Split (1)

train · 133k rows

text stringlengths 0 868k
We used the terms hpv and urine to search the pubmed database in august 2012 for relevant literature . The identified studies were then individually evaluated to ascertain whether results on hpv prevalence in adolescents were reported . Studies in hiv - positive populations and renal allograft recipients were excluded as these patient groups have a reported increased risk of hpv infection . Studies that included paired urine and cervical samples were sought as they would allow for comparison of the presence of hpv in both samples . We therefore excluded female studies in which hpv dna was detected in urine samples only, with the exception of the four studies including adolescents as they shed some light on the expected urinary hpv prevalence rates in this group . As few studies in asymptomatic male populations were found, we included the male populations of four studies despite the fact that they may be at greater risk of hpv infection: two studies on male partners of hpv - positive women, one on male partners of women with cervical cancer, and one on males with urethritis . Whenever possible we extracted information on country, recruitment setting, age (range and mean), urine sampling procedure, total sample size, percentage of samples containing human genomic dna, hpv assay used, proportion and type of cervical lesions, and availability of cervical sample . As a main result we report hpv prevalence in urine samples and cervical samples in female study populations . We also report sensitivity, ie, the probability of an hpv - positive urine sample given an hpv - positive cervical sample, and specificity, ie, the probability an hpv - negative urine sample given an hpv - negative cervical sample . Concordance for any hpv type and for hpv16 (and/or hpv18) was measured as the percentage of paired urine and cervical samples that yielded the same hpv result, ie, either both positive or both negative . In contrast, type - specific concordance (combined concordance for a group of hpv types) was measured only in the set of paired urine and cervical samples that were both positive for any hpv type . Within this smaller set of samples, type - specific concordance was calculated as the percent of paired urine and cervical samples that were positive for the same hpv type . Results from 21 female study populations from 17 publications that reported hpv prevalence in urine samples are summarized in table 1 . Prusty et al22 and manhart et al23 included females 1825 years of age, while only two studies, one from scotland by oleary et al24 and one from india by hussain et al,25 included females less than 18 years of age (figure 1 and table 1). The hpv prevalence (any type) varied from 1.1% in the age group 1114 years in the oleary et al24 study to 29.6% in the age group 2021 years in the manhart et al23 study . Oleary et al24 reported the lowest percentage of samples (83.6%) containing amplifable human genomic dna; prusty et al22 reported the highest percentage (100%). We identified 14 studies that measured hpv positivity in paired urine and cervical samples from symptomatic females;18,22,2637 of these studies, nine reported the age range and nine the mean age of the study population . These studies included women with symptoms that led to various gynecological complaints and women diagnosed with invasive cervical cancer . Urine and cervical samples were collected at gynecological, colposcopy, genitourinary, sexually transmitted disease, and adolescent clinics . In general, hpv prevalence increased with the severity of cytological or pathological findings, and this was observed both in urine samples and cervical samples . All studies that reported age - specific hpv prevalence showed lower prevalence in urine samples than paired cervical samples, with the majority of the studies reporting a 10%20% lower hpv prevalence, save the studies by rymark et al33 and cuschieri et al18 (figure 2). With the exception of studies by rymark et al33 and jacobson et al,31 which covered narrow age ranges (1621 years and 1120 years, respectively), the studies in this review generally reported hpv prevalence in a broad age range . Populations presenting cytological or histological pathology generally had a higher hpv prevalence compared to those with normal cytology (figures 1 and 2). The studies showed a 75%100% concordance for any hpv type in paired urine and cervical samples (or 41%93% by kappa agreement). Type - specific concordance was reported in five studies, showing 100%, 90.5%, 71.0%, 70.8%, and 40.0% concordance . The latter estimates were calculated by including hpv - negative samples from either (not both) site, thereby reducing the type - specific concordance . Eight of the eleven studies published after 2000 also reported either type - specific concordance for hpv16 or hpv18, or concordance for the two types in combination . Hpv16-specific concordance or concordance for any hpv type by severity of cervical lesion was reported in three studies . In contrast alameda et al26 reported a higher concordance for any hpv type in low grade squamous intraepithelial lesion (lsil) than in high grade squamous intraepithelial lesion (hsil). Forslund et al29 showed neither an increase nor a decrease in concordance for any hpv type with increasing severity . The only study that estimated sensitivity and specificity for hpv dna detection in urine samples compared to cervical samples in a presumably asymptomatic, drop - in, sexual health service clinic population was published by cuschieri et al18 who reported a sensitivity of 90.6% (95% confidence interval [ci] 79.3%96.9%) and a specificity of 67.6% (95% ci 50.2%82.0%). In the studies with symptomatic populations, the sensitivity varied from 52.9% to 100% . We identified 14 male study populations from 13 publications that reported hpv positivity in urine samples and at least one other urogenital site (table 2). Only the studies by lazcano - ponce et al38 and cuschieri et al18 included males less than 18-years old . The 117 males aged 1625 years in the cuschieri et al18 study showed a 36.7% hpv prevalence in urine samples versus 29.1% in samples taken from the shaft of the penis . The study by lazcano - ponce et al38 included 120 healthy males aged 1455 years in mexico (43 males in the range 1420 years) and reported a 6.9% and 42.7% hpv prevalence in urine samples and urethra samples, respectively . Similarly, hpv prevalence in the other studies listed in table 2 was generally lower in urine samples than in other urogenital samples . For example, weaver et al39 recruited 317 sexually active university students, aged 1825 years, and measured hpv prevalence in urine samples as well as in samples from the glans, penile shaft, scrotum, and foreskin . Samples taken from the foreskin showed the highest prevalence (28.1%), while urine samples showed the lowest prevalence (5.8%). The percentage of urine samples in which human genomic dna could be detected varied substantially between the studies . While weaver et al39 detected human genomic dna in 99.7% of urine samples and 94.0%98.3% of samples from other sites, giuliano et al only detected human genomic dna in 51.3% of urine samples and 84.0%98.0% of samples from other sites, with semen samples having the highest human genomic dna detection rate . In the study by hernandez et al,40 semen samples and urine samples had the lowest human genomic dna detection rate, with 56.1% and 57.0%, respectively, compared to 78.8%95.1% from other urogenital sites . To illustrate some of the technical variability in these studies, we have listed the urine sampling procedure and the dna detection method used (tables 1 and 2). The most common urine sampling procedure in both female and male populations was first - void urine in contrast to mid - stream urine, which vorsters et al17 suggested would be preferable if the goal were to analyze a maximum number of exfoliated cells . The order of urine and cervical sampling may also affect the hpv dna detection rate in urine, and some studies have suggested that it is preferable to collect the urine sample first (reviewed in sehgal et al).21 in the female populations listed in table 1, urine sampling was not always carried out prior to cervical sampling and was sometimes done after washing the genitals . For hpv dna detection, variants of the my09/my11 primer were most commonly used, but other primers, such as general primer gp5/6, in - house primers, e6-primers, hybrid capture ii, and dna chip assays were also used . In summary, the technical variability may contribute substantially to hpv dna detection rates . Results from 21 female study populations from 17 publications that reported hpv prevalence in urine samples are summarized in table 1 . Prusty et al22 and manhart et al23 included females 1825 years of age, while only two studies, one from scotland by oleary et al24 and one from india by hussain et al,25 included females less than 18 years of age (figure 1 and table 1). The hpv prevalence (any type) varied from 1.1% in the age group 1114 years in the oleary et al24 study to 29.6% in the age group 2021 years in the manhart et al23 study . Oleary et al24 reported the lowest percentage of samples (83.6%) containing amplifable human genomic dna; prusty et al22 reported the highest percentage (100%). We identified 14 studies that measured hpv positivity in paired urine and cervical samples from symptomatic females;18,22,2637 of these studies, nine reported the age range and nine the mean age of the study population . These studies included women with symptoms that led to various gynecological complaints and women diagnosed with invasive cervical cancer . Urine and cervical samples were collected at gynecological, colposcopy, genitourinary, sexually transmitted disease, and adolescent clinics . In general, hpv prevalence increased with the severity of cytological or pathological findings, and this was observed both in urine samples and cervical samples . All studies that reported age - specific hpv prevalence showed lower prevalence in urine samples than paired cervical samples, with the majority of the studies reporting a 10%20% lower hpv prevalence, save the studies by rymark et al33 and cuschieri et al18 (figure 2). With the exception of studies by rymark et al33 and jacobson et al,31 which covered narrow age ranges (1621 years and 1120 years, respectively), the studies in this review generally reported hpv prevalence in a broad age range . Populations presenting cytological or histological pathology generally had a higher hpv prevalence compared to those with normal cytology (figures 1 and 2). The studies showed a 75%100% concordance for any hpv type in paired urine and cervical samples (or 41%93% by kappa agreement). Type - specific concordance was reported in five studies, showing 100%, 90.5%, 71.0%, 70.8%, and 40.0% concordance . The latter estimates were calculated by including hpv - negative samples from either (not both) site, thereby reducing the type - specific concordance . Eight of the eleven studies published after 2000 also reported either type - specific concordance for hpv16 or hpv18, or concordance for the two types in combination . Hpv16-specific concordance or concordance for any hpv type by severity of cervical lesion was reported in three studies . In contrast alameda et al26 reported a higher concordance for any hpv type in low grade squamous intraepithelial lesion (lsil) than in high grade squamous intraepithelial lesion (hsil). Forslund et al29 showed neither an increase nor a decrease in concordance for any hpv type with increasing severity . The only study that estimated sensitivity and specificity for hpv dna detection in urine samples compared to cervical samples in a presumably asymptomatic, drop - in, sexual health service clinic population was published by cuschieri et al18 who reported a sensitivity of 90.6% (95% confidence interval [ci] 79.3%96.9%) and a specificity of 67.6% (95% ci 50.2%82.0%). In the studies with symptomatic populations, the sensitivity varied from 52.9% to 100% . We identified 14 male study populations from 13 publications that reported hpv positivity in urine samples and at least one other urogenital site (table 2). Only the studies by lazcano - ponce et al38 and cuschieri et al18 included males less than 18-years old . The 117 males aged 1625 years in the cuschieri et al18 study showed a 36.7% hpv prevalence in urine samples versus 29.1% in samples taken from the shaft of the penis . The study by lazcano - ponce et al38 included 120 healthy males aged 1455 years in mexico (43 males in the range 1420 years) and reported a 6.9% and 42.7% hpv prevalence in urine samples and urethra samples, respectively . Similarly, hpv prevalence in the other studies listed in table 2 was generally lower in urine samples than in other urogenital samples . For example, weaver et al39 recruited 317 sexually active university students, aged 1825 years, and measured hpv prevalence in urine samples as well as in samples from the glans, penile shaft, scrotum, and foreskin . Samples taken from the foreskin showed the highest prevalence (28.1%), while urine samples showed the lowest prevalence (5.8%). The percentage of urine samples in which human genomic dna could be detected varied substantially between the studies . While weaver et al39 detected human genomic dna in 99.7% of urine samples and 94.0%98.3% of samples from other sites, giuliano et al only detected human genomic dna in 51.3% of urine samples and 84.0%98.0% of samples from other sites, with semen samples having the highest human genomic dna detection rate . In the study by hernandez et al,40 semen samples and urine samples had the lowest human genomic dna detection rate, with 56.1% and 57.0%, respectively, compared to 78.8%95.1% from other urogenital sites . To illustrate some of the technical variability in these studies, we have listed the urine sampling procedure and the dna detection method used (tables 1 and 2). The most common urine sampling procedure in both female and male populations was first - void urine in contrast to mid - stream urine, which vorsters et al17 suggested would be preferable if the goal were to analyze a maximum number of exfoliated cells . The order of urine and cervical sampling may also affect the hpv dna detection rate in urine, and some studies have suggested that it is preferable to collect the urine sample first (reviewed in sehgal et al).21 in the female populations listed in table 1, urine sampling was not always carried out prior to cervical sampling and was sometimes done after washing the genitals . For hpv dna detection, variants of the my09/my11 primer were most commonly used, but other primers, such as general primer gp5/6, in - house primers, e6-primers, hybrid capture ii, and dna chip assays were also used . In summary, the technical variability may contribute substantially to hpv dna detection rates . According to the world health organization (who), 33 countries have implemented hpv vaccination as part of their national immunization program.41 generally, vaccination is provided to girls, and it is therefore recommended to monitor the impact of vaccination on hpv prevalence among female adolescents.15 in august 2012, we identified four publications that reported hpv prevalence in urine samples from asymptomatic female adolescents . Hpv prevalence has been strongly associated with age, being nearly nonexistent in preadolescents, gradually increasing with sexual activity among adolescents, and generally peaking around 25 years of age.42 however, regional differences in hpv prevalence do exist.43 therefore, the first step when monitoring hpv prevalence is to establish the baseline hpv prevalence in the relevant age groups . To date, only hussain et al and oleary et al reported baseline hpv prevalence based on urine samples from a large unvaccinated adolescent population.24,25 the hussain et al25 study from india used self - collected urine of the cervix and that care should be taken when samples from healthy children attending public school and achieved a 57.3% participation rate . Oleary et al24 analyzed urine samples from 1118-year - old school and college males (1121) and females (1341) in scotland 4 months before vaccination was introduced in the national immunization schedule in 2008 . A limitation of the study was that the estimated response rate for providing a urine sample was as low as 14% . While the low response rate can introduce bias and lead to erroneous estimates of the overall hpv prevalence, it was not directly related to the sampling method and probably refects a general challenge to achieve high response rates in this age group . This, in turn, could partially explain why only few studies measuring hpv prevalence in urine samples from female adolescents in the general population have been performed and published . The five studies that reported hpv prevalence by lesion severity showed a similar association for paired urine and cervical samples, with higher hpv prevalence in the most severe lesions . This is to some degree related to regional differences in hpv prevalence,43 the age distribution of the different study populations,43 and the setting in which the women were recruited . There were also differences in sampling procedures and hpv detection methods, including the number of types detected by a given assay . It is therefore not possible, as vorsters et al17 pointed out, to perform a meta - analysis on the present urine - based hpv prevalence studies . Detection of human genomic dna is commonly used to control for the adequacy of samples for hpv detection . Studies including female populations showed a high detection rate of human genomic dna in urine samples (83%100%), while male populations showed a larger range of detection rates (30%100%). In an hpv monitoring setting, a low human genomic dna detection rate would lead to reduced coverage and create a concern of bias in hpv estimates . In general, studies on female populations in this review indicated that high detection rates of human genomic dna are feasible . In cervical screening the main focus is to detect hpv or cervical abnormalities at the individual level, while population - based hpv prevalence is used more in a monitoring or epidemiological setting . Therefore, although prevalence in urine samples was lower than in cervical samples in the studies included in this review, monitoring by regular urine measurements over time may still be a useful way of identifying shifts in hpv prevalence due to imparted immunity against vaccine hpv types . However, the differences in hpv concordance of paired urine and cervical samples illustrates that hpv positivity in urine should be interpreted independently of the cervix and that care should be taken when inferring that a similar change is taking place in the cervix . On the other hand hpv detection in urine samples could be considered an independent measurement of the impact of hpv vaccination but it would have only limited public health interest . Furthermore, we observed that hpv negativity in the cervix commonly predicted an hpv - negative result in the urine as well, while hpv positivity in the cervix less commonly predicted hpv positivity in the urine . Although daponte et al showed an increased concordance with increased lesion severity for any hpv type, other studies like alameda et al,26 rymark et al,33 and gupta et al30 showed a relatively high concordance, even in populations where hpv prevalence is low . The variability of hpv16/18-specific concordance, the types included in both of the available hpv vaccines, further exemplifies the uncertainty of using urine samples to estimate future changes in the incidence of cervical lesions . The most comprehensive monitoring of changes in hpv prevalence would be carried out by establishing baseline hpv prevalence before measuring any impact of vaccination as well as regular measurements of hpv prevalence in both vaccinated and unvaccinated females and males . The age group (or groups) and sample size to include in hpv monitoring should be carefully selected to assure there is enough statistical power to identify changes in overall hpv prevalence as well as hpv type - specific changes . Models suggest that there will be a significant reduction in the prevalence of vaccine hpv types in males in the future because after vaccination, fewer girls will transmit hpv to their male partners.44 monitoring hpv prevalence in males could therefore be a near - term end point that could also help to estimate the effect of herd immunity . The differences in hpv prevalence across different urogenital sites illustrates that no single site repeatedly shows the highest hpv dna detection rate and that urine in particular has a relatively low hpv dna detection rate compared to other sites . In addition, male urine generally has a lower detection rate for human genomic dna than samples from other urogenital sites . With lower detection rates for human genomic dna, a larger sample size would be needed to detect changes with the same power as other urogenital sites . A protocol with sufficient detail on technical and practical issues that influence hpv detection is therefore necessary to ensure comparability between these measurements . This includes, among other issues, urine sampling procedure, handling of samples, extraction of dna, and assay used for hpv genotyping.17 in addition it might be useful to store an extra aliquot of extracted dna from each regular measurement to be able to perform hpv genotyping on all dna collected from urine samples over many years . This would also allow for using any novel genotyping technology that may have developed during the monitoring period . Information on more aspects of hpv monitoring can also be found in the human papillomavirus laboratory manual issued in 2009 by the who hpv laboratory network (who hpv labnet).45 this manual covers guidance on specimen collection and handling for hpv testing, with the aim to assist in establishing the laboratory support required for implementation and monitoring of hpv vaccination programs . Several of the who hpv labnet members are actively undertaking studies of hpv detection in urine, and a leading role for the who hpv labnet in further standardizing and optimizing the technology for hpv detection in urine seems appropriate.18,45,46 this is the first review that focuses solely on the use of urine to monitor changes in hpv prevalence in an asymptomatic population . The major shortcoming of this review is that, to date, there are few studies on the topic . We have therefore included studies from symptomatic populations and older populations that used urine for purposes other than monitoring, although these are not comparable to asymptomatic adolescents in all aspects . In addition, the studies highlighted in the present review as well as in the reviews of vorsters et al17 and seghal et al,21 showed that the large variability in sampling and genotyping methodology make direct comparisons of data, like concordance, inaccurate.17,21 assuming a future reduction in overall hpv prevalence and vaccine hpv type - specific prevalence and using urine testing as a monitoring method, care should be taken when interpreting the data . Indeed the data may not necessarily mimic the true hpv distribution in the cervix nor estimate the expected reductions in cervical cancer and high - grade lesions, as indicated by variable vaccine hpv type - specific (hpv16/18) concordance between paired urine and cervical samples . There is great scientific and political interest in monitoring the early effects of hpv vaccination in the general population . However, monitoring hpv prevalence as an early measurement of vaccine impact is only possible in a few countries as substantial financial and human resources are needed as well as a 510-year commitment in order to demonstrate results.16 urine is an adequate alternative biospecimen for monitoring hpv prevalence in female adolescents to determine the early effect of hpv vaccination on a population level . Strategies for recruitment should be optimized to avoid low response rates, sampling and hpv detection protocols should be detailed and standardized to ensure comparability, and importantly, care should be taken when extrapolating findings to the cervix . In males, urine samples do not seem to be optimal for monitoring hpv prevalence due to a low human genomic dna content compared to other urogenital sites . Although urine sampling has some advantages and is the only relevant option for sampling the general population in the youngest age groups, it also has several disadvantages, most importantly the fact that hpv prevalence in urine is only a distant measure of the main end point of vaccine impact, cervical cancer . In each situation the costs and benefits of hpv dna detection in urine, compared to alternative monitoring options, should be carefully considered.16,47
Portugal, as many other european countries, faces a growing elderly population, which increases the pressure on institutions and professionals to provide social and medical care in the most cost - effective way . The health and social care sectors in portugal need a major reorganization effort and the concept of integrated care emerges as a response to these challenges based on a coordinated work between independent institutions and professionals as a way to guarantee the continuity of care, improving health, quality of care and patient satisfaction, raising the efficiency and the effectiveness of social and health systems, and fostering patient's empowerment . Integrated care may be defined as a well - planned and well - organized set of services and care processes, targeted at the multifaceted / multidimensional needs / problems of an individual client or group of persons with similar needs / problems . Integration is frequently seen as a cross - organizational integration of services, but tasks and services also have to be integrated within organizations . However, this type of integration is a more common management task, while integration across organizations and services is a relatively new issue for the professionals in the long - term care sector ., it is not very different from innovations in industry, commercial services or other public sectors, such as education or public transport . In all these sectors, supply - driven management systems are gradually being replaced by integrated, demand / client - driven systems . The integrated care approach is particularly relevant to patients with multiple and complex needs, such as the old and disabled, whose care in portugal has been held to a great extent by social institutions and encompasses complex interactions between different professionals and institutions . In portugal, like in most of the southern european countries, the change in the paradigm is just starting and care, as it is understood in the northern european countries, is a relatively recent concept . The investigation and practice of integrated care that has been gaining breadth in other european countries [68] is slowly getting to portugal . The programme of integrated support to the elderly established in 1997 in portugal (programa de apoio integrado a idosos paii) (dispatch collection no . 259/97 of 21st of august) has the following objectives: ensuring the provision of care, including care of an urgent and permanent nature, trying to maintain the autonomy of the elderly in their own homes;establishing the means to ensure the mobility of the elderly and their accessibility to appropriate benefits and services;providing support to families taking care of dependent relatives;promoting the training of professionals, volunteers, family members and other informal care providers;setting measures to prevent isolation, exclusion and dependency and 6) to contribute to intergenerational solidarity as well as creating jobs . On the other hand, 101/2006 of 06/06/2006) has been created recently . Ensuring the provision of care, including care of an urgent and permanent nature, trying to maintain the autonomy of the elderly in their own homes; establishing the means to ensure the mobility of the elderly and their accessibility to appropriate benefits and services; providing support to families taking care of dependent relatives; promoting the training of professionals, volunteers, family members and other informal care providers; setting measures to prevent isolation, exclusion and dependency and 6) to contribute to intergenerational solidarity as well as creating jobs . On the other hand, in fact, the portuguese healthcare system has a significant number of regulations, but few measures have been fully implemented . In terms of supply, there is a reasonable range of services and professionals to satisfy the needs of health and care services for the elderly . The health and care systems are facing several problems such as multiple entry points, inappropriate use of costly and scarce resources, waiting lists and a deficient transmission of information between institutions and professionals . Social and health institutions are among the most complex and interdependent institutions but they have remained separated for several reasons: different rules and jurisdictions, distinct budgets, different institutional and professional cultures and different approaches in the provision of care . Nevertheless, a home support service called sad provided by non - profit institutions to the dependent population, is believed to be a first approach to integrated care . It aims at improving the quality of life of patients and their families and avoiding or delaying institutionalization, keeping the patients in their homes and in their usual social environment . The specific objectives of sad include: satisfying patients basic needs, providing physical and social support to the individuals and their families, and collaborating in health care provision . Therefore, sad planning, structuring and operating clearly offers many opportunities for integration between several care providers . The integration of care encompasses many aspects that must be planned and implemented at different levels . Integration may impact significantly on one or several organizations' structures, people, cultures, strategies, management and information systems, but some may remain unchanged . However, the effort must inevitably translate into one aspect, communication among parties, if results are to be achieved . Silber states that there is no quality health care without a proper management of information and its flow . In a context of integration the paper unfolds as follows: first, we show how health and social care evolved through time, from an integrated approach to separated systems, describing the historical development of the portuguese health care system and its financing and discussing the offering of social care in portugal, namely sad . Before the eighteenth century, health care was provided only to the poor by hospitals and religious charities (misericrdias). The development of public health services started in 1901 with the start of a network of medical officers responsible for public health . In 1945, a public law established public maternity and child welfare services, as well as national programmes for tuberculosis, leprosy and mental health . In 1946, a mandatory social health insurance system was created, caixas de previdncia, which provided cover to the employed population and their dependants through social security and sickness funds . This system was financed by contributions of employees and employers and provided out - of - hospital curative services, free at the point of use . The democratic revolution occurred on 1975 ending a long period of political dictatorship and a process of health services nationalization began, aiming to give the whole population access to healthcare, independent of their ability to pay . In 1979, the national health service (nhs) was created as a universal system, free at the point of use . In fact, until 1979 the portuguese state had left the responsibility for paying for health care to the individual patient and his / her family . The care of the poor was the responsibility of charity hospitals and the department of social welfare was responsible for the out - of - hospital care . After 1974, district and central hospitals owned by the religious charities were taken over by the state, as well as 2000 medical units or health posts across the country, which previously operated under the social welfare system for the exclusive use of social welfare beneficiaries and their families . The public health services and the health services provided by social welfare were brought together, leaving the general social security system to provide cash benefits and other social services for namely the elderly and children . The 1979, legislation established the right of all citizens to health protection, access to the nhs for all citizens, integrated health care including health promotion, disease surveillance and prevention and a tax - financed system of coverage in the form of the nhs . Since then, a number of reforms have been carried out . In 2002 a framework for the implementation of public / private partnerships aiming at building, maintaining and operating the health facilities was created . A decree established the obligation of nhs drugs prescription using the common international denomination, as well as the conditions under which prescribed brands can be substituted by generics . Around 40% of all nhs hospitals were transformed into public enterprises . However, in the twenty - first century, the health care system in portugal still faces many problems such as inadequate ambulatory services, long waiting lists, dissatisfaction of consumers and professionals, increasing expenditures with health and increasing demand for health care from vulnerable groups . However, actual health expenditures usually exceed the budget limits, requiring the approval of supplementary budgets . The health subsystems account for around 5% of total health expenditure and are normally financed through employer and employee contributions . These contributions are often insufficient to cover the full costs of care, which are in a significant part shifted onto the nhs . There are other complementary sources of financing such as the voluntary health insurance, which has been taken out by approximately 10% of the population, as well as the the mutual funds voluntary contributions are managed by non - profit organizations that provide limited cover for consultations, drugs and some inpatient care . In recent years, there has been increasing use of co - payments in health care with the aim of making consumers more cost - aware, which have accounted for over 30% of total health expenditure over the last ten years . In portugal, there is an insufficient provision of community care services, including long term care and social services for the chronically ill, the elderly and other groups with special needs . In fact, the family has been assuming the first line of care, particularly in rural areas . Yet, the demographic pressures demand new solutions in what refers to the provision of social care . However, ipss (instituies particulares de solidariedade social), which are non - profit non - public institutions for social solidarity, and among them misericrdias have been the main providers of these services, namely meals activities, laundry services and assistance obtaining medication or health care . According to the law no 119/83 of 25 of february (ipss statutes): these are non - profit and non - public institutions whose main purpose is to provide social support to necessitous persons but also to promote education and prevention of diseases . The government recognises the relevance of ipss in the provision of social services to the population through the establishment of cooperation and financial agreements . In fact, the family support has been decreasing and the state considers the ipss a strategic part in the care system . Compared to the residential care provided by the public sector, the nursing homes run by misericrdias and other non - profit institutions are usually of better quality and only request a nominal contribution from patients and their families . Nursing homes in the private sector are very expensive and the majority of the population cannot pay for them . Home care is expanding in portugal and in some regions infrastructures to deliver support to the elderly have been developed in partnership with municipalities, regional health administrations and non - profit institutions . Sad is a social response that consists of the provision of individualized care in the patients' home when they cannot assure temporarily or permanently the satisfaction of their basic needs and their daily activities . Sad is a recent service, designed to give domiciliary support on the social sphere and collaborate on the provision of health care by ipss to maintain people in their usual social environment, close to their families, neighbours and friends . Its big impulse was between 1986 and 1995 with an average opening of 75 new facilities per year . In the second half of the 1990s, sad spread all over the country, with an average opening of 122.3 new facilities per year . Sad must provide the following services: hygiene and comfort in the home, nursing, transportation, meal delivery and laundry . However, it can also cover other needs such as buying essentials, accompanying to social activities and doing little repairs . The bodies involved in sad are patients, ipss, health centres, physicians, municipalities and other entities . In the year 2000, sad in portugal was characterized as follows: a homogeneous distribution with the most populous regions having more than 100 institutions providing the service;a covering rate around 2.64%; services required mostly by elderly over 74 years old, with a percentage of women of 57%;93% of providers having agreements with social security;6% of providers having rehabilitation services5.7% of providers having night service . A homogeneous distribution with the most populous regions having more than 100 institutions providing the service; a covering rate around 2.64%; services required mostly by elderly over 74 years old, with a percentage of women of 57%; 93% of providers having agreements with social security; 6% of providers having rehabilitation services 5.7% of providers having night service . Before the eighteenth century, health care was provided only to the poor by hospitals and religious charities (misericrdias). The development of public health services started in 1901 with the start of a network of medical officers responsible for public health . In 1945, a public law established public maternity and child welfare services, as well as national programmes for tuberculosis, leprosy and mental health . In 1946, a mandatory social health insurance system was created, caixas de previdncia, which provided cover to the employed population and their dependants through social security and sickness funds . This system was financed by contributions of employees and employers and provided out - of - hospital curative services, free at the point of use . The democratic revolution occurred on 1975 ending a long period of political dictatorship and a process of health services nationalization began, aiming to give the whole population access to healthcare, independent of their ability to pay . In 1979, the national health service (nhs) was created as a universal system, free at the point of use . In fact, until 1979 the portuguese state had left the responsibility for paying for health care to the individual patient and his / her family . The care of the poor was the responsibility of charity hospitals and the department of social welfare was responsible for the out - of - hospital care . After 1974, district and central hospitals owned by the religious charities were taken over by the state, as well as 2000 medical units or health posts across the country, which previously operated under the social welfare system for the exclusive use of social welfare beneficiaries and their families . The public health services and the health services provided by social welfare were brought together, leaving the general social security system to provide cash benefits and other social services for namely the elderly and children . The 1979, legislation established the right of all citizens to health protection, access to the nhs for all citizens, integrated health care including health promotion, disease surveillance and prevention and a tax - financed system of coverage in the form of the nhs . Since then, a number of reforms have been carried out . In 2002 a framework for the implementation of public / private partnerships aiming at building, maintaining and operating the health facilities was created . A decree established the obligation of nhs drugs prescription using the common international denomination, as well as the conditions under which prescribed brands can be substituted by generics . Around 40% of all nhs hospitals were transformed into public enterprises . However, in the twenty - first century, the health care system in portugal still faces many problems such as inadequate ambulatory services, long waiting lists, dissatisfaction of consumers and professionals, increasing expenditures with health and increasing demand for health care from vulnerable groups . However, actual health expenditures usually exceed the budget limits, requiring the approval of supplementary budgets . The health subsystems account for around 5% of total health expenditure and are normally financed through employer and employee contributions . These contributions are often insufficient to cover the full costs of care, which are in a significant part shifted onto the nhs . There are other complementary sources of financing such as the voluntary health insurance, which has been taken out by approximately 10% of the population, as well as the the mutual funds voluntary contributions are managed by non - profit organizations that provide limited cover for consultations, drugs and some inpatient care . In recent years, there has been increasing use of co - payments in health care with the aim of making consumers more cost - aware, which have accounted for over 30% of total health expenditure over the last ten years . In portugal, there is an insufficient provision of community care services, including long term care and social services for the chronically ill, the elderly and other groups with special needs . In fact, the family has been assuming the first line of care, particularly in rural areas . Yet, the demographic pressures demand new solutions in what refers to the provision of social care . Some social services are provided in each region through the ministry of social security . However, ipss (instituies particulares de solidariedade social), which are non - profit non - public institutions for social solidarity, and among them misericrdias have been the main providers of these services, namely meals activities, laundry services and assistance obtaining medication or health care . According to the law no 119/83 of 25 of february (ipss statutes): these are non - profit and non - public institutions whose main purpose is to provide social support to necessitous persons but also to promote education and prevention of diseases . The government recognises the relevance of ipss in the provision of social services to the population through the establishment of cooperation and financial agreements . In fact, the family support has been decreasing and the state considers the ipss a strategic part in the care system . Compared to the residential care provided by the public sector, the nursing homes run by misericrdias and other non - profit institutions are usually of better quality and only request a nominal contribution from patients and their families . Nursing homes in the private sector are very expensive and the majority of the population cannot pay for them . Home care is expanding in portugal and in some regions infrastructures to deliver support to the elderly have been developed in partnership with municipalities, regional health administrations and non - profit institutions . Sad is a social response that consists of the provision of individualized care in the patients' home when they cannot assure temporarily or permanently the satisfaction of their basic needs and their daily activities . Sad is a recent service, designed to give domiciliary support on the social sphere and collaborate on the provision of health care by ipss to maintain people in their usual social environment, close to their families, neighbours and friends . Its big impulse was between 1986 and 1995 with an average opening of 75 new facilities per year . In the second half of the 1990s, sad spread all over the country, with an average opening of 122.3 new facilities per year . Sad must provide the following services: hygiene and comfort in the home, nursing, transportation, meal delivery and laundry . However, it can also cover other needs such as buying essentials, accompanying to social activities and doing little repairs . The bodies involved in sad are patients, ipss, health centres, physicians, municipalities and other entities . In the year 2000, sad in portugal was characterized as follows: a homogeneous distribution with the most populous regions having more than 100 institutions providing the service;a covering rate around 2.64%; services required mostly by elderly over 74 years old, with a percentage of women of 57%;93% of providers having agreements with social security;6% of providers having rehabilitation services5.7% of providers having night service . A homogeneous distribution with the most populous regions having more than 100 institutions providing the service; a covering rate around 2.64%; services required mostly by elderly over 74 years old, with a percentage of women of 57%; 93% of providers having agreements with social security; 6% of providers having rehabilitation services 5.7% of providers having night service . The main purpose of this study is to analyze sad in portugal and specifically in the district of aveiro and to understand if it is the first step towards integrated care . The analysis refers to the number and capacity of institutions that provide sad, the type of services provided, demographic data, the kind of relation between all the parties and the cooperation and communication level . At present, the interactions between the parties committed to sad are as described in figure 1 . In the future, it is expected that a model will emerge in which the ipss acts as a link between the patient / families and the other parties, fostering the sharing of patient information and improving the quality in the provision of care (figure 2). The data on which this work is based came from the analysis of documents provided by institutions like ine and from a questionnaire submitted to 75 institutions to capture: (a) demographic and structural data; (b) the type of information that the professionals need to fulfil their jobs; and (c) the kind of relationship and constraints, if they exist, between the institutions that provide sad and the patients, the social and health systems and the local authorities . The conditions in the district were thought to be appropriated to this study but the results have to be interpreted with caution concerning representativeness and cannot be generalized to the country . The questionnaire was submitted to 75 institutions that provide sad (63% of the total) previous to being piloted in two different institutions, in order to be adapted and ameliorated . Among the 75 institutions, 45 were surveyed by telephone and 30 by e - mail . In the year 2000, the number of ipss registered in portugal with social purposes was around 3000 and the total number of ipss's elderly patients was 136,639 . The social protection to the elderly represented 31.8% of all of the ipss's activities in 2000 and 33.8% in 1998 (table 2). According to the social security there are 248 ipsss in aveiro and 48% of them the elderly population is estimated to be 103,848 citizens, which means that the ipsss in aveiro can only provide services to 3, 4% of the elderly population in the region . Only 2, 7% make use of sad, which corresponds to 80% of the capacity of the ipsss . However, while some institutions in some municipalities have extra capacity, in others, all the resources are being used . Except for one municipality, we can say that the district doesn't seem to lack capacity with regard to the provision of this service . The enquiries were conducted along with directors (45%), case workers (29%) and other professionals (26%). Concerning human resources, 1% of the institutions have less than 10 employees, 43% have between 10 and 30 employees, the majority of the ipsss (84%) provides sad daily (including weekends), in comparison to 16% of the institutions that only offer this service on mondays . Sad can be provided not only to the elderly but also to people with special needs: 100% of the ipsss provide sad to the elderly, 76% of the institutions provide sad to everyone who needs this service (elderly, ill, disabled), 12% exclusively to the elderly, 8% to the elderly and the disabled and 4% to the elderly and the ill . Usually it is the family who contacts the ipss when there is an interest in sad . The family is responsible for 46% of the contact with the ipss, followed by health institutions (21%), the user (20%), the social security (8%) and neighbours (5%). The main reason (74% of the cases) for appealing to sad is the user's real need of this service, while a lower percentage (15%) of the cases want to benefit from other services offered by the ipss (11% didn't answer this question). With regard to the abilities of the professionals involved in sad, 55% of the ipsss require professionals with specific qualifications, while 45% of the cases don't . However, 76% of the ipsss provide specific training, against 24% who don't . The institutions involved in sad, other than the ipsss, are: the social security, who maintains a formal partnership with the ipsss and pays a contribution per patient;some health institutions, but in only 25.6% of the cases is there a formal relationship;the municipalities (21.5%);other entities (20%). In the case of these last two parties, the social security, who maintains a formal partnership with the ipsss and pays a contribution per patient; some health institutions, but in only 25.6% of the cases is there a formal relationship; the municipalities (21.5%); other entities (20%). In the case of these last two parties, the relations are strictly informal . The communication between the professionals involved in sad is considered easy for 61% of the interviewees, and 43% of the personnel classify the availability of information as good, 41% as regular, 10% as very good, 3% as bad and 3% as very bad . The means of contact between the ipsss and the patient or someone responsible for the patient are: exclusively the domiciliary visit made by the case worker (44%); only by telephone (1%); through domiciliary visits and telephone (55%). The frequency of contact between the case worker and the patient can be summarized as follows: 33% have weekly contact with the patient; 33% whenever is necessary; 16% monthly; 15% twice a month; and 3% gave no response . On a daily basis, there is contact between sad workers and the patient, and important information can be communicated to the case worker . With regard to the type and quality of services, the interviewee's perceptions the percentage of institutions providing the different services seems to be in line with the results of previous national studies . From our work physiotherapy and nursing support are provided in the health centres because most of the ipsss do not have the necessary resources . All the interviewees considered the family the most relevant element in the system that support sad, followed by the neighbours (53%), friends (26%) and volunteers (21%). With respect to quality control and assessment mechanisms of sad, 96% of the ippss apply questionnaires or have informal conversations with the patients to measure their satisfaction level and consequently the quality degree of the services provided . Only 4% of the ipsss included in this study do not make this type of evaluation . Regarding the accessibility of financial resources to provide this service, 46% of the interviewees evaluate the situation as regular, 31% as good, 14% as bad, 4% as very good and 5% as very bad . The main purpose of this study is to analyze sad in portugal and specifically in the district of aveiro and to understand if it is the first step towards integrated care . The analysis refers to the number and capacity of institutions that provide sad, the type of services provided, demographic data, the kind of relation between all the parties and the cooperation and communication level . At present, the interactions between the parties committed to sad are as described in figure 1 . In the future, it is expected that a model will emerge in which the ipss acts as a link between the patient / families and the other parties, fostering the sharing of patient information and improving the quality in the provision of care (figure 2). The data on which this work is based came from the analysis of documents provided by institutions like ine and from a questionnaire submitted to 75 institutions to capture: (a) demographic and structural data; (b) the type of information that the professionals need to fulfil their jobs; and (c) the kind of relationship and constraints, if they exist, between the institutions that provide sad and the patients, the social and health systems and the local authorities . The conditions in the district were thought to be appropriated to this study but the results have to be interpreted with caution concerning representativeness and cannot be generalized to the country . The questionnaire was submitted to 75 institutions that provide sad (63% of the total) previous to being piloted in two different institutions, in order to be adapted and ameliorated . Among the 75 institutions, 45 in the year 2000, the number of ipss registered in portugal with social purposes was around 3000 and the total number of ipss's elderly patients was 136,639 . The social protection to the elderly represented 31.8% of all of the ipss's activities in 2000 and 33.8% in 1998 (table 2). According to the social security there are 248 ipsss in aveiro and 48% of them the elderly population is estimated to be 103,848 citizens, which means that the ipsss in aveiro can only provide services to 3, 4% of the elderly population in the region . Only 2, 7% make use of sad, which corresponds to 80% of the capacity of the ipsss . However, while some institutions in some municipalities have extra capacity, in others, all the resources are being used . Except for one municipality, we can say that the district doesn't seem to lack capacity with regard to the provision of this service . The enquiries were conducted along with directors (45%), case workers (29%) and other professionals (26%). Concerning human resources, 1% of the institutions have less than 10 employees, 43% have between 10 and 30 employees, 22% have between 31 and 50 and 30% have more than 50 . The majority of the ipsss (84%) provides sad daily (including weekends), in comparison to 16% of the institutions that only offer this service on mondays . Sad can be provided not only to the elderly but also to people with special needs: 100% of the ipsss provide sad to the elderly, 76% of the institutions provide sad to everyone who needs this service (elderly, ill, disabled), 12% exclusively to the elderly, 8% to the elderly and the disabled and 4% to the elderly and the ill . Usually it is the family who contacts the ipss when there is an interest in sad . The family is responsible for 46% of the contact with the ipss, followed by health institutions (21%), the user (20%), the social security (8%) and neighbours (5%). The main reason (74% of the cases) for appealing to sad is the user's real need of this service, while a lower percentage (15%) of the cases want to benefit from other services offered by the ipss (11% didn't answer this question). With regard to the abilities of the professionals involved in sad, 55% of the ipsss require professionals with specific qualifications, while 45% of the cases don't . However, 76% of the ipsss provide specific training, against 24% who don't . The institutions involved in sad, other than the ipsss, are: the social security, who maintains a formal partnership with the ipsss and pays a contribution per patient;some health institutions, but in only 25.6% of the cases is there a formal relationship;the municipalities (21.5%);other entities (20%). In the case of these last two parties, the social security, who maintains a formal partnership with the ipsss and pays a contribution per patient; some health institutions, but in only 25.6% of the cases is there a formal relationship; the municipalities (21.5%); other entities (20%). In the case of these last two parties, the communication between the professionals involved in sad is considered easy for 61% of the interviewees, and 43% of the personnel classify the availability of information as good, 41% as regular, 10% as very good, 3% as bad and 3% as very bad . The means of contact between the ipsss and the patient or someone responsible for the patient are: exclusively the domiciliary visit made by the case worker (44%); only by telephone (1%); through domiciliary visits and telephone (55%). The frequency of contact between the case worker and the patient can be summarized as follows: 33% have weekly contact with the patient; 33% whenever is necessary; 16% monthly; 15% twice a month; and 3% gave no response . On a daily basis, there is contact between sad workers and the patient, and important information can be communicated to the case worker . With regard to the type and quality of services, the interviewee's perceptions the percentage of institutions providing the different services seems to be in line with the results of previous national studies . From our work physiotherapy and nursing support are provided in the health centres because most of the ipsss do not have the necessary resources . All the interviewees considered the family the most relevant element in the system that support sad, followed by the neighbours (53%), friends (26%) and volunteers (21%). With respect to quality control and assessment mechanisms of sad, 96% of the ippss apply questionnaires or have informal conversations with the patients to measure their satisfaction level and consequently the quality degree of the services provided . Only 4% of the ipsss included in this study do not make this type of evaluation . Regarding the accessibility of financial resources to provide this service, 46% of the interviewees evaluate the situation as regular, 31% as good, 14% as bad, 4% as very good and 5% as very bad . Portugal, as most countries, has a fast growing elderly population that demands a deep analysis on the adjustment of the care system that is at present very fragmented . Socio - demographic trends demand new approaches in the provision of care such as the integrated care concept to promote the continuity of care and the reduction of inefficiencies and redundancies, which implies a change in the professionals' culture and a redesign of the care system itself . Sad, a domiciliary service offered to frail and dependent persons, was believed to be a first approach to integration . However, in respect to sad in aveiro, the majority of the institutions that provide this service do not work in an integrated way . The integration of care exists only formally with the social security and rarely with some health centres . Even with respect to the communication between the professionals involved with sad, which is considered to be easy and good, the use of communication technology is restricted to the use of telephone as well as computers, where some records on the patients are stored but not shared between institutions . The care services provided are mainly of a social nature which is obviously the consequence of a lack of resources and competencies necessary to deliver health care . Only 8% of the institutions offer a physiotherapy service and in almost half of the cases, the service is evaluated as bad or very bad . Nursing is provided in 35% of the cases, but in 29% it is evaluated as bad or very bad by the professionals . The percentage of no answers is high, mirroring some difficulties in evaluating these kinds of services, provided by other entities . In 73% of the institutions, it implies that actors (members) and activities (functions) are relatively highly connected, interdependent and functioning to achieve common goals . Integration always implies the inclusion of certain actors and activities and the exclusion of others . The extension of these institution's boundaries is believed to be conditioned by a number of political, structural, individual, social and cultural aspects, which need to be identified and managed . The integrated care concept requires major efforts concerning communication between parties and the building of a shared vision between scientists, politicians and practitioners . These parties also need to recognize important interdependencies, learn how to work as a team, as well as mitigate some professional and institutional boundaries . The health and social systems, although interdependent, are divided because they have different goals and rules, inter - sectoral boundaries and professional and cultural differences . As a consequence, vulnerable individuals, like the elderly, require a mix of services delivered sequentially or simultaneously by multiple providers and receiving care at home, in the community and in institutional settings . That is why it is so important to find innovative ways to get around these gaps . However, there are several barriers to this effort that must be further investigated and surpassed . Based on analyses performed on the various systems in eu member states in the context of the carmen project, managers in these countries face many of the same obstacles: insufficient public funding to provide sufficient services;non - corresponding funding and legislative systems;unequal access;unbalanced systems;system's complexity;responsibility as a barrier to decision - making;interface problems;supply driven systems;human resources;non - responding cultures;quality management and integration becoming an end in itself . Insufficient public funding to provide sufficient services; non - corresponding funding and legislative systems; responsibility as a barrier to decision - making; supply driven systems; non - responding cultures; quality management and integration becoming an end in itself . The analysis also states that sometimes the obstacles are used merely as an excuse for non - collaboration . Jenny billings, research fellow, centre for health services studies, university of kent, canterbury, united kingdom . Leonor cardoso, phd, teacher of work and organizational psychology faculty of psychology and education sciences university of coimbra, portugal.
Ivm was initially introduced by pincus and enzmann (1935), using immature rabbit oocytes capable of undergoing spontaneous maturation and fertilization in vitro . The first group that succeeded in producing a child via ivm were trounson et al . (1994), using oocytes recovered from an untreated ovary in patients with polycystic ovaries . In - vitro maturation (ivm) has advanced significantly from its initial description to its current widespread clinical applications . Despite these advances, however, there are still many controversial issues surrounding this treatment . Given that ivm is an emerging protocol (at least in humans), there are many controversial areas of debate, and especially regarding the subject of the best candidates for ivm; how should we select our patients? We have conducted a review of the literature in the pubmed database from 1999 - 2013 for publications concerning the indications of ivm and examined the possibility that ivm results may be comparable to standard ivf . Taking into consideration that no standard protocol exists up to present in different centres, all forms of ivf (unstimulated, stimulated, oestrogen suppressed) are considered together . Several studies covered different indications for ivm: patients with normo - ovulatory cycles (dal canto et al ., 2006; fadini et al ., 2009; mikkelsen et al ., 1999, 2001), polycystic ovarian syndrome (pcos) or normo- ovulatory women with polycystic ovaries (pco) (child et al ., 2001, 2002; soderstrom - anttila et al ., 2005), fertility preservation (huang et al ., 2010; maman et al ., 2011; 2010), poor ovarian response (ivm may serve the last choice of treatment after the failure to achieve pregnancy in traditional ivf) (liu et al ., 2003) and in rare conditions such as rescue of oocytes which have failed to mature in stimulated cycles (tan and child, 2002) or cases with unexplained primarily poor quality embryos (hourvitz et al ., 2010). Normo - ovulatory women may be treated with ivm . Since early studies, (child et al ., 2001; mikkelsen et al ., 1999, 2000, 2001; soderstrom - anttila et al ., 2005) in which a 4%-25% clinical pregnancy rates were reported, there has been a constant improvement in results in normo - ovulatory patients of up to 30% pregnancy rate (fadini et al ., (2006) as well suggested that ivm was a good treatment with a comparable pregnancy rate to ivf, mainly due to the italian law, which allows a maximum of three oocytes per ivf cycle and prohibits embryo or zygote (2pn cells) cryopreservation . Ivm oocytes fertilize and undergo development in vitro with rates similar to in vivo matured control oocytes . In ivm cycles implantation and pregnancy rates are lower compared with controlled ovarian stimulation treatments, but accurate patient selection can improve ivm clinical outcome (fadini et al ., 2013). The main advantages of the ivm protocol in normo - ovulatory patients are: elimination of the side - effects of drug stimulation and reduction of the costs of the entire procedure, both in terms of time consumption and patient costs for drugs . Pcos patients are prone to develop ovarian hyperstimulation syndrome (ohss) with conventional ivf treatments . A potentially useful alternative for women with pcos is earlier retrieval of immature oocytes from small antral follicles, without using hormonal stimulation, followed by ivm of those oocytes . Substituting ivm in pcos patients eliminates the risk of ohss and lowers the cost of treatment . From early 2000 until the present, studies have demonstrated a encouraging pregnancy and delivery rate in pcos patients undergoing ivm treatments of 21.9%-29.9% (child et al ., 2001, 2002; ellenbogen et al . Recent publications report up to 32%-44% pregnancy and 22 - 29% delivery rates (shalom - paz et al ., 2011, 2012), comparable with ivf pregnancy rates results of 38%-45% (shalom - paz et al ., 2012). In another study of junk and yeap (2012) the transfer of a single blastocyst embryo obtained after ivm in patients with pcos was proposed . They obtained a live birth rate of 42.4% per oocyte collection and 45.2% per embryo transfer . In 20 oestrogen suppressed in vitro maturation cycles the implantation, pregnancy and delivery rates were 17.5%, 40% and 40% respectively (vitek et al ., 2013). Indeed sart lists higher clinical pregnancy rate for young women as> 46% in 2012 . However in europe the pregnancy and delivery rates in this group of patients undergoing icsi was 35.5% and 24.3% respectively (ferraretti et al ., 2013). De ziegler et al . (2012) opposed the need of ivm in the gnrh antagonist era . However, his results did nt take into consideration the fact that with gnrh - agonist used as a trigger to control the risk of ovarian hyperstimulation syndrome, higher pregnancy losses were observed (humaidan et al ., 2005). On the other hand, the dual trigger approach (gnrh - agonist + lowhcg) revealed 2.9% of ohss complications (griffin et al ., 2012). Even applying the strategy of ovarian stimulation using the combination of gnrh antagonist with gnrh agonist to trigger ovulation and freezing all of the oocytes or embryos for later use (devroey et al ., 2011) do not eradicated ohss totally as severe ohss after gonadotropin - releasing hormone (gnrh) agonist trigger and freeze - all approach in gnrh antagonist protocol was described (fatemi et al ., the emerging technology of ivm in oocyte retrieval has recently become another option for fertility preservation . This procedure can be done without hormonal stimulation and within a short time frame; oocytes being collected during the follicular phase, within up to 13 days from cancer diagnosis and the resulting embryos either vitrified or fertilized and cryopreserved (huang et al ., 2010; 2010). To shorten the period of time until cancer treatment, studies by maman et al . Therefore, in cases of cancer patients, especially in which hormonal treatment is contraindicated and those who must start chemotherapy without delay, ivm might be the only option to preserve fertility . However, up to now, no data are available concerning pregnancy rates in this group of patients . One flow of ivm had been suggested, as mature eggs at retrieval often give rise to embryos that result in live birth pointing that they are not really ivm oocytes . However, from 1224 oocytes retrieved in ivm cycles only 15.6% were found mature up to six hours after retrieval vs. 64.9% that matured in vitro after 6 - 48 hours (ellenbogen et al ., 2011). No differences were found regarding fertilization and cleavage rates or top quality embryos developed from either oocytes (ellenbogen et al ., 2011). . However, soderstorm - anttila et al . (2006) showed comparable complications and malformations for babies born after undergoing ivm and ivf . (2007) described a normal pregnancy course for ivm patients compared to ivf cycles . (2012) reported normal growth and development of 196 babies born from ivm cycles . Recently, chian and cao (2014) reported 1421 healthy infants born following immature oocyte retrieval and ivm . Those changes are established during oocyte growth, and ivm may modify the normal maturation of the oocytes (bao et al ., 2000). Moreover, may have deleterious effects on the organization of the meiotic spindle and chromosome alignment of human oocytes . This finding may be a possible explanation for the reduced developmental potential of oocytes matured in vitro compared with those matured in vivo (li et al ., however despite the great achievements obtained in treating infertile couples by standard ivf during the last 34 years, it has become evident in recent years that ovarian stimulation, although a central component of ivf, may itself have detrimental effects on oogenesis, with production of aneuploidity (baart et al ., 2007), reduced embryo quality, lower endometrial receptivity and perhaps also perinatal outcomes (santos et al ., 2010). In vitro maturation of oocytes is a simple procedure . It is an economical and less stressful procedure for women . Puncture is simple and safe and it can improve the disrupted endocrine environment and induce a spontaneous recovery of ovulation and pregnancy in women with pcos without other infertile factors . It can avoid short - term complications, such as ovarian hyperstimulation syndrome and possible long - term complications, such as hormone dependent neoplasm s including breast and ovarian cancers . Studies to date have not identified an alarming rate of congenital anomalies in ivm children, and studies which have followed up children to the age of 2 years old have provided reassuring results regarding their growth and development . Ivm holds great promise as an alternative to assisted reproductive technologies and may be the procedure of choice not only for infertile patients but also for obtaining oocytes for donation or fertility preservation . Improving embryonic - endometrial synchrony through pharmaceutical or other manipulation of endometrial / uterine receptivity will hopefully result in future improvements in ivm success rates . Proper counselling of these patients about advantages and disadvantages of the procedure should be performed routinely . The goal of the art is to help patients fulfil their most basic desires of reproduction and continuity, using technology that was only imaginary not long ago . These techniques are not yet flawless and may be associated with taking some calculated risks and courageous decision making, without which we would never have been able to help so many people and create so many happy families.
Degenerative conditions of the cervical spine (eg, degenerative disc disease or cervical spondylotic myelopathy) are characterized by the degeneration of the intervertebral discs of the cervical spine . A damaged vertebral disc due to degenerative disc disease can cause discogenic pain; however, not all degenerated discs cause pain . In addition to having the low - grade pain of a stiff or inflexible neck, many patients with cervical disc degeneration have numbness, tingling, or even weakness in the neck, arms, or shoulders as a result of nerves in the cervical area becoming irritated or pinched . Aging, genetics, metabolic disorders, and mechanical stress are known risk factors for cddd.1 the progression of cddd can lead to the collapse of the intervertebral space, disc herniation, spinal stenosis, and radicular arm pain with or without neurologic deficit . If conservative therapy fails, patients frequently undergo anterior cervical discectomy and fusion (acdf). Since the initial description of acdf by smith and robinson as well as by cloward,1,2 many technical modifications have been reported . Currently, surgeons may use autologous bone graft, allograft, synthetic material, and/or interbody cages as interposition grafts . The use of anterior iliac bone graft for anterior interbody fusion has been the gold standard for decades . Although highly successful fusion is achieved by autologous iliac bone graft, the use of this graft has greatly diminished owing to donor - site morbidity.37 interposition grafts are often combined with anterior locking plates to increase the immediate postoperative stability after bone grafting between vertebral bodies . Anterior plates enhance rigidity of fixation and decrease risk of nonunion, which may lead to kyphosis and pseudarthrosis, particularly in multilevel cases.812 moreover, anterior plating may also reduce the risk of graft extrusion.13 however, implantation of a plate in the anterior cervical spine poses an increased risk of hardware - related complications such as screw or plate dislodgement, soft tissue injury, esophagus perforation, nerve palsy, and dysphagia, and may contribute to adjacent level degeneration and osteophyte formation.1419 to prevent these complications, cages have been studied and applied in humans as potential bone substitutes for autograft in interbody fusion . The roi - c implant system (roi - c, zimmer biomet, austin, tx, usa) is composed of the roi - c zero - profile interbody fusion cage with vertebridge self - locking plates designed for stand - alone fusion . First clinical use of the roi - c occurred in 2008, and in february 2009, the us food and drug administration approved the roi - c system for single - level treatment of degenerative cervical spine conditions . The purpose of the clinical study was to assess the occurrence of fusion, dysphagia, and other short - term complications, and the postoperative effectiveness in patients who underwent acdf with the roi - c system . The roi - c implant system consists of d-shaped blocks in a variety of footprints and heights (figure 1). The roi - c implant system is comprised of a radiolucent polyetheretherketone (peek) optima lt1 cage with tantalum alloy radiologic position markers . Peek is a nonabsorbable biopolymer that has been used in a variety of industries, including medical devices . The peek cages are biocompatible, radiolucent, and have modulus of elasticity similar to bone . The roi - c titanium - coated implant offers a porous plasma titanium coating made of unalloyed nonferromagnetic titanium (ti), sprayed onto the superior and inferior surfaces of the implant . The curved shape of the roi - c anatomic implants allows for optimum surface area contact with vertebrae that embody a curved surface morphology . Both the roi - c and roi - c titanium - coated implant systems include a lordotic shape as well, which allows for optimum surface area contact with vertebrae that embody a flat surface morphology . To promote faster rates of fusion, the roi - c cage features an enclosed chamber that may be filled with autologous or allogenic bone graft . To prevent device migration and provide increased joint stability, both the superior and the inferior surfaces of the implants have a pattern of teeth . The roi - c implant system is intended for insertion using an anterior approach . In order to provide the stability needed for successful fusion, the vertebridge plates are manufactured from surgical titanium (ti6al4v), and are used to affix the roi - c implant to the superior and inferior vertebral bones of the index level . The vertebridge anchor plate technology allows the roi - c implant to be used as a stand - alone construct, although supplemental fixation may be used as patient needs dictate . The roi - c implant system is indicated for use in skeletally mature patients with cervical degenerative disc disease (cddd) with accompanying radiculopathy and/or myelopathy at a single disc level from c2 to t1 . These patients should have 6 weeks of nonoperative treatment unless they have severe or progressive neurologic dysfunction . The roi - c implants are intended for use with autogenous or allogenic bone graft composed of cancellous and/or corticocancellous bone graft . Supplemental internal fixation with two vertebridge anchor plates is required to use this system properly . The roi - c implant system has been designed to be compatible with optional supplemental fixation specifically for the system using the vertebridge anchor plates to affix the roi - c cage to the underlying vertebral bone, and to specifically allow for the option of a stand - alone construct . The roi - c is designed for implant as an intervertebral spacer via the anterior approach . The patient is positioned supine, and radiographic imaging is obtained in the anterior posterior (ap) and lateral planes to identify the level of diseased disc(s), sizing and placement of the implant, and plate insertion . After successful general anesthesia, the basic techniques for exposure, discectomy, and decompression are performed using a standard right- or left - sided approach . When indicated, the posterior longitudinal ligament is resected to allow for excision of extruded disc material and/or to determine the appropriate intervertebral disc height . The endplates are abraded before fusion by removing the cartilaginous tissue from the endplates using surgeon preferred tools such as rongeurs, curettes, or shaving spatulas . Only the cartilaginous portion of the vertebral endplate is removed, and the bony endplate is preserved as much as possible to prevent cage subsidence . After the midline is determined, the roi - c trials have the same dimensions as the implants and provide optimal endplate coverage, height restoration, and stability . The trial is placed in front of the space to visually determine width, and the selected trial is inserted into the space . Under lateral radiographic imaging the following are confirmed: implant depth and heightendplate coverage (ap)conformity with the superior dome for the anatomic designrestoration of the lordotic curve for the lordotic design . Implant depth and height endplate coverage (ap) conformity with the superior dome for the anatomic design restoration of the lordotic curve for the lordotic design . The distraction is released in order to assess the height that will best restore the anatomic shape of the operated space, as well as the best stability to the implant . The trial is then removed, and the appropriate - sized final cage endplates are inserted to an adequate depth under lateral fluoroscopic guidance . The central space of the roi - c may be filled with autologous bone to facilitate bony integration . The implant is inserted by gently tapping the end of the implant holder as necessary . If the implant position is too anterior, the ap positioning can be adjusted by dialing the adjustable stop from 0 to 5 mm . For each millimeter imaging, insertion of the implant is completed, and a final assessment of implant depth and endplate coverage is performed . A tantalum marker is located 1 mm from the posterior implant edge for positioning reference . The surgeon should verify that the marker is at least 1 or 2 mm anterior to the canal to avoid compression of the dura mater . Following this, ap and lateral fluoroscopy is performed to confirm the appropriate positioning and size of the device . After implantation of the cage, the two cervical anchoring clips are placed into the lower and upper vertebra through the anterior part of the cage to ensure primary stabilization by the self - locking function of the anchoring clips . The vertebridge plates are inserted one after the other, as the plate paths cross in the plate housing portion of the implant holder (ie, the plate inserted into the cranial slot will be anchored into the caudal vertebral body, and the plate inserted into the caudal slot will be anchored in the cranial vertebral body). The second plate can be inserted only after the first plate is locked . Upon radiographic confirmation of plate location, the implant holder is removed, and the surgical incision is irrigated and closed in the standard manner . Standard surgeon practice should be followed for postoperative care after implantation, including normal precautions for cervical fusion . As many of these procedures are done in an outpatient setting, most patients are ambulatory on the day of surgery . The roi - c system was subjected to preclinical biomechanical testing to assess stability and pullout force . The aim of this study was to biomechanically evaluate the roi - c construct compared to conventional bone grafts with anterior plating and to stand - alone peek cages with integrated screws . Cadaveric motion segments from two cervical spines (c2c3, c4c5, and c6c7) were mounted in epoxy and tested using a hydraulically actuated spinal loading system (mts 810, mts systems, eden prairie, mn, usa). The flexibility protocol using application of pure moments was chosen to provide a direct comparison to the intact specimens, as well as to published data . Pure moments of 2.5 nm in flexion - extension, bilateral lateral bending, and axial torsion were applied with a 20 n machine - applied axial preload to maintain compression of the segment . Force was applied at 10 mm / min under a 50 n axial preload to measure peak extraction loads . The vertebrae were allowed to rotate during pullout testing . The intact construct averaged 12.93.6 in flexion - extension, 9.72.6 in lateral bending, and 10.31.3 in axial torsion . Range of motion (rom) of the roi - c with vertebridge plates was 39%53% relative to the intact construct, with mean flexion - extension of 6.63.3, lateral bending of 3.82.4, and axial torsion of 5.52.5. in each test direction, the range of motion of roi - c was significantly reduced (p0.01) compared to the intact specimen . Roi - c also had less range of motion (% of intact rom) in all directions compared to a stand - alone peek cage with two screws, as well as to a traditional peek cage with cervical plate construct (figure 2). Average pullout loads for roi - c were greater than reported pullout loads for a conventional cervical plate (232.7 n vs 202 n, respectively), which are well above the expected physiologic loads.20 pullout failure of the roi - c only occurred due to plowing of the device through the bone and opening (lordosing) of the segment . In flexion - extension, lateral bending, and axial torsion, the roi - c with vertebridge anchoring plates showed lower rom than published data21 of a similar stand - alone peek cage with two integrated screws and a conventional construct comprised of a peek cage and metal cervical plate . The pullout resistance of the roi - c with vertebridge plating is comparable to published data22 of a bone graft with cervical plate and screws . When additional resistance to expulsion vs a cage alone is desired, the roi - c with vertebridge plating was shown to be a viable option . The roi - c system was subjected to preclinical biomechanical testing to assess stability and pullout force . The aim of this study was to biomechanically evaluate the roi - c construct compared to conventional bone grafts with anterior plating and to stand - alone peek cages with integrated screws . Cadaveric motion segments from two cervical spines (c2c3, c4c5, and c6c7) were mounted in epoxy and tested using a hydraulically actuated spinal loading system (mts 810, mts systems, eden prairie, mn, usa). The flexibility protocol using application of pure moments was chosen to provide a direct comparison to the intact specimens, as well as to published data . Pure moments of 2.5 nm in flexion - extension, bilateral lateral bending, and axial torsion were applied with a 20 n machine - applied axial preload to maintain compression of the segment . Force was applied at 10 mm / min under a 50 n axial preload to measure peak extraction loads . The vertebrae were allowed to rotate during pullout testing . The intact construct averaged 12.93.6 in flexion - extension, 9.72.6 in lateral bending, and 10.31.3 in axial torsion . Range of motion (rom) of the roi - c with vertebridge plates was 39%53% relative to the intact construct, with mean flexion - extension of 6.63.3, lateral bending of 3.82.4, and axial torsion of 5.52.5. in each test direction, the range of motion of roi - c was significantly reduced (p0.01) compared to the intact specimen . Roi - c also had less range of motion (% of intact rom) in all directions compared to a stand - alone peek cage with two screws, as well as to a traditional peek cage with cervical plate construct (figure 2). Average pullout loads for roi - c were greater than reported pullout loads for a conventional cervical plate (232.7 n vs 202 n, respectively), which are well above the expected physiologic loads.20 pullout failure of the roi - c only occurred due to plowing of the device through the bone and opening (lordosing) of the segment . In flexion - extension, lateral bending, and axial torsion, the roi - c with vertebridge anchoring plates showed lower rom than published data21 of a similar stand - alone peek cage with two integrated screws and a conventional construct comprised of a peek cage and metal cervical plate . The pullout resistance of the roi - c with vertebridge plating is comparable to published data22 of a bone graft with cervical plate and screws . When additional resistance to expulsion vs a cage alone is desired, the roi - c with vertebridge plating was shown to be a viable option . This was a retrospective, multicenter study of patients who underwent single - level acdf with the stand - alone configuration of the roi - c cage with vertebridge anchor plates and autograft bone (figure 3). Surgical data and patient demographic information were collected from 110 patients at seven study centers in the us (registration number nct02104167; clinicaltrials.gov). The western institutional review board (irb) approved the study protocol for five centers, and approval was granted at two centers by local hospital irbs (baystate medical center, springfield, ma, usa; st . Inclusion criteria included a diagnosis of ddd at one level between c2 and t1 with radiculopathy and/or myelopathy confirmed by radiographic imaging and corresponding pain and/or neurologic deficit . Data were collected retrospectively from the preoperative and operative periods, and at 2 and 6 months . The final follow - up visit was conducted prospectively between december 2013 and january 2015 . Fusion status was determined using ap, lateral, and flexion / extension radiographs at each time point, and was defined by the presence of bridging bone with less than 2 segmental motion in flexion / extension and less than 3 mm of ap translation . Device integrity was assessed radiographically for subsidence, pseudarthrosis, and device - related complications . Clinical examination at the final follow - up included measurement of neck disability index (ndi), and measurement of neck and radicular arm pain using a visual analog scale (vas) of 0100, with 0 representing no pain and 100 representing severe pain . Literature controls were obtained from peer - reviewed publications of us food and drug administration randomized studies reporting the 2-year outcomes of single - level acdf with plate and screws . Autograft was added to the cage in each case, and no supplemental fixation was used . Patients left the hospital after an average stay of 0.7 days (range 02 days). The mean ndi, vas neck pain, vas right arm pain, and vas left arm pain scores at the final follow - up visit were 19, 26.5, 12.5, and 15.3, respectively (table 2). Rates of dysphagia were 8.2%, 2.3%, and 1.8% at 2 months, 6 months, and 12 months, respectively (table 3). Fusion was achieved in 29.2% of patients at 2 months, 85.7% at 6 months, and 99.1% of patients at the final follow - up visit . There was one instance of pseudarthrosis (0.9%) and one secondary surgery (0.9%). . This patient was asymptomatic (ndi score = 4; neck and arm pain scores = 0) and did not undergo surgical treatment . The second patient, who initially underwent a c3c4 procedure with roi - c, presented with a diagnosis of cervical stenosis with myelopathy at multiple adjacent levels (c4c6). Although the roi - c had successfully fused, the patient had subsequent c3c6 fusion 8 months after the initial procedure . This was a retrospective, multicenter study of patients who underwent single - level acdf with the stand - alone configuration of the roi - c cage with vertebridge anchor plates and autograft bone (figure 3). Surgical data and patient demographic information were collected from 110 patients at seven study centers in the us (registration number nct02104167; clinicaltrials.gov). The western institutional review board (irb) approved the study protocol for five centers, and approval was granted at two centers by local hospital irbs (baystate medical center, springfield, ma, usa; st . Inclusion criteria included a diagnosis of ddd at one level between c2 and t1 with radiculopathy and/or myelopathy confirmed by radiographic imaging and corresponding pain and/or neurologic deficit . Data were collected retrospectively from the preoperative and operative periods, and at 2 and 6 months . The final follow - up visit was conducted prospectively between december 2013 and january 2015 . Fusion status was determined using ap, lateral, and flexion / extension radiographs at each time point, and was defined by the presence of bridging bone with less than 2 segmental motion in flexion / extension and less than 3 mm of ap translation . Device integrity was assessed radiographically for subsidence, pseudarthrosis, and device - related complications . Clinical examination at the final follow - up included measurement of neck disability index (ndi), and measurement of neck and radicular arm pain using a visual analog scale (vas) of 0100, with 0 representing no pain and 100 representing severe pain . Literature controls were obtained from peer - reviewed publications of us food and drug administration randomized studies reporting the 2-year outcomes of single - level acdf with plate and screws . This was a retrospective, multicenter study of patients who underwent single - level acdf with the stand - alone configuration of the roi - c cage with vertebridge anchor plates and autograft bone (figure 3). Surgical data and patient demographic information were collected from 110 patients at seven study centers in the us (registration number nct02104167; clinicaltrials.gov). The western institutional review board (irb) approved the study protocol for five centers, and approval was granted at two centers by local hospital irbs (baystate medical center, springfield, ma, usa; st . Inclusion criteria included a diagnosis of ddd at one level between c2 and t1 with radiculopathy and/or myelopathy confirmed by radiographic imaging and corresponding pain and/or neurologic deficit . Data were collected retrospectively from the preoperative and operative periods, and at 2 and 6 months . The final follow - up visit was conducted prospectively between december 2013 and january 2015 . Fusion status was determined using ap, lateral, and flexion / extension radiographs at each time point, and was defined by the presence of bridging bone with less than 2 segmental motion in flexion / extension and less than 3 mm of ap translation . Device integrity was assessed radiographically for subsidence, pseudarthrosis, and device - related complications . Clinical examination at the final follow - up included measurement of neck disability index (ndi), and measurement of neck and radicular arm pain using a visual analog scale (vas) of 0100, with 0 representing no pain and 100 representing severe pain . Literature controls were obtained from peer - reviewed publications of us food and drug administration randomized studies reporting the 2-year outcomes of single - level acdf with plate and screws . Autograft was added to the cage in each case, and no supplemental fixation was used . Patients left the hospital after an average stay of 0.7 days (range 02 days). The mean ndi, vas neck pain, vas right arm pain, and vas left arm pain scores at the final follow - up visit were 19, 26.5, 12.5, and 15.3, respectively (table 2). Rates of dysphagia were 8.2%, 2.3%, and 1.8% at 2 months, 6 months, and 12 months, respectively (table 3). Fusion was achieved in 29.2% of patients at 2 months, 85.7% at 6 months, and 99.1% of patients at the final follow - up visit . There was one instance of pseudarthrosis (0.9%) and one secondary surgery (0.9%). This patient was asymptomatic (ndi score = 4; neck and arm pain scores = 0) and did not undergo surgical treatment . The second patient, who initially underwent a c3c4 procedure with roi - c, presented with a diagnosis of cervical stenosis with myelopathy at multiple adjacent levels (c4c6). Although the roi - c had successfully fused, the patient had subsequent c3c6 fusion 8 months after the initial procedure . In the current study, we demonstrate that the zero - profile roi - c cage allows for similar or better clinical and radiographic outcomes compared with acdf with anterior plating . During the postoperative follow - up period, no internal fixation loosening, detachment, fractures, instability, or subsidence occurred in our study . Subsidence of an interbody cage can lead to a variety of complications, including loss of foraminal and disc height, segmental spinal instability, and loss of lordosis.23 preserving the cortical endplates is a critical factor in preventing interbody cage subsidence, and it has been proven that endplate preparation decreases the strength and stiffness of the vertebral bodies.24,25 the surgical technique of the roi - c implant system requires minimal preparation of the endplates, and the clinical evidence suggests that roi - c and other interbody fusion cages should have low subsidence rates because of this.24 compared to acdf with plate and screws, implant of the roi - c leaves less hardware in the patient . Moreover, while use of the roi - c cage does not always mean a smaller skin incision compared to acdf using a plate; it does involve less dissection and a smaller exposure in the prevertebral space . It also holds distinct advantages when doing a c7-t1 fusion, where one would not need to expose further caudally than the disc space itself . Implant of the roi - c is particularly valuable in cases where there is an existing plate at an adjacent level . Such cases would require a much bigger exposure extending to the other end of the plate to remove it, in order to place a new plate across the new target level . With the roi - c, there is no need to remove an existing adjacent plate, in fact no need to expose it at all, as it can just be left alone . In the occasional situation where the anchor encounters an existing screw in the shared vertebral body, the screw can just be removed and not the entire plate, which requires minimal extension of exposure . Because nonunion has been linked to poor outcomes,10 the primary goal of acdf is to achieve solid bony fusion, which prevents delayed kyphotic deformity with concomitant foraminal stenosis that may cause root compression and neck pain.26,27 we found that the roi - c was associated with a high rate of bony fusion (99.1%). Grasso et al28 and wang et al29 reported 100% fusion in roi - c patients followed for 2 years, and hoffstetter et al30 reported similar fusion rates for roi - c (95.2%) vs acdf (96%) after a mean follow - up of 13.9 months . Increased rates of fusion have been reported in acdf with anterior plating compared with acdf without plate.13,3133 fusion rates of acdf with cervical plating have been estimated to be 97.1% for single - level procedures.33 comparatively, randomized control clinical trials involving patients treated with acdf with anterior plating and allograft bone had fusion rates of 89% to 96.6% at 24 months.3438 the zero - profile roi - c anchored cage combines interbody support and supplemental fixation into a single device . An integral part of the roi - c system is the two verte - bridge anchoring plates, which eliminate the basic disadvantage of stand - alone cages . These unique structures offer a fixation mechanism that is similar to the function of a plate and screws . We believe that the self - locking vertebridge plates ensure excellent primary stability of the implant and promote early fusion . Furthermore, the elastic modulus of the anchored cage is similar to that of bone, which theoretically helps to decrease stress shielding and increase bony fusion . The anatomical shape of the anchored cage (with its upper convex part in the frontal and sagittal planes) allows a wide grafting space and close contact between the endplate bone and the implant . In our study, the roi - c implant system with vertebridge anchoring plates demonstrated low rates of dysphagia at 6 (2.3%) and 12 months (1.8%), respectively . Other studies of roi - c have reported similarly low rates of dysphagia (0%3.1%).2830 in contrast, dysphagia rates as high as 35.1% have been reported after acdf with anterior plating.39 several studies suggest that the use of anterior locking plates is associated with a higher rate of postoperative dysphagia.13,40,41 bazaz et al40 observed a lower rate of dysphagia (14.1%) in patients without anterior plating compared with the case in patients (21.1%) who received a construct including an anterior locking plate . Mobbs et al13 observed a similar trend, with a significantly higher rate of dysphagia in patients who received an anterior locking plate (4.5%) compared with constructs without anterior plating (0.8%). Although the causes of dysphagia after acdf procedures are not well understood, several physiologic mechanisms have been proposed . The occurrence of dysphagia and dysphonia has been linked to causes such as damage or compression of the soft tissues of the trachea or esophagus from the anterior plate41,42 or scar tissue from the incision.43 irritation or impingement can occur because the anterior cervical locking plate is placed directly posterior to the esophagus.13,40,41,44 the design and thickness of anterior locking plates also correlate with postoperative dysphagia.41 another possible mechanism for postoperative dysphagia after acdf with anterior plating may be additional traction required to place an anterior locking plate . Increased pressure on the esophagus during implantation of an anterior plate has been suggested to contribute to dysphagia in patients who undergo acdf with anterior plating.45 in contrast, the roi - c implant system stabilizes the joint without the need for anterior plating . This zero - profile design decreases the likelihood for dysphagia and dysphonia by avoiding compression of the soft tissues, and the use of the curved anchor plates instead of screws allows for a smaller surgical incision that does not extend beyond the size of the cage . There is a growing consensus that acdf alters the natural history of cervical spondylosis and hastens the development of degenerative changes at levels immediately above and below fused regions . In this retrospective study, one patient (0.9%) had adjacent segment degeneration that required a subsequent fixation at an adjacent level . Hofstetter et al30 reported that two roi - c patients (5.7%) required repeat surgery for adjacent level disease . Schwab et al46 found that cervical fusion reduced the number of vertebrae with active function and caused biomechanical changes . To maintain the function of the entire cervical spine, the body increases the activity of the adjacent fused vertebral segments to compensate, causing adjacent segment degeneration . The presence of a plate and screws is also likely to accelerate degenerative changes in adjacent segments,47 and anterior interbody fusion can also contribute to adjacent segment degeneration,48 but the exact pathophysiologic mechanism of adjacent segment degeneration remains unknown . The design of the roi - c implant system utilizes the core principles of previous interbody cages to take advantage of the safety and successful clinical history of anterior interbody fusion devices, while addressing some of the drawbacks of previous interbody implants . The clinical results of the roi - c implant system have demonstrated positive clinical outcomes with high fusion rates and low rates of subsidence, dysphagia, reoperation, and adjacent segment degeneration . The elegant design and ease of use of the roi - c with vertebridge locking plates represent an improved surgical option for a stable anterior interbody fusion without the need for anterior plating or posterior fixation . Possible advantages of the roi - c for spinal fusion surgery include a short operative time, less dissection and smaller exposure of the prevertebral space, and less implanted hardware, with the associated benefit of less trauma to the surrounding soft tissues.
Osteoarthritis (oa) is a degenerative joint disease that progressively causes loss of joint function and is a major source of physical disability and impaired quality of life in many countries [13]. The pathological changes which occur during oa involve all the joint structures, that is, synovium, cartilage, and bone tissues, but the main hallmark of this disease is the degradation of cartilage [4, 5]. Aging, trauma, hormonal, and mechanical factors are reported to contribute to the onset and progression of oa [68]. In addition, several studies have demonstrated the polymorphisms of some genes may be related to the pathogenesis of oa as well [911]. It is now accepted that the excessive and spontaneous inflammation plays a significant role in the molecular pathogenesis of oa, contributing to a highly catabolic state, chondrocyte apoptosis, and the resultant progressive degeneration of articular cartilage [1214]. Bradykinins, a family of oligopeptides derived from the enzymatic action of kallikreins on kininogens, can promote all the major signs of inflammation, including hyperemia, leakage of plasma proteins, and pain [1517]. The presence of bk was previously reported in the synovial fluid from patients affected by arthritis of different etiologies, including oa [18, 19]. Bdkrb2 has been detected on the synovial lining cells, fibroblasts, and endothelial lining cells of blood vessels from oa patients [18, 21]. Clinically, the administration of b2 receptor antagonists effectively reduced the inflammatory articular pain and knee oa progression, suggesting the bdkrb2 is involved in the development of oa [18, 22]. The genetic variants of bdkrb2 may lead to altered biological activities of the functional protein . The gene polymorphisms of bdkrb2 have been shown to be related with acei - induced cough in hypertensive patients, left ventricular hypertrophy, and insulin resistance [2326]. However, its relation with oa remains unknown . In this study, we enrolled knee oa patients to explore the role of bdkrb2 in oa . A total of 245 patients with primary knee oa were recruited from dec 2008 to feb 2009 . The severity of oa was evaluated according to the kellgren - lawrence (kl) grade classification, and only patients with k / l grades of 2 or higher were included . Both oa and control groups were interviewed to obtain demographic data and all of established risk factors . In the study, other etiologies causing knee diseases such as inflammatory arthritis (rheumatoid, polyarthritic, or autoimmune disease), posttraumatic or postseptic arthritis, skeletal dysplasia, or developmental dysplasia were excluded from oa group . All the control never had any signs or symptoms of arthritis or joint diseases (pain, swelling, tenderness, or restriction of movement). The clinical characteristics of all enrolled subjects, including age, sex, body mass index (bmi), smoke status, bone fracture history, knee activity, and regular excise, were recorded . The study was approved by the ethics review committee of our hospital, and written informed consent was obtained from all participants . Reaction conditions for genotyping the two polymorphic loci (+ 9/9 and c 58 t) were as follows: dna (100 ng) was amplified in a 25 l reaction buffer containing 0.2 mmol / l deoxynucleotide triphosphates, 1.0 mmol / l mgcl2, 20 mmol / l tris / cl (ph = 8.4), 50 mmol / l kcl, 0.015 nmol of each primer, and 0.5 u taq polymerase (invitrogen corporation, carlsbad, ca, usa) for 40 cycles of one minute at 94c, 30 s at 60c (+ 9/9) or 57c (c 58 t), and 10 s at 72c, followed by a five - minute soak at 72c in a g - storm thermal cycler (alphametrix biotech gmbh, rdermark, germany). The primers for the bdkrb2 + 9/9 polymorphism were as follows: forward, 5-tccagctctggcttctgg-3, and reverse, 5-agtcgctccctggtactgc-3, and the amplification products were 80 bp (9) versus 89 bp (+ 9). The bdkrb2 c 58 t polymorphism was assayed using a pair of degenerate primers which were as follows: forward, 5-aaggtggccgcagccttcc-3, and reverse, 5-ctcatctttcaagggctggcta-3. The reverse primer contained a g - c transversion (underlined) that generated a recognition site (5-ctag-3) for the restriction endonuclease bfai (new england biolabs, ipswich, ma, usa) in the presence of the c allele . If the c allele was present, the 133 bp pcr product digested to 112 + 21 bp . All pcr or digestion products were size - separated by electrophoresis in 8% polyacrylamide gel electrophoresis gels run in 1 trisborate - edta buffer and visualized with ethidium bromide and ultraviolet light . When observed or expected values included a cell with a value less than 5, fisher's exact test was used . In all cases, or fisher tests were used to compare genotype frequency and demographic distributions between cases and controls . Multiple logistic regression analyses were used to evaluate if each snp was independently associated with oa when adjusted for the potential confounding effects of important clinical variables . The odds ratios (ors) and 95% confidence intervals (cis) were calculated . All analyses were performed by using spss software (statistical package for the social sciences, version 16.0, spss inc, chicago, il, usa). Table 1 shows demographic and clinical characteristics of all subjects in the study . There were no significant differences in sex, age, smoke status, and history of heavy labor work between knee oa cases and controls . Obesity prevalence was significantly higher in the oa patient group than in controls (p = 0.013). Table 2 described the genotype distributions and allele frequencies of bdkrb2 polymorphisms in knee oa and control subjects . The genotype frequencies for all polymorphisms did not differ significantly from those expected under hardy - weinberg equilibrium (both p> 0.05). The genotype frequencies and allele frequencies at bdkrb2 58t / c were similar between oa and control subjects . The 9/9 genotype was significantly higher in knee oa subjects than in controls (33.46% versus 20.07%). Accordingly, the 9 allele frequency was higher in oa patients than controls (57.754% versus 47.34%, p <0.001). Logistic regression analysis showed a significantly increased risk for knee oa for the 9/9 genotype compared with the + 9/+9 genotype (or = 2.35, 95% ci: 1.4093.937; p <0.001) after adjustment with sex, age, bmi, smoke status, history of labor work, regular exercise, and knee activity . The adjusted or for 9 allele carriage was significantly higher than 9 allele carriage (or = 1.52, 95% ci: 1.1861.947, p <0.001). All the oa patients were grouped into two subgroups: subjects with kl 3 and those with kl score> 3 (table 3). We found that the + 9/+9 genotype was higher in those with kl score> 3 than in those with kl score <3 . The + 9/9 and 9/9 genotypes represented higher risks of being severer oa (or = 3.09, p <0.001, and or = 2.98, p = 0.002, resp . ). Osteoarthritis (oa) is a painful and degenerating progressive disease of the joints which affects millions of patients worldwide . In this study, we investigated whether bdkrb2 gene polymorphisms influence the susceptibility of oa in a chinese cohort . Our results showed that the 9/9 carriers had markedly higher risk for oa compared with + 9/+9 carriers . Besides, the + 9/9 and 9/9 genotypes represented higher risks of being severer oa than + 9/+9 carriers . To the best of our knowledge, this is the first study regarding the role of bdkrb2 gene polymorphisms in oa . It contributes to the initiation and maintenance of inflammation, to exciting and sensitizing sensory nerve fibres, thus producing pain, and to activating synoviocytes and chondrocytes which are the main cells involved in the homeostasis of synovial fluid and cartilage, respectively [29, 30]. The bdkrb2 is constitutively expressed in most tissues and is considered a stronger mediator of vasodilation and inflammation through increased production and release of nitric oxide [31, 32]. In humans the bdkrb2 gene contains a number of polymorphic loci, including a nine - base insertion / deletion in the first exon of the gene (+ 9/9, rs5810761) and c to t transition in the promoter region (c 58 t, rs1799722). The 9 bp deletion (9) in the gene encoding the bdkrb2 is associated with expression of higher concentrations of receptor mrna, suggesting its strong functional relevance . The + 9/9 genetic polymorphisms have been reported to be associated with a series of pathological conditions including coronary artery disease, systemic hypertension, and increased left ventricular mass associated with hypertension and pulmonary artery pressure [3638]. To our surprise, although the role of bdkrb2 in inflammation has been documented, we did not find any reports with regard to the genetic polymorphisms of bdkrb2 gene and inflammation . In this study, we firstly reported the role of genetic polymorphisms of bdkrb2 in oa . We found that the 9 p polymorphisms, rather than the 58t / c polymorphisms, are not only associated with the oa risk but also the oa severity . This finding suggests that the bdkrb2 + 9/9 polymorphisms may be used as a genetic marker for the onset and development of oa . However, it should be pointed out that our study is preliminary, and the results need to be further confirmed in larger - scale study, ideally, in different ethnic populations.
The birth of a premature infant has long been documented as a stressful event for parents . The premature birth of an infant and the following neonatal intensive care cause psychological distress and can have a traumatizing effect on parents . The neonatal intensive care unit (nicu) environment has the potential to exacerbate stress for parents of infants admitted to the nicu . Mothers have typically been found to have higher levels of distress than fathers and they experience significant levels of stress and depression in the early postpartum period . Maternal stress can have deleterious effects on mother - infant interaction, particularly on mothers abilities to form an attachment to their baby . Maternal stress diminishes the mother's ability to be sensitive to the infant's cues and be responsive in interacting with the infant . Participating in infant care influences the maternal feelings in a positive direction . Finding of a study has shown that a mother who is denied the opportunity comparing to a mother whose child is left feeling confused and anxious . When the mother is nearby, breastfeeds and takes care of her child's daily care she has a feeling of participation . This situation creates a need for practices that support parents during the acute phase of their infant's hospitalization in neonatal intensive care . The facilitation of maternal confidence and positive parenting in the nicu may be a key point in establishing and sustaining long - term healthy mother - infant interactions and positive child outcomes . Nicus have been established in iran since about 1984, and today they are running in the state and private hospitals of 31 provinces under the supervision of a neonatologist . There are high - tech equipments for infants treatment in most of these wards and mothers can settle in specific rooms close to the ward, so that they can go to their infants to take care of them primarily based on their willing and abilities at the times . Fathers can also visit their infants in specific hours, but they cannot stay there and no health care is provided for them . The premature birth rate in the place of research, esfahan, isfahan, is about 12 - 13%, and due to the prepared facilities, especially in the state hospitals, many of these infants would be saved . In iran, no organized goal - oriented effort has been taken to increase the parents information and confidence and to decrease the mothers stress and anxiety following giving birth to an immature infant and its being in nicu . This would cause distress in mother - infant interaction, and so, the absence of timely and effective mothers participation in taking care of the infant . On the other hand, the nursing workload in nicus is too high and nurses do not have enough time to help parents . Regarding without to these points, researchers tend to conduct the creating opportunities for parent empowerment (cope) program in this survey . As a result, researchers tend to conduct the creating opportunities for parent empowerment (cope) program in this survey . Due to the fact that it is both a written and audiotaped program and the information is provided in a simple language, it is not a time - consuming work for the nurses to transfer the information to the parents . Bernadette melnyk, dean and distinguished foundation professor in nursing, arizona state university college of nursing and healthcare innovation . The goal is to teach parents the normal behaviors and characteristics of a preemie, and various activities help the parents to understand and appreciate their baby's special qualities . The content of the cope program and skill - building activities is guided by self - regulation theory (johnson, fieler, jones, wlasowicz, and mitchell, 1997) and control theory (carver, 1979) (as cited in melnyk et al ., 2001). On the basis of these theories, cope intervention would strengthen parents knowledge and beliefs about their premature infants and their own parenting role and remove barriers that would inhibit them from participating in their infants care and interacting with them in a developmentally sensitive manner . Phase i occurs 2 - 4 days after infants hospitalization, phase ii occurs 2 - 4 days after phase i, phase iii occurs 1 - 3 days before discharge to home, and the last one occurs 1 week after discharge from the nicu . In every phase, mothers get a pictorial booklet and related audiotaped information . Moreover, in order to implement the experimental information, parent is given a four - phase workbook and is supposed to do and record the related activities . Phase i contains the tendered information about immature infant's physical and behavioral features, the differences between mature and immature infants, information about nicu's environment, and offers the strategies that help parents to participate in taking care of the infant . Also, some milestones that the infant achieved while in the nicu are listed in the workbook and mothers are supposed to record the time that they occurred . In phase ii, in addition to giving emphasis on the information in the first one, it renders new information about infant's behaviors, its growth and development, and gives further suggestions regarding increasing the mother's participation to take care of the infant and meeting its needs . The workbook of this phase contains activities that tend to identify the specific features of infant to understand infant's stress signs, or the signs of readiness for communication . In phase iii, supplementary information about the details of infant's states and behavior, such as sleepiness, quiet alert state, or active alert state, and the best time to make communication with it is tendered . Also, related topics about parental role in the process of infant's smooth transition from hospital to home and continuance of mother - infant positive interaction are discussed . The activities of the workbook of this phase contain the items that help parents to identify specific behavioral signs in infant and providers the ability to calm it down at times of stress . Phase iv contains supplemental data about the behavior of immature infant and the parental role related to infant's growth and development, and also some suggestions to increase the mother - infant positive interaction . Workbook activities of this phase contain a series of specific techniques to improve the infant's cognitive development, such as songs and games, appropriate to its age . Bernadette melnyk, dean and distinguished foundation professor in nursing, arizona state university college of nursing and healthcare innovation . The goal is to teach parents the normal behaviors and characteristics of a preemie, and various activities help the parents to understand and appreciate their baby's special qualities . The content of the cope program and skill - building activities is guided by self - regulation theory (johnson, fieler, jones, wlasowicz, and mitchell, 1997) and control theory (carver, 1979) (as cited in melnyk et al ., 2001). On the basis of these theories, cope intervention would strengthen parents knowledge and beliefs about their premature infants and their own parenting role and remove barriers that would inhibit them from participating in their infants care and interacting with them in a developmentally sensitive manner . Phase i occurs 2 - 4 days after infants hospitalization, phase ii occurs 2 - 4 days after phase i, phase iii occurs 1 - 3 days before discharge to home, and the last one occurs 1 week after discharge from the nicu . In every phase, mothers get a pictorial booklet and related audiotaped information . Moreover, in order to implement the experimental information, parent is given a four - phase workbook and is supposed to do and record the related activities . Phase i contains the tendered information about immature infant's physical and behavioral features, the differences between mature and immature infants, information about nicu's environment, and offers the strategies that help parents to participate in taking care of the infant . Also, some milestones that the infant achieved while in the nicu are listed in the workbook and mothers are supposed to record the time that they occurred . In phase ii, in addition to giving emphasis on the information in the first one, it renders new information about infant's behaviors, its growth and development, and gives further suggestions regarding increasing the mother's participation to take care of the infant and meeting its needs . The workbook of this phase contains activities that tend to identify the specific features of infant to understand infant's stress signs, or the signs of readiness for communication . In phase iii, supplementary information about the details of infant's states and behavior, such as sleepiness, quiet alert state, or active alert state, and the best time to make communication with it is tendered . Also, related topics about parental role in the process of infant's smooth transition from hospital to home and continuance of mother - infant positive interaction are discussed . The activities of the workbook of this phase contain the items that help parents to identify specific behavioral signs in infant and providers the ability to calm it down at times of stress . Phase iv contains supplemental data about the behavior of immature infant and the parental role related to infant's growth and development, and also some suggestions to increase the mother - infant positive interaction . Workbook activities of this phase contain a series of specific techniques to improve the infant's cognitive development, such as songs and games, appropriate to its age . Data were collected from september 2009 to february 2010 in the educational nicus of state hospitals affiliated to isfahan university of medical sciences in iran (20-bed nicu in shaheed beheshti hospital and 14-bed nicu in alzahra hospital). Following the father's inability to stay long and take care of the infant in ward's environment, all mothers who were 18 years and older, could read and speak persian, had no infant admitted to the nicu, and with infants with the following criteria participated in this study: (a) gestational age of 26 - 34 weeks, (b) birth weight of less than 2500 g and appropriate for gestational age, (c) anticipated survival, (d) singleton birth, (e) no severe handicapping conditions, and (f) born at the study sites . Mothers were excluded from the study if they did not visit their infants for more than 4 days and if their infants died or discharged before completing the cope program . Researchers screened 290 premature births and 135 of them met the eligibility criteria [figure 1]. Among these 135 eligible births, 20 (14.8%) mothers refused participation, with the majority of them wanting to concentrate only on the new infant or they believed that participation would take time away from the other children at home . Researchers were unable to contact the mothers of 15 (11.1%) premature infants who met the eligibility criteria . Mothers who agreed to participate were randomly assigned to the study conditions by using rand function in excel 2007 . The final sample after randomization comprised 100 mothers . After enrollment and randomization of the study groups, data for 10 mothers were eliminated from the study for analyses . Five mothers in the cope program were eliminated from the study because of infant death (n = 2), transfer to another hospital (n = 1) or completion of baseline measures only (n = 2). Five comparison mothers also were eliminated from the analysis because of infant death (n = 2) or completion of baseline measures only (n = 3). Therefore, the final sample for data analyses included 90 mothers (45 in the cope and 45 in the comparison group). The well - known state - trait anxiety inventory (stai) was used to measure maternal state and trait anxiety . Current feelings of anxiety are measured with the a - state scale, while an individual's anxiety proneness is measured in the 20-item trait scale (a - trait). A - state was used as the dependent variable to assess mothers current anxiety levels . Trait anxiety was assessed at one contact point only to measure anxiety proneness . Maternal trait anxiety and demographic measures are considered as important covariates in the study because findings from prior research have supported that these variables have potential effects on maternal state anxiety and mother - infant interaction . The reliability was measured by cronbach's alpha, and it was 0.93 for state anxiety and 0.87 for trait anxiety . Content validity index was measured as validity, and it was 0.97 for state anxiety and 0.99 for trait anxiety . The parental stressor scale: neonatal intensive care (pss: nicu) assessed parental stress in the nicu arising from four dimensions: (a) sights and sounds, (b) infant behavior and appearance, (c) parental role alteration, and (d) staff behaviors and communication . Parents rate their perceptions of the stress level generated by each of the 46 items on a 5-point likert scale ranging from 1 (= non - stressful) to 5 (= extremely stressful). The index of parental participation / hospitalized infant (ipp - hi) is an instrument that is designed for nurses and/or mothers to rate the range of care - related activities that mothers were observed or reported themselves to be involved in while there infant is hospitalized in an nicu . The ipp / hi is described as a 25-item dichotomous instrument that measures a range of previous 48-h time period activities of mothers, including items that pertain to routine infant care, basic illness - related care, emotional and developmental care, information seeking, and involvement in care by serving as an advocate and a decision - maker . Cronbach's alpha was 0.90 and content validity index was 0.99 . Concerning the point that it takes more time to implement phase iii of the cope program and that phase iv is conducted on the basis of home visit which is not common in iran, these phases were omitted with the program designer's permission . The issues of every phase consist of the scientific information in simple language, which almost coincided with nicus conditions in iran . The necessary reformation regarding the context's eloquence and fluency was done with the help of three faculty members of the school of nursing and midwifery, shaheed beheshti medical university . Then, the information was prepared in the form of audiotape and a booklet (a separate booklet for every phase with related picture). Finally, in order to measure the booklet and audiotape fluency and clearness in mothers opinion, a pilot study was done on five mothers . In each hospital, there was a suitable room (without noise and shuttling) beside the nicu, which were useless in the evening . Mothers came to this place alone and one of the researchers gave instruments to them to complete . Two to four days post nicu admission, the mother completed demographic and infant variables questionnaire as well as state anxiety inventory and the parental stressor scale . Then, the phase i booklet was given to the mother and she listened to its audiotape . Manipulation checks consisted of 10 true or false questions that the mother answered immediately after each intervention phase to assure they processed the audiotaped information . The first set of activity workbook was then given to the mother with specific instructions on how to complete . Four to eight days post nicu admission, the mother completed stai and the parental stressor scale . Next, the phase 2 booklet was given to the mother and she listened to its audiotape . Then, the mother answered the phase 2 manipulation check questions, and at the end, she received phase ii of activity workbook with specific instructions on how to complete . Six to twelve days post nicu admission was the last visit of the research for each mother and she completed state anxiety inventory, the parental stressor scale, and the (ipp - hi). Researcher requested the mother to complete the workbook activities and she monitored them throughout the study . Researcher prompted the mothers who had not completed the activities by the time of the next phase of the intervention to perform them by the next contact . Mothers in the comparison group filled out all questionnaires at the same time as the intervention group (2 - 4, 4 - 8, and 6 - 12 days after infant hospitalization). They did not receive the cope program, but using the content of each phase of the cope program, one of the researchers answered all their questions . After ultimate assessment (6 - 12 days after infant hospitalization), this group also received a booklet which is a combination of phases i and ii of the cope program . Two to four days post nicu admission, the mother completed demographic and infant variables questionnaire as well as state anxiety inventory and the parental stressor scale . Then, the phase i booklet was given to the mother and she listened to its audiotape . Manipulation checks consisted of 10 true or false questions that the mother answered immediately after each intervention phase to assure they processed the audiotaped information . The first set of activity workbook was then given to the mother with specific instructions on how to complete . Four to eight days post nicu admission, the mother completed stai and the parental stressor scale . Next, the phase 2 booklet was given to the mother and she listened to its audiotape . Then, the mother answered the phase 2 manipulation check questions, and at the end, she received phase ii of activity workbook with specific instructions on how to complete . Six to twelve days post nicu admission was the last visit of the research for each mother and she completed state anxiety inventory, the parental stressor scale, and the (ipp - hi). Researcher requested the mother to complete the workbook activities and she monitored them throughout the study . Researcher prompted the mothers who had not completed the activities by the time of the next phase of the intervention to perform them by the next contact . Mothers in the comparison group filled out all questionnaires at the same time as the intervention group (2 - 4, 4 - 8, and 6 - 12 days after infant hospitalization). They did not receive the cope program, but using the content of each phase of the cope program, one of the researchers answered all their questions . After ultimate assessment (6 - 12 days after infant hospitalization), this group also received a booklet which is a combination of phases i and ii of the cope program . Data were analyzed using spss 16 for windows . A p value of 0.05 was set for statistical significance . In addition, t - tests for continuous variables, analyses for categorical variables, and mann - whitney u test for qualitative variables were performed to determine if the two study groups differed in these baseline factors . Spearman correlation test and repeated measurements test were also performed . Among the 90 mothers, no significant group differences were found at baseline in maternal demographic and infant variables [tables 1 and 2]. In addition, no baseline differences between groups were found for stress and anxiety [table 3]. Comparability of the cope intervention and comparison groups conditions comparability of the cope intervention and comparison groups infant conditions during the nicu hospitalization, mothers in the cope program reported significantly less overall parental stress in the nicu than did mothers in the comparison group [figure 2]. Mothers state anxiety decreased over time, with significant cope and comparison - group differences identified [figure 3]. Mothers in the cope program were also more involved in their infants care in the nicu than the comparison mothers [figure 4]. Maternal stress over time maternal state anxiety over time maternal participation cope mothers had also significantly high total scores on the questions in manipulation checks dealing with the cope - program content, indicating that mothers processed the content of the program from all two phases of the interventions . The purpose of this study was to perform the cope program for iranian mothers and evaluate its effectiveness on the level of stress, anxiety, and participation of mothers who have premature infants hospitalized in nicus . Findings of this study provide additional support for earlier studies that proved instructing parents in premature behavior and involving them in the care of their infant may facilitate bonding, increase parents confidence in care giving, and possibly improve the parent - child relationship . After performing just the first stage of the program, the state anxiety level of the mothers reduced, and after performing phase ii of the program, the state anxiety level of the mothers further reduced . Since most mothers education was less than diploma, it can be said that the information in phases i and ii could the level of education in most of the mothers was less than diploma (high school), it can be said that the information in phases i and ii could provide iranian mothers information needs . Clear information of the infant's condition provided for parents on a regular basis facilitates accurate perception of the infant's morbidity, with subsequent alterations in distress levels . After performing two phases of cope program, mothers stress reduced in the experimental group, while assessments conducted at the same time in the control group indicated that stress in the second assessment was more than in the first one . This finding indicates that parents of premature infants experience heightened anxiety and stress during and following their infants nicu stay . Cope mothers were significantly less stressed related to nicu because they were given concrete information regarding the nicu environment and what to expect of their premature infants . The results of this study showed that the mothers participation in the experimental group was more than that in the control group . Through the parental role information in the cope program, mothers learned how best to interact with their infants during hospitalization and were encouraged to be involved in their infants care . Nursing support reduces parental stress and anxiety during infants nicu hospitalization and, therefore, fosters the parents abilities to cope with the difficulties they are facing . Giving understandable information is critical for optimal parental involvement in their infant's care . In the study of melnyk et al . (2006), all four phases of the cope program were conducted in the usa . The results of this study demonstrate the following: mothers in the cope program reported significantly less overall parental stress in the nicu than did mothers in the comparison group, the level of mothers anxiety reduced at the end of program (after performing phase iv), and the mother's participation in taking care of the infant did not have significant statistical differences between the two groups . Contrasting this study with the study of melnyk et al . (2006), the findings of the two studies are the same in the effect of program on the mothers stress related to nicu . However, the results of anxiety and participation are different . Also, there are differences in the socioeconomic status of samples in the two studies . Most of the mothers education was less than a diploma in the present study, while most of the mothers had an education level of more than a diploma in the study of melnyk et al . (2006). Also, the income of most of the families in this study was less than $4000, but the families in melnyk et al . 's (2006) study had more than $40,000 as income . According to the above analysis, further and earlier effect of program in this study can be due to economical and cultural differences between samples . On the other hand, welfare and educational facilities and psychological support are not the same in these two countries . This is the supportive finding for this claim that higher ses socioeconomic status mothers have stricter and more demanding cognitive schemas for their own beliefs / confidence in how they should parent their premature infants, while lower socioeconomic status mothers may have schemas that are less rigid . One of the limitations of this study is that it was conducted in only the state hospitals . Potential differences in practice may exist in private institutions that may influence generalizability of the findings . It also would be possible to determine if the intervention program may have positive effect on fathers psychological condition in the situation that they could not participate in their infants care during hospitalization in the nicu . Analyzing the results of the present study specified that psychological status and participation of iranian mothers who had premature infants improved by presenting cope intervention in the nicus . During this program, mothers knew about the differences between their infants and mature infants, and they learned how to play their maternal role in the nicu and how to interact suitably with their infants . Therefore, the results of this study confirm the findings of previous studies regarding theory - based intervention with parents of premature infants that begins early in the nicu stay and results in (1) less parental stress in the nicu, (2) more positive parent - infant interactions in the nicu, and (3) less parental anxiety after hospitalization.
Climbing can be performed for recreational purposes or as a competition, on both natural rocks and indoors . The growing interest in this form of physical activity makes it easier to organize sports events that quite naturally, involve the implementation of relevant training methods that prepare climbers to compete and win . As in any other sport discipline, the factors determining top performance must be precisely established to increase the effectiveness of athlete recruitment, selection and training . Numerous practitioners along with theoreticians specializing in sports training indicate that high performance in climbing is mainly based on strength and endurance (espaa - romero et al ., 2009; grant et al ., 2001; macleod et al ., 2007; schweizer and furrer, 2007). However, the importance of other factors in determining elite performance has also been noted (mermier et al ., 2000). To assess muscular strength in humans, dynamometer tests (requiring the use of appropriate measuring devices) and specific tests (measuring motor abilities) a review of the literature shows that both of these types of tests have been applied to investigate climbers strength . Endurance is usually determined by maximal exercise tests, which measure the time the subject needs to attain grip strength equal to a predetermined percentage of maximum strength (ferguson and brown, 1997; macleod et al . Some specific tests have the subjects hang from ledges of different widths until volitional exhaustion (macleod et al ., 2007; rokowski and tokarz, 2007). Analysis of the available literature indicates a great need for scientific research focused on training of climbers (amca et al ., 2012; thus, an increasing number of studies on the physiology, biomechanics and biochemistry of this sports discipline may be observed . Moreover, there is a lack of literature with respect to testing of motor abilities . Most of the studies have described some state of the climber s body that is, however, difficult to evaluate without attending a well - equipped laboratory . Thus, a practical application of the research results is rather complex and often impossible without the assistance of scientists . Consequently, coaches and athletes are left alone with large amounts of data from which they need to make an optimal choice for training purposes . Previous research shows that specific and dynamometer tests applied to elite climbers result in different assessments of their motor abilities . In a rokowski and tokarz s (2007) study, the results of the dynamometer strength tests were unrelated to subjects climbing performance, but the results of the specific test requiring subjects carrying a maximum weight to hang from a ledge 2.5 cm in width were strongly correlated with their climbing performance . This difference naturally raises the question of why the results of the dynamometer tests were weakly correlated with climber s performance, unlike the results of specific tests . The explanation lies possibly in the technical limitations of the measurements made with dynamometers and in the unique nature of climber s movements . There are a limited number of grip configurations allowing maximum grip strength to be measured with the dynamometer, some of which are never used on the climbing wall . This indicates a need for further research to remove the doubts regarding whether ledge tests truly measure climbers endurance and whether ledges of different widths should be used; another issue to discuss is how muscle strength influences test results . Since the main force that climbers must manage is that of their own body weight (ruchlewicz et al ., 1997), many studies make a point of climbers having the appropriate body build (giles et al . The hypothesis that the body mass of elite athletes has a major impact on their performance in motor abilities tests appears to be well - founded . There are also reasons to believe that climbing - specific strength of individual climbers is correlated with their ability to increase muscular strength . In the literature, researchers refer to contact strength, a term unique to climbing, which determines an athlete s ability to grasp a hold with maximum strength on contact (fanchini et al ., this study aimed to establish which types of specific tests could be effectively used in assessing muscular strength and endurance of highly trained sport climbers . The authors attempted to answer the following questions: do dynamometer tests and specific tests measure the same aspects of muscular strength and endurance? If yes, how are laboratory tests and specific field tests similar and what makes them different? The second part of the study focused on establishing whether basic anthropometric variables of climbers had an effect on the measurement of their motor abilities . Fourteen male climbers capable of handling 7a- 8a+/b on - sight grades volunteered to participate in the study . Their mean (sd) age was 26.6 5.6 years, body height 177.4 4.5 cm and body mass 74.4 5.1 kg . All participants were advised of the purpose and scope of the study, as well as of any negative impacts it might involve, orally and in writing . The research project was approved by the bioethics commission at the local medical chamber in cracow . The research activities related to this study were performed in the facilities of the academy of physical education in cracow (ape cracow), partly at the department of biomechanics (laboratory tests) and partly in the gym (motor ability tests). To encourage the climbers to perform as well as they could, the measurements included elements of competition . The sequence of measurements was implemented in strict accordance with the research protocol: climbers were assessed for body build (height and mass) before their motor abilities were tested . During the laboratory tests and the motor ability tests, the break between tests performed in the biomechanics laboratory and those in the gym was one week . The first of them, measuring maximal isometric grip strength (fmax), used a hand dynamometer (hottinger baldwin messtechnik gmbh, darmstaddt, germany) with linearly adjustable resistance points that was therefore suitable for all subjects regardless of their hand size . The device complied with the iso 6789 regulations, according to which the minimization of measurement error of the strength converter to 1% of the true value was required . The subjects were asked to shape their hand into a hook grip with an opposing thumb so that the resistance of the dynamometer acted on their intermediate phalanges (fingers ii - v) and the ball of the thumb (i). During the measurements this setup was used to measure maximum grip strength of their right and left hands (fmax r, fmax l) in newtons [n]; the results were then divided by the subject s body mass to calculate their relative strength (fw r, fw l) expressed in n / kg . Picture 1 shows the procedure applied to measure strength of the fingers . The subjects had to grip a 2.5 cm wide ledge and to hang vertically with an additional maximum load attached to their hip belt . The grip was performed with only four fingers of each hand (without thumbs) and with hands shoulders width apart . The subject was required to maintain this position for 3 s. each attempt started with adding a load of 40 kg, and in the consecutive attempts, the load was increased by 5 kg each time . When the subject was not able to remain in the position for 3 s, the attempt was stopped, and in the following trials, the additional load was reduced by 1 - 2 kg to determine the individual maximum load the subject was able to hold . The results of this test were recorded as absolute values, a sum of body mass and the additional load [kg], and relative strength, i.e., without body mass (rokowski and tokarz, 2007). The results of the test in absolute and relative values were referred to as ledge 1 and ledge 2, respectively . Body mass [kg]; fmax r, fmax l maximal grip strength (right and left hands) [n]; fw r, fw l relative grip strength (right and left hands) [n / kg]; fmax r, fmax l maximum muscle force development (right and left hands) [n / s]; ledge 1 maximal strength of the fingers (hang from a 2.5 cm wide ledge) [kg]; ledge 2 relative strength of the fingers (hang from a 2.5 cm wide ledge) [kg / kg]; bar 1 maximal strength of arm muscles (hang from a bar) [kg]; bar 2 relative strength of arm muscles (hang from a bar) [kg / kg]; hang 1 muscle endurance (hang from a 2.5 cm wide ledge) [s]; hang 2 muscle endurance (hang from a 4.0 cm wide ledge) [s]; hang muscle endurance (hang from a bar) [s]; pull ups maximum number of pull - ups [n]; t fmax 50% muscle endurance (maintain a dynamometer grip force at 50% of fmax) [s]. The specific test of finger strength (refer to abbreviation: ledge 1, ledge 2, hang 1, hang 2). On the same day, the subjects performed a test assessing strength of their arm muscles (picture 2). They were asked to do a pull - up bringing their chin over the bar, with the maximum weight they could lift attached to their harness . The results of this test were recorded (with an accuracy of 1 kg) in both absolute and relative values (ferguson and brown, 1997); for the purpose of later analysis, these values were further referred as bar 1 and bar 2, respectively . The arm strength test (refer to abbreviation: bar 1, bar 2, pull ups). The speed of action of the climbers finger flexors was measured at the same diagnostic station as previously grip strength . The subjects performed an isometric muscle contraction to achieve maximum tension of the muscles as fast as they could . The force values were recorded and the data were used to calculate the rate of force development . Of the indicators calculated with f = f(t), only maximum muscle force development values of the left and right hand (fmax l and fmax r, respectively) expressed as n / s were used in further analysis (ruchlewicz et al ., the group of tests assessing climbers muscle endurance consisted of laboratory tests and specific motor tests . Muscle resistance to fatigue was measured in subjects as they performed prolonged isometric muscle contractions by squeezing an adjustable hand dynamometer . The subjects were instructed to maintain muscle contractions at 50% of their maximum grip strength until failure . They were able to follow their grip strength variations in all trials as signals generated by the dynamometer were displayed on a computer monitor they could see . With this setup, they were able to adjust the force they applied by increasing or decreasing grip strength as needed . The outcome of this laboratory test was expressed as grip duration in seconds; in further analysis, it was referred as t fmax50% . Subjects endurance (the resistance of muscles to fatigue) was also examined with specific motor tests . The first of them (hang 1) required the subject to hang from a 2.5 cm wide ledge . The second test (hang 2) the only difference was that a 4 cm ledge was used . In both tests, the subjects had to grip the ledge with four fingers of each hand (the thumb left disengaged), hands held at shoulders width, upper extremities straight, and they were required to hang vertically as long as they could (until failure) (ferguson and brown, 1997). The outcome of these tests was the length of the time that they could maintain this position, measured with an accuracy of 1 s. in the experiment, two of the tests measuring muscle resistance to fatigue used the pull - up bar . The first of them (hang) required the subject to hold the bar with an overhand grip and to hang from it until volitional exhaustion . The result of this test was expressed by the time the subject could hold on . In the second test (pull ups), the maximum number of pull - ups completed by the subject was recorded, but for a pull - up to be credited, it had to be performed in accordance with the international physical fitness test rules (quaine and vigouroux, 2004). After the results of the tests were processed with descriptive statistics (the arithmetic mean and measures of variance), rank correlation coefficients were calculated (pearson s r) to determine whether particular structural and functional variables were correlated with each other . Finally, to determine strength of the relationships between the values of all investigated variables and climbers competence, the spearman s rank correlation was used . The calculations were performed with the statistica 10 statistical software package (statsoft, usa). Fourteen male climbers capable of handling 7a- 8a+/b on - sight grades volunteered to participate in the study . Their mean (sd) age was 26.6 5.6 years, body height 177.4 4.5 cm and body mass 74.4 5.1 kg . All participants were advised of the purpose and scope of the study, as well as of any negative impacts it might involve, orally and in writing . The research project was approved by the bioethics commission at the local medical chamber in cracow . The research activities related to this study were performed in the facilities of the academy of physical education in cracow (ape cracow), partly at the department of biomechanics (laboratory tests) and partly in the gym (motor ability tests). To encourage the climbers to perform as well as they could, the measurements included elements of competition . The sequence of measurements was implemented in strict accordance with the research protocol: climbers were assessed for body build (height and mass) before their motor abilities were tested . During the laboratory tests and the motor ability tests, the break between tests performed in the biomechanics laboratory and those in the gym was one week . The first of them, measuring maximal isometric grip strength (fmax), used a hand dynamometer (hottinger baldwin messtechnik gmbh, darmstaddt, germany) with linearly adjustable resistance points that was therefore suitable for all subjects regardless of their hand size . The device complied with the iso 6789 regulations, according to which the minimization of measurement error of the strength converter to 1% of the true value was required . The subjects were asked to shape their hand into a hook grip with an opposing thumb so that the resistance of the dynamometer acted on their intermediate phalanges (fingers ii - v) and the ball of the thumb (i). During the measurements, this setup was used to measure maximum grip strength of their right and left hands (fmax r, fmax l) in newtons [n]; the results were then divided by the subject s body mass to calculate their relative strength (fw r, fw l) expressed in n / kg . Picture 1 shows the procedure applied to measure strength of the fingers . The subjects had to grip a 2.5 cm wide ledge and to hang vertically with an additional maximum load attached to their hip belt . The grip was performed with only four fingers of each hand (without thumbs) and with hands shoulders width apart . The subject was required to maintain this position for 3 s. each attempt started with adding a load of 40 kg, and in the consecutive attempts, the load was increased by 5 kg each time . When the subject was not able to remain in the position for 3 s, the attempt was stopped, and in the following trials, the additional load was reduced by 1 - 2 kg to determine the individual maximum load the subject was able to hold . The results of this test were recorded as absolute values, a sum of body mass and the additional load [kg], and relative strength, i.e., without body mass (rokowski and tokarz, 2007). The results of the test in absolute and relative values were referred to as ledge 1 and ledge 2, respectively . Body mass [kg]; fmax r, fmax l maximal grip strength (right and left hands) [n]; fw r, fw l relative grip strength (right and left hands) [n / kg]; fmax r, fmax l maximum muscle force development (right and left hands) [n / s]; ledge 1 maximal strength of the fingers (hang from a 2.5 cm wide ledge) [kg]; ledge 2 relative strength of the fingers (hang from a 2.5 cm wide ledge) [kg / kg]; bar 1 maximal strength of arm muscles (hang from a bar) [kg]; bar 2 relative strength of arm muscles (hang from a bar) [kg / kg]; hang 1 muscle endurance (hang from a 2.5 cm wide ledge) [s]; hang 2 muscle endurance (hang from a 4.0 cm wide ledge) [s]; hang muscle endurance (hang from a bar) [s]; pull ups maximum number of pull - ups [n]; t fmax 50% muscle endurance (maintain a dynamometer grip force at 50% of fmax) [s]. The specific test of finger strength (refer to abbreviation: ledge 1, ledge 2, hang 1, hang 2). On the same day, the subjects performed a test assessing strength of their arm muscles (picture 2). They were asked to do a pull - up bringing their chin over the bar, with the maximum weight they could lift attached to their harness . The results of this test were recorded (with an accuracy of 1 kg) in both absolute and relative values (ferguson and brown, 1997); for the purpose of later analysis, these values were further referred as bar 1 and bar 2, respectively . The arm strength test (refer to abbreviation: bar 1, bar 2, pull ups). The speed of action of the climbers finger flexors was measured at the same diagnostic station as previously grip strength . The subjects performed an isometric muscle contraction to achieve maximum tension of the muscles as fast as they could . The force values were recorded and the data were used to calculate the rate of force development . Of the indicators calculated with f = f(t), only maximum muscle force development values of the left and right hand (fmax l and fmax r, respectively) expressed as n / s were used in further analysis (ruchlewicz et al ., 1997). The group of tests assessing climbers muscle endurance consisted of laboratory tests and specific motor tests . Muscle resistance to fatigue was measured in subjects as they performed prolonged isometric muscle contractions by squeezing an adjustable hand dynamometer . The subjects were instructed to maintain muscle contractions at 50% of their maximum grip strength until failure . They were able to follow their grip strength variations in all trials as signals generated by the dynamometer were displayed on a computer monitor they could see . With this setup, they were able to adjust the force they applied by increasing or decreasing grip strength as needed . The outcome of this laboratory test was expressed as grip duration in seconds; in further analysis, it was referred as t fmax50% . Subjects endurance (the resistance of muscles to fatigue) was also examined with specific motor tests . The first of them (hang 1) required the subject to hang from a 2.5 cm wide ledge . The second test (hang 2) the only difference was that a 4 cm ledge was used . In both tests, the subjects had to grip the ledge with four fingers of each hand (the thumb left disengaged), hands held at shoulders width, upper extremities straight, and they were required to hang vertically as long as they could (until failure) (ferguson and brown, 1997). The outcome of these tests was the length of the time that they could maintain this position, measured with an accuracy of 1 s. in the experiment, two of the tests measuring muscle resistance to fatigue used the pull - up bar . The first of them (hang) required the subject to hold the bar with an overhand grip and to hang from it until volitional exhaustion . The result of this test was expressed by the time the subject could hold on . In the second test (pull ups), the maximum number of pull - ups completed by the subject was recorded, but for a pull - up to be credited, it had to be performed in accordance with the international physical fitness test rules (quaine and vigouroux, 2004). After the results of the tests were processed with descriptive statistics (the arithmetic mean and measures of variance), rank correlation coefficients were calculated (pearson s r) to determine whether particular structural and functional variables were correlated with each other . Finally, to determine strength of the relationships between the values of all investigated variables and climbers competence, the spearman s rank correlation was used . The calculations were performed with the statistica 10 statistical software package (statsoft, usa). Small differences in body mass (range from 61 to 69 kg) and a low coefficient of variance (cv = 3.5%) showed that the sample of climbers was very homogenous in that respect . The results of the strength tests divided them into three groups characterized by similarly distributed results: the dynamometer tests (fmax, fw), the pull ups tests (bar 1 and bar 2) and the test with the 2.5 cm ledge . The cv values calculated for these three groups were 10, 7 and more than 20%, respectively . With regard to the endurance tests, pull - ups on the bar were the only test to have a cv below 15% . The mean time of maintaining grip force equal to half of its maximum value (t fmax 50%) was below 2 minutes; however, some climbers could continue for more than 3 minutes . In the endurance tests with the bar, the climbers could hang vertically for an average of 4 minutes (hang) and the mean number of pullups they could do exceeded 22 . Statistical characteristics of somatic variables, muscle strength and endurance in the studied climbers (n = 14) statistical significance: p<0.01, * p<0.05 mass body mass [kg]; fmax r, fmax l- maximal grip strength (right and left hands) [n]; fw r, fw l relative grip strength (right and left hands) [n / kg]; fmax r, fmax l maximum muscle force development (right and left hands) [n / s]; ledge 1 maximal strength of the fingers (hang from a 2.5 cm wide ledge) [kg]; ledge 2 relative strength of the fingers (hang from a 2.5 cm wide ledge) [kg / kg]; bar 1 maximal strength of arm muscles (hang from a bar) [kg]; bar 2 relative strength of arm muscles (hang from a bar) [kg / kg]; hang 1 muscle endurance (hang from a 2.5 cm wide ledge) [s]; hang 2 muscle endurance (hang from a 4.0 cm wide ledge) [s]; hang muscle endurance (hang from a bar) [s]; pull ups maximum number of pull - ups [n]; t fmax 50% muscle endurance (maintain a dynamometer grip force at 50% of fmax) [s]. The cluster analysis formed two main groups of tests: one consisting of tests measuring various aspects of muscle strength and speed, and the other comprising tests investigating muscle endurance . Among the strength tests, the results of ledge 1 and ledge 2 were most similar . On the upper level in the bottom section of the diagram, they were positioned with the results of the dynamometer tests measuring absolute and relative grip strength and muscle force development . In the upper section of the diagram, the results of ledge 1 and ledge 2 connected with the results of bar 1 and bar 2, which showed absolute and relative arm strength . In the second group of tests (evaluating muscle endurance), the results of hang 1 and hang 2 were closely related . On the upper level, they co - occurred with the results obtained from the hang test . The results of both identified groups of tests (measuring different aspects of muscle strength and endurance) clearly clustered together in the mid - section of the diagram . In the upper section, still higher in the taxonomic tree, in the upper section of the diagram, there were body mass values . At the highest level, they were together with the results of the dynamometer test requiring the subjects to maintain 50% of fmax until volitional exhaustion . An enhancement to the above analysis was provided by the results of pearson s rank correlations (table 2). The coefficients of the rank correlation (table 3) for ledge 1 and ledge 2 were very high (r = 0.99). Analysis of the correlations between the results of the dynamometric (strength) tests and those yielded by the test measuring strength of the fingers in the specific position of the hand on the hold (ledge 1 and 2) did not show any statistically significant coefficients . The same applied to the ledge 1 and 2 strength tests and the arm strength tests (bar 1 and 2) the results of the ledge and pull ups bar tests were positively correlated, but the correlations were significant in one case only . The results of the muscle endurance test maintaining 50% of fmax were not found to be significantly related to the results of any other test . P<0.01, * p<0.05 spearman s rank correlation coefficients (r) between variables statistical significance: p<0.01, * p<0.05 spearman s rank correlation coefficients (table 4) between climber s competence and the results of the finger strength tests (ledge 1 and 2) and of the test measuring resistance to fatigue of the isometrically contracted forearm muscles (hang 1, 2 and hang) were statistically significant . The strongest correlations were found between climber s competence and the relative results of the finger strength test (r = 0.7); much weaker, but still significant coefficients were found between the level of competence and the results of the muscle endurance tests (r = 0.53 0.57). Especially noteworthy was a relatively high, although statistically non - significant coefficient of correlation between climber s competence and the results of the pull ups test (r = 0.48). Coefficient rank size of climber s competence with body mass, motor effects of strength and endurance character (n = 14) statistical significance: the cluster and correlation analysis of the results of the above tests provided answers to the question of how useful a motor test scan could be in evaluating muscle strength and endurance in sport climbers . A literature review has shown that while some researchers use dynamometers to assess muscle strength variables, others prefer specific motor tests . Unlike the results obtained during specific trials (ferguson and brown, 1997), those provided by dynamometer tests have not been significantly correlated with athlete s competence, which casts some doubts as to whether dynamometer tests and specific conditioning tests, such as hanging from a ledge, measure the same aspects of muscle strength . An explanation of this inconsistency can be sought in the technical limitations of the standard measurement devices . Laboratory tests utilizing standard dynamometers very rarely replicate the true conditions of a climbing competition, especially regarding the configuration of the climber s wrists and fingers during grips (booth et al . This fact makes them less useful for assessing muscle strength, particularly in elite climbers . The outcomes of this research fully support this observation, as they showed that although the dynamometric and specific tests were part of the same group of strength tests, their results were not significantly correlated . The reasons for these results can be identified with an analysis of the grips . Unlike the ledge test, the grip strength test actively engages climber s muscles and the thumb acting in opposition to the fingers . Moreover, the specific tests engage many more muscle groups (the whole group of antigravitational muscles moving the upper extremities) than the dynamometer tests . Finally, the muscles that the dynamometric grip activates remain in an isometric contraction . In contrast, the muscle work required in a climber hanging from a ledge must be more effective because the engaged muscles must cope with gravity - induced stretching . All these findings provide grounds for concluding that the two types of tests differ from each other: the measurement of grip strength is not specific in determining the performance of elite climbers, although it is a useful tool for evaluating the general population or for application in cross - sectional studies . In elite climbing, a variable that should be considered relates to specific grips, especially the ones using distal phalanges . Moreover, an evaluation of elite climbers can be performed on the basis of specific tests . The assumptions made in this study were that climber s performance and the results of the arm strength tests (bar 1 and 2) would correlate and that some affinity between the results of the pull - up bar and ledge tests performed with additional loads could be expected . The motor tests (ledge 2 and bar 2) were very similar, their results, as presented in the tree diagram, were positioned close to each other, and both measured relative strength of the arms, but they were indeed different . The result of the ledge test is determined by strength of the finger flexors, whereas in the pull ups test, the elbow flexors are most significant . More arguments in support of this observation can be found in watts et al . (1993). Evaluating the bioelectric potential of the flexor digitorum superficialis and the brachioradialis, the researchers established that both muscles were active in a subject doing a pull - up engaging the four fingers of each hand and that the bioelectrical potential in the flexor digitorum superficialis was greater . All available studies and practical experience indicate that endurance is important in competitive sport climbing (espaa - romero et al ., 2009; the endurance tests applied in this study required the climbers to hang from a bar, a 2.5 cm ledge and a 4 cm ledge until volitional failure (hang, hang 1 and 2, respectively). The duration of the trial was an indication of the subject s resistance to fatigue . It was not surprising to find that the results of both ledge tests (r = 0.77) were very strongly correlated . At the same time, the duration of the bar test (hang) was significantly correlated only with the time of the 4 cm ledge test (hang 2). While the ledge tests engage distal phalanges of the last four fingers, the bar test requires the motor apparatus of the whole hand to be activated, which means that the ledge tests appear to measure muscle resistance to fatigue in small grips and the bar test to measure resistance to fatigue in larger grips . Since climbing difficulty inherently concerns the types of grips a route involves and because the most difficult routes that only elite climbers can complete have holds requiring many small grips, it becomes quite clear why the length of time climbers could hang from the ledge differentiated them from each other and why this time was correlated with their competence . The necessity for laboratory tests to replicate actual climbing requirements and the objective problems with meeting this demand seem to be the main reason why the results of the test requiring subjects to maintain a dynamometer grip force at 50% of fmax were not directly related to the results of the endurance tests . It was found that climbers were able to generate higher grip force values than non - athletes, although the two groups did not significantly differ in the length of time they could maintain the required force . The outcomes of this experiment additionally show that the results of the test were not related to climber s competence . All these findings and the aforementioned limited value of grip strength tests in climbing provide grounds for not using the grip force test to evaluate muscle endurance in climbers . The last element of our study on muscle endurance concerns the results of the pull - up test . When applied to the general population, the test accurately measures strength of subjects upper extremities, as most of them do not have appropriately strong arms to complete the pull - up test easily; additionally, the test allows to observe how particular individuals differ in that respect . In elite climbers, relative strength of the upper extremities is much greater, and thus the interpretation of the test s results is not so simple . Not only can they perform more repetitions, but the number of pull - ups completed differs only slightly between individual climbers (table 1). The results of the analyses indicate that the pull - up test has a hybrid character (requiring both strength and endurance). Its results in the dendrogram are situated close to the results of the strength and endurance tests, which implies that in elite climbers, the test measures the endurance of arm muscles . Although the number of pull - ups the studied climbers could complete on the bar and their performance were not significantly correlated, it is still important to remember that the functional status of the arm musculature is vital in this sport . The results of other studies (booth et al ., 1999) lead to the same conclusion, as they clearly point to much greater strength endurance of the arms of climbers compared to non - climbers . It can be presumed that the absolute result of the strength test in particular may heavily depend on subject s body mass . Some evidence in support of this conclusion however, in competitive sport climbers, this relationship is somewhat different . The main resistance force they must cope with while climbing comes from their body weight (quaine and vigouroux, 2004; ruchlewicz et al ., 1997); therefore, they need to demonstrate high values of relative strength, defined as the ratio between maximum strength and body mass (michailov et al ., the rank correlation coefficients between the results of muscle strength and muscle endurance tests and climbers body mass were low . This finding was probably caused by the very small variance in body mass (a cv of approximately 3.5%) and the climbers being very similar in their skills . The aforementioned small range in body mass values can probably be attributed to the nature of the training process and the related length of climbing experience, as well as to the specific selection of individuals for this sport . No subjects in the study had body mass greater than 70 kg and the difference between the heaviest and the lightest climber only slightly exceeded 10% (8 1997), elite climbers were found to have a similar body build, which appears to clearly indicate that this morphological feature is not a major factor in differentiating climbers in terms of strength and endurance.
