137cc, 11.8% . For the haplotypes, the values were as follows: ac (607/137), 22%; ag, 14.6%; cg, 55.9%; and cc, 7.5% . Lps - stimulated production of il-18 was lower in persons with the cc genotype than in donors with the gg genotype at the 137 position of the gene promoter . Il-18 production by lps - stimulated pbmc from healthy donors carrying the ca genotype was significantly higher than from those carrying the cc genotype at the 607 position . Alleles 607c and 137 g are associated with increase of spontaneous production of il-18, allele 137 g increases spontaneous and stimulated production . Genetic factors are important in the pathogenesis of all major human diseases and it is known that human populations vary genetically because of polymorphisms, which can affect aspects of the immune response . Diverse polymorphic variants of cytokine genes may induce high or low levels of protein production . Single nucleotide polymorphisms in the il-18 gene promoter at 607 ca and 137 gc affect functionally active parts of this promoter, that is, binding sites for creb transcriptional factors and the h4tf-1 nuclear factor, respectively . Therefore, mutation at these two sites could influence il-18 expression and alter the level of il-18 production . Considering the distributions of il-18 gene alleles in healthy donors from different populations, we found various frequency rates . In the japanese population, the genotypes gg, gc, and cc were found at the 137 position of the promoter with frequencies of 75.4%, 23.1%, and 1.2%, respectively; the genotypes aa, ac, and cc at the 607 position had the frequencies 43.9%, 39.2%, and 16.9%, respectively . Genotype frequencies in the chinese population were 137gg, 67.3%; 137gc, 30%; 137cc, 2.7%; 607aa, 24.7%; 607ac, 53.3%; and 607cc, 22% . For european populations from switzerland and italy, the characteristic frequencies of the genotypes 137gg, 137gc, and 137cc were 54.1% and 48.3%, 38.7% and 43.8%, and 7.2% and 7.9%, respectively . Il-18 genotypes at the 607 position of the promoter were found in the italian population at the following rates: aa, 23.6%; ac, 47.2%; cc, 29.2% . We found the following il-18 genotype frequencies in healthy donors from novosibirsk (southwestern siberia): gg, gc, and cc at the 137 position of the promoter were found in 45.5%, 42.7%, and 11.8% of cases, respectively; aa, ac, and cc at the 607 position were found in 16.1%, 44.7%, and 39.2%, respectively . Thus, the genotype frequencies within the population of southwestern siberia are similar to those of european countries (italy and switzerland). There are, however, some differences in genotype distribution between the inhabitants of southwestern siberia and the populations of china and japan . It is well known that gene promoter polymorphisms can affect the level of protein production . Our study demonstrated a relationship between two il-18 gene promoter polymorphisms and the level of lps - stimulated il-18 production . Pbmc from persons carrying the c allele at the 137 position of the promoter show low lps - stimulated production of the cytokine . Also, the level of il-18 production by pbmc from donors with the 607ac genotype is higher than that from donors with the 607cc genotype . There appears little dose effect of the allele a of 607 snp and we could not detect any difference of il-18 production when heterozygote for 137 snp was considered as a whole . However, after splitting heterozygote for one snp according to their genotype at other snp, we were able to demonstrate differential haplogenotypic il-18 production . . Increased lps - stimulated production of il-18 was associated with a haplogenotype 607cn/137gn in comparison with 607cn/137cc . Thus alleles 607c and 137 g are associated with increase of spontaneous production of il-18, allele 137 g increases spontaneous and stimulated production . It is possible to assume that only in case of presence of both alleles conducts to increase production of il-18 protein . The increased frequency of allele 607a with high production il-18 is connected with heterozygotes 607ca (16 donors from 19). . Showed that a polymorphic variant of the il-18 gene influenced il-18 production by monocytes . In particular, they showed that spontaneous and lps - stimulated production of il-18 in volunteers with the 137gg genotype was higher than in those with the 137gc genotype, which is in agreement with our results . Il-18 is a pleiotropic proinflammatory cytokine that predominantly influences the differentiation of type 1 t - helper cells, thus participating in the establishment of the cellular immune response and inflammatory reactions . A study of the relationship between il-18 gene promoter polymorphisms and the likelihood of developing oncological diseases showed that women carrying the c allele in the 137 position of the promoter are at greater risk of developing ovarian carcinoma . On the basis of our results and data from the literature, one could suppose that the presence of the c allele at the 137 position in the il-18 gene promoter in such patients results in a less efficient antitumor immune response because il-18 production by immunocompetent cells is diminished . The serum level of the proinflammatory factor il-18 is known to be significantly elevated in patients with atopic asthma during the acute phase . Studies of the association between il-18 polymorphism and atopic asthma have revealed that the g allele at the 137 position leads to an elevated risk of disease development; moreover, none of the 74 patients examined had the cc genotype, which according to our data is associated with reduced il-18 production . Moreover, the linkage disequilibrium was observed between the 137 and 105 polymorphisms of the il-18 gene and the 105a allele of the il-18 gene which may be associated with the pathogenesis of asthma . Premature infants with reduced birth weight are at risk of developing necrotizing enterocolitis and il-18 that is also involved in the pathogenesis of this disease . Analysis of the association between disease severity and genotype frequencies at the 607 position of the il-18 gene showed that the aa genotype frequency is significantly higher in patients with the third and most severe stage of necrotizing enterocolitis, when the intestinal wall is perforated . On the basis of present knowledge, one may assume that allelic variants of the il-18 gene promoter at the 607ca and 137gc positions, which, according to our results, influence the level of protein production, could result in conditions of which the pathogenesis involves a significant role for il-18 . In conclusion, this study shows that the il-18 genotype frequencies among healthy donors from novosibirsk city (southwestern siberia) are as follows: 607cc, 39.2%; 607ac, 44.7%; 607aa, 16.1%; 137gg, 45.5%; 137gc, 42.7%; and 137cc, 11.8% . Allelic variants in the il-18 gene promoter at the 607ca and 137gc positions influence the level of production of the mediator by immunocompetent cells . Lps - stimulated production of il-18 in persons with the cc genotype is lower than that in donors with the gg genotype at the 137 position of the promoter . The c allele frequency is significantly higher in the group with low lps - stimulated il-18 production . Lps - stimulated production of il-18 by pbmc from healthy donors is significantly greater in those carrying ca genotype at the 607 position . Thus alleles 607c and 137 g are associated with the increase of spontaneous production of il-18 and allele 137 g increases spontaneous and stimulated production . It is possible to assume that only in case of presence of both alleles conducts to increase production of il-18 protein.
|
Recurrent pregnancy loss (rpl) or habitual miscarriage is the loss of three or more consecutive pregnancies before the 20 week of gestation (1). The world health organization (who) has defined a miscarriage as the loss of a fetus or embryo weighing 500 g, which would normally be at 2022 weeks of gestation . It varies with age and parity and a woman over the age of 35 is at greater risk of pregnancy loss than a 25-year - old woman . However, epidemiologic studies have revealed that 1% to 2% of women experience recurrent pregnancy loss (2). Approximately 15% of clinically recognized pregnancies result in spontaneous loss, and there are many more pregnancies that fail prior to being clinically recognized . The risk of miscarriage is 30% after two previous losses and 35% after the third one . This strongly suggests a need for evaluation after just two losses in patients with no prior live births . An earlier evaluation may further indicate whether the fetal cardiac activity is identifiable prior to a loss, if the woman is older than 35 years, or the couple has had difficulty in conceiving . There are several leading causes of rpl, among them are uterine anatomical defects, (intrauterine adhesions, uterine fibroids or polyps and cervical incompetence), genetic factors, infectious, immunological, environmental and blood dyscariasis . However, despite extensive investigation of female partners in a large number of cases (40% 50%) no cause has been identified and such cases are classified as idiopathic . It is possible that in such cases, the male partner may harbour sperm abnormalities . Evaluation of male factor in rpl involves paternal chromosomal analysis only and the role of sperm factors has totally been ignored . With the advent of advanced assisted micromanipulation procedures, however, routine semen parameters do not provide much information regarding sperm functional competence and reproductive potential . Thus, this study was designed with the aim to evaluate the role of sperm factors, oxidative stress and dna damage in irpl following spontaneous conception . In this study we analysed semen samples for free radical levels, particularly the reactive oxygen species (ros), total antioxidant capacity (tac) and sperm dna damage to evaluate if irpl is associated with poor sperm quality in terms of dna damage and oxidative stress . Twenty couples with irpl attending antenatal clinic and twenty fertile men who had fathered a child a year prior to the study and had normal sperm parameters were enrolled as cases and controls, respectively, after signing an informed consent form each and obtaining the approval from the institute's ethical clearance committee (ref . The study was conducted from march 2010 to july 2011 at laboratory for molecular reproduction and genetics, all india institute of medical science, new delhi, india . A detailed family, clinical, occupational and reproductive histories and a 7 day recall of the participants diet were recorded in a pre - designed performa . The individuals were evaluated to rule out immunological, endocrinological, infectious or anatomical defects . The absence of antiphospholipid syndrome was confirmed by ruling out the presence of lupus anticoagulant (la) and anticardiolipin (acl) antibodies . Both the patients and the controls belonged to the same socio - economic strata (lower and low middle class) of the north indian society . Therefore, the dietary intake, which could influence the levels of antioxidants, was similar in both the infertile men and controls . Semen samples were obtained by masturbation and collected into sterile non - toxic vials, after a period of 7296 hours of sexual abstinence . Specimens were allowed to liquefy for 3040 minutes at room temperature, and time of liquefaction was noted . After liquefaction, 400 l of raw semen was used to assess basal ros levels . Ten microlitters of luminol (5-amino-2, 3,-dihydro-1,4-phthalazinedione; sigma, usa), prepared as 5 mm stock in dimethyl sulfoxide (dmso), was added to the mixture and served as a probe . A negative control was prepared by adding 10 l of 5 mm luminol to 400 l of pbs . Levels of ros were assessed by measuring the luminol - dependant chemiluminescence with the luminometer (sirius, berthold detection systems gmbh, pforzheim, germany) in the integrated mode for 15 minutes . Each sample was analysed in duplicate and the mean of three readings at a 1-week interval was taken . Total antioxidant capacity was assessed using the commercially available kit (cayman chemical item number 709001, usa) as per the specifications of the kit manufacturer . Frozen aliquots of semen were placed in a 37 c water bath until just thawed, after which samples were diluted with tne buffer to 1210 sperm cells per ml . 0.20- ml aliquots of diluted samples were mixed with 0.40 ml of acid - detergent solution (0.08 m hcl, 0.15 m nacl, 0.1% triton x-100, ph=1.2). After 30 s, the cells were stained by adding 1.2 ml acridine orange (ao) stain solution (containing 6 g ao, chromatographically purified; polysciences, inc ., usa) per ml buffer (0.037 m citric acid, 0.126 m na2hpo4, 0.0011 m edta (di - sodium), 0.15 m nacl, ph = 6.0) was added . Cells were analysed using fac scan flow cytometer (bd biosciences, usa), with an air- cooled argon laser operated at 488 nm and a power of 15 mw . For every six test samples, one standard reference sample was analysed to ensure instrument stability . Under these experimental conditions, and excited with a 488 nm light source, ao intercalated with double - stranded dna emits green fluorescence and ao associated with single - stranded dna emits red fluorescence . Thus, sperm chromatin damage can be quantified by flow cytometric (fcm) measurements of the metachromatic shift from green (native, double - stranded dna) to red (denatured, single - stranded dna) fluorescence and displayed as red (fragmented dna) versus green (dna stainability) fluorescence intensity cytogram patterns . The green fluorescence (fl1) was collected through a 515 545 nm bandpass filter, and the red fluorescence (fl3) was collected through a 650 nm long pass filter . After staining with ao staining solution, the sample was placed in the flow cytometer and run through the flow system . After complete analysis of the sample, the x- (red fluorescence) and y - mean (green fluorescence) values were recorded manually after selecting gate for sperm cells using flowjo cytometry analysis software (oregon, usa). Extent of dna denaturation (damage) was expressed in terms of dfi, which is the ratio of red to total (red plus green) fluorescence intensity, i.e. The level of denatured dna over the total dna . The percentage of high dna stainability cells (hds) were also recorded in each sample manually from the graph plot . Hds represents another distinct population in semen that characterizes immature spermatozoa with incomplete chromatin condensation . Statistical analysis was performed using spss version 15 and the parameters were compared by mann - whitney test . Pearson correlation test was used to find the correlation between parameters and a p - value <0.05 was considered significant . Receiver operating characteristics (roc) curve analysis was applied to find out the cut - off value of dfi to discriminate male partners from fertile controls . Semen samples were obtained by masturbation and collected into sterile non - toxic vials, after a period of 7296 hours of sexual abstinence . Specimens were allowed to liquefy for 3040 minutes at room temperature, and time of liquefaction was noted . After liquefaction, 400 l of raw semen was used to assess basal ros levels . Ten microlitters of luminol (5-amino-2, 3,-dihydro-1,4-phthalazinedione; sigma, usa), prepared as 5 mm stock in dimethyl sulfoxide (dmso), was added to the mixture and served as a probe . A negative control was prepared by adding 10 l of 5 mm luminol to 400 l of pbs . Levels of ros were assessed by measuring the luminol - dependant chemiluminescence with the luminometer (sirius, berthold detection systems gmbh, pforzheim, germany) in the integrated mode for 15 minutes . Each sample was analysed in duplicate and the mean of three readings at a 1-week interval was taken . Total antioxidant capacity was assessed using the commercially available kit (cayman chemical item number 709001, usa) as per the specifications of the kit manufacturer . Frozen aliquots of semen were placed in a 37 c water bath until just thawed, after which samples were diluted with tne buffer to 1210 sperm cells per ml . 0.20- ml aliquots of diluted samples were mixed with 0.40 ml of acid - detergent solution (0.08 m hcl, 0.15 m nacl, 0.1% triton x-100, ph=1.2). After 30 s, the cells were stained by adding 1.2 ml acridine orange (ao) stain solution (containing 6 g ao, chromatographically purified; polysciences, inc ., usa) per ml buffer (0.037 m citric acid, 0.126 m na2hpo4, 0.0011 m edta (di - sodium), 0.15 m nacl, ph = 6.0) was added . Cells were analysed using fac scan flow cytometer (bd biosciences, usa), with an air- cooled argon laser operated at 488 nm and a power of 15 mw . For every six test samples, one standard reference sample was analysed to ensure instrument stability . Under these experimental conditions, and excited with a 488 nm light source, ao intercalated with double - stranded dna emits green fluorescence and ao associated with single - stranded dna emits red fluorescence . Thus, sperm chromatin damage can be quantified by flow cytometric (fcm) measurements of the metachromatic shift from green (native, double - stranded dna) to red (denatured, single - stranded dna) fluorescence and displayed as red (fragmented dna) versus green (dna stainability) fluorescence intensity cytogram patterns . The green fluorescence (fl1) was collected through a 515 545 nm bandpass filter, and the red fluorescence (fl3) was collected through a 650 nm long pass filter . After staining with ao staining solution, the sample was placed in the flow cytometer and run through the flow system . After complete analysis of the sample, the x- (red fluorescence) and y - mean (green fluorescence) values were recorded manually after selecting gate for sperm cells using flowjo cytometry analysis software (oregon, usa). Extent of dna denaturation (damage) was expressed in terms of dfi, which is the ratio of red to total (red plus green) fluorescence intensity, i.e. The level of denatured dna over the total dna . The percentage of high dna stainability cells (hds) were also recorded in each sample manually from the graph plot . Hds represents another distinct population in semen that characterizes immature spermatozoa with incomplete chromatin condensation . Statistical analysis was performed using spss version 15 and the parameters were compared by mann - whitney test . Pearson correlation test was used to find the correlation between parameters and a p - value <0.05 was considered significant . Receiver operating characteristics (roc) curve analysis was applied to find out the cut - off value of dfi to discriminate male partners from fertile controls . The mean age of the cases and the controls were 33.354.95 and 31.402.34 years, respectively . After detailed gynaecological and laboratory investigation, it was found that the female partners were normal . Moreover, there was no occupational or environmental exposure to radiation (electromagnetic radiation), high temperature, toxic chemicals (insecticides and pesticides), mutagens or pollutants in the patients or the controls . None of the patient or the controls had life style factors as smoking or alcohol intake which could affect the dna integrity . All patients and controls were of the same socio - economic strata with poor / low intake of fruits and vegetables . No significant differences in age, seminal volume, liquefaction time, ph and sperm concentration were observed between male partners of idiopathic rsa cases and controls, but sperm morphology and motility were significantly (p <0.05) lower in male partners of patients with irpl (table 1). Ros in neat semen was significantly (p <0.05) elevated in cases as compared to controls . The mean ros levels observed were 47427.00 relative light unit (rlu)/min/20 million sperm in cases as compared to 13644.57 rlu / min/20 million sperm in controls (table 2); normal value <15,000 rlu / min/20million sperm . The average mean of tac in controls (6.95 mm trolox) was significantly (p <0.05) higher as compared to cases (2.98 mm trolox). The mean dfi of male partners was found to be 23.379.9 (8.5044.07) and the mean dfi of controls was 13.895.40 (7.7025.80), (table 2). The mean dfi was significantly (p <0.05) higher in cases when compared to controls . The high ros shows positive correlation with sperm dna damage in male partners, but no such correlation was observed in controls . By applying roc curve analysis, a threshold value of 16.50 was obtained to discriminate cases from controls (figure 2). Receiver operating characteristics (roc) curve analysis for dfi comparison of semen parameters in the cases and controls values are expressed as median (range). Keys: sc sperm count; sm sperm motility; nm normal sperm morphology; sma sperm motility grade a comparison of dfi and ros levels of cases and controls values are expressed as median (range) values expressed as meansd p - values <0.05 considered significant . Key: dfi: dna fragmentation index; ros: reactive oxygen species; tac: total antioxidant capacity the area under curve was 0.781 with a standard error of 0.076 . Higher numbers of sperm cells were detected with green fluorescence (y - axis) and lower numbers of cells with red fluorescence (x - axis) in pseudo - colour scsa cytogram of control samples (figure 1a), while more numbers of sperms were towards red fluorescence in the cytogram of cases (figure 1b) indicating dna damage and high dfi . X - axis represents fragmented dna and y - axis represents native dna to correlate the semen parameters with dfi, the study group was divided into two groups, group a with dfi> 16.50 and b with dfi <16.50 . Sperm motility and morphology were significantly (p <0.05) compromised in group a. however, no significant differences were observed in the seminal volume, sperm count, ph and liquefaction time . A negative correlation was observed between motility, morphology and dfi and ros levels in cases versus the controls . The role of sperm factor in early embryogenesis has not been intensively investigated in cases of irpl following spontaneous conception . However, recent studies (6) have emphasized that sperm dna damage (dna fragmentation or denaturation) and/or chromosomal aneuploidies may compromise early embryonic development and result in irpl (6, 7). Till date, in cases of irpl, the male partner is only investigated for the presence of chromosomal abnormalities . . However, a large number of cases may have sub - microscopic rearrangements or nonspecific dna damage which is not detected by cytogenetic analysis . Such dna alterations and sperm dna damage may be due to oxidative stress (imbalanced ros and tac) in cases of irpl with both normal and abnormal semen profiles . In this study we analysed ros levels, tac and sperm dna damage in cases experiencing irpl following spontaneous conception . We planned to analyse these idiopathic cases of irpl for oxidative stress and dna damage . It has been reported that spermatozoa membrane is rich in polyunsaturated fatty acids and it is poor in cytosolic antioxidants . Therefore, sperms are vulnerable to oxygen induced damage which leads to lipid peroxidation and mitochondrial and nuclear dna damage . Increased ros and reduced tac leads to oxidative stress which culminates to sperm dna damage impairing the reproductive functional efficiency of the sperm . The ros being highly reactive has a tendency to react with sperm biomolecules as proteins, lipids and dna . Though, the physiological levels of ros form a major component of regulatory pathways in various biological systems, but its increased concentration is lethal to the normal sperm functioning . Increased free radical levels damage the nucleohistone component of the sperm genome . This component which maintains its nucleosomal structure has genes which are transcribed and are critical for early embryonic development (hox and, hsp genes). The reactive nitrogen species is another category of free radicals which contributes to oxidative stress . Although low levels of ros are necessary for normal sperm function but its high levels generated by immature and morphologically abnormal spermatozoa and by activated leukocytes in semen, exposure to xenobiotics, electromagnetic radiation, varicocele, infection and inflammation impair sperm functional competence by damaging the sperm membrane, mitochondrial and nuclear dna (7). This is particularly relevant in the era when advanced forms of assisted reproductive technologies are commonly used (technologies that often bypass the barriers to natural selection), because there is some uncertainty regarding the safety of using dna - damaged spermatozoa due to lack of longterm follow up studies . Defective sperm function is the most common cause of infertility, and until recently, it was difficult to evaluate and treat . Part of this difficulty was due to our incomplete understanding of the factors contributing to normal and abnormal sperm functions leading to male infertility . It has been reported that majority of couples experiencing rpl are infertile and a large number of couples experiencing assisted and spontaneous conception failure may have underlying sperm factor(s) (sperm mitochondrial and nuclear dna damage and oxidative stress). A previous study from our laboratory (8), documented that infertile men with normal / or abnormal sperm parameters had raised ros and decreased antioxidant levels . However, it is difficult to predict increased ros levels and dna damage based on standard semen parameters . Thus tests for seminal oxidative stress and dna integrity should be done complementary to routine semen assessment . Therefore, the attention has now shifted from analysing standard semen parameters to studying/ evaluating molecular aspects of spermatozoa, among these are sperm chromatin structure assay, free radical levels, sperm transcript and telomere length (6, 7, 9). Men with high sperm dfi had poor success rate in art (ivf / icsi) (1012). Therefore, to measure the dna integrity of spermatozoa, various methods have been employed which are important to understand the etiology of irpl and also to prevent severe financial burden of repeated art failures and minimise emotional stress (9, 13). However, their utility in clinical settings are limited and also their threshold values are not clear (5, 14). In this preliminary pilot study we used sperm chromatin structure assay (scsa) for evaluating sperm chromatin structure assay in male partners of couples experiencing irpl . Scsa is a sensitive technique that uses the metachromatic property of acridine orange (oa) to emit green fluorescence when it binds to double - stranded native dna and to emit red fluorescence when it binds to fragmented single - stranded dna . It evaluates sperm chromatin susceptibility to acid denaturation and is expressed as dna fragmentation index (dfi) (15). Our results clearly showed that male partners of couples experiencing irpl had poor sperm quality and loss of dna integrity . It is possible that raised ros levels and oxidative dna damage have been associated with poor blastocyst development and impaired embryogenesis and consequently pregnancy loss . The dfi threshold value of 16.50% observed in this study may be used to discriminate male partners of couples experiencing rpl and fertile men . This value is similar to an iui study, where the sperm dna fragmentation was found to be lower (12%) in the group that resulted in pregnancy than those that did not (16), but to further validate the threshold value from this pilot study, a large sample size is required . The negative correlation of sperm dna fragmentation with fertilization and embryo cleavage rate was reported by sun jg et al ., (in contrast, no association was found between dna fragmentation and ivf and icsi outcome by tunel1 assay undertaken by benchaib et al . (18), however, they observed high fertilization rate in the group with dna fragmentation <10% . Recent study by dada et al, reported that infertile men with repeated icsi failure had increased sperm dna fragmentation (19). Among various methods to assay the sperm dna fragmentation, scsa forms a reliable method for studying sperm chromatin integrity (6, 15, 20, 21). Various studies have reported threshold cut - off values between 2030% in infertile men opting for art (16, 22, 23) but in cases of irpl the cut - off values by various methods of sperm dna fragmentation assay have not been reported and the cut - off values also vary with the methods used for the assessment of sperm dna integrity . It has been reported that there is a 3-fold increase in the miscarriage rate in cases with high dna fragmentation (6, 7, 18, 2426). This may be a mechanism of natural selection where embryos with intact dna integrity could only complete development . Previous studies have reported increased incidences of genetic / epigenetic abnormalities, genitourinary abnormalities, musculoskeletal defects, autosomal disorders and even carcinoma in children who conceived from sperm harbouring dna damage (2729). Recent studies have shown that sperm dna damage correlates with infertility, early pregnancy loss, defective embryogenesis, congenital malformations and genetic abnormalities . In our study 15 out of 20 male partners had high dfi (> 16.5%), these cases had a greater chance of prenatal and postnatal morbidity . In these cases one of the chief causes of sperm dna damage is oxidative stress (9, 15, 25, 26, 3032) which results in the generation of oxidized bases like etheno nucleosides which impair oocyte nucleoside excision repair capacity and thus the sperm dna damage is not repaired, therefore accumulation of such oxidized bases may lead to higher probability of pre- or post - implantation failure . " Oxidative stress " is a state of homeostatic imbalance associated with cellular damage induced by increased oxygen and oxygen - derived oxidants (reactive oxygen species) which overwhelm the antioxidant defence mechanisms (33, 34). Oxidative stress in sperm is the result of imbalance between ros generation and the scavenging anti - oxidant potential . The scavenging potential in gonads, seminal fluid and sperm is normally maintained by adequate levels of antioxidants . A situation in which there is a shift in this ros balance towards pro - oxidants because of either excess ros or diminished anti - oxidants, can be classified as oxidative stress . In our study, the ros scavenging potential measured as a parameter of total antioxidant capacity was found to be significantly reduced in infertile men . Therefore, in our samples it was both the reduced total antioxidant capacity and the increased ros levels which could have lead to the sperm dna damage . Sperm exist in a state of oxygen paradox as they require oxygen for atp production but are thus exposed to high ros levels which damage both mitochondrial and nuclear dna (25). An additional factor of impaired dna repair mechanism due to mutations in the dna repair genes as dna pol g, p53, bcl 2 could also be predicted in our infertile men . Mammalian spermatozoa are rich in polyunsaturated fatty acids and, thus, are very susceptible to ros attack which results in a decreased sperm motility due to altered membrane permeability and fluidity, presumably by a rapid loss of intracellular atp leading to axonemal damage, decreased sperm viability, and increased midpiece morphology defects with deleterious effects on sperm capacitation and acrosome reaction (3537). Lipid peroxidation (lpo) of sperm membrane is considered to be the key mechanism of this ros - induced sperm damage leading to infertility (31, 32, 38). Lipid peroxidation is the most extensively studied biochemical manifestation of oxygen activation in reproductive biology (39). In spermatozoa, production of malondialdehyde (mda), an end product of lpo induced by ferrous ion promoters, has been reported (32, 40). Spermatozoa, unlike other cells, are unique in structure, function, and susceptibility to damage by lpo (38). In general, the most significant effect of lpo in all cells is the perturbation of membrane (cellular and organellar) architecture and function (transport processes, maintenance of ion and metabolite gradients, and receptor mediated signal transduction). Besides membraneous effects, lpo can damage dna and proteins, either through oxidation of dna bases (primarily guanine via lipid peroxyl or alkoxyl radicals) or through covalent binding to mda resulting in strand breaks and cross - linking (39). Ros can also induce oxidation of critical -sh groups in proteins and dna, which will alter structure and function of spermatozoa with an increased susceptibility to attack by macrophages (41). The oxidative damage to mitochondrial dna occurs in all cells rich in mitochondria including spermatozoa . In addition, the redox status of human spermatozoa affects phosphorylation and atp generation with a profound influence on fertilizing potential (41). Sperm dna damage is associated with high levels of reactive oxygen species, which are detected in the semen of 25% of infertile men (42). Although low levels of reactive oxygen species are necessary for normal sperm functions (capacitation and acrosomal reaction) high levels of ros are generated by defective spermatozoa and by seminal leukocytes (43), which result in sperm dysfunction . The association between sperm dna damage and sperm - derived reactive oxygen species suggests that dna damage may be caused by a defect in spermiogenesis (44), whereas the association between sperm dna damage and leukocyte - derived reactive oxygen species suggests that dna damage may be caused by a post - testicular defect (45). In a previous study from our laboratory, we documented that raised ros levels lead to both mitochondrial sequence variation and nuclear dna damage, which results in impaired motility and hypospermatogenesis which may be the underlying pathology in infertility and rsa (6, 7). The high ros showed a positive correlation with sperm dna damage in male partners, but no such correlation was observed in controls . The male partners showed a negative correlation of dfi with sperm motility and morphology, although no such correlation was found in controls, which is in accordance with earlier studies (41). It is postulated that since oxidative stress is a chief cause of dna damage it could also cause mitochondrial sequence variation which further results in increased production of free radicals and lower levels of atp leading to impaired motility low atp levels secondary to mitochondrial dysfunction lead to impaired polymerization of microtubules resulting in partially formed or totally disorganized micro tubular apparatus . Unlike the relatively loose structure of chromatin (dna and nuclear proteins) in somatic cells, sperm chromatin is highly compact because of the unique association of the sperm dna and sperm nuclear proteins (predominantly highly basic proteins known as protamines). These neutralize the negative charge of dna and thus make the dna highly crystalline and a compact toroid (48, 49). During the later stages of spermatogenesis, the spermatid nucleus is remodelled and condensed, which is associated with the displacement of the majority of histones (85%) by transition proteins and then by protamines (50). The dna strands are tightly wrapped around the protamine molecules (about 50 kb of dna per protamine), forming tight and highly organized loops . Inter- and intra - molecular disulfide cross - links between the cysteine - rich protamines are responsible for the compaction and stabilization of the sperm nucleus . It is thought that the nuclear compaction is important to protect the sperm genome from external stresses such as oxidation or temperature elevation (51). The current understanding is that sperm chromatin is tightly packaged by protamines, but up to 15% of the dna remains packaged by histones at specific dna sequences (52). The histone - bound dna retains its nucleosomal structure, and it is peripherally located in the nucleus containing genes essential for early embryonic development . The ttaggg - rich hexamere repeats (telomeres) are also peripherally located (53). These guanine - rich repeats with low oxidation potential get oxidised to 8-oh 2-deoxy guanosine which is promutagenic and results in transversion and single - stranded breaks and subsequently telo - mere shortening . Telomere shortening was also observed in these cases (outside preview of this paper). However, oxidative stress induced dna damage, unlike other cytogenetic abnormalities and mutations, can be minimized by lowering the exposure to factors which lead to increased ros production, by maintaining minimum life style modifications like quitting smoking and alcohol intake, exercising in moderation, increasing the intake of fruits and vegetables and treating acute and chronic infections and inflammations . The assay of oxidative stress and integrity of the sperm dna is essential in couples with irsa following natural and induced conceptions . This pilot study, the first of its kind in india, established the role of sperm factors in irsa . This would aid in providing most in- depth understanding of this problem and advising appropriate therapeutics to the couples . Early diagnosis of oxidative stress should warrant prompt antioxidant supplementation and life style modifications to the best of our knowledge, this pilot study showed a positive correlation between dfi and ros and an association between increased free radical levels and loss of dna integrity in couples experiencing irsa . It also established a dfi threshold value of 16.50% by scsa, however, the authors stress the need to further potentiate these results in a large cohort of irsa cases.
|
Pigment - epithelium - derived factor (pedf) is a glycoprotein that belongs to the superfamily of serpin protease inhibitor proteins without inhibitory function, encoded by the gene serpinf1 located on chromosome 17p13 which is well conserved in evolution . It is a protein of 418 amino acids, with a size of 50 kda and widely expressed in most body tissues . It is an extracellular protein which shows the secondary and tertiary structure of serpin and binds to collagen-1 and heparin . The -sheet is the dominant feature of the secondary structure and comprises the core structural domain of the protein, being closely involved in dynamic movements that are part of serpin function . Existence of a reactive centre loop (rcl) is another feature of serpins, and it is a proteinase recognition site and a critical component of the function of serpins . Pedf was originally isolated from the conditioned medium of cultured human fetal retinal pigment epithelium cells . As mentioned before, it can be found in almost all tissues but the highest amount of expression has been observed in the eye, fetal and adult liver tissue, adult testis, ovaries, placenta, and the pancreas . A significant reduction in the expression of pedf is found in senescent (aging) cells . Pedf is a pluripotent molecule with neurotrophic qualities, and several biological activities have been ascribed to it, including antiangiogenic, antiproliferative, prodifferentiation, neuroprotective, anti - inflammatory, and antitumour properties [68]. The antiangiogenic properties and neurotrophic activities of the protein are due to peptides derived from the n - terminal region of this protein, while the c - terminal peptides interact with its membrane receptor . How pedf controls all these biological processes and how it intercepts growth - promoting signals, accelerates cell death cascades, and prolongs cellular lifespan remains widely unknown but it presumably binds to cell surface receptors to trigger various signalling cascades . Evaluating the expression of different pedf receptors (pedf - rs) could help to determine the specific biological responses of pedf . Studies show that there are at least two different pedf - rs, specific to neural or endothelial cells, respectively . The signalling pathways activated by pedf regulate a number of key transcription factors including nuclear factor kappa - light - chain - enhancer of activated b cells (nf-b), nuclear factor of activated t cells (nfats), peroxisome proliferator - activated receptor (ppar-), and the potent promigratory urokinase - type plasminogen activator (upa)/receptor (upar) system [8, 13]. Stem cells are recognised by two important features, firstly the self - renewal property and secondly the multilineage differentiation potential . These characteristics make stem cells a preferred candidate for cell - based therapy for diseases such as neuronal damage . Generally, stem cells are divided into two groups based on their origins: embryonic stem cells (escs) which are harvested from the inner cell mass of blastocysts and have the ability to produce all three embryonic germ layers - ectoderm, endoderm, and mesoderm and adult stem cells which are critical for tissue homeostasis . Adult stem cells support tissue regeneration and replacement of ongoing cell loss due to natural cell death and injury . These cells can be found in most tissues such as the brain, bone marrow, liver, and retina [16, 17]. Stem cells divide via mitosis and produce one daughter cell to replace the divided parent cell (and thereby maintain the stem cell pool) and one other cell which will go through the differentiation process . Recently, a phenomenon known as trans - differentiation has been identified which is when tissue - specific stem cells switch their lineage to that of some other tissue under suitable conditions . For example, bone marrow stem cells are able to transdifferentiate into skeletal muscle, smooth muscle, and neuronal cells . In spite of the unique properties of stem cells (self - renewal and differentiation), adult stem cells stay dormant through most of their lifetime and are activated under certain circumstances by specific environmental factors . The specific surrounding environment includes stroma which contains fibroblasts, macrophages, neutrophils, endothelial cells and other differentiated cells, and the microenvironment around the stem cell . The surrounding microenvironment of a stem cell is known as the stem cell niche and it includes different signalling areas which helps the daughter cell commit to different fates . Stem cells need to be held within the niche and this happens via adhesion between stem cells and underlying basement membrane or support cells . Upon division, if a cell is placed outside the niche, it commits to differentiation depending on the different microenvironmental stimuli and signalling it encounters in its new niche . Stem cells have the capacity to react to a broad range of growth factors and signalling molecules and express many of the important downstream signal transduction components such as those signal transduction pathways that are present and may be active in stem cells . These include notch, transforming growth factor beta (tgf), wnt, bone morphogenetic proteins (bmps), hedgehog, and janus kinase / signal transducer and activator of transcription (jak / stat) family members . Human embryonic stem cells (hescs) grown in vitro require feeder cells such as fibroblasts to maintain proliferation and pluripotency . In a study using microarray analysis to study the gene expression profile of human foreskin fibroblasts, a number of molecular targets were identified that are potentially involved in the ability of these cells to act as feeder cells for hescs . The most likely target genes they found were pedf, c - kit, and leptin . These findings were supported by real - time polymerase chain reaction (rt - pcr) and virtual serial analysis of gene expression (sage) analysis . It has been hypothesized that the protein products of these genes may play an important role in the support of hesc growth by human foreskin fibroblasts . Age - related macular degeneration (amd) is one of the common causes of blindness in the elderly and is characterised by degeneration and loss of retinal pigmented epithelial (rpe) cells and photoreceptor cells in the macular region . There are two late forms of the disease: in geographic atrophy (also known as dry) there are confluent areas of rpe degeneration and loss in the macular region, while in neovascular amd (also known as wet), there is growth of blood vessels from the choroid through bruch's membrane to the subretinal space a process known as choroidal neovascularization (cnv) [24, 25]. Hesc - derived retinal pigment epithelium (hes - rpe) seems to be a promising strategy for cell replacement in this condition . Studies have shown that polarised hes - rpe cells secrete high levels of pedf and that culture medium containing this pedf increased proliferation and supported the survival of retinal progenitor cells (rpcs) isolated from human fetal eyes . This role of pedf was confirmed by the addition of neutralising pedf antibody to the culture media, which diminished or completely abolished the increase in rpc proliferation and survival . Apart from the potential effects of pedf on rpcs, pedf also has at least three important effects on the health of rpes . The first effect is the neuroprotective activity towards photoreceptors and other retinal neural cells against damage of cytotoxic injury . Second, its antiangiogenic effect prevents pathologic neovascularisation through inhibiting endothelial cell migration and promoting endothelial apoptosis . Third, its antiaging function inhibits premature senescence of both rpe cells and their neighbouring retinal cells (table 1). Bone marrow - derived stem cells (bmscs) are also called mesenchymal stem cells (mscs) because these cells are able to differentiate into a variety of mesodermal tissues including bone, cartilage, and adipose . One of the most abundant proteins identified in murine mesenchymal msc - conditioned medium is pedf . Immunofluorescent staining shows a high level of expression of pedf in the rough endoplasmic reticulum / golgi areas . Pedf is also found to be located near the plasma membrane and in the extracellular space (considering the ability of pedf to bind to collagen and proteoglycans in the extracellular matrix). The role of bone - marrow - derived scs (bmscs) or mscs in angiogenesis is not clear but it has been suggested that they may support and stabilise newly formed blood vessels . One of the key factors that stimulates angiogenesis is vascular endothelial growth factor (vegf). This factor is expressed in a wide range of cells including bmscs . On the other hand, one of the key functions of the pedf molecule is the inhibition of angiogenesis . In a study by fan et al . (2011), it was observed that pedf expression was much stronger than that of vegf in bmscs . Based on data acquired during that project, the authors concluded that bmscs may not usually be an angiogenesis - promoting population in a normal environment . This view was supported by other findings that, in the presence of high cell numbers, mscs are capable of inhibiting capillary growth . During differentiation of mscs to osteoblasts, it has been shown that a high level of pedf is expressed during early stages of bone development by osteoblasts and to a lesser extent in osteoclasts [30, 31]. Osteoblasts and possibly osteoclasts are able to synthesise and release pedf, and this protein has a critical role in normal and abnormal bone angiogenesis . In developing bones, blood vessel growth is localised . In locations such as the long bone growth plate, blood vessels selectively invade the region between hypertrophic chondrocytes and newly formed bone matrix (figure 1). These newly formed vessels allow migration of osteoblasts which leads to new bone matrix deposition and bone elongation . Pedf is expressed in the epiphyseal cartilage and in the areas of active bone remodelling in the primary spongiosa and periosteum of metaphyseal bone . There is a gradual decrease in the intensity of pedf expression as chondrocytes differentiate toward the base of the growth plate [30, 32]. It has been found that pedf secreted from enriched mouse bone marrow cells exhibiting surface markers characteristic of multipotent mscs is able to attract fibroblasts and this property may play a role in regulating the cellular profile at the site of an injury . Pedf secretion happens in early postinjury stages rather than late postinjury and is due to the different cellular requirements during different stages . For example, pedf released by resident stem cells may stimulate migration of cells needed early in regeneration, such as fibroblasts while inhibiting migration of cells such as endothelial cells needed for capillary formation at subsequent stages of healing . In 2006 ramrez - castillejo et al . Showed that pedf produced by the subventricular zone (svz) in the mouse brain promotes self - renewal and invigoration of slowly dividing adult neural stem cells (nscs) in vitro . It also stimulates the expansion of the stem cell niche in brain and induces differentiation toward the neuronal phenotype in multiple cell types . In the subependymal zone (sez) of the adult mammalian brain, neuroblasts and oligodendrocytes are produced from nscs through fast - dividing transit - amplifying progenitors (taps). Vascular elements and several endothelium - derived factors are known to regulate the proliferation and/or survival of neural progenitors and pedf is one of them . (2009) found that pedf could modulate the balance between symmetric and asymmetric divisions in nscs . Essentially pedf promoted self - renewing divisions and maintenance of a multipotent state in nscs through its effects on notch transcriptional activity . Activation of notch receptors by membrane bound ligands results in the generation of an intracellular domain of notch (nicd) which moves to the nucleus, where it binds the repressor c promoter - binding factor 1 (cbf1). Cbf1 can then bind to the promoters and initiate transcription of genes in the hes1 and herp families and, possibly, the egfr gene . This results in the effects of notch signalling, that is, increase in self - renewal of nscs . One of these is n - cor, which is a corepressor for a number of nuclear receptors and can bind to cbf1 . It was postulated that the cbf1-binding sites in the hes1 and egfr promoters were occupied by n - cor, repressing the transcription of these genes (figure 2(a)). It was found that, in the presence of pedf, n - cor moves from a nuclear to cytoplasmic location and that pedf removes n - cor (the repressor) from the cbf1-binding sites in the promoters of the hes1 and efgr genes, thus allowing cbf1 (the inducer) to bind and activate these genes (figure 2(b)). Further experiments suggested that pedf carries out these activities through a noncanonical activation of the nf-b pathway . Mscs have been shown to differentiate into endothelial cells (ecs) and vascular smooth muscle cells (vsmcs) and incorporate into the new blood vessel wall and form vascular tubes . Mscs have an explicit role in various proangiogenic models although, interestingly, they have an antiangiogenic effect on corneal wound healing after chemical injury . Studies show that mscs contribute to the formation of choroidal neovascularisation (cnv) and they can differentiate into both vascular and extravascular cells in cnv . The mechanism of cnv is complex but, basically, a disrupted balance between angiogenic and antiangiogenic factors like vegf as an angiogenic stimulator and pedf as an inhibitor of angiogenesis is the cause . The effects of pedf on cnv are complicated: while pedf suppresses the growth of endothelial cells exposed to fibroblast growth factor-2 (fgf2), it evokes proliferation of endothelial cells in the presence of high vegf levels . In another report, pedf showed concentration - dependent effects on cnv and endothelial cell function: low doses are inhibitory, but high doses can increase neovascularisation . In a study by hou et al . (2010), it was observed that injecting mscs transduced with adenoviral vectors expressing pedf (adpedf) caused a regression in neovascularisation as a result of the cnvs being encapsulated in retinal pigment epithelial cells (rpes). Deterioration of photoreceptor cells may be caused by a continuous degeneration of retinal pigment epithelium (rpe) cells and can lead to vision loss . Furthermore, when these cells were injected into the superior subretinal space of royal college of surgeons (rcs) rats, a well - established model of retinal degeneration due to defective phagocytosis of photoreceptor outer segments by the rpe, these cells produced more pronounced rescue effects than nontransduced cells . Stem cell therapy, especially using mscs, has been considered as a promising method for treating myocardial infarction (mi). In a study where myocardial infarction was induced in c57bl/6 mice, it had been observed that mscs could ameliorate mi injury, but that mscs derived from older donors had less efficacy . Furthermore, infarcts treated with (adpedf-) transduced mscs that over - expressed pedf contained fewer ecs, vsmcs, and macrophages but had increased number of fibroblasts . They concluded that it was the increased expression of pedf in aged mscs that impaired their therapeutic efficacy . Pedf has a range of functions in different tissues and cells; however, the impact of this interesting protein on stem cells is not yet clear . Pedf expressed in feeder cells appears to have a supportive effect on stem cells such as hescs and rpcs . Pedf affects nscs via the notch transcriptional pathway, promoting self - renewing divisions, maintaining a multipotent state of these cells and supporting expansion of the stem cell niche . Stem cells transduced with adenoviral vectors carrying pedf exhibit potential for enhanced stem cell therapy in diseases such as macular degeneration . However, the effects of pedf on stem cells in other disease states are clear . Whilst pedf generally causes regression of cnv established by vegf, the effects may be concentration dependent both on the concentration of vegf and pedf . As for myocardial infarction, the presence of excessive pedf is actually reported to reduce the efficacy of stem cell therapy . To conclude, the role of pedf in stem cells in various pathologies does differ, and while counterproductive in some cases such as myocardial infarction, it may have a positive role to play in some instances . Further studies on pedf and stem cells will help illuminate such instances and whether they can be used therapeutically.
|
Topical steroid - dependent face is a common condition resulting from misuse of topical steroids over the face which may lead to erythema, burning and scaling . . The common indications are conditions such as psoriasis, lichen planus, eczema, lichen simplex chronicus, and other steroid - responsive dermatoses . However, because of their property of producing bleaching and anti - inflammatory effect, they have been misused frequently . They are misused for varied indications such as acne, pigmentation, fungal infection, pruritus, and many a times as a cosmetic or a skin cream for any type of rash . The main reason for such misuse in our country is its free availability as an over - the - counter (otc) medication . Furthermore, topical steroids are available in various irrational combinations which cause more damage to the skin . There are studies which have tried to highlight the various side effects and harm caused by misuse of topical steroids and its combinations . These studies have tried to bring to the notice of regulatory authorities about the damage caused by the free availability of these creams . In this study, we have tried to find out the awareness among patients about these drugs and also as to how many of them have used these medicines . This was a prospective study conducted at the dermatology outpatient department (opd) in a tertiary care hospital . A total of 1000 adult patients attending the dermatology opd were included in the study . Each patient attending the dermatology opd irrespective of their complaints the questions mainly tried to find out if the patients had ever heard about the commonly abused topical steroids and its combinations (betnovate, skinlite, melacare, panderm, fourderm, lobate gm, quadriderm) in our area and if they had used any of those creams . They were also asked about usage of any other creams other than the ones mentioned in the list . Furthermore, they were asked regarding who suggested those creams to them, the duration of usage, and if they noticed any side effect . Patients <18 years and those not willing to answer the questionnaire were excluded from the study . A total of 1000 adult patients (male: 360, female: 640) were included in the study . Eight hundred and nine patients out of the 1000 patients had heard about at least one of the topical steroids mentioned in the questionnaire . Six hundred and twelve patients (400 female and 212 male) had used the topical steroid or its combination for various indications [table 1]. Brand names of the topical steroid - containing products the indications for which these medicines were used included acne (30.2%), allergy (14.8%), pigmentation (11.4%), boils (0.3%), eczema (0.98%), fairness (as cosmetic 10.8%), fungal infections (3.4%), injury (3.5%), itching (11.7%), oily skin (0.65%), skin rashes (7.1%), white patches (1.9%), and burns (0.32%). Acne was the most common indication for which topical steroid was used, followed by allergy and rashes . Around 66 (10.8%) patients were using these medicines as a cosmetic for fairness and 70 (11.4%) patients were using it to remove pigmentation due to various reasons . Overall 52.4% of patients were using these creams mainly over the face and rest of them were using it over other parts of the body as a general skin cream for any rashes . Friends had suggested these medicines in 191 (31.2%) patients, followed by pharmacists in 71 (11.6%) patients . The duration of the usage of these creams varied from 1 day to 10 years . Around 383 (62.5%) patients had used these creams for a duration varying from 1 week to 3 months . One hundred and seven (17.4%) patients had used these creams from 3 months to 2 years . Three hundred and eighteen (51.9%) patients complained of some form of side effect after using these creams . One hundred and twenty - seven patients complained of aggravation of symptoms, 65 patients complained of increased pigmentation [figure 1], 26 patients developed pimples [figure 2], and redness and irritation was seen in 74 patients . Other minor side effects included white patches, burning sensation, and no improvement of the skin problem [table 2]. Pigmentation due to use of topical steroid adverse effects as complained by the patients using topical steroids topical steroids were first used in dermatology by sulzberger and witten in 1952 when they published an article on the effect of topically applied compound f in selected dermatoses . Topical steroids have greatly contributed to the dermatologist's ability to effectively treat several difficult dermatoses . They were hailed as a panacea for all ills by physicians and patients and gained rapid popularity . Topical steroids are one of the most commonly used drugs by dermatologists worldwide . However, the dramatic symptomatic relief from these medications led to misuse and abuse of these drugs by both nondermatologists and patients . The rampant misuse and abuse of these medicines led to the development of various side effects, both cutaneous and systemic . Various studies have tried to highlight the menace caused by the use of topical steroids . A multicentric study by saraswat et al . Has also been done to highlight the topical steroid abuse on the face . Around 2296 patients with facial dermatoses were screened, of which 433 patients were using topical steroids . In our study, we have included 1000 adult patients attending dermatology opd irrespective of their skin complaints . We have tried to find out how many patients have heard about any of the common topical steroids available otc in our area and also how many of them have used these creams . Around 809 patients (80.9%) had heard of at least one of the topical steroids or its combinations . Six hundred and twelve (61.2%) patients had used one of the steroids or steroid combinations for a duration varying from 1 day to 10 years . The common indications for which steroid was used were acne, fairness (as cosmetic), pigmentation, and allergy . The findings are similar to the study conducted by saraswat et al . And dey . An iraqi study showed 7.9% of patients using topical steroid for similar indications . In our study, 302 (49.5%) patients who had used the steroid had received the prescription from a doctor . In the study by saraswat et al ., 41% of the patients had received the recommendation from a doctor . In the present study, 301 (49%) patients were advised to use these medicines by pharmacists, friends, and relatives . However, most of the time, general practitioners and doctors from alternative medicine had prescribed these medicines . General practitioners and pharmacists are often the first point of contact for most of the patients . Training and sensitizing them regarding steroid abuse would help in reducing the incidence of topical steroid - related side effects . The common side effects found in our study were acne, pigmentation, redness, itching, burning sensation, striae, and aggravation of existing skin problem . These are similar to the findings by saraswat et al . And dey . The nature of side effect correlated with the duration of the usage of topical steroid . However, many of our patients were not aware of the fact that the problems they were facing were due to the long - term use of steroids . From the findings of our study and other studies, we would like to conclude that topical steroid abuse is rampant in our population . The reason for this varies from wrong prescription, dubious marketing by pharmaceutical companies, free availability of these medicines as otc drugs, and lack of regulations regarding the manufacturing of irrational combinations . As general practitioners and pharmacists are recommending these products in majority of the cases, it is very important to sensitize these people about the possible complications of these drugs and the extent of problem the society is facing because of irrational and unregulated use of these drugs . Our study aims to highlight the misuse of steroids and its combination anywhere on the body . Our study was an outpatient - based study, and further larger studies will give a clearer picture about the magnitude of the steroid abuse . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . Topical steroid abuse is not only limited to the face but also over the rest of the body . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . Topical steroid abuse is not only limited to the face but also over the rest of the body . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . Topical steroid abuse is not only limited to the face but also over the rest of the body.
|
In developed countries, the population of elderly people is steadily increasing, which is associated with increased needs for permanent institutional care . In 2009 in poland, 13.3% of people were aged 65 years or older, and the annual growth for this age group is about 57,000 people . Approximately 17,500 persons in this group need permanent care in different types of nursing homes and 53% of them are bedridden . The demographic structure of people in this age group is highly variable . In 1980, people over 65 years of age comprised 10.1% of the total population, 13.5% in 2009 and, according to demographic projections, in the year 2035, it will be 23.2% . The increase in the proportion of the oldest group in the general population of poles, i.e. Aged 85 years and above, increased from 0.7% in 1989 to 1.3% in 2009 . The increasing population of people aged over 65 years makes the health problems of this age group dominant in the health care system not only in poland but throughout the world . With age, there are an increasing number of persons demanding long - term care, whose primary role is to provide an older person with the longest possible operational independence . Home care in the older person s place of residence applies in most of the geriatric population with some degree of disability . However, with much infirmity, especially in combination with a number of chronic diseases, it often needs to become institutionalised . It is estimated that between 10 and 25% of older people may require placement in various forms of care homes . On the other hand, changes in the immune system occurring during the aging process pose a higher risk of infections in this population . The significance of these changes for healthy elderly people is limited, but with many chronic conditions and polypharmacy, malnutrition occurs secondary to the deterioration of the immune function . Residents of nursing homes are at a particularly high risk, among which a significant degree of functional disability with urinary incontinence and bowel incontinence, cognitive impairment, weak cough reflex, dysphagia and reduced mobility are often present . The recognition of infection in this population is difficult due to the increased likelihood of atypical infection presentation [6, 7]. At present, infections have never been evaluated in polish long - term care facilities (ltcfs). Hence, the objective of this study was to estimate the epidemiology of infection, depending on the type of ltcf . The second aim was to assess the relationship between the frequency of infection and health status, tested using a point prevalence study (pps) and incidence study for the analysis of capabilities to implement targeted continuing surveillance only in the high - risk portion of ltcf residents . A 1-day pps was carried out in october 2009 in three ltcfs: two residential homes (rhs) and one nursing home (nh). A resident was defined as a person being a resident in ltcfs for> 48 h during the study day . An nh was defined as an institution where residents need medical or skilled nurses supervision 24 h a day and which provides more intensive health care than an rh, where residents are unable to live independently and require supervision or assistance with the activities of daily living . Infections were defined according to mcgeer s criteria and were detected by trained health personnel with the cooperation of the project worker . Information on potential risk factors was collected from the medical history, medical and nursing records, and recorded on a questionnaire form . The functional status of the study participants was estimated using the katz scale (scores range from 0 to 6) and barthel s index (scores range from 0 to 100). Physical dependence was also classified according to the following five - point scale: 1 independent, 2 independent with falls, 3 limitations in movement, 4 bedridden, mobile, 5 bedridden, dependent . Material for microbiological examination was collected, depending on the clinical status of patients, i.e. Wound swabs, pharyngeal swabs, sputum, urine and others . Prospective continuous surveillance was carried out from december 2009 to november 2010 in the same three ltcfs . Infections were defined according to mcgeer s criteria and were detected by trained health personnel . Amongst the patients enrolled in the study, two persons dropped out and 31 patients died . The relation between types of care, socio - demographic characteristics, and incidence and prevalence of infections were analysed with two main groups of statistical techniques: if the numerical parameters (age, length of stage etc .) Were compared by a nominal characteristic (type of care, form of infection etc . ), a simple analysis of variance (anova) test was used . If the distribution of numerical characteristics did not fit the normal distribution, the non - parametric alternative of anova, the kruskal chi - square () and likelihood ratio frequency tests were used . In cases where the categorical variable (i.e. Type of care) was obviously dependent on the parameters measured in a continuous scale (age, barthel s scale), the significance of such relations was analysed using logistic regression . To obtain the sensitivity of the proposed inclusion criteria based on barthel s scale, receiver operating characteristic (roc) as this analysis demands the criteria of true - positive and false - positive recognition, they were based on the following assumptions: residents with endemic infections fulfilling at least one of the following criteria were included in the group that required the monitoring of: urinary catheter, tracheostomy tube, feeding via gastric catheter, stool incontinence or stroke . The common results of several risk factors on the probability of infection were analysed with multivariable models based on nominal logistic regression . The study was approved by the ethics committee at the jagiellonian university and it conforms to the guidelines set forth by the declaration of helsinki . A 1-day pps was carried out in october 2009 in three ltcfs: two residential homes (rhs) and one nursing home (nh). A resident was defined as a person being a resident in ltcfs for> 48 h during the study day . An nh was defined as an institution where residents need medical or skilled nurses supervision 24 h a day and which provides more intensive health care than an rh, where residents are unable to live independently and require supervision or assistance with the activities of daily living . Infections were defined according to mcgeer s criteria and were detected by trained health personnel with the cooperation of the project worker . Information on potential risk factors was collected from the medical history, medical and nursing records, and recorded on a questionnaire form . The functional status of the study participants was estimated using the katz scale (scores range from 0 to 6) and barthel s index (scores range from 0 to 100). Physical dependence was also classified according to the following five - point scale: 1 independent, 2 independent with falls, 3 limitations in movement, 4 bedridden, mobile, 5 bedridden, dependent . Material for microbiological examination was collected, depending on the clinical status of patients, i.e. Wound swabs, pharyngeal swabs, sputum, urine and others . Prospective continuous surveillance was carried out from december 2009 to november 2010 in the same three ltcfs . Infections were defined according to mcgeer s criteria and were detected by trained health personnel . Amongst the patients enrolled in the study, two persons dropped out and 31 patients died . The relation between types of care, socio - demographic characteristics, and incidence and prevalence of infections were analysed with two main groups of statistical techniques: if the numerical parameters (age, length of stage etc .) Were compared by a nominal characteristic (type of care, form of infection etc . ), a simple analysis of variance (anova) test was used . If the distribution of numerical characteristics did not fit the normal distribution, the non - parametric alternative of anova, the kruskal chi - square () and likelihood ratio frequency tests were used . In cases where the categorical variable (i.e. Type of care) was obviously dependent on the parameters measured in a continuous scale (age, barthel s scale), the significance of such relations was analysed using logistic regression . To obtain the sensitivity of the proposed inclusion criteria based on barthel s scale, receiver operating characteristic (roc) this analysis demands the criteria of true - positive and false - positive recognition, they were based on the following assumptions: residents with endemic infections fulfilling at least one of the following criteria were included in the group that required the monitoring of: urinary catheter, tracheostomy tube, feeding via gastric catheter, stool incontinence or stroke . The common results of several risk factors on the probability of infection were analysed with multivariable models based on nominal logistic regression . The study was approved by the ethics committee at the jagiellonian university and it conforms to the guidelines set forth by the declaration of helsinki . Surveillance (pps and incidence study) encompassed 193 people, of which 86 comprised residents (44.6%) belonging to the rhs group and 107 persons (55.4%) made up the nh group . The total number corresponded to 2.6% of the total population of nh residents (n = 4,154) in the maopolska region for the year 2009 . The study population was not a homogeneous population; it differed significantly in body weight, general condition expressed as various (chronic) diseases, problems maintaining personal hygiene expressed as urinary and/or stool incontinence, use of tracheotomy tubes, enteral feeding and frequency of hospitalisation before the pps day (table 1). Differences were observed in the general condition of residents, expressed specifically in the barthel or katz scales that is, those with a low scale with a low value were significantly more likely to be under nh care and physical activity, in that nh residents had significantly more limited mobility . Invasive procedures such as feeding by gavages, tracheotomy or bladder catheterisation at least one was performed in 36% of the test group, with no intravascular injections being applied (table 1).table 1characteristics of the studied population at baselinerhs (no./%)nh (no./%)p valuemale residents3641.93532.7residents with recent hospitalisation2023.387.5<0.001 intensive care unit22.310.9 internal medicine unit1315.143.7 surgery unit55.810.9normal body weight7587.28276.60.003 overweight910.51615.0 obesity00.000.0 malnutrition / cachexia22.365.6diabetes2326.73129.0asthma / chronic obstructive pulmonary disease1719.81917.8venous insufficiency2124.41514.0pressure sore33.565.6prostatic hyperplasia1027.81954.30.010stroke55.82523.4<0.001urinary incontinence: diapers2326.73936.4<0.001bladder catheterisation (on a permanent basis)00.03936.4stool incontinence67.06762.6<0.001peripheral vascular disturbances2427.93229.9atherosclerosis of lower extremities89.31413.1varicose veins of lower extremities1922.11211.20.020dysphagia44.72624.3<0.001gastric catheter00.02624.3<0.001tracheostomy tube11.243.7gastrostomy tube00.032.8ulcers55.843.7other wounds11.210.9feeding via gastric catheter00.02422.4<0.001feeding via gastrostomy tube00.032.8age, mean sd (95% ci) (years)76.2 10.5 (73.978.4)76.8 11.1 (74.678.9)length of stay in the facility, mean (years)6.54.2barthel s index, mean sd (95% ci)75.6 34.5 (68.283.0)19.5 17.4 (16.122.9)0.001katz scale, mean sd (95% ci)4.7 2.1 (4.25.1)1.3 1.6 (0.91.6)<0.001physical activity, mean sd (95% ci)1.9 1.2 (1.72.2)3.7 1.1 (3.53.9)<0.001estimated number of infections in 2008, mean1.40.6<0.001rhs residential homes, nh nursing home, sd standard deviation, ci confidence intervalphysical activity, expressed on a five - point scale: 1 independent patient, no limitations, 2 independent no limitations, recurrent falls, 3 limitations in mobility, 4 bedridden, able to change body position on his / her own, 5 bedridden, dependent on others characteristics of the studied population at baseline rhs residential homes, nh nursing home, sd standard deviation, ci confidence interval physical activity, expressed on a five - point scale: 1 independent patient, no limitations, 2 independent no limitations, recurrent falls, 3 limitations in mobility, 4 bedridden, able to change body position on his / her own, 5 bedridden, dependent on others thirty - two cases of infection were detected in 30 persons, and the prevalence was 14.0% in rhs and 18.7% in the nh . Various types of infections were observed significantly more frequently in patients with asthma, various types of wounds (pressure sore, ulcers and others), atherosclerosis of lower extremities and tracheotomy tubes and conditions in patients hospitalised in the intensive care unit (icu) within 1 year before the pps day . There was no significant association between prevalence and diabetes, venous insufficiency, stroke, prostatic hyperplasia, the value of the barthel or katz scales and other determinants of health deficits, such as urinary and/or stool incontinence or dementia . In addition, age did not influence the risk of developing an infection . Among the infections, infections of the skin and the upper respiratory tract were dominant (table 2).table 2characteristics of patients with at least one detected infection in the point prevalence study (pps) and in the prospective continuing surveillance (cs) study (n = 193)participants with an infection(s) in the pps (no./%)p valueparticipants with an infection(s) in the cs (no./%)p valuemale residents1114.33444.2type of care residential home1214.0<0.0014046.5 nursing home2018.75349.5asthma / chronic obstructive pulmonary disease147.30.0202311.9pressure sore115.7<0.00194.7urinary incontinence: diapers157.83719.20.034urinary catheterisation (on permanent basis)105.22419.2stool incontinence178.84523.30.021atherosclerosis of lower extremities126.20.004199.8tracheostomy tube10.50.00152.60.006ulcers42.184.10.011other wounds31.60.00731.6feeding via gastrostomy tube10.531.60.034age mean sd (95% ci) (years)79.5 12.0 (75.983.1)78.0 11.4 (75.680.2)barthel s index, mean sd (95% ci)48.2 39.3 (36.260.1)41.1 39.2 (33.448.8)0.009katz scale, mean sd (95% ci)2.8 2.6 (2.13.6)2.5 2.5 (2.03.0)0.006physical activity, mean sd (95% ci)3.1 1.6 (2.63.6)3.1 1.6 (0.13.1)0.041rhs residential homes, nh nursing home, sd standard deviation, ci confidence intervalphysical activity, expressed on a five - point scale: 1 independent patient, no limitations, 2 independent no limitations, recurrent falls, 3 limitations in mobility, 4 bedridden, able to change body position on his / her own, 5 bedridden, dependent on others characteristics of patients with at least one detected infection in the point prevalence study (pps) and in the prospective continuing surveillance (cs) study (n = 193) rhs residential homes, nh nursing home, sd standard deviation, ci confidence interval physical activity, expressed on a five - point scale: 1 independent patient, no limitations, 2 independent no limitations, recurrent falls, 3 limitations in mobility, 4 bedridden, able to change body position on his / her own, 5 bedridden, dependent on others biological materials for bacteriological examination were collected from all 32 symptomatic infections, and microbiological confirmation was obtained in two cases out of 11 lower respiratory tract infections . The dominant aetiological factors of microbiologically confirmed infections were staphylococcus aureus (19.4%) and gram - negative bacilli: escherichia coli and pseudomonas aeruginosa (table 3).table 3cases of infections and their aetiology in the pps versus incidence studyclinical type of infectionpoint prevalence study (pps)incidence studyno.%prevalence rate (%) no.%cumulative rate (%) density rate (1,000 pds)wound1753.18.81910.99.80.3upper respiratory tract1134.45.721.41.00.0lower respiratory tract39.41.6116.35.70.2pneumonia00.00.04224.021.80.7urinary tract infection13.10.53017.115.50.5others00.00.07140.636.81.1total32100.016.617510090.72.8microbial etiologyno%no%staphylococcus aureus719.489.5pseudomonas aeruginosa719.42529.8escherichia coli719.41113.1klebsiella spp.411.11011.9proteus spp.38.31011.9acinetobacter spp.25.633.6other616.71720.2total36100.084100.0polyaetiological422.21732.1 cases of infections and their aetiology in the pps versus incidence study the study was performed in the years 2009 and 2010 . The study involved 193 residents in three ltcfs; 94 residents (48.2%) had symptoms of infection, while the other participants did not show signs of any infections . In the studied group of 94 persons (48.2% of the total), 175 cases of infections were detected . These infections were most commonly respiratory tract infections and pneumonia, as well as urinary tract infections . The total incidence was 2.7/1,000 patient days (pds); it was higher in the nh at 3.6/1,000 pds compared to 1.9 [relative risk (rr) 1.9] in rhs, but these differences were not significant . One gastrointestinal (gi) tract infectious outbreak associated with norovirus aetiology was found among 25 residents of rhs . There were 157 cases of infections other than gi (endemic) infections observed in 75 residents . Factors important for the risk of any infection were the general status of patients, expressed using the barthel and katz scales, as well as limited physical activity, stool incontinence, urinary catheterisation, tracheostomy tube, ulcers in pps and feeding via gastrostomy tube (table 3). The multivariable analysis of the common influence of age, physical activity, katz scale and barthel score (c = 12.1362; df = 5; p = 0.0330) resulted in a rather low predictability (r = 0.0475). Roc curve analysis of sensitivity supports these conclusions, as the calculated sensitivity of the model is only 0.64251 . The model that also includes a categorical variable is slightly more significant (= 28.8014; df = 16; p = 0.0253) and more predictable (r = 0.1124). The parameter analysis shows that significant influence was confirmed for two factors: tracheotomy tube (p = 0.380) and ulcers (p = 0.0280). Close to significance was also found for asthma (p = 0.701). The roc curve analysis shows that the sensitivity of the model is equal to 0.69242 . In the group of residents described by the barthel scale as 15 or less (a total of 67 persons34.7% of the population), there were 81 cases of endemic infections observed in 42 patients (62.7% of such residents), which accounted for 51.6% of all such infections . The incidence of endemic infection was significantly dependent on the physical condition of the residents, as expressed by the barthel scale . The lowest value of the scale, 0, was associated with a 62.5% risk of developing this type of infection (rr 1.8), as well as in residents with a scale value of 115 (incidence 62.9%, rr 1.9). In residents with higher values of the scale, described as 1650, 5175 and 76100, significantly lower morbidity rates were observed, respectively: 40.0% (rr 1.0), 18.2 (rr 0.5) and 15.0% (rr 0.3). Based on the assumed barthel scale, the sensitivity value for including these patients in two critical groups (0 and 115 were calculated) was 0.9355 (r = 0.9616, area under the curve = 0.824). During the study period (1 year), changes in the condition of residents were observed in only 24 cases . Thirty - one persons died during the study (mortality 16.1%) and 16 deaths (51.6%) were directly related to the developed infections . Fifty - three biological samples in total were collected for microbiological examinations (30.3% of all cases of infections). Materials for microbiological examination were collected from 14 cases of wound infection, seven cases of pneumonia and seven cases of urinary tract infections and others . The dominant aetiological agents were p. aeruginosa (29.8%) (table 3). Surveillance (pps and incidence study) encompassed 193 people, of which 86 comprised residents (44.6%) belonging to the rhs group and 107 persons (55.4%) made up the nh group . The total number corresponded to 2.6% of the total population of nh residents (n = 4,154) in the maopolska region for the year 2009 . The study population was not a homogeneous population; it differed significantly in body weight, general condition expressed as various (chronic) diseases, problems maintaining personal hygiene expressed as urinary and/or stool incontinence, use of tracheotomy tubes, enteral feeding and frequency of hospitalisation before the pps day (table 1). Differences were observed in the general condition of residents, expressed specifically in the barthel or katz scales that is, those with a low scale with a low value were significantly more likely to be under nh care and physical activity, in that nh residents had significantly more limited mobility . Invasive procedures such as feeding by gavages, tracheotomy or bladder catheterisation at least one was performed in 36% of the test group, with no intravascular injections being applied (table 1).table 1characteristics of the studied population at baselinerhs (no./%)nh (no./%)p valuemale residents3641.93532.7residents with recent hospitalisation2023.387.5<0.001 intensive care unit22.310.9 internal medicine unit1315.143.7 surgery unit55.810.9normal body weight7587.28276.60.003 overweight910.51615.0 obesity00.000.0 malnutrition / cachexia22.365.6diabetes2326.73129.0asthma / chronic obstructive pulmonary disease1719.81917.8venous insufficiency2124.41514.0pressure sore33.565.6prostatic hyperplasia1027.81954.30.010stroke55.82523.4<0.001urinary incontinence: diapers2326.73936.4<0.001bladder catheterisation (on a permanent basis)00.03936.4stool incontinence67.06762.6<0.001peripheral vascular disturbances2427.93229.9atherosclerosis of lower extremities89.31413.1varicose veins of lower extremities1922.11211.20.020dysphagia44.72624.3<0.001gastric catheter00.02624.3<0.001tracheostomy tube11.243.7gastrostomy tube00.032.8ulcers55.843.7other wounds11.210.9feeding via gastric catheter00.02422.4<0.001feeding via gastrostomy tube00.032.8age, mean sd (95% ci) (years)76.2 10.5 (73.978.4)76.8 11.1 (74.678.9)length of stay in the facility, mean (years)6.54.2barthel s index, mean sd (95% ci)75.6 34.5 (68.283.0)19.5 17.4 (16.122.9)0.001katz scale, mean sd (95% ci)4.7 2.1 (4.25.1)1.3 1.6 (0.91.6)<0.001physical activity, mean sd (95% ci)1.9 1.2 (1.72.2)3.7 1.1 (3.53.9)<0.001estimated number of infections in 2008, mean1.40.6<0.001rhs residential homes, nh nursing home, sd standard deviation, ci confidence intervalphysical activity, expressed on a five - point scale: 1 independent patient, no limitations, 2 independent no limitations, recurrent falls, 3 limitations in mobility, 4 bedridden, able to change body position on his / her own, 5 bedridden, dependent on others characteristics of the studied population at baseline rhs residential homes, nh nursing home, sd standard deviation, ci confidence interval physical activity, expressed on a five - point scale: 1 independent patient, no limitations, 2 independent no limitations, recurrent falls, 3 limitations in mobility, 4 bedridden, able to change body position on his / her own, 5 bedridden, dependent on others thirty - two cases of infection were detected in 30 persons, and the prevalence was 14.0% in rhs and 18.7% in the nh . Various types of infections were observed significantly more frequently in patients with asthma, various types of wounds (pressure sore, ulcers and others), atherosclerosis of lower extremities and tracheotomy tubes and conditions in patients hospitalised in the intensive care unit (icu) within 1 year before the pps day . There was no significant association between prevalence and diabetes, venous insufficiency, stroke, prostatic hyperplasia, the value of the barthel or katz scales and other determinants of health deficits, such as urinary and/or stool incontinence or dementia . In addition, age did not influence the risk of developing an infection . Among the infections, infections of the skin and the upper respiratory tract were dominant (table 2).table 2characteristics of patients with at least one detected infection in the point prevalence study (pps) and in the prospective continuing surveillance (cs) study (n = 193)participants with an infection(s) in the pps (no./%)p valueparticipants with an infection(s) in the cs (no./%)p valuemale residents1114.33444.2type of care residential home1214.0<0.0014046.5 nursing home2018.75349.5asthma / chronic obstructive pulmonary disease147.30.0202311.9pressure sore115.7<0.00194.7urinary incontinence: diapers157.83719.20.034urinary catheterisation (on permanent basis)105.22419.2stool incontinence178.84523.30.021atherosclerosis of lower extremities126.20.004199.8tracheostomy tube10.50.00152.60.006ulcers42.184.10.011other wounds31.60.00731.6feeding via gastrostomy tube10.531.60.034age mean sd (95% ci) (years)79.5 12.0 (75.983.1)78.0 11.4 (75.680.2)barthel s index, mean sd (95% ci)48.2 39.3 (36.260.1)41.1 39.2 (33.448.8)0.009katz scale, mean sd (95% ci)2.8 2.6 (2.13.6)2.5 2.5 (2.03.0)0.006physical activity, mean sd (95% ci)3.1 1.6 (2.63.6)3.1 1.6 (0.13.1)0.041rhs residential homes, nh nursing home, sd standard deviation, ci confidence intervalphysical activity, expressed on a five - point scale: 1 independent patient, no limitations, 2 independent no limitations, recurrent falls, 3 limitations in mobility, 4 bedridden, able to change body position on his / her own, 5 bedridden, dependent on others characteristics of patients with at least one detected infection in the point prevalence study (pps) and in the prospective continuing surveillance (cs) study (n = 193) rhs residential homes, nh nursing home, sd standard deviation, ci confidence interval physical activity, expressed on a five - point scale: 1 independent patient, no limitations, 2 independent no limitations, recurrent falls, 3 limitations in mobility, 4 bedridden, able to change body position on his / her own, 5 bedridden, dependent on others biological materials for bacteriological examination were collected from all 32 symptomatic infections, and microbiological confirmation was obtained in two cases out of 11 lower respiratory tract infections . The dominant aetiological factors of microbiologically confirmed infections were staphylococcus aureus (19.4%) and gram - negative bacilli: escherichia coli and pseudomonas aeruginosa (table 3).table 3cases of infections and their aetiology in the pps versus incidence studyclinical type of infectionpoint prevalence study (pps)incidence studyno.%prevalence rate (%) no.%cumulative rate (%) density rate (1,000 pds)wound1753.18.81910.99.80.3upper respiratory tract1134.45.721.41.00.0lower respiratory tract39.41.6116.35.70.2pneumonia00.00.04224.021.80.7urinary tract infection13.10.53017.115.50.5others00.00.07140.636.81.1total32100.016.617510090.72.8microbial etiologyno%no%staphylococcus aureus719.489.5pseudomonas aeruginosa719.42529.8escherichia coli719.41113.1klebsiella spp.411.11011.9proteus spp.38.31011.9acinetobacter spp.25.633.6other616.71720.2total36100.084100.0polyaetiological422.21732.1 cases of infections and their aetiology in the pps versus incidence study the study involved 193 residents in three ltcfs; 94 residents (48.2%) had symptoms of infection, while the other participants did not show signs of any infections . In the studied group of 94 persons (48.2% of the total), 175 cases of infections were detected . These infections were most commonly respiratory tract infections and pneumonia, as well as urinary tract infections . The total incidence was 2.7/1,000 patient days (pds); it was higher in the nh at 3.6/1,000 pds compared to 1.9 [relative risk (rr) 1.9] in rhs, but these differences were not significant . One gastrointestinal (gi) tract infectious outbreak associated with norovirus aetiology was found among 25 residents of rhs . There were 157 cases of infections other than gi (endemic) infections observed in 75 residents . Factors important for the risk of any infection were the general status of patients, expressed using the barthel and katz scales, as well as limited physical activity, stool incontinence, urinary catheterisation, tracheostomy tube, ulcers in pps and feeding via gastrostomy tube (table 3). The multivariable analysis of the common influence of age, physical activity, katz scale and barthel score (c = 12.1362; df = 5; p = 0.0330) resulted in a rather low predictability (r = 0.0475). Roc curve analysis of sensitivity supports these conclusions, as the calculated sensitivity of the model is only 0.64251 . The model that also includes a categorical variable is slightly more significant (= 28.8014; df = 16; p = 0.0253) and more predictable (r = 0.1124). The parameter analysis shows that significant influence was confirmed for two factors: tracheotomy tube (p = 0.380) and ulcers (p = 0.0280). Close to significance was also found for asthma (p = 0.701). The roc curve analysis shows that the sensitivity of the model is equal to 0.69242 . In the group of residents described by the barthel scale as 15 or less (a total of 67 persons34.7% of the population), there were 81 cases of endemic infections observed in 42 patients (62.7% of such residents), which accounted for 51.6% of all such infections . The incidence of endemic infection was significantly dependent on the physical condition of the residents, as expressed by the barthel scale . The lowest value of the scale, 0, was associated with a 62.5% risk of developing this type of infection (rr 1.8), as well as in residents with a scale value of 115 (incidence 62.9%, rr 1.9). In residents with higher values of the scale, described as 1650, 5175 and 76100, significantly lower morbidity rates were observed, respectively: 40.0% (rr 1.0), 18.2 (rr 0.5) and 15.0% (rr 0.3). Based on the assumed barthel scale, the sensitivity value for including these patients in two critical groups (0 and 115 were calculated) was 0.9355 (r = 0.9616, area under the curve = 0.824). During the study period (1 year), changes in the condition of residents were observed in only 24 cases . Thirty - one persons died during the study (mortality 16.1%) and 16 deaths (51.6%) were directly related to the developed infections . Fifty - three biological samples in total were collected for microbiological examinations (30.3% of all cases of infections). Materials for microbiological examination were collected from 14 cases of wound infection, seven cases of pneumonia and seven cases of urinary tract infections and others . The dominant aetiological agents were p. aeruginosa (29.8%) (table 3). The study encompassed various populations of patients and was conducted in two parts: pps and continuing surveillance study (incidence study). The rates from the two studies cannot be compared directly, owing to different methodologies, but both are used in national programmes in europe and throughout the world . In italy, the incidence was estimated to be 11.8/1,000 pds, with a prevalence of 8.4/100 residents [11, 12], and in norway, it was 5.2/1,000 pds and 6.7/100 residents, respectively . In the usa, incidence was shown to be 7.7/1,000 pds, in canada 1.89.5/1,000 pds and in germany 6/1,000 pds . The methodology of the two types of studies is different, and the results are incomparable, but the results are different than what was expected . The prevalence rate was much higher than expected in both studied ltcf populations (rhs and nh), but incidence rates were lower than expected for both populations . However, infections are common among residents in ltcf, with a frequency comparable to rates observed in acute care facilities [11, 12]. The prevalence of infections depends on the profile of the residents of ltcfs they are very heterogeneous populations . Patients vary in age, may be admitted for psychiatric or medical care and, moreover, may remain in ltcfs permanently or for a given period . The frequency of infections is higher among elderly residents who permanently stay in an ltcf . The reason for the observed differences (between high prevalence and low incidence) was also the method of data collection, as the pps was performed in cooperation with an external investigator, who based his findings mostly on ward documentation and, secondly, on nurse and doctor interviews, while the continuing study was performed mainly by the physician in charge in cooperation with specially trained nursing personnel, which may have resulted in differences in sensitivity . However, we are not able to exclude the effects of some prevention strategies, because almost all residents of the nh had undergone vaccination against influenza and pneumococcal disease . Infections in ltcfs are usually considered to be endemic infections, outbreaks and/or the presence of alert pathogens with multiple antimicrobial resistances . The most frequent endemic infections are respiratory tract infections, urinary tract infections, and skin and soft tissue infections . However, skin infections were the most frequent in our residents . This was probably connected with the clinical status of those persons, because they suffered from atherosclerosis of lower extremity arteries, had mobility problems and, consequently, skin ulcers and pressure sores . Among the risk factors of infections, advanced age is usually an important factor increasing this risk . In our observations, however, age did not increase the incidence of disease . Only an insignificant trend of more pronounced and frequent development of infections appeared in the subgroup of the oldest residents (> 90 years of age). The average age of patients with and without infections did not differ significantly (about 78 vs. 76.6 years), but it was lower than the age of residents of such facilities in other countries . Nevertheless, the results show that there is a need for improvement not only when it comes to the sensitivity of the surveillance but also high prevalence rates, i.e. The risk of infection for a resident of a polish ltcf is high . There are significant differences in the identified types of infections between prevalence and incidence . The main reason is methodology: the short time frame of the pps is too sensitive for, for example, pneumonia, because residents with pneumonia are more likely to be hospitalised than patients with various forms of wound infections usually treated in an ltcf . For the surveillance of rapidly progressing disease, like lower respiratory tract infections or urinary tract infection, a continuous study is more appropriate . Thus, even though the presence of the test is easier and less expensive, it does not include all phenomena which are infections in ltcfs . The presented analysis also points to various results when it comes to the risk factors for developing an infection . The pps results showed only a slight relationship between the general status of patients and the risk of developing an infection . None of the commonly used scales for estimating the patients general status, e.g. The barthel or katz scales, were helpful in estimating the risk of developing an infection, similarly to physical activity described in a five - point scale . The incidence study, on the other hand, showed more expected results, with confirmation of the relationship between many procedures characteristic for ltcfs . In this study, the data on the general status of patients was also confirmed as having value in the surveillance of residents . The prospective active surveillance for endemic infections in ltcfs should be restricted to the selected groups of residents with the highest risk of infection (low score on the barthel or other scales). Targeted incidence surveillance could be a valid alternative: a barthel score of 15 was showed to have the best sensitivity and specificity and, together with other risk factors, proved to have a good predictive value thus, patients with a barthel score of 15 or more could be included in such a targeted surveillance . Such targeted surveillance is particularly important in countries such as poland, with limited resources in infection control, which is generally associated with both a small number of infection control officers and a lack of infection surveillance infrastructures in the ltcf . A focus on the high - risk population might be a solution for cost - effective surveillance; similarly among hospitalised patients, it seems that this type of approach could also be implemented in the ltcf . During the study period, the average time between any change of health status of the residents was 190 days (sd 106). However, as the lower limit of the 95% confidence interval for the calculated mean is 149, we propose this value as the check value for the barthel scale period . For practical reasons, it is reliable to check it every 6 months . Both prevalence and incidence methods of surveillance are currently recommended by the eu, but, at the same time, beginning in 2006, there has been an on - going european programme called improving patient safety in europe (ipse). It seems reasonable not to limit the studies of infections in ltcfs only to pps, but to wage the decision of the need to introduce prospective continuous surveillance based on the specific situation . This has a special meaning in countries that are only preparing to introduce surveillance to ltcfs, such as poland, where the development in this field of health care is not complete . A good confirmation of this is the age of residents encompassed in this study, which was much lower than the age of ltcf residents in other countries . In norway, 78% of residents were> 81 years old, in italy, the median age was 81 years, with values of 89 years in canada and 83 years in germany . That may be the reason for the lower incidence of infections than that seen in the literature and important information for public health . A main source of the study limitation this was due to a mistrust of residents (who had to agree to participate) and staff who participated in such studies for the first time, as they had not yet been implemented in poland . In small long - term care facilities (ltcfs), prospective infection surveillance is more valuable, because the prevalence data are limited in terms of variation, distribution, risk factor of infections and also risk of lost data in connection with, for example, the hospitalisation of residents . Prospective surveillance may be targeted using a threshold of the barthel scale of 15, as identified with a specificity / sensitivity analysis . Target surveillance based on the barthel scale may especially be used in countries with limited resources in infection control . Further research on the basis of a larger group of residents is needed in order to be able to discuss the possibility of targeted surveillance in ltcfs . The identified infection rates in the incidence study in polish ltcfs are similar to other reports . This article is distributed under the terms of the creative commons attribution license which permits any use, distribution, and reproduction in any medium, provided the original author(s) and the source are credited.
|
Acute appendicitis and typhlitis are the most common causes of gastrointestinal surgical complications in children undergoing chemotherapy for acute leukemia with reported incidences of 0.54.4% and 1.76.7% respectively [14]. Early diagnosis by radiologic imaging is essential as appendicitis usually requires emergent surgical management . In such situations, the clinician must also balance the risk of further immunosuppression and chemotherapeutic toxicities with the risk of delaying appropriate leukemia therapy . A retrospective case review of all children 18 years of age diagnosed with acute leukemia at our institution between january 2002 and december 2011 was performed after obtaining institutional irb approval . Amongst 154 children eligible, three (1.9%) patients appendicitis was diagnosed based on clinical, imaging and histologic findings . A 17-year - old girl with relapsed acute myeloid leukemia (aml) developed nausea, vomiting, mild lower abdominal pain and breakthrough menstrual bleeding three days into hospitalization for induction chemotherapy with cytarabine and mitoxantrone . On day fifteen, her abdominal pain localized to the right lower quadrant (rlq) followed by fevers three days later . Eventually, she underwent a matched unrelated donor bone marrow transplant (bmt) and was in remission at seven - year follow - up . An 18-year - old girl with relapsed leukemia consistent with acute lymphoblastic leukemia (all) in addition to intermittent nausea, vomiting, and diarrhea, significant rlq pain with fever on hospital day nineteen (maximum 39.5 c) prompted an abdominal ct scan that showed an edematous, thickened appendix with surrounding inflammation . She underwent an emergent laparoscopic appendectomy and pathology revealed a non - perforated appendix with inflammatory infiltrate without leukemic involvement . She eventually underwent a matched related donor bmt and was in remission at three - year follow - up . A 10-year - old girl presented with generalized myalgias, fevers and gingival hypertrophy and was diagnosed with primary aml with maturation (fab: m2). Cytogenetics revealed no clonal abnormalities and aml panel fluorescent in - situ hybridization studies were normal . During hospitalization for induction chemotherapy, after five days of decitabine (20 mg / m / day) on study and one dose of systemic cytarabine (100 mg / m / dose), she developed abdominal pain with high - grade fevers (maximum 40.1 c). Abdominal ct scan demonstrated numerous fluid - filled edematous bowel loops with enhancement, fluid collections, and findings consistent with an inflamed appendix with fecalith . An emergent laparotomy revealed gross soilage of the abdomen due to a perforated necrotic appendix eroding into the distal ileum and colon necessitating a diverting ileostomy and partial right colectomy . At the time of surgery, her absolute neutrophil count (anc) was 4.0810/l . Histopathology revealed immature myeloid cells, consistent with leukemic involvement of the appendix, in addition to inflammatory infiltrates . Parenteral antimicrobial therapy was continued for approximately 6 weeks during which chemotherapy was held to avoid further immunosuppression . Packed red blood cell and platelet transfusions were required within the first postoperative week following which no transfusion support was needed until resumption of standard chemotherapy about 8 weeks later . During this 8 week period, her anc fluctuated from 0.64 to 5.3310/l with counts of <110/l noted only on 2 occasions at 24 days and 37 days from surgery . She did not experience sustained neutropenia and, hence, no significant issues were noted during this 8 week period . Bone marrow biopsy twenty - five days from initiation of induction chemotherapy showed no morphologic features of aml . Despite receiving only a short course of decitabine and one dose of systemic cytarabine, she achieved and maintained complete remission until resumption of standard intensive chemotherapy . A 17-year - old girl with relapsed acute myeloid leukemia (aml) developed nausea, vomiting, mild lower abdominal pain and breakthrough menstrual bleeding three days into hospitalization for induction chemotherapy with cytarabine and mitoxantrone . On day fifteen, her abdominal pain localized to the right lower quadrant (rlq) followed by fevers three days later . Eventually, she underwent a matched unrelated donor bone marrow transplant (bmt) and was in remission at seven - year follow - up . An 18-year - old girl with relapsed leukemia consistent with acute lymphoblastic leukemia (all) was hospitalized for chemotherapy with cytarabine and clofarabine . In addition to intermittent nausea, vomiting, and diarrhea, significant rlq pain with fever on hospital day nineteen (maximum 39.5 c) prompted an abdominal ct scan that showed an edematous, thickened appendix with surrounding inflammation . She underwent an emergent laparoscopic appendectomy and pathology revealed a non - perforated appendix with inflammatory infiltrate without leukemic involvement . She eventually underwent a matched related donor bmt and was in remission at three - year follow - up . A 10-year - old girl presented with generalized myalgias, fevers and gingival hypertrophy and was diagnosed with primary aml with maturation (fab: m2). Cytogenetics revealed no clonal abnormalities and aml panel fluorescent in - situ hybridization studies were normal . During hospitalization for induction chemotherapy, after five days of decitabine (20 mg / m / day) on study and one dose of systemic cytarabine (100 mg / m / dose), she developed abdominal pain with high - grade fevers (maximum 40.1 c). Abdominal ct scan demonstrated numerous fluid - filled edematous bowel loops with enhancement, fluid collections, and findings consistent with an inflamed appendix with fecalith . An emergent laparotomy revealed gross soilage of the abdomen due to a perforated necrotic appendix eroding into the distal ileum and colon necessitating a diverting ileostomy and partial right colectomy . At the time of surgery, her absolute neutrophil count (anc) was 4.0810/l . Histopathology revealed immature myeloid cells, consistent with leukemic involvement of the appendix, in addition to inflammatory infiltrates . Parenteral antimicrobial therapy was continued for approximately 6 weeks during which chemotherapy was held to avoid further immunosuppression . Packed red blood cell and platelet transfusions were required within the first postoperative week following which no transfusion support was needed until resumption of standard chemotherapy about 8 weeks later . During this 8 week period, her anc fluctuated from 0.64 to 5.3310/l with counts of <110/l noted only on 2 occasions at 24 days and 37 days from surgery . She did not experience sustained neutropenia and, hence, no significant issues were noted during this 8 week period . Bone marrow biopsy twenty - five days from initiation of induction chemotherapy showed no morphologic features of aml . Despite receiving only a short course of decitabine and one dose of systemic cytarabine, she achieved and maintained complete remission until resumption of standard intensive chemotherapy . Appendicitis is seen in the general population with a lifetime cumulative incidence rate of 9% . Our calculated incidence rate of appendicitis in the setting of acute leukemia (1.9%) correlates with the reported incidence of 0.54.4% . Leukemic involvement of the gastrointestinal tract as well as the treatment thereof can compromise the structural integrity of the intestinal wall . Moreover, atypical presentations of appendicitis are common in immunocompromised patients due to underlying malignancy and ongoing chemotherapy . Early symptoms such as nausea, vomiting, abdominal pain, and diarrhea are non - specific and may be attributed to chemotherapy side effects delaying accurate diagnosis . In addition, typhlitis often mimics the classic presentation of appendicitis, and therefore imaging must be performed to distinguish these entities as their management approaches differ . Although successful conservative management has been reported, the majority require surgical intervention to avoid devastating complications . Several groups have demonstrated safety and efficacy of surgical intervention and operative management may also shorten the length of hospital stay compared to nonoperative management . In our cohort, all three patients were operated upon emergently and all of them including the patient with appendiceal perforation and leukemic infiltration tolerated surgery well . For the treating clinician, the bigger conundrum is the need to suspend chemotherapeutic treatment during life - threatening infections such as appendicitis, while weighing in a heightened risk for uncontrolled leukemic cell proliferation . Alternatively, other anti - leukemic agents such as decitabine have been demonstrated to be effective and well - tolerated in adults with myelodysplastic syndrome, high risk aml, as well as those ineligible for standard chemotherapy due to extensive comorbidities such as the elderly [1113]. Decitabine (5-aza-2-deoxycytidine) is a cytosine nucleoside analog that after phosphorylation directly incorporates into dna resulting in inhibition of dna methyltransferases . The resulting dna hypomethylation causes reversal of abnormal epigenetic silencing of genes critical to normal cellular differentiation, proliferation, and normal cellular life processes such as apoptosis . It has minimal toxicity and hence is favored in patients who are unable to tolerate standard chemotherapeutic regimens . Our third patient was enrolled in a trial utilizing a short five - day course of decitabine prior to intensive chemotherapy with cytarabine, daunorubicin and etoposide . She achieved and remained in remission with one cycle of decitabine and one dose of cytarabine without significant hematologic toxicities despite considerable delay in resumption of chemotherapy due to overwhelming infection . Low - dose decitabine (20 mg / m / day for 10 days given every 4 weeks) has demonstrated promising results in children with very high risk relapsed/ refractory aml in whom other treatment options had been exhausted . Three out of eight patients had a complete response, with best responses noted after a median of 2.5 cycles . Despite significant comorbidities, decitabine monotherapy demonstrated minimal toxicity . Recently, sequential treatment with decitabine and cytarabine was found to be more effective than cytarabine alone in xenograft models of childhood aml . Relative to studies with heavily pre - treated patients, our patient was chemotherapy naive and had minimal hematologic or other toxicities secondary to chemotherapy . Given the favorable toxicity profile and efficacy in childhood aml, we suggest that decitabine may serve as a bridging anti - leukemic agent during serious illness and reduce risk of recurrence secondary to prolonged treatment delays . Overall, managing concurrent malignancy and critical illness is a delicate balance, one in which decitabine may play a pivotal role; however further clinical trials are needed.