Type 1 diabetes (t1d), is a chronic autoimmune disease and it is common in children the body's own immune system attacks the beta - cells in the islets of langerhans of the pancreas, destroying or damaging them . It can lead to long - term complications including cardiovascular disease, blindness and kidney failure . The damage of the beta - cells in the islets of langerhans which caused by cytotoxic lymphocytes results in insulin deficiency and hyperglycemia . Autoreactive t - cells that recognize islet autoantigens have been identified and are thought to play a direct role in t1d immunopathogenesis . The breakdown of beta cell - specific self - tolerance by t lymphocytes involves a number of dysregulated events intrinsic and extrinsic to t cells . The peripheral tolerance to self antigens t regulatory cells are minor population of cd4 + t cells express high levels of cd25 . It has an important role in the control of immune reactivity against self antigens, and probably plays a role in pathogenesis of t1d . Different studies[169] had recently reported findings related to the frequency and function of regulatory t cells in t1d, but their results represents a somewhat conflicting body of findings . We aimed to estimate the frequency of regulatory t cells in recently diagnosed diabetes in children attending assiut children university hospital, egypt . Twenty patients meeting the diagnostic criteria of t1d were recruited consecutively at the pediatric clinical endocrinology unit, children hospital of assiut university, faculty of medicine . In addition to twenty children with age and sex - matched, none of whom had either a personal or family history of diabetes or other autoimmune pathologies as control were included in the study . Definite diagnosis of t1d according to the definition of the world health organization criteria that defines this form of diabetes with permanent insulinopenia prone to ketoacidosis, result from a cellular - mediated autoimmune destruction of the beta cells of the pancreas.on insulin replacement therapy.age range 2 - 16 years.diabetic duration less than 12 weeks . Definite diagnosis of t1d according to the definition of the world health organization criteria that defines this form of diabetes with permanent insulinopenia prone to ketoacidosis, result from a cellular - mediated autoimmune destruction of the beta cells of the pancreas . On insulin replacement therapy . Children with secondary diabetes mellitus (dm).children with type 2 dm.evidence of active infection requiring antibiotic therapy or other concurrent diseases.other autoimmune disease.age <2 years> 16 years . Evidence of active infection requiring antibiotic therapy or other concurrent diseases . Other autoimmune disease . Twenty patients meeting the diagnostic criteria of t1d were recruited consecutively at the pediatric clinical endocrinology unit, children hospital of assiut university, faculty of medicine . In addition to twenty children with age and sex - matched, none of whom had either a personal or family history of diabetes or other autoimmune pathologies as control were included in the study . Definite diagnosis of t1d according to the definition of the world health organization criteria that defines this form of diabetes with permanent insulinopenia prone to ketoacidosis, result from a cellular - mediated autoimmune destruction of the beta cells of the pancreas.on insulin replacement therapy.age range 2 - 16 years.diabetic duration less than 12 weeks . Definite diagnosis of t1d according to the definition of the world health organization criteria that defines this form of diabetes with permanent insulinopenia prone to ketoacidosis, result from a cellular - mediated autoimmune destruction of the beta cells of the pancreas . On insulin replacement therapy . Children with secondary diabetes mellitus (dm).children with type 2 dm.evidence of active infection requiring antibiotic therapy or other concurrent diseases.other autoimmune disease.age <2 years> 16 years . Evidence of active infection requiring antibiotic therapy or other concurrent diseases . Other autoimmune disease . Definite diagnosis of t1d according to the definition of the world health organization criteria that defines this form of diabetes with permanent insulinopenia prone to ketoacidosis, result from a cellular - mediated autoimmune destruction of the beta cells of the pancreas.on insulin replacement therapy.age range 2 - 16 years.diabetic duration less than 12 weeks . Definite diagnosis of t1d according to the definition of the world health organization criteria that defines this form of diabetes with permanent insulinopenia prone to ketoacidosis, result from a cellular - mediated autoimmune destruction of the beta cells of the pancreas . On insulin replacement therapy . Children with secondary diabetes mellitus (dm).children with type 2 dm.evidence of active infection requiring antibiotic therapy or other concurrent diseases.other autoimmune disease.age <2 years> 16 years . Evidence of active infection requiring antibiotic therapy or other concurrent diseases . Other autoimmune disease . All cases were subjected to: full history including demographic factors: age, sex, residence, family history of diabetes.full clinical examination.complete blood count (celltac e automated hematology analyzer, tokyo, japan).serum insulin c - peptide levels were measured by radioimmunoassay using commercial kits (diagnostic systems laboratories inc, webster, texas). Fasting normal insulin c peptide=0.78 - 5.19 ng / ml.flow cytometric detection of regulatory t cells, b - lymphocytes and t - lymphocytes . Full history including demographic factors: age, sex, residence, family history of diabetes . Full clinical examination . Serum insulin c - peptide levels were measured by radioimmunoassay using commercial kits (diagnostic systems laboratories inc, webster, texas). Fasting normal insulin c peptide=0.78 - 5.19 ng / ml . Flow cytometric detection of regulatory t cells, b - lymphocytes and t - lymphocytes . Cd4cd25foxp3 regulatory t cells in whole blood samples were enumerated using fluoroisothiocyanate (fitc)-conjugated forkhead box protein 3 (foxp3) (e bioscience, usa), phycoerythrin (pe) conjugated cd25 (iq product, the netherland) and peridinium - chlorophyll - protein (per - cp)-conjugated cd4 (becton dickinson, bioscience, usa). Fifty l of blood sample was incubated with 10 l of cd4, cd25 for 15 minutes at room temperature in the dark . Following incubation, rbc lysis, washing with phosphate buffer saline (pbs), addition of fixed solution to fix the cells and incubation for 10 minutes were done . After incubation, cells were washed with pbs, and then permelized solution and 10 l of foxp3 were added and incubated for 30 minutes at room temperature . For detection of b- and t - lymphocytes, 50 l of blood sample was stained with 10 l of fitc - conjugated cd19 and pe - conjugated cd3 (becton dickinson biosciences, usa). Flow cytometric analysis was done by facscalibur flow cytometry with cellquest software (becton dickinson biosciences, usa). Forward and side scatter histogram was used to define the lymphocyte population (r1). Total cd4cd25, cd4cd25, cd4cd25 (defined as the population of cd4 positive t cells whose cd25 expression exceeded the level of cd25 positivity seen in the cd4 negative t cells) and cd4cd25 foxp3 regulatory t cells was evaluated as a percentage of total lymphocytes and of cd4 as shown in figure 1 . The expression of foxp3 in cd4cd25 and in cd4cd25 cells was expressed as geometric mean of fluorescence intensity (mfi). (a) forward and side scatter histogram was used to define the lymphocytes population (r1). (b, c) the expression of cd4 and cd25 in total lymphocytes (r1) was detected, compared with the negative isotype control and and different gates were drown to define cd4 cd25cells (r2), cd4cd25 cells (r3), and cd4cd25 cells (r4). (d) the percentage of cd4cd25 foxp3cells (r5) in total lymphocytes was determined . (e - g) show the analysis of regulatory t cells in cd4 cells (r 6). Cd4 cd25cells (r7), cd4cd25 cells (r8), and cd4cd25 cells (r9). (h) show the expression as a geometric mean of fluorescence intensity (mfi) of foxp3 in cd4cd25 cells . The positivity was defined as fluorescence (red histogram) higher than that of the isotype control (open histogram) statistical package for social sciences (spss), version 16 was used for data analysis . All data were expressed as the mean standard error of mean (sem). Due to the small sample size and a propensity for outliers in some of the variables, cd4cd25foxp3 regulatory t cells in whole blood samples were enumerated using fluoroisothiocyanate (fitc)-conjugated forkhead box protein 3 (foxp3) (e bioscience, usa), phycoerythrin (pe) conjugated cd25 (iq product, the netherland) and peridinium - chlorophyll - protein (per - cp)-conjugated cd4 (becton dickinson, bioscience, usa). Fifty l of blood sample was incubated with 10 l of cd4, cd25 for 15 minutes at room temperature in the dark . Following incubation, rbc lysis, washing with phosphate buffer saline (pbs), addition of fixed solution to fix the cells and incubation for 10 minutes after incubation, cells were washed with pbs, and then permelized solution and 10 l of foxp3 were added and incubated for 30 minutes at room temperature . For detection of b- and t - lymphocytes, 50 l of blood sample was stained with 10 l of fitc - conjugated cd19 and pe - conjugated cd3 (becton dickinson biosciences, usa). Flow cytometric analysis was done by facscalibur flow cytometry with cellquest software (becton dickinson biosciences, usa). Forward and side scatter histogram was used to define the lymphocyte population (r1). Total cd4cd25, cd4cd25, cd4cd25 (defined as the population of cd4 positive t cells whose cd25 expression exceeded the level of cd25 positivity seen in the cd4 negative t cells) and cd4cd25 foxp3 regulatory t cells was evaluated as a percentage of total lymphocytes and of cd4 as shown in figure 1 . The expression of foxp3 in cd4cd25 and in cd4cd25 cells was expressed as geometric mean of fluorescence intensity (mfi). (a) forward and side scatter histogram was used to define the lymphocytes population (r1). (b, c) the expression of cd4 and cd25 in total lymphocytes (r1) was detected, compared with the negative isotype control and and different gates were drown to define cd4 cd25cells (r2), cd4cd25 cells (r3), and cd4cd25 cells (r4). (d) the percentage of cd4cd25 foxp3cells (r5) in total lymphocytes was determined . (e - g) show the analysis of regulatory t cells in cd4 cells (r 6). Cd4 cd25cells (r7), cd4cd25 cells (r8), and cd4cd25 cells (r9). (h) show the expression as a geometric mean of fluorescence intensity (mfi) of foxp3 in cd4cd25 cells . The positivity was defined as fluorescence (red histogram) higher than that of the isotype control (open histogram) statistical package for social sciences (spss), version 16 was used for data analysis . All data were expressed as the mean standard error of mean (sem). Due to the small sample size and a propensity for outliers in some of the variables, some demographic and clinical data of diabetic children and controls were presented in table 1 . Some demographic and clinical data of diabetic children and control there were no significant difference in white blood cells count, platelet count and hemoglobin concentration between diabetic patients and controls [table 2]. The level of insulin c peptide was significantly lower in children with / t1d compared with controls with p <0.000 . Some laboratory characteristics of diabetic patients and controls there were no significant difference in the percentages of t lymphocytes (cd3), b lymphocytes (cd19) and t helper cells (cd4) between patients than controls [table 3]. The percentages of total cd4cd25 and cd4cd25 in total lymphocytes were not significantly different between patients and controls . The percentages of cd4cd25 and cd4cd25 foxp3 in total lymphocytes were significantly decreased in patients than controls . Similar results were observed when these cells were analyzed as a percentage of cd4 t cells . Regulatory t cells in diabetic patients and controls the mfi of foxp3 expression in cd4cd25 foxp3 cells was significantly decreased in patients than controls, while mfi of foxp3 expression in cd4cd25 cells was not significantly different between patients and controls [table 3]. The frequency of cd4cd25 foxp3 was positively correlated with age of the patients (r = 0.585, p <0.000), and the level of insulin c peptide (r = 682, p <0.000) [figures 2 and 3]. Correlations between the frequency of cd4cd25foxp3 and age of diabetic patients correlations between the frequency of cd4+cd25foxp3 and level of insulin c peptide type 1 diabetes is a well - known autoimmune disease; however there are still some processes in its pathogenesis to be elucidated . T regulatory cells are essential for maintaining peripheral tolerance, preventing autoimmune diseases and limiting chronic inflammatory diseases . These cells modulate the intensity and quality of immune reactions through attenuation of the cytolytic activities of reactive immune cells . In this study, cd4cd25 foxp3 cells were considered as regulatory t cells, as the suppressive capacity of regulatory t cells in humans seems to be confined to cd4cd25 cells with the highest expression of cd25 (cd4cd25, whereas cd4 t cell with intermediate expression of cd25 might also contain recently activated t cells and effector t - cells without regulatory function. [1517] also, the identification of foxp3 as a regulatory lineage specific factor provided a useful phenotypic and optimal marker for regulatory t cells,[1820] and the suppressive phenotype and the development of regulatory function depend on the expression of foxp3. [2124] indeed, recent results indicate that foxp3 behaves as a master regulator of the regulatory t cells phenotype . We found the frequency of cd4 cd25 and cd4 cd25 foxp3 both in total lymphocytes and in cd4 cells were significantly decreased in diabetic patients than controls while the frequency of total cd4cd25 and cd4 cd25 both in total lymphocytes and in cd4 cells were not significantly different in patients and controls . This decline in the frequency of cd4 cd25 and cd4 cd25 foxp3 t cells in our patients could implies that the deficiency of regulatory t cells may has a role in the pathogenesis of type 1 diabetes . In accordance with our results, luczyski et al ., found a statistically significant decrease of t regulatory cells in children with newly diagnosed / t1d . Ryba et al ., also reported lower percentage of regulatory t cells in children with / t1d . Luczyski et al ., reported that percentage of cd4cd25 was decreased in diabetic patients than controls, the same as our study, while the percentages of cd4+cd25highcd127dim/ were very low and did not differ between t1d and control children and this difference could be due to the of different markers of regulatory t cells they used, cd127dim/ and not foxp3 as our study . Lindley et al ., reported that there is no difference in the level of regulatory t cells between patients with / t1d and healthy controls . However, in these studies, the patients were adult or have long lasting diabetes . In brusko et al ., their patients and controls are older than our patients, and their controls from considerably older than their patients . Glisic - milosavljevic et al ., reported that there is a higher level of ongoing apoptosis in cd4+cd25 + t cells in recent - onset t1d subjects and in subjects at high risk for the disease . On the contrary, in long - standing / t1d and / t2d subjects, cd4+cd25 + t cell apoptosis is at the same level as in control subjects . This high level of cd4+cd25 + t - cell apoptosis could explain the decrease of regulatory t cells in our patients . Foxp3, is a critical molecular switch for the genetic programming of natural regulatory t cell development and function . In this study; the mfi of foxp3 expression in cd4cd25 cells were 44.68 2.34 and 74.81 3.47 in patients and controls respectively, while the mfi of foxp3 expression in cd4cd25 were 29.05 2.49 and 37.09 3.50 in patients and controls respectively . The expression of foxp3 in cd4cd25 foxp3 cells was significantly decreased in diabetic patients than controls, while its expression in cd4cd25 cells was not significantly different between patients and controls . Lawson et al . Reported that there was no difference in foxp3 expression on cd4cd25 t cells in patients with / t1d, but in contrast to our study the patients had long standing diabetes, and both patients and controls were adult subjects . In the present study, cd4cd25foxp3 was positively correlated with age of diabetic children . Brusko et al ., reported in their study that increasing age was associated with an increase in total cd4cd25 frequency . In the present study, insulin c peptide level was significantly lower in children with / t1d compared with control . In addition, the frequency of cd4cd25 foxp3 was positively and significanty correlated with the level of insulin c peptide . Insulin c - peptide level is the most reliable factor in evaluation of the endogenous insulin secretion in patients with / t1d . Autoimmune destruction of the beta cells of pancreas results in deficiency of both insulin and insulin c - peptide . This study concluded that children with / t1d have lower percentages of t regulatory cells in the peripheral blood which correlated positively with age of patients and the level of insulin c peptide . The percentages of regulatory t cells were assessed in the peripheral blood but not at the site of affection (pancreas and/or draining lymph nodes).the distinction of regulatory t cells by a flow cytometry including - high expression of cd25 antigen is very subjective and can result in different findings from different laboratories . The percentages of regulatory t cells were assessed in the peripheral blood but not at the site of affection (pancreas and/or draining lymph nodes). The distinction of regulatory t cells by a flow cytometry including - high expression of cd25 antigen is very subjective and can result in different findings from different laboratories . The percentages of regulatory t cells were assessed in the peripheral blood but not at the site of affection (pancreas and/or draining lymph nodes).the distinction of regulatory t cells by a flow cytometry including - high expression of cd25 antigen is very subjective and can result in different findings from different laboratories . The percentages of regulatory t cells were assessed in the peripheral blood but not at the site of affection (pancreas and/or draining lymph nodes). The distinction of regulatory t cells by a flow cytometry including - high expression of cd25 antigen is very subjective and can result in different findings from different laboratories.
Calcifying fibrous tumor (cft) is a very rare, usually benign soft tissue tumor characterized by a proliferation of bland spindled mesenchymal cells with abundant collagen, background lymphoplasmacytic inflammation and variable amounts of stromal calcification . Herein, we report the case of a patient with cft arising within soft tissue densely adherent to the left adrenal gland . A 22-year - old man was evaluated and treated from age 10 for chronic epigastric pain . Egd and other diagnostic studies failed to elucidate a cause . Computed tomography (ct) he underwent ct imaging which revealed a solid 6.2 5.9 4.8 cm well - circumscribed retroperitoneal mass thought to be emanating from the lateral limb of the left adrenal gland (fig . The mass was abutting the posterior pancreatic tail and antero - superior aspect of the left kidney . Adrenal biochemical studies, including acth, cortisol, dehydroepiandrosterone sulfate, free testosterone, aldosterone, renin, plasma fractionated metanephrines, were within normal ranges . Insulin, proinsulin, c - peptide and glucose levels were normal . Figure 1:(a) ct scan of the abdomen showing a 6.2 5.9 4.8 cm retroperitoneal mass appearing to emanate from the lateral limb of the left adrenal gland . (b) photograph of the gross specimen revealing a firm, white - tan and well - circumscribed tumor . (a) ct scan of the abdomen showing a 6.2 5.9 4.8 cm retroperitoneal mass appearing to emanate from the lateral limb of the left adrenal gland . (b) photograph of the gross specimen revealing a firm, white - tan and well - circumscribed tumor . A portion of normal adrenal tissue is visible . Given the concern for an adrenocortical or other malignancy (pancreatic or soft tissue), an exploratory laparotomy via subcostal incision was performed . Findings revealed a firm, circumscribed mass emanating from the posterior aspect of the left adrenal gland . The mass did not involve any adjacent structures and there was no evidence of lymphadenopathy . A left adrenalectomy with en bloc resection of periadrenal soft tissue was performed without violation of the capsule . Histologically, the mass comprised a hypocellular proliferation of bland spindle cells, densely hyalinized collagen, chronic lymphoplasmacytic inflammation and dystrophic calcifications (fig . While there was no infiltration into the adrenal gland, there was early entrapment of small vessels . Most of the spindle cells that appeared morphologically fibroblastic were normochromatic, and had a low mitotic rate (01 per 10 high - powered fields). Figure 2:(a, b) cft demonstrating hypocellular proliferation of bland spindle cells, densely hyalinized collagen, chronic lymphoplasmacytic inflammation and dystrophic calcifications (h&e; x400 and x20). (c, d) inflammatory component of cft, comprised small lymphocytes and plasma cells, the latter are occasionally binucleate or have russell bodies (h&e; x200 and x400). (a, b) cft demonstrating hypocellular proliferation of bland spindle cells, densely hyalinized collagen, chronic lymphoplasmacytic inflammation and dystrophic calcifications (h&e; x400 and x20). (c, d) inflammatory component of cft, comprised small lymphocytes and plasma cells, the latter are occasionally binucleate or have russell bodies (h&e; x200 and x400). Immunophenotypically, the spindle cells were negative for smooth muscle actin, desmin, alk, s100, cd34 and cd117 . The plasma cells were polytypic without restricted kappa or lambda light chain expression, and the majority expressed immunoglobulin g (igg) with a subset positive for igg4 . In three x400 plasma cell - rich fields (hotspots), the average number of igg - positive cells was 183 and the average number of igg4-positive cells was 11 (ratio = 16) (fig . Figure 3:immunohistochemical stains for (a) kappa light chain expression (x200), (b) lambda light chain expression (x200), (c) igg (x200) and (d) igg4 (x200). Immunohistochemical stains for (a) kappa light chain expression (x200), (b) lambda light chain expression (x200), (c) igg (x200) and (d) igg4 (x200). Cft, initially described by rosenthal and abdul - karim in 1988 (childhood fibrous pseudotumor with psammoma bodies), was further characterized by fetsch et al . In 1993 (calcifying fibrous pseudotumor), and then reported as a series of 15 cases by nascimento et al . In 2002 . Cfts can arise in a variety of locations, but are more commonly described arising in or from the pleura, thoracic cavity, extremities, mediastinum and abdominal cavity [3, 4]. To date, there have only been four previously reported cases of adrenal cft [58]. These lesions were previously called calcifying fibrous pseudotumor . However, due to a local recurrence rate of ~10%, these lesions were renamed cfts in the current world health organization classification . This case is similar to the one reported by lau and weiss, although in that particular case, the mass nearly replaced the entire adrenal gland, whereas in this current case, the adrenal gland was spared . Closer scrutiny of these previous cases suggests that the tumors were perhaps adjacent to rather than arising from the adrenal gland as in this case [58]. The gross description, histology, immunophenotype and polytypic nature of the plasma cells are identical . Radiologic characterization of these masses is not well described other than being solid tumors that are usually well circumscribed . Magnetic resonance imaging findings described in a case report revealed signal iso - intense to skeletal muscle on t1 weighted images and low signal intensity on t2 weighted images . Other types of benign fibrous tumors reveal intense peripheral enhancement after gadolinium injection; however, the cft showed only mild peripheral enhancement . Histologically, cfts are composed of a hypocellular proliferation of non - atypical spindle cells, dense collagen, lymphoplasmacytic inflammation and stromal calcifications . In the majority of cases, the spindle cells are negative for actins, s100, desmin and alk . Cd34 expression is more variable and can be focal or diffuse . Similar to cft, inflammatory myofibroblastic tumor (imt) contains a proliferation of spindle cells accompanied by inflammation - containing plasma cells . Spindle cells of imt are usually positive for muscle specific actin, sma and desmin, but staining can be focal . Of note, 2540% of extrapulmonary imts recur, but metastasis is rare (<2% of cases). The histological similarities between cft and imt have raised the question as to whether cfts are a sclerosing end stage of imts . Both lesions consist of spindle cells, collagen deposition and lymphocytic infiltrates . Despite similarities,, cft is an uncommon soft tissue lesion of uncertain etiology low on the list of differential diagnoses often occurring in younger patients in a variety of locations and usually associated with a clinically benign course.
Biological membranes provide physical boundaries between different worlds, separating the cellular and extracellular environments and the diverse cellular compartments . However, they are highly dynamic and interactive boundaries, as they act as a scaffold for molecules and molecular complexes that physically and functionally link these different environments (singer and nicolson, 1972). The fundaments for the structure and functions of biological membranes ever since 1925, it became clear that membranes are a bimolecular sheet (gorter and grendel, 1925), and at the end of the 1960s the nature of this bimolecular sheet as a bilayer of amphipathic lipids was unveiled (steim et al . Thus, the creation of the lipid bilayer, a consequence of the aggregational properties of complex amphipathic membrane lipids, represents the first level of lipid - driven organization in biological membranes . To serve its primary function as a physical boundary, however, the fatty acyl chains of the phospholipids constituting the bulk of biological lipid bilayers at 37c are in a fluid phase . Thus, biological lipid bilayers at physiological temperature are bidimensional fluids . The fluid mosaic model proposed by singer and nicolson (1972) describes the fluid phospholipid bilayer as the solvent for membrane proteins, implying that, as for a three - dimensional viscous solution, the protein molecules dissolved in the two - dimensional fluid would possess a certain degree of lateral motility, freely diffuse in the phospholipid bilayer, and distribute along the membrane surface in a random (aperiodic) arrangement . The fluid mosaic model, implying a random distribution of plasma membrane components over microscopic distances, predicts the absence of long - range order in plasma membranes . However it assumes that some of the lipid components might be not in the bulk, fluid bilayer phase, but they might rather be more strongly (specifically?) Interacting with the membrane proteins, thus allowing lateral heterogeneity on a short distance (<100 nm). In addition, the model incorporates the notion that the random distribution of membrane components might be perturbed by external, physiological stimuli, and that the subsequent aggregation of membrane components might be of crucial importance in some biological processes . Shortly after the fluid mosaic model had been formulated (19741978), experiments studying thermal effects on the behavior of membrane lipids suggested that phase behavior of lipid mixtures could be responsible for a certain degree of lateral organization in biological membranes, introducing the notion that the collective aggregational properties of membrane lipids might be the driving force for the creation of a second level of order in biological membranes (lee et al ., 1974; wunderlich et al ., 1975, 1978). In 1982, the concept that the existence of multiple phases in the membrane lipid environment can drive the organization of the lipid components of membranes into domains (karnovsky et al ., 1982) was clearly formulated . This concept became the basis of the lipid raft hypothesis (simons and van meer, 1988). However, while there is today no doubt that ordered structures that differ in lipid and/or protein composition from the surrounding membrane (to this writer, this is the minimal acceptable definition for membrane domains; lindner and naim, 2009) exist in biological membranes, the real contribution of phase separation to the stabilization of membrane domains in living cells is just beginning to be elucidated . This is probably not surprising, keeping in mind the huge diversity of membrane lipids . A typical biological membrane contains hundreds of different lipid species, as progressively elucidated by the emerging contribution of a sophisticated lipidomic approach . We have detailed information on the phase behavior for only relatively simple mixtures of the most common membrane lipids (sonnino et al ., 2006; goni et al ., 2008; quinn, 2010). Translating this information to the phase behavior of natural membranes has proven to be extremely difficult, and a reductionist approach might be conceptually inadequate to investigate a phenomenon that is based on the maintenance of collective properties (this concept has been nicely addressed in a recent review (mouritsen, 2010). In addition, our capability to understand the importance of lipid phase separation in organizing membranes has been further limited by other factors: (1) the complexity of membrane chemistry is not limited to lipid components . Biological membranes do contain an incredible number of different proteins (maybe it is worth to recall that, when the fluid mosaic model was proposed, the notion that one single type or class of structural membrane protein exists had been just recently refuted). Thus, it is clear that other lipid - driven or lipid - influenced interactions, in addition to phase separation, can be extremely relevant to determine membrane organization; (2) biological membranes are systems not at equilibrium (mayor and rao, 2004), while most pieces of information regarding lipid phase separation have been obtained from the study of equilibrium artificial systems . Many studies on lipid rafts in biological systems rely on the putative resistance of lipid raft components to the solubilization by non - ionic detergents . Detergent - resistant membrane preparations might reflect the properties of lipid rafts in living cells (sonnino and prinetti, 2008), however they are undoubtedly systems driven to equilibrium by the specific experimental conditions used for detergent extraction systems . To understand the dynamics (in time and space) of phase separation - driven domains in living cells we still miss adequate experimental tools, even if the first pieces of information in this direction have been recently provided . The pillar of the original lipid raft model is that lipids can organize domains in cellular membranes . The non - complete miscibility of lipids in complex mixtures can be described using phase diagrams (goni et al ., 2008). This property leads to phase separation in model systems as well as likely in biological membranes (sonnino et al ., 2006, 2007; lindner and naim, 2009; westerlund and slotte, 2009; elson et al ., 2010; mouritsen, 2010; quinn, 2010). Liquid immiscibility, heterogeneity can be driven by a multitude of specific lateral interactions . Then, why phase separation should be biologically relevant? Phase separation can be observed in all membrane models that recapitulate the other basic properties of a cellular membrane; moreover, the main difference between bona fide lipid rafts and the surrounding membrane is the lipid composition . On this basis, lipid rafts should be defined as areas of phase separation in biological membrane (lindner and naim, 2009), the properties of lipid rafts in living cells should be dictated by the forces governing phase separation, and a biological event should be lipid raft - dependent if dependent on those forces . Since phase separation of lipids is a consequence of the collective properties of a membrane lipid environment, the dependence of a biological event on lipid rafts should not be defined on the basis of natural or experimental changes in the cellular levels of a single lipid (in other word, a biological event or cellular properties can be dependent on a specific lipid, e.g., cholesterol - dependent, without being lipid raft - dependent). Lipid bilayers usually exist in a liquid - disordered (ld) phase characterized by high fluidity, in which the lipid acyl chains are disordered and highly mobile . Lowering the temperature below the melting point freezes the lipid acyl chains in an ordered gel phase (solid - ordered) with very limited freedom of movement . In mixtures comprising a bilayer - forming lipid, such as dipalmitoylphosphatidylcholine, and cholesterol (or ergosterol in yeast), a third physical phase, the liquid - ordered (lo) phase (ipsen et al ., 1987), can be observed . In the lophase, the acyl chains of lipids are extended and ordered, as in the gel phase, but have higher lateral mobility in the bilayer . However, glycerolipids with saturated chains are not neglectable membrane components (prinetti et al ., 2001), and in some other classes of complex membrane lipids (e.g., sphingomyelin and gangliosides, at least in the nervous system), palmitic and stearic acid represent the main fatty acids . Lipids with a high content of saturated acyl chains (that possess a high melting point and can be tightly packed with a high degree of order in the hydrophobic core of a bilayer) are characterized usually by a higher transition temperature, within or above the physiological range (prinetti et al . The difference of transition temperature due to the different acyl chain composition probably represents one of the main forces leading to phase separation in lipid mixtures and aggregates, including bilayers . Indeed phase separation can be observed in binary mixtures of diacyl lecithins differing in chain length and/or saturation (goins et al ., 1986; masserini and freire, 1986; masserini et al ., 1988, 1989; rock et al ., 1991; terzaghi et al ., 1993; palestini et al ., 1994, 1995) and, in turn, complex lipids containing palmitic acid are highly enriched in detergent - resistant membrane fractions from cells (e.g., neurons) (prinetti et al ., 2001; pitto et al . Phase separation of sphingomyelin in dimyristoylphosphatidylcholine bilayers depends on the degree of sphingomyelin chain mismatch (kahya et al ., 2005) and distribution of ganglioside gm1 in the fluid phase of a phospholipid bilayer (palestini et al ., 1995) is inversely correlated with the acyl chain length and directly correlated with the degree of unsaturation . Brain gangliosides, usually highly enriched in stearic acid, are typical lophase lipids . On the other hand, very long (c24) fatty acids are abundant in sphingolipids outside the nervous system . Lipid bilayers of the skin stratum corneum, characterized by an extremely high content of unusually long chain ceramides, are very rigid (bouwstra and ponec, 2006), and, based on neutron diffraction experiments on artificial membranes, it has been proposed that the organization of stratum corneum lipid bilayers could be stabilized by a partial interdigitation between the two leaflets (ruettinger et al ., 2008). Interdigitated hydrocarbon chains seem to play a role in the stabilization of lipid domains in human neutrophils, enriched in lactosylceramide with a high content of c24 fatty acid chains (iwabuchi et al ., 2008; yoshizaki et al ., 2008). Interdigitation of long chain fatty acid residues of complex membrane lipids might thus represent a further feature that favors the separation of phases with a higher level of order . This hypothesis still needs to be proven, however, it has been suggested that, even in the absence of interdigitation, long chain fatty acid - containing sphingolipids can form quasi - crystalline structures in glycerophospholipid bilayers (quinn, 2010). Cholesterol, that alone has a melting point of 148.5c, preferentially associates with ordered acyl chains of complex lipids, due to the tight packing of the planar smooth -face of the sterol ring against the extended acyl chains of lophase lipids, both glycerol- and sphingolipids (mouritsen, 2010; quinn, 2010). Cholesterol (in a wide molar range, including also physiologically reasonable concentrations) forms a liquid - ordered phase in dimyristoylphosphatidylcholine or distearoylphosphatidylcholine bilayers (almeida et al ., 1992) alone, in phospholipid bilayers in the presence of sphingomyelin, that mixes more ideally with cholesterol that a phosphatidylcholine with the same acyl chain (snyder and freire, 1980; sankaram and thompson, 1990) and in sphingomyelin vesicles (ferraretto et al ., 1997). In the lo phase, the sterol molecules are tightly intercalated between the ordered acyl chains of the bilayer - forming lipid (brown and london, 2000; sonnino et al ., 2006), and cholesterol it should be noted that despite this, understanding the real role of cholesterol in stabilizing membrane domains is made difficult by the lack of precise information about the transbilayer distribution of this molecule . Reports in the literature indicate that a large fraction of plasma membrane cholesterol is associated with the inner leaflet (75% in human erythrocytes, schroeder et al ., 1991; 85% in mice synaptic membrane, igbavboa et al ., 1997). Ergosterol, the main sterol in fungi, is also able to stabilize liquid - ordered phases (klose et al ., 2010). Coexistence of lo and ld phases has been shown in ternary mixtures of cholesterol with a high- and a low - transition temperature lipid (for example, in ternary mixtures of dipalmitoyl pc, dioleyl pc, and cholesterol (veatch and keller, 2005), sometimes using a sphingolipid as high melting lipid (mattjus and slotte, 1996). A strong preferential interaction between cholesterol and sphingomyelin, leading to the formation of liquid - condensed cholesterol- and sphingomyelin - rich domains, has been suggested by some studies in mixed monolayers (li et al ., 2003; mattjus and slotte, 1996; ohvo - rekila et al ., 2002). However, this notion has been subsequently confuted by a paper (holopainen et al ., 2004) clearly showing that in phospholipid bilayers there is no evidence of such a specific interaction between cholesterol and sphingomyelin . In the case of sphingolipids, phase separation and association with lo phase in glycerophospholipid bilayers are favored by two additional features, that are unique to this class of lipids . (1) sphingolipids, as ceramide - based amphipathic lipids, can create a complex network of hydrogen bonds thanks to the presence in the ceramide moiety of the amide nitrogen, the carbonyl oxygen and the hydroxyl group positioned in proximity of the water / lipid interface of the bilayer (pascher, 1976). The contribution of a hydrogen bond network to lipid lipid interactions stabilizing a more rigid segregated phase in the bilayer is energetically remarkable (310 kcal per hydrogen bond vs 23 kcal per interaction in the case of van der waals forces between hydrocarbon chains). The relevance of this factor has been confirmed by recent studies showing that (a) mixtures of natural sphingomyelin and phosphatidylcholine molecular species with comparable fatty acyl chains are largely immiscible at temperatures above the transition temperature of sphingomyelin (quinn and wolf, 2009); (b) increased order can be observed in c18-sphingomyelin molecules in a dioleylphosphatidylcholine bilayer due to the formation of sphingomyelin nanoclusters stabilized by hydrogen bonds (mombelli et al ., 2003; pandit et al ., (2) glycosphingolipids, present in all mammalian cell membranes as minor components, however abundant in some tissues (e.g., brain) and cell types (e.g., neurons) and asymmetrically enriched in the outer leaflet of the plasma membrane, are defined on the basis of their sugar hydrophilic headgroup . Even the simplest, monosaccharide - based glycosphingolipid headgroup is much bulkier that phospholipid headgroups, and, as a general trend, the volume occupied by the sugar headgroup increases with the complexity of the oligosaccharide chain (figure 1). Theoretical calculations of minimum energy conformation show that the oligosaccharide hydrophilic headgroup of ganglioside gm1, one of best studies gangliosides, occupies a volume much larger than that occupied by phosphocholine, the bulkiest headgroup present in phospholipids (acquotti et al ., predictions based on the geometrical properties of glycosphingolipid molecules indicated that separation of a glycosphingolipid - rich phase in a phospholipid bilayer, concomitantly accompanied by the acquisition of a positive membrane curvature, would imply a minimization of the interfacial free energy required to accommodate the amphipathic glycosphingolipid molecule in the bilayer . In other words, the geometrical properties dictated by the bulky hydrophilic headgroup of glycosphingolipid strongly favor phase separation and spontaneous membrane curvature (acquotti et al ., 1990, 1991, 1994; scarsdale et al ., 1990;, 1990a, b, 1994; levery, 1991; siebert et al ., 1992; poppe et al ., 1994; brocca et al ., these predictions are confirmed by the observation that the extent of ganglioside phase separation in glycerophospholipid bilayers depends on the surface area occupied by the glycosphingolipid oligosaccharide chain, that is usually directly correlated with the number of sugar residues present in the oligosaccharide (masserini and freire, 1986; masserini et al . In addition, gm1-enriched domains can be formed in sphingomyelin bilayers (ferraretto et al ., 1997) and phase separation was observed in mixed micelles of two different gangliosides (gm2 and gt1b (cantu et al ., 1990), gd1b and gd1b - lactone (cant et al ., 1991), or gm1 and gd1a (del favero et al ., 2010) with identical composition of the hydrophobic moiety (figure 2). Schematic representation of the volume occupied by phosphocholine, the headgroup of phosphatidylcholine (pc), and by the oligosaccharide chains of three gangliosides of the ganglio tetraose serie, monosialoganglioside gm1, disialoganlioside gd1a, trisialoganglioside gt1b . Schematic representation of phase separation driven by the differences in the oligosaccharide chains in a gm2/gt1b micelle . It has been recently proposed that membrane curvature can greatly contribute to the reduction of line tension (the energy required to maintain a border between a membrane domain and the surrounding membrane environment) (baumgart et al ., 2003), thus representing a general principle explaining the segregation of lipids and proteins in cellular membranes (tian and baumgart, 2009). It has been suggested that clustering of glycosphingolipids could be further stabilized by the formation of lateral carbohydrate carbohydrate interactions . Nevertheless, while head - to - head carbohydrate carbohydrate interactions have been convincingly described for glycolipids (hakomori, 2004), direct side - by - side oligosaccharide oligosaccharide interactions remain at present merely hypothetical, and nmr studies on ganglioside micelles (brocca et al ., 1998) seem to exclude significant inter - molecular side - by - side interactions . On the other hand, nmr revealed strong interactions between different portions of gm1 oligosaccharide and solvent water molecules (brocca et al ., 1998) suggesting that a network of water - mediated hydrogen bridges could contribute to the stabilization of a glycolipid cluster (it is here worth to recall that water bridges between saccharides play a relevant role in stabilizing the tridimensional structure of hyaluronan (heatley and scott, 1988). Fluid immiscibility, with the separation of a liquid - ordered phase, provides in principle an explanation for the existence of membrane heterogeneity as a consequence of the intrinsic properties of the lipid components of biological membranes . The main criticism against this view is represented by the fact that model systems represent a strong simplification respect to the complexity of the lipid environment in a real membrane . Thus, a big effort has been made to extend these studies to systems closer to the complexity of biological membranes, and fluid phase separation has been observed in reconstituted versions of biological membranes (e.g., giant unilamellar vesicles formed by lipids from brush border membranes (dietrich et al ., 2001) or by lung surfactants (bernardino de la serna et al ., 2004) or, more recently, in vesicles obtained by various methods from cells (mast cells, fibroblasts, baumgart et al ., 2007;, 2008; veatch et al ., 2008; a431 cells, lingwood et al ., 2008) and in budded hiv virus membranes (brugger et al ., 2006) (that are natural example of cell - originated membrane vesicles). The properties of the lipid raft model inferred on the basis of these evidences are basically in agreement with those of the purified detergent - resistant membrane fractions (sonnino and prinetti, 2008) and describe membrane domains based on lipid - driven phase separation as relatively large, stable equilibrium structures, that can be affected by artificial or physiological perturbations . However, this scenario clashed with the view of lateral heterogeneity of biological membranes that emerged more recently by studies conducted using high - resolution (in time and space) techniques in unperturbed, living cells (that obviously represent the ultimate test bed for the lipid raft hypothesis) (reviewed in jacobson et al.,2007; lingwood and simons, 2010). In addition to fluorescence microscopy, that is particularly suitable for the study of living cells and is characterized by a high sensitivity, but hampered by a relatively poor spatial resolution, several high - resolution techniques have been used to study cell membrane heterogeneity in unperturbed cells (table 1) (jacobson et al ., 2007; owen et al ., 2009). Some of these techniques are particularly appealing also for their capability to unveil the dynamics of membrane domains, that is completely lacking in equilibrium - based investigation methods, such as those used to study phase separation in model systems or those based on the analysis of membrane fractions separated on the basis of their detergent solubility . When applied to the study of cell membrane heterogeneity, these techniques were supportive to the lipid raft hypothesis at a limited extent: they basically confirmed that there is a non - random distribution of cell surface molecules, leading to a highly hierarchical membrane organization . In addition, they confirmed the importance of cholesterol and sphingolipids in membrane domain formation (eggeling et al ., 2009). However, all these techniques measure experimental parameters that can be related to the association of a membrane molecule with a putative lipid raft, but basically no experimental technique is currently available to proof that membrane domains observed in intact cells correspond to a liquid - ordered phase . Indeed, the actual view depicted by the advent of these non - invasive approaches encompasses the existence of domains deeply differing in their size and spatial and temporal dynamics, but anyway strongly privileges the notion that membrane domains are small, highly dynamic structures, that are actively maintained and that can be generated, dissipated or deeply reorganized in response to diverse biochemical stimuli . The reported size of these ordered structures in intact cells greatly varies between the nanometer (wilson et al .,; sharma et al ., 2004; douglass and vale, 2005) and the micrometer - scale (schutz et al ., 2000; hao et al ., 2001; gaus et al ., 2003; gomez - mouton et al ., 2004), and their lifespan ranges from microseconds (dietrich et al ., 2002; dahan et al ., 2003; kusumi et al ., 2005a) to milliseconds and seconds (schutz et al ., 2000; gaus et al ., 2003; lommerse et al ., 2004b; these amazing differences in the reported features of membrane domains probably do at least in part reflect the great differences in spatial and temporal resolution that are characteristic of the different techniques used . On the other hand, it is unquestionable that they indicate the coexistence of multiple kinds of non - equilibrium membrane domains, whose features seem to be hardly explainable on the sole basis of the lipid raft hypothesis, i.e., on the basis of fluid fluid phase separation . Should we hence forget about liquid - ordered phase in real biological membranes? The notion of liquid - ordered phase, and the derived concept of lipid raft, still explain several of the properties of membrane domains observed in intact cells, including the heterogeneity at the nanometer scale of membrane domains and their highly dynamic nature . For the latter point, it should be recalled that coalescence of lipid rafts, i.e., the fusion of nanoscale domains into larger signaling platforms, can occur at physiological temperature, possibly under physiologically relevant stimuli (ayuyan and cohen, 2008; hofman et al ., 2008; lingwood et al ., 2008), an indication that phase separation can occur under biologically relevant conditions in intact cells . Moreover, even if no analytical approach can identify a liquid - ordered phase in a living cells, convincing evidences on the ordered nature of lipid - driven membrane domains have been recently obtained . Two findings are particularly convincing in this direction: (1) stimulated emission depletion microscopy, that allows recording of membrane - associated molecules dynamics much below the diffraction limit imposed by visible light, showed the presence of cholesterol- and sphingolipid - dependent nanodomains that exclude glycerophospholipids and transiently trap gpi - anchored proteins (eggeling et al ., 2009); (lingwood et al ., 2008) showed that, in plasma membrane spheres obtained by a cell - swelling procedure from a431 cells, cross - linking of gm1 ganglioside using pentavalent cholera toxin at 37c resulted in the cholesterol - dependent coalescence of gm1-rich domains with the formation of micrometer - scale domains . The resulting gm1- and cholesterol - enriched phase is characterized by a lower translational diffusion, and fluorescent microscopy and spectroscopy performed using order - sensitive probes (kaiser et al ., 2009) revealed that the degree of lateral order in the gm1 domain is sensibly higher than in the surrounding membrane, however it is considerably lower than in the ordered phase of giant unilamellar vesicles, representative of a lipid ordered phase . As a consequence, this gm1 domains recruits lipid - anchored proteins usually regarded as lipid raft markers (but not transferrin receptor, usually excluded from lipid rafts), but also transmembrane proteins normally not associated with liquid - ordered phases in model systems or with detergent - resistant membrane fraction . From these studied clearly emerged that ordered phases in living cells resemble but are not completely equivalent to liquid - ordered phases, and that phase separation under physiological conditions only partially explains the behavior of ordered membrane domains, implying an important role for additional forces . In cell membranes, in addition to liquid liquid immiscibility, heterogeneity can be driven by a multitude of specific lateral interactions . It is a well established notion that proteins possess the potential to organize membrane domains, and indeed protein protein interactions have been regarded for several years as the main factor responsible for the stabilization of membrane macro- and microdomains . Protein- and lipid - driven lateral organizations have been regarded as somehow mutually exclusive, while it is clear that they are cooperative in the creation of membrane structural and functional heterogeneity . Obvious limitations to reciprocal diffusion are present for proteins belonging to a multimolecular complex, formed by direct protein protein interactions, such as the respiratory chain complex in prokaryotes and the complexes organized by membrane receptors . In addition, protein - driven membrane domains can be based on the presence of protein scaffolds (recently reviewed in lindner and naim, 2009), that can be organized by extracellular (e.g., galectins), intracellular (clathrin in clathrin - coated pits, the actin network at the cytosolic face of plasma membrane, that can be anchored to transmembrane proteins creating a membrane - skeleton fence limiting the lateral diffusion of molecules trapped in the fence (kusumi and suzuki, 2005b), or membrane proteins [tetraspanins (hemler, 2005), caveolins and cavins (prinetti et al ., 2008; sonnino and prinetti, 2009), flotillins (rajendran et al ., 2007)]. These domains are mainly driven in their formation and stabilized by protein protein interactions, but specific binding between protein and lipids can be as well involved in the stabilization of the domains (prinetti et al ., 2009). Specific lipids are component of the quaternary structure of membrane - associated proteins or protein complexes, e.g., beta 2 adrenergic receptor (cherezov et al ., 2007; hanson et al ., 2008), cytochrome bc1 (wenz et al ., 2009), and specific binding of gangliosides to membrane receptors has been known from a long time, even if only recently some molecular details have been unveiled (reviewed in prinetti et al ., 2009). Some proteins that are associated with lipid domains are surrounded by a shell of typical raft lipids (sphingolipids, cholesterol) (fantini and barrantes, 2009): a lipid shell might confer to a membrane protein higher affinity for lipid rafts, determining its partitioning to a phase separated membrane domain in cooperation with or even in the absence of a specific raft targeting motif . Cholesterol binding domains and sphingolipid binding domains (that can bind the polar headgroups of sphingolipids) have been identified and characterized in several proteins (epand, 2006; fantini and barrantes, 2009). The binding of lipids to receptors induces conformational changes affecting both ligand binding and signaling pathways downstream to receptor activation . On the other hand, it can deeply influence the lateral organization of membrane components in the domain of a membrane - organizing protein . For example caveolin-1, a typical scaffold - forming protein, tightly and specifically binds cholesterol (murata et al ., 1995; li et al ., 1996; thiele et al ., 2000), and cholesterol, in turn, is essential for caveolae formation and maintenance (fielding and fielding, 2000; ikonen et al ., 2004). Remarkably, palmitoylation (usually regarded as a lipid raft targeting motif) of caveolin does not affect its association with lipid rafts, however it is relevant for caveolin interaction with cholesterol (uittenbogaard et al ., 2002). The interaction of tetraspanins with cholesterol or sphingolipids does not affect direct interactions of tetraspanins with other membrane proteins (integrins), but affects tetraspanins homo - oligomerization and signal transduction through tetraspanin - dependent complexes (glycosynapse) (charrin et al ., 2003; hakomori, 2009). Even in the case of membrane domains usually regarded as exclusively protein - driven and lipid raft - independent, a role of lipid protein interactions has been described . In the case of clathrin - dependent endocytosis, phosphatidylinositol(4,5)-bisphosphate is used as the membrane anchor for several proteins involved in the formation of clathrin - coated pits (haucke, 2005; hning et al . Transient confinement zones fenced by a diffusion barrier created by the anchoring of actin filaments to transmembrane proteins has been sometimes regarded as an alternative model to lipid rafts to explain the organization of membrane domains (kusumi and suzuki, 2005b). However, recent data indicate a close interplay between actin mediated- and lipid raft - mediated events (e.g., endocytosis of gpi - anchored proteins (chadda et al ., 2007; goswami et al ., 2008), and suggest that lipid - based domains can be stabilized by the cortical actin network (chichili and rodgers, 2009; rollason et al ., 2009). One year before formalizing the fluid mosaic model, singer and nicolson (1971) wrote that, to fully understand the function of mammalian cell membranes, it would be necessary to know the structure of cell membranes, we mean the detailed arrangement and conformation of the individual proteins, lipids, oligosaccharides and other components of membranes and concluded that we are a very long way from such knowledge at the present time . There is no doubt that tremendous progresses have been made in this direction, and our current view on membrane organization has been in the last decade deeply influenced by the lipid raft hypothesis . The lipid raft hypothesis had the great merit to re - focus the researcher's attention on the importance of lipids, and in particular on the importance of collective properties of a cellular lipid environment, in determining membrane organization, and to root the notion that membrane order is highly dynamic and changing . However it is gradually emerging the importance of the interplay of different lipid - sensitive mechanisms for membrane lateral organization, and an interpretation model solely based on fluid fluid phase separation is probably no longer adequate in describing the whole complexity of lipid - dependent membrane heterogeneity . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
In western countries, obesity, defined as a body mass index (bmi) 30 kg / m, is reaching the proportions of an epidemic.1,2 lifestyle interventions are seldom associated with long - lasting results.3 accordingly, requests for bariatric surgery have dramatically increased in recent years,4 with the majority of the procedures performed through laparoscopic approach, which is a valid option to open surgery and demonstrated to reduce major complications.5 in italy, 11,483 bariatric surgeries have been performed in 2015, with a laparoscopic approach in 97% of cases.6 on the other hand, perioperative management of morbidly obese patients is undoubtedly challenging for anesthesiologists . . Nevertheless, neuromuscular blockade may be important during laparoscopic surgery in order to optimize ventilation and maintain an adequate pneumoperitoneum.7 nonetheless, correct dosing of nondepolarizing neuromuscular blocking agents should be calculated according to ideal body weight in order to avoid extended duration of action810 and postoperative residual curarization (porc). Porc may potentially induce adverse respiratory events11 and its frequency is often underrated: ~30% of all patients receiving a neuromuscular blocking drug show signs of impaired activity and coordination of the pharyngoesophageal muscles, and this may result in an increased incidence of complications after anesthesia.11 close monitoring of neuromuscular function has been recognized as an effective way to lower the occurrence of porc and related pulmonary complications.1113 porc increases the risk of critical respiratory events,11 due to an impaired activity and coordination of the pharyngoesophageal muscles.14,15 a train - of - four (tof) ratio <0.9 has shown to be associated with a heightened risk of pulmonary complication.14,15 in addition, neuromuscular blocking agents smooth the ventilatory response to hypoxia, and may increase the risk of respiratory impairment.16 accordingly, use of antagonists, either acetylcholinesterase inhibitor (achei) or sugammadex, is strongly recommended when there is evidence of an incomplete recovery from neuromuscular blockade (tof ratio <0.9).17 to monitor neuromuscular blockade, anesthesiologists may use acceleromyography - based monitoring . A tof ratio of 1.0 represents complete recovery from paralysis, while residual neuromuscular block (nmb) is defined as a tof ratio of <0.9; the latter is associated with impairment in swallowing, airway obstruction, and heightened risk of gastric content aspiration.14,15 in this study, we analyzed and compared the costs and the recovery times after sugammadex or neostigmine administration, and estimated the time of operating theater occupancy (time from starting anesthesia to when the patient was transferred to the postanesthesia care unit [pacu]), in morbidly obese patients undergoing bariatric surgery . After obtaining ethical committee approval (university of naples federico ii 188/13), we conducted a retrospective analysis by searching in the hospital database, using the international classification of diseases 9th revision code for bariatric surgery . Due to the retrospective nature of the study, the local ethics committee (university of naples federico ii) did not find it necessary to obtain specific written informed patient consent . Patients were considered eligible, if they conformed to the following inclusion criteria: age> 18 and <45 years, bmi 40 kg / m, and american society of anaesthesiologists class iii, and no planned intensive care unit admission . Exclusion criteria were the planned or unplanned admission to intensive care unit, surgery lasting more than 3 hours, redo surgery (second bariatric surgical intervention with a more efficacious effect on weight loss), extremely morbidly obesity (bmi> 60 kg / m). Other exclusion criteria were the presence of comorbid conditions such as neuromuscular disorders, liver or renal dysfunction, and history of malignant hyperthermia . The following anesthesiological procedure is the standard protocol in our institution: induction of general anesthesia is performed administering propofol 12 mg / kg and remifentanil 0.250.5 g / kg / min and maintained with sevoflurane and remifentanil 0.150.3 g / kg / min . Standard monitoring consists of five - lead electrocardiography, pulse oximetry, end - tidal carbon dioxide, and noninvasive blood pressure monitoring . Neuromuscular monitoring is performed using acceleromyography (tof - watchw sx and tof - watch sx monitoring program, organon ireland ltd ., neuromuscular blockade is obtained with either rocuronium 1.2 mg / kg or cisatracurium 0.2 mg / kg . Maintenance doses of rocuronium 0.15 mg / kg or of cisatracurium 0.03 mg / kg are given as required to keep the neuromuscular blockade depth at 15% of first twitch (t1). Patients receive rocuronium or cisatracurium based on ideal body weight.18 at the end of surgery, sugammadex 2.0 mg / kg as a single dose or neostigmine 50 g / kg plus atropine 0.01 mg / kg is given at the reappearance of two twitches on the tof recording . Patients are extubated in the operating room (or) when a tof ratio of 0.9 is achieved and then transferred to the recovery room . In the recovery room, vital parameters and aldrete score data for analysis were retrieved from clinical charts, anesthesia charts, and pacu records . Our primary end point was comparing the latency to achieve a tof ratio> 0.9 after reversal agents administration, the mean time to achieve an aldrete score of 10, and the cost associated with these drugs . Our secondary end points were to evaluate the duration of operating theater occupancy, to identify the incidence of postoperative desaturation in pacu, and to evaluate the length of stay in hospital . Data are presented as mean (standard deviation) and were compared using the wilcoxon rank sum test or mann whitney u test . The statistical analysis was performed using spss for windows, version 10.1 (spss inc ., the overall number of elective laparoscopic bariatric surgery performed in our institution (university of naples federico ii) from 2009 to 2013 was 321 . In our analysis, we included 99 patients who fulfilled inclusion criteria, allocating them in one of the two groups: in group 1 (n=50 sug), rocuronium administration was used for neuromuscular paralysis and sugammadex was used for reversal; in group 2 (n=49 neo), rocuronium (35 patients) or cisatracurium (14 patients) were used for neuromuscular paralysis and neostigmine for reversal . Duration of surgeries was not significantly different between the two groups (table 2). In the sug group, the mean recovery time from reversal administration to a tof ratio 0.9 was quicker than in neo group (1.4 [0.4] minutes vs 26.4 [5.9] minutes, p<0.05) and all patients who received sugammadex recovered to a tof ratio> 0.9 within 5 minutes from its administration . Sug group experienced a remarkable less duration of operating theater occupancy (time from starting anesthesia till time that the patient was transferred to the pacu) compared with neo (93.3 minutes vs 116.6 minutes, p<0.05). The mean time to obtain an aldrete score of 10 (indicating that these patients were ready to be discharged from pacu) was 16 (1.8) minutes in sug group and 21.8 (2.8) minutes in neo group (p<0.05). There were no significant differences in spo2 at pacu admissions or discharge and in length of stay in hospital between the two groups . The sugammadex dose used to reverse neuromuscular paralysis was 258.8 (58.4) mg (table 2), and the mean cost per treatment was 146.7 . In neo group, the mean dosage to reverse neuromuscular paralysis was 6.4 (0.9) mg and the calculated cost per treatment was 3.6 . Our health system assigns for the three bariatric procedures we included in our analysis (laparoscopic sleeve gastrectomy, laparoscopic adjustable gastric band, laparoscopic biliopancreatic diversion) the same reimbursement of 5,681 . Consequently, the cost of sugammadex accounted for the 2.58% of the total cost per surgery, while the neostigmine cost accounted for 0.06% . However, the mean time saved using sugammadex instead of neostigmine was 23 minutes (table 3). Total time saved for all the procedures done in the sug group was 19.4 hours, while the total cost due to sugammadex use was 7,335 . An analysis of the economic impact of sugammadex use in our study (table 3) shows that 12 extra laparoscopic sleeve gastrectomies could be carried out with the time saved by sugammadex . The reimbursement for these extra surgical procedures would be 68,172 with a cost of sugammadex for all surgical procedures (n=50 + 12) of 9,095 . Subtracting the cost due to sugammadex, the total net gain (68,172 9,095) in terms of reimbursement would be 59,077 and the net gain for all surgeries (n=50 + 12) in terms of reimbursement would be 952.8 (59,077/50 + 12). As a result, 1 of sugammadex may generate 6.5 of reimbursement (952.8/146.7). In this retrospective analysis, we evidenced that sugammadex accelerated recovery from nmb and may bring potential favorable economic implication . Extended routine monitoring of neuromuscular function may be particularly advantageous and may reduce the frequency of residual neuromuscular blockade.19,20 evidences from literature report that many clinicians do not routinely use reversal agents before extubation.21,22 use of antagonists, either achei or sugammadex, may help in preventing incomplete recovery from neuromuscular blockade (tof ratio <0.9).17 sugammadex, a new reversal of neuromuscular blockade, encapsulates rocuronium in a stable complex which is excreted and removed by the kidney, while acheis augment acetylcholine availability at the neuromuscular junction . The efficacy of acheis is limited by the ceiling effect in which additional doses have no further effect when there is a complete inhibition of all cholinesterases.23,24 furthermore, acheis are associated with vagal reactions, autonomic instability, and nausea and vomiting.25 nowadays, it is widely ascertained that sugammadex induces a faster recovery from rocuronium muscular block than acheis, independently from the depth of the block.26 anyway, the high cost associated with sugammadex limits its use in routine clinical practice, where a clear benefit, from an economic perspective, is evident only when the time saved from recovery is used for more productivity.27 in our study, the faster recovery rate of sug group shortened the duration of operating theater occupancy by a mean time of 23 minutes . It is necessary to clarify that the time saved by sugammadex is related to anesthesia period and other variables (nurse staff, room sterilization, skills of anesthesiologists and surgeons, etc) may influence the time of operating theater occupancy . On the other hand, even if sugammadex cost accounted for the 2.58% of the cost per surgery, total time saved for all the procedures in which sugammadex was used was 19.4 hours compared with neostigmine . Consequently, we may speculate that the rocuronium / sugammadex regimen would allow us to perform an other 12 laparoscopic sleeve gastrectomies . The time saved by sugammadex could be employed not only for more productivity, but also to reduce costs associated with operating room occupancy (ie, personnel). Carron et al28 conducted a retrospective study showing that sugammadex use may reduce the risk of porc, with an estimated cost - saving of 2.9/case . The authors concluded that the increased turnover and workflow using sugammadex clearly outweigh its high cost . This figure is similar to the findings of an earlier simulation - based analysis, in which the authors concluded that the reduced recovery time could increase the number of cases by 2.4% over a 3-month period.29 as stated elsewhere, this kind of economic analysis does not reflect clinical recommendations27 or, as in our experience, the complexity of the reimbursement fees from the regional health system in italy . Moreover, the cost of sugammadex can vary substantially in different regions, making it difficult to reach any broader pharmacoeconomic conclusions . As shown in a recent systematic review,30 sugammadex may be cost - effective only when the time saved in the operating theater is spent in productivity . This assumption seems not applicable for the time saved in the recovery room.30 on the other hand, it is still unclear if sugammadex administration is associated with a better postoperative outcome.31 a randomized study32 in morbidly obese patients showed that the use of sugammadex was associated with a tof ratio> 0.9 (assessed using acceleromyography) in pacu, while neostigmine was not . However, it is worth mentioning that tof ratio assessed by acceleromyography may be not reliable and accurate in awake patients.33 carron et al34 have shown that sugammadex use is associated with a faster and safer recovery profile from neuromuscular blockade than neostigmine in morbidly obese patients, making it suitable for a fast - track bariatric surgery . Another prospective study in patients undergoing laparoscopic bariatric surgery evidenced that the frequency of postoperative mechanical ventilation requirement was not different, if neuromuscular blockade was reverted with sugammadex or neostigmine.35 perhaps, sugammadex may be clinically useful in reducing postoperative adverse respiratory events in patients at risk, such as in elderly patients with american society of anaesthesiologists status of three or more.36 more recently, a randomized trial37 involving patients undergoing abdominal surgery has shown that sugammadex use was associated with full recovery from nmb, while 43% of patients in the neostigmine group experienced signs (tof ratio <0.9 in pacu) of residual curarization . Also the discharge time was faster for patients in the sugammadex group . Although not powered for showing differences in pulmonary function compromise, postoperative respiratory complications were similar in the two groups . In our study, we did not find desaturation in pacu and differences in length of stay in both groups, suggesting that major pulmonary complication did not occur . An european prospective multicenter observational study (clinicaltrials.gov website: nct01865513) named post - anaesthesia pulmonary complications after use of muscle relaxants has been recently sponsored by the european society of anaesthesia . This project aims to evaluate the effects of management of neuromuscular blockade on postoperative pulmonary complications in a general anesthetized population . The postanaesthesia pulmonary complications after use of muscle relaxants trial will investigate if the technique of neuromuscular monitoring influences the risk for postoperative pulmonary complications . Hopefully, the role of tof will be cleared and a solid basis for implementing its use will be consolidated.38 the main limitations of this study are its retrospective nonrandomized, single - center design, and the exclusion of extremely morbidly obese (bmi> 60 kg / m) patients . As cisatracurium and rocuronium were both considered in the analysis, we may not rule out the presence of an analytical bias . Moreover, the time saved by sugammadex is related to anesthesia period and other variables may influence the time of operating theater occupancy . We did not record tof ratio at pacu, but we considered the aldrete score as a clinical index of full recovery from nmb . The clinical application of a tof - driven protocol to reverse neuromuscular paralysis in morbidly obese patients should be encouraged . However, the main benefit is the time saved in the operating room, which could be used in more productivity, such as increasing the number of surgical procedures to perform.
A total of 21 isolates of c. dubliniensis, 10 from the buccal cavity and 11 from subgingival biofilm, were collected from 240 non - smoking individuals who attended the dental clinic of the university of buenos aires, argentina . Periodontal evaluations included clinical examination and radiographs with clinical measurements: clinical attachment level (cal), pocket depth (pd), plaque index (29), gingival index (30), and bleeding on probing (bop). Measurements were made at four sites per tooth (mesial, buccal, distal, and lingual positions) at 15 teeth excluding the third molar . Participation in our survey was voluntary and all the patients provided a written informed consent . The dental professional then isolated the area to be sampled by means of cotton rolls and a high - speed suction device . Following removal of the supragingival plaque, in order to avoid contamination, four subgingival plaque samples were taken from each patient: the upper right and lower central incisor, the first upper right molar and the first lower left molar, to mimic the more common periodontal pockets infected in periodontitis, by using a 7/8 sterile gracey curette . Samples were pooled and cultured on a differential chromogenic medium (chromagar candida, paris, france). Buccal cavity samples, including palatal, buccal mucosa, and tongue, were collected by sterile cotton - tipped swabs and were streaked directly onto the chromogenic medium . Isolated yeasts were identified by conventional mycological methods: colony color on the chromogenic medium, micromorphology in agar milk with 1% tween 80 (31), and carbohydrate assimilation tests using the commercially available kit api i d 32c (biomrieux, france). Further studies were conducted for characterization of c. dubliniensis, including chlamydospore formation on staib agar after incubation for 72 h at 28c (32) and specific pcr with primers from actin gene (act1)-associated intron sequences of c. dubliniensis, dubf (gtatttgtccttccccttttc) and dubr (gtgttgtgtgcactaacgtc) (7, 33). Yeast dna was isolated according to a previously described technique (7, 34, 35). The dna was quantified and its purity was evaluated at 260 nm (smartspec 3000 spectrophotometer bio - rad). Primer sequences were as follows: opa 02 (tgccgagctg), opa 09 (gggtaacgcc), m13f (cgacgttgtaaaacgacgcccagt), m13r (caggaaacagctatgac), and ocp 5 (gatgaccgcc). Arbitrary amplification was performed in a total volume of 50 l containing: 1buffer 2.5 mm mgcl2, 0.2 mm each of the dntp, 0.5 m of the primer, 1.25 u taq dna polymerase (invitrogen), and 75 ng of template dna . The cycling program was made up of 4 min at 94c, 35 cycles of 1 min at 94c, 1 min at 25c, 2 min at 72c followed by a final extension of 5 min at 72c . These steps were carried out in a minicycler dna thermal cycler (tm mj research inc ., ny, usa). They were visualized under uv light and digitalized by the image analyzer software (epi - chemi darkroom . Each band was scored as positive or negative for all isolates, and for each isolate, the presence or absence of each band was registered . The resulting matrix was interpreted using the treecon program, where isolates were grouped according to their pattern resemblance . Based on matrix of similarity coefficients (sc), a dendrogram was generated by the unweighted pair group method using arithmetic averages (upgma). The criterion used for genotyping was as follows: arbitrary threshold at an sc of 90% for high relatedness isolates (20). Confidence intervals (ci) were calculated at 95% employing the epi - info 6.04 program (atlanta university, usa). A total of 21 isolates of c. dubliniensis, 10 from the buccal cavity and 11 from subgingival biofilm, were collected from 240 non - smoking individuals who attended the dental clinic of the university of buenos aires, argentina . Periodontal evaluations included clinical examination and radiographs with clinical measurements: clinical attachment level (cal), pocket depth (pd), plaque index (29), gingival index (30), and bleeding on probing (bop). Measurements were made at four sites per tooth (mesial, buccal, distal, and lingual positions) at 15 teeth excluding the third molar . Participation in our survey was voluntary and all the patients provided a written informed consent . The dental professional then isolated the area to be sampled by means of cotton rolls and a high - speed suction device . Following removal of the supragingival plaque, in order to avoid contamination, four subgingival plaque samples were taken from each patient: the upper right and lower central incisor, the first upper right molar and the first lower left molar, to mimic the more common periodontal pockets infected in periodontitis, by using a 7/8 sterile gracey curette . Samples were pooled and cultured on a differential chromogenic medium (chromagar candida, paris, france). Buccal cavity samples, including palatal, buccal mucosa, and tongue, were collected by sterile cotton - tipped swabs and were streaked directly onto the chromogenic medium . Isolated yeasts were identified by conventional mycological methods: colony color on the chromogenic medium, micromorphology in agar milk with 1% tween 80 (31), and carbohydrate assimilation tests using the commercially available kit api i d 32c (biomrieux, france). Further studies were conducted for characterization of c. dubliniensis, including chlamydospore formation on staib agar after incubation for 72 h at 28c (32) and specific pcr with primers from actin gene (act1)-associated intron sequences of c. dubliniensis, dubf (gtatttgtccttccccttttc) and dubr (gtgttgtgtgcactaacgtc) (7, 33). Yeast dna was isolated according to a previously described technique (7, 34, 35). The dna was quantified and its purity was evaluated at 260 nm (smartspec 3000 spectrophotometer bio - rad). Primer sequences were as follows: opa 02 (tgccgagctg), opa 09 (gggtaacgcc), m13f (cgacgttgtaaaacgacgcccagt), m13r (caggaaacagctatgac), and ocp 5 (gatgaccgcc). Arbitrary amplification was performed in a total volume of 50 l containing: 1buffer 2.5 mm mgcl2, 0.2 mm each of the dntp, 0.5 m of the primer, 1.25 u taq dna polymerase (invitrogen), and 75 ng of template dna . The cycling program was made up of 4 min at 94c, 35 cycles of 1 min at 94c, 1 min at 25c, 2 min at 72c followed by a final extension of 5 min at 72c . These steps were carried out in a minicycler dna thermal cycler (tm mj research inc . They were visualized under uv light and digitalized by the image analyzer software (epi - chemi darkroom . Each band was scored as positive or negative for all isolates, and for each isolate, the presence or absence of each band was registered . The resulting matrix was interpreted using the treecon program, where isolates were grouped according to their pattern resemblance . Based on matrix of similarity coefficients (sc), a dendrogram was generated by the unweighted pair group method using arithmetic averages (upgma). The criterion used for genotyping was as follows: arbitrary threshold at an sc of 90% for high relatedness isolates (20). Confidence intervals (ci) were calculated at 95% employing the epi - info 6.04 program (atlanta university, usa). The 240 subjects included in the study ranged in age from 18 to 75 years (mean age 37), 55% were females (132/240) and had not received any antibacterial or antifungal agents before sampling . Table 1 shows clinical periodontal parameters (pd and cal meansd) of subjects at the time of sampling . Patients were classified into groups according to the periodontal health status as shown in table 1: healthy (n=53), gingivitis (n=58), and chronic periodontitis (n=129). Clinical periodontal parameters (meansd and 95% confidence interval) of subjects at the time of sampling according to periodontal health status * healthy, n=53; gingivitis, n=58; chronic periodontitis, n=129 . Kruskal wallis test: (differences in the median values among the groups ) h=902,675 with two degrees of freedom (p<0.001). As expected, periodontitis sites showed significantly more signs of disease, including higher mean pd (p<0.001) and mean cal (p<0.001) than healthy patients . Table 2 summarizes species distribution of yeast isolates in the buccal cavity and the subgingival biofilm according to the periodontal health status in 240 immunocompetent individuals . Species distribution of yeast isolates in buccal cavity (bc) and subgingival biofilm (sb) according to periodontal health status in 240 immunocompetent individuals healthy, n=53; gingivitis, n=58; chronic periodontitis, n=129 . Wallis test, p <0.01 . Out of the 203 recovered yeasts, c. albicans was the most frequent species corresponding to 26.7% (64/240) in the buccal cavity and 21.7% (52/240) in the subgingival biofilm, as shown in table 2 . C. dubliniensis was isolated in 4.2% (10/240) and 4.6% (11/240) of patients in both niches, respectively . Distribution of c. dubliniensis isolates from the subingival biofilm according to periodontal health status (table 2), was as follows: 2.5% from subjects with chronic periodontitis, 1.7% with gingivitis, and 0.4% from healthy individuals . We selected five rapd primers, based on their reproducibility, after pre - screening to analyze 21 isolates of c. dubliniensis . The number of bands ranged from three splitters (m13r) to 12 (m13f). Two of the five primers were the most informative (m13f and opc5) and they generated the highest number of band patterns (between 10 and 12). 1 shows the dendrogram of rapd fingerprints of c. dubliniensis isolates, the sc ranged from 50 to 100% . Eight genetic clusters and five main genotypes were obtained at an sc of 90%, genotypes i, ii, iii, iv, and v, as shown in fig . 1 . Dendrogram generated by upgma clustering method, using the coefficient of similarity between rapd - pcr of c. dubliniensis in oral cavity (a) and subgingival biofilm (b) in immunocompetent individuals . All isolates unclustered or belonging to different clusters by rapd analysis were observed to differ by three or more bands . Rapd analysis showed identical genotypes of c. dubliniensis in different sampling sites in eight of the 10 patients (buccal cavity and subgingival areas), except for those observed in two participants . One case was patient 1, who presented presumably unrelated isolates (fig . 1, green arrows). The other patient, number 3 presented two strains in subgingival biofilm (cd3b and cd3bb), which represented genotype i and iv, respectively (fig . Moreover, participant 3 presented a mouth c. dubliniensis strain, cd3a, which corresponded with genotype iii (fig . 1, red arrows). The 240 subjects included in the study ranged in age from 18 to 75 years (mean age 37), 55% were females (132/240) and had not received any antibacterial or antifungal agents before sampling . Table 1 shows clinical periodontal parameters (pd and cal meansd) of subjects at the time of sampling . Patients were classified into groups according to the periodontal health status as shown in table 1: healthy (n=53), gingivitis (n=58), and chronic periodontitis (n=129). Clinical periodontal parameters (meansd and 95% confidence interval) of subjects at the time of sampling according to periodontal health status * healthy, n=53; gingivitis, n=58; chronic periodontitis, n=129 . Kruskal wallis test: (differences in the median values among the groups ) h=902,675 with two degrees of freedom (p<0.001). As expected, periodontitis sites showed significantly more signs of disease, including higher mean pd (p<0.001) and mean cal (p<0.001) than healthy patients . Table 2 summarizes species distribution of yeast isolates in the buccal cavity and the subgingival biofilm according to the periodontal health status in 240 immunocompetent individuals . Species distribution of yeast isolates in buccal cavity (bc) and subgingival biofilm (sb) according to periodontal health status in 240 immunocompetent individuals healthy, n=53; gingivitis, n=58; chronic periodontitis, n=129 . Out of the 203 recovered yeasts, c. albicans was the most frequent species corresponding to 26.7% (64/240) in the buccal cavity and 21.7% (52/240) in the subgingival biofilm, as shown in table 2 . C. dubliniensis was isolated in 4.2% (10/240) and 4.6% (11/240) of patients in both niches, respectively . Distribution of c. dubliniensis isolates from the subingival biofilm according to periodontal health status (table 2), was as follows: 2.5% from subjects with chronic periodontitis, 1.7% with gingivitis, and 0.4% from healthy individuals . We selected five rapd primers, based on their reproducibility, after pre - screening to analyze 21 isolates of c. dubliniensis . The number of bands ranged from three splitters (m13r) to 12 (m13f). Two of the five primers were the most informative (m13f and opc5) and they generated the highest number of band patterns (between 10 and 12). 1 shows the dendrogram of rapd fingerprints of c. dubliniensis isolates, the sc ranged from 50 to 100% . Eight genetic clusters and five main genotypes were obtained at an sc of 90%, genotypes i, ii, iii, iv, and v, as shown in fig . 1 . Dendrogram generated by upgma clustering method, using the coefficient of similarity between rapd - pcr of c. dubliniensis in oral cavity (a) and subgingival biofilm (b) in immunocompetent individuals . All isolates unclustered or belonging to different clusters by rapd analysis were observed to differ by three or more bands . Rapd analysis showed identical genotypes of c. dubliniensis in different sampling sites in eight of the 10 patients (buccal cavity and subgingival areas), except for those observed in two participants . One case was patient 1, who presented presumably unrelated isolates (fig . 1, green arrows). The other patient, number 3 presented two strains in subgingival biofilm (cd3b and cd3bb), which represented genotype i and iv, respectively (fig . Moreover, participant 3 presented a mouth c. dubliniensis strain, cd3a, which corresponded with genotype iii (fig . 1, red arrows). C. dubliniensis is a yeast species that is characterized by its in vitro resistance to the antifungal azole group in hiv patients, for their capacity to adhere in vitro to human buccal epithelial cells and other microorganisms in the oral microbiota, as well as the high proteinase activity (9, 15, 37, 38). Later, numerous papers have been published indicating its presence in all types of clinical samples as well as in healthy individuals (7, 10, 14, 33, 3950). In this study, c. dubliniensis showed a prevalence of 4.2% in the buccal mucosa from 240 patients . These results do not match those found by other authors, who found low prevalence of this species in healthy hiv - negative patients (14, 44, 5153). This disagreement could be due to the different study populations evaluated (healthy subjects and periodontitis patients). In this study, the prevalence of c. dubliniensis was 4.6% (95% ci: 2.48.3) in subgingival biofilm in patients from buenos aires, argentina . Table 2 shows an increased prevalence of this species in individuals with chronic periodontitis, compared to healthy individuals and individuals with gingivitis, which is not a statistical significant difference . Based on the findings in this study, it is confirmed that c. dubliniensis can colonize subgingival biofilm in immunocompetent individuals with periodontal disease and healthy ones (6, 7)., since these authors found that c. dubliniensis dominated among candida species other than c. albicans, being most prominent in periodontal pockets (54). Others authors have not found c. dubliniensis in the gingival sulcus in healthy individuals (4, 10, 11). The rapd - based typing was used to assess the diversity of candida species isolates, as it has been described as a simple, rapid, and reliable discriminatory method for clinical epidemiological studies of oral candida infections (17, 23, 24, 27, 35). In spite of this, and considering the reproducibility pitfalls of the rapd method, it was considered adequate to compare the reliability of the rapd - based clustering with that obtained with pulsed field gel electrophoresis analysis, referred to as a more robust method (20, 23, 55). In the present study, the rapd analysis showed similar genotypes of c. dubliniensis in different sampling sites from the same patient (buccal cavity and subgingival areas), except for those observed in two patients (fig . Rapd profiles of c. dubliniensis isolates from the participants were generally distinct; therefore almost every individual harbored his / her own specific isolate . Such genetic heterogeneity within isolates was reported from other oral and non - oral sources in c. albicans (25, 26, 56). These results led us to the conclusion that, the origin of the colonization of c. dubliniensis in subgingival biofilm seems to be the buccal cavity, consequently, it may be assumed that most of c. dubliniensis in these sites arise from endogenous commensal strains . As the only mode of reproduction known for c. dubliniensis is asexual, these results suggest a common clonal origin of isolates in both niches (57). In our series, c. dubliniensis genotypes had some differences between oral and subgingival isolates in two patients . Participants 1 and 3, harbored subgingival strains genetically presumably unrelated, to the isolated ones from their buccal cavity . Pizzo et al . (25) noted the presence of a different c. albicans dna type in subgingival sites . This observation suggests that the presence of c. albicans or c. dubliniensis could also occur due to the colonization with subgingivally adapted strains, possibly as a result of genetic variations such as gene conversion and/or chromosomal translations (19, 2527). Similar c. dubliniensis genotypes may be distributed among healthy and periodontal disease individuals, as shown in fig . 1, genotypes i, ii, iii, and v included isolates from individuals that were healthy or had periodontal disease . Therefore, a hypervirulent strain of c. dubliniensis that is involved in disease patients should be excluded . Other authors also observed that genetically identical yeasts appeared in both healthy and diseased subjects when they investigated c. albicans isolates (22, 25, 27). To date, no studies have been aimed at genetic characterization of subgingival c. dubliniensis isolates . Therefore, our yeast isolates were subjected to rapd - pcr analysis, which has proved to be a rapid, simple, cost - effective and discriminatory technique for molecular typing of c. dubliniensis . This is the first survey in argentina to study the molecular characterization of c. dubliniensis by rapd - pcr clinical isolates in different ecological niches of the oral cavity . Such findings may be useful as baseline information on subgingival c. dubliniensis colonization in our country . There is no conflict of interest in the present study for any of the authors.
The endoplasmic reticulum (er) is an essential organelle of eukaryotic cells functioning in secretory protein synthesis and processing, lipid synthesis, calcium storage / release, and detoxification of drugs . Unfolded proteins are retained in the er and targeted for retrotranslocation to the cytoplasm for rapid degradation . Under normal physiological conditions, there is a balance between the unfolded proteins and the er folding machinery . Disruption of the balance results in accumulation of unfolded proteins, a condition termed er stress [15]. The er stress triggers the unfolded protein response (upr), which attenuates protein translation, increases protein folding capacity, and promotes degradation of unfolded proteins, thus restoring er homeostasis . However, prolonged upr leads to an attempt to delete the cell causing injuries . Molecular chaperones such as the glucose - regulated protein 78 (grp78/bip) interact with three er membrane resident stress sensors: inositol - requiring enzyme-1 (ire1), transcription factor-6 (atf6), and pkr - like eukaryotic initiation factor 2 kinase (perk), and play a vital role in maintaining the protein homeostasis inside the er [15]. Many human diseases such as metabolic syndrome, neurodegenerative diseases, alcohol - induced organ disorders, and inflammatory diseases involve er stress and impaired upr signaling [17]. Increasing evidence supports er stress as a key mechanism in alcohol - induced liver disease (ald), a disease that affects over 140 million people worldwide . Potential molecular mechanisms underlying alcohol - induced er stress in major organs including liver, brain, pancreas, lung, and heart have been discussed previously [810]. In this review, i will focus on updates and new insights into the pathogenesis of alcohol - induced er stress and discuss an emerging role of alcohol - induced er stress in liver tumorigenesis and hepatocellular carcinogenesis . Alcohol is mainly metabolized in the liver and liver cells are rich in er, which assume synthesis of a large amount of secretory and membrane proteins . The upr plays a pivotal role in maintaining er homeostasis in the liver under both physiological and pathological conditions [4, 5, 9]. In the early 80s, stress - induced er damages in the liver were observed in ultrastructural, morphological, and histological studies [43, 44]. However, little was known then about occurrence and mechanisms of alcohol - induced er stress . A role of er in alcohol metabolism began to be recognized as nadh from the hepatic alcohol oxidation by alcohol dehydrogenase (adh) was also found to support microsomal alcohol oxidations [4346]. The inducible microsomal ethanol oxidizing system (meos) is associated with er proliferation and concomitant induction of cytochrome p4502e1 (cyp2e1) in rats and in humans [45, 46]. Free radical release, as a consequence of cyp2e1 activities in the er and subsequent oxidative stress, and lipid peroxidation generally contribute to ald . However, alcohol - induced er stress response (aerr) that involves the upr was not recognized until recently . Molecular evidence for an impaired upr was first found in the mice with chronic intragastric alcohol infusion (ciai) (figure 1; table 1). Alterations of some er stress markers: grp78, grp94, chop (c / ebp homologous protein), and bad (the bcl-2-associated death promoter), in dna microarrays were associated with severe steatosis, scattered apoptosis, and necroinflammation . Srebp-1c (sterol regulatory element - binding protein-1c) was found to be a strong candidate linking er stress to alcoholic fatty liver, because srebp-1c knockout mice were protected against triglyceride accumulation . Chop was found to be a key factor in aerr - caused cell death, as knocking out chop resulted in minimal alcohol - induced apoptosis in the liver . Upstream of er stress, altered methionine metabolism, and elevated homocysteine were initially proposed to be responsible for aerr because alcohol - induced hyperhomocysteinemia (hhcy) is often seen in rodents and humans [4750] and homocysteine is known to modify proteins biochemically [8, 9, 11]. First, betaine is a methyl donor for remethylation of homocysteine to methionine catalyzed partially by betaine - homocysteine methyltransferase (bhmt). Simultaneous betaine feeding or transgenic expression of bhmt in ciai mice decreased the elevated homocysteine and abrogated aerr in parallel with decreased alt and amelioration of ald [11, 14, 15]. Second, an intragastric infusion with both high fat and alcohol induced moderate obesity and much severe ald, which resulted from synergistic effects of an accentuated er stress by the alcohol - induced hhcy in combination with mitochondrial stress, nitrosative stress, and adiponectin resistance . Consequently, the rat animals have a minimal er stress response and are more resistant to ald, which correlates with a significant induction of bhmt . Fourth, in a study with 14 inbred mouse strains with ciai, profound differences in ald were observed among the strains in spite of consistently high levels of urine alcohol . Er stress related genes were induced only in strains with the most liver injury, which were closely associated with expression patterns of methionine metabolism - related genes and plasma homocysteine levels . Thus, abnormal protein modifications by excessive homocysteine as a result of aberrant one - carbon metabolism and methionine deficiency are likely responsible for the alcoholic er stress and upr in ciai mice that lack a sufficient upregulation of bhmt . However, other causes for the alcoholic er stress are present in the ciai model . For instance, in a study with ciai rats to examine effects of selective inhibition of cyp2e1 on the development of alcoholic fatty liver, liver triglycerides were lower . Er stress indicated by the er stress marker trb3 (a mammalian homolog of drosophila tribbles functions as a negative modulator of protein kinase b) was increased after ethanol and was further increased upon inhibition of cyp2e1 or overall ethanol metabolism . This suggests a contributing role of alcohol metabolites, for example, acetaldehyde, or oxidants to the alcoholic er stress response . In another study with cystathionine synthase (cbs) heterozygous mice treated with ciai, steatohepatitis was accompanied with upregulations of hepatic er stress components including grp78, atf4 (activating transcription factor 4), chop, and srebp-1c and negatively correlated with s - adenosylmethionine (sam) to s - adenosylhomocysteine (sah) ratio . Aerr was associated with a decrease in levels of suppressor chromatin marker trimethylated histone h3 lysine-9 (3meh3k9) in the promoter regions of the er stress markers . Similarly, epigenetic mechanism for aerr might also occur in human alcoholics, as dna hypermethylation of the promoter of herp (homocysteine - induced er protein) gene downregulates its mrna expression in patients with alcohol dependence . Aerr occurs not only in the aforementioned ciai models but also in other chronic or acute models / systems (table 1), which have been providing additional insights into aerr and ald . In micropigs fed alcohol orally, liver steatosis and apoptosis were shown to be accompanied by increased mrna levels of cyp2e1 and selective er stress markers . Folate deficiency appeared to be responsible for the er stress and injury . In mice, however, oral alcohol feeding ad libitum does not usually result in hhcy as remarkable as seen in the ciai mice . Correspondingly, the degree of aerr and subsequent liver injury may depend on additional genetic and/or dietary factors . For instance, in the mice with liver specific deletion of grp78/bip, a robust er stress response was observed at moderate oral alcohol doses (e.g., 4 g / kg), which was accompanied by much aggravated hepatosteatosis and hepatic fibrosis . Thus, compared to the homocysteine - er stress mechanism, the liver bip deletion represents a genetic predisposition that unmasks a distinct mechanism by which alcohol induces er stress, one that is largely obscured by compensatory changes in normal animals or presumably in the majority of human population who have low - to - moderate drinking [8, 22]. The effect of genetic predisposition on aerr and hepatic injury is also observed in a recent study using mice with low alcohol - induced plasma homocysteine and deficient in the acid sphingomyelinase (asmase). Strong aerr and enhanced susceptibility to lipopolysaccharides (lps) or concanavalin - a were present in asmase / mice fed alcohol orally, indicative of a mitochondrial effect on aerr . In addition, in iron overloaded mice deficient in the hemochromatosis gene (hfe/), cofeeding ad libitum with alcohol and a high - fat diet (hfd) led to profound steatohepatitis and fibrosis [24, 25]. Xbp1 splicing, activation of ire-1 and perk, and increased chop protein expression were associated with impaired autophagy response, suggesting that preconditioning with iron overloading may modulate aerr and promote liver injury through interacting with other adaptive or compensatory mechanisms . Alternatively, the contributing role of er stress to ald in oral feeding models could be secondary . This is indicated by a time - course study with a mouse model of early - stage ald . Mice with oral alcohol feeding exhibited significant hepatic steatosis and elevated plasma alt values . At 1 to 2 weeks after alcohol feeding, oxidative stress indicated by 4-hydroxynonenal- (4-hne-) modified proteins was increased, whereas hepatic glutathione (gsh) levels were significantly decreased as a consequence of decreased cbs activity, increased gsh utilization, and increased protein glutathionylation . Except for 4-hne adduction to the er disulfide isomerase (pdi), significant upregulations of other er markers and srebp pathways were not detected in vivo during the same early period of alcohol feeding [26, 27]. Although the actual blood alcohol levels were not measured in this study, which might not reach a critical point and vary widely among individual mice at a liberal access to alcohol, the results may suggest a secondary role of aerr in this early ald model . Thus, interplay or cross - talk between aerr and other stresses might be critical in ald . This notion is supported by a few most recent reports, which appears more evident in cell or animal models with acute alcohol exposure . However, in a perfused rat liver system, downregulation of grp78 and activation of c - jun n - terminal kinase (jnk) and protein kinase b (pkb / akt) were enhanced by a cotreatment of acute ethanol with a classical inhibitor of adh, and an antioxidant addition reduced the activation of jnk and cell death . High concentrations of the pharmacological er stress - inducing agents such as tunicamycin or brefeldin a activate jnk and inhibit mitochondrial respiration and cell death in hepatocytes . Second, the mice with liver specific grp78 deletion are sensitized to a variety of acute hepatic disorders by alcohol, a high - fat diet, anti - hiv drugs, or toxins . Hiv protease inhibitors inhibit the er caatpase (serca) and modulate calcium homeostasis in mice and primary human hepatocytes, which aggravates aerr and ald . Third, the interferon regulatory factor 3 (irf3) is activated early by er stress in mice fed alcohol either orally or intragastrically, which involves an er adaptor, the stimulator of interferon genes (sting). Independent of inflammatory cytokines and type - i interferons (ifns), irf3 exerts its pathogenic role in ald through causing apoptosis of hepatocytes, which strongly suggests that aerr pathways and the lps - tlr4 (toll - like receptor 4) pathways are parallel or equally important in initiating ald . In addition to rodents, aerr has also been found in other species including human alcoholics (table 1). Zebrafish larvae represent an alternative vertebrate model for studying aerr and ald because their liver possesses the pathways to metabolize alcohol that can be simply added to the water, that is, acute alcohol . Aerr is present in alcohol - treated zebrafish, which may also interact with other pathological factors . Upon alcohol challenge further, the er stress response appeared much robust in zebrafish deficient in the cdp - diacylglycerol - inositol 3-phosphatidyltransferase (cdipt) that primarily locates on the cytosolic aspect of the er . Thus, integrity of the er or alcohol metabolism might be necessary for aerr . In supporting this, in the species caenorhabditis elegans without a liver for alcohol digestion / metabolism, little aerr has been detected . The most important and clinically relevant studies regarding aerr are from human cells and patients . Aerr is reported in human monocyte - derived dendritic cells (mddc), hepg2 cells expressing human cyp2e1, and primary human hepatocytes . Oxidative stress resulted from the function of cyp2e1 and/or interactions with other drugs contributing to aerr in the human cells . However, cultured human cell models may not reflect the complexity of the response in vivo . For instance, it was reported that, upon alcohol exposure, vl-17a cells metabolized alcohol which caused er fragmentation inside the cells, but little activation of upr target genes was detected . Nevertheless, striking upregulation of multiple er stress signaling molecules was detected in human patients with ald (table 1) [3942], which is correlated with deregulated lipid metabolism, ceramide accumulation, and impaired insulin signaling, indicating that aerr is an integrated part of pathogenesis of ald in human alcoholics . It has been well accepted that the upr is a double - edged response because both adaptive survival and eliminative apoptosis can be induced by upr components [16]. It is beneficial or prosurvival if it happens transiently or lasts for a short period of time, whereas it is detrimental or deadly if it is prolonged . Recent studies indicate that the upr is associated with solid tumor development in many types of tissues or organs including the liver [55, 56]. Since the microenvironments of solid tumors are generally hypoxic, acidic, and nutrient deficient [57, 58], which individually or collectively favor activation of er stress response, it is conceivable that the upr is persistently present during tumorigenesis . Emerging evidence suggests that cancerous cells could modify and perturb the er stress - associated cell death signaling, which permits survival and growth . For instance, the master regulator upr, grp78, plays a dual role in tumor cells [22, 59]. It controls early tumor development through suppressive mechanisms such as the induction of cell cycle arrest or tumor dormancy upon perk activation . On the other hand, at more advanced stages of tumor progression, during which cells are exposed to more severe stressors, grp78 suppresses caspase 7 activation and interacts with er stress - induced protein chaperones such as clusterin to promote cell survival and further tumor development . The perk - eif2-atf4 pathway is often activated by the hypoxic condition in solid tumors [6264], which activates angiogenic genes, vascular endothelial growth factor (vegf), type 1 collagen inducible protein, and autophagosome components such as lc3, ensuring cell survival over hypoxia - induced er stress [6567]. Prolonged expression and activation of atf6 in addition, the ire1-xbp1 pathway interacts with antiapoptotic bcl-2 family members and the sigma-1 receptor, which is often increased in many human cell lines [6972]. Therefore, impaired and/or prolonged upr has a high potential to modulate cell fates and differentiations towards tumorigenesis . However, the mechanisms by which alcohol exerts its carcinogenic effect are largely unknown and currently there is no effective treatment . Considering that several lines of evidence indicate that polymorphic responses of major er chaperones to alcohol and other stressors are associated with hepatocellular carcinogenesis in human populations [7782], it is not unusual to find a role of aerr in hcc . In fact, we recently found spontaneous hepatocellular adenomas- (hca-) like tumors in aged female mice with a liver specific bip deletion and under constitutive er stress [22, 59, 83]. Active atf6, chop, gsk3, and creld2 (cysteine rich with egf - like domains 2) were increased in the knockout, indicative of continuous er stress response . None of p53, hnf1, or gp130 was significantly changed compared between wild type and knockout . Interestingly, cyclin d was specifically reduced in the tumor portion of the knockout mice . Since most liver tumors were found in female knockouts, expression of receptors for sex hormones such as estrogen receptors, er and, and androgen receptor, ar, three variants of er were detected in the liver, and their molecular sizes are 66 kd, 46 kd, and 36 kd, respectively . The er variant 36 kd was remarkably increased in the tumor portion of the knockout liver . In contrast, there were no significant changes in the expression of er, ar, cyclin e, or cyclin g. these findings revealed thatinhibition of cyclin d and overexpression of er variant 36 kd are associated with the tumor development in the female knockouts under constitutive er stress . Furthermore, the tumors are highly malignant in mice with additional stresses such as high - fat diet or alcohol intake [83, 84]. The pathways of erk1/2, stat3, and p38 were activated, which are known to promote hcc progression [85, 86]. The constitutive er stress - induced spontaneous liver tumors that are dominant in female animals are similar to human hca [8790], which are of clinical relevance since about 80% of hca cases are from women taking oral contraceptives for years [90, 91]. Potential causesfor human hca are mutations in hnf1, -catenin, gp130, or chronic inflammation [8793]. Hepatocellular protein homeostasis has rarely been noticed to be a potential mechanism for hca development . Thus, the above findings on cyclin d and er variants may reveal a novel er stress mechanism for hca for several reasons (figure 2). First, the in vivo inhibition of cyclin d expression upon er stress in knockouts is consistent with an earlier study, which demonstrated that activation of the upr in mouse nih 3t3 fibroblasts with tunicamycin led to a decline in cyclin d and subsequent g(1) phase arrest [9496]. Second, increased expression of cyclin d is usually associated with proliferation in other systems . However, a number of studies have shown many new roles of cyclin d and a surprising lack of the correlation of increased cyclin d with proliferation in tumors [99, 100]. For instance, in one subtype of human breast carcinoma, cyclin d1 protein expression was absent in the noninvasive cells [101, 102]. Similarly, a loss of cyclin d did not inhibit the proliferative response of mouse liver to mitogenic stimuli and mrna levels of cyclin d1 were downregulated in patients with hcc . Most recent molecular evidence further supports this er stress - cyclin d - tumorigenesis mechanism . Nrf2 (the nuclear factor erythroid 2-related factor 2) activities are associated with aging . Er stress activates nrf2 and atf6, both of which regulate the orphan nuclear receptor, shp (small heterodimer partner) which acts as a transcriptional corepressor modulating cyclin d1 and subsequent hepatic tumorigenesis [106, 107]. The er stress sensor perk has been shown to phosphorylate the forkhead transcription factor 3 (foxo3) and suppressed foxo3 exacerbates alcoholic hepatitis and insulin resistance impairing cyclin d function promoting hcc [109111]. Thus, abnormal functions of cyclin d under er stress conditions most likely disturb liver cell proliferation (figure 2). Third, since the authentic er66 interacts with cyclin d physically [100, 101], the hepatic er variants may result from an unbalanced long - term molecular interaction between er and the suppressed cyclin d under er stress (figure 2). Alternatively, the er variants may be produced from an incomplete protein processing / maturation of er by an impaired er - associated degradation (erad). Components of erad are indeed altered in the bip knockout mouse models under constitutive upr [22, 59, 83, 84], and there is a report indicating that an activation of the xbp1-hrd1 (an e3 ubiquitin ligase also called synoviolin) branch by the upr facilitates nrf2 ubiquitylation and degradation during liver cirrhosis . Fourth, considering that er gene polymorphism is associated with risk of hbv - related acute liver failure and a switch from the authentic er to a predominant expression of er36 is associated with development and progression of hcc [114116], the hepatic er variants could also play an important role in alcohol and er stress - associated hcc . The tumorigenic signaling downstream of cyclin d and er variants can be activations of the erk1/2, ip3k - pkc, or jak - stat pathways . Overexpressed er36 has been associated with activation of these pathways and carcinogenesis in other systems such as breast cancer and gastric cancer [118122]. In the liver, activations of erk1/2 and jak - stat pathways were observed in the bip knockout mice fed alcohol and high - fat diet [83, 84]. Finally, studies on hepatoma cell lines, hcc tissues, and animal models of hcc suggest a possible role of sex hormones and their receptors in hcc pathogenesis . A male prevalence of hcc is often observed in young and middle aged patient populations in certain regions exposed to additional hcc risk factors . However, the male prevalence of hcc tends to diminish in aged human populations as well as in aged animals fed alcohol [83, 84]. Therefore, alcohol - induced er stress and cell cycle impairment may exert specific effects on aging, hepatic expression of estrogen receptors, and subsequent tumorigenesis in females . Alcohol - induced hepatic er stress occurs in the liver of many species including human alcoholics, which has recently been established as an important mechanism for both acute and chronic alcohol - induced liver pathogenesis and disease development . Multiple factors commonly associated with alcohol consumption such as acetaldehyde, oxidative stress, excessive homocysteine, toxic lipid species, increased sah, aberrant epigenetic modifications, disruption of calcium homeostasis, and insulin resistance induce er stress response individually or collectively . However, the precise contribution of each of the factors to the er stress induction is not clear and their importance to ald may depend on doses, duration and patterns of alcohol exposure, presence or absence of genetic and environmental factors, cross - talks with other pathogenic pathways, and liver disease stages . The upr, as an integrated part of liver physiology and pathology like the immune response, may occur more or less all the time during alcohol consumption, which attempts to restore er homeostasis and protect against ald . However, this adaptive protection is not without detrimental consequences . Prolonged upr leads to excessive deletion of the damaged hepatocytes or cell cycle arrest, which triggers inflammatory response or interrupts normal cellular processes causing profound injuries . Emerging evidence by us and others indicates a direct involvement of long - term alcohol and constitutive er stress in liver tumorigenesis and hepatocellular carcinogenesis . The er stress and malfunctioning of cyclin d - caused cell cycle arrest are a well - established molecular mechanism, and the surprise overexpression of estrogen receptor variants under constitutive upr may result from a mal - targeting of protein processing and turnover by aberrant erad, which reflect complexity and depth of prolonged upr - mediated pathogenesis . Thus, liver tumorigenesis by alcohol and er stress may involve not only cyclin d, er variants, erk1/2, pkc, and stat pathways, but also other cell cycle targets such as il-6, p21, p27, and cdk, other pathways such as src / egfr, pten - tgf, and insulin / igf, and epigenetic regulations such as mirnas targeting the upr components . In addition, liver progenitor cell activation by alcohol may contribute to the malignant transformation of nonmalignant tumors developed under long - term er stress [22, 59]. Future work should be directed to define the er stress mechanisms leading to hcc and to develop multiple therapeutic approaches to target er stress in human alcoholics with hcc.
Neutropenia is a common toxicity resulting from myelosuppressive chemotherapy that leads to dose delays and reductions (i.e., deviations from recommended drug dose intensity and timing), which can compromise treatment efficacy and survival.1 neutropenia - associated complications, namely fever and infection, generate hospitalizations and increase costs and mortality during chemotherapy.2 myeloid colony - stimulating factors (csfs) can be used to decrease the risk of neutropenia, but defining appropriate application of such drugs has been controversial as they are expensive and not likely to improve outcomes in low risk patients.3,4 understanding the frequency of neutropenia so that clinicians can more effectively manage chemotherapy, including the administration of prophylactic csf drugs, is critical for improving patient outcomes and controlling health care spending . Trial participants tend to be highly selected and do not represent the majority of patients receiving chemotherapy in the community.5,6 additionally, reporting of hematologic toxicities within clinical trials is inconsistent.7 prospective cohort studies can produce generalizable high - quality data on chemotherapy toxicities, but are expensive and time - consuming to conduct.8 administrative data containing diagnosis codes for neutropenia and other toxicities provide better patient representation than do clinical trial populations and are relatively inexpensive to obtain, but likely underestimate the occurrence of adverse events as toxicities are only captured when a clinical intervention generates a billing claim.9,10 the lack of reliable data documenting neutropenia events in real - world settings makes it difficult to provide patients with information on both efficacy and toxicity of various drug regimens, to identify key risk factors, and to create clinically useful predictive modes with which to guide csf administration.7,11 advances in health information technology, including detailed electronic records of laboratory test orders and results, may be capable of fulfilling the need for accurate clinical information on chemotherapy toxicities to improve patient care . The department of veterans affairs (va) electronic medical record (emr) includes diagnosis codes from inpatient and outpatient visits as well as the results of all laboratory tests performed on a given patient, allowing instances of neutropenia to be identified from the results of laboratory tests measuring neutrophil and white blood cell (wbc) count . To explore the ability of electronic laboratory results to better quantify the burden of neutropenia in a broad population of veterans receiving chemotherapy for lung cancer, this study compared algorithms based on electronic test results with more common approaches relying on claims data.12,13 specifically, we calculated the incidence of neutropenia in the first cycle of chemotherapy using laboratory results, diagnosis codes, and the combination of these two approaches, and we described variation in these algorithms by patient treatment characteristics . As a secondary aim we determined the accuracy of administrative coding of neutropenia compared to absolute neutrophil counts (anc) derived from laboratory test results . After institutional review board approval, we accessed data for the va northwest health network, which comprises 8 medical centers and 30 community based outpatient clinics (cbocs) across a multistate area that includes washington, alaska, oregon, idaho, one county in western montana, and one county in northern california . Veterans newly diagnosed with non - small cell lung cancer (nsclc) in these areas between january 1, 2000 and december 31, 2009 were identified through the va s cancer registry program.14,15 once identified, we extracted detailed demographic and medical history information for each patient along with specific treatment, care delivery, and outcome information from the first year after their diagnosis from the va northwest health network s data warehouse . Compiled data included all laboratory tests ordered by providers and their results, as well as linked pharmacy records detailing all administered chemotherapy agents . The final patient cohort was restricted to individuals receiving a chemotherapy agent related to lung cancer (va drug class an900) within 11 months of diagnosis and surviving 28 days after their initial chemotherapy administration, similar to the criteria described by hosmer et al.16 all laboratory records from the 28 days following initiation of chemotherapy were reviewed to identify measures associated with wbc count . A 28-day window was used to ensure that observed neutropenic events were associated with the first cycle of chemotherapy, when risk of neutropenia is greatest and most patients still receive full - dose chemotherapy, as opposed to subsequent cycles.17 this time frame was also used for predictive modeling of neutropenia risk to inform csf prophylaxis.16 two approaches were used to determine anc on a given day . Laboratory results directly reporting neutrophil count or number were cleaned and standardized to give anc in cells / mm . Additionally, laboratory results reporting wbc count and percentage of segs (i.e., segmental mature) and bands (i.e., rod - shaped immature) neutrophils were used to indirectly calculate anc by multiplying wbc count by the sum of percent segs and bands . Our primary measure of neutropenia was defined as having an anc of <1,000 cells / mm calculated by either approach on any day within the 28-day window . We also identified patients whose anc fell below 500 cells / mm and 100 cells / mm during this period . Inpatient and outpatient records from the 28 days following chemotherapy initiation were queried to identify international classification of diseases, ninth edition (icd-9) codes for neutropenia or an associated disorder of the white blood cell . Based on consultation with clinical colleagues, receipt of any of the following six codes was considered an occurrence of neutropenia: 288.0 (agranulocytosis), 288.00 (neutropenia), 288.03 (drug induced neutropenia), 288.5 (leukocytopenia), 288.8 (specified disease of wbc), 288.9 (unspecified disease of wbc). Data on cancer stage and treatment extracted from the emr included receipt of surgery or radiation therapy and the american joint committee on cancer (ajcc) stage as recorded by the cancer registrar . Using the linked pharmacy data, time to initial chemotherapy administration was calculated based on the date the first chemotherapy claim for va drug class an900 appeared in pharmacy data post diagnosis . Extracted patient demographics included the following: date of birth, body mass index (bmi) at diagnosis, and gender . Finally, preexisting comorbidity was categorized based on the charlson comorbidity index using inpatient and outpatient records from the same period . The charlson comorbidity index predicts one - year mortality in patients with a range of comorbid conditions . Conditions are scored based on mortality risk and summed to give a total score, with higher scores indicating greater mortality risk.18 patient clinical and demographic characteristics were examined overall and by neutropenia outcomes . Descriptive statistics including chi - square tests were compared to identify variation in frequency of neutropenia events by algorithm . Accuracy of the icd-9 diagnosis codes for neutropenia was assessed by calculating sensitivity (percentage of patients with a laboratory result indicating low anc who had an icd-9 code for neutropenia) and specificity (percentage of patients without a laboratory result indicating low anc who had no icd-9 codes for neutropenia) of diagnostic codes using the laboratory - derived outcome measures of neutropenia as a gold standard . We also calculated positive predictive value (ppv) (the percentage of patients with an icd-9 code for neutropenia who had a laboratory result indicating low anc) and negative predicative value (npv) (the percentage of patients without an icd-9 code for neutropenia who had no laboratory results indicating low anc). After institutional review board approval, we accessed data for the va northwest health network, which comprises 8 medical centers and 30 community based outpatient clinics (cbocs) across a multistate area that includes washington, alaska, oregon, idaho, one county in western montana, and one county in northern california . Veterans newly diagnosed with non - small cell lung cancer (nsclc) in these areas between january 1, 2000 and december 31, 2009 were identified through the va s cancer registry program.14,15 once identified, we extracted detailed demographic and medical history information for each patient along with specific treatment, care delivery, and outcome information from the first year after their diagnosis from the va northwest health network s data warehouse . Compiled data included all laboratory tests ordered by providers and their results, as well as linked pharmacy records detailing all administered chemotherapy agents . The final patient cohort was restricted to individuals receiving a chemotherapy agent related to lung cancer (va drug class an900) within 11 months of diagnosis and surviving 28 days after their initial chemotherapy administration, similar to the criteria described by hosmer et al.16 all laboratory records from the 28 days following initiation of chemotherapy were reviewed to identify measures associated with wbc count . A 28-day window was used to ensure that observed neutropenic events were associated with the first cycle of chemotherapy, when risk of neutropenia is greatest and most patients still receive full - dose chemotherapy, as opposed to subsequent cycles.17 this time frame was also used for predictive modeling of neutropenia risk to inform csf prophylaxis.16 two approaches were used to determine anc on a given day . Laboratory results directly reporting neutrophil count or number were cleaned and standardized to give anc in cells / mm . Additionally, laboratory results reporting wbc count and percentage of segs (i.e., segmental mature) and bands (i.e., rod - shaped immature) neutrophils were used to indirectly calculate anc by multiplying wbc count by the sum of percent segs and bands . Our primary measure of neutropenia was defined as having an anc of <1,000 cells / mm calculated by either approach on any day within the 28-day window . We also identified patients whose anc fell below 500 cells / mm and 100 cells / mm during this period . Inpatient and outpatient records from the 28 days following chemotherapy initiation were queried to identify international classification of diseases, ninth edition (icd-9) codes for neutropenia or an associated disorder of the white blood cell . Based on consultation with clinical colleagues, receipt of any of the following six codes was considered an occurrence of neutropenia: 288.0 (agranulocytosis), 288.00 (neutropenia), 288.03 (drug induced neutropenia), 288.5 (leukocytopenia), 288.8 (specified disease of wbc), 288.9 (unspecified disease of wbc). Data on cancer stage and treatment extracted from the emr included receipt of surgery or radiation therapy and the american joint committee on cancer (ajcc) stage as recorded by the cancer registrar . Using the linked pharmacy data, time to initial chemotherapy administration was calculated based on the date the first chemotherapy claim for va drug class an900 appeared in pharmacy data post diagnosis . Extracted patient demographics included the following: date of birth, body mass index (bmi) at diagnosis, and gender . Finally, preexisting comorbidity was categorized based on the charlson comorbidity index using inpatient and outpatient records from the same period . The charlson comorbidity index predicts one - year mortality in patients with a range of comorbid conditions . Conditions are scored based on mortality risk and summed to give a total score, with higher scores indicating greater mortality risk.18 descriptive statistics including chi - square tests were compared to identify variation in frequency of neutropenia events by algorithm . Accuracy of the icd-9 diagnosis codes for neutropenia was assessed by calculating sensitivity (percentage of patients with a laboratory result indicating low anc who had an icd-9 code for neutropenia) and specificity (percentage of patients without a laboratory result indicating low anc who had no icd-9 codes for neutropenia) of diagnostic codes using the laboratory - derived outcome measures of neutropenia as a gold standard . We also calculated positive predictive value (ppv) (the percentage of patients with an icd-9 code for neutropenia who had a laboratory result indicating low anc) and negative predicative value (npv) (the percentage of patients without an icd-9 code for neutropenia who had no laboratory results indicating low anc). A total of 2,977 patients diagnosed with nsclc were identified from the cancer registry during the study period . We included 753 patients who received chemotherapy for lung cancer within 11 months of diagnosis . We excluded 35 patients who died within 28 days of initial chemotherapy administration, resulting in a final sample of 718 individuals . Based on electronic laboratory data, 118 individuals (16.4 percent) were identified as having an anc <1000 cells / mm within 28 days of their initial dose of chemotherapy (table 2). Additionally, 61 individuals had an anc <500 cells / mm (8.5 percent) and 13 had an anc <100 cells / mm at least once during their first treatment cycle (1.8 percent). Of the 718 patients, 90.3 percent had at least one electronic laboratory test result to quantify anc level available in their emr in the 28 days following chemotherapy initiation . The average number of anc measurements for each individual was 4.85 and ranged from zero to 18 . In instances where there were multiple measures of anc available for a given day, which occurred 1,018 times (41.5 percent of all available anc measures were from a day where more than one assessment of anc was available), they were consistently similar . Calculating anc from laboratory tests reporting wbc count and percent of mature and immature neutrophils identified more individuals who experienced neutropenia than direct measures of neutrophil count . Of the 118 individuals whose anc fell below 1,000 cells / mm during their first cycle of chemotherapy, 56 were identified based on a direct measure of neutrophil count while the 62 remaining individuals were identified using calculations based on test results reporting wbc count, segs, and bands . We identified icd-9 codes for neutropenia in the 28 days following chemotherapy initiation among 49 individuals (6.8 percent) (table 2). Of these individuals, 33 had at least one outpatient code identifying a neutropenic event, 23 had at least one inpatient code, and 7 had both . The icd-9 code for agranulocytosis (288.0) appeared most frequently (63.3 percent of patients with a neutropenia event received this code) (table 3). The proportion of individuals with neutropenia identified by laboratory data was significantly higher than the proportion of patients with neutropenia identified by icd-9 codes in all patient subgroups except those who did not receive surgery or radiation (table 2). In bivariate analysis, additional treatment and age at diagnosis were associated with having a neutropenia event identified by laboratory values, with those receiving both surgery and radiation and individuals diagnosed between 65 and 69 having the highest rate of identified neutropenic events using this algorithm . None of the patient or treatment variables were associated with having a neutropenia event identified by icd-9 codes . When a combination of icd-9 codes and laboratory - determined anc was used, only receipt of radiation was associated with identification of neutropenic events (table 2). Of the 49 patients who had an icd-9 code for neutropenia during their first cycle of chemotherapy, 31 were also identified with an anc level <1000 cells/ mm during this period (table 4). Of the remaining individuals, 16 had only normal laboratory results and 2 had no laboratory results from which to calculate anc during that time . Conversely, of the 669 patients without codes for neutropenia during the 28 days after beginning chemotherapy, 87 had laboratory results indicating their anc had fallen below 1000 cells / mm in their emr . Compared to the available laboratory data, icd-9 codes for neutropenia had a sensitivity of 26.3 percent and specificity of 97.0 percent . The diagnostic performance characteristics of icd-9 codes for an anc <500 cells / mm and an anc <100 cells / mm are given in table 2 . Overall, sensitivity and npv of diagnostic codes increased while specificity and ppv decreased with increasing levels of myelotoxicity . Based on electronic laboratory data, 118 individuals (16.4 percent) were identified as having an anc <1000 cells / mm within 28 days of their initial dose of chemotherapy (table 2). Additionally, 61 individuals had an anc <500 cells / mm (8.5 percent) and 13 had an anc <100 cells / mm at least once during their first treatment cycle (1.8 percent). Of the 718 patients, 90.3 percent had at least one electronic laboratory test result to quantify anc level available in their emr in the 28 days following chemotherapy initiation . The average number of anc measurements for each individual was 4.85 and ranged from zero to 18 . In instances where there were multiple measures of anc available for a given day, which occurred 1,018 times (41.5 percent of all available anc measures were from a day where more than one assessment of anc was available), they were consistently similar . Calculating anc from laboratory tests reporting wbc count and percent of mature and immature neutrophils identified more individuals who experienced neutropenia than direct measures of neutrophil count . Of the 118 individuals whose anc fell below 1,000 cells / mm during their first cycle of chemotherapy, 56 were identified based on a direct measure of neutrophil count while the 62 remaining individuals were identified using calculations based on test results reporting wbc count, segs, and bands . We identified icd-9 codes for neutropenia in the 28 days following chemotherapy initiation among 49 individuals (6.8 percent) (table 2). Of these individuals, 33 had at least one outpatient code identifying a neutropenic event, 23 had at least one inpatient code, and 7 had both . The icd-9 code for agranulocytosis (288.0) appeared most frequently (63.3 percent of patients with a neutropenia event received this code) (table 3). The proportion of individuals with neutropenia identified by laboratory data was significantly higher than the proportion of patients with neutropenia identified by icd-9 codes in all patient subgroups except those who did not receive surgery or radiation (table 2). In bivariate analysis, additional treatment and age at diagnosis were associated with having a neutropenia event identified by laboratory values, with those receiving both surgery and radiation and individuals diagnosed between 65 and 69 having the highest rate of identified neutropenic events using this algorithm . None of the patient or treatment variables were associated with having a neutropenia event identified by icd-9 codes . When a combination of icd-9 codes and laboratory - determined anc was used, only receipt of radiation was associated with identification of neutropenic events (table 2). Of the 49 patients who had an icd-9 code for neutropenia during their first cycle of chemotherapy, 31 were also identified with an anc level <1000 cells/ mm during this period (table 4). Of the remaining individuals, 16 had only normal laboratory results and 2 had no laboratory results from which to calculate anc during that time . Conversely, of the 669 patients without codes for neutropenia during the 28 days after beginning chemotherapy, 87 had laboratory results indicating their anc had fallen below 1000 cells / mm in their emr . Compared to the available laboratory data, icd-9 codes for neutropenia had a sensitivity of 26.3 percent and specificity of 97.0 percent . The diagnostic performance characteristics of icd-9 codes for an anc <500 cells / mm and an anc <100 cells / mm are given in table 2 . Overall, sensitivity and npv of diagnostic codes increased while specificity and ppv decreased with increasing levels of myelotoxicity . This study utilized administrative data collected in the va emr to compare diagnostic coding for neutropenia with laboratory - determined anc measurements in lung cancer patients treated within the va northwest health network . The prevalence of neutropenia during the first cycle of chemotherapy was 6.8 percent based on administrative diagnostic coding, 16.4 percent based on laboratory data, and 18.9 percent using either indicator . Additionally, 8.5 percent of patients experienced severe neutropenia (anc <500 cells / mm). These estimates fall within the range of incidence rates reported in previous studies of nsclc patients undergoing chemotherapy . Observed neutropenia during the first three months of chemotherapy in 9.222.5 percent of nsclc patients identified in the surveillance, epidemiology, and end results (seer)-medicare database, depending on their chemotherapy regimen.11 in a prospective cohort study, lyman et al . Identified severe or febrile neutropenia in 9.3 percent of one nsclc sample and 11.1 percent of a second sample.20 comparing rates of neutropenia between studies is difficult because of variation in its definition and measurement, but our results indicate that using a combination of icd-9 codes and laboratory results identified more patients who experienced neutropenia than either method alone, suggesting that the burden of neutropenia in nsclc patients undergoing chemotherapy may be greater than previously estimated . When comparing diagnosis codes and laboratory results, inpatient and outpatient icd-9 codes have a low sensitivity (26.346.2 percent) for identifying individuals with neutropenia as determined by laboratory tests, even using a liberal outcome definition combining multiple icd 9 codes . Specificity (93.997.0 percent) was higher . These results are similar to a recent study that evaluated the accuracy of claims - based definitions of febrile neutropenia in patients receiving chemotherapy in a large health care system, where diagnostic codes had relatively poor sensitivity compared to definitions that relied on emr data including anc, body temperature, and administration of antibiotic or antiviral therapy.10 the mechanisms explaining the discordance between anc measures and icd-9 codes in our study are unknown, but it did not appear that those with low anc measurements were receiving other neutropenia - associated codes . For example, of the 7 individuals who had an anc <100 cells / mm during the first cycle of chemotherapy, but no corresponding icd-9 codes in their emr, only one had a code for fever, infection, or symptoms of neutropenia in their chart (an outpatient code for fever). None of the patient - level variables were associated with the likelihood of having a neutropenia event identified by icd-9 codes, while the likelihood of having a neutropenia event identified in laboratory data varied by both age and treatment type . Thus, it is possible that the results of previous studies of patient - specific risk factors that relied on diagnostic codes may be biased . Older age is a known risk factor for neutropenia, but our algorithms identified the most neutropenia events in those patients ages 6069 years.20 higher rates of adverse events have been previously observed in this age group and may reflect more aggressive treatment of patients under age 70, potentially explaining these findings.21 similarly, the higher rates of neutropenia events identified in patients who underwent surgery and radiation in addition to chemotherapy may also be due to treatment intensity, though these findings should be interpreted with caution as this study was not designed to identify patient - level neutropenia risk factors . Overall, our results highlight the limitations of diagnosis codes for answering key question about chemotherapy treatment and speak to the need for additional clinical data on toxicities to supplement their use.10 electronic records of laboratory test ordering and results appear well suited to fulfill this need . This study is limited by its potential lack of generalizability outside the va.22 the patient population receiving care at the va is primarily male and has a different comorbidity profile than the general population of nscl patients receiving chemotherapy . Thus, concordance between diagnosis codes and laboratory data may be different in other settings, particularly those with more recent emr implementation or where coding is linked to reimbursement . Another limitation is our use of anc as a gold standard for assessing neutropenia, as opposed to more clinically relevant outcomes such as low anc with presence of a fever or duration of neutropenia . There is no icd-9 code for febrile neutropenia and clinicians may not code for neutropenia unless the patient has an infection that requires intervention or is at extremely high risk for infection based on other factors . Neutropenia or low anc alone also may not be the ideal outcome for future patient - centered research using laboratory data . Finally, laboratory data with which to measure anc (i.e., a direct measure or results reporting wbc count, segs, and bands) were available for only 90.3 percent of the sample, possibly limiting our ability to identify all individuals who experienced neutropenic events during the period of interest . This data source should not be interpreted as a true gold standard for neutropenia events as it has similar limitations as other types of emr - derived data . Despite these limitations, this study addresses a key methodological challenge to generating evidence about treatment - related toxicities by presenting a novel comparison of administrative and more granular laboratory data in a large population of veterans receiving care across six western states . Diagnostic codes in administrative data identified only a portion of the patients who experienced neutropenia during the first cycle of chemotherapy and do not fully capture the burden of this adverse event in nsclc patients treated within the va . In addition to more expensive prospective studies, laboratory tests results contained in the emr are a feasible source of clinical data on chemotherapy toxicities . Such data will be essential for future research aimed at predicting, preventing, and treating neutropenia in patients receiving myelosuppressive chemotherapy . With the increasing availability of systems that capture computerized administrative and medical data, it will be possible to develop algorithms that identify patients at risk of neutropenia and to guide their treatment with csf drugs, further personalizing chemotherapy care and controlling health care cost.11.23
Gastric carcinoma is the second leading cause of cancer deaths worldwide, however, its incidence varies greatly between eastern and western countries . The most important prognostic factors in gastric cancer (gc) include depth of invasion, lymph node (ln) involvement, and distant metastases . Preoperative knowledge of ln status is helpful for clinical staging and for planning the optimal treatment . The japanese research society for the study of gastric cancer (jrsgc) has described 16 nodal stations, which surround the stomach, and depending upon the location of the primary tumor; they are grouped into n1, n2, and n3 groups [figures 1a and b]. In general station n1 lns are perigastric in location, n2 lns lie around celiac artery (cal) and its branches and n3 lns are found in the ligaments surrounding stomach and in retroperitoneum . Most investigators have found, high sensitivity (60 - 90%) and relatively low specificity of multidetector spiral computed tomography (mdct) for nodal staging . The accuracy of magnetic resonance imaging is considered to be inferior to mdct for n staging . Staging accuracy, and decision - making, is improved when positron emission tomography (pet) and ct are both utilized rather than either alone . Currently, endoscopic ultrasonography (eus) is accepted as the most efficient diagnostic method for t staging and has been found efficient for n staging also . Comparative study of eus and multislice spiral ct in gc has shown greater accuracy of eus for n staging . The most recent guidelines of the national comprehensive cancer network introduced eus as a preferred modality of gc staging if no evidence of m1 disease is present at ct - pet . Eus guided fine - needle aspiration (fna) cytology of ln stations defined by international association of study of lung cancer has made a significant impact in the management of lung cancer . The use of eus in the preoperative determination of ln status in patients with gc can have a significant impact on patient management . Eus elastography significantly improves the specificity of ln staging in esophageal cancer and can be useful in gc also . A technique for identification of individual ln stations suggested by jrsgc has not been described so far by eus . This article presents a technique to identify the regional nodal stations of gc by eus . This figure shows lymph nodes near right paracardial area, station 1; lesser curvature, station 3; supra pyloric area, station 5; left paracardial area, station 2; greater curvature, station 4; and infrapyloric area station 6 this figure shows n2 stations near; left gastric artery (station 7), common hepatic artery (station 8), celiac artery (station 9) and splenic artery (stations 10 and 11). Lymph nodes (lns) of n3 stations are seen near hepatoduodenal ligament (station 12), the posterior aspect of the pancreas (station 13), the root of the mesentery (station 14), the transverse mesocolon (station 15) and para - aortic area (station 16). The para - aortic ln at station 16 are seen above (16a) and below (16b) the lower border of left renal vein where it crosses the aorta . Two scanning methods are used for eus examination of the stomach and duodenum: the water - filling method (by introducing 300 - 500 ml of 0.9% isotonic saline solution into the stomach) and the balloon contact method . Retroperitoneal organs (kidney, spleen, pancreas and adrenal gland) are identified by their characteristic appearance . The examination of vessels of portal venous system, aorta and its branches and the inferior vena cava and its tributaries is done by conventional techniques . During imaging of ln stations additional efforts are made to follow the course of vessels as far as possible with the help of color doppler . This helps in tracing the course of vessels in the ligaments surrounding the stomach and duodenum where the n2 and n3 lns are located . On eus, the ligaments of stomach can be identified as hyperechoic areas between two adjacent organs on the lesser curvature (hepatogastric and hepatoduodenal ligament - lesser omentum) and greater curvature (gastrophrenic, gastrosplenic, lienorenal and gastrocolic ligament - greater omentum). The scanning is done in a systematic way to identify each ln station [figures 1a and b, video 1 and table]. The imaging of peri - gastric lns (n1 stations 1 - 6) is done from esophagogastric junction and fundus for stations 1 and 2, from body of the stomach for stations 3 and 4 and from the antrum and the first part of the duodenum for stations 5 and 6 [figures 211]. Following the course of blood vessels helps in imaging of n2 group lns: left gastric artery [station 7, figure 12], common hepatic artery [station 8, figures 1315], cal [station 9, figures 16 and 17] and splenic artery [stations 10 and 11, figures 1820]. Screening of hepatoduodenal ligament is done from 1 part of the duodenum for station 12 [figures 2124]. The posterior aspect of the pancreas is scanned from stomach and duodenum for station 13 [figures 25 and 26]. The root of the mesentery is seen from stomach and from descending duodenum for station 14 [figures 27 and 28]. The transverse mesocolon and inferior aspect of pan is seen from a third part of the duodenum after identifying the course of superior mesenteric artery for station 15 [figures 29 and 30]. Para - aortic nodes of station 16 are visualized from stomach as well as from duodenum [figures 3137]. Imaging of station 17 is done from the posterior wall of the stomach for ln lying anterior to the pan [figure 38]. Imaging of station 18 is done from stomach and the horizontal part of the duodenum [figure 39]. The ln of station 20 is located near the aortic hiatus [figure 41]. Additional imaging of ln of lower thoracic, paraesophageal and diaphragmatic area is done from stomach and esophagogastric junction [figures 42a d]. In this case the linear eus scope model 3870 utk pentax, tokyo, japan and color doppler machine: hitachi eub-7500; hitachi medical systems, tokyo, japan was used for evaluation . The gastroesophageal (ge) junction lies about 3 - 4 cm below the diaphragm . The ge junction demarcates the area between the paracardial stations (stations 1 and 2) and the lesser and greater curvature stations (stations 3 and 4). The lymph node (ln) of station 1 lies in the right paracardial area, and the ln of station 2 lie in left paracardial area . The ln in this figure belongs to station 1 and lies between the wall of the stomach and the left lobe of the liver and lies along esophageal branch of left gastric artery . Lga: left gastric artery, sa: splenic artery the lymph node (ln) of station 1 lies on the right side of esophagogastric junction . This ln lies between the wall of the stomach and the left lobe of the liver in the hepatogastric ligament, which lies between the liver and stomach . The identification of hepatogastric ligament is done as the hyperechoeic area between liver and stomach during anticlockwise rotation after visualizing the aorta the imaging of the left paracardial and right paracardial areas can be done along a plane which lies posteriorly along the anterior border of aorta and anteriorly goes through the segments 2 and 3 of the left lobe of the liver . Initially, the segments 2 and 3 of liver are visualized in an open position by echoendoscope . A clockwise rotation of the echoendoscope from this position traces the right paracardial area till it reaches the hilum of the liver and traces it on further rotation till the aorta is visualized after a 180 rotation . An anticlockwise rotation from segments 2 and 3 of liver traces the left paracardial area where the origin of left inferior phrenic artery is seen as the first branch from the anterolateral surface of the abdominal aorta above the origin of the celiac artery . The gastrophrenic ligament lies in left paracardial area where lymph node of station 2 lies in at the left margin of the gastroesophageal junction along the esophagocardiac branches of left inferior phrenic artery the lesser curvature of the stomach is approximately 10 cm in distance and can be divided into two parts . The branches of left gastric artery lie in the upper part of the lesser curvature in the hepatogastric ligament near the upper part of the lesser curvature (about 5 cm below the esophagogastric junction). The station 3 lymph nodes (lns) lie along the lesser curvature of the stomach . The lns up to 5 cm below the junction are included in the upper part of the lesser curvature . Cal: celiac artery in this image, the left gastric vein is seen joining the upper part of the portal vein (pv) and this lymph node (ln) lies very close to the upper part of the lesser curvature . The left gastric artery and vein run together in the hepatogastric ligament and a ln, which lies close to either, can be included in 3a . The ln labeled as 11p lies more close to the splenic artery than to the lesser curvature and hence is not included in station 3a . The lns of the 3b (not seen in this image) station lie along the right gastric artery in the lower part of the lesser curvature . The origin and course of right gastric artery is difficult to identify on endoscopic ultrasonography . Lgv: left gastric vein, pv: portal vein the lienorenal ligament is seen as a structure between the splenic hilum and the left kidney and includes the tail of pancreas . In this ligament the splenic artery and splenic vein traverse toward the hilum of the spleen but the lymph node (ln) is away from the vessels . In this case, a ln lying at the hilum of the spleen close to the tail of pan is seen and belongs to station 4 . Lk: left kidney, d1, d2: diameter of node the station 3 lymph nodes (lns) lie along the lower part of the lesser curvature of the stomach where the pancreas is also seen . This ln belongs to station 3b as it lies close to the lower part of the lesser curvature . In this image the portal vein (pv) is seen behind the pan and an ln of station 12p lies close to pv . Rra: right renal artery, hop: head of pancreas in this image, the ln lies at the upper border of the pancreas between the lesser curvature and the left gastric vein (lgv). The lgv is seen joining the upper border of portal vein (pv) near the portal venous confluence . This lymph node (ln) is in proximity of two vessels; the pv and sa . However, this ln lies very close to the lower part of the lesser curvature of the stomach and belongs to station 3b . Pvc: portal venous confluence two lymph nodes are seen adjacent to the greater curvature . They belong to station 4 . It is difficult to identify the blood vessels along the greater curvature because of their smaller caliber imaging from the duodenal bulb can show the portal vein (pv) and the bifurcation of common hepatic artery into the hepatic artery proper and gastroduodenal artery . In this image, the lymph node is seen between the supra pancreatic part of pv and the wall of the duodenum and belongs to station 5 imaging from the duodenal bulb can also show the portal vein and the bifurcation of common hepatic artery into the hepatic artery (ha) proper and gastroduodenal artery . The ha tends to run in a cranial direction toward the hilum of the liver and the gastroduodenal artery tends to go down behind the duodenum . In this image twolymph nodes (lns) are seen and station 5 ln lies between duodenum and liver while station 6 ln lies between duodenum and pan . Pan: pancreas, cha: common hepatic artery the lymph node (ln) labeled as station 7 lies a little away from the wall of stomach and close to the trunk of left gastric artery (lga). Sometimes it is possible to follow the branches of lga to the level of the origin of esophageal branches the lymph node (ln) labeled as station 8a lies close to the common hepatic artery . One ln lies anterior to hepatic artery (ha), and one ln (8p) lies anterior to inferior vena cava posterior to ha . The ln labeled as 8a can be also included in station 3b and such cases the proximity to the vessel or to the wall of the stomach will decide the station . In this case, the station 8a ln is equidistant from ha and from wall of the stomach . Ha: hepatic artery the lymph node (ln) labeled as station 8p lies close to the common hepatic artery . This ln lies anterior to inferior vena cava and posterior to hepatic artery this lymph node (ln) cluster is seen anterior to hepatic artery (ha) as well as near the proximal part of the splenic artery (sa). One of the lns is touching the sa and can be labeled as either 8a or 11p . At this point, the distance between ha and sa is only about 5 mm, and it is not possible to differentiate between 8a and 11p the lymph node (ln) labeled as station 9 lies just above the celiac artery (cal) and in front of the abdominal aorta . The trunk of left gastric artery near its origin is also seen, but this ln is closest to the cal and hence is labeled as station 9 . Another ln lying below the cal lies close to the abdominal aorta and belongs to station 16a2 . A ln belonging to 11p station lies near the lower border of the splenic artery the celiac artery (cal) takes a vertical course anteriorly after taking origin from the abdominal aorta . This lymph node (ln) is seen just above the anterior most part of cal, which is not seen in this frame . The splenic artery (sa) is the most tortuous artery of the whole body and in this frame is seen lying anterior to aorta . The ln lying above sa is closer to cal and anterior to aorta and thus belongs to station 9 the splenic artery (sa) runs a tortuous course and sometimes dips behind and above the pancreas . In this image, two lymph node (ln) are seen, and the ln labeled as 11d is seen close to the distal part of sa near the upper border of the body of pan . The upper ln is at station 4 this image shows another lymph node (ln) in the lienorenal ligament close to the hilum of the spleen and can be included either in station 11d or 10 . The station 10 ln lies more close to the pancreatic tail whereas station 11d lies near the upper border of the body of pancreas . On endoscopic ultrasonography a demarcation of the point where the body of pan becomes tail can be seen when the renal artery and renal vein are no longer visualized because of the entry into to the hilum of the left kidney . So the inclusion of this ln can be done in station 10 in this case one - lymph node (ln) labeled as 11p lies above the splenic artery as it takes a tortuous course and dips down . The ln labeled as 12p lies in the hepatoduodenal ligament just above the upper border of head of the pancreas as the portal vein exits near the upper border on its way to the hilum of the liver the portal vein (pv) near its formation lies anterior to the inferior vena cava (ivc) and maintains this position till it reaches the hilum . In this case the lymph node (ln) labeled as 12p lies posterior to pv and anterior to ivc . The location of this ln can be also included as precaval because it lies on the anterior surface of the proximal half of ivc . The ln of station 8a is also seen lying anterior to hepatic artery the bifurcation of the celiac artery into the hepatic artery (ha) and splenic artery (sa) produces a vertical seagull like appearance with vascular signals on endoscopic ultrasonography from stomach where the limb coming toward the probe is sa and the limb going away from the probe is ha . In between the two vessels lies the highest point of pancreas, which is called tuber omentale in this case a lymph node (ln) is seen just above the tuber omentale and is close to four vessels, which are celiac artery, hepatic artery, splenic artery and portal vein . This ln lies in the lower part of the gastro hepatic omentum and can be included in station 9, 11p, 8a and 12p the lymph node labeled as 12b lies along the common bile duct in the curve below union of the cystic duct with gallbladder . This lies in the hepatoduodenal part of lesser omentum and is best visualized from the bulb . Cbd: common bile duct, gb: gall bladder the lymph node (ln) labeled as 13 lies behind the pancreas just close to the lower end papilla and anterior to inferior vena cava . The can be included in station 12b (close to common bile duct) or precaval ln also in this case two - lymph nodes (lns) are seen . Station 16a2 lies below the celiac artery above the renal vein anterior to aorta imaging from stomach can sometimes push the scope below the level of head and body of pancreas . A lymph node (ln) lying cranial to duodenal papilla during imaging from 2 part of the duodenum can be considered as station 13 whereas an ln lying below the papilla will lie close to the lower border of pan and will belong to station 18 the superior mesenteric artery (sma) is the second ventral branch of the aorta, given off slightly below the celiac trunk, which descends in a groove on the posterior surface of the neck of the pancreas . Below the inferior margin of the neck of the pan, it goes anterior to the uncinate process and the horizontal portion of the duodenum and enters the root of the mesentery . It is easy to identify lymph node (ln) close to sma and superior mesenteric vein (smv) from the horizontal portion of the duodenum . In this image, the ln is seen near the root of mesentery close to the origin of sma and also close to the place where the smv is about to join splenic vein for formation of the portal vein . The sma nodes (14a) can lie behind the body of pan, on the uncinate process of pan or near the root of mesentery the station 14v nodes lie close to superior mesenteric vein within the mesentery, the main arterial stem of superior mesenteric artery (sma) describes an arc that spans the distance between the horizontal duodenum and the ileocecal junction, where the sma terminates by anastomosing with one of its own branches, the ileocolic artery . Of the arteries to the large intestine, the middle colic artery (mca) this branch is usually given off at the inferior margin of the neck of the pancreas before the sma enters the mesentery . The jejunal branches are seen going away from the probe, and the inferior pancreaticoduodenal artery is seen as the first branch arising from the right side of the sma coming toward the probe . The second branch coming from the right side of sma is mca, which is seen to enter the transverse mesocolon . Mca: middle colic artery, infr pda: inferior pancreaticoduodenal artery, imv: inferior mesenteric vein the lymph node (ln) lying along middle colic artery belongs to station 15 . In the second image, a ln is also seen along the first - jejunal vein the middle colic artery (mca) is seen taking origin from the right side of superior esenteric artery from the horizontal part of the duodenum . The course of the mca is followed - up to the lymph node present in transverse mesocolon (station 15) the distance between the esophageal hiatus and the aortic hiatus is about 1.5 cm, and the crux of diaphragm comes in between the two . A lymph node (ln) lying between the esophageal and aortic hiatus can be differentiated by the location: a ln between crux and aorta will be called as aortic hiatus node (16a1) whereas an ln between esophageal hiatus and crux will be called as esophageal hiatal node belonging to station 20 this lymph node (ln) belonging to station 16a2 lies below the celiac artery and posterior to the origin of superior mesenteric artery (sma). Although this ln is very close to the posterior surface of sma, the ln lies anterior to aorta and this ln is not included in the root of mesentery ln (station 14a) in this image, the upper and lower boundary of station a2 are seen as the upper border of the celiac artery (cal) (orange line) and lower border of left renal vein (lrv) (blue line). The lymph node (ln) belonging to station 16a2 lies below the cal and above the lower margin of lrv anterior to the aorta . Although the lns lie posterior to the pancreas, the location near the aorta places them in para - aortic group the lower border of left renal vein (lrv) demarcates the upper border of station 16b1 . This image shows a lymph node anterior to aorta and below the lower border of lrv belonging to station 16b1 . The lower border of station 16b1 is identified by origin of inferior mesenteric artery, which is not seen in these images . Lrv: left renal vein this image shows 16b1 lymph node in a different patient in this case two - lymph nodes (lns) are seen: one ln lies above the origin of inferior mesenteric artery from the aorta, and the second ln lies below the level of the upper margin of origin of i m a . The upper ln belongs to station 16b1, and the lower ln belongs to station 16b2 . It is uncommon to see the origin of i m a from aorta by endoscopic ultrasonography but in this image the lns can be seen from the stomach below the level of the pancreas . I m a: inferior mesenteric artery the fine - needle aspiration cytology was done from the 16b1station imaging from stomach can sometimes push the scope below the level of head and body of pancreas . A lymph node (ln) lying cranial to duodenal papilla can be considered as station 13 whereas a ln lying below the papilla will lie near the lower border of pan and will belong to station 18 . In this case, the papilla is not seen but two ln lies behind the pan in retroperitoneum and belongs to station 13 and another ln, which belong to station 18 lies along the inferior border of the body of pan the station 18 lymph nodes (lns) are retroperitoneal and lie along the inferior border of the body of pancreas . In this case, the ln is seen from the horizontal part of duodenum anterior to the superior mesenteric vein (smv) just below the place where it crosses the uncinate process . The part of pan lying in front of smv belongs to the uncinate process a color doppler shows the superior mesenteric vein and the lymph node belonging to station 18 from the horizontal part of the duodenum in this case the station 19 and 20 lymph node (ln) are seen . The station 19 ln is retroperitoneal and lies on the inferior surface of the diaphragm . In this case, the ln is much away from the esophageal hiatus and also away from the aorta . The diaphragm is not seen in this image, but the location anterior to crux, below the esophageal hiatus suggest this ln as station 19 . The station 20 ln lies between the esophageal hiatus and crux of diaphragm the lymph node (ln) in supra diaphragmatic location lie near the esophagus: paraesophageal below the pulmonary vein (110) (a), below the left atrium (la) (111) (b), close to inferior vena cava (supra diaphragmatic) (c) and close to aorta in a posterior mediastinal location (112) (d). The international association for the study of lung cancer classification of lung cancer staging identifies these lns in a different manner as station 8 and station 9 ln . Ripv: right inferior pulmonary vein, st7: station 7 of international association of study of lung cancer classification for ln . The nomenclature of nodal stations in abdomen is based primarily on the relationship of the lymphatic drainage (lns) that follows the accompanying vessel (artery and vein) or a direct relationship with the regional organ . The accompanying vessels traverse through the ligaments surrounding stomach and the metastatic nodes commonly reside in ligaments rather than the retroperitoneum . Soon after the first descriptions of the five - layer structure of the gastric wall, eus became a standard technique for the staging of gc . Until a few years ago, the impact of eus in gc was limited by the lack of therapeutic options, surgery being the only recourse either with curative or with palliative intent . The clinical arena of gc has changed substantially in recent years as treatments have become more numerous . Besides the traditional surgical approach, endoscopic mucosal resection and submucosal dissection are adopted for the early stages of the disease, and neoadjuvant therapies are used for the advanced stages . As a consequence, the potential role of eus in gc has become much more attractive to identify the patients suitable for minimally invasive treatment, those who should undergo primary surgery, and those who need neoadjuvant therapy . Under- or over - staging of ln disease has been noted when eus is used alone and a multimodality imaging with ct, pet scan along with eus and eus - fna of nodal stations may provide a more detailed staging . The additional value of eus - fna over eus alone for n and m staging of gc are emphasized in a study where distant ln and liver metastases were detected by eus - fna in 42% of the patients, and ct of the abdomen or thorax had previously failed to show any abnormality . Although preliminary reports have yielded conflicting results in this respect, gc restaging after neoadjuvant treatment is likely to emerge as another clinical task for endosonographers . The practical impact and use of eus in treatment decisions in gc patients is lower than would have been expected from the eus . Eus - fna should be considered an integral part of the eus staging procedure for gc in the near future.
The current investigation was a prospective, multicenter, cohort study conducted at third referral hospitals in south korea, between december 2009 and october 2010 . Patients who met the following criteria were included in this study: 1) between 18 and 90 years of age; 2) an established diagnosis of dm; 3) lower limb discomfort for longer than six months; 4) a diagnosis of pad established by the absence of one or more foot pulses of the involved foot or an ankle brachial pressure index (abi) less than 0.9 . Patients were excluded from the study if they had critical limb ischemia, defined as the presence of rest pain requiring analgesics for a duration of more than 2 weeks, the presence of non - healing ischemic ulcer, or gangrene; a stroke or myocardial infraction within the last 3 months; a tendency towards hemorrhage; severe liver or kidney disease; having undergone endovascular intervention of the coronary artery or a peripheral artery; or having undergone operative revascularization within the last 3 months . With these strict inclusion and exclusion criteria, 100 diabetic patients with pad were enrolled in this study, 6 of whom were excluded because they chose to discontinue the medication . All patients who were eligible for the study agreed to participate and signed a written informed consent . This study was performed according to the declaration of helsinki and was approved by the respective local institutional review boards from the institutions participating in the study . Patients were administered oral beraprost (40 g) 3 times daily (120 g / day) for 12 weeks . Use of other drugs with significant effects on peripheral vessels, hemostasis, or platelet function during the study was prohibited . Among these included pentoxifylline, heparin, warfarin, aspirin, persantine, ticlopidine, and prostaglandin e1 analogs . All other medical care regimens were continued throughout the course of the study in all the patients . The following safety assessments were made before treatment, as well as 6 weeks and 12 weeks thereafter, or at drug discontinuation: serum chemistry, hematology, electrocardiogram, vital signs, concomitant medication changes, and adverse events . First, a list of descriptors was chosen on the basis of our experience and analysis of the literature . Following discussions and approval of content validity by a panel of 4 korean diabetic foot experts, we included 8 descriptors (burning, coldness, edema, exertional pain, throbbing, shooting, stabbing, and paresthesias) in the initial version of the questionnaire . A pilot study was performed in all patients who participated in this study at their first visit in order to verify the face validity of the questionnaire . The patients were asked to complete the questionnaire and to rate each descriptor for clarity in wording, understanding, and relevance to their current symptoms . After the pilot study, the " throbbing " descriptor was excluded because it was considered irrelevant by a majority of patients . In addition, the " shooting " descriptor was excluded because of very low prevalence (<30% of the patients reported the symptom) as compared to the other descriptors . Thus, the final version of the disease - specific symptom questionnaire included 6 descriptors: burning, coldness, edema, exertional pain, stabbing, and paresthesias . Each subjective symptom was ranked from 0 to 4, according to the severity of the symptoms felt by the patient; 0 reflected asymptomatic status and 4 reflected the greatest severity . Patients were asked for their subjective assessment of their symptoms in the written questionnaire before treatment and at 12 weeks . In addition to the assessment of subjective symptoms, patients were evaluated serially for new complaints, changes in symptoms, and functional status . Statistical analyses were consequently performed with the spss ver . 18.0 (ibm co., armonk, ny, usa). Differences between pretreatment and the last follow - up were analyzed by the wilcoxon matched - paired signed - ranks test . First, a list of descriptors was chosen on the basis of our experience and analysis of the literature . Following discussions and approval of content validity by a panel of 4 korean diabetic foot experts, we included 8 descriptors (burning, coldness, edema, exertional pain, throbbing, shooting, stabbing, and paresthesias) in the initial version of the questionnaire . A pilot study was performed in all patients who participated in this study at their first visit in order to verify the face validity of the questionnaire . The patients were asked to complete the questionnaire and to rate each descriptor for clarity in wording, understanding, and relevance to their current symptoms . After the pilot study, the " throbbing " descriptor was excluded because it was considered irrelevant by a majority of patients . In addition, the " shooting " descriptor was excluded because of very low prevalence (<30% of the patients reported the symptom) as compared to the other descriptors . Thus, the final version of the disease - specific symptom questionnaire included 6 descriptors: burning, coldness, edema, exertional pain, stabbing, and paresthesias . Each subjective symptom was ranked from 0 to 4, according to the severity of the symptoms felt by the patient; 0 reflected asymptomatic status and 4 reflected the greatest severity . Patients were asked for their subjective assessment of their symptoms in the written questionnaire before treatment and at 12 weeks . In addition to the assessment of subjective symptoms, patients were evaluated serially for new complaints, changes in symptoms, and functional status . Statistical analyses were consequently performed with the spss ver . 18.0 (ibm co., armonk, ny, usa). Differences between pretreatment and the last follow - up were analyzed by the wilcoxon matched - paired signed - ranks test . Four patients failed to qualify for the study because of adverse reactions to beraprost, the study medication . The mean age was 63.5 years (range, 30 to 83 years) and the mean duration of dm was 9.3 years (range, 1 to 30 years). Diabetic retinopathy, nephropathy, and neuropathy were present in 8 patients (8.9%), 11 patients (12.2%), 18 patients (20.0%), respectively, some of whom had more than one complication . Comorbidities, including hypertension, hyperlipidemia, and previous myocardial infarction were noted in 57 patients . Ten patients were either current smokers or had a history of smoking within the past 2 years . No specific counseling on diet, smoking cessation or exercise was offered during the study period . Of 81 patients with coldness, 59 patients (72.8%) showed improvement in their symptoms, 21 patients (25.9%) remained the same, and one patient (1.2%) worsened . Seventy - four patients had edema, and 39 patients (52.7%) showed improvement in this symptom . Stabbing, burning, and paresthesias were observed in 61, 56, and 67 patients, respectively, and 65.6%, 64.3%, and 55.2% of them showed improvement in the respective symptoms . Significant improvement in all estimated subjective symptoms (coldness, edema, exertional pain, stabbing, burning, and paresthesias) in the lower extremities was reported at 12 weeks (p <0.001). There were 18 patients with neuropathy that was determined by an absent protective threshold using a 5.07 (10 g) semmes - weinstein monofilament . With the numbers available, these patients that had accompanying neuropathy showed significant improvement in all 6 subjective symptoms at 12 weeks (p <0.05) (table 3) there were no reports of critical cardiovascular events, including myocardial infarction, transient ischemic attack or ischemic gangrene, during the treatment period with beraprost . Adverse reactions considered to be causally related to beraprost occurred in 4 of the 94 patients (4.3%), and all of these patients discontinued treatment prematurely . Insomnia (one patient) and dyspepsia (one patient) were reported as well . Treatment of pad can be considered to take part in 3 stages: lifestyle and risk factor modification, pharmacotherapies, and revascularization . Treatment of the patient's lower extremity symptoms should be chosen on the basis of the severity of the symptoms . Pharmacotherapy includes vasodilating agents, calcium channel blockers, anticoagulants, antiplatelets, and prostaglandin analogs . A revascularization procedure, including surgical or endovascular intervention, is usually reserved for patients with disabling claudication that affects their quality of life, after medical therapy has failed to improve symptoms and critical limb ischemia symptoms . . Currently, 2 agents are available in the united states for the symptomatic treatment of pad: pentoxifylline and cilostazol . Both drugs have shown to increase pain - free walking time and total distance walked, although the data on pentoxifylline is conflicting.19,20) in comparison with the placebo, cilostazol improved the distance that patients with intermittent claudication were able to walk during standardized treadmill testing.21,22) however, its use is contraindicated in patients with heart failure, and a sizable minority discontinues treatment due to gastrointestinal upset or palpitations . Prostaglandins have also shown clinical benefit in reducing the symptoms of intermittent claudication and significant increase in walking distance.23,24) pgi2 which is synthesized in vascular endothelial and smooth muscle cells, shows antiplatelet action and vasodilating action.4,5) beraprost sodium is a stable, orally active pgi2 analogue, launched in japan in 1992, and is currently used in several countries to treat ischemic symptoms in chronic arterial occlusion . Beraprost has favorable effects on maximal treadmill walking distance and quality of life, while reducing the incidence of critical cardiovascular events in patients with intermittent claudication at 6 months.9) however, another trial of beraprost that involved 897 patients in the united states showed no significant improvement in maximal walking distance.10) although the two trials were well designed, only a few patients with dm were included in these studies . For that reason, it is necessary to test the efficacy of beraprost treatment in patients with dm specifically . Intermittent claudication has been considered the most characteristic manifestation of pad.12) however, in community - based epidemiologic studies, many people with pad have symptoms other than classic intermittent claudication.14 - 16) significant improvement of pain - free walking distance or maximum walking distance has been demonstrated . However, if the patients' subjective symptoms assessment is not changed, there is no reason to consider the effect to be beneficial . Thus, we developed a new disease - specific symptom questionnaire, which evaluated the effects of pad on leg discomfort in daily life, to assess therapeutic responses . In this study, 6 subjective symptoms were evaluated as parameters of the drug effect . Oral administration of beraprost over a period of 12 weeks resulted in significant improvement in all measures of subjective symptoms in diabetic patients with pad (p <0.001). Coldness was the next commonly reported subjective symptom, occurring in 90.0% of the enrolled patients, and 72.8% of these patients reported improvement in this symptom . Neuropathies developing in patients with diabetes are known to be heterogeneous in respect to their symptoms, pathologic alterations, and pattern of neurologic involvement . Chronic neuropathic pain is present in 13% to 26% of diabetic patients.25 - 28) the symptom in diabetic painful neuropathy was most often described by the patients as " burning / hot, " " electric, " sharp, " " achy, " and " tingling".29) these symptoms are similar to those observed in pad patients . Therefore, when pad patients accompanied with neuropathy are treated with beraprost, it is difficult to predict the outcome . In this study, we observed improvement in all of the 6 symptom parameters in patients accompanied with neuropathy . Therefore, if pad is prevalent in patients suspected to have diabetic neuropathy, we may expect improvement in some symptoms by treating pad . One study of beraprost demonstrated that beraprost increased blood flow significantly to the skin of the feet in patients with type 2 diabetes.30) consistent with an increase in abi, significant improvement in coldness of the limb, numbness, and paralysis was observed in diabetic patients with pad after treatment with beraprost.11) in this study, a 12-week treatment with beraprost significantly improved edema (39 of 74 patients, 52.7%) and coldness (59 of 83 patients, 72.8%). All of the above suggests that, in treatment of diabetic circulatory disorders, beraprost dilates peripheral vessels and increase blood flow to the skin, resulting in the improvement of various symptoms . In the current study, adverse events considered by the investigators to be drug - related were observed in 4 patients (4.3%), including headache (2 patients, 2.1%), insomnia (one patient, 1.1%), and dyspepsia (one patient, 1.1%). The incidence of adverse events in our study was relatively low compared to that in previous studies.9 - 11) this is probably because the period of medication was relatively short in our study . The limitations of this study include the uncontrolled and nonrandomized design, as well as the relatively small sample size . In addition, the lack of placebo control limits the statistical power of the data . Also, there was a limited ability to perform analyses of a subgroup with neuropathy because sample size could be decreased further . In the present study, various antipyretic analgesics, tricyclic antidepressants, the anticonvulsants gabapentin and pregabalin, as well as serotonin and norepinephrine reuptake inhibitors were used concomitantly with beraprost . Therefore, to verify the contributory effect of beraprost treatment, separate analyses should have been done before and after beraprost treatment for groups using and not using each concomitant drug . No changes in activity or risk factor modification were recommended during the trial . By minimizing the biases coming from these factors, these similarities lent statistical power to our results . Finally, objective findings such as abi and transcutaneous oxygen saturation were not measured to assess the efficacy of beraprost . Instead, this study focused on the effect of beraprost on subjective leg symptoms in diabetic patients with pad . In future prospective randomized studies, evaluation of abi or transcutaneous oxygen saturation are required to determine whether objective findings indeed improve . Diabetic patients with pad may have various symptoms that are generally reproducible during daily activities, resulting in a negative impact on quality of life . Beraprost is an agent with pharmacological actions unlike other drugs in respect to the treatment of pad . This trial showed statistically significant improvement of subjective symptoms in diabetic patients with pad after 12 weeks of therapy with beraprost, even without specific risk - factor modification and a directed exercise program . Beraprost may present a new option for the treatment of various symptoms in diabetic patients with pad . Further studies are needed with a larger sample size and a placebo control to confirm our results.
Knee injuries, particularly anterior cruciate ligament (acl) tears, in skeletally immature patients have been increasing due to an increase in the participation of adolescents in sports and leisure activities1). There has been much debate over whether conservative or surgical treatment is better for acl tears in skeletally immature patients with growth potential . Recently, surgical intervention is recommended to avoid the complications of conservative treatment, which include additional meniscal tears or early onset of degenerative arthritis2 - 4). When it comes to transphyseal acl reconstruction, one of the most important criteria to determine the timing of surgery is the amount of remaining growth potential, because physeal damage during the procedure can lead to premature growth plate closure, growth disturbances, leg length discrepancies, or angular deformities5 - 9). The timing of growth plate closure can be different for each patient and skeletal maturity should be assessed by taking various factors into consideration including tanner stage, risser sign, adolescent growth spurt, and comparison of the patient's height to that of the other family members . In practice, proper treatment selection for relatively young patients can be made without difficulty if skeletal maturity is considered achieved based on radiographic evidence of physeal closure . In contrast, utmost care should be taken in determining an appropriate treatment timing and method in late adolescents (around the age of 15 years) with skeletal immaturity . In this study, we performed acl reconstruction in skeletally immature patients and evaluated the long - term functional and radiological outcomes of the surgery at the time of skeletal maturity . A total of 158 patients with 18 years of age underwent transphyseal acl reconstruction at our institution between january 1993 and december 2008 . Of these patients, 25 patients (25 cases) who were available for 2 years of follow - up and showed skeletal maturity at last follow - up were reviewed retrospectively for this study . From each patient's medical records the following were assessed: the mechanism of injury, injury to surgery interval, preoperative clinical examination findings, preoperative knee function (lysholm score), preoperative sports participation level (tegner activity level), and presence of a combined injury . It was difficult to obtain a precise tanner staging based on retrospective review of medical records and radiographs . Therefore, the presence of a gap between the growth plates on anteroposterior (ap) radiographs was considered evidence of skeletal immaturity (fig . Knees with a patellar ligament injury that required surgery or posterolateral instability were excluded from the study . There were 15 boys with a mean age of 16 years and 4 months (range, 9 years and 8 months 17 years and 9 months) and 10 girls with a mean age of 16 years and 6 months (range, 14 years and 2 months 17 years and 9 months). The combined injuries were medial meniscal tear in 4 cases, lateral meniscal tear in 8 cases, and bilateral meniscal tears in 1 case . The mechanism of injury was sports related in 24 cases (soccer in 10 cases, basketball in 9 cases, cycling in 1 case, horse vault in 2 cases, judo in 1 case, and ski in 1 case) and falling in 1 case . The mean injury to surgery interval was 12.6 months (range, 1 - 40 months). Care was taken to minimize the bone tunnel size relative to the entire physes during tunnel placement . Taking care not to damage the tibial physis, tibial tunnel drilling was started medial to the tibial spine at an angle of <30 from the tibial axis toward the tibial isometric point . A femoral tunnel was drilled at an angle of 45 from the femoral physis in the' over - the top' position using a reamer that was rotated counterclockwise to prevent additional damage to the physis . Femoral graft fixation was done using the endobutton (smith & nephew, andober, ma, usa). Tibial graft fixation was achieved using either a screw if the tunnel length below the physis was sufficient (30 mm) or an endowasher or a buckle staple if the tunnel length was 30 mm . The graft used was hamstring tendon autograft in 22 cases and tibialis posterior allograft in 3 cases . On the postoperative clinical assessment, generalized ligamentous laxity was assessed, the lachman test, pivot shift test, and drawer sign test were performed at the last follow - up evaluation, and objective assessment was carried out using a kt 1000/2000 arthrometer (medmetric, san diego, ca, usa). The clinical results were evaluated according to the international knee documentation committee (ikdc) criteria . The last follow - up radiographs taken at skeletal maturity were assessed to identify early growth plate closure, leg length discrepancies, angular deformities, early degenerative changes, and side - to - side differences . The lysholm score was used to assess the improvement in clinical function and the tegner activity level to evaluate the level of return to sports activities . Chicago, il, usa). The wilcoxon - sign rank test was used to compare the preoperative and postoperative knee function . The mann - whitney u test was used to compare the radiographic measurements of the operated and non - operated sides at the last follow - up evaluation . The mean follow - up period was 74.4 months (range, 25 - 216 months). The mean age of the patients at last follow - up was 22 years and 7 months (range, 17 year -36 years and 3 months). Of the boys, 3 patients who did not appear to have gone through adolescent growth spurt were classified as tanner stage 3 and the remaining 12 patients, as tanner stage 4 . All the girls (n=10) including the two whose first menstruation started within 1 year after surgery were classified as tanner stage 4 . The possibility of tanner stage 5 was ruled out because there was no radiographic evidence of growth plate closure and 3 cm leg length growth was observed after surgery in all of them . On the preoperative knee function, the ikdc level was categorized as c (68%) in most of the cases: a in 1 case (4%), b in 2 cases (8%), c in 17 cases (68%), and d in 5 cases (20%). The ikdc level was improved overall postoperatively: a in 22 cases (88%) and b in 3 cases (12%) (table 1). The mean kt 1000/2000 arthrometer side - to - side difference was improved from 10.6 mm (range, 9 - 14 mm) preoperatively to 3.4 mm (range, 2 - 8 mm) postoperatively (p<0.001). The mean lysholm score was improved from 48.8 (range, 5 - 92) preoperatively to 93.3 (range, 79 - 100) at last follow - up (p<0.001). The mean tegner activity level was improved from 3.0 (range, 1 - 7) preoperatively to 5.6 (range, 4 - 10) postoperatively (p<0.001). The mean amount of leg length growth from the time of surgery to last follow - up was 4.6 cm (range, 3.1 - 9.6 cm) on the operated side and 4.7 cm (range, 2.9 - 9.6 cm) on the non - operated side (table 2). There was no observed leg length discrepancy of 2.5 cm in any of the patients . The side - to - side difference was <1 cm in most of the patients (21 cases, 84%). Although 1 cm side - to - side difference was noted in 4 cases (range, 1.1 - 1.6), it was not clinically significant . There was no observed angular deformity of 5 in any of the patients on the coronal and sagittal views (fig . 3). Albeit within the normal range, the posterior distal femoral angle on the sagittal plane decreased significantly after surgery on the operated side compared to the preoperative measurement (p=0.046) and to the non - operated side (p=0.002). Posterior proximal tibial angle was not significantly changed between the preoperative and postoperative period (p=0.137), but decreased on the operated side compared to the non - operated side (p=0.025) indicating a tendency to an increase in the posterior tibial slope . Degenerative arthritis combined with subchondral sclerosis was observed on the radiograph in 1 patient after reconstruction using a hamstring tendon autograft . The patient was a professional basketball player and had generalized ligamentous laxity and knee instability . Surgery - related complications, such as infections, were not observed in all the patients and 10o of flexion contracture was noted in 1 case . The treatment of choice for acl tears in adolescents should be determined with care according to the stage of skeletal maturity . Based on the magnetic resonance imaging evaluation of the closure of distal femoral and proximal tibial physes, sasaki et al.10) reported that skeletal maturity is reached by the age of 16 in boys and 14 in girls . However, skeletal maturity cannot be assessed solely by age, but is considered achieved in general based on the following criteria: tanner stage 4 or 5, <2.5 cm difference in height with other family members, adolescent growth spurt, and radiographic evidence of growth plate closure2,11). Acl tears in adolescents can be reconstructed after skeletal maturity or growth spurt with the same method used in adults . On the other hand, utmost care has been taken in the determination of treatment timing and methods in patients who are skeletally immature for their chronological age, as in our study, to avoid possible complications of growth plate damage . Acl tears in skeletally immature patients can be treated either non - surgically or surgically with primary repair, physeal sparing reconstruction, partial physeal sparing reconstruction, or transphyseal reconstruction . The recent consensus is that surgical management of acl tears is more advantageous over conservative treatments, considering that the latter has been associated with meniscal damage and knee instability, which can cause additional ligament damage and early onset of degenerative arthritis in the long term3,12 - 14). However, the established reconstruction techniques using femoral and tibial tunnels carry the risk of growth plate damage, leg length discrepancies, or abnormal knee alignment for patients with open physes15 - 18). Thus, a variety of attempts have been made to prevent or to minimize the potential side effects . Janarv et al.4) reported that growth retardation occurred when 7 - 9% of the distal femoral physis was destroyed, whereas retardation was not observed when of 4 - 5% of the physis was injured in a rabbit model . In the study, bony bridge formation could be prevented with the placement of a tendon graft in a transphyseal tunnel . Stadelmaier et al.19) reported that a fascia lata autograft placed in tunnels drilled across growth plates prevented formation of a bony bridge in a canine model . Minimal physeal injury and graft placement in bone tunnels have been advocated in many later studies as well . Bales et al.8) suggested the use of relatively small 7 - 8 mm bone tunnels, the placement of a graft within the tunnels, and the performance of fixation proximal to the physis in the femur and distal to the physis in the tibia . According to the 3d ct study by shea et al.20), proximal tibial tunnel that started more medial, distal, and with a steeper angle of inclination, significantly reduced damage to the tibial physis . In the present study, transphyseal acl reconstruction was performed with care to minimize damage to the femoral and tibial physes in all patients, as suggested in the abovementioned studies . The tibial bone tunnel was placed as close as possible to the center of the physis with an inclination of 30 with regard to the tibial axis to be perpendicular to the tibial physis . The femoral bone tunnel was created with an inclination of 45 to avoid excessive damage to the physes . The diameter of the bone tunnels was <7 - 8 mm, which was <5% of the total area of the physes and accordingly resulted in reduced complication rates . Femoral graft fixation was performed proximal to the physis using the endobutton (femoral cortical suspensory fixation). Tibial fixation was achieved distal to the physis by a screw if the tunnel was 30 mm in length and by an endowasher or a buckle staple for a <30 mm tunnel . Surgical techniques designed to minimize the risk of physeal injury have produced relatively successful results in many studies . Unfortunately, those techniques have not been tested in a large number of subjects and are technically challenging21 - 24). Considering that the prevalence of complications of physeal injury is very low15 - 18) and experienced surgeons produce more satisfactory results compared to the inexperienced25), we believe that transphyseal reconstruction is a relatively safe and promising surgical procedure for acl tears . Streich et al.26) reported successful clinical results of transphyseal acl reconstruction in 17 patients with tanner stage 1 or 2 . There were no leg length discrepancies or abnormal knee alignments in any of the patients . Frosch et al.27) performed a meta - analysis to compare various acl reconstruction techniques for skeletally immature patients . According to the study, the incidence of leg length discrepancies or abnormal knee alignment after acl reconstruction was relative low and physeal sparing techniques resulted in higher complication rates . The posterior distal femoral angle of the reconstructed side on the sagittal plane decreased postoperatively in our study . This can be attributed to the femoral physeal injury caused by the 45 inclination of the femoral tunnel with regard to the tibia . The decrease in the posterior proximal tibial angle that resulted in the increase in the posterior tibial slope of the reconstructed side was also attributed to unavoidable physeal injury . However, all the values were within the normal range . In addition, side - to - side differences in the sagittal plane alignment would not have significant influence on the clinical knee function due to the compensatory mechanism compared to those in the coronal plane alignment28). The one patient with flexion contracture showed no signs of abnormal sagittal plane alignment including distal femoral flexion, an increase in the proximal tibial posterior slope, or displacement of the anatomical axis from the preoperative to the last follow - up period . Therefore, we thought that the 10 flexion contracture was caused by soft tissue contracture that occurred during the postoperative immobilization period . In a study by briggs et al.29), the mean lysholm score was 94 and the mean tegner activity level was 5.7 in 488 normal adult subjects . In our study, the mean lysholm score was 93.32 and the mean tegner activity level was 5.6 at the last follow - up, which shows that our values were similar to those found in normal adults . In the patient who showed knee joint instability after surgery, generalized ligament laxity was present and reconstruction was carried out using a hamstring tendon autograft . Kim et al.30) reported that the results of reconstruction using autologous bone - patellar tendon - bone grafts were better than those using hamstring grafts in patients with generalized ligament laxity . However, reconstruction using an autologous bone - patellar tendon - bone graft is avoided in general in skeletally immature patients because of the risk of physeal injury in the graft donor site or remaining bone tissues in the bone tunnel . The use of autologous hamstring tendon grafts in patients with open physes can be advantageous in that donor site physeal injury can be prevented and fixation can be achieved away from the physes by placing a sufficient length of graft in the bone tunnel . However, we had difficulty in associating the cause of instability with the graft choice in this study because the patient was a professional athlete . Except for the 3 patients in tanner stage 3, 22 patients showed tanner stage 4 of sexual maturity . Physeal closure did not occur in them despite the chronological age and the mean 4 cm leg length growth was observed until the last follow - up . This indicates that the possibility of constitutional growth delay should also be considered prior to treatment selection . Thus, the level of skeletal maturity should be determined by considering various factors based on thorough clinical and radiographic assessments . The growth pattern and illness history of the patient's family, level of daily living activities, and sports participation level should also be assessed prior to determining surgical techniques and selecting grafts . The limitations of this study include the retrospective design, relatively small number of patients, relatively old age of the patients with a mean age of 16 years, and the use of 2 different grafts . In addition, the possible long - term effects of the side - to - side difference in the sagittal plane alignment were not thoroughly identified . The significance of this study is that it showed the efficacy of transphyseal acl reconstruction for skeletally immature patients based on the long - term follow - up evaluations that were performed after the patient's had achieved skeletal maturity . We believe that transphyseal reconstruction produces satisfactory results for the treatment of acl tears in adolescents with open physes without the risk of leg length discrepancies or abnormal alignment in the coronal plane.
The dominant motoric view of cerebellum has now changed to include its role in all cognitive functions and behavior as for the cerebral cortex . Lesions of the cerebral cortex producing secondary mania are commonly described, but cerebellar lesion producing mania is relatively uncommon . This was a case report of a 28-year - old unmarried man from a rural low middle - income group, farmer by occupation presented to our out - patient department (opd) on 05.05.2008 with acute excitement and inability to walk . Although working in the fields the previous day, he had a feeling of giddiness and had projectile vomiting . He could not sleep on the day of onset of his complaints . Throughout the night he was disturbing others and demanding things . He was talking spontaneously and excessively to everyone as if they were familiar to him . He was expressing grandiose ideas that he has a lot of power and can even beat 500 men . He lacked insight to his mental illness, but accepted his walking difficulty and said he wants medical attention . There was mild slurring of speech, but the classical speech of cerebellar disorder was absent . There was no history of fever, convulsions, incontinence, swallowing or visual difficulty . Urine examination, blood examination, including electrolytes, x - ray chest and skull were within the normal limits . Bender - gestalt test showed signs of organicity [figure 1]. In young mania rating scale, he scored 32 . Bender - gestalt test drawing of the patient showing evidence of organicity like poor form level & poor relationship to one another and to the whole spatial background he was seen by neurologist twice and was diagnosed of having left cerebellar stroke . Computed tomography (ct) brain was done twice, which showed a hypodense lesion in left cerebellar hemisphere suggestive of vascular infarct [figure 2]. Magnetic resonance imaging (mri) he fulfilled the criteria to diagnose organic manic disorder f06.30 as per icd 10 . Computed tomography of brain showing hypo dense lesion in left cerebellar hemisphere suggesting vascular infarct patient was followed - up in the next 1 month . He was given tablet sodium valproate 200 mg 2 bd and tablet olanzapine 5 mg 2 bd and tablet diazepam 5 mg 2 h. neuroimaging studies confirm that the cerebellum is activated milliseconds before cerebral activation in all aspects of cognitive function like memory and thinking as it is before motor movements . Cerebellum has rich to and fro connections not only to pyramidal areas but also to prefrontal lobe, temporal lobe, limbic area, cingulate gyrus, hypothalamus and thalamus . The role of the cerebellum in cognition and behavior is gaining more and more importance now . Movement abnormalities in catatonia are again thought to be due to cerebellar and basal ganglia involvement . They beautifully illustrated a patient aa who presented with cerebellar signs as well as symptoms of schizophrenia . Andreason suggests the presence of cognitive dysmetria due to cerebellar involvement in schizophrenia which is analogous to motor dysmetria so far described in cerebellar patients . Lauterbach analyzing 45 post - stroke patients noted mania in three patients who had lesions in left cerebellum or left cerebellar tracts to right caudate and thalamus . Unlike previous reports in literature, our patient is interesting in the sense that the cerebellar lesion has produced cerebellar and manic features simultaneously . Schmahman and sherman in his editorial in brain documents the evidence for the neuropsychological and behavioral involvement in cerebellar lesions . He suggests that cerebellar lesions produce not only motor dysfunction but it produces a cerebellar cognitive affective syndrome . Its defining features are disturbances in executive function, spatial recognition, language and emotional regulation of behavior . Posterior lobe lesions produce core cerebellar syndrome, whereas vermian lesions produce pronounced affective disturbance . Now we recognize subcortical dementia and obsessive - compulsive disorder is due to basal ganglia lesions . Similarly, by analogy we should give more attention to the cerebellum for cognition and behavior . Contribution of the cerebellum to cognition and emotion can no longer be ignored . From a clinical perspective, cerebellum has to be more closely looked for in ct and mri pictures of our patients . We have to learn more about cerebellum and we should not confine it to only a minor motor role . Frick mentions that the cerebellum may form a major neurological component of the ego, particularly sub serving the autonomous ego functions . Before concluding i shall quote what dow says about cerebellum in his book, just as cerebellum maintains motor balance it can as well balance other functions of brain of particular relevance to psychiatry.
Patients with alcohol abuse and dependence may suffer from psychiatric disorder, and there is a high prevalence of alcohol and other drug use disorders among patients with schizophrenia and other psychotic disorders shown to be as high as 50% in some studies.13 a high prevalence of alcohol abuse and substance use disorders has also been found in patients with first - episode psychosis.4,5 while alcohol - induced psychotic disorder is a well - recognized clinical disorder, relatively little is known about the mechanism of this condition . Previous studies have reported decreased -aminobutyric acid (gaba, inhibitory)6 and increased plasma glutamate and aspartate in patients who consume alcohol,7 while a placebo - controlled study reported superior efficacy of the inhibitory neurotransmitter glycine in reducing hallucinations in patients.7 certain genetic variants (alleles), particularly the adh1b2, adh1b3, adn1c1, and aldh2 2 alleles, which code for alcohol - metabolizing enzymes such as alcohol dehydrogenase (adh) and aldehyde dehydrogenase (aldh), have been associated with lower rates of alcohol dependence.8 the presence of these alleles may lead to an accumulation of acetaldehyde during the alcohol metabolism process, which can result in heightened subjective and objective effects.8 furthermore, the existence of an acute brain syndrome manifested by psychotic reaction to alcohol without regard to the amount of alcohol consumed has been well - described in the past.9,10 the acute, chaotic disruption of behavior resulting from ingestion of a small quantity of alcohol, known as pathological intoxication, has long been recognized as a psychiatric entity.11 pathological intoxication (pi), also called alcohol idiosyncratic intoxication, was said to occur predominantly in persons with low tolerance to alcohol, but its existence as a definable syndrome is still controversial.12 the disease has been defined as an acute brain syndrome manifested by a marked behavioral or psychotic reaction after minimal alcohol intake in people with no preexisting mental disorder.12 the essential points of all the definitions of this disease were the following: 1) marked maladaptive behavioral change (usually aggressive or assaultive behavior) with minimal alcohol intake, 2) the behavior is atypical of the person when not drinking, and 3) cause not being any other physical or mental disorder according to dsm - iii - r (diagnostic and statistical manual of mental disorders third edition revised).13 although pi had been listed in previous dsm editions, dsm - iv omitted it because of lack of supporting evidence to show that it was distinct from regular alcohol intoxication . Furthermore, such a condition of pi would be mostly likely diagnosed as alcohol intoxication or alcohol - related disorder according to dsm - iv to dsm - v . There was also some evidence of pi in the people s republic of china, and only ten published case reports of pi have been identified upon a chinese language literature review from 1984 to 2012 . The data for this review were based on the chinese language literature identified from searches of the china national knowledge infrastructure (www.cnki.net; 19792012), which is the largest online chinese language literature database . Blood alcohol concentration was not measured in any patient, none of them showed unsteady gait and were inarticulate . Besides, all had absolute aggressive behavior changes, and the duration of the episode was quite short and ceased after a few minutes to several hours . Most of them were young, and four of them had accompanying schizophrenic symptoms such as visual hallucination or delusion . In the current study, we report a 24-year - old man, without a known psychiatric history of psychotic or affective disorder, who developed a unique, brief psychotic disorder following ingestion of small quantities of alcohol, which seems very different from pi . Mr z. is a 24-year - old, previously healthy college student who developed psychotic features after drinking beer on the evening of june 15, 2011 . Ten minutes after having drunk two glasses (~200 ml) of beer (alcoholic strength of the beer was less than 4%), he was agitated and screaming, saying that his parents were in danger and that he should go to save them . He also masturbated in public without feeling shy although there were two female classmates around . Following this, he was sent to the hospital immediately . At the time of admission, he demanded strongly that the door be closed and curtains be drawn over the windows . When he saw his father, he grabbed both of his father s hands tightly as if he feared losing his father . He closed his eyes but did not sleep the entire night, and he also called his father s name every 5 minutes to ensure that his father was around . He looked at the curtain all through the night from the bed, watching the shadow that the light of street lamp cast through the curtain, and listened to the noise of cars as if waiting for something to happen . Nuclear magnetic resonance imaging (mri) scan of the brain and 24-hour ambulatory electroencephalogram examination revealed no remarkable changes . Self - rating anxiety scale and self - rating depression scale were administered to him, and the scores of the two scales were 50 and 28 . There were no other mental records for him as he was unwilling to complete any more tests . At the time of admission, blood was routinely drawn to determine the blood alcohol level, perform routine blood examination, and assess hepatic and renal function and serum electrolyte level . Blood alcohol level on admission was 30 mg / dl (6.52 mmol / l), and other blood examination results were normal . Besides, the time span between ingestion of alcohol and blood alcohol level testing was very short there was no evidence of auditory or visual hallucination, delusions of reference, or other psychotic symptoms . He had not experienced stress or other traumatic experiences before . Besides, there was a drinking history for the patient: he had consumed alcohol only one or two times in the past 3 months far from alcohol abuse and dependence . For this reason, it was considered that the current situation was an episode of brief psychotic symptoms, but not schizophrenia spectrum or other psychotic disorders . So, the doctor began therapy with seroquel (quetiapine) 25 mg qn initially . The doctor felt that his mental state returned to normal and that his symptoms resolved completely . He was discharged on the treatment of seroquel (quetiapine) 50 mg / night . When he went back school 1 week later, he did not take medication as before . He still studied well in school as before and showed no unusual behavior or symptoms . Approximately 40 days later, he had drunk approximately 150 ml of beer with his father and his relatives . We started therapy with seroquel (quetiapine) 25 mg / night (as before). Furthermore, the patient did not experience any psychotic symptoms or behavior change in between these two episodes . Approximately 30 days later, his symptoms recurred again because he had drunk three glass of beer, approximately 150 ml . His mental state returned to normal and his symptoms resolved completely 4 days after he took the medicine . He has since stopped taking the medicine and also does not drink alcohol any more . In the present report, we described the case of a young patient who presented with three episodes of behavioral change of acute onset suggestive of the brief psychotic episodes . Interestingly, each of the hospital admissions was triggered by small quantities of alcohol consumption . The symptoms manifested mainly as thought blocking; psychosensory disturbance; public masturbation; insecurity without elevated, expansive, irritable mood; or other psychotic symptoms . The patient returned back to normal after therapy . Both the mri scanning of the patient s brain and 24-hour ambulatory electroencephalogram were unremarkable . Furthermore, the patient and his family had no history of psychotic or affective disorder, personality disorder, or a seizure disorder . There was a very light history of drinking for the patient, and there was no weird behavior before when he consumed alcohol . What surprised us most was that once he had drunk such a small amount alcohol, his behavioral reaction started to emerge . To our knowledge, there is no related literature reporting the occurrence of such type of symptoms after ingestion of a small quantity of alcohol . Alcohol addiction or withdrawal could induce psychotic symptoms,14 but it seems that the patient in our case was far from such circumstances . The patient had no history of alcohol abuse and dependence, but had drunk beer only one or two times in the 3 months before the first episode . Also, blood alcohol concentration at admission was low (only 6.52 mmol / l), and the amount of beer ingested was small and the alcoholic strength of beer he consumed was less than 4% . Several differences should be pointed out when comparing these disease characteristics to that of pi . In our case, the patient experienced a marked behavioral change, such as public masturbation, but no aggressive or assaultive behavior . In addition, the duration of the episode in our patient (~37 days) was much longer than that in the cases with pi, which lasts for only several minutes or hours.1012 besides, most pi patients presented total amnesia for the period of the episode,12 while in our case the patient had partial amnesia . Subsequently, when we used seroquel to treat the patient, he started to do better . Also, episode of pi normally end with sound asleep.1012 in conclusion, there was insufficient evidence to demonstrate that the patient might suffer from pi or other alcohol - related neuropsychiatric disorders, although the episodes were induced by ingestion of a tiny amount of alcohol . Although the patient showed atypical psychotic symptom without evident hallucination or delusion in these three episodes, the childish mannerisms and bizarre behavior still relates to or is characteristic of schizophrenia . Besides, the age of onset is 24-year - old (very young) however, the one noteworthy point was that the patient would return to normal every time after therapy with seroquel (quetiapine). As the evidence accumulates, we have more confidence to speculate that the patient might be exhibiting early symptoms of schizophrenia and that ingestion of small amount of beer might induce the episode accidentally . In other words, ingestion of small amount of alcohol might be one of the predisposing factors of the episode of atypical psychotic symptoms in our case . Theoretically speaking, other issues, such as negative life events, might also induce psychosis . The patient presented with irritability, psychomotor agitation, and insomnia after drinking beer, which also fulfils the dsm - iv criteria for catatonia . Catatonia is a clinical syndrome characterized by alterations in motor behavior, and changes in thought and mood and can occur in the context of several disorders, including neurodevelopmental, psychotic, bipolar, depressive disorders, and other medical conditions . Catatonia has been documented as occurring in alcohol withdrawal in rodents, and rarely in humans, but not occurring in alcohol drinking.15,16 another possible diagnosis for this case was delirium . A patient with general delirious symptoms including thought process and sensory disturbances may fulfill the dsm - iv criteria for delirium . However, our patient exhibited no clouded consciousness, disorientation, or disturbed circadian rhythms, so this was not a possible diagnosis in this case . Clinical studies have documented a significant degree of comorbidity between anxiety disorders and alcohol use disorders . Previous studies, including both animal and human, have shown that acute exposure to low - to - moderate doses of ethanol are anxiolytic,17,18 and ingestion of small amount of ethanol resulted in development of anxiety symptoms in our patient . One possible reason for this could be that acute ethanol ingestion in our patient was associated with an acute decrease in gaba concentrations of the brain, and studies (in humans and animals) have shown that gaba deficits may induce stress and anxiety.19,20 taken together, this case demonstrates a special presentation of a marked behavioral change, which is suggestive of an episode of brief psychotic symptoms, after ingestion of small quantities of alcohol . And we can only assume, from the evidence and analysis, what disease the patient might be having . As a psychiatrist, it is essential to advise the patient not to drink any more, and, satisfactorily, he was also studying well at school during the follow - up period of 3 months.
Though rare, it can lead to neurological sequelae such as bowel and bladder dysfunction, sexual dysfunction, saddle anesthesia, sciatica, and motor weakness . Hematoma is a good culture medium for bacteria; therefore, reducing hematoma is advantageous in reducing infection . Many surgeons consider that a surgical drain increases the postoperative infection rate2561821). As a foreign body is inserted into a patient, it can lead to local inflammatory responses and can activate host defense system; alternatively, it can act as an inlet of infection . Therefore, there is a controversy about usefulness of surgical drain in single - level lumbar disc surgery and that bleeding is not much . In this study we studied 70 patients who had undergone single - level lumbar discectomy from april 2011 to march 2012 . The patients who had undergone multilevel surgery, fusion surgery, and/or previous lumbar surgery were not included in this study . This study was based on retrospective analysis of the patients' medical records that included their age, sex, diagnosis, level of surgery, mean operation time, length of stay after surgery, past history (hypertension and diabetes), and smoking or not, levels of c - reactive protein (crp), and scores of visual analogue scale (vas). The patients were divided into 2 groups: one that received the surgical drain and the other that did not . There were 42 patients who received the drain that included 21 men and 21 women with mean age of 49.93 years, and there were 28 patients who did not receive the drain that included 13 men and 15 women with mean age of 43.86 years . Both groups received prophylactic antibiotics (1st generation cephalosporin) intravenously for 7 to 8 days . We checked the levels of crp on postoperative days 1, 3, and 5 . The amounts of surgical drainage collected for 24 hours were checked daily at the same time . In drainage group, proximal tip culture of surgical drain was conducted when removed . Between postoperative days 7 and 8, we compared the rates of infection, the levels of crp, and the scores of vas in preoperative, postoperative, and the first postoperative follow - up phases at the outpatients department . The demographics of the 2 groups were compared using t - test and fisher exact test . The mean duration of the surgical drain and the mean of total amounts of drainage were 2.88 days and 71.57ml, respectively . The daily amounts of drainage on the postoperative days 1, 2, and 3 were 35.4, 20.8, and 14.27ml, respectively (fig . The differences in the levels of crp between the 2 groups were not significant (p>0.05) (fig . 2). The mean level of crp in drainage group on postoperative days 1, 2, and 3 were 4.17, 3.76, and 2.41mg / l and in nondrainage groups mean level of crp were 4.89, 5.2, and the differences in the scores of vas in preoperative, postoperative, and follow - up phases were not significant between the 2 groups (p>0.05) (fig . 3). The mean scores of vas in the drainage group in preoperative, postoperative, and follow - up phase were 7.5, 2.64, and 0.64 and mean scores of vas in the nondrainage groups were 7.28, 2.1, and 0.76 . The mean length of hospital stay after surgery was 9.68 days; further, it was 8.68 days in the drainage group and 9.87 days in the nondrainage group . The mean operation time of the drainage group was longer than the nondrainage group (150.2 minutes vs. 130.8 minutes). But there was no significant difference between the 2 groups (p>0.05). In the group that did not receive surgical drain, the mean operation time of infected patients was 100 minutes and that of no infection patients was 144.5 minutes . The operation time of infected patients was shorter than no infection patients, but there was no significance (p>0.05). There was no statistically significant difference between the 2 groups (p=0.157) (tables 1, 2). One of the 2 infected patients in the group that did not receive surgical drain was a 39-year - old woman who had undergone left l5-s1discectomy . After 13 days of operation, she had fever and pus - like discharge at the operated site . She underwent a repeated surgery on postoperative day 14 and received antibiotics treatment for 6 weeks (fig . The other patient was a 53-year - old woman who had undergone right l4-l5 discectomy . The lumbar magnetic resonance imaging (mri) revealed fluid collection with rim enhancement at the operated site and adjacent soft tissue enhancement was also observed . She underwent a repeated surgery on postoperative day 13 and received antibiotics treatment for 6 weeks . The intraoperative pus culture grew methicillin - resistant and coagulase - negative staphylococcus (fig . The incidence of symptomatic epidural hematoma is rare; however, the overall incidence rates of epidural hematomas on the first postoperative day of lumbar decompression surgery were reported using mri to be as frequent as 86%12). Postoperative surgical drain cannot only reduce the incidence and severity of hematoma formation but can also reduce the postoperative fibrosis14). The incidence of postoperative infection can be less than 1% after decompressive operation and more than 10% after fusions15). In this study, we analyzed the relation between the surgical drainage and postoperative infection in 70 patients who had undergone single - level lumbar disc surgery . There were 2 cases of postoperative infection and both of them did not receive surgical drains; however, there was no statistical significance . Additionally, there was no significant difference in the outcomes of surgery (pain and length of hospital stay after surgery). Additionally, from the financial perspective, there was no significant increase in the length of hospital stay because of surgical drain . The difference in the infection rates of the 2 groups (one that received the surgical drains and the other that did not) was not statistically significant . Although many surgeons consider that surgical drain insertions increase infection rate, many studies have also shown no increase in the infection rate of surgical drains34816). Kanayama et al.8) studied drain use after single - level lumbar decompression surgery and found " wound infection was not influenced by use of a drain . " More recently, poorman et al.17) studied drain use in cervical surgery and concluded " no differences in incidence of complications . " Ho et al.7) reported significant increase the incidence of delayed postoperative infection in patients who did not received surgical drains . Though it may not always be correct, the tip cultures of surgical drains can allow us to detect postoperative infection at an early stage, and it can lead to faster initiation of antibiotics treatment10111920). Positive tip culture predicts wound infection in 50% and a negative culture virtually excludes the possibility of a deep infection . Kobayashi et al.11) studied the efficacy of use of drain tip culture and conclude " rain tip culture is useful for early detection of surgical site infection caused by methicillin resistant bacteria . " In their series, there were 34 cases of positive tip culture and there were 19 surgical site infections . Drain tip culture had a sensitivity of 52%, specificity of 92% and the association between positive tip culture and wound infection was significant (p<0.05). In our study, the patients who underwent postoperative infection may have an opportunity to detect it earlier if they received drain tip culture . Surgical drains can reduce the risk of hematoma formation and can detect postoperative infection early by conducting drain tip culture . However, even though simple, inserting surgical drain require additional effort of medical worker, time, cost of material, postoperative care and patient's discomfort . The decision to use or not a surgical drain is left to the surgeon's discretion but using surgical drain can be considered in patient who has bleeding tendency and who has susceptibility to infection . Although many surgeons are apprehensive about postoperative infection by surgical drainage, no increase in infection rate and no difference in wound healing or postoperative neurological deficit have been observed . The tip cultures of surgical drains can be an effective means of detection of the postoperative infection
The hiv epidemic, directly and indirectly, puts a high burden on human societies which cannot be easily estimated due to its several complicated factors . With increasing the prevalence of hiv infection gross domestic product (gdp) hiv / aids is a serious health threat for prisoners in many countries and it causes major challenges for prison and public health authorities and national governments . Worldwide, the levels of hiv among prisoners tend to be much higher than in the population outside . Prisons are considered as an important source of transmission and spread of hiv and other blood - borne diseases (2). Over the past two decades several studies have demon strated the role of prisons in the spread of blood - borne infections such as hiv and viral hepatitis (38). Globally, around 16 million people inject drugs form whom three million are living with hiv and based on available evidences the most important reason for the rapid spread of hiv in such places is the use of shared needles and syringes among injecting drug users (idus) (9). The high risk behaviors in prisons which pave the way of hiv transmission are not just limited to shared needle injection; the prisons provide a ground for other high risk behaviors that may lead to blood - borne diseases . In numerous studies, some high risk behaviors during imprisonment some behaviors like homosexuality and tattooing are more common in prisons than normal societies yet, compared with using shared needles; they have received less attention (10). The common response of policy makers in countries with hiv epidemic among idus is to concentrate on public training and raising awareness to prevent using illicit drugs and high risk sexual relationships . In addition to training, harm reductions is considered as a pragmatic approach to prevent hiv . Using these two approaches, i.e. Training and raising awareness concurrent with harm reduction interventions, iran has been able to make a good response against hiv in general population and especially in prisons (11). The current status of hiv / aids in iran (based on the registered records of islamic republic of iran from the beginning) can be demonstrated as follows: by the end of 2011, a total of 24,290 people infected with hiv / aids had been identified from which 93.5% were male and 6.5% were female . Among the total registered cases in the country since 1984, the share of common causes of hiv infection has been as follows: shared drug injection 69.6%, sexual transmission 10.5%, mother - to - child transmission (mtct) 1 percent, and unknown 17.9% (12). As it was noted, in the second half of 1990s some hiv infection epidemics in iran s prisons were reported and based on the reports by ministry of health (moh) and unaids the hiv epidemic was expended in prisons in these years (13). Based on the available evidences, hiv / aids has become prevalent in prisons mostly through the use of shared needles in idus (14). It is estimated half of prisoners in iran are imprisoned due to drug - related crimes (15). According to a study, about 11.6% of the prisoners in iran are idus (16). Harm reduction is a health - centered approach which is the main key for controlling hiv among idus; it is aimed to reduce the harms of high risk behaviors like intravenous drug injection and to change these behaviors to less harmful methods and behaviors (17). Harm reduction programs are selected as the main strategy for controlling hiv in iran s prisons . The administration of methadone maintenance therapy (mmt) and the establishment of triangular clinics are two main harm reduction activities that are convincingly administered in iran s prisons . Triangular clinics in prisons provide several services for prisoners including: counseling and training about hiv / aids and other stis, harm reduction and mmt services, and treatment of stis . Accordingly, administration of mmt and prisoner s access to triangular clinic services had extended quickly with a high coverage during the period 1999 to 2011 . These services are presented in order to reduce the spread of hiv and other blood - borne diseases in prisons . This study was carried out to examine the prevalence of hiv and its association with harm reduction interventions in iran prisons during a 13- years period (19992011). Assessing the milestones through the establishment of sentinel sites is one of the conventional methods for monitoring hiv / aids . The data collected from sentinel sites have a special value for observing and monitoring the trends . In iran, the sentinel sites are chosen by technical committees whose members are from prison organization and moh . Based on available statistics of prison organization the total number of prisons in iran which changed from 227 in 2006 to 242 prisons in 2011; the prisons and prisoners in each prison are selected randomly . Based on conditions it is tried to establish sentinel sites in all parts of the country and provinces and in all major prisons . About 150 to 400 samples were randomly examined in each sentinel site . However, in small prisons and sometimes for other reasons the number of samples might become more or less than this number . Sometimes some small jails were merged together to form a sentinel site . Samples were randomly selected from the list of all prisoners in each ward or prison . The trained people selected the participants and filled up the questionnaires and took samples after counseling prisoners and taking their consent to enroll in the study . If a prisoner was reluctant, he was not enrolled and no samples were taken . The main variables which were investigated included age, gender and the possible way of transmission . In all these sentinel studies, first the study objectives for described for the participants and after taking their informed consent, the samples were taken . The samples were anonymously sent to a laboratory for elisa test and positive elisa cases were then confirmed by western blot . After collecting data, the results collected from sentinel sites were sent to the center for disease control of the moh and prison organization . This study includes all the data collected from sentinel sites established in all prisons of iran from 1999 to 2011 . In addition, the data about the major interventions conducted in this period of time including prisoners mmt and triangular clinics in prisons were collected in both absolute and cumulative forms . The collected data included the number of people under the coverage of mmt and the number of triangular clinics . Data and information regarding the expansion of mmt and triangular clinics in prisons were received from the health statistics and information management department in prison organization . To analyze the data, firstly the trend of hiv prevalence in prisons and also the trend of expanding the interventions were described . Then, the hiv prevalence and confidence interval of prevalence among iran prisoners were calculated for each year . Variable transformation was used to describe the variables better and to depict a graph showing the logical relationship between the simultaneous decrease in prevalence of hiv and an increase in the trend of interventions . The logarithm of the number of established triangle clinics in prison and the number of prisons accessing mmt services were used to show the changes in variables . To evaluate the correlation between the prevalence and each of the administered interventions in prisons the pearson correlation coefficient test was used for the second half of the mentioned time period . Based on the conducted study, a number of 551 sentinel sites were established in iran s prisons during the 13 years and in this check points 212,475 prisoners were evaluated and tested . Table 1 presents the number of sentinel sites, the number of inmates who were tested, hiv prevalence, and the confidence interval for hiv prevalence in prisons of iran from 1999 to 2011 . As shown in table 1, the maximum prevalence happened in 2002 (3.83%) and the minimum prevalence in 2011 (1.28%). Data in table 1 shows that the hiv prevalence in iran had an increasing trend from 1999 to 2002, so that 3.83 percent of prisoners in iran were hiv infected in 2002 . With implementation of harm reduction and interventional programs, the prevalence of hiv in iran s prisons gradually decreased from 2005 to 2011, so that it reached the minimum level of 1.28% in 2011 . Two most important and effective interventions that have been carried out are: 1- initiation and expansion of mmt . The program only covered 100 people in 2002 while it covered 38,256 people in 2011; 2- setting up triangular clinics in prisons: the triangular clinics were set up in only one prison in 2001 while they were set up in 125 prisons in 2011 . Hiv prevalence in prisons of iran (19992011) mmt is one of the main harm reduction activities in iran s prisons that have received a lot of investment and budget allocations . Based on the data collected from mmt department in health office of prison organization (table 2), the coverage of mmt program in iran s prisons had an increasing trend from 2002 to 2011, so that mmt program has become accessible for all provinces in iran since 2007 . Based on the data presented in table 2, mmt program was introduced only in one of the prisons in iran in 2002 while five years later in 2007 the mmt interventional program was expanded to all provinces . Expanding methadone maintenance therapy (mmt) in prisons of iran, 1999 - 2011 another important harm reduction activity for controlling hiv / aids was the introduction and expansion of triangular clinics . These clinics were introduced to iran s prisons in 1999; triangular clinics had been set up in all prisons in iran by 2001 to provide main services including counseling and training, harm reduction, and hiv / sti related services . Table 3 shows the trend of developing and expanding triangular clinics in iran s prisons . Number of prisons and provinces which established triangular clinics (vct services) as shown in table 3, the coverage of the triangular clinics services in all 30 provinces had reached 100 percent by 2006 . Following the national territorial divisions, a new province (alborz province) based on the results of statistical tests, there is a significant correlation between increasing mmt centers in iran s prisons and reducing the hiv prevalence from 2002 [= - 0.62 with p=0.001]. Besides, there is a significant correlation between increasing the number of triangular clinics providing vct services and reducing the incidence of hiv in prison from 2002 [= - 0.51 with p = 0.016]. Graph 1 shows the relationship between the decreasing trend of hiv prevalence and the administered interventions . As shown in the fig . 1, with increasing the interventions which reached the maximum in 2004 and 2005 the trend of hiv prevalence started decreasing . Based on the results of current study the trend of hiv prevalence in iran s prisons from 1999 to 2000 can be described as follows . In the early years, i.e. 1999 to 2000, hiv had an increasing trend; it mostly remained stable from 2002 to 2005 and since 2005 it has started a decreasing trend . The main interventions including mmt and triangular clinics had been introduced and expanded since 2002, and since 2006 and 2007 these services have become available in most of prisons in iran . The coverage of interventions has become stable since 2007 and it has been tried to increase the quality of services since then . The increasing trend of hiv and the maximum level of hiv prevalence had happened in iranian prisons during 2002 to 2005 when hiv was spreading in the country . During that time in our study, the maximum prevalence was 3.83% in 2002 which was 19 times more than the prevalence in general population . Overall, the first cases of hiv / aids epidemics in iran were started among idus in iran s prisons . As a result, the primary spread of the disease in prisons led to the spread of hiv / aids in iran . The first alarms for the spread of hiv rose in prisons among idus, however the early responses were not up - to - date and satisfactory . In that time, based on moh protocols hiv positive prisoners were quarantined . Due to this strategy and, also the lack of harm reduction programs in prisons, the increasing trend of hiv prevalence in iran s prisons which had started from the second half of 1990s lasted until the early years of 2000s; while hiv was spreading with an alarming speed, the interventional activities were adopted with a delay (18). After understanding the danger, the quarantining strategy was stopped also prisons started interventional activities, the rapid growth of hiv infection was dropped and from 2002 until 2005 the hiv prevalence was remained almost stable or had slight fluctuations . As it is obvious, because of the impacts of the increased coverage and the quality of harm reduction services the trend of hiv prevalence has started falling since 2005 . Analysis of the results of this study shows that the two main interventions (mmt and triangular clinics) in line with harm reduction services first dropped the increasing trend of hiv prevalence in iran s prisons and then have made it reversed . Although based on a comparison in 2008 the prevalence of hiv among iran s prisoners was eight times more than that among general population, it has decreased obviously compared with previous years . Concerning the epidemic stages of hiv / aids, we can say iran is in concentrated epidemic stage, i.e. It is concentrated in idus as one of the high risk groups . It is quite obvious that the high risk group of idus in iran has had the biggest role in spreading hiv in the society and prisons . The estimations about the prevalence of drug abuse in iran present significant numbers (16). However, the most important fact is that about half of iran s prison inmates are drug addicts from which 11.6% are idus (16). Additionally, it has been reported that the prevalence of using shared needles and syringes among idus prisoners is 47.3% (16). One of the outcomes of this study is to present a 13-year trend of hiv epidemic in the prisons of iran . There are few number of studies focusing on the prevalence of hiv in prisons in low and middle - income countries and most of effective and useful studies and researches are conducted in high income countries; the data in low and middle income countries are very limited and inadequate (19). Even in high income countries it is difficult to estimate the accurate number of hiv infected prisoners and the reported hiv prevalence are usually limited to only a prison or a region and cannot accurately reflect the prevalence of hiv in all prisons of a country (19). However, the data in the current study which is collected from annual data gatherings from sentinel sites in most of prisons in the country can demonstrate the real trend of hiv prevalence in iran s prisons . Our result is in line with other finding in other countries which reported higher prevalence in prisons than in general populations . Nevertheless, re - viewing the prevalence of hiv in prisons around the world has shown that hiv infection is a serious issue that needs further actions (20). In terms of hiv prevalence among prisoners, in some cases our results shows higher prevalence of hiv in the country s prisons than in the general population . In a study among 623 prisoners at one of the belize central prisons, the hiv test positivity rate was 4% (21). Hiv prevalence among prisoners in austria was five times higher than the prevalence in the general population of the country (22). Hiv prevalence among prisoners in america has been reported to be five times higher than the prevalence in the general population (23). Overall, the reported prevalence rates in different prisons from different countries are diverse . In some prisons from different parts of the world, different studies have reported a various range of hiv prevalence in prisons on different countries: the hiv prevalence is reported zero among scottish male inmates and lowa prisoners (24), 33.6% among adult prisoners in catalonia, spain (25), and more than 50% among women in a correctional facility in new york (26). World health organization has recommended a comprehensive package including nine interventions for idus for many countries especially low and middle income countries; in this package four important and effective activities that can effectively reduce hiv prevalence are (27): needle and syringe programs (nsp)/medications - assisted therapy (mat)/antiretroviral therapy (art) / hiv counseling and testing (hct) from the activities mentioned, nsp and mat can decline injecting behavior . Hct or vct reduce the risk of risky sexual behavior and art can the risk of transmission through intravenous drug injection and also through sexual relationships . Iran has complied with these guidelines and provided a good coverage of these programs, particularly in prisons, and has been able to control hiv infection in prisons . In spain, the impact of harm reduction programs, particularly nsp program, in reducing hiv infection in prisons has been proven (28). . Based on the results it can be concluded that setting up triangular clinics and methadone maintenance therapy as the hiv / aids control strategies which are implemented in iran s prisons following the who recommendations are highly efficient and they not only controlled the prevalence of hiv but also has led to its decreasing trend in prisons . It is recommended to continue and enhance these services and try to increase the quality of services in iran . In other countries that are facing concentrated epidemics among idus and have many addicts and especially idus in their prisons these experiences and strategies may be implemented to reduce and control hiv in prisons . It is recommended to conduct further studies to measure the quality of interventions . Additionally, since harm reduction programs cover a large group of people in iran s prisons, it may provide a good ground for studying positive outcomes as well as deficiencies and problems of harm reduction activities to be utilized in the prisons all around the world . As one of the study limitations, the data used in this study was extracted from the data collected by hiv / aids surveillance system over a period of 13 years . The data may not have the same quality over the mentioned period; since the data had not been intended for a research, it might have some biases . Another limitation is that its response rate is not clear and it is likely the people who rejected doing the test were those who were infected with hiv . Intravenous drug injection can lead to the spread of hiv / aids in prisons and societies all over the world . In regions and countries where the epidemic is highly prevalent among idus and prisoners, mmt and development of triangular clinics can be utilized to control hiv / aids epidemic quickly . Ethical issues (including plagiarism, informed consent, misconduct, data fabrication and/or falsification, double publication and/or submission, re dundancy, etc) have been completely observed by the authors.
Polycystic ovary syndrome (pcos) is the most common endocrine disorder among women of reproductive age, affecting nearly 7% of them . The endocrine hallmarks are hyperandrogenemia and, to a less extent, hypersecretion of luteinizing hormone . The characteristic clinical features of pcos are menstrual irregularity, such as amenorrhea, oligomenorrhea, or other irregular uterine bleeding, and signs of excessive androgen production, such as hirsutism, greasy skin, acne, and obesity . Pcos is considered to be not only a reproductive endocrinopathy, but also a metabolic disorder, and its morbidity may include hyperinsulinemia, insulin resistance, early onset of type 2 diabetes mellitus, and dyslipidemia . Obesity is a prominent feature of pcos, occurring in 40 - 50% of pcos patients . Also, the prevalence of pcos is increased in overweight and obese women when compared to their lean counterparts . The prevalence rates of pcos in underweight, normal - weight, overweight, and obese women are 8.2, 9.8, 9.9, and 9.0%, respectively . Prevalence rates reaches 12.4 and 11.5% in women with bmi 35 - 40 kg / m and greater than 40 obesity worsens the clinical, endocrine and metabolic features of the syndrome, mostly by increasing insulin resistance and hyperinsulinaemia . Besides obesity, the topography of body fat is an important issue . The major endocrine symptom of pcos, hyperandrogenicity, is clearly associated with the amount of fat localized in the upper body sites . It is suggested that there is a possible association between diet and risks of pcos . The objective of this study was to characterize the anthropometric and dietary profile of women with pcos and to compare it with that of healthy age - matched women . The study participants, materials, and methods were approved by the student research committee of shiraz university of medical sciences . This study was a case - control study . The study population consisted of patients who attended the clinic for gynecology and obstetrics at motahari clinic (shiraz medical university) from april 2009 to august 2009 . Sixty five women aged between 17 and 48 years, who fit the diagnostic criteria for pcos served as cases . The pcos was diagnosed byultrasound appearance of polycystic ovaries and determination of hormonal parameters based on standard rotterdam criteria 2003 . We excluded patients with any other etiology such as liver, kidney and heart problems . The control group consisted of 65 healthy women who attended the clinic along with their patients and were matched for age with the pcos group . All the participants, pcos patients as well as controls, were in good health conditionandwere not on any medication which might affect hormone metabolism or body composition . All the participants were non - smokers and none of them was on excessivephysical training . For each participant, a questionnaire of demographic information (job, exercise habits, education and socio- economic status, etc . Each participant was asked to provide a detailed history of menstruation and also signs and symptoms of pcos such as acne, hirsutism and greasy skin . Anthropometric information was gathered as follows: stature (in cm) and body weight (in kg) were determined for eachparticipant and bmiwas calculated . The waist and hip circumferences were measured and the waist - to - hip ratio (whr) was also calculated . To evaluate the dietary intake of the participants, three 24-hour dietary recall questionnaires were filled for each person (two weekdays and a weekend) by a trained dietition . Total energy intake (kcal), levels of carbohydrate (%), protein (%), fat (%), sfa (gr), pufa (%) and mufa (%) intake in the participants were also analyzed, using food processor software nut-4 modified by incorporating the iranian food table . Statistical analysis was done using the statistical package for the social sciences, version 13.0, for windows (spss, inc ., chicago). The independent samplet - test and mann - whitney u test was used to compare the means of the two groups . Statistical analysis was done using the statistical package for the social sciences, version 13.0, for windows (spss, inc ., chicago). The independent samplet - test and mann - whitney u test was used to compare the means of the two groups . The participants of the present study were 65 women with pcos as cases and 65 healthy women as control group . The average age of the participants in the case and control groups was 25.11 6.1 and 26.11 6.5 years, respectively . Besides the age variable, the two groups were also matched regarding the education and socio - economic status (p = 0.499). There was no significant difference in the percentage of women who exercised regularly between the two groups (32.3% vs. 35.8%; p = 0.075). A significantly higher percentage of pcos women reported pcos in their family than healthy women (p <0.001). There was no significant difference between the mean of body mass index of the two groups [table 1], but the mean of the waist circumference was significantly higher in the pcos group, compared to the control group (p = 0.016). Anthropometric characteristics of the participants we also compared the occurrence of three most common signs of this syndrome including acne, hirsutism and greasy skin in the normal weight and overweight subgroups of pcos women [table 2]. Although there were no significant differences in greasy skin and acne between the normal weight and overweight pcos patients, a significantly higher percentage of overweight patients had hirsutism compared to the normal weight (p = 0.009). Pcos signs and dietary pattern in the normal weight and overweight patients with pcos the mean intakes of calorie in the pcos and control group were 1508 581 and 1207 391 kcal, respectively [table 3]. There was a significant difference between the mean calorie intake of the pcos and control groups (p = 0.001) so that the pcos women consumed more calorie than the healthy ones . The mean fat intake (%) was significantly higher in the pcos group than the control group (p = 0.019). Sfa and pufa were also consumed more in the pcos group (p = 0.043 and 0.025, respectively). As shown in table 2, no significant difference was seen between their dietary intakes . Pcos is the most common endocrine disorder among women of reproductive age, affecting nearly 7% of them . Pcos is considered to be not only a reproductive endocrinopathy, but also a metabolic disorder, and its morbidity may include hyperinsulinemia, insulin resistance, early onset of type 2 diabetes mellitus, dyslipidemia, macrovascular disease and thrombosis, endometrial hyperplasia and carcinoma, and obstructive sleep apnea . In the present study, the dietary patterns and anthropometric characteristics of a group of women with pcos and a group of age - matched healthy women were compared . The mean bmi of the two groups was within the normal range (19 - 24.9kg / m), and there was no significant difference between the two means . But different patterns of fat distribution were seen between the two groups, so that the marker of abdominal obesity, mean of waist circumference was significantly higher in the pcos patients than the healthy controls . Similar results were reached in a study by kirchengast et al ., who showed that lean pcos patients have a significantly higher amount of fat tissue of the total body and the upper body region compared to the lean controls . The gynoid type of fat distribution develops during female puberty and persistsduring the fertile phase of adult life . Peripheralfat tissue, especially in the lower body region is an importantsource of extra - ovarian estrogen synthesis, because the aromatizationfrom androgens to estrogens takes place there . It is important to note that the major endocrine symptom of pcos, hyperandrogenicity, is clearly associated with a preponderance of fat localizedin the upper body sites . This sex specific fat distribution, commonly called android fat distribution, is associated with obesity and a variety of metabolic characteristics, but is also mentioned as an indicator of reduced reproductivecapability of the woman . Insulin resistance is independent of the effect of obesity; both lean and obese women with pcos have evidence of decreased insulin sensitivity, but insulin resistance is most marked where there is an interaction between obesity and the syndrome . Systemic hyperinsulinism plays a major role in the development of the hyperandrogenism characteristic of the pcos . Insulin also inhibits hepatic synthesis of sex hormone binding globulin, the key circulating protein that binds to testosterone and thus increases the proportion of testosterone that circulates in the unbound, biologically available, or free, state . A close correlation exists between adiposity and severity of the symptoms in women with pcos, and since acne, hirsutism and greasy skin are the most common variable signs of hyperandrogenism, the prevalence of these symptoms were assessed in two bmi subgroups of our patients: the normal weight and overweight . Although there were no significant differences in greasy skin and acne between the normal weight and overweight pcos patients, a significantly higher percentage of overweight women reported hirsutism compared to the normal weight . In a study by liou et al ., the obese women with pcos did not present with a higher prevalence of hirsutism and in fact they had a lower incidence of acne than non - obese participants . In another cross - sectional study by tamimi et al ., hirsutism, the major clinical feature of pcos, did not increase significantly from the normal weight subgroup to overweight and to obese subgroups of pcos patients . There is a fairly general agreement that sex hormone binding globulin (shbg) concentrations are much lower in obese women than the lean pcos patients . Obese women with pcos have high free androgen indices and lower shbg than non - obese women; therefore, one would expect the obese women with pcos to show more severe functional hyperandrogenism . Among hyperandrogenism symptoms, lifestyle modification focusing predominantly on diet and exercise behavior is considered the preferred first - line treatment for pcos management with the primary goal to normalize serum androgens and restore reproductive function . The reported incidence of obesity and insulin resistance among the women with pcos led us to hypothesize that patients with pcos consume foods that contribute to obesity, elevated insulin concentrations, and ultimately, insulin resistance . Our major findings were that women with pcos had a diet with higher total energy and fat, saturated fat and poly - unsaturated fat compared to the healthy controls . But we did not find any difference between the dietary intakes of normal weight and overweight pcos patients . Wild et al.21 found that women with pcos had a diet higher in saturated fat and lower in dietary fiber than age - matched control women ., investigated the habitual diet and activity patterns of 21 uk women with pcos . In their study, mean percentage energy from fat was 38% (12% energy from saturated fat), with 68% of women with pcos consuming> 35% energy from fat . Epidemiological studies suggest an association between a high fat, particularly saturated fat intake and reduced insulin sensitivity . In most of the dietary studies in women with pcos, improvements in metabolic and reproductive outcomes have been closely related to improvements in insulin sensitivity, suggesting that dietary modification designed to improve insulin resistance may produce benefits greater than those achieved by energy restriction alone . In an interventional study by thompson et al . On the effects of energy - restricted high protein diet (5000 - 6000 kj / d), weight loss via energy restriction improved reproductive function, cardiometabolic abnormalities, and hormonal parameters in overweight and obese women with pcos . As reported, in our participants, this high fat diet might have increased insulin resistance and caused hyperinsulinemia in patients . As we discussed previously, hyperinsulinemia can cause hyperandrogenism . We conclude that in pcos patients, android obesity in a common feature and this abdominal adiposity may be related to pcos complications . We can also report that pcos symptoms are more severe in overweight pcos patients than the normal weight . As to the dietary pattern, pcos patients consume more calories and more fat in their diets and this might have been correlated to their disease . We recommend clinical trials to be designed to assess the effects of different patterns of diet and changes in anthropometric indices on the signs and symptoms of pcos.
Alzheimer's disease (ad) and related dementias affect an individuals' quality of life (qol) in profound ways . Qol has been identified as a primary goal of dementia treatment [1, 2]. For instance, the international working group for the harmonization of dementia drug guidelines recommended that qol be included as an outcome measure in dementia clinical trials . The value of qol measurement lies in its ability to capture potential benefits and harms of treatment not detected by typical patient - oriented performance outcomes, such as cognitive tests . Unfortunately, the neurological deficits associated with a dementing disease often make measurement of patient qol difficult . Anosognosia, an organically mediated unawareness of the impairments, is a frequent occurrence in the disease, affecting up to 50% of individuals with mild to moderate ad . This lack of insight may limit the reliability of affected individuals' assessment of their qol . Concurrently, proxy's attributions of the affected individual's qol are often quite different from the affected person and rated significantly lower [6, 7]. These discrepancies may help explain the lack of uniformly accepted qol measure for studies of people with dementia . However, since both provide distinct information, a combination of proxy and patient qol ratings may be more appropriate . Along with the importance of qol measurement for understanding the impact of the social, behavioral, and cognitive changes associated with dementia, an accurate assignment of qol is also important from an economic perspective . Measures of qol serve as the basis of the cost utility analyses used by healthcare payer agencies to determine economic aspects of treatment effectiveness . The core of this analysis is a unit known as quality adjusted life years (qalys). Qalys provide a single index that combines survival estimates and health - related qol data, resulting in judgments about the relative effectiveness of a treatment intervention . Qol survey responses from patients were used for estimation in 58% of qaly approaches reported in one study . However, qaly estimates for dementia are subject to widely different interpretations, and the utility of such estimates is controversial . Valid measures of qol in dementia will be important for assessing the efficacy of future disease modifying therapies for dementing illnesses like ad, because these agents are designed to slow progression without directly improving symptoms . Since, by definition, dementia diagnosis requires a loss of functional independence, treatments that slow progress will prolong disability . This raises significant problems for interpreting patient - centered qol as the basis of qaly calculations for such treatments . However, qol assessment is also important from a family systems perspective . Because a family unit functions as an interconnected whole, dysfunction or illness in one family member affects other family members . More than 70% of individuals with ad and other dementias receive care in a family setting; caring for someone with dementia leads to caregiver burden, adverse effects on family interactions, changes in family roles, and communication difficulties [12, 13]. The family caregiving alliance has consequently suggested that quality of care assessments should embrace a family - centered perspective . Therefore, development of a family quality of life (fqol) measure is pertinent for providing a more complete basis for qaly estimates of potential disease modifying therapies for dementia, as well as for clarifying the care needs of people with dementia and their families . One difficulty in assessing the impact of dementia on family function and well - being lies in determining an adequate operational definition of fqol that encompasses individual needs within a family unit . A concept primarily studied in the field of developmental and intellectual disabilities, fqol has been defined as the interaction and reverberation of individual members as they produce the aggregate of family quality of life . In operational terms, the beach center fqol scale, a measure developed to assess fqol among families of children with developmental intellectual disabilities, conceptualizes fqol as the positive and negative impacts experienced by families as a result of supports and services for themselves and/or their children with disabilities . A previous study identified that the domains of beach center fqol scale items could be successfully adapted to address dementia - related changes in family interactions . The specific goals for the current study were to further explore the potential utility of the fqol construct in guiding dementia care, and to gain insight regarding the following questions related to fqol.who do dementia patients consider to be family?do family members report ways that dementia affects their fqol?what are the common fqol - related needs that families identify in a healthcare setting? Who do dementia patients consider to be family? What are the common fqol - related needs that families identify in a healthcare setting? Based on the beach center fqol instrument and the authors' prior work with families caring for dementia, the domains associated with fqol in dementia were defined as (1) family interactions, (2) direct care / activities of daily living support, (3) emotional / behavioral well - being, (4) physical and cognitive well - being, and (5) disability - related support / medical care [16, 18]. The domains were then used to construct a series of open - ended questions focused on assessing the impact of dementia on these areas . Developed by a neurologist (dg) and neuropsychologist (jd), this format was chosen to allow for flow of thought and feelings not traditionally captured with quantitative methods . The person with dementia and a family member were asked to complete separate but similar questionnaires . Caregivers were allowed to assist the affected person in completing the form, but were instructed to ensure that responses reflected the affected person's thoughts . Dyads, consisting of care recipients with dementia and family caregivers, were recruited for completion of the fqol questionnaire during a visit to an outpatient, interdisciplinary dementia care clinic located at a university medical center . All patient participants met dsm - iii diagnostic criteria for dementia, as recommended by the american academy of neurology guidelines for dementia diagnosis . While the specific cause of dementia was not assessed for the purpose of the study, ad is the most common diagnosis among patients in the enrolling clinic, followed by a minority of patients who present with other causes of dementia such as dementia with lewy bodies, and vascular dementia . Dementia severity, as assigned by clinicians providing care, was generally mild to moderate . Because patient responses were required, persons with severe dementia were likely not able to participate . A family was identified by the patient per specific guidelines to include one or more persons with whom they share emotional closeness and the dementia experience, whether or not they were related by blood or marriage . The study was approved by an internal institutional review board . Since the study was deemed to involve minimal risk, participants were not required to sign an informed consent document . However, before data were collected, the caregiver / patient dyads were informed of the purpose of the study and informed that each would be asked to complete a 7-item open - ended questionnaire . All participants were informed of their right to refuse participation or withdraw from the study at any time without consequence to their health care . First, the person with dementia was asked to list family members who think of themselves as part of your family (even though they may or may not be related by blood or marriage) and who support and care for you on a regular basis . All identifying information was removed from study material before analysis to assure the participants' anonymity and confidentiality . Four dyads were excluded because of insufficient data, defined as no response to> 50% of questions on both caregiver and patient forms . Notably, all four of the removed dyads involved a complete lack of response from either the patient or the caregiver . Only matched pairs of patients and caregivers in which both responded to> 50% of their respective question sets qualitative methods of data analysis were used . A neuropsychologist (jd) and a graduate student in gerontology (br) independently developed initial sets of categorization codes, which they used to separately analyze ten test cases . They then jointly reviewed their codes to determine agreement and create a final, focused, coding scheme . The final scheme categorized response types into three categories (1) response focused on an individual's needs, (2) response focused on family needs, or (3) neither . Spss for windows version 12.0 was used to compute frequencies for types of responses and to interpret demographic information . The mean age of patients was 72.1 years, and 53% were men . For the caregiver respondents, the mean age was 62.1, and 72% were women . The majority of patients included their spouse (80.5%) in the listing of their family members, followed by a daughter (58.4%), a son (46.8%), a step - child or child - in - law (37.7%), and a grandchild (22.1%). Other possible family members, such as a friend, neighbor, or caregiver, were listed fewer than 10 percent of respondents answers . All analyzed dyads provided at least two family - focused responses in completion of their questionnaires . This included responses that specifically mentioned multiple family members, as well as responses that included plural terms such as, we, they, or our / my family . Examples of family - focused responses include we will have to repeat things . Overall, we are positive and supportive and are here to help and love our family member and we as a family simply repeat, re - word something he is having trouble with . Sometimes we just let it go when we know he has not gotten responses were considered to be individually focused when they (1) reported on changes in cognitive domains, such as memory and thinking, without mentioning the impact of those changes on others, or (2) indicated that only the patient or caregiver was being mentioned, (e.g., patient says she does not like being different from the way she was before the onset . And what can i do to improve my memory?). Individually, only four of the patients and one caregiver who completed the questionnaires did not provide at least one family - focused response . Patients were more likely than caregivers to provide family - focused responses on four of the seven questionnaire items (items 1, 3, 4, and 5). Caregivers more frequently provided family - centered responses on two of the seven items (items 6 and 7). One item had identical proportions of family - focused responses from both patients and caregivers . Predictably, questionnaire item 1, which inquired about how the presence of dementia symptoms affected family interactions, was the most likely to elicit a family - focused response, from both patients (78%) and caregivers (70%). All our kids know the situation, but do not really want to accept the outcome . Item 5, which inquired about self - perceptions of thinking and memory, and addressed family interactions secondarily, elicited a family - focused response from 48% of patients and 32% of caregivers . An example of a caregiver's family - focused response to this question was poor short - term memory and repetitions limit enjoyability of discussions and family meals together . Patient has developed confabulations, in unkind ways, that disturb more distant family members . Item 3 inquired about changes in mood and emotions, and the effect on family interactions . It was as likely to elicit a family - focused response from the patients as the query on cognitive abilities in item 5 (48%) and was the second most likely question to elicit a family - focused response from caregivers (39%). Examples of family - focused responses to this item included (from patient) fluctuating between normal and a little nervous . Feel less secure about my own input; (from family member) it included the lack of initiative and empathy makes us sad, feeling like it is a one - way relationship . Item 4 inquired about changes in physical functioning and its effects on family interactions . An example of a patient response to this question was energy level has dropped, so not able to do many things . Items inquiring about adl / iadl assistance (item 2) and what questions the patients / caregivers hoped to have answered during their visit (item 6) elicited family - focused responses in only 614% of patients and 1417% of caregivers . An example of a patient family - focused response for question two was husband meds . . Personal care myself . Examples of caregiver responses for item 6 include if there is any way we can communicate other than speech sign language, and so forth . And anything we can do differently that may stimulate brain more to maybe keep mind from completely going . Item 7 queried whether respondents saw ways for the clinic staff to help improve family function . Only 14% of patients and 26% of caregivers responded with family - focused responses that included tangible suggestions such as emotional support or increased knowledge of the disease . An example of a patient response to this question was better understanding of the disease process . An example of a response from a caregiver was respite care over 60% of family - focused responses indicated family function did not need improvement . The first asked about whom dementia patients consider to be family . For our respondents family this supports the potential usefulness of assessing fqol in community - dwelling people with dementia instead of the more typical separate patient and single - caregiver measures of individual qol . On many questionnaires, issues related to the dynamics of family - based care emerged (e.g., very difficult to communicate with my family, and this is depressing to us all) indicating that solely inquiring about individual qol from a caregiver or patient perspective alone fails to assess important dynamics within a family unit . The second study question investigated how families report the effects of dementia on domains associated with fqol . Our earlier study revealed that family interactions were articulated infrequently in a medical care setting, suggesting that important aspects of family well - being may not be addressed prospectively by families seeking medically oriented dementia care or by health care providers . To compensate for this problem, the current study used questions designed to identify ways that dementia impacts family interactions in specified domains . Results indicated a high frequency of family - focused responses for items regarding thinking and memory . There were fewer family - centered responses to queries about topics to be addressed at the medical visit or on how family functioning could be improved . Persons with dementia seemed at a particular loss in expressing questions about how their family's functioning could be improved, with over half (52%) leaving the question unanswered . While it is possible that both patients and caregivers did not feel their family situation needed any improvement, there is a substantial likelihood that the observed patterns reflect a combination of ascertainment bias in our specialty clinic population, inadequate study instrumentation, and the study's physical and temporal location in an obvious medical clinic setting . The final question the study sought to assess was what broader needs patients and families commonly identified in a dementia - specialty healthcare setting . Though 26% of caregivers provided family - focused responses to the item querying how the clinic staff could help improve family function, few clear themes emerged from these questions . Responses were most likely to raise questions about care activities unique to their own patient and family the majority of the study sample was caucasian and english speaking, from a geographically restricted, mostly rural to suburban area in the eastern us . Participants had physical and financial access to expert care and literacy levels sufficient to read and provide written responses to the questions . Different phrasing and content for the questions would likely be needed to best address dementia care needs in other locations . These issues detract from the ability to generalize our findings to individuals from other cultures and backgrounds and point to the need for further outreach to minority and underprivileged populations regarding the effects of dementia and its associated care on family function . Additionally, the lack of randomization of study participants inherent in qualitative research further detracts from generalizability of these findings . Although the survey used first - person language to query the patient about their dementia care concerns, it was evident that family members frequently completed the responses survey on the patient's behalf . This was a practical necessity in the care setting because of the nature and severity of the patient's cognitive deficits . It is also unclear as to how responses to these questions might change over time or in response to interventions . Given that dementia severity was not assessed as a variable in our study, it is possible that it would not generalize to individuals in earlier or more severe stages of dementia . Previous studies have reported that qol may be independent of cognitive function, supporting the potential value of inquiry on aspects fqol in all stages of the disease . However, behavioral symptoms, which have a major impact on caregiver well - being and qol, were probably not sufficiently addressed in our study . The phrasing of questionnaire item 3, which was intended to assess these symptoms, focused on mood, but this may not have triggered responses regarding other behavioral and psychiatric symptoms of dementia . Future studies will be needed to assess the impact of a broader spectrum behavioral and psychiatric symptoms, especially agitation and sleep disturbances, on fqol . The use of a brief, easy to administer, open - ended questionnaire in this study was central to our examination of the elements that contribute to fqol in dementia . This approach permitted volunteers to provide subjective views and experiences of the effect of dementia on fqol . Future studies may be best served by asking additional domain - specific questions and inquiring about the significance of each . Additionally, measuring the frequency of family - focused responses will likely not serve as a complete indication of how dementia affects the family . Along these lines, future studies may need to assess what the family has done to cope with changes in family function that result from dementia symptoms . It is likely that many variables, such as those that reflect coping skills, social resources, caregiver and patient personality, and overall resilience, will have different effects from one family to another . Additional research is currently underway to further develop the fqol construct in this population, including assessment of which fqol domains are most important, and most affected among families caring for someone with dementia . Better understanding of these influences on fqol in dementia has both public and personal health implications . From the public health perspective, meaningful measures of fqol might allow refinements in cost utility analysis and resource utilization estimates to account for the effect of the disease on the family unit, rather than the affected person in isolation . At an individual level, assessing the determinants of fqol may allow healthcare practitioners to be more effective in predicting the resources that families need to best support affected persons and to optimize family function and well - being.
The number of end - stage renal disease (esrd) patients requiring dialysis treatment has been rapidly increasing worldwide over the past few decades . Korea is one of the countries with the highest increase in incidence (120%, from 2000/2001 to 2012/2013) and prevalence of esrd (from 585 per million in 2000/2001 to 1,442 per million in 2012/2013). Most esrd patients choose between hemodialysis (hd) and peritoneal dialysis (pd) at initiation of renal replacement therapy . It is crucial to address which modality is a better option for long - term mortality and morbidity outcomes in esrd patients . Multiple studies have been conducted to investigate these issues, but the results were not conclusive . In korea, we reported that overall mortality rate and incidence of cardiovascular events are higher in incident pd patients than in hd patients . Short - term pd patient survival rate is generally considered superior to that of hd, whereas long - term pd survival is inferior or comparable to that of hd . Although it is an older report, the survival rate in us pd patients was 86.8% at 1 year and only 11.3% at 10 years . In korea, the survival rate in pd patients was 95.2% at 1 year and 36.4% at 10 years in the 2014 annual report of the korean esrd registry; however, there have been some reports suggesting improvements in pd patient survival that must be considered when selecting dialysis modality ., we aim to elucidate why patient survival is worse and cardiovascular events are more prevalent among pd patients than hd patients in korea . Recently, patient survival with pd as an initial treatment modality has consistently improved worldwide: this improvement was the most dramatic in the us . From patients starting dialysis in 2000 to those starting in 2008, survival rates improved in both hd and pd patients . Of note, the extent of improvement was more prominent in pd patients . The 5-year survival rate of hd patients improved from 34.5% to 40.2%, while that of pd patients greatly improved from 37.3% to 50.3% . Therefore, the higher death rate of pd compared to hd seems to be at least comparable or reversed since the late 2000s . Most recently, us pd patients have had a similar life expectancy to that of hd patients . The authors analyzed data from the us renal data system for secular trends in survival among patients treated with hd and pd on day 90 of esrd in three 3-year cohorts (19961998, 19992001, and 20022004). Analysis revealed that there was a progressive attenuation in the higher risk of death in patients treated with pd in earlier cohorts . For the 20022004 cohort, there was no significant difference in risk of death between hd and pd patients . The survival superiority of hd over pd was lost from an old cohort to a more recent one, with hd and pd showing equivalent outcomes . The adjusted median life expectancy of hd and pd patients was 48.3 and 43.8 months in the 19911995 cohort period, respectively, while it was 51.7 and 50.8 months in the 20012004 cohort period . In australia and new zealand, home hd has been widely used in these two countries, and the proportion of patients using home hd at the end of 2014 was 9% in australia and 18% in new zealand . The survival rate was compared among in - center hd, home hd, and pd . Overall, there was a 25% lower adjusted mortality risk associated with dialysis inception during 2008 to 2012 compared to 1998 to 2002 . In addition, there was a 21% reduction in mortality for those on facility hd therapy, a 27% reduction for those on pd therapy, and a 49% reduction for those on home hd therapy . Therefore, survival improvement has been more prominent in home - based dialysis therapy compared to facility hd . A comparison of outcomes according to the era of dialysis initiation was performed in a nationwide pd cohort . Although pd patients recently had more comorbidities including diabetes mellitus (dm), patient survival improved along all study periods . Compared to 2005/2006, patients starting in 2007/2008 had a relative risk reduction of 0.83, and those starting in 2009/2010 had a relative risk reduction of 0.69 . Although there has been no official report on temporal changes in patient survival including all european pd patients, there is scattered evidence in some countries . A cooperative study of spanish pd registries showed that annual mortality was gradually decreasing, despite significant regional differences . In addition, one report showed that italian pd patient survival significantly improved over 30 years . The annual mortality rate of pd patients in 2000 was 26%, which was much lower in 2011 at 15% . However, their 5-year patient survival was surprisingly found to be lower in the 20022006 cohort compared to the 19972001 cohort . Patients were older and the proportion of patients with diabetes or hypertension was also higher in the more recent cohort . Hong kong is one of the most developed countries in terms of pd patient care; thus, the small change in patient characteristics could have significant effects on patient outcomes . In almost all countries, patients starting pd have more unfavorable baseline characteristics, which may translate to worse survival; however, the survival rate of patients starting pd has gradually and significantly improved, likely due to advancements in standard pd patient care . Ethnic diversity and the heterogeneity of patient characteristics between those being treated with hd and pd at initiation of dialysis therapy are fundamental problems that make it difficult to draw conclusions regarding mortality . Although some cardiovascular morbidities such as myocardial infarction (mi) and congestive heart failure (chf) are more prevalent in pd patients in korea at the initiation of dialysis therapy, patients on pd are generally younger and have fewer comorbidities than those on hd . In the us, pd patients are younger and healthier, whereas in australia and new zealand, pd patients are older and more commonly have diabetes, coronary artery disease (cad), cerebrovascular accidents, and peripheral vascular disease . On the contrary, in taiwan, no definite differences were found in age, proportion of patients with diabetes and cardiovascular disease, and severity of illness as measured by the charlson comorbidity index score between patients with hd and pd ., patient - related factors such as life - style, economic status, predialysis education level, ability to perform self - care, and the availability of familial support are major determinants . Social factors such as local cost barriers and reimbursement systems can also influence whether hd or pd is favored, which has a substantial impact on initial choice of modality . Several common points can be deduced from previous studies regarding mortality based on dialysis modality: (1) pd is associated with equivalent or better survival among non - dm patients and younger dm patients in the us, canada, and denmark; (2) the relative risk of death from pd versus hd varies with time on dialysis treatment pd is usually associated with better survival during the first 12 years, and results vary thereafter; (3) in patients with cardiac comorbidities (cad or chf), the death risk of pd patients is higher than that of hd patients [2,2123]. However, our analysis of nationwide data that included more than 32,000 patients suggested that these findings are not necessarily valid in korea . After controlling for baseline differences in demographic data and comorbidities between hd and pd patients using propensity score matching (7,049 patients for each modality), pd use was associated with a 20% higher mortality than hd use when used as the first modality . Although hemorrhagic stroke was more frequently seen in hd than pd patients, the patients on pd had 29% and 18% higher risks of non - fatal mi and of the need for target vessel re - vascularization, respectively, than patients on hd . Recent trends identified by inter - modality comparisons have indicated that, although pd use is declining, patient survival with pd as an initial modality has consistently improved in the us, canada, and europe and has become at least comparable or even superior to that of hd in recent years . Korea is not an exception regarding recent improvements in pd - related outcomes . In the korean society of nephrology (ksn)-esrd registry, there was significant improvement in long - term survival in both hd and pd patients . The five - year survival rate of hd patients improved from 52% in the 2005 report to 71% in the 2014 report, while that of pd patients greatly improved from 29% to 66% during the same period . In addition, compared to patients initiating pd therapy during 19811992, those initiating therapy during 19922005 had 32% and 35% decreases in the risk of death and technique failure, respectively . A similar trend was also observed in a more recent cohort in korea: there was significant improvement in the survival rate of incident pd patients during a relatively short interval between 2005 and 2008 . After adjusting for confounding variables, incident dialysis patients in 2008, including both hd and pd patients, had an 18% lower risk of death compared to those starting dialysis in 2005 . Furthermore, it is likely that the survival rate of pd patients improved greatly after 2008 in korea . Analysis of a prospective observational cohort of 31 korean dialysis centers with patients who started dialysis from 2008 to 2011 revealed that the crude mortality rate was 78.5 per 1,000 patient - years, and patients on pd had a 51% lower risk of death compared to those on hd . This is a significantly lower value compared with 116 per 1,000 patient - years in all korean incident esrd patients initiating dialysis from 2005 to 2008 . Although the exact reason why korean pd patients have worse outcomes is not currently clear, there are some potential explanations . First, as mentioned above, two large - scale studies based on the database from the center for medicare and medicaid services (cms) and the united states renal data system (usrds) revealed that incident esrd patients with preexisting cad or chf might not be optimal candidates for pd . Adjusted mortality risks were significantly higher in patients with cad or chf when initiating treatment with pd than with hd . These findings directly opposed the widely accepted assumption that pd may have advantages over hd in cardiovascularly compromised patients in such a way that pd enables them to maintain more stable levels of blood pressure, volume status, electrolyte balance, and uremic toxins compared to hd [2831]. In addition, other studies have also provided a basis to explain the disadvantage of pd in atherogenesis . Patients with pd had higher levels of total cholesterol, low - density lipoprotein - cholesterol, and lipoprotein(a) along with lower levels of high - density lipoprotein - cholesterol compared to those with hd . Elevated levels of sympathetic activity and asymmetric dimethylarginine (adma), a potential inducer of endothelial dysfunction, were also reported in pd patients compared to those with hd . Moreover, the chronic volume overload frequently encountered in pd patients may also create greater susceptibility to adverse cardiac remodeling than in hd patients . We also found that previous history of mi or chf has a significant interaction with dialysis modality for major adverse cardiac and cerebrovascular events (macce; defined as a composite endpoint of all - cause mortality, non - fatal acute mi, percutaneous coronary intervention, coronary artery bypass graft, and non - fatal stroke) in korean incidnet dialysis patients (fig . 1). In brief, in patients with preexisting mi and chf, pd conferred a 57% (relative risk [rr], 1.57; 95% confidence interval [ci], 1.202.05) and 25% higher (rr, 1.25; 95% ci, 1.101.42) risk, respectively, of macce than hd . There is further evidence supporting this hypothesis: the proportion of patients with chf was significanly lower in those starting pd in 2008 compared to those starting pd in 2005 (17.2% in 2005 vs. 13.6% in 2008, p = 0.008). This could be directly associated with improved patient survival among patients starting pd in 2008 compared to those starting in 2005 . Despite these evidence - based disadvantages of pd in cardiac - compromised patients, the practice pattern favoring pd over hd when choosing initial dialysis modality for such patients is still observed in korea . According to our study, the proportions of patients with preexisting mi and chf were significantly higher in pd patients than in hd patients (4.7% in pd vs. 3.3% in hd and 16.1% in pd vs. 14.3% in hd, respectively). Diabetes is another common condition associated with worse outcomes in patients on pd than in those on hd . However, the percentage of diabetic patients was not significantly lower in patients initiating dialysis with pd than in those with hd . Until 2008 in korea, pd had been more frequently or at least comparably implemented in patients who were more likely to be adversely affected by pd than hd; this may lead to adverse outcomes from pd . This is in contrast to cases in europe and the us where patients with cad, chf, and diabetes were at least evenly distributed between hd and pd or were more frequently assigned to hd than to pd . When mortality and cardiovascular morbidities were compared as a study endpoint, we adjusted for baseline cardiac conditions and diabetic status . However, this adjustment is not perfect . It is not possible to control for all factors underlying overt cardiac diseases and diabetes that are intrinsically involved in the progression of cardiovascular morbidities, which are the most important determinants of death in korean dialysis patients . Nevertheless, we do not think that all patients with cad, chf, or diabetes should avoid pd . Rather, we should identify baseline characteristics that do not increase risk or reduce risk and should refine them when those at high risk want to select pd as an initial dialysis modality . A comparison of mortality and major cardiovascular events between hd and pd among dialysis patients in korea revealed that pd was likely to be inferior to hd, with some exceptions in specific subgroups . However, this is not consistent with the results of other recent studies, and the results cannot be directly applied in practice . The discrepancy may be associated with differences in practice - patterns as well as ethnicity - related patient characteristics, potential selection bias from non - randomization, or other unmeasured factors . With further analysis, we suggest that special attention should be given to patients with dm, cad, or chf when choosing pd as the first dialysis modality . In addition, more meticulous patient care should be offered during the entire duration of dialysis in high - risk pd patients in order to reduce mortality risk.