|
The perioperative period of major oncological surgery is marked by several potential causes for renal injury such as hypotension, volume depletion, self - regulation disorders of the kidney, surgical trauma and drug - induced nephrotoxicity . On the other hand, patients with oncological malignancies are susceptible to various kidney insults that are associated to complications from the disease itself or from its treatment, such as chemotherapy and radiotherapy . Thus, surgical stress would potentiate various risk factors to kidney injury previously present in the carriers of malignancies, resulting in increased length of hospitalization, infectious complications, and mortality rates . In the last few years, several researchers have been trying to find serum and urinary biomarkers that could detect earlier or even predict the evolution to acute kidney injury (aki)/failure in patients at risk . Neutrophil gelatinase - associated lipocalin (n - gal) is a widely studied early biomarker of ischemia and kidney injury, which allows the identification of patients at a higher risk of kidney injury 48 h before traditional detection methods, thereby allowing the implementation of preventive / protective strategies before renal damage becomes irreversible . Considering the negative impact of aki among oncology patients, this study intended to assess the efficacy of urinary n - gal as an early biomarker of aki immediately after major oncological surgeries in patients admitted to the intensive care unit (icu). This was a prospective cohort study on consecutive patients diagnosed with solid neoplasia, submitted to elective or emergency surgeries, and admitted in the icu of a cancer hospital . All adult patients (aged> 18 years) submitted to major oncological surgeries (abdominal, pelvic, thoracic, or head / neck) were included, since they previously had a normal renal function . The exclusion criteria were: patients with a previous diagnosis of kidney injury or failure (with or without renal replacement therapy), pregnant women, and terminal patients under exclusive palliative support . Acute kidney injury diagnosis was defined in accordance with the aki network definition of injury criteria . Selected variable data (age, acute physiology and chronic health evaluation ii [apache ii], n - gal, c - reactive protein - immediate postoperative [crp - ipo], serum creatinine - ipo, serum creatinine 1 po, serum urea - immediate po and 1 po, length of hospitalization, operation time, and serum lactate - ipo) were standardized using z function and later analyzed by principal component analysis (pca), after verification of the data quality using kaiser - meyer - olkin (kmo) test . It was possible to determine the explanatory variables for each of the patients, with a priori - defined outcome (0-normal; aki). Urinary n - gal was measured at the time of admission in the icu using quantitative architect abbott (chemiluminescent microparticle immunoassay) method . Most of the patients (77%) were males, with a mean age of 52.8 years . Patients with elevated urinary n - gal had higher apache ii score at admission, with a trend toward higher mean age compared with those with reduced n - gal . There were no differences in gender, site of cancer, or related diseases [table 1]. Demographic characteristics and clinical outcome of the patients according to urinary n - gal levels overall incidence of po aki was 13.6% . Patients with lower levels of urinary n - gal had lower incidence of aki (lower levels of serum urea and creatinine) and shorter length of hospitalization in the icu . When patients with or without the development of aki were compared, the urinary n - gal levels were found to be a strong outcome predictor of aki incidence [table 2]. The occurrence of aki increased the length of hospitalization in the icu, although it did not increase the mortality rate . Univariate analysis of the risk factors and outcomes among patients with or without the development of aki when the kmo test value was> 0.5 (kmo = 0.695), it was possible to verify that the variables post oncological surgeries were in accordance with the pca application assumptions, after removing the variables creatinine 1 po, urea 1 po, length of hospitalization, duration of surgery, and lactate - ipo . Correlation between matrix of variables was assessed using bartlett spherical test (c = 53.097, p <0.0001). Using canonical analysis (axes f1 and f2), it was confirmed that age, n - gal, and apache ii score were the primary variables associated with aki outcome [figure 1]. When the kmo test value was> 0.5 (kmo = 0.695), it was possible to verify that the variables post oncological surgeries were in accordance with the pca application assumptions, after removing the variables creatinine 1 po, urea 1 po, length of hospitalization, duration of surgery, and lactate - ipo . Correlation between matrix of variables was assessed using bartlett spherical test (c = 53.097, p <0.0001). Using canonical analysis (axes f1 and f2), it was confirmed that age, n - gal, and apache ii score were the primary variables associated with aki outcome [figure 1]. When the kmo test value was> 0.5 (kmo = 0.695), it was possible to verify that the variables post oncological surgeries were in accordance with the pca application assumptions, after removing the variables creatinine 1 po, urea 1 po, length of hospitalization, duration of surgery, and lactate - ipo . Correlation between matrix of variables was assessed using bartlett spherical test (c = 53.097, p <0.0001). Using canonical analysis (axes f1 and f2), it was confirmed that age, n - gal, and apache ii score were the primary variables associated with aki outcome [figure 1]. This study showed that in the context of oncological surgery, the urinary n - gal level assessed at admission to the icu was a strong predictor of aki, and patients with higher values of n - gal showed a trend toward higher hospital mortality . Neutrophil gelatinase - associated lipocalin, as well as other lipocalins, is expressed biologically in various tissues, such as lungs, spleen, kidney, liver, brain, heart, and testicles, under healthy conditions in humans . But under stress conditions, it is produced by neutrophils and performs complementary functions, by transporting inflammatory substances (such as prostaglandins and arachidonic acid) and mediating the action of iron during inflammatory process . Therefore, n - gal has possible immunological action during severe acute situations, such as sepsis and trauma . On the other hand, specifically in the kidney tissue, n - gal is upregulated in injuries (particularly ischemic and by the use of contrast). Therefore, it is possible to say that plasma n - gal acts like a neutrophil activation biomarker and urinary n - gal acts like a tubular injury marker . However, because of its small size and resistance to degradation, n - gal is easily detected in the blood and urine . Therefore, increased urinary n - gal detection could be affected by a kidney process (aki) or it might reflect a severe acute systemic inflammatory process (e.g., sepsis or trauma). During differentiation of various human tissues, n - gal may play a role in the genesis and, probably, the growth, proliferation, and diffusion of human neoplasms . Major surgeries can themselves result in severe systemic inflammatory process, which intrinsically would lead to higher mortality . N - gal has been shown to be increased during the po period of major cardiac and noncardiac surgeries, correlating with the severity of inflammatory process and mortality, and even in other chronic and acute inflammatory conditions, such as extracorporeal circulation and inflammatory bowel disease . Acute kidney injury is common in the po period of major surgeries, with a strong impact on morbi - mortality, particularly in patients with cancer . Despite its multifactorial nature, a characteristic feature of aki related to po period is its association with systemic inflammation processes . In the present study, urinary n - gal showed a strong correlation to kidney dysfunction and a tendency toward increase in mortality (possibly not significant due to an insufficient number of patients). In this study, urinary n - gal, besides being clearly an aki predictor, was increased (although without statistical significance) in patients who died . N - gal has been associated with unfavorable outcome in critical patients, particularly (but not exclusively) in sepsis and systemic inflammatory reaction syndrome (sirs) patients . Inflammation has an important role in cellular biology and cancer pathophysiology, either in the development and emergence of oncogenic mutations and metastasis formation or host reaction and eventual secondary immunosuppression . Moreover, secondary to major surgeries, particularly in patients with cancer, a systemic inflammatory process is triggered, including an immunosuppressive anti - inflammatory response - an activity that could be mediated by n - gal . In the current study, all patients were submitted to moderate to high - risk surgery, with severe po inflammation, as shown by the elevated crp levels . In the current study, age> this could only be associated with the intrinsic higher severity of disease in these patients, with higher number of comorbidities and higher aki risk . However, although the literature is not clear regarding the correlation between age and n - gal levels, elderly patients with sirs / sepsis present greater inflammatory activity (determined by biomarkers) than younger patients . Hence, n - gal could hypothetically be a biomarker of age - related inflammatory activity in these patients . The incidence rate of aki (13.6%) and need for renal replacement therapy (4.5%) in this study were compatible with literature . Aki incidence varying from 6.8% (lung cancer) and 17.3% (pancreatectomy) to 38.3% (esophageal cancer) has been described in hospitalized oncology patients, with a strong correlation to hospital mortality . In this study, there was a small increase of aki incidence in gastrointestinal surgeries, although without statistical difference . The main predictors of aki were older age, apache ii score, urinary n - gal, and crp, and the first three parameters maintained their predictability when subjected to multivariate analysis . In po patients, it has been shown that aki is correlated with disease severity, previous diseases (such as chronic heart failure [chf] and diabetes), and abdominal surgery . The crp level in critically ill sepsis cancer patients shows a strong correlation with the course of acute disease, thereby being a good marker of inflammatory process . This study has some limitations, primarily because of a single center design and limited number of subjects . In addition, n - gal serum level was not measured, which could better differentiate between systemic inflammatory process and kidney injury . It has also been shown that urinary n - gal has a strong correlation with mortality and inflammatory process, independent of the presence of aki . The serial measurement of n - gal was not performed, which could increase the predictability of the diagnostic test . In addition, because two variables were studied (oncological and at po status) it would be difficult to arrive at conclusions on the relative impact of each one of the parameters involved in the development of aki . In a small cohort of cancer patients submitted to major surgery and admitted to the icu, initial urinary n - gal was a predictor of po aki . Patients with elevated urinary n - gal also showed a trend toward higher hospital mortality.
|
Natural killer t (nkt) cells are recently discovered innate - like subset of lymphocytes expressing both nk and t cell markers . Nkt cells are a phenotypically and functionally diverse subset of t cells that recognize self- and microbial lipids [1, 2]. Most nkt cells are restricted by mhc - i like molecule cd1, which can further distributed into two major subsets: type i and type ii nkt cells (table 1). Type i nkt cells are also called invariant nkt (inkt), expressing exclusively limited t cell receptor (tcr) and tcr receptors, that is, v14-j18 predominately paired with v8.2, v7, or v2 in mice and v24-j18 paired with v11 in human [2, 3]. Inkt cells secrete a wide array of cytokines and chemokines immediately upon activation through tcr engagement by glycolipids . Inkt cells exert their regulatory and cytotoxic activities also through direct contact, granzyme b, or fasl - induced mechanisms [46]. Hence, inkt cells exert both regulator and effector cell function and bridge the innate and adaptive immune responses . Recently, inkt cells have been further classified into nkt1, nkt2, and nkt17 lineages based on their cytokine profiles and distinct transcription factors, t - bet, gata-3, and rort, as conventional t helper 1 (th1), th2, and th17 cells [8, 9]. On the other hand, type ii nkt cells, which are also called non - inkt or variant nkt (vnkt) cells, express more diverse tcr and tcr receptors . There still exists a minor group of cd1 nonrestricted nkt cells, referred to as nkt - like cells [11, 12]. A hallmark of inkt cells is their capacity to rapidly produce copious amounts of cytokines and chemokines upon tcr stimulation, which endows these cells with potent immunomodulatory activities for a wide variety of immune responses and diseases (figure 1). Inkt cells exhibit potent effector functions and play critical roles in antimicrobial defense, cancer immunosurveillance, and modulation of immune - mediated disorders [1316]. As inkt cells recognize glycolipids that are enriched in microbes and parasites, they are believed to play important roles in the infections caused by these pathogens . Hygiene hypothesis, which tries to explain the declined infections with rising autoimmune and atopic diseases in the recent two to three decades [17, 18]. In this review, we summarize the roles of inkt cells in parasitic infections, with particular emphasis on the involvement of inkt cells in the hygiene hypothesis and underlying mechanisms . Albeit being widely studied during viral and bacterial infections, the role of inkt cells during parasite infections remains largely unexplored . As helminth infections can usually induce th2-dominated immune responses and inkt cells can rapidly produce copious amounts of various cytokines including interleukin-4 (il-4), these cells might be important players in the initial steps leading to th2 responses during helminthiasis . Recent reports have indicated that nkt cells are involved in the pathogenesis of several parasite infections in animal models and patients, playing, in most cases, protective or regulatory roles towards hosts . It is caused by digenetic blood trematodes, of which there are three main species: schistosoma mansoni, s. japonicum, and s. haematobium . Previous studies by others and us indicated that egg deposit in the liver was a determining factor to drive th2 response in s. mansoni and s. japonicum infections in mice [20, 21]. Nkt cells may contribute to regulating the cytokine secretion profiles during infections . In mice infected with s. mansoni, inkt cells exhibited an activated phenotype . Hepatic inkt cells produced both interferon- (ifn-) and il-4 following schistosome egg deposited in the liver . Further studies revealed that s. mansoni activated both inkt and non - inkt cells in vivo . Inkt cells contributed to th1 cell differentiation, whereas non - inkt cells might be mostly implicated in th2 cell differentiation in response to this parasite . Luo and colleagues reported that nk and nkt cells were activated and expanded from draining mesenteric lymph node (mln) in mice 57 wk after infection with s. japonicum . . However, the kinetics of nkt cells and their precise roles in immunomodulation during schistosome infections remain unclear . This is also true to nematode infections, where nkt cells remains ill - defined in their pathogenesis . A pioneer work from balmer and colleagues found an expansion of nkt (cd3nk1.1) as early as 24 hours following the infection with brugia pahangi . However, depletion of nk1.1-expressing cell had no effect on the th2 development during the gastrointestinal nematode trichuris muris infection . Inkt cells have been reported playing crucial roles in the pathogenesis of protozoan infections . In malaria, early interactions between blood - stage plasmodium parasites and cells of the innate immune system, including innate - like nkt cells, are important in the timely control of parasite replication and in the subsequent elimination and resolution of the infection . The lipid extracts from murine malaria parasites could actually be loaded onto cd1 molecules to stimulate inkt cell by the use of artificial antigen - presenting beads . The level of protective antimalaria immunity was greatly enhanced by coadministration of -galactosylceramide (-galcer) with suboptimal doses of irradiated sporozoites or recombinant viruses expressing a malaria antigen in mice . Inkt cells were increased in numbers and played critical roles through the secretion of ifn- in reducing liver - stage burden to a secondary infection by murine malaria plasmodium yoelii . -c - galcer displayed a superior inhibitory activity against the liver stages of the rodent malaria parasite p. yoelii compared to its parental glycolipid, -galcer . This adjuvant effect depended on nkt cell activation, which was able to boost ifn- production by nk cells and memory cd8 t cells . Visceral leishmaniasis (kala - azar) is a deadly disease caused by the parasitic protozoa leishmania donovani . Inkt cells are involved in the pathogenesis of leishmaniasis . In patients with visceral leishmaniasis, bone - marrow - derived non - inkt cells dominantly produced ifn- in response to l. donovani antigen in vitro . Post - kala - azar dermal leishmaniasis is a chronic dermal complication that occurs usually after recovery from visceral leishmaniasis . There was a raised proportion of circulating nkt cells in these patients compared to health controls . Karmakar and colleagues isolated a natural ligand of nkt cells, -(14)-galactose terminal glycosphingophospholipid (gspl) from this parasite to treat infected balb / c mice . This immunotherapy with gspl induced ifn- through the cooperative action of tlr4 and nkt cells, which contributed to the effective control of acute parasite burden in the infected animals . By use of inkt cell - deficient (j18) c57bl/6 mice, another study demonstrated that inkt cells played a role in early and sustained proinflammatory cytokine response warranting efficient organization of hepatic granulomas and parasite clearance of l. donovani . Nkt cell activation by -galcer during intradermal dnap36 priming was highly protective against murine cutaneous leishmaniasis, resulting in the heightened activation and development of cd4 and cd8 effector and memory t cells . Conversely, activation of inkt cells exacerbated, rather than ameliorated, experimental visceral leishmaniasis by l. donovani, which was correlated with a bias towards increased il-4 production by inkt . This may illustrate the double - edged sword of nkt cell - based therapy in leishmaniasis . Inkt cells protect mice against toxoplasma gondii infection . By oral infection of mildly virulent strain me49 t. gondii cysts, most cd1d - deficient c57bl/6 mice died within 2 wk of infection compared to no death in wt mice . After activation with t. gondii, nkt cells were important mediators of the immune response via a robust ifn--mediated effect that limited parasite replication and allowed for parasite clearance . Nevertheless, this strong th1 response, when uncontrolled, can mediate the lethal ileitis . Treatment of mice with a single injection of -galcer one day before infection activated intestinal nkt and led to a shift in cytokine secretion towards a th2 profile and a dramatic increase in treg cells in mlns, which alleviated intestinal lesions and increased survival of mice . On the other hand, inkt cells may negatively regulate the immune response against t. gondii infection possibly by producing il-4 and suppressing the induction of heat shock protein 65 . The latter is induced in host macrophages by t cells and plays an essential role in protective immunity in this infection . Nkt cells are involved in the pathogenesis of some other protozoan infections, providing protection against infections in most cases . Cd8 nkt cells were able to activate macrophages to kill trypanosoma congolense through the production of nitrogen oxides, whereas treg cells prevented the activation of the cd8 nkt cells . However, another report indicated that loss of inkt cells did not affect the susceptibility or resistance in cd1d c57bl/6 mice to the infections with virulent african trypanosomes, t. congolense or t. bruce . Lotter and colleagues identified a lipopeptidophosphoglycan from entamoeba histolytica membranes (ehlppg) as a possible inkt natural ligand . Ehlppg treatment, similar to -galcer application, induced protective ifn- but not il-4 production from inkt cells and significantly reduced the severity of amebic liver abscess in mice infected with e. histolytica . By the use of cd1d ko mice, it was found that inkt cells contributed to resistance against this protozoan and to the control of inflammation in the colitis induced by the infection . Inkt cells play important roles in the pathogenesis of some other parasitic diseases, as well as of a wide range of microbe infections, as seen in recent nice reviews [10, 46, 47]. Nkt cells play protective role against a wide range of parasite infections as discussed above, whereas the underlying molecular mechanisms are not fully elucidated . Shifting of host's cytokine secretion profiles may account for the protective or, in some cases, pathogenic effects of nkt cells on parasitic infections . Activated inkt cells can also transactivate many other immune cells or attract these cells to the sites of infection to exert their regulatory roles . Like nk cells, activated nkt cells can also mediate cytotoxic activity, possibly involving both perforin / granzyme and fas / fasl pathways [5, 6, 48]. Parasites are enriched in lipid, which may contain natural ligands for nkt cells as discussed in the next section . Therefore, it is not surprising that inkt cells participate in the pathogenesis of a range of different parasitic infections . The role of inkt cells in some parasitic infections and possible effect mechanisms are summarized in table 2 . The hygiene hypothesis was proposed in 1989 by strachan to explain the dramatic increase in the prevalence of autoimmune and allergic diseases over the past two to three decades . According to this hypothesis, reduced exposure to microorganisms and parasites in childhood is the main cause for the increased incidence of both th1-mediated autoimmune diseases and th2-mediated allergic diseases . Currently, the hypothesis is becoming more accepted with accumulating epidemiological and clinical evidences to support [5052]. Although the exact scientific underpinnings for the hygiene hypothesis and the underlying mechanisms by which infections affect the immune system to prevent diseases have remained a puzzle over the years for both scientists and clinicians, there is increasing recognition that exposure to infectious agents evokes fundamental effects on the development and behavior of the immune system [18, 53]. The core of this hypothesis consists in the notion that the microbial environment interfaces with the innate immune system and modulates its ability to impart instructions to adaptive immune responses, particularly when such interactions occur in utero and/or in early life . Many chronic infections, both microbial and parasitic, induce forms of immune suppression or downmodulation . Recent studies have indicated that infectious agents stimulate a large variety of regulatory t cells, such as th2, treg, tr1, and nkt cells, which secrete immunosuppressive cytokines / chemokines, such as il-10 and tgf- to alter the th1/th2 balance . Infections may induce the generation of regulatory macrophages, dendritic cells, innate lymphoid cells (ilc), nk, and b cells [5658]. Tlr - myd88 pathway is believed to be involved in the induction of different subsets of regulatory t cells, such as treg and nkt cells . The ability of infectious agents to regulate the immune system of their host is an increasingly fascinating topic . Helminths, as long - lived parasites, are remarkable for their ability to manipulate host immunity, protecting themselves from elimination and minimizing severe pathology in the host [53, 56, 59, 60]. Immunomodulation by parasitic helminths is a general phenomenon that is conserved across species, classes, and even phyla . Therefore, parasitic infections are a major theme in the hygiene hypothesis . Allergies and autoimmune diseases are less prevalent in countries with higher burdens of helminths and other parasitic organisms . There are strong epidemiological evidences to support the premise that the dramatic increase in atopic disease in the developed world is a direct consequence of the eradication of helminth infections . At least some helminthes seem to have antiallergic or anti - inflammatory effects in humans . Experimental evidences have also shown the significant suppression for the development of airway hyperresponsiveness (ahr) in mice infected with numerous helminths, including blood fluke schistosoma japonicum, filaria litomosoides sigmodontis, nematode heligmosomoides polygyrus, and nippostrongylus brasiliensis . These mice show attenuated airway inflammation with reduced infiltration of eosinophilia in the bal and lung and allergen - specific ige in sera . Experimental studies have also shown protective effects of helminth infections in animal models of autoimmunity . Surprisingly, helminths have been shown to suppress various types of autoimmune disease, such as collagen - induced arthritis, experimental autoimmune encephalomyelitis, and type 1 diabetes in murine models as reviewed recently . Helminth infections might be beneficial to the induction of multiple regulatory mechanisms, including various regulatory cell populations, inhibitory receptors, blocking antibodies, and two prominent cytokines: il-10 and tgf- [61, 66]. Thus, it is not surprising that helminths can modulate immunopathology, whether in the context of allergic inflammation or autoimmune disease, either directly or indirectly . A study shows that serum antibodies to toxoplasma gondii tend to be negatively associated with allergic sensitization to food and aeroallergens in children from different geographical areas in greece, netherlands, china, india, and russia . A negative association also exists between t. gondii infection and the presence of multiple sclerosis . The literature is limited regarding the involvement of inkt cells in this hypothesis . On the other hand, many microorganisms and parasites contain various lipids in their structures . The bacterial and parasitic cell wall is a cellular structure highly enriched in a variety of glycolipids and lipoproteins . Along with -galcer, growing evidences suggest that some microorganisms, including mycobacteria, sphingomonas, borrelia, helicobacter pylori, streptococcus pneumoniae, and group b streptococcus, can produce cd1d - restricted ligands capable of activating a proportion of inkt cells . Hence, inkt cells can respond directly by recognizing the glycolipid antigens expressed by these bacteria . Inkt cells can also respond indirectly to many other bacteria such as salmonella enterica and staphylococcus aureus . Of note, some protozoan and helminthic parasites also contain natural ligands of nkt cells and several candidates have been successfully isolated . The excretory and secretory (es) products, which are often glycosylated, are found in the bloodstream of infected hosts and dictate particular functional immune responses that allow persistence of the parasite, typically by inducing th2-associated cytokines and expansion of various regulatory cell subsets, including nkt cells [22, 56, 69]. The adult worms of schistosoma mansoni express a range of glycoconjugates, such as galactosylceramide and glucosylceramide, which may contain natural ligands of nkt cells . Infection with s. mansoni or exposure to eggs from this helminth inhibited the development of type 1 diabetes in nod mice . In addition, soluble extracts from worms or eggs of this schistosome possess the similar ability as infection to prevent the onset of diabetes if injection is given at early age (4 wk old). Soluble adult worm antigen or soluble egg antigen may expand the inkt cell population in nod mice, although the lipids binding to inkt cells have not been targeted in this study . Lipid extracts from murine malaria parasites can actually be loaded onto cd1 molecules to expand inkt cells . Lotter and colleagues have identified a lipopeptidophosphoglycan from e. histolytica membranes as a possible inkt natural ligand, which can stimulate inkt cells to produce ifn- to exert protective role against this infection . Karmakar and colleagues isolated a natural ligand of nkt cells, -(14)-galactose terminal glycosphingophospholipid (gspl), from l. donovani to treat infected balb / c mice . These investigations pave the way to identify natural ligands of inkt cells for the development of novel therapeutic agents . Inkt cells may exert their immunomodulatory effects in hygiene hypothesis through the interaction with treg, th17, and other immune cells . Upon activation with microbial and parasitic lipid antigens, inkt cells rapidly produce a wide range of cytokines and chemokines, transactivating many immune cell types, such as th1, th2, and treg . In eae model, inkt cells th17 cells in the mlns are greatly reduced in cd1 mice or j281 mice, which lack inkt cells . Inkt cells induce the conversion of nave diabetogenic bdc2.5 t cells into foxp3(+) treg cells in the pancreatic lymph nodes accumulating in the pancreatic islets . In addition, inkt cells can suppress both antigen - induced acute arthritis and collagen - induced chronic arthritis, likely via inhibition of arthritogenic th1 cells . In toxoplasma gondii infection, activation of inkt cells by -galcer can lead to a shift to th2 cytokine profile and a significant increase in treg cells in mlns, which exerts protective role and increases survival of mice . The recently defined innate lymphoid cells (ilc) share some features with inkt cells . Upon activation without the need of prior sensitization, both cells can release copious amounts of th1, th2, and/or th17 cytokines that shape subsequent innate and adaptive immune responses . Although sparse up to now, there exists experimental evidence for direct interactions of ilcs and nkt cells possibly via their effector cytokines . For example, nkt cells, as well as alveolar macrophages, secrete endogenous il-33 that enhance il-5 production from ilc2 in lungs during influenza virus infection . The interaction of inkt cells with other t cell subsets and underlying mechanisms remain to be elucidated . Taken together, microbe and parasite infections, especially at early lifetime, parasitic worms are able to survive in their mammalian host for many years due to their ability to manipulate the immune response . The underlying mechanisms regarding how infections affect the immunity of hosts remain to be clarified . Upregulation of regulatory t cell subsets, such as treg, and induction of inhibitory cytokines and/or chemokines are the common findings . Given the fact that many microbes and parasites are enriched in lipid antigens and nkt cells are unique t cell subset that can recognize lipid antigens, it is reasonable to speculate that nkt cells play key roles in this hypothesis (figure 2). Inkt cells are unique innate - like t cell subset that bridge between innate and acquired immunity systems . Inkt cells exert both effector and regulatory functions through direct contact or quick secretion of copious amounts of cytokines, chemokines, and other mediators upon their tcr engagement by glycolipid antigens . These cytokines and chemokines critically regulate the downstream differentiation of th1, th2, th17, and other cells . Therefore, inkt cells have been postulated to have an important proximal immunoregulatory role and influence both innate and acquired immune systems . They participate in the host's immunity and immunopathogenesis of a wide range of parasite infections as discussed above . More thorough investigation is clearly necessary to better define their mode of activation and their regulatory functions in parasitic infections . Although the involvement of inkt cells in the hygiene hypothesis and the contribution to autoimmunity and allergic inflammation remains to be fully elucidated, exploiting inkt cells in helminth immunomodulatory mechanisms may lead to opening a new avenue to develop novel safer therapeutic agents for these diseases based on the manipulation of inkt cell function.
|
Due to the limited capacity of our visual system, selective attention needs to efficiently filter relevant stimuli from the incoming stream of visual information . Which stimuli are selected for further processing is a complex process that depends on various factors such as physical salience (e.g., [1, 2]), task - relevance [3, 4], threat relevance [5, 6], or learning experience . Current visual attention theories, modeling which information is selected under which circumstances, often assume that the visual system weights such factors and assigns priority to each stimulus in the visual field, determining the probability with which it is selected [811]. Naturally, as observers, we desire to attend to those stimuli that correspond to our current intentions and goals . By means of a search template that directly refers to a mental image of the desired object we can efficiently find such stimuli and deploy our attentional resources to it [1214]. High weights for features corresponding to current goals of the observer can also have detrimental effects, impairing performance . For example, contingent capture describes the effect that visual attention is captured by task - irrelevant stimuli that match the search template in one or more features [15, 16]. It was argued that attention deployment towards stimuli that partially match the search template, regardless of its actual task - relevance, is mediated by working memory (wm) which may store the search template so that the observer can constantly match incoming information in ongoing tasks [8, 1720]. A study by woodman & arita provided neurophysiological evidence that attentional templates are maintained in wm and that the strength of template representations in wm predicts the performance in a visual search task . As wm has a limited capacity, search templates maintained in wm for a search task at hand may sometimes compete with other information maintained in wm . More recent research has indeed suggested that visual selection can be closely intertwined with visual working memory processes [2225], for example, by showing memory - driven attentional capture . For example, olivers and eimer presented observers colored items they had to maintain in wm before they were being probed for correct retrieval . During maintenance, observers performed a visual search task . When distractors shared the colors of items maintained in wm, search was slowed down compared to distractors of neutral colors, suggesting attentional capture by features in wm (see also [24, 26]). Although it seems plausible that our perception can be biased towards stimuli that match our goals and intentions, perception as such is never a self - purpose; we intend to perceive something so that we can act upon the perceived . Action as the purpose of selection has been brought forward by allport's selection - for - action theory allport and a large body of literature has pointed towards a close interrelation of selection and action since (e.g., [2834]). 's study, participants had to prepare a grasping or pointing movement according to a cue presented in the beginning of each trial . For grasping, size is a relevant dimension because grasping requires the specification of size - related parameters to control grip aperture . For pointing, luminance is a relevant dimension because pointing crucially requires the localization of to - be - pointed objects and this localization before participants executed the movement, they were shown a search display with various filled grey circles . Either all circles were identical, or one circle was a size singleton (smaller circle) or one circle was a luminance singleton (brighter circle). After the search task, participants executed the previously prepared movement towards one among various, real objects in front of them . It was found that preparing a grasping movement facilitated detection of size singletons, whereas preparing a pointing movement facilitated detection of luminance singletons . The authors concluded that planning an action biases visual perception towards dimensions that deliver important information for controlling that action . The large overlaps between visual attention and wm have been attributed to attentional control mechanisms being in some way common with those recruited in the service of wm maintenance [23, 25]. Similarly, the overlaps between visual attention and action planning have been ascribed to a common coding of perception and action [29, 32, 36]. It seems economically plausible that a common mechanism allows the visual system (a) to deploy attention to the relevant information currently available to the senses, (b) to maintain information not present to the senses anymore, and (c) to plan action related to the present / maintained visual information . This study aimed at investigating such interactions of visual attention, visual wm, and action planning . More specifically we were interested in whether attention is particularly biased towards dimensions that are both action relevant and wm relevant, for example, towards a red circle if red is to be held in wm and a grasping movement is to be executed towards a circular item . The present study combined a visual search task with a working memory (wm) task and a motor task . Participants had to prepare a pointing or grasping movement but withhold execution until the end of a trial . Participants also had to memorize a color hue until the end of a trial . At the end of a trial, participants performed the planned movement towards the memorized (circular) item, thus combining wm and motor planning . While participants planned the movement and held the color in their wm, they had to perform a visual search task in which they always had to respond to a diamond - shaped target among circle distractors . Note that, for grasping, shape was a relevant dimension because the to - be - grasped objects were circles and thus required the specification of circle - related parameters (e.g., [37, 38]). In some of the trials, one of the distractors could be colored; the color could be related or unrelated to the color in wm . We hypothesized that the additional color singletons will capture attention and slow down response times (c.f .,), even more so when they are related to wm content (c.f .,). Memory - relevance and action - relevance coincided when the additional singleton in the search task was of a color related to wm and when a grasping movement was being prepared . Thus we expected the capture effect to be most pronounced when the color singleton both matches the wm content and is congruent to the action - relevant dimension, because, for such stimuli, task - relevance and action - relevance coincided . 21 volunteers (aged 1927 years) naive to paradigm and objective of the experiment participated for course credit . All but two were right - handed and all had normal or corrected - to - normal vision (tested with landolt ring test, visus 1). Participants were seated in a comfortable chair in a dimly lit room at 50 cm distance from an lcd - tn screen (samsung syncmaster 2233). Participants had a customizable keyboard (ergodex dx1) on their left side in front of them with two buttons that were labeled n and were operated by the middle and index finger of the left hand . Stimulus presentation and response collection were controlled by a windows pc using e - prime 2 routines . The examiner sat approximately 2 m behind the participant with a standard keyboard on her lap to register participants' movement . Movement cues were color photos taken from a female volunteer showing a forearm / hand on a black background that performs a pointing or grasping movement (see figure 1(b)). The numbers of pixels for the pointing and grasping hands were approximately identical (~20% of the screen; ~80% were black pixels). Memory items were filled circles (diameter: 3.6 visual angle) colored in one of nine shades of four colors (blue, green, yellow, and red), that is, 36 different hues in total . Rgb values were identical to those used by olivers & eimer; see the appendix for rgb and cie(x, y) values . Search displays consisted of eight items placed on an imaginary circle with a diameter of 10.6 (see figure 1(a)). Colors were taken from the same pool of colors as memory items (see above). Targets were grey diamonds (3) with an embedded stylized black m or n. m and n were made by removing two lines from the hourglass; that is, m, n, and hourglass were superposable . In the target was presented equally often in each of the eight positions . In memorized color trials and neutral color trials, there was one target, one color distractor, and six grey distractors . Target and color singleton were presented equally often in each of the eight positions but never in neighboring positions . Each trial started with a central fixation, shown for 500 ms (see figure 1(c)), and was replaced with a movement cue shown for 1500 ms . Participants were instructed to prepare the indicated movement but withhold movement execution until the end of the trial . A display followed for 1000 ms that randomly showed one of the 36 color hues . Participants were instructed to memorize this hue until it was probed in the end of the trial . After a blank display showing only a fixation cross, the search display was shown . In one - third of the trials (320 trials),, a color distractor was presented that had a hue from the same color category as the memorized item but never the exact same hue (memorized color). In the remaining third of the trials, a color distractor was presented that had a hue from a different color category as the memorized item (neutral color). Participants were instructed to respond as fast as possible (while avoiding errors) to the letter embedded in the target (50% m, 50% n) by pressing the according button on the keyboard . After participants responded, the search display was replaced by another blank display for 500 ms . Subsequently, a memory probe display appeared with three (circular) memory items arranged in a pyramid arrangement . Participants were instructed to execute the planned movement towards the item with the memorized hue . The two other items were always from the same color category as the memorized hue (e.g., if the memorized items were from the category red, two out of the remaining eight hues were randomly selected to appear together with the memorized hue). All items being from the same color category was thought to discourage verbalization of the color and encourage a visual memory representation . For pointing movements participants had to touch the screen with the tip of their right index finger . For the grasping movement participants had to make a claw - like gesture with their right hand, touching the screen with all five fingers along the outlines of the respective memory item . After participants performed the movement, the examiner pressed one out of two buttons to register which movement had been executed by the participant (point versus grasp) and pressed one out of three buttons to register towards which item the movement was made (first, second, and third colored circle within the pyramid arrangement). Only trials in which participants performed the correct movement and towards the correct object were counted as correct trials . After an intertrial interval of 1000 ms (black screen), a new fixation cross announced the beginning of a new trial . There were six experimental conditions: three color conditions (color absent, memorized color, and neutral color) and two movement conditions (pointing and grasping). Target position (or target - color distractor position combination, resp .) Was counterbalanced with each of the six experimental conditions across the experiment . The experiment comprised 960 trials (+ 30 practice trials) divided in 40 blocks of 48 trials, that is, 160 trials per experimental condition . After each block a pause of at least 10 sec followed and performance feedback (rts and accuracy for the search task and accuracy for the motor task) was provided to participants on the screen . Mean response times (rt) and error rates were calculated for each participant separately for each of the six experimental conditions . For memorized color trials, rts were collapsed across all hues from the same category as the memory item . For neutral colors, rts were collapsed across all hues from all categories to which the memory item did not belong . Only trials in which all three tasks (search task, motor task, and memory task) were performed correctly and trials without exceedingly long search rts (> 2000 ms) or short rts (<300 ms) remained in the rt analyses . These criteria were reached in 64.5% (sd = 8.8%) of the trials . Data were submitted to a 2 3 anova with the factors color (absent versus memorized versus neutral) and movement (pointing versus grasping). Greenhouse - geisser correction was applied when appropriate . As measures of effect size, partial eta squared () is reported for anovas, and epsilon () is reported for t - tests . Search rts depended on the presence of a color distractor, f(2,40) = 32.96, p <0.001, = 0.622 . Rts were shortest when color was absent (m = 789 ms) followed by distractors with neutral colors (m = 830 ms) and distractors with memorized colors (m = 854 ms), all p <0.001 (contrasts); see figure 2 . How much search rts were modulated by color singleton depended on preparation of a movement, f(2,40) = 5.44, p = 0.008, = 0.214 . Follow - up t - test for dependent measures showed that differential movement preparation (pointing versus grasping) did not affect neither trials without color distractors (m = 6 ms), t(21) = 0.79, p = 0.440, = 0.24 nor trials with neutral color distractors (m = 4 ms), t(21) = 0.61, p = 0.548, = 0.19 . In trials with memorized color distractors, however, preparing a grasping movement increased search rts compared to preparing a pointing movement (m = 19 ms), t(21) = 2.85, p = 0.010, = 0.88 . To confirm that the 2-way interaction is not a merely additive effect of wm and action planning, an additional anova was calculated in which the capture effect was taken as a dependent measure (mean rts for color absent were subtracted from mean rts for memorized color and neutral color, resp . ). A 2 2 anova with the factors color (memorized versus neutral) and movement (pointing versus grasping) results showed that the capture effect was not modulated by the preparation of a movement (p = 0.084) but was modulated by the distractor type (mmem = 65 ms versus mneutr = 41 ms), f(1,40) = 22.59, p <0.001, = 0.530 . The increase in attentional capture for memorized colors was more pronounced for grasping (m = 35 ms) than for pointing (m = 13 ms), f(1,40) = 7.72, p = 0.012, = 0.279 . The correct movement according to the movement cue was executed equally often for grasping (93.3%) as for pointing (92.3%), p> 0.5 . The memory items were correctly identified (in terms of executing the movement towards the item of the hue that was shown in the beginning of the trial) in 71.0% of the trials (sd = 2.1%). To reveal whether those participants that were best in memorizing were also the ones that were most distracted by memorized color distractors, pearson's product - moment correlation was computed for memory accuracy and rt difference for color absent versus memorized color (across movement conditions). Results showed a strong correlation (= 0.44; p = 0.024); that is, the better memory performance, the more rt impairment due to memorized colors; see figure 3 . No such correlation was found for memory performance and rt impairment due to neutral colors (p = 0.127). The key result of the present study is an interrelation of action planning and maintenance in working memory (wm). Attention was particularly biased towards colors matching wm content when participants prepared a grasping movement compared to a pointing movement . When no color distractor was presented or the color distractor had a color unrelated to wm content, the preparation of the movement did not affect attention deployment . The presence of a color distractor impaired visual search even though colors were entirely search - irrelevant . Even though the task could be solved and the target be found most of the times (overall error rates ~3%), response times were slowed down . This is a replication of earlier findings showing that salient stimuli can capture attention against the intention of an observer [2, 3941]. Apparently, salient distracting information needs to be rejected before attention can be directed towards the task - relevant stimulus, a time demanding process . Current visual attention models account for attentional capture, for example, by assuming that the weight of any bottom - up feature map cannot be set to zero by the observer, regardless of the task - relevance of the feature dimension (guided search, [11, 14]). By this means, salient stimuli will always project on the master map of activations (or, priority map,), based on which attention deployment is being made . The present study also showed that the attentional capture was particularly pronounced when the color distractor matched the color category that was held in wm . This suggests that stimuli matching information maintained in wm are given more priority in visual processing than stimuli of equal salience that were not maintained in wm . It should be noted that the longer response times for trials in which task - irrelevant color distractors were present do not necessarily indicate that those distractors were processed in a bottom - up manner . According to bacon and egeth, two search modes would have been applicable in the present search task: singleton detection mode in which observers search for anything that stands out from the background and feature search mode in which observers search for a predefined feature (here, diamond), a search mode only possible when the target feature is known and does not change between trials . As in the present paradigm observers searched for a diamond - shape target throughout the experiment while ignoring color both search modes could have been used . Applying the feature search mode (rather than singleton detection) would have been particularly beneficial to color - present trials as distraction by the irrelevant color singleton would have been minimized . In color absent trials, however, observers could have applied the simpler singleton detection mode as this search mode was sufficient to efficiently find the target . If this was the case longer rts for color - present trials may have been due to differences in search strategy and not to bottom - up attentional capture . Different search modes in color - absent and color - present trials seem, however, rather unlikely as the trial types were completely randomized between trials . This makes it unlikely that observers switched their search mode between trials because they could not predict which trial type would follow . Only as soon as stimuli showed up on the screen could observers know whether a color was present or not . Regardless of the applied search mode, more priority to wm - related stimuli is well in line with the notion that visual attention and wm may rely on the same mechanism of prioritization of items [5254] and replicates earlier results showing that guidance of attention from wm occurs even when it is detrimental to performance [13, 23, 25, 55]. For example, olivers and colleagues [13, 23] argue that search templates and other representations in wm compete for resources . As a search template, items have full access to the sensory input and can bias selection towards matching objects . Maintaining an item in wm (e.g., because it will be probed in the end of a trial) is similar to adopting a search template (or an attentional set;). Such representations (so - called accessory memory items) have a passive status after being encoded into wm to not interfere with an ongoing task (here, the search task) and can be reactivated to regain the status of a search template when they become relevant (here, when memory probes are presented). Reactivation of accessory memory items may also happen involuntarily, for example, when a wm matching distractor is presented during the search task . This leads to prioritization of features held in wm, attentional capture results which may impair performance (see also [24, 25]). In the present study this was the case in the, it seems that weights for features in the wm task spill over to visual search and bias attention accordingly (e.g., [53, 56]). The increased attentional capture by color distractors matching the item held in wm could also be due to color priming from the wm displays to the search displays [7, 57]. Previous studies using a similar paradigm, however, could rule out the possibility of priming effects (e.g., [24, 26, 58]). Those studies showed that attentional capture during a search task occurred only when previously presented items had to be remembered . When observers were merely exposed to the crucial features, no such effects were found . Additional evidence comes from an imaging study when wm content was repeated in a search task, enhanced activity in a variety of brain regions known to be sensitive to the prior history of events was found . Conversely, when items only had to be identified but not held in wm, their repetition elicited a suppressed response in the same regions . Given the similar paradigm it seems likely that, also in the present experiment, visual search costs were due to wm content rather than repetition effects . Interestingly, the present results indicate that guidance of attention from wm was most pronounced when participants prepared a grasping movement . This indicates that apart from overlaps between visual attention and wm there may also be a connection between wm and action planning; see wm model in figure 4 . There is quite some evidence that action planning has a strong impact on perceptual processes, even in situations when action and perception are not directed to the same objects but merely overlap in time (e.g., [2834]). For example, when observers have the intention to perform an action, such as grasping or pointing, their attention can be biased towards simultaneously presented yet unrelated visual objects . This leads to faster target detection when the target is congruent to the planned action compared to incongruent targets [32, 34]. In the present study, the feature dimension shape was crucial to the search task; the feature diamond was task - relevant as targets were diamond - shaped; the feature circle was task - irrelevant as distractors were circle - shaped . Shape is a dimension also relevant to grasping as grasping requires the specification of shape - related parameters . For example, for a safe grip of an object, an agent needs to know the properties of its surface; a ball is grasped differently than a cube (e.g., [37, 38]). In the present study, participants had to grasp circular items in the memory probe display, rendering the feature circle particularly crucial for action planning . Conversely, when participants had to point at the circular items, no feature should have been rendered more crucial because none of the features in the search task (shape, color) were particularly relevant for pointing . It appears that when circles were made relevant through planning of a grasping movement, circular distractors captured more attention than when a pointing movement was planned but only if their color matched wm content . Thus wm might be a mediating process involved in the relation of action planning and attention . In terms of the wm model by olivers and colleagues the planning of an action such as a grasping movement might increase the demand on wm and thus cause additional interference in wm because it requires the maintenance of information for subsequent action execution (see figure 3). In the present study preparing a grasping movement may have needed the maintenance of an action - relevant feature circle shape in wm . This action - relevant feature may have prioritized processing of circle distractors in memorized colors in the search task, thus increasing interference with target processing and impairing performance . Our data show that action planning only modulated search performance when participants prepared a grasping movement and one of the distractors was in a memorized color . This suggests that only when both circle prioritization by action - planning and color prioritization by wm maintenance coincided did attentional capture by the color singleton particularly impair search performance . This is strong evidence for a common mechanism underlying selective attention, wm, and action planning . The present results thus add to the previous literature showing that action planning is a rather dominant source of top - down control in selection and not only can modulate attention deployment but also can interact with wm content . Even though nine hues had to be distinguished within one color category, participants correctly remembered the hue in ~71% of the cases (chance level 1/3). If the ability to discriminate hues was as good for color distractors as for memory probes, one would expect no distraction away from the target as the color singleton never exactly matched the hue of the memorized color . However, hues within the same color category induced a significant increase in target search time compared to a neutral color category . This indicates that, whereas participants were able to keep a relatively precise representation of the memory item in wm, a much broader variety of hues, actually the entire color category, was able to involuntarily capture attention . Perception of similar hues as one color category is a basic mechanism of the visual system [60, 61] and is, for example, crucial to perceive a constant surface under varying lighting conditions . In the present study, whether hues were perceived as belonging to one category or not might have been due to varying time pressure or processing strategies . For example, observers may have been biased towards the entire wm - relevant color category under the time pressure of the search task (rt was stressed for the search task) that did not allow the visual system to differentiate between hues . When the memory probe was shown in the end of a trial, however, observers were able to make more precise color judgments (precision was stressed for the memory task). Moreover, the visual system may have relied on color categories when no explicit incentive to differentiate between hues was present (such as for task - irrelevant distractors during search); thus attention was biased towards the entire category . This may in fact be an adaptive strategy of the visual system to cope with the invariance of physical features in real world settings . For example, color constancy describes the effect that observers perceive the color of an object constant even though the exact wavelength may change drastically as a function of environmental variables such as illumination, perspective, shading, and distance [63, 64]. More recently it was found that attention deployment can be biased towards perceptual categories that typically share very few low - level features, even when this is detrimental to performance . The present results may provide an example in which attention deployment is biased towards a color category even though only one subset of that category (a specific hue) was task - relevant . A strategy to more thoroughly process colors, however, might have been used when observers had the incentive to correctly identify one hue among similar ones (such as for the memory probe). This notion is in line with findings suggesting that how prominent the effect of color category on hue perception is relies on various factors such as the specific task, cognitive demands, and strategies of the observer . In the present study it should be noted that some studies suggest that longer response times for distractor - present trials in additional singleton paradigms are due to nonspatial filtering costs [4245] whereas other studies suggest they are due to attentional capture by the distractor [39, 4648]. One reason for the diverging results may be that singletons only capture attention when they match the observer's goal . Although the present study cannot contribute to answering this open question, we assume that in the present study attentional capture accounts for the longer response times for distractor - present trials . Even though color distractors never matched the target category, they did match the wm content, namely, in the memorized color condition . As it was the observers' goal to maintain items in wm, attentional capture by items matching wm content may therefore be considered attentional capture due to matching of the observer's goal . In line with this, in a study using a similar paradigm as the present study, an n2pc component contralateral to the memory - matching distractor (i.e., a distractor negativity) was found, suggesting that indeed stimuli sharing features of wm content capture attention . To sum up, the present results showed that action planning not only determines the way we perceive our visual environment but also determines how working memory (wm) drives attention deployment . Observers were distracted from target search when a salient color item was presented concurrently to the target . This distraction was more pronounced when the colored item was related to a color held in wm, indicating attention guidance by wm content . Preparing a grasping movement enhanced wm guided attention deployment . We conclude that target templates, action plans, and wm maintenance have common underlying mechanisms and compete for processing capacity.
|
Though aortic dissection is very rare in young children,1) this abnormality is certainly recognized, particularly in those with congenital heart disease, connective tissue disorders, or severe trauma.2) early diagnosis and treatment is crucial for this life - threatening abnormality.3) aortic dissection type b is defined as the appearance of a false lumen at the segment distal to the left subclavian artery . This type of dissection occasionally extends toward the descending thoracic aorta and the abdominal aorta . Fatal complications of type b aortic dissection include rupture of the thoracic aorta, leg ischemia, visceral ischemia, and renal failure.1 - 4) most frequently the presenting complaint is severe pain, and the report of the pain migrating is the most important clue for diagnosis.5) an 11-year - old boy presented to the emergency department with severe chest pain that started while he was swimming at school, 30 minutes prior to presentation . This sudden onset of chest pain was the initial event, and was associated with shortness of breath and diaphoresis . The patient was obese, weighing 59 kg, over the 95th percentile for age . The patient took medications, including an angiotensin converting enzyme - inhibitor and corticosteroids for the past three years, and antithrombotics for the past four months . The heart rate was 120/minute, the initial blood pressure (bp) was high, 150/90 mmhg in both arms, the respiration rate was 25/minute, and the body temperature was 36.8. laboratory testing revealed a hemoglobin of 13.4 g / dl; a platelet count of 446,000/ul; cardiac enzymes and serum electrolytes including na, k, ca, phosphate were all normal . 1). The trans - thoracic echocardiography revealed a normal cardiac structure with normal systolic and diastolic function . To decrease the high bp and rapid heart rate, an iv beta - blocker was infused . The bp and heart rate, the sharp chest pain persisted at the mid - sternum and extended to the abdomen . Thus an aortic dissection was suspected and emergency computed tomography (ct) scanning of the chest and abdomen was performed . The diagnosis of aortic dissection was established by ct imaging from the visualization of a torn intimal flap noted from the left subclavian artery to the left common iliac artery (fig . There was impending luminal obstruction of the left iliac artery due to the extension of the dissection (fig . Treatment with intravenous esmolol and nitroprusside was started in the intensive care unit and his bp improved to 120/75 mmhg, the heart rate was normalized to 75/minute, and the chest pain was controlled with an intravenous morphine infusion . The patient was sent to surgery immediately . While waiting for the emergency operation, the eyes deviated and seizures developed with loss of consciousness . A chest x - ray, taken immediately, demonstrated left lung haziness (fig . An aortic dissection is a condition with many predisposing factors, and rarely occurs in children or adolescents . Fikar reported a retrospective analysis of aortic dissection and found that 22% of young children and adolescent patients had no apparent risk factors.1) this fatal abnormality certainly does occurs in young populations, particularly those with congenital heart disease, connective tissue disorders or severe trauma2); congenital cardiovascular disorders are the most common related conditions and trauma - associated aortic dissection is considered a relatively rare event.1) aortic dissection is a life - threatening condition that requires rapid diagnosis and treatment.3) fikar reported that aortic dissections occur in less than 3.5% of the population, with a mortality of 0.035% in the young, under 19 years of age.4)5) the mortality rate of untreated aortic dissection rises by 1 - 2% hourly for the first 48 hours from symptom onset . Early surgery is associated with a better outcome.4) in addition, evaluation of predisposing conditions is important . Coarctation of the aorta and congenital aortic valve stenosis with bicuspid or quadricuspid aortic valves are the most common predisposing cardiovascular anomalies of aortic dissection . Marfan's syndrome, type iv ehlers danlos syndrome, and turner's syndrome, are connective tissue disorders that are non - cardiac causes of aortic dissection . These disorders usually have clear physical stigmata associated and are inherited in an autosomal dominant fashion.4) when it occurs in youth, aortic dissection usually arises during the adolescent period rather than childhood.6) in young children, rarer causes of aortic dissection have been reported, such as: trauma, cocaine abuse, and weight lifting.4) the most frequent presenting symptom of aortic dissection is severe pain (85 - 95%), the initial site of which varies, and frequently migrates in 60 - 80% to the exact site of extension of the dissection . Chest pain can involve the anterior and posterior chest wall, neck, jaw, shoulder, abdomen or extremities . Neurological symptoms affect 15 - 45% of patients; with confusion, weakness, and dysesthesias.5) high bp is an important distinctive finding when comparing children with adults, as hypertension is rare in children.2)4) in this child's case, there are a few factors which may have contributed to the lack of prior symptoms . Steroid medication taken during the previous three years for treatment of iga nephropathy might have masked the development of hypertension . Also, the steroid treatment probably had an influence on the disintegration of the connective tissue of the media; as for the cystic medial degeneration, it might have progressed and been associated with the development of hypertension.7) in addition, this child was obese, weighing 59 kg, over the 95th percentile for his age . In this particular case, the aortic dissection might have been related to the masked hypertension . In addition, the obesity (weight> 95% for his age) might have been a causal factor of the hypertension.7) there were no findings to suggest a connective tissue disorder . The aortic dissection was likely associated with obesity and hypertension, and aggravated by strenuous exercise (swimming), which led to the fatal event . Hatzaras et al.8) reported in 2007 that strenuous physical activity and severe emotional stress were clear precipitating factors of the acute onset of the thoracic pain of acute aortic dissection . Thus, severe physical and emotional stress may precipitate aortic dissection, presumably on the basis of a transient, severe hypertensive reaction . Strenuous physical activities include lifting weights, swimming, and shoveling snow.8) edwin, in 2010, reported that swimming could precipitate acute aortic dissection in the absence of any predisposing factors; possibly this child's swimming triggered the arterial dissection, as reported previously.9) the chest x - ray of an aortic dissection is not always specific for the aortic shadow . However, mediastinal widening, pleural effusion, abnormal aortic contour and cardiomegaly can be seen.4)5) even though the patient had a normal chest x - ray, an aortic dissection was not excluded.11) aortography, magnetic resonance imaging, or echocardiography are helpful, but the ct scan is the first - choice diagnostic modality . Transesophageal echocardiography is known to be highly sensitive and specific for detection of intimal flap aortic dissection as well and it is therefore regarded as the imaging modality of choice at some cardiovascular centers.4) it can also identify pericardial effusions, aortic insufficiency, and compromise of the coronary arteries; in addition it can be performed at the bedside in the emergency room . Aortic dissection is categorized as two types: type a involves the ascending aorta, and type b has restricted involvement within the aorta distal to the left subclavian artery.11) type b aortic dissection frequently precedes aneurysm formation and late rupture . Moreover, type b aortic dissection is usually associated with hypertension . In this case, though, there was no documented history of hypertension before the fatal event, nor were there symptoms or signs of hypertension . The aortic dissection might still have been associated with the hypertension, triggered by strenuous exercise (swimming). In general, patients with aortic dissection may present with severe chest and back pain, leg ischemia, and lower - extremity neurological symptoms.12) in these cases, medical therapy could be recommended for uncomplicated type b aortic dissection . The first goal in medical treatment of an aortic dissection is to maintain the bp and heart rate.13) surgery is necessary for type a dissection or type b dissection with impending rupture, rapid progression of symptoms, or risk of abnormal perfusion of vital organs.14 - 20) the various aortic diseases which lead to dissection or rupture, cardiomyopathy, coronary anomalies, obstructive coronary artery disease, valvular disease, and myocarditis, are among the most common causes of cardiovascular deaths in the young.19) many sudden deaths in the young occur during or shortly after exercise.19) clinical suspicion of aortic dissection in children is based on the history of pain, which can be migratory . A normal chest x - ray cannot rule out the diagnosis of an aortic dissection; this grave condition can easily slip under the list of differentials when diagnosing children and adolescents . In conclusion, physicians working in an acute care setting, particularly in the emergency room, should be aware of the disorders and clinical characteristics predisposing patients to an acute aortic dissection, even in children and adolescents.4)
|
Among technical errors which might cause misinterpretation of the us image of the examined focal lesion one can number inter alia artifacts resulting from the volumetric averaging in near and far field . An artifact in the near field can result in lesions localized at depths up to 10 mm not being visualized and small hypoechogenic cancers with hyperechogenic halo may be presented as hypoechogenic lesions . In order to eliminate this type of artifact, use a standoff pad or thick layer of gel is recommended . With particularly large breasts volumetric averaging artifacts in the far field result from the averaging of cyst echogenicity with normal tissues echogenicity localized at the same depth . As a result complex cyst (arrow) of uncircumscribed margin, with acoustic shadow behind the lesion, insusceptible to compression, mimicking solid lesion birads - usg 4 inappropriate setting of general enhancement or time gain curve (tgc) can have an influence on incorrect differentiation of focal lesions, e.g. Neoplastic lesions and cysts . They should be set so that fat tissue echogenicity is identical in preglandular, glandular and post - glandular zone . Otherwise fat tissue echogenicity differences at different depths can lead to an incorrect assessment of focal lesion echogenicity, which is assessed in relations to fat tissue (fig . 4). Hyperechogenic focal lesion in relation to fat tissue, of identical echogenicity in particular zones the appropriate range of the ultrasound beam should include the chest wall . To improve penetration, an increase in general beam enhancement and/or compression force on the examined breast can be used . In the case of large breasts, breasts during lactation, breast inflammation, inflammatory cancer or breasts with radiation lesions, the number of errors can be decreased using a linear transducer of lower frequency, e.g. 5 mhz . The last group of technical artifacts are artifacts present in cysts or dilated lactiferous ducts; they include reverberations, comet tail artifacts and lateral beam artifacts (fig . Transducer head rotation or its slope, the use of harmonic imaging or real time compound imaging may be useful . These can be divided into: false negative results where the assessed lesion is incorrectly identified as too low category in birads - usg classification relative to the histologic verification;false positive results where the assessed lesion is identified as to too high category in birads - usg classification relative to the histologic verification . False negative results where the assessed lesion is incorrectly identified as too low category in birads - usg classification relative to the histologic verification; false positive results where the assessed lesion is identified as to too high category in birads - usg classification relative to the histologic verification . This can result from: the similarity of some benign lesions and normal breast structures to malignant neoplastic lesions (false positive results);the similarity of some malignant lesions to normal breast structures or benign lesions (false negative results);the characteristics of some breast diseases, with the absence of focal lesion (both false negative and false positive results);lack of visualization of the lesion by the examiner (false negative results);technical aspects (false positive and false negative results). The similarity of some benign lesions and normal breast structures to malignant neoplastic lesions (false positive results); the similarity of some malignant lesions to normal breast structures or benign lesions (false negative results); the characteristics of some breast diseases, with the absence of focal lesion (both false negative and false positive results); lack of visualization of the lesion by the examiner (false negative results); technical aspects (false positive and false negative results). False negative results the example can be focal lesions of malignant carcinomas which can mimic normal breast structures or benign lesions, e.g. Ductal carcinoma in situ, invasive ductal carcinoma of high grade of histopathological malignancy, mucinous carcinomas, medullary carcinomas, metastases to breasts and also carcinomas in cysts and papillary carcinomas . Papillary neoplastic lesions may mimic benign papillomas and other benign hyperplasias (in the assessment of their character and in identifying their birads category one should take into account their size, localization and ultrasound structure) (fig . Ductal carcinoma in situ (dcis) presenting itself in the us examination as dilated lactiferous duct with dense contents, insusceptible to compression, circumscribed margin of the walls birads - usg 3 in order to avoid incorrect diagnoses, one should use as many techniques enabling lesion character differentiation as possible, such as harmonic imaging, vascularization pattern assessment, compressivity in conventional imaging and in sonoelastography . This last method is particularly useful in the differentiation of focal lesions (including invasive carcinomas) from fat lobules which undergoes greater deformability in comparison with solid lesions . Fat lobules may be incorrectly interpreted as solid lesions birads 3 or birads 4 or some malignant neoplastic lesions if they have decreased echogenicity or have uncircumscribed margins in us examination . False positive results identifying benign lesions and normal structures incorrectly as malignant neoplasms results most often from alack of knowledge of anatomy and the changes related to the regression of the lobules and stromal fibers of breasts resulting from aging (that is the ratio of glandular and fat tissue in the breast). In the us image hypoechogenic areas mimicking focal lesions are visible, which are in fact fat tissue (fig . 7). In such situations a series of sections should be done in order to confirm or eliminate the connection of the lesion with the surrounding fat tissue . Conversely, complex fibroadenomas, sclerosing, giving acoustic shadow or having angular edges are often classified to birads 4 category, although in the majority of cases they are benign (fig . 8). At the present stage of technological ultrasound development similarly, it is impossible to distinguish between papillary neoplasm hyperplasias in the cyst lumen and papillary metaplasia . Doppler assessment of lesion vascularization helps to identify birads category (4 or 5), in which carcinomas and intercystic papillomas usually have a vascular stem (fig . B. the same lesion in a different section has the connection with surrounding fat tissue (arrows) solid, hypoechogenic lesion, oval, of uncircumscribed margin, blue in elastogramme (as in lesion insusceptible to deformation). Examination: fibroadenoma with sclerosing hyperechogenic solid lesion localized intraductally, with visible vascular stem, insusceptible to compression, in patient with high risk nipple discharge . In histopathological examination: papilloma in this group of false positive diagnoses there are also architecture disorders and lesions giving acoustic shadows such as fat tissue necrosis, adenosis sclerosans, scars after surgical procedures, biopsies, radial scar or focal fibrosis (fig . Hypoechogenic glandular tissue architecture distortion of spicular margins, with acoustic shadow (arrow). Biradsusg 5 . In histopathological examination: focal fibrosis fat tissue necrosis demands special attention; depending on the reason and duration it may look like a simple cyst, complex cyst or solid lump . In later stages of the disease there are angular edges giving an acoustic shadow which resembles the us image of a cancer with desmoplastic reaction . In order to differentiate, one should asses the vascularization of the lesion fat tissue will not exhibit the features of the flow presence, it will undergo compression and in elastogrammes it will show the soft lesion pattern (fig . 11). In the case of postoperative scars or after biopsies, the differentiating element is the medical history . In cases of negative history, these lesions are classified as birads - usg 4 or 5 and demand histopathological verification . B. in elastogramme homogenous lesion, of blue color (deformation susceptible lesion pattern), of the average value e = 13 kpa . In cytological examination fat tissue the last group of cases, both false negative and false positive, are lesions which do not form an image of a focal lesion . Among this group of false negative lesions one can number malignant neoplasms such as carcinomas in situ of low grade of histopathological malignancy, lobular carcinomas, early stages of other carcinomas, in particular of small size . In the case of lobular carcinomas, in which neoplastic cells bands are scattered among normal stromal cells in the us examinations, they are often visible as acoustic shadows among echogenic fibrous tissue (fig . These images are highly unspecific and may occur in benign and malignant hyperplasia . Because in such cases mammography examination (mmg) has a limited sensitivity, histopathological verification should be performed . False positive lesions which do not form focal changes also include fibrocystic dysplasia, post - traumatic, postoperative, post - radiation lesions or fat tissue necrosis . Solid hypoechogenic lesion with prevalence of superiorinferior dimension over latero - lateral dimension, giving acoustic shadow, in color doppler with pathological vessels, with hyperechogenic halo before the us examination, the doctor should perform a medical history and physical breast examination, he should also refer to previous imaging examinations performed (fig . 13).a us examination performed according to the polish ultrasound society breast examination standards (fig . 14).treating each pathological focal lesion or lesion in lactiferous ducts visualized in us examination which does not fulfill the criteria of a benign lesion, as suspected of malignant character until the final histopathological diagnosis (fig . 15).very careful analysis of the visualized focal lesions in breasts, both clinical (palpable) and subclinical (below 5 mm in diameter); small focal lesions in breasts usually do not have the typical morphology of a benign or a malignant lesion (fig . 16).obeying the rule that each focal change in breast in birads - usg 4 and 5 category is confirmed by microscope examination (fnab, cb) (fig . 17), whereas in birads - usg 3 category it is possible to perform fnab or refer the patient to a control examination in 6 months.very careful ultrasound examination of breasts with cystic changes, particularly multiple, which can cover small foci of breast cancer (fig . Referring for further diagnostics of all fluid - filled lesions in breasts which do not fulfill classical criteria of breast cysts (that is birads - usg 2).precise ultrasound examination in women who have reported in medical history or currently have bloody discharge from the nipple, with its cytological assessment (fig . 19).very careful performance of breast ultrasound examination in women with a predominance of glandular tissue with normal result of mammographic examination . In such cases many small, solid focal lesions which might be breast cancer are not visualized in mmg (fig . 20).very careful performance of the ultrasound examination of glandular breasts with features of a significant degree of remodeling by stromal tissues . Biopsy, mammography, magnetic resonance mammography and systematic 6 monthly control us examination.the use of a standoff pad or great amount of gel in breast focal lesions localized superficially in order to optimize the image (fig . 22).careful performance of the ultrasound examination in women after mastectomy because of breast cancer and after breast conserving therapy one should remember that they have an increased risk of breast cancer morbidity in the second breast or a recurrence incidence (fig . 23).careful performance of the examination in women after breast focal lesion excision . The scar after surgical procedure in us examination may be similar to focal malignant lesion (fig . 24).a group particularly exposed to more frequent breast cancer incidence are women with familial breast cancer . From the moment of receiving this information they should be included in the program of prophylactic breast cancer examinations . In high and very high risk groups of breast cancer morbidity one should perform alternate mmg examination and magnetic resonance examination every 6 months complemented by the us examination of breasts every 12 months.in all doubtful and diagnostically difficult cases one should consult other doctors in more specialized centers.the diagnoses should be systematically verified and one's diagnostic mistakes should be analyzed . Before the us examination, the doctor should perform a medical history and physical breast examination, he should also refer to previous imaging examinations performed (fig . A us examination performed according to the polish ultrasound society breast examination standards (fig . 14). Treating each pathological focal lesion or lesion in lactiferous ducts visualized in us examination which does not fulfill the criteria of a benign lesion, as suspected of malignant character until the final histopathological diagnosis (fig . Very careful analysis of the visualized focal lesions in breasts, both clinical (palpable) and subclinical (below 5 mm in diameter); small focal lesions in breasts usually do not have the typical morphology of a benign or a malignant lesion (fig . 16). Obeying the rule that each focal change in breast in birads - usg 4 and 5 category is confirmed by microscope examination (fnab, cb) (fig . 17), whereas in birads - usg 3 category it is possible to perform fnab or refer the patient to a control examination in 6 months . Very careful ultrasound examination of breasts with cystic changes, particularly multiple, which can cover small foci of breast cancer (fig . Referring for further diagnostics of all fluid - filled lesions in breasts which do not fulfill classical criteria of breast cysts (that is birads - usg 2). Precise ultrasound examination in women who have reported in medical history or currently have bloody discharge from the nipple, with its cytological assessment (fig . Very careful performance of breast ultrasound examination in women with a predominance of glandular tissue with normal result of mammographic examination . In such cases many small, solid focal lesions which might be breast cancer are not visualized in mmg (fig . . Very careful performance of the ultrasound examination of glandular breasts with features of a significant degree of remodeling by stromal tissues . The use of a standoff pad or great amount of gel in breast focal lesions localized superficially in order to optimize the image (fig . Careful performance of the ultrasound examination in women after mastectomy because of breast cancer and after breast conserving therapy one should remember that they have an increased risk of breast cancer morbidity in the second breast or a recurrence incidence (fig . The scar after surgical procedure in us examination may be similar to focal malignant lesion (fig . A group particularly exposed to more frequent breast cancer incidence are women with familial breast cancer . From the moment of receiving this information they should be included in the program of prophylactic breast cancer examinations . In high and very high risk groups of breast cancer morbidity one should perform alternate mmg examination and magnetic resonance examination every 6 months complemented by the us examination of breasts every 12 months . In all doubtful and diagnostically difficult cases classical us image as for a malignant lesion in the breast of 50 years old woman who had mammography performed in which no potentially malignant lesions were stated . The breast with predominance of glandular tissue segmentally dilated lobular lactiferous duct with tissue echoes (arrows). In fnab ductal carcinoma in situ breast cyst with tissue echoes in its lumen (arrow). These echoes did not change their localization after the change of breast position during examination . Final diagnosis: papilloma in the cyst the first us examination in 37 years old woman who experienced repeated breast soreness in consecutive menstrual cycles . Focal lesion in glandular tissue of the diameter of 6 mm (arrows). In fnab examination: glandular cancer pathological focal lesion in breast (arrows). In the us examination the pattern as for a benign lesion . Histopathological diagnosis: medullary breast cancer focal lesion in breast of the diameter of 5 mm (arrow) among cysts . In histopathological examination: invasive ductal breast cancer intraductal breast papilloma (arrow). In medical history reported bleeding from the nipple 1 month prior the us examination small, 7 mm in diameter, invasive ductal cancer of breast (arrow) in 45 years old woman with volumetric predominance of glandular tissue, who in previously performed mammography did not have any lesion suspected of malignancy a. glandular breast cancer (arrows). B. area of increased remodeling of glandular tissue by stroma (arrows) breast skin fibroma (arrow), the examination was performed with a standoff pad . Us image of breast skin is indicated by small arrows breast cancer recurrence (arrow) in woman with breasts of glandular structure . The recurrence was diagnosed 8 months after quadrantectomy performed because of invasive ductal cancer scar in the breast (arrows) after fibroadenoma excision
|
Matrix tablets offer a great potential as oral drug delivery system due to their simplicity, cost effectiveness, reduced risk of systemic toxicity, and minimal chance of dose dumping [1, 2]. They exclude complex production procedures such as coating and pelleatization during manufacturing, and drug release rate from the dosage form is controlled mainly by the type and proportion of polymer used in the preparations . Various natural and synthetic hydrophilic polymers have been used in production of matrix tablets for soluble and insoluble drugs for years [1, 47]. Hydrophilic matrices are generally made of hydrogels, which have water absorbing capacity and swell to form a gel - like structure . Swollen gel acts as a reservoir which slowly releases the drug dispersed already in the hydrogel matrices . Over the years, the use of polymer combinations as blends to prolong the drug release rate has become more popular, which may allow formulators to develop sustained release dosage forms that may show performance improvements over the individual polymer components . Among various methods of the matrix tablet preparation, direct compression method has attracted much attention due to its technological simplicity and industrial acceptability as it involves simple blending of all ingredients used in formulations followed by compression . Moreover, it requires fewer unit operations, less machinery, reduced number of personnel and reduced processing time, increased product stability, and faster production rate . Bisoprolol fumarate, chemically 1-[4-(2-isopropoxyethoxymethyl)phenoxy]-n - isopropyl-3-aminopropan-2-ol fumarate, is a cardioselective -blocker (scheme 1) without membrane stabilizing activity or intrinsic sympathomimetic activity [10, 11]. It is almost completely absorbed from the gastrointestinal tract and undergoes minimal first - pass metabolism resulting in an oral bioavailability of about 90% . However, multiple dosing of various conventional immediate release tablets is necessary to maintaine desired therapeutic level . Hence, sustained release formulations of bisoprolol fumarate could be beneficial to reduce the dosing frequency with improved patient compliance . In the development of any pharmaceutical formulation like matrix tablet for sustained release ability, an important issue is to design a formulation with optimized quality in a short time period and minimum number of trials . The response surface methodology has been commonly used for designing and optimization of different pharmaceutical formulations, which requires minimum experimentation [12, 13]. Thus, it is less time - consuming and cost - effective than the conventional methods of formulating dosage forms . Based on the design of experiments, response surface methodology encompasses the generation of polynomial equations and of the response over the experimental domain to determine the optimum formulation(s). The objective of the current investigation was to develop bisoprolol fumarate sustained release matrix tablet containing a hydrophilic polymer - blend of calcium alginate, hydroxypropyl methylcellulose (hpmc k4 m), and carbopol 943 by direct compression method using response surface methodology . A computer - aided optimization technique using 2 (three - factor and two - level) factorial design was employed to investigate the effect of the amounts of various hydrophilic polymers, namely, calcium alginate, hpmc k4 m, and carbopol 943 in polymer - blend used as three independent process variables (factors), on the properties of bisoprolol fumarate sustained release matrix tablets like drug release and hardness . Bisoprolol fumarate, microcrystalline cellulose (ph 101), and lactose were obtained from b. s. traders pvt . Ltd ., calcium alginate, hydroxypropyl methylcellulose (hpmc k4 m), and carbopol 943 were purchased from merck specialties pvt . Bisoprolol fumarate matrix tablets were prepared by the direct compression method after proper mixing of suitable ratios of various hydrophilic polymers as release modifiers with others excipients . The drug, polymers, and other excipients were first passed through sieve #80 . Then drug and all the materials were uniformly mixed and compressed on single punch tablet machine (cadmach machinery co. pvt . Ltd ., india) using 6 mm round and flat punches (for batch size 100 tablets). 2 (three - factor and two - level) the amount of hydrophilic polymers in polymer - blend, namely, amount of calcium alginate (a), hpmc k4 m (b), and carbopol 943 (c) as the prime selected independent variables (factors), which were varied at two levels (low and high). Different trial formulations of bisoprolol fumarate matrix tablets were prepared according to the trial proposal of 2 factorial design . The cumulative drug release after 6 hours (r6h,%) and hardness (kg / cm) was investigated as dependent variable (responses). The matrix of the design including investigated factors and responses is shown in table 2 . For optimization, the effects of independent variables upon the responses were modeled using the following first - order polynomial equations involving independent variables and their interactions for various measured responses, studied in this investigation . For optimization, effects of various independent variables upon measured responses were modeled using following mathematical model equation involving independent variables and their interactions for various measured responses generated by 2 factorial design is as follows: (1)y = b0+b1a+b2b+b3c+b4ab+b5ac+b6bc, where y is the dependent variable, while bo is the intercept; b1, b2, b3, b4, b5, b6, and b7 are regression coefficients; a, b and c are independable variables and ab, ac, and bc are interactions between variables . One - way anova was applied to estimate the significance of the model (p <0.05) and individual response parameters . The powder equivalent to 20 mg of bisoprolol fumarate was taken and transferred to 100 ml of volumetric flask . Then, the volume was made up to 100 ml with 0.1 n hcl . After proper dilution, absorbance values were measured at the maximum wavelength (max) using a uv - vis spectrophotometer (thermo spectronic uv-1, usa) at 224 nm . Tewenty tablets from each batch were sampled and accurately weighed using an electronic analytical balance . The weight variation (%) was calculated as (2)weight variation (%) = standard deviationmean weight100 . The tablets were first kept in between two jaws after adjusting the tester to zero, a force was applied until the tablet breaks into fragments, and the reading was noted from the scale, which indicated the pressure required in kg . In vitro drug release studies were performed in usp dissolution apparatus, basket type (campbell electronics, india), at 50 rpm maintained at 37 0.5c . The dissolution mediums used were 900 ml of 0.1 n hcl (ph 1.2) for the first 2 hours and then 900 ml of phosphate buffer (ph 7.4) for next hours . The 5 ml of aliquots was withdrawn from the dissolution vessel at specific time intervals and replaced with equivalent volume of fresh medium . 40) and then used for determination of bisoprolol fumarate spectrophotometrically using a uv - vis spectrophotometer (thermo spectronic uv-1, usa) at 224 nm . To analyze the mechanism of drug release from these bisoprolol fumarate matrix tablets, the in vitro dissolution data were fitted to various mathematical models like zero - order, first - order, higuchi, and korsmeyer - peppas models [1417]. Zero - order model: f = k0 t, where f represents the fraction of drug released in time t, and k0 is the apparent release rate constant or zero - order release constant . First - order model: ln(1 f) = k1stt, where f represents the fraction of drug released in time t and k1 is the first - order release constant . Higuchi model: f = kht, where f represents the fraction of drug released in time t, and kh is the higuchi dissolution constant . Korsmeyer - peppas model: f = kpt, where f represents the fraction of drug released in time t, kp is the rate constant and n is the release exponent; this indicates the drug release mechanism . Again, the korsmeyer - peppas model has been employed in the in vitro drug release behavior analysis of various pharmaceutical formulations to distinguish between various release mechanisms: fickian release (diffusion - controlled release), non - fickian release (anomalous transport), and case - ii transport (relaxation - controlled release). When n 1.0, it is case - ii transport and this involves polymer dissolution and polymeric chain enlargement or relaxation . Statistical optimization was performed using design - expert 8.0.6.1 software (stat - ease inc . Traditionally, pharmaceutical formulators develop various formulations by changing one variable at a time, and the method is time - consuming . However, many experiments, not succeed in their purpose because they are not properly thought out and designed, and even the best data analysis cannot compensate lack of planning . Therefore, it is essential to understand the influence of formulation variables on the quality of formulations with a minimal number of experimental trials and subsequent selection of formulation variables to develop an optimized formulation using established statistical tools for optimization . A total of 8 trial formulations of bisoprolol fumarate matrix tablets were proposed by the 2 factorial design for three independent variables: amounts of calcium alginate (a, mg), hpmc k4 m (b, mg), and carbopol 943 (c, mg), which were varied at two different levels (high and low). The effects of these independent variables on cumulative drug release after 6 hours (r6h), percentage and hardness, kg / cm, were investigated as optimization response parameters in the current investigation . According to the 2 factorial design, various trial formulations of bisoprolol fumarate matrix tablets were prepared by direct compression method using ingredients stated in table 1 . The results of the anova indicated that these models were significant for all response parameters (table 3). The design - expert 8.0.6.1 software provided suitable polynomial model equations involving individual main factors and interaction factors after fitting these data . (3)r6h(%)=84.370.64a0.87b0.78c+6.5 103 ab+1.1102ac+9.4103bc,[r2=0.9999; f - value=2714.99; p<0.05]. The model equation relating hardness as response became: (4)hardness (kg / cm2) = 2.84 + 0.02a+7.87103b + 0.05c+2.50104ab1.08 103ac1.12104bc [r2=0.9996; f - value=454.17; p<0.05]. Model simplification was carried out by eliminating nonsignificant terms (p> 0.05) in model equations resulting from the multiple regression analysis, giving (5)r6h(%)=84.370.64a0.87b0.78c + 9.4103bc, hardness (kg / cm2)=2.84 + 0.02a+7.87103b + 0.05c1.08103ac . Each response coefficient was studied for its statistical significance by pareto charts as shown in figures 1 and 2 . Coefficients with t values of effects above the bonferroni line are designated as significant coefficients coefficients with t values of effects between bonferroni line and t limit line are termed as coefficients likely to be significant; coefficients with t values of effects below the t limit line are statistically insignificant coefficients . Therefore, these pareto charts supported also the anova results for the model simplification by eliminating nonsignificant terms (p> 0.05) in both the model equations . The influences of main effects (factors) on responses investigated (here, r6h,% and hardness, kg / cm) were further elucidated by response surface methodology . Response surface methodology is a widely proficient approach in the development and optimization of drug delivery devices . Three - dimensional response surface plots and their corresponding contour plots to estimate the effects of the independent variables (factors) on each response investigated were presented in figures 3, 4, 5, 6, 7, and 8 . The three - dimensional response surface plot is very useful in learning about the main and interaction effects of the independent variables (factors), whereas two - dimensional contour plot gives a visual representation of values of the response . The three - dimensional response surface plots and corresponding contour plots relating r6h and hardness indicate the deceased values of r6h and increased values of hardness with the increment of all three independent variables (amounts of calcium alginate, hpmc k4 m, and carbopol 943 in bisoprolol fumarate matrix tablets). A numerical optimization technique based on the desirability approaches the desirable range of these responses was restricted to 40r6h 60% and 4 hardness 5 kg / cm, whereas the ranges of factors were restricted to 15 a 20 mg, 30 b 35 mg, and 30 c 35 mg . In order to evaluate the optimization capability of these models generated according to the results of 2 factorial design, optimized bisoprolol matrix tablets were prepared by direct compression method using one of the selected optimal process variable settings proposed by the experimental design . The selected optimal process variable settings used for the formulation of optimized bisoprolol matrix tablets were a = 15.28 mg, b = 32.12 mg, and c = 30.31 mg . The numerical analysis was performed to acquire the optimal values of responses based on desirability criterion by the help of design expert 8.0.6.1 software, which led to develop optimized bisoprolol fumarate matrix tablets (fo). Table 4 depicts the results of predicted values obtained from the mathematical model and practically observed (actual value). The optimized bisoprolol fumarate matrix tablets (f - o) showed r6h of 41.61 1.97% and hardness of 4.65 0.07 kg / cm within small error values (less than 5), indicating that mathematical models achieved from the 2 factorial design were well fitted . All the bisoprolol fumarate matrix tablets contained bisoprolol fumarate within 97.99 0.85 to 99.03 0.59 (table 5). Therefore, the drug content results ascertain the presence of bisoprolol fumarate in appropriate amount in all the matrix tablets . Weight variation does serve as a pointer to good manufacturing practices (gmps) maintained by the manufacturers as well as amount of active pharmaceutical ingredients (apis) contained in the formulation . The weight variation of these tablets varied from 1.88 0.08 to 3.07 0.28%, and none of the tablets deviated by up to 5% from their mean weight (table 5). The uniform drug content and weight of the formulated bisoprolol fumarate matrix tablets indicate the uniform mixing of bisoprolol fumarate with other ingredients used . The hardness test for bisoprolol fumarate matrix tablets was done to assess the ability of tablets to withstand handling without fracturing or chipping . A force of about 4 kg / cm is the minimum requirement for a satisfactory hardness of tablets . The results of the hardness testing showed that the hardness of all these matrix tablets was within the range between 3.19 0.25 and 4.65 0.07 kg / cm (tables 2 and 4), indicating satisfactory hardness . In vitro drug release from all bisoprolol fumarate matrix tablets was in the 0.1 n hcl (ph, 1.2) for the first 2 hours and then in phosphate buffer (ph, 7.4) for the next 4 hours . All these matrix tablets containing bisoprolol fumarate showed prolonged sustained drug release over 6 hours (figure 9). The cumulative drug release from these matrix tablets after 6 hours of dissolution (r6h,%) was within the range, 41.61 1.97 to 74.62 2.36% . From the response surface analysis, it was found that the r6h values decreased with the increment of all three independent variables (amount of calcium alginate, hpmc k4 m, and carbopol 943). The higher viscosity due to increasing amount of various hydrophilic polymers used, calcium alginate, hpmc k4 m, and carbopol 943 may promote the formation of highly viscous gels upon contact with aqueous fluids of the dissolution medium, which would retard the drug release rate from these bisoprolol fumarate matrix tablets . The in vitro drug release data from various bisoprolol fumarate matrix tablets were evaluated kinetically using various mathematical models such as zero - order, first - order, higuchi, and korsmeyer - peppas models . The results of the curve fitting into these above - mentioned mathematical models are given in table 6 . When respective correlation coefficients of drug release from bisoprolol fumarate matrix tablets were compared, it was found to follow the first - order model (r = 0.9906 to 0.9953) over a period of 6 hours . The value of release exponent (n) determined from in vitro bisoprolol fumarate release data of various matrix tablets ranged from 0.56 to 0.74, indicating anomalous (non - fickian) diffusion mechanism of drug release . The anomalous diffusion mechanism of drug release demonstrates both diffusion - controlled and swelling - controlled drug release from bisoprolol fumarate matrix tablets . Bisoprolol fumarate matrix tablets for sustained release application were successfully developed by response surface methodology based on 2 factorial design . The amounts of calcium alginate, hpmc k4 m, and carbopol 943 in bisoprolol fumarate matrix tablets on the properties of bisoprolol fumarate sustained release matrix tablet like drug release and hardness were analyzed and optimized . The three - dimensional response surface plots and corresponding contour plots relating r6h and hardness indicate the deceased values of r6h and increased values of hardness with the increment of amount of calcium alginate, hpmc k4 m, and carbopol 943 . The optimized bisoprolol fumarate matrix tablets (f - o) showed r6h of 41.61 1.97% and hardness of 4.65 0.07 kg / cm . These developed optimized matrix tablets showed prolonged sustained release of bisoprolol fumarate over 12 hours, which might be beneficial over the conventional tablet to reduce the dosing frequency with improved patient compliance.
|
Emotional health is a state of emotional and psychological wellbeing in which the individual perceives his surroundings realistically, copes with routine stressors of life, is capable of interacting with others, realizes his potentials, and functions fruitfully (1). According to world health organization statistics, in addition, at least 20% of adolescents will experience some form of mental illness such as depression, suicidal behaviors or eating disorders (3). These disorders usually begin in adolescence and continue during adulthood (4, 5). Students involved in bullying behavior in schools whether as bullies (who bullied other schoolmates, but were not bullied) or as victims (who were bullied, but did not bully) or as bully victims (who both bullied and were bullied) reported more emotional impairment and psychosomatic symptoms than students not involved in bullying behavior (613). Bullying effect on adolescents extends into adulthood . Those who were victims of bullying are at increased risk of poor health, wealth, and social relationships outcomes in adulthood (14). School climate research suggested that there are several characteristics associated with positive perception of school climate such as safety and belonging, student participation and responsibility in the school life, and relationships to teachers and peers (15). School climate and school pressure have been found to be predictive of emotional health and the incidence of bullying (1618). School pressure(student feeling of great pressure to achieve due to un realistic expectations form teachers or parents) and negative perception of school climate (sense of belonging to school, perception of safety, fairness of rules, participation in making rules, feeling about school) found to be associated with negative emotional health and higher incident of bullying (1620). Interpersonal relationships with teachers and peers are part of the psychosocial school climate that affects students emotional health . Supportive relationships at school from teachers and peers are associated with better emotional health and lower incidence of bullying (11, 16, 17, 2126). The previous research studies suggested that schools, emotional health, and bullying could be related . However, the relationships between schools, emotional health, and bullying need more investigation in jordan . Therefore, the purpose of the current study was to examine the relationships between perceived school climate, school pressure and emotional health and bullying among adolescent school students in jordan . The study will answer the following research questions: what is the relationship between school related factors including (school climate, school pressure, peer support, teacher support) and student emotional health?what is the relationship between school related factors including (school climate, school pressure, peer support, teacher support) and student bullying behavior?what is the relationship between student emotional health and bullying behavior? What is the relationship between school related factors including (school climate, school pressure, peer support, teacher support) and student emotional health? What is the relationship between school related factors including (school climate, school pressure, peer support, teacher support) and student bullying behavior? In this cross sectional study, 1166 in - school adolescents in amman from 6, 7, 8, 9, and 10 grades were selected from five public and two private schools . A three - stage cluster sampling technique was used to draw the study sample . At the first level, the researcher selected school directorate that represent the public and private sectors of education randomly . Then the researcher randomly selected schools within each directorate from a list of schools that are available online by the ministry of education (27). Finally, within each selected school the researcher chose a class from each of the 6 through 10 grades randomly . Ethical approval was obtained from the research committee at the faculty of nursing, the research ethical committee at the deanship of academic research at the university of jordan, and the ministry of education ethical committee . The informed consent of the parents or legal guardians was obtained prior to data collection . A written assent was obtained from the students as well . Additionally, the school counselor accompanied researchers during data collection process to alleviate any potential psychological harm that may result from answering any of the instrument questions . Administration of the questionnaire took place in the school classroom filled within the class period for all selected classes in the same day . The health behavior in school aged children (hbsc) the hbsc questionnaire found to be a valid and reliable measure of adolescents health behavior (2830). The hbsc study conceptualizes adolescent health in multidimensional manner and creates measures that represent students emotional health and wellbeing (31). A committee of experts in community health nursing reviewed the translated questionnaire, performed back translation, validated its content, and checked its appropriateness to jordanian culture . The core contains: selected demographic questions (age, gender, family structure, father s and mother s occupation), behavioral questions relevant to major health problems (dental hygiene, eating habits, and physical activity), psychosocial aspects of health, psychosomatic complaints and subjective health . All the subscales used in this study are derived from the hbsc questionnaire . The school climate scale (with scores ranging from 6 to 30) was derived from six items, including our school is a nice place to be and i feel i belong at this school . The internal consistency (cronbach s a) for this scale was 0.76 in our study . The school pressure scale (with scores ranging from 4 to 20) consisted of four items . A sample item for this scale was my parents expect too much of me at school . This low consistency in the scale could be due to different response of our students to excess pressure from teachers and parents . Two scales were created to measure two types of school support . The peer support scale consisted of three items (with scores ranging from 3 to 15) and had an overall internal consistency of 0.73 . The teacher support scale consisted of four items (with scores ranging from 4 to 20) and had an internal consistency of 0.80 . The first scale, emotional well - being, consisted of five items with an internal consistency of 0.62 . An example of an emotional well - being item was in general, how do you feel about your life at present? The second scale, psychosomatic symptoms, was derived from eight items asking about the exhibition of a range of symptoms such as headache in the last six months . Both items asked how often the student had engaged in bullying during the school term, one item as a victim and one item as a perpetrator . The items were scored from 1 being never to 5 being several times a week . Statistical package for social sciences (spss, version 17) was used in our data analysis . In total, descriptive statistics (percentage, mean, standard deviation minimum, maximum) were used to describe demographic characteristics of study sample . Pearson correlation was used to examine the association between the following variables, school climate, school pressure, peer support, teacher support, emotional wellbeing, psychosomatic symptoms, and bullying behavior . Findings were considered statistically significant if the p value was .05 (34). Ethical approval was obtained from the research committee at the faculty of nursing, the research ethical committee at the deanship of academic research at the university of jordan, and the ministry of education ethical committee . The informed consent of the parents or legal guardians was obtained prior to data collection . A written assent was obtained from the students as well . Additionally, the school counselor accompanied researchers during data collection process to alleviate any potential psychological harm that may result from answering any of the instrument questions . Administration of the questionnaire took place in the school classroom filled within the class period for all selected classes in the same day . The health behavior in school aged children (hbsc) questionnaire was used in this cross - sectional study . The hbsc questionnaire found to be a valid and reliable measure of adolescents health behavior (2830). The hbsc study conceptualizes adolescent health in multidimensional manner and creates measures that represent students emotional health and wellbeing (31). A committee of experts in community health nursing reviewed the translated questionnaire, performed back translation, validated its content, and checked its appropriateness to jordanian culture . The core contains: selected demographic questions (age, gender, family structure, father s and mother s occupation), behavioral questions relevant to major health problems (dental hygiene, eating habits, and physical activity), psychosocial aspects of health, psychosomatic complaints and subjective health . All the subscales used in this study are derived from the hbsc questionnaire . The school climate scale (with scores ranging from 6 to 30) was derived from six items, including our school is a nice place to be and i feel i belong at this school . The internal consistency (cronbach s a) for this scale was 0.76 in our study . The school pressure scale (with scores ranging from 4 to 20) consisted of four items . A sample item for this scale was my parents expect too much of me at school . This low consistency in the scale could be due to different response of our students to excess pressure from teachers and parents . Two scales were created to measure two types of school support . The peer support scale consisted of three items (with scores ranging from 3 to 15) and had an overall internal consistency of 0.73 . The teacher support scale consisted of four items (with scores ranging from 4 to 20) and had an internal consistency of 0.80 . The first scale, emotional well - being, consisted of five items with an internal consistency of 0.62 . An example of an emotional well - being item was in general, how do you feel about your life at present? The second scale, psychosomatic symptoms, was derived from eight items asking about the exhibition of a range of symptoms such as headache in the last six months . Both items asked how often the student had engaged in bullying during the school term, one item as a victim and one item as a perpetrator . The items were scored from 1 being never to 5 being several times a week . Statistical package for social sciences (spss, version 17) was used in our data analysis . In total, descriptive statistics (percentage, mean, standard deviation minimum, maximum) were used to describe demographic characteristics of study sample . Pearson correlation was used to examine the association between the following variables, school climate, school pressure, peer support, teacher support, emotional wellbeing, psychosomatic symptoms, and bullying behavior . Findings were considered statistically significant if the p value was .05 (34). Description of characteristics of the study participants (n=1166) (table 1) considered school students of 11 to 16 years and more of old . About 72% of students clustered at 13 to 15 years of old and 52.7% were girls (n=614) and 47.3% were boys (n=552). According to participants characteristics, majority of participants mothers (93.1%, n=879) were educated and 38% (n=364) of participants fathers were having bachelor education . About 59% (n=662) of participants fathers were full time employees and performing professional work while almost 65.9% (n=754) of participants mothers were housewives . Among jordanian school students, understanding students emotional health (measured by emotional wellbeing and psychosomatic symptoms) and bullying behavior has been shown in relation to school climate, school pressure, peer support, and teacher support . Descriptively, students had similar school related influences in terms of school climate (57.619), school pressure (54.316.1), and teacher support (54.221.1). Emotional wellbeing elucidate only 43.3 index which sustain mild emotional support of students at school age . Further, substantial (37.518.6) bullying behavior has been reported among jordanian students (see table 2). Alongside with mild emotional support description of the participants (n=11166) description of school related variables and student s emotional health (emotional wellbeing and psychosomatic symptoms) and bullying behavior (n=1166) the relationships between school related factors and student s emotional health (emotional wellbeing and psychosomatic symptoms) and bullying behavior (n=1166) this section answers the study questions whether there is a relationship between schools in terms of school climate, school pressure, peer support, and teacher support and emotional health and bullying behavior (table 3). Data were analyzed using pearson correlation coefficient and categorized according to munro (35) who classified a correlation of 0.00 - 0.25 little, 0.26 - 0.49 low, 0.50 - 0.69 moderate, 0.70 - 0.89 high, and 0.90 - 1.00 very high . The significant correlation emphasizes the importance of understanding school related factors influence students emotional health and bullying behavior . Whilst school climate, teacher support, and peer support were having a relatively low significant correlation (r=0.20, r=0.22, r=0.35 respectively), school pressure had no influential relationship with emotional wellbeing . Surprisingly, in examining the relationship between psychosomatic symptoms as dependent variable and school related factors, results revealed little significant correlation between school climate, school pressure, and teacher support (r=0.15, r=0.15, r=0.12 respectively) and psychosomatic symptoms compared to no specific correlation found in relation to peer support . Results revealed that school climate, teacher support, and peer support were having relatively little correlation (r=0.25, r=0.24, r=0.22 respectively) with bullying behavior . Additional finding was a significant (p<0.001) relationship found between students emotional wellbeing and psychosomatic symptoms and bullying behavior (r=0.18, r=0.096) which denotes consistent effects between these variables . This study indicates that emotional health of students is associated with perception of school climate and bullying behavior . Data revealed significant (p<0.001) correlations between school related factors (school climate, peer support, and teacher support), and emotional health and bullying behavior among adolescent students of jordanian schools . This is congruent with freeman (16) who found that students, who reported a more positive school climate, whether accompanied by high or low levels of school pressure, are more likely to report better emotional wellbeing and lower psychosomatic symptoms . Of more interest, this suggests that student s perceptions of a more positive school climate did not seem to alter the relationships between high school pressure and their emotional health and/or bullying behavior . These relationships between school pressure, emotional health and bullying behavior seemed to be relatively inconsistent with previous studies in norway (26, 36), poland (37), and sweden (38) which have reported conclusive evidence linking the negative effects of increased school pressure on emotional health . However, we should bear in mind the relatively low internal consistency of the school pressure subscale used in this study 0.44 which is likely to mask the actual association between school pressure and student s emotional wellbeing and bullying . Nevertheless, the findings of this study do not extend such previous findings across norway, sweden, and poland, our finding support a canadian study (39) which revealed a limited influence of school pressure on both student s emotional health and their bullying behavior . It is suggested that school support does have an association with school climate and pressure and therefore create the noted relationships between the above - mentioned variables, however, it is challenging to define the specific process that links school climate and school pressure to emotional health and bullying . Significantly, it remains well documented that school support is connected to both emotional health and bullying (11, 16, 17, 2126). A further finding can be found in this study that those students, who generally reported positive perception to their school climate, also reported having higher levels of emotional wellbeing and reported being less involved with bullying behavior than other students report . The significant relation that emerged may be useful for developing interventions targeting the students as well as their school environment . For example, the stronger relationship between emotional wellbeing and bullying behavior observed in this study suggest that bullied students reported low emotional wellbeing and negative perception to their school environment than uninvolved students ., the lack of a relationship between emotional wellbeing and school pressure could indicate that school pressure is less likely to influence student s wellbeing . In this study, the significant correlation between bullying and emotional health suggested that bullied students reported complaints that are more psychosomatic and reported frequent tiredness, nervousness, sleeping problems and dizziness than none involved students . This is highlighting the importance of preventive intervention research targeting bullying behaviors not only among students but also among their teachers as well . Given the limited scope of the tool and the exploratory nature of this study, we could not identify the nature of bullying behavior among those students . To further understand the social and environmental factors associated with the student s bullying at the schools of jordan, further studies and interventional programs are needed to understand the bullying behaviors and then to create a healthy school and social environments that are intolerant with bullying . In line with school - based interventions used in norway (32) and england (40) we argue that the schools of jordan are in urgent need for a national awareness and effort toward establishing school - based interventions that target the school environment and aims to increase teachers and parents awareness about bullying . Bullied students identified are in further needs for a safe environment and for support as well as protection . Given the significance of this issue and the potential long - term negative outcomes for the bullied students, the issue of bullying and emotional health of students in jordan s school merits serious attention, both for future research and preventive intervention . First, the broadly focused aspect of the hbsc in terms of health behaviors assessment in students, as well as the lack of psychometric analysis for the arabic version of the hsbc . Another limitation is the fact that this study was cross - sectional and included only middle and high school aged students; therefore, data related to elementary school students are lacked . This study informs policy makers, health professionals, parents, teachers and school administrators of the value that a positive school climate has on students emotional health and bullying behavior . Students, who reported positive perception to their school climate, also reported having better emotional health and reported being less involved with bullying behavior than other students . This highlighting the significance of developing school - based intervention programs targeting school environment and bullying behavior . Efforts should be made to develop school polices that enhance students emotional wellbeing and prevent bullying . School counselors efforts should be increased to spread the awareness about the prevalence and the long negative consequences of poor emotional health and bullying, not only for teachers but also for students and their parents as well . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, redundancy, etc .) Have been completely observed by the authors.