In february 2012, a previously healthy 40-year - old man visited the academic medical center outpatient department, reporting fever, headache, sweating, and nausea . The signs and symptoms had started 1 day earlier, on the day of his return from a 1-month holiday in borneo . He reported frequent insect bites and exposure to fresh water . He had taken malaria chemoprophylaxis as recommended, and his vaccinations were up to date . Physical examination indicated that he was afebrile, was hemodynamically stable, and had a discrete macular rash on the trunk but no eschar . Laboratory results showed a hemoglobin concentration (16.8 g / dl) within reference range, a leukocyte count of 4,700 cells / mm with lymphopenia (1,090 cells / mm), and thrombocytopenia (116,000 cells / mm). C - reactive protein (42 mg / l) and serum creatinine (1.32 mg / dl) concentrations were moderately elevated . A thick smear showed no plasmodia, and a dengue antigen test result was negative . By the next day, the patient s condition had deteriorated; he was experiencing chills, his temperature was 39c, and the rash had become more pronounced . He was admitted to the hospital and given doxycycline (200 mg twice a day) for suspected rickettsiosis or leptospirosis . After admission, his condition deteriorated further; increasing dyspnea progressed to respiratory failure, necessitating intubation and admission to the intensive care unit on the second day after admission . Chest radiograph of 40-year - old man with acute respiratory distress syndrome as a complication of murine typhus . On the fourth day of intubation, cultured blood, urine, and bronchial fluid remained sterile, and test results for leptospira, legionella, influenza virus, and hiv were negative . All antimicrobial drugs except doxycycline were discontinued; doxycycline was continued for a total of 14 days . Serum collected 1 day after admission showed weakly positive igg against r. typhi; after 7 days, the immunofluorescent antibody titer had increased 4-fold (from 1:64 to> 1:256). The patient recovered completely and was doing well at his last follow - up visit . To determine prevalence of such cases, we conducted a search of published studies mentioning pulmonary manifestations of murine typhus (details in the technical appendix). From 779 records, we selected 22 cohort studies and 18 case studies that, according to title and abstract, were relevant to our research question . We differentiated between studies with individual patient data (case reports and case series) and studies without individual patient data (cohort studies). For each study, we recorded year of publication, study design, and country of infection . We also recorded the presence of pulmonary involvement, defined as cough and any mention of an abnormal finding on chest radiograph, without further distinction . An overview of study characteristics detailing prevalence of cough and chest radiograph abnormalities is provided in the technical appendix table 1 . Two studies were prospective population - based studies of the causative agent of fever of unknown origin . Specific; in 17 of these studies, patients had been recruited retrospectively from hospital databases or chart reviews . The 22 study reports that contained data on the presence or absence of cough together accounted for 1,060 patients with murine typhus . Mean prevalence (all patients from all studies combined) of cough was 30.1% (95% ci 23.336.9). Data on presence or absence of radiographic abnormalities were mentioned in 9 study reports (412). Taken together, these studies evaluated 621 patients and 104 chest radiographs showing abnormalities, leading to a prevalence rate of chest radiograph abnormalities of 16.7% (95% ci 8.2125.5). Pulmonary manifestations were also documented by the case studies . Among these studies, 2 patients had ards, 7 had bilateral pulmonary infiltrates, 5 had unilateral pulmonary infiltrates, 1 had pulmonary embolism, and 1 had respiratory failure (no chest radiograph was reported) (technical appendix table 2). We also found that cough occurred more commonly among patients in studies conducted in asia (99 [38.2%] of 259 patients) than among those in studies conducted in the mediterranean region (118 [25.8%] of 457) and north america (56 [23.3%] of 240). In the literature, we found 7 reported cases of respiratory distress associated with murine typhus (including the case reported here), 2 of which described respiratory distress not classified as ards (2,13). Of these 7 case - patients with ards / respiratory distress, 5 (71%) patients were from asia (2,3,11,13), 1 was from the mediterranean region (4), and 1 was from the united states (14). Cough and chest radiograph abnormalities were frequent manifestations of murine typhus . For cough associated with murine typhus, we found a prevalence rate of 30% . The prevalence of chest radiograph abnormalities was more difficult to ascertain because this result was less often reported and more influenced by bias . The pulmonary aspects of r. typhi infection are probably the result of damaged pulmonary microcirculation, leading to pulmonary edema . The case reported here is unusual in that the symptoms progressed rapidly and the response to doxycycline was relatively slow . It is worth noting that we found no more than 2 reported cases of fatal murine typhus associated with pulmonary system disease; both were the result of severe disease complicated by ards . Most cases of severe murine typhus with pulmonary manifestations originated in asia, and cough was more frequently a symptom among patients in asia . The primary strength of our study is the extensive literature search, which covered studies from different parts of the world and included cohort studies and case series . The main limitation of this study is the retrospective nature of the data collection for most studies, which is prone to bias and renders meaningful statistical analysis of results impossible . Therefore, prospective studies evaluating pulmonary manifestations of murine typhus and possible geographic variation are needed . Although murine typhus usually follows a benign course, severe disease with pulmonary manifestations, including ards, can occur, as described for the patient reported here . We suggest that murine typhus should be included in the differential diagnosis for any patient who has a fever and respiratory signs and who has been in a typhus - endemic area within the incubation period . Flowchart of study selection for review, table of cohort studies of murine typhus, and table of case studies detailing chest radiograph abnormalities.
Modern high - dose - rate brachytherapy (hdr - bt) of prostate cancer enables the delivery of a very high single or multiple dose of radiation to the target volume (e.g. Prostate capsule) and, at the same time, preventing the organs at risk from unnecessary radiation (e.g. Urethra and rectal wall) [13]. The 3d reconstruction of ultrasound image series is used for prospective treatment planning which is based on dose volume parameters . There are certain dose volume constraints for target coverage and dose limits in oars [4, 5]. Furthermore, there is some evidence that dose values in treated volume are dependent on different factors such as prostate volume, location of urethra and number of inserted applicators [69]. Amongst the large number of prostate cancer patients there is a group that is suitable for combined treatment of external beam radiotherapy (ebrt) and preceded or followed by hdr - bt . The feasibility and efficacy of such approach in localized prostate cancer has been already proven [4, 10, 11]. Combination of ebrt with hdr - bt boost is found to be effective and related to comparatively low incidence of side effects [4, 1113]. It was noticed during clinical practice in the department that the final outcome of consecutive hdr - bt treatment plans optimization was connected, to some extent, to e.g. Prostate volume or number of needles used for the implant . A question has been posed about the nature of this observation and whether it could be related to other prostate cancer prognostic factors . The aim of this study was to determine the relation between dose - volume parameters (in the prostate and oars) obtained from hdr - bt treatment plans and particular prostate cancer prognostic factors along with prostate volume and the number of implanted needles . In the study, high - dose - rate brachytherapy for prostate cancer was introduced to the brachytherapy department in greater poland cancer centre in july 2006 . Since that time till july 2007, the number of 190 patients (age 52 - 81, median 68 years) with localized prostate cancer (t1 - 30n0m0) has been treated with interstitial iridium-192 (i) hdr - bt (table 1). All patients were treated with combination of external beam radiotherapy . According to the institutional protocol, dose of 50 gy (dose fraction of 2 gy) was initially administered to the prostate and pelvis (in case of high risk of nodal involvement). Intensity modulated radiotherapy (imrt) or 3-dimentional conformal radiotherapy (3dcrt) techniques were used . After 2 - 4 weeks patients were admitted for 48 hour in - ward stay to be boosted with hdr - bt . To all men, dose of 15 gy boost to ctv1 (encompassed by prostate capsule) patients characteristics (n = 190) in 3 cases treated volume exceeded recommended 60 cc and achieved 81 up to 87 cc abbreviations: i - psa initial level of prostate specific antigen, ns not specified, gs gleason score swift system (nucletron) for hdr brachytherapy of prostate cancer example of hdr brachytherapy of prostate cancer (swift); templates, steel needles and connection cables visible prognostic factors such as age, staging, gleason score, initial psa level, and prostate volume (based on transrectal ultrasound examination) were assessed before the procedure . Real - time intraoperative treatment planning software (nucletron b. v., swift) was used in order to incorporate blind inverse planning optimization and is complementary to microselectron hdr remote afterloader (nucletron b. v., veenendaal, the netherlands) (fig . 2). This system enables the operator to acquire series of ultrasound images, offers real - time visualization of the needle placement, display 2d and 3d volumes for 3d planning as well as gives the opportunity to optimize a conformal treatment plan and to generate the dose volume parameters with dose volume histogram (dvh). Dose volume parameters were determined as follows: dmin (minimal dose), dmax (maximal dose), dmean (mean dose), d90 (the percentage of reference dose [dref] delivered to 90% of treated volume), v100, v150, v200 (the volume of the target receiving 100%, 150% and 200% of reference dose, respectively) for prostate; dmin, dmax, dmean, d10 (the percentage of the reference dose delivered to 10% of oar volume) and v100 for urethra and rectum (oars), respectively (fig . Treatment plan, dose volume parameters and dose volume histogram (dvh) from swift planning system as it is accepted in our department, the aim of each good quality implant is to deliver more than 90% of prescribed dose to at least 90% of target volume (d90> 90%). Dose volume limitation of oars such as urethral d10 <120% and rectal d10 <75% were taken into account during treatment plan optimization . Once the data was collected, the dose volume parameters were correlated with prognostic factors, prostate volume and number of needles used for particular implant . Firstly, prognostic factors were correlated with actual prognostic factors, followed by dose - volume parameters for the prostate, urethra and anterior rectal wall, respectively . Secondly, prostatic dose - volume parameters were correlated with dose - volume parameters for urethra and, separately, for the anterior rectal wall . All findings obtained from the calculation were taken into consideration only in case of attaining significant level of p - value <0.05 (table 3). Investigated parameters and the way of correlation prognostic factors vs. prognostic factors prognostic factors vs. prostatic dvh parameters prognostic factors vs. urethral dvh parameters prognostic factors vs. rectal dvh parameters prostatic dvh parameters vs. urethral dvh parameters prostatic dvh parameters vs. rectal dvh parameters abbreviations: dvh dose volume histogram, t tumor stage according to tnm classification, i - psa initial level of prostate specific antigen (before treatment), dmin minimal dose in treated volume, dmax maximal dose in treated volume, dm mean dose, d90 the percentage of prescribed dose delivered to 90% of treated volume, d10 the percentage of the organ at risk receiving 10% of prescribed dose; v100, v150, v200 the percentage of treated volume receiving 100, 150 and 200% of prescribed dose, respectively statistical analysis results (spearman rank correlation coefficient; significance level: p - value <0.05). Abbreviations: dvh dose volume histogram, ptv planning target volume, oar organ at risk, t tumor stage according to tnm classification, gs gleason score, i - psa initial level of prostate specific antigen (before treatment), vol volume of prostate gland assessed before treatment, nn number of needles used for implant, dmin minimal dose in treated volume, dmax dose, d90 the percentage of prescribed dose delivered to 90% of treated volume (ptv), d10 the percentage of the organ at risk receiving 10% of prescribed dose; v100, v150, v200 the percentage of treated volume receiving 100, 150 and 200% of prescribed dose, respectively; blank spaces lack of statistically significant correlation the mean value of d90 was calculated to be 13.69 gy which stands for 91.3% of dref (range 65.9 - 102.8%, median 91.8%). The mean urethral and rectal d10 was 18.27 gy = 121.8% dref (range 78.8 - 152.9%, median 122.4%) and 9.96 gy = 66.4% dref (range 37.4 - 98.1%, median 66.7%), respectively . Statistical analysis of prostate cancer prognostic factors correlated with dose - volume parameters, revealed as a set of results and pointed below . This finding can be explained with another statistically significant relation between age and decreased t stage the older the patient, the lower t stage is likely to be assessed . On the other hand, higher t stage (in relatively younger patients) the t stage is also proportional to final values of prostatic d90 and v100 . As for gleason score (gs), it was found to be directly proportional only to i - psa and inversely proportional to prostate volume, with no relation to any of dose volume parameters . As it can be derived from the above, i - psa is proved to be related to t stage and gleason score . No relation to any of dose - volume parameters was identified for i - psa . Furthermore, the larger the prostate volume and the higher t stage to be assessed, the lower gs can be determined and larger number of needles is required for implantation . Moreover, large prostate volume results in higher values of prostatic dmin, d90 and v100 and lower values of prostatic dmean and v200 . Urethral dmin, dmean and v100 are directly proportional and dmax is inversely proportional to prostatic volume . It is quite clear that the number of needles used for an implant is directly related to the prostate volume . For a particular implant, the number of 14 needles was used in average (range 7 - 18). Correlation of the number of needles with prostatic and urethral dose - volume parameters resulted in the same findings such as the prostate volume . One could notice that no relationship was found between prognostic factors and dose volume parameters for rectal wall . All the collected data were secondarily analyzed paying particular attention to correlation between dvh parameters for prostate gland and oars . As it turned out, the prostatic d90 and v100 are inversely proportional to urethral d10 and dmax and directly proportional to urethral dmin, dmean and v100 (table 4). In a real situation the better target coverage is achieved, the lower d10 and maximal dose to the urethra is delivered . In the study,, it was found to be directly proportional to urethral dmax and d10, rectal dmin, dmax, dmean, d10 and v200 . Moreover, higher values of prostatic v200 were related to lower urethral dmean and v100 . Correlation results divided into two groups of directly or inversely proportional relationships between investigated parameters abbreviations: t tumor stage according to tnm classification, i - psa initial level of prostate specific antigen (before treatment), gs gleason score, vol prostate volume, nn dose, d90 the percentage of prescribed dose delivered to 90% of treated volume, d10 the percentage of the organ at risk receiving 10% of prescribed dose; v100, v200 the percentage of treated volume receiving 100 and 200% of prescribed dose, respectively demanes et al . Reported excellent target coverage with d90 between 105% and 113% of the prescribed dose, kini et al . Some of our treatment plans were suboptimal, although the high single dose of 15 gy was prescribed to ctv1 (prostate capsule) in contrast to ctv2 (peripheral zone) [4, 15] or ctv3 (tumor volume). It appears that differences came from various descriptions of the target and the method of 100% prescribed isodose normalization . Furthermore, the data is derived from the first set of implants used in the department which is also the cause of worse results . In the first year after introducing the procedure, the implantation technique has improved, in concordance with lee et al . And merric et al . Who have reported their data about learning curve . The study results indicate that in the group of older patients one can expect relatively more difficulties in achieving good quality implants . It is due to the fact that older patients are more likely to be diagnosed with lower t stage, which results in smaller volume of the prostate . [7, 8] did not find significant correlation between the prostate volume and the number of needles implanted, but patients with 11 needles or less tended to develop higher grade genitourinary (gu) toxicity as compared with those with 12 needles or more . The gu toxicity was increased due to more inhomogenic dose distribution and hot spots as a result of small number of implanted needles . This finding corresponds with our study, which show statistically significant relationship between small numbers of implanted needles and lower prostatic dmin, d90 and v100, higher prostatic dmean and v200 as well as lower urethral dmin, dmean, v100 and higher dmax . The usage of small number of needles was intentional approach of kovcs et al . . He prescribed reference dose of 15 gy to peripheral zone of the prostate (ctv2) with critical structures covered by low - dose areas and neglecting, to some extent, the total dose covering of the prostate . Furthermore, borghede et al . Focused on the tumor volume (ctv3) that was defined within the prostate gland . As per duchesne et al ., it is essential to limit the level of v200 to 15% of the target, in order to decrease the risk of late gu morbidity . This can be achieved in relatively large prostate glands, implanted with greater number of needles; based on our study and published data [1, 2, 14]. In addition, to improve treatment plan prepared for good implant it is advisable to use anatomy - based inverse optimization tools instead of e. g. geometrical ones [5, 20, 21]. Till date, no data was found regarding minimal prostate volume that should not be implanted and the smallest number of applicators to be used without compromising dose distribution, as well as acceptable incidence of side effects and satisfactory outcome . In conclusion, statistical analysis revealed significant correlation between age, t stage, prostate volume and number of needles used for the implant and increased prostatic d90 and v100, decreased v200 . Amongst prognostic factors no relationship was found between any prognostic factor and rectal wall dvh parameters . In other words, increased prostate volume with improved d90 and larger number of implanted needles results in better target coverage (higher value of v100), better dose distribution (less hot - spots with lower value of v200) and decreased dose delivered to the urethra (lower urethral d10 and dmax). Further investigation with close follow - up should give an answer whether the above arguments corresponds with morbidity and outcome.
Dowling degos disease (ddd) is a rare autosomal dominant condition characterized by multiple, small, round pigmented macules usually arranged in reticular pattern . The lesions are chiefly distributed in axillae and groins, but other areas may be involved, including the intergluteal and inframammary folds, neck, scalp, trunk, and arms . Other features include scattered comedo - like lesions and pitted acneiform scars near the angles of the mouth . Dyschromatosis universalis hereditaria (duh) is an autosomal dominant condition characterized by hyperpigmented macules admixed with hypopigmented lesions involving the trunk, extremities, and the face . Herein we report three cases of ddd in a family with features overlapping with duh . A 65-year - old male (index case) presented with lesions over his face, trunk, and axillae since the age of 25 years . The lesions initially appeared over the face and later progressed to involve the axillae and trunk . He was accompanied by his two sons, 40 years (case 2) and 28 years (case 3) of age, who had similar lesions since 23 years of age . On examination, all the three cases had reticulate hyperpigmented macules over the neck, both axillae [figure 1] and flexural aspect of both forearms . Mottled hypopigmented macules were seen over the chest and abdomen [figure 2]. Multiple pitted scars and open comedones with few cysts were present over the back [figure 4], chest and abdomen . Hyperpigmented macules over the axilla in case 1 hypopigmented macules over the chest and abdomen in case 1 pitted scars over the perinasal and perioral area in case 1 comedones over the back in case 1 a skin biopsy performed from the index case showed elongated branched pigmented rete ridges [figure 5]. A diagnosis of ddd was arrived at based on the clinical and histopathologic findings, the atypical feature in these three cases being the presence of hypopigmented macules over the chest and abdomen . Histopathologic examination of the skin biopsy performed from the index case showing elongated branched pigmented rete ridges . Ddd is characterized by a triad of reticular pigmentation in the flexures, comedo - like lesions and pitted acneiform scars . The histology is diagnostic, with a distinct form of acanthosis, characterized by an irregular elongation of thin branching rete ridges, with concentration of melanin at the tips (antler like appearance). Follicular infundibulum may be involved and in some cases there is follicular plugging . In the present study, the association of ddd with reticulate acropigmentation of kitamura (rapk) has been earlier described in the literature . Vasudevan et al . Reported a patient having overlapping features of ddd, rapk, and reticulate acropigmentation of dohi (rapd). There patient had acral pigmentation and palmar pits resembling rapk with flexural involvement resembling ddd . They proposed that all these entities may be a part of the single pigmentary disorder . In the present study, all three cases had all features of ddd . Absence of palmar pits and acral pigmentation excluded coexistence of rapk; however, the presence of hypopigmented macules admixed with hyperpigmented macules on the trunk suggested the coexistence of duh . Wu et al . Described a family with autosomal dominant inheritance of a skin disorder with clinical features of both ddd and duh and they coined the term generalized ddd . They believed that number of previously reported cases of ddd - rapk syndrome or ddd - duh overlap may be the cases of generalized ddd . Most patients in this group have the characteristic histologic findings of epidermal atropy, elongated rete ridges, horn cyst formation, and hyperpigmented tips . The distribution may be reticulate in flexural areas (classic ddd) or generalized with hypopigmented papules (generalized ddd). Histopathology of hypopigmented area shows elongation of rete ridges, basal hypopigmentation with pigment in the tip of rete ridges . Patients may or may not have atrophic brown macules on the back of hands and feet, palmar pits, and broken epidermal ridges, the entity known as rapk . Clinically, both have hyperpigmented and hypopigmented lesions; and histopathology of hyperpigmented lesions shows basal hyperpigmentation and pigment incontinence, whereas hypopigmented lesions shows basal hypopigmentation . Although duh and dsh have similar histopathologic features, they differ from ddd group . In the present study, cases 1, 2, and 3 had lesions similar to the case described by wu et al . Galli galli disease (ggd) is the name given to a rare form of acantholytic ddd . Described a case of ggd in an indian family where 25 persons had ddd and they have been able to document a heterozygous nonsense mutation c.c10 t in exon 1 of the krt5 gene in four members of the family . All the cases described by them showed a mottled pigmentation comprising hypo- and hyperpigmented asymptomatic macules similar to our case . They pointed out that the hypopigmented lesions in the ddd spectrum has been underreported in india . A similar mutation has been described in chinese family with ddd with hypopigmented macules adjacent to the classic lesions showing histologic features of ddd . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Cardiovascular diseases (cvds) are the main causes of death worldwide, with well recognized risk factors associated with their development.1 low levels of high - density lipoprotein cholesterol (hdl - c) rank among the most common lipid abnormalities associated with cvd.2 low hdl - c is currently defined as an hdl - c value <40 mg / dl for men and <50 mg / dl for women.3 factors associated with low hdl - c include cigarette smoking,4 high triglyceride concentrations,5 a sedentary lifestyle,6 and insulin resistance.7 nonpharmacological strategies to increase hdl - c concentration include increasing alcohol and fish consumption,8,9 weight reduction,3 physical activity,10 and smoking cessation.8 some of these strategies are difficult to implement in practice . Moreover, in low - income countries, these interventions could be costly for the general population . Epidemiologic evidence indicates that a high consumption of vegetables reduces the risk of cvd,11 and particular attention has been paid to tomato - based products . Growing evidence from several epidemiological studies indicates that lycopene, the major carotenoid in tomatoes,12 might be more important than other carotenoids in preventing atherosclerosis and cvd.13,14 the consumption of more than seven servings per week of tomato - based products has been associated with a 30% reduction in the relative risk of cvd.15 such potential benefits to vascular health from a tomato - rich diet could be related to a lowering of arterial intimal wall thickness,13,16 a reduction in levels of low - density lipoprotein cholesterol (ldl - c),17 and an inverse correlation with markers of inflammation and vascular endothelial dysfunction.18 however, hdl - c levels may also be positively influenced by tomato consumption . In a pilot study, we found that tomato juice consumption did not increase hdl - c after 1 month (unpublished data); this finding has also been reported previously.19 in contrast, another study has shown that the daily consumption of 300 g of uncooked tomatoes during 1 month significantly increased hdl - c levels by 15.2%.20 however, that study was not controlled, blinded, or randomized . Roma tomato consumption could be an accessible intervention to improve hdl - c levels; however, a longitudinal clinical trial is necessary to evaluate this association . Therefore, we performed a randomized, single - blinded, controlled clinical trial to specifically evaluate whether the consumption of two uncooked tomatoes per day (14 servings a week) during 1 month could produce a favorable effect on hdl - c . Our data suggest that raw tomato consumption can increase hdl - c levels in overweight women . This study was conducted according to the guidelines in the declaration of helsinki, and all procedures involving human patients were approved by our institutional human research ethics committee (ref2039). Written informed consent was obtained from all patients after a full explanation of the purpose and nature of all procedures was provided . Between march 1, 2009 and april 30, 2011, workers and patients from the instituto nacional de ciencias mdicas y nutricin salvador zubirn were invited to participate in the study . After participants had signed the informed consent, a complete fasting lipid profile was measured in all participants . Of 432 potentially eligible subjects, 66 (15.2%) fulfilled the inclusion criteria, defined as age between 18 years and 65 years, low hdl - c level (men <40 mg / dl and women <50 mg / dl), and a normal triglyceride concentration (<150 mg / dl). Exclusion criteria included a previous diagnosis of diabetes; arterial hypertension; renal, hepatic, or cardiac insufficiency; hyperuricemia; hyperandrogenic anovulation; thyroid dysfunction (hypothyroidism or hyperthyroidism); any difficulty in swallowing; or hospitalization in the previous 6 months . Additionally, subjects taking fibrates, statins, nicotinic acid, steroids, allopurinol, hormone replacement therapy (testosterone, estrogens, or progesterone), metformin or other oral hypoglycemic agents, insulin, sibutramine, orlistat, and nonsteroidal antiinflammatory drugs were also excluded (n = 366). Furthermore, 14 individuals who fulfilled the inclusion criteria declined to participate or were unable to participate because of acute illness or difficulty in attending the study visits (figure 1). A final sample of 52 patients was randomized using a block - designed randomization system with sealed opaque envelopes for assignment . This was a longitudinal, comparative, randomized, single - blinded, controlled clinical trial . The protocol included a 2-week run - in period with prescription of an isocaloric diet (50% carbohydrates, 20% proteins, and 30% fats). After completion of the run - in period, participants were randomized to consume 300 g of raw cucumber (control group) or the same amount of uncooked tomatoes (approximately two roma tomatoes) a day . Participants were instructed to minimize changes in diet and daily habits, specifically physical activity and smoking . We used cucumber because (1) it was not possible to have a tomato placebo; (2) cucumber does not have any lycopene; (3) both can be consumed in a similar manner; and (4) the required quantity can be measured in the same way . After treatment assignment, we requested participants to avoid mentioning during clinical evaluations whether they were in the tomato or cucumber arm of the study . Clinical evaluation consisted of a complete medical history and physical examination performed by one nurse and one physician unrelated to the study . Resting blood pressure was measured in the morning by a trained nurse using a mercury sphygmomanometer and after instructing participants to remain seated at rest for at least 10 minutes . Basal daily physical activity was evaluated with a questionnaire already validated in the mexican population.21 the questionnaire quantifies the level of physical activity (kilocalories per day or in kilojoules if kilocalories are multiplied by 4.1855) over a 24-hour period as previously described.22 every subject completed three questionnaires, recording the physical activity level over 2 workdays and 1 day of the weekend . These results were analyzed, and the average kilocalories per day and kilocalories per month were obtained . Smoking was classified as (1) current in those who smoked more than one cigarette per day (low: 114; moderate: 1524; high: 25); (2) previous smoker (one or more cigarettes per day in the past); or (3) never smoked . After participants removed their shoes and upper garments, body weight was quantified with a um-026 tanita body composition analyzer (tanita corporation, tokyo, japan). All subjects were instructed to stand on the central part of the scale during weight assessment . Height was obtained to the nearest 0.5 cm using a floor scale s stadiometer with the patient standing on the central part of the scale . Body mass index (bmi) was calculated as weight (in kilograms) divided by height (in meters squared). Waist and hip circumferences were measured with patients standing with their feet together, placing their arms on their sides with the palms of their hands facing inward, and breathing out gently . Abdominal circumference was measured to the nearest 0.1 cm at the level of the greatest frontal extension of the abdomen between the bottom of the rib cage and the top of the iliac crest . In addition, nutritional evaluation consisted of three 24 hour food records for each patient at every visit . Consumption of carbohydrates, proteins, lipids, fiber, simple sugars, fish, omega-3 acids, and alcohol was calculated with standardized tables.2326 another nutritionist evaluated adherence, asking for the number of days per week that a given patient fully complied with tomato or cucumber consumption . To detect small changes in weight, physical activity, and diet throughout the study duration, the clinical and nutritional evaluations were performed every week during the 6-week study period (table s1). Glucose and lipid profiles were measured at the screening visit and again at the end of follow - up . Laboratory measurements were performed in the department of endocrinology and metabolism at the instituto nacional de ciencias mdicas y nutricin salvador zubirn using standardized procedures . Glucose was measured by the glucose oxidase method (roche diagnostics, indianapolis, in, usa); serum total cholesterol, triglycerides, hdl - c, and ldl - c levels were measured by an enzymatic method (beckman coulter, inc, brea, ca, usa). The coefficients of variation for total cholesterol and hdl - c were 3.3% and 2.5%, respectively . The sample size was calculated with the formula for means for two - tailed comparisons . According to a previous report,20 we expected an increase of at least 6 mg / dl in hdl - c after 1 month of tomato consumption . With a standard deviation of 5 mg / dl, an alpha level of 0.05, and a study power of 80%, and adding 20% for potential losses, we calculated that a total of 48 subjects (24 per group) was required . Smirnov test, were expressed as means and standard deviation, whereas variables with a skewed distribution were reported as median and interquartile range . A test, student s unpaired t - test, wilcoxon signed rank test, or mann whitney u test was used as appropriate for comparison between groups . Correlation coefficients between hdl - c and dimensional variables were evaluated in all participants and were calculated with the spearman s rho or pearson s r tests . To evaluate the effect of tomato consumption on hdl - c, we used the difference between final and basal levels (indicated as delta). A stepwise linear regression model was used to examine the impact of variables on delta hdl - c levels . The variables selected for the regression analyses were those that correlated significantly or those that are known to be associated with plasma hdl - c levels . All reported p - values were based on two - sided tests, with p 0.05 considered significant . Analyses were performed with the statistical package for the social sciences version 17.0 (spss, inc, chicago, il, usa). This study was conducted according to the guidelines in the declaration of helsinki, and all procedures involving human patients were approved by our institutional human research ethics committee (ref2039). Written informed consent was obtained from all patients after a full explanation of the purpose and nature of all procedures was provided . Between march 1, 2009 and april 30, 2011, workers and patients from the instituto nacional de ciencias mdicas y nutricin salvador zubirn were invited to participate in the study . After participants had signed the informed consent, a complete fasting lipid profile of 432 potentially eligible subjects, 66 (15.2%) fulfilled the inclusion criteria, defined as age between 18 years and 65 years, low hdl - c level (men <40 mg / dl and women <50 mg / dl), and a normal triglyceride concentration (<150 mg / dl). Exclusion criteria included a previous diagnosis of diabetes; arterial hypertension; renal, hepatic, or cardiac insufficiency; hyperuricemia; hyperandrogenic anovulation; thyroid dysfunction (hypothyroidism or hyperthyroidism); any difficulty in swallowing; or hospitalization in the previous 6 months . Additionally, subjects taking fibrates, statins, nicotinic acid, steroids, allopurinol, hormone replacement therapy (testosterone, estrogens, or progesterone), metformin or other oral hypoglycemic agents, insulin, sibutramine, orlistat, and nonsteroidal antiinflammatory drugs were also excluded (n = 366). Furthermore, 14 individuals who fulfilled the inclusion criteria declined to participate or were unable to participate because of acute illness or difficulty in attending the study visits (figure 1). A final sample of 52 patients was randomized using a block - designed randomization system with sealed opaque envelopes for assignment . This was a longitudinal, comparative, randomized, single - blinded, controlled clinical trial . The protocol included a 2-week run - in period with prescription of an isocaloric diet (50% carbohydrates, 20% proteins, and 30% fats). After completion of the run - in period, participants were randomized to consume 300 g of raw cucumber (control group) or the same amount of uncooked tomatoes (approximately two roma tomatoes) a day . Participants were instructed to minimize changes in diet and daily habits, specifically physical activity and smoking . We used cucumber because (1) it was not possible to have a tomato placebo; (2) cucumber does not have any lycopene; (3) both can be consumed in a similar manner; and (4) the required quantity can be measured in the same way . After treatment assignment, we requested participants to avoid mentioning during clinical evaluations whether they were in the tomato or cucumber arm of the study . Clinical evaluation consisted of a complete medical history and physical examination performed by one nurse and one physician unrelated to the study . Resting blood pressure was measured in the morning by a trained nurse using a mercury sphygmomanometer and after instructing participants to remain seated at rest for at least 10 minutes . Basal daily physical activity was evaluated with a questionnaire already validated in the mexican population.21 the questionnaire quantifies the level of physical activity (kilocalories per day or in kilojoules if kilocalories are multiplied by 4.1855) over a 24-hour period as previously described.22 every subject completed three questionnaires, recording the physical activity level over 2 workdays and 1 day of the weekend . These results were analyzed, and the average kilocalories per day and kilocalories per month were obtained . Smoking was classified as (1) current in those who smoked more than one cigarette per day (low: 114; moderate: 1524; high: 25); (2) previous smoker (one or more cigarettes per day in the past); or (3) never smoked . The anthropometric measurements were performed by a nutritionist blinded to the participant s intervention . After participants removed their shoes and upper garments, body weight was quantified with a um-026 tanita body composition analyzer (tanita corporation, tokyo, japan). All subjects were instructed to stand on the central part of the scale during weight assessment . Height was obtained to the nearest 0.5 cm using a floor scale s stadiometer with the patient standing on the central part of the scale . Body mass index (bmi) was calculated as weight (in kilograms) divided by height (in meters squared). Waist and hip circumferences were measured with patients standing with their feet together, placing their arms on their sides with the palms of their hands facing inward, and breathing out gently . Abdominal circumference was measured to the nearest 0.1 cm at the level of the greatest frontal extension of the abdomen between the bottom of the rib cage and the top of the iliac crest . In addition, nutritional evaluation consisted of three 24 hour food records for each patient at every visit . Consumption of carbohydrates, proteins, lipids, fiber, simple sugars, fish, omega-3 acids, and alcohol was calculated with standardized tables.2326 another nutritionist evaluated adherence, asking for the number of days per week that a given patient fully complied with tomato or cucumber consumption . Adherence was reinforced in every visit . To detect small changes in weight, physical activity, and diet throughout the study duration, the clinical and nutritional evaluations were performed every week during the 6-week study period (table s1). Glucose and lipid profiles were measured at the screening visit and again at the end of follow - up . Laboratory measurements were performed in the department of endocrinology and metabolism at the instituto nacional de ciencias mdicas y nutricin salvador zubirn using standardized procedures . Glucose was measured by the glucose oxidase method (roche diagnostics, indianapolis, in, usa); serum total cholesterol, triglycerides, hdl - c, and ldl - c levels were measured by an enzymatic method (beckman coulter, inc, brea, ca, usa). The coefficients of variation for total cholesterol and hdl - c were 3.3% and 2.5%, respectively . The sample size was calculated with the formula for means for two - tailed comparisons . According to a previous report,20 we expected an increase of at least 6 mg / dl in hdl - c after 1 month of tomato consumption . With a standard deviation of 5 mg / dl, an alpha level of 0.05, and a study power of 80%, and adding 20% for potential losses, we calculated that a total of 48 subjects (24 per group) was required . Smirnov test, were expressed as means and standard deviation, whereas variables with a skewed distribution were reported as median and interquartile range . A test, student s unpaired t - test, wilcoxon signed rank test, or mann whitney u test was used as appropriate for comparison between groups . Correlation coefficients between hdl - c and dimensional variables were evaluated in all participants and were calculated with the spearman s rho or pearson s r tests . To evaluate the effect of tomato consumption on hdl - c, we used the difference between final and basal levels (indicated as delta). A stepwise linear regression model was used to examine the impact of variables on delta hdl - c levels . The variables selected for the regression analyses were those that correlated significantly or those that are known to be associated with plasma hdl - c levels . All reported p - values were based on two - sided tests, with p 0.05 considered significant . Analyses were performed with the statistical package for the social sciences version 17.0 (spss, inc, chicago, il, usa). A total of 52 subjects were included in the study . They were randomized to receive tomato (n = 26) or cucumber (n = 26). Two patients were eliminated after 1 week of follow - up (for gastric intolerance and poor study compliance). Both requested to be excluded from the study . The mean adherence per month was 27.6 1.9 days and 27.5 2.0 days in the tomato and cucumber groups, respectively (p = 0.90). A total of 47 (94%) of the subjects declared that they had followed the assigned intervention for 25 days during the month of follow - up (table 1). There were no significant differences between groups with respect to age (p = 0.49) or bmi (p = 0.64). We only identified a significantly higher consumption of omega-3 fatty acids in the tomato group (p = 0.02). During the study, table 2 shows the effect of tomato consumption on lipid profile and anthropometric measurements of the subjects categorized by group and gender . Baseline values of hdl - c (36.5 7.5 mg / dl versus 36.8 7.2 mg / dl, p = 0.83) and triglyceride levels (113.4 46.4 mg / dl versus 108.5 36.9 mg / dl, p = 0.54) were similar between groups . Additionally, at baseline, serum triglycerides (p = 0.77), total cholesterol (p = 0.82), and ldl - c (p = 0.37) were not different between groups (table 2). After 1 month of intervention, a significant increment of hdl - c levels from 36.5 7.5 mg / dl to 41.6 6.96 mg / dl (p <0.0001) was observed in the group assigned to tomato consumption (table 2). The mean increment of hdl - c was 5.0 2.8 mg / dl (range 112 mg / dl). Levels of triglycerides, ldl - c, and total cholesterol did not change significantly . Adherence correlated positively with the hdl - c increment in the tomato group (r = 0.34, p = 0.01). This association was not identified with cucumber consumption (r = 0.08, p = 0.71; figure 2). Figure 3 shows the change in hdl - c levels according to days of adherence (figure 3a) and in every case studied (figure 3b). To identify independent factors related to the change in hdl - c, we performed a linear regression model using the delta (final - basal) hdl - c level as the dependent variable, adjusted for those variables that could change hdl - c (table 3). Results showed that tomato consumption (= 5.79, 95% confidence interval [ci] 3.997.59; p <0.0001) and days of adherence (= 0.61, 95% ci 0.12 - 1.11; p = 0.01) were independently and significantly associated with the increment in hdl - c levels (f = 5.20; r = 0.83; r = 0.69; p <0.0001). There were no significant differences between groups with respect to age (p = 0.49) or bmi (p = 0.64). We only identified a significantly higher consumption of omega-3 fatty acids in the tomato group (p = 0.02). During the study, table 2 shows the effect of tomato consumption on lipid profile and anthropometric measurements of the subjects categorized by group and gender . Baseline values of hdl - c (36.5 7.5 mg / dl versus 36.8 7.2 mg / dl, p = 0.83) and triglyceride levels (113.4 46.4 mg / dl versus 108.5 36.9 mg / dl, p = 0.54) were similar between groups . Additionally, at baseline, serum triglycerides (p = 0.77), total cholesterol (p = 0.82), and ldl - c (p = 0.37) were not different between groups (table 2). After 1 month of intervention, a significant increment of hdl - c levels from 36.5 7.5 mg / dl to 41.6 6.96 mg / dl (p <0.0001) was observed in the group assigned to tomato consumption (table 2). The mean increment of hdl - c was 5.0 2.8 mg / dl (range 112 mg / dl). Levels of triglycerides, ldl - c, and total cholesterol did not change significantly . Adherence correlated positively with the hdl - c increment in the tomato group (r = 0.34, p = 0.01). This association was not identified with cucumber consumption (r = 0.08, p = 0.71; figure 2). Figure 3 shows the change in hdl - c levels according to days of adherence (figure 3a) and in every case studied (figure 3b). To identify independent factors related to the change in hdl - c, we performed a linear regression model using the delta (final - basal) hdl - c level as the dependent variable, adjusted for those variables that could change hdl - c (table 3). Results showed that tomato consumption (= 5.79, 95% confidence interval [ci] 3.997.59; p <0.0001) and days of adherence (= 0.61, 95% ci 0.12 - 1.11; p = 0.01) were independently and significantly associated with the increment in hdl - c levels (f = 5.20; r = 0.83; r = 0.69; p <0.0001). The occidental diet is usually composed of high - glycemic - index and high - fat foods and has been associated with the development of chronic diseases, including cvds, cancer, and diabetes.27 in contrast, the consumption of tomato - based food sources along with fresh fruit, vegetables, and olive oil is common in a mediterranean dietary pattern and provides a variety of nutrients with potential cardiovascular benefits.28 however, investigation regarding the association between tomato - based food intake and cvd risk has demonstrated contradictory results . Previous studies have focused on carotenoids, including lycopene, and their association with either atherosclerosis, different cvd subtypes, or multiple cardiovascular risk factors.2832 ascherio et al33 reported no association between dietary lycopene and stroke in a large cohort of healthy male professionals . In contrast, karppi et al34 recently reported a 59% lower risk of ischemic stroke associated with tomato consumption . These inconsistent results may be explained by the following: (1) the considerable variation in the estimation of lycopene intake depending on the assessment tools used;12 (2) differing absorption, probably because carotenoids are tightly bound to macromolecules in foods, and therefore, their absorption may vary;35 (3) differing availability of lycopene, because this depends on the processing and treatment of the food containing the carotenoid and on the fat content of the meal in which lycopene is consumed;12 or (4) because some studies analyze the effect of different sources of dietary tomato in combination, including both healthy and unhealthy foods (for example, pizza, tomato juice, and fresh tomatoes).19,32 furthermore, the relationship between the estimated intake and serum lycopene levels is very poor, with pearson s correlation coefficients between 0.1 and 0.3.35,36 for example, one study reported a low correlation between dietary lycopene levels and plasma lycopene levels . Despite this fact, the authors confirmed a 30% reduction in the relative risk of cvd.15 with this information in mind, we aimed to evaluate the change in hdl - c after 1 month of adding two roma tomatoes daily to the participants regular diet . This intervention was planned to reduce the variability of a tomato - based diet using only fresh uncooked tomatoes . We used uncooked tomato because in a pilot study, we did not identify any significant change in hdl - c using additional methods of preparation (cooked, juiced, or in sauce), a finding that has been reported previously.19 in contrast, an uncontrolled, nonrandomized prospective study reported that the daily consumption of 300 g of uncooked tomatoes for 1 month significantly increased hdl - c levels by 15.2%.20 after taking into consideration other variables that could increase hdl - c, the beta value in the linear regression model analysis indicated that we could expect a mean increment of 5.79 mg / dl in hdl - c after the consumption of two daily roma tomatoes over a 1-month period . The increment in hdl - c levels was independent of these and other parameters that are known to modify the circulating hdl - c concentration (table 3). Furthermore, the increment in hdl - c levels in the group allocated to tomato consumption showed a direct relationship with compliance . Although mean alcohol, fish, and omega-3 fatty acid consumption was higher in the tomato group at follow - up, these differences were not significant (table 1). The randomized and blinded design of our clinical study suggests that this variation was by chance, and the regression analysis results strongly suggest that the increment in hdl - c was mainly attributable to fresh tomato consumption . Although the increase in hdl - c was not significant in men, a statistical trend was seen (p = 0.06). We therefore conclude that overweight women can benefit from daily fresh tomato consumption . To the best of our knowledge, this is the first clinical trial that specifically evaluates the impact of fresh tomato consumption on hdl - c levels . According to our results, an intake of 14 servings of fresh tomato per week may have a similar positive impact (increment between 3.9 mg / dl and 7.5 mg / dl; table 3) on hdl - c as physical activity (3.03.5 mg / dl), but a smaller effect than alcohol consumption (9.013.1 mg / dl) or smoking cessation (9.9 mg / dl).8 nevertheless, consumption of uncooked tomato could be recommended as an additional strategy to increase hdl - c levels . The advantage of fresh tomato consumption is the fact that tomato is available worldwide, and in low - income countries, it may be an additional affordable strategy for populations with low hdl - c levels . The underlying mechanism of the increase in hdl - c with raw tomato may or may not be related to lycopene . Fuhrman et al37 showed that 60 mg of lycopene per day for 3 months in six men (approximately equivalent to the amount of lycopene in 1 kg of tomatoes) caused a 14% reduction in plasma ldl - c with no significant change in hdl - c . However, only a small sample of patients was analyzed, not necessarily with enough statistical power to show a difference in hdl - c after the intervention . Recently, lycopene has been shown to yield improvement in hdl - c functionality, with increases in hdl - c subtypes 2 and 3 after a lycopene - rich diet and supplements . The activity of cholesteryl ester transfer protein decreased and the activity of lecithin cholesterol acyltransferase increased in the serum of overweight, middle - aged individuals.38 although the bioavailability of lycopene is higher after tomatoes are processed, for example, as a paste, and less bioavailability is seen with raw tomato,39,40 the results of a study by mceneny et al38 suggest that the benefit of raw tomato consumption in serum hdl - c levels reported here could be explained by regulation of the activity of key enzymes in hdl - c metabolism and could also be associated with the improvement in hdl - c functionality after lycopene consumption . Nevertheless, we cannot confirm this hypothesis in the present study, and we cannot rule out the possible role of other unidentified nutrients or beta - carotenes . Although we showed a significant elevation of hdl - c levels after 1 month of tomato consumption, only two women normalized their level to 50 mg / dl or more, and no men achieved normal levels (40 mg / dl). However, 20 patients (40%) finished the study with levels> 40 mg / dl . Studies have shown that increasing the concentration of hdl - c can slow and even reverse the progression of coronary atherosclerosis and can reduce cardiovascular risk in the majority of people with dyslipidemia even if normalization has not been achieved.41 however, it is necessary to assess whether the consumption of tomatoes for longer periods of time or at higher daily amounts can normalize hdl - c levels in a greater proportion of patients . Future prospective studies should evaluate the impact of fresh tomato consumption on different cardiovascular risk factors and outcomes . The main limitation of the present study is that we cannot describe the mechanism of how fresh tomato consumption increases hdl - c . Second, we evaluated compliance subjectively; however, participants in both groups reported similar adherence to blinded researchers . Also, the number of male patients studied was small, which may explain the lack of significant associations . Another limitation is the fact that we cannot completely rule out the influence of other nutrients, foods, or cointerventions by participants, and this may provide alternative explanations for our findings . However, the randomized and longitudinal design of our study, the absence of loss to follow - up, and the fact that we adjusted the analyses for the main confounding factors that influence hdl - c levels suggest that the increment in hdl - c was caused by the increase in tomato consumption . An additional strength of the study design is that we evaluated patients without hypertriglyceridemia, and patients without treatments that may influence hdl levels . In conclusion, raw tomato consumption (14 servings a week for 1 month) showed a favorable effect on hdl - c levels in overweight women . Clinical and nutritional characteristics of the population studied throughout the study notes: data represent the mean sd . Abbreviations: n, number of subjects; bmi, body mass index; wc, waist circumference; hc, hip circumference; sbp, systolic blood pressure; dbp, diastolic blood pressure; sd, standard deviation.
World health organization estimates that one million serious unintentional poisonings occur every year and an additional two million people are hospitalized for suicide attempts with pesticides . India is a predominantly agrarian country where pesticides are routinely used for farming . According to data available from national poison information centre india, suicidal poisoning with house - hold agents (ops, carbamates, pyrethrinoids, etc .) Recent data from national crime bureau of india shows suicide by consumption of pesticides account for 19.4% and 19.7% of all cases of suicidal poisoning in the year 2006 and 2007 respectively . Op compounds inhibit acetylcholinesterase resulting in accumulation of acetylcholine (ach) and overstimulation of cholinergic synapses . Patients die mostly from respiratory failure and lung injury, although there is variability in the clinical symptoms and signs depending on nature of compounds, amount consumed, severity, time gap between exposure, and presentation in the hospital . Common clinical features of op poisoning include the following: respiratory: increased bronchial secretions, bronchospasm, chest tightness, dyspnoea, cough eyes: blurred vision, conjunctival injection, dimness of vision, miosis gastrointestinal: cramping, diarrhea, nausea, vomiting urinary: incontinence cardiovascular: bradycardia, hypotension exocrine glands: hyperamylesia, increased salivation muscle fasciculation, cramping, weakness, diaphragmatic paralysis, respiratory failure, tachycardia, hypertension . Thus we can appreciate that a patient with op poisoning presents with a variety of signs and symptoms . In india, unconscious patients are often brought by their relatives and neighbors who are unable to provide correct information regarding the nature of the particular poison to which the patient was exposed . In such cases the diagnosis of op poisoning is based on clinical features as observed by the treating physicians . The clinical features also help to determine the severity of poisoning which is of prognostic importance . A literature search was conducted which consisted of a medical literature analysis and retrieval system online (medline) database search (accessed on 16.4.2009) and a world wide web search (search engine: google, accessed on 16.4.2009) using the following keywords: organophosphorus poisoning, clinico - epimiological features, study . The search revealed that only a few studies have considered the clinical and epidemiological features of op poisoning. [611] our study was conducted in this backdrop to explore the clinical features and epidemiological characteristics of patients presenting with op poisoning . Respiratory: increased bronchial secretions, bronchospasm, chest tightness, dyspnoea, cough eyes: blurred vision, conjunctival injection, dimness of vision, miosis gastrointestinal: cramping, diarrhea, nausea, vomiting urinary: incontinence cardiovascular: bradycardia, hypotension exocrine glands: hyperamylesia, increased salivation muscle fasciculation, cramping, weakness, diaphragmatic paralysis, respiratory failure, tachycardia, hypertension . Thus we can appreciate that a patient with op poisoning presents with a variety of signs and symptoms . In india, unconscious patients are often brought by their relatives and neighbors who are unable to provide correct information regarding the nature of the particular poison to which the patient was exposed . In such cases the diagnosis of op poisoning is based on clinical features as observed by the treating physicians . The clinical features also help to determine the severity of poisoning which is of prognostic importance . A literature search was conducted which consisted of a medical literature analysis and retrieval system online (medline) database search (accessed on 16.4.2009) and a world wide web search (search engine: google, accessed on 16.4.2009) using the following keywords: organophosphorus poisoning, clinico - epimiological features, study . The search revealed that only a few studies have considered the clinical and epidemiological features of op poisoning. [611] our study was conducted in this backdrop to explore the clinical features and epidemiological characteristics of patients presenting with op poisoning . The study was conducted in a tertiary care medical college and hospital in west bengal, india . All consecutive patients presenting in the emergency department of the hospital with history and clinical evidence of op poisoning during the study period were considered eligible for participation in the study . Patients attending the emergency department with history of exposure to op compounds were initially evaluated and resuscitated for maintaining airway, breathing, and circulation . Informed consent was obtained from eligible patients / legally authorized representatives (if the patient was unconscious). After completing the medicolegal formalities careful history was taken from the patients / legally authorized representatives (in case the patient was unconscious) following which clinical examination was carried out to determine the common clinical features of op poisoning . Data collected were analyzed in computer by using the statistical package for social sciences (spss) program version 10 . Data analysis was done by using descriptive and inferential statistical methods: frequency, percentage, means, standard deviation (s.d . ). A two - tailed p - value less than 0.05 was considered to be statistically significant . The study was conducted in a tertiary care medical college and hospital in west bengal, india . All consecutive patients presenting in the emergency department of the hospital with history and clinical evidence of op poisoning during the study period were considered eligible for participation in the study . Patients attending the emergency department with history of exposure to op compounds were initially evaluated and resuscitated for maintaining airway, breathing, and circulation . Informed consent was obtained from eligible patients / legally authorized representatives (if the patient was unconscious). After completing the medicolegal formalities careful history was taken from the patients / legally authorized representatives (in case the patient was unconscious) following which clinical examination was carried out to determine the common clinical features of op poisoning . Data collected were analyzed in computer by using the statistical package for social sciences (spss) program version 10 . Data analysis was done by using descriptive and inferential statistical methods: frequency, percentage, means, standard deviation (s.d . ). A two - tailed p - value less than 0.05 was considered to be statistically significant . A total of 968 patients presented in the emergency department of the institute during the study period with the clinical features of op poisoning . Mean age of the persons presenting in the emergency with clinical features of op poisoning is 34.47 years (means.d . : poisoning with suicidal intent was more common (82.02%) than the accidental one (17.98%) (p - value <0.0001). Majority of the patients were housewives (42%) followed by farmers (33.99%), shopkeepers (9.93%), laborers (8.14%), students (6.2%). The mean interval between poison consumption and admission to hospital was 4.4 hours (means.d . : 4.42.29). Regarding the type of poison consumed by the patient, methyl parathion was the most common poison consumed by the patients (35.74%) followed by diazinon (28.62%), chlorpyriphos (19.52%), dimicron (16.12%). The signs and symptoms with which the patients presented are enumerated in table 2 . In the present study, nausea and vomiting is the most common symptom reported by 85.02% of patients followed by abdominal cramps (47.93%), while miosis is the most common sign observed in 91.94% patients . Following admission, a total of 56 (5.78%) patients died during their hospital stay . Respiratory failure was the primary cause of death in 21 patients (37.5%) followed by cns depression (33.92%), cardiac arrest (21.44%), and septicemia (7.14%). Baseline demographic parameter of the patients of op poisoning (n=968) clinical features of patients suffering from op poisoning at presentation in the present study, majority of the patients belonged to the young age group (means.d . : females show a clear preponderance over male with a male (m): female (f) ratio of 1:1.38 . This finding is in agreement with studies conducted in turkey (m: f=1:1.47), nepal (m: f=1:2). However, in the study conducted in chennai by shivaprasad et al ., (2001), male patients (74%) outnumbered female (26%). Majority of the affected patients in our study are housewives (42%) which is at par with the study conducted in turkey (housewives 47.3% of total sample). In the present study, poisoning with suicidal intent was more common (82.02%) than the accidental one (p - value <0.0001). This is in congruence with studies conducted in nepal, turkey, gulbarga where poisoning with suicidal intent accounts for 95.24%, 75.9%, and 97.25% of total cases of op poisoning respectively . The mean interval between poison consumption and admission to the hospital was 4.4 hours (means.d . : 4.4 2.29). In studies conducted at chennai, maximum patients (89.69%) presented within 6 hours . Regarding the type of poison consumed by the patient, methyl parathion was the most common poison (35.74%) followed by diazinon, chlorpyriphos, dimicron ., carbamates however, in a study conducted in turkey, dichlorvos was the most common one . This variation in the type of poison consumed can be attributed to the regional availability of pesticides in different countries . Clinical presentation depends on the specific op involved, the quantity absorbed, and the type of exposure . In our study nausea and vomiting was the most common symptom (85.02%) while miosis (91.94%) was the most common sign . A comparison between the clinical features as observed in our study with earlier studies has been listed in table 3 . The mortality rate in our study was 5.78% which is comparable to the study done in turkey (9.1%). The present study showed that majority of the patients were of young age with females outnumbering males . Poisoning with suicidal intent was more common than accidental . Nausea and vomiting was the most common symptom reported by the patients while miosis was the most common sign observed by the treating physicians of the research team.
If this deficiency is not identified and correctly treated in time, it can eventually become more severe and induce a significant increase in the morbidity / mortality rate with a subsequent increase in the length of the hospital stay [2, 3]. Currently, few studies allow us to evaluate the effects upon these parameters, of appropriate nutritional support during hospital stay [4, 5]. This is partly due to the fact that in nonspecialized departments, without an experienced nutritional team, the nutritional prescriptions usually remain poorly adapted . The aim of the study was to determine the current practices of nutritional support among hospitalized patients in nonspecialized hospital departments . Two departments were selected at the chu of marseille: gastroenterology and visceral surgery . During a 2-month observation period, a gastroenterologist and a visceral surgeon were, respectively, assigned to each department, both nonspecialists in the field of nutrition, and they prescribed nutritional support according to their usual criteria to patients in whom nutritional support seemed to be indicated / necessary . Initially, the doctors recorded the weight and the loss of weight (normal, mild, or severe malnutrition). Digestive pathology and treatment (type of surgery) malnutrition treatment (enteral or parenteral nutrition, nutritional assistance) and nutritional cocktails data (volume, calories, calorie - nitrogen ratio, glucose - lipid ratio, nitrogen, and electrolytes) were equally recorded . Once the weight, height, and loss of weight expressed as a% of usual weight related to the duration of weight loss were registered, the body mass index was automatically obtained allowing for the calculation of the nutritional risk index and subsequently the risk of malnutrition . According to these data, the software was able to calculate the patient's level of energetic needs (total energy expenditure, calculated from resting energy expenditure, resulting from harris and benedict formula, corrected by a coefficient ranging from 1.2 to 2, according to the activity of the patient and severity of the disease). The needs water, electrolytes, vitamins, and trace elements were finally completed . The software, designed according to the recent proposals of the agence nationale d'accrditation et d'evaluation en sant and within the programme national nutrition et sant [26], was used to determine prescription proposition with an appropriate nutritional mixture / product . Having recorded the data, the software proposed the evaluation of the nutritional status of the patient and the doctor was asked to follow the indications of the algorithm . Severely malnourished patients were defined by patients who cannot take a diet covering at least 60% of their nutritional needs within 1 week after surgery; patients with an early postoperative complication (sepsis, respiratory, or renal insufficiency, acute fistula, acute pancreatitis). According to the results of the nri, the software proposed, in cases of mild malnutrition, to seek the advice of a specialized nutritional team in order to prescribe nutritional complements or a balanced diet . In cases of severe malnutrition, the software proposed, depending on the functional state of the gastrointestinal tract, enteral nutrition or parenteral nutritional support or total parenteral nutrition . After 5 minutes necessary to complete the process, the software proposed the most appropriate nutritional mixture according to the patient's needs . Finally, the software allowed the doctor either to conserve his initial evaluation (nutritional assessment, strategy of nutritional support, and nutritional mixture) or to modify some or all of the parameters . A variation of more than 20% from the calculated ideal values for any component of the nutritional mixture was systematically announced by a visual signal . Eighty six point seven% of them were hospitalized in the visceral surgery department and 14% in the medical gastroenterological department; 3.3% of the patients needed radiochemotherapy . Nutritional support was needed for surgical procedures in 55% of the cases; in 14% the diseases affecting the gi tract implied extended lesions (malabsorption, crohn's disease, and chronic intestinal pseudo - obstruction) and short bowel syndrome in 5% of cases and 26% of the cases were uncategorized . According to the software data, 100% of the patients selected demonstrated severe malnutrition . In 38.3% of these cases the initial diagnosis given by doctors was in agreement / consistent with that proposed by the software; in 38.3% of cases the doctors detected moderate malnutrition and in 23.4% of cases an absence of malnutrition . In 57.5% of cases the doctors maintained their initial diagnosis; the propositions offered by the software were adopted in 42.5% of cases . The modalities / types of nutritional support, including enteral or parenteral assistance or total parenteral nutrition, proposed by the doctors were similar to those of the software in 79.2% of cases; the initial personal decisions of the doctors were unchanged in 16.7% of cases; those of the software were taken into account in 4.1% of cases . The doctors' prescriptions of nutritional mixtures / cocktail were matching those proposed by the software in 17.5% of cases; those of the software were taken into account in 50.8% of cases; initial personal prescriptions were unchanged in 31.7% of cases . When subgroups of patients were considered, in cancer patients, software and doctors agreed in the nutritional status assessment in 38.3% of cases, in modalities of nutritional support in 80% of cases, and in composition of nutritional mixture in 15% of cases; in noncancer patients, accordance was successive and in the same order as 36.7%, 78.3%, and 21.7% of cases . Strategic decisions of nutritional support are obviously randomly taken in university hospitals in spite of the fact that doctors routinely treat malnourished patients with severe diseases . Nevertheless, even if malnutrition was misevaluated by doctors in more than 2/3 of cases, the need for nutritional support was confirmed by the software in 100% of cases . However, the strategy of nutritional support proposed by the doctors was adequate in nearly 80% of cases while nutritional mixture prescriptions were adequate in almost 15% of cases . In spite of an obvious inconsistency within the global strategy of nutritional support and inaccuracies in malnutrition assessment leading to inadequate prescriptions of nutritional mixtures, in most of the cases, doctors were able to correctly indicate the nutritional strategy . On the other hand, the fact that doctors modified their initial nutritional mixture prescription according to that proposed by software while they maintained their initial diagnosis and strategies in almost 4% of the cases seems to be a reassuring argument . This reveals that doctors might be aware of their lack of training on nutritional topics . This leads to the conclusions that either doctors need specialized training in nutrition or interventional teams could intercede with supposed malnourished patients . The proposed software, leading to appropriate therapeutic decisions in most of the cases, could resolve these difficulties . In fact, the use of the proposed software could contribute to optimizing the strategy of nutritional support in hospitalized patients and subsequently reduce postoperative complications and mortality rates and duration of hospital stay . This needs to be demonstrated by further prospective studies using the software, which would allow for standardized prescriptions . Furthermore, beyond the medical and economic consequences, the training capacities of the software for practitioners could be a supplementary argument for its systematic use in hospitalized patients . Several algorithms of decisions, namely, the programme national nutrition et sant, malnutrition universal screening tool, and nutritional risk index, have been proposed in the strategy of nutritional support . None of these algorithms led to a rational proposal of the adequate nutritional mixture consistent with all the parameters characterizing the patients . The proposed software could be considered as a new step in rationalization and optimization of nutritional strategies in hospitalized patients, in reference to the current knowledge in this field . In all hospital departments, computerized systems that systematically detect malnutrition in hospitalized patients could offer the possibility of adequate nutritional support together with corresponding statistical and prospective studies . Regarding its frequency and its medical and economic consequences, malnutrition in hospitalized patients has been the object of numerous studies . Nevertheless, in 2012, malnutrition often remains unknown / misdiagnosed in hospitalized patients and subsequently undertreated if not untreated . This could be prevented by adequate nutritional support strategies, coming from modern techniques, including computerized programs.
Cytauxzoon felis is a tick - transmitted protozoan parasite that can cause cytauxzoonosis in wild and domestic felids . Cytauxzoonosis in domestic cats has been reported throughout central, south - eastern and south - central usa . Oklahoma is considered enzootic for c felis and iowa (ia) is a non - enzootic state but borders other enzootic states . Domestic cats infected with c felis often show severe, acute clinical signs characterized by fever, inappetence, anorexia, dyspnea and icterus . Onset of disease typically occurs 1014 days after c felis - infected ticks feed on naive cats and progresses quickly, with fatalities reported 17 days after onset of clinical signs . A recent study demonstrated 60% survival in c felis - infected cats that received a combination therapy of azithromycin and atovaquone with supportive care . A free - roaming cat is a domestic cat that has been born and raised without or limited contact to humans and is unsocialized . As free - roaming cats live outdoors and are exposed to ticks, they are favorable populations in which to examine and monitor the distribution and range of cytauxzoonosis . Our objective was to determine the prevalence of c felis infections in free - roaming cats in enzootic north - central oklahoma (ok) and non - enzootic central ia . Blood samples were collected from free - roaming cats in stillwater, ok, and ames, ia, as part of community trap cats were trapped mainly in north - central ok and in central ia . In ok, all cats were sedated with a mixture of tiletamine hydrochloride and zolazepam hydrochloride (telazol; zoetis), ketamine hydrochloride (ketamine; putney) and xylazine (anased; akorn). In ia, a mixture of ketamine hydrochloride (ketamine; putney), dexmedetomidine hydrochloride (precedex; orion pharma), buprenorphine (simbadol; zoetis) and butorphanol tartrate (torbugesic - sa; zoetis) was used for sedation in 20122013 . In 2014, butorphanol tartrate (torbugesic - sa; zoetis) was added to the mixture but only for fractious cats . The approximate ages of cats were determined based on dentition, and cats that were 46 months or older were selected for blood collection to increase the chance of finding c felis - infected cats . Cats were placed in dorsal recumbency, fur around the neck was clipped and 70% isopropyl was sprayed in the area . Approximately 1 ml blood was collected from the jugular vein and was immediately placed in an edta collection tube . Genomic dna was extracted from peripheral whole blood samples using genejet whole blood dna purification mini kit (thermo scientific). Briefly, 200 l whole blood was mixed with 20 l proteinase k solution and 400 l lysis solution . After incubating the sample at 56c for 10 mins, the prepared mixture was transferred to the spin column and centrifuged for 1 min at 6000 g (~8000 rpm). The column was then washed with 500 l wash buffer i and centrifuged again for 1 min at 8000 g (~10,000 rpm). The column was then washed with wash buffer ii and centrifuged for 3 mins at 20,000 g (14,000 rpm). Dna was extracted with 200 l preheated (approximately 56c) pcr - quality water added to the center of the column membrane to elute genomic dna . The sample was incubated for 2 mins at room temperature and centrifuged for 1 min at 8000 g (~10,000 rpm). A conventional pcr was performed to amplify the c felis small subunit rrna (ssu - rrna). Cycling conditions of nested pcr were as follows: denaturation at 95c for 5 mins, annealing at 54c for 1 min and extension at 72c for 1 min . Pcr products were separated on 1.75% agarose gel and viewed with ultraviolet light . Positive control templates consisted of dna extracted from whole blood of a cat that died from an infection of c felis, whereas negative control reactions used dna isolated from purified water . Pcr products were purified using a qiaquick pcr purification kit (qiagen) and amplicons were sequenced by eurofin genomics (huntsville, al). Ninety - five percent confidence intervals (cis) were calculated according to sterne s exact method, using quantitative parasitology 3.0 . A total of 380 blood samples were collected from january to may 2014 in ok . Three of 380 (0.8%; 95% ci 0.222.3%) samples showed approximately 250 bp bands, which were targeted product size for c felis . Blast comparison of these three sequences showed 100% identity to c felis (eg, l19080, ay531524, ay679105, af399930, gu903911). All c felis - infected cats were male and older than 12 months of age . Two infected cats were from stillwater, ok, and caught separately in march and april respectively . One c felis - infected cat originated from drumright, ok, in march (figure 1). A total of 292 blood samples were collected from august 2012 to april 2014 in ia . Neuter return (tnr) programs were conducted in stillwater, ok, and ames, ia . The prevalence of c felis (0.8%) in north - central ok found in the current study was lower than the previously reported 3.4% in domestic cats in ok . Rizzi et al reported a difference in prevalence of c felis infection depending on geographic locations within ok; 13/77 (16.9%) cats were infected with c felis in eastern ok, while 10/602 (1.7%) cats were infected with c felis in north - central ok . Rizzi et al postulated differences in the prevalence of c felis within ok could include strain variation in virulence of c felis, differences in immunologic responses of cats to infection with c felis and differences in c felis inoculation from ticks . Three different genotypes of c felis, ribosomal internal transcribed spacer regions (its) a, b and c, have been demonstrated, and itsb and itsc seem to be more pathogenic with a higher mortality rate than itsa . Although it has not been established which genotype is more prevalent or pathogenic than others in ok, genotypic variations could influence prevalence because cats infected with the more pathogenic genotype are likely to succumb to infection . As cats become infected with c felis through tick bites, prevalence of c felis infection in domestic cats is likely affected by geographic variation of the abundance and activity of ticks and reservoir hosts . Our study supports the report of rizzi et al, which demonstrated that the prevalence of c felis in a given enzootic area can vary from location to location and from the population of cats sampled . Dna of c felis was not detected in 291 blood samples collected from free - roaming cats in central ia, a non - enzootic state that borders enzootic states . One case of c felis infection in a domestic cat has been reported in south - western ia along the missouri river . Unfortunately, this report did not provide details regarding travel history, age, or sex of the infected cat . In our study, blood samples were collected from relatively young cats, and that might have influenced the results as those cats had experienced less time being exposed to tick vectors . As the geographic distribution and range of a americanum expands northwards, it is important to keep monitoring free - roaming cat populations where cytauxzoonosis has not been considered enzootic . Historically, only bobcats were thought to be reservoirs for c felis; however, reports have indicated domestic cats that survive acute cytauxzoonosis become chronically infected with c felis and can also serve as a source of c felis infection . As free - roaming outdoor cats encounter ticks, the source of c felis infections, they are an excellent population to monitor the expansion of c felis distribution in the usa.
Pulmonary embolism (pe) is a common disorder and an important cause of morbidity and mortality . Pe occurs in approximately 650,000 patients annually in the us, of whom approximately 300,000 die.13 pe often arise from thrombus originating in the deep venous system of the lower extremities or pelvis . A blood clot dislodges and is swept into the pulmonary circulation and lodges in a pulmonary artery . If the clot is large enough to obstruct large vessels in the lung, it can cause hemodynamic instability, along with right ventricular (rv) failure, and possibly death . However, 5%10% of patients with pe have an unstable hemodynamic status and go into shock, and have an almost 60% higher mortality rate compared with patients without these characteristics.4,5 currently, thrombolytic therapy for pe is still controversial . Only patients with acute massive pe (ie, those at the highest risk of immediate death) are eligible for fibrinolytic therapy if no contraindications are present . There are not enough data on recombinant tissue plasminogen activator (rt - pa; alteplase) in patients with massive pe . We aimed to evaluate the results of massive pe and thrombolytic treatment in patients with hemodynamic instability due to massive pe . We retrospectively evaluated patients with pe between january 2010 and december 2013 in the department of pulmonary medicine, medical park samsun hospital, samsun, turkey . The diagnosis of pe and patient selection for thrombolytic treatment were decided on using the following criteria: 1) patients> 17 years with onset of symptoms suggestive of acute massive pe; 2) massive pe defined as acute pe with sustained hypotension (systolic blood pressure <90 mmhg for at least 15 minutes or requiring inotropic support, not due to a cause other than pe, such as arrhythmia, hypovolemia, sepsis, or left ventricular [lv] dysfunction), pulselessness, or persistent profound bradycardia (heart rate <40 bpm with signs or symptoms of shock). In addition, acute rv dilation, hypokinesis, and acute pulmonary arterial hypertension with paradoxal movement of the interventricular septum on echocardiography were added as criteria for thrombolytic treatment in patients with hemodynamic instability and/or cardiopulmonary arrest; and 3) pe is confirmed with contrast - enhanced thorax computed tomography (ct) in appropriate patients . The rt - pa (actilyse; boehringer ingelheim, ingelheim, germany) is administered as a 10 mg bolus via central line and 90 mg continuous infusion over 2 hours . All of the patients were monitored for measurements of heart rate; systolic, diastolic, and mean systemic blood pressures; and oxygen saturation with a pulse oximeter . The study was performed in accordance with the ethical principles in the good clinical practice (gcp) guidelines, applicable local regulatory requirements, and the protocol was approved by local ethics review boards . All the patients read the patient information form about the study procedure and written informed consent was obtained . The rt - pa (actilyse; boehringer ingelheim, ingelheim, germany) is administered as a 10 mg bolus via central line and 90 mg continuous infusion over 2 hours . All of the patients were monitored for measurements of heart rate; systolic, diastolic, and mean systemic blood pressures; and oxygen saturation with a pulse oximeter . The study was performed in accordance with the ethical principles in the good clinical practice (gcp) guidelines, applicable local regulatory requirements, and the protocol was approved by local ethics review boards . All the patients read the patient information form about the study procedure and written informed consent was obtained . A total of 34 patients were diagnosed and treated with rt - pa because of massive pe . The female to male ratio was 19/15 and the mean age was 6 3.113.2 years . Pe diagnosis was made using echocardiography (64.7%) or contrast - enhanced thorax ct with echocardiography (32.4%) (figures 1,2,3, and 4). Twenty - two (64.7%) patients went into cardiopulmonary arrest due to massive pe and 17 (50%) of total patients recovered without sequelae . Eleven (32.4%) of patients were diagnosed with massive pe during cardiopulmonary arrest with clinical and echocardiographic findings . Rt - pa was administered during cardiopulmonary resuscitation (cpr) and four (36.3%) patients responded and survived without sequelae . The complications of rt - pa treatment were hemorrhage in five (14.7%) patients and allergic reactions in two (5.9%) patients . Pe ranges in severity from acute massive pe to acute pulmonary infarction to acute embolism without infarction to multiple emboli . Only patients with acute massive pe (ie, those at the highest risk of immediate death) are eligible for fibrinolytic therapy if no contraindications are present . In the international cooperative pulmonary embolism registry (icoper) of 2,454 consecutive patients from seven countries, 4.2% had massive pe . In the us, approximately 150,000 patients per year are diagnosed with acute pe, resulting in thousands of recognized deaths annually from massive pe . Many additional deaths occur each year in the us as a result of undiagnosed massive pe that is mistaken for acute myocardial infarction or ventricular arrhythmia.57 the most experience with thrombolytic agents in pe is with streptokinase and urokinase, which are first - generation plasminogen activators . Tissue - type plasminogen activator (t - pa) is a second - generation thrombolytic agent that has high affinity for fibrin and is activated by fibrin . Alteplase was the first rt - pa and is identical to native t - pa . In vivo, t - pa is synthesized and made available by cells of the vascular endothelium . It is the physiologic thrombolytic agent responsible for most of the body s natural efforts to prevent excessive thrombus propagation . In 1986, goldhaber et al reported that 26 hours of rt - pa was effective in achieving angiographically proven clot lysis in acute pe.8 if available, a bedside transthoracic echocardiogram should be obtained as soon as diagnosis of massive pe is suspected . When we suspect massive pe in hemodynamically unstable patients the echocardiogram is not only useful for substantiating the diagnosis by confirming rv dysfunction and dilatation but can also exclude diagnoses that may mimic pe such as aortic dissection, pericardial tamponade, or acute myocardial infarction . We performed the echocardiography in 23 (64.7%) patients as a diagnostic tool, of which 11 (32.4%) of them were in cardiopulmonary arrest . The echocardiogram can also diagnose complications of pe such as right heart thrombi or even show thrombus protruding into the left atrium via a patent foramen ovale or atrial septal defect . In patients with poor image quality of the rv or in those who undergo cpr, transesophageal echocardiography may be used . In patients who can be stabilized with fluids, pressors, or mechanical ventilation, a contrast - enhanced chest ct will demonstrate filling defects in the main or lobar pulmonary arteries, as well as rv enlargement on the reconstructed ct four - chamber view.911 although systemic fibrinolysis is not worth the risk in all patients with acute pe, it is recommended as standard, first - line treatment in patients with massive pe . The preferred fibrinolytic agent is alteplase as a 100 mg continuous 2-hour infusion, as in our patients . In an overview of the five randomized controlled trials that included patients with massive pe, fibrinolysis reduced the risk of death or recurrent pe by 55%.12,13 active cpr is clearly not a contraindication for thrombolytic therapy . Studies that aim to identify causal factors in out - of - hospital cardiac arrest show that 50%70% of cases are attributable to either massive pe or acute myocardial infarction.14,15 although cardiac arrest initiated by intracoronary thrombosis in situ is different from the mechanisms associated with pe, thrombolysis has proved to be an effective treatment strategy for both these diseases.16,17 recent clinical case reports and small case series have suggested that thrombolysis during cardiac arrest can contribute to hemodynamic stability and is associated with improvements in long - term survival and functional recovery, as seen in our four (36.3%) patients . In an overview of eleven randomized controlled trials of fibrinolysis versus heparin among 748 unselected pe patients, major bleeding complications occurred in 9.1% of fibrinolysis - treated and 6.1% of heparin - treated patients . Major bleeding also occurs more often in patients with massive rather than non - massive pe, both with fibrinolysis plus heparin and with heparin alone . In an overview of the five randomized controlled trials that included patients with massive pe, fibrinolysis doubled the risk of major bleeding: 22% of fibrinolysis versus 12% of heparin patients (6,18). We noted the complications of rt - pa treatment were hemorrhage in 5 (14.7%) patients and allergic reactions in 2 (5.9%) patients . Ruiz - bailn et al described the outcomes using thrombolysis during cpr of patients in cardiorespiratory arrest (ca) caused by fulminant pe (fpe).18 rt - pa was administered during usual cpr maneuvers when there was a strong suspicion of fpe, as in our patients . They concluded that early thrombolysis during cpr maneuvers for ca apparently caused by an fpe may reduce the mortality rate among these patients . Also, we noted that the most common finding was intractable tachycardia in all patients with massive pe . We suggested that the bradycardia and intractable tachycardia with systemic hypotension should be included in the criteria of thrombolytic treatment in patients with massive pe . In conclusion, mortality due to massive pe is much more than estimated and alteplase can be safely used in patients with massive pe . If there is any sign of acute pe, echocardiography should be used during cardiopulmonary arrest / instability, and alteplase should be given to patients with suspected massive pe.
Its geography, climate, and demographic characteristics have been described elsewhere [3, 20]. In brief, malaria transmission occurs throughout the year but is limited to the low - land areas . The average annual incidence of parasitemia is estimated to be 876 episodes per 1000 people, with most cases due to p. falciparum . The prevalence of asexual parasitemia in 2005 was estimated to be 7.5% for p. falciparum, 6.4% for p. vivax, 1.9% for mixed infection, and 0.6% for plasmodium malariae . Until november 2008, rumah sakit mitra masyarakat (rsmm) was the only referral hospital in the district, and since 2008 approximately 80% of patients with malaria attending an inpatient facility in the district have been treated there . Rsmm has a capacity of 110 beds, with a high - dependency unit, a 24-hour emergency department, and an outpatient department that reviews approximately 300 patients per day, 6 days per week . The age distribution of all patient presentations peaks in infancy, with a second peak among individuals aged in their late 20s, whereas the absolute number of patient presentations with malaria peaks during the second year of life . Vivax malaria is the dominant cause of malaria in patients <3 years of age in both the outpatient and inpatient setting, and thereafter, p. falciparum is the most common malaria parasite [3, 20]. Hospital protocols recommend that all patients presenting to the outpatient department with a fever and that all inpatients, regardless of diagnosis, should have a blood film performed for detection of malaria parasites . Microbiological diagnosis of malaria is based on a thick blood film examination, with confirmatory thin blood films and rapid diagnostic tests for p. falciparum also performed in some cases . Microscopy quality control of the hospital laboratory suggests> 90% accuracy . On their first presentation to rsmm, every patient is assigned a unique hospital record number, and this is used to link all clinical and laboratory data from all presentations . Demographic and administrative information is recorded by hospital clerks, along with the diagnosis from the attending physician (classified according to the international classification of diseases) and any deaths . For the purposes of analyses, ethnicity was categorized as highland papuan, lowland papuan, or non - papuan, based on location of the clans village(s). Complete blood counts are ordered according to clinical indication and are generated by coulter counter (jt coulter, ramsey, minnesota). Clinical and hematology data were merged using the unique hospital record number and date of presentation . If> 1 laboratory measurement was available for a single presentation, the minimum platelet count was taken (figure 1). The primary outcome in this study was the mean number of platelets per microliter associated with infection for each plasmodium species, compared with patients without malaria . Secondary measures included the risk of severe thrombocytopenia, the population attributable fraction (par) of severe thrombocytopenia associated with infection by the different plasmodium species, and all - cause mortality . Thrombocytopenia was defined as severe if the platelet count was <50 000 platelets/l (approximately the fifth percentile) and very severe if the count was <20 000 platelets/l (approximately the first percentile; supplementary figure 1). Continuous data were analyzed using linear regression, and binary data (such as severe thrombocytopenia and death) were analyzed using logistic regression . Since some patients appeared in the database multiple times, robust standard errors were calculated using the clustered sandwich estimator . For the purposes of these analyses, univariable and multivariable analyses were performed for each of the following variables: infecting plasmodium species (negative, p. falciparum, p. vivax, p. malariae, p. ovale, or mixed species), sex, ethnicity (non - papuan, high - land papuan, or lowland papuan), age group (<1 year, 1 to <5 years, 5 to <15 years, and 15 years), year of presentation (20042012), department (outpatient vs inpatient), and number of presentations with malaria in the preceding 2 months . Fractional polynomials were used to define the nonlinear relationship between age and the mean platelet count and risk of severe thrombocytopenia, but to maintain the stability of these models the following patients were excluded: patients with platelet counts of <5000 or> 1 000 000 platelets/l (338 [0.16%]), infants <1 week of age (1073 [0.50%]), and adults> 63 years of age (the 99th percentile; 2205 [1.02%]). Adjusted pafs of severe thrombocytopenia were calculated from multivariable logistic regression models, using the punaf module for stata, which derives pafs by means of the formulae provided in greenland and dreschler . Because of very small numbers, data from patients with p. ovale infections (30 [0.01%]) are included in the baseline values and the univariable analyses but excluded from the multivariable analyses . Ethics approval for this study was obtained from the health research ethics committees of the university of gadjah mada, indonesia, and the menzies school of health research, darwin, australia . Since data were gathered from routine hospital surveillance, informed consent was not requested from participants . Its geography, climate, and demographic characteristics have been described elsewhere [3, 20]. In brief, malaria transmission occurs throughout the year but is limited to the low - land areas . The average annual incidence of parasitemia is estimated to be 876 episodes per 1000 people, with most cases due to p. falciparum . The prevalence of asexual parasitemia in 2005 was estimated to be 7.5% for p. falciparum, 6.4% for p. vivax, 1.9% for mixed infection, and 0.6% for plasmodium malariae . Until november 2008, rumah sakit mitra masyarakat (rsmm) was the only referral hospital in the district, and since 2008 approximately 80% of patients with malaria attending an inpatient facility in the district have been treated there . Rsmm has a capacity of 110 beds, with a high - dependency unit, a 24-hour emergency department, and an outpatient department that reviews approximately 300 patients per day, 6 days per week . The age distribution of all patient presentations peaks in infancy, with a second peak among individuals aged in their late 20s, whereas the absolute number of patient presentations with malaria peaks during the second year of life . Vivax malaria is the dominant cause of malaria in patients <3 years of age in both the outpatient and inpatient setting, and thereafter, p. falciparum is the most common malaria parasite [3, 20]. Hospital protocols recommend that all patients presenting to the outpatient department with a fever and that all inpatients, regardless of diagnosis, should have a blood film performed for detection of malaria parasites . Microbiological diagnosis of malaria is based on a thick blood film examination, with confirmatory thin blood films and rapid diagnostic tests for p. falciparum also performed in some cases . Microscopy quality control of the hospital laboratory suggests> 90% accuracy . On their first presentation to rsmm, every patient is assigned a unique hospital record number, and this is used to link all clinical and laboratory data from all presentations . Demographic and administrative information is recorded by hospital clerks, along with the diagnosis from the attending physician (classified according to the international classification of diseases) and any deaths . For the purposes of analyses, ethnicity was categorized as highland papuan, lowland papuan, or non - papuan, based on location of the clans village(s). Complete blood counts are ordered according to clinical indication and are generated by coulter counter (jt coulter, ramsey, minnesota). Clinical and hematology data were merged using the unique hospital record number and date of presentation . If> 1 laboratory measurement was available for a single presentation, the minimum platelet count was taken (figure 1). The primary outcome in this study was the mean number of platelets per microliter associated with infection for each plasmodium species, compared with patients without malaria . Secondary measures included the risk of severe thrombocytopenia, the population attributable fraction (par) of severe thrombocytopenia associated with infection by the different plasmodium species, and all - cause mortality . Thrombocytopenia was defined as severe if the platelet count was <50 000 platelets/l (approximately the fifth percentile) and very severe if the count was <20 000 platelets/l (approximately the first percentile; supplementary figure 1). Continuous data were analyzed using linear regression, and binary data (such as severe thrombocytopenia and death) were analyzed using logistic regression . Since some patients appeared in the database multiple times, robust standard errors were calculated using the clustered sandwich estimator . For the purposes of these analyses, univariable and multivariable analyses were performed for each of the following variables: infecting plasmodium species (negative, p. falciparum, p. vivax, p. malariae, p. ovale, or mixed species), sex, ethnicity (non - papuan, high - land papuan, or lowland papuan), age group (<1 year, 1 to <5 years, 5 to <15 years, and 15 years), year of presentation (20042012), department (outpatient vs inpatient), and number of presentations with malaria in the preceding 2 months . Fractional polynomials were used to define the nonlinear relationship between age and the mean platelet count and risk of severe thrombocytopenia, but to maintain the stability of these models the following patients were excluded: patients with platelet counts of <5000 or> 1 000 000 platelets/l (338 [0.16%]), infants <1 week of age (1073 [0.50%]), and adults> 63 years of age (the 99th percentile; 2205 [1.02%]). Adjusted pafs of severe thrombocytopenia were calculated from multivariable logistic regression models, using the punaf module for stata, which derives pafs by means of the formulae provided in greenland and dreschler . Because of very small numbers, data from patients with p. ovale infections (30 [0.01%]) are included in the baseline values and the univariable analyses but excluded from the multivariable analyses . Ethics approval for this study was obtained from the health research ethics committees of the university of gadjah mada, indonesia, and the menzies school of health research, darwin, australia . Since data were gathered from routine hospital surveillance, informed consent was not requested from participants . Of the 922 120 patient presentations to the mitra masyarakat hospital between april 2004 and december 2012, 837 989 (90.9%) were to the outpatient department alone, and 84 131 (9.1%) resulted in hospital admission (table 1). Microscopically confirmed malaria was diagnosed in 18.3% of patient presentations (168 525), with p. falciparum accounting for 53.3% of monoinfections, p. vivax for 32.3%, p. malariae for 2.7%, and p. ovale for 0.07% . Mixed - species infections were detected in 19 569 presentations (11.6%), which, in 18 489 (94.5%) cases, were mixed p. falciparum and p. vivax infections (table 1). Overall, 215 479 presentations (23.4%) could be matched with at least 1 platelet count measurement (figure 1). A greater proportion of outpatient visits were linked to a platelet count measurement if the patient had malaria rather than no malaria (30.1% vs 15.2%, respectively; p <.001). The corresponding figures for patients admitted to the wards were (91.6% vs 74.5%; p <.001). Patients who had a platelet measurement had a median age of 21.0 years, compared with 23.0 years among those without a measurement . Measurement of platelets was also slightly more common in males, compared with females (23.6% vs 23.1%), and in papuans, compared with non - papuans (23.7% vs 21.5%). The mean platelet count was significantly lower in highland papuans (204 10 platelets/l), compared with that for lowland papuans (278 10 platelets/l) and non - papuans (247 10 platelets/l; p <.001 for both comparisons). Whereas the overall risk of severe thrombocytopenia with each presentation fell to <2% from early childhood in non - papuans and lowlanders, highlanders remained at significantly greater risk throughout adulthood (p <.001; supplementary figure 2). The mean platelet concentration and prevalence of severe thrombocytopenia varied significantly with plasmodium species (table 1). Overall, p. falciparum, alone or as part of a mixed infection, was associated with the greatest difference in mean platelet counts, compared with counts for individuals without malaria (127 10 platelets/l [95% confidence interval [ci], 126 to 129 10 platelets/l]; p <.001). After adjustment for confounding factors, patients presenting to hospital with malaria had lower mean platelet counts and higher odds of severe thrombocytopenia than patients without malaria at all ages (figure 2). Patients with p. falciparum (alone or as part of mixed infections) without a history of presentation to the hospital with malaria within the preceding 2 months had significantly lower platelet counts (127 10 platelets/l [95% ci, 126 10128 10 platelets/l]), compared with those with a single recent episode of malaria (140 10 platelets/l [95% ci, 138 10143 10 platelets/l]) and those with 2 episodes (149 10 platelets/l [95% ci, 143 to 155 10 platelets/l]). The influence of recent history of malaria was not apparent in patients presenting without malaria or in those with p. vivax monoinfection . In total, 75 029 (34.8%) of the 215 479 presentations were associated with a platelet count of <150 10 platelets/l, 12 722 (5.9%) had counts of <50 10 platelets/l, and 2001 (0.9%) had counts of <20 10 platelets/l . Compared with patients without malaria, patients with p. falciparum infection were at the greatest risk of severe thrombocytopenia (adjusted odds ratio [or], 6.03 [95% ci, 5.776.30]), followed by those with mixed infections (adjusted or, 5.40 [95% ci, 5.025.80]), those with p. vivax infection (adjusted or, 3.73 [95% ci, 3.513.97]), and those with p. malariae infection (adjusted or, 2.16 [95% ci, 1.782.63]); p <.001 for all comparisons; table 2). Patients with a recent presentation to the hospital with malaria due to any plasmodium species were at a lower risk of severe thrombocytopenia, compared with those with no recent malaria (adjusted or, 0.71 [95% ci, .67.75]; p <.001; table 2). The effect of recent malaria was most noticeable in patients presenting with p. falciparum infection (adjusted or, 0.50 [95% ci, .45.55]; p <.001), compared with those without malaria (adjusted or, 0.89 [95% ci, .80.98]; p = .017) or those with p. vivax (adjusted or, 0.96 [95% ci, .841.09]; p = .510). In total, 215 044 (99.8%) of patients with platelet counts available also had hemoglobin levels measured; of these, 3.7% (7931) had severe anemia . The risk of severe thrombocytopenia was 18.7% (1484 of 7931) among patients with severe anemia, compared with 5.4% (11 221 of 207 113) among those without severe anemia (adjusted or, 3.16 [95% ci, 2.963.37]; p <.001). The overall adjusted population fraction of severe thrombocytopenia attributable to p. falciparum infection was 35.9% (95% ci, 34.9%36.8%), with 9.1% (95% ci, 8.6%9.7%) attributable to p. vivax, 0.5% (95% ci, 0.3%0.6%) attributable to p. malariae, and 7.0% (95% ci, 6.6%7.5%) attributable to mixed species infections (table 2). Admission for inpatient care was required in 49.6% of patients (6196 12 499) initially presenting to the outpatient department with severe thrombocytopenia, compared with 29.0% (57 966 of 200 066) among patients without severe thrombocytopenia (or, 2.41 [95% ci, 2.322.50]; p <.001). Overall, 1.3% of patients (2701 of 215 479) with a platelet measurement died, with the risk of death rising exponentially as the platelet count fell (figure 3). The mortality risk among patients with severe thrombocytopenia (<50 000 platelets/l) was 7.9% (324 of 4084) among those without malaria, 2.1% (120 of 5722) among those with p. falciparum infection, 1.5% (25 of 1650) among those with p. vivax infection, 1.7% (2 of 114) among those with p. malariae infection, and 1.7% (19 of 1148) among those with mixed infections . When platelet counts fell to <20 000 platelets/l, the risk of death increased to 11% (108 of 978) among patients without malaria, 5.6% (40 of 708) among those with p. falciparum infection, 3.6% (6 of 168) among those with p. vivax infection, 0% (0 of 15) among those with p. malariae infection, and 3.1% (4 of 131) among those with mixed infections . Overall, compared with patients with neither severe anemia nor thrombocytopenia, the adjusted ors for death were 5.21 (95% ci, 4.535.98) among those with severe anemia alone, 4.65 (95% ci, 4.105.28) among those with severe thrombocytopenia alone, and 16.44 (95% ci, 13.7019.74) among those with both (table 3). This relationship was apparent in both children and adults with malaria and in p. falciparum, p. vivax, and mixed infections (table 4). In the absence of severe anemia, the greatest risk of mortality associated with severe thrombocytopenia was among patients without malaria (adjusted or, 6.21 [95% ci, 5.377.20]; p <.001), whereas the risk among patients with malaria was 2.77 (95% ci, 2.20 to 3.480; p <.001), with no difference between infecting species (table 4). The overall paf of death associated with severe thrombocytopenia was 14.6% (95% ci, 13.1%16.0%); the full multivariable model for mortality is presented in table 3 . There was no significant difference in the risk of bleeding recorded in patients with (4.3% [21 of 490]) and those without (5.7% [126 of 2211]) severe thrombocytopenia (p = .228). Overall, 215 479 presentations (23.4%) could be matched with at least 1 platelet count measurement (figure 1). A greater proportion of outpatient visits were linked to a platelet count measurement if the patient had malaria rather than no malaria (30.1% vs 15.2%, respectively; p <.001). The corresponding figures for patients admitted to the wards were (91.6% vs 74.5%; p <.001). Patients who had a platelet measurement had a median age of 21.0 years, compared with 23.0 years among those without a measurement . Measurement of platelets was also slightly more common in males, compared with females (23.6% vs 23.1%), and in papuans, compared with non - papuans (23.7% vs 21.5%). The mean platelet count was significantly lower in highland papuans (204 10 platelets/l), compared with that for lowland papuans (278 10 platelets/l) and non - papuans (247 10 platelets/l; p <.001 for both comparisons). Whereas the overall risk of severe thrombocytopenia with each presentation fell to <2% from early childhood in non - papuans and lowlanders, highlanders remained at significantly greater risk throughout adulthood (p <.001; supplementary figure 2). The mean platelet concentration and prevalence of severe thrombocytopenia varied significantly with plasmodium species (table 1). Overall, p. falciparum, alone or as part of a mixed infection, was associated with the greatest difference in mean platelet counts, compared with counts for individuals without malaria (127 10 platelets/l [95% confidence interval [ci], 126 to 129 10 platelets/l]; p <.001). After adjustment for confounding factors, patients presenting to hospital with malaria had lower mean platelet counts and higher odds of severe thrombocytopenia than patients without malaria at all ages (figure 2). Patients with p. falciparum (alone or as part of mixed infections) without a history of presentation to the hospital with malaria within the preceding 2 months had significantly lower platelet counts (127 10 platelets/l [95% ci, 126 10128 10 platelets/l]), compared with those with a single recent episode of malaria (140 10 platelets/l [95% ci, 138 10143 10 platelets/l]) and those with 2 episodes (149 10 platelets/l [95% ci, 143 to 155 10 platelets/l]). The influence of recent history of malaria was not apparent in patients presenting without malaria or in those with p. vivax monoinfection . In total, 75 029 (34.8%) of the 215 479 presentations were associated with a platelet count of <150 10 platelets/l, 12 722 (5.9%) had counts of <50 10 platelets/l, and 2001 (0.9%) had counts of <20 10 platelets/l . Compared with patients without malaria, patients with p. falciparum infection were at the greatest risk of severe thrombocytopenia (adjusted odds ratio [or], 6.03 [95% ci, 5.776.30]), followed by those with mixed infections (adjusted or, 5.40 [95% ci, 5.025.80]), those with p. vivax infection (adjusted or, 3.73 [95% ci, 3.513.97]), and those with p. malariae infection (adjusted or, 2.16 [95% ci, 1.782.63]); p <.001 for all comparisons; table 2). Patients with a recent presentation to the hospital with malaria due to any plasmodium species were at a lower risk of severe thrombocytopenia, compared with those with no recent malaria (adjusted or, 0.71 [95% ci, .67.75]; p <.001; table 2). The effect of recent malaria was most noticeable in patients presenting with p. falciparum infection (adjusted or, 0.50 [95% ci, .45.55]; p <.001), compared with those without malaria (adjusted or, 0.89 [95% ci, .80.98]; p = .017) or those with p. vivax (adjusted or, 0.96 [95% ci, .841.09]; p = .510). In total, 215 044 (99.8%) of patients with platelet counts available also had hemoglobin levels measured; of these, 3.7% (7931) had severe anemia . The risk of severe thrombocytopenia was 18.7% (1484 of 7931) among patients with severe anemia, compared with 5.4% (11 221 of 207 113) among those without severe anemia (adjusted or, 3.16 [95% ci, 2.963.37]; p <.001). The overall adjusted population fraction of severe thrombocytopenia attributable to p. falciparum infection was 35.9% (95% ci, 34.9%36.8%), with 9.1% (95% ci, 8.6%9.7%) attributable to p. vivax, 0.5% (95% ci, 0.3%0.6%) attributable to p. malariae, and 7.0% (95% ci, 6.6%7.5%) attributable to mixed species infections (table 2). Admission for inpatient care was required in 49.6% of patients (6196 12 499) initially presenting to the outpatient department with severe thrombocytopenia, compared with 29.0% (57 966 of 200 066) among patients without severe thrombocytopenia (or, 2.41 [95% ci, 2.322.50]; p <.001). Overall, 1.3% of patients (2701 of 215 479) with a platelet measurement died, with the risk of death rising exponentially as the platelet count fell (figure 3). The mortality risk among patients with severe thrombocytopenia (<50 000 platelets/l) was 7.9% (324 of 4084) among those without malaria, 2.1% (120 of 5722) among those with p. falciparum infection, 1.5% (25 of 1650) among those with p. vivax infection, 1.7% (2 of 114) among those with p. malariae infection, and 1.7% (19 of 1148) among those with mixed infections . When platelet counts fell to <20 000 platelets/l, the risk of death increased to 11% (108 of 978) among patients without malaria, 5.6% (40 of 708) among those with p. falciparum infection, 3.6% (6 of 168) among those with p. vivax infection, 0% (0 of 15) among those with p. malariae infection, and 3.1% (4 of 131) among those with mixed infections . Overall, compared with patients with neither severe anemia nor thrombocytopenia, the adjusted ors for death were 5.21 (95% ci, 4.535.98) among those with severe anemia alone, 4.65 (95% ci, 4.105.28) among those with severe thrombocytopenia alone, and 16.44 (95% ci, 13.7019.74) among those with both (table 3). This relationship was apparent in both children and adults with malaria and in p. falciparum, p. vivax, and mixed infections (table 4). In the absence of severe anemia, the greatest risk of mortality associated with severe thrombocytopenia was among patients without malaria (adjusted or, 6.21 [95% ci, 5.377.20]; p <.001), whereas the risk among patients with malaria was 2.77 (95% ci, 2.20 to 3.480; p <.001), with no difference between infecting species (table 4). The overall paf of death associated with severe thrombocytopenia was 14.6% (95% ci, 13.1%16.0%); the full multivariable model for mortality is presented in table 3 . There was no significant difference in the risk of bleeding recorded in patients with (4.3% [21 of 490]) and those without (5.7% [126 of 2211]) severe thrombocytopenia (p = .228). In this very large hospital - based surveillance study, almost two thirds of patients with acute malaria had thrombocytopenia (platelet count, <150 000 platelets/l), with 13% of patients presenting with platelet counts of <50 000 platelets/l . The greatest risk of severe thrombocytopenia was in patients infected with p. falciparum, either alone or mixed (or, 5.46.1), accounting for> 40% of observed cases . Severe thrombocytopenia was associated with a 2.4-fold greater risk of admission to hospital and a 4.7-fold increased risk of death, rising to 16-fold when both severe anemia and severe thrombocytopenia were present (table 3). Similar relationships between the risk of death and severe thrombocytopenia were seen in both children and adults with malaria and in cases of p. falciparum and p. vivax infections . Malaria causes a variety of hematological insults arising from hemolysis, host inflammatory response, hematopoietic suppression, and splenic pooling [24, 25]. Severe anemia is an important prognostic indicator of fatal outcome, particularly in young children [3, 26]. While thrombocytopenia is also extremely common, its contribution to morbidity and mortality has been less clear . In patients with falciparum malaria, severe disease and mortality are increased with severe thrombocytopenia [15, 27], and more recently this has also been observed in patients with severe vivax malaria . Other studies showing no relationship between malarial thrombocytopenia and mortality have been smaller and may have been underpowered [28, 29]. Previous studies have shown a consistent inverse correlation between parasitemia at presentation and the platelet count, but our study did not record the peripheral parasite count routinely, and hence we were unable to explore this . In papua, we have shown that peripheral parasitemia is considerably higher in symptomatic patients with p. falciparum infections, compared with patients infected with p. vivax [20, 30]. This may have contributed to the greater risk of severe thrombocytopenia in patients with p. falciparum infection (or, 6.1), compared with those with p. vivax (or, 3.7). We have shown previously that the risk of anemia in this population is greatest in young patients, highlanders, and those presenting with recurrent episodes of malaria . In contrast, in the current analysis, the risk of severe thrombocytopenia was significantly lower in patients with malaria who had had a prior episode of malaria within the preceding 2 months (or, 0.8); this attenuation was most apparent in patients presenting with p. falciparum but not in those presenting with p. vivax monoinfection or without malaria . Furthermore, after the first year of life, lowland and non - papuan patients had a low risk of severe thrombocytopenia . The risk of thrombocytopenia was significantly higher in highland papuans, and this was sustained throughout adulthood . Highlanders constitute an ethnic group originating from non malaria - endemic regions who have not been under genetic selection pressure from malaria parasite infections . In the last decade, many highlanders have migrated at all ages to the lowland areas, where they have been exposed to malaria, often getting their first episodes of malaria in later life . Our findings are consistent with lowland ethnicity or recent malaria resulting in a reduction of the host inflammatory response to acute malaria and decreased platelet activation and consumption . The pathogenic mechanisms by which platelets mediate disease severity remain to be delineated . However, clinical, autopsy, ex vivo, and in vitro studies have shown that platelets are involved in parasite sequestration, as well as in clumping and/or agglutination of infected and uninfected erythrocytes [32, 33]. Platelets express toll - like receptors (tlrs), which, on recognition of p. falciparum molecular patterns, release pre - packaged inflammatory mediators . This could partially explain the attenuation with repeat exposure, as repeated stimulation of tlrs leads to decreased signaling and decreased inflammatory responses . Nitric oxide (no) is also a key mediator of platelet homeostasis, and the decreased no bioavailability found in both children and adults with severe and fatal malaria may contribute to increased platelet activation and consumption . First, platelet counts were only available in 26% of all presentations, and so there may be a degree of residual confounding in our multivariable analyses although the risk of thrombocytopenia was greater in inpatients than outpatients, the magnitude of the other risk factors remained similar in both departments . Second, the surveillance program did not document the presence of all severe manifestations of malaria in these patients, so it is not possible in this data set to determine whether the presence of severe thrombocytopenia would have identified patients at risk of death in whom other world health organization (who) criteria for severe disease were not apparent . Previous studies have used multivariate analysis to identify biomarkers predictive of poor outcome, but most have not included platelet counts . Hence, it is possible that the mortality risk associated with severe thrombocytopenia may be better represented by other clinical biochemical and inflammatory markers . However, platelet counts are readily available from an automated blood count, a routine laboratory test that is widely accessible even in referral inpatient facilities and even some more remote health posts and that is more accessible than other recognized laboratory predictors of mortality in who severity criteria (such lactate and bicarbonate levels or creatinine level). Our study, the largest to date that examined relationships between severe thrombocytopenia and malaria mortality, highlights that severe thrombocytopenia should serve as a warning sign of poor outcome, particularly when coexisting with severe anemia . We believe that severe thrombocytopenia may be useful in guiding the need for referral or triage to a ward where a higher level of care is provided . Our analysis focused on applying a threshold of 50 000 platelets/l, which was associated with an overall mortality of 3.9%, a paf of 14.5% and sufficient power to determine other relevant confounding factors . However, the mortality risk rose to 7.9% in patients with a platelet count of <20 000 platelets/l (5.6% in falciparum malaria and 3.6% in vivax malaria). We propose that a platelet count of 20 000 platelets/l should be included as a defining severity criterion for both falciparum and vivax malaria . Prospective studies are warranted to evaluate the prognostic value of using platelet counts in conjunction with hemoglobin concentrations to define medical interventions and to determine the underlying processes by which thrombocytopenia contributes to the pathology of malaria.
Schistosomiasis is the second most common parasitic infection of humans, following malaria, worldwide.1,2 approximately 207 million people are infected in 76 countries, and about 600 million are exposed to infection in tropical and subtropical regions of africa, asia, south america, and the caribbean . Globally, 200,000 deaths are attributed to schistosomiasis annually.13 advances in the fields of molecular biology and epidemiology have led to significant advances in our understanding of the relationship between infectious agents and cancer; however, the high prevalence of the parasitic infection in the general population, the extended latency, as well as the presence of interacting factors make detection of this relationship difficult.1,4 five species of schistosoma infect humans: s. hematobium, s. mansoni, s. japonicum, s. intercalatum, and s. mekongi.2,4 most human infections are linked to s. haematobium, s. japonicum strongly associated with bladder cancer and hepatocellular carcinoma (hcc), respectively and s. mansoni, which has been linked to many case reports of liver cancer, colorectal cancer, prostate cancer, and giant follicular lymphomas.4,5 in brazil, schistosomiasis is caused by s. mansoni, and the intermediate hosts are snails of the genus biomphalaria (b. straminea, b. glabrata, and b. tenagophila).6,7 the immunopathology of s. mansoni infection is due to granuloma formation surrounding the eggs deposited in the tissues, which is a manifestation of the delayed hypersensibility reaction . This reaction leads to pylephlebitis, peripylephlebitis, portal hypertension, splenomegaly, esophageal varices, hematemesis, and death.17 hcc is considered the fifth most common cancer in the world and is responsible for 5% of all malignant tumors in humans . In recent years, the incidence of schistomiasis has risen in many countries, including those in north america, europe, and asia.810 most hcc cases develop in the presence of advanced chronic liver disease related to chronic hepatitis c virus (hcv) infection, chronic hepatitis b virus (hbv) infection, and alcohol abuse.1,2,4,5 the relationship between hcc and s. mansoni has been debated in human cases.4,11,12 the real role of s. mansoni infection in the development of hcc has not been well characterized . The aim of this study was to report a case series of patients with hcc and s. mansoni infection at a single center from january 2002 to january 2015 and to conduct a literature review on the topic . From january 2002 to january 2015, an institutional database was screened retrospectively to identify patients with hcc and s. mansoni infection at a single center in the department of gastroenterology of university of so paulo school of medicine and hospital das clnicas, brazil . Baseline information, including patient demographics, serum biochemistries, liver biopsy when available, severity of liver disease (child - pugh classification), eastern cooperative oncology group performance status (pst), cancer stage according to the barcelona clinic liver cancer (bclc) staging system, -fetoprotein level (afp), and treatment modalities, were acquired . Diagnosis of s. mansoni infection was made based on positive epidemiology (coming or visiting from endemic areas with a history of exposure to potentially contaminated water or food), history of drug treatment for schistosomiasis or surgery (splenectomy), imaging patterns (periportal fibrosis, left lobe hypertrophy, or splenomegaly), positive stools, and/or presence of compatible histological findings (presence of schistosoma granuloma, portal fibrosis, or obliteration of portal venous branches) (fig . 1). A, small portal tract with aberrant veins and obliterative venopathy, suggestive of schistosomiasis; b, hepatocellular carcinoma, trabecular pattern . Hcc was diagnosed according to the updated noninvasive diagnostic criteria of the american association for the study of liver diseases.8 liver histology was performed to confirm diagnosis in inconclusive cases by imaging examination . Patients were classified as 0 (very early), a (early), b (intermediate), c (advanced), or d (terminal), using the bclc staging system . Curative therapies included surgical resection, liver transplantation, and local ablative therapy, such as radiofrequency ablation (rfa) or percutaneous ethanol injection . Liver transplantation was considered in patients fulfilling the milan criteria and showing increased portal pressure or bilirubin . While waiting on the liver transplant list, patients were treated with percutaneous ablation or transarterial chemoembolization (tace) as a bridge therapy to liver transplantation . If hepatectomy or orhtotopic liver transplantation were not indicated, local ablative therapies were performed, depending on the size and number of tumor nodules . In multifocal tumors or large hccs without extra - hepatic spread or vascular invasion, tace was the treatment of choice . Sorafenib was indicated for patients with advanced hcc . When treatment efficacy was considered limited or treatment - related risk was substantial due to extensive tumor burden, child - pugh class c status, or other medical comorbidities, supportive care was given . Ten cases were initially identified with hcc and s. mansoni infection in our center, however, three cases were excluded: one female patient had a biopsy consistent with budd - chiari syndrome, one male patient had impaired liver function (child c10), and one male patient who underwent the liver orthotopic transplantation with explant showed liver cirrhosis . A summary of the seven included cases is shown in table 1 and table 2 . Afp, alpha - fetoprotein; bclc, barcelona clinic liver cancer; hbct, hepatitis b core total; hbsag, hepatitis b surface antigen; hcc, hepatocellular carcinoma; ecog pst, eastern cooperative oncology group performance status; tace, transcatheter arterial chemoembolization . M, male; f, female; y, yes; n, no; na, not available; ugb, upper gastrointestinal bleeding; tpv, thrombosis of portal vein; hbv contact, hbsag negative, total anti - hbc positive, anti - hbs positive; hcc, hepatocellular carcinoma; md, moderately differentiated; afp, alpha - fetoprotein; ecog pst, eastern cooperative oncology group performance status; bclc, barcelona clinic liver cancer criteria; tace, transcatheter arterial chemoembolization . Of the seven patients with hcc and s. mansoni infection, six (85.7%) were male and one (14.3%) was female . All cases had positive epidemiology, coming from endemic areas of s. mansoni infection in brazil, and four (57.1%) had previous complications (upper gastrointestinal bleeding (ugb)) related to portal hypertension or surgery intervention (splenectomy) performed more than 10 years before the hcc diagnosis . Nontumoral portal vein thrombosis (pvt) was identified in five (71.4%) patients . All patients had negative serology for hcv, and four (57.1%) had positivity of hbvcore (hbc) antibodies without evidence of viral replication . Other causes of chronic liver disease, such as autoimmune hepatitis, -1 antitripsin deficiency, wilson s disease, and hemochromatosis, were excluded by the appropriate laboratory tests . According to bclc staging, one (14.3%) patient was bclc a and received tace instead of rfa because hcc size was> 30 mm; three (42.8%) bclc b patients received sorafenib instead of local regional treatment due to the presence of nontumoral tpv . During follow - up, all patients developed tumoral progression and died . Schistosomiasis is a major chronic disease of humans in endemic regions.15,13 while the majority of people infected with s. mansoni are relatively asymptomatic or show restricted morbidity associated with intestinal inflammation and fibrosis, a minority of infected individuals develop a severe hepatosplenic schistosomiasis, characterized by hepatic fibrosis, hepatosplenomegaly, and portal hypertension.13 this infection has an extensive transmission area in brazil, with endemic and focal areas encompassing 19 of the 27 federative units / states.6,14 the most heavily affected areas are characterized by poor sanitary conditions, poverty, and low education levels, especially in states of the northeast and southeast regions . It is estimated that approximately 2.5 to 6.0 million people are infected (5 - 10% may develop severe hepatosplenic and potentially fatal forms) and that 25 million who live in endemic areas are at risk of infection.14 humans are infected with s. mansoni following exposure to contaminated water; s. mansoni cercariae infect the host via the penetration of intact skin and become a new form called schistosomulum . After penetrating the wall of a nearby vein, schistosomula are carried in the host s blood, eventually reaching the portal venous system, where they mature and lay eggs, which either lodge into tissues and incite a granulomatous reaction or are released in feces . The eggs hatch in water to form miracidia, which invade snails and are released as cercarie, starting a new cycle.17,13 infections, in general, can initiate or promote carcinogenesis by three main mechanisms: (a) chronic inflammation due to prolonged persistence of an infectious agent in the host promotes release of reactive oxygen and nitrogen species (ros and rnos, respectively), which have the potential to damage dna, proteins, and cell membranes, and modulates enzyme activities and gene expression, which can cause carcinogenesis; (b) insertion of oncogenes into the host genome, as in hepatitis b and hepatitis c, inhibition of tumor suppressors, or stimulation of mitosis; and (c) induction of immunosuppression and consequently a reduction in immunosurveillance . Parasitic infections that initiate or promote neoplasia usually do so by mechanism one.1,2,4,5,11,15 in our sample, all patients had positive epidemiology for s. mansoni infection, and five (71.4%) previously had ugb or surgery intervention more than 10 years before the hcc diagnosis . Previous drug treatment for s. mansoni infection and the long period until the hcc disclosure could explain the negative results for the s. mansoni eggs in stool tests . Several surgical techniques have been developed to prevent rebleeding in patients with schistosomiasis and esophageal varices . After isolated splenectomy, much of the portal blood flow is diverted through the left gastric vein into the azygos system . Consequently, the liver becomes extremely arterialized with greatly increased sinusoidal pressure, leading to loss of liver function in the long term.16,17 splenectomy and ligature of the left gastric vein has been used in hepatosplenic schistosomiasis since the 1960s in brazil, becoming widespread in the 1990s.17 in our sample, patients underwent splenectomy in external services . Based on clinical and surgical data, year of fulfillment, and place the surgery was performed, it was possible to infer that two (cases 4 and 7) of the four patients in our sample underwent ligation of the left gastric vein . The peripheral destruction of the portal vein system with the occlusion or amputation of some of the medium - sized branches account for the presence of portal hypertension . The hepatic arterial changes, with hypertrophy and hyperplasia, are considered compensatory for the diminution of the portal vein flux.18 pvt was identified in five (71.4%) patients, and three (42.8%) of these patients were submitted for splenectomy in the past . Studies report that the most frequent immediate complication of esophagogastric devascularization is pvt, with an occurrence rate of 52.3%.19 postoperative pvt after splenectomy is a possible, but unusual, complication . However, because many patients remain asymptomatic, the true incidence of pvt may be underestimated . In studies where routine postoperative ultrasonography was done after splenectomy, the incidence of tpv ranged from 6.3 to 10.0%.20 in humans, portal deprivation, resulting from portacaval shunt or pvt, has been observed to induce a wide spectrum of liver nodules, including benign liver tumors, such as focal nodular hyperplasia and liver cell adenoma, and malignant tumors, such as hcc and hepatoblastoma, in addition to fibrosis and arterial proliferation in the portal space . The underlying mechanism of these changes remains unclear.21 clinical studies in egypt showed that 70 - 90% of patients with chronic hepatitis, cirrhosis, or hcc are co - infected with schistosomiasis and hcv.15 it was suggested that the combination of chronic schistosomiasis caused by s. mansoni and hbv or hcv may cause a higher risk of hcc due to the increased viral load in co - infected patients, leading to higher inflammatory activity and more advanced disease state.1,2,4,5,15 patients with s. mansoni infection tend to retain hbv and hcv for longer periods than those not infected with s. mansoni.21 in those with hepatosplenomegaly, the cell - mediated immune response was shown to be markedly depressed . Schistosoma infection affects the immune response in two ways to prolong the carrier state of the virus . Anti - idiotype antibodies produced in patients with chronic schistosomiasis can downregulate specific immune responses and suppress nonspecific immune responses.21,22 in addition, studies with mice and humans have shown that s. mansoni egg antigens can modify subpopulations of thymus helper cells, with an upregulation of helper t cell subtype 2 activity and the cytokines involved and with downregulation of helper t cell subtype 1 activity and cytokines, interleukin-2, and interferon as well as cytotoxic cd8 t cells.3,4,15,21 therefore, co - infected (s. mansoni infection and hbv or hcv) patients are at higher risk for early deterioration of liver function, the development of cirrhosis, and rapid progression towards end - stage liver disease and even hcc.20,21,23 in our sample, there were four (57.1%) patients with immunity by contact for hbv . The possible influence of this result on the disease course of these patients is unknown . A recent experimental study evaluated the role of s. mansoni infection in enhancing and aggravating the carcinogenic effect of diethylnitrosamine, a carcinogenic substance . S. mansoni infection failed to initiate any dysplastic changes.5 regarding the possible association between s. mansoni infection and hcc, studies have indicated that schistosomiasis may act as an additional factor, accelerating the injury related to other agents, such as hbv and hcv.15,2224 there are some limitations of our study . This retrospective analysis of records was performed at a single institution, which did not allow us to generalize these data to the general population . The center is a reference unity for the treatment of hcc, and, thus, most cases were referred after the diagnosis of hcc, and biopsies were directed to the focal lesions with an aim of hcc diagnosis . The clinical history and epidemiological features associated with imaging changes and preserved liver function allowed for the diagnosis of schistosomiasis in most cases . However, it is possible that there may be, in addition to the infection with s. mansoni, some degree of chronic liver disease related to vascular changes, in particular chronic portal vein thrombosis and/or absence of ligation of the left gastric vein in splenectomized . The sample had few patients, and four (57.1%) of them had immunity by contact for hbv and its meaning is uncertain . The available literature indicates that s. mansoni, in the presence of hbv and hcv infections, likely acts as a cofactor for the hepatic lesion and potentiates injury.
Pulmonary arterial hypertension (pah) is a devastating disease with 50% mortality at 2.8 years in patients left untreated or unresponsive to treatment.1 diagnostic evaluation in patients with pulmonary hypertension (ph) includes an echocardiogram, which when performed as it routinely undertaken even in tertiary referral centers, will diagnose an elevated pulmonary artery pressure . Patients are frequently misdiagnosed as having pah (diagnostic group i classification [ie, pah]) and started on pah - specific therapy based on an echocardiogram in the absence of a right heart catheterization (rhc). When the diagnostic cardiac catheterization is subsequently undertaken, many patients referred for evaluation and treatment of pah have an elevated pulmonary capillary wedge pressure (pcwp), suggesting left heart dysfunction (lhd) (diagnostic group ii classification) as a cause of ph.2,3 the distinction is important as the prognosis and therapy are different between these two disorders.4 the diagnosis of pah requires a normal pcwp, or a normal left ventricular end - diastolic pressure at the time of cardiac catheterization.5 elevated pcwp may be an indicator of lhd in patients with preserved ejection fraction . Lhd is considered a frequent cause of ph.2,6 left atrial (la) size is considered a marker of lhd with preserved ejection fraction.710 we undertook this study to examine the role of computed tomography of the chest (ct chest) in evaluating la size as an indicator of pcwp in patients undergoing ph evaluation . Our hypothesis was that a la appearing large on the ct chest would be an indicator of elevated pcwp during a rhc in patients with normal ejection fraction (ef) (> 40%) and normal aortic and mitral valves . After obtaining institutional review board approval, a retrospective study was undertaken of those patients evaluated for pah and underwent a right heart catheterization at baylor college of medicine pulmonary hypertension center from july 1, 2005 to june 30, 2006 . At this center, ct chest and echocardiography are routine evaluations undertaken for suspected ph . Of those patients, 26 were excluded from analysis, 20 due to the absence of a recent (defined as 60 days) ct chest; 3 due to the presence of congenital intra - cardiac shunts which frequently are associated with la enlargement; 1 due to the presence of lung cancer and significant pleural effusion; and 1 due to failure to obtain pcwp . Ct chests from the remaining 37 patients were reviewed on the picture archiving and communications systems by 3 independent investigators (adult pulmonologists), 2 of whom were blinded to the name, cardiac catheterization results, and diagnosis of the subjects (mk and af). Subjective impression of la size (graded as small - normal or large) was recorded (figure 1). Approximate la area was measured as follows: la area was measured in the mediastinal window at the point where la appeared largest to the reader (figure 1); horizontal length (l) and vertical width (w) of the la were measured; la area was calculated (la area = l w). La area was corrected for patient size by dividing the calculated area of the la by the horizontal chest wall length (lcw), measured in the same plane and along the same line as the measurement of the horizontal length of the la (corrected la = [l w]/lcw) (figure 1). The impression of the la by each investigator was recorded and grouped as either small - normal (group i) or large (group ii) (figure 1). When there was agreement between two investigators and disagreement with the third, the impression of the 2 agreeing investigators was accepted . Rhc had been undertaken in patients with normal mitral and aortic valves on echocardiogram with preserved left ventricular (lv) systolic function (ie, no evidence of lv systolic failure). The provided diagnosis was ph, therefore, all measurements were the standard evaluations undertaken for a diagnosis of ph . Comparisons of all measurements between the two groups were made with unpaired t - test . Pearson correlation analyses of clinical and hemodynamic parameters with la area and impression of investigators were performed with spss software . Shrout - fleiss intra - class correlation coefficient was used to measure the inter - rater reliability among the 3 investigators . The inter - rater reliability calculated using the shrout - fleiss intraclass correlation for la area was 0.865, indicating acceptable level of agreement among investigators . The estimated la area was 19.4 4.9 cm in group i and 39.9 7.6 cm in group ii (mean sd; p <0.001) (table 2a). The estimated la areas corrected for the chest wall length (l w / lcw) were 0.78 0.19 cm and 1.65 0.26 cm (p <0.001) in groups i and ii, respectively (table 2b). There was no significant difference in the mean pulmonary artery pressures between the two groups (p = 0.42) (table 1). The pcwp was 12 6 mmhg in group i and 21 7 mmhg in group ii (p = 0.001). In group i, 24 subjects had normal pcwp and 5 subjects had elevated pcwp on the rhc . Of the 5 subjects with elevated pcwp, 3 had impaired lv relaxation with preserved lv ejection fraction (lvef) (range 60%70%), 2 had elevated filling pressures on the echocardiogram suggestive of lhd, and the remaining 2 of the 5 subjects had normal lv filling pressures, lv relaxation, and la size (figure 2). In 1 subject with elevated pcwp and a diagnosis of pah, the rhc revealed marked elevation of both central venous pressure and right ventricular end - diastolic pressure and echocardiogram demonstrated a small lv with cavitary compromise due to markedly abnormal paradoxical interventricular systolic motion secondary to right ventricle systolic pressure overload . The second patient had portopulmonary hypertension and a high cardiac output that may have contributed to the high pcwp . In group ii, 7 of the 8 subjects had elevated pcwp at time of rhc (figure 2); 1 subject with normal pcwp also had normal pa pressures during the rhc . This indicates that in all but 1 subject with a large appearing la on the ct chest, also had elevated pcwp . Subjective observer impression of la size correlated with pcwp (r = 0.51, p = 0.001). There was a positive correlation between the subjective observer impression of la size on the ct chest and la size on measured echocardiogram (r = 0.61, p <0.001). The positive predictive value (ppv) of the la size in determining elevated pcwp in ph subjects was 87.5%; negative predictive value (npv) was 83% . Ppv of la size on ct chest in determining la size on echocardiogram was 90%; npv was 67% . These results suggest that looking at the la on the ct chest may be an indicator of elevated pcwp . There was a significant correlation between pcwp and estimated la area, both uncorrected (r = 0.45, p = 0.005) and corrected (r = 0.47, p = 0.003) (figure 3). This result indicates that the la area increases as the pcwp became elevated and may be an important indicator of elevated pcwp . It also suggests that there is no need to correct a la size measurement for parameters of patient size . Though no patient had a lvef <45%, uncorrected la area negatively correlated with lvef (r = 0.34, p = 0.03) (table 3) suggesting that as lvef decreased not unexpectedly la area increased . This provides some internal consistency and clinical validation of the observation . To determine if la area on a ct chest could be used to discriminate between subjects with pah (diagnostic group i) from those with elevated pcwp (diagnostic group ii), we calculated area under the receiver operating characteristic (roc) curves for both uncorrected and corrected la area . The largest area under the roc for uncorrected la area of 31 cm was 0.996 (figure 4). Therefore, uncorrected la area of 31 cm may be a good diagnostic tool to discriminate between the two groups . Value greater than 1.3 for the corrected la area yielded a sensitivity and specificity for prediction of left heart failure with preserved ef of 100% . These promising results indicate that both uncorrected and corrected la area measurements were reasonable values to distinguish between subjects with elevated pcwp (diagnostic group ii) and pulmonary arterial hypertension (diagnostic group i). The inter - rater reliability calculated using the shrout - fleiss intraclass correlation for la area was 0.865, indicating acceptable level of agreement among investigators . The estimated la area was 19.4 4.9 cm in group i and 39.9 7.6 cm in group ii (mean sd; p <0.001) (table 2a). The estimated la areas corrected for the chest wall length (l w / lcw) were 0.78 0.19 cm and 1.65 0.26 cm (p <0.001) in groups i and ii, respectively (table 2b). There was no significant difference in the mean pulmonary artery pressures between the two groups (p = 0.42) (table 1). The pcwp was 12 6 mmhg in group i and 21 7 mmhg in group ii (p = 0.001). In group i, 24 subjects had normal pcwp and 5 subjects had elevated pcwp on the rhc . Of the 5 subjects with elevated pcwp, 3 had impaired lv relaxation with preserved lv ejection fraction (lvef) (range 60%70%), 2 had elevated filling pressures on the echocardiogram suggestive of lhd, and the remaining 2 of the 5 subjects had normal lv filling pressures, lv relaxation, and la size (figure 2). In 1 subject with elevated pcwp and a diagnosis of pah, the rhc revealed marked elevation of both central venous pressure and right ventricular end - diastolic pressure and echocardiogram demonstrated a small lv with cavitary compromise due to markedly abnormal paradoxical interventricular systolic motion secondary to right ventricle systolic pressure overload . The second patient had portopulmonary hypertension and a high cardiac output that may have contributed to the high pcwp . In group ii, 7 of the 8 subjects had elevated pcwp at time of rhc (figure 2); 1 subject with normal pcwp also had normal pa pressures during the rhc . This indicates that in all but 1 subject with a large appearing la on the ct chest, also had elevated pcwp . Subjective observer impression of la size correlated with pcwp (r = 0.51, p = 0.001). There was a positive correlation between the subjective observer impression of la size on the ct chest and la size on measured echocardiogram (r = 0.61, p <0.001). The positive predictive value (ppv) of the la size in determining elevated pcwp in ph subjects was 87.5%; negative predictive value (npv) was 83% . Ppv of la size on ct chest in determining la size on echocardiogram was 90%; npv was 67% . These results suggest that looking at the la on the ct chest may be an indicator of elevated pcwp . There was a significant correlation between pcwp and estimated la area, both uncorrected (r = 0.45, p = 0.005) and corrected (r = 0.47, p = 0.003) (figure 3). This result indicates that the la area increases as the pcwp became elevated and may be an important indicator of elevated pcwp . It also suggests that there is no need to correct a la size measurement for parameters of patient size . Though no patient had a lvef <45%, uncorrected la area negatively correlated with lvef (r = 0.34, p = 0.03) (table 3) suggesting that as lvef decreased not unexpectedly la area increased . This provides some internal consistency and clinical validation of the observation . To determine if la area on a ct chest could be used to discriminate between subjects with pah (diagnostic group i) from those with elevated pcwp (diagnostic group ii), we calculated area under the receiver operating characteristic (roc) curves for both uncorrected and corrected la area . The largest area under the roc for uncorrected la area of 31 cm was 0.996 (figure 4). Therefore, uncorrected la area of 31 cm may be a good diagnostic tool to discriminate between the two groups . Value greater than 1.3 for the corrected la area yielded a sensitivity and specificity for prediction of left heart failure with preserved ef of 100% . These promising results indicate that both uncorrected and corrected la area measurements were reasonable values to distinguish between subjects with elevated pcwp (diagnostic group ii) and pulmonary arterial hypertension (diagnostic group i). Clinical suspicion of ph is usually conf irmed by an echocardiogram,11 which is typically reliable for discriminating systolic dysfunction, valvular lesions, and congenital defects . Ct chest is frequently undertaken as part of the routine evaluation of ph patients to exclude parenchymal lung disease . Estimation or measurement of la size by ct chest is simple and remarkably reliable, akin to the routine evaluation of heart size from chest x - ray . This study demonstrates the utility of routinely assessing la size / area in the evaluation of patients with ph . The data presented here indicate that most patients with a large la on ct chest, even without formal measurement, had elevated pcwp suggestive of lhd . These findings may allow patients to be stratified for risk of pah enabling prioritization for right heart catheterization and evaluation of the need for initiation of ph specific therapy . In addition inappropriate use of pah specific therapy could be avoided.4 pah is an orphan disease with a prevalence of 15 cases per million.12 in this single center study we present data from 37 patients who underwent both rhc and ct chest within 1 month of each other . There were 26 patients with pah in group i, 7 patients had lhd with preserved ejection fraction in group ii . 1 patient in group three patients in group i were diagnosed with lhd with preserved ejection fraction based on the findings of impaired lv relaxation on the echocardiogram in all 3 and elevated filling pressures in 2 of the 3 subjects . One of the patients in group i with elevated pcwp and small appearing la on ct chest had markedly enlarged right atrium and right ventricle, and small lv with shifting of the interventricular septum towards lv on the echocardiogram . This may reflect ventricular interdependence with elevated right ventricular pressure and volume shifting the interventricular septum to the left leading to obliteration of the lv cavity and lv systolic / diastolic dysfunction ., is increasingly recognized in pah populations.13,14 the elevated pcwp in left heart failure with preserved ef, on the other hand, is due to the stiffened lv with decrease compliance and associated with enlargement of the la.15 in such cases, lhd results from noncompliance of the lv, which in the presence of normal lv systolic function, produces elevated left ventricular filling pressures (elevated pcwp or lv end - diastolic pressures),16 further aggravated by increases in heart rate in response to effort or stress . Lhd with preserved ef is the commonest confounding diagnosis in the evaluation and management of patients with ph and an increasingly frequent diagnostic entity in the aging, diabetic, and hypertensive population . Evaluation of echographic parameters of lhd is beyond the scope of this paper and will be undertaken in subsequent studies . La size is considered a marker of lhd with preserved ejection fraction.710 advancing age alone does not contribute to la enlargement and the impact of gender on la volume may be due to differences in body surface area.8 however, in our study there was no difference in the body surface area or body mass index between the two groups (table 1). Factors influencing la size include valvular abnormalities and atrial arrhythmias.17 none had atrial fibrillation at the time of rhc . Prevalence of lhd with preserved ef is high and treatment remains poorly defined, risk factors include: essential hypertension, obesity, obstructive sleep apnea, renal failure, thyroid dysfunction, female gender, and older age.16,18,19 patients may be presumptively started on pah specific therapy without undergoing a diagnostic rhc . A ct chest, however, can be easily and non - invasively undertaken and our data indicates la size could give an indication of the presumed diagnosis pending rhc . The impression of la enlargement on ct in patients undergoing evaluation for ph may be an important predictor that ph specific therapy was not indicated . This data should not be construed as a recommendation to base diagnosis of ph on ct chest without proceeding to rhc but rather to identify patients at risk of lhd with enlarged la . Different imaging techniques such as 2- or 3-dimensional echocardiography, magnetic resonance imaging, and cine computerized tomography, have been used to estimate la size and/or volume.2023 these techniques are limited by availability, technical difficulties, time requirements, or need for special software.20,24 though tertiary care centers have the ability to undertake an echocardiography evaluation of patients with suspected ph, such studies have not been validated in large trials nor are they routinely applied to all echocardiograms evaluations.2527 our data demonstrate that a routine ct chest may be used to reliably predict elevated pcwp that may suggest the diagnosis of lhd in patients with preserved lv systolic function and echocardiograhic evidence of ph . Estimation of la size by ct chest may avoid initiation of unnecessary and inappropriate ph - specific therapy and delays in diagnostic rhc in patients undergoing ph evaluation . The limitations of this study were the retrospective study design, small sample size, and one center review . La area and impression may have been influenced by the cardiac cycle at the time of the ct chest and intravascular volume status of the patient ., future studies that prospectively and simultaneously evaluate the echocardiographic and hemodynamic parameters in patients undergoing ph evaluation will be needed . The results of this single - center study will need to be validated in a large prospective multi - center study.
This study provides class iv evidence that for patients with pms, rituximab provided via an ommaya reservoir depletes peripheral blood b lymphocytes . The itt - pms trial (clinicaltrials.gov identifier nct01719159) is an open - label interventional study primarily aimed at studying the feasibility and safety of it administration of rituximab in pms . A secondary endpoint is to study treatment effects on subsets of lymphocytes in peripheral blood (pb) and csf . Inclusion criteria were a diagnosis of pms and a failure to respond to or ineligibility for conventional therapies . Ten patients were included from september 2009 to march 2011 and followed for 1 year . Informed consent was obtained prior to enrollment, and the study was approved by the regional ethical review board of ume university (dnr 08 - 157 m). The primary research question of this substudy was whether injection of rituximab would cause depletion of pb b lymphocytes . This observational study without a control group provides class iv evidence regarding this question . Under general anesthesia, a ventricular catheter was introduced into the right frontal horn through a 10 mm diameter burr hole placed 2 cm to the right of the midline at the level of the coronal suture and connected to a subcutaneous ommaya reservoir . Rituximab (10 mg / ml; roche ab, stockholm, sweden) was administered as 3 doses of 25 mg at weekly intervals . The first injection was performed approximately 3 weeks after implantation of the ommaya reservoir in order to allow surgery - related subcutaneous swelling to subside . Patients were premedicated with 1 mg iv clemastine and 4 mg oral betamethasone 1 hour before the it rituximab injection . In order to assess tolerance, the rituximab dose was titrated for the first 3 patients, with daily doses of 1 mg, 2.5 mg, 5 mg, 10 mg, and finally 25 mg . Daily monitoring of routine blood parameters and lymphocyte subpopulations by flow cytometry was performed to assess the safety and pharmacodynamic profile of it treatment . Patients were evaluated clinically at baseline and then at 1, 3, 6, 9, and 12 months posttreatment . Lumbar puncture was performed at each visit to follow i m parameters and axonal damage markers . Lymphocyte subsets were determined using monoclonal antibodies to the following surface antigens: cd3 (bd 560365), cd4 (bd 341115), cd8 (bd 345772), cd16 cd56 (bd 337166), cd45 (bd 560777; bd biosciences, san jose, ca), and cd19 (302230; biosite, san diego, ca). Csf was centrifuged at 800 g for 15 minutes, supernatant was gently removed, and the cell pellet was resuspended in phosphate - buffered saline before analysis using a facscanto ii (bd biosciences). The itt - pms trial (clinicaltrials.gov identifier nct01719159) is an open - label interventional study primarily aimed at studying the feasibility and safety of it administration of rituximab in pms . A secondary endpoint is to study treatment effects on subsets of lymphocytes in peripheral blood (pb) and csf . Inclusion criteria were a diagnosis of pms and a failure to respond to or ineligibility for conventional therapies . Ten patients were included from september 2009 to march 2011 and followed for 1 year . Informed consent was obtained prior to enrollment, and the study was approved by the regional ethical review board of ume university (dnr 08 - 157 m). The primary research question of this substudy was whether injection of rituximab would cause depletion of pb b lymphocytes . Under general anesthesia, a ventricular catheter was introduced into the right frontal horn through a 10 mm diameter burr hole placed 2 cm to the right of the midline at the level of the coronal suture and connected to a subcutaneous ommaya reservoir . Rituximab (10 mg / ml; roche ab, stockholm, sweden) was administered as 3 doses of 25 mg at weekly intervals . The first injection was performed approximately 3 weeks after implantation of the ommaya reservoir in order to allow surgery - related subcutaneous swelling to subside . Patients were premedicated with 1 mg iv clemastine and 4 mg oral betamethasone 1 hour before the it rituximab injection . In order to assess tolerance, the rituximab dose was titrated for the first 3 patients, with daily doses of 1 mg, 2.5 mg, 5 mg, 10 mg, and finally 25 mg . Daily monitoring of routine blood parameters and lymphocyte subpopulations by flow cytometry was performed to assess the safety and pharmacodynamic profile of it treatment . Patients were evaluated clinically at baseline and then at 1, 3, 6, 9, and 12 months posttreatment . Lumbar puncture was performed at each visit to follow i m parameters and axonal damage markers . Lymphocyte subsets were determined using monoclonal antibodies to the following surface antigens: cd3 (bd 560365), cd4 (bd 341115), cd8 (bd 345772), cd16 cd56 (bd 337166), cd45 (bd 560777; bd biosciences, san jose, ca), and cd19 (302230; biosite, san diego, ca). Csf was centrifuged at 800 g for 15 minutes, supernatant was gently removed, and the cell pellet was resuspended in phosphate - buffered saline before analysis using a facscanto ii (bd biosciences). One day after the first dose (1 mg), peripheral b lymphocytes were clearly depleted, and after the second day's dose (2.5 mg), peripheral b lymphocytes were virtually undetectable (figure 1a). B - lymphocyte (cd19; a) and total lymphocyte (cd45; b) counts (cells/l) in peripheral blood during dose titration (n = 3). Treatment days indicated by vertical arrows . The full dose (3 25 mg given 1 week apart) resulted in complete depletion of peripheral b lymphocytes for 36 months and an initial reduction of total cd45 lymphocytes (figure 2). Most patients had very low csf lymphocyte counts prior to treatment, which reduced them even further, making consistent changes difficult to evaluate . In 2 patients in whom the initial cell counts were slightly elevated, the same pattern of depletion was seen in the csf as in pb: an immediate drop in both b lymphocytes and total cd45 lymphocytes (figure 3). B - lymphocyte (cd19; a) and total lymphocyte (cd45; b) counts (cells/l) in peripheral blood for 1 year posttreatment (n = 10). B - lymphocyte (cd19; a) and total lymphocyte (cd45; b) counts (cells/l) in csf for 1 year posttreatment (n = 10). The primary outcome of the clinical trial, safety and tolerability, will be presented when the trial is complete . Up to this point, no unexpected side effects have occurred; the most common side effect is transient vertigo in conjunction with the it injections . The only serious side effect so far has been a low virulent infection introduced via the ommaya reservoir that responded promptly to standard antibiotic treatment and removal of the reservoir . In this ongoing trial, we observed an almost immediate effect on b - lymphocyte counts in the peripheral compartment at ultra - low doses of intrathecally administered rituximab . Following a dose of 3.5 mg given over 2 days, peripheral b lymphocytes were essentially eliminated, and the total dose of 3 25 mg given 1 week apart resulted in complete peripheral depletion of b lymphocytes for 36 months . There was a concomitant depletion of total csf lymphocytes and b lymphocytes, albeit with low baseline counts . Although the rationale for administering rituximab it was to achieve an effective therapeutic antibody concentration within the bbb, we observed a rapid and potent effect on lymphocytes in the peripheral compartment . It has previously been shown in nonhuman primates that the pharmacokinetics of rituximab delivered it involves a biphasic clearance with a 5-hour terminal half - life of the drug in the csf compartment, which concurs with the observations in the present study . Similar depletion of peripheral b lymphocytes was also noted in a recent study of it administration of anti - cd20 antibodies in experimental autoimmune encephalomyelitis (eae). Hence, it is important to evaluate the effect on csf lymphocytes, considering the rapid clearance from the it compartment . Only 2 patients had a high enough baseline csf total cell count to be able to reliably discern a change posttreatment . Both showed an initial depletion of b lymphocytes with a return to baseline by 6 months . Total csf lymphocyte counts also decreased to almost zero in these 2 patients, which cannot be explained by b - lymphocyte depletion alone . This is in agreement with previous data on csf t cells after rituximab treatment, but the exact mechanisms are unknown . The recently described effect of rituximab on a subset of t cells expressing cd20 is an interesting mechanism that needs to be investigated further . A weakness in our study is that we cannot determine whether changes occurring among lymphocyte subsets in the csf are an effect of rituximab within the cns compartment or are a result of a peripheral depletion and subsequently less recruitment into the csf from pb . It is presently not known whether appropriate effector mechanisms exist in the csf to mediate lysis by injected monoclonal antibodies . However, there is now believed to be an inflammatory milieu along the meninges in many cases of pms that could possibly facilitate both complement - mediated lysis and antibody - dependent cytotoxicity . There are also data indicating increased complement activation in ms, with the highest occurrence among progressive patients . Furthermore, it was shown that it administration of anti - cd20 monoclonal antibody could reduce the amount of b lymphocytes in the meninges in eae with a concomitant modest amelioration of the clinical course . There is a need for further research in this area in order to define the role of it therapy in neuroinflammatory conditions . We report an unexpected and profound effect on peripheral b lymphocytes after even minute doses of rituximab injected it . Furthermore, the total dose of 75 mg rituximab given in the csf compartment resulted in complete depletion of peripheral b lymphocytes for up to 6 months . This indicates that present doses of 5001,000 mg given intravenously in the clinic may be unnecessarily high . The data also indicate a possible effect on csf lymphocytes, which requires further study . The rapid redistribution of it - injected rituximab to the peripheral compartment has strong implications regarding the frequency of it injections needed to achieve the desired effect in the cns . Anders svenningsson was responsible for the design and conceptualization of the study and patient management and wrote the first draft of the article . Joakim bergman was partly responsible for patient management and sample collection and participated in data analyses and manuscript revisions . Richard birgander participated in the design and conceptualization of the study and was active in patient management and data retrieval . Thomas lindqvist participated in the design and conceptualization of the study and was active in patient management and data retrieval . Tommy bergenheim participated in the design and conceptualization of the study, was responsible for all neurosurgical procedures, and participated in manuscript revisions . The study was funded by the research fund for clinical neuroscience at ume university hospital and the regional agreement between ume university and vsterbotten county council on cooperation in the field of medicine, odontology and health (alf). A. svenningsson has served on the advisory boards for sanofi - genzyme and biogen idec; has received travel funding and/or speaker honoraria from biogen idec, sanofi - genzyme, novartis, and baxter medical; and has received research support from biogen idec . M. vgberg has received travel funding and/or speaker honoraria from biogen idec, novartis, baxter medical, and pharma industry writing honoraria and has received research support from biogen idec and neuro sweden.
Osteoporotic vertebral compression fracture (ovcf) is the most common fracture seen in patients with osteoporosis . The diagnosis of the ovcf may be suspected during the clinical evaluation and confirmed with radiologic findings, such as radiography, ct and mri . Especially, the mri is the gold standard for the investigation of vertebral bone marrow edema in ovcf . The t1wi and the fat - suppressed t2wi have been useful in detection of the faint bone marrow edema which is associated with acute ovcf125816). The signal intensity (si) of ovcfs differs according to the fracture ages . In the acute stage (<2 months), ovcfs show low si on t1wi and high si on t2wi, in correspondence to the bone marrow edema and the fracture line19). The low si pattern of acute ovcf on t1wi can be seen as focal, band - like, or diffuse7). Due to fatty marrow changes of bone marrow edema, chronic ovcfs show an absence of low si of vertebral body on t1wi otherwise1). Three types of vertebral deformity are usually described; wedge, biconcave, and crush deformities4). All types of deformity were associated with height loss, which was more high degree in patients with crush deformity4). To our knowledge, there are no prior study discussed the relationship between the low si pattern, according to early bone marrow edema pattern on t1wi and the vertebral deformity types on the follow up mri in patients with acute ovcf . If vertebral deformity types can be predicted immediately after acute ovcf, more proactive treatment can be initiated relatively early . The purpose of this study was to evaluate the predictability of vertebral deformity types and prognosis using early bone marrow edema pattern of ovcf on t1wi . From may 2009 to january 2013, 234 patients with thoracolumbar vcf, who underwent lumbar spine mri were retrospectively reviewed . The inclusion criteria were as followed; 1) patients 50 years, 2) recent history of back pain after a minor trauma of less than 2 months, 3) lumbar bone marrow density t - score of less than -2.5, 4) underwent conservative treatment, 5) patients who underwent follow up lumbar spine mri . Exclusion criteria were as followed; 1) vcfs show absence of low si of vertebral body on t1wi of initial mri (n=104), 2) pathologic vcfs related to malignancy (n=7) or spine infection (n=9), 3) underwent surgical procedure before underment follow up mri (n=47). Finally, 64 patients were enrolled with 75 acute ovcfs (table 1). 10 men and 54 women with a mean age of 69.4 years (range, 56 - 85 years) were included . In 5 of the 64 patients, ovcfs were diagnosed in more than one vertebral body (4 patients had 2 involved vertebrae and 1 patient had 3 involved vertebrae). Thirty - four fractures were in the thoracolumbar junction (t11l1), and 41 fractures were in the lumbar vertebral column . The mean follow up interval of mri was 25.7 months (range between 198 months). Lumbar spine mri was performed with a 1.5 tesla (ge medical systems, milwaukee, wi, usa and siemens, erlangen, germany) or 3 tesla (achieva, philips medical system, the netherlands). Axial and sagittal t1wi [repetition time (tr)/echo time (te), 350467/9], t2wi (tr / te, 27503300/116117) and fat - suppressed t2wi were obtained with fast spin echo techniques . Typical imaging parameters were as followed: echo train length, 20; matrix number, 384448256; slice thickness, 4 mm; field of view (fov), 290300290300 mm for the sagittal plane and echo train length, 14; matrix number, 320400256284; slice thickness, 4 mm; field of view (fov), 160180160180 mm for the axial plane . Three musculoskeletal radiologists retrospectively reviewed the lumbar spine mris independently and any inconsistencies were resolved by consensus . Acute ovcfs were defined as vcfs with low si on t1wi and high si on fat - suppressed t2wi in correspondence to the bone marrow edema, discontinuity of the vertebral cortex, or fracture line19). Type 1 was defined as diffuse low si (more than 90% of vertebral body involvement), type 2 was defined as globular or patchy low si (non - band like) and type 3 was defined as band like low si (parallel the adjacent end plate) (fig . Vertebral deformity was defined as height reduction in the vertebral body with more than 20% compared with the height of adjacent vertebral bodies . The vertebral deformity types of ovcfs on follow up mri were classified into three types based on the center of the most height reduction of vertebral body . The vertebral deformity types are classified as anterior wedge, biconcave or crush deformity depending on whether anterior, middle, or posterior portion of vertebral body was most diminished in height12). In addition, an entire height reduction with retropulsed fragment at the posterior wall of the vertebral body was defined as crush deformity (fig . In addition, in order to determine the patient's prognosis according to the early bone marrow edema pattern on t1wi, incidence of vertebral osteonecrosis, spinal stenosis and the degree of vertebral body height loss were evaluated on the follow up mris . Vertebral osteonecrosis was defined as vcf with " intravertebral vacuum cleft sign " or " fluid sign"182023). The intravertebral vacuum cleft sign was defined as the collection of intravertebral air, which appears as an area of low si on all mri sequences . The fluid sign was defined as the collection of intravertebral fluid, which appears as an area of low si on t1wi and high si on t2wi, adjacent to the fractured vertebral endplate . The degree of vertebral body height loss were assessed comparing with the vertebral body height on the initial mri . The severe degree vertebral body height loss was defined if the height reduction in the vertebral body showed more than 40%12). Statistical package for the social sciences (spss) was used for statistical analysis (spss 12.0, spss inc . A p - value of less than 0.05 was considered to indicate a significant difference . From may 2009 to january 2013, 234 patients with thoracolumbar vcf, who underwent lumbar spine mri were retrospectively reviewed . The inclusion criteria were as followed; 1) patients 50 years, 2) recent history of back pain after a minor trauma of less than 2 months, 3) lumbar bone marrow density t - score of less than -2.5, 4) underwent conservative treatment, 5) patients who underwent follow up lumbar spine mri . Exclusion criteria were as followed; 1) vcfs show absence of low si of vertebral body on t1wi of initial mri (n=104), 2) pathologic vcfs related to malignancy (n=7) or spine infection (n=9), 3) underwent surgical procedure before underment follow up mri (n=47). Finally, 64 patients were enrolled with 75 acute ovcfs (table 1). 10 men and 54 women with a mean age of 69.4 years (range, 56 - 85 years) were included . In 5 of the 64 patients, ovcfs were diagnosed in more than one vertebral body (4 patients had 2 involved vertebrae and 1 patient had 3 involved vertebrae). Thirty - four fractures were in the thoracolumbar junction (t11l1), and 41 fractures were in the lumbar vertebral column . The mean follow up interval of mri was 25.7 months (range between 198 months). Lumbar spine mri was performed with a 1.5 tesla (ge medical systems, milwaukee, wi, usa and siemens, erlangen, germany) or 3 tesla (achieva, philips medical system, the netherlands). Axial and sagittal t1wi [repetition time (tr)/echo time (te), 350467/9], t2wi (tr / te, 27503300/116117) and fat - suppressed t2wi were obtained with fast spin echo techniques . Typical imaging parameters were as followed: echo train length, 20; matrix number, 384448256; slice thickness, 4 mm; field of view (fov), 290300290300 mm for the sagittal plane and echo train length, 14; matrix number, 320400256284; slice thickness, 4 mm; field of view (fov), 160180160180 mm for the axial plane . Three musculoskeletal radiologists retrospectively reviewed the lumbar spine mris independently and any inconsistencies were resolved by consensus . Acute ovcfs were defined as vcfs with low si on t1wi and high si on fat - suppressed t2wi in correspondence to the bone marrow edema, discontinuity of the vertebral cortex, or fracture line19). Type 1 was defined as diffuse low si (more than 90% of vertebral body involvement), type 2 was defined as globular or patchy low si (non - band like) and type 3 was defined as band like low si (parallel the adjacent end plate) (fig . Vertebral deformity was defined as height reduction in the vertebral body with more than 20% compared with the height of adjacent vertebral bodies . The vertebral deformity types of ovcfs on follow up mri were classified into three types based on the center of the most height reduction of vertebral body . The vertebral deformity types are classified as anterior wedge, biconcave or crush deformity depending on whether anterior, middle, or posterior portion of vertebral body was most diminished in height12). In addition, an entire height reduction with retropulsed fragment at the posterior wall of the vertebral body was defined as crush deformity (fig . In addition, in order to determine the patient's prognosis according to the early bone marrow edema pattern on t1wi, incidence of vertebral osteonecrosis, spinal stenosis and the degree of vertebral body height loss were evaluated on the follow up mris . Vertebral osteonecrosis was defined as vcf with " intravertebral vacuum cleft sign " or " fluid sign"182023). The intravertebral vacuum cleft sign was defined as the collection of intravertebral air, which appears as an area of low si on all mri sequences . The fluid sign was defined as the collection of intravertebral fluid, which appears as an area of low si on t1wi and high si on t2wi, adjacent to the fractured vertebral endplate . The degree of vertebral body height loss were assessed comparing with the vertebral body height on the initial mri . The severe degree vertebral body height loss was defined if the height reduction in the vertebral body showed more than 40%12). Statistical package for the social sciences (spss) was used for statistical analysis (spss 12.0, spss inc . A p - value of less than 0.05 was considered to indicate a significant difference . According to the early bone marrow edema pattern on t1wi, 26 (34.6%) showed type 1 pattern, 14 (18.7%) showed type 2 pattern and 35 (46.7%) showed type 3 pattern . On the follow up mri, 21 (28%) showed an anterior wedge deformity, 26 (34.7%) showed a biconcave deformity and 17 (22.7%) showed a crush deformity . 11 (14.7%) ovcfs showed a height reduction less than 20% in the vertebral body (table 1). The mean age was 73.5 years in type 1 group, 66.3 years in the type 2 group, and 68.8 years in the type 3 group . The difference was statistical significant (p<0.005). Among 26 patients of type 1 group, 5 patients (19.23%) who the conservative management failed, underwent surgical intervention (3 patients: laminectomy with posterior instrumentation, 1 patient: laminectomy, 1 patients: partial corpectomy and cylinder insertion with posterior instrumentation). All 14 patients of type 2 group were managed with conservative treatments . Among 35 patients of type 3 group, 5 patients (14.29%) who the conservative management failed, underwent surgical intervention (laminectomy with posterior instrumentation). The results of the relationship between the low si of ovcfs according to early bone marrow edema pattern on t1wi and vertebral deformity types of ovcfs on the follow up mri are shown in table 2 . For each low si type according to the early bone marrow edema pattern on t1wi, the frequency of vertebral deformity type was assessed . Among 26 ovcfs with type 1 low si pattern, 3 ovcfs (11.5%) showed anterior wedge deformity, 9 ovcfs (34.6%) showed biconcave deformity and 13 ovcfs (50%) showed crush deformity on the follow up mri (fig . 3). 1 ovcf (3.8%) showed no change of vertebral body configuration . Among 14 ovcfs with type 2 low si pattern, 1 ovcf (7.1%) showed anterior wedge deformity, 10 ovcfs (71.4%) showed biconcave deformity (fig . 4, 5) and 1 ovcf (7.1%) showed crush deformity on the follow up mri . 2 ovcfs (14.3%) showed no changes of the vertebral body configuration . Among 35 ovcfs with type 3 low si pattern, 17 ovcfs (48.6%) showed anterior wedge deformity (fig . 3), 7 ovcfs (20%) showed biconcave deformity and 3 ovcfs (8.6%) showed crush deformity on the follow up mri . 8 ovcfs (22.9%) showed no change of the vertebral body configuration . In summary, differences of the vertebral deformity types of ovcfs were visible on the follow up mris, according to the early bone marrow edema pattern on t1wi . Crush deformities were more frequent in patients with type 1 low si pattern on t1wi (13/26, 50%), biconcave deformities were more frequent in patients with type 2 low si pattern (10/14, 71.4%) and anterior wedge deformities were more frequent in patients with type 3 low si pattern (17/35, 48.6%). The results of the patient's prognosis according to early t1-weighted mri - based classification are shown in table 3 . The mean vertebral body height loss was 39.3% in the type 1 group, 31.7% in the type 2 group, and 29.2% in the type 3 group . The mean vertebral body height loss was higher in type 1 bone marrow edema pattern on t1wi, but the difference was not statistical significant (p=0.113). However, the incidence of severe degree vertebral body height loss (height reduction more than 40%) was significantly higher in the type 1 group (53.9%) than in type 2 group (28.6%) or type 3 group (37.1%). Also the incidence of vertebral osteonecrosis and spinal stenosis was significantly higher in the type 1 group than in others . Among 26 subjects of the type 1 group, 9 (34.6%) showed vertebral osteonecrosis, among 14 subjects of the type 2 group, 1 (7.1%) showed and among 35 subjects of the type 3 group, 2 (5.7%) showed . The difference was statistical significant (p<0.001). Among 26 subjects of the type 1 group, 16 (61.5%) showed spinal stenosis, among 14 subjects of the type 2 group, 1 (7.1%) showed and among 35 subjects of the type 3 group, 6 (17.1%) showed . The diagnosis of the ovcf may be suspected during the clinical evaluation and confirmed with radiologic findings such as radiography, ct and mri . Morphologic features of ovcfs include the height reduction in vertebral bodies and various vertebral body deformities on plain radiographies . But due to inadequate film quality false - negative rates of plain radiography from 27% to 45% were reported in previous studies12). The ct is one of the most suitable imaging techniques for the evaluation of bone structures can be used to establish the degree of cortical bone destruction . The mri is considered as useful for the differentiation between chronic and acute fractures and for early diagnosis especially, because the bone marrow edema which are associated with fractures of the vertebral body are clearly shown as si changes . Patients with ovcfs were managed with conservative treatments, including pain control, short period of bed rest and a brace regularly . The most of the patients showed a successful pain relief 3 months after the fracture921). Some patients who the conservative management failed and the pain continued because of a severe degree vertebral body height loss or kyphosis may be candidates for invasive therapies such a vertebroplasty, balloon kyphoplasty and posterior lumbar interbody fusion (plif). The patients with ovcf that have> 40% loss of vertebral height loss, or> 30 degrees of kyphosis often can be treated with surgical intervention15). However no obvious consensus has been reached yet about the surgical indications in the ovcfs treatment with the after failure of conservative management exemption . Therefore if vertebral deformity types and degrees of ovcf can be predicted at early stage, more active treatment can be initiated relatively early . In this study acute ovcfs were classified into three types of low si pattern according to the early bone marrow edema pattern on t1wi and the relationship between the low si pattern and final vertebral deformity types of ovcfs on follow up mri were assessed on the follow . Differences of the final vertebral deformity types of ovcfs according to the early bone marrow edema pattern on t1wi were statistical significant (p<0.001). Especially, when the acute ovcfs showed diffuse low si on t1wi, the most frequent vertebral deformity type on the follow up mri was the posterior portion of vertebral body height loss or an entire height reduction with retropulsed fragment at the posterior wall of the vertebral body . In addition, in the present study, the severe degree vertebral body height loss (height reduction more than 40%) was more frequent in patients with diffuse low si pattern on t1wi of initial mri . According to previous study, higher rates of initial vertebral collapse (more than 28.5%) are known as risk factors for conservative treatment failures in patients with ovcf10). Also, associated vertebral osteonecrosis and spinal stenosis was more frequent in patients with diffuse low si pattern on t1wi of initial mri . These results were similar to the results of a previous study reported by kanchiku at al.7), where the relationship between si patterns of ovcfs based on mri and patient's outcome were examined . In that study the signal changes of ovcfs were classified into six types based on t1wi in the center of the vertebral bodies (total, anterior, posterior, superior, inferior, and central). There was found no intraspinal protrusion in the inferior and superior types and the neurological stability was achieved but otherwise there was found a high frequency of intraspinal protrusion in the total and posterior types . And ovcfs associated with vertebral osteonecrosis were known for their poor prognosis1418202223). Therefore, for subjects with acute ovcfs, especially with diffuse low si pattern on t1wi, an appropriate treatment based on a mri diagnosis of low si pattern early after the injury should be concerned to prevent the progression of the vertebral deformity or the affected vertebral body to a severe degree vertebral collapse . Like in the most retrospective studies, the mri follow up periods were not uniform for each patient . In addition, we only included patients who underwent conservative treatment and underwent follow up mri . A further limitation was the number of type 2 subjects compared to the numbers of type 1 or type 3 subjects . But to our knowledge, this report is the first study for a description of the relationship between the early bone marrow edema pattern on t1wi and the vertebral deformity types on follow up mri . It is also the first study for a prognosis evaluation for patients under the use of early bone marrow edema pattern on t1wi . In conclusion, early bone marrow edema pattern of ovcf on t1wi, significant correlated with vertebral deformity types on the follow up mri (p<0.001). Poor prognostic factors such as higher rates of vertebral body height loss, crush deformity and severe degree vertebral body height loss (height reduction more than 40%) on the follow up mri were more frequent in patients with diffuse low si type according to the early bone marrow edema pattern on t1wi . In addition, vertebral osteonecrosis and spinal stenosis on the follow up mri were more frequent in patients with diffuse low si type . Therefore the diffuse low si type according to the early bone marrow edema pattern on t1wi can be considered as one of the poor prognostic factors for the acute ovcfs.
The number of primary hip arthroplasties performed in the younger age patients escalates the demand for revision procedures . Revision procedures almost always pose the surgeon strife due to their complexity and level of competence needed . The crucial determinants in selection of a surgical procedure are the remnant bone stock and the nature of defect . We present the new technique of trabecular metal acetabular revision system (tmars) cup - cage construct to accomplish the massive acetabular bone defect in our case . A 29 year old male, college lecturer by profession, presented with pain in the left hip and inability to bear weight on left lower limb for 2 years, along with an active discharging sinus over the thigh . He was operated for giant cell tumor of the proximal femur 8 years back by excision and reconstruction by a custom made total hip replacement (thr) prosthesis . Routine blood investigations revealed elevated total leukocyte count, erythrocyte sedimentation rate (esr), and c - reactive protein (crp) levels . Radiographs revealed protrusion of the acetabular and femoral components into the pelvis through a breach in the acetabulum and loosening of prostheses, zones of lysis with extensive periosteal reaction in the remnant femur [figure 1]. Preoperative radiographs of left hip and thigh anteroposterior (a) and lateral views (b), showing a paprosky type 3b acetabular defect along with intrapelvic migration of acetabular and femoral component and areas of loosening all the investigations put together were suggestive of possible pelvic discontinuity and septic loosening of the prosthesis . The first stage consisted of removal of the prosthesis, debridement, and placement of an antibiotic cement spacer . Antibiotic cement was prepared by amalgamation of vancomycin powder (4 g in 40 g packet of cement) in gentamicin precontained cement (palacos r+g). A cement spacer in the shape of a sphere was made for the acetabulum and the femoral aspect was taken care by an antibiotic cement coated kuntscher nail inserted into the canal [figure 2a and b]. He was put on intravenous amikacin (750 mg once a day for first 5 days) and magnamycin (2 g twice a day) for 6 weeks and then switched over to oral cefuroxime (500 mg twice a day) for another 6 weeks . The followup esr and crp showed a downward trend at 6 weeks and returned to normal by 3 months . Then, the patient was planned for final reconstruction with proximal femoral allograft prosthesis composite for the femoral defect and trabecular metal shell (tm, zimmer, warsaw, in, usa) with cage for the acetabulum . Postoperative radiographs anteroposterior (a) and lateral views (b) following the initial debridement depicting the cement spacer in acetabulum and antibiotic cement coated k nail in the femoral canal the hip joint was exposed by a standard posterior approach . The cement spacer in the acetabulum was removed, thoroughly debrided, and acetabulum was assessed for size and type of defect . The native bone was present only in posterosuperior and inferomedial portions, constituting around 30% of the true acetabulum with conspicuous pelvic discontinuity . A homan retractor was placed in the obturator foramen which represents the level of inferior extent of the true acetabulum . The future hip center was identified by horizontal and vertical distances from this point as determined preoperatively from radiographs by comparison with the normal side . The acetabulum was prepared by graduated reaming until the appearance of bleeding bone and sized for the tm shell . The tm shell of the size of last reamer was impacted into the prepared acetabulum and then held in place by screws drilled into the posterosuperior portion of the cup . The cup was then assessed for stability with a kocher's clamp and it was not found to be satisfactory . Thus, the need of a cup - cage construct, which was suspected preoperatively by virtue of pelvic discontinuity, was corroborated by intraoperative assessment . A cup - cage construct using tmars cage (zimmer) was fashioned to secure the tm shell in place till osteointegration . The ischium was exposed and a slot was prepared by an osteotome for placement of inferior flange of the cage . The ilium in the posterosuperior portion of the acetabulum was also adequately exposed to receive the superior flange of the cage . The appropriate sized tmars cage was selected and flanges were contoured to seat on the patient's ilium and ischium . The cage was embedded onto the tm shell and held in place by inferior flange in the slot in ischium and screws were drilled into the ilium in the superior flange . Best press fit, maximum contact with the host bone, and adequate stability of the cage dictated the ultimate orientation of the construct, i.e. In a more vertical position and relative retroversion . An appropriate sized liner was selected and cemented in position over the cup - cage construct with pressure in desired 45 abduction and 20 anteversion for maximum joint stability . Femoral reconstruction was done by allograft prosthesis composite after the removal of k nail [figure 3]. Intravenous antibiotic cefotaxime (1 g every 12 h) was administered for the first 5 days and then switched over to oral cefuroxime for another 10 days . Patient was mobilized non weight bearing with walker for the first 6 weeks and then partial weight bearing with crutches till the signs of radiographic union appeared, i.e. At 3 months . Hip abductor strengthening exercises were started from 8 weeks and he was allowed full weight bearing from 3 months . Immediate postoperative radiograph of pelvis with bilateral hips anteroposterior view following the second stage reconstruction illustrating a well - constructed acetabular and femoral defect with cup - cage construct and allograft prosthesis composite, anatomic restoration of the hip center, and equalization of limb length . The inferior flange of the cage had cut through the ischium followup radiographs at 30 months showed solid union of the allograft with the native bone on the femoral side and good consolidation on the acetabular aspect with no zones of radiolucency [figure 4a and b]. Followup radiographs of pelvis with bilateral hips anteroposterior view (a) and left thigh (b) at 30 months showing good osteointegration on the acetabular aspect and solid graft host bone union on the femoral side with no displacement of constructs the cement spacer in the acetabulum was removed, thoroughly debrided, and acetabulum was assessed for size and type of defect . The native bone was present only in posterosuperior and inferomedial portions, constituting around 30% of the true acetabulum with conspicuous pelvic discontinuity . A homan retractor was placed in the obturator foramen which represents the level of inferior extent of the true acetabulum . The future hip center was identified by horizontal and vertical distances from this point as determined preoperatively from radiographs by comparison with the normal side . The acetabulum was prepared by graduated reaming until the appearance of bleeding bone and sized for the tm shell . The tm shell of the size of last reamer was impacted into the prepared acetabulum and then held in place by screws drilled into the posterosuperior portion of the cup . The cup was then assessed for stability with a kocher's clamp and it was not found to be satisfactory . Thus, the need of a cup - cage construct, which was suspected preoperatively by virtue of pelvic discontinuity, was corroborated by intraoperative assessment . A cup - cage construct using tmars cage (zimmer) was fashioned to secure the tm shell in place till osteointegration . The ischium was exposed and a slot was prepared by an osteotome for placement of inferior flange of the cage . The ilium in the posterosuperior portion of the acetabulum was also adequately exposed to receive the superior flange of the cage . The appropriate sized tmars cage was selected and flanges were contoured to seat on the patient's ilium and ischium . The cage was embedded onto the tm shell and held in place by inferior flange in the slot in ischium and screws were drilled into the ilium in the superior flange . Best press fit, maximum contact with the host bone, and adequate stability of the cage dictated the ultimate orientation of the construct, i.e. In a more vertical position and relative retroversion . An appropriate sized liner was selected and cemented in position over the cup - cage construct with pressure in desired 45 abduction and 20 anteversion for maximum joint stability . Femoral reconstruction was done by allograft prosthesis composite after the removal of k nail [figure 3]. Intravenous antibiotic cefotaxime (1 g every 12 h) was administered for the first 5 days and then switched over to oral cefuroxime for another 10 days . Patient was mobilized non weight bearing with walker for the first 6 weeks and then partial weight bearing with crutches till the signs of radiographic union appeared, i.e. At 3 months . Hip abductor strengthening exercises were started from 8 weeks and he was allowed full weight bearing from 3 months . Immediate postoperative radiograph of pelvis with bilateral hips anteroposterior view following the second stage reconstruction illustrating a well - constructed acetabular and femoral defect with cup - cage construct and allograft prosthesis composite, anatomic restoration of the hip center, and equalization of limb length . The inferior flange of the cage had cut through the ischium followup radiographs at 30 months showed solid union of the allograft with the native bone on the femoral side and good consolidation on the acetabular aspect with no zones of radiolucency [figure 4a and b]. Followup radiographs of pelvis with bilateral hips anteroposterior view (a) and left thigh (b) at 30 months showing good osteointegration on the acetabular aspect and solid graft host bone union on the femoral side with no displacement of constructs the management of an infected thr with a bone defect is almost always an arduous mission to the treating surgeon . The problems confronted in these cases would be infection on precedence, followed by the bone defect . We resorted to two stage procedure is the gold standard of care with promising results to affray infection.13 comparable results have been proclaimed even with single stage revision.45 we resorted to two stage procedure due to non availability of special incubation techniques for impregnation of antibiotics into the allograft and lack of clinical experience with the same . The option of allograft prosthesis for the proximal femoral defect was straightforward and driven by the evidence in literature.67 anatomic restoration of the hip center and stability are the prime factors which govern the outcome in any hip replacement surgery . Proper placement of an acetabular component close to native hip center in these settings could be possible only with use of cages and allograft, i.e. By procurement of an enduring bony substratum which can guard the new acetabular component . However, there have been many controversies regarding the ideal treatment for the acetabular bone defects encountered in revision situations . Situations in which there is> 50% available bone stock can be managed by uncemented cups and morselized allografts with good outcomes.810 conflict arises in the setting of acetabular bone defect more than 50% . Traditionally in the past, rings and cages had been used in combination with allograft to address these bone defects . Literature unveils mediocre results with the use of cages and failure rates reaching up to 25% at 57 years.1112 rings and cages provide only initial stability and do not have a surface that permits osteointegration . So, the allograft should unite with the host bone and osteointegration should take place by the time the cage loses its initial strength . This contention gets complicated in the midst of infection, graft collapse, and resorption, which are more common with allograft.1314 the use of allograft provides an advantage of restoration of the bone stock even in the case where future revision is necessary . The advent of tm shell technology has changed the face of revision arthroplasty . The porous tantalum is used in this technology and it is the only material which simulates the native bone . The properties of high porosity (80%), coefficient of friction, and intrinsic strength provide greater stability and an environment conducive for bone in growth.15 tm cups have bestowed excellent short to mid term results . Unger et al . Have reported a failure rate of 2% at a mean followup of 42 months with the use of tm cups in contained and segmental defects.16 lakstein et al . Advocated the use of tm cups in contained defects with <50% host bone contact, with their results of success rate being 96% at a mean followup of 4 years.17 the indications of tm cups have broadened to address even the massive uncontained defects with augments and cup - cage constructs . Cup - cage construct was first described by hanssen and lawellan.18 this employs an ilio - ischial cage which allows for permanent anchorage by bone in growth and provides a good support for the tm cup till osteointegration . The stresses are relieved from cage after the osteointegration of the cup, and thus may defeat the cage failures . Summary of reports which employed the trabecular metal cup - cage construct there are many constraints in a developing country like india, which may limit the appositeness of the above principles in all cases of failed hip replacements . They include high costs of surgery and nonavailability of the suitable implant and allograft . However, a routinely available, less expensive burch schneider cage might serve the purpose of provision of initial stability for the tm cup and substitute the role of a tmars cage . Burch schneider cage is also made of pure titanium (protasul - ti) like tmars cage and is rough - blasted on the side facing bone . Tmars cage caters the advantage by its modularity, flexibility, and design . However, there is not yet any published study elucidating the use of burch schneider cage in cup - cage construct . The cup - cage construct carries the theoretical advantages in comparison to the allograft for the reconstruction of massive acetabular bone defects . This new technique has come up with encouraging short term results [table 1] and invokes comparative trials with long term followup . Thus, the cup - cage construct may mitigate the need of allografts for reconstruction of acetabulum in future.21
Freshwater fishes contain saturated fatty acids (safas), monounsaturated fatty acids (mufas), and long - chain polyunsaturated fatty acids (pufas) that have significant role in human health . Polyunsaturated fatty acids (pufas) are particularly important due to their ability to prevent cardiovascular disease, psychiatric disorders, and some other illnesses such as atherosclerosis, thrombogenesis, high blood pressure, cancer, and skin diseases . Pufas are commonly categorized into two main groups omega 3 (3) and omega 6 (6) depending on the position of the first double bond from the methyl end group of the fatty acid . The main 3 pufas playing important role in human health include -linolenic acid (ala), docosahexaenoic acid (dha), eicosapentaenoic acid (epa), and docosapentaenoic acid (dpa) and 6 pufas include linoleic acid (la) and arachidonic acid (ara). These pufas are not synthesized in the human body and therefore inclusion in human diets is a necessity . Ultimately, it is important to take a proactive approach to ensure sustained access and uptake of pufas for proper maintenance of our health . The variation in fa of fish is due to diet consumed, reproductive cycle, temperature, season, and geographical location [47]. Nile perch lates niloticus, nile tilapia oreochromis niloticus, tilapia zillii, and rastrineobola argentea fishes constitute great resources for communities living around lake victoria . The fishes are widely distributed throughout the lake representing the most fished species for human consumption . They have significant commercial and ecological roles in the lake ecosystem and aquaculture potential particularly for oreochromis niloticus and tilapia zillii [10, 11]. The nutritional quality of these species in the area is important for rural communities since they are crucial diets and provide livelihoods subsequently influencing community health . Previous studies on fas of fish species in lake victoria have concentrated on growth stages and general proximate analysis particularly in kenyan and ugandan waters of lake victoria . Kizza et al . Analyzed the lipid content and fa profiles of lates species whereas turon et al . The fa compositions of muscle and heart tissue of nile perch, lates niloticus, and nile tilapia, oreochromis niloticus, in lakes victoria and kioga have been investigated by kwetegyeka et al . . Mwanja et al . Characterized the fish oils of mukene (rastrineobola argentea) of nile basin waters, lake victoria, lake kyoga, and the nile river . Established the fa profiles of the eggs and juvenile muscle of nile perch (lates niloticus). The use of fa profile of the polar fraction as a taxonomic marker for nile perch lates niloticus, nile tilapia oreochromis niloticus, marbled lungfish protopterus aethiopicus, bagrus docmak, and african catfish clarias gariepinus was compared by kwetegyeka et al . . The effects of heavy metal pollution on 3 pufas levels in tilapia fish from winam gulf of lake victoria were explored by muinde et al . . The proximate composition of rastrineobola argentea (dagaa) of lake victoria - kenya has been analyzed by ogonda et al . . Although these studies have been conducted in lake victoria, none was carried out in the tanzanian waters . Moreover, there is lack of information on the composition and levels of pufas of freshwater fish species at different trophic levels in lake victoria . Limited literature is available on the fa profile of tilapia zillii although it is among the most consumed fish around lake victoria . The only data available in this species is that from olagunju et al . In nigeria who analyzed the nutrient composition of tilapia zillii . The present study investigated the types and levels of 3 pufas in four different species, nile perch (lates niloticus), nile tilapia (oreochromis niloticus), tilapia zillii, and dagaa (rastrineobola argentea) in mwanza gulf of lake victoria . A total of 48 individual species of lates niloticus, oreochromis niloticus, tilapia zillii, and rastrineobola argentea were collected from mwanza gulf and morphologically identified using keys given by eccles and skelton . After collection each sample was stored in plastic bags and preserved by using dry ice while still in the boat and later frozen at 20c . Frozen samples were shifted by airplane to the zoology laboratory at the university of dar es salaam for analysis . In the laboratory, the fish samples were thawed to remove the ice for easy cutting of tissues . Each individual fish was cut, starting from the upper part below the dorsal fin down to the abdomen . Sample tissues were washed in water to remove blood and dried with a tissue paper to remove excess water . For each sample extraction of lipid was done by using methanol and chloroform at a ratio of 2: 1 and mixed by a vortex for 2 minutes . The samples were then stored in a refrigerator for two days to speed up extraction of lipid . Addition of extra 1: 1 methanol to chloroform was done to extract the remaining lipids from the tissues . The two layers formed by fish tissues (lipids and aqueous solution) were separated by using a separating funnel to obtain lipids followed by addition of sodium sulphate to remove traces of water from the lipids . Evaporation to remove chloroform was done locally in air conditioned room at 16c for 24 hours . Five (5) mg of lipid was suspended in 1 ml toluene prior to derivatization . Then, 2 mls of methanoic sulphuric acids (1% v / v) was added to each sample in vials and sealed . The samples were heated in a stopper tube at a temperature of 50c overnight for 16 hours to speed up the reaction . This was followed by addition of 2 mls of water containing sodium bicarbonate (2%: w / v) to each sample to neutralize the acids . Extractions of product were done by addition of hexane / diethyl ester (1: 1, by vol; 2 5 m). Evaporation to remove acids was done locally in air conditioned room at 16c for 48 hours . The determination of types and levels of omega 3 pufas was done by using a gas chromatograph mass spectrometer (gc - ms - qp2010 ultra), which was equipped with flame ionization detector (fid). 1 l of fame in hexane was injected into the gc - ms in a split ratio 1.0 . Helium was used as the carrier gas at a flow rate of 2 ml / min . Temperature was programmed as follows: column oven was set at 90c, held for 2 minutes, and then increased to 260c and held for 5 minutes and total time was 41 minutes . The 3 pufas (ala, epa, and dpa) were identified by comparing their retention time with those of commercial standards . The data is presented as mean standard error and was tested for homogeneity of variances using levene's test . Then the data was analyzed by using one way analysis of variance (anova) to compare the levels of 3 pufas . Tukey's hsd multiple comparisons test was done to evaluate specific differences in the levels of the selected 3 pufas in the four fish species all analyses were done using statistical package for social science (spss) version 20 for windows . A total of 36 fas were identified in the four commercial species of fish from mwanza gulf of lake victoria (table 1). The unsaturated fas were relatively many (27) compared to safas (9). The most dominant safas were palmitic acid, pentadecanoic acid, stearic (octadecanoic) acid, tetracosanoic acid, and heptadecanoic acid . Twenty (20) of the 27 unsaturated fas were pufas and 7 were mufas . Among the 20 types of pufas, the 3 pufas were relatively more abundant (8), followed by 6 pufas (7). The dominant 3 pufas were docosatrienoic, docosapentaenoic, docosahexaenoic, eicosapentaenoic, and eicosatetraenoic acids . The 9 pufas and mufas were dominated by eicosadienoic acid and oleic acid, respectively . O. niloticus had comparatively the highest number of fas particularly in mufas, 3 pufas, and 6 pufas and other unsaturated fas compared to l. niloticus, t. zillii, and r. argentea (figure 1). Some of the types of fas that were found only in o. niloticus included hexadecadienoic acid, alpha linolenic acid, 9-tetradecenoic acid, 11-tetradecenoate, and 11, 13-eicosadienoic acid (table 1). The dominant 3 pufas in all four sampled commercial fish species were docosatrienoic acid, docosahexaenoic acid, docosapentaenoic acid, eicosapentaenoic acid, and eicosatetraenoic acid (table 2). Similar to types of fas, o. niloticus recorded more types of 3 pufas (8 equivalent to 31%) than l. niloticus (7), t. zillii (7), and r. argentea (4) (figure 2). The results showed a significant difference in epa levels among the four commercial fish species (f = 6.19, p = 0.001). Tukey's hsd multiple comparisons test showed significant higher levels of epa in r. argentea than o. niloticus (p = 0.001), t. zillii (p = 0.036), and l. niloticus (p = 0.009). The dpa levels were not significantly different among the four commercial species (f = 0.652, p = 0.583). This study found 36 types of fas with different saturation levels in the four commercial fish species . These results are reasonably similar to those obtained by mohamed and al - sabahi . In their study out of the 36 fas, the saturated safas were 9 (25%) and unsaturated ones were 27 (75%) which included 20 pufas and 7 mufas . The dominant unsaturated fas were octadecanoic acid, arachidonic acid, docosapentaenoic acid, eicosapentaenoic and docosahexaenoic acid, and oleic acid . The existence of more unsaturated fas than saturated fas in the fish samples is similar to mwanja et al . Who obtained more categories of unsaturated fas (53.91%) than saturated fas (46.24%) in r. argentea . The dominant unsaturated fas in this study are similar to those obtained by zenebe et al . Mohamed and al - sabahi, osibona, grgn and akpinar, effiong and fakunle, and muinde et al . . The more unsaturated fas than saturated fas obtained in this study are probably due to their natural ubiquitous occurrence . Freshwater species are known to contain appreciable amount of unsaturated fas and sometimes more than saturated ones [15, 24]. The dominant 3 pufas found in all four commercial fish species were of epa, dpa, and dha . This finding is similar to zenebe et al . And grgn and akpinar who described that the most abundant fas in freshwater species are epa and dha . The domination of these 3 pufas might be attributed to the feeding habit of the four species . The three species (r. argentea, o. niloticus, and tilapia zillii) feed lower in the food chain mainly on microalgae (diatoms and dinoflagellates) which are excellent sources of epa, dpa, and dha . For example, a study by mfilinge et al . And meziane et al . Reported that diatoms and dinoflagellates contain higher concentrations of epa and dha, respectively, and have been used as markers of diatoms and dinoflagellates in the aquatic food web . O. niloticus and r. argentea are the major prey of l. niloticus in lake victoria [33, 34]. Equally, t. zillii which has relative similar size and shape is also consumed by l. niloticus . Based on this feeding chain, it is more likely that the epa, dpa, and dha contained in the herbivorous fish species were transferred to the carnivorous ones via the food chain . The present results showed that o. niloticus had relatively more types of 3 pufas than the other species, t. zillii, l. niloticus, and r. argentea . The more types of 3 pufas in o. niloticus might be attributed to the diverse food items consumed by the fish . O. niloticus is an omnivorous fish consuming diverse species of phytoplankton, insects, and juveniles fish . A study by rumisha and nehemia reported that o. niloticus feeds primarily on cyanophyta, diatoms, dinoflagellates, desmids, and green algae . It has also been found to expand its diet from plant materials to include insects and fish . The fas composition reflects the composition of the diet, because you are what you eat . Thus, expansion of diet and diversity of microalgae species contribute to o. niloticus having more types of 3 pufas which are beneficial for the health of consumers as well as fish . The other three species, l. niloticus, r. argentea, and t. zillii, have specialized feeding as they increase in size . L. niloticus is a predator that feeds on fish (including its own species), crustaceans, and insects . R. argentea is zooplanktivorous feeding on zooplankton, surface insects, chironomids, and the prawns (caridina nilotica). T. zillii adults feed on phytoplankton, detritus, and macrophytes . Due to their specialized feeding, they limit the diversity of food and therefore pufas compared to the omnivorous o. niloticus . In addition, more types of 3 pufas in o. niloticus could be as a result of desaturation and elongation of fas . The ability to elongate and desaturate fas is not the same in all species of fish . O. niloticus have the ability to bioconvert stearic acid, oleic acid, and other fas, which belong to group c:18 fas, to highly unsaturated fas . For example, arachidonic fa (20:4n-6) is a product of an elongation and desaturation of metabolic precursor of linoleic acid (18:2n-6), whereas epa and dha their metabolic precursor are alpha linolenic acid . Stearic acid, oleic acid, and other c:18 groups were found to be dominant fas, contributing to higher composition of fas in o. niloticus . By virtue of this capability, classified o. niloticus as an excellent source of 3 pufas and being ideal for production of 3 supplements . The present study indicated that r. argentea have relatively higher levels of both epa and dpa . This finding is contrary to mwanja et al . Who found low levels of epa in r. argentea . In this study the higher levels of epa and dpa in r. argentea could be attributed to its feeding behavior . Adult r. argentea explore the bottom zone during daytime which is the habitat for zooplankton and macrobenthic invertebrates . Furthermore, the relatively higher levels of epa and dpa in r. argentea may also be attributed to the swimming mode and pattern . R. argentea is a slow swimmer commonly exhibiting vertical movements for avoidance of predators in search for food . On the contrary, o. niloticus, t. zillii, and l. niloticus are fast swimmers utilizing more energy for movements against current . For this reason it is more likely for r. argentea to conserve more epa and dpa, which account for higher levels of these fas than those in the other species . Thus fish consumers should eat more r. argentea due to its high nutritional value and low selling price . The current study identified 36 fas in four commercial species of fish from mwanza gulf of lake victoria . O. niloticus was found to contain more types of fas and 3 pufas than l. niloticus, t. zillii, and r. argentea . Moreover, r. argentea has significantly and relatively higher levels of epa and dpa than the other three commercial fish species from mwanza gulf of lake victoria . Thus fish consumers should eat more o. niloticus to get a variety of fas types and r. argentea to obtain high levels of epa and dpa.
The global burden of disease 2004 data estimated that 186 million (2.9%) of the world s population were severely disabled and another 797 million (12.4%) had moderate long - term disability . The average global prevalence of moderate and severe disability in children is 93 million (5.1%). However, the situation with regard to children with disabilities has often been neglected . The proportion of children among all age groups suffering both moderate and severe disability is higher in low- and middle - income countries than in high - income countries . Previous research on childhood disability in low- and middle - income countries focused on intellectual and hearing disabilities, and little is known about other types of disabilities . Presence of disability is considered as a key component of quality - of - life evaluation . Children with disabilities continue to face discrimination and restricted access to social services up to adulthood . For example, vision problems correctable by glasses accounted for 40 percent of disabled children not attending school in brazil . Development of principles and standard scales for disabilities that are sensitive to cultural and resource differences has long been desired . After the united nations international seminar on measurement of disability in 2001, the washington group on disability statistics (washington group) was formed under united nations sponsorship and developed a set of general disability measures that have been used by several countries in censuses and surveys . The questions use the world health organization s international classification of functioning, disability, and health as a conceptual framework and focus on functioning in basic actions . The disability status of the population has been a concern in vietnam due to prolonged periods of war . In 2006, the washington group disability measures were translated into vietnamese and included in the questionnaire of the vietnam household living standard survey . Economic burden had been expressed as a percentage of health - care expenditure relative to household income, with the rationale that a high percentage means that it is likely to force household members to cut their consumption of other minimum needs, trigger productive asset sales or high levels of debt, and lead to impoverishment . A study on data from the world health survey in 20022004 in 14 developing countries showed that households with disabilities experienced higher ratios of health - care to total household expenditure than households without disabilities in two - thirds of countries . Although the vietnamese government is developing a universal health insurance system, households with members suffering disabilities have to pay extra expenses for examination, treatment, rehabilitation, and other costs related to health - care use . Further, the disability statuses of children differ according to the socioeconomic statuses of their families . Data from the world health surveys in 14 countries showed that persons with disabilities are significantly worse off in two or more dimensions of economic well - being (education, employment, assets / living conditions, household expenditures, and household expenditures on health care). On the other hand, study of the multiple indicator cluster survey data in 20 countries did not indicate a consistent relationship . Pattern of associations differ by countries and type of disabilities; there are still controversial issues that need to be resolved based on evidence . The objectives of this study were to assess the economic burden of disability in different functional domains among school - aged children in vietnam and to evaluate the association between presence of disability and demographic and household characteristics of children, as well as between economic burden of disability and demographic and household characteristics of children, using a large national representative sample . The vietnam household living standard survey has been conducted nationwide by the general statistics office, ministry of planning and investment, vietnam in 1993, 1998 and every 2 years since 2002 . Survey households were chosen using a multistage stratified cluster sampling process in which representative clusters were selected from all 64 provinces in vietnam, and a random sample of households was selected within each cluster . Information collected regularly in every survey included basic demographic characteristics, educational attainment, health care use, and employment for all household members; household income and expenditure; and housing condition . Information was collected through face - to - face interviews with household heads, and key commune officials . The survey employed intensive interviewer training, standardized measurement tools and techniques, and instrument pretesting . The reason for selecting the survey conducted in 2006 was that it was the latest survey that had collected information about disability . The survey was conducted among a total of 9,189 households in may and september 2006 . Use of the vietnam household living standard survey data for this study was approved by the general statistics office, ministry of planning and investment, vietnam . The data set used in this study was provided by the general statistics office and did not contain personally identifiable information . Two types of main outcome variable were presence of difficulties that were result of some physical or mental health problems, and health - care expenditure in the past 12 months . Presence of difficulties was assessed according to the standard set of questions recommended by the washington group . The validity of this scale in the surveys in asian and pacific countries confirmed previously . The questions aimed to identify difficulties in six functional domains: vision (vision difficulties or problems), hearing (hearing limitation or problems), remembering or concentrating (problems with remembering or thinking that contribute to difficulty in doing daily activities), mobility (limitation or problems getting around on foot), self - care (problems with taking care of yourself independently), and communication (problems with talking, listening, or understanding speech such that it contributes to difficulty in doing daily activities). Furthermore, the response categories captured the degree or severity of the difficulty; the response options were no, at least some difficulty, at least a lot of difficulty, and unable to do it at all . In this study, we dichotomized the response into no and yes (at least some difficulty or more). Information regarding expenses related to use of medical services was collected for each household member who had used health - care services in the past 12 months . The expenses included out - of - pocket payment for medical service, treatment, and other related costs, such as bonuses for medical staff, and transportation fees . The unit of measurement was 1000 vietnamese dong (vnd) (equivalent to 0.063 - 0.066 united states dollars during the survey periods). We did not include payment for non - prescribed medicine, medical tools, health insurance, and aid, because information about them was not collected at the individual level . Independent variables included sex, age, area (urban, and rural), household income in the past 12 months, educational attainment, and occupation of household head . Age was categorized into three groups: 610, 1114, and 1517 years, each corresponding to modal age for a primary school, a lower secondary school, and an upper secondary school, respectively . Household income was calculated as total household revenue minus total expenditure for the revenue - generating activities and divided into quintiles . We analyzed all children (n=9,882) between 6 and 17 years of age in survey households . The analysis did not account for the intra - household correlation because a small proportion of households (7.6%) had more than one child with disabilities . The data set included the household sampling weight for each household, which had been calculated as the inverse of its household selection probability . We used the weight to take into account the multistage sampling design for all analyses . The prevalence of difficulty in six functional domains was calculated by sex, age, area, household income, educational attainment, and occupation of household head . The difference in prevalence by these characteristics was assessed with a logistic regression analysis . The multivariable logistic regression analysis required ten cases per independent indicator variable in the model . In the subsequent analysis, a combined variable for difficulty in hearing, remembering or concentrating, mobility, self - care, or communication was used instead of using separate variables for difficulty in each domain . The frequency of having difficulty in vision was high enough for a multivariable analysis, and this domain was not combined . The per capita household income was calculated by dividing household income by the number of household members . Then the ratio of the mean health - care expenditure to the mean per capita household income in the past 12 months was computed for each difficulty status . To compare the ratio by difficulty status, a dichotomous variable to indicate whether the ratio was greater than 0.05 or not was created and used as a dependent variable in the logistic regression models . The choice of 0.05 was based on the lower threshold value for catastrophic impact of health - care expenditure share used by van doorslaer . The ratio of the mean health - care expenditure to the mean per capita household income was also compared by characteristics of subjects among all children, among children with difficulty in vision, and among children with difficulty in hearing, remembering or concentrating, mobility, self - care, or communication . The odds ratio was adjusted for sex, age, area, household income in the past 12 months, educational attainment, and occupation of household head . The vietnam household living standard survey has been conducted nationwide by the general statistics office, ministry of planning and investment, vietnam in 1993, 1998 and every 2 years since 2002 . Survey households were chosen using a multistage stratified cluster sampling process in which representative clusters were selected from all 64 provinces in vietnam, and a random sample of households was selected within each cluster . Information collected regularly in every survey included basic demographic characteristics, educational attainment, health care use, and employment for all household members; household income and expenditure; and housing condition . Information was collected through face - to - face interviews with household heads, and key commune officials . The survey employed intensive interviewer training, standardized measurement tools and techniques, and instrument pretesting . The reason for selecting the survey conducted in 2006 was that it was the latest survey that had collected information about disability . The survey was conducted among a total of 9,189 households in may and september 2006 . Use of the vietnam household living standard survey data for this study was approved by the general statistics office, ministry of planning and investment, vietnam . The data set used in this study was provided by the general statistics office and did not contain personally identifiable information . Two types of main outcome variable were presence of difficulties that were result of some physical or mental health problems, and health - care expenditure in the past 12 months . Presence of difficulties was assessed according to the standard set of questions recommended by the washington group . The validity of this scale in the surveys in asian and pacific countries confirmed previously . The questions aimed to identify difficulties in six functional domains: vision (vision difficulties or problems), hearing (hearing limitation or problems), remembering or concentrating (problems with remembering or thinking that contribute to difficulty in doing daily activities), mobility (limitation or problems getting around on foot), self - care (problems with taking care of yourself independently), and communication (problems with talking, listening, or understanding speech such that it contributes to difficulty in doing daily activities). Furthermore, the response categories captured the degree or severity of the difficulty; the response options were no, at least some difficulty, at least a lot of difficulty, and unable to do it at all . In this study, we dichotomized the response into no and yes (at least some difficulty or more). Information regarding expenses related to use of medical services was collected for each household member who had used health - care services in the past 12 months . The expenses included out - of - pocket payment for medical service, treatment, and other related costs, such as bonuses for medical staff, and transportation fees . The unit of measurement was 1000 vietnamese dong (vnd) (equivalent to 0.063 - 0.066 united states dollars during the survey periods). We did not include payment for non - prescribed medicine, medical tools, health insurance, and aid, because information about them was not collected at the individual level . Independent variables included sex, age, area (urban, and rural), household income in the past 12 months, educational attainment, and occupation of household head . Age was categorized into three groups: 610, 1114, and 1517 years, each corresponding to modal age for a primary school, a lower secondary school, and an upper secondary school, respectively . Household income was calculated as total household revenue minus total expenditure for the revenue - generating activities and divided into quintiles . We analyzed all children (n=9,882) between 6 and 17 years of age in survey households . The analysis did not account for the intra - household correlation because a small proportion of households (7.6%) had more than one child with disabilities . The data set included the household sampling weight for each household, which had been calculated as the inverse of its household selection probability . We used the weight to take into account the multistage sampling design for all analyses . The prevalence of difficulty in six functional domains was calculated by sex, age, area, household income, educational attainment, and occupation of household head . The difference in prevalence by these characteristics was assessed with a logistic regression analysis . The multivariable logistic regression analysis required ten cases per independent indicator variable in the model . In the subsequent analysis, a combined variable for difficulty in hearing, remembering or concentrating, mobility, self - care, or communication the frequency of having difficulty in vision was high enough for a multivariable analysis, and this domain was not combined . The per capita household income was calculated by dividing household income by the number of household members . Then the ratio of the mean health - care expenditure to the mean per capita household income in the past 12 months was computed for each difficulty status . To compare the ratio by difficulty status, a dichotomous variable to indicate whether the ratio was greater than 0.05 or not was created and used as a dependent variable in the logistic regression models . The choice of 0.05 was based on the lower threshold value for catastrophic impact of health - care expenditure share used by van doorslaer . The ratio of the mean health - care expenditure to the mean per capita household income was also compared by characteristics of subjects among all children, among children with difficulty in vision, and among children with difficulty in hearing, remembering or concentrating, mobility, self - care, or communication . The odds ratio was adjusted for sex, age, area, household income in the past 12 months, educational attainment, and occupation of household head . Among 9,882 children, 397 (4.0%) children had at least one type of disability . Table 1table 1prevalence of difficulty in six functional domains by demographic and household characteristics of childrennfunctional domainsvisionhearing, remembering or concentrating, mobility, self - care, or communicationtotalhearingrememberingor concentratingmobilityself - carecommunicationoverall9882186(1.9%)223(2.3%)49(0.5%)98(1.0%)58(0.6%)82(0.8%)93(0.9%)sexboy503271(1.4%)119(2.4%)27(0.5%)53(1.1%)29(0.6%)51(1.0%)52(1.0%)girl4850114(2.4%)104(2.1%)22(0.5%)45(0.9%)29(0.6%)31(0.6%)41(0.8%)p=0.002p=0.459p=0.614p=0.539p=0.849p=0.047p=0.328age6 - 10313233(1.1%)89(2.8%)16(0.5%)33(1.1%)12(0.4%)44(1.4%)31(1.0%)11 - 14364181(2.2%)63(1.7%)17(0.5%)32(0.9%)19(0.5%)19(0.5%)30(0.8%)15 - 17310972(2.3%)71(2.3%)16(0.5%)33(1.1%)27(0.9%)20(0.6%)31(1.0%)trendp<0.001trendp=0.197trendp=0.909trendp=0.979trendp=0.017trendp=0.003trendp=0.971areaurban2198104(4.7%)39(1.8%)8(0.4%)14(0.6%)12(0.6%)21(1.0%)13(0.6%)rural768482(1.1%)184(2.4%)41(0.5%)84(1.1%)46(0.6%)61(0.8%)80(1.0%)p<0.001p=0.090p=0.271p=0.066p=0.814p=0.484p=0.044household income1st quintile (lowest)254218(0.7%)82(3.2%)20(0.8%)35(1.4%)18(0.7%)26(1.0%)37(1.5%)2nd quintile234128(1.2%)60(2.6%)15(0.6%)30(1.3%)19(0.8%)19(0.8%)26(1.1%)3rd quintile194832(1.7%)35(1.8%)8(0.4%)17(0.9%)5(0.2%)12(0.6%)15(0.8%)4th quintile157542(2.7%)21(1.4%)4(0.3%)11(0.7%)5(0.3%)11(0.7%)7(0.4%)5th quintile (highest)147465(4.4%)24(1.6%)2(0.1%)5(0.3%)12(0.8%)13(0.9%)9(0.6%)trendp<0.001trendp<0.001trendvp<0.001trendp<0.001trendp=0.545trendp=0.503trendp=0.001educational attainment of household headprimary school graduate or none277938(1.4%)49(1.8%)16(0.6%)20(0.7%)10(0.4%)19(0.7%)16(0.6%)lower secondary school graduate312265(2.1%)79(2.5%)22(0.7%)43(1.4%)22(0.7%)24(0.8%)39(1.3%)upper secondary school graduate121944(3.6%)19(1.5%)2(0.2%)6(0.5%)7(0.6%)11(0.9%)2(0.2%)junior college degree, bachelor s degree, or higher276139(1.4%)76(2.8%)9(0.3%)29(1.0%)20(0.7%)28(1.0%)36(1.3%)trendp=0.523trendp=0.064trendp=0.054trendp=0.789trendp=0.151trendp=0.116trendp=0.079occupation of household headleaders, professionals, or staffs in any fields72535(4.8%)11(1.6%)2(0.3%)3(0.4%)7(1.0%)8(1.1%)3(0.4%)skilled workers in personal services and sales24510(3.9%)5(2.0%)2(0.8%)3(1.2%)002(0.8%)skilled workers in agriculture and fisheries4065(1.2%)8(2.0%)2(0.5%)5(1.2%)0(0.1%)2(0.4%)4(1.0%)skilled handicraftsman and other skilled manual workers109238(3.5%)18(1.6%)3(0.3%)10(0.9%)5(0.5%)6(0.5%)5(0.5%)assemblers and machine operators2695(1.9%)3(1.0%)2(0.7%)2(0.7%)1(0.4%)1(0.4%)1(0.4%)unskilled workers636076(1.2%)157(2.5%)35(0.6%)64(1.0%)43(0.7%)57(0.9%)66(1.0%)armed forces1801(4.4%)01(4.4%)1(4.4%)1(4.4%)1(4.4%)not working76718(2.3%)20(2.6%)3(0.4%)10(1.3%)1(0.2%)7(1.0%)10(1.3%)p<0.001p=0.402p=0.719p=0.582p=0.104p=0.442p=0.226data for per capita household income and educational attainment of the household head were missing in 2 cases and 1 case, respectively . Shows the prevalence of difficulty in six functional domains marginally and by demographic and household characteristics of the 9,882 children . The overall prevalence of difficulty were 1.9% for vision, 0.5% for hearing, 1.0% for remembering or concentrating, 0.6% for mobility, 0.8% for self - care, and 0.9% for communication . Data for per capita household income and educational attainment of the household head were missing in 2 cases and 1 case, respectively . Table 2table 2relation between having difficulties and demographic and household characteristics of childrendifficulties in visiondifficulties in hearing, remembering or concentrating, mobility, self - care or communicationor(95%ci)or(95%ci)sexboyreferencereferencegirl1.70(1.23, 2.37)p=0.0020.91(0.69, 1.20)p=0.513age610referencereference11142.10(1.35, 3.27)p=0.0010.61(0.43, 0.86)p=0.00415172.09(1.34, 3.28)p=0.0010.84(0.60, 1.18)p=0.319trend p=0.001trend p=0.300areaurbanreferencereferencerural0.34(0.23, 0.50)p<0.0011.04(0.69, 1.56)p=0.842household income1st quintile (lowest)referencereference2nd quintile1.35(0.73, 2.49)p=0.3330.83(0.58, 1.19)p=0.3013rd quintile1.50(0.82, 2.73)p=0.1840.60(0.39, 0.92)p=0.0204th quintile1.93(1.05, 3.55)p=0.0340.46(0.27, 0.77)p=0.0045th quintile (highest)2.54(1.39, 4.66)p=0.0030.55(0.32, 0.94)p=0.029trend p=0.001trend p=0.002educational attainment of household headprimary school graduate or nonereferencereferencelower secondary school graduate1.25(0.81, 1.93)p=0.3191.57(1.08, 2.27)p=0.017upper secondary school graduate1.30(0.77, 2.17)p=0.3271.08(0.59, 1.98)p=0.804junior college degree, bachelor s degree, or higher0.82(0.49, 1.35)p=0.4261.47(1.02, 2.11)p=0.040trend p=0.380trend p=0.124occupation of household headleaders, professionals, or staffs in any fieldsreferencereferenceskilled workers in personal services and sales0.87(0.38, 1.96)p=0.7311.17(0.39, 3.53)p=0.782skilled workers in agriculture and fisheries0.43(0.16, 1.21)p=0.1111.09(0.43, 2.76)p=0.858skilled handicraftsman and other skilled manual workers1.00(0.59, 1.70)p=0.9990.88(0.39, 1.97)p=0.757assemblers and machine operators0.36(0.13, 0.98)p=0.0450.63(0.17, 2.35)p=0.490unskilled workers0.48(0.29, 0.80)p=0.0041.19(0.62, 2.30)p=0.606armed forces3.27(0.38, 27.94)p=0.279not working0.67(0.33, 1.36)p=0.2631.32(0.59, 2.95)p=0.492the odds ratios were adjusted for all other characteristics . Shows the adjusted odds ratios of difficulties in vision as well as those in hearing, remembering or concentrating, mobility, self - care, or communication for each characteristics of subjects . Difficulties in vision were more prevalent among girls than boys, among children who were 1117 years of age than those who were 610 years of age, and in urban areas than rural areas . With regard to the association between difficulty and household income, the direction of association differed between difficulty in vision and difficulty in the other domains: household income of a child with difficulty in vision was higher than that of a child without difficulty in vision, whereas household income of a child with difficulty in domains other than vision was lower than that of a child without difficulty in domains other than vision . The odds ratios were adjusted for all other characteristics . With regard to all subjects, the average per capita household income was 7441.2 thousand vietnamese dong, or 469491 united states dollars; per capita total household expenditure was 5350.6 thousand dong, or 337353 dollars; and health - care expenditure was 95.0 thousand dong, or 6 dollars . Table 3table 3per capita household income and health - care expenditure in the past 12 monthsper capitahousehold income(1000 vnd) [a]health - careexpenditure(1000 vnd) [b][b]/[a][b]/[a]>0.05mean(sd)mean(sd)share of inpatientcare expenditure%or(95%ci)overall7441.2(9043.1)95.0(887.9)54.9%0.01284.6%children with difficulties in specific domainsvisionno7382.2(9052.6)81.3(709.5)53.4%0.01104.4%referenceyes10521.5(7969.7)807.4(3901.1)62.9%0.076714.6%4.78(2.95, 7.73)p<0.001p<0.001p<0.001hearing, remembering or concentrating, mobility, self - care, or communicationno7467.9(9059.6)83.3(792.7)50.2%0.01124.4%referenceyes6284.0(8234.2)601.0(2735.9)83.1%0.095613.3%3.13(2.04, 4.80)p<0.001p<0.001p<0.001hearingno7454.2(9061.6)94.8(888.4)54.9%0.01274.6%referenceyes4827.1(2777.5)133.6(783.7)54.2%0.02776.8%1.33(0.49, 3.62)p=0.578p<0.001p<0.001remembering or concentratingno7461.8(9073.7)91.6(845.4)53.6%0.01234.5%referenceyes5391.7(4743.5)430.1(2845.4)82.3%0.079814.3%3.22(1.78, 5.81)p<0.001p<0.001p<0.001mobilityno7441.8(9055.9)85.7(810)51.2%0.01154.5%referenceyes7341.7(6615.2)1656.5(4567.1)87.0%0.225624.8%7.49(3.90, 14.38)p<0.001p<0.001p<0.001self - careno7438.1(9014.6)86.7(807.7)51.3%0.01174.5%referenceyes7809.8(12029.1)1079.7(4023.4)89.7%0.138216.2%3.99(2.06, 7.74)p<0.001p<0.001p<0.001communicationno7460.0(9069.7)89.7(825.3)52.8%0.01204.5%referenceyes5456.8(5231.6)649.4(3447.4)84.8%0.119014.9%3.46(1.91, 6.28)p<0.001p<0.001p<0.001p - values compairing per capita household income or healthcare expenditure by difficulty status were obtained with mann - whitney u tests . The odds ratios compared the odds of [b]/[a]>0.05 between children with a specific disability and those without . The odds ratios were adjusted for sex, age, area, household income, and educational attainment and occupation of household head . Compares the ratio of health - care expenditure to per capita household income between children with a specific disability and those without . The proportion of children with a ratio greater than 0.05 was 4.6% and was higher among children with difficulty in vision, remembering or concentrating, mobility, self - care, and communication than those without these respective difficulties . Among children with difficulty in vision, both household income and health - care expenditure were higher among children without difficulty in vision, respectively . On the other hand, among children with difficulty in hearing, remembering or concentrating, mobility, self - care, or communication, household income was lower and health - care expenditure was higher than among children without difficulty, respectively . P - values compairing per capita household income or healthcare expenditure by difficulty status were obtained with mann - whitney u tests . The odds ratios compared the odds of [b]/[a]>0.05 between children with a specific disability and those without . The odds ratios were adjusted for sex, age, area, household income, and educational attainment and occupation of household head . Table 4table 4ratio of health - care expenditure to per capita household income among all children who were 617 years of ageper capita householdincome [a](1000 vnd)health - careexpenditure [b](1000 vnd)[b]/[a][b]/[a]>0.05mean(sd)mean(sd)%or(95%ci)overall7441.2(9043.1)95.0(887.8)0.01284.6%areaurban12349.6(13779.1)126.6(945.6)0.01034.0%referencerural6036.5(6480.7)86.0(870.4)0.01424.8%0.91(0.69, 1.22)p=0.535household income1st quintile (lowest)2607.1(642.9)44.8(448.6)0.01725.3%reference2nd quintile4324.0(465.6)91.3(746.9)0.02116.0%1.13(0.87, 1.45)p=0.3643rd quintile6215.7(642.9)130.5(1500.5)0.02104.6%0.82(0.61, 1.10)p=0.1914th quintile9090.6(1068.7)96.1(685)0.01063.0%0.52(0.36, 0.75)p=0.0015th quintile (highest)20582.2(17665.2)139.3(754)0.00683.0%0.53(0.36, 0.80)p=0.002trend p<0.001educational attainment of household headprimary school graduate or none6528.2(6541.5)84.6(681.4)0.01304.9%referencelower secondary school graduate7223.7(6977.3)107.5(1138.1)0.01494.8%1.03(0.80, 1.33)p=0.793upper secondary school graduate11528.2(14240.1)136.2(1135.5)0.01184.5%1.13(0.79, 1.63)p=0.497junior college degree, bachelor s degree, or higher6800.9(9819.9)73.2(564.8)0.01084.2%0.86(0.66, 1.13)p=0.279trend p=0.319occupation of household headleaders, professionals, or staffs in any fields14587.6(19354.9)120.7(693.7)0.00832.9%referenceskilled workers in personal services and sales12555.6(18497.1)142.9(929.3)0.01144.5%1.35(0.61, 2.99)p=0.459skilled workers in agriculture and fisheries8658.4(11815.4)99.3(548.3)0.01155.8%1.76(0.91, 3.41)p=0.092skilled handicraftsman and other skilled manual workers7300.0(5111.7)114.2(801.1)0.01565.2%1.45(0.82, 2.56)p=0.205assemblers and machine operators11464.5(9493.2)84.7(662.9)0.00743.9%1.25(0.53, 2.97)p=0.612unskilled workers6082.9(5630.6)92.5(992.7)0.01524.7%1.25(0.75, 2.10)p=0.389armed forces14426.3(5345.6)40.6(82.1)0.00280.0%not working8288.8(10242.1)51.9(157.5)0.00634.7%1.40(0.76, 2.58)p=0.280the odds ratios were adjusted for sex, age, and all other characteristics . Compares the ratio of health - care expenditure to per capita household income among all children who were 617 years of age by their characteristics . The proportion of children with a ratio being greater than 0.05 was higher among children from the poorer households . Table 5table 5ratio of health - care expenditure to per capita household income among children with difficulty in visionper capita householdincome [a](1000 vnd)health - careexpenditure [b](1000 vnd)[b]/[a][b]/[a]>0.05mean(sd)mean(sd)%or(95%ci)overall10521.5(7969.7)807.4(3901.1)0.076714.6%-areaurban13450.2(9074.0)308.2(1432.3)0.02298.0%referencerural6811.5(3937.7)1439.8(5603.3)0.211423.1%5.19(1.53, 17.60)p=0.008household income1st quintile (lowest)2941.3(498.8)296.4(1044.2)0.100816.6%reference2nd quintile4319.3(477.3)191.0(365.9)0.044223.3%2.29(0.41, 12.59)p=0.3423rd quintile6293.8(694.8)1665.8(7964.4)0.264710.7%0.83(0.11, 6.03)p=0.8534th quintile8979.4(900.8)705.1(2693.2)0.07859.4%0.87(0.15, 5.21)p=0.8805th quintile (highest)18369.0(8705.7)853.5(2665.9)0.046515.6%3.24(0.61, 17.27)p=0.168trend p=0.383educational attainment of household headprimary school graduate9437.2(9528.8)586.8(2222.6)0.062217.4%referencelower secondary school graduate8397.7(4406.0)1601.3(6128.6)0.190720.0%1.31(0.47, 3.64)p=0.611upper secondary school graduate14054.0(10112.1)197.9(343.0)0.01419.9%0.81(0.16, 4.07)p=0.796junior college degree, bachelor s degree, or higher11153.5(7011.5)392.1(2088.0)0.03528.4%0.51(0.11, 2.37)p=0.386trend p=0.303occupation of household headleaders, professionals, or staffs in any fields13808.2(5597.7)524.8(1932.6)0.03808.6%referenceskilled workers in personal services and sales12739.0(7626.8)1212.3(4290.6)0.09527.9%0.68(0.04, 12.59)p=0.798skilled workers in agriculture and fisheries7388.3(1640.2)1292.3(2707.2)0.174920.2%2.80(0.14, 54.00)p=0.496skilled handicraftsman and other skilled manual workers7424.0(4390.7)1068.1(3417.2)0.143917.1%1.08(0.17, 6.79)p=0.935assemblers and machine operators10534.1(3370.4)630.5(860.6)0.059941.9%9.18(0.95, 88.46)p=0.055unskilled workers9511.7(8433.8)876.3(5236.1)0.092116.8%1.15(0.21, 6.20)p=0.871not working14710.4(13221.9)205.4(290.6)0.01406.2%0.52(0.04, 7.47)p=0.628the odds ratios were adjusted for sex, age, and all other characteristics . Compares the ratio of health - care expenditure to per capita household income among children with difficulties in vision by their characteristics . In rural areas, household income was lower and health - care expenditure was higher compared with urban areas, among children with a difficulty in vision . The proportion of children with a ratio greater than 0.05 was higher in rural areas than urban areas . Table 6table 6ratio of health - care expenditure to per capita household income among children with difficulty in hearing, remembering or concentrating, mobility, self - care, or communicationper capita householdincome [a](1000 vnd)health - careexpenditure [b](1000 vnd)[b]/[a][b]/[a]>0.05mean(sd)mean(sd)%or(95%ci)overall6284.0(8234.2)601.0(2735.9)0.09613.3%areaurban12824.1(16921.9)282.8(675.7)0.02215.4%referencerural4907.6(3477.6)668.0(2991.4)0.13612.9%1.34 (0.29, 6.26)p=0.710household income1st quintile (lowest)2618.1(632.8)349.0(2097.2)0.13311.9%reference2nd quintile4322.5(506.4)749.1(2560.5)0.17317.0%1.05 (0.32, 3.43)p=0.9293rd quintile6222.9(687.4)937.6(4695.9)0.15111.1%0.15 (0.03, 0.86)p=0.0334th quintile9108.4(1140.7)61.4(85.8)0.0070.0%-5th quintile (highest)21188.9(18713.3)1074.0(2424)0.05124.0%0.59 (0.15, 2.23)p=0.432trend p=0.033educational attainment of household headprimary school graduate4801.7(3129.5)319.8(1365.7)0.06710.1%referencelower secondary school graduate5816.4(4466.5)861.3(3858.1)0.14814.2%1.40 (0.33, 5.85)p=0.648upper secondary school graduate11232.7(22455)1471.4(3432.9)0.13138.4%12.30 (2.29, 66.07)p=0.003junior college degree, bachelor s degree, or higher6515.3(6914.2)298.1(1508.6)0.0468.4%0.70 (0.13, 3.68)p=0.673trend p=0.972occupation of household headleaders, professionals, or staffs in all fields24946.8(26821.6)1751.4(3303.5)0.07028.6%referenceskilled workers in personal services and sales5541.4(1866.3)92.3(143.1)0.01725.7%1.40 (0.04, 43.55)p=0.848skilled workers in agriculture and fisheries6949.9(4327.8)1062.1(2487.6)0.15335.9%0.92 (0.10, 8.60)p=0.944skilled handicraftsman and other skilled manual workers6118.2(3232.9)264.8(378.6)0.04329.3%0.42 (0.05, 3.73)p=0.439assemblers and machine operators8885.6(5298.1)969.6(932.7)0.10972.2%-unskilled workers4917.6(4013.0)611.4(3070.9)0.1247.6%0.09 (0.01, 0.65)p=0.017armed forces10092.00.0 - 0.0%-not working5985.4(4888.2)79.9(121.6)0.01315.5%0.35 (0.02, 5.65)p=0.462the odds ratios were adjusted for sex, age, and all other characteristics . Compares the ratio of health - care expenditure to per capita household income among children with difficulties in hearing, remembering or concentrating, mobility, self - care, or communication by their characteristics . The proportion of children with a ratio greater than 0.05 was higher among children from the poorer households . The goodness - of - fit of the multivariable logistic regression model was higher for analysis in children with difficulties than in all children: the pseudo r of the multivariable logistic regression model was 0.013 among all children, 0.163 among children with difficulty in vision, and 0.231 among children with difficulty in hearing, remembering or concentrating, mobility, self - care, or communication . We used a large national representative sample to present the economic burden of disabilities by different functional domains among school - aged children and its association with demographic and household characteristics of children in vietnam . The ratio of health - care expenditure to per capita household income was higher among children who had a difficulty in vision, remembering or concentrating, mobility, self - care, or communication compared with those who did not have the respective difficulty . There was a relation between household income and the presence of difficulty in vision, as well as between household income and the presence of difficulty in hearing, remembering or concentrating, mobility, self - care, or communication: difficulty in vision was more prevalent in richer households; on the other hand, difficulty in hearing, remembering or concentrating, mobility, self - care, or communication was more prevalent in poorer households . In the vietnam household living standard survey 2006, the estimated prevalence of difficulty in vietnamese children ranged from 0.5% for hearing to 1.9% for vision . The prevalence of disability among children in low- and middle - income countries has varied across studies . For example, the prevalence of visual impairment varied between 0.1% and 12.5%; the prevalence of hearing impairment between 0.4% and 19.7%; and the prevalence of intellectual disability between 0.09% and 18.3% . The prevalence of difficulty estimated in this study was within the range of previous reports in low- and middle - income countries . Households with children with a disability spent more on health care than households without such children . Regarding difficulty in vision, the increase in the economic burden of health care among children with disability was caused by substantially higher health - care expenditure . The higher household income among children with difficulty in vision than children without this difficulty diluted the influence of the increase in the health - care expenditure for difficulty in vision . The share of inpatient care expenditure relative to total health - care expenditure among children with difficulty in vision was not as high as that among children with disabilities in other domains . This low share of inpatient care is consistent with the fact that among the pediatric population in the uk, the proportion of children who received hospital eye services and required hospital admission was low (less than 10%) and with the fact that the total cost of ophthalmic surgery and inpatient eye services was less than that of ophthalmology outpatient eye services . Regarding difficulties in other domains, the difference in the ratio was caused by both relatively lower income and substantially higher health - care expenditure among children with a disability than those without the respective disability . Households with children with difficulty in hearing, remembering or concentrating, mobility, self - care, or communication tended to be poorer than those without children with difficulties . With the exception of difficulty in hearing, there were systematic differences in the mechanisms of high economic burden of disability between difficulty in vision and difficulty in other domains . In our analysis among children 617 years of age, a higher prevalence of disability was observed in the poorer households with regard to disability in hearing, remembering or concentrating, mobility, self - care, and communication . With regard to difficulty in vision, on the other hand, the prevalence was higher among those better off . In studies among adult populations, it has been reported that a larger percentage of children among those who are less wealthy were screened positive with the disability questions, but the association was not consistent . The possible reason for the reverse trend with regard to difficulty in vision observed in this study is longer study hours among children from better off households than those from worse off households . In vietnam, besides engaging in the standard school curriculum, children are enrolled in many kinds of academic tutorials to improve their knowledge and skills . These extra classes have proliferated, since teachers often organize home - based classes to supplement their income . Extra classes mean an increased workload for the participating students compared with those not participating . The location can be at school, a teacher s house, or a student s house . Lengthy exposure to such factors as inadequate indoor illumination in the reading environment or a chair or table unsuitably large for a child s body size are reported to adversely impact a student s visual acuity . In addition to known risk factors of visual difficulties, such as retinopathy of prematurity and family history of high refractive error, these environmental conditions and lifestyles are now suggested as modifiable causes . The increase in the working hours of children under uncontrolled conditions is considered as a potential concern for child visual development . The authors hypothesized that the different impact of health - care expenditure by demographic and household characteristics of subjects was captured by the fitness of the regression model to the observed data . The model, which included socioeconomic factors, namely household income, educational attainment, and occupation of the household head, explained the variation in the ratio of health - care expenditure to the per capital household income better in the analysis including only children with a disability than in the analysis including all children . This finding was interpreted as indicating that the association between socioeconomic status and household burden was stronger; in other words, the impacts of differences in socioeconomic status on the household burden of health - care expenditure were higher for children who had disabilities than for those who did not . Socioeconomically disadvantaged children not only suffered from higher risk of disability but also experienced heavier disadvantage from their socioeconomic status when they had a disability compared with those who were well off . More attention should be paid to reducing the disadvantage caused by poor socioeconomic conditions when households have children with disabilities . The results of the present study will be useful for the design of equitable health systems in vietnam . This study used a nationwide household sample that was representative for the whole country, that is, the 8 regions, urban / rural areas and 64 provinces in vietnam . The sample size was large, allowing us to reliably estimate the prevalence of difficulties and to conduct multivariable analyses . The information was self - reported, and there is a potential for information bias; however, the magnitude of the bias is considered to be low because of several reasons: the survey employed high - quality interviewer training and standardized data collection procedures across geographic regions; the response rates were high, and there were only a small amount of missing data; and validated measurement scale for disability was used, and the calculated prevalence of disability was within the range from studies in other countries . Income was measured as a sum of all reported revenue and costs for all types of activities . Health - care expenditure was collected for each member of family and asked separately for inpatient and outpatients care . The survey was cross - sectional and suitable for estimating prevalence and national average income and expenditure . However, no temporal relation was definitively confirmed because of the possibility of reverse causation . To ascertain if poor socioeconomic status causes difficulty or difficulty leads to poor socioeconomic status or both, further studies are necessary . If the poor families had difficulty in accessing health care and did not receive all the needed care, their health - care expenditure would tended to be lower than needed, leading to underestimation of the potentially higher burden of disability among the poor households . Data included siblings living in the same household, and underestimation of standard errors was possible, because the analyses did not take the intraclass correlation into account . The magnitude of the bias, however, is considered to be small because there was only one child with a disability in most of the households . Health - care needs of children with a disability pose a higher burden on households with lower financial resources . Visual disability was more prevalent among children from richer households, whereas other disabilities were more prevalent among children from poorer households.
Class 1a pi3ks are directly linked to lymphocyte activation mainly through receptor tyrosine kinases, such as the antigen and cytokine receptors (engelman et al ., 2006; huang and sauer, 2010; so and fruman, 2012). Class 1a pi3ks, hereafter referred to as pi3k, are comprised of a catalytic subunit of 110 kda (of which there are three isoforms) that generates phosphatidylinositol 3,4,5 phosphate (pip3) from its main substrate phosphatidylinositol 4,5 phosphate (pip2), and a regulatory subunit (of which there are five isoforms). Pten encodes a protein with a lipid phosphatase function that directly opposes pi3k signaling by dephosphorylating pip3 at the 3 position to generate pip2 . Cells lacking pten have elevated levels of pip3 and constitutive activation of pi3k signaling pathways (stambolic et al ., 1998; cantley and neel, 1999). With increasing age, mice heterozygous for pten develop t cell lymphomas and cancers in multiple tissues, and develop a lethal polyclonal autoimmune disorder, similar to that seen in fas - deficient mice (di cristofano et al ., 1998, 1999; podsypanina et al ., 1999; suzuki et al ., germline mutations in pten occur in a group of autosomal dominant syndromes known as the pten hamartoma tumor syndromes, which include cowden syndrome, proteus syndrome, proteus - like syndrome, and bannayan riley ruvalcaba syndrome, demonstrating the importance of pten as a tumor suppressor . Consistent with this, genomic amplification and mutation of either pi3k or akt has been reported in a large number of cancers as well (samuels et al ., 2004; lee et al ., 2005; carpten et al ., 2007 2009), although the role of pten as a tumor suppressor is now believed to involve more than its ability to oppose pi3k signaling . While disruption of regulation by pten has the overt phenotype of cancer progression, pten also plays an important role in maintaining t cell tolerance at multiple stages within the t cell compartment . Upon ligation of the t cell receptor (tcr) in the presence of co - stimulatory molecules, pi3k recruitment and activation leads to the production of lipid products which in turn recruit downstream ph - domain containing targets such as pdk1 and akt (see figure 1). Ultimately, these events lead to activation of the mtor pathway and inactivation of members of the foxo family, inducing growth and proliferation of t cells and acquisition of effector function (for review, see engelman et al ., 2006; finlay and cantrell, 2010; so and fruman, 2012). In the absence of pten, tcr stimulation alone results in hyperactivation of the pi3k pathway, resulting in effective cytokine production and proliferation independent of co - stimulation (buckler et al ., 2006). Thus, put another way, negative regulation of pi3k signaling by pten enforces the requirement for co - stimulation in nave t cells . However, the notion that pi3k signaling is required for co - stimulation to mediate its effects has been challenged by the generation of mice which lack all isoforms of the regulatory subunit of class 1a pi3k in t cells (deane et al ., 2007). T cells from these mice are able to proliferate under co - stimulatory conditions in the absence of detectable akt signaling . These mice also maintained a normal anti - viral response upon mhv infection, although in vivo t helper function to b cell antibody responses was impaired . Whether the relative lack of defects is due to the fact that lack of pi3k was genetic, rather than acquired, however, these studies indicate that potential therapies targeting pi3k for inflammatory diseases and cancer may not compromise all aspects of cellular immunity, and further suggest that pi3k signaling has specialized functions in the context of t cell activation . Pten / pi3k signaling in mature t cells.class 1a pi3ks are activated by receptor tyrosine kinases that drive co - stimulatory, t cell receptor (tcr), and cytokine signaling pathways . Pten directly opposes pi3k signaling by converting pi(3,4,5)p3 to pi(4,5)p2 . Through their ph - domains, pdk1 and akt bind pip3, enabling akt to be phosphorylated by pdk1 on ser308 . Akt can then target downstream substrates such as foxos in the nucleus, leading to their inactivation and export from the nucleus . This results in attenuation of a foxo - dependent gene program normally acting to promote pathways involved in, but not limited to, t cell homeostasis (in resting t cells), apoptosis (upon, for example, cytokine withdrawal), treg induction, and homing to secondary lymphoid organs (in circulating, nave t cells). Akt also targets tsc2 and pras40 (not shown), negative regulators of mtorc1, allowing for activation of mtorc1 . Activation of s6k and 4ebps by mtorc1 results in increased protein translation, allowing growth and proliferation, and upregulation of hif-1, important for glycolytic metabolism . Inhibitory targeting of bad and gsk3 also contribute to akt s effect on cell cycle, survival and metabolism . Pi3k activation is critical for optimal responses of t cells to cytokines which utilize the common gamma chain . For example, engagement of the il-2r on activated t cells results in activation of the jak / stat pathway, as well as the pi3k and mapk pathways, and the combination of these signals is required for the observed proliferation and cell survival in response to il-2 . Thus, appropriate responses to tcr ligation and cytokines require downregulation of pten, which is constitutively expressed in nave t cells . This normally occurs as a consequence of tcr stimulation itself, which terminates detectable pten expression within 2448 h. the importance of this is demonstrated by two findings . First, retroviral mediated enforced expression of pten renders activated il-2r t cells unable to fully respond to il-2 stimulation . Second, regulatory t cells, which normally do not divide in response to il-2 alone, have complete responses and signaling to il-2 restored solely by genetic ablation of pten (bensinger et al ., 2004; walsh et al ., 2006 this demonstrates that control of pi3k through pten plays an important role not only in modulating the degree of activation signals within lymphocytes, but in maintaining traits of a specific lineage . Deletion of pten, or expression of constitutively active myristoylated - akt, within the cd8 t cell compartment inhibits the development and survival of memory cd8 t cells (hand et al ., 2010). On the contrary, akt is required for a transcriptional program leading to upregulation of cytolytic effector, chemokine, and adhesion molecules (macintyre et al ., 2011). Conditional deletion of pten using ox40-cre has demonstrated that pten plays a critical role in limiting the expansion of tfh cells and in maintaining control over gc reactions, indicating that t cell intrinsic roles of pten are crucial for maintaining global levels of tolerance (rolf et al ., 2010). Lastly, the promotion of itreg generation and maintenance by pd - l1 is associated with downregulation of akt signaling and concomitant upregulation of pten expression (francisco et al ., 2009). These examples all provide evidence that the balance of akt signaling within multiple stages of development and differentiation states helps determine cellular fate . Pten also has been shown to play an important role in central tolerance and in regulating proliferation of developing cells in the thymus (suzuki et al ., 2001; hagenbeek et al ., signaling, loss of pten allows cells to bypass the -selection checkpoint, indicating that pi3k signaling is crucial for the ongoing development of early t cell precursors . Interestingly, thymic cellularity and subset percentages are relatively unperturbed prior to tumor development, which likely occurs at the dp stage during thymic maturation, suggesting that secondary events emerge in this context of pten loss to promote transformation (discussed below; hagenbeek et al ., 2004; hagenbeek and spits, 2008; xue et al ., 2008; guo et al ., members of the foxo family of transcription factors play a critical role in dna damage and oxidative stress responses (tran et al ., 2002; miyamoto et al ., 2007 2009) and in preventing entry into cell cycle (medema et al ., 2000), acting as bona fide tumor suppressors as demonstrated in hematopoietic and epithelial tissues (coffer, 2003; accili and arden, 2004; paik et al ., 2007). It is becoming increasingly appreciated that foxos play important roles within the t cell compartment as well, regulating homing (fabre et al ., 2008; sinclair et al ., 2008; finlay et al ., 2009; kerdiles et al ., 2009; finlay and cantrell, 2010), survival (hedrick, 2009; kerdiles et al ., 2009; dejean et al ., 2011), and the development and function of effector and memory subsets (kerdiles et al ., 2010; ouyang et al ., 2010; rao et al ., 2012). In quiescent cells, foxos are active within the nucleus, where they maintain the pattern of chemokine and adhesion molecule expression, and expression of the il-7r, needed for the migration and survival of circulating t cells (fabre et al ., 2008; akt phosphorylation on ser473, mediated by mtorc2, is critical for foxo inactivation, implicating mtor in control over foxos, and placing pten upstream in this pathway . Importantly, mtorc2 has been shown to be critical for the phenotype in models of pten loss . Prostate cancer caused by conditional pten deletion in prostate epithelium requires mtorc2, and deletion of one copy of rictor, required for mtorc2 complex assembly and activity, was sufficient to protect pten heterozygous mice from prostate cancer (guertin et al ., 2009). The role of foxos in t cells was first described using mice in which retroviral gene - trap targeting of embryonic stem cells was used to generate a null foxo3 allele, although the authors could not rule out the possibility that undetectable levels of a truncated form of foxo3 was produced (lin et al ., 2004). These mice exhibited spontaneous lymphoproliferation and multi - organ lymphocyte infiltration, indicating that foxo3 is important for the control of t cell tolerance and homeostasis . This hyper - activated phenotype was correlated with decreased expression of ib and ib, leading to increased nf-b activation . As ikk has been shown to phosphorylate and inactivate foxos (hu et al ., 2004), this implicates foxos in a critical negative feedback loop that may serve to limit inflammatory responses in certain settings, and is potentially important in the context of tumors which maintain low levels of akt activation . Other studies using foxo3-deficient strains did not find the same immunological defects (hosaka et al ., 2004; dejean et al ., 2009), attesting first to the redundancy of members of this family and, second, to the possibility of dominant - negative effects of undetected foxo3 gene products in the aforementioned mice . T cell - specific loss of foxo1 was shown to severely disrupt t cell homeostasis, resulting in multi - organ lymphocyte infiltration as well as exocrine pancreatitis and hind limb paralysis (kerdiles et al ., 2010). This was attributed to a defect in both the development and function of foxp3 regulatory t cells, and this phenotype was exacerbated by combined deletion of foxo1 and foxo3 (kerdiles et al ., 2010; more recently, foxo3a has been mechanistically linked to anergy induction in t cells through upregulation of sirt1 (gao et al ., 2012). Il-2 was shown to reverse t cell anergy through the pi3k pathway by inactivation of foxos, which prevented transcriptional upregulation of sirt1 . In mouse embryonic fibroblasts and lymphoid cells, growth factor and cytokine withdrawal upregulates bh3-only pro - apoptotic mediators puma and bim in a foxo3a - dependent manner that requires downregulation of pi3k / akt signaling (you et al ., 2006). These findings strongly support the idea that impaired downregulation of pi3k activity, as seen in t cells lacking pten, results in survival effects and apoptotic resistance in response to cytokine deprivation through inactivation of foxo family members . Fasl has been shown to be another important target of foxo (brunet et al ., 1999). Given that pten heterozygous mice display decreased sensitivity to fas - mediated aicd, similar to lpr and gld mice (van parijs and abbas, 1996), constitutive inactivation of foxos due to loss of pten is likely a partial mechanism underlying the phenotype observed in these mice . Additionally, the finding that a deficiency in foxos is sufficient to drive the development of hemangiomas, similar to what is seen in patients with cowden disease and bannayan zonana syndrome, and thymic lymphomas, similar to mice with a t cell - specific deletion of pten, as well suggests that inactivation of foxos may be critical for the phenotype brought on by loss of pten (paik et al ., 2007). Genetic studies in mice expressing conditional alleles of pten have been crucial for studying the tissue specific role of pten in tumorigenesis . Deletion of pten during hematopoiesis using mx-1-cre results in myeloproliferative disease and transplantable leukemia, and has shown that pten is required for maintaining the hematopoietic stem cell (hsc) compartment (yilmaz et al ., 2006; lee et al ., similar to the mx-1-cre model of pten loss, vec - cre - mediated pten loss, in which nearly 40% of fetal liver hscs were subject to deletion of pten, led to impaired hsc self - renewal and the development of a myeloproliferative disorder followed by leukemia (guo et al ., 2008). It is notable that this phenotype shares striking similarity to mice in which all six alleles of foxo1/3a/4 were deleted by mx-1-cre (tothova et al ., 2007), and to foxo3a mice (miyamoto et al ., 2007) importantly, this study reported the same t(14;15) chromosomal translocation (seen within a subset of human t - all), in all blast - crisis samples analyzed from these mice, suggesting a critical genomic destabilizing event potentially independent of pten s role in controlling pi3k / akt signaling . Similarly, this translocation, involving the c - myc and tcr/ loci and resulting in constitutively high levels of c - myc, was found to recur with 100% incidence in t cell lymphomas from mice in which pten was deleted specifically in t cells (cd4-cre pten mice, hereafter referred to as pten-t mice; liu et al ., 2010). Thus, well after t lineage commitment in mice subject to lymphoma and lymphoproliferative autoimmune disease, pten is critical to prevent the emergence of the same genetic abnormality present in hscs that correlates with the selective pressure of these cells for the development of leukemia . A deficiency in rag1 or tcr prevented the t(14;15) translocation event in pten-t mice, but did not inhibit malignant transformation, although lymphomagenesis developed with delayed onset and was primarily restricted to the thymus (liu et al . Interestingly, mature t cells from 3-week - old pten-t mice that had not undergone transformation, when transferred into either immunocompetent or immunoincompetent recipients, did not develop a malignant phenotype throughout the duration of the host s life, suggesting that malignancy arises within the thymus after a period of latency in these mice, consistent with an earlier report demonstrating that transplanted pten thymocytes gave rise to t cell lymphomas in immunodeficient recipients (hagenbeek and spits, 2008). Supporting this, pten-t mice thymectomized at 3 weeks of age did not develop lymphoma, although later in life these mice exhibited signs of systemic autoimmunity . Thus, within distinct developmental stages, pten is required for the prevention of lymphoma and autoimmunity . In the context of dna damage, loss of pten enables cells to bypass the normal g2/m checkpoint enforced by chk1 as a result of akt - mediated chk1 sequestration in the cytoplasm (puc et al ., 2005). Akt has also been shown to promote prosurvival responses following dna double - strand breaks (dsbs; bozulic et al ., 2008). It is possible that secondary mutations or other genetic alterations occurred in rag1 or tcr pten-t mice as a result of genetic instability due to pten loss, and that hyper - active akt maintains the survival of these cells that would normally undergo apoptosis . Spectral karyotyping analyses, however, failed to detect any chromosomal translocations in these mice to support this idea . Induction of the notch pathway in malignant cells from these mice, however, was shown to increase cellular levels of c - myc, suggesting that pi3k and c - myc cooperate in multiple models of pten loss to promote lymphomagenesis and lymphoproliferative autoimmune disorder . Disruption of foxo function has been shown to accelerate c - myc - driven lymphomagenesis (bouchard et al ., 2007), and constitutively active mutants of foxo3a resistant to inactivation by akt directly repress multiple target genes of c - myc and block c - myc - dependent proliferation and transformation (bouchard et al ., 2004; jensen et al ., 2011). Together, this offers the possibility that c - myc and pi3k cooperate in tumorigenesis through inactivation of foxos . Whether or not restoration of foxo signaling in mice lacking pten in t cells has an effect on metabolism, survival, infiltrative capacity, lymphomagenesis, or the prevention of autoimmunity remains to be seen . A recent study in which pten cd4-cre mice were crossed to pdk1 mice has shown that while lymphoma did not develop in this model of t cell - specific pten deletion, pdk1/akt signaling was dispensable for the survival, proliferation and differentiation of t cell progenitors, and in vivo expansion of peripheral t cells (finlay et al ., 2009). The mechanism for control of cell metabolism independent of pdk1 is unclear in these mice, although thymocyte proliferation in the absence of pten was shown to require rhoa - dependent pathways, and a dependence on c - myc, which was recently shown to play a pivotal role in t cell metabolism following activation (wang et al ., 2011), mice which express a single hypomorphic pdk1 allele similarly prevented a wide range of tumors when crossed to pten heterozygous mice, indicating that the requirement for pdk1 in the context of tumor formation brought on by loss of pten is not limited to its role in controlling migratory capacity of t cells (bayascas et al ., 2005). Additionally, deletion of s6k1 in the mx-1-cre model of pten loss resulted in delayed development of leukemia, indicating that an mtorc1-mediated pathway, in this context shown to involve induction of a hif-1-dependent glycolytic program, contributes to leukemogenesis in pten - deficient cells (tandon et al ., pten nuclear function, independent of its lipid phosphatase activity, has been shown to contribute to its tumor - suppressive effects and, in particular, in maintaining genomic stability . Control of dna stability and dsb repair has in part been attributed to interaction of pten with an integral kinetochore protein, cenp - c . Mutants originally identified in cowden disease patients demonstrated that the c - terminus of pten, but not the phosphatase domain, was required for interaction with centromeres and with cenp - c, and that dna instability and dsbs could be prevented by a phosphatase - dead pten mutant which retained its ability to bind to cenp - c (shen et al ., 2007). Additionally, nuclear exclusion of pten, but not a phosphatase - inactive mutant, was shown to impair the tumor - suppressive apc - cdh1 nuclear complex, again demonstrating tumor - suppressive capability of catalytically inactive pten (song et al ., 2011). Additional protein protein interactions within the nucleus, independent of pten catalytic activity, have been shown to increase the activity and stability of p53 (li et al ., 2006; salmena et al ., 2008), and upregulate expression of rad51, an essential component of the dsb repair machinery (baker, 2007; shen et al ., 2007). A lysine to glutamate mutation in pten (k289e) identified in a cowden syndrome family, which lead to a dramatic decrease in nuclear import without disrupting phosphatase activity or membrane localization of pten, as well strongly supports the idea that nuclear pten can be critical for tumor suppression independent of its role in opposing pi3k signaling in certain contexts (trotman et al . . Molecular and phenotypic consequences of loss of pten phosphatase - dependent and -independent functions during hematopoiesis and within the t cell compartment.loss of pten phosphatase activity results in increased levels of pip3, causing hyperactivation of the akt pathway and subsequent activation of the mtor pathway, and inactivation of the foxo family of transcription factors . Disruption of pten phosphatase - independent function accounts for loss of much of its nuclear activity, compromising genetic stability and dsb repair, leading to chromatid breaks and translocations . That mature t cells do not undergo transformation, and that lymphoma in t cell - specific pten knockout mice is of thymic origin, suggests that pten phosphatase - independent function contributes less to the phenotype at the mature t cell stage, and that loss of t cell tolerance can likely be attributed to loss of pten phosphatase activity . Whether depletion of hematopoietic stem cells (hscs) and development of leukemia stem cells (lscs), as well lymphomagenesis, depends on the absence of pten phosphatase activity (which likely maintains survival of genetically aberrant cells), pten phosphatase - independent activity (promoting genetic instability), or both, remains an open question . Inactivation of pten phosphatase activity is sufficient to abrogate its tumor - suppressive effects, emphasizing the importance of pten s role in downregulation of pi3k signaling . This has been demonstrated by a subset of cowden disease patients that harbor a missense mutation at a cysteine residue (c124) critical for phosphatase activity . A c124s mutant has been shown to form a stable complex with pip3, potentially protecting it from dephosphorylation by other lipid phosphatases to account for higher cellular levels of pip3 compared to conditions in which pten is completely absent (myers et al ., 1998). As well, the importance of akt activity in tumor development induced by loss of pten has been reported in a number of studies (stiles et al ., 2002; bayascas et al ., 2005 constitutive akt activation in t cells and thymocytes has been shown to be sufficient to drive autoimmunity and lymphoma (rathmell et al ., 2003) and thymomas (malstrom et al ., 2001), respectively, and bone marrow chimera experiments have demonstrated that enforced expression of constitutively active akt in hscs was sufficient for the development of myeloproliferative disease, t cell lymphoma, or aml (kharas et al ., 2010). Pten-t mice crossed onto the rag1 background, which do not harbor the t(14;15) translocation, potentially serve as an example in which akt signaling is not sufficient to drive cancer progression (liu et al ., 2010). In vitro studies using malignant cells from these mice demonstrated a dependence on notch, suggesting that akt at the very least must cooperate with other oncogenic pathways to allow tumor growth in this model, similar to what has been suggested in an mmtv - myrakt breast cancer model with respect to tumorigenesis induced by loss of pten (blanco - aparicio et al ., 2007). In contrast to this, in a model of notch - induced tumorigenesis, genetic loss of pten induced an oncogene addiction switch that rendered t - all cells resistant to notch inhibition through gsis and dependent on pi3k / akt signaling to maintain tumor growth (palomero et al ., 2007). This idea is perhaps emphasized by the observation that pten-t mice, regardless of whether the t(14;15) translocation event occurs, maintain constitutively high levels of c - myc . The reliance on c - myc in the context of pten loss remains an important question . In tumors driven by inducible c - myc activation in a zebrafish model of t - all, constitutive activation of the akt pathway through genetic disruption of pten or transgenichexpression of akt2 rendered cells in this model independent of c - myc for tumor progression (gutierrez et al . Conversely, conditional genetic disruption of both pten and c - myc in mice, while still subject to myeloproliferative and lymphoproliferative disorders, prevented the development of hematopoietic malignancies, highlighting an important dependence on c - myc in this context of pten loss (zhang et al . Whether loss of pten allows the survival of cells that, through other mechanisms, have acquired genetic aberrations, such as translocations resulting in constitutive c - myc, or whether pten, independent of its role in pi3k downregulation, prevents genetic instability that collaborates with dysregulation of pi3k to allow cancer progression, remains an open question that needs to be addressed in a context - dependent manner, with consideration of what function of pten is lost, changes in levels of expression, and in which tissues abnormal growth originates . Pten is the one of the most frequently mutated or lost genes in human cancer . Given the emerging roles of pi3k in immune system regulation, it is possible that pten is also playing a prominent role in the prevention of autoimmune disease and inflammatory / lymphoproliferative syndromes . The finding that pten did not play a role in lymphomagenesis in mature t cells from mice which lack pten specifically in t cells suggested that pten has a specific function in preventing lymphoma within a distinct time frame in this compartment . That these non - malignant t cells were able to provoke autoimmunity demonstrates that well beyond the stage at which pten is required for prevention of lymphomagenesis in this model, pten plays a critical role in the maintenance of t cell tolerance . It will be important to determine which biochemical requirements pten fulfills in each stage of protection, and whether these requirements are distinct within different stages from cells of the same lineage, or whether lack of particular features leads to different outcomes depending on developmental stage . Given the importance of pi3k signaling in both normal immunity and the development of cancer, it will be interesting to see how closely pten s role as a lipid phosphatase is tied to prevention of disease, and how integral pi3k signaling remains throughout disease progression . Uncovering the specific biochemical functions of pten within these contexts will be key to the development of targeted therapies for the prevention and treatment of t cell malignancies and autoimmune disease . The authors declare that the research was conducted in the absence of any commercial or financial relationships that could be construed as a potential conflict of interest.