|
Sarcomatoid variant of urothelial carcinoma (suvc) is rare and because of its rarity most practitioners including urologists and oncologists may not have encountered the disease . The literature on sarcomatoid variant of urothelial carcinoma has been reviewed in the ensuing paper . Sarcomatoid variant of urothelial carcinomas may generally present with specific symptoms of lower urinary tract symptoms and haematuria . Sarcomatoid carcinoma is a fairly uncommon form of carcinoma whose malignant cells have histological, cytological, or molecular properties of both epithelial tumours (carcinoma) and mesenchymal tumours (sarcoma). Eble et al . Stated that sarcomatoid variant of urothelial carcinoma should be the terminology that is used for all biphasic malignant neoplasms which exhibit morphologic and/or immunohistochemical evidence of epithelial and mesenchymal differentiation with the presence or absence of heterologous elements acknowledged in the pathology report . Lopez - beltran and associates stated that some of the patients with sarcomatoid variant of urothelial carcinoma have previous history of having been previously treated by means of radiotherapy or cyclophosphamide therapy . Lopez - beltran et al . Iterated that some of the most frequent presenting symptoms and signs of sarcomatoid variant of urothelial carcinoma include haematuria, dysuria, nocturia, acute retention of urine, and lower abdominal pain . These aforementioned symptoms would generally be related to sarcomatoid urothelial carcinoma of the urinary bladder . In view of the fact that sarcomatoid urothelial carcinoma can affect the entire urothelium, it would be said that sarcomatoid urothelial carcinoma of the ureter and renal pelvis may present as loin pain and haematuria . Lopez - beltran et al . Reported that sarcomatoid urothelial carcinoma usually presents between the ages of 50 years and 77 years and the mean age of presentation is 66 years . Black et al . Reported the incidence of sarcomatoid urothelial carcinoma to have ranged from 02% to 4.3% . The suggested incidence was confirmed in an analysis of the surveillance, epidemiology, and end results (seer) database . Wright et al . Reported that in total, 135 sarcomatoid urothelial carcinoma and 166 cases of carcinosarcoma were identified from a total of 182,283 patients with primary bladder cancer . Lopez - beltran et al . Stated that sarcomatoid variant urothelial carcinomas often on macroscopic examination are seen as polypoid with large intraluminal masses (see figure 1 which represents a nephroureterectomy specimen of a sarcomatoid variant of urothelial carcinoma encountered by the authors). Lopez - beltran et al . Stated that microscopically sarcomatoid urothelial carcinoma is composed of a urothelial, glandular, or small cell component which exhibit variable degrees of differentiation and that carcinoma in situ is found in 30% of cases of sarcomatoid variant of urothelial carcinoma and that occasionally carcinoma in situ is the only apparent epithelial component . A number of authors [2, 59] stated that a small subset of sarcomatoid variant of urothelial carcinoma of the urinary bladder and renal pelvis may exhibit a prominent myxoid stroma, a finding which may mislead the pathologist into making a diagnosis of inflammatory pseudotumour (inflammatory myofibroblastic tumour) but this is characteristically positive for anaplastic lymphoma kinase stains unlike sarcomatoid variant of urothelial carcinoma which is negative . Lopez - beltran et al . Reported in their large case series that the most common heterologous element was osteosarcoma which was followed by chondrosarcoma but in addition multiple types may be present (see figures 2; 3; 4; 5; 6 which show various microscopic features of a sarcomatoid variant of urothelial carcinoma of the renal pelvis encountered by the authors). It has been stated that immunohistochemical staining had revealed that epithelial elements react with cytokeratins; on the other hand, stromal elements react with specific markers which correspond with the type of mesenchymal differentiation (see figures 7 and 8 showing positive immunohistochemical staining with cytokeratin (mnf16) and vimentin taken from a sarcomatoid variant of urothelial carcinoma of renal pelvis encountered by the authors) [10, 11]. It has also been stated that results of molecular / genetic studies strongly argue for a common monoclonal cell origin of both the epithelial and mesenchymal components in sarcomatoid variant of urothelial carcinoma [1012]. This rare biphasic variant of urothelial carcinoma had, until recently, only been described in small case series, which had suggested a poor outcome for patients with this variant of urothelial carcinoma . Black and associates [3, 13] confirmed that patients with sarcomatoid variant of urothelial carcinoma have worse disease - specific and overall survival, even after adjusting for stage of tumour, in comparison with patients with high - grade pure urothelial cancer . No published articles have focused on treatment for sarcomatoid variant of urothelial carcinoma although one group suggested that radical cystectomy should be the preferred option of treatment for patients with stage t1 disease, rather than intravesical therapy [3, 13, 14]. The ensuing discussion details out some of the case reports and case series that have been published that relate to the presentation, investigation and diagnosis, and treatment and treatment outcomes of sarcomatoid variant of urothelial carcinoma . It has been stated that although sarcomatoid variant of urothelial carcinoma is rare, sarcomatoid carcinoma including carcinosarcoma is more common than primary sarcoma of the urinary bladder [2, 4, 6, 11, 1521]. In 2009, amin stated that more than 100 cases of sarcomatoid variant of urothelial carcinoma had been reported in the literature at that time and that a recent seer data analysis revealed that 301 cases were sarcomatoid carcinomas and carcinosarcomas among 46,515 patients (0.6%) of carcinoma of the urinary bladder . The terminology carcinosarcoma has been used by some authors, and in earlier publications, to designate tumours which had overt epithelial histology admixed with sarcomatous histology with heterologous elements . The latest world health organization (who) classification in 2004 acknowledged this controversy and endorsed the terminology sarcomatoid carcinoma as others have done [1, 20, 22]. Molecular studies by two groups of researchers [11, 12] revealed a common clonal origin for the carcinomatous and sarcomatous components, and the outcomes of tumours with and without heterologous elements are largely similar . Nevertheless, a recent study by wright et al . Revealed that data which was reported to the seer registry and analysed for outcome strictly on the basis of icd - o-3 histological code showed that sarcomatoid variant of urothelial carcinoma and carcinosarcoma patients did worse in comparison with high - grade urothelial carcinoma and, when separated, carcinosarcoma patients did worse than sarcomatoid variant of urothelial carcinoma patients . Commenting on the aforementioned database results, amin stated that a potential well - known draw - back of analysing data from large publicly reported base is that the cases are not centrally reviewed by a group of dedicated pathologists and that differing criteria and nomenclature may be used by different reporting pathologists . Some authors [20, 22] stated that there is the likelihood that as many leading centre classification schemes and papers have adopted and endorsed a unifying approach to terminology, this could have likely influenced and compounded the analysis of data which was evaluated without ascertaining if uniform criteria were used without a histological rereview of the study . Amin stated the following.the sarcomatoid areas (obvious sarcomatoid overgrowth) may merge with foci of urothelial carcinoma, squamous cell carcinoma, adenocarcinoma, or small - cell carcinoma and most commonly resemble a high - grade sarcoma, which has not been otherwise specified to have malignant fibrous histiocytoma histology.heterologous differentiation may be present . However, this has no definite prognostic significance.in decreasing order of frequency, areas of osteosarcoma, chondrosarcoma, rhabdomyosarcoma, liposarcoma, angiosarcoma, or a mixture of sarcoma histologies may be seen in sarcomatoid urothelial carcinoma.in the absence of an obvious invasive carcinoma (urothelial, glandular, small cell, and so on), in a primary spindle cell tumour of the urinary bladder, a history of prior urothelial neoplasia, coexistence of in situ disease such as urothelial carcinoma in situ or strong and relatively diffuse cytokeratin immunoreactivity would be of help in establishing the diagnosis of sarcomatoid carcinoma over a primary sarcoma . The sarcomatoid areas (obvious sarcomatoid overgrowth) may merge with foci of urothelial carcinoma, squamous cell carcinoma, adenocarcinoma, or small - cell carcinoma and most commonly resemble a high - grade sarcoma, which has not been otherwise specified to have malignant fibrous histiocytoma histology ., areas of osteosarcoma, chondrosarcoma, rhabdomyosarcoma, liposarcoma, angiosarcoma, or a mixture of sarcoma histologies may be seen in sarcomatoid urothelial carcinoma . In the absence of an obvious invasive carcinoma (urothelial, glandular, small cell, and so on), in a primary spindle cell tumour of the urinary bladder, a history of prior urothelial neoplasia, coexistence of in situ disease such as urothelial carcinoma in situ or strong and relatively diffuse cytokeratin immunoreactivity would be of help in establishing the diagnosis of sarcomatoid carcinoma over a primary sarcoma . Shah et al . Reported that earlier treatment with radiation therapy and intravesical cyclophosphamide chemotherapy and external beam radiotherapy for carcinoma of the prostate gland had been associated with sarcomatoid carcinoma of the urinary bladder . Some authors [24, 25] stated that the differential diagnosis of sarcomatoid variant of urothelial carcinoma includes benign or locally aggressive conditions and some of these conditions include: pseudosarcomatous myofibroblastic proliferations (post - operative spindle cell nodules) and pseudo - tumours (inflammatory myofibroblastic tumours) of the urinary bladder, urothelial carcinoma with chondroid or osseous metaplasia (e.g., the absence of atypical cartilage or osteoid, resp . ), primary sarcomas, mainly leiomyosarcomas . Some authors [6, 15] stated that pseudosarcomatous myofibrosarcomatous proliferations may form large mass lesions which protrude in the lumen of the urinary bladder as a polypoid tumour and/or widely involve the urinary bladder wall including the muscularis propria . High cellularity, frequent mitoses (not atypical), and necrosis together with an infiltrative growth compound the distinction with sarcomatoid carcinoma . The lesion often has a myxoid background with granulation - tissue - type vascularity, extravasated red cells, and an inflammatory infiltrate . They [6, 15] also stated that a zonal pattern of distribution, that is, more myxoid and hypocellular regions toward the surface and greater cellularity with a fibrous background toward the base, a nodular - fascitis-type appearance of the lesion, the absence of an epithelial component as well as the absence of nuclear atypia (hyperchromasia, chromatin abnormalities, and anaplasia) are key in the distinction from a malignant process . In addition, jones and young stated that a subgroup of sarcomatoid carcinomas may exhibit a more prominent myxoid background which may add to the marked diagnostic overlap and to the difficulty in distinguishing between the two entities . Amin had an anecdotal experience, which had to some degree also been commented upon in the literature, that leiomyosarcomas of the urinary bladder also have a more prominent myxoid appearance . Some authors stated that immunohistochemical studies, similar to morphology, have marked overlap in the staining characteristics between pseudosarcomatous myofibroblastic proliferations, sarcomatoid carcinoma, and leiomyosarcomas, even though they had recently observed that the use of a judicious panel of immunostaining agents (pan - cytokeratin, smooth muscle actin, desmin, alk-1, p63, ck5/6, and/or high - molecular - weight cytokeratin) interpreted strictly within the morphological context may be of some value . It has also been stated thatpseudosarcomatous myofibroblastic proliferations are usually positive for pan keratin, smooth muscle actin, desmin, and alk-1;sarcomatoid carcinomas may also stain positively for pan - cytokeratin and smooth muscle actin and rarely with desmin, but they may be distinguished by their positivity for p63, ck5/6, and high - molecular - weight cytokeratin (in 10% to 40% of cases);leiomyosarcomas are positive for actin, desmin (usually extensively), and occasionally pan - cytokeratin (usually weak or focal). They are negative for p63, ck5/6, high - molecular - weight cytokeratin, and alk-1 [15, 26]. Pseudosarcomatous myofibroblastic proliferations are usually positive for pan keratin, smooth muscle actin, desmin, and alk-1; sarcomatoid carcinomas may also stain positively for pan - cytokeratin and smooth muscle actin and rarely with desmin, but they may be distinguished by their positivity for p63, ck5/6, and high - molecular - weight cytokeratin (in 10% to 40% of cases); leiomyosarcomas are positive for actin, desmin (usually extensively), and occasionally pan - cytokeratin (usually weak or focal). They are negative for p63, ck5/6, high - molecular - weight cytokeratin, and alk-1 [15, 26]. Amin iterated that the differential immunostaining characteristics and the extent of staining of the individual markers between these three differential diagnostic considerations are important in the ultimate weight of support immunohistochemistry provides in this difficult area . Amin stated that there are no standardized clinical management protocols for sarcomatoid carcinoma and that adjuvant therapy has varied from institution to institution and the treatment paradigms may be different from the therapy for a primary sarcoma, for example, leiomyosarcoma . Black et al . Reported down staging (pt0 at cystectomy) for almost half of patients in their centre . Amin additionally stated that almost all the cases of sarcomatoid carcinomas present at a high stage; they often exhibit nodal and/or distant metastases, and they are associated with very poor prognosis . Information gained from a number of publications would indicate that an estimated 70% of patients with sarcomatoid variant of urothelial carcinoma die within 2 years of diagnosis [2, 4, 6, 11, 1621, 27]. Amin stated that in comparison with patients with urothelial carcinoma alone, patients with sarcomatoid variant of urothelial carcinoma are at a greater risk for death even after adjusting for the stage of the tumour at presentation . Arun et al . In 2008 reported a 40-year - old man who presented with abdominal mass of four months duration and haematuria of recent onset . He had a computed tomography scan which demonstrated the mass to be arising from the left kidney . He underwent cystoscopy which revealed polypoidal extension of the growth through the left ureteric orifice . Arun et al . Reiterated statements made by other authors and stated the following.sarcomatoid carcinoma is one of the rare variants of urothelial carcinoma and sarcomatoid carcinoma involving the renal pelvis is rarer still.histological differentiation from true sarcoma is difficult and immunohistochemistry is helpful in this regard.generally sarcomatoid carcinomas present at a high stage and have a poor prognosis . Sarcomatoid carcinoma is one of the rare variants of urothelial carcinoma and sarcomatoid carcinoma involving the renal pelvis is rarer still . Sarkissian and lara reported a 52-year - old man who presented with left flank pain, haematuria, nausea, vomiting, and fever . He had a past medical history of superficially invasive, low - grade papillary urothelial carcinoma and gleason 6 adenocarcinoma of prostate for which he had undergone cystoprostatectomy with ileal conduit four years earlier . Histological examination of the specimen revealed that all the margins of the specimen were clear of tumour . His investigations revealed an elevated white blood cell count (23,000) and elevated creatinine (3.8) and computed tomography scan revealed findings which were adjudged to be consistent with an abscess of the left kidney . The aetiology of this process was unclear; there was no sign of obstruction at the ureteroileal anastomosis . Macroscopic examination of the specimen revealed multiple irregular fragments of pink - tan, focally haemorrhagic partially soft, and partially firm tissue with areas consistent with necrotic renal cortex, medulla, pelvis, calyces, and perinephric fat . There was also grey - white, friable and necrotic tissue present in the morcellated fragments . Histological examination of the specimen revealed a biphasic malignant neoplasm with epithelial and sarcomatoid elements . The sarcomatous portion of the tumour consisted of sheets of malignant spindle cells with large vesicular nuclei, prominent nucleoli, and frequent mitotic figures . The tumour also had areas of frankly invasive squamous carcinoma with origin from the renal pelvis as well as low - grade papillary urothelial carcinoma . The residual renal parenchyma was extensively necrotic, and there was abscess formation and diffuse glomerular sclerosis . Immunohistochemical staining of the specimen revealed biphasic expression of the sarcomatous component with strong positivity for vimentin and focal positivity for keratin ae1/3 . Sarkissian and lara concluded that (a) high - grade transitional cell carcinoma can imitate severe purulent kidney infection, (b) this disease is characterized by an unfavourable course and poor prognosis, (c) in spite of the clinical signs of inflammatory renal disease, an underlying neoplastic disorder should always be considered, especially in patients with prior history, and (d) in uncertain cases, a quick preoperative biopsy and histological examination of the kidney are recommended . Leder and dunnick stated that malignant tumours from the urothelium of the renal pelvis account for only 5% of urinary tract neoplasms, with the most common of these being transitional cell carcinoma and squamous cell carcinoma . Cohen and johansson stated that of the tumours that arise from the renal pelvic urothelium, approximately 90% are transitional cell carcinomas . They concluded that the tumour should be diagnosed as sarcomatoid carcinoma and they should be discriminated from true . Stated that in some cases, the terminology carcinosarcoma is used as a synonym for sarcomatoid carcinoma but they are considered clearly separate entities . On the other hand, unlike sarcomatoid carcinoma, carcinosarcoma exhibits, in addition to a malignant epithelial component, specific features of mesenchymal differentiation such as chondrosarcoma, osteosarcoma, rhabdomyosarcoma, liposarcoma, or malignant fibrous histiocytoma . Some authors [16, 22, 33, 34] stated that histological distinction of sarcomatoid carcinomas from carcinosarcomas is often difficult and immunohistochemistry is a helpful diagnostic adjunct in the correct diagnosis . A number of authors [5, 32, 34, 35] had stated that sarcomatoid carcinoma of the kidney is usually a variant of renal cell carcinoma; nevertheless, transitional cell carcinoma of the renal pelvis might also assume a sarcomatoid appearance, even though this occurs only rarely . Other authors [36, 37] had stated that the sarcomatoid renal pelvic tumour should not be confused with sarcomatoid renal cell carcinoma, a high - grade malignant variant of renal parenchymal origin . Stated the following.demonstration of a transitional cell carcinoma component should be important in the differential diagnosis.the possibility of a high - grade urothelial carcinoma should always be considered in the evaluation of a tumour displaying unusual morphologic features in the renal pelvis, and attention to proper sampling as well as the use of immunohistochemical stains will be of importance to arrive at the correct diagnosis . The possibility of a high - grade urothelial carcinoma should always be considered in the evaluation of a tumour displaying unusual morphologic features in the renal pelvis, and attention to proper sampling as well as the use of immunohistochemical stains will be of importance to arrive at the correct diagnosis . Reported a 67-year - old woman who had experienced several weeks of visible haematuria with clots . She underwent elsewhere cystoscopy and transurethral resection of a urinary bladder tumour and histology of the resected tumour revealed a high - grade urothelial carcinoma of the urinary bladder with areas of sarcomatoid and neuroendocrine differentiation . She had a repeat cystoscopic biopsy from her urinary bladder and histological examination of the specimen revealed invasive high - grade urothelial carcinoma with prominent sarcomatoid and neuroendocrine elements, and invasion of the muscularis propria and the tumour was staged as t2an0 . The patient was further advised that bladder - conserving approaches were not recommended in view of the likely poor response to chemoradiation by the sarcomatoid elements, rendering radical cystectomy the standard of care . Nevertheless, the patient continued to seek bladder preservation and presented to a different hospital to discuss bladder - sparing options . At this institution she was also advised that radical cystectomy was the traditional standard of care, but it was agreed that chemoradiation was a reasonable alternative because cystectomy could be reserved for salvage operation . At this institution she denied further haematuria, increased urinary frequency, urinary urgency, urinary retention, dysuria, incontinence, anorexia, or weight loss . She stated that she was a nonsmoker but she reported a significant history of second - hand exposure to smoke . She had a past medical history of peptic ulcer and had in the past undergone appendicectomy and tonsillectomy . In this new institution, a treatment programme was developed for her, which consisted of 7 weeks of weekly radiation therapy integrated with chemotherapy, with follow - up routine cystoscopy thereafter to monitor response . Her radiation programme consisted of 36 fractions over 49 days, with a dose of 39.6 gy to the bladder and pelvic lymph nodes followed by 25.2 gy to the bladder tumour . Her chemotherapy regimen was comprised of cisplatin 35 mg / m (49 mg in 500 ml normal saline over 1 hour) at the beginning of weeks 1, 3, 5, and 7, with each cycle divided over 2 consecutive days . She was also treated with palonosetron hydrochloride 0.25 mg intravenous bolus and dexamethasone 20 mg intravenous 50 ml saline while receiving chemotherapy . She tolerated the therapy well, without interruptions and with only mild diarrhoea which improved with loperamide . Biopsies were taken from the initial location at that time and histological examination of the biopsies were negative for carcinoma . . Stated that their report demonstrated only 1 case with limited follow - up but the favourable tumour response, coupled with an improved quality of life with a native bladder, provided a strong argument for bladder preserving chemoradiation as an alternative treatment regimen for sarcomatoid variant of urothelial carcinoma of the urinary bladder . Also reaffirmed statements made by other authors that sarcomatoid carcinomas of the urinary bladder are exceedingly rare and that they are highly aggressive spindle - cell neoplasms which are usually diagnosed at an advanced stage and they have a median survival of 10 months . Iterated that radical surgery with adjuvant radiation therapy to eradicate microscopic disease is the traditional standard treatment for most sarcomas, in view of the fact that these tumours show poor response to primary radiation therapy . . Stated that the literature regarding nonsurgical therapy for these bladder tumours is scarce but one case report described a patient with metastatic sarcomatoid carcinoma of the urinary bladder who demonstrated a clinical complete remission after cisplatin and gemcitabine, and another described a complete remission pursuant to neoadjuvant chemotherapy using carboplatin and gemcitabine followed by partial cystectomy [42, 43]. Reported a 32-year - old woman with neurogenic bladder due to spina bifida who had been managed with intermittent self - catheterizations since puberty . She had transurethral resection biopsies of the tumour and histological examination of the tumour revealed muscle - invasive sarcomatoid urothelial carcinoma with carcinoma in situ of the bladder neck . She had computed tomography scan which did not show any evidence of nodal disease or distant metastasis . Microscopic examination of the specimen revealed that the tumour was a high - grade urothelial carcinoma, grade iii according to the classification of the world health organization (who) of 1973, invading the whole bladder wall and pericystic lipoid tissue (stage pt3a). A large subset of the tumour assumed spindle cell / sarcomatoid appearance with high mitotic rate and atypical mitoses . Immunohistochemical staining of the tumour revealed that the tumour cells were positive for the epithelial membrane antigen (ema), cytokeratin 18 (ck18), and vimentin . Some tumour cells were positive for cd117 (c - kit), whereas all of them were negatively stained for ck7, ck20, desmin, and cd34 . . Stated that the aforementioned histologic and immunohistochemical evidence of both epithelial and mesenchymal differentiation would classify this tumour as sarcomatoid variant of urothelial carcinoma without heterologous elements . The patient had completed 4 cycles of gemcitabine and carboplatin and at 9 months of follow - up she remained disease free . Nomikos et al . Stated the following.their case was the first report of bladder urothelial carcinoma of the sarcomatoid variant diagnosed in a young patient with spina bifida.high index of clinical suspicion and appropriate usage of immunohistochemical techniques are essential for fast diagnosis of this rare clinical entity.primary radical cystectomy and adjuvant chemotherapy may improve outcome . Their case was the first report of bladder urothelial carcinoma of the sarcomatoid variant diagnosed in a young patient with spina bifida . High index of clinical suspicion and appropriate usage of immunohistochemical techniques are essential for fast diagnosis of this rare clinical entity . Bostwick and cheng stated that sarcomatoid carcinoma is a biphasic malignant neoplasm which exhibits morphologic and/or immunohistochemical evidence of epithelial and mesenchymal differentiation . By means of immunohistochemistry, epithelial elements react with cytokeratins, whereas stromal elements react with vimentin or specific markers corresponding to the mesenchymal differentiation . Microscopically, it is composed of spindle cell / sarcomatoid elements with high mitotic rate and atypical mitoses . Wang et al . Undertook a retrospective review of their experience in managing patients with sarcomatoid bladder cancer between 1997 and 2011 in order to better define the behaviour and outcomes of the disease . Wang et al . Reported that the median age of the patients was 63 years . 85% of the patients presented with muscle - invasive disease and 50% presented with stage iv carcinoma . They reported that patients with sarcomatoid variant of urothelial carcinoma were younger (p, 0.010), and they more commonly presented with high - grade histology (p, 0.01) and advanced stage disease (p, 0.01), in comparison with patients who had conventional urothelial carcinoma . Wang et al . Also reported that at a median follow - up of 7 months (range 1.3 to 112 months), five patients (35.7%) had died in the follow - up; the two - year survival was 53.5% . Wang et al . Stated that sarcomatoid bladder cancer was associated with poor prognosis and that multimodality therapy may improve the outcome of the patients . Wang et al . Stated the following.their study showed patients with this rare form of urothelial carcinoma are diagnosed at a younger age and they present with a higher grade of histologic malignancy as well as an advanced stage in comparison with patients without sarcomatoid differentiation.consistent with previous studies, the cancer specific survival of this cohort of carcinosarcoma of the urinary bladder was poor.in view of the absence of randomized and controlled trials, there is no standard treatment for this disease.only few studies reported the use of chemoradiotherapy and chemotherapy after surgical resection of carcinosarcoma of the urinary bladder.in their series, aggressive multimodality treatment, in 3 patients, led to complete responses and markedly improved survival . And it was gratifying to report the long - term survival, multiple years, of the three patients with sarcomatoid bladder cancer.the low incidence of sarcomatoid variant of urothelial carcinoma renders the conduct of randomized trials rather impossible and drawing clear guidelines for its management is subsequently difficult . However, their series would suggest that long - term survival is possible in patients treated with multimodality therapy, and the optimal treatment modality has yet to be defined.future studies must investigate the combination of chemotherapy with new targeted therapies . Their study showed patients with this rare form of urothelial carcinoma are diagnosed at a younger age and they present with a higher grade of histologic malignancy as well as an advanced stage in comparison with patients without sarcomatoid differentiation . Consistent with previous studies, the cancer specific survival of this cohort of carcinosarcoma of the urinary bladder was poor . In view of the absence of randomized and controlled trials, only few studies reported the use of chemoradiotherapy and chemotherapy after surgical resection of carcinosarcoma of the urinary bladder . In their series, aggressive multimodality treatment, in 3 patients, led to complete responses and markedly improved survival . And it was gratifying to report the long - term survival, multiple years, of the three patients with sarcomatoid bladder cancer . The low incidence of sarcomatoid variant of urothelial carcinoma renders the conduct of randomized trials rather impossible and drawing clear guidelines for its management is subsequently difficult . However, their series would suggest that long - term survival is possible in patients treated with multimodality therapy, and the optimal treatment modality has yet to be defined . . Stated that the cytological features of sarcomatoid variant of urothelial carcinomas are not well known and only one cytological analysis of sarcomatoid variant of urothelial carcinoma had previously been reported . Reported their study which included the first analysis of cytological features from a series of sarcomatoid variant of urothelial carcinoma and discussed possible differential diagnostic considerations . They analysed and reviewed the cytological features of a series of sarcomatoid variant of urothelial carcinoma cases which included 6 voided urine specimens from 3 patients with sarcomatoid variant of urothelial carcinoma . They reported that several characteristic cytological features were revealed and some of these include the following.tumour cells were abundant in a necrotic background and while single tumour cells were predominant, small clusters of cells were occasionally present.tumour cells were large - sized and round to polygonal in shape with ill - defined cell borders.tumour cells had a high nuclear / cytoplasmic ratio and enlarged round to oval nuclei containing coarse chromatin and occasional nucleoli.spindle-shaped atypical cells were rarely identified (1/6 specimens). Tumour cells were abundant in a necrotic background and while single tumour cells were predominant, small clusters of cells were occasionally present . Tumour cells were large - sized and round to polygonal in shape with ill - defined cell borders . Tumour cells had a high nuclear / cytoplasmic ratio and enlarged round to oval nuclei containing coarse chromatin and occasional nucleoli . . Stated that the cytological features of 1, 2, and 3 are indistinguishable from those of conventional invasive high - grade urothelial carcinoma . . Postulated that these tumour cells originated from the conventional high - grade urothelial carcinoma component of sarcomatoid variant of urothelial carcinoma and this component is usually present in this type of lesion, particularly on the surface of the tumour . Moreover, the sarcomatoid component of sarcomatoid variant of urothelial carcinoma is usually present in the deeper portion of the tumour, and therefore detection of this component in the voided cytological specimen is low . Even though cytodiagnosis of sarcomatoid variant of urothelial carcinoma is extremely difficult, cytodiagnosis of malignancy may prove possible due to the presence of a conventional urothelial carcinoma component . Sarcomatoid variant of urothelial carcinoma is a rare aggressive type of tumour which tends to present at a younger age and at a higher grade and stage . Sarcomatoid variant of urothelial carcinoma is associated with inferior outcome in comparison with conventional urothelial carcinoma . There is anecdotal information which would suggest that chemoradiation in addition to radical surgery may improve prognosis of the tumour . There is a need for a multicentre trial of various treatment options for sarcomatoid variants of urothelial carcinoma in order to arrive at a consensus opinion regarding the best treatment option . Urologists and oncologists should be encouraged to report cases of sarcomatoid variant of urothelial carcinoma they encounter in order to contribute to the understanding of the biological behaviour of the tumour.
|
He presented with a 10-year history of voiding difficulty . Before this presentation, a digital rectal examination revealed bilateral enlargement of the prostatic lobes . Under a clinical diagnosis of bph, he was administered tamsulosin 0.2 mg once with the insertion of a urethral foley catheter . Transrectal ultrasonography revealed that the volume of the prostate was approximately 136 ml (fig . His prostate - specific antigen level was 2.12 ng / ml . Two weeks later, a pressure flow study (pfs) was performed to evaluate his voiding symptoms and showed an obstructive pattern and normal detrusor function according to the international continence society and schffer nomogram (fig . 1c). His maximal urine flow rate (qmax) was 9 ml / sec on the pfs . Simple x - ray and computed tomography (ct) scan suggested the presence of several bladder stones . We decided to perform concomitant lessv and step under a diagnosis of bladder stones and bph . Informed consent was obtained after a complete description of the less with the use of a homemade single - port device . With the patient under general anesthesia, a midline incision of approximately 3 cm was made at the level of three fingerbreadths above the symphysis pubis, followed by a dissection to reach the bladder . The anterior wall of the bladder was then incised at approximately 2 cm to minimize the bladder wall and port - device . Pneumovesicum was formed while maintaining 12 cm h2o pressure . Using a 10-mm rigid laparoscope (conmed linvatec, largo, fl, usa), the prostatic adenoma, urethral foley catheter, and bilateral ureteral orifices urinary drainage was halted to prevent gas leakage, and the urethral catheter tip was then moved to the bladder neck . Using rigid instruments, the bladder stones were grasped and extracted through a hole in another finger of the glove . After removal of the bladder stones, a dissection was made starting from the right prostatovesical junction using a rigid laparoscopic dissector and an enseal trio tissue sealing device (ethicon endo - surgery inc ., air ventilation was continuously maintained to minimize vesical neuromuscular trauma due to visual field securing and pneumovesicum . After sufficient dissection of the huge adenoma, the port - device was removed . Using ellis forceps, the huge adenoma was pulled outward and the index finger was inserted into the dissection plane as described in a previous report . The suprapubic catheter was used to make up for the obstruction of the urethral catheter . The bladder was sutured with 3 layers, and the skin was approximated by using a skin stapler (3 m precise skin stapler, 3 m co., preston, mn, usa). The suprapubic and urethral catheter were removed on the 7th and 8th postoperative day, respectively . First reported step for large bph using an r - port (advanced surgical concepts, wicklow, ireland) between 2008 and 2009 . The two groups of desai and sotelo jointly reported 34 cases of step including a case of r - less in 2010 . In their study, the authors conducted the enucleation by using electrocautery and ultrasonic shears under laparoscopic video assistance . Interestingly, oh and park reported 32 cases of f - step in the treatment of a huge prostate following desai et al . In their study, they reported a new enucleation method using fingers and excellent outcomes . After the prostatic capsule was dissected with the use of articulating instruments, traction suturing was performed on the prostatic adenoma . The adenoma was enucleated by using the index finger after removing the homemade single - port device . In our case, we used the same method to remove the prostatic adenoma, because the prostatic adenoma was too large to remove with the use of laparoscopic instruments . In fact, use of less for the primary treatment of urological cancers might be limited because of issues such as the extraction method of the specimen and maintaining oncologic principles . The ideal indications for less may be pediatric urologic diseases and benign, non - life - threatening diseases . Recently, kaouk et al . Reported a worldwide multi - institutional analysis of 1,076 cases of less in urology . In their study, malignant disease including renal tumor, adrenal tumor, prostate cancer, and bladder cancer made up approximately 46.6% of the sample . More than half of the cases were benign disease, for which less was performed . In benign urologic disease, there were 42 cases (3.9%) of less for bph including step . To the best of our knowledge, concomitant lessv and f - step have not been reported in previous studies . Step was estimated to be a very difficult procedure according to autorino et al . . However, it may be more advantageous for surgeons with experience in less or conventional laparoscopy, but may show a steep learning curve as shown for holmium laser enucleation of the prostate (holep) or an even steeper learning curve in surgeons without experience in less or conventional laparoscopy . Although step has better cosmesis than open surgery, it may require a suprapubic catheter and may have an external wound compared to turp or holep . However, step or f - step might be a viable treatment option in patients with huge prostate of more than 80 ml . In our case, the concomitant lessv and f - step has some advantages, as follows: urethra and bladder neck injuries may occur due to the long - time use of a rigid resectoscope, but they can be prevented in concomitant lessv and f - step . Meanwhile, no suturing with laparoscopic instruments is required in f - step as compared with pyelolithotomy or ureterolithotomy . For a large bladder stone in addition, the single incision in the concomitant lessv and f - step without the need for a position change is an important advantage . Our case suggests that concomitant lessv and f - step can be used as an alternative technique in the treatment of huge bph with huge prostate and bladder stones, for which open surgery is usually performed.
|
Hypothalamic - pituitary - adrenal (hpa) axis dysfunction in mood disorders is one of the most robust findings in biological psychiatry . However, considerable debate surrounds the nature of the core abnormality, its cause, consequences and treatment implications . To review the evidence for the role of hpa axis dysfunction in the pathophysiology of mood disorders with particular reference to corticosteroid receptor pathology . A selective review of the published literature in this field, focusing on human studies . The nature of basal hpa axis dysregulation described in both manic and depressed bipolars appears to be similar to those described in mdd . But studies using the dexamethasone/ corticotropin releasing hormone (dex / crh) test and dexamethasone suppression test (dst) have shown that hpa axis dysfunction is more prevalent in bipolar than in unipolar disorder . There is robust evidence for corticotropin releasing hormone (crh) hyperdrive and glucocorticoid receptor (gr) dysfunction in mood disorders, with increasing evidence for disorders within the avp system . Hpa axis dysfunction is prevalent in patients with mood disorder, particularly those with psychotic disorders and bipolar affective disorder . Dysfunction of gr may be the underlying abnormality and preliminary findings suggest that it is a potential target for novel therapies.
|
In sub - saharan africa, hiv prevalence trends differ between individuals with different socioeconomic backgrounds . Hiv infections were concentrated among those with higher levels of education or wealth in sub - saharan africa before 1996 in many countries . It therefore seems that during the 1980s and 1990s, in the absence of widespread health promotion, prevailing sexual behaviour patterns led to more rapid spread of infection among the relatively wealthy, more mobile and more educated within african countries . However, over time, prevalent infections are increasingly concentrating among those of lower education . In a systematic review published in 2008, including more than 200,000 individuals from 11 countries between 1987 and 2003, hiv infections appeared to be shifting towards higher prevalence among the least educated in sub - saharan africa, reversing previous patterns . In tanzania, studies in the 1990s suggested a higher prevalence of hiv among the more educated . In a rural population in tanzania, the association between educational attainment and hiv prevalence reversed between 1991 and 2005 . In 1991, secondary education was associated with a higher risk of hiv infection compared with those with no formal education (odds ratio 4.5), whereas in 2005 it was associated with a lower risk (odds ratio 0.4). Subsequently, we (jh and lh) have reported on data from two large nationally representative surveys conducted in 2003/2004 and 2007/2008 in tanzania, and showed that over this relatively short time period, hiv prevalence was stable among those with no formal education, whereas it had fallen quite steeply among those with secondary education . While this trend was not statistically significant in any population subgroup, the same patterns were noted among the younger groups aged 15 to 24 years in whom prevalence trends are thought to be most indicative of incidence patterns linked to sexual behaviour . Among these young people, comparing hiv prevalence in 2007/8 with that in 2003/4 the point estimate odds ratios suggested stable or even increasing prevalence among those with no education (adjusted odds ratios aor of 1.29 males and 1.50 in females, respectively), and falling prevalence among those having attended primary education (aors: 0.41 males, 0.74 females) or secondary education, particularly among males (aors: 0.18 males, 0.85 females). While there is relatively strong empirical evidence for a changing association over time between indicators of relative socioeconomic position and prevalent hiv infection in sub - saharan african countries, the behavioural patterns that underlie these trends sexual behaviour is influenced by an individual's sex, age and marital status; their perception of cultural and religious norms; and social and economic factors . Sexual behaviour can also be influenced by health promotion . In countries with severe hiv epidemics, health promotion efforts provide information about the health implications of sexual activity and its link to risk of hiv infection, attempt to influence social norms around sexual behaviours and have made technologies such as male condoms more accessible . A key focus has been encouraging young people to delay their first sexual experience (abstain), have only one sexual partner (be faithful) and use condoms (condomise). There is evidence from wealthy countries and, more recently, from sub - saharan africa that these efforts have been at least partly successful in reducing the hiv infection rates . We analysed sexual behaviour patterns among young people with different levels of educational attainment in tanzania . We established whether sexual behaviour characteristics were associated with educational attainment using data from each of the 2003/2004 and 2007/2008 national surveys . Finally we sought to establish whether the association between educational attainment and sexual behaviour was changing over time by fitting interaction terms between educational attainment and time period in our regression models in a manner similar to our previous paper on prevalent hiv infection using the same datasets . We analysed data from two national cross - sectional surveys conducted in tanzania in 2003/4 and 2007/8, which were available from www.measuredhs.com . These surveys used two - stage sampling to identify nationally representative samples of adults aged 15 to 49 years . Our analysis in this paper is focused on 15- to 24-year - olds . Both surveys achieved high response rates . We restricted our analysis to individuals for whom full data were available on a small set of variables relevant to our purpose (sex, age, urban / rural residence, educational attainment, household asset - wealth, date of interview, prevalent hiv infection and a number of characteristics of sexual behaviour described in more detail below). All of our analyses used the survey commands in stata v. 11 to reflect the sampling strategy and ensure that our results would be representative of the national population structure . Data were collected on whether each participant had ever previously had sex during their life and, among those who reported ever sexual activity: age at first sex, the total number of sexual partners in the last year and condom use at last sex with non - spousal partners occurring during the last year . We approached the questions using two data analysis strategies described below and applied to a pooled data set . We stratified all our analyses by sex . In line with our previous work we considered three categories of educational attainment: no education, primary education and secondary education or higher . First, we used data on age of first sex, date of birth and date of interview to analyse progression to first sex for two time periods . We used survival analysis to describe the incidence of first sex, which can be used as a population - level measure of the beginning of exposure to stis . This analysis was restricted to respondents aged between 19 and 22 years in each survey in order to describe the experience of those mostly likely to have had their first sex in the years immediately before each survey . Using the survival commands in stata we estimated the total person years and the median age at first sex for each education group by sex and survey . We fitted crude and adjusted cox regression models to compare the effect of education on progression to first sex adjusting for current age, for each survey by sex . We fitted further cox regression models for each sex for both surveys combined and included a term for interaction between education and year of survey to formally assess whether the association between educational attainment and rate of first sex was changing over time . Our second data analysis strategy concentrated on the year prior to interview and measures for individuals aged 15 to 24 years at time of interview who reported having ever been sexually active . These measures were whether in the last year respondents had had more than one sexual partner and whether they had not used a condom at last sex with a non - cohabiting partner (unprotected last sex) among those who reported having had such a partner . We conducted separate logistic regression analyses for the outcomes adjusting for age, urban / rural residence and asset wealth . Again we assessed whether there was an association between educational attainment and each characteristic in 2003/2004 and in 2007/2008 (reporting odds ratios and wald - test p - values), and whether there was evidence for interaction between education and survey year . We report the results for each characteristic of sexual behaviour in separate tables (tables 24), and additionally report the key terms from the final models with an interaction term in a separate table (table 5). The total number of individuals included in the analysis in 2003/4 was 4710 and in 2007/8 it was 6691 (table 1). Both surveys included more female than male participants and a greater proportion of rural respondents . The proportion of respondents who had attended secondary school was higher in 2007/2008 than in 2003/2004, and in both years men were more likely than women to have attended secondary school . In both years, it was most common for respondents to have attended some primary school, but not secondary school . Hiv prevalence was lower in 2007/2008 than in 2003/2004 and was higher in women than in men in both years . More young men than young women reported more than one partner in the last year in both surveys, although prevalence of this behaviour was lower for both sexes in 2007/8 compared with 2003/2004 . Unprotected last sex with a non - cohabiting partner was reported by more females than males and was slightly lower in 2007/2008 compared with 2003/2004 for both sexes . Characteristics of participants aged 15 to 24 in nationally representative aids indicator surveys in tanzania in 2003/2004 (n=4710) and 2007/2008 (n=6691). Of those reporting a non - cohabiting partner . In the 2003/2004 survey, there was little evidence that educational attainment was associated with age at first sex among males (adjusted hazard ratio comparing secondary to primary education 0.88). In the 2007/2008 survey, there was evidence that higher educational attainment was associated with later first sex (hazard ratio comparing secondary to primary education 0.53, 95% ci 0.40 to 0.70). The association between education and age at first sex in males changed between these surveys, and this is supported by the small p - value for the interaction term in the cox regression model (interaction p=0.04, table 5). Differences in the rates of first sex among those aged 19 to 22 at time of survey by educational attainment, gender and survey . Less than 75% of this cohort had had sex by the time of the survey . This is the wald - test p - value for the education*time period interaction term in the pooled model . See table 5 for more detail of changes over time in behaviour by educational strata . Among females, compared to those with primary education, women with no education had sex at a younger age, and women with secondary education were older at first sex . There was relatively weak evidence that this association changed between the surveys (p - value for interaction term 0.17). Women were on average younger at first sex and showed a larger differential by educational status than men . Among males in 2003/2004, greater educational attainment was associated with a lower prevalence of reported sex with more than one partner in the last year, although after adjustment this relationship became slightly weaker (aor, comparing secondary to no education 0.63, 95% ci 0.35 to 1.13). A similar, though slightly stronger, association was seen in 2007/2008 (interaction p - value for change over time in the strength of association = 0.75). Association between educational attainment and reporting more than one partner in the previous year among young people in tanzania, stratified by sex and year of survey . This is the wald - test p - value for the education*time period interaction term in the pooled model . See table 5 for more detail of changes over time in behaviour by educational strata . Females with primary or secondary education were less likely to report more than one sexual partner in the last year than those with no education in 2003/4 (e.g. Aor for secondary versus no education 0.28, 95% ci 0.10 to 0.80). By 2007/2008 there was slightly less evidence of association between education and reporting more than one partner in the last month (e.g. Aor for secondary versus no education 0.46, 95% ci 0.16 to 1.28). The limited change over time in association between education and more than one sexual partner among females (p - value for interaction = 0.36) primarily arose because of a decrease in the proportion of females with no or primary education reporting this behaviour . Among men reporting a non - cohabiting partner there was strong evidence that men with primary or secondary education were less likely to report unprotected last sex with these partners compared to those with no education in both 2003/2004 and 2007/2008 (aors comparing secondary with no education 0.18, 95% ci 0.09 to 0.36 and 0.42, 95% ci 0.21 to 0.82). Over time there was a fall in reported unprotected last sex among those with no education, while this had increased among those with secondary education . Consequently, there was strong evidence that the magnitude of this relationship was decreasing over time (interaction p<0.001). Association between educational attainment and reporting unprotected last sex with a non - cohabiting partner among young people reporting a non - cohabiting partner in tanzania, stratified by sex and year of survey . This is the wald - test p - value for the education*time period interaction term in the pooled model . See table 5 for more detail of changes over time in behaviour by educational strata . The pattern among women was similar to that among men . In 2003/2004 among women with a non - cohabiting partner in the previous year, those with primary or secondary education were less likely to report non - condom use at last sex (aor comparing secondary with no education 0.14, 95% ci 0.06 to 0.34). By 2007/2008, while this pattern was seen in an unadjusted analysis, this relationship was no longer present after further adjustment for age, urban / rural location and wealth tertile (aor 0.51, 95% ci 0.23 to 1.15). Among women, there was strong evidence for a weakening in the association between education and unprotected sex over time (interaction p<0.001). In the 2003/2004 survey, there was little evidence that educational attainment was associated with age at first sex among males (adjusted hazard ratio comparing secondary to primary education 0.88). In the 2007/2008 survey, there was evidence that higher educational attainment was associated with later first sex (hazard ratio comparing secondary to primary education 0.53, 95% ci 0.40 to 0.70). The association between education and age at first sex in males changed between these surveys, and this is supported by the small p - value for the interaction term in the cox regression model (interaction p=0.04, table 5). Differences in the rates of first sex among those aged 19 to 22 at time of survey by educational attainment, gender and survey . Less than 75% of this cohort had had sex by the time of the survey . This is the wald - test p - value for the education*time period interaction term in the pooled model . See table 5 for more detail of changes over time in behaviour by educational strata . Among females, compared to those with primary education, women with no education had sex at a younger age, and women with secondary education were older at first sex . There was relatively weak evidence that this association changed between the surveys (p - value for interaction term 0.17). Women were on average younger at first sex and showed a larger differential by educational status than men . Among males in 2003/2004, greater educational attainment was associated with a lower prevalence of reported sex with more than one partner in the last year, although after adjustment this relationship became slightly weaker (aor, comparing secondary to no education 0.63, 95% ci 0.35 to 1.13). A similar, though slightly stronger, association was seen in 2007/2008 (interaction p - value for change over time in the strength of association = 0.75). Association between educational attainment and reporting more than one partner in the previous year among young people in tanzania, stratified by sex and year of survey . This is the wald - test p - value for the education*time period interaction term in the pooled model . See table 5 for more detail of changes over time in behaviour by educational strata . Females with primary or secondary education were less likely to report more than one sexual partner in the last year than those with no education in 2003/4 (e.g. Aor for secondary versus no education 0.28, 95% ci 0.10 to 0.80). By 2007/2008 there was slightly less evidence of association between education and reporting more than one partner in the last month (e.g. Aor for secondary versus no education 0.46, 95% ci 0.16 to 1.28). The limited change over time in association between education and more than one sexual partner among females (p - value for interaction = 0.36) primarily arose because of a decrease in the proportion of females with no or primary education reporting this behaviour . Among men reporting a non - cohabiting partner there was strong evidence that men with primary or secondary education were less likely to report unprotected last sex with these partners compared to those with no education in both 2003/2004 and 2007/2008 (aors comparing secondary with no education 0.18, 95% ci 0.09 to 0.36 and 0.42, 95% ci 0.21 to 0.82). Over time there was a fall in reported unprotected last sex among those with no education, while this had increased among those with secondary education . Consequently, there was strong evidence that the magnitude of this relationship was decreasing over time (interaction p<0.001). Association between educational attainment and reporting unprotected last sex with a non - cohabiting partner among young people reporting a non - cohabiting partner in tanzania, stratified by sex and year of survey . This is the wald - test p - value for the education*time period interaction term in the pooled model . See table 5 for more detail of changes over time in behaviour by educational strata . The pattern among women was similar to that among men . In 2003/2004 among women with a non - cohabiting partner in the previous year, those with primary or secondary education were less likely to report non - condom use at last sex (aor comparing secondary with no education 0.14, 95% ci 0.06 to 0.34). By 2007/2008, while this pattern was seen in an unadjusted analysis, this relationship was no longer present after further adjustment for age, urban / rural location and wealth tertile (aor 0.51, 95% ci 0.23 to 1.15). Among women, there was strong evidence for a weakening in the association between education and unprotected sex over time (interaction p<0.001). We have previously described how hiv prevalence among adults in tanzania remained stable at about 4% among those with no prior education between 2003/2004 and 2007/2008, while falling steeply from approximately 8% to just 2% over the same period among those with secondary education . Here, we sought to examine the patterns and trends in characteristics of sexual behaviour that might explain the shifting socioeconomic distribution of hiv prevalence over time, focusing on young people since this is the population subgroup in which prevalence trends are most likely to represent incidence patterns . Sexual behaviour patterns generally followed a pattern of less risk (or at least, behaviour patterns more in line with core hiv prevention messages) in more educated groups, or had no association with education . This strengthens the evidence that since 2000 new infections have been concentrating among the least educated . Our second interest was in changes over time in the association between educational attainment and behavioural risk factors: the data we present here suggest that the gap in risky behaviours between more and less educated was increasing (males) or stable (females) over time for age at first sex, stable for multiple partners and may be closing for unprotected last sex (table 5). Interactions between year of survey and level of educational attainment in adjusted, sex - stratified analysis of self - reported sexual behaviour . Rate / odds ratios show the adjusted relative difference in the reported characteristic by survey year, stratified by educational groups . These interaction test (wald - test) p - values are also reported in tables 24 . There are of course multiple characteristics of sexual behaviour relevant to hiv transmission that we have not reported on here, such as frequency of sex, age - mixing, participation in most - at - risk groups such as female sex workers, marriage and within - marriage behaviours . We were also missing data, allowing us to investigate in more detail the many potential pathways through which education may be associated with hiv risk . It is also not possible for us to eliminate the possibility that some behavioural patterns over time reported here arise because of changing composition of educational groups that have occurred as access to education has expanded as opposed to changes in behavioural tendency . Sexual behaviour characteristics are also notoriously subject to potential reporting biases including social desirability bias, with the potential for differential misreport at different time points and among different socioeconomic groups . The specific potential effects of such biases on the findings reported here are difficult to predict . The small sample sizes in some strata meant that interaction tests for change in behaviour by survey year had low power . We were also not able to track incident hiv infections, the primary outcome of interest . Finally, while a major strength was that we used data from two surveys, even this approach provided data on only one time period (2000 to 2008). These limitations require significant care in further interpretation, and ongoing monitoring of this phenomenon is warranted before strong conclusions can be drawn . In addition, robust theories will be required to provide a framework to aid interpretation of emerging data . To contribute to this second component, in the remainder of this discussion we will outline how the emerging data on prevalent hiv infections in tanzania, to some extent complemented by the analysis of sexual behaviour presented here, perhaps fit with the pattern that would be predicted by the the hypothesis, originally described in relation to child health in brazil, is a variant of the better known tudor - hart's inverse care law, which describes the phenomenon that health needs are often inversely associated with the quality and accessibility of health care services . The inverse equity hypothesis suggests that the introduction of health interventions will tend to benefit those of the highest socioeconomic position first, only later benefiting those in lower socioeconomic groups . For example, in western australia, there was a significant time - lag in the diffusion of a range of coronary procedures recommended following myocardial infarction to those of lower socioeconomic position . Applied to hiv prevalence, the inverse equity hypothesis would suggest that the roll - out of hiv prevention messages and technologies would be first taken up by higher socio - economic groups, and thus that risky behaviours and incidence rates would start to decrease in these groups before lower socioeconomic groups . Although little data on sexual behaviour are available from earlier in the epidemic, in the 1980s to 1990s prevailing sexual risk patterns must have been higher in higher socioeconomic groups because these groups had the highest levels of hiv prevalence in early studies . Which aspects of sexual behaviour drove this association is unclear, although it seems likely that condom use was low in all sections of society . Efforts to scale - up hiv prevention activities in sub - saharan africa grew during the 1990s and were catalysed in particular in the early 2000s, especially following the durban 2000 world aids conference and the united nations general assembly special session on hiv / aids in 2001 . Under the inverse equity hypothesis, we might expect this shift in the scale of health promotion activities to have led to faster adoption of safe - sexual behaviour characteristics (such as delaying first sex, only having one partner and using condoms) by those of higher socioeconomic position . Data on hiv prevalence seem to suggest this pattern, although there have previously been few attempts to explore the phenomenon more directly in relation to risk behaviours . Our analysis focused on time trends a few years after 1996: our retrospective analysis of rates of first sex includes data from just after 1 january 2000, but the majority of the changes we explore are between the years preceding the 2003/2004 and 2007/2008 surveys . As we have described, over this time period the educational gap in rate of first sex was either stable or perhaps widening, the gap in multiple partnerships was also stable, while condom use appeared to be catching up in the least educated . Different aspects of sexual behaviour may themselves change differently over time and in respect to educational attainment . This is an interesting observation that warrants further research to unpick the dynamics in more settings and over a broader time period, and to assess whether this can be considered in line with or contradictory to the hypothesis . Nevertheless, we suggest that currently available evidence on the social epidemiology of hiv prevalence in sub - saharan africa (closing educational differences in prevalence demonstrated in several studies, and mostly stable or reducing educational difference in risky sexual behaviours over the time period shown in this study) seem broadly consistent with the inverse equity hypothesis . Further research could apply this lens when describing trends in hiv prevalence and behaviour among different socioeconomic groups and thus strengthen or weaken support for this . It seems unlikely that any single piece of work will allow a definitive conclusion to be drawn about whether the inverse equity hypothesis can be said to apply in relation to the emerging characteristics of the hiv epidemic . This is because much relevant data have simply not been collected, and because the (quasi-)experimental conditions that would allow strong conclusions to be drawn have not been present over the roll - out of hiv prevention activities across the region, and for a variety of other reasons . First, mathematical models can be used to explore the incidence, mortality and behavioural patterns underlying hiv prevalence trends . Adapting existing models to incorporate markers of socioeconomic stratification is feasible and would be highly instructive . It would allow more comprehensive linking of reported sexual behaviour and hiv prevalence trends, estimates of incidence and predictions about the future course of the epidemic to be made . Second, pooled analysis of data from hiv prevention trials to assess whether there is evidence of differential effect of interventions by socioeconomic status would be useful . Third, a growing number of countries over the next few years will have serial, nationally representative hiv prevalence surveys available . Many also have data on some aspects of sexual behaviour going back to the 1990s . There is much work to do on this body of data to strengthen or challenge the inverse equity hypothesis across multiple settings . Jh's contribution to this work was funded by the dfid - funded strive research programme consortium . The paper is based on data collected by measure dhs with support from multiple donors and drawing on expertise in hiv / aids epidemiology in tanzania . Jh conceived the study and led the design of the analysis and the study write - up.
|
Cardiovascular disease (cvd), including heart attack, angina, and stroke, is ranked as the number one cause of mortality worldwide . Statins, cholesterol - lowering drugs, are first choice drugs for reducing the chance of suffering a cvd event . Although not thought of traditionally as antimicrobials, statins have been shown to have antimicrobial effects . Hence, the aim of this study was to assess the in vitro efficacy of simvastatin against selected strains of oral streptococci as determined by the minimum inhibitory concentration (mic). Streptococcus mutans (25,175), streptococcus anginosus (33,397), streptococcus sanguis (10,556), and streptococcus salivarius (2593) were purchased from the american type culture collection (manassas, va, usa). All streptococci were inoculated in / on brain heart infusion (bhi) broth / agar and grown at 37c in anaerobic jars in an atmosphere of carbon dioxide . The concentration of log phase cells that were used was between 10 and 10 colony - forming unit (cfu)/ml as determined by serial plating . Usa) was solubilized in 100% dimethyl sulfoxide (dmso) resulting in a 12 mm solution, and then diluted 1:2 in eight steps with dmso to make stock solutions ranging from 6 mm to 24.7 nm . For bacterial growth studies, to this, a fixed culture of bacteria (75 l bacterial suspension, od 600 nm = 1.5, 1010 cfu / ml) and 2.85 ml media were added to obtain a final volume of 3 ml . Dmso alone (75 l), added to bacterial suspension (75 l) and media (2.85 ml), was used as control . Growth curves were generated for each tube by removing 100 l samples, adding 900 l clear media, and measuring turbidity on a spectrophotometer at 600 nm . The mic was considered to be the lowest concentration of simvastatin that prevented bacterial growth, i.e., a clear test tube . Each clear experimental tube was subsequently subcultured onto agar plates and the plates were incubated for 24 h to determine minimum bactericidal concentration (mbc) of simvastatin . Experiments were repeated three times for each bacterial species . For each strain of bacteria, growth curves were started by adding a fixed culture of bacteria (150 l bacterial suspension, od 600 nm = 1.5) to 5.7 ml of bhi media . Growth was monitored by measuring the increase in turbidity on a spectrophotometer (od = 600 nm). After 3 h, simvastatin was added at its mic, and turbidity was measured for another 6 h. at the end of this time (9 h. total incubation), the cells were pelleted in sterile eppendorf tubes, washed twice in sterile isotonic saline, and transferred back into sterile bhi (6 ml). Streptococcus mutans (25,175), streptococcus anginosus (33,397), streptococcus sanguis (10,556), and streptococcus salivarius (2593) were purchased from the american type culture collection (manassas, va, usa). All streptococci were inoculated in / on brain heart infusion (bhi) broth / agar and grown at 37c in anaerobic jars in an atmosphere of carbon dioxide . The concentration of log phase cells that were used was between 10 and 10 colony - forming unit (cfu)/ml as determined by serial plating . Usa) was solubilized in 100% dimethyl sulfoxide (dmso) resulting in a 12 mm solution, and then diluted 1:2 in eight steps with dmso to make stock solutions ranging from 6 mm to 24.7 nm . For bacterial growth studies, 75 l of each simvastatin / dmso solution was used . To this, a fixed culture of bacteria (75 l bacterial suspension, od 600 nm = 1.5, 1010 cfu / ml) and 2.85 ml media were added to obtain a final volume of 3 ml . Dmso alone (75 l), added to bacterial suspension (75 l) and media (2.85 ml), was used as control . Growth curves were generated for each tube by removing 100 l samples, adding 900 l clear media, and measuring turbidity on a spectrophotometer at 600 nm . The mic was considered to be the lowest concentration of simvastatin that prevented bacterial growth, i.e., a clear test tube . Each clear experimental tube was subsequently subcultured onto agar plates and the plates were incubated for 24 h to determine minimum bactericidal concentration (mbc) of simvastatin . For each strain of bacteria, growth curves were started by adding a fixed culture of bacteria (150 l bacterial suspension, od 600 nm = 1.5) to 5.7 ml of bhi media . Growth was monitored by measuring the increase in turbidity on a spectrophotometer (od = 600 nm). After 3 h, simvastatin was added at its mic, and turbidity was measured for another 6 h. at the end of this time (9 h. total incubation), the cells were pelleted in sterile eppendorf tubes, washed twice in sterile isotonic saline, and transferred back into sterile bhi (6 ml). Growth curves for s. anginosus in the presence of simvastatin are shown in figure 1 . The mic of simvastatin against the selected oral bacteria was determined to be 37.5 m (15.6 g / ml) for s. mutans and s. sanguis and 18.75 m (7.8 g / ml) for s. anginsous and s. salivarius . However, the minimum bactericidal activity was not determined by subculture since aliquots (100 l) from clear culture tubes showed bacterial growth when streaked onto agar plates and incubated for 24 h. this measure of antibacterial activity indicates that simvastatin is a bacteriostatic antimicrobial agent against these bacteria . Growth curve of streptococcus anginosus in the presence of simvastatin: an example of the interference caused by the minimum inhibitory concentration (7.8 g / ml) and at two concentrations (3.95 and 1.98 g / ml) below the minimum inhibitory concentration when mic concentrations of simvastatin were added to growing bacterial cultures, slowed growth rates were observed as compared to control growth curves . However, when the simvastatin - treated bacteria were washed and transferred to growth medium lacking simvastatin, they resumed growth [figure 2]. This measure of antibacterial activity confirms that simvastatin is a bacteriostatic antimicrobial agent against these strains of bacteria . Simvastatin (minimum inhibitory concentration = 7.8 g / ml) added to log phase (left arrow) inhibited growth of the bacteria; removal of simvastatin (right arrow) allowed bacteria to resume growth, thus confirming bacteriostatic effect of simvastatin growth curves for s. anginosus in the presence of simvastatin are shown in figure 1 . The mic of simvastatin against the selected oral bacteria was determined to be 37.5 m (15.6 g / ml) for s. mutans and s. sanguis and 18.75 m (7.8 g / ml) for s. anginsous and s. salivarius . However, the minimum bactericidal activity was not determined by subculture since aliquots (100 l) from clear culture tubes showed bacterial growth when streaked onto agar plates and incubated for 24 h. this measure of antibacterial activity indicates that simvastatin is a bacteriostatic antimicrobial agent against these bacteria . Growth curve of streptococcus anginosus in the presence of simvastatin: an example of the interference caused by the minimum inhibitory concentration (7.8 g / ml) and at two concentrations (3.95 and 1.98 g / ml) below the minimum inhibitory concentration when mic concentrations of simvastatin were added to growing bacterial cultures, slowed growth rates were observed as compared to control growth curves . However, when the simvastatin - treated bacteria were washed and transferred to growth medium lacking simvastatin, they resumed growth [figure 2]. This measure of antibacterial activity confirms that simvastatin is a bacteriostatic antimicrobial agent against these strains of bacteria . Simvastatin (minimum inhibitory concentration = 7.8 g / ml) added to log phase (left arrow) inhibited growth of the bacteria; removal of simvastatin (right arrow) allowed bacteria to resume growth, thus confirming bacteriostatic effect of simvastatin statins, cholesterol - lowering drugs, are first choice drugs for reducing the chance of suffering a cvd event . Statins inhibit 3-hydroxy-3-methylglutaryl coenzyme a (hmg - coa) reductase leading to decreased synthesis of endogenous cholesterol . Hmg - coa reductase is a rate - limiting enzyme in the human mevalonate pathway, an important cellular metabolic pathway present in all higher eukaryotes and many bacteria . Statins also have a range of cholesterol independent results, including anti - inflammatory functions and antimicrobial activity . Statins inhibit several clinical isolates of methicillin - resistant staphylococcus aureus, vancomycin - resistant enterococci, escherichia coli, porphyromonas gingivalis, and aggregatibacter actinomycetemcomitans in vitro . Likewise, there is some evidence that statins may aid in treating a range of other bacterial infections . Although the exact mechanism by which simvastatin inhibits the growth of these streptococci is unknown, it is possible that it inhibits bacterial hmg - coa reductase . There are two distinct classes of hmg - coa reductase enzymes, the human or eukaryotic class i enzyme and the prokaryotic class ii enzyme . Crystal structures of a representative of each class of the enzyme have been determined, the class i human enzyme and the class ii enzyme from pseudomonas mevalonii . The enzymes are not identical, having different crystal structure, and they react differently to statins . The class ii enzymes are not as easily inhibited by statin drugs, requiring a thousand - fold higher concentration of statins than the class i enzymes . These experiments demonstrate the in vitro bacteriostatic effect of simvastatin on s. mutans, s. anginsosus, s. sanguis, and s. salivarius . Only data for s. anginosus were presented in the figures, but similar results were obtained for the other bacteria, all of which are potentially pathogenic . S. mutans, in addition to being the primary causal agent responsible for dental caries, is commonly found in coronary plaque specimens . Along with s. mutans, s. salivarius and s. sanguis belong to the viridans group streptococci, common etiologic agents of subacute bacterial endocarditis . Simvastatin has in vitro efficacy against the specific strains of bacteria used in this study at concentrations slightly less than the observed mic's of 15.67.8 g / ml, i.e., slowed growth curves were observed down to approximately 1.0 g / ml . Dmso, a cryopreservative agent routinely used in microbiology, was used to solubilize simvastatin and had no effect on bacterial growth . The mbc could not be determined because the simvastatin / dmso combination became insoluble at concentrations higher than 45 times the mic . Routinely, the mbc of bacteriostatic agents is many - fold higher than their mic . At its mic, simvastatin prevents the growth of the tested bacteria but does not kill them . As this study was conducted using in vitro treatment of planktonic cells, it is not clear whether similar effects would be seen in vivo insofar as the bacteria would be contained within a biofilm . Other statins, for example, rosuvastatin, pravastatin, lovastatin, fluvastatin, and atorvastatin, are available commercially, each having different pharmacokinetic properties . Only simvastatin was used in this study . Simvastatin is an inactive lactone prodrug which is reversibly converted to a competitive inhibitor of hmg - coa reductase, simvastatic acid, in the gut wall and other tissues . 5%, and its half - life is 25 h. thus, for the average adult who has 5 l of blood and ingests one single dose of 60 mg simvastatin, the active metabolite reaches its peak plasma concentration of 0.6 g / ml several hours later . Thus, these experiments indicate that simvastatin concentrations needed for in vitro antimicrobial inhibition (1.9515.6 g / ml mic) slightly exceed the concentration present in human blood or crevicular fluid during statin treatment (0.6 g / ml). This would imply that there is no relevant antibacterial effect of statins at concentrations attained in plasma or crevicular fluid . However, the results of in vitro studies are difficult to translate directly into clinical practice . Mic values are laboratory measures of a fixed concentration of an antibacterial agent being tested against an initially fixed concentration of bacteria that does not necessarily correspond to bacterial densities at site of infection . Nevertheless, since the mic is a measure of the potency of an antibacterial drug, simvastatin is less potent than either penicillin or amoxicillin (mic 0.030.06 g / ml) against oral streptococci . Statins have the potential to benefit oral health when locally delivered . In a clinical trial, pradeep and thorat reported greater increase in clinical attachment and greater decrease in gingival index and probing depth at chronic periodontitis sites treated nonsurgically with scaling and root planing and locally delivered simvastatin, compared to scaling and root planing plus placebo in humans . Likewise, another clinical study utilizing topical application of simvastatin in the treatment of chronic periodontitis, indicated that scaling and root planning in the presence of a simvastatin gel significantly inhibited pro - inflammatory cytokines in crevicular fluid . To date, there are no clinical studies relating simvastatin to reduced dental caries . However, although it has been widely used for its systemic hypolipidemic effect, it has not been considered as a topical antimicrobial agent . It is well known that dental caries is associated with microbial biofilm, of which streptococci are important members in both health and disease . Dentists recommend the regular removal of this film on the teeth as the best treatment for preventing both dental caries and periodontal disease . However, it is appreciated by practicing dentists that most people have difficulty in accomplishing effective oral hygiene . Thus, any agent that adds even temporary stasis of biofilm formation could be a complementary method of plaque control, thus altering the disease process . The practical implications of the present study are that it would be a great advantage, for those prescribed simvastatin, to have this drug simultaneously help both systemically and locally in the oral cavity . This could be accomplished by having statin users chew, swish, and swallow, which is feasible since the drug is suitable to mucous membrane, odorless, tasteless, and does not alter taste perception . As a bacteriostatic agent, simvastatin may act synergistically with other plaque control agents and thus work in localized adjunctive therapy . It has been used in this way to eradicate helicobacter pylori in patients receiving triple therapy for the treatment of peptic ulcer . Bacteriostatic agents are often as effective as bactericidal agents in the treatment of gram - positive infections in patients with uncomplicated infections and noncompromised immune systems . Thus, simvastatin may prove to be a good candidate for a therapeutic agent to be used in local drug delivery to target oral bacteria . In this regard, the mic of simvastatin against oral bacteria compares favorably with essential oil (mic 512 g / ml), chlorhexidine gluconate (mic 12 g / ml), and triclosan (mic 7.8 g / ml). These in vitro findings add to the existing evidence that simvastatin has potential use as a novel antiplaque agent . This study demonstrates the in vitro antimicrobial effect of simvastatin on streptococci commonly found in the mouth . Simvastatin has efficacy against these specific strains of bacteria at concentrations slightly less than the observed mic's of 15.67.8 g / ml, which compares favorably with reported values for topical agents such as essential oil, chlorhexidine gluconate, and triclosan . For patients who are prescribed simvastatin, this drug may act synergistically with other plaque control agents and thus work in localized adjunctive therapy if chewed and swished orally before swallowing
|
Systemic lupus erythematosus (sle) is an autoimmune disease characterized by immune system dysfunction and the production of autoantibodies that lead to inflammation and tissue damage . T - lymphocytes (t - cells) promote inflammation through producing co - stimulatory signals and cytokines that activate dendritic cells and b - cells . Activation of auto - reactive t - cells leads to abnormalities in cd4 and cd8 t - cells, which are critical drivers of the b - cell - dependent autoantibody response [3,57]. Based on these previous findings, we speculate that an imbalance in the t - cell subset distribution eventually results in the development of sle . To that end, immunosuppressive or cytotoxic drugs that target t - cells can induce long - term remission in sle patients . In t - cell leukemia patients, long - term maintenance combination chemotherapy has been shown to be an effective, low - cost treatment regimen with limited adverse effects that can control disease in a stable manner over several years . Based on these previous findings, we hypothesized that the combination of the cell cycle - specific drug vincristine with the non - cell cycle - specific drug cyclophosphamide would be effective in treating sle via positively affecting their t - cell subset distribution . Thus, the aims of the present study were to (i) analyze the t - cell subset distribution in sle patients at baseline and (ii) determine whether vincristine - cyclophosphamide combination therapy can positively affect their t - cell subset distribution to keep the disease in remission . This study was approved by the ethics committee (irb) of the second hospital at shanxi medical college (taiyuan, china). All subjects recruited for this study provided written informed consent prior to their participation . Between october 2008 and october 2012, 30 sle patients were consecutively recruited from the inpatient population of the second hospital at shanxi medical college . All sle patients fulfilled the american college of rheumatology (acr) classification criteria for sle . The degree of sle disease activity was assessed using the sle disease activity index (sledai). Patients with any other autoimmune disease, those having received immunosuppressive therapies other than glucocorticoid therapy within the past 6 months, or those with wbc counts of less than 3.010/l were excluded . Fifteen healthy volunteers matched by race, sex, and age were recruited from the outpatient population of the same hospital during the same time period . The 30 sle patients were subdivided into 2 groups: those with low disease activity (low activity, sledai9, n=17 cases) and those with high disease activity (high activity, sledai>9, n=13 cases). All sle patients were given vincristine (1 mg by intravenous drip) followed by intravenous cyclophosphamide over the next 24 hours (200600 mg depending on sle patient s wbc count; 200 mg for 3.04.010/l, 400 mg for 4.01010/l, 600 mg for> 1010/l). This therapeutic regimen was executed every three weeks, and prednisone therapy was permitted . According to the total duration of vincristine - cyclophosphamide combination therapy, all sle patients were divided into 4 groups: a 3-month group, a 6-month group, a 1224-month group, and> 24-month group . Multitest antibodies cd3 (fitc), cd8 (pe), cd45 (percp), and cd4 (apc) were purchased from bd biosciences . Peripheral blood samples (2 ml) from each subject were collected in edta - coated tubes at baseline and at various time points (i.e., 3 months, 6 months, etc .) During vincristine - cyclophosphamide combination therapy . For immunofluorescence staining, fresh edta - treated whole blood samples were kept at room temperature immediately after collection, and 50 l was placed in a trucount tube . After incubation at 4c for 30 min in the dark, stained cells were washed with facs buffer (phosphate - buffered saline (pbs), 0.2% fetal bovine serum (fbs), 0.09% nan3) and then incubated once again for 15 min in the dark . Negative controls were performed simultaneously using fitc - labelled mouse anti - human igg1 mab and apc - labelled mouse anti - human igg1 mab . All samples were analyzed on a facscanto (bd bioscience, san jose, ca, usa), and the resulting data was analyzed with multiset software . An independent student s t - test was used for comparisons between 2 groups, and 1-way analysis of variance (anova) was used for comparisons among 3 or more groups . This study was approved by the ethics committee (irb) of the second hospital at shanxi medical college (taiyuan, china). All subjects recruited for this study provided written informed consent prior to their participation . Between october 2008 and october 2012, 30 sle patients were consecutively recruited from the inpatient population of the second hospital at shanxi medical college . All sle patients fulfilled the american college of rheumatology (acr) classification criteria for sle . The degree of sle disease activity was assessed using the sle disease activity index (sledai). Patients with any other autoimmune disease, those having received immunosuppressive therapies other than glucocorticoid therapy within the past 6 months, or those with wbc counts of less than 3.010/l were excluded . Fifteen healthy volunteers matched by race, sex, and age were recruited from the outpatient population of the same hospital during the same time period . The 30 sle patients were subdivided into 2 groups: those with low disease activity (low activity, sledai9, n=17 cases) and those with high disease activity (high activity, sledai>9, n=13 cases). All sle patients were given vincristine (1 mg by intravenous drip) followed by intravenous cyclophosphamide over the next 24 hours (200600 mg depending on sle patient s wbc count; 200 mg for 3.04.010/l, 400 mg for 4.01010/l, 600 mg for> 1010/l). This therapeutic regimen was executed every three weeks, and prednisone therapy was permitted . According to the total duration of vincristine - cyclophosphamide combination therapy, all sle patients were divided into 4 groups: a 3-month group, a 6-month group, a 1224-month group, and> 24-month group . Multitest antibodies cd3 (fitc), cd8 (pe), cd45 (percp), and cd4 (apc) were purchased from bd biosciences . Peripheral blood samples (2 ml) from each subject were collected in edta - coated tubes at baseline and at various time points (i.e., 3 months, 6 months, etc .) During vincristine - cyclophosphamide combination therapy . For immunofluorescence staining, fresh edta - treated whole blood samples were kept at room temperature immediately after collection, and 50 l was placed in a trucount tube . After incubation at 4c for 30 min in the dark, stained cells were washed with facs buffer (phosphate - buffered saline (pbs), 0.2% fetal bovine serum (fbs), 0.09% nan3) and then incubated once again for 15 min in the dark . Negative controls were performed simultaneously using fitc - labelled mouse anti - human igg1 mab and apc - labelled mouse anti - human igg1 mab . All samples were analyzed on a facscanto (bd bioscience, san jose, ca, usa), and the resulting data was analyzed with multiset software . An independent student s t - test was used for comparisons between 2 groups, and 1-way analysis of variance (anova) was used for comparisons among 3 or more groups . Patient characteristics are summarized in table 1, and the percentages of t - cell subsets in each experimental group are shown in table 2 . At baseline, the cd3 t - cell percentage was significantly lower in the high activity group than healthy controls (p=0.004), while there was no significant difference in the cd3 t - cell percentage between the low activity group and healthy controls (p>0.05; figure 1a). Furthermore, at baseline, the cd4 helper t - cell (th cell) percentage was significantly lower in the low activity group than healthy controls (p<0.001), and the cd4 th cell percentage was significantly lower in the high activity group than the low activity group (p<0.001; figure 1b). Finally, at baseline, the cd8 suppressor t - cell (ts cell) percentage was significantly higher in the low activity group compared with healthy controls (p<0.05), while there was no significant differences in the cd8 ts cell percentage between the high activity and low activity groups nor between the high activity group and healthy controls (p>0.05; figure 1c). Correlation analysis was then applied to evaluate the relationship between t - cell subsets, sledai scores, and the complement component c3 at baseline . A significantly negative correlation was observed between the cd3 t - cell percentage and sledai score at baseline (r=0.471, p=0.015; figure 2a). A significantly negative correlation was observed between the cd4 th cell percentage and sledai score at baseline (r=0.473, p=0.015; figure 2b). Moreover, a significantly positive correlation was observed between cd4 th cell percentage and c3 at baseline (r=0.612, p=0.002; figure 2c). However, no correlations were observed among cd8 ts cell percentage, sledai score, or c3 at baseline (p>0.05; data not shown). The low activity and high activity patients in each treatment group (i.e., 3-month, 6-month, etc .) Were pooled together and compared against the high activity baseline group and low activity baseline group in order to simplify the comparative analysis . After 3 months of combination therapy, the cd3 t - cell percentage was significantly higher than the high activity baseline (p=0.000; figure 3). After 6 months of combination therapy, the cd3 t - cell percentages remained significantly higher than the high activity baseline (p<0.01). The cd3 t - cell percentages across all combination therapy time groups showed no significant differences with the low activity baseline (p>0.05). After 3 months of combination therapy, the cd4 th cell percentage was significantly higher than both the high activity and low activity baselines (p<0.05). After 6 months of combination therapy, the cd4 th cell percentage showed no significant difference with both the high activity and low activity baselines (p>0.05), but did present a non - significant upward trend . After 3 months of combination therapy, the cd8 ts cell percentage showed no significant difference with both the high activity and low activity baselines (p>0.05). After 6 months of combination therapy, the cd8 ts cell percentage was significantly higher than the high activity baseline (p<0.05). After 12 months of combination therapy, the cd8 ts cell percentage was also significantly higher than the low activity baseline (p<0.05). Patient characteristics are summarized in table 1, and the percentages of t - cell subsets in each experimental group are shown in table 2 . At baseline, the cd3 t - cell percentage was significantly lower in the high activity group than healthy controls (p=0.004), while there was no significant difference in the cd3 t - cell percentage between the low activity group and healthy controls (p>0.05; figure 1a). Furthermore, at baseline, the cd4 helper t - cell (th cell) percentage was significantly lower in the low activity group than healthy controls (p<0.001), and the cd4 th cell percentage was significantly lower in the high activity group than the low activity group (p<0.001; figure 1b). Finally, at baseline, the cd8 suppressor t - cell (ts cell) percentage was significantly higher in the low activity group compared with healthy controls (p<0.05), while there was no significant differences in the cd8 ts cell percentage between the high activity and low activity groups nor between the high activity group and healthy controls (p>0.05; figure 1c). Correlation analysis was then applied to evaluate the relationship between t - cell subsets, sledai scores, and the complement component c3 at baseline . A significantly negative correlation was observed between the cd3 t - cell percentage and sledai score at baseline (r=0.471, p=0.015; figure 2a). A significantly negative correlation was observed between the cd4 th cell percentage and sledai score at baseline (r=0.473, p=0.015; figure 2b). Moreover, a significantly positive correlation was observed between cd4 th cell percentage and c3 at baseline (r=0.612, p=0.002; figure 2c). However, no correlations were observed among cd8 ts cell percentage, sledai score, or c3 at baseline (p>0.05; data not shown). The low activity and high activity patients in each treatment group (i.e., 3-month, 6-month, etc .) Were pooled together and compared against the high activity baseline group and low activity baseline group in order to simplify the comparative analysis . After 3 months of combination therapy, the cd3 t - cell percentage was significantly higher than the high activity baseline (p=0.000; figure 3). After 6 months of combination therapy, the cd3 t - cell percentages remained significantly higher than the high activity baseline (p<0.01). The cd3 t - cell percentages across all combination therapy time groups showed no significant differences with the low activity baseline (p>0.05). After 3 months of combination therapy, the cd4 th cell percentage was significantly higher than both the high activity and low activity baselines (p<0.05). After 6 months of combination therapy, the cd4 th cell percentage showed no significant difference with both the high activity and low activity baselines (p>0.05), but did present a non - significant upward trend . After 3 months of combination therapy, the cd8 ts cell percentage showed no significant difference with both the high activity and low activity baselines (p>0.05). After 6 months of combination therapy, the cd8 ts cell percentage was significantly higher than the high activity baseline (p<0.05). After 12 months of combination therapy, the cd8 ts cell percentage was also significantly higher than the low activity baseline (p<0.05). Dysfunction in t - cell activation and proliferation plays an important part in sle development through promoting lymphocytic organ infiltration and aiding b - cells in producing auto - antibodies, a process which eventually leads to tissue destruction . Specifically, changes in the t - cell subset distribution is a hallmark of sle; for example, mclnerney et al . Showed that 45% of the sle patient population has markedly depressed cd4 th cells levels, and matsushita et al . Showed that sle patients have an increase in cd8 ts cell counts accompanied by a decrease in cd4 th cell counts . Here, we analyzed the t - cell subset distributions of both high and low activity sle patients relative to healthy control individuals at baseline (prior to vincristine - cyclophosphamide combination therapy) in order to determine whether t - cell subset distributions vary across different levels of sle disease activity . In the high activity group, the percentages of cd3 t - cells and cd4 th cells were significantly lower than healthy controls at baseline; however, the cd8 ts cell percentage was not significantly different than healthy controls at baseline . In contrast, in the low activity group, the cd3 t - cell percentage was not significantly different than healthy controls at baseline, but the cd4 th cell percentage was significantly lower, while the cd8 ts cell percentage was significantly higher, than healthy controls at baseline . Based on this data, significantly negative correlations were observed between the cd3 + t - cell and cd4 + th cell percentages and sledai score at baseline . These combined results indicate that t - cell subset distributions vary across different levels of sle disease activity with higher cd3 t - cell and cd4 th cell percentages favoring lower sle activity . A complex regulatory interplay exists between cd8 ts cells and cd4 th cells in sle . For example, filaci et al . Demonstrated that only cd8 ts cells from sle patients in remission and healthy individuals can function as effective suppressors of cd4 th cells, while cd8 ts cells from active sle patients fail to suppress committed cd4 th cells . Moreover, cd42h4 th cells which are suppressor / inducer cd4 th cells that promote cd8 ts cell - based inhibition of b - cells have been previously shown to have significantly lower proportions in sle patients . Based on this previous evidence from sle patients, the lower cd4 th cell percentages observed with higher sle activity in the current study may actually indicate lower cd42h4 th cell levels and, in turn, lower cd8 ts cell - based inhibition of b - cells . If so, this hypothesis would correctly explain the deficient cd8 ts cytotoxic capacity as well as the b - cell hyperactivity observed in highly active sle [1619]. In order to test this hypothesis, further research should focus on measuring and correlating the levels of cd42h4 th cells, cd8 ts cells, and b - cell autoantibody production as a function of sle activity . With respect to vincristine - cyclophosphamide combination therapy, vincristine blocks t - cell mitosis in metaphase, while cyclophosphamide targets rapidly - proliferating t - cells irrespective of cell cycle phase . Therefore, vincristine and cyclophosphamide can be applied in combination to accomplish a synergistic cytotoxic effect . Specifically, as vincristine activity begins to decline after a few hours, t - cells that have accumulated in metaphase re - initiate their cell cycle, and cyclophosphamide is then available to kill these t - cells during dna replication [2227]. Here, we found that after the first 3 months of vincristine - cyclophosphamide combination therapy, the cd3 t - cell and cd4 th cell percentages both increased relative to the high activity baseline, which appropriately correlates with reduced sle disease activity as discussed above . After 6 months of combination therapy, the cd3, cd4, and cd8 t - cell percentages all increased relative to the high activity baseline . As cd3 + t - cell and cd4 + th cell percentages negatively correlate with sledai, vincristine - cyclophosphamide combination therapy appears to positively affect t - cell subset distribution to control sle disease activity by increasing their cd3 t - cell and cd4 th cell percentages . T - cell subset distributions vary across different levels of sle disease activity with higher cd3 t - cell and cd4 th cell percentages favoring lower sle activity . Vincristine - cyclophosphamide combination therapy appears to positively affect the t - cell subset distribution in sle patients to keep the disease in remission by increasing their cd3 t - cell and cd4 th cell percentages . Further studies are needed to examine how the distributions of cd4 th, cd8 ts cells, and other lymphocytes are maintained in sle and to investigate the t - cell - specific cytotoxic mechanisms underlying vincristine - cyclophosphamide combination therapy in sle.
|
Oculogyric crisis (ogc), classified as eyeball dystonia, was first described in patients suffering from encephalitis lethargica.1 nowadays, this symptom is more frequently observed as a side effect of treatment with dopamine receptor - blocking drugs (drbds).2 it manifests as spasmodic deviations of the eyeballs, mainly upward but also in other directions, lasting from a few minutes to several hours.3 it occurs during the first hours or days after the introduction of drbds . Tetrabenazine is mainly used in patients with hyperkinetic movement disorders, such as tics, chorea, tardive dyskinesia, and dystonia . Its mechanism of action involves the reversible inhibition of vesicular monoamine transporter type 2, thus preventing the uptake of serotonin, norepinephrine, and dopamine by presynaptic neurons . Jankovic and beach found that acute dystonic reactions occurred in nine (2.3%) patients and two (0.5%) additional patients had acute oculogyric crises attributed to tetrabenazine.4 we present a case report of a patient suffering from gilles de la tourette syndrome (gts) who developed ogc during treatment with tetrabenazine . An 18-year - old male patient with gts began to experience head shaking followed by coughing at the age of 11 years . During the next several years, he developed numerous motor and vocal tics (nose twitching, jaw tightening, biting his cheek, clenching his fingers into a fist, throwing his head back, rolling his eyes to one side, tensing his buttocks, twisting movements of the hands and feet, resulting in abnormal posture, bending his body to one side giving the sustained position of his body, and exhaling loudly). His tic - reducing therapy included haloperidol, perphenazine, quetiapine, sulpiride, and clonazepam without success, and thus he was referred to piotr janik (the first author of this paper) at age 17 years . He had a positive family history of tics (his brother) and obsessive compulsive behaviors on his paternal side (his brother, uncle, and grandfather). We found his tics to be associated with lower educational achievements and negative impacts on his family and social life . During the next year, he was put one by one on risperidone, aripiprazole, and topiramate without success . During another visit at age 18 years, he presented with jaw snaps, head jerks, quickly flexing and extending arms, popping knuckles, tensing of the abdomen, nose picking, rubbing one foot against the other, bending up of the nose using a finger combined with frowning, and rapid jerking of the body . His vocal tics included screeching; throat clearing; and sniffing, humming, and squeaking noises . He also displayed self - injurious behavior he had to use a mouthguard to protect his teeth from damage caused by clenching his jaw . To assess the severity of his tics comorbid conditions included depression at age 16 treated with escitalopram and paroxetine . At the time of examination, no comorbid mental disorders were diagnosed . Due to the lack of effectiveness of previous treatments, tetrabenazine in gradually increasing dose was introduced . However, after 8 days of therapy, at a dose of 62.5 mg of tetrabenazine daily, the patient developed involuntary movements of the eyeballs characterized by spasmodic deviations of the eyes upward and to one side that lasted for around an hour, with a frequency of a few times per day . In addition to ogc, the patient experienced severe, brief episodes of throwing back his head and twisting movements of his hands and feet that resembled retrocollis and limb dystonia, respectively . Excessive salivation, slurred speech, and food dropping from the mouth were also reported by the patient . All symptoms resolved a week after tapering the tetrabenazine dose to 37.5 mg daily . At this dose, tics remained poorly controlled and tetrabenazine was totally stopped . Despite further treatment with other drbds, among them permission from an ethics committee was not necessary in the presented case, as tetrabenazine is a widely approved treatment for gts . The drug has previously been used as a last - resort treatment for patients with severe tics; therefore, no novel medical treatments were performed on our patient . Acute ogc seems to be a rare complication in the treatment of gts patients because, nowadays, mostly second - generation drbds are used to alleviate tics . There are only a few case reports in the literature of this complication arising with the use of second - generation drbds . Two papers report the development of acute ogc shortly after administration of aripiprazole and one paper reports similar symptoms after treatment with risperidone.57 we also observed two young adults with gts who developed ogc after treatment with risperidone 4 mg daily and sulpiride 300 mg daily . The only two reports of tetrabenazine - induced acute dystonia were those of jankovic and beach4 and burke et al.8 the four patients described by burke et al varied in terms of drug dose (from 25 to 300 mg), underlying condition (gts in one case, dystonia in three others), patients age (from 20 to 30 years), and sex (two females, two males).8 unfortunately, the characteristics of patients who developed acute dystonia with tetrabenazine treatment were not included in the second paper.4 both authors reported that acute dystonia was dose - related and improved spontaneously when the dosage was reduced, as was the case with our patient . In contrast to burke s patient with gts who developed ogc and retrocollis while being treated with tetrabenazine 300 mg, we observed such a complication on a low dose of tetrabenazine . The fact that tetrabenazine - induced ogc is rarely seen and may occur with different doses suggests that this complication will develop in vulnerable young adults in particular . In addition, our patient had some dystonic tics as part of his tic repertoire since early adolescence . Interestingly, these tics as well as some facial and cervical motor tics worsened during treatment with tetrabenazine . The severity of all these tics abated after tetrabenazine treatment was reduced and then stopped . Since dystonic tics often resemble acute dystonic reaction, it is not always easy to differentiate these movement disorders . Compared to dystonia, tics are shorter lasting movements, typically not painful, are preceded by premonitory sensations, and do not cause persistent postures . Based on these clues, we classified these movements as worsened tics rather than drug - induced acute dystonic reaction . It is believed that to cause acute dystonic reactions, the drug must be able to block dopamine receptors . However, tetrabenazine, a monoamine - depleting medication, and alpha - methyl - para - tyrosine, a catecholamine - depleting agent, may induce acute dystonic reactions.8,9 our case report is not in line with the hypothesis that tetrabenazine causes this side effect by dopamine blockade rather than monoamine depletion because it is also able to block dopamine receptors in rat brain.10,11 our patient had been exposed to numerous drbds before and after he developed ogc, which never caused symptoms of acute dystonia . The resolution of ogc after a reduction in the dosage of tetrabenazine, which probably resulted in enhanced dopaminergic transmission, is compatible with the theory that the decrease of dopamine transmission induced by tetrabenazine could also be involved in the pathogenesis of acute dystonia.
|
It arises from the superior margin of the sphenopalatine foramen and accounts for 0.05% of all head and neck neoplasms . The typical histopathologic appearance of jna is numerous wide, irregular vessels with a single layer of endothelial cells embedded in fibrous stroma . The abundant vascular component is responsible for the excessive bleeding during surgery or following biopsies.1 extranasopharyngeal angiofibromas (enas) have been reported sporadically in the literature . They most commonly originate from the maxillary sinus, and women are affected . Compared with nasopharyngeal fibromas, the lesion is diagnosed earlier, is less vascularized, and occurs in older patients.2 similar to jnas, the treatment of choice for enas is surgery . The surgical approach is tailored to the location and size of tumor.1 in our case, the tumor was small enough for total excision with an endonasal endoscopic approach . This is the first case report in the english literature of angiofibroma originating in the inferior turbinate in a young woman . Enas are rarely seen, and the inferior turbinate is an extremely rare location for them . There are reports in the english literature of inferior turbinate angiofibroma in male patients.3 4 5 6 in female patients, there is only one case report in the english literature of inferior turbinate angiofibroma in a 52-year - old woman.7 recently, a report was published of a 9-year - old girl with angiofibroma obstructing the nasal cavity and originating from the inferior turbinate.8 differential diagnosis includes fibrosed antrochoanal and ethmoidal polyp and other fibrovascular tumors, such as capillary hemangioma, hemangiopericytoma, and solitary fibrous tumor.3 a 26-year - old woman was referred to our clinic with intermittent epistaxis from the right nasal passage for the previous 2 months . Maxillofacial magnetic resonance imaging showed a lobular, contoured mass originating from the right inferior turbinate and hanging to the right of the nasal cavity, with dense contrast enhancement denoting hypervascularity (figs . 1, 2, and 3). We decided to embolize the vascular feeding of the mass to make surgery more feasible . The patient consulted with the invasive vascular radiology department and decided on the embolization process under intravenous sedation . Vascular feeding of the mass was seen from the right internal maxillary artery, and this branch was embolized . When looking at the posterior wall of the sinus and pterygopalatine fossa, no masslike structure was evident . The approximately 3-cm - diameter mass originated from the posterior edge of the right inferior turbinate (fig . A partial turbinectomy was performed, and the posterior edge of the remaining turbinate was cauterized . A mean age of 20 to 30 years in enas was found in the literature.1 2 9 our case was also in this group . Enas mostly originate from the maxillary sinus.2 there are also some reports of tumors located in the ethmoid sinus, nasal cavity, nasal septum, larynx, sphenoid sinus, cheek, conjunctiva, oropharynx, retromolar area, and middle turbinate.3 10 11 12 13 14 15 16 the clinical presentation of enas depends on tumor localization . In our case, but because of the limited space in the nasal cavity, diagnosis was made at an early tumor stage . The tumor's location indicated that the origin may be from ectopic tissues located further from its usual place.17 there is also a reported case of an angiofibroma arising from the inferior turbinate after co2 laser turbinoplasty.18 in our case, there was no history of turbinate surgery . Selective angiography is a useful diagnostic method to demonstrate tumor vascular composition and to confirm the diagnosis . Endoscopic and radiologic examination is important, but definitive diagnosis is made by histopathologic analysis . We should consider these neoplasms possibly in female patients, at every age, with extranasopharyngeal localization, and we should not perform biopsy because of massive bleeding.
|
A secondary neoplasm of the thyroid gland is a distinctly uncommon cause of thyroid enlargement, the reported prevalence of which range from 2% to 3% of all thyroid malignancies, autopsy series, however, report a prevalence varying from 1.25% to 24% these tumors mimic primary thyroid gland tumors and often lead to diagnostic difficulties . Herein, we report an interesting case of secondary thyroid cancer coexisting with a micropapillary carcinoma in a 67-year - old male patient following a left radical nephrectomy done 15 years prior for a fuhrman grade iii pt3n0m0 renal cell carcinoma (rcc). We additionally discuss the issues and challenges in its diagnosis and the role of palliative thyroidectomy in metastatic rcc with a thyroid gland secondary . A 67-year - old man with no comorbid conditions presented to us with the complaints of swelling in the anterior neck of 3 months duration . A rapid increase in size of the swelling and with associated pain and difficulty in breathing for a couple of weeks prompted him to seek medical attention . He had undergone a left radical nephrectomy done 15 years prior at our center for a fuhrman grade iii pt3n0m0 rcc following which he defaulted . Physical examination revealed a well - circumscribed firm to hard swelling arising from the right lobe of the thyroid gland measuring 8 cm 8 cm, which was pushing the trachea to the left of the midline . Fine needle aspiration cytology (fnac) from the thyroid swelling suggested a poorly differentiated carcinoma with a possibility of metastasis from a renal primary . A subsequent tru - cut biopsy with immunohistochemistry (ihc) correlation (immunopositivity to vimentin, epithelial membrane antigen, ki-67 and cd10 positive and negative for thyroglobulin, thyroid transcription factor-1, and calcitonin) revealed a tumor with clear cell histology confirming a diagnosis of metastasis from a rcc [figure 1a - d]. (a) positron emission tomography (pet)-computed tomography showing an ill - defined heterogeneous mass with a large necrotic component and increased metabolic activity in the right lobe of thyroid standardized uptake value (suv - 7.2) which was causing mass effect over right neck great vessels and trachea . (b) pet avidity in the nodule in left lower lobe lung (suv - 1.7) a positron emission tomography (pet)-computed tomography done for metastatic workup revealed an ill - defined heterogeneous mass with a large necrotic component and increased metabolic activity in the right lobe of thyroid standardized uptake value (suv - 7.2), which was causing mass effect over right neck great vessels and trachea [figure 1a and b]. In addition, pet avidity was noted nodule in left lower lobe lung, (suv - 1.7), multiple mediastinal nodes, (suv - 1.7 - 2.2 right adrenal soft tissue lesion (suv - 4.6), and multiple nodules (suv - 3.2) along the body and tail of the pancreas [figure 2a and b]. (a and b) positron emission tomography - computed tomography scan showing right adrenal soft tissue lesion standardized uptake value (suv - 4.6) and multiple nodules along the body and tail of the pancreas (suv - 3.2) a palliative total thyroidectomy [figure 3a and b] was contemplated in view of the compressive and obstructive symptoms, the final histopathology of which revealed an 8 cm 7 cm 4.5 cm tumor replacing entire right lobe of the thyroid, which on microscopy revealed a neoplasm arranged as nests of cells with round to oval nuclei, clear cytoplasm, and fibro - vascular septa . The thyroid follicles were compressed at periphery, capsular infiltration, and occasional vascular tumor emboli were also noted . The final diagnosis confirmed the preoperative diagnosis of metastatic rcc, clear cell type, fuhrmann grade iii, with an additional focus of papillary micro carcinoma in the left lobe of the thyroid [figures 4a - d, 5a - d]. The patient made an uneventful recovery and was subsequently started on targeted therapy (tablet sunitinib 50 mg orally once a day) and continues to be on follow - up for 4 months, relieved of his compressive symptoms . (a) clinical photograph showing the 8 cm 8 cm swelling arising from the right lobe of thyroid (b) clinical specimen photograph following palliative total thyroidectomy (a and b) microscopy examination of the thyroidectomy specimen revealed a neoplasm arranged as nests of cells with round to oval nuclei, clear cytoplasm, and fibro - vascular septa . The thyroid follicles were compressed at periphery, capsular infiltration (h and e, 20) (c) vascular tumor emboli (h and e, 10). (d) an additional focus of papillary micro carcinoma in the left lobe of the thyroid (h and e, 10) (a) tumor cells showing immunopositivity to vimentin, immunohistochemistry (ihc, 10) (b) tumor cells with immunopositivity to cd10 (ihc, 10) (c) tumor cells with immunopositivity to epithelial membrane antigen (ihc, 10) (d) tumor cells with immunopositivity to ki-67 (ihc, 10) the vast majority of the malignant tumors that involve the thyroid gland are primary tumors which include papillary, follicular, medullary, and anaplastic carcinomas . . Primary tumors of the kidney (48.1%), colorectal (10.4%), lung (8.3%) breast (7.8%), and sarcoma (4.0%) are the most common tumors reported to metastasize to the thyroid . It has been widely believed that the thyroid gland, because of its abundant vascular supply is a vulnerable site for metastatic involvement . A few authors have additionally proposed that the susceptibility of the thyroid gland to metastatic growth is increased when affected by goiter, neoplasms, or thyroiditis, and this can be explained due to metabolic changes in the thyroid gland, some other authors have, however, refuted this claim . Metastasis from rccs has been reported to account for nearly 12 - 34% of all secondary thyroid tumors . These tumors may represent the first manifestation or may present as a synchronous or metachronous metastasis in a preexisting clear cell renal carcinoma . The metastases usually are reported to appear as metachronous lesions, often several years after nephrectomy . Although metastasis to the thyroid gland should be suspected in patients with a history of renal tumors, a definitive preoperative diagnosis of primary versus a secondary tumor may not always be straightforward . An fnac of thyroid gland is useful in the diagnosis of secondary tumors as well . The differential diagnosis for tumors with clear cell appearance should include paragangliomas, differentiated thyroid cancer, lung, and salivary gland secondary tumors . A background knowledge of the primary tumor would aid the pathologist in choosing the appropriate ihc markers for confirmation of the final diagnosis, as was used in our patient . There are no clear guidelines regarding the role of thyroidectomy in secondary thyroid tumors from rccs since most clinical studies have included a small numbers of patients . A hemi or a total thyroidectomy is generally recommended in patients with no other metastases; wherein the long term prognosis is good . A palliative thyroidectomy is usually reserved for patients with disseminated disease only in the presence of compressive symptoms as was successfully done in our patient . Interestingly, the previously described association of thyroid and pancreatic metastases of rcc was also noted in our patient . The management of metastatic rccs has undergone dramatic changes over the last decade, and this has mostly been due to the introduction of many targeted agents which have had a positive impact on the overall survival . The role of metastasectomy in the era of targeted therapy is evolving and needs to be better elucidated . The possibility of metastatic rcc should be kept as a differential during the course of the evaluation of clear cell tumor of the thyroid gland, more so when found in a patient with a prior history of renal tumor, irrespective of the duration . The coincidental association of thyroid and pancreatic metastases in rcc needs to be further explored . Metastatectomy has the potential to improve the quality of life and possibly survival in a selected group of patients and should be judiciously used in patients with secondary thyroid tumors from an rcc.