Tumors derive from a single cell clone but consist of heterogeneous cell subpopulations with diverse features and functions . Sequencing analysis has revealed that tumors accumulate mutations, the majority of which do not provide selective benefits, while a small subset of mutations drive cancer development by conferring a selective advantage . A limited number of subclones with a selective advantage survive treatment with anticancer drugs or radiation . Such subclones can initiate tumors when inoculated into immunocompromised mice and are known as cancer stem or cancer - initiating cells (cics). Cics can lead to tumor recurrence because they escape apoptosis by effluxing antitumor drugs and degrading reactive oxygen species (ros), which are related to radiation - induced apoptosis . Cics are generally defined on the basis of their ability to initiate a tumor in a transplantation assay in immunocompromised mice . In leukemia, breast, lung, and colon cancers, however, recent reports reveal that in some tumor types, such as melanomas, the majority of tumor cells can initiate tumors . Asymmetrical division of stem cells yields a stem cell and a more highly differentiated cell . As in the case of physiological stem cells, cics are derived from cics but not from non - cics under normal conditions . However, under some conditions, such as severe hypoxia, non - cics can yield cics; this phenomenon is known as plasticity . The dynamic exchange between cics and non - cics may enable tumors to survive under unfavorable conditions . Therefore, cics may not be a distinct cell type but may be a mode or phenotype of tumor cells . This review briefly describes isolation of cics from tumor cell populations and the microenvironmental factors that regulate cic phenotypes in uterine cancer and lymphoma . Cics express high levels of cell membrane - associated abc transporters . When stained with hoechst 33342 dye and incubated for approximately 1 hour in contrast, a small population with high efflux ability eliminates hoechst 33342 dye (hoechst 33342-low). The upper part shows an image of hoechst 33342 staining, in which hoechst 33342 dye is designated by stars . The lower part shows the dot - blot pattern of flow cytometers, in which hoechst 33342-high cells are contained in the mp, whereas hoechst 33342-low cells in the sp . Upper part shows the image of cm - h2dcfda staining, in which ros is designated as flowers . When treated with hydrogen peroxide, most tumor cells are stained with cm - h2dcfda, but a small population remains unstained . The upper part shows an aldefluor assay, in which aldh - high population is figured out in the box (red part). These boxed cells are diminished when treated with n, n - diethylaminobenzaldehyde, the inhibitor of aldh . The lower part shows the results of immunohistochemical analysis using an anti - aldh antibody, in which a portion of uterine endometrioid carcinoma cells is aldh - positive . ). Cics express high levels of cell membrane - associated atp - binding cassette (abc) transporters, which play important roles in efflux of antitumor drugs . When stained with hoechst 33342 dye, most tumor cells retain the dye and are termed hoechst 33342-high . However, a small population with high efflux ability eliminates hoechst 33342 dye and are termed hoechst 33342-low . Most tumor cells are hoechst 33342-high, and are termed the main population (mp), whereas hoechst 33342-low cells are known as the side population (sp). Flow cytometers equipped with ultraviolet lasers can be used to distinguish the mp and sp, which enable isolation of sp cells . Because sp cells can efflux compounds efficiently, cics are considered to be involved in the sp . Patrawala et al . Reported that the sp cells in several tumor cell lines are more tumorigenic than mp cells . This finding is consistent with the concept that cics are enriched in the sp . Cics express high levels of cell membrane - associated abc transporters . When stained with hoechst 33342 dye and incubated for approximately 1 hour in contrast, a small population with high efflux ability eliminates hoechst 33342 dye (hoechst 33342-low). The upper part shows an image of hoechst 33342 staining, in which hoechst 33342 dye is designated by stars . The lower part shows the dot - blot pattern of flow cytometers, in which hoechst 33342-high cells are contained in the mp, whereas hoechst 33342-low cells in the sp . Upper part shows the image of cm - h2dcfda staining, in which ros is designated as flowers . When treated with hydrogen peroxide, most tumor cells are stained with cm - h2dcfda, but a small population remains unstained . The lower part shows the staining of endometrioid carcinoma cells . The upper part shows an aldefluor assay, in which aldh - high population is figured out in the box (red part). These boxed cells are diminished when treated with n, n - diethylaminobenzaldehyde, the inhibitor of aldh . The lower part shows the results of immunohistochemical analysis using an anti - aldh antibody, in which a portion of uterine endometrioid carcinoma cells is aldh - positive . The second method of isolating cics is based on their ability to degrade ros (fig . Upon x - ray irradiation, tumor cells produce a large quantity of ros and undergo apoptosis . Cics express high levels of ros - degrading enzymes, such as superoxide dismutase, which facilitate their escape from apoptosis by degrading intracellular ros . Intracellular ros can be stained with 5-(and 6)-chloromethyl-2,7-dichlorohydrofluorescein diacetate (cm - h2dcfda). When treated with hydrogen peroxide, most tumor cells are stained with cm - h2dcfda, but a small population remains unstained . These cm - h2dcfda - low cells are more tumorigenic than cm - h2dcfda - high cells, and cics are enriched in the cm - h2dcfda - low population . S lymphoma cell lines, most foxo3a - expressing cells are contained in the cm - h2dcfda - low population . A small subpopulation of hodgkin s lymphoma cells expressing foxo3a can degrade ros efficiently and is resistant to apoptosis . Sternberg (rs) cells; however, foxo3a - expressing cells are small mononucleated cells . The l1236 and l428 hodgkin s lymphoma cell lines include both small mononucleated and giant multinucleated cells . In these cell lines, multinucleated cells are derived from mononucleated cells, but mononucleated cells are not derived from multinucleated cells . These findings suggest that some mononucleated cells, but not rs cells, are the cics of hodgkin s lymphoma . Several such markers, such as cd133 and cd44 (cd44v isoform), have been reported; aldehyde dehydrogenase (aldh) is one of the most commonly used . High aldh activity is present in not only normal stem cells, such as hematopoietic and neural stem cells, but also various types of cics . Indeed, immunohistochemical analysis using an anti - aldh antibody revealed that a portion of uterine endometrioid carcinoma cells are aldh - positive, and cases with high aldh activity have an unfavorable prognosis (fig . Aldh - high endometrioid carcinoma cells are resistant to apoptosis, mobile, and highly invasive . Sp and ros - degrading cells can only be detected while alive . By contrast, aldh - high cells can be detected immunohistochemically in formalin - fixed paraffin - embedded tissues . Uterine endometrioid carcinoma cells usually express steroid hormone receptors, such as estrogen and progesterone receptors . However, double staining of clinical samples with anti - aldh and anti - hormone receptor antibodies revealed that aldh - high cells are negative for these hormone receptors . Aldh - high endometrioid carcinoma cells appear to be immature and negative for differentiation markers, such as estrogen and progesterone receptors . Because aldh - high cells are readily isolated by flow cytometry, their proteome can be investigated using mass spectroscopy (table 1table 1 . List of proteins preferentially expressed in the aldh - high population of uterine endometrioid adenocarcinoma cells). These cells also exhibit impaired akt phosphorylation and matrix metalloproteinase-2 activation, which account for their impaired proliferation and invasion, respectively . Elevated expression of s100a4 is related to myometrial and lymphatic invasion in well- to moderately - differentiated endometrioid carcinoma . Notably, strong and diffuse expression of s100a4 is observed in tumor tissues with a microcystic, elongated, and fragmented (melf) pattern, which is associated with a highly invasive phenotype . However, aldh is not an almighty marker of cics, because, for example, aldh is highly expressed in stromal cells, such as dendritic cells and macrophages, in lymphoma . This suggests the presence of microenvironmental factors that induce or inhibit aldh expression and suggests that intercellular signaling between tumor cells might regulate aldh expression . Indeed, phosphorylated smad-2, an indicator of tgf- signaling activation, is present at higher levels in aldh - low than -high endometrioid carcinoma cells . Tgf- family members regulate cell fates in developing embryos; for example, lefty determines the left similarly, the development or differentiation of tumor cells might be controlled by tgf- family members . Among the tgf- receptor ligands immunohistochemical analysis of clinical samples has revealed nodal - high tumor cells to be aldh - low cells, and vice versa . These findings suggest that nodal inhibits aldh expression via stimulation of tgf- signaling in uterine endometrioid carcinoma cells . Lymphomas can be categorized using the surface markers of differentiation status expressed by lymphocytes . For example, peripheral t - cell lymphoma cells express the t - cell marker cd3, and diffuse large b - cell lymphoma cells express the b - cell markers cd79a and cd20 . Lymphoplasmacytic lymphoma (lpl) is a rare indolent disease that affects the bone marrow, and is associated with expression of the b- and plasma - cell markers cd20 and cd138 . Mwcl-1 cells are derived from lpl, and express cd20 and cd138 as surface markers . Mwcl-1 cells include three subpopulations: cd20 cd138, cd20 cd138, and cd20 cd138 cells . The first subpopulation expresses neither b- nor plasma - cell markers, the second subpopulation expresses only b - cell markers, and the third subpopulation expresses both b- and plasma - cell markers . When cultured, cd20 cd138 cells yield all three subpopulations, but cd20 cells do not yield cd20 cd138 cells (fig . Mwcl-1 cells derived from lpl include three subpopulations: cd20 cd138, cd20 cd138, and cd20 cd138 cells . When cultured, cd20 cd138 cells yield all three subpopulations, but cd20 cells do not yield cd20 cd138 cells . The cd20 cd138 subpopulation expresses the chemokine receptor cxcr7, the ligand of which is cxcl12 . The number of cd20 cd138 cells increases in a time- and dose - dependent manner when mwcl-1 cells are cultured in the presence of cxcl12 . ). Cd20 cd138 cells have higher ros degradation and in vitro colony formation activities than cd20 cd138 and cd20 cd138 cells . When cultured in the absence of serum or the presence of an anticancer drug, cd20 cd138 cells immunohistochemical analysis of clinical samples has indicated that lpl tumor cells undergoing apoptosis are cd138 . The production of all three subpopulations, efficient ros degradation and in vitro colony formation activities, and resistance to apoptosis suggest that cd20 cd138 cells are candidate cics in lpl . Mwcl-1 cells derived from lpl include three subpopulations: cd20 cd138, cd20 cd138, and cd20 cd138 cells . When cultured, cd20 cd138 cells yield all three subpopulations, but cd20 cells do not yield cd20 cd138 cells . The cd20 cd138 subpopulation expresses the chemokine receptor cxcr7, the ligand of which is cxcl12 . The number of cd20 cd138 cells increases in a time- and dose - dependent manner when mwcl-1 cells are cultured in the presence of cxcl12 . As described above, cics are plastic under stress conditions, in which non - cics are transformed to cics . Indeed, hypoxia induces conversion of cd20 cd138 cells to cd20 cd138 cells, whereas normoxic conditions do not . Among the proteins preferentially expressed by the cd20 cd138 subpopulation, expression of the chemokine receptor cxcr7 it is possible that the conversion from cd20 cd138 to cd20 cd138 cells is mediated by signaling via cxcr7 (fig . This is plausible because the number of cd20 cd138 cells increases in a time- and dose - dependent manner when mwcl-1 cells are cultured in the presence of cxcl12, a ligand of cxcr7 . Recently, a constitutively active mutation of cxcr4, a receptor related to cxcr7, has been reported in lpl . The fact that cics are resistant to apoptosis and related to aggressive behavior is consistent with the notion that the cics of lpl utilize the cxcl12-cxcr4/cxcr7 axis . Cics, which are resistant to anticancer drugs and escape from apoptosis, may be a good therapeutic target for cancers . However, they are, under some circumstances, derived from non - cics due to their plasticity . Therefore, the regulatory mechanism of cics should be determined . Reagents that block the signals controlling cics may interfere with their plasticity, leading to their complete elimination . The tgf- family member nodal regulates aldh activity in uterine endometrioid carcinoma, whereas signaling via the chemokine receptor cxcr7 regulates cics in non - hodgkin s lymphoma . Therefore, investigation of the cics of each tumor type is necessary to facilitate development of novel therapeutics . Aldh - high tumor cells express a large number of factors, some of which play roles in invasion and some of which play roles in mobility . Although aldh - high cells are invasive and mobile, these characteristics are likely mediated by different factors . Genome - editing techniques will enable determination of the function of such factors in cics, which will facilitate development of novel therapeutics.
Loss of muscle mass, particularly of fast - twitch or type ii fibers that accompany advanced age, is associated with muscle weakness, increased fatigability, and a loss of functional independency . Reduced muscle strength in older people has been associated with both muscle atrophy and reduced ability to rapidly produce force, which may increase the risk of falling . Increases in muscle cross - sectional area in response to training in old age have been reported by several authors . It has been shown that resistance exercise training increases rate of muscle protein synthesis and therefore improves muscle mass and function . Some examples of resistance training include lifting of weights or working out on resistance machines in the gym and for older people, hand weights, light free weights or stretching bands can be used . Progressive resistance exercise training increases muscle strength, gait velocity, and stair climbing power in physically frail elderly people . Kimura et al . Reported that after 12 weeks of resistance exercise training, muscle strength and quality of life increased among older adults by improving physiological function . Arai et al . Found that short - term and low - frequency resistance exercise (2 days / week for 12 weeks) have beneficial effects on physical function in older adults . Women around 50 years of age are characterized by the beginning of hormonal alterations denoting the transitional phase or the premenopausal state . The high variability in hormone levels, as an increase in follicle stimulating hormone (fsh) or a decrease in estradiol, influences the loss in skeletal muscle mass (women 42 - 63% lesser than men) and adversely affects the activities of daily living in females with advancing age . Menopause is associated with the well - documented loss of bone mass, muscle weakness, increase in body fat mass and a decline in lean tissue mass (sarcopenic obesity), by muscular and bone - joint complaints, and by hot flashes . While physical exercise, in general, is beneficial, strength training (st) is often referred to as an effective type of exercise to enhance skeletal muscle function in women . These problems associated with increasing of age can have adverse effects on various aspects of life and performance of daily activities in women . In addition, periods of inactivity are more common in older adults, because of illness, hospitalization, and limited period of disability that reduces muscle strength, and neural adaptation . Reported that older adult may lose some neuromuscular performance after a period of short - term detraining . Results from the elliott study show that 10-rm muscle strength decreased after eight weeks of detraining . Most of these studies have used dumbbells or resistance training machines based on more than 12 weeks resistance training programs which are not accessible for all individuals . In this study, we used the thera - band tubing in the form of a short - term (12 weeks) strength training that has fewer barriers to performance of resistance exercise for elderly persons to avoid doing these training . Exercise with thera - band tubing is a unique type of resistance training and the resistance provided by thera - band tubing is based on the amount that the band or tubing is stretched . Each color will provide a specific amount of resistance at the same percent elongation, regardless of initial resting length . There are limited studies available about resistance training and its effects on muscle mass in iranian adult populations . This is an interventional study, conducted to examine whether resistance exercise training with thera - band tubing increases muscle mass in 50-year - old women . Twenty apparently healthy post - menopausal women, aged 50 years old participated in this study . According to the previous similar studies sample size and based on the minimum sample size required for such studies, we invited 30 women to be enrolled in this study . We excluded 5 women before starting the intervention based on exclusion criteria and 5 other subjects did not complete the intervention because of fracture, traveling, age mismatch and were excluded during the study . Thus, matched for weight and age, 20 women, randomly assigned into the control (n = 10) and resistance training groups (n = 10), completed the study . All subjects were inactive and had not participated in regular physical activity for at least 1 year . A written consent was obtained from each participant and all of them received a comprehensive explanation of the proposed study and its benefits and inherent risks . Before beginning the exercise program, according to the recommendation of american college of sport medicine (acsm), some questions were asked to determine participant's suitability for beginning an exercise program . Volunteers were excluded at baseline if they had diabetes, parkinson's disease and peripheral neuropathy or if they were taking hormone replacement therapy (hrt) or medications like -adrenergic blockers, -agonists, ca channel blockers and corticosteroids that would influence muscle amino acid metabolism . Moreover, a physician examined all the participants to detect possible medical problems such as osteoporoses that could prevent them from the training . The study was approved by the research ethics committee of the research institute for endocrine sciences, shahid beheshti university of medical sciences . The experimental design program consisted of 12 weeks of resistance training and four weeks of detraining . Resistance training program, designed to develop muscle mass and strength, was performed three times a week (non - consecutive session) for 12 weeks at a local fitness center . Each session lasted 60 min, and had a warm - up and cool - down period of 10 min stretching and flexibility exercise for limbs and trunk, before and after the strength programs . The exercise sessions were monitored under direct supervision of an exercise specialist to ensure correct technique, safety, and proper exercise intensity . We used the charts that show the resistance strengths for the thera - band color sequences to determine the force that were produced by thera - band . Then, for each subject, the 1 repetition maximum (1-rm) was estimated using the following formula to adjust the exercise intensity: 1-rm = w/[1.0278 (0.0278 r)] (w = force produced by thera - band and r = number of repetitions). Based on the related tables, 10-rm for arm muscles was derived and the resistance exercise program was designed for each participant, based on 80%, 85%, and 100% 10-rm . The resistance exercise consisted of 10 movements with three sets of 10 repetitions that were separated by 3 min of rest . At the end of each month, 1-rm with the thera - band tubing was determined and the resistance exercise program was designed based on the new record . The resistance training (rt) group performed the chest press, biceps curl, triceps extension, side shoulder raise, seated row, seated shoulder press, up right row, lateral raise, lat pull down and front raise . Following completion of the resistance training program, the rt group was instructed to maintain their normal lifestyle and avoid starting any new exercise program during the detraining period . The control (c) group was instructed to keep their normal pattern of activity during the 12 weeks intervention period and the four weeks of detraining . Measurements were done to three times points; at baseline, after 12 weeks intervention, and subsequently, after four weeks of detraining in both groups . Also, 1-rm for biceps was determined using the dumbbell for both groups . Body weight of participants were assessed using a digital electronic weighing scale (seca 707; range 0.1 - 150 kg, hanover, md) with an accuracy of up to 1 kg for body weight . With shoes removed and wearing light clothing, standing height was measured barefooted to the nearest 0.1 cm and body mass index (bmi) was calculated as weight (kg)/height (m). Three sites of skinfold thickness (triceps, subscapular, and suprailiac) were determined using the harpenden caliper to the nearest 0.1 mm in triplicate on the right side of body and the mean values between two nearest measurements were used for analysis . Percentage of body fat were estimated from skinfold thickness (triceps and subscapular), based on mcardle method . Fat mass was calculated by multiplying percentage of body fat to body weight, and fat free mass (ffm) was estimated by subtracting fat mass from body weight . Percentage of body fat: 0.55 (sf thickness of triceps) + 0.31 (sf thickness of subscapular) + 6.13 mid - arm circumference (mac) was measured using the non - elastic measuring tape at the midpoint between the acromion process and the olecranon process and then muscle mid - arm circumference (mamc) was estimated using the following formula: mamc = mac (cm) (3.14 skinfold thickness of triceps). Before initiating the resistance exercise program, after training, and detraining, a three - day - diet recall was completed at three times point to determine any weight changes and body composition from pre- to post - training . All subjects were asked not to change their dietary pattern throughout the duration of study . A 10-min warm up, stretching, and range of motion for trunk flexion (sitting position) was determined by the sit - and - reach test . The participants were asked to sit on the floor with legs fully extended and bare feet against the standard sit - and - reach box, and then to bend over and touch the box with both hands as far as possible . The best of three trials was recorded . For trunk extension (prone position), participants were asked to lie face down with arms at the side and extended the spine by lifting the shoulders and chin from the floor as far as possible . The kolmogorov smirnov test was used to determine normality of the distribution for outcome measures and data are reported as the mean and standard deviations . For comparing the means of two groups, independent sample t - test was used to examine any differences between the rt and the c groups for each variable . Repeated measures were used to examine any differences between baselines, after intervention, and detraining values in the rt and the c groups . Twenty apparently healthy post - menopausal women, aged 50 years old participated in this study . According to the previous similar studies sample size and based on the minimum sample size required for such studies, we invited 30 women to be enrolled in this study . We excluded 5 women before starting the intervention based on exclusion criteria and 5 other subjects did not complete the intervention because of fracture, traveling, age mismatch and were excluded during the study . Thus, matched for weight and age, 20 women, randomly assigned into the control (n = 10) and resistance training groups (n = 10), completed the study . All subjects were inactive and had not participated in regular physical activity for at least 1 year . A written consent was obtained from each participant and all of them received a comprehensive explanation of the proposed study and its benefits and inherent risks . Before beginning the exercise program, according to the recommendation of american college of sport medicine (acsm), some questions were asked to determine participant's suitability for beginning an exercise program . Volunteers were excluded at baseline if they had diabetes, parkinson's disease and peripheral neuropathy or if they were taking hormone replacement therapy (hrt) or medications like -adrenergic blockers, -agonists, ca channel blockers and corticosteroids that would influence muscle amino acid metabolism . Moreover, a physician examined all the participants to detect possible medical problems such as osteoporoses that could prevent them from the training . The study was approved by the research ethics committee of the research institute for endocrine sciences, shahid beheshti university of medical sciences . The experimental design program consisted of 12 weeks of resistance training and four weeks of detraining . Resistance training program, designed to develop muscle mass and strength, was performed three times a week (non - consecutive session) for 12 weeks at a local fitness center . Each session lasted 60 min, and had a warm - up and cool - down period of 10 min stretching and flexibility exercise for limbs and trunk, before and after the strength programs . The exercise sessions were monitored under direct supervision of an exercise specialist to ensure correct technique, safety, and proper exercise intensity . We used the charts that show the resistance strengths for the thera - band color sequences to determine the force that were produced by thera - band . Then, for each subject, the 1 repetition maximum (1-rm) was estimated using the following formula to adjust the exercise intensity: 1-rm = w/[1.0278 (0.0278 r)] (w = force produced by thera - band and r = number of repetitions). Based on the related tables, 10-rm for arm muscles was derived and the resistance exercise program was designed for each participant, based on 80%, 85%, and 100% 10-rm . The resistance exercise consisted of 10 movements with three sets of 10 repetitions that were separated by 3 min of rest . At the end of each month, 1-rm with the thera - band tubing was determined and the resistance exercise program was designed based on the new record . The resistance training (rt) group performed the chest press, biceps curl, triceps extension, side shoulder raise, seated row, seated shoulder press, up right row, lateral raise, lat pull down and front raise . Following completion of the resistance training program, the rt group was instructed to maintain their normal lifestyle and avoid starting any new exercise program during the detraining period . The control (c) group was instructed to keep their normal pattern of activity during the 12 weeks intervention period and the four weeks of detraining . Measurements were done to three times points; at baseline, after 12 weeks intervention, and subsequently, after four weeks of detraining in both groups . Also, 1-rm for biceps was determined using the dumbbell for both groups . Body weight of participants were assessed using a digital electronic weighing scale (seca 707; range 0.1 - 150 kg, hanover, md) with an accuracy of up to 1 kg for body weight . With shoes removed and wearing light clothing, standing height was measured barefooted to the nearest 0.1 cm and body mass index (bmi) was calculated as weight (kg)/height (m). Three sites of skinfold thickness (triceps, subscapular, and suprailiac) were determined using the harpenden caliper to the nearest 0.1 mm in triplicate on the right side of body and the mean values between two nearest measurements were used for analysis . Percentage of body fat were estimated from skinfold thickness (triceps and subscapular), based on mcardle method . Fat mass was calculated by multiplying percentage of body fat to body weight, and fat free mass (ffm) was estimated by subtracting fat mass from body weight . Percentage of body fat: 0.55 (sf thickness of triceps) + 0.31 (sf thickness of subscapular) + 6.13 mid - arm circumference (mac) was measured using the non - elastic measuring tape at the midpoint between the acromion process and the olecranon process and then muscle mid - arm circumference (mamc) was estimated using the following formula: mamc = mac (cm) (3.14 skinfold thickness of triceps). Before initiating the resistance exercise program, after training, and detraining, a three - day - diet recall was completed at three times point to determine any weight changes and body composition from pre- to post - training . All subjects were asked not to change their dietary pattern throughout the duration of study . A 10-min warm up, stretching, and flexibility exercise for limbs and trunk was done before flexibility testing . Range of motion for trunk flexion (sitting position) was determined by the sit - and - reach test . The participants were asked to sit on the floor with legs fully extended and bare feet against the standard sit - and - reach box, and then to bend over and touch the box with both hands as far as possible . The best of three trials was recorded . For trunk extension (prone position), participants were asked to lie face down with arms at the side and extended the spine by lifting the shoulders and chin from the floor as far as possible . The kolmogorov smirnov test was used to determine normality of the distribution for outcome measures and data are reported as the mean and standard deviations . For comparing the means of two groups, independent sample t - test was used to examine any differences between the rt and the c groups for each variable . Repeated measures were used to examine any differences between baselines, after intervention, and detraining values in the rt and the c groups . Data were analyzed using spss version 15 and an alpha level <0.05 was considered significant . There were no significant differences between the training and control groups in age, height, weight, bmi, and dietary intake [table 1]. The mean and standard deviations of skinfold thickness, maximum force, mamc, trunk flexion, and extension at baseline, 12 weeks of resistance training and detraining are shown in table 2 . Subjects characteristics at baseline, after resistance training, and after detraining effects of resistance training on physical measurements mean s.d for age and height in the c group was 56.7 3.9 years, 155.9 7.3 (cm) and for the rt group was 54.4 4.7 years, 157.0 6.6 (cm), respectively . There were no significant differences in bmi and caloric intake (kcal) in the rt and the c groups throughout the 16-week experimental period . However differences between the rt and the c groups after 12 weeks of resistance training and at the end of study in triceps skinfold thickness, percentage of body fat, and trunk extension were statistically significant (p <0.05). In the rt group, there was a significant increase in maximum force for biceps curl [table 2] from 4.7 1.3 kg to 5.3 1.2 kg after intervention, and a decrease from 5.3 1.2 kg to 5.1 1.2 kg after detaining (p <0.05). During 12 weeks of intervention, significant increases were observed in mamc (from 24.5 3.1 to 25.7 3.3 cm), ffm (from 49.4 7.3 to 51.6 7.9 kg), trunk flexion (from 7.1 3.7 to 9.4 3.9 cm) and extension (from 17.3 5.5 to 20.5 6.0 cm) and after four weeks detraining, significant decreases were observed in mamc (from 25.7 3.3 to 25.6 3.2 cm), trunk flexion (from 9.4 3.9 to 9.0 4.1 cm) and extension (from 20.5 6.0 to 19.9 6.0 cm) in rt group [table 2]. The rt group demonstrated significant decreases during resistance training and increases during detraining in skinfold thickness (triceps, subscapular, and suprailiac) [figures 13]. Mamc, ffm, trunk flexion, and extension decreased and skinfold thickness (triceps, subscapular, and suprailiac) [figures 13]; percentage of body fat, and weight of body fat increased in the control group (p <0.05) [table 2]. Skinfold thickness (triceps) in the resistance training group during a 12 weeks strength program followed by a 4 weeks detraining period . Significant difference from training skinfold thickness (subscapular) in the control group during a 12 weeks strength program followed by a 4 weeks detraining period . Significant difference from training skinfold thickness (suprailiac) in the control group during a 12 weeks strength program followed by a 4 weeks detraining period . Significant difference from training after four weeks of detraining period, values of mamc, trunk flexion, and extension were still higher (p <0.05) [table 2] and skinfold thickness were lower (p <0.05) compared to the baseline values in the rt group [figure 1]. Our findings showed that 12 weeks of resistance training with thera - band tubing significantly improved muscle function and enhanced strength and muscle endurance in postmenopausal women, whereas four weeks of detraining caused significant reduction in the muscle strength . In this study we used thera - band tubing for resistance exercise training because it is cheap, available, and easy to work with and, make no noise . However, in most studies in this area, strength training was performed with resistance - related machines, which are usually not available for everyone and increase the risk of injury and muscle damage . According to the acsm reports, strength training is important for improving quality of life and physical function in older adults . Moreover, resistance exercise training can be a safe and effective strategy to enhance the neuromuscular system of older adults . However, recommendations of resistance exercise prescription for the elderly have emphasized that increase in exercise intensity should be slower and at a lower rate of progression, compared with younger adults . In addition, previous studies have reported that after a short - term detraining period, the muscle strength gain induced by resistance exercise programs is lost . When physical exercise is stopped (detraining), the body may lose the beneficial adaptations, which is a response to diminished physiological demand . Since, older adults are more likely to interrupt an exercise program due to various conditions, such as hospitalization, exercise programs should aim to obtain longer lasting effects on muscle strength . Decrement in strength, a greater potential of disability and functional impairment in activities of daily living, insulin resistance, an increased incidence of falls and hip fractures is likely the result of age - related atrophy in muscle mass . Sarcopenia contributes significantly to decrease quality of life and health - care costs in the elderly . Our data revealed that 12 weeks of training improved maximum force for biceps curl, while in the detraining period, muscle strength was decreased, although the strength was greater in the resistance group compared to the baseline values and the control group . Examined the effect of strength training and short - term detraining on maximum force and the rate of development of 24 older men (70 - 80 years), during a 16-week training program, three times per week, three sets of six to ten repetitions at 70 - 90% of 1-rm and followed by 4 weeks of detraining; they concluded that high - intensity resistance training can improve maximum force and rate of development of older men, but these individuals may lose some performance after a period of detraining . Evaluating the effects of 10 weeks of moderate resistance strength training followed by 6 weeks of detraining on muscle strength, kalapotharakos et al . Studied 18 healthy older men (61 - 75 years); the moderate resistance strength group, performed resistance protocol for 1 h, 3 times per weeks 3 sets of 15 repetitions at 60% of 1-rm and were instructed to continue their usual leisure activities as before and not to perform any strength exercises; results showed that muscle strength improved after moderate resistance strength training and that short - term detraining period affects muscle strength and power in older adults . Various strength training programs can be developed based on intensity of training (load), the number of sets and repetitions (volume), repetition velocity, length of exercise and rest between sets, and the number of exercise sessions per week (frequency). Nevertheless, it is unclear that how rate of intensity and volume are necessary to significantly improve strength gains and physical performance in this population . Previous study suggests that resistance training with 80% 1-rm may improve health and function in older adults . However, few studies have documented the effects of the low (50% 1-rm), moderate (70% 1-rm), and high intensity (90% 1-rm) resistance exercise on strength development in the elderly, and results show that the low, moderate, and high intensity training caused a significant strength improvement, but the high intensity training protocol caused the most impressive improvement of strength as compared to the low and moderate intensity training . The most important benefit of increased muscle strength in the elderly is a decreased risk of falling, helping them to maintain an independent lifestyle . We showed decrease in body fat and skinfold thickness in response to 12 weeks resistance training without any changes in bmi in the rt group . On the other hand, we found significant differences between the rt and c group only in triceps skinfold thickness and percentage of body fat, possibly because of changes in body fat distribution while the caloric intake was not changed in study population . Hunter et al . Also reported that older adults can lose fat mass after 25 weeks of resistance training program when weight is maintained . The results of kang et al . Indicated that after 12 weeks of light resistance exercise 3 day / wk and 40 min, using dumbbells and rubber band, both body weight and body fat were decreased . It seems weight loss in these subjects occurred because of the mild energy restriction during intervention . After detraining, we saw increase in percentage of body fat and skinfold thickness, although it was still lower than baseline values . Therefore, the resistance program, performed on a regular basis, can maintain the effects of exercise adaptations . We found resistance training had a significant and positive effect on mamc and ffm changes that accompanied the change in muscle function, and a significant negative effect on mamc changes after a short term detraining period . Our findings are consistent with the results of the melnyk and yarasheski studies; melnyk et al . Examined the effects of 9 weeks of strength training and 31 weeks of detraining on regional muscle areas and they concluded that strength training induced increases in cross - sectional areas . Reported that at 3 months of supervised weight lifting exercise, performed 3 days / wk at 65 - 100% of initial 1-rm, muscle contractile protein synthetic pathway, increased with progressive resistance exercise training in 76 - 92-year - old women and men . Some other similar studies in older adults, assessing body composition with dual energy x - ray absorptiometer, also reported no significant change in total body weight with modest changes in ffm and fat mass . Considering that women typically have a smaller muscle mass in both the upper and lower body and aging is associated with not only a loss muscle mass but also an increase in fatty infiltration in muscle, a program of resistance exercise may be an appropriate strategy to prevent disability induced by sarcopenia . Increase in the rate of muscle protein synthesis, which is greater than protein breakdown reflects the alteration in ffm, which is the rate of synthesis after a training period . Our investigation showed that trunk flexibility improved during intervention and the flexibility gains were lost after detraining but the values still were greater than baseline . Flexibility losses leads to dysfunction and inability to perform everyday activities such as getting up from a chair, walking, and climbing stairs . . Showed that resistance training with intensities greater than 60% of 1-rm improved range of motion and flexibility gains and detraining reversed these gains in elderly people; their findings suggested that adaptations in strength and flexibility performance are highly associated with the exercise intensity used . Aging is strongly associated with significant loss in range of motion and flexibility is important for maintaining or improving joint range of motion that can be related to a higher quality of life and independency for elderly people . Showed that the combination of resistance training and flexibility training produces a significant improvement in joint range of motion in older adults . Therefore, it seems that resistance training with stretching, and flexibility exercise is an effective exercise to enhance flexibility, which are an important fitness parameter contributing to, optimal health functional status and independent living of elderly women . In addition, we presented no data about the effects of resistance training on bio - chemical factors like urinary 3-methylhistidine or serum leucine, and studies are recommended to assess these factors . The findings of the present study indicated that 12-week resistance training regimen with thera - band tubing is sufficient to enhance strength of healthy postmenopausal women which may contribute to prevent disabilities induced by sarcopenia with advanced age . This suggests that a resistance strength training program is an effective intervention to prevent functional reductions, increase the quality of life and can contribute to the improvements in daily activities, prolonging independence, and the safety of women . Postmenopausal women should continue to train and minimize detraining periods, as increased physical activity levels are essential for the protection of neuromuscular function, muscle tissue, and functional performance.
Abdominal compartment syndrome (acs) is defined as a sustained intra - abdominal pressure (iap) associated with new organ dysfunction / failure . Acs or intra - abdominal hypertension (iah) may occur after intra - abdominal events such as surgery, trauma and peritonitis . Acs progression can be life threatening with multiple organ dysfunction in the respiratory, cardiac, renal and gastrointestinal systems . Emergency laparotomy for abdominal decompression is often considered in patients with acs,,,,,, . We report the first known case of acs owing to simple elongated sigmoid colon, without volvulus or peritonitis . An 86-year - old man presented at our hospital for chronic constipation with elongated sigmoid colon . He did nt take any medicine that could slow up the bowel movements, as anti - depressive drugs or another . Moreover, the frequency of his admission to hospital had increased up to once a month . At each admission, he was treated with colonoscopy to remove sigmoid colon gas, subsequently becoming symptom - free . The patient has developed several symptoms of dementia along with his aging, which have led to poor performance status . Recently, on admission, he suffered from severe abdominal distension with hypotension, tachycardia and tachypnea twice a week . Iap was measured using the trans - bladder method and showed elevated iap of 21 mmhg . Abdominal x - ray showed a large quantity of sigmoid colon gas and elevated bilateral diaphragm (fig . However, laboratory investigations were unremarkable for blood cell count, biochemical factors and blood gas . Contrast - enhanced computerized tomography (ct) scan demonstrated that the sigmoid colon was only elongated at the extremities and dilated with the large quantity of gas, and apparent volvulus was not observed . Meanwhile, the patient s inferior vena cava had collapsed because of the dilated colon (fig ., we decided to decompress colon gas by colonoscopy, instead of performing emergency laparotomy . However, we decided to perform elective surgery the day after the interventional decompression by colonoscopy . On laparotomy, his sigmoid colon was approximately 100 cm in length, but his rectum was normal . The dilated sigmoid colon was successfully resected, and the subsequent reconstruction was done by functional end - to - end anastomosis (fig . Histological examination showed normal sigmoid ganglion cells, and the patient was diagnosed with simple elongated sigmoid colon without volvulus and idiopathic megacolon . An 86-year - old man presented at our hospital for chronic constipation with elongated sigmoid colon . He did nt take any medicine that could slow up the bowel movements, as anti - depressive drugs or another . Moreover, the frequency of his admission to hospital had increased up to once a month . At each admission, he was treated with colonoscopy to remove sigmoid colon gas, subsequently becoming symptom - free . The patient has developed several symptoms of dementia along with his aging, which have led to poor performance status . Recently, on admission, he suffered from severe abdominal distension with hypotension, tachycardia and tachypnea twice a week . Iap was measured using the trans - bladder method and showed elevated iap of 21 mmhg . Abdominal x - ray showed a large quantity of sigmoid colon gas and elevated bilateral diaphragm (fig . However, laboratory investigations were unremarkable for blood cell count, biochemical factors and blood gas . Contrast - enhanced computerized tomography (ct) scan demonstrated that the sigmoid colon was only elongated at the extremities and dilated with the large quantity of gas, and apparent volvulus was not observed . Meanwhile, the patient s inferior vena cava had collapsed because of the dilated colon (fig ., we decided to decompress colon gas by colonoscopy, instead of performing emergency laparotomy . However, we decided to perform elective surgery the day after the interventional decompression by colonoscopy . On laparotomy, his sigmoid colon was approximately 100 cm in length, but his rectum was normal . The dilated sigmoid colon was successfully resected, and the subsequent reconstruction was done by functional end - to - end anastomosis (fig . Histological examination showed normal sigmoid ganglion cells, and the patient was diagnosed with simple elongated sigmoid colon without volvulus and idiopathic megacolon . Acs was first reported by kron et al . In 1984, who described its pathophysiology resulting from iah secondary to aortic aneurysm surgery . Acs is defined as a sustained iap> 20 mmhg that is associated with new organ dysfunction / failure . Elevated iap possibly induces adverse effects on pulmonary, cardiovascular, renal, splanchnic, musculoskeletal and central nervous system physiology,,,,,, . For example, iap causes a direct reduction in cardiac output resulting from the decreased cardiac venous return from the inferior vena cava and portal vein . The elevated diaphragm causes reductions in total lung capacity, functional residual capacity and residual volume . The disordered physiology following iah may result in a clinical syndrome with significant morbidity and mortality . The correct diagnosis of acs onset and timely appropriate intervention are required for optimal outcome . Although the exact incidence of acs has not been established, studies have increasingly examined acs in certain groups . Abdominal surgery, major trauma, volvulus, acute pancreatitis, liver dysfunction, sepsis, shock, obesity and age have all been reported as risk factors for acs, . In the present case, we diagnosed acs originating from a simple elongated sigmoid colon, because we observed abdominal distension with elevated iap, hypotension, tachycardia and tachypnea . The mental and physical functions of this patient were gradually declining owing to his progressive dementia . Iah or acs may become more common with a growing aging population, particularly in japan . Several previous reports have demonstrated iah and acs triggered by sigmoid volvulus or peritonitis . However, ours is the first case of acs based on simple elongated sigmoid colon . This report may serve as a warning case for surgeons that acs may occur even in simple elongated colon without volvulus or peritonitis . We described for the first time a case of acs originating from an elongated sigmoid colon in an elderly man . Considering the growing aging population and higher likelihood of acs, surgeons will need to precisely diagnose acs and determine the optimal time for surgery . Written informed consent was obtained from the patient for publication of this case report and accompanying images . A copy of the written consent is available for review by the editor - in - chief of this journal on request . Yk has been involved in drafting of the manuscript and revised it critically for important intellectual content.
Ventricular tachycardia or fibrillation (vt / vf) in patients with acute myocardial infarction (ami) is associated with a poor prognosis.1) despite a better prognosis for early vt / vf compared to late vt / vf, early refractory vt / vf is a serious obstacle for the definitive treatment with primary percutaneous coronary intervention (pci). One of the recent advances in the field of critical care is the extracorporeal life support (ecls) system, which is portable, readily applicable and easy to maintain . Before its advent, patients with ami complicated by refractory vf / vt before commencing primary pci would rarely survive or recover without ischemic brain damage . Such patients are among those who can derive the most benefit from ecls at present . In fact, ecls has well demonstrated its efficacy in treating in - hospital cardiopulmonary arrest and is being used for broader indications then before.2) the use of ecls after prolonged cardiopulmonary resuscitation (cpr), a traditional contraindication, is particularly challenging . Here, we present two cases of emergency ecls after prolonged cpr for in - hospital cardiac arrest caused by refractory vf in patients with ami waiting for primary pci . A 55-year old man visited the emergency room due to acute ch - est pain . His vital signs were stable but his electrocardiogram (ecg) showed st - elevation in leads ii, iii and avf as well as q waves in leads v 1 and 2 (fig . 1). The patient had a history of repeated amis, for which he had received multiple stents in two different hospitals . Despite the higher risk of recurrent cardiovascular events, his compliance seemed poor and he was still a heavy smoker . His current medication included triple antiplatelet therapy, a lipid - lowering agent, a beta - blocker, and an angiotensin - converting enzyme inhibitor . The pain - to - door time was about 30 minutes and the pci team was called after diagnosis of an acute inferior wall st - elevation myocardial infarction (stemi). During the stay in the emergency room, the patient suddenly collapsed from vf . Cpr was initiated and repeated shocks at maximum energy were administered . Throughout about 30 minutes of conventional cpr,, we decided to implement ecls (capiox ebs, terumo, tokyo, japan). The right femoral vessels were accessed guided by anatomical landmarks and ecls was finally implemented, about 2 hours from the initiation of cpr . With full support, we achieved a flow rate of 4.8 l / min and mean arterial pressure of 70 mm hg, but vf persisted . Now the patient could be transferred to the catheterization room to undergo primary pci, without the need for chest compressions for his fibrillating heart . In the catheterization room, the left femoral artery accessed also guided by anatomical landmarks and a coronary angiogram (cag) was performed . The right cag revealed one stent in the proximal portion that was totally occluded by a thrombus (fig . The coronary flow was successfully restored after ballooning, about three hours from the onset of chest pain . We implanted a long drug - eluting stent on the previous stent because the residual stenosis after ballooning was more than 80% (fig . We finished the procedure by installing an intra - aortic balloon pulsation (iabp) catheter to assist recovery . The iabp and ecls could be weaned on the third day and the patient was transferred to general ward on the fourth day . He was discharged with chest wall pain, caused by the cpr, and a large hematoma around the ecls cannula insertion site, which had required a transfusion . Vital signs were stable but his ecg showed st - elevation in leads v 1 - 4 and isolated vpc . He had hypertension, hypercholesterolemia and acquired immunodeficiency syndrome, for which he received regular medications including anti - viral agents . The pain - to - door time was about 60 minutes and primary pci was promptly arranged after diagnosis of an acute anterior wall stemi . During transfer to the catheterization room, one run of non - sustained vt appeared which could be suppressed with intravenous lidocane . However, during preparation for the procedure in the catheterization room, a sustained vt developed and turned into vf . We immediately called the ecls team and continued cpr . At about 45 minutes of continuous cpr, normal sinus rhythm spontaneously restored with the implementation of ecls (capiox ebs, terumo, tokyo, japan) via the right femoral vessels . Restoration of sinus rhythm resulted in a stable patient with a flow rate of 2.5 l / min and mean arterial pressure of 80 mm hg . His right cag showed no significant stenosis, however, the left cag revealed a thrombotic occlusion of proximal left anterior descending coronary artery . Coronary flow was successfully restored after ballooning, about two and half hours from the onset of chest pain . We implanted a drug - eluting stent in the culprit lesion with no further complications . He regained full consciousness the same day, in the absence of any neurological deficit . The ecls could be weaned the second day and the patient was transferred to general ward on the third day . Finally, he was discharged with no complications except for chest wall pain caused by the cpr . A 55-year old man visited the emergency room due to acute ch - est pain . His vital signs were stable but his electrocardiogram (ecg) showed st - elevation in leads ii, iii and avf as well as q waves in leads v 1 and 2 (fig . 1). The patient had a history of repeated amis, for which he had received multiple stents in two different hospitals . Despite the higher risk of recurrent cardiovascular events, his compliance seemed poor and he was still a heavy smoker . His current medication included triple antiplatelet therapy, a lipid - lowering agent, a beta - blocker, and an angiotensin - converting enzyme inhibitor . The pain - to - door time was about 30 minutes and the pci team was called after diagnosis of an acute inferior wall st - elevation myocardial infarction (stemi). During the stay in the emergency room, the patient suddenly collapsed from vf . Cpr was initiated and repeated shocks at maximum energy were administered . Throughout about 30 minutes of conventional cpr,, we decided to implement ecls (capiox ebs, terumo, tokyo, japan). The right femoral vessels were accessed guided by anatomical landmarks and ecls was finally implemented, about 2 hours from the initiation of cpr . With full support, we achieved a flow rate of 4.8 l / min and mean arterial pressure of 70 mm hg, but vf persisted . Now the patient could be transferred to the catheterization room to undergo primary pci, without the need for chest compressions for his fibrillating heart . In the catheterization room, the left femoral artery accessed also guided by anatomical landmarks and a coronary angiogram (cag) was performed . The right cag revealed one stent in the proximal portion that was totally occluded by a thrombus (fig . The coronary flow was successfully restored after ballooning, about three hours from the onset of chest pain . We implanted a long drug - eluting stent on the previous stent because the residual stenosis after ballooning was more than 80% (fig . We finished the procedure by installing an intra - aortic balloon pulsation (iabp) catheter to assist recovery . The iabp and ecls could be weaned on the third day and the patient was transferred to general ward on the fourth day . He was discharged with chest wall pain, caused by the cpr, and a large hematoma around the ecls cannula insertion site, which had required a transfusion . Vital signs were stable but his ecg showed st - elevation in leads v 1 - 4 and isolated vpc . He had hypertension, hypercholesterolemia and acquired immunodeficiency syndrome, for which he received regular medications including anti - viral agents . The pain - to - door time was about 60 minutes and primary pci was promptly arranged after diagnosis of an acute anterior wall stemi . During transfer to the catheterization room, one run of non - sustained vt appeared which could be suppressed with intravenous lidocane . However, during preparation for the procedure in the catheterization room, a sustained vt developed and turned into vf . We immediately called the ecls team and continued cpr . At about 45 minutes of continuous cpr, normal sinus rhythm spontaneously restored with the implementation of ecls (capiox ebs, terumo, tokyo, japan) via the right femoral vessels . Restoration of sinus rhythm resulted in a stable patient with a flow rate of 2.5 l / min and mean arterial pressure of 80 mm hg . His right cag showed no significant stenosis, however, the left cag revealed a thrombotic occlusion of proximal left anterior descending coronary artery . Coronary flow was successfully restored after ballooning, about two and half hours from the onset of chest pain . We implanted a drug - eluting stent in the culprit lesion with no further complications . He regained full consciousness the same day, in the absence of any neurological deficit . The ecls could be weaned the second day and the patient was transferred to general ward on the third day . Finally, he was discharged with no complications except for chest wall pain caused by the cpr . Prolonged cpr (> 30 minutes) or unwitnessed cardiac arrest are poor prognostic markers for the implementation of ecls.3) according to rhee et al.4) the time to ecls for in - hospital arrest or shock patients was 4323 minutes in failed weaning cases versus 258 minutes in successful weaning cases in korea . With this in mind, although the precise impact of cpr duration on predicting survival or neurologic recovery seems to be unclear, our experiences suggest that well organized cpr can protect the major organs, including the brain, for up to 2 hours in witnessed in - hospital cardiac arrest . With advancements in ecls systems, patients with in - hospital arrest more experience with the use of ecls will help define its most appropriate time of deployment . Because primary pci (the treatment of choice for stemi) is readily available and highly successful in current practice, patients with refractory cardiac arrest are likely candidates for ecls . However, conclusions from our limited experiences should not be generalized to other causes of cardiac arrest . According to recent epidemiological study, sustained vt / vf occurred in 5.7% of acute stemi patients undergoing primary pci, which mostly happened before the end of cardiac catheterization.1) although the frequency of refractory cardiac arrest is not well documented, it is a potential threat in all patients with ami . Our experience of the past two years suggests refractory vf / vt accounts for about 2.5% of patients with stemi waiting for primary pci (unpublished data). The importance of chest compression during cpr is increasingly emphasized.5 - 8) we think the favorable results of our cases are based on the endeavored cpr, conducted with minimal interruption of chest compression . Also, the cpr in both cases was fully directed by the same experienced cardiologist . To improve the outcome of ecls, rapid and accurate cannulation of the ecls system is important . In one of our two cases we spent about 90 minutes on ecls implantation, mostly due to difficulty in cannulation of the pulseless vessel without interrupting chest compression this was further complicated by formation of a large hematoma at the cannulation site, requiring a transfusion . We hope our experiences may contribute to improving the prognosis of patients with cardiac arrest.
Mosquitoes were collected from june to september 2003 at the ejido francisco villa, municipality of pesqueria, state of nuevo leon (2547n, 10003w), with cdc - type light traps baited with dry ice and mechanical aspiration from resting sites on vegetation and in houses . The area is located 40 km northeast of monterrey and consists of mixed suburban housing and agriculture . Average annual rainfall in the region is 550 mm; the mean annual temperature is 28c . After collection, the mosquitoes were placed on dry ice for transport back to the medical entomology laboratory, faculty of biological sciences, autonomous university of nuevo leon, monterrey, where they were separated into pools of 10 insects each, based on species, date, and method of collection (table 1). The mosquitoes were stored in a mechanical freezer at 70c and later transported on dry ice to the university of texas medical branch (utmb) to be processed for virus isolation . A total of 2,297 mosquitoes, representing 4 genera and 11 species, were tested in 238 pools (table 1). Individual mosquito pools were titrated manually in sterile, ten broeck tissue grinders containing 1.0 ml of phosphate - buffered saline, ph 7.4, containing 30% fetal bovine serum and antimicrobial agents (penicillin, streptomycin, and amphotericin). The resultant suspension was centrifuged at 12,000 rpm for 5 min; then 200 l of the supernatant was injected into a flask culture of vero cells . After the solution was absorbed for 1 h at 37c, maintenance medium (9) was added; cultures were maintained in an incubator at 37c and examined daily for evidence of viral cytopathic effect (cpe) for 14 days . A single pool of cx . Quinquefasciatus yielded a virus isolate, designated nl-54, which produced cpe on approximately day 7 . The isolate was identified as wnv by immunofluorescence, hemagglutination - inhibition (hi) test, complement - fixation test, vectest wnv / sle antigen assay (medical analysis systems, camarillo, ca, usa), and reverse transcription polymerase chain reaction (rt - pcr) (9,10). The wnv human isolate was from a 62-year - old mexican woman living in the municipality of etchojoa (near ciudad obregon) in sonora state . She visited a local hospital in july 2004 with symptoms of fever, headache, vomiting, arthralgias, and myalgia . An acute - phase blood sample was obtained, and a presumptive diagnosis of dengue fever was made . The patient was sent home and subsequently completely recovered . When rt - pcr using dengue primers was negative on the acute - phase serum, a culture was performed . Wnv was isolated from the sample at the state public health laboratory in sonora and at utmb, upon culture in vero cells . Hi tests conducted on the acute - phase serum at utmb with west nile, st . Louis encephalitis, yellow fever, dengue 1, and dengue 2 viral antigens were negative, which indicated that the patient had no preexisting flavivirus antibodies . An immunoglobulin (ig) m enzyme - linked immunosorbent assay (11), performed on the acute - phase specimen and a 30-day convalescent - phase serum specimen in sonora, demonstrated seroconversion and the presence of wnv - reactive igm antibodies in the convalescent - phase serum sample . Viral rna was extracted from the 2 wnv strains after a single vero cell passage directly from 140 l of the infected cell culture supernatants, using the qiaamp viral rna extraction kit (12). Rt - pcr was performed by using 3 primer pairs to amplify the entire prm - e genes of each wnv isolate as previously described (12). Pcr products were gel purified with the qiaquick kit (qiagen, valencia, ca, usa) according to the manufacturer's protocol, and the resulting template was directly sequenced with the amplifying primers . Analysis and assembly of sequencing data were performed with the vector nti suite software package (informax, frederick, md, usa). Nucleotide and deduced amino acid sequences of the 2004-nucleotide region representing the prm - e genes from each isolate were aligned with the alignx program in the vector nti suite and compared to sequences of selected north american wnv isolates for which the prm - e genes were available in genbank . Phylogenetic trees were constructed by bayesian analysis with the program mrbayes, version 2.0 (13), with the metropolis - coupled, markov chain, monte carlo algorithm run with 4 chains over 150,000 generations under a general time - reversible model with a burn - in time of 50,000 generations . The bayesian consensus tree was compared to trees generated by neighbor - joining, maximum parsimony, and maximum likelihood analyses using paup, version 4.0b10 (14), and each method generated trees with the same overall topology . The consensus phylogram of the 40 wnv isolates generated by bayesian analysis (13) is shown in the figure, with confidence values at relevant nodes to demonstrate statistical support for each clade . Phylogram of 2 west nile viruses (wnv) isolated from a mosquito pool and human serum in mexico (shown in bold). The phylogenetic tree was generated by bayesian analysis of a 2004-nucleotide region of the prm and e genes of 40 wnv isolates rooted by the most closely related old world strain, israel 1998 . Ay963774), to the prototypical north american wnv isolate, wn - ny99 (genbank accession no . Ay371271) (2), and an isolate collected in harris county, texas, in 2002 (genbank accession no . Ay185906) (15) indicated nucleotide and deduced amino acid differences and similarities among each of the isolates . Both the mexican mosquito and human isolates reported herein shared a nucleotide mutation at position 660 (c to u) of the prm gene and 2 mutations at positions 1442 (u to c) and 2466 (c to u) of the e gene . Each of these 3 mutations was shared with a 2003 horse strain from nuevo leon (mexnl-03) (7) and a 2002 bird isolate from harris county, texas (tx-1) (15). The mutation at nucleotide 1442 also represented a deduced amino acid substitution in the envelope protein (v159a). The mexican mosquito and human isolates reported herein shared a unique mutation at genomic position 1320 (a to g) in the e gene . The human isolate also had 3 additional mutations in the e gene at positions 1074 (g to a), 1656 (u to c), and 1974 (c to u). The nucleotide mutations at nucleotide positions 660, 1442, and 2466 have also been described in most wnv isolates sequenced from texas, illinois, and colorado in 2002 (12). This finding suggests that isolates obtained from northern states of mexico (i.e., nuevo leon and sonora) were derived from wnv strains circulating in the western united states . Only a single mutation at position nucleotide 2466 was shared by these 2 isolates and a 2003 bird isolate from tabasco state (tm171 - 03). This finding supports results from earlier studies that suggest separate introductions of wnv into mexico (2,7). Phylogenetic trees generated by a number of methods indicate that the recent mexican mosquito and human isolates belong to the clade comprised of wnv isolates collected outside the northeastern united states after 2001, with the exception of isolates collected along the southeast coast of texas . (those isolates constitute a separate, sister clade relative to all other north american wnv isolates sequenced to date [figure].). Because of a shared mutation between the recent mexican mosquito and human isolates, these 2 virus strains constitute a distinct subclade within the larger us 2002 clade that is supported by strong bayesian confidence values (94%). The accumulation of 3 additional nucleotide mutations in the 2004 mexican human isolate is illustrated by longer branch lengths in comparison to the 2003 mosquito pool isolate nl-54, which suggests the continued microevolution of wnv in mexico from year to year . * nucleotide numbers correspond to wn - ny99; amino acid substitutions are in brackets . Genbank accession number . Our patient represents the first reported autochthonous human case of confirmed wnv infection in mexico . The paucity of human cases reported to date from mexico is curious for several reasons: 1) a large number of cases are reported from the united states, 2) available evidence indicates that wnv is now widely distributed in mexico (17), 3) most of the wnv virus strains circulating in the republic are genetically similar to those in the united states (figure). One explanation for this difference could be the failure of local health personnel to recognize the various clinical forms of wnv infection . As illustrated by our patient, west nile fever can easily be mistaken for dengue fever . A second reason may be the difficulty of making a serologic diagnosis of wnv infection among persons living in geographic regions where several different flaviviruses circulate, and people have multiple flavivirus infections (11). A third and related possibility is that wnv infection may be less severe in persons with preexisting heterologous flavivirus antibodies (11).
It is an infection caused by various fungal species of trichophyton, epidermophyton, and microsporum genera, together known as dermatophytes belonging to order onygenales . Terbinafine was added to this list of antifungals in the early 1990s and has since then shown good efficacy in widespread tinea infections . It is the only orally available allylamine antifungal . With a favorable mycological and pharmacokinetic profile, terbinafine is considered to be a first - line drug for the treatment of tinea corporis and cruris . Squalene epoxidase is an enzyme responsible for synthesis of ergosterol, an important component of fungal cell membrane . This ultimately results in fungal cell wall disintegration allowing terbinafine to exert its fungicidal action . The side effects include gastrointestinal side effects such as nausea, vomiting, and abdominal pain . The drug has shown consistent efficacy against dermatophytes achieving more than 90% cure rates at a dose of 250 mg / day when administered for 2 weeks . However, recently, we have observed decreased efficacy terbinafine in patients with tinea infections . This study is aimed at documenting these cases of terbinafine therapy failure in patients of tinea corporis and/or tinea cruris . We also tried to see the correlation of this resistance with the species involved as well as the percentage of body surface area involved . The study was carried out in northern part of india during spring and summer season with an average humidity of 70% and an average temperature of 28c . Patients diagnosed to have tinea corporis and/or tinea cruris on clinical examination and involving more than 1% body surface area were taken up for the study . The diagnosis was made by clinical examination followed by 10% koh smear and culture in all the patients . Only culture positive patients were included in the study and culture negative patients were excluded from the study . Patients who had taken any treatment, had any previous history of intolerance to the drug under study, had any abnormality in the laboratory investigation or who were immune compromised, pregnant or lactating, were excluded from the study . Moreover, patients with a history of tinea infections in family, friends, or close contacts were also excluded from the study . A total of 100 patients satisfying all the inclusion criteria were included in the study . Culture was performed simultaneously on sabouraud's dextrose agar (sda) medium with chloramphenicol and sda with chloramphenicol and cycloheximide . All the enrolled patients were put on oral terbinafine 250 mg once daily for 2 weeks . No antacids or antihistamines were prescribed, and the patients were advised to take the medication at bedtime . No topical antifungals or antifungal steroid combination agents were allowed during the study . Clinical examination and fungal culture were repeated at the end of treatment period to document clinical and mycological cure, respectively . Residual pigmentation was present in some cases but was not taken as suggestive of incomplete cure . Patients who had a persistent clinical disease on clinical examination were given alternate oral treatments and were excluded from further analysis . Cases, in whom the disease was seen to be cured clinically, were advised to go for repeat cultures from the initial involved sites only . In addition, these clinically cured patients were asked to come for follow - up every 2 weeks . Relapse was defined as the appearance of lesions seen clinically and confirmed on culture subsequently . In this study, a total of 100 culture positive patients of tinea corporis and/or tinea cruris in age group of 1662 years were included in this study . The disease was found to be more common in males, the male: female ratio being 1.63:1 (62 males and 38 females). The majority of patients, i.e., 63% were in the age group 2030 years . The most common causative organisms grown on culture were trichophyton rubrum and trichophyton tonsurans [table 1]. The percentage distribution of various causative organisms involved at the end of oral terbinafine therapy, only 70 cases out of 100 were clinically cured while the rest (30/100) had signs of persistent infection at the treated site (persisters). On repeat fungal culture, five cases out of the seventy clinically cured patients had a positive culture with the same organism that was grown initially . Thus, out of a total of 100 cases enrolled, only 65% could achieve both clinical and mycological cure after 2-week terbinafine therapy (cured). Over the 12-week follow - up, clinical relapse was seen in 22 of the 65 clinico - mycologically cured patients (relapse). Relapse was confirmed on culture as the repeat cultures grew primary pretreatment isolates in all cases . Thus, at the end of 12 weeks, there were only 43 cases out of the total 100 cases enrolled who were able to maintain a long - term clinical and mycological cure after 2 weeks of oral terbinafine treatment [table 2]. Percentage of causative organisms viz - a - viz the cured, persisters and relapse groups majority of the relapses (16/22) were seen after 8 weeks of completion of treatment . This was followed by 3 more cases at the end of 4-week while further 2, 6, 3, and 7 patients relapsed at 6, 8, 10, and 12 weeks, respectively . The mean percentage body surface area involvement in the cured, persistent, and relapse groups was 3.23 1.2%, 3.65 1.73%, and 3.182 1.46%, respectively . Thus, there was no significant difference in the body surface area involvement when compared with the cured and the persistent disease groups (mann whitney u - test, p: 0.3908). Furthermore, there was no significant difference between the cured and the relapse group as far as the body surface area involvement is concerned (mann whitney u - test, p: 0.5952). Dermatophytosis, being among the most common dermatologic conditions, does not spare people of any race or age . According to the world health organization, about 20% of the world population are affected by cutaneous dermatophytic infections . Dermatophytes are related fungi capable of causing skin infection of the type known as ringworm or dermatophytosis . The ringworm species belong to three asexual genera: microsporum, trichophyton, and epidermophyton, which attack the keratinized tissue and cause a wide spectrum of clinical manifestations, of which the most predominant type of infection is tinea corporis followed by tinea cruris, tinea pedis, and onychomycosis . Tinea corporis accounts for about 70% of the dermatophytic infection . In this study, which was limited to cases with tinea corporis and/or tinea cruris we found tinea cruris with corporis was the predominant type seen in 52% of cases followed by tinea corporis only (28%) and tinea cruris only (20%). In this study, . And kumar et al . Reported male: female ratio 1.86:1 and 1.36:1, respectively, in patients with tinea infection . The predominance of males is usually thought to be a result of increased physical activity and thus increased perspiration . The patients belonged to the age group of 1462 years, with the mean age being 29.06 10.76 years . The maximum number of patients, i.e., 63% was in the age group 2030 years . In a recent study by surendran et al . From south india, a similar age statistics was seen . Moreover, multiple authors from various parts of india have reported comparable data on age distribution . Tinea corporis and tinea cruris are most commonly caused by trichophyton species of which t. rubrum is most common infectious agent in the world accounting for around 50% of tinea corporis cases . In this study, the most common causative organism isolated after culture was t. rubrum, followed by t. tonsurans, trichophyton mentagrophytes, trichophyton verrucosum, and microsporum gypseum in that order . Within the genus trichophyton, even one study from northeast india reported t. tonsurans as the most common etiological agent in dermatophytosis . Diagnosis of tinea corporis and/or tinea cruris is mostly done clinically . To avoid a misdiagnosis, important for successful treatment, identification of dermatophyte requires both a fungal culture on sabouraud's agar media and a mycological examination, consisting of a 1015% koh preparation, from skin scrapings . In our patients, koh slide test was positive in 94% of cases . However, much lower percentages of culture positivity in dermatophytosis have been reported by some authors . The treatment is based on the infection site, an area involved etiological agent, and penetration ability of the drug . Although topical antifungals may be sufficient for treatment of tinea corporis and/or tinea cruris, lesions which are widespread or fail to respond to topical therapy need systemic therapy . Among the several systemic antifungal drugs used to treat dermatophytosis, terbinafine's fungicidal action, combined with its excellent pharmacokinetic properties, makes it an ideal systemic drug for the purpose . It exhibits its action on fungi by inhibiting the enzyme squalene epoxidase, thus causing an ergosterol deficiency which is important for fungal cell wall integrity . Terbinafine is particularly effective against the species in trichophyton, microsporum, and epidermophyton genera, which in fact are the most common causative agents for tinea infections . Historically griseofulvin was considered the drug of choice for tinea infections for a pretty long time . However, reports of higher relapse rates with griseofulvin pushed terbinafine to the forefront in treatment of tineacorporis and cruris . Over the years terbinafine slowly gained a first line drug status in the treatment of tinea infections particularly tineacorporis and cruris where clinical and mycological cure rates were reported to be around 90% . Even with an intermittent pulse dose therapy cure rates of around 90% have been reported with terbinafine . However, these results are in contrast to what we experienced in our patients of tinea cruris and corporis treated with oral terbinafine . We found a clinical efficacy of only 43% in our patients followed for a 12-week . Such a low clinical efficacy might be a result of the appearance of resistant strains of dermatophytes . Although resistance to terbinafine in dermatophytosis is very uncommon in clinical practice, it has been reported in clinical isolates which result from sequence variation in the gene for squalene epoxidase . These mutations ultimately decrease the affinity of the terbinafine binding domain resulting in decreased susceptibility to the drug . The low clinical efficacy as observed in this study could not be attributed to extensive body surface area involvement as there was no statistically significant difference between the cured, persistent and the relapsed cases . Again numerous authors have reported excellent results with oral terbinafine therapy in immunocompromised individuals who interestingly have extensive area involvement . Even 1 week short course oral therapy with terbinafine has shown good results in such individuals with extensive skin area involvement . However, primary resistance to terbinafine in clinical t. rubrum strains has been reported long back . Thus, we need to seriously consider the appearance of resistance to terbinafine in dermatophytes as an upcoming challenge in dermatological practice . Our results demand further studies to characterize the resistant strains isolated, at a molecular and biochemical level and further test the susceptibility to various antifungals so that an alternate treatment could be proposed . The main limitation of the study was the absence of calculation of mic in cases with failed cure and relapse . Incomplete cure is very common after a 2-week course of oral terbinafine therapy and recommendations about the daily dose and duration of oral therapy need to be changed and updated accordingly . This article highlights the presence of resistance to terbinafine in our cases of tinea infections . This article makes the dermatologists aware of the growing resistance to terbinafine and stimulates further microbiological studies in this respect . This article highlights the presence of resistance to terbinafine in our cases of tinea infections . This article makes the dermatologists aware of the growing resistance to terbinafine and stimulates further microbiological studies in this respect . This article highlights the presence of resistance to terbinafine in our cases of tinea infections . This article makes the dermatologists aware of the growing resistance to terbinafine and stimulates further microbiological studies in this respect.
Subcellular localization is a key feature for characterizing physiological functions of proteins: in eukaryotes compartmentalization finalizes the sets of possible interacting molecules and therefore the biological process(es) in which a protein is involved . To date it has been carried out only for a narrow subset of known proteins . Presently only unicellular species have been extensively analyzed by means of high - throughput experiments, such as s.cerevisiae (1,2). Different approaches, such as green fluorescent protein (gfp)-tagging (2) and immunoluminescence (1), agree only on 75% of the annotations and this is mainly due to experimental limitations and possible interference of the tagging procedures on the normal protein trafficking (3,4). Although it is difficult to scale these techniques to more complex organisms, a partial map for mouse liver cells was recently produced (5). Curated annotations of the subcellular localization, although probably not covering all the available experimental knowledge, are contained in the swissprot database . The amount of proteins with an experimental annotation listed in swissprot is different for different species and reaches at the most half of the total amount of proteins in a genome (see below). The question remains, however, as to how one can obtain a reliable annotation of subcellular localization for the rest of the proteins . Although in principle a change in few residues could result in a change of the localization of a protein, in practice with very few exceptions natural proteins with a sequence identity> 30% share the same localization (68). In the most successful cases, about two - thirds of a genome can be annotated both by experimental results and similarity search . Many predictors have been developed recently [(4,711), a list is available at]. A prerequisite for a predictive method is its capability of well performing when the query sequence shares very low sequence similarity to known proteins . It is therefore important to implement and adopt predictors tested with a rigorous cross - validation procedure on sets of proteins <30% identical with respect to the sequences used for the training . Another important feature to be considered in adopting a predictor is how the relative abundance of localization among different sub - compartments was treated during the training phase . Indeed, with the available data it is difficult to estimate the real proportions between the proteins targeted into the different subcellular localizations; most of the predictive methods tend in fact to overestimate localization types for which more examples are known (8). It is therefore necessary to adopt predictive methods that attempt to correct bias towards one or more localization classes . They include (i) the results of large - scale experiments for the determination of subcellular localization in specific organisms [ygfp (1), for yeast; and ormdb (5), for mouse]; (ii) the annotations of proteins to be found in organelles [plprot (12), for proteins from plastids; organelledb (13), for proteins in different organelles; and mitop2 (14), for mitochondrial proteins]. A database collecting all the annotations listed in swissprot is also available [dbsubloc (15)]. Finally databases that implement predictors of subcellular localization based on different methods have been reported [loctarget (16) and pa - gosub (17)]. Loctarget (16) is specific for structural genomics targets and lists some 50 000 proteins from different organisms . Pa - gosub (17) contains the annotations of eukaryotic subcellular localization and protein function of different genomes and is based on homology search and bayesian artificial networks for prediction . We recently developed bacello, a well - performing balanced method for the prediction of subcellular localization, outperforming previously existing methods for the same task (8). We adopt bacello to annotate whole genomes in association with methods specifically implemented for the prediction of the topology of integral membrane proteins . In this paper we present eukaryotic subcellular localization database (esldb), a database of protein subcellular localization which provides an annotation for the entire proteomes of eukaryotic organisms . For each sequence our database contains the experimental localization, when available, the homology - based annotation, when feasible, and the predicted localization computed with the in - house developed machine learning based methods . By this the new database provides more features than other existing databases . To date, five proteomes were fully processed: homo sapiens, mus musculus, caenorhabditis elegans, saccharomyces cerevisiae and arabidopsis thaliana . In summary, esldb is, to our knowledge, the first database containing the available experimental and similarity - based annotations for eukaryotic proteomes listing for each protein sequence also the predicted subcellular localization . Five different genomes were downloaded as specified: h.sapiens (ensembl ncbi36), m.musculus (ensembl ncbim36), s.cerevisiae (ensembl sgd1), c.elegans (ensembl cel150) and a.thaliana (tair6). For each protein the corresponding swissprot entry in release 50 was found, when existing, searching for exactly matching sequences . The amount of genomic sequences that is deposited in the swissprot database ranges from 13% for both a.thaliana and c.elegans to 79% for s.cerevisiae (table 1). Number of proteins with an experimental or a similarity - based annotation of the subcellular localization the sequences experimentally annotated are included among those annotated by similarity . For these proteins the experimental annotation was extracted by parsing the the annotations directly or implicitly referring to one of the following 17 classes were taken into account: nucleus, cytoplasm, mitochondrion, plastid, golgi, endoplasmic reticulum, lysosome, endosome, vesicles, peroxisome, vacuole, cell wall, secretory pathway, extracellular, cytoskeleton, membrane and transmembrane (table 1 in supplementary data lists the keywords that have been considered for assigning the localization). Only 22% of all the swissprot entries for the five considered species record the experimental subcellular localization . The rate of experimental annotation ranges from 46% of the s.cerevisiae proteome to <10% for a.thaliana and c.elegans (table 1). The experimental annotation column in table 2 lists the amount of proteins experimentally annotated in each one of the 17 types of considered localization . It is worth mentioning that the same sequence can be annotated in swissprot with two (or rarely more) different localizations . For example, this happens for proteins that shuttle between the nucleus and the cytoplasm . In these cases it is evident that the amount of proteins in the different localizations spans two orders of magnitude . Number of sequences in the 17 different subcellular localizations as derived with experimental and similarity - based annotations the sequences experimentally annotated are included among those annotated by similarity . The best way to annotate the remaining proteins is to search for experimentally annotated sequences sharing high identity (68). Since the three eukaryotic kingdoms (metazoa, viridiplantae and fungi) differ in number and types of possible localizations, three kingdom - specific datasets of annotated proteins were extracted from swissprot . These dataset contains 26 192 sequences for metazoa, 6370 sequences for viridiplantae and 4023 sequences for fungi . All the sequences of the five considered genomes were searched for similar sequences in the appropriate dataset using blast (18). When matches were found with an e - value <10 (roughly corresponding to an identity level> 30%) the annotation of the best - scoring match was transferred to the query sequence . When multiple matches are found with the same best scoring e - value, similarity - based annotation column in table 2 contains the number of proteins annotated with the above described procedure in each localization (including the sequences experimentally annotated). Also in this case, sequences that end up with a multiple annotation are counted several times . It appears that a large portion of the sequences, ranging from 32% in h.sapiens up to 67% in a.thaliana, is not endowed with similar counterparts with an annotated localization . In this case subcellular localization can be predicted with specifically suited methods . For generating our annotation system we developed a pipeline that comprises previously described methods, all based on machine learning tools and that are proved to outperform most of the available predictors for the same task when rigorous cross - validation procedures are adopted (8). The pipeline is shown in figure 1 . First of all, membrane proteins are discriminated with spep (19) and ensemble (20): the former is a neural network based method for predicting the presence of signal peptide while the latter is a method based on neural networks and hidden markov models for the prediction of the topology of all - alpha transmembrane proteins . When a signal peptide is predicted, it is cleaved from the sequence before predicting the presence and the location of the transmembrane helices . If no transmembrane helix is found, the uncleaved sequence is analyzed using bacello (8), a recently developed tool for predicting the subcellular location of eukaryotic proteins . This is based on a decision tree of support vector machines and it discriminates four localizations in metazoa and fungi (cytoplasm, nucleus, extracellular and mitochondrion) and five localizations in viridiplantae (the same as before plus chloroplast). Bacello, spep and ensemble are predictive methods described previously (8,17,18). At the end of the pipeline up to five localizations can be discriminated in metazoa and fungi and up to six in viridiplantae . Although the possible types of localization are 17 (see above), the actual reduction in the number of discriminated localization is due to the lack of an adequate number of non - redundant examples for training . A novelty of bacello is that first takes into consideration that the actual proportion of proteins targeted towards each compartment remains unknown by adopting an equiprobability hypothesis and a balancing procedure (8). The structure of the predictive system allows annotating the subcellular localization in a hierarchical way . First, all membrane proteins are separated from soluble ones; the latter are then divided into intracellular and secreted . Intracellular proteins are separated in nucleocytoplasmic and organellar; the former are then separated in cytoplasmic and nuclear while the latter, in the case of viridiplantae, are further divided into mitochondrial and chloroplastic . The topology of the decision tree and the balancing procedure were adopted for maximizing the prediction performances as evaluated on testing sets independent of the training sets . The best scoring binary decisions are at the top of the tree, the worst - scoring at the bottom . The predictions are stored in the database along with the hierarchy of the decisions in the pipeline . All the proteins of a genome, also when experimental and/or homology - based annotation are possible, are annotated by means of the predictive method . In table 3 number of sequences in the six predicted subcellular localizations table 4 contains the evaluation of the coverage and the accuracy of the prediction for the proteins of h.sapiens, as compared with both the experimental and the similarity derived annotations . We considered 6444 unique proteins experimentally annotated and 25 134 unique sequences for which a similarity - based annotation is available . The coverage is computed as the fraction of correctly predicted sequences in each class over the number of proteins belonging to the class . The accuracy is the fraction of correctly predicted proteins over the total number of proteins predicted in the class . The agreement between the annotations and the prediction is good, especially when predictions are compared with the experimental annotations and the higher levels of the hierarchical prediction are considered . Performance of the prediction pipeline as compared with the experimental and the similarity - based annotations the indentation of the subcellular localization names reflects the hierarchy of the prediction (see figure 1). Coverage = (no . Of proteins of class i predicted as class i)/(total no . All the data are available at the website () and can be accessed by protein code, as derived from the original and above - mentioned versions of the genomic databases, or by protein description, as derived from the swissprot entries . Alternatively the sequence of interest can be submitted and, by means of the md5 encoding, the match engine searches for identical sequences deposited in the database . Moreover, complex searches can be performed combining the different annotation methods and the different localizations . The entries matching the query keys can either be displayed or downloaded in a tabular format that contains the experimental and the similarity - derived annotation and the localization prediction for each match . Pages containing more details about each one of the proteins (figure 2) are linked to the protein codes and contain the sequence, the description and the link to the swissprot file when an experimental annotation exists . When the sequence can be annotated by similarity, the swissprot entry corresponding to the most similar sequence is reported together with the e - value as computed by blast (18). In both the tabular and the detailed pages, the results of the prediction are given together with the complete path through the decision tree . This information can be useful since, as we commented in the previous section, the accuracy of the prediction lowers as the number of discriminated classes increases . This means that annotations in the macro - classes are endowed with a higher reliability . All the data contained in the database can be freely downloaded in flat file format . The database resides in a postgresql server and the web interface has been implemented using python, html 4.0 and css 2.0 languages . More available eukaryotic proteomes are currently under process and will be added to the database . Moreover we plan to regularly update the database as new versions of swissprot or new releases of the considered proteomes will be available.
Between october 1996 and december 2000, 320 rectal cancer patients, who had undergone preoperative mr imaging and a curative resection using tme, were selected from the radiological and surgical database . In our institution, preoperative pelvis mr imaging was routinely performed for the purpose of providing a staging procedure . Twenty - one patients with a local recurrence and/or distant metastasis were retrieved from those 320 patients . Four patients, who received preoperative therapy between mr imaging and surgery, were excluded in order to eliminate the effect of the preoperative adjuvant therapy on the local recurrence . Finally, 17 patients were enrolled in this study as the locally recurrent group . They consisted of nine men and eight women (mean age 59 [range 22 - 77] years), and had undergone a surgical resection within the two weeks of the mr imaging (mean 6 [range 2 - 14] days). The recurrent sites were the anastomotic sites (n=9), the pelvic sidewall (n=7), and the regional lymph node (n=1). The tumor recurrences were confirmed by open surgery (n=2), a tissue biopsy (n=9), and a clinical evaluation (n=6). The biopsy were carried out using a sigmoidoscope or colonoscope (n=7), an open biopsy (n=1), and an image guided method (n=1). The clinical diagnosis of a local recurrence was based on the follow - up ct or mr imaging showing a gradually increasing mass in the surgical area, an increased level of the serum carcinoembryonic antigen (cea), and a worsening of the clinical course . For the purpose of comparison, the non - recurrent 54 patients (27 men and 27 women, mean age 56 years old) meeting the following criteria were retrieved: 1) they underwent preoperative mr imaging followed by curative surgery within two weeks without neoadjuvant therapy, as in the recurrent group, 2) no radiological or clinical evidence of a local recurrence or a distant metastasis for at least three years, 3) a postoperative pathological stage higher than t1 regardless of the n stage based on the tnm system (table 1) (18), and 4) medical records with a pathological report and the mr images that could be used to review each case . Only those patients with a pathological stage higher than t1 were selected because all patients in the recurrent group had tumors higher than t1 . Distant hepatic metastases were noted in two patients with a local recurrence on the preoperative mr images and a combined curative resection of the primary and metastatic lesion was performed . However, no distant metastases were noted on the preoperative mr images of the non - recurrent patients . Based on the medical records of the subjects, the following variables from the recurrent and non - recurrent groups were compared: patients' age, gender, surgical methods, postoperative adjuvant treatment, and pathological findings from the surgical specimens, including the depth of the tumor invasion (t stage), the status of the lymph node involvement (n stage), tumor location, maximum diameter of the tumor, histological grades, the presence of a microscopic vascular invasion, and the involvement of the resection margin . The analysis was performed by dividing the surgical methods into a low anterior resection and an abdominoperineal resection, and by dividing the tumor locations into the distal, middle, and proximal regions according to the endoscopic findings . The presence of a microscopic vessel invasion was determined according to the original pathological reports . The histological grades were divided into two grades: well or moderately differentiated and poorly differentiated . The circumferential resection margin was considered to be narrow when the distance from the main tumor or the mesorectal tumor deposit to the lateral surgical margin was described as being <1 mm in the original pathological reports (19). Both findings of a narrow circumferential resection margin and the involvement of the proximal or distal margin were grouped together as an involvement of the resection margin . Mr imaging was performed on a 1.5-t whole - body system (horizon, ge medical systems, milwaukee, wis .) Using a pelvic phased - array coil . Tap water was then administered to the rectum to most patients using a rectal tube until the patient indicated discomfort . After the localizer images were obtained, if not contraindicated, 20 mg of scopolamine butylbromide (buscopan; boehringer ingelheim, germany) was injected intravenously in order to minimize the peristalsis and to alleviate the rectal spasm . With the patient in a feet - first, supine position, axial t1-weighted conventional spin - echo images of the pelvis were obtained using a 24 cm field of view (fov) in a 5-mm section thickness, 1.5-mm intersection gap, 500 - 600/8 - 10 (repetition time msec / echo time msec), 256 192 matrix, and 1 signal acquired . The axial, sagittal, and coronal t2-weighted fast spin - echo images were then obtained using a 24 - 26-cm fov in a 5 - 6-mm section thickness, a 1 - 2.5-mm intersection gap, 4,000 - 6,000/75 - 105 (repetition time msec / echo time msec), a 512 256 matrix, an echo train length of 10 - 12, and the two signals were averaged ., k.j.h . ), who were not involved in the preoperative interpretation of the mr examination, analyzed the hard copy images retrospectively . The mr images of the locally recurrent patients were mixed with the non - recurrent patients, and the reviewers analyzed the mr images independently in random order without the clinical or pathologic data . Each reviewer recorded all of the following items: 1) a direct invasion of the perirectal fat by the primary rectal carcinoma, 2) involvement of the perirectal lymph nodes, 3) perirectal spiculate nodules, 4) perivascular encasement, and 5) an enlargement of the pelvic wall lymph node . An interruption of the outer muscular layer and/or a grossly rounded or nodular appearance of the outer margin of the rectal mass were considered to be the indicators of a direct invasion of the perirectal fat by a primary rectal carcinoma . The direct invasion of the perirectal fat with a rounded or nodular margin, which penetrated the outer wall of the rectum, was analyzed separately again because it was believed that the two findings might have a different sensitivity and specificity for an invasion of the perirectal fat . The lymph nodes in the perirectal space was considered a metastatic lymph nodes if they exhibited the following: 1) its size was> 5 mm in the short axis diameter (20), 2) its signal intensity was heterogeneous, or 3) it had an irregular margin with a preserved nodal configuration (21). A perirectal spiculate nodule was defined as a solid nodule in the perirectal space that was separated from the primary rectal mass and had irregular spiky projections on the outer border without any configuration suggesting a nodal structure . A perivascular encasement was defined as an irregular margined soft tissue nodule or conglomerated lymph nodes that were closely attached to the branch of the perirectal vessels . The condition of the small lymph node or tumor nodule simply located adjacent to the vessel was not included in this finding . An enlargement of the lateral pelvic lymph node was defined as those cases with a lymph node> 1 cm along the pelvic wall external to the perirectal fascia (21). Each finding was defined as being present when more than two reviewers recorded the finding as being present . The clinicosurgical profiles and mr imaging findings of the recurrent and non - recurrent groups were compared by a student's t, a chi - square or a fisher's exact test . Logistic regression analysis was used to determine the independent significant factors affecting the local recurrence for the significant variables . A test was used to assess the interobserver variability in terms of the lesion detection and the differentiation of a benign lesion from a malignant focal hepatic lesion . The degree of agreement was categorized as follows: value of <0, poor; of 0.00 - 0.20, slight agreement; of 0.21 - 0.40, fair agreement; of 0.41 - 0.60, moderate agreement; of 0.61 - 0.80, substantial agreement; and of 0.80 - 1.00, almost perfect agreement (22). Between october 1996 and december 2000, 320 rectal cancer patients, who had undergone preoperative mr imaging and a curative resection using tme, were selected from the radiological and surgical database . In our institution, preoperative pelvis mr imaging was routinely performed for the purpose of providing a staging procedure . Twenty - one patients with a local recurrence and/or distant metastasis were retrieved from those 320 patients . Four patients, who received preoperative therapy between mr imaging and surgery, were excluded in order to eliminate the effect of the preoperative adjuvant therapy on the local recurrence . Finally, 17 patients were enrolled in this study as the locally recurrent group . They consisted of nine men and eight women (mean age 59 [range 22 - 77] years), and had undergone a surgical resection within the two weeks of the mr imaging (mean 6 [range 2 - 14] days). The recurrent sites were the anastomotic sites (n=9), the pelvic sidewall (n=7), and the regional lymph node (n=1). The tumor recurrences were confirmed by open surgery (n=2), a tissue biopsy (n=9), and a clinical evaluation (n=6). The biopsy were carried out using a sigmoidoscope or colonoscope (n=7), an open biopsy (n=1), and an image guided method (n=1). The clinical diagnosis of a local recurrence was based on the follow - up ct or mr imaging showing a gradually increasing mass in the surgical area, an increased level of the serum carcinoembryonic antigen (cea), and a worsening of the clinical course . For the purpose of comparison, the non - recurrent 54 patients (27 men and 27 women, mean age 56 years old) meeting the following criteria were retrieved: 1) they underwent preoperative mr imaging followed by curative surgery within two weeks without neoadjuvant therapy, as in the recurrent group, 2) no radiological or clinical evidence of a local recurrence or a distant metastasis for at least three years, 3) a postoperative pathological stage higher than t1 regardless of the n stage based on the tnm system (table 1) (18), and 4) medical records with a pathological report and the mr images that could be used to review each case . Only those patients with a pathological stage higher than t1 were selected because all patients in the recurrent group had tumors higher than t1 . Distant hepatic metastases were noted in two patients with a local recurrence on the preoperative mr images and a combined curative resection of the primary and metastatic lesion was performed . However, no distant metastases were noted on the preoperative mr images of the non - recurrent patients . Based on the medical records of the subjects, the following variables from the recurrent and non - recurrent groups were compared: patients' age, gender, surgical methods, postoperative adjuvant treatment, and pathological findings from the surgical specimens, including the depth of the tumor invasion (t stage), the status of the lymph node involvement (n stage), tumor location, maximum diameter of the tumor, histological grades, the presence of a microscopic vascular invasion, and the involvement of the resection margin . The analysis was performed by dividing the surgical methods into a low anterior resection and an abdominoperineal resection, and by dividing the tumor locations into the distal, middle, and proximal regions according to the endoscopic findings . The presence of a microscopic vessel invasion was determined according to the original pathological reports . The histological grades were divided into two grades: well or moderately differentiated and poorly differentiated . The circumferential resection margin was considered to be narrow when the distance from the main tumor or the mesorectal tumor deposit to the lateral surgical margin was described as being <1 mm in the original pathological reports (19). Both findings of a narrow circumferential resection margin and the involvement of the proximal or distal margin were grouped together as an involvement of the resection margin . Mr imaging was performed on a 1.5-t whole - body system (horizon, ge medical systems, milwaukee, wis .) Using a pelvic phased - array coil . Tap water was then administered to the rectum to most patients using a rectal tube until the patient indicated discomfort . After the localizer images were obtained, if not contraindicated, 20 mg of scopolamine butylbromide (buscopan; boehringer ingelheim, germany) was injected intravenously in order to minimize the peristalsis and to alleviate the rectal spasm . With the patient in a feet - first, supine position, axial t1-weighted conventional spin - echo images of the pelvis were obtained using a 24 cm field of view (fov) in a 5-mm section thickness, 1.5-mm intersection gap, 500 - 600/8 - 10 (repetition time msec / echo time msec), 256 192 matrix, and 1 signal acquired . The axial, sagittal, and coronal t2-weighted fast spin - echo images were then obtained using a 24 - 26-cm fov in a 5 - 6-mm section thickness, a 1 - 2.5-mm intersection gap, 4,000 - 6,000/75 - 105 (repetition time msec / echo time msec), a 512 256 matrix, an echo train length of 10 - 12, and the two signals were averaged . Three gastrointestinal radiologists (o.y.t ., l.j.s ., k.j.h . ), who were not involved in the preoperative interpretation of the mr examination, analyzed the hard copy images retrospectively . The mr images of the locally recurrent patients were mixed with the non - recurrent patients, and the reviewers analyzed the mr images independently in random order without the clinical or pathologic data . Each reviewer recorded all of the following items: 1) a direct invasion of the perirectal fat by the primary rectal carcinoma, 2) involvement of the perirectal lymph nodes, 3) perirectal spiculate nodules, 4) perivascular encasement, and 5) an enlargement of the pelvic wall lymph node . An interruption of the outer muscular layer and/or a grossly rounded or nodular appearance of the outer margin of the rectal mass were considered to be the indicators of a direct invasion of the perirectal fat by a primary rectal carcinoma . The direct invasion of the perirectal fat with a rounded or nodular margin, which penetrated the outer wall of the rectum, was analyzed separately again because it was believed that the two findings might have a different sensitivity and specificity for an invasion of the perirectal fat . The lymph nodes in the perirectal space was considered a metastatic lymph nodes if they exhibited the following: 1) its size was> 5 mm in the short axis diameter (20), 2) its signal intensity was heterogeneous, or 3) it had an irregular margin with a preserved nodal configuration (21). A perirectal spiculate nodule was defined as a solid nodule in the perirectal space that was separated from the primary rectal mass and had irregular spiky projections on the outer border without any configuration suggesting a nodal structure . A perivascular encasement was defined as an irregular margined soft tissue nodule or conglomerated lymph nodes that were closely attached to the branch of the perirectal vessels . The condition of the small lymph node or tumor nodule simply located adjacent to the vessel was not included in this finding . An enlargement of the lateral pelvic lymph node was defined as those cases with a lymph node> 1 cm along the pelvic wall external to the perirectal fascia (21). Each finding was defined as being present when more than two reviewers recorded the finding as being present . The clinicosurgical profiles and mr imaging findings of the recurrent and non - recurrent groups were compared by a student's t, a chi - square or a fisher's exact test . Logistic regression analysis was used to determine the independent significant factors affecting the local recurrence for the significant variables . A test was used to assess the interobserver variability in terms of the lesion detection and the differentiation of a benign lesion from a malignant focal hepatic lesion . The degree of agreement was categorized as follows: value of <0, poor; of 0.00 - 0.20, slight agreement; of 0.21 - 0.40, fair agreement; of 0.41 - 0.60, moderate agreement; of 0.61 - 0.80, substantial agreement; and of 0.80 - 1.00, almost perfect agreement (22). For the 17 patients in the recurrent group, the time interval between surgery and local recurrence ranged from five to 48 months (mean duration: 17 months). A local recurrence occurred within two years in 15 (88%) patients (mean duration: 14.6 months) and at 34 and 48 postoperative months in the remaining two patients . The follow - up periods in the non - recurrent patients ranged from 40 to 65 months (mean duration: 53 months). For a direct invasion of the perirectal fat by the primary rectal carcinoma, when the irregularity and nodular bulging of the outer wall of the rectum were used as the criteria, the sensitivity, specificity, positive predictive value (ppv), and negative predicted value (npv) of the preoperative mr imaging were 94%, 26%, 78%, and 63%, respectively . However, when only nodular bulging was used as the criterion, they were 48%, 84%, 89%, and 37%, respectively . For regional lymph node involvement, the sensitivity, specificity, ppv, and npv of the mr imaging were 77%, 35%, 35%, and 77%, respectively . Table 2 shows a comparison of the preoperative mr imaging findings between the two groups . Perirectal spiculate nodules and perivascular encasement were significantly more common in the recurrent group than in the non - recurrent group (figs . 1, 2). Enlarged pelvic wall lymph nodes were also more commonly observed in the recurrent group, but the difference was only marginally significant (p=0.052) (fig . The statistical analysis results showed moderate to substantial agreement between the observers on the mr imaging findings as follows: 0.52 - 0.61 for outer wall penetration, of 0.38 - 0.49 for regional lymph node involvement, and of 0.47 - 0.68 for the presence of spiculate nodules . Table 3 shows a comparison of the clinicosurgical profiles between the two groups . The microscopic vessel invasion and n stage were more common in the recurrent group than in the non - recurrent group . The lateral margin was narrow or involved in two patients from the recurrent group and in three from the non - recurrent group . Distal margin involvement was observed in two patients from the recurrent group, but in none from the non - recurrent group . Involvement of the resection margin was more common in the recurrent group, but the difference was only marginally significant (p=0.052). Table 4 shows the results of the logistic regression analyses of the mr imaging and clinicosurgical findings . Because the seven patients with a perivascular encasement belonged to the 12 patients who had a perirectal spiculate nodule, the perivascular encasement and perirectal spiculate nodule were grouped together, and only the latter was included in the logistic regression analysis . Therefore, logistic regression analysis included the perirectal spiculate nodule, the histopathologically determined pathological node status, vascular invasion, and the involvement of the resection margin . The results showed that the presence of a perirectal spiculate nodule (odds ratio, 7.382; 95% confidence interval, 1.438 - 37.889; p value, 0.017) was the only variable independently predictive of a local recurrence . The perirectal spiculate nodule observed on the mr images in this study has not been reported elsewhere . On a routine analysis of the preoperative mr images of rectal cancer, a perirectal spiculate nodule is not normally considered to be an independent finding but it might be categorized as either a metastatic lymph node or a tumor nodule of a t3 disease . It may either be a metastatic lymph node with an extranodal extension (16) or a perirectal tumor deposit described in colon cancer (18, 23, 24). Goldstein et al . (23) described the pericolic tumor deposit as a grossly palpated adenocarcinoma within the pericolic adipose tissue, but not within the lymph node, probably representing an adenocarcinoma extending along the nerves or vessels, and indicating a poor prognosis . According to new edition of the american joint committee on cancer (ajcc) cancer staging handbook (18), there was some comment about the tumor nodule on the perirectal adipose tissue . A tumor nodule in the pericolorectal adipose tissue of a primary carcinoma without histological evidence of a residual lymph node in the nodule is classified in the pn category as a regional lymph node metastasis if it has the form and smooth contour of a lymph node . If the nodule has an irregular contour, it should be classified in the t category and be coded as either v1 (microscopic venous invasion) or v2 (if it was grossly evident), because there is a strong likelihood that it represents a venous invasion (18). These statements suggest that an irregular shaped tumor nodule in the perirectal space is a significant prognostic factor and should be dealt with separately . Therefore, special attention needs to be paid to perirectal spiculate nodules in mr images and it should be evaluated separately from metastatic lymph node . The perirectal spiculate nodule might indicate the biological aggressiveness of the primary carcinoma and the locally advanced disease, which requires more intensive therapy . A perivascular encasement has also never been addressed before . In general, a vascular invasion is highly suggested when the tumor is in close contact with a vessel . Microscopic vascular invasion of a rectal tumor has been reported to be a dismal sign of an increased rate of local recurrence and poor survival (1, 6, 25, 26). 17) reported a tubular structure on the mr images as a gross tumoral vascular invasion . However, a gross vascular invasion can be observed in advanced diseases after a microscopic invasion progresses to the gross scale . A review of the histopathological reports, three from seven patients (43%) with the mr findings of a perivascular encasement had a microscopic vascular invasion, which is in contrast to nine out of 64 patients (14%) without them . Although a microscopic vascular invasion was more frequent in those patients with perivascular encasement, a histological vascular invasion was not always described in the pathological reports of patients with a perivascular encasement . Because the surgical specimens in this study had not been analyzed using whole mount histology with a direct radiological - pathologic correlation, the precise relationship between the perivascular encasement and the microscopic vascular invasion could not be determined . However, because perivascular encasement was closely related to the vessels and microscopic vascular invasions are more frequently reported in patients with them, it was hypothesized that perivascular encasement might be related to a vascular invasion . The radiological - pathological correlated studies should be followed in order to verify this hypothesis . A perirectal lymph node metastasis is a well - known risk factor for a local recurrence (3, 27, 28). However, in this study, the accuracy of the preoperative mr imaging for determining the involvement of the perirectal lymph nodes was low, as in previous reports (10, 11, 13, 29). Therefore, the regional lymph node metastasis determined by the mr imaging was not associated with a local recurrence in this study, even though the nodal status determined histologically was . Mr imaging cannot accurately diagnose the presence of a microscopic metastasis in the regional lymph nodes, and it is also inaccurate in estimating the nodal status based on the size criteria (10, 16). Brown et al . (16) reported that prediction of nodal involvement in rectal cancer with mr imaging could be improved by using the border contour and the signal intensity characteristics of the lymph nodes instead of the size criteria . If the encouraging criteria suggested by brown et al . (16) are considered, the accuracy of the nodal staging with mr imaging is expected to increase . In this study, a direct invasion of the perirectal fat by the primary rectal carcinoma, as determined by either mr imaging or the histological examination, was not associated with the local recurrence . This is to be expected because the current tme technique is useful in eliminating tumors despite their transmural extension (3, 28). Statistical analysis of the pelvic lymph node enlargement showed a value close to statistical significance . When tme was used as the standard surgical technique, a pelvic node dissection is not usually performed . Controversy still remains as to the potential benefits of a pelvic node dissection as well its unwanted effects on voiding and sexual dysfunction (30 - 33). Nonetheless, a lymph node dissection or preoperative radiotherapy at the affected site is an option that can be considered when a lymph node enlargement is observed on the preoperative mr images for a reduction of a local recurrence (21). There are many treatment options for rectal cancer patients . With the introduction of the tme technique (3) and preoperative radiotherapy (34 - 36), the rate of a local recurrence has been reduced significantly . Some institutes in europe recommend the use of preoperative radiotherapy as a routine treatment modality to boost survival (34, 35). Considering the recurrence rate in those patients who underwent surgery only, preoperative radiotherapy would mean that more than 70% of the patients would receive unnecessary additional treatment . Furthermore, the discrimination between locally advanced disease with a high risk of a local recurrence and localized disease with a low risk is needed . In this study, the preoperative mr image could provide not only the preoperative staging but also the potential for providing information on a local recurrence . First, the total number of study cases and the overall number of cases with a local recurrence were small . Second, the histopathological findings of the surgical specimen were based on the original pathological reports without direct radiological - pathologic correlations . However, these findings were clinically correlated with the local recurrence by the follow - up study . These results should be verified by further studies using a large population and a pathological correlation in order for these findings to be a useful guideline for treatment . However, because a local recurrence usually occurs within 2 - 3 years in most cases (21, 30), is believed that this limited follow - up period did not adversely affect these results . In conclusion, the results of this study indicate that the perirectal spiculate nodule and perivascular encasement depicted by the preoperative mr images are significant predictors of a local recurrence after curative surgery on a rectal carcinoma . These mr findings may be helpful in planning the appropriate preoperative adjuvant therapy.
Mitochondrial myopathy, encephalopathy, lactic acidosis, and stroke - like episodes (melas) syndrome is a multi - system mitochondrial disorder characterized by stroke - like episodes with various combinations of additional symptoms . The diagnosis of melas is usually based on characteristic symptoms such as lactic acidosis, deafness, diabetes mellitus, short stature, myopathy, and cognitive decline, often with a family history showing maternal inheritance . We herein report an unusual case of melas - like encephalopathy with isolated recurrent stroke - like episodes in adulthood . The diagnosis in this case was supported by the detection of a mitochondrial mt - nd3 gene mutation . The patient was a 41-year - old man who had experienced generalized convulsions, insomnia, and depression since 20 years of age . He had been diagnosed with ischemic stroke at 33 years of age and epileptic seizure with epileptic encephalopathy at 37 years of age . He had no other systemic signs of mitochondrial disorder, such as short stature, diabetes mellitus, deafness or heart failure . He developed myoclonus in the distal extremities, gait disturbance, and dysarthria at 41 years of age . Three months later, he was admitted to our hospital due to impaired consciousness and vomiting . A neurological examination showed gaze nystagmus, cerebellar ataxia, and myoclonic movement in his distal extremities . His mini - mental status examination score was 15/30, and his frontal assessment battery score was 5/18 . A laboratory examination showed slightly increased serum pyruvic acid levels (1.2 mg / dl), but his serum lactate levels were normal (14.2 mg / dl). The cerebrospinal fluid lactate (34.8 mg / dl) and pyruvic acid (1.6 mg / dl) levels were elevated . Brain magnetic resonance imaging (mri) showed bilateral cortical and subcortical high - intensity lesions on t2-weighted imaging (t2wi) and fluid attenuated inversion recovery (flair), distributed bilaterally and almost symmetrically . Bilateral red nuclei, mesencephalic tectum, vermis and cerebellar flocculus were also involved (fig . Some of the cortical and subcortical lesions gave a high signal on diffusion - weighted imaging (dwi) (fig . These lesions appeared as high or iso signal intensity on the apparent diffusion coefficient (adc) map . (a, c) axial and coronal flair brain mri images showing cortical and subcortical high - intensity lesions distributed bilaterally and almost symmetrically . (b) some of the cortical and subcortical lesions gave a high signal on diffusion - weighted imaging . (d) a large lactate doublet (arrow) was identified on mrs centered in the lesion . (e) tc - ethylcysteinate dimer spect imaging revealed a bilateral multifocal increase in the perfusion of the cortical lesions . (f) a histopathological study of the biopsied muscle showed no myopathic changes or ragged red fibers on hematoxylin and eosin staining and gomori trichrome staining . A heteroplasmic substitution (m.10158t> c) was found in the mt - nd3 gene (arrow). Two weeks later, the high signal on dwi had diminished, and four weeks later, the high signal on t2wi and flair had diminished (fig . H - mrs revealed elevated lactate concentrations in the lesions (fig . 1d). Tc - ethylcysteinate dimer single photon emission computed tomography (spect) imaging revealed bilateral multifocal increase of perfusion in the mri lesions (fig . A histopathological study of the biopsied right biceps branchii muscle revealed mild variation in the fiber size, measuring from 30 to 90 microns in diameter, which was thought to be a non - specific change . No necrotic or regenerating fibers were seen . On modified gomori - trichrome stain, ragged red fibers (rrfs) were not observed . However, the complete sequencing of mitochondrial dna samples extracted from the biopsied muscle revealed a heteroplasmic m.10158t> c mutation, with a level of mutant heteroplasmy of 69.5%, in the mitochondrial complex i subunit gene, mt - nd3 (fig . Brain mri of dwi (upper), adc map (middle), and flair (bottom) images are shown . Because his family had no clinical symptoms suggestive of mitochondrial diseases, we could not conduct a complete mtdna sequence analysis of his family . Over a two - month period, he experienced two stroke - like episodes with simple partial seizure and vomiting . Each time the stroke - like episodes ended within four days with drip infusion of edaravone and supportive care . To control epileptic seizure, we added levetiracetam (1,000 mg / day) to zonisamide (400 mg / day) and carbamazepine (400 mg / day). Because he had not yet been diagnosed with melas - like encephalopathy at that time we herein report an unusual adult case of melas - like encephalopathy where the diagnosis was delayed because the adult - onset isolated stroke - like episodes were not accompanied with a family history showing either maternal inheritance or symptoms such as deafness, diabetes mellitus, heart failure, short stature, myopathy, or mental retardation . In addition, a histopathological study of the biopsied muscle revealed no myopathic features or rrfs . However, a sequence analysis of the mitochondrial genome extracted from the biopsied muscle revealed a heteroplasmic m.10158t> c mutation in the mitochondrial complex i subunit gene, mt - nd3 . Stroke - like lesions may evolve subacutely over hours to days but have greater potential for reversibility than actual strokes . Recent studies have demonstrated a beneficial effect of l - arginine in melas for the acute treatment and prevention of stroke - like episodes (1). Indeed, we previously reported a woman harboring a m.10158t> c mutation who was successfully treated with l - arginine and anti - epileptic agents (2) (table). She developed right - side hemianopia and motor aphasia at 63 years of age, which was her first stroke - like episode . Her aphasia worsened with each episode but completely recovered to baseline with radiological improvement following treatment with high - dose l - arginine in each acute phase . At the three - year follow - up, she had no neurological deficit except for minimal word - finding difficulties and appeared otherwise healthy . These features are clearly different from the progressive nature of melas and may be due to the lack of multi - systemic features in melas . Dwi: diffusion weighted image, adc: apparent diffusion coefficient, flair: fluid - attenuated inversion recovery, t2wi: t2 weighted image, rrf: ragged - red fibers, ssv: sdh - reactive blood vessels, cbz: carbamazepine, zns: zonisamide, lev: levetiracetam, pht: phenytoin, clb: clobazam, vit: vitamin this lack of multi - systemic features in melas and the atypical brain mri findings in the present case resulted in a delayed diagnosis . He was not developmentally disabled and had been healthy until he developed insomnia and depression at 20 years of age . When he was admitted to our hospital at 41 years of age, he was suffering from higher brain dysfunction . His higher brain functions and neurological manifestations worsened with each stroke - like episode, resulting in serious physical and cognitive sequelae . On comparing these two adult - onset cases harboring m.10158t> c, the early diagnosis and treatment for mitochondrial stroke - like episodes, especially l - arginine therapy, may help prevent further deterioration, particularly of the higher brain function . The m.10158t> c mutation, which is known to cause lethal infant - onset leigh syndrome, is located within the coding region of the loop domain of the nd3 subunit protein . The m.10158t> c mutation has been reported to decrease complex i activity to 8 - 23% of that of controls (3,4). The common clinical features related to the m.10158t> c mutation in a total of 10 patients, including our 2 adult - onset cases as well as previously described infant and pediatric patients, are a relatively high rate of sporadic occurrence, selective vulnerability of the central nervous system (cns), no myopathic findings, and no rrfs or cytochrome c oxidase (cox)-defective fibers, even in patients with relatively high mutation loads (2 - 7). The mutation load has been reported to vary among patients and specimens: muscle, blood, hair and fibroblasts . All of the patients showed a higher mutation load in the muscles (73 - 100%) and a lower load in the blood (0 - 48%) (3 - 7). Therefore, to detect diagnostic pathogenic mutations, not only blood but also biopsied muscle should be analyzed . Such heteroplasmy may account for the differences in the phenotypical expression, as patients harboring m.10158t> c mutation appear not to have non - neurological symptoms or relevant family history . Despite the high mutation loads (from 70% to more than 98%), a histological analysis of the biopsied muscle revealed no specific findings in the present or previous adult cases or in the previously reported infant harboring the m.10158t> c mutation (3 - 7). Rrfs have been found in up to 90% of melas patients, which is thought to be the histological hallmark of melas (8). A higher proportion of heteroplasmic mitochondrial dna mutation was reported to be associated with rrfs, based on an analysis of patients with different large mitochondrial dna deletions and melas patients with the m.3243a> g point mutation (9). In addition to the m.10158t> c mutation, the m.10191t> c as well as m.10197g> a mutations are located in the matrix - loop domain of the nd3 subunit protein and are known to cause leigh syndrome or leigh - like syndrome with dystonia, respectively (6,10 - 12). Patients aged 16, 25, and 52 years harboring 73%, 70%, and 77% m.10191t> c mutation in muscle (6,10,11) and 9-month - old and 37-year - old patients harboring 100% and 97% m.10197g> a mutation (12) were found to have no rrfs, although all of these patients who underwent an analysis of mitochondrial respiratory chain activities in muscle showed a specific defect in the activity of complex i. it seems to be unlikely that the pathological analysis of the muscle was conducted too early to show any pathological changes . Thus, the absence of any pathological changes in the biopsied muscles despite a high mutation load and the predominance of cns manifestations might be common among patients harboring pathogenic mutations in the nd3 gene . Although l - arginine has emerged as an effective treatment of stroke - like episodes in melas, the unique manifestation of adult - onset, isolated mitochondrial stroke - like episodes in our patients could be easily misdiagnosed, resulting in serious sequelae . Mitochondrial dna analyses using biopsied muscle should be considered in patients with suspected stroke - like episodes, even if the muscle pathology shows a normal appearance.
Schistosomiasis is a major human helminth infection endemic in developing countries where children harbor the greatest number of parasites . Urogenital schistosomiasis, caused by infection with s. haematobium, is the most prevalent in sub - saharan africa and affected children suffer stunted growth, impaired memory and cognitive development, anemia, haematuria, and reduced physical fitness . Current control programs target school children, typically aged 6 years old and above and younger pre - school age children (i.e., 5 years and below) are not treated . This is partly because they have been regarded as being at very low risk of infection and infection - associated morbidity and partly because, until recently, there has been lack of safety data on praziquantel in this age group . Yet, the reality is that exclusion of these children from control programs leaves them at high risk of developing chronic pathology as has been shown in high endemic foci . This health inequality is now being addressed with the realization that preschool age children do experience significant levels of infection [37]. The who has recently formally recognized that these children should be considered for treatment and studies on the safety and efficacy of praziquantel, as well as methods of diagnosis and drug delivery in this age group [6, 911], have been carried out . The next stage is to assess the consequences of praziquantel treatment beyond the reduction of infection, particularly the effects on schistosome - specific responses as well as responses to bystander antigens . Indeed, praziquantel treatment of school children and adults has been shown to enhance immune responses associated with resistance to reinfection with schistosomes in endemic areas [12, 13] but immunological studies in pre - school children are scarce . Moreover, antihelminthic treatment has been associated with an increase in atopy [14, 15], as a result of alterations in the immunological balance established by the parasites . These studies were conducted in schoolchildren and the effect of antihelminthic treatment on allergic sensitization in younger children remains to be determined . Schistosome infections have also been reported to both exacerbate and ameliorate responses associated with resistance to plasmodium falciparum, the causative agent of malaria [16, 17]. Nonetheless, previous studies in schoolchildren aged 618 years old showed that antihelminthic treatment of s. haematobium infection did not alter immune responses to the malaria vaccine candidates merozoite surface protein (msp) 1 and 2 . Thus, the first aim of this study was to determine the short - term antihelminthic effects on immunological markers of exposure to schistosome (igm directed against schistosome cercariae, egg, and adult worms) and malaria (igm directed against plasmodium total schizont) infections as well as the effects on antibody responses associated with resistance to infection / reinfection (ige and igg4 directed against schistosome cercariae, egg, and adult worms, igg directed against plasmodium vaccine candidates msp-1 and msp-2 [16, 2123]) in children aged 35 years in zimbabwe . We also determined the effects of antihelminthic treatment on allergic sensitization to the house dust mite d. pteronyssinus, the most prevalent allergen in zimbabwe . The second aim of this study was to identify antigens serologically recognized on the adult worm by these children (individually) both before and 6 weeks after treatment, to assess whether antischistosome antibody changes following treatment were due to qualitative changes in antigens recognised by the host immune system as has been shown in adults . The study population was recruited from magaya, chitate, and chipinda villages in the mashonaland east province of zimbabwe where s. haematobium is endemic . Populations from the 3 villages and selection criteria have been described elsewhere [9, 26, 27]. Forty - one (41) children were included in this study; 31 had received praziquantel treatment while 10 children, whose parents declined treatment for religious reasons, formed the untreated control group . All the treated children who were egg positive at baseline (n = 4) had cleared infection at the six weeks follow up . There was no significant difference between treated / untreated children in terms of village of residence (z = 1.037, p = 0.463) and their parents were all subsistent farmers . All the children were also part of a larger study investigating the safety of praziquantel and they reported no adverse effects 24 hours following treatment . Three children provided enough blood samples to enable proteomic analyses on schistosome antigens serologically recognised before versus after treatment . Permission to conduct the study in the region was obtained from the provincial medical director . Institutional and ethical approval was received from the university of zimbabwe and the medical research council of zimbabwe respectively . In addition, the study received ethical approval from the world health organization's research ethics review committee . At the beginning of the study, parents and guardians of participating children had the aims and procedures of the project explained fully in the local language, shona, and written consent was obtained from participants' parents / guardians before enrolment into the study . After collection of all samples, all compliant participants were offered anti - helminthic treatment with the recommended dose of praziquantel (40 mg / kg of body weight). Lyophilized soluble s. haematobium adult (swap), cercariea (cap), and egg (sea) antigens were obtained from the theodor bilharz institute (giza, egypt) and reconstituted in ultra pure water as recommended by the manufacturer . Recombinant antigens (from plasmodium merozoite surface protein, msp) were msp-119 antigen, the 19 kda c - terminal domain of msp1, and msp-2 which has 2 serotypes: ch150 that belongs to serotype a (3d7-like), and dd2 that belongs to serotype b (fc27-like). A standard indirect enzyme - linked immunosorbent assay (elisa) was optimized as described previously [26, 27] and used to quantify levels of antibodies directed against swap, sea, and cap (igm, ige, and igg4); p. falciparum antigens (igm and igg), and derp 1 allergen (ige and igg4) both before and 6 weeks after treatment . For schistosome - specific antibodies, microtitre plates were coated overnight at 4c with 100 l / well of antigen at 5 g / ml (10 g / ml for sea) in carbonate bicarbonate buffer (ph = 9.6) and then washed once with pbs/0.03% tween20 (which was used for all subsequent washes). 100 l of the serum samples was then added diluted at 1: 20 for ige (anti - sea, swap and cap); 1: 100 for igm anti - swap and igg4 anti - cap and swap; 1: 400 for igm anti - cap and sea and igg4 anti - sea . Plates were incubated for 2 hours at 37c . After washing 3 times, 100 l of antihuman horse - radish peroxide conjugated ige (sigma), igm (dako) or igg4 (the binding site) was added diluted (with blocking buffer) at 1: 1000 except for igm anti - swap (1: 2000), igg4 anti - cap and swap (1: 500), and ige anti - swap (1: 250). After 1 hour incubation at 37c followed by 6 washes, 100 l of the substrate (abts) was added . The reaction was stopped, using 25% hcl, after 15 min incubation at room temperature for igm and igg4 and 30 min incubation at 37c for ige . Absorbance readings of all wells were performed at 405 nm . For plasmodium - specific responses, the same protocol was followed but 50 l / well of 1 g / ml (crude schizont) or 50 ng / ml (recombinant antigens) was used to coat plates . All samples were diluted 1: 100 for all assays and secondary antibodies (sigma) diluted 1: 1000 (igm and igg) for crude antigens and 1: 2000 (igg) for recombinant antigens . The colorimetric reaction time was 15 minutes at room temperature for all assays . For derp1-specific responses, plates were coated with 50 l / well of 5 g / ml and samples diluted 1: 10 . Detection antibodies (ige from sigma and igg4 from the binding site) were diluted 1: 1000 and the reaction time for the substrate was 30 minutes at 37c . All laboratory assays for the pre- and posttreatment time points were run at the same time and by the same individual . All samples were assayed in duplicate and 3 sera from european children (negative controls) who have never been exposed to schistosome or malaria infections were included on each plate and were used to set up cutoff points for igm status (ods of 0.2, 0.24, and 0.55, resp . A blank control containing no sera was included in duplicate on each plate and the background absorbance of reagents in the absence of serum was subtracted from all readings . A pool of responders (positive controls) was run on each plate and readings were comparable across plates; that is, the% cvs were less than 20% for all comparisons and readings were below the critical values as determined by reed et al . ; one hundred g of antigen (swap), diluted 1: 1 in lithium dodecyl sulphate, was run on a 10% gel using sodium dodecyl sulphate (sds) buffer . The gel (7 cm) was subsequently divided longitudinally into 2 parts, the first to be used for western blotting and the second for protein identification . The same gel for western blot and protein identification was used to exclude variations due to experimental settings . The proteins on the piece of gel used for identification were stained with silver nitrate while the rest were transferred onto a 0.45 m nitrocellulose membrane . Proteins were transferred onto a nitrocellulose membrane using a wet system, in transfer buffer made of 20% methanol, 25 mm tris, and 192 mm glycine . The membrane was then blocked with 2% bsa in tbs/0.05% tween20 for 3 hours, washed 2 times in tbs/0.05% tween/0.2% triton x-100, and cut into strips . On each strip, 1.5 ml of individual serum diluted 1: 50 in blocking solution was added and all strips were incubated overnight at 4c . After 3 washes, 1.5 ml of hrp - conjugated ige antibody (sigma) was added and the strips incubated for 2 hours at room temperature . After 4 washes, the strips were incubated in ecl plus reagent system for 5 minutes, before being exposed on hyperfilm . The film was developed and bands were matched to those on the silver - stained piece of gel . Bands on the silver stained piece of gel that matched those on the western blots were excised, reduced with farmer's reagent, and subjected to in - gel trypsin digestion using standard protocols . The resulting tryptic peptides were solubilized in 0.5% formic acid and fractionated on a nanoflow uhplc system (thermo rslcnano). Peptide separation was performed on a pepmap c18 reversed phase column (lc packings), using a 585% v / v acetonitrile gradient (in 0.5% v / v formic acid) run over 45 min at a flow rate of 0.2 ul / min . Eluate was analysed by online electrospray ionisation (esi) mass spectrometry using an amazon ion trap ms / ms (bruker daltonics) operating a continuous duty cycle of survey ms scan followed by up to five ms / ms analyses of the most abundant peptides, choosing the most intense multiply charged ions with dynamic exclusion for 120 s. ms data was processed using data analysis software (bruker) and the automated matrix science mascot daemon server (v2.1.06). Protein identifications were assigned using the mascot search engine to interrogate schistosome protein sequences in the ncbinr database, allowing a mass tolerance of 0.3 da for both ms and ms / ms analyses . Since the data did not fulfill the assumptions for parametric tests and data transformations could not overcome this, nonparametric tests were used for all statistical analyses . The nonparametric wilcoxon signed - rank tests for paired samples were performed to compare pre- and posttreatment antibody raw data (optical densities), ratios (ige / igg4), and infection intensities . For comparisons between groups of different individuals (i.e., infected versus uninfected, igm negative versus igm positive, etc . ), mann - whitney u tests were performed . The cutoffs for igm anti - schistosome or antischizont antigens were calculated as the mean absorbance plus 2 standard deviations of readings from european negative controls . All statistical analyses were conducted in pasw statistics (formerly spss) 17 and p values of <0.05 were considered significant . A sequential bonferroni correction was used to identify results that were significant in the context of the multiple statistical comparisons . At baseline, 38 children provided urine samples and 13.2% (ci95 4.428) were schistosome egg positive (mean egg count of 10 eggs/10 ml). Of the 41 children included in this study, 17.5% (ci95 7.332.8) showed immunological evidence of recent exposure to egg antigens (positive anti - sea igm), 39% (ci95 24.255.5) to cercariae antigens (positive anti - cap igm), and 22% (ci95 10.637.6) to adult schistosome antigens (positive anti - swap igm). None of the children were p. falciparum positive as determined by thin and thick smears or by the paracheck serological test but 21% (ci95 7.142.1) showed immunological evidence of recent exposure to parasite antigens (positive anti - schizont igm). No significant difference in plasmodium - specific antibody levels was observed between schistosome egg positive versus egg negative children (z = 0.132, p = 0.935; z = 0.742, p = 0.505; z = 0.579, p = 0.62; z = 1.354, p = 0.202; z = 1.180, p = 0.271, resp ., for msp119, dd2, ch150, schizont - igm, and schizont igg). Similarly, there was no significant difference in levels of derp1-specific responses between schistosome egg positive versus egg negative (z = 0.173, p = 0.4315; z = 1.152, p = 0.1245; z = 1.36, p = 0.087, resp ., for ige, igg4, and ige / igg4 ratio). At baseline, there was no significant difference in mean antibody levels (all isotypes) between children who were subsequently treated and those who were not . Furthermore, infection levels were comparable between the two groups (z = 0.146, p = 0.884 for mean infection intensity and = 0.043, p = 0.662 for prevalence). Six weeks after treatment, all of the treated children were schistosome egg negative (all the egg positive children had cleared infection), resulting in a significant fall in the mean egg count (z = 1.626, p = 0.034). On the other hand, infection intensity increased for the one child who was egg positive at baseline in the untreated group (73 to 166 eggs per 10 ml). There were significant changes in levels of the majority of antibodies in the treated children between the two time points as shown in table 2 and detailed below . Overall, the percentage of children with positive cap- and swap - igm (marker of exposure) increased after treatment (39% to 63.4% and 22% to 43.9%, resp . ). Adult schistosome worm and cercariae - specific igm titers, but not egg - specific igm, rose significantly in treated children (figure 1(a)). Similarly, adult worm and egg - specific ige titers also increased significantly following treatment (figure 1(b)). The figures (figures 1(a) and 1(b)) further illustrate that there was no clear distinction between children who were egg positive and negative at baseline . Overall, adult worm specific igg4 titers (figure 1(c)) decreased following treatment, but the decline only occurred in children with mild infection at baseline (0.3 to 10.7 mean eggs/10 ml) and not in egg negative children . The decline was however not statistically significant after bonferroni correction (table 2). In contrast, levels of all anti - schistosome antibodies (except egg - specific igg4 which declined) did not change significantly in the 6 weeks period for untreated children (figures 1(a)1(c) and table 1). No significant changes occurred in the ratio ige / igg4 against all the 3 parasite life cycle stages (z = 1.118, p = 0.453; z = 1.139, p = 0.128; and z = 0.02, p = 0.492, resp ., for adult worm, cercariae and egg antigens) in either group (treated or untreated). A significant increase in ige and igg4 against derp1 was observed in treated children (figure 2). No significant change was observed in the ratio ige / igg4 in both groups (z = 0.431, p = 0.333 and z = 0.357, p = 0.361, resp ., for treated and untreated groups). A decrease occurred in titres of igm and igg antibodies against the total schizont antigen following praziquantel (pzq) treatment (figure 3(a)). Similarly there was a significant decline in igg levels against all the malaria vaccine candidates msp-1 (msp119) and msp-2 (dd2 and ch150) after treatment (figure 3(b)). Untreated children also exhibited a decrease in igg against dd2 and msp119, and igm against the total schizont over the same time frame . The before treatment and after treatment western blot assays were conducted on the same membrane to exclude any variation that might arise from the use of different antigen preparations . Only 1 band (~80 kda) was recognized by all serum samples collected before treatment (figure 4). Six weeks following treatment, sera from treated children recognized an additional band (~100 kda) which was absent on the blot from the untreated child . Furthermore, the image master analysis showed that the 80 kda band was enhanced after treatment (the bands were quantified by their pixel intensities). The potential identities of the proteins recognized, and the corresponding hit scores, are listed in table 3 . With increasing calls for the inclusion of pre - school children and infants in mass chemotherapy programmes for schistosome control [1, 4, 6, 9, 11], and studies in school children and adults suggesting that antihelminthic treatment not only affects immune responses directed against schistosomes but may also affect immune responses directed against unrelated antigens [13, 14, 32], the current study aimed to investigate immunological consequences of praziquantel treatment in young pre - school age children . The study shows significant changes in the levels of anti - schistosome adult worm igm and ige antibody titres 6 weeks following praziquantel treatment in children aged 35 years old living in an s. haematobium endemic area . There was a decline in anti - schistosome worm igg4 levels following treatment, essentially driven by children presenting with s. haematobium eggs in urine at baseline . However, this decline was not statistically significant following bonferroni correction, possibly due to the small sample size . The change in anti - schistosome antibody levels in children who were egg negative at baseline suggests that these children may have had prepatent infection, single sex infection, and/or low levels of infection undetected by the egg count technique . Indeed, recent studies in pre - school children using a rapid diagnostic test based on cercariae antigens indicate that infection levels are about 3 times higher than prevalence obtained by the egg count . Consistent with these findings, the current study shows a prevalence of 39% based on cap - igm, which is 3 times higher than the 13% prevalence obtained based on egg count . The possibility of prepatent and/or single sex infections was further supported by the increase in the percentage of children with positive cap- and swap - igm after treatment . The increase in anti - worm and anti - cercariae igm responses is consistent with reported changes in adult worm (and cross - reactive) antigens exposed to the immune system following the killing of adult worms by praziquantel . Antiegg responses have been proposed as a diagnostic tool for schistosome infections in young children where egg counts are less reliable due to low levels of patent infection or to single sex infections . In this study, antiegg igm responses did not change following treatment, suggesting that while antiegg responses may be good markers of the presence of a patent schistosome infection before treatment, they may not be a reliable tool for use in evaluating the efficacy of treatment . This study showed that, consistent with findings in older individuals, praziquantel treatment boosts the anti - worm ige immune responses associated with protection, suggesting that this young age group may also benefit immunologically from anti - schistosome chemotherapy, which reduces reinfection in older children and adults by stimulating ige responses [13, 32]. The increase in ige titres was accompanied by an increase in the number of parasite antigens recognised, suggesting that treatment results in the enhancement of antigen recognition as already reported for older children and adults . Hidden antigens or enhanced affinity maturation of ige responses . The proteins identified after treatment were essentially constituents of the parasite surface and musculature, consistent with the praziquantel disruptive action on them [3638]. Among these was the myosin heavy chain, which has been previously recognized by pooled sera from older individuals with a longer history of infection . Two distinct fragments of this protein have previously been associated with protection against reinfection in mice vaccinated with radiation - attenuated cercariae [40, 41]. S. mansoni heat shock protein 70 (hsp70) homologue was also identified, consistent with previous results from pooled samples of older individuals . Hsps are proteins that are expressed by all eukaryotic cells to maintain cell homeostasis under stress conditions . Furthermore, because they are suspected of being inducers of multiple pathways of immunity, these proteins may be explored as potential adjuvants in vaccine development against cancer and infections (reviewed by segal et al . ). This approach presents the limitation that all the parasite antigens described were recognised by ige . Although parasite - specific ige antibodies have been associated with protection [21, 32, 43], vaccine candidates eliciting ige responses in helminth endemic areas have recently been shown to induce urticaria . Although desensitization of the ige - inducing vaccine is a possibility to overcome this problem, identification of antigens recognized by other isotypes may be more realistic . Nevertheless, characterising parasite antigens eliciting ige responses gives the information on what to avoid or take with precaution in vaccine design . Furthermore, given the similarities between anti - helminth and anti - allergen responses, comparative studies (schistosome antigens versus allergens) would provide the spectrum of antigen recognition and inform on possible cross - reactivity . This would narrow the choice of antigen vaccine candidates and minimise the risk of sensitization . In this study, anti - plasmodium responses declined in both treated and untreated children, suggesting that this change was not due to praziquantel treatment . Since the decline was both in igm responses directed against the schizont (marker of exposure to plasmodium infection) and igg responses directed against the vaccine candidates msp-1 and msp-2, it is likely that the decline was reflecting normal dynamics of plasmodium antibodies in the absence of infection . Levels of antibodies to several plasmodium antigens vary with the seasonality of parasite transmission, often being higher during periods of high transmission than at the end of a low transmission season . Furthermore, levels of anti - plasmodium antibodies directed against both crude and recombinant antigens tend to be higher in individuals carrying parasites than in those without parasites . The region of zimbabwe where the present study was conducted is mesoendemic for malaria with an incidence of 0.2 to 10 cases/1000/year . The absence of plasmodium parasites on blood smears of participants in this study and the decline in the levels of anti - plasmodium antibody responses may therefore reflect the end of a malaria transmission season in this area (at the time of sample collection). In the present study, there was no significant difference for derp1 specific antibodies between schistosome egg positive and negative children at baseline . Following treatment, derp1 specific ige and igg4 were significantly increased, resulting in the ratio ige / igg4 (which is associated with allergic reactivity) being not significantly changed . Hagel and colleagues indicated that a certain threshold is required for parasite infection to suppress allergic reactivity, consistent with findings from animal models . The low levels of infections in the present study population would therefore explain the absence of significant changes in the ratio ige / igg4 against derp 1 allergen . The increase in allergen - specific ige responses in treated children may be due to cross - reactivity since levels of these antibodies directed against schistosome antigens also increased following treatment . However, cross - reactivity cannot explain the increase in igg4 against derp1 in treated and, to a lesser extent, in untreated children, since the anti - schistosome igg4 declined . Changes in antimite igg4 antibodies following seasonal changes in natural exposure to house dust mites have previously been reported . Investigations on natural temporal variations in levels of exposure to mite were beyond the scope of this study but this finding requires further investigation . The current study presents the limitation that the sample size was small, which could have affected the statistical power . This was due to the limited accessibility of these young children in terms of blood collection, and also because treatment has only recently started in this age group . Nevertheless, this study is one of the first to demonstrate a boost, due to praziquantel treatment, in anti - schistosome immune responses in pre - school age children . Taken together, findings from this study suggest that praziquantel treatment of preschool children has comparable effects to those reported in studies on older children and adults, boosting antibody responses associated with putative resistance to schistosome infection / reinfection six weeks following chemotherapy . Furthermore, serological recognition of schistosome antigens was enhanced following praziquantel treatment in these young children, and recognized antigens are associated with the development of acquired protective immunity . Praziquantel treatment did not have a significant effect on plasmodium - specific responses, which showed temporal fluctuation in both untreated and treated individuals . Furthermore, pzq treatment did not significantly alter allergen - specific responses which would mediate pathology in allergic disease . Thus, the study suggests that pre - school age children may also benefit immunologically from praziquantel treatment.