|
Hepatocellular carcinoma (hcc) is the sixth most common cancer worldwide, and it is the third most common cause of death from cancer . Recent studies demonstrated clinical features of multiple primary malignancies involving hcc [2, 3]. However, hcc patients bearing other malignancies with distal metastasis are not only uncommon, but also difficult to diagnose . Therefore, the therapeutic approach for and the clinical course of these patients remains unclear . Herein, we describe a case of metachronous multiple primary malignancies consisting of hcc and gastric cancer with intracranial metastasis . A 76-year - old man visited our hospital because of visual disturbance, weakness of the left upper and lower limbs, and gait disturbance . The patient had been treated for cirrhosis caused by chronic hepatitis c virus (hcv) infection . Because hcc was detected, approximately 60 mm in diameter, in the right lobe, he had undergone transarterial chemoembolization 3 and 10 years earlier . When radiofrequency ablation was performed for the recurrent hcc 2 years ago, the patient had neither a history of smoking nor an elevation of tumor markers for primary lung cancer (such as squamous cell carcinoma antigen and neuron - specific enolase). Since the resected gastric cancer histologically lacked an involvement of lymph nodes, we considered the possibility that lung tumors were of hcc origin . Subsequently, sorafenib was administered . Because of adverse events such as a hand - foot skin reaction, the dose of sorafenib was reduced from 800 to 200 mg / day . On admission, serum levels of hepatobiliary enzymes and renal function markers such as blood urea nitrogen and creatinine were normal . Although blood count tests showed slight anemia (hemoglobin: 11.5 g / dl) and thrombocytopenia (8.5 10/l), his white blood cell count was normal (4,000/l). However, the levels of alpha - fetoprotein (afp), des - gamma - carboxy prothrombin (dcp), and carbohydrate antigen 199 (ca199) were within the normal range (5.6 ng / ml, 21 u / ml, and 10.2 u / ml, respectively). Although the patient's consciousness level was normal [glasgow coma scale was a full score (e4v5m6)], he exhibited left - sided hemifield visual disturbance and left - sided hemiparesis . Enhanced mri revealed an intra - axial tumor in the right occipital cerebral lobe (fig . 2). Taking into consideration the markedly elevated level of carcinoembryonic antigen, but not afp or dcp, we made a preoperative diagnosis of intracranial metastasis of gastric cancer, and a craniotomy of the tumor was performed . Macroscopic examination of the resected specimen revealed that the tumor was yellowish - white, solid, and accompanied by necrosis (fig . Pathological examination revealed that the tumor was consistent with metastatic adenocarcinoma of gastric cancer origin (fig . The patient's visual disturbance, hemiparesis, and gait disturbance markedly recovered to normal after surgery . Follow - up mri conducted 1 week after the craniotomy revealed the successful removal of the tumor . Because a small lesion was detected in the left precentral gyrus, the patient received additional gamma - knife treatment (20 gy). Sorafenib administration was discontinued and s-1 (tegafur / gimeracil / oteracil potassium, 50 mg / day) was administered postoperatively . He was alive for 5 months after the gamma - knife treatment, without any recurrence . Advances in diagnostic modalities and therapeutic approaches have improved the prognosis of patients with multiple primary malignancies . In the diagnosis of multiple primary malignancies, according to the criteria, each of the tumors must be distinct and present a definite picture of malignancy . It has been reported that the prevalence of multiple primary malignancies varies from 0.7 to 11.7% [5, 6]. In western countries, prostate, colon, and in contrast, gastric cancer predominates in asian countries [8, 9]. In our case, although multiple lung metastases were observed concurrently, it was difficult to determine whether the tumor was derived from hcc or gastric cancer . We considered the possibility of hcc origin because of an increase in the serum level of afp and pivka - ii despite the curative treatment of recurrent hcc and histological findings of resected gastric cancer not involving the lymph nodes . The frequency of intracranial metastasis in patients with gastric cancer ranges from 0.16 to 2.0% [10, 11]. It has been documented that aggressive treatments such as resection and/or whole brain radiation therapy could improve the quality of life and prolong the survival [12, 13]. In our case, although another intracranial lesion was detected after craniotomy, the tumor was successfully treated with a gamma - knife . Given that the multiple lung tumors gradually enlarged during the administration of sorafenib, it was undeniable that the lung tumors were derived from gastric cancer . Together, these findings indicate the possibility that sufficiently aggressive treatment for intracranial metastasis of gastric cancer enables further anti - cancer treatment and improves the prognosis, even of patients with multiple primary malignancies . When original tumors are radically treated in patients with multiple primary malignancies, further treatment including craniotomy and gamma - knife for the metastatic intracranial tumors might contribute to prolonged survival . Considering that intracranial metastasis of gastric cancers is frequently accompanied by bone, liver, and lung metastases [10, 14], it is of importance to determine whether or not aggressive treatment, including surgical resection, improves both the performance status and the prognosis of the patients.
|
In humans, cryoglobulinemia can be responsible for a membranoproliferative glomerulonephritis (mpgn), which is characterized by the formation and/or deposition of immunoglobulins (igs) and complement in the glomeruli, followed by an influx of inflammatory cells [1, 2, 3]. Since the early studies to investigate complement activation by immune complexes in experimental nephrotoxic nephritis, the complement system has been considered to play an important proinflammatory role in the glomerulus [5, 6]. In cryoglobulinemia, however, there is no clear evidence that complement activation is central in mediating tissue damage by immune deposits . Results have been obtained in mice by trendelenburg et al ., who analyzed the role of complement in the pathogenesis of initial glomerular inflammation induced by murine 619 igg3 monoclonal cryoglobulins . Their results indicated that complement c5 has a predominant role in neutrophil recruitment as c5-deficient mice had significantly reduced glomerular infiltration by polymorphonuclear neutrophils . This is of particular interest, as the monoclonal complement c5-blocking antibody eculizumab could offer a promising therapeutic option for patients with cryoglobulin - induced glomerulonephritis . Cryoglobulinemia is a rare disease and is characterized by igs that precipitate in the cold . Depending on the clonality of the precipitating igs, three types of cryoglobulinemia can be distinguished . Type i cryoglobulinemia consists of a single monoclonal cryoprecipitable ig, whereas type ii and iii cryoglobulins are mixed, i.e. Composed of monoclonal (type ii) and polyclonal (type iii) antibodies with rheumatoid factor activity against other igs . Mixed cryoglobulinemia may be associated with numerous infectious and immunological diseases as well as lymphatic malignancies . In particular, mixed cryoglobulinemia type ii is strongly associated with chronic hepatitis c, and nowadays rarely appears as an isolated disease, i.e. The so - called essential cryoglobulinemia . Clinically, cryoglobulinemia manifests itself with symptoms like weakness and arthralgias and variable cutaneous and visceral organ involvement [9, 10]. It is poorer in patients with renal involvement, liver failure, lymphoproliferative disease and malignancies . Steroids suppress inflammation with success in some patients, but additional plasmapheresis to remove circulating cryoglobulins and immunosuppressive treatment to inhibit the formation of new cryoglobulins are often necessary [11, 12, 13]., usa) is a monoclonal antibody that targets complement c5 and prevents the cytolytic and proinflammatory effects of complement activation . It effectively reduces intravascular hemolysis, thereby improving anemia and quality of life and decreases transfusion requirements [15, 16]. Since the initial validation of inhibition of a complement component as a therapeutic target, the field for the use of eculizumab has been expanded . Recently, eculizumab has been approved from the fda for the treatment of patients with atypical hemolytic uremic syndrome, in whom the control of complement activation is insufficient . Furthermore, eculizumab has been successfully used preemptive prior to kidney transplantation [18, 19] or postoperatively to prevent disease recurrence in the allograft [20, 21, 22] in several cases with complement disorder - associated atypical hemolytic uremic syndrome . Here, we report on an exceptional case of mixed essential cryoglobulinemia with severe glomerulonephritis characterized by a prominent infiltration of the glomeruli by neutrophils . A 1-patient clinical trial of eculizumab was attempted to investigate whether complement inhibition would be sufficient to inhibit this relapsing glomerulonephritis . The initial partial response was, however, not sustained, and the patient returned to intermittent plasmapheresis . A 55-year - old woman was diagnosed with a mixed type ii cryoglobulinemia (monoclonal igm - kappa and polyclonal igg) and immune complex - mediated glomerulonephritis in may 2006 . She developed an acute nephritic syndrome with pathological urinary sediment (i.e. Dysmorphic erythrocytes, cellular casts and leucocytes), high proteinuria (7 g / day), arterial hypertension, volume overload and moderate renal function impairment, which got worse over time . Further, she suffered from weakness and arthralgias, but other organ manifestations besides the kidney were not present . The first renal biopsy showed endocapillary hypercellularity with infiltration of mononuclear cells, an unusual high number of neutrophils, and subendothelial immune deposits, which were positive for igm as well as complement c3 and c5b-9, resembling acute poststreptococcal glomerulonephritis; however, classical humps were missing (fig . Extensive screening for an infectious disease (i.e. Serological testing and pcr for hiv, hcv, hbv, cmv and ebv) and malignancy (bone marrow biopsy, computed tomography of the chest and abdominal organs) was negative . Further, autoantibodies were negative (ana, anca, anti - dna, antiphospholipid antibodies) except for rheumatoid factor, with a titer> 1/10,000 . A second renal biopsy 1 year later showed early stage mpgn with a still high number of neutrophils, which was interpreted as a progression of disease . The patient was unresponsive to high - dose steroids and subsequently received cyclophosphamide pulse therapy, mycophenolat mofetil and two courses of the monoclonal anti - cd20 antibody rituximab . These immunosuppressive therapies all failed to get the cryoglobulin - induced glomerulonephritis under control . On october 2006, once to twice weekly plasmapheresis was started with success . However, plasmapheresis was complicated by two catheter - related blood stream infections . In addition, she suffered from headache and complained about unpleasant diaphoresis during the procedures . At the request of the patient, plasmapheresis was interrupted several times with prompt disease relapses manifested by an increase in serum creatinine and proteinuria, and reinstitution of intensive plasmapheresis . Thus, we designed a protocol to test whether eculizumab could replace plasmapheresis at the time of a relapse . The protocol was approved by the local ethical committee, and informed consent was provided in accordance with the declaration of helsinki . Criteria for treatment success were: (i) prevention of progression as determined by maintenance or improvement in renal function, (ii) reduction of proteinuria, and (iii) no appearance of new extrarenal disease manifestations . In june 2011, the study was started after the last series of plasma exchange, with a continuous surveillance of renal function and clinical signs of relapse . As expected from previous intervals between plasmapheresis series, it took 3 weeks until relapse . Eculizumab was dosed at 900 mg intravenously every 7 days for 4 weeks, at 1,200 mg 7 days later, and another dose of 1,200 mg 14 days later . At that time of initiating eculizumab therapy, mol / l (egfr 13 ml / min), proteinuria was 8 g / day and the patient still had nephritic urinary sediment . The patient had been vaccinated against neisseria meningitis 14 days prior to receive the first dose of eculizumab . 2 shows the clinical course and renal function (i.e. Serum creatinine and proteinuria), before and after initiating eculizumab . Blood samples were drawn to control blood concentrations of eculizumab and blockage of the complement system during the treatment . Complement activity was shown to be blocked using a hemolytic assay (ch50) and by the drop to background of the high levels of soluble c5b-9 (microvue complement sc5b-9 plus; quidel corporation, san diego, calif . The eculizumab infusions were well tolerated and the patient reported an improvement in her well - being . Nevertheless, without plasmapheresis the blockage of the terminal complement was not sufficient to control the disease . Proteinuria remained at high levels of 68 g / day, hematuria persisted and renal function remained stable for some weeks before deteriorating . After 7 weeks of therapy, the patient was urgently admitted to hospital because of fluid overload . To our knowledge, this is the first report of a clinical trial to investigate the monoclonal complement inhibitor eculizumab in a patient with mixed cryoglobulinemia and severe glomerulonephritis . The unique features of the cryoglobulinemic mpgn in this patient were the resistance to treatments such as steroids, cyclophosphamide and rituximab, the presence of high numbers of neutrophils in two renal biopsies taken at 1-year interval (on both occasions at the time of a severe relapse), and the prompt response to plasmapheresis . All these features suggested that complement was a major player in the disease process: indeed complement was activated and deposited in the glomeruli, and complement factor c5a is known to be a highly active chemotactic agent for neutrophils . In addition, recently macrophages have been shown to be central to the nephritis in a model of murine cryoglobulinemic mpgn . The improvement felt by the patient and the stabilization of the creatinine level after initiation of eculizumab suggested that complement might be involved in the inflammation and tissue damage induced by cryoglobulins . However, it became evident after 7 weeks that there was no improvement, rather a slow deterioration of renal function with ongoing signs of active nephritis in the urinary sediment . This observation does, however, not exclude a role for complement in cryoglobulin - induced glomerulonephritis . For instance, we do not know whether complement blockade would prevent a relapse, i.e. Whether complement might induce a cascade of inflammatory events, which then become independent of continuous complement activation . Further, one can argue that the blockage of c5 by eculizumab plays a central role to prevent the chemotactic function of c5a for the recruitment of neutrophils . Once they have invaded the glomerulus where the inflammatory processes take place, they act independently of complement c5a, which has no proinflammatory effects . This would be an argument for a prophylactic and sustained use of eculizumab in patients with cryoglobulinemia when the disease is in remission and against its use as a salvage therapy in disease relapse, to induce a more prolonged remission or reduce the frequency of relapses ., where the c5-deficient mice had impressively less influx of neutrophils, as their experimental model of cryoglobulin - induced glomerulonephritis rather resembles a model of preemptive blockage of c5a to prevent glomerular inflammation just at the beginning and not when the inflammatory process is fully developed as it is in case of a relapse . In addition, eculizumab will not prevent the deposition of c3 fragments and release of c3a, which by themselves might interact with complement receptors on mesangial cells, macrophages / monocytes and neutrophils and activate these cells . Usually, the development of clinical therapy protocols relies on evidence - based guidelines that mainly focus on randomized, controlled trials; however, for rare diseases, such as in the present case of essential cyoglobulinemia, treatment options rely on similarities to other diseases and the understanding of the pathological process on experimental data obtained in animal models . Since human data of cryoglobulinemia are scarce, the present 1-patient trial report demonstrating the response to eculizumab whether considered partially positive or negative might be of use for the medical community.
|
Despite the availability of a large number of therapeutic agents for the management of type 2 diabetes (t2d), patients continue to present with high levels of glycated hemoglobin a1c (hba1c) in actual clinical practice . Insulin is the most potent therapy for t2d; however, physicians often take a conservative approach to insulin dose optimization citing lack of familiarity and the risks of hypoglycemia and weight gain as some of the main concerns associated with its use . It is acknowledged that insulin therapy tailored towards the requirements of individual patients would be more effective in helping patients manage hyperglycemia, while mitigating the risks of hypoglycemia and weight gain . A study by riddle et al . Suggests that basal (fasting) glucose, rather than postprandial plasma glucose (pppg), tends to contribute more towards overall hyperglycemia at higher hba1c levels in t2d patients . Basal insulin therapy could therefore help decrease hyperglycemia in t2d patients by providing additional glycemic control . Insulin detemir (idet) is a basal insulin analogue with a protracted duration of action compared to neutral protamine hagedorn (nph) insulin . Idet remains soluble in the subcutaneous depot following injection, which may contribute to its lower within - subject variability with regard to nph insulin and another basal analogue, insulin glargine (iglar). Studies have found that idet provides hba1c reductions in t2d patients comparable to those provided by iglar and nph insulin . Idet therapy is also associated with significantly less weight gain compared to iglar and nph insulin in t2d management . It has also been noted that glycemic control improved following idet therapy in t2d patients previously treated with other basal insulins in combination with oral glucose - lowering drugs (oglds). In india, the t2d epidemic is widespread with a reported diabetes prevalence of 9.0% in 2011 . By 2030, the diabetes prevalence is set to increase to 10.6%, marking the urgent need to improve t2d management in the country . In developing nations such as india where diabetic complications are common and a large segment of the population is of working age, the high t2d prevalence can have serious economic implications as well . Evidence from randomized controlled trials however, the patient populations of these trials are selected based on restrictive criteria and may not be truly representative of the patients seen in actual clinical practice . Large observational studies such as a1chieve, on the other hand, can provide relevant and timely data that would help in gauging patient responses to different therapies in a heterogeneous setting . This sub - analysis of the a1chieve study aimed to determine the clinical safety and effectiveness of insulin detemir in indian patients switched from previous nph insulin or iglar therapy . In the open - label, 24-week, non - interventional a1chievestudy, the clinical safety and effectiveness of the novo nordisk insulin analogs, idet (levemir), biphasic insulin as part 30 (novomix 30) and insulin as part (novorapid) in the treatment of t2d was evaluated in routine clinical care . Here, the clinical safety and effectiveness of idet was explored in indian patients switched from either iglar or nph insulin . Have described the methods and procedures of the a1chieve study in detail . In brief, the prescription of idet was determined by the local physicians, who also supervised all aspects of the patients treatment . The physicians performed all evaluations at routine visits to the local clinics, following which the data were transferred to standard case report forms . Indian patients switching therapy from either pre - study iglaror nph insulin to idet were included in this sub - analysis . Patients were excluded if they had received treatment with any of the study insulins for more than 4 weeks before the start of the study . Pregnant or breastfeeding women were excluded as were those who intended to become pregnant within 6 months from the start of the study . Study approval was obtained from the relevant local authorities and signed informed consent was obtained from all patients . The primary outcome measure was the incidence of serious adverse drug reactions (sadrs), including major hypoglycemic events, from baseline to week 24 . Secondary outcomes included the number of serious adverse events (saes) and the changes in the proportion of patients reporting hypoglycemic events in the 4 weeks before baseline and week 24 . Additional outcomes comprised the change from baseline to week 24 in hba1c, fasting plasma glucose (fpg), pppg, systolic blood pressure (sbp), body weight, lipids (total cholesterol, triglycerides, high - density lipoprotein [hdl] cholesterol, and low - density lipoprotein [ldl] cholesterol) and quality of life (qol). Qol was determined using the euroqol visual analogue scale (eq - vas) that rates an individual's current health state on a scale of 0 (worst score) to 100 (best score). Local laboratories were used for laboratory measurements and followed local standardization and quality control procedures . Statistical analyses were performed for indian patients switching from pre - study iglar and nph insulin . Descriptive statistics (mean, sd) and frequency tables (n,%) were used to summarize continuous and discrete variables, respectively . The change from baseline to week 24 in the proportion of patients reporting at least one event of hypoglycemia the change from baseline to week 24 for hba1c, fpg, pppg, sbp, body weight, lipids, and qol was analyzed using a paired t - test . No p values are presented as the number of patients analyzed was less than 100 for all endpoints . In the open - label, 24-week, non - interventional a1chievestudy, the clinical safety and effectiveness of the novo nordisk insulin analogs, idet (levemir), biphasic insulin as part 30 (novomix 30) and insulin as part (novorapid) in the treatment of t2d was evaluated in routine clinical care . Here, the clinical safety and effectiveness of idet was explored in indian patients switched from either iglar or nph insulin . Have described the methods and procedures of the a1chieve study in detail . In brief, the prescription of idet was determined by the local physicians, who also supervised all aspects of the patients treatment . The physicians performed all evaluations at routine visits to the local clinics, following which the data were transferred to standard case report forms . Indian patients switching therapy from either pre - study iglaror nph insulin to idet were included in this sub - analysis . Patients were excluded if they had received treatment with any of the study insulins for more than 4 weeks before the start of the study . Pregnant or breastfeeding women were excluded as were those who intended to become pregnant within 6 months from the start of the study . Study approval was obtained from the relevant local authorities and signed informed consent was obtained from all patients . The primary outcome measure was the incidence of serious adverse drug reactions (sadrs), including major hypoglycemic events, from baseline to week 24 . Secondary outcomes included the number of serious adverse events (saes) and the changes in the proportion of patients reporting hypoglycemic events in the 4 weeks before baseline and week 24 . Additional outcomes comprised the change from baseline to week 24 in hba1c, fasting plasma glucose (fpg), pppg, systolic blood pressure (sbp), body weight, lipids (total cholesterol, triglycerides, high - density lipoprotein [hdl] cholesterol, and low - density lipoprotein [ldl] cholesterol) and quality of life (qol). Qol was determined using the euroqol visual analogue scale (eq - vas) that rates an individual's current health state on a scale of 0 (worst score) to 100 (best score). Local laboratories were used for laboratory measurements and followed local standardization and quality control procedures . Statistical analyses were performed for indian patients switching from pre - study iglar and nph insulin . Descriptive statistics (mean, sd) and frequency tables (n,%) were used to summarize continuous and discrete variables, respectively . The change from baseline to week 24 in the proportion of patients reporting at least one event of hypoglycemia the change from baseline to week 24 for hba1c, fpg, pppg, sbp, body weight, lipids, and qol was analyzed using a paired t - test . No p values are presented as the number of patients analyzed was less than 100 for all endpoints . A total of 102 patients switched therapy from pre - study iglar to idet (gla group), while 39 patients switched from pre - study nph insulin to idet (neu group). Demographic and baseline characteristics of the gla and neu groups are presented in table 1 . Demographic and baseline characteristics by pre - study basal insulin regimen at baseline, the most commonly used oglds were metformin and sulfonylureas in both groups [table 1]. The three most common reasons reported by physicians for therapy change were to improve glycemic control (for 96.1% of patients), reduce the risk of hypoglycemia (42.2% of patients) and improve weight control (32.4% of patients) in the gla group . In the neu group, the most common reasons for therapy change were to improve glycemic control (97.4% of patients), reduce the risk of hypoglycemia (51.3% of patients) and try a new insulin (25.6% of patients). Insulin dose and frequency by pre - study basal insulin regimen the mean pre - study iglar dose was 0.26 0.13 u / kg, and 84.3% of patients followed qd dosing . The mean idet dose was 0.23 0.09 u / kg at baseline and 0.25 0.12 u / kg at week 24 . At baseline, 87.3% of patients dosed idet qd, while at week 24, 62.7% and 37.3% of patients followed qd and bid dosing, respectively . The mean pre - study nph insulin dose was 0.27 0.16 iu / kg, and 64.1% and 35.9% of patients followed qd and bid dosing, respectively . At baseline and week 24, the mean idet dose was 0.24 0.09 u / kg and 0.28 0.09 u / kg, respectively . While 87.2% of patients followed qd dosing at baseline, 67.7% and 32.3% of patients followed qd and bid dosing, respectively, at week 24 . There were no sadrs, saes, or major hypoglycemic events reported in either group throughout the study . In the gla group, 11.8% of patients reported overall hypoglycemia at baseline compared to 7.5% at week 24 [table 3]. The corresponding incidence rates of overall hypoglycemia were 2.80 events per patient - year and 1.36 events per patient - year, respectively . No nocturnal hypoglycemic events were reported at week 24 in the gla group [table 3]. Outcomes for hypoglycemia by pre - study basal insulin regimen at baseline in the neu group, 10.3% of patients reported overall hypoglycemia, corresponding to an incidence rate of 2.33 events per patient - year [table 3]. At week 24, no hypoglycemic event of any category was reported in the neu group . In the gla group, the mean sd hba1c was 9.9 1.8% at baseline compared to 7.6 0.9% at week 24 (mean change: 2.3 the mean hba1c level was 9.1 1.2% at baseline and 7.3 0.7% at week 24 (mean change: 1.7 0.9%). Fifteen patients had hba1c levels of <7.0% at week 24 in the gla group compared to 3 patients at baseline . In the neu group, 6 patients had hba1c levels of <7.0% at week 24 compared to 1 patient at baseline . The mean fpg and pppg levels also appeared to improve from baseline to week 24 in the gla and neu groups [table 4]. Glycemic parameters by pre - study basal insulin the mean levels of total cholesterol, triglycerides, and ldl cholesterol appeared to improve over 24 weeks in the gla and neu groups, while the mean hdl cholesterol levels appeared unchanged in both groups [table 5]. Outcomes for lipid profile, body weight and sbp by pre - study basal insulin regimen in the gla group, the mean body weight was 72.1 11.7 kg at baseline and 72.3 11.3 kg at week 24 [table 5]. Over the same period in the neu group, the mean body weight was 69.5 13.0 kg and 69.8 12.4 kg, respectively . At baseline and week 24, the mean sbp was 131.6 13.8 mmhg and 128.5 15.7 mmhg, respectively, in the gla group, and 140.5 16.0 mmhg and 132.8 12.2 mmhg, respectively, in the neu group [table 5]. In the gla group, the mean qol score on the eq - vas was 56.2 10.9 points at baseline compared to 72.4 10.5 points at week 24 . In the neu group, the mean qol score was 56.6 6.7 points at baseline and 73.8 9.9 points at week 24 . A total of 102 patients switched therapy from pre - study iglar to idet (gla group), while 39 patients switched from pre - study nph insulin to idet (neu group). Demographic and baseline characteristics of the gla and neu groups are presented in table 1 . Demographic and baseline characteristics by pre - study basal insulin regimen at baseline, the most commonly used oglds were metformin and sulfonylureas in both groups [table 1]. The three most common reasons reported by physicians for therapy change were to improve glycemic control (for 96.1% of patients), reduce the risk of hypoglycemia (42.2% of patients) and improve weight control (32.4% of patients) in the gla group . In the neu group, the most common reasons for therapy change were to improve glycemic control (97.4% of patients), reduce the risk of hypoglycemia (51.3% of patients) and try a new insulin (25.6% of patients). Insulin dose and dosing frequency details are presented in table 2 . Insulin dose and frequency by pre - study basal insulin regimen the mean pre - study iglar dose was 0.26 0.13 u / kg, and 84.3% of patients followed qd dosing . The mean idet dose was 0.23 0.09 u / kg at baseline and 0.25 0.12 u / kg at week 24 . At baseline, 87.3% of patients dosed idet qd, while at week 24, 62.7% and 37.3% of patients followed qd and bid dosing, respectively . The mean pre - study nph insulin dose was 0.27 0.16 iu / kg, and 64.1% and 35.9% of patients followed qd and bid dosing, respectively . At baseline and week 24, the mean idet dose was 0.24 0.09 u / kg and 0.28 0.09 u / kg, respectively . While 87.2% of patients followed qd dosing at baseline, 67.7% and 32.3% of patients followed qd and bid dosing, respectively, at week 24 . There were no sadrs, saes, or major hypoglycemic events reported in either group throughout the study . In the gla group, 11.8% of patients reported overall hypoglycemia at baseline compared to 7.5% at week 24 [table 3]. The corresponding incidence rates of overall hypoglycemia were 2.80 events per patient - year and 1.36 events per patient - year, respectively . No nocturnal hypoglycemic events were reported at week 24 in the gla group [table 3]. Outcomes for hypoglycemia by pre - study basal insulin regimen at baseline in the neu group, 10.3% of patients reported overall hypoglycemia, corresponding to an incidence rate of 2.33 events per patient - year [table 3]. At week 24, no hypoglycemic event of any category was reported in the neu group . In the gla group, the mean sd hba1c was 9.9 1.8% at baseline compared to 7.6 0.9% at week 24 (mean change: 2.3 1.7%). In the neu group, the mean hba1c level was 9.1 1.2% at baseline and 7.3 0.7% at week 24 (mean change: 1.7 0.9%). Fifteen patients had hba1c levels of <7.0% at week 24 in the gla group compared to 3 patients at baseline . In the neu group, 6 patients had hba1c levels of <7.0% at week 24 compared to 1 patient at baseline . The mean fpg and pppg levels also appeared to improve from baseline to week 24 in the gla and neu groups [table 4]. The mean levels of total cholesterol, triglycerides, and ldl cholesterol appeared to improve over 24 weeks in the gla and neu groups, while the mean hdl cholesterol levels appeared unchanged in both groups [table 5]. Outcomes for lipid profile, body weight and sbp by pre - study basal insulin regimen in the gla group, the mean body weight was 72.1 11.7 kg at baseline and 72.3 11.3 kg at week 24 [table 5]. Over the same period in the neu group, the mean body weight was 69.5 13.0 kg and 69.8 12.4 kg, respectively . At baseline and week 24, the mean sbp was 131.6 13.8 mmhg and 128.5 15.7 mmhg, respectively, in the gla group, and 140.5 16.0 mmhg and 132.8 12.2 mmhg, respectively, in the neu group [table 5]. In the gla group, the mean qol score on the eq - vas was 56.2 10.9 points at baseline compared to 72.4 10.5 points at week 24 . In the neu group, the mean qol score was 56.6 6.7 points at baseline and 73.8 9.9 points at week 24 . This sub - analysis demonstrated the clinical safety and effectiveness of idet therapy in indian patients with t2d switched from iglar and nph insulin . As observed in the overall a1chieve study, idet therapy appeared to be associated with beneficial effects on glycemic parameters and hypoglycemia . Glycemic control was sub - optimal at baseline in patients previously treated with iglar and nph insulin . In the gla group, patients had a mean baseline hba1c of 9.9 1.8%, diabetes duration of 9.0 5.7 years and had been taking insulin for an average of 2.6 2.0 years . In the neu group, the mean baseline hba1c level was 9.1 1.2%, diabetes duration was 8.9 6.3 years and patients had been on insulin therapy for an average of 2.5 2.9 years . Switching to idet therapy was seen to be well - tolerated in the gla and neu groups with no sadrs, saes, or major hypoglycemic events reported during the study . Clinical trials have not identified any difference between idet and iglar with regard to the risk of hypoglycemia . In this sub - analysis, the incidence rate of overall hypoglycemia was 2.80 events per patient - year at baseline and 1.36 events per patient - year at week 24 in the gla group . No nocturnal hypoglycemic events were reported at week 24 in the gla group against an incidence rate of 1.91 events per patient - year at baseline . Idet has been noted to have a significantly lower risk association for hypoglycemia than nph insulin in 2 randomized controlled trials in patients with t2d . In the neu group in this study, no events of hypoglycemia were reported at week 24 against a baseline incidence rate of 2.33 events per patient - year . Glycemic parameters appeared to improve after 24 weeks in both the gla and neu groups . At week 24, the mean hba1c was 7.6 0.9% in the gla group and 7.3 0.7% in the neu group . However, these levels still fall short of the internationally recommended hba1c target of <7.0% . Also, the number of patients meeting the hba1c target of <7.0% at week 24 was low in both groups . Most patients (> 60%) in both the gla and neu groups followed qd dosing of idet at week 24, with the remaining patients following bid dosing . In the gla group, the mean daily insulin dose by weight was 0.23 0.09 u / kg at baseline and 0.25 0.12 u / kg at week 24 . In the neu group also, the difference in mean dose between baseline and week 24 was small (0.24 0.09 and 0.28 0.09, respectively), suggesting that perhaps the physicians were overly cautious in applying dose titration . It is possible that a more aggressive approach to dose titration may have led to more effective reductions in glycemic levels and more patients achieving the recommended hba1c target at week 24 . A general lack of insulin dose optimization in clinical practice in india has also been identified in the prospective 26-week impact study, which evaluated the effectiveness of the indian insulin guideline on premixed insulin . Mean body weights remained very similar from baseline to week 24 in both the gla and neu groups, in line with the known weight - sparing effect of idet therapy . The mean qol also appeared to improve with idet therapy in both groups, in line with the overall a1chieve study results that showed a significant improvement in qol in patients treated with idet . This study may have been limited by the lack of a control group and the possible introduction of recall bias in the reporting of safety data, particularly hypoglycemic events . The small number of patients in this sub - analysis was also a limiting factor . Concomitant medication and diet were not restricted; hence, it was not possible to determine the effect, if any, of non - pharmacological treatment on the study outcomes . The heterogeneity of the local healthcare systems meant that there was no standardization across sites . However, this study provided the opportunity to study the effect of switching therapy from nph insulin and iglar to idet in the routine clinical setting in india . All measurements made by the laboratories followed local standardization procedures and the 24-week duration of the study was considered adequate to determine the preliminary clinical trend following therapy change . Data from non - interventional studies such as a1chieve can help bridge the gap between recommended healthcare policies for t2d and actual clinical practice . Also, patient education can play a key role in improving compliance to blood glucose monitoring, weight control, diet and exercise . A holistic approach to the treatment of t2d, involving increased patient education, recommendations for diet and exercise and therapeutic strategies that target glycemic levels without increasing the risk of hypoglycemia and weight gain, may be indicated to improve patient compliance and facilitate disease management . In this sub - analysis, idet therapy was noted to be well - tolerated with minimal change in weight and a low risk of hypoglycemia in patients switched from nph insulin and iglar . It would be interesting to note the effect of additional dose titration with idet over a further period of evaluation in a larger patient group.
|
The sequencing of several genomes and the hapmap project, coupled to high - density genotyping technologies and new statistical tools, have made possible the systematic interrogation of the genetic basis of complex traits in humans . Largely consistent with the community's expectations, the past two years have seen a logarithmically expanding number of genomic regions associated with a broad range of phenotypes (see for an updated list). We now know of at least 16 potential susceptibility loci for type 2 diabetes in the human genome, and there are similar or better numbers for other diseases, including type 1 diabetes (24 + loci) and crohn's disease (30 + loci; see for examples). Similar progress has been made in the identification of genomic regions that influence quantitative traits, such as height, metabolite abundance and drug response . These discoveries infuse us with optimism about the potential for understanding the key homeostatic pathways that are causally related to these disorders, which could lead to new drug development and better patient management . At the same time, these studies have presented us with some surprising findings . Most importantly, lost in the collective euphoria of apparently rapid progress is the fact that, some notable exceptions notwithstanding, we are now faced with three major challenges . Firstly, the total sum of disease risk attributed to common variants detected by genome - wide association studies (gwass) remains modest, raising a problem analogous to the astrophysicists' search for' dark matter' . Secondly, the overwhelming majority of single nucleotide polymorphisms (snps) associated with disease lie in intra- or intergenic regions; there has been a striking dearth of coding snps . Finally, almost none of the association studies have led to the identification of the causal allele(s), and thus neither the' disease - associated' gene, nor indeed the type of lesion (gain - of - function, loss - of - function, and so on), can be identified unequivocally . The sheer number of disorders subjected to gwas suggests that these deficiencies are unlikely to be random findings, or to represent idiosyncratic genetic architecture of specific phenotypes . Rather, it is likely that these observations result from biological principles that will require a significant shift in our approach to understand them . The second challenge, that of the modest risk conferred by common variants, is in some ways a minor problem, despite the unwelcome consequence that it potentially hinders, and might even defeat, the utility of high - density genotyping as a prognostic clinical tool . The fact that the relative risk conferred by most snps associated with crohn's disease lingers in the 1.2 - 1.5 range (with the exception of alleles of nod2, which encodes nucleotide oligomerization domain protein 2, and il23r, which encodes the interleukin-23 receptor) does not detract from the establishment of the hypothesis that defective autophagy is part of the cause of this disorder, which has, in turn, enabled the development of mammalian models to study the disease process . Likewise, the association of the same genomic regions with discrete disorders can highlight not only suspected relationships (rheumatoid arthritis and lupus), but also novel and surprising ones (diabetes and colon cancer; see for more details). The first and third challenges mentioned above, those of the genetic' dark matter' and allele causality (coupled to mutational models), are more complex and are probably interlinked . Reasonable hypotheses have been put forth that suggest that the failure to detect the majority of the genetic load in complex disease is a reflection of insufficient statistical power, as evidenced by the accelerated locus discovery by meta - analyses . At the same time, evolutionary arguments have been proposed to explain the preferential enrichment of non - coding variants in complex disease . Most prominently, it has been suggested that strong (often coding) mutations that have a significant impact on fitness would be more likely to be associated with mendelian disorders, whereas milder alleles that affect spatiotemporal patterns of gene expression are more likely candidates for exerting modest effects in complex disease . It is reasonable to predict that understanding of the total genetic load in complex disease will be enhanced by higher density genotyping, increased sample size and expanded ethnic diversity, and medical resequencing of risk regions . Importantly, however, none of these tools will unequivocally enable the transition from association to causality . The sobering reality remains that, despite the hundreds of loci identified, the number of bona fide genes associated with complex disease identified through gwass is modest . Regrettably, a guilty - by - association view has emerged and the definitions of' locus' and' gene' are becoming dangerously interchangeable . At best, most arguments for the role of specific genes on conferring susceptibility put forth to date are correlative; although many will turn out to be correct, this is unlikely to be the ubiquitous truth . Case - control association studies pointed to a region on 10q26 that conferred strong susceptibility to amd, and further work suggested that variation in the promoter region of htra1, which encodes a multi - functional serine protease, might explain the effect . However, additional genotyping and, independently, complete resequencing of the risk haplotype, pointed to a deletion in the 3' untranslated region (utr) of predicted transcript loc387715 that destabilizes its message, suggesting that loss of that transcript, and not htra1, drives the susceptibility to amd . Unfortunately, the presence of a haplotype that is not associated with amd that carries a premature termination codon in loc387715 confounds that hypothesis as well . Similar questions should be raised about the direct involvement in obesity of the fto gene, given that the associated snp lies in intron 1 of that gene's transcript . Even though the fto protein is now being investigated mechanistically to understand energy regulation, there is no actual evidence that fto is the gene that underlies the association . Notably, fto, and the neighboring gene ftm (or rpgrip1l), which lies less than 1 kilobase away in a head - to - tail orientation, have been shown to be co - regulated by the transcription factor cutl1, and at least one of the associated snps maps to a predicted cutl1 binding site, raising the possibility that dysfunction at ftm, not fto, might be the driver of the phenotype . Intriguingly, ftm is mutated in several ciliopathies, which are hallmarked, among other features, by hyperphagia - driven obesity . There is no doubt that additional, denser genotyping, admixture mapping and deep resequencing will refine current loci and uncover new ones . However, it is important to consider the relative value of these data without physiologically relevant functional interpretation . In some instances, population- and genetic - based arguments can suggest that certain alleles cause certain phenotypes, as has been shown by medical resequencing of candidate genes in patients at the extremes of high - density lipoprotein (hdl) and low - density lipoprotein (ldl) plasma levels . Nonetheless, even in these examples, in vitro assays that tested the functional consequences of the mutations were necessary for the researchers to present compelling arguments . Given these observations, it might be prudent to refocus our efforts on how to evaluate the physiological impact of genetic and genomic variation on gene function, because without that ability, the contribution of additional gwass on understanding disease mechanisms will remain limited . Given the plethora of in vitro and in vivo tools available to the community, it should be possible to develop assays that can test directly the effect of gene variation in appropriate cell lines, cell types and animal models; without such tools, we might be left with an unexplorable catalog of associated snps but gain little wisdom about how to develop diagnostics and therapeutics for complex traits . Amd: age - related macular degeneration; gwas: genome - wide association study; snp: single nucleotide polymorphism . I thank sara katsanis and erica davis for helpful discussion and editing of the manuscript . This work was supported by grants r01hd04260 from the national institute of child health and development, r01dk072301 and r01dk075972 from the national institute of diabetes, digestive, and kidney disorders and p20mh084018 from the national institute of mental health.
|
Evidence is accumulating that enteric glial cells (egc) are the morphological and functional equivalent of the astrocytes found in the central nervous system (cns).recent studies have demonstrated that egc participate in homeostasis of the gastrointestinal tract . In transgenic mouse models in which egc are selectively ablated, the loss of glia results in intestinal inflammation and disruption of the epithelial barrier . In vitro experiments showed that chronic egc activation causes the release of proinflammatory cytokines and nitric oxide (no) in the enteric neuroimmune network [4, 5]. No is a weak radical produced from l - arginine via the enzyme no synthase (nos). Because increased no production via inducible nos (inos) is involved in the pathogenesis of inflammatory bowel disease (ibd), alterations in enteroglial structure have been studied extensively in patients with ibd [79]. Demonstration of the increased enteroglial - derived s100b protein expression together with a significant increase in no production in intestinal biopsy specimens of patients with celiac disease and ulcerative colitis (uc) suggests that egc participate directly in chronic mucosal inflammation via s100b upregulation stimulating no production . These findings were confirmed using in vitro cultures of human egc exposed to proinflammatory stimuli, in which significant increases in the cell proliferation rate, expression of s100b protein, and no production consequent to the induction of egc - derived inos protein were seen when egc are activated [4, 5]. Enteric glial cells express not only s100b, but also high levels of glial fibrillary acidic protein (gfap). Several studies have shown that s100b immunoreactivity mostly colocalizes with the gfap - positive enteroglial mucosal network in tissue specimens from patients with intestinal inflammation [1, 5]. Similarly, in the cns, astrocytes induce endothelial cells to form the tight junctions of the blood - brain barrier (bbb). A peripheral blood - tissue barrier similar to the bbb exists in the intestine where the neuronal plexi are similarly impermeable to systemic macromolecules . In this sense, egc, besides releasing cytokines, likely control the integrity and permeability of the submucosal blood vessels to confer intestinal epithelial barrier functions, as demonstrated in animal studies in which ablation of the enteroglial network enhances intestinal vascular permeability, resulting in severe mucosal inflammation [3, 7]. Cns astrocytic glial markers have been studied extensively in the peripheral blood of patients with either traumatic brain injury or cerebral infarcts . Although suggestive, data on egc - derived glial markers are limited to the abovementioned experimental models of intestinal inflammation in the human gut [1, 4, 5, 10], while there is a lack of data on serum levels . We hypothesized that a disruption of egc populations could lead to altered serum levels of egc - derived s100b and gfap via disruption of the peripheral blood - tissue barrier in patients with uc . This study investigated whether these enteroglial markers could serve as noninvasive indicators of egc activation and the disease activity in patients with uc . Thirty - five uc patients from erciyes university medical school, gastroenterology department, and 40 age- and sex - matched controls from bozok university medical faculty, neurology department, ranging in age from 30 to 65 years, were enrolled in this cross - sectional prospective study between january 2012 and june 2013 . The diagnosis of uc was based on standard clinical, radiological, endoscopic, and histological criteria . Clinical disease activity was evaluated using the modified truelove - witts severity index (mtwsi) [1315]. Clinical active disease was defined as an estimated mtwsi score of 4 or higher and patients with a score lower than 4 were considered to be in remission (inactive). The uc patients included were all on mesalazine, and 11 (31.4%) were in remission with immunosuppressive agents including azathioprine or steroids . Patients with malignancy, chronic renal, hepatic, cardiovascular, or connective tissue diseases, thyroid disease, diabetes mellitus, chronic obstructive pulmonary disease, a history of local trauma or surgery, and acute or chronic infections were excluded from the study . In addition, those who were pregnant, morbidly obese, current smokers, or current consumers of alcohol were excluded . The study protocol was approved by the bozok university research ethics committee, and written informed consent was obtained from all participants . Body mass index (bmi) was calculated as the weight in kilograms divided by the square of height in meters . Fasting venous blood samples were analyzed for measuring the erythrocyte sedimentation rate (esr), c - reactive protein (crp), and white blood cell count (wbc) using standard methods . The specimens were centrifuged at 5000 rpm for 5 min, after which the supernatant was removed immediately and kept frozen at 80c until assayed . All serum samples were prepared within 30 min . Serum samples were analyzed for human gfap and s100b using commercial enzyme - linked immunosorbent assay (elisa) kits for human gfap and s100b (biovendor research and diagnostic products; heidelberg; germany). The samples were assayed following the manufacturer's protocol in the laboratory of bozok university medical faculty . For the gfap elisa, 100 l of diluted standard, quality controls, and serum samples were applied to an antibody - coated microtiter plate and incubated for 120 min, with shaking at 300 rpm on an orbital microplate shaker . After washing, 100 l of biotin labeled antibody solution was added to each well and incubated for 60 min, with shaking at 300 rpm . After washing, 100 l of conjugate was added and the plate was incubated for 60 min, with shaking at 300 rpm . After the third wash, 100 l of substrate solution was added and the plate incubated for a further 15 min in the dark . Then, 100 l of stop solution was added and the absorbance was measured at 450 nm on a microtiter plate reader . The gfap levels in the culture medium were determined using a standard curve of gfap . Similarly, serum samples were used for s100b elisa . To minimize the assay variation, all serum samples were analyzed on the same day in the same laboratory batch and by the same analyst at bozok university medical faculty . The limits of detection for human gfap and s100b were 0.045 ng / ml and 15 pg / ml, respectively . The serum gfap concentrations are expressed in ng / ml, whereas the s100b concentrations are expressed in pg / ml . The shapiro - wilk test, histograms, and q - q plots were used to test the normality of the data, and levene's test was used to assess the variance in homogeneity . Independent - sample t - tests and mann - whitney u tests were used to compare differences between continuous variables, and chi - square () analyses were used to assess differences between categorical variables . Pearson correlations were used to examine the relationships between s100b and uc disease activity and duration . Values are expressed as frequencies and percentages, means and standard deviations, or medians and interquartile ranges . Analyses were conducted using spss 15.0 (spss; chicago, il; usa), and statistical significance was set at p <0.05 . The demographic and laboratory data for the control group and patients with uc are summarized in table 1 . No significant differences were found between the groups in terms of age or sex (p> 0.05). Bmi was significantly lower in the patients with uc compared with the controls (p <0.05). The esr and crp were significantly higher in uc patients than in controls (p <0.001), whereas the wbc was similar in both groups (p> 0.05). No gfap was detected in the serum samples of either uc patients or controls (p> 0.05; table 2). However, we found a significant decrease in the s100b serum levels in patients with uc compared with the controls (p <0.001; table 2; figure 1). No correlation between the serum s100b levels and the disease activity or duration was observed (p> 0.05). Twenty - four (68.6%) patients were defined as having clinically active disease and 11 (31.4%) patients were in remission . The serum s100b levels did not differ between active and remission uc patients (p> 0.05). The main findings of this study were as follows: (1) gfap was not detected in either the uc patients or controls, while the serum s100b levels were decreased markedly in the uc patients; (2) there was no correlation between the serum s100b levels and the disease activity or duration in uc patients; and (3) the serum s100b levels were similar in active and remission uc patients . Similar to astrocytes in the cns, we hypothesized that disruption of intestinal barrier function or dysregulation of submucosal vascular function could lead to altered serum levels of egc - derived s100b and gfap in patients with uc . The expression of gfap is modulated by glial cell differentiation, inflammation, and injury, and the gfap level corresponds to the functional state of glial cells . In animals, two classes of glial cells can be distinguished: gfap - positive and -negative groups . Von boyen et al . Suggested that proinflammatory cytokines control gfap - positive enteric glia, which are in turn involved in modulating the integrity of the bowel during inflammation . In humans, gfap expression is altered in the mucosa of patients with ibd . In an animal model of crohn's disease, the glial network was impaired in noninflamed regions of the intestinal mucosa, which was reflected in a significant decrease in gfap immunoreactivity . Thus, we might expect gfap to be detected in the serum of individuals with uc, mainly due to the disruption of egc populations via the disruption of the peripheral blood - tissue barrier . However, no gfap was detected in the serum samples of either uc patients or controls . A possible explanation is that gfap is strictly specific to cns - related astrocytic processes . S100b belongs to a multigene family of calcium binding proteins and is expressed abundantly in the brain . It is a small, diffusible neurotrophin that is situated in the cytoplasm or nucleus of cells in both nervous system and non - nervous system tissues . In the brain, as an intracellular regulator, s100b affects protein phosphorylation, energy metabolism, the dynamics of the cytoskeleton constituents, calcium homeostasis, and cell proliferation and differentiation [18, 23]. At the extracellular level, s100b has a dual role: it acts as a neuroprotective or a neurotoxic or neurodegenerative molecule depending on its concentration . At picomolar or nanomolar concentrations, s100b promotes neuron survival, neurite outgrowth, and astrocyte proliferation and negatively regulates astrocytic responses to neurotoxic agents [18, 23]. Micromolar amounts of s100b protein produce neuronal death, as seen in several neuropathologies, such as alzheimer's disease and down syndrome . In the human gut, among s100 proteins, only s100b protein is specifically and physiologically expressed by egc [1, 5, 10], while other members, such as s100a8, s100a9, and s100a12, are found in phagocytes and intestinal epithelial cells in patients with ibd . S100b interacts with target proteins within cells, altering their functions once secreted with the multiligand receptor for advanced glycation end - products (rage). This interaction with rage ultimately leads to the transcription of different cytokines, particularly inos . Therefore, s100b can be considered an easilydiffusible proinflammatory cytokine that gains access to the extracellular space, especially at sites of immune / inflammatory reaction in the gut [1, 5, 10]. Experimental models have indicated that egc are able to recognize inflammatory stimuli and that, once activated, they produce and release s100b in up to micromolar concentrations in the intestinal mucosa of patients with uc . They thereby contribute to no production in the human gut, a hallmark of uc . Moreover, disruption of the peripheral blood - tissue barrier was shown to correlate positively with mucosal inflammation in uc patients, and a high serum level of s100b has been proposed as a marker for bbb disruption following exercise . However, we observed markedly decreased serum levels (pg / ml) of s100b in patients with uc . This contrasts reports of experimental models showing increased s100b expression due to egc activation [1, 4, 5, 10]. In other words, one is that its picomolar concentrations may suggest prosurvival effects of this protein in the enteroglial network in uc patients . Only newly diagnosed uc patients, while the median disease duration was 3 years in our patient group, who were all taking mesalazine and a small number were also taking immunosuppressive agents . These agents might inhibit the inflammatory response related to the high s100b expression in our patients, as described in a previous study, displaying decreases in both the cerebrospinal fluid and serum concentrations of s100b under immunosuppressive treatment in patients with neuroinflammatory pathologies . In animal models of ibd, 5-aminosalicylic acid was found to inhibit the expression of inos, which is also involved in the pathogenesis of ibd . It has already been demonstrated that enteroglial - derived s100b protein expression induces no production in experimental models [1, 4, 5, 10]. Other than the effects of immunosuppressive treatment on no signaling targeting the vascular endothelium, mesalazine treatment could also inhibit inos via the inhibition of s100b, which might explain the decreased levels in our uc patients . This raises the question: does mesalazine act via this pathway in the treatment of uc? Alternatively, the persistent inflammation in uc could lead to severe, widespread damage to the enteroglial architecture in uc patients, leading to a reduction in the extracellular secretion of s100b protein . Furthermore, we hypothesized that s100b levels were further decreased in uc patients with high disease activity or duration . However, we failed to identify a relationship between these variables, and larger cohorts are needed to produce more definitive results . In addition, the serum s100b levels did not differ between uc patients with active disease and those in remission . Perhaps their ongoing medical treatment inhibits the egc - derived s100b release in uc patients with active or inactive disease . First, it will be necessary to validate these findings in a larger cohort including untreated uc patients to clarify the exact role of s100b . Second, this study investigated only serum samples; mucosal biopsy analyses should provide additional clarification . Third, data on s100b gene expression profiles, posttranscriptional s100b protein levels determined by western blot analysis, and no measurements are lacking and might better clarify the mechanisms underlying uc - related enteroglial activation . Fourth, the control group should be well matched regarding bmi, which may be associated with serum s100b levels in humans . Some clinical studies have considered bmi to be an important confounding factor for examining the role of s100b protein [3133], while others have not [34, 35]. In conclusion, this is the first study to demonstrate that, unlike the markedly increased expression of gfap and s100b observed in experimental models, s100b levels were decreased significantly in patients' serum samples . After confirmation achieved by the inclusion of serum from the untreated uc patients in a larger cohort, s100b could be suggested to have an occult role, whereas gfap might be of no diagnostic value in patients with uc . Despite the abovementioned limitations, we consider this to be a pioneer study that may guide subsequent research on this issue . Indeed, we wish to validate the present findings in a larger cohort, with additional research on no measurements and the inclusion of untreated patients, all of which we lacked due to limited funding . Future large - scale longitudinal studies that overcome the current study's limitations will present a more detailed view of the underlying mechanisms of the regulation of s100b and its actual role as a noninvasive biomarker of egc activation in patients with uc.
|
Out of any other entities in the world of pharmaceuticals, perhaps penicillin needs no introduction . Right from the time of world war ii, penicillin, the first discovered -lactam antibiotic (la), has been and still is one of the most widely used antibiotic agents, in terms of annual bulk production (~3 10 kg / year), annual sales (~$15 billion), and market share (~65% of the total antibiotic market) [13]. It is no secret that the growth of many penicillin - resistant pathogens has prompted only a minor portion of penicillins to be utilized for therapeutic functions . On the other hand, this further boosts the effectiveness of penicillins and also widens the range of antimicrobial properties or activities [2, 5]. Production of ssps is essentially a two - step process: first, penicillins (in bulk) are converted to 6-aminopenicillanic acid (6-apa) through a procedure mediated through chemicals or enzymes . Next, extended processing of 6-apa is achieved by using enzymes to get the final product (ssps). Conventionally, 6-apa used to be synthesized principally by hydrolysis of penicillins using unsafe chemicals and solvents (trimethylchlorosilane, phosphorous pentachloride, and dichloromethane), at unusually low temperatures . Currently, the preferred method for this is enzymatic alteration of bulk penicillins into 6-apa using penicillin acylase . In the context of the current work it is interesting to note that till date several stages for enhanced heterologous production of pga have been proposed using recombinant dna technology and for this escherichia coli or e. coli is the preferred host system due to strong growth features and renowned physiology and metabolism . Out of several different microbial pga sources, pga from e. coli (ecpga) has outstanding potential for industrial purposes and also has been broadly studied as a part of academic research [7, 8]. Research focus on pga production involving expression of pac gene from e. coli in e. coli has transcended diverse but linked areas like manipulation of the cell physiology [911], investigation of the effects of translocation efficiency [10, 11], and extracellular secretion [12, 13]. In addition, several studies have focused on expression of pac genes from other bacterial sources in e. coli . For a detailed review see the review by srirangan et al . . Along with e. coli, alternative hosts for expression have also been investigated: gram positive bacillus expression systems [1417] and eukaryotic expression systems like saccharomyces cerevisiae and pichia pastoris [1820]. Contrary to laboratory scale, production of pga in large scales is challenging mainly due to this exclusive gene expression and various methods for protein maturation . Therefore, it is mandatory to design key biochemical engineering approaches with improved upstream processing (strain manipulation), cultivation method, and highly robust downstream processing (dsp). The most important aspect that needs focus is the downstream processing with chromatography as an essential tool for pga recuperation and refinement [2124], direct immobilization without purification, and selective yield of the periplasmic part only and not the whole cell lysate [26, 27]. Very recently, a significant advancement has been achieved through extracellular production of pga with high purity and yield has been reported in e. coli involving a single - step dsp which is based on tangential flow filtration anion - exchange membrane chromatography (tff - amec). All these highlight the importance of application of a total quality system that needs to be built - in into the system rather than tested only on the end - products . It is our belief that all the distinct stages like strain manipulation, cultivation method, and purification can be significantly improved by implementing a quality control scheme by identifying the critical control points . Past study from our group has shown that a stringent quality system may be proposed for a general pilot scale production of any alternative and complementary medicine . With this motivation we have analyzed and proposed a mechanism for inclusion of six sigma methodology in the production process . This may reduce batch - to - batch variations and produce better products that will adhere to the regulatory norms and meet quality issues . Enzymatic hydrolysis of penicillin g to obtain 6-apa is one of the most relevant examples of industrial implementation of biocatalysts [1, 31, 32]. A procedure for large - scale industrial production of penicillin g is represented in figure 1 . It has been reported that organic solvent mediated hydrolysis of penicillin g, with the objective of extracting it from the culture medium, may greatly abridge the industrial manufacturing of 6-apa . It may be noted that immobilization of enzyme on a carrier results in the loss of enzyme activity . Therefore, in recent years, carrier - free immobilized enzymes such as cross - linked enzymes, cross - linked enzyme crystals (clecs), and cross - linked enzyme aggregates (cleas) have been in regular use . These procedures are beneficial over carrier - bound enzymes as the final preparation has high concentration of enzyme per unit volume . Optimization of 6-apa manufacturing using cross - linked enzyme aggregates (clea) of bacillus badius penicillin g acylase (pac) has also been reported . According to the authors, this work has a strong potential for industrial application mainly because of faster conversion of penicillin g to 6-apa by clea - pac and also proficient reusability . In a recent study, the enzymatic hydrolysis of penicillin g for production of 6-apa was obtained by using penicillin g acylase as catalyst in an aqueous - methyl isobutyl ketone (mibk) system . According to the authors, the optimized conditions are initial ph 8.0, 5.0% (w = v) substrate (penicillin g), temperature at 35c, and the ratio of aqueous and organic phase 3: 1 . In a very recent study, different soil bacterial samples from different places of dibrugarh (india) were isolated and incubated in presence of penicillin g (2 mg / ml) for 48 hours at 37c for conversion to 6-apa which was detected by thin layer chromatography (tlc). Also, the use of whole cell or isolated enzyme for the preparation of 6-apa has been reported [35, 38, 39]. This includes manufacturing of a fully efficient, permuted single - chain penicillin g acylase, production of alcaligenes faecalis penicillin g acylase in bacillus subtilis wb600 (pma5) fed with partially hydrolyzed starch, and application of cross - linked enzyme aggregates of bacillus badius penicillin g acylase for the production of 6-apa . In order to preserve high activity and specificity, better contamination control, and log life, various techniques have been used to immobilize the penicillin g acylase either as free form or as whole cell enzyme . However, it may be noted that further studies would benefit from optimizing the manufacturing of 6-apa using different immobilization techniques . In the context of the current work, considering several options, we choose to base our hypothesis based on a recombinant e. coli based expression platform that must contain the pac gene from e. coli itself . Considering that once the upstream process is optimized, cultivation should be done with a high cell density and should be followed by extensive dsp, as suggested elsewhere [4, 34]. In pharmaceutical industries, 6-aminopenicillanic acid (6-apa) is a very important intermediate product, primarily for being the precursor for the semisynthesis of -lactam antibiotics such as ampicillin and amoxicillin . Although its metabolic role is not completely understood, it is widely used for the production of 6-apa . The main reason is that it can catalyze the hydrolysis of penicillin g in this compound and phenylacetic acid . This enzyme could also be used to catalyze the reverse reaction and the synthesis of the amide bond . Penicillins have a heterocyclic group consisting of a thiazolidine ring (with 5 members including one sulphur atom) joined with a -lactam ring (with 4 members). These are distinguished from each other by the nature of the side chain, which is attached to the amine group in position 6 through a peptide link . The fermentation of microbes of the penicillium chrysogenum type makes it possible to obtain the greatest output of the corresponding penicillin . But there must be optimum culture conditions depending on the precursor used, which is normally peng or penv . Several other reactions also take place during this type of fermentation and alongside the penicillin biosynthesis reactions . By other reactions, we refer to the reactions forming other metabolites, as well as the degradation reactions of penicillin to penicillanic acid . They also include oxidation of the phenylacetic acid precursor to o - hydroxyphenylacetic acid (oxidized derivative). The resulting penicillin is converted into 6-apa by the reaction of removing the side chain linked to the amino group in position 6 . Initially chemical processes achieved this reaction, but in recent times it is carried out through enzymatic processes using enzymes like penicillin acylase or amidase . The function of this enzyme is to recognize the side chain and break the peptide link joining it to the 6-apa nucleus . Subsequently, the 6-apa is extracted by adjusting the ph to the isoelectric point . The side chain component is first isolated through a solvent this is followed by an additional aqueous - phase extraction, so that it may be recycled as a precursor in the fermentation itself . After all these, we can recover the 6-apa product, which is present in the crystallization mother liquors, through concentration by the reverse osmotic process . In statistics, we know that sigma () is a term that commonly represents standard deviation which is an indicator of the degree of deviation in a group of measurements or a process . Six sigma (6) is a statistical perception that assesses a process in terms of faults or defects (see table 1). It can be envisioned as a viewpoint of managing which centers on erasing defects through practices that stress understanding, measuring, and betterment processes . Harry (1998) defines six sigma to be a strategic initiative to boost profitability, increase market share and improve customer satisfaction through statistical tools that can lead to breakthrough quantum gains in quality . In 1987, motorola first launched six sigma and was soon followed by some leading electronic companies such as ibm, dec, and texas instruments in early 1990s . In 1995, when ge and allied signal instigated six sigma as planned initiatives, a fast propagation took place in nonelectronic farms globally . By detecting and eliminating the reasons of defects (errors) and minimizing inconsistency in production and business processes, it crafts a unique infrastructure of personnel within the business organization (black belts, green belts, etc .) By employing an array of quality management methods . Each six sigma assignment that is carried out within an organization follows an established sequence of steps and has quantified economic targets . These have five phases each and are motivated by deming's plan - do - check - act cycle . While dmaic is used for projects aimed at improving an existing business process, dmadv is used for projects aimed at creating new product or process designs . Since in the current study we only deal with devising a strategy to improve the large - scale existing production of penicillin g and its subsequent conversion to 6-apa, we will consider only dmaic . Dmaic (define - measure - analyze - improve - control) process acts as a step forward policy and is probably the most important methodology in six sigma management . This methodology allows genuine improvements and genuine results and works identically well on several entities (variation, cycle time, yield, design, etc . ). We may also standardize the principal product or process features of other leading global farms ., the product features such as reliant variables, relevant process mapping, essential measurement performing, result recording, and short- and long - term process capability estimating are selected . In identifying critical product features, here we scrutinize and standardize the principal product / process performance metrics with different statistical and quality control tools . A gap analysis often ensues to detect the regular factors of thriving performance, that is, what factors explicate best - in - class performance . Here we identify those product performance features which have to be advanced to reach the target . This is followed by detecting the major sources of variation, identification of the principal process variables (by taguchi methods and other vigorous experimental designs), and verification of the developed orders of principal process variables . The final phase is commenced by knowing that the new process conditions are documented and scrutinized via statistical process control (spc) methods . Sometimes, it is wise to revisit one or more of the earlier phases depending upon the consequence of such a follow - on investigation . As a part of the current work, it is essential to be acquainted with the current status of the application of total quality system for the production of pharmaceuticals, preferably through a few case studies . It is a probability that the modification of the fermentation unit of the bioprocess or improvement of operations in downstream processing may result in the design and optimization advancement of the pharmaceutical production process . It is found that quality control strategies (including six sigma) as a means to either improve production or to enhance product quality in the pharmaceutical industries have been proposed or predicted through simulations by diverse groups [4953]. An early study forecasted a theoretical model for penicillin synthesis, with qualitative prediction of different developments that are generally countered in experiments and also reviewed various models for secondary metabolite manufacturing . This work was carried forward by birol et al . Where the authors broadened the model by bajpai and reuss and developed a simulation code for a fed - batch fermenter producing penicillin by including several additional parameters and trying to identify errors in a representative penicillin fermentation procedure . Both these studies throw some light on the possibility of minimal deviation from the ideal process flowchart that could be achieved through accurate modular predictions . Also, it is critical that any group embarking on such work comprehends the process well particularly while choosing correct output variables . This has been shown by an earlier work where the operating ph and temperature turned out to be the decisive parameters that affected the penicillin yield . Case studies that involve integration of six sigma methodology in pharmaceutical production unit have been conducted in related areas such as biological, parenteral operations, safety, and improved control of potency . Six sigma can serve as the driving force for continuous improvement by identifying the root cause or causes of low process yield, due to excessive variance in the desired specifications . It has been proposed that the six sigma methodology may decrease discrepancy and focus on significant elements to attain continuous improvement by identifying and analyzing all of the constituent steps of prophylactic antibiotic administration and then observing them for improvement . According to nunnally and mcconnell, the application of six sigma has helped in minimizing deviations in two of the key variables, ph and specific potency, in a fermentation set - up . Recently, a very interesting work has focused on an amalgamation of six sigma methodology with incorporated design and control and has predicted superior yield of archetypal penicillin . This significant work, which used a combination of different quality control approaches including process analytical technologies (pat) and six sigma methodology, demonstrated a 40% decrease in batch time, but simultaneously a considerable enhanced throughput yield and reduction in the concentration of contaminants . This facilitated our work which is based on similar motivation, but we have focused exclusively on penicillin g and have extended the approach till its conversion to 6-apa . We are going to implement the five major principles of six sigma methodology (dmaic) as indicated in figure 2 and explained in section 4 . We will start with define . Here the approach is twofold: (a) define the process and (b) define the business case . Briefly, the inputs consist of culture medium, inoculum (penicillium chrysogenum), and trained personnel required to handle the operations and for process monitoring . Both fermentation and downstream processing (recovery and purification) have been integrated into processes for simplicity of the six sigma approach . The output is the crystallized form of penicillin g. (b) define the business case . Problem statement: product quality, safety, consistency, and purity depend on presence of contaminants . Project goal: improvement of product quality, safety, consistency, and purity can be addressed by considering the following key issues: (a) examination of seed lots for endogenous and adventitious microbial contaminants (like retroviruses, bacteria, fungi, mycoplasma, etc . ), done by some important tests: (i) reverse transcriptase (rt) assay and electron microscopy (em) (for retroviruses), (ii) sterility and mycoplasma test, in vitro virus test, and genetic, immunological, and biochemical tests (for bacteria, mycoplasma, and fungi), and (iii) determination of inherent characteristics like isoenzyme pattern and chromosomal composition (for establishing cell identity), and (b) examination of cell and product stability during the production process . In the past decade, several studies have stressed upon the fact that due to their extremely minute physical dimensions em remains the preferred choice for visualization of most viruses (including retroviruses) either in liquid samples or in infected cells [5659]. Though there have been some concerns raised over the usefulness of em [60, 61], particularly when more sensitive methods such as the pcr and fluorescence light microscopy are available, the credibility of em (particularly tem) remains indispensible for some virological features, preliminary detection of unidentified viral agents and increased resolution for distinguishing between viral protein aggregates and viral particles with distinct structures, and is thus on the preferred list of regulatory agencies when inspecting for the viral safety of biological products . In fact, we believe that inspection of pharmaceutical samples through a combination of an em technique and other techniques like rt - pcr could be most potent for the identification of desired target . This combinatorial approach is highly beneficial for the analysis of complex biological systems (such as those involving retroviruses) because there is more data available to make valid conclusions possible than it would have been using a single approach [5658]. Thus, in order to enforce a stringent quality control system, use of high - throughput analytical instruments and hyphenated techniques is necessary, even though this may significantly raise the expenditure and cost of implementation . While the authors acknowledge the fact that initial investment costs are high, especially those pertaining to em, and research groups particularly in developing countries could be apprehensive in this regard, the possibility of enhanced grants from government agencies in helping procuring the instrument could be a source of hope . The objective of measure is to identify critical measures in the penicillin production process that are necessary to evaluate the success which will meet the requirements of customer and to develop a methodology to collect data efficiently and to measure the process performance . However, the most important part is to understand the elements of six sigma calculation and establish a threshold value for sigma for the upstream, fermentation, and downstream processes . This is very important since it explains how we are doing all those implementations which we need to do . The main activities involved in this section are (i) identifying inputs (inoculums, media, etc . ), processes (upstream, fermentation, and downstream processing), and output (6-apa, penicillin g, etc .) Indicators, (ii) developing operational definition and measurement plan, (iii) plotting and analyzing data, (iv) identifying any special cause, (v) constructing cause and effect matrix, and (vi) collecting other baseline performance data . To materialize what we have thought of, we need some good mold sampling techniques . From these, we may choose the one or two different techniques that suit best for p. chrysogenum . To accumulate particles that are airborne, we need a tape, cassette, or a gathering device together with a regulated air pump . Some common air - samplers are impaction samplers, cassette samplers, cassette - like samplers, andersen samplers, and andersen - type impaction samplers . Investigating the air may be helpful because of the huge supply source which has not yet been found in a building . This may be significant to analyze the relative molecule levels between an issue territory and a control region or in a prior zone and then afterward cleaning . A qualitative analysis of an air sample by an expert technician can provide proof of a nearby problem mold reservoir in certain cases, for example, if the indoor sample contains long chains of penicillium spores . Examining particles on a slide to count mold spores / cubic meter of air, mold spores / square meter of surface area, or mold cfu (colony - forming units) is a common practice in building investigations . These measures can be used to describe the results of some sampling or mold testing if there are more than 10000 molds present in one cubic meter of air in a building, the mold contamination is a reality, though this is not a customary quantitative standard . The inspected surface is first pressed with an agreeable cellophane tape, then evacuated, and altered to a clean surface for mailing to a lab . The tape may also be extensively analyzed for identifying the genus and species of a particular mold . This is the minimum exorbitant gathering system accessible and is a favoured instrument . In some cases genera determination alone is quite sufficient as some of the common problem - genera (penicillium and aspergillus spp .) If there are large amounts of molds present in a building, this is just a qualitative technique . Combined with a visual inspection to locate target areas of risk and to find visible problems, it is the most essential component of a building mold investigation and is the method recommended by experts . When a tape is pressed into a sizeable area of anticipated mold growth on a surface, it collects majority of the material . This often includes enough structural material based on which persistent awkward mold genera and species may be isolated . When a sample is properly collected, it will definitely contain some significant tools that may aid in speciation, like hyphae, conidia, and so forth . In short, we can say that the determination of the presence of a building mold problem (toxic or allergenic) versus cosmetic mold can usually be made from tape samples alone . For testing beddings, curtains, and so forth (which are soft goods) for enhanced levels of tainted spores, vacuum samples may be a suitable choice as a qualitative approach, which can be used as an inspection method for mold clearance . A vacuum or an air pump may be attached to a collection canister through which particles may be drawn onto the surface of the filter or into some particular gathering storage place . The main r&d lab clears the filter onto a microscope slide, washes the filter onto a microscope slide, or uses another method to transfer particles for examination by microscope for preparation by culture . This is a good choice for microscopic inspection of the particles but may kill the identified hyphae and conidiophores . Two principal ways of swab processing are either by culturing (the swab is rolled across a culture plate for culturing and subsequent sample detection) or by a direct examination (similar to tape sampling explained above). Please note that techniques such as amplification through polymerase chain reaction or pcr may also be tried for the detection of individual species and/or genus with superior precision and fairly rapidly . Perhaps more important is that the database of pcr identification information is limited to a small set of species compared with the wide range of genera / species which normally occur . The most commonly used seed lot system involves one 100200 vial master cell bank (mcb) and one or more 400500 vial manufacturer's working cell banks (mwcb) derived from the mcb . While the adventitious agents, such as mycoplasma, viruses, and prions can be initiated during the handling procedure or may be added by the parental cells and nutrients and can be identified via specific tests such as sterility and mycoplasma tests, the contaminants of bacterial origin are usually identified by cell substrate inoculation in suitable microbial media and incubating for 24 weeks followed by biochemical tests and microscopic examination . Inoculum stability is also measured at three levels: (i) during the storage of cell banks, (ii) through several cell divisions in each production batch, and (iii) during various production batches . Suspension systems, such as stirred tank or airlift reactors, and entrapped systems, such as fluidized bed or hollow fiber reactors, are commonly used for penicillin g production . Stirred tank and airlift reactors can operate in batch and fed - batch mode . (a) in - process testing . In - process testing must be done at 3 different stages . They are (i) testing of samples collected at the preculture (inoculum) step, (ii) testing of samples collected at specific intervals during the large - scale cultivation process, and (iii) testing of samples collected at the end of the bioreactor run . There must be a methodical exploration in order to resolve the cause of contamination and widespread decontamination of the bioreactor and all the affected areas are recommended . Also, the entire analysis and decontamination actions must be properly documented and preserved . (b) culture stability testing . Factors such as specific productivity (pg / cell / day), cell growth kinetics, and the portion of producer cells in the cell bank (clonality) may assist in scrutinizing the similarity between the mcb and mwcb . The manufacturing process may witness the subsequent stage of cell line stability tests being performed, for which the cells are assembled from initial, middle, and terminal phases of the cultivation cycle . For example, in a batch process, cells are collected from the preculture, inoculum, and three times during production: the lag phase, the exponential growth phase, and at the end of production . Several sophisticated supervising and organizing strategies, for instance, optical density probes and image analysis attached to some superior controls system have been applied in small - scale fermentation . However, these advanced strategies are at most cautiously applied in large - scale fermentation processes . Production processes typically utilize online control for ph, temperature, and dissolved oxygen only . Batch cultures often require little to no additional monitoring and control other than frequent offline measurements of cell density and viability . Control strategies based on cell growth estimates, online oxygen utilization rates (our), or glucose and lactate measurements have been applied . However, it is a common observation that, in large - scale processes, the rates for addition of nutrients are more often based on time generated proceedings and utilize the control for feedback less frequently . It must be demonstrated that the purification process will remove known impurities such as dna and medium components . The information for approval is ordinarily assembled by studying full - scale assembling runs and likewise by challenge " studies utilizing model viruses, dna, and process contaminants on scaled - down variants of full - scale process . The itemized dissection of a little number of full - scale assembling runs can give immediate confirmation that the refinement procedure can reliably evacuate known polluting influences for which delicate examinations exist . Though the entire study is hypothetical, we have been able to identify some critical points which may act as potential sites for integrating the six sigma methodology . First the process and the business case need to be defined separately which could be trailed by investigation of the seed lots and the cell or culture stability . All the potential adventitious agents must be identified using scientific tests and provisions must be included to get rid of them . Also, process improvement needs constant attention by in - process testing and inspection of the culture stability . We have also considered several strategies for process validation and tried to correlate dmaic with respect to penicillin g production . It is our understanding that six sigma can be effectively used as a part of total quality system for the mass production of penicillin g and its subsequent conversion to 6-apa.
|
Biomarkers for the early diagnosis, management, and treatment of alzheimer's disease (ad) are important . In vivo cross - section imaging during an annual comprehensive eye exam with a dilated pupil has been available for a decade for glaucoma and macular degeneration, and this same imaging, using optical coherence tomography (oct), has been demonstrated to show deficits specific to ad [17] and mild cognitive impairment (mci). These deficits are in the form of nerve fiber layer tissue drop out in the retina and optic nerve . The retrograde loss of nerve fiber layer tissue in the retina and optic nerve may be an early biomarker of ad, and these deficits in the nerve fiber layer of the retina and optic nerve may be the earliest sign of ad, even prior to damage to the hippocampal region that impacts memory . The oct technology used to identify nerve fiber layer defects in ad reported in the literature is an older version often referred to as time domain - oct . Time domain - oct (time - oct) only resolved the retina to approximately ten microns, whereas newer clinical oct imaging systems high definition / resolution / fourier / spectral domain - oct (hdr - oct) can resolve the retina to five microns or less, acquire images faster, reregister retinal location, and does not require the dilation of the pupils of the eye . Oct is similar to ultrasound, but instead of measuring echoed sound waves, it measures the echoed time delays of a reflected light beam . The oct used for ocular imaging has a fiber optic delivery system coupled with a slit - biomicroscope . The patient sits with their head positioned in a chin rest and the experience is similar to having a photograph taken of the eye . This type of imaging can easily be incorporated into annual eye exams for those with ad . The first published reports of imaging in vivo retinal tissue with oct were in 1993 [8, 9], and the first reports of oct use showing significant deficits in the eyes of participants with ad were in 2001 . Oct technology and its application in the eye had origins in the department of electrical engineering and computer science at massachusetts institute of technology where james g. fujimoto, ph.d ., a professor in computer sciences and electrical engineering along with his students had collaborated with carmen a. puliafito, md who at the time was affiliated with the massachusetts eye and ear infirmary (meei). Fujimoto contributed with the idea to generalize axial scanned images to transverse images and published the precursor images of ex vivo retina and these are considered to be the first illustration of oct use . Joel s. schuman, md was a glaucoma fellow at meei in 1989 and was doing work in the laboratory of dr . He eventually worked closely with the new england eye center at tufts medical school where over 10,000 patients were imaged with the initial prototype . Clinical studies took place between 1994 and 1995 and carl zeiss meditec made available the first commercial instrument in 1996, the stratus - oct . Optovue, carl zeiss meditec, heidelberg engineering, topcon medical systems, and bioptigen are some of the other companies that have developed imaging technology using the hdr - oct systems . All publications to date, using oct technology in the study of ad, have used the stratus - oct from carl zeiss meditec which was the time - oct . The parameters are longitudinal axial resolution <10 microns in tissue, transverse resolution 20 microns in tissue, scan speed 400 a scans per second, longitudinal depth 2 mm in tissue, and an optical source of superluminescent diode at 840 nanometers . The newer hdr - oct from carl zeiss meditec; the cirrus / hd - oct has improvements that will make the technology more effective in ad . Among the improvements is the ability to reregister the images assuring more precise, repeat measurements for longitudinal studies . The parameters are longitudinal axial resolution <5 microns in tissue, transverse resolution 15 microns in tissue, scan speed 27,000 scans per second, longitudinal depth 2 mm in tissue, and an optical source of superluminescent diode at 840 nanometers . 6 shows stratus - oct images of the nerve fiber layer in a normal age control participant that was age matched to the ad participant, a participant with ad and a participant with both glaucoma and parkinson's disease (not age matched). While it is likely that hdr - oct technology will become an integral part of the diagnosis and management of ad, differentiating the optic nerve fiber losses and retinal changes from common age - related ocular disease, and in particular glaucoma will remain clinically demanding . The two diseases, ad and glaucoma, impact the same visual pathways early in their disease processes . Additionally both diseases can result in subtle changes in the functional aspects of vision . The oct imaging picks up the deficits related to ad as structural drop out due to retrograde degeneration from the brain tissue in visual processing areas such as the visual association area, brodmann 19 . Further, the degeneration in the visual association area may be one of the earliest brain tissues damaged by ad, even before the memory / hippocampal areas . That neurodegenerative pathology of ad originates in the visual association area is indicated in the studies by mckee and colleagues of autopsied brains in the framingham heart study . Mckee and colleagues found that in the visual association - brodmann 19 area of over 50% of those that had been classified as being cognitively normal, having no memory impairments, there were findings related to ad such as beta amyloid and neurofibrillary tangles . Similar structural findings were commonly associated with alzheimer's disease . In some of the cognitively normal cases, there was no ad - related pathology in the hippocampus area which processes memory, but there was ad related pathology in the visual association - brodman 19 . Losses in visual function attributed to ad have many aspects in common with the functional losses in glaucoma . Both diseases show structural changes early in their course in the visual cortex [15, 16] and lateral geniculate nucleus [1719]. The ability to detect motion is reduced in ad [20, 21]; there are visual field defects [22, 23]; contrast sensitivity deficits in the lower spatial frequencies have been reported in participants with ad . There is a more aggressive destruction of structure and function when patients have both ad and glaucoma . Glaucoma impacts up to three million americans, but only one half of those with glaucoma are aware they have it . Those over the age of 60 of any race are at greater risk of developing glaucoma and it is estimated that 8% of those over the age of 80 have elevated iop . The magnocellular - mediated visual functions are those that are not easily assessed during conventional eye examinations such as motion processing and contrast sensitivity function . There are losses in the magnocellular layers of the lateral geniculate nucleus in glaucoma [17, 18]. The lateral geniculate nucleus neurons early on in the glaucoma disease process show significant shrinkage and are observed even before nerve fiber loss in the optic nerve with conventional direct viewing methods [28, 29]. A single case study reported in the literature by gupta and colleagues regarding changes in the visual cortex in human glaucoma indicated reductions in autopsied tissue in the area below the calcarine sulcus compared to normal control . This region of change corresponded to an area of superior visual field loss that had been identified in the participant prior to death . Structural defects specific to the magnocellular visual pathway have also been identified in individuals with ad even in brain areas devoid of plaques and neurofibrillary tangles . The magnocellular visual pathway shows signs of individual cell drop out in the primary visual cortex of ad individuals . Neurofibrillary tangles and amyloid plaques have been identified in the lingual and cuneal gyri of participants with ad, and these correlate with the incidence of functional visual field loss in ad participants . The magnocellular layers in the lateral geniculate nucleus have been shown to have plaques associated with ad . Sundowning may be caused by disruptions in the circadian rhythm of ad patients . Sundowning is a general term describing symptoms such as sleep disturbance, nocturnal delirium, disorientation at the onset of darkness, night - time activity, and agitation . Disturbances in the circadian rhythm occur in ad patients, with rates ranging from 12% to 25% . Ad is associated with changes in the suprachiasmatic nucleus [34, 35]. The eye's intraocular pressure follows a circadian rhythm with increases in intraocular pressure at night [3639]. There are reports that found greater fluctuation and range in intraocular pressure in individuals with glaucoma compared to healthy control individuals [39, 40]. Studies by liu and colleagues found that the larger the diurnal variation and fluctuation of intraocular pressure, the greater the risk for structural damage due to glaucoma . Intraocular fluctuation may not be a risk factor, but actually an early symptom of glaucoma, as the disease impacts the optic nerve and the axons leading to brain structures processing circadian function . Light has a strong influence on the circadian system and the timing and duration of exposure to daylight can impact circadian phases, melatonin suppression, physiological responses, and alertness . A previously unknown photoreceptor that was dissimilar to both rod cells and cone cells was identified by berson and colleagues . These cells are retinal ganglion cells that directly innervate the suprachiasmatic nucleus and are reactive to light even when all synaptic input from rod cells and cone cells is blocked . Damage anywhere along the visual pathways that process functions related to the circadian retinal cells has potential to disrupt circadian rhythms, and these structural deficits will result in further reduction of the nerve fiber layers in the retina as measured by oct . This would be the case whether the site of origin is in the brain such as in ad or in the optic nerve as in glaucoma . One such study found a higher rate of glaucoma among 112 residents with ad compared to 774 residents without ad . The diagnosis of glaucoma was based on visual field defects or optic nerve cupping observed during eye examinations . While there may be field defects in ad, there is generally no optic nerve cupping . A record review in a large glaucoma clinic identified seven patients with elevated intraocular pressures or ocular hypertension that initially had normal visual fields and normal optic discs and had also been diagnosed within one year of also having ad . Among these patients, there was a more glaucomatous optic neuropathy which was much more rapid compared to other glaucoma patients . Figure 1 shows the nerve fiber layer deficits identified with time - oct in a participant that had both glaucoma and parkinson's disease . Figure 1 also shows the same participants optic nerve, demonstrating both nerve fiber loss and optic nerve cupping . A study found a higher rate of glaucoma among ad patients compared to non - ad patients . In their study of 172 patients with ad in japan compared to 176 age matched controls, tamura and colleagues found those with ad had a rate of glaucoma of 23.8% compared to only 9.9% of the age - matched controls having glaucoma . If there are two neurodegenerative processes such as glaucoma and ad affecting one of the major relay centers for visual function, it is easy to appreciate that the loss in function can be substantial . As ad progresses causing substantial reductions in brain volumes, there may be additional impact on the visual system creating abnormal pressure gradients at the back of the eye along the nerve . This can cause stress and damage to the lamina cribrosa, the supportive tissue to the optic nerve . When there is a lower pressure on the posterior nerve such as was found in a study of cerebrospinal fluid pressure by berdahl and allingham, there is a significantly higher rate of glaucoma . In their study, the average cerebrospinal fluid pressure was 33% lower in those with glaucoma compared to those without a diagnosis of glaucoma . Morgan and colleagues theorize that when the cerebrospinal fluid pressure is low, there is an influence on subarachnoid space . Because of the space location posterior to the globe and nerve and its pressure relationships to intracranial, retrolaminar and translaminar tissue it is as if there is damage much like would occur with an elevation of pressure inside the eye . There is increasing evidence that low cerebrospinal fluid pressure causes glaucoma like damage [4850]. Wostyn and colleagues have had long standing theories regarding changes in cranial pressure and the relationship of the stress of change to neurodegenerative diseases including ad and glaucoma, and the recent findings related to reduced cerebrospinal fluid and glaucoma are supportive of this . Wostyn reports in a study that a subgroup of ad participants had low cerebrospinal fluid pressures and he attributed this to brain atrophy . He further theorizes, as did morgan and colleagues, that this produces an abnormal high translamina pressure difference and this is what leads to the higher incidence of glaucoma among those with ad . Published studies look at more advanced dementia in already diagnosed ad and residents in nursing homes with ad . To date there are no published studies investigating glaucoma in mild cognitive impairment or in mild ad . This still leaves the possibility that the two diseases are unrelated, but because they affect the same axonal structures and visual pathways the result is an expression of the vision losses related to glaucoma at an earlier stage of the disease . It is estimated that thirty to fifty percent of ganglion cells and fibers in the visual pathway are damaged by glaucoma before the disease is detected by conventional visual field testing of the peripheral vision [53, 54]. As ad destroys visual pathway fibers, the result may simply be an earlier expression of the functional losses in glaucoma because there are fewer neural reserves . Ad damages the lateral geniculate nucleus and glaucoma damages the lateral geniculate nucleus early in the respective disease processes . Damage secondary to ad also occurs in the visual association cortex and other higher cortical areas, the primary visual cortex [16, 55], and visual association areas . A study by blanks and colleagues studied 16 individuals with ad with an age range of 7693 . They found that within the ganglion cell layer, the cells having the largest diameter may have been preferentially affected in ad . Sadun and bassi analyzed 3 eyes from ad individuals ranging in age from 7689 years . Hinton and colleagues analyzed the optic nerves of 10 individuals with ad and 10 age - matched normal individuals ages 7689 years . This study found eight of the ten nerves obtained from participants with ad compared to the controls were significantly different in fiber count compared to the normal individuals . The described findings are in contrast to the findings of curcio and colleagues who examined four ad eyes with an age range of 6786 years as well as the eyes from four age - matched normal individuals . The individuals with ad had the disease for at least four years and had severe dementia . Curcio and colleagues did not find difference between the eyes from participants with ad compared to the age - matched control eyes . Davies and colleagues studied 9 ad and 7 normal eyes and found no histopathologic evidence of differences in the retinal ganglion cells between individuals with ad and age - matched normal individuals . With imaging using uhr - oct, we can now measure in vivo, without discomfort, but still obtain detailed imaging of structures that parallel common histologic methods, but eliminates artifacts related to tissue movement, cell displacement, cell shrinkage or nerve fiber dissipation . The uhr - oct allows for repeat measurements of the same participant over time with image reregistration . Using photographs, hedges and colleagues studied the retinal nerve layer of 26 participants in various stages of ad and 23 age - matched controls with ages of both groups ranging from 52 to 93 . They found a greater amount of nerve fiber loss in the individuals with ad compared to age - matched normal individuals . There was a trend towards increasing nerve fiber layer abnormalities with progression and duration of the disease . . In the retinal photographs of 22 ad participants and 24 normal age - matched participants, tsai and colleagues found that five of the ad participants had nerve fiber loss compared to one of the control participants . The photographic method showed that there was a significant correlation in degree of segment optic nerve pallor and the duration of ad . Trends were identified in the segment pallor and the mean alzheimer's disease assessment scale (cognitive, no cognitive and total). Duration and severity of ad probably impact optic nerve findings . Conventional photographic studies that include only early - onset ad may result in conclusions that the optic nerve is not impacted (and therefore no change in the ganglion cells) because the sample studied has not had the progression of the disease to the point where the ganglion cells have been impacted . However, in the study using oct looking at both ad and mci, pacquet and colleagues found no statistical difference between ad and mci indicating that the oct imaging may be more sensitive to early disease than any previous histologic or photographic method . Parisi and colleagues used the older version of time - oct to assess the optic nerve fiber layer thickness in 17 ad participants and 14 age - matched control participants and found a significant reduction in nerve fiber thickness in the ad individuals compared to the age - matched control participants . Early reports using imaging technologies other than oct failed to show deficits in the nerve fiber layer associated with ad . Scanning laser polarimetry (gdx nerve fiber analyzer) assesses the nerve fiber layer by measuring changes in the polarization due to the bi - refringent properties of the nerve fiber layer . Kergoat and colleagues used this technique and found no differences in the optic nerve fiber layer in 30 individuals with early - stage ad, compared to age - matched normal individuals . The same group failed to find nerve fiber layer deficits using yet another imaging technology . The technology, scanning laser tomography (heidelberg retinal tomograph - hrt), uses confocal scanning lasers to provide real - time three - dimensional images and measurements of the optic disc and surrounding area . Parameters that can be measured include cup area, disc area, cup volume, rim volume, cup / disc area ratio, and rim dim / disc area . Iseri and colleagues used oct imaging technology to measure macular volume and found that of 28 eyes tested in group of alzheimer's participants there was significant thinning of the macula compared to 30 eyes tested from a group of control participants . Iseri and colleagues also measured thinning of the retinal nerve fiber layer in those with ad compared to age - matched control participants and that both the macular thinning and nerve fiber layer thinning were correlated with the severity of cognitive function . Berisha and colleagues have reported the only study to have looked at all three groups; glaucoma, ad, and age - matched control participants . The group of glaucoma participants had an average age of 71, ad participants had an average age of 76, and the age matched control participants had an average age of 72 . They found significant differences between the groups in the superior quadrant thickness of the nerve fiber layer when measured with oct and abnormal cup to disc ratios in only the glaucoma group . The glaucoma participants had an average of 106 mm in the superior optic nerve fiber layer; the ad participants had an average of 90 mm, and the control participants an average of 115 mm . This study demonstrated that the deficits identified with oct are unique to ad and are not undiagnosed ocular pathology such as glaucoma . Superior nerve fiber layer deficits were also identified in those with ad compared to normal age - matched control participants in a study by lu and colleagues . This study looked at 22 participants with ad and 22 age - matched control participants . This study, unlike other studies using oct, found an increase in the cup to disc ratio of participants with ad compared to age - matched control participants as well as inferior nerve layer deficits compared to the age matched control participants . While not an oct study, danesh - meyers and colleagues used the ocular imaging technology using scanning laser tomography, hrt, and also found an increase in cup to disc ratios in addition to the deficits in nerve fiber layers . If intraocular pressure is the only criteria utilized to rule out glaucoma in studies, this may result in the inclusion of a variety of glaucomas: normal tension glaucomas, glaucomas that have a wide fluctuation in pressure, and glaucomas that had at baseline / young age very low pressures that are now within normal, but high normal ranges . An increased cup to disc ratio, also called cupping, is the physical phenomenon hypothesized to be caused by pressure at the posterior of the eye upon the nerve resulting in cell death and subsequently loss of the fibers themselves . The nerve has fewer nerve fibers along the edge or rim of the optic nerve . As more and more fibers are lost, the nerve starts to be hollowed out and then flattened . Figure 1 shows oct images of the cup to disc ratio in a normal age - matched control participant, a participant with ad, and a participant with parkinson's disease as well as glaucoma . Using the older oct technology, paquet and colleagues studied a group of participants with both mci and ad and looked at 15 noncognitively impaired age - matched participants, 14 participants with mild ad, 12 participants with moderate ad, and 23 participants with mild cognitive impairment . They found that the nerve fiber layer was thinned in those with mild cognitive impairment, mild ad, and moderate to severe ad . They also did not find any significant difference between those with mild ad and mild cognitive impairment . Even the older oct imaging technology with its lower resolution has the potential to identify biomarkers of disease prior to substantial impact on the cognitive functions currently used to identify alzheimer's disease . The older oct technology has also been reported to identify deficits in the nerve fiber layer of those with parkinson's disease compared to age - matched controls [6870]. The visual system provides opportunity to use noninvasive clinical tools to identify and monitor biomarkers of neurodegenerative diseases such as ad . The number of those with ad in the united states is approaching 5.1 million, and this number is expected to reach 13.2 million by the year 2050 . Ad is estimated to cost americans $100 billion a year both in direct costs and indirect costs . Oct imaging has demonstrated structural nerve fiber deficits in the eye in early alzheimer's disease as well as mild cognitive impairment . Imaging with faster technology with significantly higher resolution such as the fourier / spectral / high resolution - oct may prove to be an efficient, cost - effective means of identifying and monitoring biomarkers of early ad.
|
In our rush to embrace th17 cells as the purveyors of tissue damage, we should not forget that cytokines produced by th1 cells and other cell types are critical in promoting various forms of inflammation . Administration of ifn-, for example, worsened disease in patients with ms (13). And blocking tumor necrosis factor (tnf), which can be produced by various cell types, is a gold standard for treatment of diseases now thought to be driven largely by th17 cells, including ra, crohn's disease, and various forms of psoriasis (1). Furthermore, type i ifns, which are therapeutic in ms (14, 15), are pathogenic in systemic lupus erythematosus (16). It is worth noting that the role of il-17 in these major human diseases is much less well understood than tnf, ifn-, or type i ifns . Ex vivo studies have also suggested that cytokines of the th1/th2 axis are critical determinants in mycobacterial diseases ranging from tuberculoid leprosy, which is primarily driven by il-12 and th1 cells, to lepromatous leprosy, which is mediated by th2 cells (17). And although th17 is a welcome addition to our understanding of immune - mediated tissue damage, we still need the th1/th2 axis and other inflammatory mediators to explain many aspects of human autoimmune, allergic, and infectious diseases . In a recent issue of the jem, luger et al . (7) demonstrated that il-17 and il-23, a cytokine that drives expansion of th17 cells, are important in the pathogenesis of eau, a model that reflects many aspects of both infectious and autoimmune uveitis in man . In that study, administration of antibodies against il-17 inhibited the development of eau after immunization with the retinal antigen intra - retinal binding protein (irbp) in complete freund's adjuvant (cfa), and also reversed established disease (7). Antibodies against il-23 also aborted the development of eau in this model, but only when given early in the disease (fig . 1 a). Blocking il-23 was no longer effective by day 7, a time when t cells capable of inducing uveitis were already present . The authors thus concluded that il-23 is important for the priming of uveitis - inducing t cells, but not for their effector function . Supporting a role for il-23 in eau induction, mice lacking the il-23 subunit p19 or p40, which is also shared by il-12, were protected against disease . Mice lacking the il-12only subunit p35, by contrast, were more susceptible to eau than were wild - type mice (fig . 1 a). Finally, transfer of in vitro polarized, irbp - specific th17 cells into recipient mice triggered eau, even in the complete absence of ifn- (fig . There was a significant reduction of eau in p19 and p40 knockout mice, with a significant increase in eau in p35 knockout mice compared with wild type . Antibody blockade of il-17 reduced disease when given either during disease induction or after disease onset, whereas antibody blockade of il-23 reduced disease only when administered during disease induction . Transfer of th1-polarized, irbp - specific cd4 t cells induced eau (top). In this model, blocking il-17 had no effect on disease and blocking ifn- ameliorated disease . Transfer of th17-polarized, irbp - specific cd4 t cells induces eau (bottom), and, in this model, disease was equivalent when cells were transferred into ifn-deficient mice . Irbp - pulsed mature dendritic cells were injected into mice, followed by pertussis toxin at day 2 . In this model, disease was decreased in ifn-deficient mice, despite an increased production of il-17 in the central nervous system as compared with wild - type mice . These findings in eau are similar to studies in eae, in which chronic disease is reduced in il-17 mice, although these mice still develop acute paralysis of their hind limbs (18). Adoptive transfer of myelin - reactive t cells from il-17 mice into wild - type mice also leads to much milder eae, as measured by incidence and severity of paralysis, compared with transfer of myelin - reactive t cells from wild - type mice (18). Other data from luger et al ., however, suggested that eau can also develop in the absence of th17 cells . Transfer of a th1 clone specific for irbp, for example, caused severe disease in the absence of il-17 production (fig . Moreover, disease severity in response to immunization with irbp plus cfa was comparable in wild - type and il-17deficient mice (7). It should be noted that many investigators equate the loss of il-17a in the il-17 mice (7) with a complete loss of th17 cells, but these cells also produce other cytokines, including il-17f, il-21, and il-22 . Although luger et al . Conclude that the development of eau in il-17 mice required an ifn-producing effector t cell, they did not formally rule out a role for other th17 cytokines (7). These results are difficult to interpret given other studies showing a protective role for ifn- in eau . Neutralization of ifn- has been shown to exacerbate eau, just as it does eae (46). Furthermore, eau develops efficiently in mice depleted of ifn-, and, perplexingly, recombinant ifn- has been shown to protect against disease (19, 20). How, then, could an ifn-producing effector cell be important for the pathogenesis of eau, if recombinant ifn- is itself protective? Akin to the anomalies and paradoxes seen with th1 cells in eae, these results are probably telling us something highly important, although we do not yet have enough knowledge to explain it . But the data certainly conflict with the notion of il-17 as a master mediator of tissue damage, at least in eau . Went on to induce eau by immunizing mice with irbp - pulsed dendritic cells, a model that is independent of cfa (fig . The disease was characterized by an influx of t cells that produce large amounts of ifn- but little il-17 . And ifn-deficient mice immunized with irbp - pulsed dendritic cells were protected against disease despite the robust production of il-17 (7). It is possible that the use of adjuvants in certain animal models of autoimmune disease, such as eae, eau, and collagen - induced arthritis, might skew the importance of il-17 . Indeed, the presence of adjuvants that, like cfa, contain killed mycobacteria might provide a critical clue to explain the discrepancies between different models . In this issue, kroenke et al . Show that adoptive transfer of either th1- or th17-polarized myelin - reactive t cells induces eae (8). Ascending paralysis ensued in both models, but the cellular infiltrate induced by th17 cells was rich in neutrophils, whereas macrophages predominated the th1-induced infiltrate a pathological picture similar to ms, in which neutrophilic infiltration is rare . The pathology seen with il-17induced eae was reminiscent of that seen in acute disseminated encephalomyelitis, and other rare demyelinating conditions such as marburg's disease, and also resembles certain aspects of neuromyelitis optica neuromyelitis optica is also similar to th17induced eae in that the pathology is most intense in the spinal cord and optic nerves . (9) showed that eae is most intense in the brain when th17/th1 ratios are high, whereas inflammation is focused on the spinal cord when th17/th1 ratios are more widely varied . The overall picture that emerges suggests that eae has a variety of histological and anatomical manifestations depending on the cytokines produced by the disease - inducing t cells (8, 9). Thus, one cannot conclude at all that eae is driven by th17 cells . The data from kroenke et al . (21) indicated that even th2 cells can induce eae in rag - deficient mice . In that study, such pathology replete with eosinophils, typical of allergic disorders, would be worthy of the original term for eae, experimental allergic encephalomyelitis . Other cytokines like osteopontin drive the production of ifn- (22, 23), and osteopontin has also recently been shown to drive the production of il-17 (24). Osteopontin is critical in triggering relapses of eae and is elevated in the plasma of patients suffering ms relapses (25). Is it thus possible that osteopontin is the main driver of tissue damage and ms relapses, and not ifn- or il-17? It can hardly be concluded at this point that th17 is the sole driver of tissue damage in ms or eae . Another issue that must be considered is that il-17 would not have evolved if it only did harm . The protective side of il-17 was demonstrated in a recent study of mycobacteria tuberculosis infection, in which il-17 was required to recruit protective ifn-producing cd4 t cells into the lung (26). In an asthma model, neutralization of il-17 increased eosinophilic infiltration during the effector phase of disease, and administration of recombinant il-17 diminished airway hyperreactivity and reduced the numbers of eosinophils and lymphocytes in bronchial lavage (27). In this model of asthma, il-17 thus appears to be a negative regulator of established disease (27). How can we continue to call the th17 pathway the critical mediator of immune - mediated tissue damage with such counter examples from autoimmunity, infectious disease, and allergic disease? The ultimate significance of the th17 pathway in human disease remains unclear, and we are only now clarifying the details of the th17 pathway in humans . The first analyses of the th17 pathway came from studies of experimental diseases in mice, and the first studies on the th17 in man revealed significant differences . As natalie angier wrote in her elegant book the canon, whether sizing up new acquaintances or seizing on novel ideas, we remain forever at the mercy of our first impressions (28). In immunology (at least these days), our first impressions often come from mice . Again to quote angier, we should analyze the source of our misconceptions, and then we have a chance of amending, remodeling, or blowtorching them as needed, and replacing them with a closer approximation of science's approximate truths (28). The parallels between mouse and man first diverged in defining a role for transforming growth factor (tgf)- in the differentiation of th17 cells . In mice, il-6 and tgf- two initial human studies, however, showed that il-6 and il-1 (produced by monocytes or conventional dendritic cells), but not tgf-, were critical for the priming of th17 responses (29, 30). In one of those studies, tgf- suppressed il-17 production (29). More recent data, however, revealed that tgf-, il-1b and il-6, il-21, or il-23 (in serum - free conditions) could induce il-17 production from naive human cd4 t cells from umbilical cord blood (31). Induced il-17 expression, but this suppression was relieved in the presence of inflammatory cytokines . Another study showed that tgf- was essential, along with il-23, il-1, and il-6 for th17 differentiation (32). Yet another showed that tgf- enhanced il-17 in peripheral t cells (33). At this point it appears that il-1 and il-6 drive il-17a production from central memory cd4 t cells, whereas tgf- and a constellation of other inflammatory cytokines promote the differentiation of naive cd4 t cells into th17 cells (34). Local induction of tgf- in mouse brain, for example, leads to induction of eae (36), and its pharmacologic suppression reverses paralytic disease (37). Tgf- signaling in the brain leads to increased production of il-6, which then enhances inflammation (37). Tgf- is elevated in chronic ms lesions, in which there is also intense production of il-17 from astrocytes and oligodendroglia (38). Thus, tgf- might promote il-17 production during the chronic active phase of ms (9, 38). Studies in humans have also revealed the existence of t cell clones in the intestines of patients with inflammatory bowel disease that produce both il-17 and ifn-, and are thus designated th1/th17 cells . These dual producers can also be found in eae lesions in mice (39) and express both the th17-inducing transcription factor ror-t and the th1-inducing transcription factor t - bet . Immunologists ought to be restrained in attributing too much to the th17 pathway at this stage . The plentiful exceptions outlined in this commentary suggest that its signature function as the mediator of organ - specific tissue damage in autoimmunity and other forms of pathology should be refined . Exceptions always teach us something important, as we have learned from our evolving understanding of the th1/th2 paradigm (1). The th17 pathway has many divergent roles in models of autoimmune, infectious, and allergic disease . Indeed, il-17 is not even a purely th17 cytokine because it is also made by macrophages (40), astrocytes (41), oligodendroglia (41), uterine fibroids (42), and corneal epithelial cells on the surface of the eye (43). Emerging data indicate that molecules such as osteopontin drive both th1- and th17-mediated tissue damage (2225). We might thus be heading toward the conclusion that no single molecule or th pathway dominates and that there is no hierarchical scheme at all . It is difficult to understand how so many immunologists developed such exuberant enthusiasm for th17 in the first place, placing it in a starring and paramount role for all immune - mediated tissue damage . One of the groups who was instrumental in the discovery and elucidation of this pathway recently reviewed the subject with a balanced perspective (2). They enumerated the multiplicity of inconvenient truths that befuddled this role for th17 when they asked, but are th17 cells the only effector cells capable of inducing organ - specific autoimmunity? Mice deficient in t - bet and stat-4, and thus lacking th1 cells (45, 46), have overwhelmingly large numbers of th17 cells (47, 48) and yet are resistant to eae (4749). Do those data suggest that th1 cells are pathogenic and th17 cells are not? The truth is probably somewhere in the middle . For many reasons, we support the idea that both th1 and th17 cells are capable of inducing autoimmunity (2). An emerging conclusion is that tissue damage and protection are nuanced and are governed by multiple / redundant molecular interactions that involve many cytokines, including the type i ifns, and other molecular cascades including, for example, the coagulation pathway (50). Thus, we should reserve our judgment about th17 and not jump to conclusions as we did with the th1/th2 paradigm (1).
|
But, considered little more than cellular garbage cans acting to discard unwanted molecular components, exosomes remained little studied for the next 10 years . Over the past few years, however, evidence has begun to accumulate that the vesicles are like signaling payloads containing cell - specific collections of proteins, lipids, and genetic material that are transported to other cells where they alter function and physiology . The findings have reignited interest in exosomes, but also more generally in all secreted vesicles, whether they can be called exosomes or not, and the topic has now blossomed into a full - fledged field of research that of vesicle - modulated cell - cell communication . Two years ago, i began receiving daily emails regarding my articles on exosomes, requesting reprints, details on exosome - related protocols, and advice on the purification and characterization of the vesicles . Having worked in this area for more than 10 years, i thought i knew all the other researchers working on the subject, but the requests were coming in from groups i hadn't heard of before . The flood of inquiries made me realize that the field had been growing, attracting the attention of more and more researchers in a relatively short period of time . A quick glance at the literature confirmed the trend: while fewer than 20 pubmed - referenced papers using the word exosomes were published in early 2003, and just over 60 in 2007, nearly 350 exosome studies have been published in the last 3 years alone . The idea thus came to me and to graa raposo, who discovered exosomes from immune antigen - presenting cells in 1996, to organize an international workshop on exosomes (iwe). Although a meeting organized by the late rose johnstone, who participated in the first description of exosomes in 1983, had drawn 25 scientists to montreal, canada, in 2005, the new meeting, which took place this january at our home institution, the curie institute in paris, attracted nearly 10 times as many attendees . There, researchers discussed their recent findings on exosomes, and on other types of secreted membrane vesicles, in fields ranging from immunology to neurobiology and tumor biology, as well as potential clinical applications, such as biomarkers or as therapeutic tools . In pluricellular organisms, cells communicate with each other via extracellular molecules such as nucleotides, lipids, short peptides, or proteins . These molecules are released extracellularly by cells and bind to receptors on other cells, thus inducing intracellular signaling and modification of the intracellular physiological state of the recipient cells . But, in addition to these single molecules, eukaryotic cells also release in their extracellular environment complex structures called membrane vesicles, which contain numerous proteins, lipids, and even nucleic acids, and can affect the cells that encounter these structures in much more complex ways . Although known to exist for several decades (for instance, in blood, where they are generally called microparticles, or in seminal fluid, where they are called prostasomes), membrane vesicles have long been thought of as mere cell debris, signs of cell death, or structures very specific to a unique organ . The phenomenon of exosomes and their wider involvement in intercellular signaling began to emerge from this picture in the last decade . Exosomes are formed in endosomal compartments called multivesicular endosomes, containing internal vesicles that package and store molecules in membrane - bound structures . Endosomes are generally considered to function as an intermediate compartment between the plasma membrane, where endocytosis of extracellular molecules takes place, and compartments (lysosomes), where these molecules are released and degraded . However, about 25 years ago, the groups of philip stahl in the united states and rose johnstone in canada described, using very elegant pulse - chase and electron microscopy experiments, that in reticulocytes undergoing maturation into red blood cells, multivesicular late endosomes could fuse back with the plasma membrane (instead of with lysosomes), and release their contents, including numerous small vesicles, extracellularly . In 1987, the term exosomes was proposed to define these extracellularly released intra - endosomal vesicles . Exosomes remained all but forgotten for the next 10 years until raposo, while working with the group of hans geuze in holland in 1996, showed that epstein barr virus (ebv)-transformed b - lymphocytes secreted exosomes that bore molecules essential for the adaptive immune response: major histocompatibility class (mhc) ii dimers bound to antigenic peptides . These exosomes were also shown to present the mhc peptide complexes to specific t cells, suggesting that they could play a role in adaptive immune responses . Two years later, the groups of raposo, amigorena, and zitvogel demonstrated that dendritic cells (the immune cells that initiate adaptive immune responses by presenting mhc peptide complexes to nave t cells) also secrete exosomes bearing functional mhc peptide complexes, which could promote induction of antitumor immune responses in mice in vivo . These results provided the basis for the hypothesis that exosomes could play an active role in intercellular communication, at least in the immune system, and prompted the very first attempt at using them in the clinic, as a new type of anticancer therapy in humans . (after phase i trials held between 1999 and 2002, a phase ii trial is currently ongoing at the gustave roussy institute (with participation of the curie institute) in france .) The first major advance of subsequent years was linked to the development of large - scale protein analysis techniques, which allowed us to demonstrate that exosomes represent a specific subcellular compartment, rather than random cell debris . Proteomic analyses of exosome composition were first performed on exosomes secreted by dendritic cells, and then on exosomes from numerous other different cell types, which are compiled in the exocarta compendium . These studies showed that exosomes did not contain a random array of the intracellular proteins, but a specific set of a few protein families, essentially coming from the plasma membrane, endocytic pathway, and the cytosol, with very limited amounts of proteins from other intracellular compartments (e.g., nucleus, endoplasmic reticulum, and golgi apparatus), which made them clearly different from membrane vesicles released by apoptotic cells . These results established that exosomes are actively secreted by live cells, and confirmed their intra - endosomal origin . In parallel, studies of exosomes purified in vitro from tissue cultures (of immune cells but also epithelial and tumor cells), started showing that exosomes secreted by one cell could be captured by another cell and transfer information to the latter . The information transferred could include antigens or mhc peptide complexes for increasing the range of antigen - presenting cells and the efficiency of induction of immune responses [13 - 15], or in some cases negative signals leading to death of the target cell . These observations provide the basis of the nowadays popular idea that exosomes represent a new type of intercellular messenger . The second real breakthrough in this field came in 2007, with the convincing description by the group of jan ltvall in sweden of the presence of mrna and microrna (mirna) inside these vesicles . In addition, the authors showed, at least in vitro using large amounts of concentrated exosomes, that some mrna present in exosomes could be translated into proteins in target cells, suggesting that exosomes can transfer genetic information . This discovery, and the concomitant development of research on mirnas, sparked the recent exponential increase in the numbers of papers on exosomes . In january 2011, oral and poster presentations at the iwe 2011 covered all the currently explored fields of exosome research spanning immunology and cell biology, their use as biomarkers, and their relationship to tumors . My four major conclusions from this meeting are that: (a) exosomes are not the only secreted membrane vesicles that could act as intercellular messengers, and efforts should be dedicated to combine and compare data obtained on these different vesicles; (b) the next few years should show us whether rna and mirna in circulating vesicles (exosomes or others) will prove to be useful biomarkers of various diseases, providing new diagnostic or prognostic tools; (c) although they were originally described in cells of the immune system, exosomes are now known to be secreted by many different cell types, and a large amount of recent data highlight their possible functions as messengers during development of tumors, in some functions of stem cells, in the nervous system, or during interactions of pathogens with their host; (d) although the last 3 decades have expanded our knowledge of exosomes considerably, there is still no definite evidence for their physiological functions in vivo, and demonstrating such functions remains a major challenge of this field . The term exosomes should be used to define secreted membrane vesicles that form inside intracellular multivesicular compartments and that are released upon fusion of these compartments with the plasma membrane (figure 1). Because of this intracellular origin, exosomes are similar in size to internal vesicles of multivesicular compartments; that is, around 100 nm in diameter . Exosomes are commonly purified on the basis of size by serial steps of centrifugation, with a final 100,000 g ultracentrifugation to pellet exosomes; however, this purification is not absolute . Some cells also release other types of membrane vesicles, which can, for instance, directly bud off the plasma membrane towards the outside of the cell . The size of such vesicles is not as strictly determined as that of exosomes, and they can be anywhere between 501,000 nm in diameter . Various terms have been used for these vesicles, such as ectosomes, shed vesicles, or microvesicles, but this latter term has also been used more widely for any type of vesicle, whether intra- or extracellular, and regardless of its intracellular origin . The release of large plasma membrane - derived vesicles is quickly induced after stimuli such as fresh fetal calf serum on tumor cells, complement deposition, or increasing intracellular ca in neutrophils . Vesicles can be separated by size using ultracentrifugation at different speeds, with the larger vesicles pelleting at lower speed than the smaller ones . But similarly sized vesicles of different intracellular origins (i.e., exosomes and small plasma membrane - derived vesicles) will not be separated by this method . Flotation of vesicles on sucrose gradients can allow some separation of vesicles with different densities, but this separation is not complete . Thus, adequate means to distinguish the different types of vesicles secreted by a cell are still lacking . Proteomic studies of microvesicles or ectosomes have not, so far, been as extensive as for exosomes, but they are underway and they will help to understand the specificity of their secretion . Like exosomes, membrane microvesicles and ectosomes contain various active molecules, such as cytokines, growth factor receptors, and rnas, and also metalloproteases (which have not been described in exosomes), but since studies comparing exosomes and other vesicles released by the same cells are only beginning now, understanding the functional specificity of each type of vesicle should become possible in the next few years . Since the identification of rna in exosomes in 2007 and development of high - throughput techniques for nucleic acid analyses, there have been an ever increasing number of studies reporting sequences of the rna in exosomes . Such studies show that not all messenger rnas present in a cell end up in exosomes, and there is apparently specific targeting of some mrna sequences into the released vesicles . These last observations refute the idea that mrna in exosomes results from a random contamination of secreted vesicles by mrna released extracellularly by dying cells . However, it is still unclear from the few published studies whether one can (as for exosomal proteins) find a set of exosomal mrna that would be consistently targeted to exosomes in any cell type, possibly in addition to cell type - specific mrna sequences . Understanding the mechanisms of mrna targeting to these vesicles should open the way to understanding the function of rna delivery to secreted vesicles . Of note, mrna has also been described in microvesicles (or mixed exosome / microvesicle preparations) released by tumors or embryonic stem cells [21 - 23], and some ongoing studies are now comparing sequences of rna targeted to either exosomes or larger vesicles, and determining whether there is a distinct targeting to each of them . The situation is even more complicated for mirna: even though they have also been observed in various exosome preparations, the heterogeneity of techniques used to identify the mirna sequences do not allow one to conclude whether there is specific targeting of mirna to secreted vesicles . In addition, although extracellular release of mirna can be decreased by some drugs, the literature still describes heterogeneous results concerning the respective contribution of free (or protein - associated) mirna, as compared to mirna encapsulated in exosomes or other secreted membrane vesicles . Despite the uncertainties about the nature of mrna and mirna - carrying vesicles, the biopharma industry has put a lot of effort into studying the use of secreted vesicles especially their mrna and mirna content as biomarkers in clinics . This is easier than it might seem to be because their encapsulation into membrane vesicles protects extracellular rnas from degradation, and allows efficient recovery from biological fluids, such as plasma, urine, milk, sperm, or saliva . Work in several different laboratories to compare rna (as well as protein) sequences in vesicles isolated from normal and cancer cell lines, for instance, and from biological fluids of patients (cancer or other diseases) is ongoing . It is still too early to propose new biomarkers (either for diagnosis, prognosis, or predictive response to therapies) from these studies, but given the current effort put in this direction, the next few years should allow us to decide whether such markers exist and are useful . Once secreted, membrane vesicles interact with surrounding cells: many fluorescence microscopy studies show capture of these vesicles and accumulation in internal endocytic or phagocytic compartments, especially in phagocytic cells such as macrophages, but one must keep in mind that vesicles smaller than 200 nm in diameter cannot be detected by confocal microscopy techniques, and only electron microscopy allows detailed visualization of exosomes . Hence, the way individual vesicles interact with recipient cells is still not known, and has been proposed to involve binding at the cell surface via specific receptors, internalization by endocytosis or micropinocytosis, and/or fusion with plasma membrane or with the limiting membrane of internal compartments . Evidence that fusion does occur in certain cases comes from a recent study showing diffusion of exosomal lipids in the membrane of recipient cells: this observation explains how exosomes could release their internal content (e.g., rna) into the cytosol of recipient cells . Exosomes induce physiological changes in recipient cells upon interaction . Because the original description of exosomes was in immune cells, there is a vast amount of data on the immunological effects of exosomes, and these vary strongly depending on the physiological state of the cells which secrete them (see for references). For instance, mature dendritic cells secrete exosomes that carry antigens or mhc peptide complexes, and induce antigen - specific immune responses by other dendritic cells (especially in the context of anticancer therapies); conversely, exosomes secreted by dendritic cells subjected to immunosuppressive treatments, or modified to express immunosuppressive cytokines, can instead promote tolerogenic immune responses, which could make them useful as a treatment for autoimmune diseases . In a third example, macrophages infected with procaryotic mycobacteria release exosomes that, depending on the mycobacteria strain, bear antigens and promote immune responses (nonpathogenic strain), or inhibit macrophage activation and cytokine secretion, thus dampening immune response (pathogenic strain). Although exosomes secreted by tumor cells carry antigens from the secreting tumors and can be captured and used to present tumor antigens by dendritic cells, they also bear various immunosuppressive molecules, which can inactivate t lymphocytes or natural killer cells, or promote the differentiation of regulatory t lymphocytes or myeloid cells (which suppress immune responses). The net result of these contradictory effects in vivo is not yet established, and although several groups defend the hypothesis that tumors secrete exosomes to promote their growth by inhibiting antitumor immune responses, or by promoting angiogenesis or migration outside the tumor bed to form metastases, this has not been proved . Still, it has been suggested that depletion of membrane vesicles from the blood circulation of patients could be used as an anticancer treatment, but i would be cautious in using such approaches in the absence of proper understanding of what tumor - derived exosomes or other membrane vesicles do in vivo . An alternative explanation is that membrane vesicles of tumor origin in the circulation of cancer patients could simply be the result of tumor expansion, rather than a sign of active involvement of these vesicles in tumor progression . Other tissues or cells secrete exosomes bearing immunosuppressive molecules: placenta - derived vesicles, which bear ligands for natural killer lymphocytes, are found in pregnant women's blood circulation, and extensive analyses of components of these vesicles are underway to identify their role in the mother's tolerance to the fetus . Depending on the state of the host, exosomes (or vesicles) present in their bronchoalveolar fluid can bear tolerizing molecules (e.g., in mice tolerized for an allergen) or, conversely, increase proinflammatory cytokine secretion by airway epithelial cells (in asthmatic human patients). Secretion of exosomes by eukaryotic parasites (leishmania major) or pathogens (such as fungi) has also been recently described . It is thought to contribute to tolerance of the host for the parasite by dampening immune response or, conversely, to contribute pathologic inflammatory reactions of the host to the pathogen . Exosomes are secreted by neural, epithelial, muscle, and stem cells, and their range of proposed functions is extensive . Exosomes from mesenchymal stem cells contribute to tissue repair of host cardiac tissue, and, conversely, lung tissue can release exosomes (or possibly other vesicles) that modify stem cells to promote differentiation of the lung tissue into lung epithelial cells . Exosomes are secreted by neurons, oligodendroglial cells, and microglia, and exosomes from each source can affect other neural cells [28 - 30]. Exosomes are involved in the formation / transfer of pathogenic proteins (such as prions and amyloid deposits). Despite the amount of data on what exosomes (and other secreted membrane vesicles) can do in vitro, or in vivo when injected into animals, all data discussed above were obtained with vesicles purified and concentrated in vitro from cell culture supernatants or from biological fluids, so it is not clear whether these processes occur under physiological conditions . The main problem is that the efficiency of the purification and quantification procedures is unknown . It is likely that ultracentrifugation does not allow 100% recovery of the vesicles secreted at any given time, and that part of the secreted vesicles are even inaccessible to purification because they are recaptured by cells rather than released in the culture medium or fluid, so it is very difficult to know whether the amounts of membrane vesicles used to observe the effects described above correspond to physiological amounts secreted in vivo, or not . Indeed, there remains a nagging question in the exosome field as to whether they actually have any physiological functions in vivo . Answering this question requires tools to inhibit or increase exosome secretion specifically, without affecting secretion of other membrane vesicles, or affecting general secretion of proteins or lipid mediators . Several groups are currently trying to identify such tools, especially by deciphering the molecular mechanisms involved in formation of intracellular vesicles of multivesicular compartments, and in the fusion of these compartments with the plasma membrane . Several molecules have been shown to affect exosome secretion, although in the absence of means to visualize and quantify actual fusion of multivesicular endosomes with the plasma membrane in real time, it is still difficult to know whether they are involved specifically in this final step, or at another stage of the endocytic pathway . A consensus has not yet been reached on the molecular mechanisms involved . Indeed, depending on the cell types, different molecules have been described in the biogenesis and secretion of exosomes: rab11 in erythroleukemia cell lines, rab27 in hela cells, and rab35 and neutral sphingomyelinase in oligodendroglial cells . It remains to be determined whether these discrepancies are due to different machineries used in different cell types, and/or whether the secreted vesicles analyzed in the different studies come from different intracellular compartments (along the endocytic pathway, or even outside this pathway). Recent studies showing that internal vesicles of multivesicular endosomes can, in some circumstances, form without the help of the escrt (endosomal sorting complex required for transport) machinery (described as being responsible for segregation of molecules into internal vesicles of late endosomes in yeast) suggest that, indeed, more types of multivesicular compartments than initially thought may coexist in the same cells, and may possibly lead to different types of exosomes . In any case, targeting one or the other of these molecules to affect exosome secretion will require careful evaluation of the consequences (in terms of exosomes, but also other secretions) in each different model system analyzed . Other approaches to address the physiological functions of exosomes in vivo, proposed during the meeting in paris, include generating exosomes with modified expression of a given functional protein and analyzing their functional outcome, or containing bacterial enzymes to identify target cells via measurement of the enzymatic activity . Using these approaches in genetically modified mice will be the next step for this challenging field . Finally, similar cell biology studies on the generation of other secreted membrane vesicles are also underway, and hopefully will allow proper discrimination of the roles as messengers of the different types of vesicles . With the amazing expansion of the number of published studies on exosomes in the last 3 years, it is clear that research on secreted membrane vesicles and their roles as intercellular messengers is now a very exciting field, with new ideas, hypotheses, and questions coming up faster than answers! The iwe in paris allowed most of the long - term exosome and vesicle aficionados, as well as many of the newcomers, to meet, exchange ideas freely, and to point out current problems with technologies, definitions, and characterization . The meeting ended with the decision to prolong this very productive workshop by setting up future yearly meetings, virtual spaces to record exchanges and discussions (such as a website and/or a facebook page), and a scientific society dedicated to exosomes and secreted membrane vesicles . Some of these are already underway, with the next iwe tentatively scheduled for april 2012, a facebook page already up and running, a website for comparison of protein and rna composition of exosomes already set up, and the rest hopefully coming soon . We strongly encourage the readers of this article to check these web links to follow the next steps of this emerging scientific world.
|
A substantial amount of research has focused on biomarkers that identify people at higher risk of developing cardiovascular disease.1 one indicator that seems to play a pivotal role is dysfunction of the autonomic nervous system . Specifically, increased sympathetic and/or decreased parasympathetic activity has been associated with increased risk for a number of cardiac outcomes such as sudden cardiac death, heart failure, ventricular arrhythmias, or hypertension.2, 3 heart rate variability (hrv) is a valid noninvasive technique for estimating the characteristics of the autonomic nervous system and for quantifying modulation of the sympathetic and parasympathetic inputs.4, 5 decreased hrv has been linked to increased mortality in cardiac patients6, 7 and increased risk of coronary heart disease and cardiac mortality in general populations.8, 9 establishing the associations between hrv and coronary heart disease remains problematic because a number of cofactors may wholly or partially account for the increased risk of coronary heart disease among persons with decreased hrv . These factors include age, poor health, physical inactivity, and medication use as well as socioeconomic status (ses) and ethnicity . Hrv is believed to decline as people age, but a key scientific question is whether falls in hrv occur naturally with age as a result of the aging process itself or as a result of pathogenic processes and/or medication use . A number of studies have documented the normal changes in hrv that accompany aging10, 11, 12, 13, 14, 15, 16 and hrv changes due to chronic diseases or healthrelated conditions.17, 18, 19, 20, 21 these studies, however, have significant limitations including a reliance on crosssectional data or lack of statistical adjustment for important factors . The evidence of agerelated hrv changes is based primarily on crosssectional studies of different age groups,10, 12, 13, 14, 15, 16 making it difficult to identify withinperson change . Differences between age groups in crosssectional studies could be related to selective survival among older people rather than genuine effects . A small number of longitudinal studies on agerelated hrv changes have been conducted.11, 17, 18, 19, 20, 21 of these, only a few are population based,18, 19, 20, 21 and others have relied on small samples of elderly participants.12, 13 no studies with large sample sizes have conducted> 2 repeated hrv measurements . Medication use and/or the existence of prevalent cardiometabolic problems such as diabetes or stroke may be related to hrv changes over time . Cardiac autonomic modulation has been found to be significantly influenced by sex.10, 12, 14, 16 on average, women have been shown to have reduced sympathetic influence and enhanced parasympathetic influence on heart rate (hr) relative to men.22 over time, different ways of responding to health conditions and medication may influence the shape of hrv changes between men and women . Another relevant factor that contributes to accelerated aging processes and development and prognosis of cardiovascular disease outcomes is ses.23 it is well documented that persons from lower ses groups have higher risk of cardiovascular disease outcomes and reduced hrv and parasympathetic activity than persons from higher ses groups.24, 25 it remains unclear how the associations between ses and hrv change as people age . Similarly, ethnicity is associated with hrv levels . On average, people of white ethnic origin have been shown to have lower hrv than african americans,26 whereas studies of differences in hrv levels between people of south asian and european origin have shown inconsistent results.27, 28 evidence of ethnic differences in changes in hrv over time is limited . Finally, physical activity has been proposed as a further important determinant of hrv.29 maintenance of physical activity as part of the aging process may have a positive effect on the rate of change in hrv over time . Using unique data from a large, longitudinal uk populationbased cohort study with 3 measurements of shortterm hrv over a 10year period, we sought to test whether hrv changes were largely normative or caused by pathological changes with aging . We also examined whether changes in hrv over time varied systematically by ses, ethnicity, and habitual physical activity . The whitehall ii cohort study is an ongoing longitudinal study of 10 308 civil servants (6895 men and 3413 women) based in london, united kingdom.30 all civil servants aged 35 to 55 years and employed in 20 londonbased white collar civil service departments were invited to participate in this study, and recruitment took place from 1985 to 1988 . Subsequent data collection alternated between postal questionnaires alone and postal questionnaires accompanied by clinical examination . Hr and hrv were measured at the fifth (19971999), seventh (20022004), and ninth (20072009) phases of data collection . At phase 5, all study members known to be alive and resident in the united kingdom were invited to attend a screening clinic . Although 6554 participants (1909 women) attended the clinic (67% of participants), hr was recorded for only 3365 participants because of staff availability . No hrv recordings were collected on 69 days during screening, accounting for the majority of missing hrv data at phase 5 . Participants who did not undergo hrv recordings at phase 5 did not differ significantly from those who did with respect to age, sex, and employment grade.24 to focus on the estimation of withinperson change in hr and hrv levels, we restricted the analytical sample to the subset of participants with at least 2 hrv measurements . The analytical sample for this study comprised 4414 participants (3176 men) with at least 2 hrv measurements . The university college london medical school committee on the ethics of human research approved the whitehall ii study . Whitehall ii data, protocols, and other metadata are available to bona fide researchers for research purposes . Details on the assessment of hr and hrv in whitehall ii can be found elsewhere.20, 24 briefly, 5minute supine resting 12lead ecgs were obtained after 5 minutes of rest . Kardiosis cardiologic diagnostic systems), a seer mc recorder (ge medical systems), and a getemed recorder (getemed teltow) were used at phases 5, 7, and 9, respectively . Five minutes of beattobeat hr data were sampled at 500 hz frequency to obtain a digitized sequence of r waves . Using an automatic algorithm,31 ecg abnormalities including ectopic beats, right bundlebranch block, respiratory arrhythmia, blocked atrial extrasystole, and highamplitude and wide t waves were identified, and normal qrs complexes suited for a reliable hrv analysis were detected . Hrv was analyzed both in the time domain (standard deviation of all intervals between r waves with normaltonormal conduction [sdnn]) and in the frequency domain using a blackmantukey algorithm . Frequencydomain components were computed by integrating the power spectrum within 2 frequency bands: 0.04 to 0.15 hz (lowfrequency power [ms]) and 0.15 to 0.4 hz (highfrequency power [ms]). Lowfrequency power (lowfrequency hrv [lfhrv]) reflects both parasympathetic and sympathetic hr modulations; high frequency (highfrequency hrv [hfhrv]) is an index of parasympathetic modulation of hr.4, 5 in addition, we used lfhrv in normalized units (lfnu [%]), which was computed as lf/(lf+hf). To avoid redundancy, the hfhrv in normalized units, being equal to 100% minus lfnu (%), was not analyzed . These ratiobased hrv measures have been proposed as indices of sympathovagal balance.4, 5 age at phase 5 (19971999) was categorized into 4 groups (4449, 5054, 5559, and 6069 years). Ses, assessed by the british civil service employment grade, was categorized into 3 groups in order of decreasing salary and work role: administrative (high), professional / executive (middle), and clerical / support (low). Ethnicity was defined according to the office for national statistics 1991 census categories, and participants were initially categorized into 4 ethnic groups: white european, south asian, african caribbean, and other . Numbers were too small to examine age and sexspecific hr and hrv trajectories for nonwhite minority ethnic groups . Physical activity was categorized according to whether participants adhered to the world health organization (who) physical activity guidelines of at least 1 hour of vigorous activity 3 times or 2.5 hours of moderate activity 5 times per week.32 these guidelines are widely used and have been quantitatively validated for cardiovascular outcomes.33 habitual physical activity over the 10year period was categorized as hardly ever (once or less through followup), sometimes (in 2 phases), or always (in all 3 followup phases) meeting the who guidelines . Cardiometabolic problems at each phase were assessed as the presence of any of the following chronic disease or healthrelated conditions: diagnosed coronary heart disease including heart failure,9, 34 stroke,35 hypertension,18, 20 diabetes,19, 29 and obesity.20 these factors were chosen as covariates based on systematic literature review as likely to profoundly influence hrv . At each screening, participants provided details of current medications taken in the previous 14 days (generic name, brand name, or both). Prescribed medication included all drugs taken in the previous 14 days that were prescribed by a doctor such as analgesics, antihyperlipidemic agents, antidiabetic agents, psychotropic agents, and antibiotics . We distinguished between beta blockers (british national formulary codes, chapter 2.4) and other prescribed medications because previous studies have shown the former to have a beneficial effect on hrv levels.36 other cardiovascular and central nervous system related medications have been shown to decrease or have no effect on hrv levels.17, 18 analyses were performed in stata 13.1 (statacorp). Sdnn, lfhrv, and hfhrv were transformed by natural logarithm because their distributions were skewed . Outliers (mean3 sd) were trimmed to 3 sd from the mean prior to transformation . Ageadjusted arithmetic and geometric means and 95% cis were calculated for the subset of 1658 participants with complete hr and hrv measurements at each phase of data collection . For this subset of participants, the change in hr between the first and third measurements was defined as hr at phase 9 minus hr at phase 5, scaled to a time difference of 10 years . For hrv measurements, spearman rank correlation coefficient was used to examine the correlations between the hr and hrv measures at phase 5 . Two sets of linear mixed models were used to estimate change in hr and hrv over 10year followup . This method of estimation uses all available data over followup, takes into account the intraindividual correlation between repeated measurements, and can handle missing data . The intercept was fitted as a random effect, allowing participants to have different hrv values at baseline.37 the first set of models was used to examine agespecific hrv trajectories without adjusting for any covariates . The dependent variable was the 3 repeated measurements of hr and hrv, and the independent variables were time (exact time in years between phases, included as a continuous variable, divided by 10 to yield estimates of change over 10 years), age at phase 5 (included as a categorical variable), and interaction between time and age (thereby enabling the rate of change to vary by age at baseline). Interaction terms suggested sex difference in the association between age and hr trajectories (p=0.074), leading us to stratify all analyses by sex . In the second set of models, 5 key covariates (cardiometabolic problems, medication use [other than beta blockers] versus those not on medication, ses, ethnicity, and adherence to who physical activity guidelines) were included to explore their temporal association with hr and hrv . The following 3 ageadjusted coefficients were of interest, using cardiometabolic condition incidence as an example: (1) the coefficient for time represented the 10year change in hr or hrv for participants in the reference category (ie, no cardiometabolic condition), (2) the coefficient for cardiometabolic condition represented the difference in hr or hrv between the no cardiometabolic condition and cardiometabolic condition groups at baseline (phase 5), and (3) the coefficient for the interaction between time and cardiometabolic condition represented the difference in the 10year rate of change between participants with and without cardiometabolic condition . As we focused on medications associated with potential decreases in hrv, we excluded participants using beta blockers in primary analyses . In secondary analyses, we focused specifically on the rates of change in hr and hrv for the participants who reported use of beta blockers at any phase over the 10year period . Sensitivity analyses were also run focusing specifically on a subset of healthy participants, namely, those who were free of a cardiometabolic condition and had no reported medication use over the 10year period . The whitehall ii cohort study is an ongoing longitudinal study of 10 308 civil servants (6895 men and 3413 women) based in london, united kingdom.30 all civil servants aged 35 to 55 years and employed in 20 londonbased white collar civil service departments were invited to participate in this study, and recruitment took place from 1985 to 1988 . Subsequent data collection alternated between postal questionnaires alone and postal questionnaires accompanied by clinical examination . Hr and hrv were measured at the fifth (19971999), seventh (20022004), and ninth (20072009) phases of data collection . At phase 5, all study members known to be alive and resident in the united kingdom were invited to attend a screening clinic . Although 6554 participants (1909 women) attended the clinic (67% of participants), hr was recorded for only 3365 participants because of staff availability . No hrv recordings were collected on 69 days during screening, accounting for the majority of missing hrv data at phase 5 . Participants who did not undergo hrv recordings at phase 5 did not differ significantly from those who did with respect to age, sex, and employment grade.24 to focus on the estimation of withinperson change in hr and hrv levels, we restricted the analytical sample to the subset of participants with at least 2 hrv measurements . The analytical sample for this study comprised 4414 participants (3176 men) with at least 2 hrv measurements . The university college london medical school committee on the ethics of human research approved the whitehall ii study . Whitehall ii data, protocols, and other metadata are available to bona fide researchers for research purposes . Details on the assessment of hr and hrv in whitehall ii can be found elsewhere.20, 24 briefly, 5minute supine resting 12lead ecgs were obtained after 5 minutes of rest . Kardiosis cardiologic diagnostic systems), a seer mc recorder (ge medical systems), and a getemed recorder (getemed teltow) were used at phases 5, 7, and 9, respectively . Five minutes of beattobeat hr data were sampled at 500 hz frequency to obtain a digitized sequence of r waves . Using an automatic algorithm,31 ecg abnormalities including ectopic beats, right bundlebranch block, respiratory arrhythmia, blocked atrial extrasystole, and highamplitude and wide t waves were identified, and normal qrs complexes suited for a reliable hrv analysis were detected . Hrv was analyzed both in the time domain (standard deviation of all intervals between r waves with normaltonormal conduction [sdnn]) and in the frequency domain using a blackmantukey algorithm . Frequencydomain components were computed by integrating the power spectrum within 2 frequency bands: 0.04 to 0.15 hz (lowfrequency power [ms]) and 0.15 to 0.4 hz (highfrequency power [ms]). Lowfrequency power (lowfrequency hrv [lfhrv]) reflects both parasympathetic and sympathetic hr modulations; high frequency (highfrequency hrv [hfhrv]) is an index of parasympathetic modulation of hr.4, 5 in addition, we used lfhrv in normalized units (lfnu [%]), which was computed as lf/(lf+hf). To avoid redundancy, the hfhrv in normalized units, being equal to 100% minus lfnu (%), was not analyzed . Age at phase 5 (19971999) was categorized into 4 groups (4449, 5054, 5559, and 6069 years). Ses, assessed by the british civil service employment grade, was categorized into 3 groups in order of decreasing salary and work role: administrative (high), professional / executive (middle), and clerical / support (low). Ethnicity was defined according to the office for national statistics 1991 census categories, and participants were initially categorized into 4 ethnic groups: white european, south asian, african caribbean, and other . Numbers were too small to examine age and sexspecific hr and hrv trajectories for nonwhite minority ethnic groups . Physical activity was categorized according to whether participants adhered to the world health organization (who) physical activity guidelines of at least 1 hour of vigorous activity 3 times or 2.5 hours of moderate activity 5 times per week.32 these guidelines are widely used and have been quantitatively validated for cardiovascular outcomes.33 habitual physical activity over the 10year period was categorized as hardly ever (once or less through followup), sometimes (in 2 phases), or always (in all 3 followup phases) meeting the who guidelines . Cardiometabolic problems at each phase were assessed as the presence of any of the following chronic disease or healthrelated conditions: diagnosed coronary heart disease including heart failure,9, 34 stroke,35 hypertension,18, 20 diabetes,19, 29 and obesity.20 these factors were chosen as covariates based on systematic literature review as likely to profoundly influence hrv . At each screening, participants provided details of current medications taken in the previous 14 days (generic name, brand name, or both). Prescribed medication included all drugs taken in the previous 14 days that were prescribed by a doctor such as analgesics, antihyperlipidemic agents, antidiabetic agents, psychotropic agents, and antibiotics . We distinguished between beta blockers (british national formulary codes, chapter 2.4) and other prescribed medications because previous studies have shown the former to have a beneficial effect on hrv levels.36 other cardiovascular and central nervous system related medications have been shown to decrease or have no effect on hrv levels.17, 18 sdnn, lfhrv, and hfhrv were transformed by natural logarithm because their distributions were skewed . Outliers (mean3 sd) were trimmed to 3 sd from the mean prior to transformation . Ageadjusted arithmetic and geometric means and 95% cis were calculated for the subset of 1658 participants with complete hr and hrv measurements at each phase of data collection . For this subset of participants, the change in hr between the first and third measurements was defined as hr at phase 9 minus hr at phase 5, scaled to a time difference of 10 years . For hrv measurements, spearman rank correlation coefficient was used to examine the correlations between the hr and hrv measures at phase 5 . Two sets of linear mixed models were used to estimate change in hr and hrv over 10year followup . This method of estimation uses all available data over followup, takes into account the intraindividual correlation between repeated measurements, and can handle missing data . The intercept was fitted as a random effect, allowing participants to have different hrv values at baseline.37 the first set of models was used to examine agespecific hrv trajectories without adjusting for any covariates . The dependent variable was the 3 repeated measurements of hr and hrv, and the independent variables were time (exact time in years between phases, included as a continuous variable, divided by 10 to yield estimates of change over 10 years), age at phase 5 (included as a categorical variable), and interaction between time and age (thereby enabling the rate of change to vary by age at baseline). Interaction terms suggested sex difference in the association between age and hr trajectories (p=0.074), leading us to stratify all analyses by sex . In the second set of models, 5 key covariates (cardiometabolic problems, medication use [other than beta blockers] versus those not on medication, ses, ethnicity, and adherence to who physical activity guidelines) were included to explore their temporal association with hr and hrv . The following 3 ageadjusted coefficients were of interest, using cardiometabolic condition incidence as an example: (1) the coefficient for time represented the 10year change in hr or hrv for participants in the reference category (ie, no cardiometabolic condition), (2) the coefficient for cardiometabolic condition represented the difference in hr or hrv between the no cardiometabolic condition and cardiometabolic condition groups at baseline (phase 5), and (3) the coefficient for the interaction between time and cardiometabolic condition represented the difference in the 10year rate of change between participants with and without cardiometabolic condition . As we focused on medications associated with potential decreases in hrv, we excluded participants using beta blockers in primary analyses . In secondary analyses, we focused specifically on the rates of change in hr and hrv for the participants who reported use of beta blockers at any phase over the 10year period . Sensitivity analyses were also run focusing specifically on a subset of healthy participants, namely, those who were free of a cardiometabolic condition and had no reported medication use over the 10year period . Of the 10 308 participants at phase 1 (19851988), 306 died and 752 dropped out of the study before the start of hr and hrv data collection at phase 5 (19971999). Of the 9250 remaining participants, hr and hrv measures were obtained from 3365, 4095, and 5624 participants at phases 5, 7, and 9, respectively . A total of 6410 participated in 1 of the 3 hr and hrv assessments over 10 years; 4414 had 2 assessments of hr and hrv over the 10year followup . Twothirds (2756) of the 4414 participants in the analytical sample contributed 2 waves of hr and hrv data, and 1658 (37.6%) contributed all 3 waves . The analytical sample was composed of more men than women (70.8% versus 59.9%; p<0.001) and persons from the high employment grade (43.2% versus 35.1%; p<0.001). In participants with only 1 measure, the mean estimates of hr and lfhrv were slightly higher and lower, respectively, for both sexes at phase 5 compared with the main analysis . Table s1a compares the characteristics at phase 5 for participants with 1 hr and hrv assessment versus 2 assessments . Compared with participants with 1 assessment, the analytical sample was composed of more men than women (72.0% versus 68.4%; p=0.004), more persons in the youngest age category (22.9% versus 20.3% aged 4449 years at phase 5; p<0.001), and persons from the high employment grade (45.1% versus 38.6%; p<0.001). Table 1 presents the descriptive characteristics of the analytical sample at phases 5, 7, and 9 by age, civil service grade, ethnicity, presence of cardiometabolic problems, medication use, and adherence to who physical activity guidelines . Table s1b presents the spearman rank correlation coefficients between hr and hrv at phase 5 . Strong positive correlations were found between all hrv measures except for lfnu, ranging from 0.74 (lfhrv and hfhrv) to 0.90 (lfhrv and sdnn). Correlations between hrv and hr were negative and lower in magnitude: r=0.47 for sdnn, r=0.37 for lfhrv, and r=0.42 for hfhrv . Descriptive characteristics of analytical sample by data collection phase and sex whitehall ii study participants with 2 assessments of heart rate and heart rate variability over 10year followup . Chd indicates coronary heart disease; cns, central nervous system; cvd, cardiovascular disease; who, world health organization . Presence of any of the following cardiometabolic conditions: diagnosed chd, stroke, heart failure, diabetes, obesity, and hypertension . Habitual physical activity over the 10year period was categorized as hardly ever (once or less through followup), sometimes (in 2 phases), or always (in all 3 followup phases) meeting the who guidelines . Table 2 presents the ageadjusted means at phases 5, 7, and 9 for the subset of 1658 participants with hr and hrv measurements at all 3 phases . Average levels of hr, sdnn, and lf and hfhrv decreased consistently for men but increased for women from phase 5 to 7 . These hrv measures, however, declined significantly for both sexes over the 10year followup . Hfhrv, for example, decreased by 30.6% for men and 32.8% for women over the 10year period . Ageadjusted heart rate and heart rate variability means (95% ci) at baseline and 5 and 10year followup by sex whitehall ii study participants with assessment of hr and hrv at each phase over the 10year followup . Bpm indicates beats per minute; hfhrv, highfrequency heart rate variability; hr, heart rate; lfhrv, lowfrequency heart rate variability; lfnu, lowfrequency heart rate variability in normalized units; sdnn, standard deviation of all intervals between r waves with normaltonormal conduction . Table 3 presents the results from the mixed models that estimated associations between age at baseline and hr and hrv trajectories . Agespecific rates of change over the 10year followup estimated from each model are presented in table 4 . Results indicated significant decreases in sdnn, lfhrv, hfhrv, and hr; however, the interaction terms between age at baseline and time showed significant differences in the rate of decline in lfhrv for women, in hfhrv for men and for women, and in lfnu for men . Younger participants at baseline experienced faster decline in hfhrv than their older counterparts (p=0.001 and p=0.020 for the timeage interaction term for men and for women, respectively). Change in hfhrv for men aged 60 years at baseline, for example, was 13% over 10 years compared with 52% for men aged 44 to 49 years (see table 4). In the case of lfnu, older men at baseline (aged 5459 and 60 years) experienced decreases in lfnu compared with no change in the youngest men (aged 4449 years). Declines in hr and sdnn for women showed marginally significant differences in the rate of change across age groups (p=0.063 and p=0.060) (table 3). Associations (mixedmodels analyses) between age at baseline and heart rate and heart rate variability trajectories by sex whitehall ii study participants with 2 assessments of hr and hrv over the 10year followup hfhrv indicates highfrequency heart rate variability; hr, heart rate; lfhrv, lowfrequency heart rate variability; lfnu, lowfrequency heart rate variability in normalized units; sdnn, standard deviation of all intervals between r waves with normaltonormal conduction . P value from adjusted wald test . Estimated agespecific 10year rates of change (95% cis) in heart rate and heart rate variability trajectories by sex hfhrv indicates highfrequency heart rate variability; hr, heart rate; lfhrv, lowfrequency heart rate variability; lfnu, lowfrequency heart rate variability in normalized units; sdnn, standard deviation of all intervals between r waves with normaltonormal conduction . Table 5 presents results from the mixedmodels analysis undertaken to assess associations among cardiometabolic condition, medication use (other than beta blockers), and hr and hrv trajectories . At baseline, cardiometabolic condition was significantly associated with lower values of sdnn, lfhrv, and hfhrv for both sexes and lower values of lfnu for men . For men, cardiometabolic condition had no significant effect on the rate of decline in hrv measures . For women, cardiometabolic condition was associated with faster rates of decline in sdnn, lfhrv, and lfnu . At baseline, reported use of prescribed medication (other than beta blockers) was associated with significantly lower values of sdnn, lfhrv, and hfhrv for men and for women and with higher values of hr for men . Differences in the rate of change in hr and hrv by medication group were not significant for either sex . The dynamics of hr and hrv change over time by cardiometabolic condition and reported medication use (other than beta blockers) are presented in figures 1 and 2 respectively . Associations (mixedmodels analyses) between cardiometabolic condition and medication use and heart rate and heart rate variability trajectories by sex estimates were obtained from mixed models including time, age at baseline, timeage, cardiometabolic condition or medication use, and timecardiometabolic condition or medication use . The interaction term for models including cardiometabolic condition shows the estimated difference in the 10year rate of change between the no cardiometabolic condition and cardiometabolic condition groups . Likewise, the interaction term for models including medication use shows the estimated difference in the 10year rate of change between participants reporting and not reporting use of prescribed medication . Hfhrv indicates highfrequency heart rate variability; hr, heart rate; lfhrv, lowfrequency heart rate variability; lfnu, lowfrequency heart rate variability in normalized units; sdnn, standard deviation of all intervals between r waves with normaltonormal conduction . Modelpredicted trajectories of agerelated change in hr and hrv measures in men (a) and women (b) aged 44 to 69 years (19971999) with and without reported cardiometabolic condition over a 10year followup period . The trajectories for each age group at phases 5, 7, and 9 were predictions from a linear mixed model including time, age at baseline, timeage, cardiometabolic condition, and timecardiometabolic condition . Hr indicates heart rate; hrv, heart rate variability; hf, highfrequency heart rate variability; lf, lowfrequency heart rate variability; lfnu, lowfrequency heart rate variability in normalized units; sdnn, standard deviation of all intervals between r waves with normaltonormal conduction . Modelpredicted trajectories of agerelated change in hr and hrv measures in men (a) and women (b) aged 44 to 69 years (19971999) with and without reported medication use (other than beta blockers) over a 10year followup period . The trajectories for each age group at phases 5, 7, and 9 were predictions from a linear mixed model including time, age at baseline, timeage, use of prescribed medication, and timemedication use . Hr indicates heart rate; hrv, heart rate variability; hf, highfrequency heart rate variability; lf, lowfrequency heart rate variability; lfnu, lowfrequency heart rate variability in normalized units; sdnn, standard deviation of all intervals between r waves with normaltonormal conduction . In secondary analyses, reported use of beta blockers at baseline was associated with significantly lower values of hr, lfhrv, and lfnu for men and for women and significantly higher values of hfhrv for women . Reported use of beta blockers over 10 years was significantly associated with faster declines in sdnn and lfhrv for women (p=0.029 and p=0.032) but not for men (data not shown). At each phase, average levels of sdnn for men in the high employment grade were highest and average levels of hr were lower than for men in the middle and low grades . Differences in the rate of change in hr and hrv across ses were not statistically significant (table s2a and s2b). For both sexes, average values of lfnu were significantly higher, and for men, values of hfhrv were significantly lower for participants of white ethnic origin . Differences in the rate of change across the white and nonwhite ethnic minority groups were not statistically significant (table s3a and s3b). For men who consistently adhered to the who physical activity guidelines (at least 1 hour of vigorous activity 3 times or 2.5 hours of moderate activity 5 times per week) over the 10year period, average levels of sdnn, lfhrv, and hfhrv were higher and average levels of hr were lower than for men who met the guidelines on 1 occasion . Differences in the rate of change across the physical activity groups were not significant for hrv in either sex and were not significant for hr for men . For women, levels of adherence to who guidelines were associated with differences in the rate of change in hr . Compared with women who met the guidelines on 1 occasion throughout 10year followup, women who met the guidelines on each occasion showed a faster pace of decline in hr (table s4a and s4b). At each phase, average levels of sdnn for men in the high employment grade were highest and average levels of hr were lower than for men in the middle and low grades . Differences in the rate of change in hr and hrv across ses were not statistically significant (table s2a and s2b). For both sexes, average values of lfnu were significantly higher, and for men, values of hfhrv were significantly lower for participants of white ethnic origin . Differences in the rate of change across the white and nonwhite ethnic minority groups were not statistically significant (table s3a and s3b). For men who consistently adhered to the who physical activity guidelines (at least 1 hour of vigorous activity 3 times or 2.5 hours of moderate activity 5 times per week) over the 10year period, average levels of sdnn, lfhrv, and hfhrv were higher and average levels of hr were lower than for men who met the guidelines on 1 occasion . Differences in the rate of change across the physical activity groups were not significant for hrv in either sex and were not significant for hr for men . For women, levels of adherence to who guidelines were associated with differences in the rate of change in hr . Compared with women who met the guidelines on 1 occasion throughout 10year followup, women who met the guidelines on each occasion showed a faster pace of decline in hr (table s4a and s4b). The main finding in this large longitudinal uk populationbased study is that hrv decreased with aging independent of pathological conditions or medication use, potentially suggesting that cardiac autonomic modulation diminishes due to normative aging . Men and women showed similar rates of hrv decline, with faster decline in younger age groups . Crosssectionally, average levels of hrv were lower for men than for women, for participants with cardiometabolic condition, and for participants reporting the use of prescribed medications other than beta blockers . We further observed that women with a cardiometabolic condition experienced faster decline in sdnn, lfhrv, and lfnu compared with women without a cardiometabolic condition . Ses, ethnicity, and habitual physical activity did not show statistically significant associations with longitudinal hrv trajectories . Finally, women who met the who physical activity guidelines on each occasion over 10year followup showed a faster pace of decline in hr than women who met the guidelines on 1 occasion . Average levels of sdnn, lfhrv, and hfhrv in this large uk middleaged cohort were similar to levels seen in populationbased studies in the united states19 and germany38 based on shortterm hrv recordings measured using similar procedures . Given the dearth of longitudinal studies of patterns of hrv changes with aging, it is important that our current study replicated most of the crosssectional evidence of hrv declines with aging.10, 12, 13, 14 our study is unique in demonstrating agerelated hrv changes based on shortterm recordings . Most of the crosssectional10, 11, 14, 15 and longitudinal17, 22 evidence on agerelated changes in hrv has been based on 24hour hrv recordings that provide different physiological information than shortterm recordings during which conditions are controlled and stable.5 consequently, we can compare our findings with only 1 other longitudinal populationbased study . In the atherosclerosis risk in communities (aric) study, the mean annual decrease in sdnn for> 6000 middleaged men and women (aged 4564 years) was similar to our results.8, 18, 19 no studies of aric data have reported on longitudinal changes of frequencydomain hrv or on differences in hrv trajectories according to sex and/or across age groups . An earlier study using whitehall ii data based on 2 shortterm hrv recordings20 showed that hrv declined for men but increased for women over the 5year followup period . Using additional followup of hrv measurements for the same cohort, we no longer observed increases in mean hrv for women over the 10year period . Moreover, our analyses revealed similarities in the temporal course and rate of decline in hrv measures for both sexes . We examined the influence of a number of factors that could have accounted for the unexpected increase in hrv levels for women from phase 5 to 7, including use of hormone replacement therapy and oral contraceptives or menopausal status . These factors did not explain the 5year increase in hrv or the longer term decline in hrv over the 10year period (data not shown). The crosssectional associations found in our study between cardiometabolic conditions (history of coronary heart disease, heart failure, stroke, diabetes, hypertension, and obesity) and/or cardiovascularrelated medications (other than beta blockers) and hrv levels were also in line with previous studies.9, 18, 19, 20, 21, 34, 35 participants reporting use of beta blockers had similar or slightly more favorable hr and hrv levels compared with untreated participants . Hr and hrv levels were much more favorable for participants using beta blockers compared with those on other medications; however, the beneficial effects of beta blockers on sympathetic nervous system activity36 declined for women over the 10year followup, as reflected by their faster rate of decline in sdnn compared with those not taking medication . This finding should be treated with caution because small sample sizes meant that our study lacked sufficient power to detect small differences in the rate of change in hr and hrv according to beta blocker use . Although hrv decreases were influenced by cardiometabolic condition for women, none of the 5 key covariates fully explained the declining trend in hrv as both men and women aged over the 10year period . Our sensitivity analysis focusing specifically on a subset of healthy participants those without cardiometabolic condition and with no reported medication use at any of the 3 data collection phases produced largely similar results of declining hrv trajectories . Although the biological interpretation of hrv indices is complex, the decreasing sdnn and hfhrv trajectories may suggest that both normative and potentially pathological aging is accompanied by gradual reduction of overall fluctuation in cardiac autonomic input and by gradual reduction in parasympathetic modulation . Mechanisms underlying changes in parasympathetic modulation with aging may be related to changes in cholinergic and muscarinic pathways through which vagal signal is carried . This may include disturbed cardiac acetylcholine release response to stimulation,39 decreases in muscarinic receptor activity,40 and reductions in m2 muscarinic receptor density with aging,41 all of which have been shown to decrease with aging in clinical trials . Loss of protective vagal reflexes seems to hinder physical and psychological functioning and capacity to respond flexibly to efferent stimuli, resulting in increased vulnerability to the diseases2, 42 that are often prevalent at older ages.43 trajectories in lfhrv, measured in the supine position in our study, changed in the same direction and in a similar pattern to hfhrv, suggesting that lfhrv not only is a measure of sympathetic activity, as reported in some studies, but also represents the variation in rr interval caused by more graduated interplay between sympathetic and parasympathetic activities.5 our results may also provide possible insight into plausible biological pathways of sex differences in cardiac autonomic functioning . In addition, we observed differences in lfnu trajectories by sex that may reflect sexspecific differences in balance between the 2 branches of autonomic nervous system with aging . A number of authorities22, 44 have suggested that the parasympathetic and sympathetic branches of the autonomic nervous system operate differently for men and for women to achieve homeostasis . The observed sex differences in our study may thus be related to different biological ways of responding to stress44 and/or health conditions.45 the exact mechanisms underlying sex differences in cardiac autonomic functioning, however, are poorly understood.22 a key strength of our investigation is the use of participantlevel longitudinal data with 3 repeated measures of hrv over a decade in a nonclinical setting . Multiple measures of shortterm hrv in both the time and frequency domains allowed us to attribute hrv changes to parasympathetic or / and sympathetic modulation changes and generally to changes in cardiac autonomic function . We used repeated measures of covariates, not just baseline measures, allowing the presence of cardiometabolic condition and reported medication use to vary over the 10year period . The analytical sample for our study was reduced in size due to death and nonresponse or withdrawal from the study prior to the start of hr and hrv data collection in phase 5 and through staff not being available for 2 months at phase 5 . In addition, we restricted the analytical sample to the subset of participants with at least 2 hrv measurements to estimate withinperson change in hr and hrv levels . Although the sizeable amount of missing data at phase 5 has been shown to be random,24 the observed declines in hrv are most likely underestimated to some extent in our study because of a healthy survival bias (selective attrition in the cohort); those with the presence of risk factors or low hrv levels may be more likely to drop out.46 sample sizes were too small to examine the age and sexspecific trajectories for nonwhite minority ethnic groups such as people of south asian and african caribbean origin . We cannot rule out the contribution of device effects because different recording equipment was used in each phase; however, the hrv protocols were consistent across all data collection phases . Although 5minute hrv recordings are highly repeatable47 and considered representative of 24hour ambulatory hrv recordings,48 longterm recordings may offer more comprehensive and accurate evaluation of hrv changes over time . Finally, the whitehall ii study is an occupationbased cohort and thus is healthier on average than the general population . Nevertheless, etiological findings from the whitehall ii cohort have been shown to be comparable to other populationbased studies.49 a key strength of our investigation is the use of participantlevel longitudinal data with 3 repeated measures of hrv over a decade in a nonclinical setting . Multiple measures of shortterm hrv in both the time and frequency domains allowed us to attribute hrv changes to parasympathetic or / and sympathetic modulation changes and generally to changes in cardiac autonomic function . We used repeated measures of covariates, not just baseline measures, allowing the presence of cardiometabolic condition and reported medication use to vary over the 10year period . The analytical sample for our study was reduced in size due to death and nonresponse or withdrawal from the study prior to the start of hr and hrv data collection in phase 5 and through staff not being available for 2 months at phase 5 . In addition, we restricted the analytical sample to the subset of participants with at least 2 hrv measurements to estimate withinperson change in hr and hrv levels . Although the sizeable amount of missing data at phase 5 has been shown to be random,24 the observed declines in hrv are most likely underestimated to some extent in our study because of a healthy survival bias (selective attrition in the cohort); those with the presence of risk factors or low hrv levels may be more likely to drop out.46 sample sizes were too small to examine the age and sexspecific trajectories for nonwhite minority ethnic groups such as people of south asian and african caribbean origin . We cannot rule out the contribution of device effects because different recording equipment was used in each phase; however, the hrv protocols were consistent across all data collection phases . Although 5minute hrv recordings are highly repeatable47 and considered representative of 24hour ambulatory hrv recordings,48 longterm recordings may offer more comprehensive and accurate evaluation of hrv changes over time . Finally, the whitehall ii study is an occupationbased cohort and thus is healthier on average than the general population . Nevertheless, etiological findings from the whitehall ii cohort have been shown to be comparable to other populationbased studies.49 our study shows that normative hrvdeclining trajectories exist largely independently of cardiometabolic conditions or reported use of medication . We have further described the agerelated progression of hrv according to sex, ethnicity, ses, and habitual physical activity, and that information could help improve understanding of cardiac autonomic functioning in aging populations . The whitehall ii study is supported by grants from the uk medical research council (k013351), british heart foundation (rg/07/008/23674), stroke association, national heart lung and blood institute (hl036310) and national institute on aging (ag13196 and ag034454). Jandackova was supported by a university of ostrava award (sgs23/lf/2015) and by a young investigator of moraviansilesian region award (02679/2014/rrc). Baseline characteristics of participants with 1 assessment of heart rate (hr) and hr variability (hrv) and the analytical sample (2 assessments of hr and hrv) table s1b . Measures of heart rate and heart rate variability and their intercorrelations at baseline (n=2718) table s2a . Associations (mixedmodels analyses) between age at baseline and civil service employment grade and heart rate and heart rate variability trajectories by sex table s2b . Estimated agespecific 10year rates of change (95% cis) in heart rate and heart rate variability trajectories by civil service employment grade table s3a . Associations (mixedmodels analyses) between age at baseline and ethnicity and heart rate and heart rate variability trajectories by sex table s3b . Estimated agespecific 10year rates of change (95% cis) in heart rate and heart rate variability trajectories by ethnicity table s4a . Associations (mixedmodels analyses) between age at baseline and habitual physical activity and heart rate and heart rate variability trajectories by sex table s4b . Estimated agespecific 10year rates of change (95% cis) in heart rate and heart rate variability trajectories by habitual physical activity click here for additional data file.
|
Epilepsy is the second most prevalent neurological disorder (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(\sim 1\) \end{document}% prevalence) affecting approximately 67 million people worldwide with up to 75% from developing countries . Eeg is important in developing countries for various clinical uses, including evaluation of suitability for epilepsy surgery and treatment of status epilepticus . Epilepsy diagnosis is complicated by the fact that electrical potentials recorded from scalp electroencephalogram (eeg) have poor sensitivity to localized epileptiform activity, especially high frequency oscillations (hfos) which now attract a lot of attention as a promising marker of epileptogenesis and ictogenesis . Misdiagnosis of epilepsy is very common in patients of all ages and occurs in up to 50% of the patients, . The hfos occupy the gamma (30100 hz), ripple (100200 hz) and fast ripple (200500 hz) bands along with delta, theta, alpha and beta bands making up the remainder of the spectral content of eeg . Appearance of fast eeg rhythms at the onset of seizures in humans and animal models of epilepsy has been described in many studies and first reported in humans by fisher et al . And allen et al . . Fast rhythms are especially evident in intracranial recordings in patients considered for surgical treatment of their drug - resistant epilepsy . In recent years, there has been a surge in the number of publications on hfos and their role in epilepsy (for reviews, see, . Numerous studies on animal models and epilepsy patients have revealed that: 1) hfos are one of the most common early manifestations of seizures recorded within minutes before seizure onset; 2) hfos appear to be the most likely eeg correlate of a seizure onset zone (soz); and 3) the removal of hfo - generating areas correlates with good surgical outcome,,, . Thus, hfos appear to be an excellent marker for the epileptogenic zone but their recording from scalp with conventional disc electrodes is difficult . Eeg has been a very useful research and clinical instrument for almost a century since its first human use by hans berger in 1920s . The distance to the brain and the relatively large electrical impedance of the skull significantly reduce small electrical signals generated by individual neurons . To be detectable at the scalp, the signal should be produced by a relatively large population of neurons acting more or less synchronously at scales of at least several centimeters . Only in this case does the sum of individual neuronal signals become large enough to be detected at the scalp . Synchronous activity within neuronal assemblies is now considered an important mechanism of information processing, and this synchrony is expressed through neuronal oscillations occurring at different frequencies spanning several orders of magnitude from infraslow (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(\sim 0.01\) \end{document} hz) up to ultrafast (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(\sim 1000\) \end{document} hz) (for a comprehensive review of brain oscillations, see . There is an intricate relationship between temporal and spatial scales of brain oscillations in that higher frequency oscillations (e.g., high gamma band> 60 hz) usually occur at smaller distances between sources and involve smaller neuronal populations . This is because more precise synchronization dictated by shorter oscillatory periods can be achieved only through shorter neuronal connections with shorter propagation times or non - synaptic communication such as ephaptic interactions and gap junctions . Long distance connections have longer propagation times and therefore synchronization at larger distances is less precise and preferentially occurs at lower frequencies (e.g., within delta, theta, alpha and beta bands). As a result, high frequency oscillations> 60 hz usually reflect activity within well localized neuronal assemblies at spatial scales of a few mm, which are not typically visible from the scalp . Thus, conventional eeg has lower sensitivity to high frequency components of brain activity, . Conventional scalp eeg is also contaminated by noise represented by non - brain electrical activity such as ocular artifacts, scalp muscle potentials, and the electrocardiogram . Additional noise is occasionally produced by abnormally large electrode impedance, electrode movement, amplifier drifts, etc . The noise can be as large as, or even larger than, the brain potential of interest and represents a significant problem for electroencephalographers and neurologists . This noise shows high spatial coherence due to smearing effects of the head volume conductor . Conventional disc eeg recordings also have reference electrode problems . A common average reference and concentric electrodes have been proposed to resolve the reference electrode problems . However, in the common average reference recordings, it is possible that components present in most of the electrodes but absent or minimal in the electrode of interest may appear as ghost potentials . Thus, there is a strong need to develop new types of electrodes beyond conventional disc electrodes . To overcome the poor signal - to - noise ratio and reference problems of the disc electrodes besio et al . Have developed the tripolar concentric ring electrode (tcre), a transformative electrode configuration . The tcre consists of three electrode elements - outer ring, middle ring, and the central disc (fig . 1, b). It is distinctively different from the disc electrode which has a single element (fig . The novelty of the tcre lies in a new principle of recording electrical activity of the brain from the scalp through its three closely spaced elements . It can provide three separate signals from the three electrode elements used to record two bipolar differential signals for the tripolar laplacian derivation first described in as a weighted sum {16*(m - d)-(o - d)} where o, m, and d are the potentials on the outer ring, middle ring, and central disc, respectively . The tripolar signal is a' hardware realization' of the laplacian i.e., the second spatial derivative of the scalp signal . Unlike other software methods (' laplacian montages' in conventional eeg systems) which approximate the laplacian by taking differences between disc electrodes placed, at best,> 1 cm apart, the tcre performs the laplacian automatically and takes bipolar differences of the surface potentials from closely spaced (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(\sim 1\) \end{document} mm) concentric electrode elements with our custom preamplifier . With the electrode elements so close to each other, globally originating sources such as eye blinks, muscle or motion - related artifacts contribute nearly equally and are attenuated sharply when bipolar differences are performed by the preamplifier . Compared with disc signals, eeg recorded with the tcre (teeg as described by) has about a 4-fold (374%) increase in signal - to - noise ratio (snr) and less than one - tenth (8.27%) the mutual information between signals recorded from two adjacent tcres (which suggests a significant attenuation of volume conductance effects and, as a result, higher spatial resolution), . The tcre also has strong attenuation of various artifacts, 100 db at one radius from the electrode . Figure 1.conventional disc electrode (a) and tripolar concentric ring electrode (b). Conventional disc electrode (a) and tripolar concentric ring electrode (b). The current study presents preliminary data from patients with epilepsy in whom teeg was recorded in parallel with clinical conventional scalp eeg . The goal is to demonstrate that tripolar electrodes may provide a unique opportunity to record hfos from scalp and thus improve diagnosis of epilepsy and localization of the seizure onset and the irritative zones . Their implementation into clinical practice may eventually help determine where to place and reduce the number of intracranial grids and depth electrodes to be implanted during presurgical evaluation of patients . Patients for this study were recruited from the national institute of neurology and neurosurgery (ninn; ten patients) and rhode island hospital (rih; two patients). Patients were referred by the epilepsy clinic in each institution with the diagnosis of drug resistant epilepsy using the international league against epilepsy criteria . Diagnosis of epilepsy and epileptic seizures was based on the international classification of seizures 1981 and epileptic syndromes 1989 . Ictal and non - ictal recordings were obtained; for non - ictal recordings lateralization and localization of the irritative zone (iz) was determined whereas in ictal recordings the soz or iz was identified with the appearance of behavioral changes associated with focal low voltage, fast activity, flattening or slow wave interruption . To verify that tcres can be used to record physiological signals we recorded from three healthy subjects, one at stanford school of medicine and two at the university of rhode island (uri) placing conventional disc electrodes over the occipital lobe (at the o1 and o2 locations of the 1020 international electrode system with reference at a1 and ground electrode placed on the right collar bone). Two tcres were placed right next to the conventional electrodes at the o1 and o2 locations (o1' and o2' positions, respectively). The tcre eeg signals (teeg) were first preconditioned with our custom made preamplifiers (gain \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(=20\) \end{document}) and then passed to the bipolar inputs of the (stanford - eeg-1200, nihon kohden corporation, tokyo, japan; uri - grass technologies aura ltm-64, grass technologies, west warwick, ri) clinical eeg recording system . All signals were recorded with 1 to 120 hz band - width at 500 s / s and stored to the hard drive for post processing . The subjects were asked to close and open their eyes repeatedly to record the presence or absence of alpha rhythms, respectively . The study's recording protocol was designed in such a way as to avoid any interference with clinical eeg recording and evaluation . At both the ninn and rih during the attachment of clinical conventional disc electrodes (referred to as' eeg electrodes' or' eeg signals' in the subsequent text), the patient's scalp was cleaned with nuprep and then eeg electrodes were placed at the 1020 international electrode system locations using ten-20 paste . Collodion was also used to help hold all electrodes in place at the ninn . To obtain teeg recordings in parallel to the clinical eeg, the tcres were placed just behind the disc electrodes in locations close to the 1010 sites and attached to the scalp with ten-20 paste (fig . The ground was placed on the forehead (rih, ninn) and the reference electrode was placed on the forehead at rih and on the oz location at ninn . Clinical eeg was recorded with the comet as40 system (grass technologies, west warwick, ri) and stored separately for further clinical evaluation . The eeg sampling rate was 200 samples per second (s / s) and the low - pass filter was 70 hz (ninn and rih). The teeg data were pre - amplified with the gain equal to either 6 (for eight patients) or 100 (for four patients) and amplified and digitized with an aura ltm-64 system (grass technologies, west warwick, ri) at different sampling frequencies for different patients . For four patients the data were filtered 1100 hz and digitized at 200 s / s, another six were filtered 1200 hz and digitized at 400 s / s and for the remaining two patients the data were filtered 1250 hz and 1500 hz respectively and digitized at 1600 s / s . The 60 hz notch filter was used for all patients . The recording sessions at the ninn usually lasted for six hours, from around 7 am to 1 pm . For the two patients at rih, the recording was stopped shortly after the patient had a seizure (130 minutes total) and for the other the recording lasted 66 minutes . The ninn recording protocol included requests to patients to be sleep deprived the night before coming for a video - eeg monitoring and all patients signed an additional consent form as antiepileptic drugs dosage was reduced by half the previous day of the recording . Recorded data were reviewed by board certified neurologists and seizure onset time and duration were determined for each seizure . Seizure onset time was defined as the beginning of the first observable seizure pattern in either eeg or teeg . Note: t7/p7 and t8/p8 are the same as t3/t5 and t4/t6 in 1020 nomenclature . The blue rings are for standard 1020 electrode locations . The 105 montage with tcres (red) placed near the 1020 locations . Note: t7/p7 and t8/p8 are the same as t3/t5 and t4/t6 in 1020 nomenclature . The data were stored on the hard drive and exported from twin (grass technologies, west warwick, ri) into ascii text files that were then imported to matlab (mathworks, natick, ma) and converted to .mat files . For the teeg, next we used a modified version of the algorithm reported by gardner et al . For detection of hfos combined with the visual inspection to rule out high frequency artifacts . The algorithm performed a continuous short - time fourier transform to calculate the power within a particular frequency band over consecutive and half - overlapping one - second epochs using a hamming tapering window . As a result simple thresholding was also used to find events which had power significantly higher than the interictal background eeg . Then the time periods when the hfo power was exceeding its average plus two standard deviations were found . Frequency bands starting at high gamma band (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(\sim 60\) \end{document} hz) and up to the upper bound of the band - pass filter that varied for individual patients were searched for hfos . We selected segments up to an hour prior to the onset of the seizures and generated spectrograms to follow the temporal dynamics of pre - seizure hfos . For the patients who had epileptiform activity only but no seizures we calculated spectrograms on 10 minute long segments centered on the periods of epileptiform activity . For the patients who did not have either epileptiform activity or seizures we performed spectral analysis on multiple 10 minute long segments at various times during the recording . To assess the relationship between teeg channels containing hfos preceding seizures and the soz the ratio between the number of teeg channels with hfos in the soz and the total number of teeg channels with hfos was calculated for each patient whose seizure was recorded . We also calculated the ratio between the total number of teeg channels with hfos and the total number of teeg channels to assess how widespread the hfos were for each patient . Both ratios were averaged for the five patients with seizures included in this study . Only the channels containing hfos preceding the seizures were assessed . Soz or iz was determined for each patient independently by three epileptologists (iemj, jng, and rsf) based on eeg data and videos only . The epileptologists did not have access to teeg data and were not aware of the hfo detection results . In one patient the third soz was determined by the location of resection by the surgeon . A disjunctive (logical or) that is all channels determined as part of the soz (iz) by either one of the epileptologists were considered to be a part of the soz (iz). First, we demonstrate the suitability of tcres to provide a sound eeg signal sensitive to physiological rhythms such as alpha activity as well as their insensitivity to myogenic activity which often corrupts scalp eeg recordings especially in the high frequency range> 30 hz . If the tcre attenuates volume conductance effects and has a greater sensitivity to local sources, how good is it for recording global brain rhythms such as alpha activity? Figure 3, (a / c) shows the signals that were recorded with eyes closed / open and their corresponding power spectral densities are presented in fig . 3, (b / d). The alpha waves were present in teeg (top trace, blue) coinciding with the corresponding alpha rhythm recorded by conventional disc electrodes (middle and bottom traces, red and green respectively) (fig . The alpha waves were blocked in both teeg and eeg when the eyes were open (fig . 3, c, d). Thus, this result demonstrates the ability of tcres to record physiological rhythms . Figure 3.global physiological rhythms such as alpha activity observable with eyes closed can be recorded by tcres . Panel a: the top trace (blue) is teeg from a tcre placed next to the conventional disc electrode at o1 . The middle trace (red) both the top and middle traces are recorded with respect to the reference on the right collar bone (rcb). The bottom trace (green) is from the o1 electrode with respect to the a1 reference electrode . Panel b: the power spectral densities for the signals of panel a. panels c and d are the signals and power spectral densities when the eyes are open . It is evident that the alpha waves are present in both teeg and eeg records, specifically between 4 and 5 seconds (panel a), which is confirmed by the spectra displaying a peak just below 10 hz (panel b) but are not seen in panels c and d. global physiological rhythms such as alpha activity observable with eyes closed can be recorded by tcres . Panel a: the top trace (blue) is teeg from a tcre placed next to the conventional disc electrode at o1 . Both the top and middle traces are recorded with respect to the reference on the right collar bone (rcb). The bottom trace (green) is from the o1 electrode with respect to the a1 reference electrode . Panel b: the power spectral densities for the signals of panel a. panels c and d are the signals and power spectral densities when the eyes are open . It is evident that the alpha waves are present in both teeg and eeg records, specifically between 4 and 5 seconds (panel a), which is confirmed by the spectra displaying a peak just below 10 hz (panel b) but are not seen in panels c and d. a relative insensitivity of tcres to myogenic activity is demonstrated by teeg and eeg records obtained from the same subject during head movements (fig . The bottom trace (green) it is evident that from about 3 to 6 seconds there is a high - frequency contamination in the bipolar disc recordings that is significantly attenuated in the teeg (top trace, blue). This high - frequency interference coincided with head movements and is most likely caused by muscle artifacts . 4 shows the power spectral densities for the traces in panel a. the teeg power (blue) has the lowest power in the higher frequencies range where the muscle artifact is prominent in the records from the conventional bipolar disc signals . From our experience, such attenuation of myogenic artifacts panel a: the top trace (blue) is teeg from a tcre placed next to the conventional disc electrode at o1 . Both the top and middle traces are recorded with respect to the reference on the right collar bone (rcb). The bottom trace (green) is from the o1 disc electrode with respect to the a1 reference electrode . Conventional eeg is heavily corrupted by muscle artifacts which are evident from approximately 3 to 6 seconds of the record (middle [red] and bottom [green] traces) coinciding with head movements by the subject . These artifacts are nearly unnoticeable in the teeg (top trace [blue]). Panel b: the power spectral densities for the signals shown in panel a. the power spectrum for the teeg (blue) has much less high frequency power (> 30 hz) due to myogenic activity . Panel a: the top trace (blue) is teeg from a tcre placed next to the conventional disc electrode at o1 . Both the top and middle traces are recorded with respect to the reference on the right collar bone (rcb). The bottom trace (green) is from the o1 disc electrode with respect to the a1 reference electrode . Conventional eeg is heavily corrupted by muscle artifacts which are evident from approximately 3 to 6 seconds of the record (middle [red] and bottom [green] traces) coinciding with head movements by the subject . These artifacts are nearly unnoticeable in the teeg (top trace [blue]). Panel b: the power spectral densities for the signals shown in panel a. the power spectrum for the teeg (blue) has much less high frequency power (> 30 hz) due to myogenic activity . We separated the patients into 3 groups: (1) patients who had clinical seizures (n\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(=5\) \end{document}), (2) patients with epileptiform activity but no seizures (n\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(=3\) \end{document}), and (3) patients with neither epileptiform activity nor seizures (n\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(=4\) \end{document}). Simultaneously recorded eeg and teeg and the corresponding spectrograms from representative patients are shown in fig . 5 and 6 . 5 the patient was a 42-year - old woman with seizure onset at 9 years . She had been diagnosed with right temporal lobe epilepsy and had undergone a right temporal lobectomy but seizures persisted . She was on clonazepam (cnz), lamotrigine (ltg) and phenytoin (pht) at the time of the study . In figure 5 conventional eeg data are on panels a, b, e, f, and i and teeg data are on panels c, d, g, h, and j. the conventional eeg data were obtained from the bipolar montage (channel f8-f4). This patient had a generalized seizure (onset at approximately 610 seconds in the time scale of panels a - d in fig . The seizure activity is evident by large increases in signal amplitude and power at all frequencies . Panels e, f, g, and h are eleven - second eeg and teeg segments (marked by the black line in panel c) shown at higher sequential resolution . Note the series of high gamma - band hfos between approximately 60 to 80 hz (highlighted by ellipse in panel c) occurring about every two seconds which are clearly evident in the teeg but not eeg, starting approximately 10 min prior to the generalized seizure activity (compare panels a and c as well as e and g). With further zoom in panels i and j showing two - second segments, one can see a high frequency burst in the teeg (black horizontal line in the panel j) which is not present in the eeg (panel i). Conventional eeg (bipolar montage, channel f8-f4, panels b, f and i, 170 hz, 200 s / s), teeg (from a tripolar electrode placed right behind the f8 position (f8'), panels d, h and j, 1100 hz, 200 s / s,) and their spectrograms (panels a, e and panels c, g for eeg and teeg, respectively) starting \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(\sim 10\) \end{document} min before and continuing during a generalized seizure with onset marked with the dashed vertical black line . Panels e - h: eleven - second eeg and teeg segments (marked by the black line in panel c) are shown at higher temporal resolution . Note a series of high gamma - band bursts hfos at 6080 hz (highlighted by ellipse in c) occurring about every 2 s, which are clearly seen in the teeg spectrogram only . Panels i, j: further zoom - in of two - second segment shows one hfo in teeg (black horizontal line in the panel j) while this hfo is absent in eeg (panel i). Figure 6.panel b shows 12 minutes of bipolar eeg from fp2-f4 (170 hz, 200 s / s). Panel e shows 30 seconds of eeg from panel b at the onset of the generalized seizure (dashed line). Note the high gamma - band burst hfos just prior to the partial seizure (highlighted by ellipse in panel c). Conventional eeg (bipolar montage, channel f8-f4, panels b, f and i, 170 hz, 200 s / s), teeg (from a tripolar electrode placed right behind the f8 position (f8'), panels d, h and j, 1100 hz, 200 s / s,) and their spectrograms (panels a, e and panels c, g for eeg and teeg, respectively) starting \documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(\sim 10\) \end{document} min before and continuing during a generalized seizure with onset marked with the dashed vertical black line . Panels e - h: eleven - second eeg and teeg segments (marked by the black line in panel c) are shown at higher temporal resolution . Note a series of high gamma - band bursts hfos at 6080 hz (highlighted by ellipse in c) occurring about every 2 s, which are clearly seen in the teeg spectrogram only . Panels i, j: further zoom - in of two - second segment shows one hfo in teeg (black horizontal line in the panel j) while this hfo is absent in eeg (panel i). Panel b shows 12 minutes of bipolar eeg from fp2-f4 (170 hz, 200 s / s). Panel e shows 30 seconds of eeg from panel b at the onset of the generalized seizure (dashed line). Note the high gamma - band burst hfos just prior to the partial seizure (highlighted by ellipse in panel c). This patient was a 45 year old male, with onset of epilepsy at 22 years . His seizures consisted of simple partial seizures followed by complex partial with or without secondarily generalization . He was on carbamazepine (cbz) and ltg at the time of the recording . His magnetic resonance imaging showed left mesial temporal sclerosis and a right frontal venous angioma . Panel d shows teeg recorded from location fp2' directly behind the fp2 disc electrode ., we also found gamma band bursts (\documentclass[12pt]{minimal} \usepackage{amsmath} \usepackage{wasysym} \usepackage{amsfonts} \usepackage{amssymb} \usepackage{amsbsy} \usepackage{upgreek} \usepackage{mathrsfs} \setlength{\oddsidemargin}{-69pt} \begin{document}} {} \(\sim 70\) \end{document} hz) in the teeg, approximately three minutes before the seizures . 6(c) highlights the high gamma - band burst hfos in the teeg at location fp2' approximately 4 min prior to the partial seizure . The hfos are present throughout the pre - seizure spectrogram but became more consolidated around 70 hz about 3 min prior to the seizure . It is also important that the teeg during the tonic seizure was less contaminated with muscle and movement artifacts than the eeg (compare panels e and f). Also note the higher power in eeg (compare panels a and c) from approx . 400 to 650 s when the patient was still anxious / disoriented and moving while recovering from the seizure . During that same period overall, hfos preceding seizures were present in teeg data from all five patients whose seizures were recorded . For these five patients, out of all the teeg channels that contained hfos an average of 78.2% were also in the soz (iz) (patient minimum: 42.9%; maximum: 100%). The average percentage of the total number of teeg channels recorded that contained hfos is equal to 35.5% (patient minimum: 5.3%; maximum: 73.7%). Figure 7 portrays the relationship between the clinical soz (iz) and hfo - containing channels for two patients that we present the spectrograms for in fig . 5 (panel a) and fig . 6 (panel b) respectively . Figure 7.panel a shows the relationship between the clinical seizure onset zone (soz) and hfo - containing channels for the patient from fig . Panel b shows the relationship between the clinical irritative zone (iz) and hfo - containing channels for the patient from fig . Soz or iz was determined for each patient independently by three epileptologists (iemj, jng, and rsf) based on eeg data and videos only . Panel a shows the relationship between the clinical seizure onset zone (soz) and hfo - containing channels for the patient from fig . Panel b shows the relationship between the clinical irritative zone (iz) and hfo - containing channels for the patient from fig . Soz or iz was determined for each patient independently by three epileptologists (iemj, jng, and rsf) based on eeg data and videos only . It has been shown that eeg is frequently contaminated by artifacts originating from various sources such as scalp muscles, eye blinks, eye movements, or patient movement . State what is intuitively obvious; artifacts obscuring the eeg at the time of seizure onset can greatly hinder the interpretation of the recorded seizures . During a tonic or tonic - clonic seizure, muscle activity is very prominent and is reflected in the eeg by random, high frequency signals . . Showed that when eegs were moderately contaminated with muscle artifacts blind source separation techniques based on canonical correlation provides signals that are more reliable for source estimation than raw eeg . They also found that in cases of severe muscle contamination of the eeg or when the muscle artifact had different spatial information than the spatial information of the epileptiform event, the blind source separation techniques based on canonical correlation did not work well . In general, a major reason why eeg has not reached its full potential in epilepsy diagnosis is due to artifact contamination . We have found that the tcre and the teeg automatically attenuate myogenic activity and movement artifacts . In contrast to the typical examples of artifact contaminated conventional bipolar eeg, the teeg is much less contaminated by the muscle activity . It should be noted that conventional approaches to remove muscle artifacts by digital signal processing (such as filtering) lead to significant loss of information since the gamma band activity and hfos in general are within the bandwidth of the electromyogram (emg). In other words, removing the emg will inevitably remove high frequency components of the brain activity, which is not a desirable result . The teeg, although not as obvious, may also be contaminated with emg (fig . 4, a, top blue trace) but from a much more local source . The emg from more distant sources have nearly equal contributions on the elements of the tcre and are cancelled out when the potentials on the elements are subtracted from each other with bipolar differences . In this study, we show, in a limited number of patients, that high - power hfo activity is detected at specific locations on the scalp surface in the teeg records of patients with epilepsy . This hfo activity was apparent prior to seizures . Although there may have been hfo activity at various times in the teeg during the recordings the bandwidth of the hfo activity narrowed sharply and the power increased just prior to the seizure . We did not see the hfo activity in the conventional eeg, even when using bipolar montages which somewhat attenuates global artifacts . In some instances this may partially be due to the low - pass filter used to record the eeg . The eeg low - pass filter was set to 70 hz and this cutoff frequency may have partially filtered out gamma band activity . However, the gamma band activity detected in the teeg was often well below 70 hz, in one case as low as 63 hz, and in these cases the gamma band activity was still undetected in the conventional eeg . When a low - pass digital filter was applied to the teeg at 70 hz the hfos were still present in the teeg for patients whose hfos were below 70 hz . We do not know what the upper limit is for detecting hfos on the scalp . In rats we have found an increase in power up to 300 hz during ptz - induced seizure electrographic activity recorded with teeg . In two patients having seizures for whom the data were filtered 1250 hz and 1500 hz respectively and digitized at 1600 s / s we have detected hfo preceding seizures in gamma, ripple, and fast ripple bands at frequencies up to 425 hz . A potential disadvantage of recording with tcre is deemphasis of non - artifactual signals with wide spatial distribution, for example, spike - waves . We intend to develop the circuitry to record both teeg and an eeg approximation from the same sensor in the near future . Despite a limited sample size of patients having seizures in this study (5 patients) we were able to investigate a possible correlation between the clinically determined soz (iz) and the location of hfos detected by tcres . Hfos preceding seizures were present in teeg data from all five patients whose seizures were recorded in an average of 35.5% of the patient's teeg channels . Out of those channels containing hfos an average of 78.2% were within soz (iz) determined independently by three epileptologists based on eeg data and videos . In all five patients who had recorded seizures, at least one channel in the soz exhibited hfos (in one out of five patients hfos were present in a single teeg channel). In two patients no specific soz was determined but rather an iz . For those two patients hfos were present in 7 and 4 teeg channels respectively out of 20 (35%) and 19 (21%) channels total respectively which is on par with the population average of 35.5% . Examples of the relationship between the soz (iz) and hfo - containing channels are presented in fig . The third epileptologist (jng) mentioned 4 hz activity over central leads but no clear electrographic onset . Soz definitions from all three epileptologists (iemj, jng, and rsf) overlapped for two channels (fp2 and f4) over the right frontal lobe . These preliminary results support that teeg is capable of detecting hfos from the scalp, which are not usually seen in conventional eeg records . Further studies with more patients are needed to more accurately correlate locations of (presumably abnormal) hfo activity with clinically determined soz as well as the resected tissue in surgical cases . Due to the improved signal quality of teeg we hope that in the future we will be able to use teeg to detect seizures and trigger stimulation to attenuate seizures . We have shown that transcranial focal electrical stimulation (tfs) via tcres in rat models was effective in reducing penicillin - induced myoclonic jerks,, pilocarpine - induced status epilepticus (an extreme form of continuing seizures) and in a third model, we applied tfs in rats treated by pentylenetetrazole (ptz). Tfs significantly reduced ptz - induced hypersynchrony at the beta and gamma frequencies, most recently we developed an automatic non - invasive seizure control system based on tfs and tested it successfully on rats.
|
It is currently recognized as a dynamic process since periods of demineralization alternate with periods of remineralization through the action of calcium, fluoride, and phosphorous present in the saliva . It is, therefore, viewed as a biofilm induced disease cause by an imbalance in physiologic equilibrium between tooth mineral and biofilm fluid . The surgical approach to managing dental caries was developed a century ago as at that time there was no other valid alternative . Presently, advances in the field of caries research have led to improved understanding of the disease process . Now, early detection of initial carious lesions and emphasis on preventive measures holds the key to controlling dental caries . The discovery of the anti - cariogenic properties of fluorides is one of the most important landmarks in the history of dentistry . The cariostatic effect of fluoride is primarily due to its ability to decrease the rate of demineralization by forming fluorhydroxyapatite and enhancing the remineralization of incipient carious lesions . Fluoride incorporated into the enamel mineral during tooth development has little effect on the caries process . It is the fluoride that is incorporated post - eruptively during the caries challenge that plays an important role in caries prevention . The most effective caries preventive fluoride regimen is provided by the daily application of topical fluoride in the form of dentifrices and mouth - rinses . The various types of topical fluorides used in dentistry are: sodium fluoride (naf), sodium mono - fluorophosphate, stannous fluorides and acidulated phosphate fluoride . All these fluorides are inorganic in nature and are available in the form of solutions, varnishes, foam, gels, dentifrices, etc . This depends on the solubility of the fluoride containing compound and its adhesion to the tooth surface . In 1957, muhleman et al . Found that organic fluoride like amino fluoride compounds were superior to inorganic fluorides in reducing the solubility of the enamel . Subsequently, products containing amine fluorides (amfs) were introduced and have gained popularity in scandinavian countries . Amf has greater anti - cariogenic property for two reasons: (a) presence of fluoride, (b) the amine (organic) component has an antiplaque effect inhibiting bacterial adhesion and tensioactive property which allows accumulation of fluoride close to the tooth surface providing a sustained fluoride release . Hence, the aim of the present in vitro study was to compare the micro hardness of demineralized enamel after topical application of naf and amf solutions . Twenty intact and non - carious sound human premolars extracted from patients of age group 14 - 20 years for orthodontic purpose were collected and disinfected according to occupational safety and health administration (osha) recommendations . The teeth were decoronated at cement - enamel junction and sectioned mesio - distally into two halves using a high speed diamond disc . The resultant 40 samples were randomly divided into 2 groups - group a (n = 20 samples) and group b (n = 20 samples). The samples were mounted in cylindrical molds filled with self - cure acrylic resin and polished . A vickers micro hardness (zwik / roell indentec, japan) indenter (vicker's hardness (vh) indenter) was used to evaluate the baseline micro hardness under 100 g loads applied for 15 s at 5 different points each 1 mm apart and the mean was measured . Samples were stored in glass tubes containing 20 ml demineralizing solution for 72 h in an incubator at a temperature of 35c . The samples in group a were immersed in naf mouth wash (s - flo mouthwash, dr . The samples in group b were immersed in amf (amflor oral rinse, group pharmaceuticals, bangalore) following the same protocol . In between treatment the enamel surface hardness in both groups was measured using vickers hardness test after treatment and a comparative analysis was made . Materials used in the study statistical analysis was done using student t - test (stata version 10.1, statacorp lp, texas, usa). Statistical analysis was done using student t - test (stata version 10.1, statacorp lp, texas, usa). The samples treated with naf (group a) demonstrated a slight decrease in the mean micro hardness after treatment (from baseline). In contrast, the samples treated with amf (group b) demonstrated a statistically significant (p <0.01) increase in mean micro hardness [table 2]. Bar graph is shown in figure 1 . Bar graph showing the comparative micro hardness of group a and group b after demineralization and remineralization the progression or reversal of dental caries depends upon the balance between demineralization and remineralization processes . This balance depends upon several factors like salivary calcium and phosphate concentration, bioavailability of fluoride and the ph of saliva . Demineralization of enamel leads to the dissolution of hydroxyapatite and diffusion of calcium and phosphate ions toward the enamel surface . One of the main reasons for enamel demineralization is undoubtedly the drop in ph below the critical point for hydroxyapatite dissolution . Remineralization occurs when the ph raises and calcium and phosphate from the saliva along with fluoride start forming new hydroxyapatite crystals on the enamel . Hyper - saturation of calcium and phosphate ions causes re - precipitation of hydroxyapatite forming an intact superficial layer on the enamel surface . Remineralization of enamel is enhanced by the presence of fluoride ions which leads to the formation of fluroapatite . It acts as a catalyst and influences reaction rates with dissolution and transformation of various calcium phosphate minerals . The released mineral ions are re - precipitated as fluoroapatite which is less soluble and provides additional protection onto the apatite crystals . It has been reported that use of fluoride mouth - rinses can lead to higher levels of oral fluoride retention than fluoride dentifrices . The demineralization protocol was designed for 72 h, which was to simulate the duration that occurs in the oral cavity in caries prone individuals . There are different methods for evaluation of demineralization and remineralization of enamel which may be direct or indirect . Direct techniques are longitudinal microradiography, transverse microradiography and wavelength independent x - ray microradiography . Indirect techniques include polarized light microscopy, quantitative energy dispersive x - ray analysis, micro hardness measurement methods and iodide permeability . Indirect methods are nevertheless quantitative and can measure changes in the real physical parameters . In case of polarized light they can detect the general porosity of the enamel substrate . The use of surface micro hardness tests can measure the change in surface structural strength . Surface micro hardness is a physical property which assesses the effect of chemical and physical agents on hard tissues of teeth . It is an appropriate test for enamel due to its fine microstructure, non - homogenous and brittle nature . Micro hardness indentation provides a relatively simple, rapid and non - destructive method in demineralization and remineralization studies . Micro hardness tests are of different type which includes: knoop, vickers and brinnel . In the present study, vhn was adopted as the basis for investigation over knoop's because the square shape of indent obtained in vhn is more accurate to measure . Even the minute changes in the square shape indent obtained after the test can be easily detected . The vickers hardness values obtained during the baseline mean micro hardness measurements in the present study were in the range of 460.43 - 461.49 vhn . The surface mean micro hardness values for each group of the enamel specimens reduced to 437.54 - 439.82 vhn after the demineralization process for 72 h. after remineralization, the mean micro hardness in group a increased to 448.70 vhn whereas in group b it was 474.82 vhn . The results of the present study reveal greater increase in mean micro hardness following remineralization with amf than with naf, which was statistically significant . Amf is an organic compound-(n - octadecyltrimethylendiamine n, n, n - tris (2-ethanol)-dihydrofluoride [c27h58n2o32hf]) consisting of two functional groups, that is: a cationic amino organic group and a bound ionic fluoride group . The unique surface active property provides self - alignment of the hydrophobic part towards the oral cavity and the hydrophilic part towards the tooth surface which leads to an accumulation of fluoride close to the tooth surface . The accumulated fluoride is available directly for the formation of calcium fluoride as a labile fluoride reservoir . The benefits of amf are many . The amino (organic) molecules readily bind to the enamel surface . Its surface active / tensioactive property leads to fast distribution of fluoride and homogenous coating on tooth surface for prolonged period . The end result is the increased bioavailability of fluoride which plays a crucial role in preventing a net mineral deficit in enamel due to caries . In case of group a, there was a slight increase in surface hardness following remineralization, but it did not reach close to baseline levels . Naf which is inorganic in nature reacts with hydroxyapatite of enamel forming a thick layer of calcium fluoride . This thick layer of calcium fluoride interferes with further diffusion of fluoride from the topical fluoride thus providing a relatively lower bioavailability of fluoride ions . Another limitation is that the sodium cation does not have any independent caries prophylactic property . Thus, in terms of bioavailability this translates into a significantly higher salivary fluoride level being available from amf than naf . Studies have reported that the quality of remineralization with amf is superior to that of naf due to the slow release of fluoride and a constant salivary fluoride level . In contrast to our findings, a study by lippert et al compared the anticaries potential of two new commercial dentrifices containing amf and naf by vickers hardness testing . They attributed this to the presentation of the fluoride compound and formulation excipients on deciding the anti - caries potential in vitro . There are not many studies on enamel micro hardness to verify the efficacy of remineralization . However, several studies using polarized light microscopy, quantitative energy dispersive x - ray analysis etc . Arnold et al ., using polarized light microscopy had concluded that the superficial enamel layer were more stable after amf application than after naf or sodium monofluoride application . Another study has also revealed that slightly acidified fluoride containing dentifrices like amfs may have a marked effect on enamel remineralization . Data from the literature has also shown that amfs deposit more fluoride on enamel than sodium or stannous fluoride from concentrated topical fluoride preparations . An important factor contributing to the overall activity of topical fluorides is the mechanism of fluoride retention in the mouth and its subsequent clearance . The results of the present study as well as those from available literature indicate that organic fluorides like amf are superior remineralizing agents than inorganic fluorides and hence must be more frequently used to combat dental caries . However, the present study is an in vitro one the results of which may be quite different from the dynamic process that occurs in the in vivo situation . Therefore, further in vivo studies are necessary on to validate the findings of the present study . Both the inorganic (naf) and the organic fluoride (amf) were effective in remineralizationnaf remineralization did not restore the hardness of the enamel surface to that of pre - operative levelsamf provided greater benefits than naf which was satistically significantthe remineralized surface obtained by exposure to amf was found to be harder than intact enamel . Both the inorganic (naf) and the organic fluoride (amf) were effective in remineralization naf remineralization did not restore the hardness of the enamel surface to that of pre - operative levels amf provided greater benefits than naf which was satistically significant the remineralized surface obtained by exposure to amf was found to be harder than intact enamel.