A 69-year - old woman with a transitional cell carcinoma in the renal pelvis underwent a laparoscopic nephroureterectomy . The patient had a history of hypertension, and had no history of allergy or previous exposure to indigo carmine . Anesthesia was induced with thiopental 400 mg and vecuronium 10 mg, and maintained with 2% sevoflurane after tracheal intubation . A 20-gauge catheter was inserted into her left radial artery to monitor continuous arterial pressure . During the operation, the patient's vital signs were stable, with blood pressure (bp) 100 - 130/70 - 95 mmhg, heart rate 62 - 88 bpm, and spo2 98 - 100% . Two hundred minutes after the induction of anesthesia, she received a bolus injection of 40 mg indigo carmine (sodium indigotindisulfonate; korea united pharm ., one minute later, her bp suddenly decreased from 120/85 mmhg to 50/30 mmhg, but heart rate remained at 80 - 90 bpm . There was no evidence of massive blood loss or electrocardiographic changes prior to the hypotensive episode, and there were no skin rashes, angioedema, or any sign of bronchospasm during the hypotensive episode . She was immediately administered ephedrine 20 mg and phenylephrine 0.3 mg, which restored her bp to 120/75 mmhg . Ten days later, a 73-year - old man who underwent a radical retropubic prostatectomy under general anesthesia experienced severe hypotension after administration of indigo carmine . Ninety minutes after anesthesia induction, he received an injection of 40 mg indigo carmine, and then bp decreased from 110/65 mmhg to 60/35 mmhg without any skin rash or urticaria . He was administered ephedrine 40 mg and phenylephrine 0.3 mg, which restored his bp to the pre - indigo carmine level . Following these adverse events, we decided to dilute indigo carmine in normal saline and to administer it slowly over five minutes . The patient had a drug allergy to saridon - a (roche korea, seoul, korea), which contains acetaminophen, anhydrous caffeine, and isopropylantipyrine . Two hundred minutes after induction, she was administered 40 mg indigo carmine diluted in 20 ml of saline over five minutes . A sudden drop in bp was observed; from 125/72 mmhg to 45/30 mmhg, and injection of ephedrine 30 mg restored her bp within three minutes . Following this third episode of hypotension, we suspected a manufacturing error and checked the lot number of indigo carmine . We discarded all of the indigo carmine with lot number 001, used in our third patient, and decided to use another lot number, 002 . Two weeks later, two additional patients experienced severe hypotension following administration of indigo carmine . The first, a 68-year - old man, underwent transurethral bladder tumor resection under general anesthesia . Five minutes later, his bp dropped from 128/75 mmhg to 65/43 mmhg, and injection of phenylephrine 0.3 mg restored his bp . Another patient was a 77-year - old man who underwent transurethral resection of the bladder . Spinal anesthesia was induced with hyperbaric bupivacaine 11 mg at the l4 - 5 level . After forty - five minutes, he received indigo carmine, and then his bp decreased from 110/65 mmhg to 60/35 mmhg . After administration of 15 mg ephedrine, his vital signs remained stable throughout the rest of the procedure . The company's director informed us that lot numbers 001 and 002 were manufactured with the same raw materials, and the manufacturer provided us with indigo carmine of lot number 906, which to date has not been associated with any such adverse events . The raw materials used to manufacture indigo carmines were analyzed, including their crystalline status, thermo - physiochemical properties and particle size distribution, all of which are required analytical criteria for drug manufacture, as determined by the korea food and drug administration . A comparison of the raw materials used to manufacture lot numbers 002 and 906 showed no differences . Further analysis of the raw materials by liquid chromatography (lc) and mass spectrometry (ms) showed that, when compared with lot number 906, lot number 002 had a separated peak on lc and an abnormal fragment peak on ms, suggesting the presence of impurities (fig . All indigo carmine numbered as 001 and 002 were recalled and its usage was restricted . The term anaphylaxis has been used for all types of acute life - threatening, generalized hypersensitivity reactions due to abnormal sensitivity to a triggering agent . Although indigo carmine has no known activity in the human body, it has been found to directly activate alpha - adrenergic receptors, which may lead to reflex bradycardia and/or hypertension . Hypotension after indigo carmine administration is an unexpected adverse effect and has been reported in fewer than 10 patients over 80 years of use . Sudden, severe hypotension after indigo carmine administration was first reported in a series of four patients with no known drug allergies who underwent radical prostatectomy under epidural anesthesia . Due to the temporal association between indigo carmine injection and the hemodynamic change, usually, indigo carmine might cause both stimulant and depressant effects simultaneously, however, those cases could be induced by unopposed depressant component under sympathetic blockade . Severe hypotension, bronchospasm and urticaria after administration of indigo carmine were observed in a patient under general anesthesia . That patient, who was undergoing transurethral resection of a bladder tumor, manifested the complete spectrum of anaphylaxis five minutes after injection of indigo carmine, including hemodynamic collapse, cutaneous changes, laryngeal edema and bronchospasm . Due to a lack of prior allergies or prior exposure to indigo carmine, their case was thought to be caused by histamine release such as an anaphylactoid reaction . Life - threatening adverse reaction associated with indigo carmine presenting as even asystole was reported . Severe hypotension, bradycardia, hypoxia were observed after indigo carmine injection, and then the patient became asystolic . Following chest compression and intraaortic balloon pump support, the patient's blood pressure was stabilized . The patient's cardiac arrest event was believed to be due to an anaphylactoid reaction in response to indigo carmine . A diagnosis of anaphylaxis requires evidence of involvement of three or more organs and the detection of specific ige or a positive skin test to the alleged agent . However, since these reports did not verify these findings, it would be reasonable to diagnose these events as idiosyncratic reactions, including anaphylaxis . Compared with the previous reports, our patients had somewhat bizarre clinical manifestations . During the period described for all five patients, we used lot numbers 001 and 002 of indigo carmine on 15 patients . Hypotensive episodes in some of the other patients may have been overlooked because their symptoms were mild and they recovered immediately . In all five patients described above, saline replacement was adequate and there was no massive blood loss . There were no symptoms or signs suggesting anaphylactoid reactions, such as cutaneous changes or wheezing . Two patients who experienced hypotensive episodes were tested for hypersensitivity to indigo carmine of lot number 002 by skin prick tests and intradermal skin tests, and both were negative . Although a negative response to a suspected agent is unreliable in ruling out drug hypersensitivity, the clinical manifestations of these patients indicate that drug hypersensitivity or anaphylaxis was unlikely causes . We focused on the five patients who experienced hypotension serially within a one month period, and suspected that flaws in production were responsible for these adverse reactions . During the manufacturing process, indigo carmine molecules may be fragmented by accelerated electron beams, and these fragmented ions can be classified by their mass to charge (m / z) ratios on ms (fig . Analysis of the raw materials by lc / ms showed an abnormal peak in lot number 002 that was not present in lot number 906 . This additional peak contained abnormal amounts of fragmented ions, with m / z = 340, which had not been filtered out during the manufacturing process . Raw materials, reagents, and degradation during manufacture and storage are all possible sources of impurities in drugs . These impure drugs may cause various adverse reactions, regardless of their pharmacological effects . Determining the lot number of the drug may be helpful in investigating the causes of adverse reactions . Usually, physicians tend to ignore or miss symptoms and signs if they are not critical . However, practitioners should always pay attention when using drugs and prevent further adverse drug reactions by meticulous monitoring and prompt reporting.
Hypercholesterolemia plays a crucial role in the development of atherosclerotic disease, which is one of the leading causes of mortality in the western world . Therapy with 3-hydroxy-3-methylglutaryl - coenzyme a (hmg - coa) reductase inhibitors statins the underlying causes of this phenomenon have been extensively debated, but remain uncertain . The observed variation in biological response to statins could be due to variation in patient compliance, pharmacokinetics or pharmacodynamics and drug - drug interactions, as well as interindividual genetic differences in cholesterol biosynthesis, target lipoprotein (mainly ldl) receptor uptake or metabolism of particular statins . Any predictions of biological response of individuals to statins would thus be very valuable for more efficacious, personalized treatments . The first totally synthetic 3-hydroxy-3-methylglutaryl coenzyme a reductase inhibitor on the market, fluvastatin, is not the most frequently prescribed statin nowadays, but thanks to its well - characterized metabolism, it is particularly suitable for investigations into the influence of genetic variability on interindividual variation in therapeutic effect . Statins differ in their main metabolic fates in the human body while fluvastatin is metabolized primarily via hepatic transformation by the 2c9 isoform of the genetically polymorphic cytochrome p450 enzyme (cyp2c9); simvastatin, lovastatin and atorvastatin are metabolized by cyp3a4; and pravastatin, rosuvastatin and pitavastatin do not seem to be significantly modified by any of the cyp isoforms . Thanks to its specific metabolic route through cyp2c9, fluvastatin is only mildly susceptible to adverse drug - drug interaction effects and it is less prone to pharmacokinetic interactions compared to other hmg - coa reductase inhibitors . Importantly, chemical inhibition of the enzymatic activity of the particular cyp isoforms has been shown to elevate plasma concentrations of the active forms of the respective statins . Approximately 60% of fluvastatin orally administered in its active form is metabolized via cytochrome p450 into the inactive form . An in vivo study calculated that the relative contribution of the cyp2c9 isoform is more than 80% . The 2 main metabolites 6-hydroxy and n - desisopropyl fluvastatin are exclusively generated by cyp2c9, while the third known metabolite 5-hydroxy fluvastatin is formed by multiple pathways involving cyp2c9, cyp3a4, cyp2c8 and cyp2d6 . The 2 most common single - nucleotide polymorphic (snp) allelic variants of cyp2c9 that occur in caucasian population are cyp2c9 * 2 and cyp2c9 * 3 . The cyp2c9 * 2 allele represents an snp in exon 3 that leads to arg144cys mutation and occurs in 8%14% of caucasians, while the slightly less common cyp2c9 * 3 allele with an snp in exon 7 causes ile359leu mutation and is found in 411% of caucasians [68]. Importantly, both allelic variants have lower enzyme activity than the wild type cyp, and both would thus be predicted to elevate or modify plasma concentrations of unmetabolized, pharmacologically active forms of cyp substrates . Consistent with this idea, the plasma levels of 3r, 5s - fluvastatin (the active form) were found to be up to 3-fold higher in healthy volunteers of the * 3/3 than in those of the 1/1 genotype . This correlation between the presence of cyp2c9 3 and fluvastatin pharmacokinetics was not reflected in the cholesterol - lowering effect of the drug, but that could have been due to the fact that the study was carried out on healthy volunteers, and might not have been representative of a typical treatment regime . The subjects took fluvastatin daily only for 2 weeks, and their baseline lipid levels and the daily administered dose of fluvastatin (40 mg of racemic form) were lower than in patients normally requiring fluvastatin treatment . We thus hypothesized that the prospective association between cyp2c9 genotype and the hypolipidemic efficacy of fluvastatin could be more pronounced in a group of real hypercholesterolemic patients with pathologically elevated baseline lipids levels . This could be clinically relevant and have a direct impact on the preferred efficacious treatment regime in genetically defined subgroups of hypercholesterolemic patients on fluvastatin . All subjects were of czech nationality and gave their written informed consent prior to participating in the trial . The study protocol was approved by the ethics committee of the general university hospital in prague . Fluvastatin - treated patients were recruited by the internal medicine ward of the general university hospital in prague under exclusion and inclusion criteria . The exclusion criteria were: history of diabetes mellitus, any liver disease, any other disease causing modification of metabolic functions, previous treatment with fluvastatin, concomitant therapy with strong cyp2c9 inducers or inhibitors, history of stomach or gut surgery influencing drug absorption, any known or suspected cancers, immunosuppressive treatment, pregnancy or ongoing breastfeeding, and alcoholism . The inclusion criterion for enrolment in the trial was the initiation of treatment of hypercholesterolemia by fluvastatin in 80 mg daily per oral dose in compliance with the standard therapeutic approach in the hospital . Concomitant use of other medications was documented and possible drug - drug interactions were recorded . No interventions to standard therapeutic procedures have been done during the study, except for 1 extra blood sampling for dna isolation . The untreated control group of unrelated healthy czech caucasian volunteers was recruited as a control population for cyp2c9 genotype distribution . Biochemical data, including plasma creatine kinase, alt, ast, gmt, and alp, electrolyte balance and plasma lipid levels before and 12 weeks after fluvastatin treatment, were determined by standard methods in the institute for clinical biochemistry and laboratory diagnostics of the general university hospital . Genomic dna was isolated from peripheral leukocytes by qiamp blood mini kit (qiagen). Restriction fragment length polymorphism (pcr - rflp) analysis was carried out using previously described methods and primer sets . Taq dna polymerase, other pcr reagents and restriction enzymes were from fermentas (lithuania). The pcr products of the 2 used amplicons were separated by electrophoresis on 3% agarose gel and identified by ethidium bromide staining . An allele was assigned as cyp2c9 * 2 when the 372 base pair (bp) pcr product of the first amplicon contained a cfr 13i restriction site that yielded fragments of 253 and 119 bp upon cleavage by cfr 13i . Similarly, an allele was assigned as cyp2c9 * 3 when the 137 bp product of the second amplicon was digested into fragments of 104 and 33 bp by sty i. whenever the cleavage of an amplicon produced the expected cleavage fragments, but also left the original pcr product intact, the subject was assigned as heterozygous in the respective allele . The subjects without any of these 2 variants were assumed to be homozygous wild - type carriers of cyp2c9 * 1 . The evaluation of fluvastatin s hypolipidemic effect and its genotype - dependency was done by student s t test . Throughout the study, arithmetic mean and standard deviation were used as central tendency and dispersion measures, respectively . The expected genotype frequencies were calculated from the observed allelic frequencies using hardy - weinberg equilibrium (p+2pq+q=1). Prevalence was compared by the chi - square test, and 95% confidence interval (95% ci) of genotype frequencies was calculated . Data were processed using microsoft excel 8.0 (microsoft, usa) and statgraphics plus 3.1 (statpoint, inc . All subjects were of czech nationality and gave their written informed consent prior to participating in the trial . The study protocol was approved by the ethics committee of the general university hospital in prague . Fluvastatin - treated patients were recruited by the internal medicine ward of the general university hospital in prague under exclusion and inclusion criteria . The exclusion criteria were: history of diabetes mellitus, any liver disease, any other disease causing modification of metabolic functions, previous treatment with fluvastatin, concomitant therapy with strong cyp2c9 inducers or inhibitors, history of stomach or gut surgery influencing drug absorption, any known or suspected cancers, immunosuppressive treatment, pregnancy or ongoing breastfeeding, and alcoholism . The inclusion criterion for enrolment in the trial was the initiation of treatment of hypercholesterolemia by fluvastatin in 80 mg daily per oral dose in compliance with the standard therapeutic approach in the hospital . Concomitant use of other medications was documented and possible drug - drug interactions were recorded . No interventions to standard therapeutic procedures have been done during the study, except for 1 extra blood sampling for dna isolation . The untreated control group of unrelated healthy czech caucasian volunteers was recruited as a control population for cyp2c9 genotype distribution . Biochemical data, including plasma creatine kinase, alt, ast, gmt, and alp, electrolyte balance and plasma lipid levels before and 12 weeks after fluvastatin treatment, were determined by standard methods in the institute for clinical biochemistry and laboratory diagnostics of the general university hospital . Genomic dna was isolated from peripheral leukocytes by qiamp blood mini kit (qiagen). Restriction fragment length polymorphism (pcr - rflp) analysis was carried out using previously described methods and primer sets . Taq dna polymerase, other pcr reagents and restriction enzymes were from fermentas (lithuania). The pcr products of the 2 used amplicons were separated by electrophoresis on 3% agarose gel and identified by ethidium bromide staining . An allele was assigned as cyp2c9 * 2 when the 372 base pair (bp) pcr product of the first amplicon contained a cfr 13i restriction site that yielded fragments of 253 and 119 bp upon cleavage by cfr 13i . Similarly, an allele was assigned as cyp2c9 * 3 when the 137 bp product of the second amplicon was digested into fragments of 104 and 33 bp by sty i. whenever the cleavage of an amplicon produced the expected cleavage fragments, but also left the original pcr product intact, the subject was assigned as heterozygous in the respective allele . The subjects without any of these 2 variants were assumed to be homozygous wild - type carriers of cyp2c9 * 1 . The evaluation of fluvastatin s hypolipidemic effect and its genotype - dependency was done by student s t test . Throughout the study, arithmetic mean and standard deviation were used as central tendency and dispersion measures, respectively . The expected genotype frequencies were calculated from the observed allelic frequencies using hardy - weinberg equilibrium (p+2pq+q=1). Prevalence was compared by the chi - square test, and 95% confidence interval (95% ci) of genotype frequencies was calculated . Data were processed using microsoft excel 8.0 (microsoft, usa) and statgraphics plus 3.1 (statpoint, inc . The effect - observing pharmacodynamic part of our study involved 87 hypercholesterolemic participants treated for the first time in their treatment regime with fluvastatin (fluvastatin all patients, median age 59 years). From within this group, 48 subjects on fluvastatin monotherapy (75% males, median age 57 years) were selected by excluding patients treated with cyp2c9 inducers or inhibitors, patients taking any other hypolipidemic medications in the 8 weeks prior to our study, and patients that were on concomitant therapy with any potentially lipid - lowering agent, including over - the - counter medicines . All hypercholesterolemic subjects and control group of 254 healthy volunteers were genotyped for cyp2c9 alleles as described in methods . The demography and allelic frequency data of the analyzed groups of subjects are summarized in table 1 . As summarized in table 1, the cyp2c9 * 2 allele occurred in 9.8% of fluvastatin - treated patients and 12.2% of healthy volunteers, while the less common cyp2c9 * 3 variant was found in 5.9% of healthy volunteers and 5.7% of fluvastatin - treated patients . Approximately 9.2%, and 2.3% of the fluvastatin - treated subjects and 9.8%, and 0.4% of healthy volunteers were * 1/3 and 2/3 heterozygotes, respectively . While the 3/3 and 2/2 genotypes were identified in 0.8% and 2.0% of healthy volunteers, no fluvastatin - treated subjects were homozygous for these alleles, likely reflecting their smaller group size (table 2). Overall, demographic characteristics of the patients in different genotype groups were comparable, genotype frequency distribution did not show a significant deviation from the hardy - weinberg equilibrium, and genotype frequencies were comparable to those published for other caucasian populations (see discussion). The observed allelic frequencies and genotype distribution did not differ among healthy volunteers and patients on concomitant treatment or fluvastatin monotherapy (p=0.001), indicating that cyp2c9 polymorphism is not a predicting factor for hypercholesterolemia, assuming that genotype expression is age - independent . In our further analysis of genotype dependency of fluvastatin treatment we focused on the group of patients on fluvastatin monotherapy to exclude any possible effects of drug - drug interactions . All related adverse effects were recorded during the course of the study . To facilitate detection of any previously undiagnosed diseases potentially complicating interpretation of the data, patients clinical biochemical indicators for liver function (alt, ast, gmt, alp), electrolyte balance and general metabolism were examined before, during the study, and after at least 12 weeks of treatment with 80 mg dose of fluvastatin; they did not reveal any idiosyncrasy or abnormal elevation of any markers or biochemical parameters . Fluvastatin was well tolerated by all participants patients did not complain spontaneously, and fluvastatin treatment had no effect on the activities of creatine kinase at the administered dose of 80 mg daily . To assess the efficacy of hypolipidemic therapy, the threshold limits were defined as follows: low - density lipoprotein cholesterol (ldl - c) levels between 2.23.4 mmol / l, serum total cholesterol (tc) levels between 3.835.2 mmol / l, and triglyceride (tg) levels between 0.681.69 mmol / l . After 12 weeks of fluvastatin monotherapy of hypercholesterolemic patients, their plasma lipid levels became significantly reduced (p<0.001, table 3), demonstrating the efficacy of the treatment . Triglyceride levels fell on average by 28.1% (ranging between 5.072.9%), tc by 21.5% (6.249.4%) and ldl - c by 25.0% (2.682.4%). Eighty - nine percent of patients reached more than 10% reduction in tg levels, 84% of patients reached more than 10% reduction in tc, and 92% of patients reached more than 10% reduction in ldl - c . We next investigated the correlation between the lipid - regulating effect of fluvastatin monotherapy and cyp2c9 genotype . Subjects carrying the 1/3 genotype achieved a greater reduction in plasma levels of ldl - c than subjects with 1/1 or 1/2 genotypes (39.95% vs. 22.35% or 29.92%, respectively) with statistical significance of p<0.05 (table 3). In addition, subjects bearing the cyp2c9 1/3 genotype had slightly greater reductions in tc than 1/2 or 1/1 carriers (28.56% vs. 20.16% or 25.00%, respectively). In contrast, the reduction in plasma levels of tg did not show any correlation with cyp2c9 genotype, fluctuating around 28% in all genotype subgroups (see table 3). No genotype - related dependency was observed for high - density lipoprotein levels (data not shown). Mmol / l) was reached by 87.5% of all fluvastatin monotherapy patients, and among these the allelic frequencies of cyp2c9 3 was 6.0% (5 heterozygous subjects) and the allelic frequencies of cyp2c9 * 2 was 10.7% (9 heterozygous subjects). Mmol / l) was reached by 60.4% of patients which the cyp2c9 * 3 was present in 8.6% cases (5 heterozygous subjects), and cyp2c9 * 2 was present in 15.5% cases (9 heterozygous subjects). Plasma concentration of tg reached the threshold point (1.69 mmol / l) in 58.3% patients, of whom 7.1% carried the cyp2c9 * 3 allele (4 heterozygous subjects) and 10.7% were carriers of cyp2c9 * 2 (6 heterozygous subjects). The number of patients that met the clinical threshold concentrations after the 12 weeks of treatment is detailed in table 3 . Despite the clear effects of cyp2c9 * 3 presence on the treatment - induced reduction in ldl - c and tc levels, there was no statistically significant correlation between the cyp2c9 genotype and the overall final clinical outcome of fluvastatin treatment, as judged by the treatment adjustment of plasma lipid levels to threshold ranges mentioned above . The differences in the distribution of cyp2c9 genotypes between the groups of patients reaching and not reaching normal plasma lipid levels were not statistically significant . In conclusion, cyp2c9 polymorphism indeed seems to have an impact on the lipid - lowering efficacy of fluvastatin in hypercholesterolemic patients, but this effect does not directly translate into clinically significant differences in individuals heterozygous for the * 3 allele . The effect - observing pharmacodynamic part of our study involved 87 hypercholesterolemic participants treated for the first time in their treatment regime with fluvastatin (fluvastatin all patients, median age 59 years). From within this group, 48 subjects on fluvastatin monotherapy (75% males, median age 57 years) were selected by excluding patients treated with cyp2c9 inducers or inhibitors, patients taking any other hypolipidemic medications in the 8 weeks prior to our study, and patients that were on concomitant therapy with any potentially lipid - lowering agent, including over - the - counter medicines . All hypercholesterolemic subjects and control group of 254 healthy volunteers were genotyped for cyp2c9 alleles as described in methods . The demography and allelic frequency data of the analyzed groups of subjects are summarized in table 1 . As summarized in table 1, the cyp2c9 * 2 allele occurred in 9.8% of fluvastatin - treated patients and 12.2% of healthy volunteers, while the less common cyp2c9 * 3 variant was found in 5.9% of healthy volunteers and 5.7% of fluvastatin - treated patients . Approximately 9.2%, and 2.3% of the fluvastatin - treated subjects and 9.8%, and 0.4% of healthy volunteers were * 1/3 and 2/3 heterozygotes, respectively . While the 3/3 and 2/2 genotypes were identified in 0.8% and 2.0% of healthy volunteers, no fluvastatin - treated subjects were homozygous for these alleles, likely reflecting their smaller group size (table 2). Overall, demographic characteristics of the patients in different genotype groups were comparable, genotype frequency distribution did not show a significant deviation from the hardy - weinberg equilibrium, and genotype frequencies were comparable to those published for other caucasian populations (see discussion). The observed allelic frequencies and genotype distribution did not differ among healthy volunteers and patients on concomitant treatment or fluvastatin monotherapy (p=0.001), indicating that cyp2c9 polymorphism is not a predicting factor for hypercholesterolemia, assuming that genotype expression is age - independent . In our further analysis of genotype dependency of fluvastatin treatment we focused on the group of patients on fluvastatin monotherapy to exclude any possible effects of drug - drug interactions . All related adverse effects were recorded during the course of the study . To facilitate detection of any previously undiagnosed diseases potentially complicating interpretation of the data, patients clinical biochemical indicators for liver function (alt, ast, gmt, alp), electrolyte balance and general metabolism were examined before, during the study, and after at least 12 weeks of treatment with 80 mg dose of fluvastatin; they did not reveal any idiosyncrasy or abnormal elevation of any markers or biochemical parameters . Fluvastatin was well tolerated by all participants patients did not complain spontaneously, and fluvastatin treatment had no effect on the activities of creatine kinase at the administered dose of 80 mg daily . To assess the efficacy of hypolipidemic therapy, the threshold limits were defined as follows: low - density lipoprotein cholesterol (ldl - c) levels between 2.23.4 mmol / l, serum total cholesterol (tc) levels between 3.835.2 mmol / l, and triglyceride (tg) levels between 0.681.69 mmol / l . After 12 weeks of fluvastatin monotherapy of hypercholesterolemic patients, their plasma lipid levels became significantly reduced (p<0.001, table 3), demonstrating the efficacy of the treatment . Triglyceride levels fell on average by 28.1% (ranging between 5.072.9%), tc by 21.5% (6.249.4%) and ldl - c by 25.0% (2.682.4%). Eighty - nine percent of patients reached more than 10% reduction in tg levels, 84% of patients reached more than 10% reduction in tc, and 92% of patients reached more than 10% reduction in ldl - c . We next investigated the correlation between the lipid - regulating effect of fluvastatin monotherapy and cyp2c9 genotype . Subjects carrying the 1/3 genotype achieved a greater reduction in plasma levels of ldl - c than subjects with 1/1 or 1/2 genotypes (39.95% vs. 22.35% or 29.92%, respectively) with statistical significance of p<0.05 (table 3). In addition, subjects bearing the cyp2c9 1/3 genotype had slightly greater reductions in tc than 1/2 or 1/1 carriers (28.56% vs. 20.16% or 25.00%, respectively). In contrast, the reduction in plasma levels of tg did not show any correlation with cyp2c9 genotype, fluctuating around 28% in all genotype subgroups (see table 3). No genotype - related dependency was observed for high - density lipoprotein levels (data not shown). The upper threshold for clinically normal levels of ldl - c (3.4 mmol / l) was reached by 87.5% of all fluvastatin monotherapy patients, and among these the allelic frequencies of cyp2c9 3 was 6.0% (5 heterozygous subjects) and the allelic frequencies of cyp2c9 * 2 was 10.7% (9 heterozygous subjects). The threshold for tc level (5.2 mmol / l) was reached by 60.4% of patients which the cyp2c9 * 3 was present in 8.6% cases (5 heterozygous subjects), and cyp2c9 * 2 was present in 15.5% cases (9 heterozygous subjects). Plasma concentration of tg reached the threshold point (1.69 mmol / l) in 58.3% patients, of whom 7.1% carried the cyp2c9 * 3 allele (4 heterozygous subjects) and 10.7% were carriers of cyp2c9 * 2 (6 heterozygous subjects). The number of patients that met the clinical threshold concentrations after the 12 weeks of treatment is detailed in table 3 . Despite the clear effects of cyp2c9 * 3 presence on the treatment - induced reduction in ldl - c and tc levels, there was no statistically significant correlation between the cyp2c9 genotype and the overall final clinical outcome of fluvastatin treatment, as judged by the treatment adjustment of plasma lipid levels to threshold ranges mentioned above . The differences in the distribution of cyp2c9 genotypes between the groups of patients reaching and not reaching normal plasma lipid levels were not statistically significant . In conclusion, cyp2c9 polymorphism indeed seems to have an impact on the lipid - lowering efficacy of fluvastatin in hypercholesterolemic patients, but this effect does not directly translate into clinically significant differences in individuals heterozygous for the * 3 allele . Our study suggests that the cyp2c9 * 3 allele does partly influence the response to fluvastatin treatment in hypercholesterolemic patients . We found that heterozygous cyp2c9 * 1/3 carriers had a greater reduction in plasma ldl - c levels than wild - type subjects . They also showed a greater reduction in tc, but this effect lacks statistical significance due to low allelic frequencies of cyp2c9 3 . Both of these effects were specific to the cyp2c9 * 1/3 carriers and were not found in cyp2c9 3/2 patients (2 subjects). This finding may just reflect the small sample size, or patient compliance, or an interaction between 2 and * 3 . The cyp2c9 * 3 allele - specific effects would be more pronounced in homozygous cyp2c9 * 3/3 subjects, but those were not found in our fluvastatin monotherapy patients due to their low frequency and limited sample size in our study . Cyp2c9 polymorphisms occur at high frequency in most of the ethnic populations and the cyp2c9 3 allele is more frequent in caucasian populations than in asians (11.6% vs. 3.5%) and african americans (4.3%). Among european nations, the frequency of cyp2c9 * 3 allele varies from 6% to 10%: 10% in the spanish, 9.5% in croats, 9% in italians, 8.5% in the british, 8.0% in french, 6.7% in russians, and 6.6% in swedes . Allelic frequency of cyp2c9 * 3 in the czech population (5.9%) falls at the lower margin of this range and does not differ between the fluvastatin - treated and the control groups . The latter suggested that cyp2c9 * 3 itself is not a susceptibility factor for hypercholesterolemic disease . The lipid - lowering effect of fluvastatin among all 87 patients (irrespective of cyp2c9 genotype) in our study was compared to the data presented by novartis pharma in leskol xl prescribing information for physicians . Lipid - lowering data for leskol xl (80 mg per tablet) from three 24-week controlled trials are as follows: ldl - c reduction by 35%, tc reduction by 25% and tg reduction by 19%, which corresponds reasonably well to the data obtained in our study: 25%, 21% and 28%, respectively . We did not detect any genotype - related increase in observed adverse events nor any abnormalities in creatine kinase activities, indicative of negligible adverse - effects of fluvastatin at the doses administered (80 mg daily). Fluvastatin is generally known for its high safety and low potential for interactions, and thanks to these qualities it is frequently and preferably administered to patients with medical history of transplantations . Because of the non - intervention design of our study, patients did not undergo any pharmacokinetics testing, such as measurement of plasma concentrations of fluvastatin metabolites, to validate previous findings that the mean plasma levels of the active enantiomer of fluvastatin (single dose of 40 mg) were 3-fold higher in the cyp2c9 * 3 carriers than in non - carriers . The racemic mixture of the active 3r, 5s - fluvastatin and its inactive 3s, 5r enantiomer is primarily metabolized to 5-hydroxy-, 6-hydroxy- and n - desisopropyl - fluvastatin by cyp2c9 . This route accounts for about 50% to 80% of the total clearance, although alternative metabolic enzymes such as cyp3a4, cyp2c8 and cyp2d6 are also involved in formation of 5-hydroxy fluvastatin . However, the cyp3a4 may be a genetic determinant of interindividual differences in response to certain statins (simvastatin, lovastatin, and atorvastatin), and hypolipidemic efficacy of fluvastatin is not dependent on cyp3a4 . The possible effect of snps of these cyp enzymes is likely to be concealed by the variation derived from compliance, diet, living condition of the patients, concomitant therapy and disease and other environmental variables, and the central position of cyp2c9 enzyme and its polymorphism in fluvastatin metabolism remains relevant . Genetic variations in other genes can provide theoretical explanations for the interindividual variability of fluvastatin treatment from the genetic variation in the cholesterol / lipid pathways and spatial arrangement of the receptors to the transporters and other metabolizing enzymes . Fluvastatin transport in the human body is more complex than that of other statins because of its relatively high lipophilicity, which allows, at least partly, passive diffusion via the hepatocyte plasma membrane and increased absorption in the gut by transcellular passive diffusion . In addition, numerous studies claimed that fluvastatin is not transported by the p - glycoprotein drug transporter [2123], unlike some other statins, but it rather seems to be a substrate for organic anion transporters oatp1b1, oatp1b3, and oatp2b1, which are rich in snps . Some of these, especially oatp2b1, have been reported to play an important role in statin uptake into hepatocytes and were implicated in modulating the pharmacological action and efficacy of fluvastatin . Furthermore, it was reported that genetic polymorphism in cholesteryl - ester transfer protein could also be associated with variable lipid response to fluvastatin, and there are snps in other genes not explicitly associated with fluvastatin transport, metabolism or receptors that impact the efficacy of the treatment . In conclusion, although the limited size of patient cohorts and the consequent absence of rare genotypes including cyp2c9 * 3/3 homozygous subjects make our results preliminary in nature, the study nevertheless suggests that the cyp2c9 3 allele might correlate with a better ldl - c lowering efficacy of fluvastatin.
Cpr was used in two neuroscience courses: an introductory neuroscience course (50 students, 86% first - years and sophomores) and an upper level sensation and perception course (40 students, 95% juniors and seniors). In the introductory course, students wrote one summary essay based on a scholarly review and one argumentative essay based on a primary research article . In the upper level course, students composed two summary and synthesis essays and one argumentative essay, all of which were based on primary research articles of increasing sophistication . Information on the sample groups, student performance, and instructor grading demands is summarized in table 1 . Before the first cpr assignment, students completed an anonymous survey about their previous experience with peer review . At the end of the semester, students completed another anonymous survey that asked for qualitative and quantitative feedback on their experiences with the cpr program . Specifically, students were asked to state what they liked most and least about the cpr program, and to rate on a 15 likert scale how much they felt that their writing and peer review skills improved over the semester, how often they provided and received helpful peer reviews, to what degree they felt that they were evaluated fairly by the cpr program, and how much work they put into cpr assignments, compared to writing assignments of equal length . Instructors can opt to author new assignments, or select assignments from an online library that includes at least 24 assignments on neuroscience related topics (i.e., cognitive neuroscience, psychopharmacology, ethics, cellular and molecular neuroscience, visual neuroscience, signal transduction, clinical neuroscience, and neuroethology). Using a simple, online interface, 1), and links to relevant source materials (e.g., lecture notes, primary research articles, and scholarly search engines). Next, instructors compose high, low, and mid - quality calibration essays (fig . 2), set the evaluation parameters (ten style and content questions that can be answered in either yes / no or none / one / some categorizations; fig . Finally, instructors set the deadlines for text entry and peer review completion, and establish the grading criteria for the calibrations (the number of specific questions a student must answer correctly, and the acceptable deviation range for the holistic evaluation of the essays). Excellent technical advice is available through email and a list - serve, and formal workshops on authoring successful assignments are offered on a regular basis . Before students begin any assignment, a mandatory, online interactive tutorial familiarizes students with using the cpr interface to complete each stage of the assignment . Completing cpr assignments requires three phases of student participation: 1) composing an essay, 2) calibrating reviews against standards, and 3) reviewing self and others . Students first compose and electronically enter their essays by a certain deadline; this can be done from any internet - ready computer . Second, students evaluate three instructor - provided calibration essays holistically by numerically rating the essay from 110, and specifically by answering content and style questions set by the instructor (fig . Students learn how their calibration evaluations compare with the instructor s evaluation (i.e., the number of style and content questions answered correctly, and the deviation from the instructor s holistic score for each calibration essay .) If students do not pass a calibration evaluation, they have one more opportunity to revise their assessments before receiving their official scores on the calibration section . This second feedback in the calibration phase includes extensive comments written by the instructor to clarify student understanding of the judgment criteria . Thus, all students in the class receive the same extensive training in peer review prior to evaluating others essays . Students evaluate the essays according to the same criteria as the calibration essays and provide written justifications for each answer . If a student does not perform satisfactorily on the calibrated reviews, then his or her peer reviews do not factor into the calculation of the peer - reviewed student text ratings . Finally, after reading six essays on the same topic, students evaluate their own essays using the evaluation parameters . Immediately after the deadline for the completion of the peer and self reviews, students are able to access their peers narrative comments and receive a comprehensive score for the assignment based on four factors: essay quality, calibration review accuracy, peer review accuracy, and self review accuracy . Instructors determine weight of grading components; for both classes i weighted text 15% (5% each essay), the accuracy of three peer reviews quality 60%, the accuracy of the three calibration reviews 15% (5% each essay), and the accuracy of the self review 10% . A scoring algorithm flags the instructor to any potential errors in analysis (e.g., essays that are reviewed by fewer than three peers, peer reviews that vary significantly in holistic evaluation, or essays that are reviewed by students who have done poorly in the calibration stage). Throughout all stages of the assignment, the instructor has access to all student work, including text entries, calibration and peer reviews . Instructors also know which students reviewed each essay, and are able to change essay scores and edit assignment grades . The instructor can provide written commentary about grade changes, and has the option of making this logic visible to the students who peer reviewed the essay in question, or just to the author of the essay . These results are permanently stored in a user - friendly database on a ucla server, and can be accessed by the instructor at any time . The mean text ratings (generated by the weighted average of three anonymous peer reviews) and the mean deviations on calibrations, peer reviews, and self reviews are listed in table 1 . The cpr - calculated text ratings were within 0.5 points (on a ten - point scale) of the instructor s assessment 75% of the time . When the essays were rescored, the changes usually improved the students text ratings, consistent with the finding that peer assessment of writing tends to be slightly lower than an instructor or teaching assistant s evaluation (stefani, 1994). In both classes, the average deviation from the actual text rating was greatest in the calibration phase and least in the peer review phase (table 1), suggesting that the calibration process did indeed function successfully as a training mechanism . However, the mean deviation for the self reviews, performed after the peer reviews, was greater than the mean deviation in peer review stage; students usually rated their own essays higher than their peers assessment of the text . Similar to the findings of falchikov and goldfinch (2000), advanced students in the 300-level class did not perform any better at assessments than the beginner students in the introductory class, suggesting that peer review is not necessarily a skill served in the normal course of undergraduate academic training . Student quantitative and qualitative assessments of the cpr program are summarized in figure 5 and table 2 . Students self - reported that both their writing and peer review skills improved somewhat over the course of the semester (fig . Usually provided helpful comments in peer reviews, whereas they only sometimes received helpful comments, and only sometimes felt like their essays were being evaluated fairly (fig . 5). However, most all students agreed that, compared to other writing assignments of equal length, they spent much more time on cpr assignments . Not surprisingly, when asked to name their primary dislike of the cpr program, students cited too much work more often than any other answer (table 2). The students, by virtue of reviewing the essays in a double - blind anonymous format, lacked the requisite information to students occasionally did poor jobs at evaluating essays, but in these instances, their peer reviews were usually automatically discounted by the cpr program because these students also tended to fail the calibration section . The added motivation of being graded on the reliability of one s peer review further encouraged consistency and thoughtfulness in the peer review process . Nonetheless, students did cite grade - scheming and attempts to second guess the scoring algorithm as a major disadvantage of the program . For example, when the acceptable deviation for a peer review was 2, some students tended to rate a very good (9 or 10 quality) essay as an 8 in order to maximize their acceptable deviation range . Importantly, students voiced very few negative comments about cpr being inaccessible, hard to understand, or technically challenging . Although more students stated that the online format was a deterrent (5) than an advantage (2), technical difficulty with the program itself was never mentioned as a concern . By far, most student confusion stemmed from ambiguities in the criteria used to evaluate essays (fig . 2); specifically, students struggled to answer the evaluation questions with either yes or no answers . To address this concern, i offered full credit for a calibration review if a student holistically scored the essay within the acceptable range, but answered more of the content or style questions incorrectly than was permitted, only if the student was able to justify his or her answers with examples from the text . Another strategy to minimize confusion about the evaluation parameters is to spend time in class collectively evaluating a sample essay before students begin the first assignment, as peer assessments have been found to resemble instructor assessments most closely when judgments are based on well understood criteria (falchikov and goldfinch, 2000). Despite student critiques of the program, i still recommend the cpr program as an excellent and free resource for incorporating more writing, peer review, and critical thinking into an undergraduate neuroscience curriculum . Cpr s online data management system also has many practical advantages to the traditional paper collection method of peer review . First, the random double - blind distribution of peer essays simplifies a very difficult organizational feat and guarantees student anonymity . Second, the saved database of peer reviews is a great source of information for writing recommendation letters and for calculating participation grades in large classes . Third, the online submissions process eliminates problems with lost essays or broken printers, and the password - protected website for the class allows students to print off specific articles for the assignments without the burden of going to the library reserves, or worrying about copyright violations . Although i did not specifically measure whether learning was improved in topics covered by cpr assignments, many students cited a deepened understanding of the material as their primary like of the cpr program (fig . 5). Other studies have shown quantitative learning gains in topics presented in cpr assignments, as compared to those topics covered in didactic lectures or in active learning formats (pelaez, 2002). Perhaps one of the greatest advantages of cpr is the availability of immediate feedback on assignments . Learning is generally improved by detailed and timely feedback on student work (brown et al ., 1995), and using cpr, students received three detailed peer assessments of their work within five minutes of the deadline for completing the peer and self reviews . Furthermore, a quick online review of the essays allowed me to identify and address common content misconceptions in class and common errors in writing in the next set of calibration essays . My two primary critiques of the cpr program are that 1) there is no process for revision built into the cpr program, and 2) the peer review component of the grade is determined by the quality of the students quantitative, but not qualitative, feedback . Thus, students can receive full credit for reviews that are sloppy, pithy, or cruel in content, but within the allotted margin of error . To address the first issue, i offered students an opportunity to revise their essays for extra credit (a maximum of 40% of the difference between their grade and a perfect score). Sixty- three percent of students in the introductory class opted to revise at least one essay, whereas only 40% of students in the upper level class chose to revise an essay (table 1). This added revision process allowed me to provide students with more personal attention, and conversations with students about what peer advice to adopt and what suggestions to ignore were generally very fruitful . To address the second issue, i advised students that the quality of their written peer review comments would factor heavily into their class participation grade, 5% of their overall grade for the course . Although cpr was designed as a timesaving device for instructors, the workload associated with introducing the program and discussing the evaluation parameters using example essays (1.5 class periods), creating the assignments and the calibration essays (810 hours), and re - evaluating text ratings and contested calibration and peer reviews (48 hours) is considerable . Of course, repeating old assignments, using an assignment from the cpr library, or hiring a qualified student assistant to compose the calibration essays would significantly expedite this process . Nonetheless, cpr still requires less time than critically responding to 30 + student essays by hand, and provides far more direct experience for the students in abstract reasoning and peer review . Results of the student evaluations indicate that cpr fostered a multi - dimensional comprehension of the course material while teaching traditionally underserved academic skills: science writing and peer review . Over the course of the semester, i observed that students purpose for writing shifted from writing for the professor, to writing a clear argument for a general audience . Indeed, one of the downfalls of traditional instructor review is that comments by instructors detract students attention from their own intentions in writing, and focus that attention instead on the teachers purpose in commenting cpr certainly requires more student engagement and autonomy in the writing and review process than traditional assignments . Cpr was used in two neuroscience courses: an introductory neuroscience course (50 students, 86% first - years and sophomores) and an upper level sensation and perception course (40 students, 95% juniors and seniors). In the introductory course, students wrote one summary essay based on a scholarly review and one argumentative essay based on a primary research article . In the upper level course, students composed two summary and synthesis essays and one argumentative essay, all of which were based on primary research articles of increasing sophistication . Information on the sample groups, student performance, and instructor grading demands is summarized in table 1 . Before the first cpr assignment, students completed an anonymous survey about their previous experience with peer review . At the end of the semester, students completed another anonymous survey that asked for qualitative and quantitative feedback on their experiences with the cpr program . Specifically, students were asked to state what they liked most and least about the cpr program, and to rate on a 15 likert scale how much they felt that their writing and peer review skills improved over the semester, how often they provided and received helpful peer reviews, to what degree they felt that they were evaluated fairly by the cpr program, and how much work they put into cpr assignments, compared to writing assignments of equal length . Instructors can opt to author new assignments, or select assignments from an online library that includes at least 24 assignments on neuroscience related topics (i.e., cognitive neuroscience, psychopharmacology, ethics, cellular and molecular neuroscience, visual neuroscience, signal transduction, clinical neuroscience, and neuroethology). Using a simple, online interface, 1), and links to relevant source materials (e.g., lecture notes, primary research articles, and scholarly search engines). Next, instructors compose high, low, and mid - quality calibration essays (fig . 2), set the evaluation parameters (ten style and content questions that can be answered in either yes / no or none / one / some categorizations; fig . Finally, instructors set the deadlines for text entry and peer review completion, and establish the grading criteria for the calibrations (the number of specific questions a student must answer correctly, and the acceptable deviation range for the holistic evaluation of the essays). Excellent technical advice is available through email and a list - serve, and formal workshops on authoring successful assignments are offered on a regular basis . Before students begin any assignment, a mandatory, online interactive tutorial familiarizes students with using the cpr interface to complete each stage of the assignment . Completing cpr assignments requires three phases of student participation: 1) composing an essay, 2) calibrating reviews against standards, and 3) reviewing self and others . Students first compose and electronically enter their essays by a certain deadline; this can be done from any internet - ready computer . Second, students evaluate three instructor - provided calibration essays holistically by numerically rating the essay from 110, and specifically by answering content and style questions set by the instructor (fig . Students learn how their calibration evaluations compare with the instructor s evaluation (i.e., the number of style and content questions answered correctly, and the deviation from the instructor s holistic score for each calibration essay .) If students do not pass a calibration evaluation, they have one more opportunity to revise their assessments before receiving their official scores on the calibration section . This second feedback in the calibration phase includes extensive comments written by the instructor to clarify student understanding of the judgment criteria . Thus, all students in the class receive the same extensive training in peer review prior to evaluating others essays . Students evaluate the essays according to the same criteria as the calibration essays and provide written justifications for each answer . If a student does not perform satisfactorily on the calibrated reviews, then his or her peer reviews do not factor into the calculation of the peer - reviewed student text ratings . Finally, after reading six essays on the same topic, students evaluate their own essays using the evaluation parameters . Immediately after the deadline for the completion of the peer and self reviews, students are able to access their peers narrative comments and receive a comprehensive score for the assignment based on four factors: essay quality, calibration review accuracy, peer review accuracy, and self review accuracy . Instructors determine weight of grading components; for both classes i weighted text 15% (5% each essay), the accuracy of three peer reviews quality 60%, the accuracy of the three calibration reviews 15% (5% each essay), and the accuracy of the self review 10% . A scoring algorithm flags the instructor to any potential errors in analysis (e.g., essays that are reviewed by fewer than three peers, peer reviews that vary significantly in holistic evaluation, or essays that are reviewed by students who have done poorly in the calibration stage). Throughout all stages of the assignment, the instructor has access to all student work, including text entries, calibration and peer reviews . Instructors also know which students reviewed each essay, and are able to change essay scores and edit assignment grades . The instructor can provide written commentary about grade changes, and has the option of making this logic visible to the students who peer reviewed the essay in question, or just to the author of the essay . These results are permanently stored in a user - friendly database on a ucla server, and can be accessed by the instructor at any time . The mean text ratings (generated by the weighted average of three anonymous peer reviews) and the mean deviations on calibrations, peer reviews, and self reviews are listed in table 1 . The cpr - calculated text ratings were within 0.5 points (on a ten - point scale) of the instructor s assessment 75% of the time . When the essays were rescored, the changes usually improved the students text ratings, consistent with the finding that peer assessment of writing tends to be slightly lower than an instructor or teaching assistant s evaluation (stefani, 1994). In both classes, the average deviation from the actual text rating was greatest in the calibration phase and least in the peer review phase (table 1), suggesting that the calibration process did indeed function successfully as a training mechanism . However, the mean deviation for the self reviews, performed after the peer reviews, was greater than the mean deviation in peer review stage; students usually rated their own essays higher than their peers assessment of the text . Similar to the findings of falchikov and goldfinch (2000), advanced students in the 300-level class did not perform any better at assessments than the beginner students in the introductory class, suggesting that peer review is not necessarily a skill served in the normal course of undergraduate academic training . Student quantitative and qualitative assessments of the cpr program are summarized in figure 5 and table 2 . Students self - reported that both their writing and peer review skills improved somewhat over the course of the semester (fig . Usually provided helpful comments in peer reviews, whereas they only sometimes received helpful comments, and only sometimes felt like their essays were being evaluated fairly (fig . 5). However, most all students agreed that, compared to other writing assignments of equal length, they spent much more time on cpr assignments . Not surprisingly, when asked to name their primary dislike of the cpr program, students cited too much work more often than any other answer (table 2). However, students did report an increased sense of empathy for instructor workload . The second most common complaint was the sense of being graded the students, by virtue of reviewing the essays in a double - blind anonymous format, lacked the requisite information to students occasionally did poor jobs at evaluating essays, but in these instances, their peer reviews were usually automatically discounted by the cpr program because these students also tended to fail the calibration section . The added motivation of being graded on the reliability of one s peer review further encouraged consistency and thoughtfulness in the peer review process . Nonetheless, students did cite grade - scheming and attempts to second guess the scoring algorithm as a major disadvantage of the program . For example, when the acceptable deviation for a peer review was 2, some students tended to rate a very good (9 or 10 quality) essay as an 8 in order to maximize their acceptable deviation range . Importantly, students voiced very few negative comments about cpr being inaccessible, hard to understand, or technically challenging . Although more students stated that the online format was a deterrent (5) than an advantage (2), technical difficulty with the program itself was never mentioned as a concern . By far, most student confusion stemmed from ambiguities in the criteria used to evaluate essays (fig . 2); specifically, students struggled to answer the evaluation questions with either yes or no answers . To address this concern, i offered full credit for a calibration review if a student holistically scored the essay within the acceptable range, but answered more of the content or style questions incorrectly than was permitted, only if the student was able to justify his or her answers with examples from the text . Another strategy to minimize confusion about the evaluation parameters is to spend time in class collectively evaluating a sample essay before students begin the first assignment, as peer assessments have been found to resemble instructor assessments most closely when judgments are based on well understood criteria (falchikov and goldfinch, 2000). Despite student critiques of the program, i still recommend the cpr program as an excellent and free resource for incorporating more writing, peer review, and critical thinking into an undergraduate neuroscience curriculum . Cpr s online data management system also has many practical advantages to the traditional paper collection method of peer review . First, the random double - blind distribution of peer essays simplifies a very difficult organizational feat and guarantees student anonymity . Second, the saved database of peer reviews is a great source of information for writing recommendation letters and for calculating participation grades in large classes . Third, the online submissions process eliminates problems with lost essays or broken printers, and the password - protected website for the class allows students to print off specific articles for the assignments without the burden of going to the library reserves, or worrying about copyright violations . Although i did not specifically measure whether learning was improved in topics covered by cpr assignments, many students cited a deepened understanding of the material as their primary like of the cpr program (fig . 5). Other studies have shown quantitative learning gains in topics presented in cpr assignments, as compared to those topics covered in didactic lectures or in active learning formats (pelaez, 2002). Perhaps one of the greatest advantages of cpr is the availability of immediate feedback on assignments . Learning is generally improved by detailed and timely feedback on student work (brown et al ., 1995), and using cpr, students received three detailed peer assessments of their work within five minutes of the deadline for completing the peer and self reviews . Furthermore, a quick online review of the essays allowed me to identify and address common content misconceptions in class and common errors in writing in the next set of calibration essays . My two primary critiques of the cpr program are that 1) there is no process for revision built into the cpr program, and 2) the peer review component of the grade is determined by the quality of the students quantitative, but not qualitative, feedback . Thus, students can receive full credit for reviews that are sloppy, pithy, or cruel in content, but within the allotted margin of error . To address the first issue, i offered students an opportunity to revise their essays for extra credit (a maximum of 40% of the difference between their grade and a perfect score). Sixty- three percent of students in the introductory class opted to revise at least one essay, whereas only 40% of students in the upper level class chose to revise an essay (table 1). This added revision process allowed me to provide students with more personal attention, and conversations with students about what peer advice to adopt and what suggestions to ignore were generally very fruitful . To address the second issue, i advised students that the quality of their written peer review comments would factor heavily into their class participation grade, 5% of their overall grade for the course . Although cpr was designed as a timesaving device for instructors, the workload associated with introducing the program and discussing the evaluation parameters using example essays (1.5 class periods), creating the assignments and the calibration essays (810 hours), and re - evaluating text ratings and contested calibration and peer reviews (48 hours) is considerable . Of course, repeating old assignments, using an assignment from the cpr library, or hiring a qualified student assistant to compose the calibration essays would significantly expedite this process . Nonetheless, cpr still requires less time than critically responding to 30 + student essays by hand, and provides far more direct experience for the students in abstract reasoning and peer review . Results of the student evaluations indicate that cpr fostered a multi - dimensional comprehension of the course material while teaching traditionally underserved academic skills: science writing and peer review . Over the course of the semester, i observed that students purpose for writing shifted from writing for the professor, to writing a clear argument for a general audience . Indeed, one of the downfalls of traditional instructor review is that comments by instructors detract students attention from their own intentions in writing, and focus that attention instead on the teachers purpose in commenting cpr certainly requires more student engagement and autonomy in the writing and review process than traditional assignments.
Peripheral vascular disease of upper extremity seldom leads to tissue loss because of the relatively low metabolic demand and extensive collaterals of upper limb . Patients with end - stage renal failure (esrf) are more prone to finger gangrene, especially those with multilevel stenosis or calcification involving the forearm vessels, as shown in clinical and autopsy studies.1 this is also particularly important in patients with elbow - based arteriovenous fistula for hemodialysis, as there is a danger of arterial steal . Other differential diagnoses included rheumatological diseases, raynaud s disease, frostbites, or distal emboli . Many patients with finger gangrene presented to orthopedic surgeons for primary amputation, but there are more reports29 now of revascularization of forearm arteries to be a useful adjunct for finger salvage . We report a case of successful angioplasty of forearm arteries in a patient with esrf, and thereby saving her finger, with good clinical and functional outcome . A 51-year - old right - handed lady with esrf presented with a 2 months history of progressively worsening infected gangrene involving her right ring finger which developed after a nail clipping injury . Past medical history was significant for 20 years of esrf due to unknown etiology, currently on hemodialysis via a right neck permcath catheter, hypertension, and percutaneous coronary angioplasty via a right femoral access . On presentation, her right hand was pale and there was infected gangrene of her right ring finger, which was edematous and inflammed and spreading to the proximal pharynx . Her right radial and ulnar pulses were absent at the wrist, but her brachial pulse was palpable . Duplex ultrasound (philips iu22; philips healthcare solutions, bothell, wa, usa) showed severe multilevel stenosis of the forearm radial artery and occlusion of the forearm ulnar artery . The ultrasound criteria of moderate stenosis (50%) was at - stenosis and pre - stenosis velocity ratio of more than or equal to 2.0, or a peak systolic velocity of more than or equal to 200 cm / s . Criteria of severe stenosis (75%) was velocity ratio of more than or equal to 4.0, or peak systolic velocity of more than or equal to 400 cm / s . In view of the duplex findings, urgent revascularization of forearm arteries brachial access was established at the antecubital fossa, with antegrade insertion of a 4-french sheath (cordis corporation, fremont, ca, usa). On - table angiogram showed multilevel mid to distal ulnar artery occlusion and severe mid to distal radial artery stenoses . All the lesions were passed intraluminally with 0.018/0.014 terumo guidewire (terumo medical corporration, somerset, nj, usa) and angioplastized with 2 mm 25 mm medtronic sprinter legend balloon (medtronic inc, fridley, mn, usa). Completion angiogram showed satisfactory radiological result with some ulnar artery spasm which improved with 50 g of intra - arterial glyceryl trinitrate (ucb pharma limited, berkshire, uk) (figure 1). The wound swab grew citrobacter, and her finger infection was controlled by giving unasyn (ampicillin and sulbactam) for 2 weeks . Clopidogrel and aspirin were given for 3 months and then was advised to continue clopidogrel lifelong . Apart from clinical and duplex ultrasound outcomes, digital pressure was also a good indicator of revascularization, although this was not measured in our patient . Angioplasty of forearm arteries is a standard treatment in our territory and this paper does not require the institutional review board of the university of hong kong / hospital authority hong kong west cluster to review . Digital gangrene due to chronic atherosclerotic disease is rare due to low metabolic demand and extensive collateral circulation,10 except in patients with esrf, rheumatological diseases, raynaud s disease, frostbites, or distal emboli . Patients with renal failure are more prone to develop occlusive disease of the upper limb . Acceleration of atherosclerosis, upregulation of markers of inflammation and oxidative stress, and more severe calcification of plaques and the arterial media among esrf patients were possible mechanisms.1 steal from ipsilateral concomitant arteriovenous fistulae also contributed to some cases of hand ischemia.11 there is a relative paucity of literature on endovascular treatment of upper extremity arterial disease compared to lower limb, with medical therapy involving antiplatelet agents and lifestyle and risk factor modifications being the mainstay of treatment.12 many patients with septic digital gangrene had primary amputation by the orthopedic services, without preoperative careful vascular assessment or even consideration for revascularization . Chang et al13 reported 18 forearm bypass procedures for digital ulceration or gangrene with patency rate of 88.9% at mean follow - up of 18 months . Systematic review of 16 studies reporting outcomes of distal upper extremity bypass surgery showed an overall patency rate of 87% at an average follow - up of 34 months among 152 bypass grafts performed.14 angioplasty is an alternative option given its minimal invasive nature, but there are only a handful of cases described in contemporary literature . Search keywords comprised angioplasty, percutaneous angioplasty, revascularization and finger gangrene, ischemia, tissue loss . All studies using angioplasty as a treatment for finger gangrene due to various etiologies are included and tabulated in table 1 . Report on long - term efficacy of more than 1 year, however, was lacking . The aim of the treatment in our patient was infection control and the gangrenous fingertip was then allowed to autoamputate . With improvements in endovascular technology and wide availability of low - profile small balloons, angioplasty of the forearm arteries should be considered for finger salvage in patients with esrf . This report emphasized the importance of specialist vascular care with a combination of expert care and angioplasty of forearm arteries, even in delayed setting, with successful salvage of the patient s finger.
Current generation composite, light - weight, combat helmets provide enhanced fragmentation and ballistic protection, generally with reduced weight in comparison to previous generations of combat helmets . Previous generations of military combat helmets, such as the us personal armor system ground troops (pasgt) helmets were made solely of aramid fibers, specifically kevlar, and generally weighed 3.6 lbs (1.6 kg). The current generation of composite combat helmets may weigh as much as 15% less than the pasgt helmets . These new generations of helmets are composite laminate structures which may still include kevlar but the addition of an updated generation of materials based on ultra - high molecular weight polyethylene (uhmwpe) fibers such as spectra or dyneema have resulted in their improved ballistic performance . In general, increased helmet weight implies increased stiffness due to either more layers of composite materials such as kevlar or increased matrix or resin mass . Helmets with higher structural stiffness tend to manifest less dynamic back face deflection during ballistic impact . As the helmet weight is reduced, stiffness tends to also decrease, and thus the current generation of combat helmets tends to exhibit greater back face deflection for the same ballistic impact conditions as for the previous generation of helmets . Achieving equivalent ballistic protection (in terms of perforation or projectile defeat) at a lighter weight is a significant achievement; however, the tradeoff of greater dynamic back face deflection at reduced weight may result in other damage or injury mechanisms, such as blunt trauma injuries, coming to the forefront . As a result, behind helmet blunt trauma injuries resulting from non - perforating ballistic impact of fragments or bullets has become a concern to the warfighter and the designers of their personal protection equipment (ppe). Behind helmet blunt trauma (bhbt) and behind armor blunt trauma (babt) are injuries to the human body that result from back face dynamic deflection of the ppe armor system (helmets or body armor such as esapi 1) responding to an impulsive load due to ballistic impact of a projectile . Bhbt / babt results from non - perforating ballistic impact to the armor by the threat projectile, which means that the armor system has successfully defeated or stopped the threat . However, with the development of a new generation of ppe armor materials that have increased strength and toughness with lighter weight (resulting in significantly increased ballistic mass efficiency), the propensity for blunt trauma injuries due to back face dynamic deflection has increased . For most helmet and body armor systems there is limited space available for significant back face deformation or deflection under ballistic impact to occur without the armor impacting the head or torso of the human body . In the case of combat helmets, pad suspension systems have been designed with the objective to attenuate blunt head impact forces, but the intensity of impact conditions used to design the suspension systems are significantly lower than that due to ballistic impact . They typically are designed for motor vehicle accidents, tripping and falling accidents, and parachutist impact conditions, where the impact velocity range is only from 10 ft / s to 14 ft / s (3 m / s to 4.3 m / s) 2 . These types of impact conditions are fundamentally different from ballistic impact and the dynamic interaction that results between the helmet back face and the human head and cranium . For the case of accidents as cited above, where the head and helmet have an initial velocity and rapid deceleration is the primary injury concern, has ultimately resulted in the development of the wayne state tolerance curve 3, 4 as well as other criteria such as the head injury criteria (hic), the viscous criterion, angular rotation thresholds, translational acceleration limits, and head impact power . It is commonly accepted that skull fracture may be related to maximum dynamic force or impulse; however, there is no consensus on the criteria to use to resolve the full spectrum of possible head injuries due to the range of different injury mechanisms . Thus, to date, no equivalent injury criteria based on design guidelines for combat helmets have been developed to specifically address bhbt due to ballistic impact . The current requirement for ballistic transient deformation for the us army's advanced combat helmet 5 and the us marine corps' enhanced combat helmet 6 is no greater than 0.63-in (16.0 mm) in roma plastilina clay . To the authors' knowledge there is no correlation between level of injury and this requirement for maximum ballistic transient deformation . Bhbt injuries have been observed in the field and in laboratory testing on post - mortem human subjects (pmhs). Pmhs tests of non - perforating ballistic impact to the head protected by a helmet have shown injuries ranging from skin lacerations to extensive skull fractures and brain damage 7 . In general closed skull fracture a simple or linear fracture is a break in the skull that is not displaced and may penetrate the entire thickness of the skull . Simple or linear fractures are the most common type of skull fracture and are caused by low - energy, blunt force trauma over a wide area of the skull . Basilar skull fractures are linear fractures, but occur at the base of the skull and are associated with more severe trauma due to longer duration impulsive loads . A depressed skull fracture is one in which the segments of fractured cranial bone is pushed inward or is crushed and may subsequently compress the brain . Depressed skull fractures result from high - energy blunt force trauma to a small area of the skull . From a clinical perspective head injuries are defined as critical, moderate, and minor; where critical is associated with long duration (hours) loss of consciousness, intracranial hemorrhaging and cerebral contusion; moderate is associated with skull trauma with or without dislocated fractures and brief loss of consciousness; and minor is associated with superficial fractures and no loss of consciousness . For dynamic conditions resulting from ballistic impact to the head / helmet system, all of these levels of blunt trauma injuries are possible . Ballistic impact to combat helmets by fragments and bullets are typically a high - speed, low - mass event . However, the physical characteristics of the helmet itself (materials and layup configurations) tend to transform the impact to a reduced speed, slightly greater mass event with increased areal coverage due to the dynamic progression of the deflection and delamination of the back face materials of the helmet as it interacts with the projectile . The characteristics and understanding of the mechanics of this transfer of energy and momentum from the strike face to the back face of the helmet is critical to ppe designers, and the subsequent interaction of the dynamic back face deformation with the head and cranium are critical to warfighter survivability . To address all these concerns a research project was initiated to develop a methodology for evaluating bhbt in a consistent, reproducible, and validated approach . This project was funded by the us office of naval research (onr) as part of a future naval capability (fnc) program called limbr - lightweight individual modular body armor . The cornerstone of the experimental methodology developed in that effort is a high fidelity, human head surrogate (hhs). This human head surrogate fills the void between post - mortem human subject testing and commercial ballistic head forms such as biokinetics' ballistic load sensing headform . The void that the human head surrogate fills is that which exists between full biofidelic systems such as provided by cadavers (pmhs) and at the other extreme, non - biofidelic, mechanical head forms made of metal and elastomers . The swri human head surrogate (hhs) is made with actual human craniums and synthetic soft tissues for the brain, dura (the soft tissue between the cranium and brain), and skin, supported by a hybrid iii 50 male neck assembly . The soft tissues are represented by specialized mixtures of ballistic gels with similar density, bulk modulus, and tensile strength to actual tissue . Craniums which are then refreshed to a measured level of ductility consistent with fresh cranial bone . For example, the human surrogate head model 8, developed primarily for blast testing, consists of head structures made of biosimulant materials, such as a glass / epoxy mixture for cranial bone, sylgard silicone gel for the brain, and syntactic foam for facial structures . The hhs head form incorporates a suite of installed instrumentation with includes surface pressure measurements, intracranial pressures, cranial strains, and head and helmet accelerations . High speed video (phantom v7) and flash x - ray imaging are used to provide additional data as well as insights into the highly dynamic response of the head / helmet system . The human head surrogate (hhs) thus provides a unique combination of biofidelity with soft tissue simulants . The hhs is not encumbered by the medical restrictions for the uses and handling of pmhs but incorporates the essential features of pmhs relevant to bhbt testing (specifically, human craniums with pressurized brain and dura). Further, the hhs has a significant level of biofidelity not present in mechanical head forms, specifically the ability to directly measure skull fracture . This paper then provides a description of the human head surrogate, the methodology for ballistic testing using the hhs, plus a review of representative data for sets of ballistic tests with projectiles or threats which includes: 64-grain (0.15 oz) right circular cylinder (rcc), 9-mm full metal jacket (fmj), 7.62 x 39 (ps), and 7.62 x 51 (m80) projectiles . For experiments using ps and m80 projectiles, a supplemental ceramic applique is attached to the helmet and allows for high velocity, non - perforating experiments to be conducted with these high energy threats . To date, over 70 experiments have been performed using the hhs . In the tests reported here, the helmet used is the us marine corps' lightweight combat helmet (lwh), manufactured by gentexcorp and made of a para - aramid material . The hhs uses as a keystone to the design refreshed human craniums, supplemented by synthetic soft tissues (refer to figure 1). The human craniums used in the hhs are processed craniums which may be purchased from many different sources . These craniums are typically dehydrated due to the processing methods used when they are cleaned and dried . Since these craniums are fully processed they are not considered to be human subject testing nor generally require institutional review board approval as is required for pmhs testing . The us department of health and human services defines the guidelines for human research in the us in the code of federal regulations, title 45, part 46, protection of human subjects . Each candidate human cranium that is received from a vendor undergoes a detailed examination to characterize the initial condition and structure of the cranium, including measurement of bone thicknesses, suture integrity, and native fractures due to handling . If the cranium successfully passes this screening and characterization phase, then the cranium undergoes a process to refresh it . Processed cranial bone typically is more brittle than live or fresh bone as a result of the processing procedures; thus it is necessary to develop a method for appropriate rehydration or refreshing of the craniums used in the hhs . The objective is to rehydrate or recondition the processed human cranial bone such that its primary characteristics of ductility and strength are similar to the method that resulted in an appropriate level of ductility is based on the soaking of the cranium for 30-minutes in a shellac solution (consisting of ethanol, isopropanol, methyl isobutyl ketone, pure shellac and water). A three - point bend test configuration is used to evaluate the ductility and strength of the various refreshed bone samples based on each refreshment technique that was conceived and applied . These measured results are compared to the same three - point bending test of a fresh bone sample (fresh bone in a formalin solution) and to data in the open literature, primarily from mcelhaney et al . Bending strength and modulus (ductility) are the measures used to assess level of cranial bone refreshment; a third measure that may also be used is fracture toughness 10 . Fracture toughness is not used in this study since reference 9 did not report values for it, and it is the primary source of supplemental data used here . In addition, the authors' believe that if bending strength and modulus values are successfully achieved by the refreshment method, then fracture toughness will be appropriately achieved as well . Figure 2 displays data from the tests performed for each refreshed sample type and the fresh bone sample (identified as fa bone), and are compared to the mcelhaney et al . Data for the quantities of strength (maximum stress) and ductility (modulus). The blue horizontal lines in this figure indicate the range of variability in the mcelhaney et al . Data, while the red horizontal line is the measured value for the single sample of fresh bone (fa bone) tested in this study . The uncertainty bars associated with each sample data point represents the variability in the measured data for each set of samples used here . It should be noted, however, that these tests did not constitute a statistically meaningful sampling set in that only three or four repeat tests were conducted for each sample type and only one fresh based on this data and these two measures, we judged the shellac solution soak technique to be the most appropriate method for refreshing cranial bone for this application . The data for the shellac solution method is highlighted in figure 2 by the colored oval . The shellac solution is a biological fluid secreted by an insect and when applied to the skull is absorbed by the cranial bone . The shellac solution refreshing method proved to be quite effective in this application and no evidence of brittle bone failure is observed in any of the test results . Synthetic or surrogate soft tissues are used in the hhs to represent the brain, dura, cerebral spinal fluids, and the external skin . The brain and external skin are manufactured from perma - gel, a colorless, transparent petroleum - based thermoplastic material with a specific gravity of 0.85 (density of 53 lb / ft or 0.85 g / cc) and which at room temperature allows bullet penetrations equal to the fbi - standard 10% 250 a ordnance gelatin at 39.2 f (4 c), which simulates swine muscle tissue . Perma - gel is also calibrated for a penetration of 3.35 inches (8.5 cm) by a 0.177-in (4.5 mm) steel bb shot with a speed of 590 ft / s (180 m / s) 11 . The brain surrogate then consisted of 25 oz (700 g) of perma - gel plus 25 oz (700 g) of iron powder uniformly mixed into the perma - gel, resulting in a nominal brain mass of 50 oz (1400 g). Perma - gel is also used to represent the external skin covering the cranium and is molded to the cranium with nominal skin thicknesses ranging from 0.2 to 0.3 inches (5 to 7 mm) depending on location on the head . The dura (the soft tissue between the cranium and brain) is simulated by a thick layer of silicon with a nominal thickness of 0.02 inches (0.5 mm), where the typical thickness of the human dura is reported to vary from 0.01 to 0.03 inches (0.3 to 0.8 mm) depending on age of the human . Finally, the cerebral spinal fluids are represented by water pressurized to 0.29 psi (15 mm hg, 2000 pa). Two different versions of the hhs have evolved as the system was developed and the experimental methodology was applied through the execution of testing (see figure 1). In one version of the hhs a full encapsulation of the head with perma - gel is developed (a full - face version), fully reproducing the scalp and facial skin features (top right image in figure 1). Whereas in the second version, only a skull - cap of perma - gel is used and covers the cranium sufficiently to represent the scalp skin covered by the helmet (lower right image in figure 1) and still accounting for the proper interfacing between the helmet suspension system and the cranial skin . Both versions of the hhs provided similar dynamic results and injury conditions; however, the skull - cap version requires less time to assemble than the full - face version . In general, the hhs mass, size, and thicknesses of any and all surrogate components are tunable to be representative of actual nominal human tissues as reported in the open literature . Thus, the hhs system (minus the hybrid neck) generally has an average mass of 8.8 lb or 4 kg (with a range of 7.7 lb to 9.9 lb, 3.5 kg to 4.5 kg), where the variability is due to variations in cranium sizes and cranial bone thickness . As shown in figure 1, a hybrid iii 50 male neck assembly is inserted at the base where the spine normally intersects the cranium . The attachment to the cranium is through a gasketed ring assembly that is torqued sufficiently to maintain a strong connection between the cranium and hybrid neck and eliminate spurious flexure at the contact surface . The attachment is intended to be representative of the intersection of the atlas and axis to the head, where the hybrid iii neck assembly represents the cervical vertebrae . The assembled hhs and neck are then rigidly mounted to a steel plate and appropriately angled (to get a normal surface impact) for each test configuration . The hhs includes a suite of embedded instrumentation for measuring intracranial pressure, cranial strain, and tri - axial accelerations . Traditional piezoelectric pressure transducers and fiber - optic (fabry - perot style) gauges were initially used in the hhs . However, the fiber - optic gauges were abandoned due to their fragility (repeated breakage of the fiber during installation or testing), but are a sensor type with great potential application in this context and will be revisited in a future effort . The four gauges are embedded directly into the surrogate brain and are positioned to measure incident pressures; that is the sensing element of the transducer is flush - mounted with the brain surface . A gauge is placed in each of the four quadrants of the brain; i.e., front-0(gauge p1 in figure 3), back-180(gauge p3), right-90 (gauge p2), and left-270 (gauge p4) with these angles in reference to the front, centerline of the brain . These pressure gauges then measure the over - pressure generated in the cerebral spinal fluid that surrounds the brain and is contained within the surrogate dura . The measured over - pressures result from the dynamic deflection of the cranium due to interaction with the dynamic back face deflection of the helmet materials . Figure 4 displays the method for deploying tri - axial strain gauges for measuring cranial bone strains during ballistic impact . A total of 12 gauges are typically installed per hhs, arranged in groups of three gauges deployed in a triangular pattern around the anticipated impact or target points . In the tests conducted to date 5 hit points on the helmet are selected; i.e., frontal, crown, back, left side, and right side, all in reference to the normal human descriptions (left ear, right ear, etc . ). The gauges used are tokyo sokki kenyujo model fra-3 - 350 - 11 60 rosettes and have a range of 3% maximum strain . As shown in figure 4, the gauges are bonded directly to the refreshed cranium and the surrogate skin is then molded over the gauges . Based on test results, the bonding method for the strain gauges to the cranial bone did not alter or affect cranial fracturing in the surface areas where finally, two tri - axial accelerometers are installed with one gauge mounted in the surrogate (attached to the hard palate) and the other attached to the helmet (attached to the outer surface of the back of the helmet). These two accelerometers are measurement specialties, model 53 - 0500 - 360, and had an operational range of 20 - 1500 hz . Data from all these gauges are captured in digital form using a dewetron dewe-4102 high - speed data acquisition system with a sampling rate of 1 million data points per second . The non - perforating ballistic test method used here is similar to that defined in the us nij - std-0106.01 15 . The objective of this test methodology is to study the effect of back face deflection of the helmet due to non - perforating ballistic impact, and thus an invalid test is one where the projectile perforates the helmet . Thus, great care is taken in this study to ensure no perforations occur . In the test method, the hhs system is rigidly attached to a mounting plate, rather than a mobile stand as specified in the nij standard . This approach is appropriate for this application because a hybrid iii neck assembly is used to mount the head to the mounting plate rather than using a rigid cylinder as specified in the nij standard . The hybrid iii neck is designed to provide appropriate reaction to dynamic loads as would a human neck under crash applications and has been used in ballistic test research with other head forms, such as biokinetic's ballistic load sensing headform 14 . The impact velocity of the projectile is measured using two ballistic light screens placed 1 meter apart . A digital chronograph connected to the screens measures the time the projectile breaks the light beam at each screen and the projectile velocity is then calculated based on the time difference . Projectiles are fired from a universal gun mount system placed 2 meters in front of the first light screen, with the hhs and mount assembly placed 2 meters behind the second light screen per reference 15 . Vision research's phantom v7 high - speed cameras are used with frame rates ranging from 15,000 to 250,000 frames per second, where the frame rate is dictated by the purpose of the specific test . All projectiles are spin stabilized by using rifled gun barrels and their flight characteristics are confirmed through high - speed video imaging . In addition, a separate series of tests are executed in which flash x - ray imaging is used . Here two pulserad 150 kv (model 43731a) flash x - ray tubes or heads are deployed in which one is viewing the dynamic event from the side of the test article, while the second tube views the event from the top looking down (see figure 6). During these tests, the first copper wire is attached directly to the cranium so as to more clearly outline the headform and the second copper wire is attached to the inside surface of the helmet to more clearly define the back face of the helmet surface . Calibration tests for each projectile and velocity range are performed to measure the elapsed time from when the projectile exits the final timing screen to the instant of maximum back face deflection of the helmet . These elapsed times are then used in the hhs tests to define the timing delay for when the flash x - ray images are to be taken . Figure 7 displays the initial experimental setup conditions as visualized by flash x - ray imaging . As with most ballistic test articles, the hhs is not generally intended to be used in multiple experiments but is rather a single shot test item . However, dependent on the test conditions, the hhs may be used in multiple experiments . The procedure for determining whether a specific hhs may be used in another experiment consists of removing the skin from the cranium and comparing the bone's condition to the original cranium characterization performed when the cranium was first received . If no fractures have developed anywhere on the cranium and all sensors are still operating within calibration, then the hhs may be used in another experiment . However, if any minor, surface fractures have resulted from the previous test, then the hhs is retired and disassembled so that the sensors may be used in another hhs . A series of non - perforating ballistic tests have been conducted using the hhs and includes to date, 70 fully instrumented experiments . These tests studied the effects of projectile types, hit locations, pad suspension configurations, and ceramic applique effects on bhbt . Team wendy pads are used in all tests, in either a 5 or 7 pad configuration . The 7 pad configuration is the typical pad layout consisting of pads located at front center, front right, front left, back center, back right, back left, and on the crown . The 5 pad configuration used in this study deleted the front and back center pads, leaving the front right, front left, back right, back left, and crown pads in place . Two impact locations on the helmets are reported in this paper and are (1) front center impact of the helmet and (2) side impact of the helmet . Front center hit locations, depending on pad layout configuration are either supported by a pad (7-pad configuration) or are unsupported by a pad (5-pad configuration). All side impacts are unsupported by a pad since in either the 5 or 7 pad configurations this region of the helmet suspension has no pad deployed . The reader may see 16 for more complete details of the pad suspension system for the lightweight fragmentation helmet manufactured by gentexcorp and is representative of current applications for pad suspension systems . The threat projectiles used in this study are the 64-grain rcc, 9-mm fmj, 7.62 x 39 (ps), and 7.62 x 51 (m80). The 7.62 ps round has a mild steel core that tends to not undergo significant deformation during impact, while the 7.62 m80 round has a lead core which does undergo significant deformation during impact . Table 1 summarizes the projectile characteristics and the designed target impact velocity for each threat . The rcc projectile was modified to include a skirt which allowed the round to be fired using a .357 magnum cartridge . As discussed above, the ceramic applique is a surface conforming ceramic supplement to the baseline helmet to provide augmented performance to defeat rifle rounds such as the 7.62 x 39 (ps) and 7.62 x 51 (m80) at or near muzzle velocities . These appliques are composed of a boron carbide (b4c) ceramic derivative developed by m cubed and named bsc-800 ceramic . Two thicknesses of appliques were tested: (1) an applique with a nominal thickness of 0.2-in or 5 mm, and (2) an applique with a nominal thickness of 0.275-in or 7 mm . The appliques are bonded to the helmets using a two - component epoxy system (h. b. fuller fh-3548). An offset distance of 0.060-in (1.5 mm) between the applique and helmet is used, and is achieved by using wire and glass beads with diameters of 0.060-in (1.5 mm). The appliques tested are ceramic only; however in an actual deployed application, the ceramic will be encapsulated in a polyurea or polyurethane coating with thickness of 0.060-in (1.5 mm), thus the need for the offset distance in these tests . As discussed in an earlier section of this paper, cranial fractures may be simple (linear), basilar, or depressed, and clinical treatments for these head injuries are respectively referred to as minor, moderate, and critical . In this effort cranial damage or fracture is similarly categorized into these three injury classes - minor, moderate, and significant or critical . Minor fractures or injuries are characterized by surface simple (linear) fractures in which the fractures do not penetrate through the thickness of the cranial bone . Moderate fractures or injuries are characterized by full penetrating simple (linear) fractures or fractures that do penetrate through the thickness of the cranium, but the fractures are not dislocated and the cranium is still intact as a single structure . Critical or significant fractures or injuries are characterized by dislocated fracturing, with the condition of the cranium being fractured so as to no longer be a single structure and is fragmented into large pieces or segments . Figure 9 shows examples of each of these classes of cranial injury as identified in this study . Tables 2 and 3 summarize some of the key results from the experiments for the helmet only configurations . Of the 38 fully instrumented tests reported here for the helmet only test conditions, 9 or 24% of these experiments result in fracturing characterized as moderate . These moderate fracturing or injury conditions all are from experiments where the impact location is front center and with a 5-pad configuration (no pad support, off - pad hit). The threat projectile is the 9-mm fmj shot at an average speed of 1437 ft / s (438 m / s). For the conditions of a front center hit location with a 7-pad configuration (so on - pad hit with pad support), and again with a 9-mm fmj projectile shot at an average speed of 1404 ft / s (428 m / s), results in no injuries or cranial fractures . Although the average impact speeds of the 64-grain rcc projectiles are approximately 10% greater than for the 9-mm fmj projectiles, the kinetic energy due to the 9-mm fmj averages 60% greater than for the rcc projectiles (refer to table 3). Thus, as suggested by other studies, kinetic energy of the projectile at impact is a critical parameter relating to cranial injury, as well as intracranial pressure 7 . As shown in table 3, moderate cranial injuries result when the mean peak intracranial pressure achieves a value of 37 psig (255 kpa) resulting from impact of a 9-mm round, which is similar to the values measured in tests with cadaveric heads 7 . The relationship of the suspension pads to the impact location appears to also be important, in that for side impacts, which are off - pad hit locations, no injuries are measured for these rounds . The side impact location is supported, however, by two large pads which provide lateral support to the off - pad region; further there is essentially no curvature to the helmet structure in this region . Thus, the lateral pads provide sufficient support to mitigate deflection in this region, whereas for the front impact location, the helmet surface is highly curved and the lateral pads are separated sufficiently so as to not provide lateral support in the deflected zone . In general, these tests confirm that pads provide an energy dissipation mechanism that helps to mitigate injury for on - pad hits, and that in surface regions of the helmet will little curvature, that lateral pads can also be effective at mitigating injuries for off - pad hits . Note that results from ballistic head form testing confirms that the load on the pad when impacted by a 9-mm round is more spatially distributed, but that the local peak load along the flight path tends to be greater for an on - pad hit versus an off - pad hit 17 . The data in this study shows a different trend, in that on - pad hits with 9-mm rounds results in reduced intracranial pressures and reduced likelihood of injuries in reference to off - pad hits, as discussed further below . A similar set of tests to those just presented above, 9-mm ballistic experiments for a combat helmet, were performed by bass et al 18, but with pmhs (cadavers). In their 9 tests, projectile impact velocities ranged from 1312 ft / s to 1509 ft / s (400 m / s to 460 m / s) and all were side impact tests (although not stated, these were likely off - pad hit locations). They observed linear fractures in five of nine tests, with a 50% injury risk occurring at an impact velocity of 1433 ft / s (437 m / s). Bass et al results are similar to those measured here with the hhs, in that moderate injury (linear fractures) result for average impact velocities of 1437 ft / s (438 m / s) or greater for off - pad frontal hit locations . Table 3 presents the mean peak intracranial pressure averaged across each experiment as well as the mean peak strain measured on the surface of the cranium in the region of impact . For 5-pad (off - pad hit) test conditions that result in moderate injuries, the mean peak intracranial pressure of 37 psig (0.255 mpa) is nearly 3 times greater (2.85 times) than for the corresponding 7-pad (on - pad hit) experiments where the mean peak intracranial pressure is 13 psig (0.090 mpa). The mean peak cranial strains (shown in units of micro - strain in the table) also show a similar trend in that for the 5-pad configurations the measured mean peak strain is -0.21% and is approximately 2 times greater (1.64 times) than the mean value measured in the 7-pad configuration experiments (measured value of -0.13%). The negative values for the strains in table 3 follow the standard sign convention for strain, and thus these are compressive values . Clearly, the pad configuration is a significant factor in the magnitude of injury to the head . For these dynamic conditions, the pads are able to mitigate dynamic deflection and limit the impact conditions of the back face to the cranium when they are located between the back face deformation and the cranium . However, as presented later in this paper, as the kinetic energy of the projectile increases the ability of the pads to dissipate the back face energy is diminished . In two of the rcc side impact experiments, the rcc projectile perforated the helmet . From post - test examination of the helmet it is clear that a seam in the laminate layup in the helmet is in this area and thus represents a potential vulnerability of the helmet design for small, non - deforming projectiles such as rccs . Tables 4 and 5 summarize some of the key results from the experiments for the helmet plus applique test conditions . Of the 20 fully instrumented tests reported here, 14 of 20 (70%) experiments result in fracturing characterized by critical . Critical fracture injuries developed for 7-pad configurations with the 0.2-in (5 mm) thick applique and 7.62 x 39 (ps) projectiles, and for all test conditions with the 7.62 x 51 (m80) projectiles . In all these experiments, no perforations of the helmet resulted, which is remarkable since these high energy projectiles are all shot at muzzle velocities . In 5-pad configurations, and again using the 0.2-in (5 mm) thick applique and the 7.62 x 39 (ps) projectiles, only minor injuries are observed . Recall that the observations in the helmet only experiments are that the 5-pad configurations result in moderate injuries (the highest level achieved in those experiments) and the 7-pad configuration provided sufficient protection to fully mitigate and prevent injuries . Those observations suggest that for projectiles with lower kinetic energy that the pads are able to absorb and dissipate the load and by so doing mitigate the intensity of interaction between the back face deflection and cranium . However, for the dynamic impact conditions associated with higher kinetic energy projectiles such as the 7.62 rounds, the pads cannot respond quickly enough to either dissipate or distribute the load laterally over a sufficient area, but rather allow for a more intimate and immediate coupling between the helmet shell and the cranium, resulting in critical damage or injury . As shown in table 5, for these 7.62 projectiles, the 5-pad (off - pad hit) configuration experiments result in reduced intracranial pressures and cranial bone strains . Thus, we observe for 5-pad configurations a reduced level of injury because the pad is not present to provide the direct coupling from the shell to the cranium, and the shell back face deflection tends to be less localized or focused with more lateral spreading of the load . These observations are more fully illustrated in the flash x - ray images shown in figure 10 . In figure 10 are shown image sets from three different hhs experiments and they illustrate the characteristics of the peak dynamic deflection event, the back face signature for these helmets, and the response of the cranium to the blunt trauma resulting from back face impact . The flash x - ray technique allows for an instantaneous image at peak dynamic back face deflection based on a delayed trigger time . The top image pair shows the reference state against which the other three sets of images may be compared to . In all four image sets, the left image shows a side view of the event, while the right image shows a top down view of the event . In each image different colored curves are used to identify difference key layers in the helmet and hhs system . The yellow curve is the outer surface of the skin, while the red curve is the outer surface of the cranium (bone). This sequence of images clearly demonstrates the benefit of pads for the 9-mm projectile impact in which for the on - pad condition the amount of back face deformation is significantly less than for the off - pad result (compare the shape of the blue and yellow curves in the different images). The on - pad test shows no injury, while the off - pad hit results in moderate injury . Further, the m80 projectile result keenly illustrates the concern with bhbt in that although the projectile is defeated by the armor system a significant amount of traumatic load is transmitted to the cranium resulting in critical injury . This threat is currently an over - matching threat for this helmet in terms of bhbt, and regardless of pad configuration, results in significant or critical injuries . In table 5 a similar summary of key mean data as that presented in table 3 is shown, but for the helmet plus applique experiments . For conditions resulting in critical damage or injuries to the cranium, the mean peak intracranial pressures are again approximately 3 times greater than for conditions that result in minor damage . The greatest cranial bone strains are measured for the 7-pad (on - pad hit) configurations with the 5-pad (off - pad hit) configurations having strains that are 24% (for 7.62 x 39 projectiles) and 57% (for 7.62 x 51 projectiles) less than for the corresponding 7-pad values . This data supports the on - pad versus off - pad hit location observations discussed earlier in this paper . Figures 11 and 12 respectively display sample intracranial pressure and cranial strain time histories from selected experiments with the hhs . In these figures the data are for four different test conditions, but all are frontal impacts (see figure for specific test details). The measured pressure response at gauge locations shows the classic signature of a propagating pressure pulse . At some gauge locations, a negative gauge pressure is typically seen in the pressure time histories measured in these experiments and suggests that cavitation of the surrogate csf (cerebral spinal fluid) may be developing, resulting from the dynamic interaction of the propagating pressure waves transmitted through the csf from the primary impact location . These negative pressure signals, however, do not show the typical rapid rise to an over - pressure followed by a low - pressure response as the pressure pulse reflects back to the source, which characterizes cavitation in a pipeline . Rather, these pressure histories suggest a more diffused process of pressure propagation from the impact site, where the pressure response is less constrained and damped due to the flexible dura . When critical cranial damage results from projectile impact, the dynamic peak pressures measured at the impact location achieve values significantly greater than 50 psig (0.35 mpa), while for conditions where no cranial or minor damage results, the peak pressure at the impact location is less than 45 psig (0.31 mpa). Further, the mitigating effect of application of a thicker ceramic applique against the same projectile is displayed in figure 11 where the peak pressure is reduced by a factor of 7 due to the increased thickness of the applique (compare the upper right plot to the lower left plot). Finally, the effect of 7-pad versus 5-pad configurations for similar projectile impacts are shown by comparing the data in the top right and lower right plots of figure 11 . Here, the peak pressures are significantly reduced for the 5-pad configuration (lower right image), when compared to the 7-pad configuration, by a factor of ~10 . In these two tests, the 7-pad configuration (on - pad hit) results in critical cranial damage, while the 5-pad configuration (off - pad hit) results in minor cranial damage . As shown in table 5, the mean peak pressures (averaged across similar tests for each pad configuration - see the values for the 7.62 x 39 projectiles with 0.2-in applique) for 5-pad (off - pad) hit locations are less than for 7-pad (on - pad) hit locations by a factor of 2.8 . Shown in figure 11 (bottom plot) are results from a set of similar and recent experiments due to liu et al 19 in which they measured intracranial pressure due to ballistic impact of 9-mm rounds using live, anesthetized pigs . In their tests, they used a flat plate of aramid composites (0.35-in or 9 mm in thickness) to represent a helmet and was the target material impacted by the projectile . Foam padding providing a 0.47-in (12 mm) separation between the plate and the pigs head . They grouped impact velocities for the 9-mm rounds into three categories: velocities ranging from low (919 ft / s or 280 m / s), to moderate (1181 ft / s or 360 m / s), and to high (1377 ft / s or 420 m / s). An intracranial pressure sensor was inserted into the brain parenchyma and positioned approximately 0.47-in (12 mm) under the parietal bone and facing the point of impact . For an average impact speed of 1404 ft / s (428 m / s), they measured a mean peak intracranial pressure of 109 psig (0.751 mpa) from a sample set of 8 tests . As shown in figure 11, the characteristics of the intracranial pressure signals measured in the live pigs are similar to those for the 9-mm projectile results from the hhs (top left plot). However, the magnitude of the mean peak intracranial pressure measured in the live pigs is 3 to 8 times greater than that measured with the hhs for the same threat (refer to table 3, rows 4 and 5). Liu et al suggested that their high intracranial pressures may have resulted from the lack of scalp used in their tests as well as due to anatomical differences between pigs and humans . In figure 12, the cranial strain time histories are measured in the region of the impact location . In these time history plots a negative strain corresponds to compression, while a positive strain is tension . In those experiments in which no or only minor cranial damage occurs, the strain data measured by a rosette shows similar responses in each leg of the rosette, whereas for conditions where fracturing of the cranium results, the strain histories at a rosette location show a dispersion in the signal histories measured by each leg in the rosette . The greater the amount of cranial fracturing that results in a test, the more dispersion in the signal time histories are present . In general, cranial fracturing is observed when dynamic peak strains greater than -0.4% are achieved at the measurement locations . Finally, figure 13 displays head acceleration data from three different hhs tests and are representative of the type of data collected to date . In this figure, the head injury criterion 3,4, hic, is applied using the acceleration time history data . Hic is based on the average value of the acceleration over the most critical part of the acceleration event . The average acceleration is defined as the integral of the acceleration time history for a direction of 15 ms . Acceleration in the z - direction (refer to figure 5) is only used in the calculations here and accounts for primary motion of the head in the vertical centerline plane (essentially nodding of the head with no rotations). The calculated hic values are shown in figure 13 . A hic value of less than 519 is equivalent to an abbreviated injury scale (ais) score of 1, associated with headaches or dizziness, and is a minor injury . A hic value of 520 to 899 is equivalent to an ais score of 2 with unconsciousness of less than 1 hour and simple, linear fractures, and is a moderate injury . A hic value greater than 1860 is typically considered not survivable and has an ais score of 6 . As cited in 18, the swri human head surrogate (hhs) is developed and applied for assessing behind helmet blunt trauma injuries . This human head surrogate is designed to fill the void between post - mortem human subject testing which has biofidelity but handling restrictions and commercial ballistic head forms which have little biofidelity but are easy to use . This unique human head surrogate is based on refreshed human craniums and surrogate materials representing human head soft tissues such as the skin, dura, and brain . A methodology for refreshing the craniums is developed and used in a series of experiments in which non - perforating ballistic impact of combat helmets is performed . Sensors embedded in the human head surrogates allow for direct measurement of intracranial pressure, cranial strain, and head / helmet acceleration . Experiments include both baseline combat helmets and helmets with a supplemental ceramic applique for addressing larger caliber threats . Based on a relatively large number of tests, the swri human head surrogate has demonstrated great potential for providing insights in to injury mechanics resulting from non - perforating ballistic impact of combat helmets, allowing for a direct measure and assessment of behind helmet blunt trauma injuries.
De-117, its active form (hde-117), and deuterium - labeled hde-117 were prepared by ube industries, ltd . We obtained 10x stock pbs from millipore (billerica, ma, usa) and tween 80 was obtained from spectrum chemical (new brunswick, nj, usa). First, pcl (mn = 80 kda) was dissolved in 2,2,2-trifluoroethanol at a concentration of 150 mg / ml . Then, the solution was casted on a silicon wafer using a spin - coater (specialty coating systems, indianapolis, in, usa) at 1000 rpm for 10 seconds . Films were annealed at 110c to remove residual solvent and were left to cool at ambient temperature . Resulting films were thoroughly washed with milli - q deionized water and dried in air . Film thickness was measured using a film micrometer (igaging, san clemente, ca, usa). Four layers of pcl films were then stacked to create the desired thickness (224 m). Drug delivery devices were assembled by placing de-117 powder between two stacked films and heat - sealing the edges . Heat - sealing was performed with nichrome wire embedded in pdms; pcl films were placed on the pdms support above the wire and 1a current was applied to resistively heat the wire (fig . Schematic diagram of device fabrication and photo of a pcl device containing de-117, with dime and metric ruler (millimeter tick marks) for scale . We encapsulated de-117 between two pcl films and the edges of pcl films were heat - sealed by applying current to a wire embedded in pdms . All in vitro release studies used an elution buffer of 1 pbs with 0.1% tween 80 (ph 7.4). Elution buffer was chosen based on the reported use of pbst (pbs + tween 80) in the analysis of front - of - the - eye drug delivery devices and the aqueous humor composition (98.69% water and less than 0.1% wt / vol protein content). Volume of elution buffer was chosen to provide an absolute sink condition based on the solubility of de-117 in buffer (25 g / ml). The devices were placed on an orbital shaker at 120 rpm in a 37c incubator to mimic physiological conditions . For each sampling time point, the elution buffer was collected and replaced with fresh buffer . Concentration of de-117 in the collected elution buffer was measured using high performance liquid chromatography (hplc; 1260 infinity quaternary lc system, agilent technologies, santa clara, ca, usa). A c18 reverse - phase column (eclipse plus c18, 4.6 100 mm, 3.5 m; agilent technologies) was used with a gradient of mobile phase a: b (65:3545:55 in 12 minutes). Mobile phase a contained 0.03% trifluoroacetic acid in deionized water and mobile phase b was hplc - grade acetonitrile (thermo fisher scientific, waltham, ma, usa). The release rate at each time point was calculated by dividing the amount of drug collected by the duration between two time points . The average release rate was calculated by applying a linear regression to the cumulative released de-117 versus time . Data is presented as mean standard deviation . To evaluate the release rate of each device prior to implantation, in vitro release was studied for 10 days before implantation . Then, devices were collected, dried in a vacuum overnight, transferred to a sterile hood, washed in 70% ethanol, and subsequently dried before implantation . Implantation of pcl devices in the rabbit eye was performed in accordance with the arvo statement for the use of animals in ophthalmic and vision research . New zealand white rabbits were premedicated with 0.03 mg / kg intramuscular buprenorphine and then anesthetized by inhalation of isoflurane (2%4%). Proparacaine hydrochloride (0.5%) ophthalmic drops were given as topical anesthetic followed by betadine drops (5% povidone iodine solution). A clear corneal incision was then made using a 2.8-mm slit knife (alcon laboratories, ft . Worth, tx, usa) and widened to 4 mm, through which the pcl device was inserted into the anterior chamber . The incision was closed with 7 - 0 polyglactin 910 suture (vicryl; ethicon, somerville, nj, usa). Clinical ophthalmologic exams by visual inspection of nonanesthetized animals were performed at day 1, week 1, and 7 with anterior segment photography performed at all time points using a digital single - lens reflex (dslr) camera (canon eos rebel t4i; canon usa, san jose, ca, usa). Exams utilizing the operating microscope were also performed immediately after implantation as well as prior to euthanization and photos were taken with the canon camera body and a slr camera - microscope adapter (carl zeiss meditec, inc ., rabbits were anesthetized as described above and euthanized at various time points postimplantation (1, 2, 4, and 8 weeks) by intravenous injection of 2 mmol / kg potassium chloride into the marginal ear vein . Aqueous humor was withdrawn by limbal paracentesis using a 30-gauge needle on a 1-ml syringe . The globe was dissected to collect cornea, iris - ciliary body, retina - choroid, and vitreous humor, and preserved by freezing at 80c . We extracted de-117 and hde-117 from aqueous humor and homogenates of vitreous humor, cornea, iris - ciliary body, and retina - choroid by addition of organic solvents . We determined de-117 and hde-117 concentrations in ocular tissues by a liquid chromatography coupled with a tandem mass spectrometry (lc / ms / ms) and calculated by the analytical concentration, tissue wet weight, and dilution factor . Deuterium - labeled hde-117 was used for the internal standard of de-117 and hde-117 analyses . High performance liquid chromatographic system consists of system controller cbm-20a, solvent delivery unit lc30ad, auto - sampler sil-30ac, and column oven cto-30ac and degasser dgv-20a (shimadzu corp ., kyoto, japan). An analytical column (kinetex xb - c18, 2.1 50 mm inner diameter, 2.6 m; phenomenex, torrance, ca, usa) was used with a gradient of mobile phase a: b (68:3210:90). Mobile phase a contained 0.1% formic acid in deionized water and mobile phase b contained 0.1% formic acid in acetonitrile . The system (ab sciex qtrap 5500; ab sciex, foster city, ca, usa) interfaced by turbo ion spray with positive ion source in multiple reaction monitoring mode was applied for detection . We used lc / ms grade of acetonitrile, methanol, and formic acid (wako pure chemical industries, ltd ., devices were collected at time of euthanization in the dissection of the rabbit eye and were photographed to macroscopically observe the degree of in vivo iris tissue adherence . Then, devices were rinsed with filtered water (milli - q; emd millipore corp .) And dried in a vacuum chamber overnight . The dried devices were cut open and remaining drug was extracted from the device by serial extraction in diluent (50% acetonitrile and 50% water) over five iterations . Remaining drug in devices was characterized by hplc as described above for in vitro release studies . Peak retention time of remaining drug was compared with those of de-117 and hde-117 in 1.5 g / ml working standards . In addition, opened pcl devices were analyzed using gel permeation chromatography (gpc). Opened pcl devices were dissolved in tetrahydrofuran (thf; vwr international, radnor, pa, usa) for gpc analysis . A series of gpc columns (styragel hr 5, 2, and 0.5; waters corp ., milford, ma, usa) was used with thf flowing at 1 ml / minute for 40 minutes . A refractive index detector reference standards of pcl (mn = 80 kda, 45 kda, and 10 kda) were freshly prepared in thf . De-117, its active form (hde-117), and deuterium - labeled hde-117 were prepared by ube industries, ltd . We obtained 10x stock pbs from millipore (billerica, ma, usa) and tween 80 was obtained from spectrum chemical (new brunswick, nj, usa). First, pcl (mn = 80 kda) was dissolved in 2,2,2-trifluoroethanol at a concentration of 150 mg / ml . Then, the solution was casted on a silicon wafer using a spin - coater (specialty coating systems, indianapolis, in, usa) at 1000 rpm for 10 seconds . Films were annealed at 110c to remove residual solvent and were left to cool at ambient temperature . Resulting films were thoroughly washed with milli - q deionized water and dried in air . Film thickness was measured using a film micrometer (igaging, san clemente, ca, usa). Four layers of pcl films were then stacked to create the desired thickness (224 m). Drug delivery devices were assembled by placing de-117 powder between two stacked films and heat - sealing the edges . Heat - sealing was performed with nichrome wire embedded in pdms; pcl films were placed on the pdms support above the wire and 1a current was applied to resistively heat the wire (fig . Schematic diagram of device fabrication and photo of a pcl device containing de-117, with dime and metric ruler (millimeter tick marks) for scale . We encapsulated de-117 between two pcl films and the edges of pcl films were heat - sealed by applying current to a wire embedded in pdms . All in vitro release studies used an elution buffer of 1 pbs with 0.1% tween 80 (ph 7.4). Elution buffer was chosen based on the reported use of pbst (pbs + tween 80) in the analysis of front - of - the - eye drug delivery devices and the aqueous humor composition (98.69% water and less than 0.1% wt / vol protein content). Volume of elution buffer was chosen to provide an absolute sink condition based on the solubility of de-117 in buffer (25 g / ml). The devices were placed on an orbital shaker at 120 rpm in a 37c incubator to mimic physiological conditions . For each sampling time point, the elution buffer was collected and replaced with fresh buffer . Concentration of de-117 in the collected elution buffer was measured using high performance liquid chromatography (hplc; 1260 infinity quaternary lc system, agilent technologies, santa clara, ca, usa). A c18 reverse - phase column (eclipse plus c18, 4.6 100 mm, 3.5 m; agilent technologies) was used with a gradient of mobile phase a: b (65:3545:55 in 12 minutes). Mobile phase a contained 0.03% trifluoroacetic acid in deionized water and mobile phase b was hplc - grade acetonitrile (thermo fisher scientific, waltham, ma, usa). The release rate at each time point was calculated by dividing the amount of drug collected by the duration between two time points . The average release rate was calculated by applying a linear regression to the cumulative released de-117 versus time . To evaluate the release rate of each device prior to implantation, in vitro release was studied for 10 days before implantation . Then, devices were collected, dried in a vacuum overnight, transferred to a sterile hood, washed in 70% ethanol, and subsequently dried before implantation . Implantation of pcl devices in the rabbit eye was performed in accordance with the arvo statement for the use of animals in ophthalmic and vision research . New zealand white rabbits were premedicated with 0.03 mg / kg intramuscular buprenorphine and then anesthetized by inhalation of isoflurane (2%4%). Proparacaine hydrochloride (0.5%) ophthalmic drops were given as topical anesthetic followed by betadine drops (5% povidone iodine solution). A clear corneal incision was then made using a 2.8-mm slit knife (alcon laboratories, ft . Worth, tx, usa) and widened to 4 mm, through which the pcl device was inserted into the anterior chamber . The incision was closed with 7 - 0 polyglactin 910 suture (vicryl; ethicon, somerville, nj, usa). Clinical ophthalmologic exams by visual inspection of nonanesthetized animals were performed at day 1, week 1, and 7 with anterior segment photography performed at all time points using a digital single - lens reflex (dslr) camera (canon eos rebel t4i; canon usa, san jose, ca, usa). Exams utilizing the operating microscope were also performed immediately after implantation as well as prior to euthanization and photos were taken with the canon camera body and a slr camera - microscope adapter (carl zeiss meditec, inc ., dublin, ca, usa). Rabbits were anesthetized as described above and euthanized at various time points postimplantation (1, 2, 4, and 8 weeks) by intravenous injection of 2 mmol / kg potassium chloride into the marginal ear vein . Aqueous humor was withdrawn by limbal paracentesis using a 30-gauge needle on a 1-ml syringe . The globe was dissected to collect cornea, iris - ciliary body, retina - choroid, and vitreous humor, and preserved by freezing at 80c . We extracted de-117 and hde-117 from aqueous humor and homogenates of vitreous humor, cornea, iris - ciliary body, and retina - choroid by addition of organic solvents . We determined de-117 and hde-117 concentrations in ocular tissues by a liquid chromatography coupled with a tandem mass spectrometry (lc / ms / ms) and calculated by the analytical concentration, tissue wet weight, and dilution factor . Deuterium - labeled hde-117 was used for the internal standard of de-117 and hde-117 analyses . High performance liquid chromatographic system consists of system controller cbm-20a, solvent delivery unit lc30ad, auto - sampler sil-30ac, and column oven cto-30ac and degasser dgv-20a (shimadzu corp ., kyoto, japan). An analytical column (kinetex xb - c18, 2.1 50 mm inner diameter, 2.6 m; phenomenex, torrance, ca, usa) was used with a gradient of mobile phase a: b (68:3210:90). Mobile phase a contained 0.1% formic acid in deionized water and mobile phase b contained 0.1% formic acid in acetonitrile . The system (ab sciex qtrap 5500; ab sciex, foster city, ca, usa) interfaced by turbo ion spray with positive ion source in multiple reaction monitoring mode was applied for detection . We used lc / ms grade of acetonitrile, methanol, and formic acid (wako pure chemical industries, ltd ., devices were collected at time of euthanization in the dissection of the rabbit eye and were photographed to macroscopically observe the degree of in vivo iris tissue adherence . Then, devices were rinsed with filtered water (milli - q; emd millipore corp .) And dried in a vacuum chamber overnight . The dried devices were cut open and remaining drug was extracted from the device by serial extraction in diluent (50% acetonitrile and 50% water) over five iterations . Remaining drug in devices was characterized by hplc as described above for in vitro release studies . Peak retention time of remaining drug was compared with those of de-117 and hde-117 in 1.5 g / ml working standards . In addition, opened pcl devices were analyzed using gel permeation chromatography (gpc). Opened pcl devices were dissolved in tetrahydrofuran (thf; vwr international, radnor, pa, usa) for gpc analysis . A series of gpc columns (styragel hr 5, 2, and 0.5; waters corp ., milford, ma, usa) was used with thf flowing at 1 ml / minute for 40 minutes . Reference standards of pcl (mn = 80 kda, 45 kda, and 10 kda) were freshly prepared in thf . To design our pcl ocular implant, design parameters were based on a predictive model of drug release . Previous work showed that by changing the thickness of diffusion - limiting pcl film and device dimensions, one can design devices to achieve a desired drug release rate . Based on the physiochemical properties of the drug, the following equation can be used to predict drug release from a pcl reservoir device (drug encapsulated between two pcl films): where j is mass flux of drug through pcl film, a is device surface area, dk is a combined diffusion coefficient and partition coefficient, is the solubility of drug product at 25c, and l is the thickness of pcl film . Based on the properties of de-117 (log p = 3.15, = 25 mg / l), the predicted dk value of de-117 is 1.43 10 m / h . Considering the limited space of the anterior chamber, we chose to minimize device dimension as much as possible using current fabrication methods . Guided by this model, the final device was made with pcl film that was 224-m thick and approximately 3 3 mm in dimension (fig . These de-117loaded pcl devices achieved a zero - order release rate of 0.53 g / day in vitro (r = 0.9995 to linear fit) over 6 months (fig . (a) cumulative mass released and (b) release rate of de-117 over 6 months in vitro . Linear fit of cumulative mass released show zero - order release . To obtain pharmacokinetic characteristics and confirm biocompatibility of these devices in the intracameral space, devices preimplantation in vitro release studies of these devices yielded a linear release rate of 0.435 0.075 g / day (r = 0.989 to linear fit). The difference in release rate is due to the variability in device surface area that results from fabricating the devices by hand . Devices with and without de-117 were well tolerated in the anterior chamber (table), with no incidence of infectious complications, uveitis, or cataract over 8 weeks . The scale of the rabbit eye being several times smaller than the human eye, these devices fit tightly in the shallow anterior chamber, positioning in direct contact with both the posterior cornea and the iris . However, as the surgical technique was tuned, the rate of surgical trauma was reduced from two out of three surgeries (first day of surgery) to two out of six surgeries (second day) during the course of this study . Summary of biocompatibility analysis lc - ms analysis of de-117 and hde-117 showed that devices released de-117 in the eye as expected from the in vitro release studies; once released, de-117 was readily converted to its active form (fig . Furthermore, concentration of hde-117 in the aqueous humor was maintained at a relatively steady level (93 25 ng / ml) over the time course studied (fig . Concentration of hde-117 in the aqueous humor was also near the cmax achieved by topical administration of 0.1% de-117 solution (108 23 ng / ml) (kirihara t, et al . (a) concentration of hde-117 in the aqueous humor, distribution of (b) hde-117 and (c) de-117 in ocular tissues through 8 weeks after device implantation . Units are ng / ml for aqueous humor and vitreous humor and ng / g for cornea, iris - ciliary body, and retina - choroid . Concentration of de-117 and hde-117 in ocular tissues shows sustained release of de-117 in the anterior chamber and its conversion to hde-117 upon release . Devices showed some macroscopically observable iris stroma tissue adherence upon removal from the rabbit eye (fig . However, we noted that three out of four devices that experienced hemorrhage events during implantation (indicated with an asterisk) showed tissue adherence . This suggests that device tissue adherence is due to the surgical trauma, not due to the material properties of the device . Furthermore, lc - ms analysis of de-117 and hde-117 concentration in ocular tissues (fig . 4) confirmed that the tissue adherence did not have an observable effect on the release of de-117 from the device . Macroscopic photos of pcl devices collected from the rabbit eye through 8 weeks, showing tissue adherence after residence in the intracameral space . A correlation between tissue adherence and hemorrhage events during implantation (noted by an asterisk) has been observed . Once devices were retrieved from the rabbit eye, the remaining drug was extracted and analyzed for uniformity of its contents . Analysis of hplc showed that all remaining drug in the device was de-117 (supplementary fig . This confirmed that the drug payload was protected from esterases present in the anterior segment of the eye and was only converted to hde-117 upon release . Lastly, pcl degradation in the intracameral space was analyzed by gpc (supplementary fig ., devices retrieved from the eye at various time points showed no change in average and distribution of retention time, indicating negligible change in the molecular weight distribution of pcl in the rabbit eye up to 4 weeks . While pcl is expected to degrade in vivo, the change in pcl molecular weight over 4 weeks in vivo was likely too small to be detectable considering the inherent variability of gpc analysis . Poor patient compliance in topical glaucoma treatment has been repeatedly reported . To overcome this challenge, several drug delivery implants for glaucoma are in development . These include an implant device for delivery of latanoprost (durasert; pfizer, new york, ny, usa) and a sustained release formulation of bimatoprost currently in phase 3 clinical trials (nct02250651; allergan, irvine, ca, usa). We explored biodegradable polymers and formulations that can achieve a release of de-117 of 6 months or more in the anterior chamber and chose pcl as our device material . Compared with other polymers that have been utilized in glaucoma drug delivery devices such as poly(lactic - co - glycolic acid), we noted that a slow degradation rate of pcl is important to achieve zero - order release of the therapeutic over several months . Since the device acts as a diffusion - limiting barrier in our design, a hypothetical polymer that degrades completely in 6 months would not be able to deliver the therapeutic at a constant rate for 6 months . While pcl has been utilized in intravitreous and subretinal implants, pcl has not been widely utilized as intracameral implants for treatment of diseases, such as glaucoma . Biocompatibility of pcl and its degradation profile in the ocular space have been well characterized and our study supports previous reports that indicate that pcl is well tolerated in the eye and degrades slowly with negligible change in mn over 4 weeks . Based on the concentration of de-117 detected in the aqueous humor, in vivo release rates can be estimated . Previous studies have noted two main mechanisms of drug clearance from the anterior chamber: by convective flow due to aqueous humor turnover and by uveal blood flow . In our calculations, we assumed that the main mode of de-117 clearance from the anterior chamber is due to aqueous humor turnover considering the rapid turnover rate (2.31 l / min in rabbits, indicating complete turnover of aqueous humor in approximately 90 minutes). Based on this number, rate of drug release could be calculated by the equation below . Where r is the in vivo release rate of drug, c is the concentration of de-117 found in the aqueous humor, and aq is the rate of aqueous humor turnover . Consequently, the estimated in vivo release rate of de-117 is 0.42 0.24 g / day, which is comparable to the preimplantation in vitro release rate (0.44 0.08 g / day). We expect the actual in vivo release rate to be higher due to uveal blood flow or additional clearance mechanisms that increase the rate of de-117 clearance . An additional term that accounts for uveal blood flow was not utilized in this calculation, as we noted that an accurate prediction of in vivo release rate is not possible due to the natural variability of the aq value used in the calculation . Due to the simplifying assumptions, the equation is intended to provide an estimate of in vivo release rate in the intracameral space instead of an accurate prediction . With the constraints of the equation in mind, this calculation suggests that the experimental conditions used in the in vitro release study resembled physiological conditions in the anterior chamber of the eye and in vitro release results can be used to estimate release in vivo . The previously mentioned predictive model anticipates that the release rate of drug from pcl devices depend on the drug's solubility and log p. therefore, hydrolysis of de-117 in the device would impact the release over time: an undesirable property of a sustained release device . For example, complete hydrolysis of de-117 to hde-117 (cs = 1000 mg / l and log p = 1.19) would change the dk value of equation 2 to 1.82 10 m / h, increasing the predictive release rate 500-fold . Fortunately, de-117 is protected from hydrolysis when encapsulated in the device and is only converted to its active form when released to the anterior humor . In addition, the uniformity of remaining drug suggests that the pcl devices were not physically compromised during the implantation or retrieval procedures . However, there are a few limitations of this study that should be addressed . Current fabrication processes involve manual positioning of pcl films on the heat - sealing apparatus to achieve desired device dimensions, which can result in unintended variability . Limitations of our study also include small number of animals tested with device implantation . Since the study was focused on evaluating the biocompatibility of the device, the study was not designed to test the iop reducing effect of released de-117 . Furthermore, considering the location of implantation, damage to the corneal endothelium is possible . However, as pharmacokinetic and gpc analysis required dissection of the rabbit eyes, histology could not be performed after euthanization to check for damages . Also, based on previous report studying degradation of pcl, 80-kda pcl can take up to 2 years to completely degrade in vivo . To ensure the device is not retained in the eye after full drug depletion, the degradation rate of pcl should be tuned to match the desired lifetime of a glaucoma implant . Due to the potency of de-117, the desired maximum release rate of de-117 in the intracameral space is 0.5 g / day, which only requires loading 90 g of the drug for a 6-month release . In this study, we tested the smallest devices that could be reliably made via manual fabrication . However, there is potential to further miniaturize device size and reduce release rate to match the dose that has been successfully tested in clinical trials (0.002% wt / vol daily eye drops) (ihekoromadu n, et al . The position of device implantation can also be optimized so that the devices are away from the angle of the eye . Future studies will be powered to evaluate the iop - reducing effect of intracameral implants containing de-117 over 6 months . Also, histologic analysis on the effect of intracameral implantation will be performed to check corneal endothelial damage . Furthermore, study of these devices in larger animals, such as dogs or monkeys, will provide better representations of the iop - reducing effect in humans . In addition, blends of pcl with other biodegradable polymers, such as poly(d, l - lactide) (pla), can be explored to tune degradation rates . Previous studies have shown that the degradation rate of physical blends of pla and pcl is between those of pure pla and pcl . In summary, we demonstrate the potential of de-117 pcl devices based on in vitro release kinetics of de-117, biocompatibility of device in the intracameral space, and distribution of de-117 and hde-117 in ocular tissues upon implantation . Future studies will focus on optimizing the devices and evaluating the major points described above for further development and clinical translation.