|
The generation and preservation of the microenvironment of the tear film is guaranteed by the biological interplay between the ocular surface together with the related glands and local neural interconnections, that represent the core players for the protection of the transparency of the cornea and the health of the ocular surface . In particular, the tear layer can be considered a reservoir of soluble factors with biological effects involved in the maintenance of the physiology of surface epithelial cells including protective and antimicrobial activities, nourishing functions, and contribution to local wound healing / anti - inflammatory responses [24]. In normal conditions, it has been demonstrated that tears of healthy subjects are characterized by a so - called immune tone generated by local levels of cytokines and chemokines released by different cell types, such as immune cells and epithelial cells [5, 6]. Therefore, any alteration of the tear film may have direct consequences on the ocular surface integrity leading to pathological condition such as dry eye [7, 8]. However, at the same time, any changes on the composition of the conjunctival sac fluid might have a potential as clinical biomarker to monitor the onset - evolution of ocular surface diseases [911] and the response to pharmacological and/or surgical interventions [1214]. Photorefractive keratectomy (prk) is one of the most commonly used surgical techniques to correct refractive errors through a laser - induction ablation of the corneal epithelium, which is able to induce corneal stromal remodelling with changes in corneal refraction . This procedure is followed by the release of several factors including cytokines, growth factors, and matrix metalloproteases that are involved in both corneal wound healing process and possible postoperative (inflammatory) complications . In this light, prk might be considered a model of corneal regeneration for studies aiming at improving the comprehension of the complex biological processes underlying the maintenance of local corneal microenvironment and the wound healing process . Therefore, the objective of this study was to monitor the local cytokines / chemokines levels in patients undergoing prk including a wide inflammatory / immune mediators' profile . By this experimental approach, we aimed (i) to increase the understanding of the physiopathological response after prk in a long term postoperative period; (ii) to identify molecular mediators involved in the wound healing process after prk; and (iii) to assess a methodological approach for the identification of molecular mediators that could act as laboratory biomarkers for prognostic and monitoring purposes in the context of ocular surface diseases . The subjects involved in the study included 25 patients enrolled by the ophthalmology section at the university - hospital of ferrara . All patients underwent complete preoperatively ophthalmic examination before receiving myopic prk treatment by using the 200 hz allegretto laser platform (wavelight laser technologie ag, erlangen, germany). In particular, preoperative (1 day before prk), as well as postoperative (2, 5, and 30 days after prk), follow - up examinations included analyses of uncorrected distance visual acuity (udva), corrected distance visual acuity (cdva), manifest refraction, corneal topography, and complications . Before and after prk, at the time of patients' clinical assessment, conjunctival sac fluid samples were collected by using standard strips of schirmer test as previously described . Briefly, for each subject a volume corresponding to three notches of the strip was collected . Strips were then transferred in 400 l of 0.9% nacl solution at 4c for 36 hours, to allow the release of the conjunctival sac fluid proteins from the strip in the solution . As control, conjunctival sac fluid samples were also collected from the normal contralateral eye of the 52% of enrolled patients . Aliquots of conjunctival sac fluid solutions were stored at 80c and thawed only once before analyses . Forearm blood samples were collected from healthy subjects in the presence of sodium citrate and immediately centrifuged for plasma isolation that were stored at 80c in single - use aliquots . Written informed consents were obtained from each patient and all the procedures that followed were in accordance with the declaration of helsinki and were approved by the institutional review board (university hospital of ferrara). The biological samples were frozen and thawed only once before performing the milliplex map human cytokine / chemokine panel (merck millipore, billerica, ma), a bead - based multiplex immunoassay, which allows the simultaneous quantification of the following 29 human cytokines: egf, il-1, il-1 receptor antagonist (ra), il-1, il-2, il-3, il-4, il-5, il-6, il-7, il-8, il-10, il-12(p40), il-12(p70), il-13, il-15, 1l-17a, eotaxin, g - csf, gm - csf, ifn-2, ifn-, cxcl10, mcp-1, mip-1, mip-1, tnf-, tnf-, and vegf . Samples were analysed in duplicate following the manufacturer's recommended protocols and the results were read on a magpix instrument equipped with the milliplex - analyst software using a five - parameter nonlinear regression formula to compute sample concentrations from the standard curves, as previously described . The identified proteins were analysed by using the ipa software (http://www.ingenuity.com/; ingenuity systems, redwood city, ca, usa) in order to identify biological functions and molecular pathways associating the proteins, as well as predict protein - protein interaction networks determined by the ingenuity knowledge base . Briefly, the ingenuity pathway knowledge base identifies protein networks that are ranked in relation to the biological functions assigned to the network . The score indicates the probability that eligible proteins are in the network by random chance . In other words, high - score values indicate high reliability of protein association (a score> 2 is considered to be significant). The most highly scored networks identified were then graphically visualized showing the major molecular relationship between proteins . Data were analysed by spss statistical software and calculated as median, mean standard deviation (sd) for each group of data obtained from samples analysis . Differences between values were evaluated by using a pairwise sign - rank wilcoxon's test and a p value <0.05 was considered statistically significant . The cohort of patients enrolled for this study consisted of 64% of females with age ranging between 24 and 48 years and a mean age of 36.1 years and of 36% of males characterized by age ranging between 22 and 54 years with a mean age of 36.7 years . After prk treatment the postoperative course was clinically monitored: no complications such as keratitis, infections and/or delay on corneal epithelium regeneration were reported and all patients showed full correction of the refractive errors and restoration of a proper visual quality, with the exception of one patient showing hypermetropy at the last clinical follow - up assessment performed 30 days after surgical intervention . In a preliminary experiment, we have analysed the levels of expression of 29 cytokines / chemokines in the conjunctival sac fluid samples collected from the normal contralateral eyes of patients (see figure 1(a) and supplementary table 1 in supplementary material available online at http://dx.doi.org/10.1155/2015/942948). In particular, as summarized in figure 1(a), among the 29 cytokines / chemokines analysed by multiplex assay, only il-3 and il-17a were undetectable in all samples while the following 27 cytokines / chemokines were detectable at different levels (up to over 1000 pg / ml): egf, il-1ra, mcp-1, ip-10/cxcl10, eotaxin, gm - csf, ifn-, il-10, il-12(p40), il-12(p70), il-15, il-1, il-1, il-2, il-4, il-5, il-6, mip-1, mip-1, tnf-, tnf-, ifn-2, g - csf, il-13, il-7, il-8, and vegf . Notably, the expression profile and the levels assessed in the conjunctival sac fluids were significantly different from those documented in serum samples of healthy subjects (figure 1(b) and supplementary table 1). In fact, a higher number of soluble factors were undetectable at the serum level: il-10, il-12(p40), il-15, il-13, il-17a, il-1, il-1, il-2, il-3, il-4, il-5, il-6, and tnf- (figure 1(b)). Moreover, when clustered for ranges of expression levels, a limited number of cytokines / chemokines were detected at serum levels higher than 50 pg / ml and no soluble factor showed systemic levels over 1000 pg / ml (figures 1(a)-1(b)). The patients enrolled in the study underwent prk surgery and the levels of the same 29 cytokines / chemokines were evaluated in serial samples of conjunctival sac fluid collected one day before and at different time points (days 2, 5, and 30) after prk . The levels of the cytokines and chemokines assessed before and after the prk surgery are reported in table 1 . In order to identify clusters of cytokines / chemokines that might potentially be linked and interact at the conjunctival microenvironment level, we have firstly analysed the kinetics of release of the different cytokines / chemokines (table 1). Then, in order to understand the potential association among the cytokines / chemokines having in common the same kinetic profile, the data were analysed using ingenuity pathway analysis (ipa) software (http://www.ingenuity.com/) which identifies relevant interactions and biological mechanisms among proteins (supplementary table 2). Based on these analyses, we have identified two different kinetics of modulation, referred to as profile i and profile ii . In particular, as detailed in table 1, the majority of the cytokines / chemokines analysed, including egf, ip-10/cxcl10, eotaxin, gm - csf, ifn-, il-10, il-12(p40), il-12(p70), il-15, g - csf, il-1, il-2, il-4, il-5, mip-1, mip-1, tnf-, tnf-, ifn-2, il-1ra, il-13, il-7, and vegf, showed a dramatic decrease at day 2 after prk, followed by a rapid recover at day 5 and thereafter (profile i). The kinetics of modulation of egf, g - csf, and il-1ra are shown in figure 2(a) as representative of profile i. within the 23 cytokines / chemokines of profile i, two networks were found with score> 2 and involving 12 and 10 proteins, respectively (figure 2(b)). Of interest, both of these networks involve a high number of focus molecules mainly related to immune cell trafficking, cellular growth / proliferation, and inflammatory responses (supplementary table 2). On the other hand, il-6, il-8, and mcp-1 showed a different profile of expression (profile ii) with respect to the majority of the cytokines / chemokines analysed, characterized by an increase at day 2 after prk (table 1 and figure 3(a)). These proteins are functionally involved in a network related to inflammatory processes (figure 3(b)). Anyhow, among the panel of 29 cytokines / chemokines assessed in the present study, the peculiar kinetic of expression / modulation of mcp-1 characterized by a significant (p <0.05) and persistent increase at all times (up to 30 days) after prk (figure 3(a)) is certainly of note . Moreover, analysis of patient's matched samples shows that the levels of mcp-1 measured at the last clinical follow - up assessment performed 30 days after prk were significantly (p <0.05) different from the levels of mcp-1 detected in paired normal contralateral eyes (figure 3(c)). The first observation derived from our study is that the profile of expression of cytokines / chemokines at the conjunctival sac fluid level does not match the systemic profile for the great majority of the cytokines / chemokines analysed in line with previous observations . In this respect, we are aware that the procedures for the measurements of the cytokines and chemokines in tears show some difficulties and that the procedure employed to measure soluble cytokines / chemokines in conjunctival sac fluid might underestimate the real concentrations (since a percentage of the proteins could remain trapped in schirmer strips). In spite of these potential technical limitations, the comparative analysis of the concentrations of the same cytokines / chemokines between serum samples and tears shows a more complex pattern of expression and higher levels of cytokines / chemokines in the microenvironment of the anterior surface of the eye, with respect to the systemic circulation . This observation is likely the results of the synthesis / release from different cellular source, such as epithelial cells and immune cells, which might contribute to generate the observed differences between serum and tears . Moreover, we report for the first time the pattern of expression / modulation of a wide panel of cytokines / chemokines in the conjunctival sac fluid of patients before and after prk treatment . As observed in a previous study focused on the analysis of a single cytokine (trail), involved in migration [20, 21] and inflammatory processes, we found that the large majority of the cytokines / chemokines investigated in this study were characterized by a drastic decrease at day 2 after surgery, followed by a recover thereafter . Interestingly, only three cytokines (mcp-1, il-6, and il-8) did not show any significant decrease after surgery, with mcp-1 exhibiting the most remarkable pattern . Indeed, the mcp-1 levels in the conjunctival sac fluid showed a pronounced and significant increase already at day 2, peaking at day 5 after surgery and maintaining high levels up to day 30 after surgery . This pattern is particularly noteworthy, as mcp-1 has been involved in wound healing processes [2327]. Therefore, it is likely that mcp-1 elevation plays a significant role in the process of reepithelialization of the cornea . In conclusion, in the context of prk, our data contribute to identify the key inflammatory / immune mediators involved in the local physiopathological responses to the surgical procedure and allowed to identify mcp-1 as a key molecular mediator involved in the wound healing process after prk . Moreover, the present study, based on the application of a multiplex - array approach in the prk model of corneal regeneration, certainly contributes to the improvements in the development of biomarker profiles for other ocular surface diseases requiring monitoring of the pathology development as well as monitoring after surgery.
|
Even under normal operation of nuclear power plants (npps) discharges of radioactive substances into the atmosphere take place . Considerable attention is given to monitoring of radioactive noble gases, iodine, c, fission and activation products in particulate form in airborne effluents . The annual discharged activities of these radionuclides have been reported by individual npp . On the other hand, there is little information given on the monitoring of the release of biologically important pu, pu, am, and other transuranium nuclides (tru) from nnps under normal operation conditions . Monitoring of tru in effluents discharged to air from npps started in our institute in 1985 . The main objective was to obtain discharge data on tru for each nuclear power plant operated in the czech republic and slovak republic . Up to 2003 we had searched for tru in effluents discharged to air from five stacks (stacks 1 and 2 of the former v1 and v2, npp jaslovsk bohunice, stacks 3 and 4, of the former v3 and v4, npp dukovany and stack 5 of npp temelin). At four of these stacks (stacks 14) the effluents come from the main production building (with two pressurized water reactors of 440 mwe power of each reactor) and from the auxiliary service building for the primary system . At stack 5 the effluents come from the main production building with one pressurized water reactor of 1,000 mwe power . The results obtained were from time to time published and observations made during all the study are summarized in the previous paper . They are: (1) pu, pu, am, cm and cm can be present in effluents discharged to air . Their activity concentrations and discharged activities from individual stacks, however, vary in wide range . The presence of tru in effluents from the stack 5 was not proved at all and their activities in effluents from stacks 2 and 4 were either lower than their limits of detection or only slightly exceeded these limits in some monitoring periods . On the other hand, during all the nine years of study measurable activities of tru were found in the effluents discharged to air from stack 1 and from stack 3 since the third quarter of 1996 as a result of a defect in the fuel cladding . At the stack 3 further increases of tru activities in effluents occurred in the third quarter of 1999 and the third quarter of 2003 . (2) two phases can be distinguished in the time course of tru discharge: the first phase represents the first quarter when the increase begins and the second phase represents a further time period with lower discharges . In all the three events at the stack 3 the activity of cm reached the highest value in tru mixtures in the first phase of the discharge . Nevertheless several other substantially lower increases of tru discharge with maximum cm content were also registered during the study . Those however lasted for one or two following quarters only . (3) there exist definite activity ratios of tru in effluents discharged to air . So activity ratio of pu / pu in effluents from the stack 1 was approximately 1.0 during all the 9 years study . The activity ratios in effluents are given by the ratio of these radionuclides in fuel from which the contamination has originated . We calculated (for definite conditions) the activity ratios of pu / pu, am / pu, cm / pu and cm / pu in fuel for different burn - up values . (4) tru discharged to air from the studied stacks contribute very little to further contamination of the environment . For example, the largest annual discharge of pu, 66 kbq from the stack 1 was equivalent to the activity of these radionuclides from atmospheric nuclear tests fallout in top soil for an area 1,100 m in our geographic position . Since 2004 the search for tru in effluents discharged to air has been extended to further stacks in npp temeln . Two of them (stacks 3 and 4) belong to npp dukovany and five (stacks 59) to npp temelin . At the stack 7 the effluents come (similarly to stack 5) from the main production building with one pressurized water reactor of 1,000 mwe power . At stacks 6 and 8 the effluents come also from the main production buildings and they are released mainly during shut - down periods . Aerosol particles were collected (by the npp staff) using large volume samplers installed in the stacks above the npp air filtration system . After gamma spectrometry a part of each exposed filter was cut off and thus obtained portions were put together to yield quarterly samples in 20042005, while since 2006, half - year samples have been prepared . Tru in the air filter samples were determined using radiochemical separation and alpha spectrometry as described in our previous paper . In table 1 the annual discharged activities of tru from the studied stacks in 20042009 are presented . As can be seen the annual discharged activities of pu, pu, am, cm and cm from the stack 3 varied in the range 9601800, 320630, 7601600, <320820 and 7203500 bq, respectively . Similar values for annual discharge were obtained in 2001 and 2002 . There is no evidence for a decrease of the discharged activities within the time period from 2004 to 2009 . For example the discharge of pu in 2004 (670 bq) is lower than the discharge in 2006 (950 bq) and 2008 (890 bq). Similarly, the pu discharge in 2004 (390 bq) is lower than that in 2006 and in 2008 (450 bq).table 1annual discharged activities of transuranium nuclides from individual stacksstackyearannual discharged activities (bq) pu pu am cm cm320049603909708101,50020051,200590910>630 <7001,50020069504509003701,10020071,8006301,6008203,50020088904508004508402009670320780>280 <32072042004<110>100 <170>4,000 <4,100<220>3,300 <3,4002005>130 <190>90 <160>120 <210>150 <300>80 <1702006>780 <800>72 <90>150 <170<38>40 <612007634564<27>38 <5320081,5006701,300<705902009>42 <67>130 <150110<60<3252004<9<10<20<19<82005>45 <71<53<172006<6<61600>17 <29<52007>12 <1545170<11<62008>24 <27>8 <11110<23<52009<515>2 <4<5<362004<2480<31 <63>400 <440<162005<110 <190<97<302006<23<1086>86 <100<122007>6 <8<71405142008<14<10>23 <37>110 <130<132009<3909<5<372004<29<32<29<27<92005<25>18 <34<70<182006<7<752,000<33<72007<4<3100<3<22008<9<938<19<8200917<3>2 <10<11<482004<35>32 <59>18 <38<45<16200520061708387,0002,3009020079544569043200826<314110102009<21<1115055<992004<230<250<100<130<442005<58<130<272006>150 <160>70 <9044,000>140 <180<312007>62 <861101,800>180 <250<462008<27>330 <340160<71<372009<28<2234<20<8 annual discharged activities of transuranium nuclides from individual stacks we did not find tru in effluents discharged to air from the stack 4 in the most of monitoring periods before 2004 . During 20042009, tru were sometimes measurable in discharged effluents from this stack (at the level similar to those for the stack 3), sometimes not (table 1) tru activities in effluents discharged to air from the stacks 59 were mostly either lower than the detection limit or only slightly exceeded this limit in 20042009 . There are however, two exceptions: (1) am appeared in discharged effluents from these stacks in 2006 . (2) besides am, other low activity tru appeared especially in the stack 8 in 2006 . In table 2, activity concentrations of tru in effluents discharged to air and discharged tru activities from the stacks 59 in the first and the second half - year of 2006 are presented . It is obvious from table 2 that although in the first half - year tru were not measurable in effluents in the second half - year tru appeared in effluents from these stacks, with the maximum content of am . Maximum concentration of am 520 23 bq.m was found in effluents from the stack 8 . Maximum discharged activity of am amounted to 87000 bq . At the stack 8, well measurable activities of cm, cm and plutonium nuclides were also found in the effluents discharged to air . Discharged activities of am and other tru from the stacks 59 significantly decreased in further years (table 1).table 2activity concentrations of tru in effluents discharged to air and discharged activities for stacks 59 in first and second half - year of 2006stackhalf - year pu pu am cm cmconc. (bq.m)discharge (bq)conc. (bq . M)discharge (bq)conc. (bq.m)discharge (bq)conc. (bq.m)discharge bqconc. (bq.m)discharge (bq)51<0.009<3.7<0.008<2.9<0.009<3.7<0.030<11.7<0.008<2.92<0.006<2.5<0.007<2.93.9 0.116000.0420.0117<0.004<1.661<0.094<5.1<0.087<4.7<0.13<7.2<0.25<13.2<0.06<3.22<0.24<18<0.063<4.71.15 0.14861.15 0.0686<0.11<8.371<0.007<3.1<0.006<2.6<0.024<10.6<0.055<24.2<0.011<4.92<0.01<4.1<0.013<4.7120 3.052,000<0.02<8.5<0.004<1.781<0.27<4.8<0.20<3.5<0.11<1.9<0.23<3.9<0.09<1.621.0 0.031700.50 0.0583520 2387,00013.7 0.823000.544 0.099091<0.007<12.6<0.011<19.80.066 0.006120<0.022<37.4<0.008<14.420.089 0.0041500.041 0.0077025.7 1.1444,0000.082 0.013140<0.01<17quoted uncertainties are 1 sigma counting error activity concentrations of tru in effluents discharged to air and discharged activities for stacks 59 in first and second half - year of 2006 quoted uncertainties are 1 sigma counting error in our previous work we found that radionuclide composition of tru in discharged effluents is not random, but it is connected with burn - up values of fuel particles from which the contamination originated . The activity ratios of tru in effluents discharged to air from the stack 3 in studied years and in second half - year of 2006 from the stack 8 are presented . It can be seen that the activity ratios of pu / pu in effluents from stack 3 in 20042009 are close to value 2 . Similar values for activity ratios of pu / pu in effluents from this stack were found since the 3 quarter of 1996 up to the second quarter of 1999 and in 20022003 . The obtained ratios of am / pu and cm / pu in the studied years (table 3) are similar to those found since 3 quarter of 1999 up to 2003 .table 3activity ratios of tru in effluents discharged to air for stacks 3 and 8stackyearactivity ratio pu / pu am / pu cm / pu cm / pu320042.52.52.13.920052.01.51.12.520062.12.00.82.420072.92.51.35.520082.01.81.01.920092.12.40.92.3820062.0104827.71.1 activity ratios of tru in effluents discharged to air for stacks 3 and 8 activity ratios of pu / pu, am / pu, cm / pu and cm / pu in the effluents from the stack 8 in the second half - year of 2006 are 2.0, 1048, 27.7, and 1.1, respectively (table 3). Using relations between the calculated activity ratios of tru and burn - up values/2/for activity ratios of pu / pu = 2.0 the corresponding burn - up is 27 gwd / tu . For this burn - up value the calculated activity ratios (using the relation between activity ratios and burn - up values/2/) of am / pu, cm / pu and cm / pu are 0.14, 32, and 1.2, respectively . It can be seen that in the case of cm / pu ratios the measured (1.1, table 3) and calculated values (1.2) are close, in the case of cm / pu ratio the measured (27.7) and calculated (32) values are similar, in the case of am / pu ratios, however, the measured value (1,048) considerably exceeds the calculated value (0.14). For activity ratio am / pu = 0.14, in the case of 83 bq pu discharge (data for stack 8 in the second half year, 2006, table 2) the corresponding am discharge should be 11.6 bq . The measured am discharge is 87000 bq . We cannot explain relatively high am discharge from the stack 8 from fuel - cycle . An explanation is even more difficult for the stack seven because in effluents discharged to air from this stack no pu, pu and cm were found . To get an idea of how the studied stacks contributed to further contamination of the environment, we compared the annual discharged activities with the activities of an area of soil surface contaminated by fallout from atmospheric nuclear tests (in the case of pu also from snap-9a satellite burn - up). Taking into account the fact that at latitudes 40 to 50n the fallout of pu, pu and am till 1978 amounted to 58, 1.5 and 25 bq.m, respectively, the largest annual discharge of pu 670 bq in 20042009 (stack 4 in 2008) is equivalent to the fallout of these radionuclides on an area of 11.6 m, in the case of pu the equivalent area (maximum discharge 1,800 bq, stack 3 in 2007) is 1,200 m and in the case of am (maximum discharge 87000 bq, stack 8, 2006) this area is 3,480 m. it is evident that even the stacks with the largest annual discharges contribute to further contamination of the environment only to a very small degree.
|
Biological or biopharmaceuticals are drugs produced from living cells through the biological process, and mimic natural biological substances such as hormones . Biosimilars are copy drugs similar to biological drugs that has already been authorized (the biological reference medicine), hence similar but not identical . Indian guidelines define a similar biologics as a biological product / drug produced by genetic engineering techniques and claimed to be similar in terms of safety, efficacy and quality to a reference biologics, which has been authorized by drug controller general of india (dcgi) for safe use in india . The active substance of biosimilar medicine is similar to one of the biological reference medicine and used in general at the same dosage to treat the same disease . Biosimilars are entity based (including product - process), regulatory based (under an abbreviated testing), and market based (same manufactures, different trade name). Biosimilars also known as similar biological products, follow - up biologics, subsequent entry biological, second entry biological, biogenerics, multisource products, and off - patent biotech products as synonyms . General public and insurance companies prefer economic alternatives, the long - term economic consequence of using biosimilars have not been studied biosimilars are a new class of drugs intended to offer comparable safety and efficacy to the reference, off - patent biological . The active protein structure of biologicals makes them more prone to induce an acute and chronic immune response . The overall risk is modest with biosimilars, but regulatory pathways are required because of structural complexity, manufacturing process and risk for immunogenicity . The problems / limitations with biosimilar are that, the two biosimilar have a different origin, the two biosimilars may have same therapeutic effect, may have different side - effects and hence require thorough testing . The main reason of biosimilar drug development is the expiry of patent protection for many biological medicines [table 1]. Patent expiration of biological / biopharmaceuticals * biopharmaceuticals are different from the conventional small molecule drugs because of the size and complexity of the active substance and nature of the manufacturing process . Even minor change in the process can lead to the fatal outcome (process is product), safety, and efficacy issues . For epoietin (erythropoietin), minor change in the packaging process caused pure red cell aplasia . European medicines agency (emea) and committee for the medicinal product for human use (chmp) raised the objection that marvel insulin and reference human insulin were not comparable ., withdrew its application as they were unable to meet the standards set by chmp, but biosimilar insulin continues to flood indian market . Hence, legal and regulatory principals applicable to generic drugs cannot be applied to biosimilars . Emea - chmp has published product specific guidelines to establish the similarity in terms of safety, efficacy and quality of biosimilar product . According to these guidelines moreover, in order to support pharmacovigilance monitoring, the specific product given to the patient should be clearly identified . The active substance of the biosimilar product must be similar in molecular and biological terms to the active substance of the reference medicinal product, and the same reference product throughout the comparability program . The pharmaceutical form, doses and route of administration of the biosimilar and the reference product should be the same . If the reference product has more than one indication, the safety and efficacy for all indications have to be justified or demonstrated for each indication separately . The issue of immunogenicity should always be addressed, and its long - term monitoring is necessary . Fda was given the authority to approve biosimilars, including interchangeable, to maintain safety, efficacy, and quality of biosimilar product . Abbreviated pathway for approval of biologics that are biosimilar to already approved products . The abbreviated pathway will eliminate unnecessary and unethical testing of biosimilars in animal and human . The patient protection and affordable care act of 2010 (usa) also supports this . The new india guidelines draft guidelines on similar biologics: regulatory requirements for marketing authorization in india, were announced in june 2012, by department of biotechnology (dbt). The indian guidelines on similar biologics address the pre - marketing and post - marketing regulatory requirement (i.e., comparability exercise), and also address the requirements related to manufacturing process and quality control . As such these indian guidelines on similar biologics are comparable in many respects to biosimilar guidelines of usa and eu . India has adopted a sequential approach (like stepwise approach - us and eu) to market biosimilar products . The review committee on genetic manipulation of the genetic engineering approval committee (geac) with the permission of dcgi, approve clinical trials to be conducted in india related to biosimilar therapeutic products . The biosimilar has to demonstrate comparable data of non - clinical studies viz ., pharmacokinetics and toxicology (safety pharmacology, reproduction toxicology, mutagenecity and carcinogenicity) and clinical studies (efficacy and tolerability for each indication) before it gets approval for all indication of the reference medicine . Biosimilars in india consist primarily of vaccine, monoclonal antibodies, recombinant proteins and diagnostics, insulin (wosulin, insugen, recosulin), erythropoietin (hemax, epofer, wepox, ceriton, epofit), hepatitis b vaccine (shanvac b, revac b, enivac b, biovac b, genevac b, bevac), granulocyte colony stimulating factor (g - csf grastim, neukine), streptokinase (indikinase, shankinase, stpase), interferon alpha-2b (shanferon), rituxinab (mab), epidermal growth factor receptor (anti - egfr) (mab)(reditux, biomab - egfr). Status of similar biologics in india there are about 100 biopharmaceutical companies actively involved in research and development, manufacturing and marketing of biosimilar therapeutic products in india . There were 14 therapeutic drugs (similar biologics) available in 50 brands in 2005; the number has increased to 20 therapeutic drugs in 250 brands in 2011 . Biosimilar therapeutic products include insulin, erthropoietin, chorionic gonadotropin, streptokinase, interferon and heparin . The growing biosimilars market offers huge potential for companies involved in manufacturing, research and development . Pharmacovigilance is more important for biosimilar drugs because these are not reference medicine as such, and are from different manufacturer from the reference products . Many adverse effects may appear only after a biosimilar drug is used more extensively, for a longer period of time, in a greater number of patients . Both manufacturers and prescriber should be aware of the importance of post marketing vigilance, and careful on patients taking biosimilar . Biosimilar are not generic; biologics are larger and more complicated than chemical drugs, due to the complexity of biological / biotechnology derived products the generic approach is scientifically not appropriate for biosimilar products . The challenge with biosimilars is to know the differences which matter clinically . The specific product given to the patient
|
An incisional biopsy from mandibular region of a 45-year - old female patient was submitted to our department of oral pathology and microbiology with the history of pain and swelling in the right lower back teeth region for past 2 months . The clinical details given to us were, swelling in the right lower cheek region extraorally . Intraorally the swelling was extending from right canine to retromolar area and 45 and 46 were mobile . The hematoxylin and eosin stained histopathological stain showed numerous follicular structures within the connective tissue . The follicles were lined by tall columnar ameloblast like cells with reverse polarity and surrounding stellate reticulum like cells . Both peripheral tall columnar cells and central stellate reticulum like cells showed dense granularity . Hematoxylin and eosin stained section showing ameloblastic follicles with granular cells (h and e, 10) following the histopathological diagnosis hemimandibulectomy was done . The hemimandibulectomy specimen showed thinned out buccal cortical plate and perforation of the lingual article plate at multiple locations . Anterior and posterior surgical margins were sectioned, and histopathological examination was done after decalcification . All the sections from the excised specimen showed granular cell ameloblastoma while the anterior and posterior surgical margin did not show any residual tumor . Patient is currently on regular follow - up for the past 22 months and no sign of recurrence . Ameloblastoma sometimes exhibits granular transformation of cytoplasm occurring in central stellate reticulum like cells, and this change often extends to peripheral columnar or cuboidal cells . Hematoxylin and eosin staining and periodic acid schiff staining showed granular neoplastic cells residing within the tumor follicles . Light microscopic study of granular cell ameloblastomas shows numerous neoplastic epithelial islands in a scant, mature fibrous stroma . The most striking features of this tumor were that the center of the island had large eosinophilic granular cells, surrounded by tall columnar cells resembling the inner enamel epithelium of the enamel organ . Their cytoplasmic granules ranged from fine to coarse and in some cells pink, homogenous rounded masses which resembled inclusion bodies larger than coarse granules . The peripheral cells lining the islands were tall columnar or cuboidal with nuclei displaced opposite to the base of the cell and many peripheral cells were granular . The granular cells are a transitional or matured phase in the life cycle of ameloblasts, starting with normal stellate reticulum like cells leading to the production of granules and finally resulting in degeneration and the formation of cystic areas . Ultrastructurally, in the granular cell ameloblastoma the peripheral cells of the tumor islands were separated from surrounding stroma by continuous basement membrane . The most striking cytoplasmic feature is the presence of numerous granules (pleomorphic osmiophilic granules). The granules are round or oval, composed of homogenous amorphous osmiophilic material of different density . The granules were known to be lysosomes, which might play a role of autophagy and of remodeling the cytoplasm, as opposed to the aging or degenerating function . The cytoplasmic granularity in granular cell ameloblastomas might be caused by increased apoptotic cell death of neoplastic cells and associated phagocytosis by neighboring neoplastic cells . Lysosomal aggregation within cytoplasm is caused by dysfunction of either a lysosomal enzyme or lysosome associated protein involved in activation or targeting of the enzyme or lysosomal biogenesis . The granular cell ameloblastoma is a locally aggressive tumor with a high frequency of recurrence and potential to metastasize . It shows a slightly higher rate of recurrence of about 33.3% when compared with other common variants . However, very high recurrence rates were reported by hartman et al . (73%). The presence of tumor cells within the bone beyond the clinical and radiological margins are thought to be responsible for the recurrence when the tumors are treated with enucleation or curettage . The malignant transformation is rare, but the cases with metastasizing granular cell ameloblastoma lymph nodes, lungs and cervical vertebrae have been reported . However, further studies with long - term follow - up are necessary for the better understanding of the tumor's diagnosis, prognosis and treatment.
|
Genetically modified plant - pesticidal crops with constitutive expression of insecticidal protein (such as the cry proteins derived from the bacterium bacillus thuringiensis) require some form of resistance management program to delay the rapid evolution of resistance in targeted insects to expressed toxins . Because bt - toxins have substantial sub - lethal effects that could hasten resistance, resistance management for these toxins has focused on a high dose - refuge strategy . This strategy relies on plants expressing a sufficiently high dose of the toxin to kill> 95% of susceptible and resistant heterozygous insects, while refuges of non - transformed crops allow large numbers of susceptible insects to survive (gould 1988, van rie 1991, roush 1994). This strategy can delay the evolution of resistance to the crop, if, among other factors, the refuges produce a sufficient number of susceptible insects . The 1998 scientific advisory panel to the environmental protection agency of the u.s.a . Suggested that a refuge should produce 500 susceptible insects for each insect expected to survive in the transgenic crop (sap - epa 1998). The emphasis has primarily been on size of the refuge (proportion of overall habitat) needed to meet this or equivalent goals, but one alternative is to increase the efficiency of a refuge by producing more susceptible insects per unit area . This could be accomplished by the use of alternative hosts such as pigeon pea and velvetleaf (craig 1998). Caprio (2001) suggested that by altering the spatial structure of refuges one could impact the degree of isolation between refuges and transgenic fields and affect the impact of source - sink dynamics . Source - sink dynamics describe ecosystems in which some populations have net emigration and in which there is net population growth (sources) and other populations (sinks) where there is net immigration and in which deaths exceed births (pulliam 1988). Utilizing computer simulations, caprio (2001) modeled varying degrees of isolation between refuges and transgenic fields and found two different trends that resulted in an optimal degree of refuge isolation . When refuges were fine - grained (insects experience both habitats almost at random), with little isolation between refuges and transgenic fields, susceptible females emerging in the refuges laid many of their eggs in the most common habitat, transgenic fields, where few offspring would be expected to survive . The transgenic fields became sink habitats for susceptible moths, and fewer susceptible moths were therefore produced in the refuges and the rate of resistance evolution was increased . At the other extreme, if isolation (decreased dispersal between the two habitats) between refuges and transgenic fields was too great, large numbers of moths were produced in refuges, but few of these moths moved into transgenic fields, increasing the likelihood that resistant moths that survived in this toxic habitat would mate with each other . Between these two extremes was an optimal amount of isolation that would delay resistance the longest . Caprio (2001) suggested that isolation between refuges and transgenic fields could be manipulated by altering the width of refuges embedded within the transgenic fields . 1 m) refuges represented the minimum amount of isolation, while refuges placed in separate fields would be representative of more isolated refuges . In each case the total proportion of habitat devoted to refuges would remain identical . There would have to be many more narrow width refuges with less transgenic crop between each in the former case (e.g. One embedded refuge for each 20 rows, versus one refuge for every 1200 rows when refuges were 60 rows wide). The use of relatively narrow (16 - 100 row wide) refuges embedded into transgenic cotton, comprising 5% of the area, is a compromise between sprayed and unsprayed refuges . Are mandated by the us - epa to be larger than unsprayed refuges, but may be treated with a non - bt based foliar product . Sprayed refuges have the potential disadvantage that use of highly efficacious sprays could make these refuges ineffective . Fields with sprayed refuges also utilize two technologies simultaneously, the conventional technology applied to the refuges and the transgenic technology (a high dose transgenic crop produces too few individuals to act as a refuge for the conventionally treated refuges). In essence, the conventional technology is being utilized to protect the transgenic technology . Spatially separate unsprayed refuges are ideal because they are refuges not only for transgenic crops, but also for areas treated with conventional insecticides . Unfortunately, these refuges are easy to manage in a manner different than the surrounding bt - crop (reduced fertilizer input or irrigation, different planting dates, etc .) And have therefore become a target for minimizing compliance to resistance management guidelines . The embedded refuge concept attempts to deploy refuges within the transgenic crop in small enough units so that growers are unlikely to manage these refuges differently than the surrounding bt - crop . This has the disadvantage, relative to true unsprayed refuges, that the embedded refuges are sprayed whenever the bt - crop is sprayed, but attempts to minimize the likelihood of non - compliance with resistance management guidelines . The caprio (2001) model predicted, that in systems where pests persist for multiple generations in fields, that as refuges increase in width (but overall proportion remains the same), the density of the population in the refuges should increase . The null hypothesis tested here is that refuge population density is independent of refuge width (assuming that proportion of the total habitat devoted to refuges remains constant) for the two major insect pests the tobacco budworm, heliothis virescens (fabricius), and the cotton bollworm, helicoverpa zea (boddie) of the mid - south cotton agroecosystem . We also hypothesize that if insects are emerging primarily from local refuges a decline in egg density should be seen as one moves away from the refuge into the bt - crop . Alternatively, if insects are moving into fields from outside sources, no relationship should exist between refuges and insect egg density within this crop . In each of two years, 1996 and 1997, 3 replicates were used, each replicate consisting of a farm with three different embedded refuge widths, including narrow (16 - 24 rows wide), medium (32 - 48 rows wide) and wide (80 - 96 rows wide) refuges in a randomized design . Each refuge was surrounded with the appropriate amount of bollgard transgenic cotton expressing the cry 1ac gene isolated from b. thuringiensis so that the overall proportion of refuge cotton was 4% of the cotton habitat . Because of the large size needed for each replicate (> 140 ha), grower fields were used, and actual refuge widths depended on grower planter width . Cotton fields in mississippi generally remain furrowed throughout the year so that rows are clearly visible to growers prior to planting . This allowed growers to plant their bt - cotton and then fill in the non - bt refuges . This particular crop management practice simplified the use of embedded refuges, an advantage that may not be available in many other crops . At each farm the three refuge widths for a randomized complete block design with were replicated with farms as blocks . Each farm was sampled once per week and these counts were pooled to produce seasonal totals . Four sites were sampled at each refuge, the refuge and three distances away from the refuge . The refuge itself was sampled by randomly selecting plants from two randomly selected rows that were in the central third of the refuge . The other three samples sites at each refuge were in the transgenic cotton at distances of, in 1996, 20, 40 and 60 meters from the refuge edge, while in 1997 the distances were 40, 80 and 120 meters . At each site, 40 randomly selected plants in one row were sampled for the presence of eggs, for a total of 160 plants per refuge . In 1997 eggs were collected and identified to species (budworm or bollworm) using an elisa test (zeng et al . The eggs are morphologically indistinguishable, no attempt was made to separate budworm from bollworm larvae in that year . At the end of the season, 3 replicates of 10 row feet from the center of the refuge as well as 10 row feet of the surrounding bt - cotton (8 rows from the refuge - bt cotton interface) were harvested by hand for yield estimation . To reduce variance due to local field effects, the ratio of yield of refuge cotton compared to yield of surrounding bt - cotton was analyzed . Bt - cotton was utilized as a standard (adjusting for local environmental effects such as soil, other pests and pathogens because the two yields were from cottons grown in a similar environment) against which the yield of the refuges could be compared . Analysis of variance was performed on the mean egg density found in each refuge on each farm, with farms and refuge widths as categories . Homogeneity of variance between treatments was tested using a levene's test (wilkinson et al . A slope of the regression line significantly different from zero was considered evidence of an effect of distance on egg density and an indication that eggs were being oviposited by adults originating in the refuges (if the slope was negative). Analysis of variance was performed on the mean egg density found in each refuge on each farm, with farms and refuge widths as categories . Homogeneity of variance between treatments was tested using a levene's test (wilkinson et al . 1996). A slope of the regression line significantly different from zero was considered evidence of an effect of distance on egg density and an indication that eggs were being oviposited by adults originating in the refuges (if the slope was negative). A significant effect of refuge size on combined h. virescens and h. zea egg density was observed over the 1996 sample periods (f=5.49; df=2,30; p=0.026). No decline in egg density was recorded with increasing distance from the refuge for the distances sampled in this year (f=0.102; df=1,34; p=0.75; r=0.003; fig . 2). There was a significant decline in the relative yield of the refuge cotton compared with the surrounding bt - cotton as the refuge width increased (f=8.67; df=2,56; p<0.001). The yield in the narrowest refuges was 81% of the yield of surrounding bt - cotton, while the largest refuges yielded only 71% (fig . 3). Significantly higher h. virescens egg densities were found in larger refuges (f= 3.78; df = 2,36; p = 0.032, fig . H. zea egg densities did not vary with refuge size (f= 1.80; df = 2,36; p = 0.179, fig . Egg densities for h. virescens decreased with increasing distance from the refuges (density = 35.1 0.166 * distance; r = 0.295; p = 0.013, fig . 5), while a regression of egg density on distance from the refuge for h. zea was not significant (density = 29.6 0.075 * distance; r = 0.084; p = 0.219, fig . 5). A significant effect of refuge size on combined h. virescens and h. zea egg density was observed over the 1996 sample periods (f=5.49; df=2,30; p=0.026). No decline in egg density was recorded with increasing distance from the refuge for the distances sampled in this year (f=0.102; df=1,34; p=0.75; r=0.003; fig . 2). There was a significant decline in the relative yield of the refuge cotton compared with the surrounding bt - cotton as the refuge width increased (f=8.67; df=2,56; p<0.001). The yield in the narrowest refuges was 81% of the yield of surrounding bt - cotton, while the largest refuges yielded only 71% (fig . Significantly higher h. virescens egg densities were found in larger refuges (f= 3.78; df = 2,36; p = 0.032, fig . H. zea egg densities did not vary with refuge size (f= 1.80; df = 2,36; p = 0.179, fig . Egg densities for h. virescens decreased with increasing distance from the refuges (density = 35.1 0.166 * distance; r = 0.295; p = 0.013, fig . 5), while a regression of egg density on distance from the refuge for h. zea was not significant (density = 29.6 0.075 * distance; r = 0.084; p = 0.219, fig . 5). As predicted by modeling, we found significantly higher egg densities in wider refuges for tobacco budworm, at least for the combined (1996) and the 1997 h. virescens data . Increased isolation between the refuges and bt - cotton allowed more of the reproductive effort of females emerging in refuges to be expended in the refuges, thus increasing the population of moths in the refuges . Theoretical considerations (caprio 2001) suggest that this increase in population density would more than compensate for the increased isolation of the refuges . While individual moths emerging in the refuges would have a lower probability of mating with a resistant individual in the bt - crop, the overall probability that a resistant individual mating with an insect emerging out of the refuge would increase because of the greater refuge population size . The fine - scale structure of egg density within refuges was not investigated . Larval densities and yield loss are expected to differ within the refuge in relation to distance from the transgenic crop (alstad and andow 1995). However, the sampled eggs reflect adult dispersal patterns rather than larval movement patterns and interactions with crop types . Adult h. virescens do not oviposit preferentially on either host type (parker 1997). Given the distance over which we had to measure outside of the refuges to detect declines in oviposition, we believe it unlikely that egg density varied significantly with refuges and feel that the densities measured reflect mean densities for the entire refuge . The ability to discriminate and observe the differences between h. zea and h. virescens using the elisa in the 1997 study revealed important differences in the biology of these two insects . Populations of h. virescens are primarily restricted to cotton for four generations during the summer, with smaller populations on some wild hosts (stadelbacher et al . One would then expect that fields are initially infested with moths moving in from springtime wild hosts, but then a substantial proportion of subsequent populations originate in cotton fields . This behavior increases the potential effects of the source - sink dynamics, and is reflected in the significant effects of refuge size and a significant decline in egg density as distance from the refuges increased . H. zea, on the other hand, infests primarily corn during the first two generations of the summer, and only after corn ceases to be a suitable habitat in mid - july do bollworm moths begin to move into cotton and possibly other alternative hosts (neunzig 1969). Lopez et al . (1995) also found that h. zea is more mobile than h. virescens during mid - summer months in texas . This biological pattern limits the effects of source - sink dynamics because many of the eggs found in a cotton field will have come from moths dispersing into cotton from other fields or habitats rather than immediately adjacent refuges . This is consistent with the lack of an effect of refuge size for this species, and with the lack of a significant decline in egg density with distance from the refuges . These data, combined with the results from caprio (2001), suggest that source - sink dynamics can be important for some species in agricultural systems . The studies suggest that a suitable improvement in the strategy to delay the evolution of resistance to bt - cotton would be to deploy embedded refuges, strips of non - bt cotton planted within bt - cotton . It is essential that such strips be wide enough to generate sufficient isolation between the refuges and bt - cotton . As a rough guide, the mean proportion of eggs oviposited in refuges by females emerging in the refuges should be the inverse of the mean rate of increase in population size per generation . If the mean rate of increase per generation is 5 fold, the embedded refuges should be wide enough so that at least 20% of the eggs oviposited by females emerging in refuges would be laid in refuges . This would ensure that the population size in the refuges would approximately remain constant over the course of the season . The results presented in this paper suggest that refuges of 2448 m wide are probably not wide enough to generate this isolation for h. virescens, and embedded refuges should be at least 50 m wide . A disadvantage of conventional unsprayed refuges, which can be physically separated from bt - fields, is that such refuges may be subject to illicit insecticidal sprays . Embedded refuges could reduce such proscribed spraying by reducing the likelihood of micro - management of pest populations in such refuges, essentially hiding the refuge within the crop at large . However, for pests such as h. zea that have significant survivorship in bt - fields, a mechanism must exist to allow embedded refuges to be sprayed when the surrounding bt - fields are sprayed . In these cases, spraying of refuges should occur only when bt - fields are treated for the targeted pests . In the absence of synergy between the bt - crop and the applied insecticide, one would expect equal mortality of all genotypes related to bt - resistance in both bt - fields and refuges, and the over - spraying should not impact the rate of resistance evolution (though in comparison, an unsprayed refuge, in which the refuge population was not exposed to the insecticide, would actually benefit from applications applied to the bt - cotton). Embedded refuges, while maintaining some isolation between refuges and bt - fields, would also help limit the maximal distance between refuges and bt - plants . Further, in contrast to sprayed refuges, embedded refuges would acts as refuges for all pesticides used for lepidopteran control in cotton (except when bt - fields are over - sprayed). Because bt - fields are expected to produce very low numbers of h. virescens, they will not act as refuges for conventional sprayed fields, and one would expect that resistance to conventional insecticides will continue to evolve at a rate almost independent of the presence of plants expressing bt - toxins . Sprayed refuges use conventional insecticides to preserve susceptibility to bt - toxins and utilize two generations of toxins (bt transgenic plants and conventional foliar insecticides) simultaneously . Unsprayed refuges and, to a lesser degree, embedded refuges, represent a more balanced approach in which transgenics and conventional insecticides each would be capable of managing resistance in the absence of the other . Finally, embedded refuges should provide some advantage to a grower by limiting population growth in refuges and limiting yield loss compared to larger refuges . The optimal size for a refuge will be a compromise between grower desires (narrow refuges and larger yields) and long term resistance management (wider refuges and increased yield loss). Inevitably, however, production of susceptible insects for the management of resistance requires some yield loss . The data presented here suggest that varying the width of refuges embedded within bt - cotton can impact the growth rate of h.virescens populations in those refuges . Theoretical work suggests that these changes can significantly impact the rate of resistance evolution to bt - cotton . Based on these data as well as data on spatial aspects of female reproductive efforts (m.a.c ., unpublished data), we suggested that refuges in cotton for h. virescens be between 50 and 96 m wide . The change in mean (sem) egg density as a function of embedded refuge width for three farms in 1996 . The small refuges were 1624 m wide, the medium width refuges were 3248 m wide, and the wide refuges were 8096 m wide . The change in mean (sem) heliothine egg density as a function of distance from the refuge edge for three farms in 1996 . The relationship of relative yield (yield in the refuge relative to immediately surrounding bt - cotton) to embedded refuge width for three farms in 1996 . The small refuges were 1624 m wide, the medium width refuges were 3248 m wide, and the wide refuges were 8096 m wide . The mean density (sem) of h. virescens and h. zea eggs in embedded refuges of three different widths in 1997 . The narrow refuges were 1624 m wide, the medium width refuges were 3248 m wide, and the wide refuges were 8096 m wide . The relationship of egg density to distance from the edge of an embedded refuge for h. virescens and h. zea in 1997 . The slope of the h. virescens regression was significantly different from 0, while the slope of the h. zea regression was not.
|
High - throughput genotyping technologies contribute greatly to the hunt for susceptibility genes for complex diseases by constantly improving the precision of and the capacity for parallel genotyping 1, 2, 3 . Driven by these emerging technologies, some challenging projects, such as hapmap phase iiii 4, 5, encode 6, 7 and 1000 genomes (8), were proposed to explore the pattern in the human genome of common or rare variation . Broad application of the whole - genome single nucleotide polymorphism (snp) chips into genome - wide association studies (gwas) has also led to the discovery of more than 100 loci for nearly 40 common diseases and traits (9). Due to the great challenges presented by huge datasets, two strategies have been developed for performing data analysis for whole - genome genotyping data . One strategy is to use open - source or commercial packages that have been designed for gwas . Plink (10) is one of the most popular and powerful of these programs . Genabel (11), gwaf (12), snpassoc (13) and snpmatrix (14) are programs based on r language, which is a well - executed open - source framework . Gwas analyzer (15), gwas gui (16) and maven (17) provide platforms for intuitively viewing the results of gwas . Snptest (18) also can be used for data analysis with a software suite consisting of several programs . The above software packages are easily compatible with chip data and possess more or fewer functions according to the purpose of genetic analysis . The other strategy for performing these analyses is to take advantage of classic genetic programs that implement specific functions, such as transmission disequilibrium tests (tdt) for alleles [unphased (19)], calculating linkage disequilibrium (ld) measures and constructing ld maps [haploview (20), gold (21) and jlin (22)], haplotype inference [phase (23)], haplotype block partition [hapblock (24)], tagsnps selection [tagger (25)] and multilocus interaction methods [mdr (26)]. However, most of the classic programs that are available would be not suitable for inputting the chip data directly and require custom - made input, which results in the inconvenience of converting raw genotyping files into various data formats . Snp_tools (27) is an ms - excel add - in that can convert genotyping files into several formats, such as haploview and phase . Because it is an add - in program for excel (255 columns and 65,536 rows in ms - excel 2003), supports for the chip data are scarce . Furthermore, output formats are limited to haploview, snphap, phase and pedphase . However, as classic programs implement specific algorithms for genetic analysis and provide an option for analysis of gwas data, it is important to develop a tool to bridge these programs with raw genotyping data . Here, we present a powerful, user - friendly, lightweight toolkit named snptransformer for gwas . The major aim of snptransformer is to convert genotyping input (such as linkage and chip formats) into various outputs (such as packages for association, tdt, calculating ld measures, haplotype inference, haplotype block partition, tagsnps and multilocus interaction). With this toolkit, researchers can avoid manual coding between formats and can easily construct workflows for data analysis . Additionally, accessory tools in snptransformer perform data previewing, relational operations on ids, recoding data files and simulating map files that assist data conversion and gwas analysis . Snptransformer v1.0 was written using c++ builder with a concise and user - friendly interface . It was built and tested under windows xp . Because snptransformer is a lightweight toolkit, no installation or other package all binary programs, source codes, tutorials, examples and updates are available freely under the gnu general public license at the snptransformer website (http://snptransformer.sourceforge.net). The current version of snptransformer provides five major modules for gwas: transformer, previewer, operator, coder and simulator (table 1). As the most important module of this software package, transformer is positioned in the main window of the software and is responsible for converting file formats from genotyping data to the formats of specific classic genetics analytical tools (figure 1 and table 1). Input data include genotyping files, marker files and pedigree files (figure 2). Formats of genotyping files can be one of the following: linkage format, which integrates genotyping data and pedigree information in a single file; chip format, which is compatible with whole - genome genotyping data of affymetrix, illumina and many other chip platforms (see manual in detail); or custom format, which is similar to sequencing results . A marker file stores chromosome information and the physical positions of snps, as well as genetic positions, which are usually set to zero . Pedigree files contain information on individual ids, gender and disease status, or qualitative traits, and this file type is suitable not only for pedigree data such as linkage and tdt, but also for case / control data . Because a pedigree file is the same as the pedigree part (first six columns) of a linkage format, it is not required for a linkage format genotyping file . The output formats of snptransformer are diverse and represent essential genetic analyses for gwas (figure 2). Similar to many other tools plink is one of the most popular software platforms for gwas and can perform various genetic analyses, and the marker file of snptransformer references that of plink, leading to consistency between the input data in linkage format for snptransformer and those of plink . Haploview is a program that presents ld - based analysis tools: tdt, calculating ld measures and constructing ld maps, inferring haplotypes, partitioning haplotype blocks and selecting tagsnps and case / control association . Unphased, gold, jlin, phase, haploblock and tagger each carry out one of these analysis steps . Mdr excels at performing multi - locus interaction analysis and is widely used in association studies . At present, no tool related to two - locus interaction is included in snptransformer due to the lack of well - recognized analysis tools for this except for logistic regression, which has quite a different format from the output of snptransformer . Additional custom formats can be output using some options that are designed to count genotype / allele numbers and frequencies . To filter input data, snp or sample lists can be set to improve data quality or to narrow the target scope . With these filters, transformer can act as an extractor that searches for specific genotypes for meta - analysis . The other four modules in snptransformer have been developed to satisfy specific demands, such as previewing data files and retrieving annotation information for positive snps (table 1). Since genotyping or annotation files of whole - genome snp chips are too large to open with generic text - editor tools, previewer performs previewing of the top n lines of these files . With this function, users can view the format of annotation files for affymetrix genechip 6.0 sets that are larger than hundreds of megabytes . Furthermore, previewer can reorder the columns of input file to attain a new file that is arranged as required for further analysis . During the processing of genetic analyses, the relational operations can help search for specific information . For example, annotation information for positive snps can be retrieved by performing the inner join or left join operations including one - item (operating on single file) and two - item operations (operating between two files) are implemented by operator, similar to relational databases such as mysql and access support . Coder recodes genotypes between letters and numbers that can code one heterozygote with two alleles a and t as at (acgt - coding), 14 (1234-coding), 12 (12-coding), ab (ab - coding) or even 1 (012-coding). Another module, called simulator, is used to generate pseudo map and pedigree files without the use of real information . When using haploview to calculate ld measures, physical positions are not required to be real numbers, but rather the order of snps is sufficient if the pairwise distance can be ignored and if the order of snps is correct . In such a case considerable work remains to be accomplished in the future to meet the needs of gwas analysis . The first step in this process is to adopt parallel technology to further improve the speed of the analysis process . Another important aim in improving snptransformer is to design a personal interface for affymetrix and illumina snp chips to provide more options . In the current version, as the most important module of this software package, transformer is positioned in the main window of the software and is responsible for converting file formats from genotyping data to the formats of specific classic genetics analytical tools (figure 1 and table 1). Input data include genotyping files, marker files and pedigree files (figure 2). Formats of genotyping files can be one of the following: linkage format, which integrates genotyping data and pedigree information in a single file; chip format, which is compatible with whole - genome genotyping data of affymetrix, illumina and many other chip platforms (see manual in detail); or custom format, which is similar to sequencing results . A marker file stores chromosome information and the physical positions of snps, as well as genetic positions, which are usually set to zero . Pedigree files contain information on individual ids, gender and disease status, or qualitative traits, and this file type is suitable not only for pedigree data such as linkage and tdt, but also for case / control data . Because a pedigree file is the same as the pedigree part (first six columns) of a linkage format, it is not required for a linkage format genotyping file . The output formats of snptransformer are diverse and represent essential genetic analyses for gwas (figure 2). Similar to many other tools, the linkage format is considered the basic format of snptransformer . Plink is one of the most popular software platforms for gwas and can perform various genetic analyses, and the marker file of snptransformer references that of plink, leading to consistency between the input data in linkage format for snptransformer and those of plink . Haploview is a program that presents ld - based analysis tools: tdt, calculating ld measures and constructing ld maps, inferring haplotypes, partitioning haplotype blocks and selecting tagsnps and case / control association . Unphased, gold, jlin, phase, haploblock and tagger each carry out one of these analysis steps . Mdr excels at performing multi - locus interaction analysis and is widely used in association studies . At present, no tool related to two - locus interaction is included in snptransformer due to the lack of well - recognized analysis tools for this except for logistic regression, which has quite a different format from the output of snptransformer . Additional custom formats can be output using some options that are designed to count genotype / allele numbers and frequencies . To filter input data, snp or sample lists can be set to improve data quality or to narrow the target scope . With these filters, transformer can act as an extractor that searches for specific genotypes for meta - analysis . The other four modules in snptransformer have been developed to satisfy specific demands, such as previewing data files and retrieving annotation information for positive snps (table 1). Since genotyping or annotation files of whole - genome snp chips are too large to open with generic text - editor tools, previewer performs previewing of the top n lines of these files . With this function, users can view the format of annotation files for affymetrix genechip 6.0 sets that are larger than hundreds of megabytes . Furthermore, previewer can reorder the columns of input file to attain a new file that is arranged as required for further analysis . During the processing of genetic analyses, the relational operations can help search for specific information . For example, annotation information for positive snps can be retrieved by performing the inner join or left join operations including one - item (operating on single file) and two - item operations (operating between two files) are implemented by operator, similar to relational databases such as mysql and access support . Coder recodes genotypes between letters and numbers that can code one heterozygote with two alleles a and t as at (acgt - coding), 14 (1234-coding), 12 (12-coding), ab (ab - coding) or even 1 (012-coding). Another module, called simulator, is used to generate pseudo map and pedigree files without the use of real information . When using haploview to calculate ld measures, physical positions are not required to be real numbers, but rather the order of snps is sufficient if the pairwise distance can be ignored and if the order of snps is correct . In such a case, a map file can be easily simulated from a snp list by simulator . Considerable work remains to be accomplished in the future to meet the needs of gwas analysis . The first step in this process is to adopt parallel technology to further improve the speed of the analysis process . Another important aim in improving snptransformer is to design a personal interface for affymetrix and illumina snp chips to provide more options . In the current version,
|
Early atherogenesis is characterized by the recruitment of circulating leukocytes (e.g., monocytes / macrophages and t - lymphocytes etc .) Into artery wall, the formation of foam cells in the vessel intima, leading to the development of atherosclerotic lesions . The inflammatory responses in the atherosclerotic lesions play a crucial role to promote plaque rupture and thrombosis in the late progression of atherosclerosis, leading to myocardial infarction and strokes (libby, 2002). The rupture - prone plaque is featured by a large lipid core and accumulation of inflammatory cells including macrophages and t - lymphocytes (mann & davies, 1996). A family of matrix metalloproteinases (mmps), which are proteolytic enzymes secreted by the inflammatory cells, play a pivotal role in degrading extracellular matrix and plaque rupturing (newby, 2005). Chemokines, a superfamily of chemotactic cytokines, not only cause the recruitment of leukocytes into the arterial wall, but also influence atherosclerotic plaque stability by enhancing mmps releases (reape & groot, 1999; sheikine & hansson, 2004), and thus play a crucial role in both the initiation and the progression of atherosclerosis . Leukotactin-1 (lkn-1/ccl15), a new member of the human cc chemokine family, is a potent chemoattractant for leukocytes, and it is implicated in inflammatory pathologies including atherosclerosis . Our previous study and others have shown that the levels of lkn-1/ccl15 expression are markedly up - regulated in macrophage - derived foam cells and in human atherosclerotic lesions (lee et al ., 2002; yu et al ., 2004), and moreover, the proatherogenic mediators such as oxidized lipoprotein and oxidative stress markedly upregulte lkn-1/ccl15 gene expression and protein release from the foam cells (yu et al ., 2004), indicating lkn-1/ccl15 plays a role in the initiation of atherogenesis . However, it remains unclear whether lkn-1/ccl15 is associated with the progression of atherosclerosis . In the present study, we investigated whether lkn-1/ccl15 can enhance mmp-9 release from macrophages and/or foam cells, which influence plaque rupture . Our data demonstrated that lkn-1/ccl15 enhanced mmp-9 protein release from human macrophages and macrophage - derived foam cells, indicating that lkn-1/ccl15 may be associated with the vulnerability of plaque rupture in the late stage of atherosclerosis . The cells were plated at a density of 5 10 cells / ml in the medium containing phorbol myristate acetate (pma, sigma) at 10 m for 48 h to induce their differentiation into macrophages . After washings twice with hbss without ca and mg, the pbmcs were then suspended in 10% fbs containing rpmi and incubated for 60 min at 37 to let the monocytes attach to the culture dish . The attached monocytes were harvested by vigorous pipetting and plated at a density of 5 10 cells / ml in the medium containing pma at 10 m for 48 h to induce their differentiation into macrophages . Human low density lipoprotein (ldl) (d = 1.006 - 1.063) was separated from freshly drawn normal plasma sample by sequential ultracentrifugation and extensively dialyzed at 4 against 0.15 mol / l nacl and 0.01% edta . After edta was removed, ldl was subjected to oxidative modification by incubation with cu (5 m cuso4, 16 h at 37). Then cu was removed by extensive dialysis (yu et al ., 2004). The extent of modification was assessed by the determination of electrophoretic mobility on agarose gels . In agarose gel electrophoresis, oxldl was stored at 4 and was used within 4 weeks of preparation . To prepare macrophage - derived foam cells, human thp-1 cells were plated at a density of 5 10 cells / ml in the medium containing pma at 10 m for 48 h to induce their differentiation into macrophages, and then the cells were treated with human oxidized ldl (25 g / ml) for 4 days (yu et al ., 2004). The gelatinolytic activities of mmp-9 in the conditioning culture medium were assayed by electrophoresis on 10% polyacrylamide gels containing 1 mg / ml gelatin at 4. page gels were run at 120 v, washed in 2.5% triton x-100 for 1 h, and then incubated for 16 h at 37 in activation buffer (50 mm tris - hcl, ph 7.5, 10 mm cacl2). After staining with coomassie blue (10% glacial acetic acid, 30% methanol and 1.5% coomassie brilliant blue) for 2 - 3 h, the gel was destained with a solution of 10% glacial acetic acid, and 30% methanol without coomassie blue for 1 h. white lysis zones indicating gelatin degradation were revealed by staining with coomassie brilliant blue r-250 . The cells were plated at a density of 5 10 cells / ml in the medium containing phorbol myristate acetate (pma, sigma) at 10 m for 48 h to induce their differentiation into macrophages . After washings twice with hbss without ca and mg, the pbmcs were then suspended in 10% fbs containing rpmi and incubated for 60 min at 37 to let the monocytes attach to the culture dish . The attached monocytes were harvested by vigorous pipetting and plated at a density of 5 10 cells / ml in the medium containing pma at 10 m for 48 h to induce their differentiation into macrophages . Human low density lipoprotein (ldl) (d = 1.006 - 1.063) was separated from freshly drawn normal plasma sample by sequential ultracentrifugation and extensively dialyzed at 4 against 0.15 mol / l nacl and 0.01% edta . After edta was removed, ldl was subjected to oxidative modification by incubation with cu (5 m cuso4, 16 h at 37). Then cu was removed by extensive dialysis (yu et al ., 2004). The extent of modification was assessed by the determination of electrophoretic mobility on agarose gels . In agarose gel electrophoresis, to prepare macrophage - derived foam cells, human thp-1 cells were plated at a density of 5 10 cells / ml in the medium containing pma at 10 m for 48 h to induce their differentiation into macrophages, and then the cells were treated with human oxidized ldl (25 g / ml) for 4 days (yu et al ., 2004). The gelatinolytic activities of mmp-9 in the conditioning culture medium were assayed by electrophoresis on 10% polyacrylamide gels containing 1 mg / ml gelatin at 4. page gels were run at 120 v, washed in 2.5% triton x-100 for 1 h, and then incubated for 16 h at 37 in activation buffer (50 mm tris - hcl, ph 7.5, 10 mm cacl2). After staining with coomassie blue (10% glacial acetic acid, 30% methanol and 1.5% coomassie brilliant blue) for 2 - 3 h, the gel was destained with a solution of 10% glacial acetic acid, and 30% methanol without coomassie blue for 1 h. white lysis zones indicating gelatin degradation were revealed by staining with coomassie brilliant blue r-250 . The present study has demonstrated that lkn-1/ccl15 enhances mmp-9 protein release by macrophages and macrophages - derived foam cells, indicating that lkn-1/ccl15 may play a role in the plaque rupture of the atherosclerotic lesions . Macrophages, which are abundant in ruptured atherosclerotic plaques, express multiple mmps, weakening the plaque and making it rupture prone (boyle, 2005). Among mmps, mmp-9 (92-kda gelatinase b), which is a prevalent form expressed by activated macrophages and foam cells, is found in human coronary atherosclerotic lesions (galis & khatri, 2002; pasterkamp et al ., 2000). We found that lkn-1 significantly activated human thp-1 monocytes - derived macrophages and human pbmc - derived macrophages to release mmp-9 (fig . 1a and 1b). It has been shown that the circulating levels of lkn-1 are increased in plasma of atherosclerotic patients, and lkn-1 stimulates endothelial cells to release intracellular adhesion molecule-1 (yu et al ., 2004). Since mmp-9 is required for monocyte infiltration through endothelium from blood, lkn1/ccl15 action on macrophages to release mmp-9 may accelerate the recruitment of macrophages into the atherosclerotic lesions . It has been shown that the expression levels of chemokine genes such as monocyte chemoattractant protein-1 (mcp-1) and interleukin-8 (il-8) are upregulated in human atherosclerotic lesions and they are associated with plaque rupture by activating endothelial cells and smooth muscle cells to release mmps (kodali et al . Atherosclerotic lesions consist of mainly macrophages and lipid - laden foam cells, and thus excessive production of mmp-9 by lkn-1/ccl15 from macrophages and macrophage - derived foam cells in the lesions may accelerate the destabilization and rupture of the fibrous cap of the atherosclerotic plaque . Our data demonstrated that lkn-1 markedly enhanced the production of mmp-9 from macrophage - derived foam cells (fig . We have previously shown that proatherogenic mediators enhance lkn-1/ccl15 release from macrophages and macrophage - derived foam cells (yu et al ., 2004). Therefore, it can be postulated that macrophages and macrophage - derived foam cells in atherosclerotic lesions may enhance the local concentration of lkn-1 in the lesions, and lkn-1/ccl15 subsequently stimulate the macrophages / foam cells per se to secrete mmp-9, indicating that lkn-1/ccl15 action on macrophages and foam cells to release mmp-9 may contribute to plaque destabilization in the progression of atherosclerosis . In conclusion, lkn-1/ccl15 enhanced mmp-9 protein secretion from thp-1 monocytic cells - derived macrophages, human pbmc - derived macrophages, and thp-1 macrophage - derived foam cells in a dose dependent manner . Considering the association of mmp-9 in plaque rupture, our findings suggest that lkn-1/ccl15 could be associated with plaque destabilization in the progression of atherosclerosis . Lkn-1/ccl15 may be a useful target for the management of atherosclerosis . Further studies are needed to elucidate the inhibitory effect of phytochemicals or food factors on lkn-1/ccl15 release from macrophages / foam cells.
|
Alopecia areata (aa) is a chronic, organ specific autoimmune disease, probably mediated by autoreactive t cells, which affects the hair follicles and sometimes the nails . There is a high frequency of a family history of aa in affected persons, ranging from 10% up to 42% of cases . Clinically, the disease manifests as patchy alopecia, reticulate alopecia, ophiasis, ophiasis inversus (sisaphio), alopecia totalis or alopecia universalis . A new subtype of aa is acute diffuse and total alopecia of the female scalp characterized by rapid progression of diffuse alopecia of the female scalp, marked female predominance and a favorable prognosis . Nail changes (diffuse fine pitting, longitudinal ridging, thin and brittle fingernails and toenails and trachyonychia) may be seen in 3 - 30% of patients . Dermatoscopy is a noninvasive technique allowing rapid and magnified in vivo observation of the skin with the visualization of morphologic features often imperceptible to the naked eye . Dermatoscopy may be useful for differential diagnosis of difficult cases, in particular in diffuse aa or in patients with total hair loss by the presence of cadaverized hairs (black dots [bds]), exclamation mark hairs (tapering hairs [th]), broken hairs (bhs), yellow dots (yds) and clustered short vellus hairs (svhs) in the hair loss areas . This study was carried out in 75 patients of aa visiting dermatology outpatient department of a tertiary care center in north karnataka between november 2012 and july 2013 . The clinical diagnosis of aa was established after a detailed history taking including past and family history and clinical examination . Grading of aa was done using the following scale: scalp hair loss: s0, no hair loss; s1, <25% hair loss; s2, 26 - 50% hair loss; s3, 51 - 75% hair loss; s4, 76 - 99% hair loss; s5, 100% hair loss . Body hair loss: b0, no body hair loss; b1, some body hair loss; b2, 100% body (excluding scalp) hair loss . A digital dermatoscope (of magnification 25 and 60) was used for the evaluation . The mean age of the patients at presentation was 26.94 years, youngest being 10 months and oldest being 68 years . Alopecia areata patients categorized based on age the mean age of onset was 23.58 years . The mean duration of the current episode in recurrent cases was 5.7 months (1 week-3 years). A total of 46 patients had their first episode of aa at presentation (males 32, females 14). Patchy alopecia was the most common pattern of aa seen in 55 (73.3%) patients (43 males, 12 females). 29 patients (23 males, 6 females) had a single patch and 26 patients (20 males, 6 females) had multiple patches . The other patterns observed were: ophiasis - 9 cases (6 males, 3 females), sisaphio - 3 cases (1 male, 2 females), reticulate - 2 cases (1 male, 1 female), diffuse - 3 cases (1 male, 2 females), alopecia totalis in 1 female and alopecia universalis in 2 males [table 1]. 55 patients showed involvement of the scalp (34 males - 62.96%, 21 females - 100%) which included: occiput - 27, frontal and vertex - 19 each, temporal - 7 and parietal - 5 . The other sites involved were - beard 13 (13 males - 24.07%), moustache 8 (8 males - 14.81%), eyebrows 8 (4 males - 7.4%, 4 females - 19.04%), eyelashes 2 (1 male - 1.85%, 1 female - 4.76%), limbs 2 (2 males - 3.7%) and alopecia universalis 2 (2 males - 3.7%) [graph 2]. Sites of involvement in alopecia areata in both sexes a single site was involved in 59 patients (scalp only - 46, beard only - 9, moustache only - 3, eyebrows only - 1). 11 patients had involvement of 2 sites and> 2 sites were involved in 5 patients . These included pitting in 7 patients, ridging in 1 patient and striate leuconychia in 3 patients . The dermatoscopic features seen in our patients were as follows: yds-43 (57.33%), bds - 63 (84%), bh - 28 (37.33%), svh - 51 (68%) and th - 14 (18.67%) [figures 1 - 5]. All these dermatoscopic features were seen in 7 patients whereas 2 patients had none of the above features . Dermoscopic features in various patterns of aa 44 patients (58.67%) had received some form of treatment at presentation, whereas 31 patients (41.33%) had not taken any treatment . 75% of treated patients showed presence of svh at presentation in contrast to 51.6% of untreated patients . The various dermoscopic features in patients with and without treatment is tabulated in table 4 . The onset is within the first three decades of life although it can start at any age . The sex incidence is probably equal . In our study, males were most commonly affected than females with a male: female ratio of 2.57:1 ., whereas the study conducted by inui et al ., showed an increased female preponderance . The mean age of onset of aa was 23.58 years which was consistent with the previous studies . Patchy alopecia, being the most common pattern of aa in our study, was seen in 73.3% of patients . Mane et al ., also noted patchy alopecia as the most common pattern involving 46.7% and 87.7% of patients respectively . Dermoscopy has been established as an indispensable tool in the diagnosis and follow - up of hair disorders . In aa, dermoscopy of active disease shows yds, dystrophic hairs, as well as cadaverized (bds) and exclamation mark hairs . Yds are a powerful new tool in the diagnosis of hair loss diseases initially proposed by ross et al . Yds are marked by a distinctive array of yellow to yellow - pink, round or polycyclic dots that vary in size and are uniform in color . They represent distention of the affected follicular infundibulum with keratinous material and sebum . In aa, degenerating follicular keratinocytes probably constitute the bulk of the yd . In a study conducted by inui et al ., yds were seen in 63.7% (191/300) of cases in contrast to ross et al . The low incidence in our study may be attributed to the skin color of our patients which might make the yds difficult to perceive . Ths (exclamation marks hairs) are characterized by wider diameter in the distal shaft and thinner diameter in the proximal shaft . This pattern marks presence of the lymphocytic inflammatory infiltrate affecting the hair bulb and thus, producing thinner hair shaft . Ths were seen in 31.7% (95/300) cases of aa by inui et al . And we noted ths in 14 (18.67%) cases which was consistent with the previous studies . Bhs, considered to be dystrophic hairs produced by the least severely affected follicles in aa, are clinical markers of the disease activity and severity . Inui et al ., demonstrated bhs in 45.7% (137/300) of alopecia cases . Bds (formerly cadaverized hairs) which represent pigmented hairs broken or destroyed at scalp level are characteristic of black haired individuals . This sign is not seen in white population due to the hair color and cuticle resistance . These are a sensitive marker not only for disease activity, but also for the severity of aa . In our study, inui et al ., demonstrated bds in 44.3% (133/300) cases of aa . The presence of svhs indicates the nondestructive nature of aa, allowing hair regrowth whether or not it results in completely mature hair shafts the pigmented hairs of asians facilitate the detection of svhs by dermoscopy . The regrowth of svhs can be seen after treatment in dermoscopy even when the recovered hairs are hardly perceived by the naked eye . Short hypopigmented vellus hairs are characteristic of remitting disease . In our study, 51 out of 75 patients (68%) demonstrated the presence of svhs . Our findings were consistent with the previous studies conducted by inui et al ., where svhs were observed in 72.7% (218/300) of cases . The higher incidence of svh in our study was probably due to the various forms of treatment already received by 58.67% of patients before their first visit to our center . Demonstrated that for diagnosis of aa, yds and svhs were the most sensitive markers . The most common dermoscopic finding observed was bds, followed by svhs, yds, bhs and ths.
|
Polycystic ovary syndrome (pcos), also known as stein - leventhal syndrome, is a common endocrine disorder that occurs in 510% of women of reproductive age . According to the 2003 rotterdam criteria, it is usually defined by presence of at least 2 out of the following 3 features: i) oligoovulation or anovulation, ii) clinical and/or biochemical signs of hyperandrogenism (presence of at least 2 signs), or iii) polycystic ovaries (ovaries with many small cysts no larger than 810 mm; they occur in 1520% of women). Pcos has significant and various clinical implications, including reproductive, endocrine, and metabolic disorders such as hyperandrogenism and obesity . Obesity, especially abdominal obesity, is an independent factor aggravating pcos endocrine abnormalities, as subcutaneous abdominal adipose tissues and the liver tissues contribute to extragonadal aromatization . As individuals become obese and their adipocytes enlarge, adipose tissue undergoes molecular and cellular changes affecting systemic metabolism . Fasting body ffa and glycerol discharge from adipocytes refers to a condition characterized by an increase in levels of various inflammatory markers such as c - reactive protein (crp), fibrinogen, tumor necrosis factor- (tnf-), interleukin-1 (il-1), interleukin-6 (il-6), and neutrophil - to - lymphocyte ratio (n / l ratio). Recognition of the impact of inflammation on atheromatous plaque generation and rupture leads to interest in novel inflammatory markers and determining the best assay to define the relevant cardiovascular diseases (cvds). Respect, cellular immune activation can easily and sensitively be monitored by measurement of neopterin levels in biological fluids . Biosynthetically derived from guanosine triphosphate, neopterin [2-amino-4-hydroxy-6-(d - erythro-1,2,3-trihydroxypropyl)-pteridin] belongs to the class of pteridines . Patients with pcos are considered to be at high risk for cardiovascular diseases because of hyperandrogenism, insulin resistance, glucose intolerance, type ii diabetes, and obesity which might accompany pcos . However, there is no study in the literature reporting a direct relationship between increased / early cardiovascular mortality or morbidity and pcos . The purpose of this study was to make a comparison between obese and non - obese patients with pcos and control subjects with regard to concentrations of inflammatory markers (neopterin, il-6, tnf-, n / l ratio, and crp) and vitamin b12, which might pose a risk for atherosclerosis in patients with pcos, and to investigate the correlation between the examined concentrations and the hormonal anthropometric and cardiometabolic parameters . This study was conducted in the obstetrics and gynecology clinic of dicle university and approved by the local ethics committee of the university . A total of 30 patients between 18 and 33 years of age (mean 26.24.0 years) who presented to dicle university faculty of medicine clinic of obstetrics and gynecology between june 2013 and july 2014 and were diagnosed with pcos based on their clinical and endocrinological data were included in this study . According to the revised rotterdam diagnostic criteria, pcos was defined by the presence of at least 2 out of the following 3 features: oligo - anovulation (menstrual cycle length> 45 days or less than 6 menstrual cycles a year), clinical or biochemical hyperandrogenism (ferriman - gallowey (fg) score> 8 or elevated serum testosterone levels), and polycystic ovaries on transvaginal usg (tvusg) (enlarged ovaries with increased stromal volume and more than 10 follicles which measure 28 mm in diameter and localize along the periphery of the ovary in a way to form a pearl necklace appearance . Thyroid functions, luteinizing hormone / follicle - stimulating hormone (lh / fsh), prolactin, dehydroepiandrosterone sulfate (dheas), 17-hydroxyprogesterone (17-ohp), androstenedione, and total and free testosterone were checked in patients with pcos and control subjects, and those with thyroid diseases, hyperprolactinemia, cushing s disease, or congenital adrenal hyperplasia and those who were administered agents such as hormonal agents, ovulation inducing agents, glucocorticoids, anti - androgens, or anti - hypertensives over the last 6 months prior to the study were excluded from the study . Fifteen patients with body mass index (bmi)> 25 and 15 patients with bmi <25 were included in the pcos groups and 15 healthy control subjects with bmi> 25 and 15 healthy control subjects with bmi <25 who were between 17 and 35 years of age (mean 27.64.3 years) were included in the control groups . They were all clinically normal normo - ovulatory women who were selected for the study based solely on their bmi . All the participants, who were given detailed information about the study, gave their informed consent . Bmi was calculated in all participants using the following formula: weight (kg)/height (m). Thus, in the who and nih guidelines for asians, overweight is a bmi between 23 and 24.9 kg / m and obesity a bmi> 25 kg / m . Waist and hip circumferences were measured, and those with waist - to - hip ratio (whg)> 0.85 were regarded as android obese . Waist circumference was measured at the minimum circumference between the iliac crest and rib cage, and hip circumference was measured at the maximum circumference between waist and thighs . Nine anatomic regions were assessed on a 4-point scale where 0 meant no growth of terminal hair and 4 meant maximum hair growth . Scores below 8 were regarded as normal and scores between 8 and 36 were regarded as pathological . In addition to family history of metabolic disorders, a detailed history including menstrual cycle pattern, temporal or situated in the temples of the head profile, severity of unwanted hair growth, and drug intake was taken at the time of enrollment . Clinical examination included measurement of body weight (kg), height (cm), and waist and hip circumferences (cm) as well as fg scoring . Fg scoring was done by a single observer, and scores above 8 were taken as significant . A single observer performed trans - abdominal or transvaginal ultrasonography to reveal findings of polycystic ovarian morphology (presence of at least 10 follicles around the ovary that measure 28 mm in size, with increased ovarian volume and/or echogenic ovarian stroma). Blood samples were taken from the patients at early follicular phase (between the third and the fifth days of the spontaneous or gestagen - induced menstrual cycle). Venous blood was taken from the forearm between 08.0010.00 am after 8 h of fasting . Blood samples were immediately centrifuged, and sera were kept at 80c until laboratory testing . Serum neopterine, tnf-, and il 6 levels were determined using enzyme - linked immunosorbent assay method (sunred biotechnology company, shanghai, china) according to the manufacturer s protocols . Serum triglyceride (tag) and total cholesterol (total - c) levels were measured using an architect c 16000 autoanalyzer (abbott laboratories, abbott park, il, usa). Vitamin b12, follicle - stimulating hormone (fsh), luteinizing hormone (lh), and estradiol 2 (e2) levels were determined by electrochemiluminescence immunoassay using a cobas e 601 analyzer (roche diagnostics, mannheim, germany). Serum - free testosterone (f.test .) Levels were analyzed by means of radioimmunoassay (ria) using a ria testosterone commercial kit (immunotech, beckman coulter). Serum crp levels were measured using immunochemistry system nephelometric method (image 800, beckman coulter, usa). For n / l ratio measurements, complete blood counts of patients with pcos and control subjects were studied using an automated hematology analyzer (cell - dyn ruby - abbott diagnostics, usa). Statistical package for the social science (spss 10.0) was used for data analyses . T test and nonparametric mann - whitney u test were used for comparison of clinical and biochemical data between the groups . Whether intra - group variables demonstrated a normal distribution or not was determined by kolmogorov - smirnov test . Spearman s correlation analysis was used for investigation of correlation between the values . A p value in addition to family history of metabolic disorders, a detailed history including menstrual cycle pattern, temporal or situated in the temples of the head profile, severity of unwanted hair growth, and drug intake was taken at the time of enrollment . Clinical examination included measurement of body weight (kg), height (cm), and waist and hip circumferences (cm) as well as fg scoring . Fg scoring was done by a single observer, and scores above 8 were taken as significant . A single observer performed trans - abdominal or transvaginal ultrasonography to reveal findings of polycystic ovarian morphology (presence of at least 10 follicles around the ovary that measure 28 mm in size, with increased ovarian volume and/or echogenic ovarian stroma). Blood samples were taken from the patients at early follicular phase (between the third and the fifth days of the spontaneous or gestagen - induced menstrual cycle). Venous blood was taken from the forearm between 08.0010.00 am after 8 h of fasting . Blood samples were immediately centrifuged, and sera were kept at 80c until laboratory testing . Serum neopterine, tnf-, and il 6 levels were determined using enzyme - linked immunosorbent assay method (sunred biotechnology company, shanghai, china) according to the manufacturer s protocols . Serum triglyceride (tag) and total cholesterol (total - c) levels were measured using an architect c 16000 autoanalyzer (abbott laboratories, abbott park, il, usa). Vitamin b12, follicle - stimulating hormone (fsh), luteinizing hormone (lh), and estradiol 2 (e2) levels were determined by electrochemiluminescence immunoassay using a cobas e 601 analyzer (roche diagnostics, mannheim, germany). Serum - free testosterone (f.test .) Levels were analyzed by means of radioimmunoassay (ria) using a ria testosterone commercial kit (immunotech, beckman coulter). Serum crp levels were measured using immunochemistry system nephelometric method (image 800, beckman coulter, usa). For n / l ratio measurements, complete blood counts of patients with pcos and control subjects were studied using an automated hematology analyzer (cell - dyn ruby - abbott diagnostics, usa). Statistical package for the social science (spss 10.0) was used for data analyses . T test and nonparametric mann - whitney u test were used for comparison of clinical and biochemical data between the groups . Whether intra - group variables demonstrated a normal distribution or not was determined by kolmogorov - smirnov test . In this study, no statistically significant difference was found between patients with pcos and control subjects in age and bmi (p 0.395, p 0.760). Whr and fg scores were significantly higher in patients with pcos compared to control subjects (p 0.001 and p 0.000). Fasting blood glucose levels and tag were significantly higher in patients with pcos compared to control subjects (p 0.001, p 0.014). Lh / fsh ratio and f.test were significantly higher in patients with pcos compared to control subjects (p 0.002, p 0.014) (table 1). In this study, no statistically significant difference was found between patients with pcos and control subjects in neopterin, il-6, tnf- and crp levels . However, n / l ratio levels were significantly higher (p: 0.045) and vitamin b12 levels were significantly lower (p: 0.033) in patients with pcos compared to control subjects (table 1, figure 1). Whr and fg scores, which were used for rating of hirsutism, were significantly higher in both obese and non - obese patients with pcos compared to control subjects (p 0.000 and p 0.000; p 0.000 and p 0.024, respectively). The comparison between obese patients with pcos and obese control subjects showed that fasting blood glucose levels were significantly higher in obese patients with pcos (p: 0.001). Total - c and tag levels and lh / fsh ratio were significantly higher in the non - obese group with pcos compared to control subjects (p 0.001, p 0.007 and p 0.024, respectively). Crp levels were significantly higher in obese patients with pcos compared to control subjects (p 0.007). In the non - obese groups, il-6 levels were significantly higher in patients with pcos compared to control subjects (p 0.021) (table 2, figure 1). Whr were significantly higher in obese patients with pcos compared to non - obese patients with pcos (p 0.047). Triglyceride and crp levels were significantly higher in obese patients with pcos compared to non - obese patients with pcos (p 0.029 and 0.018, respectively) (table 3). N / l ratio levels were found to be significantly higher in non - obese patients with pcos compared to obese control subjects (p: 0.042). In addition, il-6 levels were significantly higher in non - obese patients with pcos compared to obese patients with pcos . Furthermore, crp levels were significantly higher in obese patients with pcos compared to non - obese patients with pcos (p: 0.018) (table 3). In addition, vitamin b12 was negatively correlated with lh / fsh ratio, and no correlation was found between vitamin b12 and the inflammatory markers (table 4). The correlation analysis was performed in the present study demonstrated that tag and total - c were positively correlated with crp . We found that neopterin, il-6, tnf-, and n / l ratio were positively correlated with the pcos parameters . Furthermore, we demonstrated that neopterin and il-6 were positively correlated with lh / fsh ratio, a pcos biomarker (r: 0.443 * p 0.014 and r 0.373 * p 0.042, respectively). Neopterin and tnf-, on the other hand, was positively correlated with e2 (r 0.612 * * p 0.000 and r 0.431 * p 0.001, respectively). In addition, vitamin b12 levels were found to be significantly lower in patients with pcos . The correlation analysis revealed a negative correlation between vitamin b12 and lh / fsh ratio (figure 2). The correlation analysis that was performed between crp, bmi, whr, tag, and total - c levels found a positive correlation between crp levels and bmi, whr, tag, and total - c levels (table 4, figure 2). Several studies reported an increased risk for cardiovascular diseases in patients with pcos; however, the reason for this increased cardiovascular risk has not been clarified yet . Chronic low - grade inflammation, such as is seen in individuals with an excess of visceral / ectopic fat, plays an important role in cardiovascular disorders, in addition to atherosclerosis, which is strongly influenced by the inflammatory components of visceral obesity . Compared with that of lean individuals, adipose tissue in obese persons shows higher expression of proinflammatory proteins, including tnf-, interleukin 6 (il-6), transforming growth factor 1, monocyte chemotactic protein 1, inducible nitric oxide synthase, procoagulant proteins such as tissue factor, and factor vii plasminogen activator inhibitor type 1 . The purpose of this study was to investigate inflammatory markers in pcos as well as the impact of obesity on the inflammatory markers . N / l ratio levels were significantly higher in patients with pcos compared to control subjects . N / l ratio levels were found to be significantly higher in non - obese patients with pcos compared to obese control subjects (p 0.042). Differences between the neopterin, crp, il-6, and tnf- levels were not statistically significant in patients with pcos compared to control subjects . This result might have been caused by the limited number of participants included in this study . We used ultrasound to assess central obesity; however, to evaluate central obesity magnetic resonance (mr), computed tomography (ct), and dual energy x - ray absorptiometry (dexa) may also used . Patients as well as control subjects were divided into 2 groups as those with bmi> 25 and those with bmi <25, and it was found that only 1 inflammatory marker crp the increased inflammation in patients with pcos has not been clearly explained yet, and it is still unknown whether it is caused by pcos itself or the accompanying obesity . A meta - analysis reported increased wbc and crp levels in patients with pcos, and the increase was found to be independent of obesity . However, the meta - analysis had the limitation of inadequate bmi matching concerning the studies included . Many researchers found increased crp levels in obese and non - obese patients with pcos compared to bmi - matched control subjects . In addition, crp levels were reported to be significantly higher in a pcos group with bmi> 25 however, there was no significant difference in crp levels between non - obese insulin - resistant pcos group and non - obese control subjects . The results of the present study were in agreement with those of the abovementioned studies, showing that crp might be affected by obesity . Studies showed that n / l ratio correlated with crp in several diseases with chronic inflammation such as hypertension and diabetes mellitus . In this study crp was positively correlated with bmi, whr, tag, and total - c . Studied leukocytes as an inflammatory marker, and found that neither patients with pcos nor control subjects had leukocytosis; however, leukocyte count was significantly higher in patients with pcos . These results were interpreted as a potential explanation for the increased cardiovascular risk in patients with pcos . In the present study, n / l ratio levels were found to be significantly higher in patients with pcos compared to control subjects . In addition, crp levels were significantly higher in obese patients with pcos (p 0.018). It can be inferred from these results that increased inflammation is responsible for the increased risk for cardiovascular diseases and niddm in patients with pcos . As to the comparison between non - obese patients with pcos and obese control subjects, crp levels were higher in patients with pcos but the difference was not statistically significant . We also found that crp was positively correlated with bmi and therefore was affected by obesity . However, it could increase independent of obesity in patients with pcos but the increase would be more significant in obese patients compared to non - obese patients . High serum neopterin levels in patients with atherosclerotic diseases revealed that immunological mechanisms might be responsible for development of atherosclerosis and related complications . It was reported that neopterin, a key molecule taking part in organization of immune response, was released from active macrophages of atheromatous plaque and could be helpful for cardiovascular risk stratification . In this study, neopterin levels were higher in patients with pcos, but the difference was not statistically significant, perhaps due to the limited number of cases in our study . This finding suggests that macrophage activation occurs in women with pcos, as has been reported in cardiovascular disease . Found that increased concentrations of scrp, neopterin, and wbc might be a contributory factor in increased risk for cardiovascular diseases in patients with pcos . In addition to the widely known risk factors for cvds (such as hypertension, dyslipidemia, insulin resistance, and obesity), pcos comes to the foreground as a new risk factor for cvds . It was shown for the first time by this study that patients with pcos had significantly higher serum neopterin levels compared to healthy women with regular menstrual cycles . In the present study, n / l ratio levels were significantly higher in patients with pcos compared to control subjects . Increased concentrations of n / l ratio might be a contributory factor in increased risk for cardiovascular diseases in patients with pcos . Subclinical inflammation is considered to be a cause of atherogenesis, and il-6 and tnf- are also regarded as classic cardiovascular risk factors . The most widely known and perhaps the most important systemic effect of il-6 is the effect on acute - phase proteins, particularly c - reactive protein (crp). Pcos is a proinflammatory disorder, and several studies on pcos demonstrated increased levels of circulatory inflammatory markers such as plasminogen activator inhibitor-1, il-18, tnf-, il-6, and hscrp . Gonzalez et al . Found that serum tnf- and il-6 levels were increased in patients with pcos and that the excess of adipose tissue was the most probable source . In this study, il-6 levels were significantly higher in non - obese patients with pcos compared to obese patients with pcos . It was demonstrated that il-6 is positively correlated with lh / fsh ratio, a pcos biomarker . Our study supports the studies in the literature showing that inflammation markers increase in pcos, independent of obesity . It was shown that inflammatory markers that indicate low - grade chronic inflammation such as crp and il-6 were important predictors of niddm development . Crp levels were found to be elevated in patients with pcos, and this finding was considered to be supportive of the hypothesis that elevated crp levels triggered chronic inflammation, leading to an increased risk for niddm and cvds in pcos . Kurt et al . Found significantly increased levels of crp, leukocytes, and neutrophils, which are inflammatory markers, and the increase was reported to be independent of obesity . Although closely related to hyperglycemia, tnf- is produced independently of obesity . In the present study, when obese patients with pcos were compared to the non - obese patients with pcos, we found that il-6 levels were significantly higher in non - obese patients (p 0.021). In addition, il-6 and neopterin were positively correlated with lh / fsh ratio, a pcos biomarker, and tnf- was negatively correlated with whr . Therefore, we conclude that il-6 and tnf- are positively correlated with pcos biomarkers, independent of obesity . In the present study, whr was found to be significantly higher in patients with pcos (both obese and non - obese) compared to control subjects, which led to the consideration that central body fat deposition occurred in a pathophysiological mechanism that was independent of obesity in patients with pcos . Hosseinzadeh and rocha - gonzalez found that cyanocobalamin may have anti - inflammatory effect (38, 39). Found significantly lower serum vitamin b12 levels in obese patients with pcos compared to obese control subjects . In the present study, as well, serum vitamin b12 levels were significantly lower in patients with pcos (p 0.033). However, unlike the abovementioned study, no significant difference was found between obese and non - obese patients with pcos . Therefore, b12 can say that independently of obesity decreased in pcos . In the present study inflammatory activity is increased in patients with pcos, can lead to an increased risk for atherosclerosis, and this increase is not caused by obesity but rather by the polycystic ovary syndrome itself.
|
Polycythemia vera (pv) is a myeloproliferative neoplasm (mpn) which is characterized by the proliferation of red blood cells independent of a normal control mechanism . The majority of patients have a mutation of the janus kinase 2 (jak2) gene . Diagnosis can be obtained by the examination of a complete blood count (cbc) that reveals polycythemia and other laboratory support as follows: demonstration of jak2 mutation, panmyelosis or proliferation of all myeloid lineages (including erythroids, granulocytes, and megakaryocytes) from bone marrow (bm) biopsy, subnormal serum erythropoietin, and endogenous erythroid colony formation in vitro . Both arterial and venous thromboses are major complications of pv that occur in newly diagnosed patients at 16% and 7.4%, respectively . The proposed mechanisms of thrombosis include abnormalities of red blood cells, white blood cells, platelets, endothelial cells, coagulation factors as well as patient risk factors . Thalassemia is a group of inherited red blood cell disorders that results from a defect in the globin chain synthesis leading to chronic hemolytic anemia . It has a wide range of severity, from asymptomatic to transfusion - dependent anemia . Gene defects in alpha globin were found in 30 - 40% of people in northern thailand and laos, whereas beta globin gene defects were present in 1 - 9% and hemoglobin e (hb e) was more prevalent in the thai - laos - cambodia border area, with the hb e carrier prevalence around 50 - 60% . The thalassemia syndromes that have clinical significance include hb bart s hydrops fetalis, homozygous beta - thalassemia, hb e / beta - thalassemia, and hb h disease . Hb h - constant spring (hb h - cs) disease is the most common nondeletional type of hb h disease in southeast asia that appeared to have more clinical severity than deletional hb h disease . The incidence of thrombosis in thalassemia major and thalassemia intermedia were 0.9 - 4% and 3.9 - 29%, respectively . Abnormalities in red blood cells, platelets, endothelial cells, coagulation factors as well as individual risk factors also contribute to the pathogenesis of thrombosis in thalassemia . There are only a few case reports of pv in beta - thalassemia traits, but no reports regarding thalassemia intermedia or major . We report a young man who had concurrent post - splenectomize hb h - cs disease and jak2 v617f mutation - positive pv and developed acute non - atherosclerotic st - elevation myocardial infarction (stemi) early in the course of the disease . This study was approved by the institutional review board of faculty of medicine, chiang mai university, thailand . A 17-year - old man was referred from a regional hospital to our institute for evaluation of his elevated platelet counts . He had an underlying disease of hb h disease that required a splenectomy due to transfusion dependency when he was 5 years - old . The physical examination revealed no anemia, no jaundice, an enlarged liver to two centimeters below the right costal margin, and a splenectomy scar on his abdominal wall . The cbc showed a hb of 11.5 g / dl, hematocrit (hct) of 36.5%, corrected white blood cells (wbc) of 29,200/l (neutrophils 66%, lymphocytes 16%, monocytes 8%, eosinophils 9%, basophils 1%), nucleated red cells (nrcs) 9/100 wbc, platelets 2,206,000/l . Two months prior to his referral the patient s medical record from the regional hospital showed a platelet count of 976,000/l . His blood smear revealed marked thrombocytosis with variations in size and staining of the platelets, in addition to hypochromic microcytic red blood cells, nrcs and leukocytosis as shown in figure 1a . However, mpn such as essential thrombocythemia (et) and pv could not be excluded because of the extreme thrombocytosis and abnormal platelet morphology . The patient underwent a bone marrow aspiration and a biopsy that revealed hypercellularity with an increase in megakaryocytes, erythroid cells and myeloid precursors with normal maturation, the myeloid to erythroid ratio was 1:2, compatible with panmyelosis as shown in figure 1b . Jak2 v617f mutation analysis by amplification refractory mutation system - polymerase chain reaction (arms - pcr) was positive . The hb analysis by high performance liquid chromatography (hplc) demonstrated aa2hbartscs: hba2 1.7%, hb bart s and hb h 12.3% that confirmed the diagnosis of hb h - cs disease . Alpha - globin gene analysis showed the termination codon mutation leading to hb constant spring but did not find common alpha - globin gene deletions in thailand including southeast asian deletion (- -), thai deletion (- -), 3.7-kb deletion (-a), and 4.2-kb (-a) deletion . Because red cell inclusion bodies were found after staining red cells with methylene blue, it still supported the diagnosis of hb h - cs disease . Although, the baseline hb from the regional hospital was not available, it was likely to be around 8.11.18 g / dl according to data of non - deletional hbh disease in thailand . Since his hb levels were more than the 99 percentile of this reference range to the level of 12 - 12.9 g / dl during the follow up, this supported the diagnosis of pv with hb h - cs disease . He did not receive cytoreductive treatment due to his young age and no history of thrombosis . Three months later, the patient was admitted to the hospital due to chest pain . His electrocardiogram (ecg) showed an st elevation in leads ii, iii, avf and st depression in leads v1-v6 as shown in figure 2 . Cardiac enzymes were elevated as follows: total ck of 2298 u / l (normal range 0 - 195), ck - mb of 209 ng / ml (normal range 0.63 - 5.1), and troponin t of 2.34 ng / ml (normal <0.01). Acute stemi was diagnosed . Coronary artery angiography revealed an acute clot in mid right coronary artery (rca) and irregular surface of proximal rca suspected white clot . His cbc still showed marked thrombocytosis with platelet of 2,278,000/l, hb of 9.5 g / dl, and wbc of 29,200/l (neutrophils 66%, lymphocytes 16%). The patient was a non - smoker and laboratory testing for other cardiovascular risk factors were negative as follows: fasting blood sugar (fbs) of 74 mg / dl, total cholesterol of 121 mg / dl, low density lipoprotein (ldl) cholesterol of 54 mg / dl, high density lipoprotein (hdl) cholesterol of 24 mg / dl, triglyceride of 141 mg / dl, blood urea nitrogen (bun) of 13 mg / dl, creatinine of 0.7 mg / dl, and uric acid of 6.5 mg / dl . Plateletpheresis was administered to rapidly reduce platelets, together with hydroxyurea 3000 mg / day for cytoreduction . Medical treatment for acute mi including aspirin and ticlopidine were also given without thrombolytic therapy or percutaneous coronary intervention . After two weeks of treatment, his platelet count and wbc count decreased to 949,000/l and 12,700/l, respectively without any chest pain . However, his follow - up ecg showed q wave and inverted t in lead ii, iii, avf that was compatible with inferior wall infarction . The patient was discharged from the hospital and had a follow - up appointment at a hematology clinic without any recurrent thromboembolic events . His hb levels were maintained at 8.1 - 12.9 g / dl, wbc count at 4,720 - 16,100/l, and his platelet count was around 367,000 - 784,000/l by 2000 - 2500 mg / day of hydroxyurea . Antiplatelet treatment was reduced from dual agents to low dose aspirin alone after the platelet count was controlled . We report a case of acute stemi in a young patient with hb h - cs disease and pv . The diagnosis of pv in this case was based on the bone marrow findings of panmyelosis, an increased red cell volume, and a presence of jak2 v617f mutation . From the world health organization (who) 2008 diagnostic criteria, the level of hb should be greater than 18.5 g / dl in males or more than 17 g / dl if associated with a documented and sustained increase of at least 2 g / dl from the baseline value . These criteria as well as the newly proposed criteria that reduce cut - off levels of hb to 16.5 g / dl may be not applicable for the diagnosis of pv in thalassemia since patients may have very low baseline hb levels . However, the evidence of increase red cell volume in this patient was made by applying the criteria of a hb more than the 99 percentile of reference range of thalassemia patients in thailand . Et was a possible differential diagnosis because his platelets were greater than 450,000/l, the presence of jak2 mutation, and basically did not meet the who criteria for other myeloid neoplasms . However, his bone marrow findings supported the diagnosis of pv more than et . Extreme thrombocytosis or platelet counts more than 1,000,000/l can be found not only in mpn, but also in many reactive causes . Post - splenectomized hb e / beta - thalassemia accounted for 15% of the cases of extreme thrombocytosis in thailand . It is important to note that abnormal platelet morphology and staining is very helpful when considering mpn in addition to reactive thrombocytosis . Jak2 mutation analysis is also helpful when investigating mpn since it is mainly positive in mpn, but absent in thalassemia major patients with thrombocytosis due to splenectomy . This case report illustrates the serious thrombotic complications of pv found in a splenectomized thalassemic patient . The mechanisms of thrombosis in both pv and thalassemia are complex . In this case, findings from a coronary artery angiogram suggest that marked thrombocytosis from pv in addition to post - splenectomy seems to be the most important factor that contributes to thrombus formation . Evidence of platelet activation and abnormal platelet aggregation were also found in thalassemia, especially in a post - splenectomy state . Although no polycythemia was observed in this patient due to underlying thalassemia, red blood cells in both thalassemia and pv can aggravate thrombosis due to enhanced exposure of negatively charged phosphatidylserine as well as increased cohesiveness and aggregability . As a result, non - transfusion dependent thalassemia, like in this patient, had a higher incidence of thrombotic events compared to patients who received regular transfusions . The other factors that enhance thrombus formation include leukocytosis, vascular defect, and coagulation factor abnormalities . It was hypothesized that proteolytic enzymes released from neutrophils both damage and activate endothelial cells and platelets . Consequently, endothelial cell activation, increased endothelial - derived microparticles, and a decreased level of nitric oxide in both pv and thalassemia can promote thrombosis . Finally, many abnormalities of procoagulation factors and inhibitors that promote a prothrombotic state were also reported in both pv and thalassemia . The age of onset of pv in this patient was slightly under the minimum age, in the range between 18 - 95 years, in the large international pv cohort . However, the younger age of onset is not a negative prognostic factor for survival . For acute management of extreme thrombocytosis with acute mi in this patient, we used plateletpheresis to rapidly reduce platelets before attaining the effects of the platelet - lowering agent . Although therapeutic plateletpheresis was only a weak recommendation according to current apheresis guidelines, this strategy was effective in ameliorating symptoms due to thrombocytosis in pv and et in the previous case series and possibly had benefits in terms of prevention of early recurrent mi in this case report . For long - term management of pv, phlebotomy was omitted due to the fact that the hematocrit in this case was already less than 45%, which is the current target that was confirmed in the randomized trial . However, this scenario suggests that it may have a role in the primary prevention of thrombosis in low cardiovascular risk pv patients with extreme thrombocytosis . Hydroxyurea is an effective drug but it should be used with caution in young patients, even its leukemogenic potential was not clearly demonstrated . Finally, an antiplatelet agent was given for the treatment of coronary artery disease and also for the prevention of other cardiovascular events in pv . This case report represents the importance of early diagnosis and treatment of pv in patients who have underlying inherited anemia such as thalassemia . Pv can occur in young patients and also in patients who have reactive thrombocytosis that may result in a delayed diagnosis . Careful evaluation of the baseline cbc and a peripheral blood smear are simple and effective steps before proceeding with further investigations.
|
Ohtahara syndrome is a devastating infantile epileptic encephalopathy, which has an onset within the first few weeks of life, is associated with predominantly tonic seizures, and shows suppression - burst background on eeg . It is one of the epileptic encephalopathies that are characterized by frequent and medically intractable seizures, along with a significant burden of interictal epileptiform activity, which may contribute to a progressive and often catastrophic neurodevelopmental outcome . These disorders are classified based on their electroclinical characteristic (i.e., age at onset, seizure type and eeg pattern). Seizures of patients with epileptic encephalopathies are often resistant to antiepileptic drug therapies, but may respond to a ketogenic diet . The ketogenic diet is a high fat, low carbohydrate, and restricted protein diet that has been shown to be particularly useful in some epileptic encephalopathies such as west syndrome, infantile spasms, dravet syndrome,, and lennox gastaut syndrome . However, its efficacy in ohtahara syndrome has rarely been reported, and to the best of our knowledge, there is only one isolated case report . We report a case with ohtahara syndrome that showed remarkable and sustained response for close to one year post - initiation of ketogenic diet . Our patient is a five - year - old child, full term product of a normal spontaneous vaginal delivery . Seizure onset was at 2 weeks of age and was initially attributed to reflux . He then began to have overt seizures, characterized by generalized tonic stiffening, which occurred multiple times per day . Generalized tonic in nature, occurring approximately 2030 times daily, sometimes up to 50 . An initial eeg showed suppression - burst background and several tonic seizures characterized by an electrodecremental response . A full metabolic work - up, genetic studies (arx and cdkl5), and magnetic resonance imaging of the brain were all normal, and he was presumptively diagnosed with ohtahara syndrome based on the electroclinical characteristics . Seven subsequent eegs were performed over a period of four years, and all showed predominantly suppression - burst background with several tonic seizures . His further development was severely impaired and complicated by numerous medical issues such as severe sleep apnea with frequent oxygen desaturations and recurrent aspiration pneumonia requiring tracheostomy . Goals of care were addressed at each visit, and all medical decisions were made by his mother . At baseline, he focused but did not follow, was able to cry and smile to communicate, did not roll or hold objects or sit, and was in a diaper and completely gastric (g) tube fed . He required frequent hospitalizations due to recurrent infections and worsening seizures, which were refractory to every known antiepileptic drug regimen including a course of steroids and trial with pyridoxine . A recent eeg in early 2014 showed a suppression - burst background, which was more prominent in sleep and characterized by the absence of sleep structures (fig . 1, fig . 2). A small portion (approximately 10%) of his waking background comprised of spike and slow wave discharges . In addition, in the epilepsy monitoring unit, we captured 19 seizures in a 12-hour study, all characterized by generalized tonic stiffening and an electrodecremental response on eeg . Given his lack of response to medication trials, ketogenic diet was initiated in february 2014 with a goal ratio of 4:1 (ratio of grams of fat to grams of protein plus carbohydrate). He tolerated the diet well, ketosis was achieved on day four, and he was discharged home . His mother reported a remarkable improvement in seizure frequency on subsequent follow - up via office visits or phone calls . One month post - diet initiation, he was having 03 seizures per day, which was a significant improvement from 2030 seizures per day . He has not had a single visit to the emergency room (er) in the last one year, which is a significant improvement from multiple seizure - related visits to the er the previous year . This improvement was confirmed via a repeat admission to our epilepsy - monitoring unit in february 2015 . His eeg background during this admission was unchanged when compared to his prior study a year ago, but we captured only 2 brief tonic seizures, lasting for approximately 10 s each, in a 24-hour period of monitoring . Ohtahara syndrome is one form of early infantile epileptic encephalopathy with medically intractable seizures and progressive neurodevelopmental deterioration . First described by ohtahara et al . In 1976, it is an electroclinical syndrome characterized by tonic spasms and a suppression - burst pattern on eeg . Electroencephalography of most patients with ohtahara syndrome transitions into hypsarrhythmia at approximately 3 to 6 months of age, and later into diffuse slow spike waves . Most survivors of ohtahara syndrome show an eeg with focal or multifocal spikes, and suppression - burst pattern rarely persists beyond an age of one year . To our knowledge, there is an isolated case report describing the persistence of suppression - burst pattern in a five - year - old girl with ohtahara syndrome and one reported case of an infant with ohtahara syndrome who responded to ketogenic diet, but the degree and duration of response is not known . We describe a patient with ohtahara syndrome who has survived to the age of five years, and who continues to show suppression - burst pattern on eeg, with sustained improvement in seizure frequency for one year post - initiation of ketogenic diet . Increased prominence of suppression - burst pattern with sleep and a small portion of his waking background comprising of spike and slow wave discharges might suggest transition into west syndrome or lennox gastaut syndrome . However, we did not find any sleep structures or hypsarrhythmia during the waking state, a large portion of his eeg continues to show a suppression - burst pattern in awake or asleep states, and he almost exclusively has tonic seizures, which is commonly reported in patients with ohtahara syndrome . Patients with this syndrome invariably have intractable seizures and are developmentally devastated . After initiating ketogenic diet in our patient, not only did his seizure frequency improve significantly, but there was also a clear improvement noted in his level of interaction and temperament . This could arguably have been a spontaneous remission in the course of his disease, and the only way to answer that question would be to stop the diet (to which he has responded so well) and observe any worsening of his seizure frequency . This step was considered unethical, so we did not attempt it . Given the low incidence rate of ohtahara syndrome, the strength of evidence might never be sufficient enough to recommend any treatment modality . In addition, determining what constitutes reasonable quality of life can be an endless ethical debate in this subset of patients, but any intervention that can control seizures and make them more interactive is probably worth trying . As analyzed all patient data and was a major contributor in writing the manuscript . In was involved with checking the accuracy of the ketogenic diet regimen . Cc helped gather patient data over the years and was responsible for obtaining consent from patient's family . Rhm is the primary caretaker, and has reviewed and revised the article ensuring accuracy of intellectual content . The authors received no financial support for the research, authorship, and/or publication of this article . The authors declared no potential conflicts of interest with respect to the research, authorship, and/or publication of this article.
|
The online version of this article (doi:10.1007/s00227 - 011 - 1643 - 5) contains supplementary material, which is available to authorized users . White sharks, carcharodon carcharias, observed off the coast of california belong to a genetically distinct population unique to the eastern pacific (jorgensen et al . 2010). Subadult and adults travel long distances offshore from california and northern mexico during yearly migrations (boustany et al . 2002; weng et al . 2007; domeier and nasby - lucas 2008; jorgensen et al . These offshore movements traverse international waters where individuals are susceptible to fishing mortality, yet few data are available from potential offshore fisheries, confounding efforts to determine white shark population status . Therefore, fishery - independent methods must be employed to begin to estimate their population size . Mark - recapture methods have been used to estimate white shark population sizes in south africa (cliff et al . 1996), australia (strong et al . 1996) and the northeast pacific (chapple et al . 2011). These studies are dependent on the assumption that white sharks return to the same location over multiple sampling periods . Recent work has illustrated the short - term [e.g., <8 years or 25% of estimated lifespan (cailliet et al . 1985)] seasonal site fidelity of sharks to coastal aggregation sites . White sharks tagged off coastal california and guadalupe island, mexico returned to their tagging location following offshore movements (domeier and nasby - lucas 2008; jorgensen et al . Similarly, a combination of a satellite tag and dorsal fin identification described the movement of a shark in south africa to australia and back in 9 months (bonfil et al . 2005). However, no studies have tested the long - term [e.g.,> 14 years or 50% estimated lifespan (cailliet et al . These mark - recapture frameworks also assume external identification tags or unique markings are conserved and identifiable throughout the study . Shedding and therefore, current research on white sharks has focused on the use of distinctive natural markings as individual identifiers (klimley and anderson 1996; strong et al . 1996; bonfil et al . 2005; domeier and nasby - lucas 2007; gubili et al . One method proposed for individual identification in white sharks at guadalupe island utilizes pigmentation patterns (domeier and nasby - lucas 2007). Though resighting requires only one photograph of the gill flaps, pelvic fin or caudal fin on either side, initial identification requires photographs of all three of these locations on both sides of the animal . In addition, the conditions necessary to support this type of identification, superb water visibility and high recreational diving effort, are unique to only guadalupe island . Collecting these data is likely to be too labor intensive and impractical in areas outside of guadalupe island with low water visibility (e.g., south africa) and/or limited diving effort (e.g., california). Additionally, pigmentation patterns in several sharks were shown to naturally change in shape and/or size from year to year (domeier and nasby - lucas 2007). Alternately, dorsal fins can be photographed from either side and are often observed out of the water, precluding issues with water clarity or the need for divers . Dorsal fin identification, requiring limited effort, is possible at all white shark aggregation sites globally . A comparison of matched individuals using genetic markers and dorsal fin photographs showed a high degree of concordance (85%) between the two techniques over short (5 year) time periods (gubili et al . White sharks have been shown to exhibit short - term site fidelity and repeatable individual identification through dorsal fin photographs (klimley and anderson 1996; strong et al . 2009) and body pigmentation (klimley and anderson 1996; domeier and nasby - lucas 2007); however, in order to understand the long - term status of white sharks, mark - recapture studies must be expanded out to longer time series . Therefore, it is imperative to determine whether assumptions regarding site fidelity and identification are valid across these longer time periods (e.g.,> 14 years). Here, we aimed to determine (1) the stability of posterior edge dorsal fin morphology as individual identifiers over long time periods and (2) use this information to illustrate the long - term site fidelity of individual mature and subadult white sharks at coastal aggregation sites . This study began at the south farallon islands in 1987 (see anderson et al ., the study was expanded to include coastal areas near tomales bay, california and beginning in 2005, a small amount of marine mammal blubber was used as bait to increase encounter rates and duration . High - resolution photographs and video were taken of each shark when they came near the surface to investigate a seal - shaped decoy . We extracted dorsal fin images from these photographs and, if above water photographs were not available and water clarity permitted, from underwater video . Estimates of total length (tl) were also made when possible as sharks swam alongside a research skiff of known length . Images were assessed for quality based on four criteria: angle, size, focus, and contrast . Images of insufficient quality were removed (see online resources 1 for discussion of photograph processing methods). Experts (individuals with demonstrated expertise matching dorsal fin photographs) then matched the remaining accepted fin photographs within and across all years simultaneously . If individuals were identified multiple times over the study period, we compared the earliest and latest photographs to determine long - term stability of dorsal fin morphology . When possible, secondary characteristics (e.g., tags, permanent scars, mutilations, etc .) Were used to validate these matches . . Experts matched 20 randomly chosen photographs from 12 sharks, which had obvious secondary characteristics (not evident in the fin photographs). Matching results from each expert were compared to the true matches based on these known secondary characteristics . Confirmed males were sighted nearly twice as often as confirmed females (1.8:1), though this ratio may be biased because it is easier to confirm the presence of claspers than the absence . If the sex could not be confirmed, the animal was labeled unknown . Four experts accurately identified individuals and matches 98% of the time with no false positives and only one false negative . Similarly, gubili et al . (2009) used genetic data to show nearly 85% accuracy in experts matching dorsal fin photographs . Annually, limited effort and photograph quality resulted in the identification of few sharks before 2006 when effort increased and digital slrs were used . Prior to 2006, over 60% of sharks were resighted (29 of 48). In 2006 and 2007, significantly more new sharks were recorded (76), but by 2008, 35% (27) of these new sharks had been resighted at least once . Twenty - one individuals were repeatedly identified over periods 5 year, ten individuals 10 years, and five individuals 15 years (fig . 1). To illustrate the stability of markers and the empirical evidence of longevity, we describe five individuals resighted over periods 15 years at south farallon islands (fig . 1cumulative number of individuals identified repeatedly over time periods ranging from one to twenty - two yearsfig . 2individuals a tj, b ct, c ft, d bh, and e rf repeatedly identified by dorsal fin morphology over periods> 15 years . The year indicates the date the photograph was takentable 1yearly identification of five white sharks resighted between 1987 and 20081987198819891990199119921993199419951996199719981999200020012002200320042005200620072008bhxxxxx xxxxct x x xxx x xxxxxxxx ftx xxxxxxrfxxx xtjxx xxxxxxx depicts when an animal was sighted . All individuals were identified in 1993 when effort was increased cumulative number of individuals identified repeatedly over time periods ranging from one to twenty - two years individuals a tj, b ct, c ft, d bh, and e rf repeatedly identified by dorsal fin morphology over periods> 15 years . The year indicates the date the photograph was taken yearly identification of five white sharks resighted between 1987 and 2008 x depicts when an animal was sighted . All individuals were identified in 1993 when effort was increased the longest record was shark tj, a 4.5-m - tl male . Tj was sighted 8 times over 22 years, initially in 1987 and most recently in 2008 (fig 2a). Shark ct, a 3.5-m - tl male was sighted on 14 occasions over 20 years (fig . Ft, a 4-m - tl male, was sighted 7 times in 19 years (fig . Bh and rf, a 4-m - tl male sighted 9 times (fig . All tl estimates given refer to the size at the most recent sighting of each shark . Our findings support the use of the trailing edge of the dorsal fin for long - term photo - identification studies at coastal aggregation sites . We photographically identified five white sharks repeatedly over a period of 1622 years . Through the use of secondary characteristics and comparisons of first and last photographs of these five sharks, we found no evidence of changes in the size, shape, or arrangement of existing notches on these fins . We did, however, identify two sharks that incurred changes to their dorsal fins within the study period . These two sharks, a 4.9-m - tl female photographed each year from 2004 to 2008 (fig . 3a) and a 4.3-m - tl male sighted november 07, 2008, and again 11 days later on november 18 (fig . 3b), were shown to incur damage to their dorsal fins over the periods sighted . Though the trailing edge of the dorsal fin was damaged, creating a new notch, identifiable markings above and below this notch remained unchanged and sufficient for identification, illustrating how even relatively major fin trauma may results in the addition of a notch while leaving ample morphologic information for a positive identification . It is possible that the entire fin edge could be removed or altered due to major trauma preventing matching to previous sightings, but we saw no indication of this type of trauma during the 22 years of this study, which suggests this would be an extremely rare occurrence.fig . 3identification of fins after observations of fin damage . A a female shark photographed in 2004 with a complete fin, in 2005 with large lacerations on the fin, and in 2008 with scars from the damage, but all other distinguishing markings intact . B a second shark showing new damage over a two - month period in 2008 identification of fins after observations of fin damage . A a female shark photographed in 2004 with a complete fin, in 2005 with large lacerations on the fin, and in 2008 with scars from the damage, but all other distinguishing markings intact . B a second shark showing new damage over a two - month period in 2008 dorsal fin identification also supports the long - term (15 years) site fidelity of white sharks at coastal aggregation sites and provides the longest empirical documentation of white shark longevity to date,> 22 years . Individual identification illustrated that animals returned to these sites consistently throughout the study period and potentially during their entire adult life span . Each animal was not necessarily seen every year, but unequal effort across both spatial and temporal scales most likely contributed greatly to such gaps in identification . Additionally, the prevalence of short - term resights (<5 years) is also largely attributed to increased effort during the last 3 years of the study (fig . 1). This methodology, obtaining one photograph of the dorsal fin, requires far less effort than methods to document body pigmentation patterns and does not suffer from large rates of tag shedding or biofouling as traditional tagging methods do . Many of the white sharks in this study have been tagged with (on occasion multiple) pop - off archival tags, ultrasonic transmitters and/or floy tags, which have the potential to shed within a short time span (<1 year) (jorgensen et al . 2010), precluding their use in long - term mark - recapture studies . In addition, further effort to automate the matching process will make the process more feasible with large datasets, allowing for the universal comparison of animals across different geographic regions regardless of diving effort or water clarity conditions . Dorsal fin identification offers the foundation for mark - recapture studies to quantify the population size and trends of white sharks . If possible, we suggest all available data be recorded (e.g., fin photographs and body pigments) therefore, we propose that dorsal fins, because of their ease in recording, illustrated longevity and potential for universal application, be prioritized as a method to document individual white sharks . This methodology cannot only be used to monitor the status of the white shark population in the northeast pacific, but unlike other photo - identification methods, it can be more uniformly applied to archive white sharks worldwide, standardizing documentation of individuals across vast spatial and temporal scales . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
|
For many patients with multivessel disease, pci is a definitive alternative to coronary artery by - pass graft (cabg) [1, 2]. Complete revascularization remains a desirable goal, and a satisfactory outcome may be obtained with complete revascularization with ptca or cabg [4, 5]. However, complete revascularization may not be possible in many patients, either because of the operator inability to treat all diseased coronary arteries such as chronic total occlusions and adverse stenosis morphology or simply being not easy to plan in the presence of coronary narrowing less than severe (> 50% but <70%). Alternatively, the operator might decide to selectively revascularize only large areas of myocardium at risk . Indeed, clinical reasons for this decision include, among others, unstable angina, recent myocardial infarction, severe left ventricular dysfunction, urgent / emergent pci, preexisting renal failure for which the amount of angiographic contrast media should be limited, and premature termination of the procedure for unexpected problems, such as in those elderly or frail patients who cannot lay flat for prolonged periods . Thus, revascularization of the culprit lesion may be part of an incomplete revascularization strategy which may be of value other than a common clinical practice in many selected cases, when wisely chosen because of its easier achievement and lower immediate risk . In the bari trial comparing cabg with multivessel pci, the 10-year survival did not differ between the two treatments despite the fact that 91% of significant lesions were bypassed in the cabg patients compared to 54% of significant lesions in the pci patients . In the same trial, cardiac death, myocardial infarction and angina at 10-year follow - up were similar in patients in whom a pci was performed as a planned incomplete revascularization, as compared to those with a planned complete revascularization . Furthermore, even in patients for whom complete revascularization with angioplasty was planned, only 50% of lesions were both attempted and dilated . Similar results were obtained by vandormael et al . Who found an important symptomatic relief achieved with partial revascularization in patients with multivessel disease . In these patients, 1-year cardiac event rate was not significantly higher than the rate in the group with complete revascularization . At followup, 66% of patients with complete revascularization were asymptomatic and 84% had clinical improvement; this was similar to 58% and 85%, respectively, for patients with incomplete revascularization . Thus, incomplete revascularization seems to be a valuable solution when a culprit lesion can be identified, particularly when this vessel is a favourable lesion which serves a large noninfarct territory, or in case of an acute coronary syndrome where there is the need to stabilize patient's condition [11, 12]. Moreover, in the arterial revascularization therapies studies (arts), randomization of stenting in patients with incomplete revascularization including diabetics did not influence late mortality . However, in multivessel disease, complete revascularization is often an achievable goal not often pursued both by pci and cabg, despite the fact that the latter is generally more complete . Indeed, even when complete revascularization is planned such as in the chronic total occlusion subgroup of the syntax trial, complete revascularization is obtained in only 49.4% of pci treated patients while in only 68.1% of cabg treated patients . More recently, in the five - year outcome of the arts ii study, there was no significant difference in survival rates between patients with complete and incomplete revascularization treated by pci or cabg . Conversely, this study showed a significantly lower free - from - mace survival in patients with higher syntax tertiles compared to the lower and intermediate ones . Exercise testing is a widely used method particularly valuable in assessing cardiovascular status after the occurrence of a cardiac event or therapeutic interventions such as pci . When it is performed after discharge it is helpful for activity counseling and/or exercise training as part of the cardiac rehabilitation program . However, data obtained from two meta - analyses demonstrate that exercise testing, even if information from the electrocardiogram and symptomatic data is synthesized, is poor diagnostic for myocardial ischemia with a sensitivity of 46% and a specificity of 77% [6, 7]. The use of stress nuclear imaging increases significantly the sensitivity to 87% and the specificity to 78%, while that of stress echocardiography imaging increases the sensitivity to 63% and the specificity to 87% . The lower sensitivity of the exercise ecg compared to imaging techniques in clinical practice is worsened further by inadequate stress yielding low exercise heart rates, the use of drugs that are known to influence test results, and the extent of disease in vessels other than those dilated . Furthermore, the exercise electrocardiogram does not permit the determination of location of the ischemia, nor does it accurately assess the extent of ischemia; these factors are often crucial in the clinical decision making after - pci . Although exercise testing has the advantage of widespread availability and relatively low cost, the higher test accuracy obtained by stress imaging provides greater advantages for clinical assessment of these patients . An additional advantage is that pharmacological imaging stress testing may be performed in patients who are unable to exercise or who have an uninterpretable electrocardiogram . Several studies [6, 7, 1623] employing spect myocardial perfusion imaging (mpi) at different times from pci have shown high level of sensitivity and specificity of nuclear imaging when compared to those of coronary angiography (figures 1 and 2). The overall performance of spect - mpi for the detection of myocardial ischemia was 79% for both sensitivity and specificity . The decreased specificity observed when mpi is performed prematurely after pci was initially noted following ptca [2426] and after coronary stenting [27, 28]. Indeed, mpi may be altered as a consequence of impaired flow reserve due to an epicardial coronary stenosis or, in the absence of coronary obstruction, as a consequence of an endothelial dysfunction and medial injury at the treated site or abnormal microvascular and resistive vessel function distal to the pci site as shown by various authors [29, 30] and by us in two editorials [31, 32]. Similar to mpi, echocardiography in conjunction with exercise provides useful functional assessment of coronary lesions and has a high concordance with myocardial scintigraphy . Mertes and colleagues found that exercise echocardiography may predict the development of recurrent ischemia after ptca, with a sensitivity of 83% and specificity of 85% . The functional significance of a lesion may also be determined with the use of pharmacological stress . For the detection of coronary restenosis, exercise, dipyridamole, and dobutamine echocardiography have shown a diagnostic accuracy similar to that seen with mpi although a lower sensitivity (75% to 87%) and a slight higher specificity (84% to 95%) were found in the direct comparison with the nuclear data [36, 37]. A limitation of stress echocardiography is the inability to get acceptable quality images of left ventricle walls in about 15% of patients . Indeed, if this exam is performed at institutions and interpreted by physicians with adequate experience and training, it is considered of major importance for coronary artery disease detection and, along with gadolinium, for viability detection to predict left ventricular function recovery . Both mpi and stress echocardiography have a clear superiority with regard to specificity and predictive value for postrevascularization events [4044]. Indeed, for mpi, these findings have been shown regardless of the method selected and include the use of 201tl or 99mtc radiopharmaceuticals or after the use of different modes of stress imaging [4548]. In the angioplasty compared to medicine study, 328 patients were randomized to ptca or to medical therapy . At six months after randomization, 82% of patients underwent stress mpi and were followed for more than five years . Mortality in the ptca group was 20% for those with a reversible defect versus 7% for those without such a defect (p = 0.03). By multivariate analysis, the strongest predictors of mortality were diabetes, smoking, and a reversible perfusion defect at mpi . Similarly, the relative prognostic information derived from mpi at 1 year after revascularization for patients with multivessel coronary artery disease included in the prospective east trial reveals a strong correlation between detected ischemia on thallium scintigraphy and subsequent events [45, 47]. More recently, in patients with incomplete revascularization procedures, we demonstrated that exercise spect mpi provides significant independent information concerning the subsequent risk of both hard and soft cardiac events, with a composite annualized event rate <2% for patients with a normal scan (figure 3). Mpi is able to provide incremental prognostic information after adjusting for clinical, angiographic, and exercise variables and is able to predict the occurrence of cardiac hard and soft events when separating patients according to the presence of myocardial ischemia and necrosis (figures 4 and 5). The results of this study suggest that certain high - risk patients, such as those with multivessel coronary artery disease, treated by incomplete revascularization may benefit from routine mpi; this is especially true for low - risk patients as shown by ho and colleagues who studied 211 patients between 1 and 3 years after pci and monitored them for 7.3 years . Despite a low overall annual event rate of 1% per year, an abnormal mpi was significantly predictive of cardiac death or mi, whereas a normal mpi was associated with low risk . To date, the major evidence that supports revascularization in patients with an abnormal mpi is based on the following three studies . Examined a prospective database from a single center and classified patients on the basis of the severity of ischemia on stress mpi and examined the effect of revascularization versus medical therapy on subsequent mortality after an average followup of two years . There was no difference in mortality between medical therapy and revascularization in patients with ischemia <10% of myocardium, while patients with an ischemia> 10% had lower mortality with revascularization . These results were also confirmed in the nuclear substudy of the courage trial, in which patients with stable angina had paired mpi studies performed at baseline and 618 months after randomization of optimal medical therapy versus optimal medical therapy and pci . A reduction of ischemia> 5% on mpi was associated with a 13.4% rate of the death / myocardial infarction composite event rate, whereas in those with no reduction of ischemia the composite event rate was 27.4% (more than two - fold). Indeed, pci was more effective in achieving an ischemia reduction of> 5% compared to medical therapy (33% versus 19.8%, p = 0.004). These two studies suggest that the benefits of revascularization over medical therapy are related rather than to a more complete anatomical revascularization, to a significant reduction of ischemia, revascularization driven . Similarly, in a recent study by our group in patients with a residual cto in a main coronary artery left untreated after pci who underwent follow - up stress mpi, myocardial perfusion imaging provided significant independent information concerning the subsequent risk of cardiac events . Indeed, patients with severe ischemia had significantly higher rates of death and myocardial infarction than those with either mild ischemia or no ischemia . Furthermore, by characterizing the type of defect in terms of presence of scar, ischemia only, or scar and ischemia, we observed that patients with ischemia had the worst outcomes . This study emphasizes the prognostic significance of ischemia on stress mpi even in patients with chronically occluded coronary vessels, so refocusing the attention on the difference between anatomic and functional revascularization . This study, with all others from literature, underlines that it is not the anatomic severity of coronary disease which determines prognosis, rather the achievement of a functionally complete revascularization, in other words revascularization of all coronary arteries which serve only ischemic and viable myocardial segments [9, 13, 52, 53] (figure 6). This is why many studies evaluating the impact of completeness of revascularization strategy based only on anatomic criteria (coronary stenosis 50%) have failed to demonstrate improvements in survival rates . Although complete revascularization remains a desirable goal in multivessel disease patients, incomplete revascularization strategy may be a preferred treatment strategy and a common clinical practice in many selected cases, when wisely chosen, because of its easier achievement and lower immediate risk . Among these incompletely revascularized patients, mpi is able to identify those patients with ischemic and viable myocardial regions, in which a functionally complete revascularization is needed to improve their outcome (figure 7).
|
One - dimensional (1d) nanostructured magnesium salts with different morphologies, such as needle, rod, wire, tube, and belt, have attracted much attention because of their unique properties and potential applications in nanotechnical fields . Up to now much work has been focused on the control of the morphologies of 1d 513mos since it can be used as the reinforcing agent, the flame retardant, or as the precursor for the fabrication of 1d mgo or mg(oh)2[6 - 8]. It was reported that the 513mos whisker agglomerates with a length of up to 200 m and a diameter of 0.81.2 m were formed using mgso4 and mg(oh)2 or mgo as the reactants . The sector - like 513mos whiskers with a length of 2050 m and a diameter of 0.21.0 m were synthesized using mgso4 and naoh as the raw materials [11 - 13]. Dispersive 1d 513mos without agglomerates or the sector - like were formed by employing mgso4 or the mixture of mgso4 and mgcl2 as the magnesium source and the weak alkali nh4oh as the precipitation agent [14 - 16]. But little work has been reported on the control of the sizes (length and diameter) of the 1d 513mos and it is still a challenge to synthesize 1d 513mos with high aspect ratio and perfect uniformity . Generally the solution with a lower supersaturation was favorable for the anisotropic or 1d growth of the crystals, which can be achieved by using dilute reactants or chelating agents . For example, it was reported that the presence of edta can control the morphologies and sizes of the corresponding particles owing to the chelating effects of edta with ca, zn, ce, fe, co, and bi, which can change the forms of the aqueous ions, producing a solution with less free metal ions to control the crystals growth . The growth habits of the crystals can also be altered by the capping effect of edta on the surfaces of the crystals . In the present work the 513 mos nanowires with high aspect ratio were formed by precipitation of mgso4and nh4oh solutions at room temperature followed by treatment at hydrothermal conditions . The supersaturations of the solutions were controlled at relatively low levels, which were achieved by controlling the mixing ways of the reactants or addition of edta . The preferential orientation of 513mos nanowires was identified and the related process mechanisms were discussed . Commercial reagents (nh4oh, mgso4 7h2o, and edta) with analytical grade provided by beijing chemical regent factory were used in the experiments . Three ways were adapted for the formation of the precursor slurries at room temperature: (1) single injection: 35 ml of 1.01.5 mol lmgso4was dropped (3.0 ml min) into 20 ml of 5.09.0 mol lnh4oh; (2) double injection: 35 ml of 1.01.5 mol lmgso4and 20 ml 5.09.0 mol lnh4oh were dropped (3.0 ml min) simultaneously into 510 ml water; (3) single injection in the presence of edta: 35 ml of 1.01.5 mol lmgso4mixed with varying amount of edta was dropped (3.0 ml min) into 20 ml of 59 mol lammonia . The slurry formed at room temperature was then transferred to a teflon - lined stainless steel autoclave with an inner volume of 80 cm, heated (5 c min) to 150 c and kept under isothermal condition for 8.012.0 h. the autoclave was cooled down to room temperature naturally after hydrothermal treatment and the product was filtrated, washed, and dried at 105 c for 12.0 h. the morphology and the microstructure of the samples were examined with the field emission scanning electron microscopy (fesem, jsm 7401f, jeol, japan), the high - resolution transmission electron microscope (hrtem, jem-2010, jeol, japan) and the selected area electron diffraction (saed). The crystallization and the composition of the samples were identified by the powder x - ray diffraction (xrd, d / max2500, rigaku, japan) using cuk (= 0.154178 nm) radiation . The concentrations of mgand so4were analyzed by edta titration and barium chromate spectrophotometry (model 722, xiaoguang, china), respectively . Commercial reagents (nh4oh, mgso4 7h2o, and edta) with analytical grade provided by beijing chemical regent factory were used in the experiments . Three ways were adapted for the formation of the precursor slurries at room temperature: (1) single injection: 35 ml of 1.01.5 mol lmgso4was dropped (3.0 ml min) into 20 ml of 5.09.0 mol lnh4oh; (2) double injection: 35 ml of 1.01.5 mol lmgso4and 20 ml 5.09.0 mol lnh4oh were dropped (3.0 ml min) simultaneously into 510 ml water; (3) single injection in the presence of edta: 35 ml of 1.01.5 mol lmgso4mixed with varying amount of edta was dropped (3.0 ml min) into 20 ml of 59 mol lammonia . The slurry formed at room temperature was then transferred to a teflon - lined stainless steel autoclave with an inner volume of 80 cm, heated (5 c min) to 150 c and kept under isothermal condition for 8.012.0 h. the autoclave was cooled down to room temperature naturally after hydrothermal treatment and the product was filtrated, washed, and dried at 105 c for 12.0 h. the morphology and the microstructure of the samples were examined with the field emission scanning electron microscopy (fesem, jsm 7401f, jeol, japan), the high - resolution transmission electron microscope (hrtem, jem-2010, jeol, japan) and the selected area electron diffraction (saed). The crystallization and the composition of the samples were identified by the powder x - ray diffraction (xrd, d / max2500, rigaku, japan) using cuk (= 0.154178 nm) radiation . The concentrations of mgand so4were analyzed by edta titration and barium chromate spectrophotometry (model 722, xiaoguang, china), respectively . Figure 1shows the influence of the preparation ways of the precursors on the morphologies of the hydrothermal products . 1d product with a length of 2030 m and an ununiform diameter of 0.3 1.7 m were prepared via the single injection route (fig . Uniform nanowires with a length to 2060 m and a diameter of 60300 nm were fabricated in the case of the double injection route (fig . 1b), which may be connected with the decrease of the supersaturation of 513mos in the solution due to the dilution of the reactants and will be discussed in detail later . The morphologies of the products prepared via single injection (a) and double injection (b) the influence of edta on the morphologies of the hydrothermal products was shown in fig . 2 . 1d product with a length of 3050 m and a diameter of 0.21 m were formed at 1.0 10 mol ledta (fig . 2b, c) as the edta concentration increased up to 1.0 10 mol l. the clusters of the products were composed of the twisted nanowires with a length of 100200 m and an aspect ratio up to 1,000 . The diameter of the product was broadened to 0.150.6 m and the length was about 100 m in the case of 1.0 10 mol ledta (fig . Influence of edta concentrations on the morphologies of the products (a) 1.0 10 mol l; (b, c) (different magnifications) 1.0 10 mol l; (d) 1.0 10 mol l figure 3shows the xrd patterns of the hydrothermal products formed in presence of edta . All the diffraction peaks can be indexed as those of the orthorhombic 5mg(oh)2 mgso4 3h2o (pdf no . The gradual increase of the diffraction intensities with the increase of edta concentration indicated that the presence of edta was favorable for the crystallization of 1d 513 mos . It was also noticed that most of the xrd peaks were attributed to () planes, indicating that the 513mos nanowires may have a preferential growth along b axis owing to its inherent structure . 2 the hrtem image and the saed pattern of the 513mos nanowires prepared in the presence of 1.0 10 mol ledta were shown in fig . 4 . The interplanar distances of the lattice fringes parallel (fig . 4b, corresponding to the rectangular part of the nanowire in fig . 4c, corresponding to the trigonal part of the nanowire in fig .4a) to the growth direction of the whiskers were 5.1 and 2.25, quite similar to the spacing of (202) plane (d (202) = 5.12) and (114) plane (d (114) = 2.255), respectively, indicating the preferential orientation of the nanowires along the direction, which was reconfirmed by the saed analysis in fig . 4d and also identical with the xrd analysis shown in fig . 3 . Tem (a), hrtem images (b, c) and saed pattern (d) of 513mos nanowire figure 5 shows the influence of the preparation ways of the mg(oh)2 precursors on the variation of [mg and the supersaturation of 513mos with the hydrothermal time . The supersaturation of 513mos was presented by [mg[so4[oh according to the following formation reaction:(1) variations of [mg] (a) and super - saturation of 513os (b) with hydrothermal time . Preparation ways of mg(oh)2precursor: a single injection without edta, b double injection without edta, c single injection with 1.0 10 mol ledta the presence of edta led to the decrease of [mg] (fig . 5a) and the supersaturation of 513mos (fig . 5b), which may be connected with the chelating and/or the capping effects of edta . The slow release of mgfrom the complexes might be favorable for the 1d growth of 513mos . The varying binding abilities of edta on different planes may also inhibit the radial growth and promote the axial growth of the 513mos nanowires . The increase of [mg] and the supersaturation of 513mos within initial 8 h of reaction should be attributed mainly to the dissolution of the mg(oh)2precursor, and the decrease of [mg] and the supersaturation of 513mos after 610 the lower supersaturations of 513mos achieved in either the double injection route or in the presence of minor amount of edta were favorable for the formation of 513mos nanowires with high aspect ratio . 513mos nanowires with a length of 2060 m and a diameter of 60300 nm were synthesized via the double injection - hydrothermal reaction and the uniform 513mos nanowires with a length of 100200 m and a diameter of 80200 nm were formed via single injection edta - assisted hydrothermal reaction route . The lower supersaturations of 513mos achieved in either the double injection route or in the presence of minor amount of edta, were favorable for the preferential growth of 513mos along b axis, leading to the formation of 513mos nanowires with high aspect ratios . This work is supported by the national natural science foundation of china (no.50574051).
|
Voluntary euthanasia (ve) is the act of requesting deadly medical practices in order to terminate one s life (1). The process of decision making (like that for ve) is composed of two interwoven brain based components (2). One is the conscious power of analyzing the condition and utilizing algorithmic like strategies, which is known as cognition (2, 3). This part is important since it affects the person s ability of seeking in the condition (4), estimating the parameters of a situation (5) and finally deciding (2). Chronic pain patients (cpps) develop disappointing emotional backgrounds, which affect their mental power of decision - making (6). This article argues about the mental incompetence relating decision - making that accompanies chronic pain in such patients . This can be considered as equal to the historically known conditions of torturing a person and wanting him / her to accept or confess something in return for relieving pain (7). In case of ve, the agent is the internal mental burden of a disease and the thing wanted in return for reliving the pain is dying acceptance . Therefore, in this condition the stimulator of accepting death is the emotion of escaping from pain in return for anything . This is the exaggerated form of the normal emotion of fearing and escaping from painful situations (8). In fact, a cpp fears from experiencing excess pain . According to this outlook and having in the mind that emotions - in the way it is described in the literature (9) - are the most important determinants of the alternative to be chosen (10), here it is proposed that cpps are emotionally and hence mentally incompetent for making critical decisions . Studies using mri technology have shown brain deficits in cpps (1114). More specifically in the state of chronic pain it is stated that the orbitofrontal part of the brain cortex is preferentially involved . This part functions as a link between multiple brain regions with distinct roles in the emotional assessment . These regions include lateral prefrontal areas which handle memory, effector components of the brainstem which are responsible for producing emotional responses and those parts that are considered as the brain substrates of feelings like insula and amygdale (6). According to these findings a cpp does not have a biologically healthy brain for providing the accuracy of the act of choice - making especially when he / she wants to do so for emotion - laden alternatives like that of whether to escape or cope with the pain . This can be considered as equal to the historically known conditions of torturing a person and wanting him / her to accept or confess something in return for relieving pain (7). In case of ve, the agent is the internal mental burden of a disease and the thing wanted in return for reliving the pain is dying acceptance . Therefore, in this condition the stimulator of accepting death is the emotion of escaping from pain in return for anything . This is the exaggerated form of the normal emotion of fearing and escaping from painful situations (8). In fact, a cpp fears from experiencing excess pain . According to this outlook and having in the mind that emotions - in the way it is described in the literature (9) - are the most important determinants of the alternative to be chosen (10), here it is proposed that cpps are emotionally and hence mentally incompetent for making critical decisions . Studies using mri technology have shown brain deficits in cpps (1114). More specifically in the state of chronic pain it is stated that the orbitofrontal part of the brain cortex is preferentially involved . This part functions as a link between multiple brain regions with distinct roles in the emotional assessment . These regions include lateral prefrontal areas which handle memory, effector components of the brainstem which are responsible for producing emotional responses and those parts that are considered as the brain substrates of feelings like insula and amygdale (6). According to these findings a cpp does not have a biologically healthy brain for providing the accuracy of the act of choice - making especially when he / she wants to do so for emotion - laden alternatives like that of whether to escape or cope with the pain . The central concept of this article is that a person who is under the mental pressures is not capable of making critical decisions . The same concept is already accepted for the other categories of people who cannot think well such as drunken individuals (15). The fact that mentally under pressure patients cannot think well is also indirectly accepted by all societies that refuse to obey a mentally ill patient s will in the light of labeling the patient unqualified for making a will according to the judgment of court . With the same bases, this article s concept can be accepted by the court and become a law in such societies . Therefore, the patient s will of terminating his / her life must not be accepted like that of a drunken person . Deciding to undergo euthanasia is the most critical decision of a person (not only a patient) since this decision leads to the end of making other decisions . In this respect, deciding to die is different from deciding to buy a car because the latter is reversible or can be compensated in the future and does not violate the right of making other decisions, something that the former intrudes in . Therefore the ability of making the decision of undergoing euthanasia must be considered as something different from just a right . In this mental incompetence is the common quality in both conditions of chronic pain and will rejection in the court . Therefore the accepted rules for both of these two conditions must be the same . This means that any nation that rejects the will of a mentally incompetent individual must do the same about the request of a cpp for ve.
|
Benign acute childhood myositis (bacm) is a self - limiting process characterized by sudden onset of muscle pain, more often calf pain, manifested by walking difficulty . Since many clinicians are not familiar with bacm, it is often misdiagnosed and interpreted as a more severe and complex disease . We report the case of a patient suffering from bacm in absence of any previous documented viral infections . We underline how medical history and clinical examination are sufficient for a correct diagnosis of bacm, as well as to avoid unnecessary tests . Based on the previous reports, we updated etiology and clinical data of bacm, and we propose differential diagnosis of muscle pain in children . A 7-year - old boy with acute calf pain and progressive walking difficulty was referred to our pediatric center to rule out muscle degenerative diseases . Two days earlier the child had suffered from fever, cough, malaise and rhinorrhea, which promptly resolved . The onset of calf pain was early in the morning, and it was so sharp that he had to walk on his heels mimicking a spastic gait . The child had undergone all compulsory vaccinations, and his previous clinical history was not suggestive of any remarkable diseases . No travels, trauma, vigorous exercise or similar episodes of limb pain were reported before onset of symptoms . On admission, reflexes and sensitivity of the upper and lower limbs were also normal . At rest, the patient kept his feet in slight plantar flexion . Gastrocnemius - soleus muscles on both sides were soft on palpation, and there were no inflammatory changes . Passive dorsiflexion of the ankles caused sharp pain as well as passive stretching and gentle palpation of his calves . Despite normal neurological examination, the patient was hospitalized in order to allow medical observation and exclude severe diseases . On admission laboratory tests showed a significant increase in blood levels of creatinine phosphokinase (2161 u / l, normal range <227 u / l), alanine transaminase (69 u / l, normal range: 0 - 45) and aspartate transaminase (92 u / l, normal range: 17 - 59). Mg / l) and white blood cell count (7400/l) were within normal limits . Complete blood count, electrolytes, blood urea nitrogen, creatinine, prothrombin time, partial thromboplastin time and other routine blood parameters were also within normal limits . Furthermore, serological tests ruled out recent viral infections by adenovirus, respiratory syncytial virus, cytomegalovirus, herpes virus and epstein barr virus, as well as serological tests for mycoplasma pneumonia . Since the patient refused to eat and drink, he received intravenous hydration for 24 h. during the 2 day of hospitalization pain spontaneously resolved and a normal gait was regained . Considering that daily urine output was normal, the boy was discharged, and no long - term follow - up was required . Benign acute childhood myositis is a self - limiting process which frequently affects the gastrocnemius and soleus muscles . In a review of 2004 other agents such as enterovirus, mycoplasma pneumonia and dengue virus have been involved in the process . Furthermore, five cases of bacm following h1n1 influenza a virus infection and human parainfluenza virus type 1 infection have been reported . In most cases, the disease is self - limiting and when the myositis develops the patient is already in the early convalescent phase of the viral illness . Nevertheless, it is reported that 10/316 children (3%) developed severe rhabdomyolysis, and temporary dialysis was necessary in six cases . During winter 20072008, influenza b virus was responsible for a large number of cases of bacm in germany, especially among male children aged from 6 to 9 years . Median time between the onset of fever and the beginning of bacm symptoms was 3 days . Despite the clinical course of bacm being well described, mall et al . Furthermore, the exact current incidence, prevalence and pathogenesis of bacm are not known . This could simply be explained by the increased tropism of viruses for immature muscle cells . Furthermore, each virus could act as a trigger in genetically predisposed children and in few patients with undiagnosed metabolic diseases . Nevertheless, the onset may be mistaken for very severe neurological illness such as guillain barr syndrome or chronic autoimmune diseases . As a consequence unnecessary invasive tests, such as radiography, echocardiography, daily medical examination and urine dipstick (with measurement of myoglobin) are sufficient to promptly detect complications and rule out more severe illnesses and creatine kinase (ck) should be measured only at diagnosis in order to early exclude degenerative diseases . Viral tests for bacm - related viruses should not be routinely performed because of the time interval between infection and seroconversion . Moreover, not always etiological agents can be found, and antiviral drugs are not usually recommended . Nevertheless, influenza test may be useful since influenza viruses can affect the severity of bacm . However, parents should be encouraged to monitor the child's urine output and the appearance of coca - cola colored urine and swollen legs . Hospitalization should be scheduled only when the patient's parents do not seem able to monitor the condition of their child at home . We report signs and symptoms which can help clinicians to make a correct differential diagnosis when a child suffers from acute muscle pain in table 1 . . A family history of neuromuscular disorders, myoglobinuria, trauma, chronic progression, rash, edema, muscle weakness or neurological diseases are not typically associated to bacm; in these cases further investigation is required.
|
One of the measures of child health and the health status of the general populace is infant mortality or mortality, which is well studied in jamaica and the wider caribbean[111]. The simple rationale for the use of mortality in evaluating health status is owing to its ease in which it can be used to precisely measure its outcome unlike other indicators such as quality of life, subjective wellbeing, happiness or life satisfaction[1222]. Another reason for the use of infant mortality in the measurement of health is because of the strong inverse significant correlation between it and/or general mortality and life expectancy . There is no denial therefore that infant mortality and/or mortality in general play a critical role in determining health outcomes . Although life expectancy emerged from mortality, the former only speak to length of life and not the quality of those lived years . An individual can live for 40 years or even 100 years, of which all those years were lived in severe morbidity . It is owing to aforementioned rationale why the world health organization (who) developed a mathematical technique which discount the life expectancy by the years spent in disability or morbidity . Health therefore must be more than morbidity as it expands to quality of life . Within the broadest definition of health conceptualized by the who in the 1940s, is social, psychological and physical wellbeing and not the mere absence of diseases suggesting that health is more than living to the quality of those lived years . Health has been expanded to mean much more than the absence of diseases to include measures of healthy life expectancy, happiness, utility, personal preference, and self - reported quality of life[1222]. Crisp offered an explanation for this, when he said that when discussing the notion of what makes life good for the individual living that life, it is preferable to use the term wellbeing instead of happiness, which explains the rationale for this project utilizing the term wellbeing and not good health . The issue of wellbeing is embodied in three theories - (1) hedonism, (2) desire, and (3) objective list . Using evaluative hedonism, wellbeing constitutes the greatest balance of pleasure over pain . With this theorizing, wellbeing is just personal pleasantness, which represents that more pleasantries an individual receives, he / she will be better off . The very construct of this methodology is the primary reason for a criticism of its approach (i.e. Experience machine), which gave rise to other theories . Crisp using the work of thomas carlyle described the hedonistic structure of utilitarianism as the philosophy of swine, because this concept assumes that all pleasure is on par . He summarized this adequately by saying that whether they [are] the lowest animal pleasures of sex or the highest of aesthetic appreciation . The desire approach, on the other hand, is on a continuum of experienced desires . This is popularized by welfare economics . As economists see wellbeing as constituting satisfaction of preference or desires, which makes for the ranking of preferences and its assessment by way of money . People are made better off, if their current desires are fulfilled . Despite this theory's strengths this forwarded by the possible addictive nature of consuming hard drugs because of the summative pleasure it gives to the recipient . Objective list theory: this approach in measuring wellbeing list items not merely because of pleasurable experiences nor on desire - satisfaction but that every good thing should be included such as knowledge and - or friendship . It is a concept influenced by aristotle, and developed by thomas hurka as perfectionism . According to this approach, the constituent of wellbeing is an environment of perfecting human nature . What goes on an objective list is based on reflective judgment or intuition of a person . Since an assumption of this approach is that, certain things are good for people . Crisp provided an excellent rationale for this limitation, when he said that even if those people will not enjoy them, and do not even want them . In arthaud - day et al's work, applying structural modeling, subjective well was found to constitute (1) cognitive evaluations of one's life (i.e., life satisfaction or happiness); (2) positive affect; and (3) negative affect . If an individual feels his / her life is going well, then we need to accept this as the person's reality . One of the drawbacks to this measurement is, it is not summative, and it lacks generalizability . In keeping therefore with the broad definition of health forwarded by the who, any study of health must go beyond mortality . A comprehensive search of health literature in the caribbean in particular found no research that 1) using national cross - sectional survey(s) examined health status of children, 2) investigated the changing pattern of morbidity which affect children ages 0 - 14 years, 3) investigated whether health status (i.e. Subjective wellbeing) and self - reported morbidities (i.e. Health conditions) are correlated, and if they are good measure for each other, 4) investigated whether from among the health conditions, chronic diseases and the time they begin to affect children as well as the 5) demographic characteristics of health conditions affecting children . The current study will examine the aforementioned issues as health literature in the region on child health must expand beyond infant mortality . The objectives of the study are to 1) expand the health literature in jamaica and by extension the caribbean, 2) understand the status of child health outside of mortality, 3) aid public health practitioners with research upon which they are able to further improve the quality of life of children by adding quality to their lived years, 4) investigate the age at with children in jamaica become influenced by chronic disease, it typology and 5) evaluate the subjective wellbeing of children as is done for the general populace and elderly[3037]. The current study used two cross - sectional surveys which were conducted jointly by the planning institute of jamaica and the statistical institute of jamaica (for 2002 and 2007) that collect data on jamaicans . A subsample of 8,373 and 2,104 children 0 - 14 years was extracted from a sample of 25,018 and 6,783 respondents for 2002 and 2007 respectively . The survey was a national probability sample of jamaica, and it was weighted to reflect the populace and sub - populations . Descriptive statistics, such as mean, standard deviation (sd), frequency and percentage were used to analyze the socio - demographic characteristics of the sample . Chi - square was used to examine the association between non - metric variables, and analysis of variance (anova) was used to test the relationships between metric and non - dichotomous categorical variables whereas independent sample t - test was used to examine a statistical correlation between a metric variable and a dichotomous categorical variable . The level of significance used in this research was 5% (i.e. 95% confidence interval). The current study extracted a sample of 8,373 and 2,104 children 0 - 14 years from two surveys collected jointly by the planning institute of jamaica and the statistics institute of jamaica for 2002 and 2007 respectively . The method of selecting the sample from each survey was solely based on an individual being less than or equal to 14 years . The survey (jamaica survey of living condition) began in 1989 to collect data from jamaicans in order to assess policies of the government . Since 1989, yearly the jslc adds a new module in order to examine that phenomenon which is critical within the nation . In 2002, the foci were on 1) social safety net and 2) crime and victimization; and for 2007, there was no focus . The sample for the earlier survey was 25,018 respondents and for the latter, it was 6,783 respondents . This design was a two - stage stratified random sampling design where there was a primary sampling unit (psu) and a selection of dwellings from the primary units . The psu is an enumeration district (ed), which constitutes a minimum of 100 residence in rural areas and 150 in urban areas . This means that the country was grouped into strata of equal size based on dwellings (eds). Based on the psus, a listing of all the dwellings was made, and this became the sampling frame from which a master sample of dwelling was compiled, which in turn provided the sampling frame for the labor force . One third of the labor force survey (i.e. Lfs) was selected for the jslc . The jslc 2007 was conducted may and august of that year; while the jslc 2002 was administered between july and october of that year . The researchers chose this survey based on the fact that it is the latest survey on the national population and that that it has data on self - reported health status of jamaicans . A self - administered questionnaire was used to collect the data, which were stored and analyzed using spss for windows 16.0 (spss inc; chicago, il, usa). The questionnaire was modeled from the world bank's living standards measurement study (lsms) household survey . There are some modifications to the lsms, as jslc is more focused on policy impacts . The questionnaire covered areas such as socio - demographic variables such as education; daily expenses (for past 7-day; food and other consumption expenditure; inventory of durable goods; health variables; crime and victimization; social safety net and anthropometry . Social class: this variable was measured based on the income quintiles: the upper classes were those in the wealthy quintiles (quintiles 4 and 5); middle class was quintile 3 and poor those in lower quintiles (quintiles 1 and 2). Health care - seeking behavior . This is a dichotomous variable which came from the question has a doctor, nurse, pharmacist, midwife, healer or any other health practitioner been visited? With the option (yes or no). Health conditions (i.e. Self - reported illness or self - reported dysfunction): the question was asked: is this a diagnosed recurring illness? The answering options are: yes, cold; yes, diarrhea; yes, asthma; yes, diabetes; yes, hypertension; yes, arthritis; yes, other; and no . Self - rated health status: how is your health in general? The options were very good; good; fair; poor and very poor . Descriptive statistics, such as mean, standard deviation (sd), frequency and percentage were used to analyze the socio - demographic characteristics of the sample . Chi - square was used to examine the association between non - metric variables, and analysis of variance (anova) was used to test the relationships between metric and non - dichotomous categorical variables whereas independent sample t - test was used to examine a statistical correlation between a metric variable and a dichotomous categorical variable . The level of significance used in this research was 5% (i.e. 95% confidence interval). Social class: this variable was measured based on the income quintiles: the upper classes were those in the wealthy quintiles (quintiles 4 and 5); middle class was quintile 3 and poor those in lower quintiles (quintiles 1 and 2). Health care - seeking behavior . This is a dichotomous variable which came from the question has a doctor, nurse, pharmacist, midwife, healer or any other health practitioner been visited? With the option (yes or no). Age is a continuous variable in years . Health conditions (i.e. Self - reported illness or self - reported dysfunction): the question was asked: is this a diagnosed recurring illness? The answering options are: yes, cold; yes, diarrhea; yes, asthma; yes, diabetes; yes, hypertension; yes, arthritis; yes, other; and no . The options were very good; good; fair; poor and very poor . Descriptive statistics, such as mean, standard deviation (sd), frequency and percentage were used to analyze the socio - demographic characteristics of the sample . Chi - square was used to examine the association between non - metric variables, and analysis of variance (anova) was used to test the relationships between metric and non - dichotomous categorical variables whereas independent sample t - test was used to examine a statistical correlation between a metric variable and a dichotomous categorical variable . The level of significance used in this research was 5% (i.e. 95% confidence interval). For this study there were two samples (8,373 from 2002 data survey and 2,104 from the 2007 survey). In 2002, the sample was 50.7% males and 49.3% females compared to 51.3% males and 48.7% females for 2007 . The mean age for the sample in 2002 was 7.2 years (sd = 4.2 years) and 7.3 years (sd = 4.3 years) for 2007 . The proportion of the sample in particular social class (using population income quintile) was relative the same across the two years . The number of days recorded as suffering from illness fell by 2 days in 2007 over 2002 (median number of days experiencing ill - health). In 2002, 9.4% of the sample reported an illness / injury in the 4-week period of the survey and this increased by 34.0% (to 12.6%). The percent of the sample that visited health care practitioners marginally increase from 56.7%, in 2002, to 58.6% in 2007 . Concurrently, 9.3% of sample was covered by health insurance (i.e. Total private in 2002) and this increased by 62.4% and a part of this was accounted for by a 5.1% having public health insurance coverage . In 2002, 62.6% of the sample dwelled in rural areas, 25.1% in semi - urban areas and 12.3% in urban areas compared to a shift which was noticed in 2007 as 53.2% resided in rural areas and 20.2% in semi - urban areas with 26.6% lived in urban zones (table 1). Sociodemographic characteristic of sample the general health status of children in jamaica, for 2007, was good (91.3%) compared to 6.7% fair and 2.0% poor . Interestingly, in the current study, a shift in health condition was noticed in 2007 over 2002 . The number of children who had diarrhea fell by 84.2% in 2007 over 2002, and a similar reduction was observed for those with asthma (42.1% in 2002 and 19.7% in 2007). Another critical finding was that 1.2% of children, in 2007, had diabetes mellitus compared to none in 2002 . On the contrary, 37.5% of children, in 2007, had cold which increased from none in 2002 (table 1). A cross - tabulation between health conditions and sex of respondents, revealed that no significant statistical correlation existed between the two variables and that this was for both years: for 2002 - (df = 2) = 0.232, p> 0.05; and for 2007 - (df = 5) = 8.915, p> 0.5 (table 2). In spite of the aforementioned, diagnosed health conditions by sex, 2002 and 2007 in 2002, no significant statistical relationship existed between diagnosed health conditions and area of residents ((df = 4) = 1.301, p> 0.05). On the other hand, a statistical correlation was observed for 2007 between the aforementioned variables . Furthermore, more children in semi - urban areas had cold than those who dwelled in other areas . On the contrary, diabetic cases were found in urban areas and none in other geographical zones . The findings revealed also that more rural children had asthma and more urban children had unspecified health conditions (table 3). Diagnosed health conditions by area of residence table 4 revealed that no significant association was found between diagnosed health condition and social class (i.e. Population income quintile). However, the diabetic cases were spread among the lower class (poorest 20%, 1.9%; and poor, 1.8%) and the upper class (wealthy, 2.0%). Diagnosed health conditions by population income quintile the examination of diagnosed health conditions by mean age of respondents revealed that a significant relationship existed between the two aforementioned variables in 2007, f statistic = 4.875, p <0.001; but none in 2002 - f statistic = 3.334, p> 0.05 . In 2007, the mean age of a child with diabetes mellitus was 12.33 years (sd = 2.1 yrs), 95% ci = 7.16 - 17.5 (table 5). However the mean age of a child with diarrhea lower than a child and other health conditions . Mean age of respondent who has a particular health condition the first time in the history of the jamaica survey of living conditions (jslc) that health status and self - reported health condition were collected together was in 2007 . Hence, the current study will cross - tabulate both in order to determine whether a significant correlation exist between them and what is the strength of a relationship if one does exist . Based on table 6 a weak significant statistical association exist between health status and self - reported health condition - (df = 2) = 174.512, p <0.0001, cc= 0.282 . On further examination of the findings, it was observed that no child was classified as having very good health status . Ninety - four percent of sample who had no health condition reported good health compared to 70% of those who had at least one health condition . Of those who had at least one health condition, 9.4% of them reported poor health status compared to 1% who had no health condition (table 6). Health status by self - reported illness using independent sample t - test, in 2002, the current study found that there was a significant difference between the mean age of those who sought and not seek medical care t3.425, p <0.001 . The mean age of those who do not seek medical care higher, 6.2 years (sd = 4.1), compared to those who seek care, 5.2 years (sd = 4.2 years). However, there was no difference in 2007: seek care on examination as to whether a significant statistical correlation existed between health care - seeking behavior and sex of respondents, none was found in each year it is established in epidemiology that diseases in childhood do influence poor health in adulthood, suggesting the value of child health to health status over the life course . Another importance to the study of health status is its contribution to all typology of development as human capital is critical to socio - economic and political systems . In jamaica, the statistical institute of jamaica estimated that for 2007, there was 28.3% of the nation's population was less than 14 years . Simply put, there are 45 children for every 100 working age (ages 15 - 64 years) jamaican; and to omit the health status of this cohort is to substantially neglect a critical sector of the population . The current study found that 2 in every 100 children had poor health status; and that weak significant statistical correlation existed between health status and self - reported health conditions . This therefore concurs and contradicts another study that found statistical association between health conditions and health status ., examining data for elderly barbadians, found that self - reported health conditions accounted for most of the variability in health status (i.e. Current diseases accounted for 33.5% out of r = 38.3%). This takes the study in the direction of current diseases (i.e. Health conditions) of children in jamaica . This study revealed 34% increase in cases of self - reported diseases in jamaican children . Only 13 in 100 children in jamaica, in 2007, had a least one health condition . These conditions include cold, diarrhea, asthma, diabetes mellitus and other unspecified diseases . In 2007, 20 in every 100 children had asthma, 5 out of every 100 diarrhea cases, 38 in every 100 had cold and 21 in every 100 unspecified conditions . Of the different typology of chronic dysfunctions, 12 in every 1,000 reported diabetes mellitus and no cases were found of hypertension and arthritis . Given the breadth of the unspecified category, this could include cancers, hiv / aids and other communicable or non - communicable diseases . In spite of this uncertainty, what emerged from the current research is the change in pattern of health conditions of children between 2002 and 2007 . A study conducted by walker found that growth retardation in children influence blood pressure, obesity, and other chronic health conditions, and that some 5 - 6% of children in trinidad and tobago, and jamaica are classified in this group . Walker also found that these children are more likely to experience more episodes of diarrhea, fever and other morbidities . This research revealed that number of cases of asthma, diarrhea and unspecified conditions fell accompanied with a corresponding rise in cold and diabetes mellitus . Interestingly to note is that the 1.2% of child population that were diagnosed diabetic patients represents 2.3% of the female population . The diabetic cases were not only females, but urban residents . Of those with diabetes, 1.9% was in the poorest 20%, 1.8% poor and 2.0% of the wealthy social class . Continuing, the mean age of female diabetic children was 12.3 years; and this indicates the year age in which diabetes mellitus begin to affect females in jamaica . The aforementioned finding explains the disproportionate number of females to males in the general population that have diabetes -14% females to 7.7% males . Although no cases of hypertension was reported in this study, it is established that diabetes mellitus is correlated with hypertension . Diabetes mellitus is not the only challenge faced by patients, but mccarthy argues that between 30 to 60% of diabetics also suffer from depression, which is a psychiatric illness . Diabetes mellitus does influence the health status of children and follows them across the life course . It affects lifestyle choice, functional capacity, and like mccarthy said the psychological state of people . Morrison opined that diabetes mellitus and hypertension have now become two problems for jamaicans and in the wider caribbean . This situation was equally collaborated by callender who found that there was a positive association between diabetic and hypertensive patients - 50% of individuals with diabetes had a history of hypertension . Children with diabetes mellitus therefore are highly likely to develop hypertension in the future, and so children in jamaica in the future will have twin chronic conditions . This envelope further shifts in health conditions of children in jamaica; morrison alluded to a transitory shift from infectious communicable diseases to chronic non - communicable diseases as a rationale for the longevity of the anglophone caribbean populace and this does not mitigates against lowered healthy life expectancy of the sexes in particular females who live 6 years more than males . Diabetes mellitus and any other typology of chronic diseases do more than affect healthy life expectancy; they are directly correlated with mortality . Statistics from the statistical institute of jamaica is the leading cause of deaths in female jamaicans . The reality of changing pattern of health conditions from communicable to non - communicable and the fact that this is accounted with urban poor and wealthy, indicate that public health policies are needed to address this currently and in the future . Another important fact that embedded in the current study is the early age in which females are having chronic disease, and this indicates the length of time with which they will life with this non - curable disease or likeliness of mortality . A study on morbidity and mortality patterns in the caribbean established that the transition in morbidity is not atypical to jamaica, and that the leading cause of mortality in region is similar to developed nations . Who opined that 80% of chronic illnesses were in low and middle income countries, indicating the preponderance of chronic illness in regions such as the caribbean as well as the fact that chronic illnesses are also a part of the landscape of industrialized nations . With the changing pattern of morbidity of children in jamaica, this will support modifications in lifestyle behavior which must begin from children to the populace . Although there is no statistical difference between the 3 area of residents and health conditions, the fact that the chronic dysfunctions were found in urban areas denote that public health policies must begin in earnest in those places . There is another situation that must be explored here and that is response of health services, and the management of care for those who are affected by chronic illnesses . It should be noted that 57 out of every 100 children were taken for medical care which speaks to the high proportion of children despite being ill who were not taken to traditional medical facilities . A part of the rationale for this non - medical care seeking behavior of children is adults definition of health and the cultural perspective of health . Generally, health in jamaica is defined as the absence of illness which although is negative and narrow in scope speaks to people's perspective on the matter . Interestingly in this discourse is not only the narrowed definition of health, but that severity in health conditions is substantially what drives medical care - seeking and not on the onset of illness or preventative care . This goes to the crux of why only 57 out of every 100 children who are ill would be taken to health care practitioners as their families are less likely to taken then for conditions such as the cold, but also provide an explanation for the low medical care seeking behavior for the general populace . Statistics revealed that for the last two decades (1988 - 2007), there were 4 times (years) in which males sought more medical care than females 1991 (48.5% males to 47.4% females); 1995(59.0% males to 58.9% females): 1997 (60.0% males to 59.3% females) and 2006 (71.7% males to 68.8% females), which speaks to some embedded culturalization for this health care - seeking disparity in nation . While this is not atypical to jamaica[4951], the fact that the current study revealed that there was no significant statistical difference between male and female children being taken for medical care, this explains the disparity that exists in the general populace begin in young adulthood . This is the period in which identify formation begins in adolescents and when young males begin to imitate the practices of adult men . The adolescent male therefore will seek less medical care because his adult counter believes that this is weak, feminine and reduces his machoism . One anthropologist in seeking to explain the practices of caribbean men used social learning theory to examine the lifestyle practices of boys . Chevannes argued that the young imitate the roles of society members through role modeling of what constitute acceptable and good roles which is supported by reinforcement . The young male is a subset of the society, and if men are less likely to seek health care because of a cultural perspective that they form of ill - health which goes to the crux of their manhood and possibly seeks to threaten it, young males as soon as they are somewhat responsible for their choices will do more of the same as their mentors . This gender role of sexes and health disparity which results after childhood is not limited to jamaica or the caribbean but a study carried out by ali and de muynck found that street children in pakistan had a similar gender stereotype about health, health care and medical care seeking - behavior . Using a descriptive cross - sectional study carried out during september and october 2000 of 40 school - aged street children (8 - 14 years), they found boys were reluctant to seek medical care except when there is severity of ill - health, it threatens their economic livelihood or there is a perceived reduction in functional capacity . The reason being that mild ailment is not severe enough to barr them from physical functioning and within the context of the general population that men ought to be tough, this means that they are okay; and so some morbidity are not for - hospital, which was so the case in nairobi slums . This again justifies why some children in jamaica are not taken to health practitioners as there is a perception that some illness requires home remedy . Statistics revealed that 56.0% of children (ages 0 - 4) who were not taken for medical treatment despite having an illness was because home remedies were used, figure was 32.8% for those 5 - 9 years and 25.6% for those 10 - 19 years . Inaffordability accounted for 33%, 32.5% and 35.9% of those ages 0 - 4 years, 5 - 9 years and 10 - 19 years respectively who were not brought to health care practitioner even though they were ill . The general health status of children in jamaica is good; but this mitigate against the relatively low age with which females are reported to have had diabetes mellitus and the changing pattern of health conditions which have occurred since the 2002 . Public health now has an epidemiological profile of health conditions of children and the demographic shifts which are occurring and this can be used for effective management and planning of the new health reality of the jamaican child . With the removal of health care user fees for children ages 0 - 18 years from the health care landscape of jamaica (since may 28, 2007), the transition to chronic cases in this cohort means that health care expenditure in the future will rise as we seek to care for those patients over there life course . It is critical that future research examine the composition of unspecified health conditions as this constitutes a significant percentage of diseases in 2007 unlike 2002.
|
Succinic acid is a member of the four - carbon dicarboxylic acid family in tricarboxylic acid cycle (tca) and has a wide range of applications in the fields of surfactants, green solvents, and pharmaceutical intermediates as an important four - carbon intermediate compound . Succinic acid is classified as the most promising chemical among 12 biobased chemicals by the u.s . Succinic acid has been conventionally produced from fossil raw materials for more than a century, which can lead to high cost, feedstock exhaustion, and environment pollution [3, 4]. Recent studies suggest that the production of succinic acid by microbe fermentation has the potential to solve the aforementioned problems . As the endproduct of energy metabolism, succinic acid can be produced by many anaerobic microbes, such as actinobacillus succinogenes, anaerobiospirillum succiniciproducens, mannheimia succiniciproducens, and escherichia coli especially a. succinogenes atcc 55618, which is a facultative anaerobe isolated from the bovine rumen . It could produce higher concentration succinic acid as a major endproduct than other strains without gene reconstruction and glucose feeding . However, to obtain a high production of succinic acid (i.e., more than 45 g l), the fermentation medium compositions were often complicated with the addition of high concentration of glucose and ten kinds of slight vitamins [810]. According to the aforementioned reports, about twenty kinds of components were added into the fermentation medium for the succinic acid production, which led to high cost and complex operation . It must be paid attention that the complicated medium is not the assurance of high production of succinic acid [1113]. So the optimization of fermentation medium of a. succinogenes atcc 55618 is essential . Since nine components existed in the fermentation medium (i.e., glucose, yeast extract (ye), corn steep liquor (csl), kh2po4, k2hpo4, nacl, mgcl2, cacl2, and mgco3), a great number of experiments should be simultaneously run, and the possible interactions between these components were also needed to be studied . For fermentation medium optimization, plackett - burman design (pbd) was a good choice in rapid screening multifactors to find the most significant independent factors . Moreover, to optimize the concentration of the important factors, statistical methods have been done by using response surface methodology (rsm), in which several factors were simultaneously varied . Compared with the one - factor - at - a - time method, statistical experimental design has the advantages of reducing experiment numbers and improving statistical interaction analysis [1618]. For the reasons above, we proposed the optimization method including the following steps: (1) using a two - level pbd to identify the key medium components and their experimental levels for further optimization, (2) applying the path of steepest ascent (sa) to move rapidly towards the neighborhood of the optimum response, and (3) employing a box - behnken design (bbd) to develop mathematical models to estimate the relationships between the response (i.e., the succinic acid production) and the key components . The strain of a. succinogenes atcc 55618, purchased from american type culture collection (atcc), was maintained in 20% glycerol at 70c . The plate was inoculated with the strain maintained at 70c and incubated at 37c for 2 days . Preculture medium consisted of the following components (g l): tryptone 17; soya peptone 3; glucose 2.5; nacl 5; k2hpo4 2.5 . For the first preculture, 50 ml of medium was prepared in a 250-ml anaerobic bottle, and a colony from a plate culture was inoculated, and then incubated for 12 hours at 37c on a rotary shaker at 120 rpm . For the second preculture, 47.5 ml of medium was prepared in a 250-ml anaerobic bottle, inoculated with 2.5 ml of the first preculture broth, and incubated for 12 hours at 37c on a rotary shaker at 120 rpm . G l): glucose 107; yeast extract (ye) 16; corn steep liquor (csl) 12; kh2po4 3; k2hpo4 1.5; nacl 1; mgcl2 0.3; cacl2 0.3; mgco3 40 . The fermentation medium was inoculated with 2.5 ml of the second preculture broth in 47.5 ml of medium in a 250-ml anaerobic bottle with co2 as the gas phase . . The dynamic profile of the succinic acid biosynthesis of a. succinogenes was monitored during the submerged fermentation process . Each data point was expressed by an average with an error bar (i.e., standard error from three independent samples). The purpose of plackett - burman design (pbd) was to identify the key medium components for the succinic acid production . Two dummy variables, whose levels did not change in the design, were introduced to estimate the population standard error . The first order was used to fit data from pbd as follows: (1)y=0+ixi, where y is the predicted response, 0 and i are constant coefficients, and xi is the coded independent factors . First, the effect of all variables, including dummies, was calculated as follows: (2)evi=rvi(+)rvi()n/2, where evi is the effect of variable i; rvi(+) and rvi() represent the response parameter (i.e., the succinic acid production) of an assembly in the screening design which contains the high and low levels of variable i, respectively; n is the number of assemblies (in this study, n = 12). After determining the effect of each variable, the standard deviation (sd) of dummies, which serves as the population standard deviation in the student's t - test as follows was calculated: (3)sd=(ed)2n, where ed is the effect of dummy variables; n is the number of dummy variables (in this study, n = 2). Finally, a student's t - test was performed to identify the significant t factors as follows: (4)tvi = evisd . The larger the absolute value of the t - value, the variable is more significant . The method of steepest ascent (sa) design was used to move rapidly towards the neighborhood of the optimum response . The experiments were adopted to determine a suitable direction by increasing or decreasing the concentrations of variables according to the results of pbd . A 15-run box - behnken design (bbd) with three center points was employed in this work, and the maximal values of the productions of succinic acid were shown in table 3 . To describe the relationships between the succinic acid production and the medium components, a mathematical model was developed by the following second - order polynomial equation to fit data in rsm of bbd: (5)y=0+ixi+iixi2+i=1nijxixj+ ij; i, j=1,2,3, where y is the predicted response, 0 is the offset term, i is the linear effect, ii is the quadratic effect, ij is the interaction effect, and is an experimental error . And xi and xj represent the independent variables (medium components) in the form of coded values as follows: (6)xi = xixxi i=1,2,3, where xi and xi are the dimensionless and the actual values of independent variable i, x is the actual value of the independent variable i at the central point, and xi is the step change of xi corresponding to a unit variation of the dimensionless value . The model of response was expression in terms of code variables and without the statistically insignificant terms (different models are available in bbd of statistical software package minitab 15, minitab inc ., state college, pa 16801 - 3008, usa). Standardized pareto charts, representing the estimated effects of parameters and parameter interactions on responses, permitted us to check the statistical significance of the pbd . The student's t - test permitted to check the statistical significance of the regression coefficients . The analysis of variable (anova) was performed on experimental data to evaluate the statistical significance of the model . The models of each response were expressed in terms of code / uncoded variables and without the statistically insignificant terms . A p value less than 5% indicates that model terms are significant, while less than 1% indicates that model terms are highly significant . A p value is a measure of how much evidence one has against the null hypothesis (the null hypothesis of the test read like this: h0: 1 = 2 = = i = 0; h1: at least one is not zero) and evidence against null hypothesis is more for smaller p value . A p value of 0.05 or less rejects the null hypothesis at the 5% level, that is, only 5% of the probability the supposed statistical model will fail to predict the response . The model adequacies were checked by the determination coefficients (r), adjusted r, and predicted r. the determination coefficient (r) is a measure of how well the regression equation fits the sample data . While r can be made larger simply by adding more predictor variables to the model, an adjusted r has been proposed . Adjusted r is a modification of r that adjusts for the number of explanatory terms in a model . A predicted r is used to measure the amount of variation in new data (i.e., other levels among the tested maximal value and minimal value of the factor) explained by the model . It is calculated by systematically removing each observation from the data set, estimating the regression equation, and determining how well the model predicts the removed observation . Predicted r is used in regression analysis to indicate how well the model predicts responses for new observations, whereas r indicates how well the model fits the data . Predicted r can prevent overfitting the model and can be more useful than adjusted r for comparing models because it is calculated using observations not included in model estimation . Predicted r larger values of predicted r squared suggest models of greater predictive ability the minitab 15 (minitab inc ., state college, pa 16801 - 3008, usa) software was employed for the regression analysis and the graphical optimization, respectively . For sampling, three flasks were taken each time, and cell growth was monitored by measuring the optical density at 660 nm (od660). At an od660 of 1.0, a. succinogenes atcc 55618 has a concentration of 0.626 g dry cell weight (dcw) l. for succinic acid determination, 1 ml of methanol and 1 ml of acetonitrile were added to 1 ml of fermentation broth to remove proteins, and the sample was kept at 4c overnight . After centrifugation at 11,000 rpm for 30 min, the supernatants were diluted and filtrated through a 0.22-m filter and analyzed by high - performance liquid chromatography (hplc, waters) using an agela venusil asb c18 column . The optimized mobile phase was 50 mm kh2po4 water solution, with the ph adjusted to 3.5 by h3po4 . The column oven temperature was maintained at 40c, and the flow rate was 1 ml min . The methodology of plackett - burman design (pbd) is a powerful and useful tool in rapidly searching key factors from a multivariable system . Pbd does not determine the exact quantity, but it can provide some important information about each factor by relatively few experiments . As shown in table 1, pbd for 12 trials with two levels of concentrations was undertaken to evaluate the significances of nine medium components . In order to determine the influence of the most important parameters, analysis of the measured response variables enabled to obtain standardized pareto charts and response surface plots . A standardized pareto chart consists of bars with a length proportional to the absolute value of the estimated effects, divided by the standard error . The bars are displayed in order of the size of the effects, with the largest effects on top . The chart includes a vertical line at the critical t - value for an alpha . Some investigations find that the confidence levels greater than 80% (p <0.2) are acceptable . In this study, the chart includes a vertical line at the critical t - value for of 0.20 . Effects for which the bars are smaller than the critical t - value are considered as not significant and not affecting the response variables . Effects may be positive or negative . As shown in figure 1, for the succinic acid production, the variables glucose, yeast extract, and mgco3 had a confidence level above 80% . Hence, these were considered to be significant for the succinic acid biosynthesis . Analyzed by minitab, a first - order model, was fitted to the results obtained from the twelve experiments as the equation: (7)y(g l1)=39.09 + 4.18cglucose2.28cye1.84ccsl0.83ck2hpo41.93ckh2po41.24cnacl+1.53cmgcl2 + 1.36ccacl2 + 3.26cmgco3 . Where y is the succinic acid production, and cglucose, cye, ccsl, ck2hpo4, ckh2po4, cnacl, cmgcl2, ccacl2, and cmgco3 are the value of glucose, ye, csl, k2hpo4, kh2po4, nacl, mgcl2, cacl2, and mgco3, respectively . The goodness of the regression was checked by the coefficient of determination r whose value (r = 95.39%) indicates that only 4.61% of the total variation could not be explained by the model, and it was reasonable to use the regression model to analyze the trend in the response . And then, glucose, yeast extract, and mgco3 were selected for further optimization to obtain a maximum response . According to the coefficients of the glucose (4.18), yeast extract (2.28) and mgco3 (3.26), the positive coefficients indicated that the high level of glucose and mgco3 concentration in pbd was benefit for the succinic acid production . On the contrary, the negative coefficient indicated that the low level of yeast extract concentration was helpful for the succinic acid accumulation . A maximum succinic acid production of 51.9 g l was obtained with 80.0 g l of glucose, 60.0 g l of mgco3, and 10.0 g l of yeast extract . The corresponding productivity and specific productivity were 1.1 g l h and 13.4 g succinic acid g dcw . However, the od660 of 6.2 obtained with this medium was not the highest among the 12 conditions . According to the metabolic pathway of a. succinogenes, succinic acid was an end - product from the substrate of glucose, which implied that succinic acid formation was decided by the supplement of glucose directly . The yield of succinic acid against glucose was improved by the increase of initial glucose concentration, and it would reach the peak value when the initial glucose concentration was 70.0 the culture ph value is one of the key factors in the production of succinic acid . Mgco3 was used as a neutralizing agent and added to the fermentation broth to adjust culture ph . Before optimization, the ph value decreased from 7.5 to 5.7 during the fermentation . Compared with the ph value of basic medium, the initial ph increased up to 8.0 and was followed by slow decline after the optimization . The final ph value of optimal medium with an initial ph of 7.5 was more close to neutral (about 6.5) during the fermentation, and neutral environment was helpful to accumulate succinic acid . In our previous results, the highest succinic acid production of 48.2 the pattern of succinic acid production at a culture ph of 7.0 was similar with that obtained at 7.5 . When the initial culture ph was adjusted to 6.5 or 8.0, a significant decrease of succinic acid production was observed . So, the effect of medium optimization mgco3 may be partly from the influence of the ph . On the other hand, sufficient co2 supplement in the fermentation broth could strongly influence the metabolic flux of carbon and the activities of phosphoenolpyruvate (pep) carboxykinase, which were the important committed steps for the biosynthesis of succinic acid [24, 26]; therefore, sufficient co2 is another key factor influencing succinic acid accumulation . However, in our previous work, there was no significant effect of co2 partial pressure on the production of succinic acid when gaseous co2 was used as the sole co2 donor . As an important co2 donor in the a. succinogenes fermentation, mgco3 could react with organic acids in fermentation broth and caused an increase in the dissolved concentrations of hco3, co3, and co2 . When gaseous co2 was used with mgco3, higher amount of mgco3 was more effective on promoting the succinic acid synthesis . And the maximum succinic acid production of 61.92 g l was obtained at 159.22 mm dissolved co2 concentration, which was supplied by 40 g l mgco3 with 100% co2 gas . This means that the dissolved co2 concentration was another factor affecting succinic acid synthesis . And during the fermentation process, insoluble mgco3 caused turbid broth, which made the cells spread uniformly in the broth . All these properties make mgco3 to be one of the key factors significantly improved the succinic acid production . At last, yeast extract was also screened to be a key factor because it affected cell growth directly as the nutrient . It contains many trace substances, such as folic acid, pantothenic acid, biotin, and vitamin b1, b2, b6, and b12 . This may be the important reason why many kinds of vitamins could be omitted meanwhile the succinic acid could efficiently be accumulated in this work . To conclude, the variables of glucose, mgco3, and yeast extract had a confidence level above 80% and hence were considered to significantly influence the succinic acid production . The optimal concentrations of these three key components needed to be further studied as follows . Based on the results above, glucose, yeast extract, and mgco3 were the three key factors, and the high level of glucose (i.e., 80.0 g l) and mgco3 (i.e., 60.0 g l), while the low level of yeast extract (i.e., 10.0 g l) was benefit for the succinic acid production of a. succinogenes atcc 55618 . Thus, the path of sa was moved along the path in which glucose and mgco3 increased, while yeast extract decreased (table 2). The highest succinic acid production of 48.4 1.3 g l and od660 of 6.1 was observed under the point of levels, namely, 80.0 g l of glucose, 10.0 g l of yeast extract, and 60.0 g l of mgco3 . The corresponding productivity and specific productivity were 1.0 g l h and 12.4 g succinic acid g dcw . This result suggested that the point was near the optimal point and was chosen for further optimization . As shown in table 2, the succinic acid production did not further increase with the increase concentrations of glucose and mgco3 and the decrease concentration of yeast extract . For glucose, although a. succinogenes could tolerate glucose concentration as high as 150.0 g l, the yield of succinic acid would decrease when glucose concentration exceeds 70.0 g l [9, 23]. G l, the concentrations of succinic acid could not be further improved . For mgco3, the culture ph of fermentation broth was increased with the increase of mgco3 concentration (data not shown), which may make the cells more difficult to adapt ., it was observed that the absence of yeast extract led to almost no succinic acid accumulation, which indicated that this component was the basic nutrient for the cell growth . To conclude, the highest succinic acid production was obtained under the condition of 80.0 g l of mgco3, which suggested that this point was near the optimal point . Based on the information above, taking the point (80.0 g l of glucose, 10.0 g l of yeast extract and 60.0 g l of mgco3) as the central level of bbd, then the three - factors, three - level bbd was employed (table 3). The lack of fit (lof) is the variation of the data around the fitted model . Lof is a model fit test that is used to check how well a model fits the data and help to remove insignificant terms from the model . A p - value of lof 0.614 indicted that the model fits the response well . The predicted r of 0.9696 was in reasonable agreement with the adjusted r of 0.9911, and it might be also said that the model determination coefficient (r of 0.9968) was reasonable agreement with the experimental results, indicating that 99.68% of the variability could be revealed by the model . The polynomial model for the succinic acid production was expressed by (8) (in coded value) and (9) (in uncoded value) (table 5) consider the following: (8)y=49.563 + 1.274a+5.495b+2.346c+1.008ab+0.310ac+2.373bc2.562a24.084b24.972c2(9)y=285.728 + 3.842cglucose0.092cye+5.482cmgco3 + 0.020cglucosecye+0.0031cglucosecmgco3 + 0.047cyecmgco30.026cglucose20.163cye20.050cmgco32 . The model reveals that glucose concentration (a), yeast extract concentration (b), and mgco3 concentration (c) had a significant effect (p <0.0001) on the succinic acid production (y). Positive coefficient of a, b, and c indicated a linear effect to increase . The graphs (figure 2) depict the changes in the parameter modeled as the two factors move along those levels, while the other factor held constant at the central point . According to (9), the highest succinic acid production of 52.3 g l was obtained at 14.0 g l of yeast extract and 64.3 g l of mgco3, while glucose concentration was held at 80.0 g l; the maximal succinic acid production of 50.0 g l could be observed at 82.6 g l of glucose and 62.4 g l of mgco3, while holding 10.0 g l of yeast extract; under the conditions of 83.9 g l of glucose, 13.6 g l of yeast extract and 60.0 g l of mgco3 (the factor held constant), the succinic acid production could reach its peak value of 51.8 g l. according to (8) and (9), it was predicted that a maximum succinic acid production of 53.0 g l was appeared at 84.6 g l of glucose, 14.5 g l of yeast extract, and 64.7 g l of mgco3 . In a word, the best level combination of the three key factors (i.e., glucose, yeast extract, and mgco3) was predicted by the polynomial model from bbd . Then the reliability of the model and the accuracy of the prediction should be checked by verification experiment . The availability of the regression model of the succinic acid production using the calculated optimal medium compositions, namely, 84.6 g l glucose, 14.5 g l yeast extract, and 64.7 g l mgco3, was validated with triplicate experiments . The mean maximal value of succinic acid production was 52.7 0.8 g l, which agreed with the predicted value (53.0 the model was considered to be accurate and reliable for predicting the succinic acid production by a. succinogenes . Theoretically, 1.71 mol succinate can be produced per mol glucose (plus co2), based on the available electrons (i.e., 24 electrons in glucose divided by 14 electrons in succinate = 1.71). In this work, compared with that of basic medium (0.45 mol mol glucose), the yield of succinic acid against glucose was enhanced by 111.1% in optimized medium (0.95 mol mol glucose). This may be because there are some factors other than the medium, which affect the yield of succinic acid but are not investigated in this study . Other authors have reported that the succinic acid production reached 84 g l in the fermentation of actinobacillus succinogenes nj113, in which the medium was with similar components to the basic medium in this work, and the corresponding yield of succinic acid was 1.20 mol mol glucose . Since nj113 is the strain screened by jiang et al, this strain may have greater ability to synthesize succinic acid . To conclude, the best level combination of the three key factors (i.e., 84.6 g l glucose, 14.5 g l yeast extract, and 64.7 g l mgco3) was obtained by using the statistical experimental design . 0.8 g l under the optimal medium compositions, which agreed with the predicted value (53.0 g l) well and was 67.3% higher than that obtained with the basic medium (i.e., 31.5 2.3 in this study, a highly efficient optimization method by combining plackett - burman design, steepest ascent, and box - behnken design was developed . This method was demonstrated to be effective in selecting the significant factors and enhancing succinic acid production in a. succinogenes atcc 55618 fermentation . Glucose, yeast extract, and mgco3 were screened to be key factors for the succinic acid production . A maximal succinic acid production of 52.7 0.8 g l was obtained with 84.6 g l glucose, 14.5 g l yeast extract, and 64.7 g l mgco3 . This result agreed with the predicted value well and was 67.3% higher than that obtained with the basic medium.
|
We selected nine cases of rlh, 78 cases of dlbcl, 13 cases of ptcl - nos, and 13 cases of nktcl based on the criteria that the paraffin blocks were well preserved with a sufficient amount of tissue for evaluation . Ihc reactions were performed on paraffin tissue sections using an automated ihc stainer (ventana benchmark xt, ventana medical systems inc ., detection was done using the ventana i veiw dab detection kit (ventana medical systems inc . ). Briefly, ihc staining was performed as follows: 4-m - tissue sections were deparaffinized using ez prep solution . Cc1 standard (ph 8.4 buffer containing tris / borate / ethylenediaminetetraacetic acid) was used for antigen retrieval at 99 for 60 minutes . I view inhibitor (3% h2o2, endogenous peroxidase) was blocked at 37 for four minutes . Slides were incubated with primary antibodies (table 1) at 42 for 32 minutes and secondary antibody to i view biotinylated ig at 37 for 8 minutes . Slides were incubated in i view streptavidin hrp at 37 for 8 minutes and then dab+h2o2 substrate for 8 minutes, which was followed by counterstaining with hematoxylin and bluing reagent at 37. reaction buffer (ph 7.6 tris buffer) was used as a washing solution . Antibodies to hat1, hdac1, hdac2, hdac3, and ki-67 stained the nuclei . The ihcs associated with histone - related proteins (hat1, hdac1, hdac2, and hdac3) were interpreted based on the intensity: 0, 1 +, 2 +, and 3 +, where 0 is negative, but ki-67 based on the proportion (<26%, 26 - 50%, 51 - 75%, and>75%). In hat1 and hdac1 with an intensity of 1 +, the intensity of nearby endothelial cells was served as the control one . In hat1 and hdac1 with an intensity of 3 +, however, the intensity of germinal center cells was served as the control one . Besides, in hdac2 and hdac3 with an intensity of 1 +, the intensity of endothelial cells was served as the control one . In hdac2 and hdac3 with an intensity of 3 +, however, the intensity of nearby histiocytes was served as the control one . Furthermore, 2 + was considered the moderate intensity between 1 + and 3 + (figs . 1, 2). Finally, the intensity and proportion of histone - related proteins were compared using a kaplan - meier survival and a spearman correlation coefficient . Western blot analysis was available only for three cases of rlh, four cases of dlbcl and three cases of ptcl - nos . Protein extraction was performed with the modified methods of azimzadeh et al.11 briefly, western blot analysis was performed as follows: paraffin sections were prepared from the samples of rlh and malignant lymphomas by the microdissection . Then, the paraffin sections were subjected to deparaffinization after incubated twice with xylene at room temperature for ten minutes . Following the dehydration in a graded series of ethanol (100%, 90%, and 70% etoh) for ten min each, the deparaffinized sections were resuspended in an extraction buffer (20 mm tris - hcl, ph 8.8, 2% sodium dodecyl sulfate [sds], 1% octylglucoside, 200 mm dithiothreitol, 200 mm glycine; sigma - aldrich) and then sonicated three times at 24 for 30 seconds in brasonic 8510r - dth sonicator (brason, danbury, ct, usa). This was followed by a 10-minute boiling at 100 and a centrifugation at 15,000 g at 4 for 10 minutes . Then the protein in the supernatant was separated by the sds - polyacrylamide gel electrophoresis and then transferred onto a hybond - n nitrocellulose membrane (ge healthcare, pittsburgh, pa, usa)., rabbit polyclonal anti - hat1 antibodies and monoclonal anti - hdac1 ones were used to detect hat1 and hdac1 (table 1). The intensity of anti - actin band and anti - hat1/hdac1 one was semi - automatically measured using the " wander tools " and " histogram " functions in the adobe photoshop (adobe, san jose, ca, usa) as previously described by park et al.12 then, the intensity was compared using one - way analysis of variance (anova) with the duncan's test in the sas program (sas institute, cary, nc, usa). We selected nine cases of rlh, 78 cases of dlbcl, 13 cases of ptcl - nos, and 13 cases of nktcl based on the criteria that the paraffin blocks were well preserved with a sufficient amount of tissue for evaluation . Ihc reactions were performed on paraffin tissue sections using an automated ihc stainer (ventana benchmark xt, ventana medical systems inc ., tucson, az, usa) according to the manufacturer's protocol . Detection was done using the ventana i veiw dab detection kit (ventana medical systems inc . ). Briefly, ihc staining was performed as follows: 4-m - tissue sections were deparaffinized using ez prep solution . Cc1 standard (ph 8.4 buffer containing tris / borate / ethylenediaminetetraacetic acid) was used for antigen retrieval at 99 for 60 minutes . I view inhibitor (3% h2o2, endogenous peroxidase) was blocked at 37 for four minutes . Slides were incubated with primary antibodies (table 1) at 42 for 32 minutes and secondary antibody to i view biotinylated ig at 37 for 8 minutes . Slides were incubated in i view streptavidin hrp at 37 for 8 minutes and then dab+h2o2 substrate for 8 minutes, which was followed by counterstaining with hematoxylin and bluing reagent at 37. reaction buffer (ph 7.6 tris buffer) was used as a washing solution . Antibodies to hat1, hdac1, hdac2, hdac3, and ki-67 stained the nuclei . The ihcs associated with histone - related proteins (hat1, hdac1, hdac2, and hdac3) were interpreted based on the intensity: 0, 1 +, 2 +, and 3 +, where 0 is negative, but ki-67 based on the proportion (<26%, 26 - 50%, 51 - 75%, and>75%). In hat1 and hdac1 with an intensity of 1 +, the intensity of nearby endothelial cells was served as the control one . In hat1 and hdac1 with an intensity of 3 +, however, the intensity of germinal center cells was served as the control one . Besides, in hdac2 and hdac3 with an intensity of 1 +, the intensity of endothelial cells was served as the control one . In hdac2 and hdac3 with an intensity of 3 +, however, the intensity of nearby histiocytes was served as the control one . Furthermore, 2 + was considered the moderate intensity between 1 + and 3 + (figs . 1, 2). Finally, the intensity and proportion of histone - related proteins were compared using a kaplan - meier survival and a spearman correlation coefficient . Western blot analysis was available only for three cases of rlh, four cases of dlbcl and three cases of ptcl - nos . Protein extraction was performed with the modified methods of azimzadeh et al.11 briefly, western blot analysis was performed as follows: paraffin sections were prepared from the samples of rlh and malignant lymphomas by the microdissection . Then, the paraffin sections were subjected to deparaffinization after incubated twice with xylene at room temperature for ten minutes . Following the dehydration in a graded series of ethanol (100%, 90%, and 70% etoh) for ten min each, the deparaffinized sections were resuspended in an extraction buffer (20 mm tris - hcl, ph 8.8, 2% sodium dodecyl sulfate [sds], 1% octylglucoside, 200 mm dithiothreitol, 200 mm glycine; sigma - aldrich) and then sonicated three times at 24 for 30 seconds in brasonic 8510r - dth sonicator (brason, danbury, ct, usa). This was followed by a 10-minute boiling at 100 and a centrifugation at 15,000 g at 4 for 10 minutes . Then the protein in the supernatant was separated by the sds - polyacrylamide gel electrophoresis and then transferred onto a hybond - n nitrocellulose membrane (ge healthcare, pittsburgh, pa, usa)., rabbit polyclonal anti - hat1 antibodies and monoclonal anti - hdac1 ones were used to detect hat1 and hdac1 (table 1). The intensity of anti - actin band and anti - hat1/hdac1 one was semi - automatically measured using the " wander tools " and " histogram " functions in the adobe photoshop (adobe, san jose, ca, usa) as previously described by park et al.12 then, the intensity was compared using one - way analysis of variance (anova) with the duncan's test in the sas program (sas institute, cary, nc, usa). The mean age of patients was 61 years old in 78 cases of dlbcl, 50 years old in 13 cases of ptcl - nos and 58 years old in 13 cases of nktcl . The mean follow - up periods were 31, 18, and 15.8 months in cases of dlbcl, ptcl - nos, and nktcl, respectively (range, 1 to 162 months). Of the three types of lymphoma, the ptcl - nos showed the poorest prognosis based on the death rate (table 2). The frequency of ki-67 staining was the highest in the area of> 26% and<50% and the lowest in that of> 75% in all the three types of lymphoma . In cases of rlh, the intensity was mostly 2 + for hat1, hdac1 and hdac2 but 0 and 1 + for hdac3 . Besides, in cases of dlbcl, ptcl - nos, and nktcl, it was mostly 3 + for hat1, hdac1, and hdac2 but 0 and 1 + for hdac3 . The degree of the expression of hat1 was significantly higher in cases of dlbcl, ptcl - nos or nktcl compared with rlh (p<0.05). The degree of the expression of hdac1 was significantly higher in cases of dlbcl as compared with rlh (p<0.05). Besides, the degree of the expression of hdac2 was significantly higher in cases of ptcl - nos and nktcl as compared with rlh (p<0.05) (fig . 3). The proliferation index (ki-67) was significantly correlated with the degree of the expression of hat1 and hdac1 in cases of dlbcl and that of hdac2 in cases of nktcl (p<0.05). In addition, it was also significantly correlated with the degree of the expression of hat1 and that of hdac1 in cases of dlbcl and nktcl (p<0.05). Furthermore, there were significant correlations between the degree of the expression of hdac1 and that of hdac2 in cases of ptcl - nos and between that of hdac2 and that of hdac3 in cases of dlbcl (p<0.05) (table 3). We lost many cases while preparing for a western blot analysis of the formalin - fixed, paraffin - embedded tissue samples . Besides, we also had no sufficient number of remaining cases that are available for the current study . Despite a small number of remaining cases, however, we have obtained the significant results as shown below: the density of protein band was reduced because the western blot analysis showed very strong protein bands for hat1 . The degree of the expression of hat1 was significantly higher in cases of dlbcl (3/4) and those of ptcl - nos (2/3) as compared with those of rlh (p<0.05). In the remaining cases of dlbcl (1/4) or ptcl - nos (1/3), however, the degree of the expression of hat1 was higher as compared with those of rlh ., there were no any significant results in case of hdac1 . Following an analysis of the survival curve, the degree of the expression of hat1 and hdac1 was higher in association with a poorer survival in cases of dlbcl and those of ptcl - nos . In addition, the degree of the expression of hdac3 was also higher in association with a better survival in cases of nktcl . But this also did not reach a statistical significance (p>0.05) (fig . 5). The frequency of ki-67 staining was the highest in the area of> 26% and<50% and the lowest in that of> 75% in all the three types of lymphoma . In cases of rlh, the intensity was mostly 2 + for hat1, hdac1 and hdac2 but 0 and 1 + for hdac3 . Besides, in cases of dlbcl, ptcl - nos, and nktcl, it was mostly 3 + for hat1, hdac1, and hdac2 but 0 and 1 + for hdac3 . The degree of the expression of hat1 was significantly higher in cases of dlbcl, ptcl - nos or nktcl compared with rlh (p<0.05). The degree of the expression of hdac1 was significantly higher in cases of dlbcl as compared with rlh (p<0.05). Besides, the degree of the expression of hdac2 was significantly higher in cases of ptcl - nos and nktcl as compared with rlh (p<0.05) (fig . The proliferation index (ki-67) was significantly correlated with the degree of the expression of hat1 and hdac1 in cases of dlbcl and that of hdac2 in cases of nktcl (p<0.05). In addition, it was also significantly correlated with the degree of the expression of hat1 and that of hdac1 in cases of dlbcl and nktcl (p<0.05). Furthermore, there were significant correlations between the degree of the expression of hdac1 and that of hdac2 in cases of ptcl - nos and between that of hdac2 and that of hdac3 in cases of dlbcl (p<0.05) (table 3). We lost many cases while preparing for a western blot analysis of the formalin - fixed, paraffin - embedded tissue samples . Besides, we also had no sufficient number of remaining cases that are available for the current study . Despite a small number of remaining cases, however, we have obtained the significant results as shown below: the density of protein band was reduced because the western blot analysis showed very strong protein bands for hat1 . The degree of the expression of hat1 was significantly higher in cases of dlbcl (3/4) and those of ptcl - nos (2/3) as compared with those of rlh (p<0.05). In the remaining cases of dlbcl (1/4) or ptcl - nos (1/3), however, the degree of the expression of hat1 was higher as compared with those of rlh . Following an analysis of the survival curve, the degree of the expression of hat1 and hdac1 was higher in association with a poorer survival in cases of dlbcl and those of ptcl - nos . In addition, the degree of the expression of hdac3 was also higher in association with a better survival in cases of nktcl . But this also did not reach a statistical significance (p>0.05) (fig . 5). It is well established not only that the carcinogenesis is commonly associated with the alteration of dna sequences but also that epigenetic alterations are found in various types of cancers . Aberrant methylation of cpg islands in promoter regions causes the silencing of tumor suppressor genes in some cancers including malignant lymphoma.13,14 the imbalance between acetylation and deacetylation of histone protein induces the development, invasion and metastasis of the tumor . Increased histone acetylation may lead to the development of malignant lymphoma.2 yasui et al.4 maintained, however, that the decrease of histone acetylation is involved not only in the development of tumor, but also its invasion and metastasis . The histone hypoacetylation is induced by a decrease in the activity of hat or an increase in that of hdac . The altered expression of hdac proteins has also been reported to occur in cases of tumor . These alterations include the increased expression of hdac1 in cases of gastric,15 prostate,16 colon,17,18 or breast cancer.19 besides, it has also been disclosed that the increased expression of hdac2 was present in cases of cervical,20 gastric,21 and colorectal cancer.20,22 a higher degree of the expression of hdac3 was observed in cases of colon cancer.23 according to studies about hematopoietic malignancies, the degree of the expression of such histone - related proteins as hdac1, hdac2, and hdac6 was significantly higher in cases of dlbcl or ptcl than normal lymphoid tissue.24 in addition, marquard et al.25 maintained that a high degree of the expression of hdac2 is more commonly seen in cases of aggressive ctcl rather than indolent cases . These authors also noted that the degree of the expression of hdac6 is associated with a favorable outcome.25 following the treatment with rituximab in cases of b - cell lymphoma, the degree of the expression of hdac was associated with down - regulation of cd20 expression . The expression of cd20 mrna and protein was repressed by recruitment of a histone deacetylase protein complex to the cd20 gene promoter.26 in addition, agata et al.2 reported that histone acetylation determines an accessibility to the recombination of t - cell receptor -chain genes that play a direct role in executing a developmental switch in cell fate determination . Our results showed that the degree of the expression of hat1 was significantly higher in cases of dlbcl, ptcl - nos or nktcl as compared with those of rlh (p<0.05). This is closely associated with the role of histone acetylation in inducing the expression of loose chromatin and thereby promoting the transcription . It can therefore be inferred that the effects of histone acetylation would depend on the target oncogenes . Our results showed no specific oncogenes that play a critical role in the malignant transformation . In the current study, however, histone acetylation plays a critical role in the development of such cancers as dlbcl, ptcl - nos, and nktcl . On the other hand, many studies have examined the effects of hdac inhibitors . In addition, the indications of saha have been approved for the treatment of ctcl by the us fda . It has been known that hdac inhibitors are involved in cell cycle arrest, differentiation and apoptosis in tumor cells . Some authors argue that isotype - specific hdac inhibitors may be a more effective and safe agent that causes less adverse effects . Nevertheless, isotype - specific hdac inhibitors are not popular up to present.27 in the current study, the degree of the expression of hdac1 was significantly higher in cases of dlbcl and those of hdac2 in cases of ptcl - nos and nktcl as compared with rlh (p<0.05). This is in agreement with previous reports.24 based on our results, it can be inferred that hdacs are involved in the expression of dense chromatin and this is associated with the repression of certain types of tumor suppressor genes, even though we did not disclose what these tumor suppressor genes are . This suggests that hdac1- and hdac2-specific inhibitors would be more effective for the treatment of dlbcl and that of ptcl - nos and nktcl, respectively . On the other hand, we could not verify the relationship between the expression of hdac1 and hdac2 and the survival of patients . Our results showed, however, not only that the degree of the expression of hat1 and hdac1 was significantly higher in relation to a poorer survival in cases of dlbcl or ptcl - nos but also that the degree of the expression of hdac3 was significantly lower in relation to a poorer survival in cases of nktcl (p>0.05). In addition, the expressions of hat1 were correlated with hdac1 in cases of dlbcl (p<0.05). The proliferation index was significantly correlated with the degree of the expression of hat1 and hdac1 in cases of dlbcl (p<0.05). These results indicate that hat1 and hdac1 have a synergistic effect in development of dlbcl, both of which are involved in its aggressiveness as cooperating factors . Our results are also in agreement with the reports that both hats and hdacs are involved in the development of cancer through a multi - step process together with several cooperating factors . In other words, hdacs act on specific genome regions by recruitment of dna binding factors including transcription factors, nuclear receptors and epigenetic modifiers (methyl binding proteins, dna methyltransferases, and histone methyltransferases). Considering these factors further specific studies are warranted to clarify the accurate mechanisms by which lymphoreticular malignancies occur . This will also be helpful for elucidating the effects of hdac inhibitors against malignant lymphomas . In summary, our results are as follows: the degree of the expression of hat1 was higher in cases of dlbcl, ptcl - nos or nktcl as compared with rlh.presumably, hat1 might act on some types of oncogene and thereby contribute to the development of such cancers as dlbcl, ptcl - nos, and nktcl.the degree of the expression of hdac1 and hdac2 was higher in cases of dlbcl, ptcl - nos, and nktcl as compared with rlh . Both hdac1 and hdac2 are involved in the repression of certain types of tumor suppressor genes . The degree of the expression of hat1 was higher in cases of dlbcl, ptcl - nos or nktcl as compared with rlh . Presumably, hat1 might act on some types of oncogene and thereby contribute to the development of such cancers as dlbcl, ptcl - nos, and nktcl . The degree of the expression of hdac1 and hdac2 was higher in cases of dlbcl, ptcl - nos, and nktcl as compared with rlh . Both hdac1 and hdac2 are involved in the repression of certain types of tumor suppressor genes . In conclusion, both histone acetylation and deacetylation play a critical role in the development of such cancers as dlbcl, ptcl - nos, and nktcl . In addition, it can also be concluded that both hat1 and hdac1 might be indicators for a poor prognosis in cases of dlbcl, which is based on the following results: hat1 and hdac1 have a synergistic effect in the development of dlbcl.the proliferation index was correlated to the degree of the expression of hat1 and hdac1 in cases of dlbcl.following an analysis of the survival curve, the degree of the expression of hat1 and hdac1 was higher in association with the aggressiveness and a poor survival in cases of dlbcl . In addition, hdac1- and hdac2-specific inhibitors would be more effective for the treatment of dlbcl and that of ptcl - nos and nktcl, respectively . The proliferation index was correlated to the degree of the expression of hat1 and hdac1 in cases of dlbcl . Following an analysis of the survival curve, the degree of the expression of hat1 and hdac1 was higher in association with the aggressiveness and a poor survival in cases of dlbcl . In addition, hdac1- and hdac2-specific inhibitors would be more effective for the treatment of dlbcl and that of ptcl - nos and nktcl, respectively . Our results indicate not only that the degree of the expression of hat1 and hdac1 might have a prognostic value in predicting the clinical behavior of dlbcl but also that the specific use of hdac inhibitors might lead to better treatment outcomes of the chemotherapy in cases of malignant lymphoma.
|
In men, testosterone concentrations decline gradually with age, unlike the dramatic fall in estrogen levels at the time of menopause in women . Testosterone deficiency is common in men with type 2 diabetes and it may contribute to not only impaired performance, mood, and libido, but also insulin resistance and metabolic abnormalities such as hypertension and dyslipidemia . The endocrine society clinical practical guidelines indicate that men with type 2 diabetes have a high prevalence of low serum testosterone concentrations, and the guidelines recommend measuring serum testosterone concentrations . Furthermore, the inverse association between serum testosterone concentrations and plasma glucose concentrations has been observed in many studies . However, serum testosterone concentrations in korean men with poorly controlled type 2 diabetes have never been studied . In this study, we examined whether serum testosterone concentrations are low in korean men with poorly controlled type 2 diabetes compared with healthy men . In this study, we enrolled 41 healthy men who underwent general health checks and 38 men with type 2 diabetes who were hospitalized at the cha bundang medical center, cha university, seongnam, korea . The healthy men were matched to the diabetic men by age and body mass index (bmi). All participants were aged 40 years or above in the recruitment period, from april 2010 to october 2011 . We excluded subjects who had type 1 diabetes, acute disease, known liver or kidney disease, history of stroke, angina, myocardial infarction, or cancer . This study was approved by the cha university institutional review board, and informed consent was obtained from each study participant . Total testosterone was measured using chemiluminescent microparticle immunoassay with an architect i1000 immunology analyzer (abbott laboratories, north chicago, il, usa). Sex hormone - binding globulin (shbg) levels were determined with a cobas 6000 analyzer (roche, mannheim, germany). Free and bioavailable testosterone values were calculated from total testosterone, shbg, and serum albumin values based on mass action laws using vermeulen's formula . Glycated hemoglobin (hba1c), triglyceride, total and high density lipoprotein cholesterol, and glucose values were measured by standard methods . Testosterone deficiency was designated as individuals with a total testosterone level less than 3 ng / ml . Data for continuous variables are presented as meanssds and categorical factors are reported as percentages . The participants' characteristics were compared according to diabetes status using independent - sample t tests for continuous variables and chi - square tests for categorical variables . In this study, we enrolled 41 healthy men who underwent general health checks and 38 men with type 2 diabetes who were hospitalized at the cha bundang medical center, cha university, seongnam, korea . The healthy men were matched to the diabetic men by age and body mass index (bmi). All participants were aged 40 years or above in the recruitment period, from april 2010 to october 2011 . We excluded subjects who had type 1 diabetes, acute disease, known liver or kidney disease, history of stroke, angina, myocardial infarction, or cancer . This study was approved by the cha university institutional review board, and informed consent was obtained from each study participant . Total testosterone was measured using chemiluminescent microparticle immunoassay with an architect i1000 immunology analyzer (abbott laboratories, north chicago, il, usa). Sex hormone - binding globulin (shbg) levels were determined with a cobas 6000 analyzer (roche, mannheim, germany). Free and bioavailable testosterone values were calculated from total testosterone, shbg, and serum albumin values based on mass action laws using vermeulen's formula . Glycated hemoglobin (hba1c), triglyceride, total and high density lipoprotein cholesterol, and glucose values were measured by standard methods . Testosterone deficiency was designated as individuals with a total testosterone level less than 3 ng / ml . Data for continuous variables are presented as meanssds and categorical factors are reported as percentages . The participants' characteristics were compared according to diabetes status using independent - sample t tests for continuous variables and chi - square tests for categorical variables . All statistical analyses were conducted using spss version 17.0 (spss inc ., chicago, il, usa). The mean age of men with type 2 diabetes was 55.8 years while that of healthy men was 51.9 years . The average duration of diabetes was 10.8 years from the time of diagnosis; the mean hba1c value was 10.8% . There was no significant difference in age, bmi, waist circumference, systolic and diastolic blood pressure, total cholesterol, or shbg level between men with poorly controlled type 2 diabetes and healthy men . However, men with poorly controlled type 2 diabetes had higher fasting blood glucose levels and lower serum albumin concentrations than the healthy men . Total testosterone concentrations were lower in men with poorly controlled type 2 diabetes than in healthy men after adjusting for age and bmi (3.830.32 ng / ml vs. 5.630.31 ng / ml, p<0.001). Men with type 2 diabetes also showed lower calculated bioavailable testosterone concentrations than healthy men (1.580.12 ng / ml vs. 2.270.11 ng / ml, p<0.001), but not calculated free testosterone concentrations . The prevalence of testosterone deficiency was consistently higher in men with poorly controlled type 2 diabetes than in healthy men (31.6% vs. 2.4%, p<0.001) (table 2). Many studies have documented an association between low testosterone concentrations and type 2 diabetes in men . The inverse association between serum testosterone concentrations and plasma glucose concentrations has also been well documented . However, few studies have investigated serum testosterone concentrations in men with poorly controlled type 2 diabetes . In this study, we showed that total and bioavailable testosterone concentrations were lower in men with poorly controlled type 2 diabetes than in healthy men . In the blood of normal men, 44% of total testosterone is bound to shbg, 2% is unbound, and 54% circulates bound to albumin and other proteins . Because several studies have demonstrated that shbg levels are low in type 2 diabetes, low total testosterone concentrations might be a secondary consequence to the association between low shbg levels and type 2 diabetes . However, it is unclear whether low total testosterone concentrations are a consequence of low shbg levels in men with type 2 diabetes . Indeed, it is also clear that the relationship between low testosterone concentrations and type 2 diabetes is not solely due to shbg levels because many studies have shown that the inverse association between testosterone and insulin resistance is independent of shbg levels . In this study, men with poorly controlled type 2 diabetes had lower total testosterone concentrations than healthy men, although there is no difference in shbg levels . Therefore, men with poorly controlled type 2 diabetes should undergo further evaluation for symptoms and signs consistent with androgen deficiency . However, it is not clear why shbg is not different between men with poorly controlled type 2 diabetes and healthy men in this study . Many studies have demonstrated that low levels of shbg in men are consistently associated not only with type 2 diabetes, but also with visceral obesity, insulin resistance, and hyperinsulinemia . In this study, men with poorly controlled type 2 diabetes might have insulin deficiency rather than insulin resistance because the average duration of type 2 diabetes is more than 10 years, so shbg levels might not have been different between men with poorly controlled type 2 diabetes and healthy men . Unfortunately, we have no data about serum insulin and c - peptide levels, so we are not able to identify a relationship between shbg levels and insulin secretion or resistance . Several studies have documented that serum luteinizing hormone (lh) concentrations correlate positively with serum free testosterone concentrations (hypogonadotrophic hypogonadism) in men with type 2 diabetes . In addition, mean lh levels and diurnal lh pulse amplitudes are significantly lower in obese subjects than in controls . However, in this study, men with type 2 diabetes had normal lh concentrations . This might be because the men with poorly controlled type 2 diabetes were not obese compared with the healthy men . Hyperglycemia itself might influence differences in serum testosterone concentrations between men with poorly controlled type 2 diabetes and healthy men . In this study, testosterone concentrations were found to be negatively correlated with fasting blood glucose and hba1c values (data not shown), although the sample size is small . Furthermore, reduced testosterone concentrations in men with poorly controlled type 2 diabetes may be an effect of glycemia on the testicular microvasculature or leydig cell function . First, no causal relationships among low serum testosterone concentrations and poorly controlled type 2 diabetes could be established due to the small sample size and cross - sectional nature of the study . Third, in this study, serum albumin levels were lower in men with type 2 diabetes than in healthy men . This finding is consistent with previous studies showing that albumin levels might be significantly affected by poor glucose control . We could not rule out the possibility that low serum albumin levels might have resulted in low testosterone concentrations in men with poorly controlled type 2 diabetes . Finally, because we compared serum testosterone concentrations between men with poorly controlled type 2 diabetes and healthy men, we were not able to determine whether there was a significant association between glucose control and serum testosterone concentrations ., this study shows that serum testosterone concentrations are lower in men with poorly controlled type 2 diabetes than in healthy men . Therefore, men with poorly controlled type 2 diabetes should undergo further assessment for hypogonadism.
|
We reviewed data on mumps cases reported to the registration system for notifiable infectious diseases in the netherlands (osiris) during september 1, 2009august 31, 2012 . Notification criteria for mumps include> 1 related symptom (i.e., acute onset of painful swelling of the parotid or other salivary glands, orchitis, or meningitis) and laboratory confirmation of infection or an epidemiologic link to a laboratory - confirmed case (7). In addition to basic demographic information, notification data reported to osiris included vaccination status and student or contact with student status . The questions on student / student contact status were made more specific on april 19, 2010 . For cases reported before that date, the information for the new variable was obtained from open - format questions . Laboratory confirmation criteria included> 1 of the following: detection of mumps - specific igm; detection of viral rna; or isolation of the virus on cell culture . Genotyping targeting the gene encoding the small hydrophobic protein was performed on specimens submitted to the national institute for public health and the environment by using an in - house method . We used the test for comparison of proportions and testing for trends over time and calculated a 3-week moving average to characterize trends and seasonality . The odds ratio, which describes the association between complications / hospitalizations and vaccination status, was adjusted for age and sex (when outcome was orchitis, adjustment was done for age only) and estimated by using logistic regression . Associations with p values of <0.05 were considered statistically significant, and all reported p values are 2-tailed . Stata software version 12 (statacorp, college station, tx, usa) was used for the analyses . During september 1, 2009august 31, 2012, a total of 1,557 cases of mumps were reported in the netherlands (figure); 1,254 (80.5%) of these were laboratory confirmed . Laboratory confirmation was most often by detection of viral rna (68.8%), followed by antibody detection (21.9%) and virus isolation (7.3%). In 2% of cases, numbers of notified mumps cases, by week of onset, the netherlands, september 1, 2009august 31, 2012 (n = 1,557 cases). Seasons and number of cases (n) are indicated; black line indicates 3-week moving average . Most case - patients were male (59%) and 1825 years of age (67.9%). The average annual incidence per 100,000 population was 0.5 for the 03-year age group, 0.8 for the 414-year age group, 4.5 for the 1317-year age group, 21.4 for the 1825-year age group, and 0.9 for the> 25-year age group . Of the 1,474 cases for which patient vaccination status was reported, 998 (67.7%) case - patients had received 2 doses of mmr; 157 (10.6%) had received 1 dose, and 242 (16.4%) were unvaccinated . Genetic analysis of small hydrophobic gene sequences of 808 mumps - positive samples showed that most (98.5%) outbreak strains belonged to the g5 subtype . Complications were reported in 126 cases (8.4% of 1,492 cases with known complication status) (table 1). Orchitis was the most frequent complication (109 [12.7%] male case - patients> 12 years of age) and occurred significantly more often among unvaccinated case - patients than among case - patients who had received 1 vaccine dose (p = 0.04); vaccination with 2 doses of mmr reduced the risk for orchitis even further (p<0.01). Other reported complications were meningitis (n = 6), pancreatitis (n = 3), thyroiditis (n = 1), and encephalitis (n = 1). Three case - patients had permanent unilateral hearing loss that was probably caused by mumps virus infection . Deafness and meningitis occurred more frequently among unvaccinated than vaccinated persons, but those numbers were probably too low for statistical significance (table 1). * only case - patients with known complications and vaccination status were included in the analyses . Or, odds ratio; ve, vaccine effectiveness; ref, referent; na, not applicable;, not analyzed (insufficient sample size). Adjusted for age (age groups <18 y, 1825 y,> 25 y) and sex, except orchitis, which was adjusted only for age . A total of 31 patients (2.1% of 1,436 patients with known hospitalization status) were hospitalized . Risk for hospitalization was significantly lower among case - patients who had received 2 mmr doses than for unvaccinated case - patients (p<0.01); ve for preventing hospitalization was 82% (table 1). Three distinct epidemic seasons occurred during the outbreak: seasonal peaks in spring and late autumn and a decline in number of cases during summer and, to some extent, during the christmas holidays (figure). Data on sex, age, vaccination status, residence in a city with a university, student status, and contact with student status by season are shown in table 2 . Overall, the age distribution of mumps case - patients differed significantly between the seasonal peaks (p = 0.007). The number of cases increased proportionally over time for the 1317-year age group (p = 0.003) and the> 25-year age group (p = 0.042) and decreased over time for the 1825-year age group (p<0.001). The overall proportion of cases in vaccinated persons did not change (table 2), and the proportion of complications or hospitalizations did not differ by season (data not shown). * boldface indicates significance trends by test, calculated by using proportions excluding unknowns . University cities: amsterdam, delft, eindhoven, enschede, groningen, leiden, maastricht, nijmegen, rotterdam, stichtse vecht, tilburg, utrecht, and wageningen . We found significant seasonal differences in the proportion of cases occurring in students and in persons with student contacts (p<0.001). During early spring 2010, large clusters of cases were reported from university cities of leiden and delft, as described (6). However, during 2011 and 2012, proportionally more case - patients were not students and had no contact with students than during 2010 (p<0.001). The proportion of student case - patients enrolled in higher education other than university or case - patients who had contact with these nonuniversity students increased after 2010 (p<0.001). The absolute numbers of cases in these categories increased from 2010 to 2011 but stayed more or less constant, or decreased slightly, in 2012 . The number of case patients who were university students or who had contact with university students decreased proportionally (p<0.001), and over time, proportionally more cases were reported from cities without universities (p<0.001). In addition, the total number of cases from nonuniversity cities was higher in 2012 . The epidemic of mumps in the netherlands during late 2009 through 2012 affected mainly vaccinated students . However, vaccination evidently offered protection against mumps - associated complications . The epidemic showed a seasonal trend, although cases were identified throughout the years . Over time, age, student status, and geographic distribution changed, which suggests a slight shift in transmission trends from student populations to younger and older nonstudent populations and to cities without a university . This shift may relate to increased immunity in the primarily affected high - risk student population; exposure to wild - type mumps virus may have boosted individual immunity and thus contributed to increased herd immunity . Mumps outbreaks among vaccinated populations have been reported in other countries during recent years: a 2006 outbreak in the united states (8), a 20092010 outbreak in canada (9), and a 2012 outbreak in the united kingdom (10). Description of an outbreak in 20092010 in the northeastern united states among a highly vaccinated population of orthodox jews indicated that intense exposure among boys in a religious school facilitated the transmission of mumps virus, which overpowered the vaccine - induced protection (11,12). Similar to our findings, transmission in that outbreak shifted from adolescents to younger and older populations over time . The intense social crowding among students (e.g., large indoor social gatherings) partly explains why secondary vaccine failure occurred in the outbreak described in this study . A subgroup of students, including those living with many other students and members of university fraternities, may be at increased risk for infection (6,7). Crowding in nonstudent populations may not be as intense as among students, and mixing is usually with more heterogeneous age groups . In these circumstances, . A lower rate of crowding may be one explanation for the relatively low numbers of cases among 412-year - olds, despite the generally lower igg titers in this group than in adolescent students . Still, even though lower antibody levels do not automatically mean higher risk for mumps virus infection (14), a higher rate of illness would have been expected in the 412-year age group . An additional explanation for the lower apparent illness rate among these younger children might be a higher frequency of unapparent and subclinical infections, which would lead to many undiagnosed cases in this age group . Most of the persons affected in the epidemic were male, a finding also observed in other studies (15,16). The reasons for male predominance are unclear, but significantly higher mumps antibody titers in female than in male persons have been demonstrated (13,17); this finding, in turn, may be linked to gender - associated genetic differences in immune response . Most cases occurred in persons who had received 2 doses of mmr, which suggests inadequate effectiveness of the vaccine . Recent studies indicate the effectiveness of mmr against mumps is moderate and lower than the clinical efficacy estimates (1,18). Postlicensure studies of 2 doses (jeryl - lynn strain) of mmr have provided a median ve estimate of 88% (range 79%95%) (2). A recent study of an outbreak of mumps at a student party in the netherlands estimated a ve of 68% for 2 doses of mmr (6). This estimate is, however, uncertain because of the low number of unvaccinated case - patients . We attempted to provide ve estimates against clinical mumps applying the screening method; however, because this method is most vulnerable to error when proportions of the population and case - patients vaccinated are high (19), as in this study, the estimates became inaccurate and thus are not included in our results . The possible causes for lower than expected ve include secondary vaccine failure (waning immunity), intense exposure to high virus inoculum, and a possible mismatch between the vaccine genotype and circulating strains (1,2,18,20). However, because the level of antibodies correlating with protection remains unknown (12,21), we are unable to further elucidate the role of these factors . Orchitis was the most common complication, consistent with previous outbreaks in a population with a similar age structure (1). However, orchitis occurred significantly more often among unvaccinated than vaccinated case - patients, and the vaccine was effective in preventing orchitis, which has previously been shown in a study based in part on the same study population (22) and in other studies (11,23). A previous report described 3 cases of deafness (0.19% of all notified infections), 2 in unvaccinated persons (24). The frequency of 0.005% for unilateral deafness commonly cited in the literature (25) is considerably lower than that found in our study, but this difference is likely attributable to a different denominator population . A higher incidence of deafness has been reported from japan using more appropriate denominators (26). One limitation of our study was the short time span for assessing changes over time . Mumps cases have continued to occur after our study period, but the number of cases reported after september 2012 (180 as of august 31, 2013) is much lower than that reported during the previous years . Recent numbers indicate that a similar trend in changing patterns of age and geographic distribution is ongoing; most of the more recent cases have occurred in nonstudents and in age groups other than 1825 years (data not shown). However, because of lower case numbers, this comparison must be interpreted with caution . A further limitation of our study is that it is likely that many mumps cases are not notified because they are subclinical infections or because of reluctance to seek medical care; thus, these cases are not included in our analyses . Furthermore, complications that occurred after the notification date are not included; however, because vaccination status is probably not associated with the reporting of complications, we regard our ve estimates against complications as unbiased . Although ve for mumps vaccination is not optimal for preventing clinical disease, our results support previous findings that vaccination limits the severity of disease . Because complications are the primary mumps - associated public health problem, these findings support the current vaccination recommendations . Still, this epidemic demonstrates that mumps virus can cause large outbreaks even in highly vaccinated populations . The observation that the incidence after the third season studied has been considerably lower than during previous seasons is consistent with the development of herd immunity among high - risk students resulting from the high rate of natural symptomatic and asymptomatic infections . However, the annual inflow of new susceptible students unvaccinated and vaccinated who start their studies could again lower overall immunity . A recent study suggested that use of a third mmr dose might be an effective control measure in certain outbreak situations (27). Introduction of a third mmr dose to the vaccination schedule has been considered in the netherlands (6) but was not recommended because of relatively low overall illness rates associated with mumps and other factors, including an expected low vaccine uptake . Although the vaccine remains effective in most settings and significantly reduces the risk for complications, further research is needed to understand the limitations of mmr, and modeling is warranted to understand the dynamics of mumps virus transmission in future.
|
Posttranslational modifications on proteins offer spectacular diversity and functional variety to an organism's otherwise constrained proteome . Sumoylation is one such ptm whose vast expanse of biological implications in organisms has brought it under attention; still till now many of its functional outcomes are not known . To name a few, sumoylation is involved in transcriptional regulation [13], mrna metabolism, apoptosis [5, 6], nuclear and subcellular transport [7, 8], protein trafficking, signal transduction, regulation of dna damage and replication, cell - cycle progression, competition with other members of the ubiquitin family [2, 11, 12], prevention or promotion of deacetylation, chromosome segregation, structural integrity of chromatin and many proteins, and mitosis . Also, it is known to participate in early developmental processes like cell differentiation, specification, division, and lineage commitment . Sumoylation of a target protein can change its localization in a cell by altering its intermolecular and intramolecular interactions . Hence, by determining whether a protein is sumoylated or not, vital evidences can be gathered regarding its function and spatial association . Sumo, a member of the ubiquitin family, is made up of 97 amino acids and is also called smt3p, pmt2p, pic-1, gmp-1, ubl1, and sentrin . It mostly modifies proteins present in the nucleus, cytoplasm, and sometimes the plasma membrane of eukaryotic cells . Sumo proteins are highly conserved across eukaryotic proteomes . In mammals, including humans, there are four isoforms of sumo called sumo 1, sumo 2, sumo 3, and sumo 4; in yeasts there is only one sumo protein while plants produce at least eight sumo isoforms . Sumo 1, sumo 2, and sumo 3 are expressed throughout an organism's body with the latter two having greater sequence similarity as compared to sumo 1 . Sumo 4 dominates in lymph node, kidney, and spleen in mammals, having resemblance with sumo 2 and 3 and a dominant occurrence in kidney . Sumoylation can occur in either the cytoplasm or the nucleus depending on the locality of the target protein, though the modification may afterwards be responsible for regulation of production and change in its localization mostly from other parts of cell to the nucleus . Rangap1, which controls the transportation of ribonucleoproteins across the nuclear pore complex, was identified as the first sumo target . Before sumoylation, this protein mainly resides in the cytoplasm and afterwards associates itself with the cytoplasmic fibers of the nuclear pore complex . All essential components of sumoylation are present at the nuclear pore complex which shows its involvement in nuclear import or even retention of any incoming proteins within the nucleus [26, 27]. However, tel protein, modified at k99, dominates in the cytoplasm while tel mutated and hence unable to be sumoylated at this residue mostly resides in the nucleus, pointing towards possible role of sumoylation in its export . Since sumoylation is a part of a very wide array of biological and cellular processes, even a minor dysfunction in the pathway can result in severe pathological conditions like cancer . Neurodegenerative diseases including huntington's disease, alzheimer's disease, parkinson's disease, and neuronal intranuclear inclusion disease often have anomalies in the sumoylation pathway involved in their onset . Also, type i diabetes and familial amyotrophic sclerosis have sumoylation dysfunction as a frequent part of their beginning . Sumo proteins attach covalently to lysine, which mostly lies in consensus motif kxe, where is any hydrophobic amino acid, k is the target lysine residue, x is any of the twenty encoded amino acids, and e is glutamic acid, with the help of sumo e2-conjugation enzyme, ubc9 . In mammals, any one of the four isoforms of sumo conjugates to target protein as an individual molecule or in the form of polymeric chains at target lysine . The enzymes working the sumoylation pathway are e1-activating enzyme, e2-conjugating enzyme, and e3 ligase . The sumo pathway can be categorized into maturation, activation, conjugation, and finally ligation at target site (figure 1). First of all, sumo is processed by sumo - specific proteases (senps) to cleave its terminal into an exposed diglycine motif at the carboxyl end, converting it from immature to mature protein . Secondly, activation of mature sumo takes place through an atp - dependent thioester bond formation between sumo and uba2/aos1, a heterodimeric e1-activating enzyme . The yeast homologue of uba2 subunit is uba2p, which together with aos1 was the first activating enzyme to be discovered while the human homologue is huba2; both act in the same way . In contrast to other enzymes involved in the process, ubc9 is the only type of enzyme identified in its category [31, 37]. It is ubc9 which identifies the consensus or nonconsensus sequence at target site for subsequent conjugation . In the final step, sumo is attached to target protein with isopeptide bond between the exposed diglycine on carboxyl terminal of sumo and the -amino group of target lysine in protein with the help of e3-ligating enzyme . Three distinct characteristics of ligating enzymes in sumoylation pathway have been sketched through research: (i) they should be able to directly or indirectly associate with the target protein, (ii) they should be able to bind with their preceding enzyme, ubc9, in the pathway, and (iii) they should be capable of transferring sumo to target protein or another sumo in case of poly - sumoylation . Ranbp2 which is a nuclear pore protein, topors [40, 41], pias proteins, pc2 which is polycomb group protein, and rnf4 have all been identified to have e3 ligase activity in sumoylation pathway . Nearly all research on sumo attachment has pointed out the significance of kxe motif, but on the other hand, sumoylation has been reported to occur in regions outside of this consensus motif as well: in nonconsensus sites . Xu et al . Reported 26% sumo occurrence in nonconsensus while xue et al . For example, there are four core histones, h2a, h2b, h3, and h4, that are frequently sumoylated . However, none of the sumoylated sites in these histones conform to the common consensus motif . Ndsm proposes that negatively charged amino acids around the target lysine enhance sumoylation while pdsm is based on kxexxsp motif, both being only an extension of the original common motif . An analysis of available pdb structures of several protein targets having 57 reported sumoylation sites revealed 54 of the sites to be exposed on the surface while only 3 were buried within the proteins' globular structure . Also, research has led to the conclusion that sumoylation is greatly enhanced when the target lysine is forced to adopt a favorable conformation . From this behavior it can be inferred that the conjugation enzymes and ligases have sequence preference since they come into direct contact with target protein . Sumoylation pathway requires only three enzymes, specificity of subcellular localization and appropriate presentation of target residue on globular structure . In case of other ptms, a variety of enzymes with their target recognition and modification systems bring out varied site preference; typically they are not focused on any one type of residue . The major role in sumoylation is played by only few enzymes discussed above; it suffers from the lack of efficient target recognition and modification systems, thus emphasizing the importance of motif and sequence information on the target protein as a device of recognition in the pathway . Including sequence information as a principal contributor of computational prediction performance can provide rational computational tools, but focusing entirely on the consensus motif is not preferable as it can result in missing many true positives that lie in nonconsensus regions along with high false positive rate due to the many consensus sites that are actually not sumoylated . In view of the occurrence of sumo at both consensus and nonconsensus, sites it is proposed that other than the raw amino acid sequence around a sumoylatable lysine residue there are factors of appropriate presentation and exposure of lysine and adjacent residues including steric hindrance, hydrophobicity, polarity, and entropy, playing a crucial role in determining whether a residue shall undergo sumoylation or not . However, two residues downstream and one residue upstream of the target lysine play the most important role in sumoylation [2, 50, 51]. We have employed different peptide lengths centered on lysine residues experimentally proved to undergo sumoylation with sixteen amino acid properties (table 1) from aaindex to develop a prediction model named sumohunt . These amino acid properties were chosen on the basis of their contribution in increasing structural complementarity and association between incoming sumo and target protein . Promising accuracy measures obtained on sumohunt developed by combining these properties with sequence information in the vicinity of target lysine and random - forest based algorithm presented in data mining software weka have opened new paths for the development of an efficient prediction method . 452 modified lysine instances (positive instances) were obtained from dbptm, from training sets and sites supplemented for sumopre and sumosp and in the publication titled sumo targets and site prediction: combining pattern recognition and phylogenetic conservation by xue et al . . Primary sequences around these residues were retrieved from uniprotkb in the form of 21-mer peptides: sumoylated lysine residue had 10 residues upstream and 10 residues downstream of it . The remaining 7346 lysine residues in these proteins, that is, lysine residues not reported to be modified, were assumed to be unmodified (negative instances) from a total lysine count of 7639 as calculated from mapres, and 21-mer peptides were generated for them as well . It is better to use numerical data for the development of a predictor, so every amino acid was encoded furthermore with the coefficients given in numeric matrices of chosen amino acid properties (table 1) in the aaindex . Each peptide could be represented by a 1621 dimension feature vector; that is, it could have 336 possible feature dimensions vectors . This data was made workable with weka by converting all the information into csv format followed by conversion to arff . In weka, the random forest was trained using a dataset that had equivalent amount of modified and unmodified instances; the unmodified instances were randomly selected from the larger bulk of 7346 sites . The choice of 21-mer peptide length around the target lysine site was tested against the same sites being present in 11-mer and 7-mer peptides as well . Each peptide in the latter categories could be represented in 1611 = 176 and 167 = 112 dimension feature vectors, respectively . The datasets were not formally divided into training or test sets for accuracy measurement; instead percentage split in weka was employed for this purpose to optimize the size of train and test . The dictated percentage of the original data including the most ideal - to - train instances is extracted and used as training data while the rest is used to test (s2 and s3). Accuracy measures were calculated using (1)sn = tptp+fn, sp = tntn+fp, mcc=(tptn)(fpfn)((tp+fp)(tp+fn)(tn+fp)(tn+fn)). To test our predictor's power, that is, self - consistency test, k - fold cross - validation, and jack knife (leave - one - out cross - validation). Specificity, sensitivity, accuracy, and correlation coefficient for these tests were computed (figures 2 and 3). Self - consistency test: it is predicted whether a given instance is positive or negative using the rules of the training dataset itself . K - fold cross - validation: here the dataset is randomly divided into k sections . Typical training procedure is conducted using k 1 sections while the remaining one is used as test . This is repeated k times until every set has been used as test exactly once . Jack knife cross - validation: this is also called leave - one - out cross - validation and is an extension of the k - fold cross - validation, having k equal to the exact number of instances in the dataset . The said number of decision trees is generated with each tree having paths and nodes . Every node then uses rules derived from patterns in the data to decide between two or more paths . A given instance is classified by the last rule . To develop and grow the decision trees, a random selection of inputs and features voting on the class for a given instance is then carried out by the trees . Significant increase in classification accuracies have been observed if assortment of classifier trees is used and allowed to vote for the most popular class . Often random vectors are generated which govern the growth of each tree in the assortment . To see how a random forest actually shapes its model we should know that inherently for the kth tree a random vector k is generated, independent of all the previous vectors produced, but it has the same distribution . Now a tree is grown using the training set provided and k, which makes a classifier h(x, k); here x is the input vector . The nature and dimension of k depends on its use in the construction of the tree . After a large number of trees it is difficult to interpret models developed through random forest; but there are certain features which make it suitable for the prediction of ptms: a mixture of discrete and continuous descriptors, binary, or multiclass data can be proficiently treated with random forest algorithm . This algorithm is successful even when there is a lot of disorder in the data . The number of different types of amino acid residues prevalent around the modified sites was analyzed (table 2) with all results substantiated through corresponding frequency plot (figure 4) of the same dataset . Results confirm the prevalence of the kxe motif; approximately only 24% modified sites in this research lack the consensus motif . At 1 position or in place of, it is not just any hydrophobic amino acid; the data based on 293 modified instances has a significantly higher occurrence of hydrophobic amino acids with aliphatic side chains: val (73 occurrences), leu (45), and ile (92) as compared to those with aromatic side chains: phe (9), tyr (2), trp (0), and his (1) and other hydrophobic residues . In place of x or at + 1 position a dominance of polar amino acids including glu (33), the bulky aromatic: trp (3), tyr (4), and his (4) and small - size amino acids: asn (6) and cys (3) are in a significantly lesser proportion . At + 2 position, the incidence of trp and cys is strikingly low at all twenty positions around the target lysine, the highest being only 11 for cys at position + 10 . The other three aromatic amino acids phe, tyr, and his also do not prevail around the target lysine, supporting the imperative role of a catalytically favorable presentation of lysine in its sumoylation . Aromatic molecules could potentially compromise this presentation leading towards the unavailability of target lysine to incoming sumo . In order to derive a good prediction model, the optimum window length of the peptides used for its training has to be determined . As shown in figure 5, values for all four accuracy measures are highest for peptides of window size 7 as compared to others . For 93% split (discussed in section 2.2) of original dataset to train (7% is test) at window size 21 lowest accuracy of 87.8% is encountered in comparison to 92.7% at 11 window size and 97.56% at 7 window size . Mcc and sensitivity show significant ascensions: from 75% for 21-mer peptide to 95% for 7-mer peptide and from 85% for 21-mer to 100% for 7-mer, respectively . Interestingly, an evaluation conducted for the same accuracy measures against window size during development of sumopre also resulted in the same window size being chosen as the best length . Hence, with all the information and comparisons, window size 7, which has 3 residues downstream and 3 residues upstream of the target lysine residue, is the most rational choice for our prediction model . The addition of information on physicochemical properties of amino acid residues produced powerful accuracies given in table 3 . From the several models generated, the best with the chosen window size was further substantiated by testing its stability through three procedures discussed in section 2.3 . In figure 2, accuracy measures for several k - fold cross - validations, jack - knife and self - consistency tests have been visualized . Results of the former two types of tests were all of nearly equal values with small deviations from mean while the latter varied significantly towards greater robustness; roc for these tests can be observed in figure 3 . Average values of k - fold tests and loocv for ac remained at 82%, sn at 86%, sp at 80%, and mcc at 0.66 . The last type of test, self - consistency, gave a 100% result as shown in figure 2 . The large range of biological processes and localizations populated by sumo targets presents a great motivation to unravel information regarding sumoylation and its targets by all possible means . Rigorous wet - lab experiments are frequently undertaken to isolate, identify, quantify, and report sumoylation . Sumoylated proteins have been identified in yeast strains [51, 60] using mass spectrometry, chromatography proteolytic digestion, and so forth, on a trial and error basis to find target lysine residues . On larger scale, proteomes having larger and more complex proteins with many sumoylatable lysine residues are also analyzed through mutational analysis . However, these randomly executed experiments not only take up significant amount of time but also consume physical and chemical toils that are often futile as they result in discovering lysine residues that do not undergo sumoylation . Computational prediction of target sites has become mandatory before conducting experiments; this enables researchers to directly focus on residues which are potential candidates of sumoylation . This dry - lab testing prior to corresponding wet - lab experimentation has gained much attention due to its cost effectiveness and power in proteomic data mining . Till now, nine prediction models for sumoylation have been proposed, out of which six have reported servers including sumoplot (web server), sumosp 1.0 and 2.0 (downloadable), sumopre (web server), boshu liu's psfs method (web server), sspfs (available upon request), and seesumo (web server). Sumoplot was the first step in development of computational server for the prediction of sumoylation sites but had a bias of kxe sites in data . Sumosp, 2006, was presented as sumosp 1.0 and sumosp 2.0 that were generated using gps and motifx (originally developed for phosphorylation) with sequence information only like sumoplot . Liu et al . Developed a psfs - based prediction model in 2007 trained on hundreds of amino acid properties from which seven were selected as relevant with the help of sequential forward selection . Sumopre, 2008, was developed on the basis of sequence data only with probabilistic model of prediction . Its accuracy of 97.7% is impressive but at the cost of its sensitivity which is only 73.96% . Sumosvm, 2008, was developed using support vector machines trained on sequence information, solvent accessibility, secondary structure, and evolutionary profiles . Findsumo, 2008, was soon after developed by the pssm system and with little progress in prediction efficiency . Sspfs, 2009, was developed using mrmr and nearest neighbor algorithm trained on seven optimal amino acid properties selected from hundreds of amino acid properties . Sumotr, 2010, introduced the use of hydrophobicity, 3d structure, protein volume, and sequence to shape a model through tree classification algorithms . Recently, seesumo, 2011, was introduced as a web server using random forest - based algorithm for training, but due to unavailability of its full publication, comparison and information about it have not been included here . Physicochemical properties including hydrophobicity, buriability, isoelectric point, hydrophilicity, polarity, bulkiness, and molecular weight of residues control the spatial flexibility of target residue and hence can be very important in site attachment by developing complementarity between sumo, enzymes in the pathway, and the target itself . Here, a computational system (s4) for the prediction of sumoylation and investigation of its dependence on proposed properties (table 1) has been developed using random forest - based classifier provided in weka . Different programs developed for sumoylation prediction are not directly comparable as they were developed using not only different datasets but also varied cross - validations and methods . Hence, the mcc, which is designed to assess predictive values for models from classes of different sizes, should be considered the primary measure for the purpose . It has a value between + 1 and 1, with + 1 being the highest level of prediction, 0 being the average level, and 1 showing inverse prediction . Table 4 shows the reported ac, sn, sp, mcc, and auc with their proposed training and evaluation procedures . In comparison to previous prediction methods that employed highly unbalanced datasets, equivalent amounts of modified and unmodified sites has used uneven data with a very large part of the whole dataset being based on unmodified sites . Large number of unmodified instances yields a high specificity by making the correct prediction of nearly all such sites possible, at the cost of lowered sensitivity . Unbalanced dataset reduces performance and reliability so we have made a balanced set by sampling modified and unmodified sites in equal ratios . Moreover, approximately 24% of validated sumoylation sites do not conform to the consensus motif and their representative peptides have been used in training of this model, and hence, the specificity of our prediction model is for both consensus and nonconsensus sequences, reducing the difficulty faced in prediction of the latter ones . These considerations ensure a uniformity of predictability when the predictor comes across either known or unknown sequences . Prediction accuracy achieved in this research is significantly higher than all other prediction methods except that of sumopre and sumosvm, to which it is fairly equal . However, our prediction model has exceeded all predictors with its high mcc, sensitivity, and auc . Particularly, the sensitivity (correct classification of sumoylated samples) and mcc (the measure of the overall performance of biased datasets) are higher than all others . On specificity (correct classification of non - sumoylated samples) measures it retains a similar position even after the usage of an equivalent amount of modified and unmodified sites for training . Based on the prediction performance, we believe that sumohunt can very well be used to implement a prediction server in the future that can assist as powerful and complementary tool for sumoylation site identification and that the model will be available for the purpose . Correct analysis of this modification in all proteomes can greatly enhance our knowledge of the mechanism and working of many biological systems . Computational methods of estimation can never replace experimental methods but can be of invaluable support to quicken and focus experimentation . In this research, based on experimental data, a prediction model has been developed that assures of robust computational method for highly accurate and specific sumoylation - site prediction . Moreover, the physicochemical properties proposed to be playing crucial role in the appropriate presentation and hence rapid sumoylation of target lysine have brought significant improvement in accuracy measures . This opens new paths to future work in analyzing the effect of these amino acid properties experimentally . Most importantly, based on the model presented here, it gives the possibility of building a server for prediction of sumoylation sites in relation to the spatial properties of amino acid around them and sequence information.
|
Historically, among various cultures, weight gain has been viewed as a sign of wealth and prosperity but as the dynamics of food production and consumption have changed, the world now faces an epidemic of obesity . According to the world health organization (who), worldwide prevalence of obesity has doubled since 1980 with estimated 1.5 billion adults with obesity in 2008 . In the united states, more than 64% of the population is overweight (bmi 25 kg / m), and more than 33% of the adult population meets criteria for obesity (bmi 30 kg / m). On a similar note, more than 25 million us adults have type 2 diabetes mellitus, and this figure will likely reach 50 million by 2050 given the current demographic trends and continued progression of obesity [3, 4]. The increasing worldwide prevalence of diabetes mellitus and obesity has projected concerns for increasing burden of cardiovascular morbidity and mortality . The dangers of obesity in adults and children have received more attention than ever in the recent years as more research data becomes available regarding the long - term health outcomes . The increasing rates of diabetes in children and adolescents and the limited capacity of the current therapeutic treatments to slow the disease progression raise the concern for a full blown diabetes tsunami for the generations to come . Weight loss in obese and overweight subjects can be induced via intensive lifestyle modifications, medications, and/or bariatric surgery . These methods have been shown to confer overall health benefits; however, their effect on remission of preexisting diabetes mellitus and reduction in cardiovascular risk has been variable . Recent research data has offered a much better understanding of the pathophysiology and outcomes of these management strategies in obese patients . In this paper, the authors have summarized the results of major studies on remission of type 2 diabetes mellitus and reduction of cardiovascular events by weight loss induced by different methods . Furthermore, the paper aims to clarify various prevailing myths and practice patterns about obesity management among clinicians . In preparation for this paper, several online search engines were used to gather journal articles that focused on studying the efficacy of surgical weight loss as compared to the conventional medical therapies and intensive lifestyle modifications . An initial advanced literature search was conducted by pubmed and medline using a combination of key words that included epidemiology, obesity, weight loss, diabetes mellitus, and bariatric surgery which yielded 831 articles . Furthermore, an individual screening of the articles was conducted for prospective, randomized, and controlled trials comparing the effectiveness of surgical versus medical / lifestyle intervention for weight loss and long - term cardiovascular and diabetes outcomes . Also, the cochrane collaborative database was utilized to obtain articles on the latest information on weight loss and its effects on cardiovascular risk . To write our paper, we finally selected 56 articles, based on the study design and power, which were relevant to our current discussion . Studies referred were original research, both prospective and retrospective controlled studies, and three large meta - analyses . The current review aims to draw evidence based conclusions, utilizing the latest research data, which can be utilized to guide the treatment of the obese diabetic patient population . Recent data has suggested that diabetes mellitus may be reversed or prevented with weight loss strategies in obesity [4, 6]. The exact definition of diabetes remission remains an area of debate; however, the american diabetes association (ada) currently defines this as the achievement of euglycemia without pharmacological treatment for at least 1 year . Partial diabetes remission is defined as a transition from meeting diabetes criteria to a prediabetes glycemia level (i.e., fasting plasma glucose of 100126 mg / dl and hba1c of 5.76.5%) and complete diabetes remission as the transition from diabetes criteria to full glucose normalization (i.e., fasting plasma glucose <100 mg / dl and hba1c <5.7%). Although this is a good operational definition, according to glycemic and pharmacological criteria, it does not account the underlying beta - cell function and insulin action and thus may be inappropriate to define a cure of diabetes . The most recently published data from the look ahead trial showed that the intensive lifestyle intervention (ili) is superior to conventional diabetes education in inducing weight loss and partial or complete remission of diabetes mellitus . Ili included weekly group and individual counseling in the first 6 months, followed by 3 sessions per month for the second 6 months and twice - monthly contact and regular refresher group series and campaigns for 3 years . The ili aimed to limit total caloric intake to 1200 to 1800 kcal / d through reductions in total and saturated fat intake and by increasing physical activity levels to a goal of 175 min / wk . Participants in the conventional diabetes education were offered 3 group sessions each year focusing on diet, physical activity, and social support . At 2, 3, and 4 years, respectively, 9.2%, 6.4%, and 3.5% of intensive lifestyle intervention participants (n = 2262) had partial diabetes remission compared with 1.7%, 1.3%, and 0.5% of participants in the diabetes support and education group (n = 2241). Complete remission was; however, rare: 1.3% and 0.7% at 1 and 4 years . Participants with early stage diabetes (shortest duration, not treated with insulin, good baseline glycemic control) were the most to benefit from ili . Furthermore, the study also showed that ili leads to significant improvements in other health indicators, such as body weight, fitness, blood pressure, glycemic control, and lipids . Despite improvements in risk factor profiles, ili did not result in decrease of cardiovascular events (nonfatal myocardial infarction, hospitalization for angina, nonfatal stroke, or death) compared to conventional diabetes education and therapy . As the primary end point was not met, it led to premature termination of the look ahead trial . The results of the look ahead trial are somewhat similar to action in diabetes and vascular disease (advance) trial, action to control cardiovascular disease in diabetes (accord) trial, and veterans affairs diabetes trial (vadt). In these trials, intensive medical / antiglycemic therapy did not show any cardiovascular benefit despite better diabetes control and improvement in cardiovascular risk factors . In the accord trial, the mortality rate was about 19% higher in the intensive glucose management group as compared to standard glucose management group [1113]. Nevertheless, it should be noted that most patients in the accord, advance, and vadt trials had longstanding diabetes with preexisting overt cardiovascular disease . In contrast to these studies, intensive antiglycemic therapy in newly diagnosed type 2 diabetics (ukpds study) without overt coronary heart disease resulted in reduction in coronary events . Nonetheless, the effect on cardiovascular risk reduction became apparent after several years of treatment . One may argue that the results of the look ahead trial could be similar to the ukpds study with longer followup, but the results could have been affected by the use of statins and medical therapy including angiotensin converting enzyme inhibitors in both the study groups . Orlistat leads to about 3 kg weight loss; however, no reduction in cardiovascular events has been shown despite the weight loss and improvement in diabetes mellitus and lipid parameters . Sibutramine use has been linked to increased number of nonfatal myocardial infarction and stroke despite weight loss, and for this reason, sibutramine was withdrawn from the market in october 2010 . Two other studies, the ukpds and steno trials, reported important findings in regards to reduction in cardiovascular events with better diabetes control . The open, parallel steno trial studied a composite end point of death from cardiovascular causes, nonfatal myocardial infarction, nonfatal stroke, revascularization and amputation in patients with type 2 diabetes . The study concluded that a focused multifactorial intervention that includes pharmacological therapy along with behavior modification and aspirin therapy decreased the risk of cardiovascular disease and the overall levels of glycosylated hemoglobin, blood pressure, cholesterol, and triglycerides levels as well as urinary albumin excretion . Interestingly, the 13-year followup to the steno trial (steno-2) did not reveal any significant weight loss in either study groups despite the sustained reduction in cardiovascular events in the intensive therapy group posing a question for whether weight loss plays a key role in cardiovascular risk reduction . The study showed a 50% overall risk reduction in cardiovascular and microvascular events with the implementation of the intensive multifactorial treatment . The ukpds trial on the other hand, randomly assigned 4209 patients with newly diagnosed type 2 diabetes to either conventional therapy (dietary restriction) or intensive therapy (sulfonylurea or insulin or in obese subjects metformin). The study's 10-year followup concluded that despite the loss of glycemic differences between the two groups, a continued reduction in microvascular risk and an overall risk reduction for myocardial infarction and death from any cause were observed . A summary of the main findings of various research studies is enclosed in table 1, whereas table 2 gives a summary of the baseline characteristics of the study participants for the accord, ukpds, look ahead, vadt, and advance trials . There is increasing evidence that bariatric surgery is more effective than medical or lifestyle interventions for weight loss, reduction in cardiovascular risk, and diabetes remission . The reduction in comorbidities by bariatric surgery appears to translate into a 29% mortality reduction rate [19, 20]. A large cohort study of nearly 8000 patients who had undergone roux - en - y surgery was matched to a similar sized cohort . In this study the patients with roux - en - y had a reduction of all - cause mortality by 40%, diabetes - related mortality by 92%, coronary artery disease related mortality by 56%, and mortality from cancers by 60% . A large meta - analysis published in 2009 based on the results of 621 studies (from 1990 to 2006) reported that average weight loss by a bariatric surgery was about 38.5 kg or 55.9% excess body weight loss . Overall, 78.1% of diabetes patients had complete resolution and diabetes was improved or resolved in about 86.6% of the patients . Weight loss and diabetes resolution were found to be the greatest for patients undergoing biliopancreatic diversion / duodenal switch, followed by gastric bypass, and the least with banding procedure . In a recent analysis of severely obese patients with diabetes, the adjusted probability of initial remission of diabetes mellitus was found to be 12-to-24-fold greater for patients who underwent bariatric surgery than for those who underwent medical care alone . Bariatric subjects also experienced lower relapse rates of diabetes compared to the nonsurgical subjects and without higher risk of death . Another large multisite retrospective cohort study of adults with uncontrolled or medication - controlled type 2 diabetes who underwent gastric bypass reported that 68% patients experienced an initial complete diabetes remission within 5 years after surgery, of which 35% redeveloped diabetes within 5 years . Significant negative predictors of diabetes remission were poor preoperative glycemic control, insulin use, and longer diabetes duration . Weight trajectories after surgery were significantly different for never remitters, relapsers, and durable remitters . Recently reported the results of a prospective study which gathered data 6 years after roux - en - y gastric bypass (rygb) surgery and aimed to examine the association of the surgery with weight loss, diabetes mellitus, and other health risks . They found that remission of type 2 diabetes was significantly more common among patients who underwent rygb (62%) than among severely obese subjects with diabetes who initially sought but did not undergo bariatric surgery (6%) and those who never sought bariatric surgery (8%). The swedish obese subjects (sos) study is an ongoing, nonrandomized, controlled, prospective, and matched study conducted at 25 public surgical departments and 480 primary health care centers in sweden of 2010 obese participants who underwent bariatric surgery and 2037 contemporaneously matched obese controls who received usual care . Published the 2-year and 10-year follow - up results of sos study in 2004 where they found that after two years, the weight had increased by 0.1 percent in the control group and had decreased by 23.4 percent in the surgery group (p <0.001) and after 10 years, the weight had increased by 1.6 percent in the control group and decreased by 16.1 percent in the surgery group (p <0.001). Energy intake was lower and the proportion of physically active subjects higher in the surgery group than in the control group throughout the observation period . Two- and 10-year rates of recovery from diabetes, hypertriglyceridemia, low levels of high - density lipoprotein cholesterol, hypertension, and hyperuricemia were more favorable in the surgery group than in the control group, whereas recovery from hypercholesterolemia did not differ between the groups . The surgery group had lower 2- and 10-year incidence rates of diabetes, hypertriglyceridemia, and hyperuricemia than those of the control group; differences between the groups in the incidence of hypercholesterolemia and hypertension were; however, undetectable . Published another followup results of the sos study in 2012 where they reported that bariatric surgery was associated with reduced incidence of fatal and total cardiovascular events, myocardial infarction and stroke even after the adjustment of baseline conditions (adjusted hazard ratio of 0.47; 95% ci 0.290.76; p = 0.002 for all cardiovascular deaths and adjusted hazard ratio of 0.67; 95% ci 0.540.83; p <0.001 for all first time fatal or nonfatal cardiovascular events). Another prospective, nonrandomized, and controlled one year clinical trial aimed to compare the effects of roux - en - y gastric bypass surgery and comprehensive lifestyle intervention on type 2 diabetes and obesity - related cardiovascular risk factors reported mean one - year weight loss of 30% and 8% respectively in the surgical and medical intervention groups . Beneficial effects on glucose metabolism, blood pressure, lipids, and low - grade inflammation were observed in both groups . Remission rates of type 2 diabetes and hypertension were significantly higher in the surgery group than the lifestyle intervention group; 70 versus 33%, p = 0.027, and 49 versus 23%, p = 0.016 . The surgery group experienced a significantly greater reduction in the prevalence of metabolic syndrome, albuminuria, and electrocardiographic left ventricular hypertrophy than the lifestyle group . Gastrointestinal symptoms and symptomatic postprandial hypoglycemia developed more frequently after gastric bypass surgery than after lifestyle intervention, though mortality in either group was not significantly different . One very recent prospective, randomized, and nonblinded clinical trial with one - year follow - up period, performed at the cleveland clinic, evaluated the efficacy of intensive medical therapy alone versus medical therapy combined with roux - en - y gastric bypass or sleeve gastrectomy in 150 obese patients with uncontrolled diabetes mellitus and reported hba1c reduction to 6% in 12% patients receiving medical therapy versus 42% in gastric - bypass group and 37% in sleeve - gastrectomy group . Weight loss and improvement in insulin resistance was significantly higher in both the surgical groups than in medical therapy only group . The use of drugs to lower glucose, lipid, and blood - pressure levels decreased significantly after both surgical procedures but increased in patients receiving medical therapy only . Conducted a single - center, nonblinded, randomized, and controlled trial comparing the efficacy of roux - en - y gastric bypass and biliopancreatic diversion versus medical therapy for the remission of diabetes mellitus in morbidly obese diabetic patients . At 2 years, diabetes remission occurred in no patients in the medical - therapy group versus 75% in the gastric - bypass group and 95% in the biliopancreatic - diversion group (p <0.001). Age, sex, baseline bmi, duration of diabetes, and weight changes were not significant predictors of diabetes remission or of improvement in glycemia . Though the average baseline glycated hemoglobin level had decreased in all groups, patients in both the surgical groups had greater degree of glycemia improvement than those of medical therapy group, the greatest improvement to have noted in the biliopancreatic - diversion group . Though previous studies have offered a strong evidence of benefit of bariatric surgery in patients with a bmi> 40 kg / m, the benefits in patients with a lower bmi obese patients, that is, mild (bmi = 3035 kg / m) or moderate obesity (bmi = 3540 current indications of bariatric surgery in obese patients as defined by the national institute of health are: bmi> 40 kg / m or bmi> 35 kg / m associated with serious comorbidities like diabetes, sleep apnea, obesity - related cardiomyopathy, or severe joint disease . However, recent data also suggests benefit of bariatric surgery in mild and moderate obesity patients . A recent prospective study compared the effects of laparoscopic sleeve gastrectomy (lsg) versus medical therapy on patients with type 2 dm and a bmi of <35 kg / m and reported diabetes mellitus and hypertension remission rate of 88.8% (8 of 9 patients) without undesirable excessive weight loss as compared to none of the patients (0 of 9 patients) undergoing remission in the medical therapy group . Another prospective, consecutive, and nonrandomized trial of 79 patients investigate the role of sleeve gastrectomy for patients with class i obesity (bmi 3035 kg / m) and reported promising early weight loss and quality of life improvement in patients . One of the largest, prospective randomized trials published to date studying the long - term impacts of rygb (followup being 6 years) on patients with diabetes and only class i obesity reported durable diabetes remission occurred in 88% of cases, with glycemic improvement in 11% . Mean hba1c fell from 9.7 1.5 to 5.9 0.1% (p <0.001), despite diabetes medication cessation in the majority . Weight loss failed to correlate with several measures of improved glucose homeostasis, consistent with weight - independent antidiabetes mechanisms of rygb . Hypertension and dyslipidemia also improved, yielding 5084% reductions in predicted 10-year cardiovascular disease risks of fatal and nonfatal coronary heart disease and stroke . In addition, post hoc study findings reported by sjstrm et al . Demonstrated that a higher baseline bmi may not be associated with a greater benefit of bariatric surgery . Other important comorbidities that deserve to be mentioned in this paper are nonalcoholic fatty liver disease (nafld) and non - alcoholic steatohepatitis (nash) as they may frequently be considered a part of the metabolic syndrome (insulin resistance). Some studies have reported improvement in nafld, adipokines (used to measure fatty liver disease), and insulin resistance after weight loss with bariatric surgery [36, 37]. However, randomized trials to confirm these findings are lacking and thus use of surgical approach for these conditions remains controversial . Though our current discussion mainly focuses on the review and comparison of effectiveness of medical versus surgical weight loss strategies; however, we wanted to mention here the results of another most recent randomized trial which showed that the use of mediterranean diet results in the reduction of major cardiovascular events especially in obese patient population . This study mainly compared the cardiovascular outcomes in patients receiving mediterranean diet versus those receiving regular controlled diet . None of the study patients were advised either total calorie restriction or promotion of physical activity . The effects of mediterranean diet on the weight / bmi were also not the major focus of this study . To best of our knowledge, this study is the first largest prospective study which showed significant cardiovascular risk reduction in obese patients with the use of mediterranean diet and thus this opens up a consideration for recommending the use of this dietary lifestyle intervention which may potentially reduce cardiovascular risk in obese patients . Look ahead trial, the largest prospective trial comparing efficacy of ili with standard diabetes education and management (sde) in obese diabetics, failed to show any additive benefit of ili over sde in the improvement of cardiovascular outcomes despite an observed improvement in weight loss, body fitness, and diabetes remission . Complete diabetes remission with ili was rare, but partial diabetes remission even though significant in the initial years was not long lasting . Partial diabetes remission with ili was most effectively achieved in patients with short duration diabetes history, who have lower hba1c levels and those who do not yet require insulin therapy, suggesting that emphasis on early diabetes screening and probably intensive / aggressive management in the early course of the disease warrants more attention . Some prior studies of medication based therapy have shown that reductions in hba1c and fasting glucose, if sustained, are likely to considerably reduce the risks of microvascular complications [40, 41]. One could argue that failure of demonstrating any benefit in the cardiovascular outcomes with ili in the look ahead trial could be because of improved cardiovascular risk factor control in both the study groups through medical treatment, improved clinical care after acute cardiovascular events, enrollment of a healthier - than - expected patient cohort and excluding patients with high baseline cardiovascular risk factors . However, based on the current evidence, intensive medical therapy alone does not appear to be very promising in improving cardiovascular outcomes or producing long - term diabetes remission . In contrast to weight loss by medications or intensive lifestyle modification, bariatric surgery has shown to be very effective in improving cardiovascular health and in producing diabetes remission in obese diabetic patients by the majority of both long - term and short - term cohort and prospective studies . Although one may assume that the degree of postoperative weight loss might be the major driver for improvement in diabetes mellitus in obese patients undergoing bariatric surgery, the weight loss and type 2 diabetes are often not in a direct cause - and - effect relationship . The improvement of diabetes mellitus occurs within days after gastric bypass, before there is significant weight loss [4244]. These findings suggest that bariatric surgeries may affect the diabetes course independent of the weight . Suggested that changes in the gut hormonal milieu after bypass of the distal stomach, duodenum, and proximal jejunum can influence the mechanism of type 2 diabetes . Other mechanisms involved may be changes in neurohumoral regulation, increased expression of glucose transporter type 4 (glut4), and normalization of whole - body insulin resistance . Though bmi is still the most widely used criteria for selection of patients for bariatric surgery in clinical practice, this practice pattern may change as the recent data shows significant benefit of bariatric surgery in mild and moderately obese patients . Also, one study findings suggested that high insulin levels may be a better selection criterion for bariatric surgery than high bmi, as far as cardiovascular events are concerned . As seen with intensive lifestyle treatment, patients with early stage diabetes appeared to benefit most from bariatric surgery; so a strong argument can be made for considering earlier surgical intervention in moderately obese patients (body mass index 30) with early stage diabetes . At the same time, offering bariatric surgery to every obese diabetic individual may impose serious practical concerns which include nonbenign nature of the surgical intervention (including some associated long - term mechanical and nutritional complications), nonsustained beneficial long - term effects, as shown by holman et al . And arterburn et al ., and significant increase in the nationwide healthcare burden related to the cost of intervention . I should advise my obese diabetic patients to follow intensive dietary and exercise (lifestyle) interventions as this would decrease their cardiovascular risk as compared to routine interventions and medical therapy this is the most common myth which prevails among clinicians, may it be general internists or cardiologists . Though this statement sounds very conceptual, the prospective studies have jolted this prevailing belief as intensive lifestyle interventions have not shown to decrease cardiovascular morbidity and mortality in these patients despite improvement in other health indicators like weight loss, body fitness and diabetes remission . Though with that being said, data in these studies have their own limitations as discussed earlier and the authors feel it should not preclude clinicians from advising their patients to adopt healthier lifestyle measures including intensive lifestyle interventions for management of diabetes in obesity . Poorly controlled diabetics with a long standing history of disease are most likely to benefit from intensive lifestyle therapy for their diabetes control or remission as we discussed earlier, data from prospective studies have shown that newly diagnosed diabetics or diabetics with better glycemic control are in fact more likely to achieve a partial or transient complete diabetes remission with intensive lifestyle modification and medical therapy, as compared to patients with long standing history of disease . Bariatric surgery is more effective than medical management in inducing diabetes remission because it induces rapid and more weight loss the improvement of diabetes mellitus occurs within days after gastric bypass, before there is significant weight loss . Changes in the gut hormonal milieu after gastric bypass, changes in neurohumoral regulation, and normalization of whole body insulin resistance have been proposed to be additional mechanisms providing therapeutic benefit . Weight loss strategies in obesity should include setting of realistic goals because otherwise patients will become frustrated and lose less weight . Answer . Although this sounds a very reasonable concept, several studies have offered contrasting data and support that more ambitious goals are associated with better weight - loss outcomes [47, 48]. Study results were more supportive of the idea that higher goals motivate patients to lose more weight than of the hypothesis that high goals undermine effort . Large amount and rapid weight loss is associated with poorer long - term outcomes, as compared with slow, gradual weight loss this belief probably emerged over five decades ago in reaction to the adverse effects of nutritionally insufficient very - low - calorie diets (<800 kcal per day) and has persisted to the extent that it may be common advise by many regular dieticians . In several prospective trials, patients often undergo more rapid and greater initial weight loss and this has been associated with lower body weight at the end of long - term followup . Some obese persons have a greater initial weight loss than others do due to unclear reasons, thus a recommendation to lose weight more slowly might interfere with the ultimate success of weight - loss efforts . People often may feel that they spend a lot of energy (about 100300 kcal) while indulging in one sexual intercourse . Studies have shown that an average bout of sexual activity lasting for about 6 minutes approximately expends only 21 kcal . Breastfeeding has been advocated to offer a protective benefit against the development of childhood obesity, for a long time . The incidence of type 1 diabetes is reduced by 30% in infants exclusively breastfed for at least 3 months . A reduction of 40% in type 2 diabetes also is reported, possibly reflecting the long - term positive effect of breastfeeding on weight control and feeding self - regulation . However, more recent data from prospective randomized controlled studies do not support the theory of antiobesity effects of breast milk to the children [5355]. Dietary or behavioral modifications are not going to work, so why even bother? Identification of key environmental factors and then successful interventions can achieve clinically significant reductions in obesity . Bariatric surgery offers benefits only in patients with bmi> 40 or bmi> 35 with associated severe comorbidities . Answer . Though bmi is still the most widely used criteria for selection of patients for bariatric surgery in clinical practice, this practice pattern may change as the recent data from multiple studies shows significant benefit of bariatric surgery in mild and moderate obese patients . I should advise my obese diabetic patients to follow intensive dietary and exercise (lifestyle) interventions as this would decrease their cardiovascular risk as compared to routine interventions and medical therapy . This is the most common myth which prevails among clinicians, may it be general internists or cardiologists . Though this statement sounds very conceptual, the prospective studies have jolted this prevailing belief as intensive lifestyle interventions have not shown to decrease cardiovascular morbidity and mortality in these patients despite improvement in other health indicators like weight loss, body fitness and diabetes remission . Though with that being said, data in these studies have their own limitations as discussed earlier and the authors feel it should not preclude clinicians from advising their patients to adopt healthier lifestyle measures including intensive lifestyle interventions for management of diabetes in obesity . Poorly controlled diabetics with a long standing history of disease are most likely to benefit from intensive lifestyle therapy for their diabetes control or remission, data from prospective studies have shown that newly diagnosed diabetics or diabetics with better glycemic control are in fact more likely to achieve a partial or transient complete diabetes remission with intensive lifestyle modification and medical therapy, as compared to patients with long standing history of disease . Bariatric surgery is more effective than medical management in inducing diabetes remission because it induces rapid and more weight loss . Answer . The improvement of diabetes mellitus occurs within days after gastric bypass, before there is significant weight loss . Changes in the gut hormonal milieu after gastric bypass, changes in neurohumoral regulation, and normalization of whole body insulin resistance have been proposed to be additional mechanisms providing therapeutic benefit . Weight loss strategies in obesity should include setting of realistic goals because otherwise patients will become frustrated and lose less weight . Answer . Although this sounds a very reasonable concept, several studies have offered contrasting data and support that more ambitious goals are associated with better weight - loss outcomes [47, 48]. Study results were more supportive of the idea that higher goals motivate patients to lose more weight than of the hypothesis that high goals undermine effort . Large amount and rapid weight loss is associated with poorer long - term outcomes, as compared with slow, gradual weight loss this belief probably emerged over five decades ago in reaction to the adverse effects of nutritionally insufficient very - low - calorie diets (<800 kcal per day) and has persisted to the extent that it may be common advise by many regular dieticians . In several prospective trials, patients often undergo more rapid and greater initial weight loss and this has been associated with lower body weight at the end of long - term followup . Some obese persons have a greater initial weight loss than others do due to unclear reasons, thus a recommendation to lose weight more slowly might interfere with the ultimate success of weight - loss efforts . People often may feel that they spend a lot of energy (about 100300 kcal) while indulging in one sexual intercourse . Studies have shown that an average bout of sexual activity lasting for about 6 minutes approximately expends only 21 kcal . Breastfeeding has been advocated to offer a protective benefit against the development of childhood obesity, for a long time . The incidence of type 1 diabetes is reduced by 30% in infants exclusively breastfed for at least 3 months . A reduction of 40% in type 2 diabetes also is reported, possibly reflecting the long - term positive effect of breastfeeding on weight control and feeding self - regulation . However, more recent data from prospective randomized controlled studies do not support the theory of antiobesity effects of breast milk to the children [5355]. Dietary or behavioral modifications are not going to work, so why even bother? Identification of key environmental factors and then successful interventions can achieve clinically significant reductions in obesity . Bariatric surgery offers benefits only in patients with bmi> 40 or bmi> 35 with associated severe comorbidities . Answer . Though bmi is still the most widely used criteria for selection of patients for bariatric surgery in clinical practice, this practice pattern may change as the recent data from multiple studies shows significant benefit of bariatric surgery in mild and moderate obese patients . The association of diabetes mellitus, obesity, and cardiovascular risk factors is very complex . Recent research data certainly provides a better understanding; however, many pathophysiologic mechanisms associated with the benefits of medical and surgical interventions remain poorly understood . Clinical education, research, and health policies need to increase their focus towards primary prevention of risk factors associated with diabetes mellitus and obesity especially in children and adolescents who are deemed to be at high risk . Though ili did not appear to reduce the risk of cardiovascular events significantly in prospective studies, the authors feel that it should be recommended to all the patients given the absence of long - term follow - up data and significant health benefits achieved in a subset of patients . Several myths prevail regarding obesity not only among general population but also among clinicians which may affect practice patterns . More education among the patients and general clinicians may produce better healthcare outcomes in obese subjects.bariatric surgery certainly appears to have an emerging and promising future role in the management of cardiac risk factors and diabetes remission in obese diabetic patients, especially in the subset of the newly diagnosed diabetics in this patient population . Furthermore, bariatric surgical intervention has also shown some promising outcomes in the less severely obese patient population who have high cardiovascular risk factors . However, appropriate selection criteria need a consensus opinion involving possible reformulation of the existing guidelines . The association of diabetes mellitus, obesity, and cardiovascular risk factors is very complex . Recent research data certainly provides a better understanding; however, many pathophysiologic mechanisms associated with the benefits of medical and surgical interventions remain poorly understood . Future long - term prospective studies are warranted for a better clinical decision making . Clinical education, research, and health policies need to increase their focus towards primary prevention of risk factors associated with diabetes mellitus and obesity especially in children and adolescents who are deemed to be at high risk . Though ili did not appear to reduce the risk of cardiovascular events significantly in prospective studies, the authors feel that it should be recommended to all the patients given the absence of long - term follow - up data and significant health benefits achieved in a subset of patients . Several myths prevail regarding obesity not only among general population but also among clinicians which may affect practice patterns . More education among the patients and general clinicians may produce better healthcare outcomes in obese subjects . Bariatric surgery certainly appears to have an emerging and promising future role in the management of cardiac risk factors and diabetes remission in obese diabetic patients, especially in the subset of the newly diagnosed diabetics in this patient population . Furthermore, bariatric surgical intervention has also shown some promising outcomes in the less severely obese patient population who have high cardiovascular risk factors . However,
|
Women of reproductive age (wra) in poor countries are at high risk for micronutrient deficiencies, particularly iron and zinc . Who estimates that 30.2% of nonpregnant and 41.8% of pregnant women suffer from anemia, much of it due to iron deficiency [13]. Some 1.2 billion people worldwide are at risk of inadequate zinc intake and presumably many are zinc deficient . Iron deficiency results in anemia, impaired psychomotor development, reduced physical and work capacity, impaired immunity, and adverse pregnancy outcomes . Zinc deficiency is associated with fertility reduction, poor pregnancy outcomes, mental and behavioral changes, impaired immunity, increased morbidity and mortality, and perhaps linear growth retardation [10, 11]. Several strategies have been implemented to address iron and zinc deficiency, including supplementation and food fortification . Although some pathways are unique, iron and zinc have many similar absorption and transport mechanisms and may therefore compete for absorption [12, 13]. Several studies examined the efficacy of supplementation with iron and zinc, but most were conducted in children and involved only daily doses . Little is known regarding the influence of zinc on the efficacy of iron supplementation on a weekly basis, particularly in wra . One study, in bangladeshi infants, examined weekly supplementation of zinc, iron, and of combined iron and zinc . Results showed that weekly provision of both iron and zinc supplementation did not modify the effect of each nutrient when given alone . Recently, a meta - analysis examined the impact of zinc supplementation on biochemical indicators of iron and zinc . This paper, however, did not quantify the effects of adding zinc to iron compared to iron alone on iron and zinc status . The objective of this study is to investigate the efficacy of ifa supplements provided daily or weekly with and without zinc on iron and zinc status in a randomized control trial (rct) carried out in guatemalan wra . The study design, sample size calculation, data collection, and characteristics of the guatemalan rct have been described in detail elsewhere . Briefly, 459 nonpregnant, nonlactating women aged 1549 years from the village of concepcin chiquirichapa located in the western highlands of guatemala were recruited . These women were randomly assigned to receive one of four supplements: (1) weekly 120 mg iron with 30 mg zinc, (2) weekly 120 mg iron, (3) daily 60 mg iron with 15 mg zinc, and (4) daily 60 mg iron . All supplements also contained folic acid (fa) (the weekly arms had either 5000 or 2800 g and the daily arms 400 or 200 g, resp .) And vitamin b-12 (16.8 g for the weekly arms or 2.4 g for the daily arms). Trained field workers from the community visited each woman 7 days a week to deliver and observe the ingestion of the supplements (two - three hours after a meal) for the entire 12-week duration of supplementation . The weekly dose groups received 6 placebos and 1 active pill on the third day of the week . The trial was registered in the us nih clinical trial registry (identification number nct003994862). Dietary intake data at baseline were collected by means of a semiquantitative food frequency questionnaire; socio - demographic information was also collected at baseline . Hb, serum ferritin, c - reactive protein (crp), and serum zinc were measured pre- and post - supplementation . A capillary blood sample was obtained from a finger prick to measure hb concentrations using a b - hemoglobin analyzer . Venous blood was collected for measuring serum ferritin and crp using a nephelometric immunoassay reactive kit and for determining serum zinc using a flame atomic absorption spectroscopy method . Venous blood was collected after an overnight fast using trace mineral free syringes; tubes were centrifuged within an hour at 3,000 rpm for 10 minutes at 4c . The serum was separated and stored at 70c at the institute of nutrition of central america and panama (incap) in guatemala city until analysis at the national institute of public health (niph), cuernavaca, mexico . The time lag between the last consumption of supplement and the blood draw was similar for weekly and daily groups (2.46 1.15 days versus 2.50 1.02 days, p> 0.05). Since willingness to provide a blood sample was a criterion, blood samples were available for all 459 subjects at baseline (figure 1). Of these, 422 (92%) finished the trial; reasons for loss to followup were similar across groups, but the daily iron / zinc group had a higher dropout rate compared to the other groups (p = 0.02). A total of 369 women or 88% also provided an endline blood sample (i.e., 52 women refused). Analyses were performed based on these 369 subjects (88 in the weekly iron and zinc group, 97 in the weekly iron group, 84 in the daily iron and zinc group, and 100 in the daily iron group) or 80% of those randomized at baseline . Subjects included in the analyses had similar baseline characteristics compared to subjects not included (p> 0.05, results not shown). Since the women lived 2600 m above sea level, hb was adjusted for altitude using an exponential curve of hb concentration by altitude described by cohen and haas . The effect of treatment on hb, serum ferritin, and zinc was assessed using a generalized linear regression model (sas proc mixed procedures) assuming unstructured correlation to account for the correlation among the repeated observations for a given subject, using treatment as a fixed factor and time as a covariate . The between - subjects factor was four treatment types and the within - subjects factor was treatment effects (from start to finish of supplementation). Between - group differences in treatment effect would be indicated by a significant interaction between treatment effect and treatment type . This is obtained by fitting the model below: (1)outcome = 0+1time+2treatment+3 time treatment+biother covariates . We investigated further whether the effects of supplementation varied depending on initial hb, serum ferritin, and serum zinc status . G / l, insufficient iron stores were defined as serum ferritin <20 g / l, and depleted iron stores as serum ferritin mg / l), similar at baseline and endline and across groups and their inclusion in the model (as dichotomous variables indicating> 5 mg / l at baseline and endline or alternatively,> 10 mg / l; or as linear and quadratic terms to account for nonlinearity) had only a trivial influence on estimates of the effect of supplementation on serum ferritin values and did not influence the zinc results (results not shown). Thus, for the sake of parsimony, we did not include crp in the models . All statistical tests were two - tailed, and differences were considered significant at p <0.05 . There were no significant differences in selected characteristics across the four treatment groups at baseline (table 1). Levels of hb, serum ferritin, and zinc before and after the intervention by group are shown in table 2 . Mean hb concentrations were not significantly different across the 4 treatment groups at baseline or endline . However, the changes in hb were strongly related to the initial hb concentration (r = 0.65; p <0.001). Overall hb concentrations increased by 21.8 g / l (95% ci: 17.5, 26.2) among anemic women but decreased by 4.8 g / l (6.5; 3.2) among nonanemic women (data not shown). Baseline ferritin concentrations did not differ across groups (p = 0.98) (table 2). Ferritin levels increased significantly in all 4 supplementation groups after 12 weeks of supplementation (p <0.001). The two groups receiving daily supplementation had significantly higher ferritin concentrations than those receiving weekly . : 67, 108) or 31.7 g / l in daily groups compared to 32% (95% ci: 18, 47) or 7.6 no significant differences were found in ferritin levels in the daily groups between those with or without zinc (p = 0.94) or in the weekly groups between those with or without zinc (p = 0.38). The prevalence of anemia before supplementation was 13% and that of insufficient iron stores was 19.7% . There was no difference in the proportion of anemia at baseline and endline by supplement type (table 3). The prevalence of iron insufficiency and depletion decreased significantly but was similar across the 4 groups . Overall iron insufficiency decreased from 19.7 to 6.6% (p <0.001) and iron depletion decreased from 11.5 to 2.7% (p <0.001). Serum zinc concentrations did not change in any of the intervention groups after supplementation (p = 0.55) (table 2). The prevalence of zinc deficiency did not change after supplementation in any of the four groups (p = 0.52) (table 3). In the present study, women randomly assigned to receive daily or weekly fe - fa supplements with or without zinc . Neither daily nor weekly supplementation changed hb concentrations, and the addition of zinc did not influence hb concentrations . However, hb concentrations improved significantly in women who were anemic at baseline by an average of 21.8 g / l . For serum ferritin, significant between- and within - group changes were noted . After supplementation, daily groups showed a much greater increase in serum ferritin concentrations than the weekly groups, suggesting that daily iron supplementation was more efficacious than weekly supplementation in improving serum ferritin concentrations . G / l) in the daily supplement groups compared with 32% (or 7.6 although daily or intermittent iron supplementation, with and without zinc, significantly increased serum ferritin concentration, it did not reduce the percentage of anemic women . One possible explanation is that iron deficiency may be only one of several causes of anemia . G / l, but this increase was not large enough to reduce the prevalence of anemia . Our findings showed that adding zinc to supplements containing iron did not influence iron status but also did not improve zinc status in wra . Therefore, adding zinc to ifa supplements may not be an optimal way to improve zinc status in women . The addition of zinc to ifa may have other benefits for women, but there is limited information . Findings from previous meta - analyses indicate that maternal zinc supplementation resulted in a 14% reduction in preterm delivery but had no significant impact on infant's birth weight nor on other pregnancy outcomes . In a study in peru, 1295 mothers were assigned randomly to receive prenatal supplements containing 60 mg iron and 250 g fa, with or without 15 mg zinc, beginning at 1024 weeks of gestation . Findings from this study suggested that adding zinc to ifa tablets did not affect the duration of pregnancy, size at birth, or developmental outcomes in peruvian children when assessed at 4.5 y of age but did improve postnatal growth . A study in ghana found no difference in the mean weight of newborns of women receiving a combined supplement of zinc and iron compared to those of women receiving iron alone . In a trial in nepal, 4926 pregnant women were allocated at random to five regimens: daily supplements of fa, ifa, ifa with zinc, multiple micronutrients, or vitamin a alone (control). The addition of zinc to ifa reduced the efficacy of ifa on birth weight; the mean birth weight was 53 g (0 g to 108 g) lower in the ifa plus zinc group compared to the ifa group . Also, there was no difference in the proportion of preterm births between these two groups . Finally, fetal loss and infant mortality did not differ between the groups who received ifa only and ifa with zinc [26, 27]. Thus, adding zinc to ifa supplements for women needs to be reconsidered since it appears to not benefit biochemical indicators or functional indicators . More studies that assess the impact of combined iron and zinc on functional status are needed to provide scientific evidence for public health policy . Ultimately, the public health benefit of adding zinc to iron supplements given to women depends on the baseline characteristics of specific populations and on the relative benefits of improving iron and zinc status . Possible reasons for the lack of an effect of adding zinc to iron on zinc status in wra include the negative effect of iron on the absorption of zinc . Unfortunately, the lack of a group that received zinc but no iron in the guatemalan rct does not allow us to test this possibility . A review by solomons (1986) reported that competitive inhibition of zinc uptake by iron can occur at iron: zinc ratios of 2: 1 or greater . The ratio of iron: zinc in the supplements in most studies in women is 4: 1 while that ratio in most studies in children is 1: 1 . In addition, findings from several studies suggest that iron may have deleterious effects on zinc metabolism in women . A significant reduction in zinc absorption was reported when iron was taken with zinc in pregnant [28, 29] and lactating women . In nonpregnant women, oral iron given with there is concern that folic acid supplements may impair zinc absorption [29, 33], possibly by forming an insoluble chelate in the lumen or by a mutually inhibitory effect of zinc and folate on intestinal transport mechanisms . However, subsequent studies failed to confirm the inhibitory effect of folate on zinc absorption or on zinc status [3638]. Another possible but unlikely explanation for the lack of effect of zinc supplementation on serum zinc levels may be that the dose of zinc used was insufficient; we used a dose that was twice the rda . Although several studies have been carried out to assess the interaction between iron and zinc, almost all of them used daily supplementation . To our knowledge, the guatemalan study is the first rct to investigate the influence of zinc on iron efficacy of weekly doses in women . The only other weekly dose study was conducted in bangladeshi infants who were assigned to receive weekly supplementation of 1 mg riboflavin (control), 20 mg iron, 20 mg zinc, or both for 6 months . Findings from that study were that the addition of zinc to weekly iron supplementation improved children's zinc status but had no differential effect on iron status compared to iron alone . The main strength of our study is the rct design; other strengths include the demonstration that randomization was effective, the direct observation of supplement intakes, and the careful standardization and high quality of measurements . While only 80% of women who were randomized at baseline were included in the analyses, those not included did not differ from those included in terms of baseline characteristics . Because of ethical concerns, women with severe anemia (hb <70 thus, the true prevalence of anemia in the population is higher than the prevalence reported in the study (13%). If severely anemic women had been included in the study, the average effect of supplementation might have been larger . A limitation is the absence of a placebo group; hence, we cannot exclude the possibility that community - wide dietary improvements coincided with the beginning of supplementation . Also, the lack of a zinc only group does not allow us to fully assess the interaction between iron and zinc . Another limitation of the guatemalan rct is that it provided nutrients other than iron and zinc . This study was designed primarily to test the relative impact of daily versus weekly folic acid (fa) supplements, with two levels of doses for each . The main conclusion of the study was that weekly fa (either high or low dose) may be as efficacious as daily supplementation (either high or low dose) in improving serum folate levels . Thus, because of a similar response across all groups, we believe that the folic acid in the supplements did not influence the differential responses found across groups . Both weekly groups received 16.8 g and both daily groups received 2.4 g . It was found that daily supplementation improved serum b-12 significantly while weekly supplementation had no effect . Because the key comparisons we make in our rct are between daily supplements with iron versus iron and zinc or between weekly iron supplements with iron versus iron and zinc, vitamin b-12 is not a factor in interpreting these differences . On the other hand, b-12 would be an issue in comparisons of any weekly to any daily iron / zinc group . Finally, another possible limitation of our study is that we included only crp which captures the effects of inflammation early in the acute phase response; it would have been appropriate to have also included alpha-1-acid glycoprotein (agp) to capture later stages of inflammation . Study women had low levels of crp and these levels did not influence the estimation of supplement effects . Crp values were similar across groups at baseline and endline; we would expect other unmeasured, potential confounders, such as agp, to have also been balanced across groups . For these reasons, we think it is unlikely that the omission of agp clouds the interpretation of our results . Both daily and weekly supplementations were efficacious in improving hb concentration in anemic women . However, daily supplementation was more efficacious than weekly in improving ferritin levels . The combined fe - zn supplementation was as effective as iron alone in improving iron status but not effective in improving zinc status.
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.