Phakomatosis pigmentovascularis (ppv) is a rare condition first described by ota et al ., in 1947 . There is no sex predilection, but the japanese are found to be affected more . Though four main types have been described, a fifth type with cutis marmorata and aberrant mongolian blue spot have also been added to the list . A 13-year - old female presented with port - wine stain of left side of the body including face along the distribution of 5 cranial nerve, upper limb, trunk, and lower limb [figure 1]. Additionally, this lesion was present on right side of the back as well . There was associated hypertrophy of the left lower limb with a visible vessel along the lateral aspect of the leg [figure 2]. Ophthalmological examination showed raised intraocular tension in left eye but the right eye was normal . The color doppler study of left lower limb showed absence of great and short saphenous vein . An abnormal dilated vein on lateral aspect of leg and thigh was present which was seen to drain into superficial circumflex iliac vein [figure 4]. Non - contrast computed tomography (ct) scan of brain showed focal parenchymal atrophy in the left parietal lobe region with foci of gyral calcification . Widespread port - wine stain involving left side of face and chest engorged vein over lateral aspect of left leg along with hypertrophy of lower limb bluish discoloration of sclera of left eye color doppler picture showing anomalous draining vein on lateral aspect of left leg phakomatosis is a developmental abnormality simultaneously involving eye, central nervous system, and skin . Happle and steijen proposed the genetic concept of twin spotting phenomenon to explain its etiology . Ppv were classified into four types namely; type i: nevus flammeus and epidermal nevus, type ii: nevus flammeus, mongolian spots, nevus anemicus, type iii: nevus flammeus, nevus spilus, nevus anemicus, type iv: nevus flammeus, mongolian spots, nevus spilus, nevus anemicus . A, cutaneous involvement only; and subtype b, both cutaneous and systemic involvement . Ppv type i, iii, and iv have very rarely been reported in literature . Systemic syndromes which may be associated with it are sturge - weber syndrome, nevus of ota, and klippel - trenaunay syndrome . Our patient had port - wine stain and nevus of ota and also had systemic involvement which tilted the diagnosis in favor of ppv subtype sturge - weber syndrome is defined as a facial port - wine stain with associated ipsilateral vascular malformation of leptomeninges and eye . Brain changes show increased vascularity of leptomeninges which is usually unilateral and long - term pathological changes show calcification and atrophy . Here our patient's ct scan changes showed long - term changes like atrophy and calcification of parietal lobe of brain . Eye changes in the form of glaucoma and buphthalmos may occur . Though definition of klippel - trenaunay syndrome include cutaneous capillary malformation of a limb and soft tissue swelling with or without bone hypertrophy, original description indicate that varicosities of vein on affected limb is the usual finding and lateral venous anomaly is the most common abnormality . Clinical picture showing widespread port - wine stain and hypertrophy of lower limb along with abnormal color doppler finding, suggests the diagnosis of klippel - trenaunay syndrome . Thus, our patient fulfilled all the criteria for the diagnosis of ppv along with sturge - weber syndrome and klippel - trenaunay syndrome . Few cases of ppv along with sturge - weber syndrome have been reported in literature, but ppv associated with both sturge - weber syndrome and klippel - trenaunay syndrome has been reported very rarely . In our case report we are presenting phakomatosis pigmentovascularis with sturge - weber syndrome and klippel - trenaunay syndrome which is so far very rare.
Eye injury is a significant health problem worldwide that often results in disability; the national research council reported eye injury as the most underrecognized major health problem affecting those living in industrialized countries . Such ocular trauma is the major cause of vision loss in young adults and children . Up to 14% it has been estimated that up to 19 million people are unilaterally blind as a result of ocular trauma . The high incidence of ocular trauma has extensive socioeconomic costs [2, 3]. Trauma can involve open- or closed - globe injuries, due to damage from sharp or blunt objects . Open injuries are classified in 4 subgroups on the basis of the type of trauma: rupture, penetration, perforation, and intraocular foreign body (iofb). Closed - globe injuries are divided into 2 subgroups: contusion and laceration [4, 5]. Penetrating trauma is the most common cause of ocular morbidity; it is estimated that as many as 40% of globe penetration injuries are associated with retained iofb [69]. The risk of visual loss is increased if the force that caused a closed - globe injury was sufficient to rupture the globe . Retinal detachment (rd) is a frequent sequel of severe ocular trauma, and rd often leads to proliferative vitreoretinopathy (pvr) [10, 11]. Pvr is a complex cellular process characterized by the proliferation of membranes on or beneath the retina, intraretinal degeneration, gliosis, and contraction [12, 13]. By a mechanism contraction of these proliferative membranes over the ultraspecialized tissue of the retina has disastrous consequences for vision . Pvr develops as a relatively rare complication in about 810% of patients with primary retinal detachment . The condition is much more frequent after trauma, occurring in 4060% of patients with open - globe injury . The frequency of pvr following perforation, rupture, penetration, persistence of an intraocular foreign body, and contusion is estimated to be 43%, 21%, 15%, 11%, and 1%, respectively . The high incidence of pvr after ocular trauma is thought to be due to the inflammatory reaction that follows injury, which may have involved the direct introduction of cells from outside the eye . Those eyes that develop pvr after a trauma have worse visual outcomes, with pvr considered as the primary reason for the loss of vision . In this review, we have summarized current knowledge on the pathogenesis of pvr and its correlation with ocular trauma and discussed how a fundamental understanding of the biochemical / molecular events involved is instrumental in developing novel treatment strategies . Trauma to the retina gives rise to inflammation, which involves breakdown of the blood - retinal barrier (brb). Physiologic ocular wound healing involves inflammation, scar proliferation and modulation, tissue remodeling, and restoration of retinal integrity . This healing process includes the chemotaxis of inflammatory cells such as macrophages, lymphocytes, and polymorphonuclear cells and rarely evolves to pvr . However, when certain pathological events occur simultaneously, the stimulus to protracted wound healing triggers pvr . The most important of such events are retinal break, rd, and intravitreal hemorrhage . A retinal break is likely necessary for pvr; protracted exudative rd and hemivitreal detachments without holes are insufficient to trigger pvr . The formation of a retinal break exposes the rpe to the vitreous cavity and its components, which leads to rd . The dimensions of the retinal break are directly and strongly correlated to the probability of pvr; giant retinal tears (width> 1 quadrant) are almost invariably followed by pvr . Rhegmatogenous rd occurs when the tractional forces of the vitreous on the retinal tear permit the fluid from the vitreous humor to enter the subretinal space (srs). Vitreous fluid contains a large amount of cytokines and growth factors that stimulate the activation and the proliferation rpe and retinal glial cells [12, 18]. Once the retina has separated from the rpe, the increased distance to the choroidal blood supply and the reduced oxygen flux from the choriocapillaris to the photoreceptors lead to hypoxia . An rd of only 1 mm creates sufficient hypoxia to recruit proinflammatory cytokines to the rpe monolayer . Separation of the sensory retina from the underlying rpe violates the integrity of the tight junctions that form the brb, which results in a loss of contact inhibition between rpe cells . The formation of a retinal tear or ocular injury can also trigger an intraocular hemorrhage . The direct influx of blood, serum proteins, and vitreal cells through the retinal break further stimulates pvr development . Research in animal models has shown that a single injection of fibroblasts was sufficient to induce pvr . Notably, the introduction of a sufficient amount of any cell type (whether macrophages, dermal cells, fibroblasts, or rpe cells) to the vitreous cavity results in pathology that mimics pvr . After a penetrating trauma, cells introduced from outside the eye (e.g., tenon's layer or dermal tissue) may directly initiate pvr formation . Inflammation, ischemia, and blood activate inflammatory cells (mainly macrophages, lymphocytes, and polymorphonuclear cells), which trigger the development of pvr through the formation of cytokines and growth factors . Growth factors, cytokines, and proteins entering the srs from the circulation come in direct contact with the rpe and glial or mller cells, stimulating their proliferation . Several risk factors for developing pvr have been identified: size of the retinal hole or tear (cumulative break area> 3 optic discs), detachment involving> 2 quadrants, intraocular inflammation, vitreal hemorrhage, and preoperative choroidal detachment . Other predisposing factors are grade a or b preoperative pvr, the duration of rd before corrective surgery, high levels of vitreal proteins, repeated intraocular surgeries, aphakia, previous cryotherapy and photocoagulation, and the use of intraocular gas and silicone [2123]. Kuhn and colleagues identified and stratified rupture, endophthalmitis, perforating injury, retinal detachment, and afferent pupillary defects as key risk factors predictive of a worse visual prognosis . Additional risk factors for worse final best - corrected visual acuity (<20/40) are age (young patients, especially <5 years old), injuries with retrolimbal involvement, wound length 6 mm, and blunt injuries . The time from injury to the onset of pvr ranges from 1 to 6 months . A shorter interval between injury and pvr onset is observed for perforated globes (median, 1.3 months) followed by rupture (2.1 months), iofb (3.1 months), penetration (3.2 months), and contusion (5.7 months) [15, 17]. Adhesion of the neurosensory retina to the rpe is weak owing to the existence of a specialized extracellular srs, in which the apical processes of the rpe interdigitate with the rod outer segments and specialized projections from the rpe ensheath the cone outer segments . This physiology stems from events during ontogenesis, when invagination of the optic vesicle into 2 layers forms the optic cup . The inner layer of the optic cup will eventually form the neuroretina, and the outer layer of the optic cup will form the rpe . Only pressure keeps the 2 layers apposed; the virtual space between them may be readily widened under the influence of weak tractional vitreous forces . Each rpe cell makes contact with 3040 photoreceptors, forming a functional unit; survival of the photoreceptors is dependent on the rpe and vice versa [31, 32]. The rpe also contributes to the formation of the brb, which in addition to maintaining ionic homeostasis of the srs prevents proteins and blood components from penetrating neurosensory retina . Anatomically, the neuroretina is usually considered to consist of 2 parts: the outer retina (which is avascular) and the inner retina (which is supplied with blood). The outer part is mainly nourished by diffusion from the choroid, while the inner half is supplied by the retinal circulation . Separation of the sensory retina from the underlying rpe deprives the outer retina of nutrients, with disruptive metabolic and neurochemical consequences for the entire retina . Most of detachment - induced retinal damage appears to be directly related to the reduced supply of oxygen and, to some extent, also to low levels of other substances, such as glucose [3335]. The photoreceptor layer is by far the most vulnerable area, probably because the inner segments of the photoreceptors account for almost all oxygen consumption by the outer retina and because the outer retina is mainly supplied with oxygen and nutrients via diffusion from the choroid . The outer retina becomes hypoxic; the photoreceptors are stressed, and some die by apoptosis . A few hours or days after the rd, important cellular remodeling may be observed . In the detached retina, the light - sensitive outer segments of rod photoreceptors degenerate and the synaptic terminals retract from the outer plexiform layer (opl), so that rod synapses now occur deep in the outer nuclear layer (onl). After a few days, up to 20% of photoreceptors (mainly rods) are apoptotic, while the other photoreceptors may have survived through changes in shape and/or metabolism but risk engulfment by the hypertrophic lateral branches of mller cells . Mller glial cells, with their main stalk of cytoplasm extending across the width of the entire retina, undergo several changes in morphology during their lifespan . Their nucleus often migrates into the onl, at which point their main process and fine lateral branches increase in size and fill with glial fibrillary acidic proteins (gfap) (intermediate filaments that play a role in mitosis). Mller cells proliferate as part of an inflammatory response designed to heal the retina to protect neurosensory retina from mechanical stimuli (i.e., passive movement of the detached retina) and to protect photoreceptors from apoptosis . Mller cell proliferation is evident even in portions of the retina that are not yet detached, which suggests that rd involves a general reaction of the entire retina . Recent research seems to suggest that the release of diffusible growth factors such as pdgf from the site of retinal detachment induces the activation of mller and glial cells, even in parts of the retina that remain attached . However, hypertrophic mller cells tend to fill all the empty spaces previously occupied by neurons that have degenerated, thus irreversibly altering retinal structure and function . In detached retina, the main stalk of the mller cell often grows onto the surface of the onl, along the outer limiting membrane and into the srs where it can form a microglial cell proliferation and immune cell invasion may be detected in both detached and attached retinal areas . This proliferation contributes to retinal gliotic remodeling and to neuronal retinal degeneration, which could explain the impaired recovery of vision after reattachment surgery, particularly in patients with pvr . Reattachment allows for the regrowth of outer segments and rod axons, although some of these now grow past the opl, their normal target layer, and penetrate the inner retina . Reattachment inhibits the hypertrophy of mller cells within the retina and in the srs but appears to allow the growth of these cells onto the vitreal surface of the ganglion cell layer (gcl), where they form epiretinal membranes . Neuritic sprouts from the gcl often intermingle with the mller cell processes that form epiretinal membranes . These protracted remodeling events, associated with photoreceptor cell death, often prevent complete functional recovery after surgical retinal reattachment . Early reattachment probably halts and partially reverses the remodeling process and may stimulate withdrawal of many of the neurites that grow from these cells during detachment . However, prolonged detachment may stimulate further growth of mller cells [4143]. Restoration of the blood supply to the outer retina via reconnection with rpe microvilli stimulates the regrowth of outer segments and thus restores the retina's structural integrity . It is reasonable to think that retinal reattachment represents a return of the retina to its reattachment has the ability to stop the growth of mller cell processes into the srs but cannot stop growth in the opposite direction, which stimulates the formation of epiretinal membranes [4143]. Mller cell changes allow for the formation of a scaffold that permits the adhesion and subsequent proliferation of other glial cells, leading to subretinal fibrosis and pvr . Research performed in animal models suggests that one of the mechanisms by which mller cells play a role in pvr is by upregulating the expression of pdgfr- and gfap, thus starting a process of dedifferentiation in cells whose behavior resembles that of fibroblasts . Moreover, mller cells in peripheral retina, where pvr most often occurs, have been shown to express stem cell markers indicative of active proliferation and dedifferentiation . In addition, as yet unidentified cytokines and cofactors produced by migrated rpe cells may stimulate mller cells to transform into cells with fibroblastic behavior, which then contribute to membrane formation and contraction . A thorough understanding of the molecular mechanisms underlying rd will be critical to controlling conditions such as pvr and may also elucidate associated rod axon outgrowth . Five distinct stages appear to be important in pvr development . These include breakdown of the brb, chemotaxis and cellular migration, cellular proliferation, membrane formation with remodeling of the extracellular matrix, and contraction . Soon after an rd, macrophages enter the vitreous cavity through the retinal injury [48, 49] and release inflammatory cytokines that stimulate cell migration and proliferation . However, immunohistochemical studies of pvr membranes show the presence of various subtypes of immune cells: macrophages, monocytes, t lymphocytes, b lymphocytes, glial cells, and cells expressing hla - dr and dq . Macrophages and other inflammatory cells likely initiate the central event in the pathogenesis of pvr: the vigorous proliferation of rpe . Notably, the rpe is a monolayer of differentiated cells located between the neural retina and the choroidal vasculature essential for the survival of retinal neurons and visual function . The rpe contributes to the brb, which, in addition to maintaining the ionic homeostasis of the srs, prevents proteins and blood components from penetrating neural retina . The rpe is necessary for the preservation of normal photoreceptors and choriocapillaris and also plays an important role in the intraocular wound - healing response . Contact between the rpe and vitreous cytokines triggers dedifferentiation and epithelial - to - mesenchymal transformations . Various signals have been found to trigger the migration and proliferation of rpe cells: the loss of contact, factors present in the vitreous, and signals from photoreceptors and inflammatory cells . Although rpe cells express receptors for hepatocyte growth factor (hgf), platelet - derived growth factor (pdgf), tumor necrosis factor (tnf), and other growth factors [52, 53], the interactions between rpe and mller cells are likely the primary force regulating membrane formation and contraction . Mller and rpe cell interaction can lead to the upregulation of pdgf - receptor and increase mller cell pathogenicity . Mller cells may also play a more active role than previously thought in the development of pvr membranes, especially when stimulated by an environment rich in rpe cells . Depending on the size and age of the detachment as well as the size and location of the retinal tear, rpe cells are more or less likely to abandon their natural monolayer and migrate into the subretinal and preretinal space . These cells often attach to the vitreous, which acts as a scaffold, then migrate and secrete cytokines and cofactors that can alter mller cell phenotype in ways that increase fibroblastic behavior and pathogenicity . Brb breakdown and blood coagulation over a wound site expose the rpe to various serum components, including thrombin, fibrin, and plasmin . Thrombin and fibrin have been shown to promote growth factor secretion, neural cell survival and apoptosis, cytoskeletal rearrangement, and cell proliferation . Plasmin has also been identified as the major pdgf - c processing protease in the vitreous of animal models of pvr as well as patients undergoing retinal surgery . Blocking plasmin may prevent the generation of active pdgf - c, the pdgf isoform most relevant to pvr . For this reason, plasmin was identified as a novel therapeutic target for patients with pvr . Rpe cells undergo an epithelial - mesenchymal transition [5557] and develop the ability to migrate out into the vitreous, producing a provisional extracellular matrix containing collagen, fibronectin, thrombospondin, and other matrix proteins . During this process, subretinal rpe cells may lose their connection to the rpe extracellular matrix [5962] and migrate through the retinal break to enter the vitreous cavity . Kiilgaard et al . Used 5-bromo-2-deoxyuridine (brdu) to detect proliferating rpe cells and found that posterior pole injury in the porcine eye results in rpe proliferation in the anterior part of the rpe but not in the vicinity of the lesion . This suggests that a population of rpe progenitor cells exists in the vicinity of the ora serrata . These cells as well as the neural progenitors of mller cells could supply the cells necessary for proliferation in pvr . The intravitreal fibroblasts observed in pvr derive ontologically from trans - differentiated rpe or mller cells in the case of a primary rhegmatogenous rd and from fibroblasts that originated extraocularly in the case of ocular injury . The mechanisms of induction of posttraumatic pvr are probably the same implied in experimental pvr, obtained by injection of extraocular cells into the vitreous of animal models . When a wound is created, membranes are often seen to extend intraocularly from the wound edge; the fibroblasts that constitute these membranes may be derived from tenon's layer . The contraction of these cells is responsible for the most deleterious effects of pvr, including retinal wrinkling and distortion, formation of new retinal breaks, and reopening of previously sealed breaks . Two mechanisms have been proposed to explain the membrane contraction that can lead to a secondary rd . One is the active contraction of myofibroblastic cells; the second is the motile activity of myofibroblasts, which remodel the surrounding extracellular matrix . The second mechanism is supported more strongly by scientific evidence . According to this theory, tgf- secreted by macrophages induces the transformation of fibroblasts into smooth muscle- (sm-) actin - positive myofibroblasts . The emerging hypotheses regarding the pathogenesis of pvr have focused on abnormal local concentrations of growth factors and cytokines in the vitreous . This environment is conducive to transdifferentiation, migration, proliferation, survival, and extracellular matrix formation . The growth factors likely to be involved are pdgf, tnf- and tnf-, hgf, transforming growth factor beta 2 (tgf2), epidermal growth factor (egf), and fibroblast growth factor (fgf). Cytokines such as interleukin- (il-) 1, il-6, il-8, il-10, and interferon gamma (inf-) are also thought to play a role . Recent experiments have focused attention on the activation of a receptor for pdgf (pdgfr-), which seems to play a crucial role in pvr . In recent decades, vitreous samples from patients undergoing vitrectomy for pvr were found to have elevated concentrations of fgf and pdgf when compared to patients with rd uncomplicated by pvr . It plays a central role in blood vessel formation (angiogenesis) and is produced by a plethora of cells, including sm cells, activated macrophages, endothelial cells, and rpe . Pdgf exists as a dimeric glycoprotein composed of 2 a (-aa) or 2 b (-bb) chains or a combination of the two (-ab). Pdgf acts as a chemoattractant and mediator of cellular contraction in rpe cells [71, 72]; it is a potent mitogen for cells of mesenchymal origin, such as smooth muscle and glial cells . The pdgf signaling network consists of 4 ligands (pdgf - a, pdgf - b, pdgf - c, and pdgf - d) and 2 receptors (pdgfr- and pdgfr-). Pdgfrs are classified as tyrosine kinase receptors and are encoded by 2 genes that can homodimerize or heterodimerize to form pdgfr-, pdgf-, and pdgfr-. Pdgf is mitogenic during early development; during later maturation stages, it has been implicated in cellular differentiation, tissue remodeling, and morphogenesis . Pdgf has been shown to direct the proliferation, migration, division, differentiation, and function of a variety of specialized mesenchymal and migratory cell types, especially fibroblasts, during development as well as adulthood . In essence, pdgf allows a cell to skip the g1 (growth) phase in order to divide . Lei et al . Found that the presence of pdgf, mainly pdgf - c, in the vitreous cavity was tightly associated with pvr, present in 8/9 pvr patients versus 1/16 patients with other types of retinal disease . The analysis of epiretinal membranes from eyes with pvr showed rpe and mller cell overexpression of pdgf and pdgfr- [45, 53, 74]. Pdgf, with pdgf - c as the predominant isoform, is highly expressed in the vitreous of humans and animals with pvr . Pdgf - c is secreted as a latent protein that requires proteolytic processing for activation . Plasmin has been identified as the major pdgf - c processing protease in the vitreous of pvr animals and patients undergoing retinal vitrectomy . Pdgf - c, together with its receptor pdgfr-, is currently considered as the main contributor to pvr pathology in ocular trauma . Pdgfr- has been shown to be more readily activated than pdgfr- and more likely to contribute to pvr . Increased expression of pdgfr- in the retina is associated with the formation of epiretinal membranes and the proliferation of rpe cells and mller cells [45, 76, 77]. Furthermore, the expression of functional pdgfrs in either rpe or fibroblasts is an essential step for experimental pvr [53, 75, 78]. However, in animal models, cells with no pdgfr- carried a low risk of developing pvr and were able to revert to pvr reexpression upon reestablishment of the wild - type pdgfr genotype . Similarly, blocking pdgfr reduced the potential for pvr development . Nonetheless, recent investigations have shown that blocking pdgf was not sufficient to block pdgfr- activity . Various pdgf isoforms are abundant in the vitreous of patients and experimental animals with pvr but make only a minor contribution to activating pdgfr- and driving experimental pvr . Experimental pvr was found to be dependent on pdgfr- activation, rather than the concentration of pdgf . Pegfr- is also activated by egf, fgf, insulin, and hgf [75, 78, 79]. Probably indirect activation of pdgfr- by non - pdgf agents is the most important way to activate pvr also by other growth factors . Vascular endothelial growth factor a (vegf - a), which mediates neovascularization, competitively blocks pdgf - dependent binding and pdgfr- activation . However, a recent study showed that intravitreal agents that neutralize vegf - a also inhibit non - pdgf - mediated activation, which protects against pvr . Pdgfr- is a tyrosine kinase receptor that requires high levels of intracellular reactive oxygen species . Activation by non - pdgf agents increases intracellular levels of reactive oxygen species (ros), which in turn activate src kinase and pdgfr, promoting pvr . Clinical researchers are currently evaluating drugs that target pdgfr- or signaling events required for indirectly activating pdgfr- rather than directly activating pdgf . Antioxidant - directed approaches such as those using n - acetylcysteine or tyrosine kinase inhibitors such as ag1295 or su9518 could protect against pvr in humans [8184]. Tgf-2 is the most predominant isoform in the posterior segment and is secreted as a latent inactive peptide into the vitreous by epithelial cells of the ciliary body and the lens epithelium . Tgf-2 is also produced by rpe and mller cells, fibroblasts, platelets, and macrophages . Similar to pdgf, tgf-2 is 3 times more abundant in eyes affected by pvr versus normal eyes [86, 87]. Tgf-2 is a potent chemoattractant secreted by rpe cells that plays a key role in transforming rpe cells into mesenchymal fibroblastic cells and in inducing type i collagen and extracellular matrix synthesis in rpe cells [88, 89]. Like pdgf antibodies against tgf-2 and il-10, an antagonist of tgf-, inhibit the contractility of rpe cells on epiretinal membranes . In vivo experiments have shown that decorin, a naturally occurring tgf- inhibitor, and fasudil, a potent inhibitor of a key downstream mediator of tgf- called rho - kinase, may reduce fibrosis and rd development [9194]. Another factor that has been implicated in inflammation and is considered to promote pvr is tnf-, a monocyte - derived cytotoxin . The presence of active tnf- increases serum concentrations of the soluble form of its receptor (stnf - ri and stnf - rii), which can be used as a marker of active inflammation . Genetic analysis has identified a single nucleotide polymorphism of the tnf locus that predisposes the eye to pvr . It is secreted by macrophages and acts as a multifunctional cytokine on cells of epithelial origin . Its ability to stimulate cell motility, mitogenesis, and matrix invasion makes it a central player in tissue regeneration and in rpe - related diseases such as pvr [52, 97]. Mounting evidence suggests that chemokines play a role in the inflammatory pathways involved in pvr . Those named most commonly are il-1, il-6, ifn-, and monocyte chemoattractant protein- (mcp-) 1 . Il-6 is secreted by t cells and macrophages to stimulate the immune response after trauma, especially burns or other tissue damage leading to inflammation . Il-6 stimulates the proliferation of glial cells and fibroblasts and promotes the synthesis of collagen during wound healing . Il-6 levels are significantly higher in the vitreous and subretinal fluid (srf) in pvr, particularly posttraumatic pvr [52, 98]. In a recent study, il-6 levels in the vitreous were found to be predictive for the development of pvr . Mmps are proteolytic enzymes involved in mec homeostasis; their expression is largely modulated by il-6 . Il6, mmp, and timp1 are expressed at high levels in grade b pvr, which involves intense mec remodeling, . Another cytokine involved in pvr is ifn-, a dimerized soluble cytokine that is the only member of the type ii class of interferons . Ifn- has a variable capacity to stimulate the immune response; this cytokine appears to activate macrophages during the development of pvr . Ifn- levels are 6 times higher in eyes with pvr as compared with control eyes . As mentioned above, the molecular events leading to epiretinal membrane formation in pvr are similar to those occurring in normal wound healing and scar formation . Abu el - asrar et al . Found that mcp-1 is present in the vast majority (76%) of eyes affected by pvr . Few published studies have investigated the prevention of posttraumatic pvr; surgical management remains the primary mode of therapy . However, it is possible to extend the findings about emerging therapies for the prophylaxis of pvr, the prevention of posttraumatic pvr, on the basis of the molecular mechanisms described above . The most important therapeutic targets in efforts to control the immune response after trauma are mller and epr cell proliferation and epiretinal membrane formation . A recent research on a feline model of rd reported that hyperoxic conditions reduced glutamate cycling dysregulation as well as mller cell proliferation and transformation . Similar experiments were then conducted in the ground squirrel retina, which is cone - dominated, in contrast to the rod - dominated feline retina . The squirrel study showed a similarly protective effect of oxygen supplementation on photoreceptor degeneration . Providing supplemental oxygen after a diagnosis of rd may help to improve va recovery after surgery and may reduce the incidence and severity of glial - based complications, such as pvr . The compounds tested for their ability to prevent pvr include antineoplastic agents, antiproliferative agents, anti - inflammatory agents, antioxidant agents, and anti - growth - factor agents . Current pharmacologic intervention to prevent pvr is principally focused on the use of antiproliferative and anti - inflammatory agents . A number of antiproliferative drugs such as colchicine, daunomycin, alkylphosphocholines, and 5-fu have been tested due to their ability to inhibit the proliferation of human retinal glial cells in vitro . These antiproliferative compounds inhibit non - neural retinal cells, including mller cells, which can form subretinal membranes that block photoreceptor outer segment regeneration after successful reattachment surgery . One of the most promising antiproliferative candidates is 5-fu; it has been tested in combination with heparin in recent clinical trials . 5-fu acts on dna synthesis by inhibiting thymidine formation, which inhibits cell proliferation, particularly in fibroblasts . This appears to improve the prognosis for long - term retinal reattachment following the development of pvr in animal models [106, 107]. Because 5-fu and low molecular weight heparin (lmwh) are involved in two different aspects of pvr pathogenesis, the two compounds are used together to exert a synergistic effect . Heparin is a naturally occurring complex polysaccharide that is able to bind fibronectin and a range of growth factors involved in the pathogenesis of pvr, such as fgf and pdgf . One randomized clinical trial included 174 high - risk patients undergoing primary vitrectomy for rrd who were randomized to receive either 200 g / ml 5-fu and 5 iu / ml lmwh or placebo . The results showed a significant reduction in the incidence of postoperative pvr and reoperation rates in the patients who received 5-fu and lmwh therapy . Wickham et al . Performed a prospective randomized clinical trial that included 641 patients who presented with primary retinal detachment . Patients were treated by either vitrectomy and adjuvant therapy of 5 iu / ml of lmwh and 200 mg / ml of 5-fu or vitrectomy and placebo . These results showed that the use of 5-fu and lmwh did not improve anatomic or visual success rates after 6 months . This discrepancy may stem from the inclusion criteria used for each study: the first study included high - risk patients, the latter included patients with primary rd . Although the efficacy of lmwh with 5-fu infusion during vitrectomy in preventing pvr remains controversial, this combined therapy may be used in the future to treat high - risk patients . Another drug that has been used to inhibit the uncontrolled mitogenic activity of cells at the vitreoretinal interface is daunomycin; it is an anthracycline antibiotic, a topoisomerase inhibitor of dna and rna synthesis that arrests cell proliferation and cell migration ., daunorubicin has been used for the prophylaxis of idiopathic and traumatic pvr . In a multicenter, prospective, randomized and controlled study that used daunomycin to treat pvr, use of this compound during the evidence for any impact on anatomical success rate and/or visual outcomes was inconclusive . In the early nineties, campochiaro et al . Were the first to put in evidence the ability of retinoic acids (ra) in inhibiting rpe cell growth in vitro; subsequently also retrospective and prospective in vivo studies have been conducted . Encouraging results from the use of retinoic acid were published by chang et al . From a prospective controlled interventional case series of 35 patients affected by retinal detachment complicated with pvr who were randomized to receive either 10 mg oral ra twice daily for 8 weeks the treated group had significantly lower rates of macular pucker formation with higher rates of retinal reattachment . Umazume et al . Found that dasatinib prevents rpe sheet growth, cell migration, cell proliferation, the epithelial - mesenchymal transition (emt), and extracellular matrix contraction in a concentration - dependent manner and prevents tractional retinal detachment (trd) without any detectable toxicity . Pdgfr- can be activated by pdgf, vegf, and various other growth factors [78, 119]. The apparent mechanism of action of ranibizumab involves the depression of pdgfs, which, at the concentrations present in pvr vitreous, inhibits non - pdgf - mediated activation of pdgf receptor alpha . The inhibition of the receptor by the way of non - pdgf results in a protection for the development of pvr in rabbit models . These preclinical findings suggest that the approaches to neutralize vegf - a seem to be prophylactic for pvr, but more investigations are needed . Because pvr is thought to be caused by the inflammatory healing process, intravitreal corticosteroids may be of use for treatment . These compounds exert their therapeutic action by limiting brb breakdown, reducing neutrophil transmigration, inhibiting fibroblast proliferation, suppressing macrophage recruitment, limiting leucocyte migration, decreasing cytokine production, and reducing the formation of granulation tissue . Corticosteroids inhibit the proliferation of fibroblasts, rpe cells, and rpe - transformed myofibroblasts that are responsible for the contractile properties of pvr membranes [121, 122]. Steroids also seem to interfere with the recruitment of macrophages to the site of a lesion and may block the action of monocyte / migration inhibitory factors (mifs). These drugs are applied topically as eye drops, locally by subconjunctival, peribulbar, or retrobulbar injection, and systemically via oral, intravenous, and intramuscular routes . Numerous experimental studies conducted on animal models have demonstrated the benefits of the intravitreal administration of triamcinolone . Despite this success in animal models, encouraging results regarding the use of triamcinolone acetonide emerged from a study conducted by jonas et al . However, the mean follow - up period adopted in this study was less than 2 months, which reduces the validity of the results . Despite the potential benefits, the intravitreal injection of triamcinolone acetonide is associated with side effects, including glaucoma and cataract, so recent research in this area has focused on the use of dexamethasone . A recent study conducted by bali et al . Showed that the subconjunctival injection of dexamethasone prior to surgery decreased the extent of postoperative brb breakdown as measured by laser flare photometry 1 week postoperatively . In this regard, we take the opportunity to report an important recent study in which hoerster et al . Evaluated the anterior chamber aqueous flare with laser flare photometry and found that it is a strong preoperative predictor for pvr in eyes with rd . The disadvantage of using dexamethasone is the compound's short half - life, which has led to the development of long - acting intravitreal dexamethasone implants . As demonstrated by lei and kazlauskas, the indirect activation of pdgfr triggers signaling events leading to pvr . Non - pdgf growth factors can increase intracellular concentrations of reactive oxygen species (ros), leading to pdgfr activation . Lei et al . Tested whether an antioxidant such as n - acetylcysteine (nac) was able to prevent the accumulation of ros and thereby block pdgfr activation . A 10 mmol / l - dose of nac suppressed pdgfr- activation and protected against rd in a rabbit model . Although nac did not prevent the formation of an epiretinal membrane, the compound did limit the extent of vitreous - driven contraction . Antioxidants may prevent detachments after retinal surgery and should be considered for use in combination with other therapeutic approaches . Although the exact impetus for proliferation remains unknown, there is compelling evidence that posttraumatic pvr is similar to wound healing in terms of the inflammation, proliferation, and remodeling involved . The greatest challenge is to identify a pharmacological approach and adjuvant surgery that could be truly prophylactic for the development of pvr . Various pharmacological agents have demonstrated potential in reducing postoperative pvr risks, including intravitreal lmwh, 5-fu, daunomycin, and anti - vegf drugs . Clinical reports have suggested that either systemic or intravitreal corticosteroids may be useful in attenuating pvr gravity by limiting brb breakdown . However, many clinical trials have shown inconclusive results; none of these agents has been shown to be decisive in preventing pvr after surgery . The introduction of immune cells into the vitreous cavity, as is the case in penetrating ocular trauma, triggers the production of growth factors and cytokines that come in contact with intraretinal mller and rpe cells . It is widely accepted that growth factors and cytokines, including pdgfs, hgf, tnf, and bfgf, drive the cellular responses intrinsic to pvr . These cytokines and growth factors promote an environment of cell transdifferentiation, migration, and proliferation that allows for expansion of the extracellular matrix . As this scaffold forms, it may physically attach to the retina . Subsequent contraction causes wrinkling, shortening, and tearing of the retinal tissue, otherwise known as pvr . The process involves a host of cytokines and growth factors . To our knowledge, none seem to be indispensable for disease onset or progression . However, these pathways appear to converge at the steps necessary for the expression and activation of pdgfr-, which seem to be crucial in the development of pvr . In addition to the pdgfs, all of the other growth factors mentioned above stimulate the expression and activation of pdgfr- on the surface of rpe cells, mller cells, glial cells, and fibroblasts . The activity of this receptor promotes transdifferentiation, migration, proliferation, survival, the formation of extracellular matrix, membrane formation, and contraction . A combination therapy that could block all of these agents would be an ideal addition to the arsenal currently used to prevent pvr . When used in combination with other tyrosine kinase inhibitors, the antioxidant nac prevents tractional rd in animal models by blocking non - pdgf growth factor - mediated pdgfr- activation . A recent study showed that a cocktail of neutralizing reagents targeted to multiple growth factors and cytokines was able to reduce pvr development . Antibodies against pdgf, egf, fgf-2, ifn-, il-8, tgf-, vegf, tgf-, hgf, and igf-1 to igf-12 were effective in preventing rd in a rabbit model . In the future, novel therapeutic agents could enhance functional recovery after rd by limiting cellular proliferation . A combined therapy involving oxygen supplementation, a cocktail of neutralizing reagents, and tyrosine kinase inhibitors would target intracellular and extracellular activation of pdfgr-, thereby protecting against pvr . Current investigations into the pathobiological and pathophysiological mechanisms involved are increasing the possibilities for management . It is hoped that our treatment strategies will evolve and become even more effective in achieving complete vision recovery.
Microglandular adenosis (mga) is a rare benign disease that causes proliferative glandular lesions in the breast . These benign lesions may progress to a wide spectrum of disease, from atypical microglandular adenosis (amga) to carcinoma arising in microglandular adenosis (camga). Although mga itself is benign, it can cause carcinoma, which can lead to problems if not excised completely . In this study case 1 was a 44-year - old woman with a previous history of breast - conserving surgery because of ductal carcinoma in situ (dcis) in her right breast 4 years ago . After breast - conserving surgery, she received radiotherapy on her right breast but no hormonal therapy or chemotherapy . During a regular follow - up she had no symptoms or signs associated with a breast mass . On physical examination, mammography showed heterogeneously dense breast tissue and a newly developed small nodular density at the left upper outer quadrant of the breast (figure 1a). Ultrasound examination revealed an ill - defined irregular hypoechoic nodule measuring approximately 8 mm and an ill - defined hypoechoic nodule measuring approximately 7 mm (bi - rads category 4b) at the 1 to 2 o'clock region and 5 cm from the left nipple . Both nodules were adjoining (figure 1b). Ultrasound guided localization excisional biopsy and frozen section revealed that the lesion was invasive carcinoma . She underwent modified radical mastectomy (mrm) with sentinel lymph node biopsy (slnb). No definite mass - like lesion was found on gross examination (figure 2). Microscopic examination revealed widely spread round proliferative glands lined by a single layer of flat to cuboidal epithelial cells and lacking a myoepithelial layer, indicating typical mga . In part of the lesion, the glandular lumen was obliterated by proliferation of monotonous, atypical small cells with frequent mitotic figures, indicating carcinoma in situ . A cord - like arrangement and irregular aggregates of highly atypical cells were scattered in the stroma and extended into the adipose tissue (figure 3). Immunohistochemical (ihc) staining revealed the following: s-100 protein (+), estrogen receptor (er) (-), progesterone receptor (pr) (+, allred score 3), human epidermal growth factor receptor 2 (her2) (-), lysozyme (+), 1-antitrpysin (+), calponin (-), and p63 (-). The slnb showed no evidence of metastasis . The final diagnosis was multifocal invasive carcinoma associated with dcis (grade 3) arising in mga with stage 1a, t1 (<1 cm, in the largest one), n0 (0/1), m0, and lymphovascular invasion (-). After 14 months of medical follow - up, no evidence of recurrence has been found . Case 2 was a 57-year - old woman with a palpable mass in her right breast . A firm, movable mass measuring approximately 3 cm was palpable at the right upper outer quadrant of the breast . Mammography revealed a huge mass - like lesion at the right upper breast and ultrasound revealed a lobulating heterogeneous hypoechoic mass measuring 2.62.2 cm at the 11 o'clock region of the right breast (figure 4). Positron emission tomography revealed fluorodeoxyglucose (fdg) uptake at a 2.7 cm hypermetabolic mass in the upper outer quadrant of the right breast (suvmax: 15.4) and fdg uptake in lymph nodes of the right axilla (level 1). Microscopic examination revealed encapsulated papillary carcinoma arising in mga, which exhibited atypia and variable proliferation (approximately 5.2 cm in the largest dimension). Most areas of the mga were atypical and were lined by large pleomorphic cells with nuclear hyperchromasia and prominent nucleoli . A 0.30.25 cm focus of invasion typical mga tubules with intraluminal colloid - like secretory material were found at the more peripheral area of the lesion (figure 6). Ihc staining revealed the followings: s-100 protein (+), smooth muscle myosin - heavy chain (-), er (-), and pr (-). No metastasis was observed in the sentinel lymph nodes . The final diagnosis was invasive ductal carcinoma (grade 2) associated with encapsulated papillary carcinoma arising in mga with stage ia, t1 (0.30.25 cm), n0 (0/5), m0, and lymphovascular invasion (-). The patient showed no evidence of recurrence on medical follow - up at 19 months . Fattaneh tavassoli, a breast pathologist at the yale school of medicine, usa, about these two cases . Case 1 was a 44-year - old woman with a previous history of breast - conserving surgery because of ductal carcinoma in situ (dcis) in her right breast 4 years ago . After breast - conserving surgery, she received radiotherapy on her right breast but no hormonal therapy or chemotherapy . During a regular follow - up she had no symptoms or signs associated with a breast mass . On physical examination, mammography showed heterogeneously dense breast tissue and a newly developed small nodular density at the left upper outer quadrant of the breast (figure 1a). Ultrasound examination revealed an ill - defined irregular hypoechoic nodule measuring approximately 8 mm and an ill - defined hypoechoic nodule measuring approximately 7 mm (bi - rads category 4b) at the 1 to 2 o'clock region and 5 cm from the left nipple . Both nodules were adjoining (figure 1b). Ultrasound guided localization excisional biopsy and frozen section revealed that the lesion was invasive carcinoma . She underwent modified radical mastectomy (mrm) with sentinel lymph node biopsy (slnb). No definite mass - like lesion was found on gross examination (figure 2). Microscopic examination revealed widely spread round proliferative glands lined by a single layer of flat to cuboidal epithelial cells and lacking a myoepithelial layer, indicating typical mga . In part of the lesion, the glandular lumen was obliterated by proliferation of monotonous, atypical small cells with frequent mitotic figures, indicating carcinoma in situ . A cord - like arrangement and irregular aggregates of highly atypical cells were scattered in the stroma and extended into the adipose tissue (figure 3). Immunohistochemical (ihc) staining revealed the following: s-100 protein (+), estrogen receptor (er) (-), progesterone receptor (pr) (+, allred score 3), human epidermal growth factor receptor 2 (her2) (-), lysozyme (+), 1-antitrpysin (+), calponin (-), and p63 (-). The slnb showed no evidence of metastasis . The final diagnosis was multifocal invasive carcinoma associated with dcis (grade 3) arising in mga with stage 1a, t1 (<1 cm, in the largest one), n0 (0/1), m0, and lymphovascular invasion (-). After 14 months of medical follow - up, no evidence of recurrence has been found . Case 2 was a 57-year - old woman with a palpable mass in her right breast . A firm, movable mass measuring approximately 3 cm was palpable at the right upper outer quadrant of the breast . Mammography revealed a huge mass - like lesion at the right upper breast and ultrasound revealed a lobulating heterogeneous hypoechoic mass measuring 2.62.2 cm at the 11 o'clock region of the right breast (figure 4). Positron emission tomography revealed fluorodeoxyglucose (fdg) uptake at a 2.7 cm hypermetabolic mass in the upper outer quadrant of the right breast (suvmax: 15.4) and fdg uptake in lymph nodes of the right axilla (level 1). The patient underwent right mrm with slnb . A well - demarcated solid mass measuring 2.82.4 cm microscopic examination revealed encapsulated papillary carcinoma arising in mga, which exhibited atypia and variable proliferation (approximately 5.2 cm in the largest dimension). Most areas of the mga were atypical and were lined by large pleomorphic cells with nuclear hyperchromasia and prominent nucleoli . A 0.30.25 cm focus of invasion was associated with an altered chondromyxoid stroma adjacent to the encapsulated papillary carcinoma . Typical mga tubules with intraluminal colloid - like secretory material were found at the more peripheral area of the lesion (figure 6). Ihc staining revealed the followings: s-100 protein (+), smooth muscle myosin - heavy chain (-), er (-), and pr (-). The final diagnosis was invasive ductal carcinoma (grade 2) associated with encapsulated papillary carcinoma arising in mga with stage ia, t1 (0.30.25 cm), n0 (0/5), m0, and lymphovascular invasion (-). The patient showed no evidence of recurrence on medical follow - up at 19 months . Fattaneh tavassoli, a breast pathologist at the yale school of medicine, usa, about these two cases . Since mga was first described in 1968, by mcdivitt et al ., several studies have reported cases of amga and camga [2 - 7]. To the best of our knowledge, the present cases are the first cases of invasive carcinoma arising in mga to be reported in korea . Although one report suggested that the incidence of carcinoma could be as high as 64%, it appears to have been affected by bias . Results of ihc staining of carcinoma arising in mga did not differ significantly from those of mga . In most cases, results of ihc staining showed positivity for cytokeratin, e - cadherin, and s-100 and negatively for er, pr, her2, cystic disease fluid protein (gcdfp)-15, epithelial membrane antigen, smooth muscle actin, cd10, calponin, and p63 . One of the major differences in ihc staining of mga from invasive carcinoma is that mga stains basement membranes with laminin and collagen iv . In mga and carcinoma in situ, in contrast to invasive carcinoma the preliminary pathologic diagnosis was acinic cell carcinoma (acca), and it was revised to camga after consultation with dr . Some camga cells are immunoreactive for amylase, lysozyme, and 1-antichymotrypsin, which are found in acca, indicating acinic cell differentiation . In addition to this, both exhibit glandular structures and granularity as well as stain positively for s-100 and antitrypsin, and negatively for er and pr . Signs of mga include regular nuclei, a single layer of cuboidal cells, basal lamina, eosinophilic luminal content, and empty cytoplasm on electron microscopy . . However, acca does not show regular nuclei and basal lamina, but shows granular cytoplasm and dense core granules on electron microscopy . It may or may not reveal a single layer of cells, cuboidal cells, luminal content, and gcdfp-15 in ihc staining . If mga is accompanied by amga or camga, it must be completely excised with a negative surgical margin . Incomplete excision of a primary benign mga lesion can cause recurrence of mga with development of carcinoma . It is difficult to secure a safety margin because of the insidiously invasive character of mga, and cases of axillary lymph node metastasis and distant metastasis have been reported . In addition to surgery, radiation therapy should be considered in patients with breast - conserving surgery, and adjuvant chemotherapy should be considered in patients with axillary metastasis or with invasive tumors larger than 1 cm in the absence of nodal metastasis . Despite histopathological and ihc features indicating poor prognoses, most studies have reported relatively favorable prognoses . However, longer follow - up periods are needed to determine the exact prognosis of camga.
Facial acanthosis nigricans (fan) is a term that is commonly used synonymously and interchangeably with metabolic melanosis and metabolic melasma by indian dermatologists . This label of fan is given to brown - to - black macular pigmentation with blurred ill - defined margins, commonly found on the zygomatic and malar areas with varying degrees of textural changes ranging from mild roughness to frank verrucous appearance of the affected areas [figure 1]. At times, it is also labeled, somewhat inaccurately, as frictional hyperpigmentation or pigmented contact dermatitis . This reiterates the fact that the entity we call fan lacks precise definition of clinical and histopathological features . . We present a descriptive study of patients with fan in an attempt to define the patterns of pigmentation of fan and estimate the prevalence of obesity and insulin resistance in these cases . The aims of this study were (1) to study the clinical patterns of fan,(2) to estimate the prevalence of obesity using body mass index (bmi) and waist circumference (wc) as parameters in patients with fan, and (3) to estimate the prevalence of insulin resistance (ir) and its degree in patients with fan using homeostatic model of assessment of insulin resistance (homa2 ir) as a parameter . We included patients with acanthosis nigricans (an) of the neck, with classical facial acanthosis nigricans on the face described as brown - to - black macular pigmentation with blurred ill - defined margins, on the zygomatic and malar areas with varying degrees of textural changes . Patients having a defined clinical entity responsible for facial pigmentation such as melasma, pigmented contact dermatitis, lichen planus pigmentosus, erythema dyschromicum perstans, poikiloderma of civatte, pigmentary dermacation lines, post inflammatory pigmentation, topical / systemic drug induced pigmentation, congenital / nevoid and familial causes etc . This was a prospective study conducted at two dermatology outpatient clinics with majority cases contributed by the first author . The study was conducted over a period of 2 years between march 2013 to march 2015 . One hundred and two consecutive patients who fulfilled the inclusion criteria and provided consent for use of the clinical photographs were included in the study . Each patient was subjected to an in - depth history taking with regards to the onset, duration and progress of the pigmentation, associated aggravating factors such as excessive exposure to sunlight, atopy, friction, occupational or personal use of chemicals, and cosmetics and medications applied onto the face . Systemic comorbidities and medications along with relevant past, personal, and family history with particular emphasis on associated comorbidities such as diabetes, hypertension, dyslipidemias and coronary artery disease were noted . Clinical findings in each patient with regards to the location of the pigmentation, laterality, color, and textural changes were listed . Bmi was calculated by weight in kilograms divided by the square of body height in meters . Asian indians are more predisposed to developing insulin resistance and tend to manifest cardiovascular risk factors at lower levels of bmi, as compared to other ethnic groups, and have a higher percentage of body fat and abdominal obesity at lower or similar bmi levels as compared to caucasians . Because this study comprised an indian population, the consensus statement for diagnosis and treatment recommendations for obesity and metabolic syndrome in asian indians was used to classify the patients . The patients were classified on the basis of their bmi as normal: 18.022.9 kg / m, overweight: 2324.9 kg / m, and obese> 25 kg / m . The waist circumference of each patient was measured on standing using flexible tape measured from the narrowest part of the torso, as seen from anterior view (midway between the lowest rib and iliac crest). As per the consensus statement for diagnosis and treatment recommendations for obesity and metabolic syndrome in asian indians, the risk of developing type 2 diabetes, hypertension and cardiovascular disease is higher in men with wc more than or equal to 36 inches and in females with wc more than or equal to 32 inches . Each patient was subjected to fasting blood sugar, and fasting blood insulin levels and homa2 ir calculation were determined using a computer generated software . We used homa2 ir as a measuring tool in our study because it is a validated, sensitive, and a specific marker of insulin resistance . It is a simple test based on fasting glucose and insulin measurements and shares good correlation with the gold standard clamp tests without the potential risks of hypoglycemia . The patients were classified on the basis of homa2 ir readings as normal <2, borderline 22.2, moderate 2.23, and severe> 3 . Additional investigations such as a pelvic ultrasound, hormonal, and biochemical tests were performed in relevant cases to diagnose polycystic ovarian disease (pcod). Histopathological features of the 6 skin biopsies of facial pigmentation, that were possible . Were reviewed . Data was statistically described in term of range, mean, standard deviation (sd), mode of frequencies (number of cases) and relative frequencies (% of cases). All statistical calculations were performed usingspss version 20 (statistical package for social science spss, inc . We included patients with acanthosis nigricans (an) of the neck, with classical facial acanthosis nigricans on the face described as brown - to - black macular pigmentation with blurred ill - defined margins, on the zygomatic and malar areas with varying degrees of textural changes . Patients having a defined clinical entity responsible for facial pigmentation such as melasma, pigmented contact dermatitis, lichen planus pigmentosus, erythema dyschromicum perstans, poikiloderma of civatte, pigmentary dermacation lines, post inflammatory pigmentation, topical / systemic drug induced pigmentation, congenital / nevoid and familial causes etc ., were excluded from the study . This was a prospective study conducted at two dermatology outpatient clinics with majority cases contributed by the first author . The study was conducted over a period of 2 years between march 2013 to march 2015 . One hundred and two consecutive patients who fulfilled the inclusion criteria and provided consent for use of the clinical photographs were included in the study . Each patient was subjected to an in - depth history taking with regards to the onset, duration and progress of the pigmentation, associated aggravating factors such as excessive exposure to sunlight, atopy, friction, occupational or personal use of chemicals, and cosmetics and medications applied onto the face . Systemic comorbidities and medications along with relevant past, personal, and family history with particular emphasis on associated comorbidities such as diabetes, hypertension, dyslipidemias and coronary artery disease were noted . Clinical findings in each patient with regards to the location of the pigmentation, laterality, color, and textural changes were listed . Bmi was calculated by weight in kilograms divided by the square of body height in meters . Asian indians are more predisposed to developing insulin resistance and tend to manifest cardiovascular risk factors at lower levels of bmi, as compared to other ethnic groups, and have a higher percentage of body fat and abdominal obesity at lower or similar bmi levels as compared to caucasians . Because this study comprised an indian population, the consensus statement for diagnosis and treatment recommendations for obesity and metabolic syndrome in asian indians the patients were classified on the basis of their bmi as normal: 18.022.9 kg / m, overweight: 2324.9 kg / m, and obese> 25 kg / m . The waist circumference of each patient was measured on standing using flexible tape measured from the narrowest part of the torso, as seen from anterior view (midway between the lowest rib and iliac crest). As per the consensus statement for diagnosis and treatment recommendations for obesity and metabolic syndrome in asian indians, the risk of developing type 2 diabetes, hypertension and cardiovascular disease is higher in men with wc more than or equal to 36 inches and in females with wc more than or equal to 32 inches . Each patient was subjected to fasting blood sugar, and fasting blood insulin levels and homa2 ir calculation were determined using a computer generated software . We used homa2 ir as a measuring tool in our study because it is a validated, sensitive, and a specific marker of insulin resistance . It is a simple test based on fasting glucose and insulin measurements and shares good correlation with the gold standard clamp tests without the potential risks of hypoglycemia . The patients were classified on the basis of homa2 ir readings as normal <2, borderline 22.2, moderate 2.23, and severe additional investigations such as a pelvic ultrasound, hormonal, and biochemical tests were performed in relevant cases to diagnose polycystic ovarian disease (pcod). Histopathological features of the 6 skin biopsies of facial pigmentation, that were possible . Were reviewed . Data was statistically described in term of range, mean, standard deviation (sd), mode of frequencies (number of cases) and relative frequencies (% of cases). All statistical calculations were performed usingspss version 20 (statistical package for social science spss, inc . The male - to - female ratio was found to be 2.9:1 (76 males and 26 females). The average age of the male patients with such pigmentation was 37.57 10.1 years (range: 1658 years) and that of the female patients was 31 8 years (range: 1738 years). Twenty - two (21.5%) patients gave a history of being exposed to sunlight for more than 2 hours per day . Six patients (5.88%) had history of atopy, and 27 (26.47%) patients gave history of rubbing the pigmented areas often . Systemic comorbidities such as hypertension were found in 50 (49.01%), dyslipidemias in 52 (50.98%), and ischemic cardiac disease in 4 (3.92%) cases . Seventy - eight percent of females with pigmentation fulfilled the criteria for diagnosis of pcod . Following patterns of facial pigmentation were seen in addition to the classical pigmentation on the zygomatic and malar areas [figure 1]. A)associated continuous or discontinuous horizontal band on the forehead with varying intensity of pigmentation was seen in 61 (59.80%) cases . The band merged with the zygomatic pigmentation to form a c shape when seen from the lateral view [figure 2a] textural changes ranged from mild roughness to frank verrucous change [figure 2b]b)periorbital darkening was seen to be associated in 18 (17.64%) cases . The darkening was not only attributable to the pigmentation but also to the laxity, accentuated wrinkling, and shadow effect seen in that area [figure 3a]c)perioral darkening was seen to be associated in 13 (12.74%) individuals [figure 3b]. In certain individuals, we have noticed accentuated periorbital pigmentation as an association with pigmentation of other areas zygomatic area / horizontal band / perioral / generalised pigmentationd)generalized pigmentation of the face was seen in 10 (9.8%) cases [figure 3c]. Associated continuous or discontinuous horizontal band on the forehead with varying intensity of pigmentation was seen in 61 (59.80%) cases . The band merged with the zygomatic pigmentation to form a c shape when seen from the lateral view [figure 2a]. Textural changes ranged from mild roughness to frank verrucous change [figure 2b] periorbital darkening was seen to be associated in 18 (17.64%) cases . The darkening was not only attributable to the pigmentation but also to the laxity, accentuated wrinkling, and shadow effect seen in that area [figure 3a] perioral darkening was seen to be associated in 13 (12.74%) individuals [figure 3b]. In certain individuals, we have noticed accentuated periorbital pigmentation as an association with pigmentation of other areas zygomatic area / horizontal band / perioral / generalised pigmentation generalized pigmentation of the face was seen in 10 (9.8%) cases [figure 3c]. (a) horizontal band on the forehead merging with the zygomatic pigmentation to form a c shape when seen from the lateral view . (b) (b) prominent perioral pigmentation with mild periorbital pigmentation, horizontal forehead band, and associated post - inflammatory pigmentation due to acne . (c) (d) abdominal obesity with presence of acanthosis nigricans over the knuckles an of other body sites such as axillae, groins, and knuckles was noted in 88 (86.27%) of the cases [figure 3d]. Acne with its complications such as post - inflammatory hyperpigmentation and scarring was seen in 12 (11.76%) cases . Acrochordons on the neck and/or on the face was the next most common cutaneous association seen in these cases . Seventy - four (72.54%) of the patients had a round obese face with excessive fat deposition around the cheeks and jaws [figure 4]. Obese face with deposition of fat on the cheeks and jowls the average bmi and the wc of males were found to be 30.72 4.9 kg / m (range: 22.539.9) and 37.6 inches, respectively [figure 3d]. As per criteria followed, 87 (85.29%) of the males were obese, 8 (7.8%) were overweight, and 5 (4.9%) had a normal bmi . In contrast, the average bmi of the female patients was 32.58 kg / m, which was higher than that of the males . Hundred percent of females belonged to the obese category with the average bmi being 32.5 3.3 (range: 27.937.2). The average homa2 ir in males was 3.5 1.58 (range: 1.47) whereas in females it was 3.2 1.34 (range: 1.25.5). Normal insulin levels were observed in 18 (17.64%) of the patients, 3 (2.94%) patients had borderline levels, whereas 17 (16.66%) and 64 (62.74%) of the patients had moderate and severe insulin resistance, respectively, as per the homa2 ir levels . Biopsies of the 6 patients that were available for evaluation showed mild epidermal hyperplasia with prominent melanin in the basal layer, however, without the typical papillomatosis seen in an of the flexures . There were also increased numbers of large pigmented melanocytes at the dermoepidermal junction without any nest formation [figure 5a]. Two cases also showed mild dermal fibroplasia and many scattered melanophages in the papillary dermis without any interface changes or significant dermal inflammatory infiltrate [figure 5b]. (a) hematoxylin and eosin (h and e, 20): scanner view showing lentigenous hyperplasia of rete with uniformly increased melanin in the basal layer with upper dermal fibroplasia and scattered melanophages without much inflammatory infiltrate . (b) (h and e, 100): presence of epidermal hypermelanosis, few large melanocytes, a thickened granular layer, and upper dermal fibroplasia and scatter of melanophages . (c) (h and e, 20): mild hyperplasia of rete with mildly increased melanin in the basal layer . Varied terminologies have been attributed to the pigmentation described as fan in this article on account of lack of consensus . Studies from india describing the clinicohistopathological characteristics of fan and its correlation with ir and other metabolic markers are lacking . A study by sharquie et al . Among 30 iraqi patients with fan between 16 and 58 years of age showed a male preponderance (m: f: 29:1) with presence of pigmentation on the forehead in 92.3% (28 patients), temporal areas in 54% (17 patients), nasolabial folds in 57% (18 patients), and cheeks in 66.6% (22 patients) of the patients . As also observed in our study, they found an increased prevalence of obesity with 33.3% (10 patients) being overweight and 53.3% (16 patients) being obese . Our study has, however, used parameters defined for indian patients making it more relevant and customized to the indian population ., with the same cohort and additional controls, found that fasting serum triglyceride, total cholesterol, growth hormone, and serum leptin were statistically significantly high in patients with fan in comparison with control individuals . Though an elaborate panel of metabolic markers was not performed in our study, the above mentioned observation a literature search also yielded a term maturational pigmentation (mh), an entity coined and described by dr . Melvin alexander, at the loreal institute of ethnic hair and skin international symposium in 2006 . Alexander described the condition as dark brown - to - black pigmentation localized over the malar and zygomatic areas with blurry ill - defined borders, gradually merging with the surrounding normal skin . Other features of mh that are very similar to our findings were an adult onset, relative lack of symptoms, common occurrence of bilateral lesions, patients being overweight, lack of preceding trauma, and a negative family history . However, we would like to point out some notable differences from the study by alexander et al . We did not notice a significant association with allergies (7%) in contrast to 75% in their cases . Alexander's patients had hyperglycemia and 36% showed hyperinsulinism in contrast to 82.34% of our patients in whom we documented ir by homa2 ir . While we did not notice laterality of pigmentation corresponding to the preferred side while sleeping as in dr . Alexander's study, we believe that friction and exposure to sunlight contributes to the accentuation of fan . The histopathological findings of increased numbers of large pigmented melanocytes in the epidermis and presence of fibroplasia with many scattered melanophages in the upper dermis without significant dermal inflammatory infiltrate or interface changes reflect rubbing effects or post - inflammatory changes due to the use of irritant or phototoxic topical medications [figure 5b]. Whether photofrictional effects are the initiating trigger in predisposed individuals or occur as a secondary additional effect need to be investigated further . Although we feel that fan and mh are essentially different names of a single entity describing ir in individuals, often with an obese face, we prefer to use the term fan for the following reasons . (1)there was classical an on the neck in all these cases, and of other anatomical sites in 88% of our cases(2)we have documented varying degrees of ir in 82.34% of the affected individuals(3)the mild hyperplasia of the blunt rete [figure 5c] seen in our patients may signify an early change of an, as has been noted by sharquieet al . In their two studies, where they confirmed the histopathology findings of an of the face to be similar to that of the neck and axilla (acanthosis with or without papillomatosis together with epidermal and dermal melanosis), however, milder . There was classical an on the neck in all these cases, and of other anatomical sites in 88% of our cases we have documented varying degrees of ir in 82.34% of the affected individuals the mild hyperplasia of the blunt rete [figure 5c] seen in our patients may signify an early change of an, as has been noted by sharquieet al . In their two studies, where they confirmed the histopathology findings of an of the face to be similar to that of the neck and axilla (acanthosis with or without papillomatosis together with epidermal and dermal melanosis), however, milder . We have found an increased prevalence of obesity (87.5% in males and 100% in females) and ir (82.1%) in patients with fan . An additional observation in our cases is the frequent occurrence (74%) of such pigmentation on an obese face with excessive fat deposition around the cheeks and jowls . Documenting the obese face to correlate directly with insulin resistance and visceral fat deposition lends support to our observation of the obese face . Though the pigmentation in an has been popularly attributed to the thickening of the skin and the resultant velvety texture, increased melanin, presence of large epidermal melanocytes and dermal melanin have also been shown to be important causes of pigmentation in fan as documented by sharquie et al . Histological findings in some of our cases concur with their observations [figure 5c]. They also document the severity of pigmentation of the face to be proportional to the degree of thickness and velvety texture of the epidermis . Thickening of the epidermis translates into an increased melanin store, and therefore a higher degree of pigmentation . There is documentation of elevated levels of growth hormone leading to increased fibroblast and keratinocyte activity, thus playing a role in the pathogenesis of an . The other possible cause of pigmentation is the pigment epithelium derived factor (pedf). Pedf, a multifunctional protein encoded by the serpinf-1 gene, has been shown to induce insulin resistance by acute activation of proinflammatory serine / threonine kinases and stimulation of adipocyte lipolysis that results in ectopic lipid deposition . It is thought that because an is a clinical marker of ir, increased pedf may be associated with an . This corroborates with the clinical observation that the pigmentation in these patients responds to weight loss and lifestyle modifications with little response to depigmenting agents and procedures . We would like to highlight some of the shortcomings of the current study . A comparative analysis using a control group was not done . We were not able to perform facial biopsies in more patients due to its invasive nature and the patientsconcerns regarding a possible scar on their faces . Additional investigations to document metabolic syndrome were not performed due to financial constraints of the patient in a resource poor country, where the majority of patients do not have health insurance . Grading of severity of fan and its correlation with the metabolic derangements were not a part of this study . The brown - to - black ill defined macular pigmentation on the zygomatic and malar areas with varying degrees of textural changes that we have called facial acanthosis nigricans is a common presentation, especially in overweight and obese individuals . Varied terminologies have been loosely applied to this presentation reiterating the fact that this entity needs further validation as regards its nomenclature, which is possible through description of the histopathological findings and confirmation of its association with insulin resistance and metabolic syndrome . Our study demonstrates a higher incidence of obesity and insulin resistance in patients with such pigmentation and also describes a few additional patterns we came across in association with the classical presentation of fan on the zygomatic and malar areas, namely the horizontal forehead band, perioral, periorbital and the generalized facial pigmentation . We are unable to comment on whether the additional patterns in isolation represent fan because they are also seen in situations unrelated to obesity and hyperinsulinism . However we have found them worthy of mention since they have been documented in association with the classical fan and an on the nape of neck in patients in who we have found metabolic abnormalities . Fan being essentially a simple visual finding can serve the vital role of being one of the early indicators of ir, metabolic syndrome, and probably impending diabetes mellitus . A comprehensive biochemical work - up based on this simple visual finding can ensure more timely remedial measures such as lifestyle changes and pharmacotherapy . This is, therefore, of particular importance in india which is known to be an epicenter of metabolic syndrome and diabetes mellitus . At present the most common biochemical investigations used to assess glucose metabolism are fasting blood sugar levels and 2 hours post - meal sugar levels that only help in detecting diabetes mellitus or prediabetes (impaired glucose tolerance) hence, an elevated homa2 ir level can serve as marker for ir in such cases . In addition to the investigations performed in this study, measurement of blood pressure, post - glucose 2 hours plasma glucose levels, hba1c levels, complete lipid profile, thyroid function tests, serum uric acid level, cardiovascular risk assessment, and polysomnographic sleep study are suggested in order to complete the evaluation for metabolic syndrome in these patients . Further studies are required to reach a consensus on the minimum biochemical investigations required in resource poor countries like india . Future larger, histopathologically backed studies with a comparison group would help in validating the nomenclature, pathogenesis, and correlation of this oft seen but ill studied entity with metabolic syndrome . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed . The authors certify that they have obtained all appropriate patient consent forms . In the form the patient(s) has / have given his / her / their consent for his / her / their images and other clinical information to be reported in the journal . The patients understand that their names and initials will not be published and due efforts will be made to conceal their identity, but anonymity cannot be guaranteed.
Focal segmental glomerulosclerosis (fsgs) is a pathological term to indicate glomerular lesion associated with various etiological factors . In native kidneys,, fsgs can be classified as recurrent disease or fsgs associated with chronic transplant glomerulopathy, calcineurin inhibitor (cni) toxicity and in long - standing grafts with hyperfiltration injury . The incidence of recurrent fsgs is approximately 30% and secondary disease occurs in 10 - 20% of the cases . The distinction between these various types is difficult because of lack of pretransplant diagnosis and overlapping morphological features . We analyzed 24 graft biopsies with fsgs and tried to etiologically classify them basing on the accompanying morphological features on the graft biopsies and clinical features . It is important to diagnose the condition adequately and promptly to protect the graft and inhibit the progression of the disease . Out of 363 allograft biopsies received between january 2012 and december 2013, 24 diagnosed as fsgs were included in the study . Three routine stains were done in all biopsies, which included hematoxylin and eosin, periodic acid - schiff's, and masson's trichrome . Immunofluorescence with immunoglobulin (ig) g, igm, iga, c3c and c1q was done . Criteria to diagnose fsgs included segmental sclerosis, hyalinosis and or lipid deposition, focal or segmental collapse of the tuft with prominence of podocytes of variable degree depending on the histological type of lesion diagnosed . Mean serum creatinine level was 2.7 mg / dl and mean 24 h urinary protein was 3.2 g. secondary fsgs was reported in 18 cases (75%). Causes included chronic humoral rejection in seven cases (38%), cni (cyclosporine and tacrolimus) toxicity in six cases (33%), and in long - standing grafts with hypertensive nephron loss and hyperfiltration injury in five cases (29%). The type of donor, biochemical parameters and pretransplant diagnosis for various categories are given in table 1 . Recurrent and new - onset primary diseases seven cases with chronic glomerular and tubulointerstitial changes with positive c4d were classified as chronic humoral rejection . Glomerular changes included thickening and duplication of basement membrane, increase in mesangial matrix and cellularity, and focal segmental sclerosis [figure 1]. C4d was given as positive when 10 - 50% of capillaries (c4d2) or more than 50% of capillaries (c4d3) showed linear circumferential staining . Positive c4d and segmental lesion in chronic humoral rejection (200) chronic humoral rejection mean serum creatinine level was 2.7 mg / dl and 24 h urinary protein was 2.8 g. six lesions were classified as cni toxicity . Histological features included striped fibrosis in interstitium and nodular hyaline arteriolar sclerosis (ah2 and ah3) in vessels [figure 2]. Nodular hyaline arteriolar sclerosis (periodic acid - schiff, 200) calcineurin inhibitor toxicity mean serum creatinine level was 2.1 mg / dl and mean 24 h urinary protein was 800 mg . Hyperfiltration injury was diagnosed in five cases where hypertensive glomerular changes such as thickening and wrinkling of basement membrane, ischemic collapse of the tuft, and widening of bowman's space and fsgs was seen . Vessels showed marked subintimal fibrosis with> 50% narrowing of lumen and associated with chronic tubulointerstitial changes . Mean serum creatinine level was 2.1 mg / dl and mean 24 h urinary protein was 300 mg . Clinical and morphological details are given in table 4 . Focal segmental glomerulosclerosis is a pathological term to indicate glomerular lesion associated with various clinical situations in renal allografts . Fsgs is a common cause of end - stage disease and recurrence in grafts is approximately 30% . We classified fsgs in renal grafts as recurrent disease, new - onset primary fsgs in cases where the native diagnosis was not fsgs, and secondary fsgs when associated with drug toxicity, chronic rejection or hypertension, depending on the clinical features and in correlation with various morphological features that are associated with fsgs . This number does not indicate the exact incidence, as native biopsy diagnosis is not available in many cases . Risk of recurrence includes young age of the patient, presence of mesangial proliferation, and rapid progression to end - stage disease and pretransplant bilateral nephrectomy . Recurrence occurs in renal grafts in early post - transplant period . These patients present with heavy proteinuria usually of nephrotic range . This criterion and an available diagnosis of native disease are helpful in diagnosing recurrent disease . In our series, all the four cases had a biopsy diagnosis of fsgs . The type of fsgs in native kidney was available in three cases, and recurrence disease had a similar pattern to native disease . Recurrence can be classified as recurrence of same variant (51%), recurrence of same variant preceded by minimal change disease (19%) and recurrence with a different variant of fsgs (19%). Graft survival is poor and progression to end - stage renal disease is rapid and is as high as 50% . It is therefore important to diagnose and differentiate this entity from other causes of fsgs . (a) collapsing glomerulopathy (jones, 200). (b) focal segmental glomerulosclerosis - not otherwise specified (h and e, 200) chronic transplant glomerulopathy and chronic humoral rejection are other conditions in which fsgs can occur . The mechanism for this is chronic immunological glomerular endothelial and podocyte injury, which is resulting in fsgs . This particular lesion is relatively easy to diagnose as associated features of chronic graft damage are seen, and c4d is positive . These patients presented in late post - transplant period mostly after 3 years and presentation is due to the rise in creatinine and mild proteinuria . These lesions are purely based on pathology diagnosis as serum levels do not correlate with the extent of renal damage and clinical features are not specific . Glomerular changes include glomerular hypertrophy, capillary collapse, focal segmental or focal global sclerosis . Fsgs results from hyperfiltration injury due to loss of functioning nephrons rather than direct toxic effects on podocytes . Presence of hyaline arteriopathy, stripped fibrosis, [figure 4] tubular atrophy with or without isometric vacuolation, and absence of heavy proteinuria help to diagnose this particular entity . Striped fibrosis (masson's trichrome, 100) the true incidence of glomerulonephritis in grafts is not exactly known and ranges from 4% to 20% . Membranous nephropathy and fsgs are most common of the glomerulonephropathies that can be seen in grafts with an incidence of 1 - 9% . We diagnosed two cases of new - onset fsgs in patients presenting with nephrotic range proteinuria . Histologically, there were no features of hypertension or cni toxicity and c4d was negative . New - onset fsgs has favorable clinical course when compared with recurrent disease and hence it is important to identify this lesion . In long - standing grafts with nephron loss and chronic tubulointerstitial changes we described this entity separately when arterial changes are predominant and tell - tale signs of cni toxicity are absent . An attempt was made to etiologically classify these lesions as there is a difference in treatment and prognosis . It is important to make a diagnosis carefully using clinical information and pathology when a decision about second transplant has to be made.
In 1912, crouzon described a syndrome that consisted of brachycephaly, shallow orbits, and maxillary hypoplasia . Since then, craniofacial syndromes have been subcategorized into over a hundred syndromes based on the severity of the craniofacial and associated congenital malformations . Crouzon syndrome, along with apert, carpenter, chotzen, and pfeiffer syndromes, is one of the most common genetic disorders associated with a craniofacial syndrome . Other facial deformities in crouzon syndrome may include prominent nose, frontal bossing, and ocular proptosis due to shallow orbits with or without hypertelorism, although age - related phenotype modifications have been reported . Patients of crouzon syndrome may occasionally present with hydrocephalus, seizures, and mental retardation . The incidence of hydrocephalus in craniosynostosis ranges from 4% to 26% [4, 5]. Nonetheless, short stature with growth hormone deficiency (ghd) and/or iron deficiency anemia (ida) have rarely been reported in the literature . Here we report a case of crouzon syndrome with hydrocephalus, also presenting with severe short stature due to ghd and ida . An 11 and a half - year - old boy visited our out - patient clinic for frequent dizziness and marked growth retardation . The positive facial features were brachycephaly, hypoplasia maxilla, severe ocular proptosis (hertel's exophthalmometry measuring 22 - 23 mm on both eyes) with hypertelorism, and low - set ears . He had a 3200 gm birth weight and was born to a generally healthy mother via nsd at 40 wks' gestational age . Owing to severe hydrocephalus and cerebellar tonsil herniation (chiari i malformation) revealed by magnetic resonance imaging (mri), he had endoscopic third ventriculostomy and six months later, he received frontal advancement and ventricular shunting because of a progressive increase in ventricular size and rising intracranial pressure (icp). His head circumference remained at around the 50th percentile, but he had frequent respiratory tract infections during early childhood . The patient had not been followed up regularly after the age of 6 years until recently . He was 18.5 kg and 111.2 cm, which represented 3 standard deviation (sd) in body weight and 5 sd in height of his age . His brother, who is 4 and a half years older, was 182 cm . His parents are grossly normal and the mid - parent height is 168 cm . On admission, his general condition was stable and intelligence quotient (iq) around 90 . Chromosome analysis was normal in g - banding karyotype; however, molecular analysis identified a common mutation point of cys278phe in exon iiia of the fibroblast growth factor receptor 2 (fgfr2) gene (figure 1). His bone age was only 4.55 years according to the greulich and pyle atlas (figure 2), which was a 6.5 - 7- year delay . Mri revealed obstructive hydrocephalus of both lateral ventricles with an interruption of pituitary stalk, shallow orbits, and chiari i malformation . Pituitary height was 5.6 mm in midsagittal t1-weighted spin - echo mri (figure 3), which was around mean according to tsunoda's study . A biochemistry profile revealed thyroid hormones and cortisol within normal limits, but blood routine showed microcytic anemia . A growth hormone provocative test revealed a reduced peak growth hormone response of 4.57 uiu / ml in the insulin test and 2.63 uiu / ml in the clonidine test . The concentrations of insulin - like growth factor 1 (igf - i) and insulin - like growth factor binding protein 3 (igf - bp3) were also very low (igf - i <10.0 ng / ml, igfbp-3: 1.5 g / ml). Severe iron deficiency anemia without thalassemia was noted (hemoglobin: 8.8 g / dl, rbc: 4.18 million / ul, mcv: 68.2 fl; serum iron: 7 mg / dl, ferritin: 4 ng / ml, uibc: 525 mg / dl) with regards to the microcytic anemia . Iron supplements at a dose of 100 mg / day were subscribed immediately . Human growth hormone (hgh) subcutaneous replacement at a dose of 0.3 mg / kg / week in seven divided doses was also subscribed, and the growth velocity was 3 cm per year during the first half year . After his hemoglobin and serum iron levels gradually returned to normal, his dizziness disappeared and his growth velocity increased to 5 cm per year under hgh therapy . We reviewed the literature for the incidence of hydrocephalus in crouzon syndrome and the association with ghd, only one case report: crouzon syndrome with short stature due to partial ghd was found . However, with the progressive improvement and higher usage of imaging studies, cases of the incidence of hydrocephalus in crouzon syndrome are not uncommon . From proudman's large study of central nervous system imaging in crouzon syndrome performed in south australia, most of those taken with follow - up computed tomographic scans were nonprogressive, even in cases of severe ventriculomegaly (hydrocephalus)., he suggests that hydrocephalus occurs secondary to the defective formation of the cranium, so it is reasonable that in many cases the hydrocephalus is nonprogressive . Most ventriculomegaly in crouzon syndrome is asymptomatic and does not necessitate any treatment, unless there is a clear evidence of significantly raised intracranial pressure . Fronto - orbital advancement and shunt system are treatments of choice . In our report case, ghd may have resulted in this patient's growth retardation, which is not a common finding in crouzon syndrome . There have been a few reports of endocrine disorders in children with shunted hydrocephalus, such as sexual precocity [10, 11] or decreased basal levels of gh and igf-1 . Increased intracranial pressure has been perceived as a possible cause of pituitary dysfunction . In a series of papers by lppnen et al . [1316], the growth pattern of 114 children with shunted hydrocephalus was analyzed . It was characterized by slow linear growth in prepuberty, accelerated physical maturation during puberty, and reduced final height . This has also been shown to be associated with accelerated pubertal development in both boys and girls . Furthermore, they studied these patients' serum growth hormone, plasma igf-1, and igfbp-3 concentrations . They concluded that reduced growth hormone secretion may contribute to the pattern of slow linear growth and reduced final height observed in these patients . Since there was an association with growth hormone, lppnen et al . Designed a study performing radiography of the sella turcica, mri of the pituitary gland, and pituitary hormone stimulation tests in a subgroup of this large series (54 out of 114) to assess pituitary size and functional capacity . The results indicated that children with shunted hydrocephalus had an increased pituitary size on average . About one - third of these patients had signs of reduced gh secretion and a significantly lower pituitary height, which probably contributed to their poor linear growth . Increased pituitary size was associated with enhanced gonadotrophin secretion, which may result in early puberty in children with shunted hydrocephalus . Another review article about disorders of growth and puberty in children with nontumoral hydrocephalus had similar results . They concluded that central early puberty was the most frequent endocrine disorder in 21 out of 31 patients . In their cases, short stature was frequently due to meningomyelocele and rarely to gh deficiency . In our case, the pituitary height in mri was not smaller than normal for his age, but an interruption of the pituitary stalk was found . His hydrocephalus and chiari i malformation were stationary except for the shallow orbits becoming more prominent . He had severe proptosis but his visual acuity was normal . Although chiari i malformation could also cause headache or dizziness, his dizziness might have been caused by severe ida, since the symptoms disappeared after anemia correction . The results of hgh treatment were not satisfactory during the first half year, but became better after ida had been corrected . Therefore, besides the compliance and method of hgh injection, other underlying diseases should be considered and treated if the therapeutic effect is not as expected . Tubbs et al . Reported a study which showed that a small group of children with ghd had small posterior fossa, which was similar to the features of chiari patients . They hypothesized that ghd might lead to chiari i malformation through the underdevelopment of the posterior fossa . In one of their following case studies, by presenting the case of 3 brothers, 2 with ghd and chiari, and one with neither, they provided evidence of this . Therefore, it would be interesting to see if hgh therapy leads to the improvement of chiari malformation . Although surgery is not necessary in our case so far, we hope to see hgh therapy contributes to improvement of chiari malformation by the annual mri survey . The diagnosis of crouzon syndrome is usually made by the patients' clinical signs, including acrocephaly, orbital proptosis, midfacial hypoplasia with nose, short upper lip, high narrow palate, narrowly spaced teeth, and prognathism . To date, most patients have been shown to carry mutations of the fgfr2 gene . In chiang's mutation analysis of crouzon syndrome in taiwanese patients, three of the 12 patients carried the cys342arg mutation, which is the most frequent mutation found in taiwanese patients . Molecular analysis of the fgfr2 gene can help to confirm and classify the diagnosis of craniosynostosis syndrome.
This was a prospective, cross - sectional study conducted at a tertiary care ophthalmic institute between august 2013 and march 2014 . The study protocol was prospectively approved by the institutional review board and health research ethics committee . The subjects underwent a full ophthalmic examination including best - corrected visual acuity, manifest refraction, intraocular pressure (iop) measurement with goldmann applanation tonometry, slit - lamp biomicroscopy, anterior chamber angle examination by 4-mirror gonioscopy, optic disc, and nerve fiber layer with a stereoscopic examination and photograph . The vf examination was done on a humphrey field analyzer (carl zeiss meditec, dublin, ca, usa) by using swedish interactive threshold algorithm standard 24 - 2 program . Oct scanning and vf examinations were performed by one of the authors (js). The study group consisted of consecutive unilateral primary open - angle glaucoma patients categorized as early stage by hodapp - anderson - parrish classification . Age - matched normal subjects were recruited from among those who came for a routine eye examination in the outpatient department . The other inclusion criteria were age more than 18 years, best - corrected visual acuity 20/40 or better, refractive error within 5 diopter (d) sphere and 3 d cylinder, and a willingness to participate in the study . Exclusion criteria included media opacities preventing imaging, any intraocular surgery within the last 6 months, and any retinal or neurological disease other than glaucoma that could confound the results of vf examination and sd - oct . Control subjects had normal ocular examination, open - angle on gonioscopy, iop <22 mmhg, no past history of high iop, no family history of glaucoma, normal optic disc morphology, and vf in both eyes . Glaucomatous damage was suspected on the basis of neuroretinal rim thinning or nerve fiber layer defects . All patients in the glaucoma group had these characteristic disc changes which correlated with the vf changes in the absence of other abnormalities that could explain the vf defect . The vf changes were confirmed on two separate examinations and were considered reliable only when the reliability parameters (fixation losses and false - positive or false - negative errors) were 20% . Glaucomatous vf defects were defined by the presence of two of the following three criteria: cluster of three points on pattern deviation probability plot with a p <5%, one of which had a p <1% or a pattern standard deviation (psd) with a p <5% or a glaucoma hemifield test outside normal limits . All images were acquired with the spectralis sd - oct (version 5.6.1 heidelberg engineering, carlsbad, california, usa .) After pupillary dilation . The instrument has a scan speed of 40,000 a - scans per second, with a 12 diameter scan circle around the optic nerve . The scan circle diameter (mm) depends on the axial eye length of the eye and is typically 3.53.6 mm . Trutrack (heidelberg engineering, carlsbad, california, usa) image alignment software tracks for eye movement and provides the ability to obtain multiple images from the exact same location . The average measurement values for all the six sectors were noted . The retinal thickness measurement and asymmetry analysis has been described in detail elsewhere . Retinal thickness measurements were compared between eyes (right - left asymmetry) and between the hemispheres (hemisphere asymmetry) of each eye . The average superior, inferior, and the total macular thickness were noted . The asymmetry map was displayed as a gray scale . The total number of continuous black squares (denoting a difference in thickness of> 30 m) in the right - left and the hemisphere asymmetry analysis was also noted . The vf, rnfl, and ppaa printouts for early glaucoma patients and controls are as shown [fig . 1 and 2]. We also tested out the diagnostic ability of the number of continuous black squares on the ppaa (right - left + hemisphere) in differentiating early glaucoma from normal . All oct scans were done bilaterally as the right - left asymmetry analysis requires data from the other eye . Hence, the fellow eye printout could be ignored according to our inclusion criteria . The study group patient with early glaucoma . (clockwise from top - left) (a) fundus photograph with an inferior nerve fiber layer defect . (b) retinal nerve fiber layer thickness printout with thinning in the inferotemporal quadrant . (c) visual field printout of the patient showing an early superior nasal step . (d) posterior pole asymmetry analysis report with nine continuous black squares in the inferior quadrant on hemispheric asymmetry analysis the control group subject without glaucoma . (from left to right) (a) normal retinal nerve fiber layer thickness printout . (b) posterior pole asymmetry analysis report with two continuous black squares each in the right - left asymmetry and the hemisphere asymmetry (total 4). (c) visual field printout showing a normal visual field descriptive and inferential statistics were performed using stata version 12 for windows (statacorp lp, college station, texas, usa). The demographics, rnfl, and ppaa parameters were compared using the independent sample t - test for normally distributed variables and mann whitney test for nonnormally distributed variables . Chi - square test was used to find significant differences in the gender distribution between the two groups . Receiver operating characteristic (roc) curves were used to describe the ability to discriminate early glaucomatous from healthy eyes for each spectralis oct software parameter . Sensitivities at fixed specificities of 80% and 95% were also determined for all the parameters . All images were acquired with the spectralis sd - oct (version 5.6.1 heidelberg engineering, carlsbad, california, usa .) After pupillary dilation . The instrument has a scan speed of 40,000 a - scans per second, with a 12 diameter scan circle around the optic nerve . The scan circle diameter (mm) depends on the axial eye length of the eye and is typically 3.53.6 mm . Trutrack (heidelberg engineering, carlsbad, california, usa) image alignment software tracks for eye movement and provides the ability to obtain multiple images from the exact same location . Retinal thickness measurements were compared between eyes (right - left asymmetry) and between the hemispheres (hemisphere asymmetry) of each eye . The total number of continuous black squares (denoting a difference in thickness of> 30 m) in the right - left and the hemisphere asymmetry analysis was also noted . The vf, rnfl, and ppaa printouts for early glaucoma patients and controls are as shown [fig . 1 and 2]. We also tested out the diagnostic ability of the number of continuous black squares on the ppaa (right - left + hemisphere) in differentiating early glaucoma from normal . All oct scans were done bilaterally as the right - left asymmetry analysis requires data from the other eye . (clockwise from top - left) (a) fundus photograph with an inferior nerve fiber layer defect . (b) retinal nerve fiber layer thickness printout with thinning in the inferotemporal quadrant . (c) visual field printout of the patient showing an early superior nasal step . (d) posterior pole asymmetry analysis report with nine continuous black squares in the inferior quadrant on hemispheric asymmetry analysis the control group subject without glaucoma . (from left to right) (a) normal retinal nerve fiber layer thickness printout . (b) posterior pole asymmetry analysis report with two continuous black squares each in the right - left asymmetry and the hemisphere asymmetry (total 4). Descriptive and inferential statistics were performed using stata version 12 for windows (statacorp lp, college station, texas, usa). The demographics, rnfl, and ppaa parameters were compared using the independent sample t - test for normally distributed variables and mann whitney test for nonnormally distributed variables . Chi - square test was used to find significant differences in the gender distribution between the two groups . Receiver operating characteristic (roc) curves were used to describe the ability to discriminate early glaucomatous from healthy eyes for each spectralis oct software parameter . Sensitivities at fixed specificities of 80% and 95% were also determined for all the parameters . In all, 80 eyes of 80 normal subjects and 76 eyes of 76 patients with early glaucoma were included for the study analysis . The differences in characteristics were not significantly different between the two groups except for mean deviation (p <0.01) and psd (p <0.01). Patient demographics and visual field parameters the mean values of the rnfl parameters in the two groups of participants are given in table 2 . There were significant differences between the groups for all rnfl parameters (p <0.01) except for the temporal quadrant rnfl thickness (p = 0.2). The area under curve (auc) and sensitivities at fixed specificities for all the rnfl parameters are also shown in table 2 . The values ranged from 0.563 for the temporal quadrant thickness to 0.858 for the inferotemporal quadrant rnfl thickness . Table 3 shows the predictive values and the likelihood ratios (lrs) based on the sd - oct normative data classification . Retinal nerve fiber layer thickness parameters in glaucoma and healthy eyes with area under curve and sensitivities at fixed specificities predictive values and likelihood ratios of the eye classification based on the normative database of spectral domain optical coherence tomography retinal nerve fiber layer parameters the mean values of the macular ppaa measurements in the two groups of participants are given in table 4 . Significant differences between the two groups were seen for all ppaa parameters (p <0.01) except for the right - left asymmetry (p = 0.1) and the hemispheric asymmetry analysis (p = 1). The auc and sensitivities at fixed specificities for all the macular ppaa parameters are also shown in table 3 . The auc ranged from 0.427 for the right - left asymmetry to 0.833 for the average inferior macular thickness value . The average inferior macular thickness had the highest sensitivity of 65% at a specificity of 95% . Table 5 shows the sensitivity, specificity, predictive values, and lrs for different diagnostic criteria depending on the number of continuous black cells on asymmetry analysis . Criteria a (two black cells) had the highest sensitivity at 73.7% with a specificity of only 30% . Criteria d (five black cells) had the highest specificity of 90% with a sensitivity of only 42.1% . Posterior pole asymmetry analysis parameters in glaucoma and healthy eyes with area under curve and sensitivities at fixed specificities sensitivity, specificity, predictive values, and likelihood ratios for glaucoma diagnosis based on the number of black cells (difference> 30 m) the roc curves for the best rnfl and macular ppaa parameter are as shown in fig . 3 . There was no significant difference (p = 0.5) between the aucs of the best rnfl parameter (inferotemporal rnfl thickness) and the best macular ppaa parameter (inferior macular thickness). The sensitivities of these parameters at 95% specificity were comparable (60% vs. 65%, respectively). Receiver operating characteristic curves of the best retinal nerve fiber layer (inferotemporal quadrant retinal nerve fiber layer thickness) and posterior pole asymmetry analysis (inferior quadrant macular thickness) parameters the mean values of the rnfl parameters in the two groups of participants are given in table 2 . There were significant differences between the groups for all rnfl parameters (p <0.01) except for the temporal quadrant rnfl thickness (p = 0.2). The area under curve (auc) and sensitivities at fixed specificities for all the rnfl parameters are also shown in table 2 . The values ranged from 0.563 for the temporal quadrant thickness to 0.858 for the inferotemporal quadrant rnfl thickness . Table 3 shows the predictive values and the likelihood ratios (lrs) based on the sd - oct normative data classification . Retinal nerve fiber layer thickness parameters in glaucoma and healthy eyes with area under curve and sensitivities at fixed specificities predictive values and likelihood ratios of the eye classification based on the normative database of spectral domain optical coherence tomography retinal nerve fiber layer parameters the mean values of the macular ppaa measurements in the two groups of participants are given in table 4 . Significant differences between the two groups were seen for all ppaa parameters (p <0.01) except for the right - left asymmetry (p = 0.1) and the hemispheric asymmetry analysis (p = 1). The auc and sensitivities at fixed specificities for all the macular ppaa parameters are also shown in table 3 . The auc ranged from 0.427 for the right - left asymmetry to 0.833 for the average inferior macular thickness value . The average inferior macular thickness had the highest sensitivity of 65% at a specificity of 95% . Table 5 shows the sensitivity, specificity, predictive values, and lrs for different diagnostic criteria depending on the number of continuous black cells on asymmetry analysis . Criteria a (two black cells) had the highest sensitivity at 73.7% with a specificity of only 30% . Criteria d (five black cells) had the highest specificity of 90% with a sensitivity of only 42.1% . Posterior pole asymmetry analysis parameters in glaucoma and healthy eyes with area under curve and sensitivities at fixed specificities sensitivity, specificity, predictive values, and likelihood ratios for glaucoma diagnosis based on the number of black cells (difference> 30 m) the roc curves for the best rnfl and macular ppaa parameter are as shown in fig . There was no significant difference (p = 0.5) between the aucs of the best rnfl parameter (inferotemporal rnfl thickness) and the best macular ppaa parameter (inferior macular thickness). The sensitivities of these parameters at 95% specificity were comparable (60% vs. 65%, respectively). Receiver operating characteristic curves of the best retinal nerve fiber layer (inferotemporal quadrant retinal nerve fiber layer thickness) and posterior pole asymmetry analysis (inferior quadrant macular thickness) parameters our study demonstrates that the macular thickness ppaa parameters were as good as the rnfl parameters for diagnosis of early glaucoma . There was no significant difference (p = 0.5) between the aucs of the best rnfl parameter (inferotemporal rnfl thickness) and the best macular ppaa parameter (average inferior macular thickness). The sensitivities of these parameters at 95% specificity were comparable (60% vs. 65%, respectively). This is similar to other reports in the literature stating equal diagnostic abilities of both rnfl and macular parameters . In contrast, the right - left asymmetry and the hemispheric asymmetry did not perform as well . The auc for the right - left and the hemispheric asymmetry was 0.427 and 0.499, respectively . The total number of black cells in right - left and hemispheric asymmetry was similar in early glaucoma as well as the control group (p = 0.1 and p = 1, respectively). Both of them had 5% sensitivity at 95% specificity and 10% sensitivity at 80% specificity for early glaucoma diagnosis . Comparing the diagnostic criteria based on the number of black cells, criteria a (two black cells) had the highest sensitivity at 73.7% with a specificity of only 30%, while criteria d (five black cells) had the highest specificity of 90% with a sensitivity of only 42.1% . A tradeoff between the sensitivity and specificity was seen with criteria c. these results are poorer compared to those reported by seo et al . This was probably because they included patients with localized defects confined to one hemisphere only which could have improved the hemisphere asymmetry analysis . We did not do so in this study as our inclusion criteria allowed for rnfl defects in both hemispheres simultaneously as long as they fell under the early glaucoma category . The positive predictive value of a test is defined as the proportion of people with a positive test result who actually have the disease . Similarly, the negative predictive value is defined as the proportion of people with a negative test result who do not have the disease . Predictive values are limited by the fact that they vary with the disease prevalence and therefore cannot be used interchangeably with different populations . The predictive values for the classification of the eye based on the normative data for sd - oct rnfl parameters were better than the ppaa diagnostic criteria based on the number of black cells . Positive lr is defined as the probability of an individual with disease having a positive test divided by the probability of an individual without disease having a positive test . Similarly, negative lr is defined as the probability of an individual with disease having a negative test divided by the probability of an individual without disease having a negative test . A lr close to 1 means that it fails to provide any additional information about the posttest probability of the disease . The highest positive lr was seen for the outside normal limits classification of the eye based on the sd - oct rnfl parameters (46.32), while the highest negative lr (0.9) was similar between the ppaa criteria based on the number of black cells and the classification of the eye based on the rnfl parameters . Early diagnosis of glaucoma can be achieved by population - based screening or case detection (also known as opportunistic screening). The requirement for population - based screening is a high specificity of 90% with a reasonable sensitivity of preferably higher than 80% for which none of the parameters in this study qualified . The objective for case detection, on the other hand, is to provide definitive care for which a high sensitivity is most important . We included patients with unilateral glaucoma only . Despite this, the diagnostic ability of the right - left asymmetry analysis was poor . We can only speculate that the ability would have been poorer if we had included bilateral early glaucoma patients . Nevertheless, the results of our study may not be applicable to bilateral early glaucoma patients . However, kochendrfer et al . Have demonstrated a good reproducibility of ppaa parameters and so this would not have affected our study results in any way . A limitation of our study was that it involved the analysis of indian eyes only . Control design with a clear distinction between glaucoma patients and normal subjects recruited from the general population . The effect of this spectrum bias has recently been shown wherein the diagnostic abilities were significantly higher when clear cut normal cases were taken as controls compared to when suspicious - looking discs were taken as the control group which may be clinically more relevant . However, the right - left and the hemisphere asymmetry components of the ppaa performed poorly and probably needed further refinement before they can be effectively used for diagnosing early unilateral glaucoma patients.
They are primarily produced by the spore - forming bacterium clostridium botulinum and, in rare cases, by some strains of clostridium butyricum and clostridium baratii [2, 3]. Intoxication with one of the seven distinct serotypes of bont (a g) causes botulism . One of 4 serotypes of bont (a, b, e, and f) is usually the cause of human botulism . Exposure to type a neurotoxin (bont / a) causes the majority of food - borne outbreaks and has been observed to cause more severe symptoms with a higher mortality . Bonts are zinc proteases that cleave and inactivate cellular proteins essential for the release of the neurotransmitter acetylcholine . Bont / a, -c, and -e cleave the peripheral plasma membrane protein soluble n - ethylmaleimide - sensitive factor attachment protein of 25 kda (snap-25); bont / b, -d, -f, and -g cleave synaptobrevin 2, also called as vesicle - associated membrane protein-2 (vamp-2). In addition to cleaving snap-25, bont - c also cleaves the integral plasma membrane protein, syntaxin . The soluble n - ethylmaleimide sensitive factor attachment protein receptor (snare) superfamily has become, since its discovery, the most intensively studied element of the protein machinery involved in intracellular trafficking . Currently, the only accepted assay with which to detect active clostridium botulinum neurotoxin is an in vivo mouse bioassay . However, the mouse bioassay is slow and not practical in many settings, and it results in the death of animals . Several in vitro assays have been developed to detect the activities of the different bont serotypes [613]. This approach has led to forester resonance energy transfer (fret) methods that are based on the natural substrates tagged with fluorescence dyes and their cleaved fluorescence products by bonts, which are then used to detect toxin activity [1416]. Dong and coworkers described two recombinant reporters containing residues 141206 and 3394 of neuronal snare proteins snap-25 and synaptobrevin 2, respectively . The substrates were expressed as fusions of cyan fluorescent protein (cfp) and yellow fluorescent protein (yfp), enabling the detection of bont proteolysis activity by fret . Advances in the development and optimization of fret - based assays that detect six of seven bont serotypes have also been reported [17, 18]. The fret reporters were found to be sensitive to bont serotypes and able to detect picomolar concentrations of the toxins in real - time assay . The main objective of our study was to develop a cell - based assay for the detection of bont / a and bont / e, which could be automated and applied to many laboratory settings . Here, we report a cellular sensor utilizing advanced fret - based substrates expressed as fusions of green fluorescence protein (gfp) and discosoma sp . The resulting reporters are stably expressed in living cells, and the neurotoxin cleavage activity is detected either by measuring the loss of fret or by destruction of the c - terminal fragment . These fret - based reporters are currently being evaluated for the analysis of different food matrices and also exploring new immuno - magnetic bead separation methods to counter the food matrix interference and to increase the sensitivity of the detection . Even though the assay is thousandfold less sensitive than the mouse bioassay further refinement of such assay will present an alternative to the mouse assay, and the ease of use could generate the confidence in field or reference laboratories capable of performing bont detection, leading to reduction in animal use . Bont / a (hall a strain) and bont / e (alaska strain) were obtained from metabiologics (madison, wi). Pacgfp1-c1 and pdsred - monomer - c1 were purchased from clontech laboratories (mountain view, ca). Full - length snap-25 cdna and pc12 transplantable rat pheochromocytoma cells were purchased from atcc (manassas, va). Antibodies targeting snap-25 were purchased from santa cruz biotechnology (santa cruz, ca). The hrp - conjugated secondary antibody was purchased from millipore (billerica, ma). Louis, mo). To build a neurotoxin sensor that can detect cleavage of snap-25 in living cells and to report toxin activity, we linked acgfpc1 and dsred together by using full - length snap-25 that can be cleaved by the appropriate bonts (figure 1(d)). The construct was engineered to encode full - length snap-25 sequence as a linker between acgfp1 and dsred - monomer using standard cloning techniques . Pacgfp - c1 was inserted in to pdsred - monomer - c1 by using xhoi / ecori restriction enzymes, resulting in acgfp1-dsred - monomer construct . Full - length rat snap-25 cdna was inserted in to the acgfp1-dsred - monomer vector resulting in an acgfp - snap-25-dsred construct . Pc12 cells were cultured according to standard cell culture methods . A day before transfection, cells (~1 10/ml) were seeded onto collagen - coated tissue culture dish and transfected with fret sensor (acgfp - snap-25-dsred), donor only (acgfpc1), and acceptor only (dsred - monomer) cdna constructs using a lipid - based transfection reagent according to manufacturer's instructions (lipofectin / life technologies). After incubation for six hours, the transfection medium was exchanged to dulbecco's modified eagle medium (dmem) plus 10% fetal bovine serum (fbs) to grow cells . Transfected cells were plated (~2.0 10 cells per well) onto 4-well labtek ii chamber slides and maintained at 37c, 5% co2 in a tissue culture incubator, 2448 hours prior to imaging . Thirty minutes prior to imaging, the culture medium was replaced with dmem medium without fbs . Images were acquired using a nikon eclipse ti - e confocal microscope (nikon inc ., usa) with a 1.4 numerical aperture, 100 oil - immersion objective . Images (12 bit) of multitrack channels were with the following configuration: an argon/2 laser (25 mw, t1 and t3 = 10% of laser exposure) for the green channel (donor excitation / donor emission: green ex / em), fret channel (donor excitation / acceptor emission: fret ex / em) with excitation at 488 nm, and hene 1 laser (t2 = 100%) for the red channel (acceptor excitation / acceptor emission: red ex / em) with excitation at 543 nm . All images were acquired with exactly the same settings (4 4 binning, 200 msec exposure time). The background (from areas that did not contain cells) was subtracted from each raw image . Pc12 cells transfected with gfp or dsred alone were first tested to obtain the cross - talk / bleed - through values for these filter sets . Image capture and calculations were performed by using nis - elements software (microsoft corporation). For experiments involving toxin treatment, different concentrations of holotoxin (bont / a, trypsin - treated bont / e) toxin complexes were added to the cell culture media, and cells were then analyzed as described earlier . Also, 24 h after pc12 cells were transfected with reporter constructs, growth medium was exchanged for 0.05 mg / ml g418 selection, and incubation continued until single clones appeared . Cells were transferred progressively from 24 well plates to 6 well plates as they reached confluence (1 - 2 weeks). When an assay was required, cells were collected and plated onto microtiter plates (nunc, rochester, ny) and allowed to expand for 24 h. the cells were then incubated with samples containing bont / a in the assay buffer (100 l of 50 nm hepes - naoh (ph 7.1), 5 mm nacl, 0.1% tween-20, 5 mm dithiothreitol (dtt), and 10 nm zncl2) and diluted and reconstituted with the culture medium for the duration of 2472 hours to reach desired sensitivity . Cells were then washed with phosphate - buffered saline (pbs) to reduce background before collecting fret emissions . The data was captured by measuring the total dsred emission, converted into a ratio metric value and plotted as a function of bont concentration . Alternatively, fret measurements were also taken on a synergy 2 multimode plate reader (biotek instruments, winooski, vt). For all line graphs, data shown are averages from triplicate determinations with bars indicating standard deviations . Pc12 cells grown on a culture slide were fixed in 4% paraformaldehyde and permeabilized with 1% triton x-100 . Anti - snap-25 antibody diluted in blocking buffer (1: 250 dilution) was added to the slides and incubated for 1 h at 4c and washed . Fitc labeled, goat anti - rabbit igg antibody was used in blocking buffer and added to the plates . After slides were incubated at 37c for 60 min, they were washed three times, and images were acquired using a nikon confocal microscope with fitc filter . To visualize the cleavage products of neurotoxin activity on an immune blot, pc12 cells grown on culture dishes were treated with bont / a (10 nm) at 37c for 48 h. cells were then harvested and lysed with ripa (radio - immunoprecipitation assay) buffer . Anti - snap-25 antibody (c-18, santa cruz biotechnology) directed against the c - terminus of the protein was used to recognize the botulinum neurotoxins a and e cleavage products . Peroxidase - labeled antibodies diluted in blocking buffers were used to detect cleavage products and then visualized using a gel imager (syngene, usa). We identified transplantable rat pheochromocytoma neuronal cell line (pc12 cells) (figure 1(a)) derived from rat brain medulla for developing stable cell lines expressing fret sensor . Pc12 cells are sensitive to bont / a with sensitivities equivalent to primary cord neurons, as observed by the significant cleavage of snap-25 at bont / a concentration of 1 nm (figure 1(b)). Previous reports have confirmed that the bont / a light chain contains a membrane localization signal and is targeted to the plasma membrane in differentiated pc12 cells [19, 20]. The immunofluorescence staining of methanol - fixed pc12 cells shows the localization of membrane - bound snap-25 (figure 1(c)). If the gfp and dsred are close enough to each other, excitation of the gfp moiety will result in the sensitized emission from the dsred moiety as a consequence of fret . Cleavage of the linker sequence between acgfp and dsred separates them and abolishes fret (figure 1(d)). In fret, the energy is transferred nonradioactively from donor protein to the acceptor protein when they are in very close proximity (about 50) and when the emission spectrum of the donor protein overlaps with the excitation spectrum of the acceptor protein . We generated stable cell lines that stably express the reporter protein over many passages, and the data from the p15 for nine clones are shown in figure 2(a). Out of nine subclones (3a1, 3a4, 3a9, 3a14, 3a17, 3a21, 5a3, 5a5, and 5a9) tested for stability, only two subclones, 3a14 and 5a3, constitutively expressed acgfpc1-snap-25-dsred reporter and responsive to bont / a at 1 and 10 nm (figure 2(b)). To carry out cell - based studies, clones 3a14 and 5a3 were treated with 110 nm bont / a for 7296 hours . The fret signals in living cells were acquired by using three - filter set method as shown in figure 3(a), and details are provided in the materials and methods . A progressive decrease in the fret ratio was observed over time . This sensor yielded significant fret (upper corrected fret), which was abolished after cells were treated with bont / a for 72 h (lower corrected fret). We also tested the cleavage activity of bont / e on these clones (3a14 and 5a3), which also resulted in the abolishment of fret activity as indicated by the reduction in the red florescence in the cell population as shown in figure 4(a). Bont / e response of the clone 3a14 is shown in figure 4(a), treated at 1 and 10 nm of bont / e concentration for 72 h, and it was captured using fluorescence microscopy . Pseudocolored images indicate the distribution of the gfp / dsred fluorescence ratio within the cells . When 5a3 clones at passage 15 were incubated with bont / a, the toxin is internalized resulting in the release of the bont / a light chain into the cytosol . The bont / a light chain then cleaves the reporter resulting in the release of a c - terminal reporter fragment into the cytosol that contained residues 198206 of snap-25 and dsred . The data in these studies were captured by measuring the total dsred emission of the cells using directly excited gfp (figure 3(b)). This will be an alternative toxin cleavage measurement in addition to fret fluorescence measurement explained earlier in the study . Thus, dsred emissions are divided by gfp emissions giving a ratio metric assay readout . Emissions were plotted as a function of bont / e concentration as shown in figure 4(b). In addition to holotoxin, we also checked the multiprotein complex form of the toxins bont / a and bont / e responses for the sensor assay . Pc12 cells were grown in plates treated with 0.0330 nm of bont / a and bont / e complex for different intervals (up to 72 hours) to show the toxin activity . There was only a moderate reduction in the fret activity observed with a bont / a complex as compared to holotoxin treatments . At a higher concentration (30 nm) of bont / a treatment, there was a gradual reduction in the dsred fluorescence indicating the action of toxin . This demonstrated that the bont / a and bont / e in their complex form are functionally less active in this detection method compared to holotoxin form of the toxin . The gfp and dsred emissions were collected by fluorescence microplate reader (biotek instrument, winooski, vt). Emissions were plotted as a function of bont / a holotoxin and complex as shown in figure 5(a) and bont / e holotoxin and complex concentration as shown in figure 5(b). The cell - based assay developed here has the potential to be a rapid screening method to confirm the presence of functional botulinum toxin types a and e. the fret - based reporter approach could be adapted to screen other bont serotypes with unique cleavage sites by using synthetic substrates labeled with different dyes . Cell - based reporters make it possible to gain further insights into toxin substrate recognition and cleavage in cells and to understand the bont cell biology . Here, we tested pc12 cell lines, which are large adherent cells, resist early apoptosis, and can be maintained easily with commercially available tissue culture medium and antibiotics . These stable clones could be produced in large quantities and are reproducible . In a single experiment, sufficient stable cells can easily be generated to populate twenty 96-well dishes . Alternatively, cells can also be cryopreserved with 50% viability upon thawing to provide lot - to - lot consistency . Even though the assay is of low sensitivity we are currently exploring methods to increase the sensitivity of the assay and the available immuno - magnetic separation methods to counter the food matrix interference.
Autoimmune diseases are complex immune - mediated diseases that involve both genetic and environmental factors in their pathogenesis . Infectious microorganisms have long been suggested to trigger an immune response to autoantigens by providing stimuli for the breakdown of self - tolerance and also by generating cross - reactive t cells and antibodies via molecular mimicry . Molecular mimicry is a mechanism that has a proposed role in many autoimmune diseases such as acute rheumatic fever, rheumatoid arthritis, guillain - barr syndrome, multiple sclerosis, type 1 diabetes mellitus, and lyme arthritis . In autoimmune diseases, the concept of molecular mimicry has often been used to describe similar structures shared by molecules from dissimilar proteins, as illustrated by the -helical coiled - coil streptococcal m protein and cardiac myosin in rheumatic fever . However, some proteins such as heat shock proteins are evolutionally highly conserved from prokaryotes to eukaryotes . In this review, we explore the potential role of the evolutionary conserved bacterial proteins in the production of autoantibodies with focus on granulomatosis with polyangiitis (gpa) and rheumatoid arthritis (ra). Gpa (wegener's) is a type of anca - associated vasculitis that affects small- and medium - sized vessels in many organs . Its clinical symptoms include fever, fatigue, weight loss, nasal discharge, sinusitis, cough, dyspnea, hematuria, and proteinuria . Pathologically, gpa is characterized by multi - focal granulomatous inflammation with central necrosis and necrotizing vasculitis . In addition, the presence of an anca in serum is used as a diagnostic marker . There are two types of ancas, i.e., directed against either proteinase 3 (pr3-anca) or myeloperoxidase (mpo - anca). The anca antigen specificity of gpa in european patients is predominantly pr3, whereas that in japanese patients is predominantly mpo . The pathogenesis of necrotizing vasculitis is understood to involve infiltration of neutrophils into vessel walls and their subsequent activation . Anca is known to mediate the activation of neutrophils and degranulation via crosslinking of the fc receptor and antigens expressed on the membrane . However, what causes the production of anca and granulomatous inflammation, is not known . Chronic nasal carriage of staphylococcus aureus is increased in gpa patients compared to healthy subjects (63% vs. 25%), and the carriage of s. aureus increases the risk of relapse by 7.16 fold (9). Furthermore, the addition of trimethoprim / sulfamethoxazole to maintenance treatment reduced the relapses by 60% (10). Although the underlying mechanisms for the increased relapse by s. aureus is not clear, potential roles in polyclonal activation of b cells, priming of neutrophils, and induction of anti - idiotypic antibodies to pr3-anca have been suggested (6). Reported a new anca directed against lysosomal membrane glycoprotein 2 (lamp-2) as a specific marker for focal necrotizing glomerulonephritis and showed that the autoantibodies to lamp-2 can be induced by immunization with fimh, a bacterial fimbrial adhesin of gram - negative bacteria (11). The eight amino acids of one lamp-2 epitope (p41 - 49) recognized by autoantibodies have a strong homology with the fimh of several common gram - negative species, suggesting molecular mimicry between the two proteins . We previously demonstrated that the membrane bound pr3 on neutrophils acts as a receptor for non - opsonic phagocytosis of bacteria and that the neutralization of pr3 with anca reduces both binding and phagocytosis of bacteria (12). It raised the possibility that anca may be induced by some pathogens possessing a pr3-homologous protein to avoid host immunity . When the bacterial protein database was searched using the pr3 protein sequence as a query, hundreds of bacterial proteases with 28% to 36% identity were indeed found . Among the bacteria containing pr3-homologous proteases, only vibrio cholerae, v. vulnificus, v. parahaemolyticus, and saccharomonospora viridis the spores of s. viridis, a gram - negative bacterium frequently found in hot compost and hay, can be readily dispersed in air . Prolonged exposure to those spores can cause farmer's lung, bagassosis, and humidifier fever that manifest symptoms such as fever, malaise, cough, and dyspnea similar to gpa (13). Granulomas are usually formed in an attempt to segregate foreign substances that are resistant to phagocytic clearance . If s. viridis induces anca production via molecular mimicry, the anca would inhibit phagocytosis of s. viridis . Furthermore, if s. viridis survives after phagocytosis, infection with s. viridis may also contribute to the formation of granulomatous inflammation . Already proposed evolutionarily conserved antigens as stimuli to cause breakdown of tolerance and reported well - conserved bacterial orthologs for pyruvate dehydrogenase complex e2, glutamic acid decarboxylase, histidyl - trna synthetase, and enolase among seven major autoantigens examined (14). Therefore, we further explored the possibility that evolutionarily conserved bacterial proteins are involved in autoantibody production in ra, the most common systemic autoimmune disease . Ra is characterized by the presence of diverse autoantibodies in serum and synovial fluid . Rheumatoid factor (rf) is the first autoantibody described in ra, which is directed against the fc portion of igg, a major serum component (15). The anti - citrullinated protein antibodies are a group of autoantibodies that recognize citrulline - containing peptides / proteins as common antigenic epitopes (16). Other antigens characterized as targets of autoantibodies in ra include type ii collagen (cii), binding immunoglobulin protein (bip), glucose-6-phosphate isomerase (g6pi), -enolase, and heterogeneous nuclear ribonuclear protein (hnrnp) a2 (17). Homology search with the sequence of human immunoglobulin gamma-1 heavy chain constant region did not retrieve any bacterial proteins . When the ch2 and ch3 domains, the antigenic epitopes of rf, were searched separately, however, several bacterial proteins such as the cell wall binding repeat 2 family protein and cell surface protein of clostridium difficile were found to share 46% similarities with the ch2 over 76% of the domain . Ra patients often contain high titers of anti - cii antibodies in sera and synovial fluids (19). Because cii is exclusively expressed in the cartilage, autoantibodies against cii induce joint destruction . Surprisingly, a large number of bacterial species contain collagen triple helix repeat family proteins that share a high degree of identity (32~47%) and homology (36~52%) with human cii . Among those, important human pathogens such as clostridium difficile and bacillus cereus (20,21) and a member of normal gut flora c. beijerinckii (22) bip (also known as 78 kda glucose - regulated protein or heat shock 70 kda protein 5), is a stress protein located in the endoplasmic reticulum . Therefore, cellular and humoral immune responses initiated by microbial stress proteins may target cross - reactive self proteins, resulting in autoimmunity (24). Among the hundreds of bacterial species that contain a bip - homologous stress protein dnak, human pathogens such as bartonella spp . In addition to the pathogenic bacteria, a number of bacteria in the human oral flora such as prevotella spp . And atopobium parvulum contained the bip - homologous dnak . Selective examples of bacterial dnak listed in table iii have 49~54% identities and 67~70% similarities with the human bip over 92% of the entire protein . Glucose-6-phosphate isomerase (g6pi) is a ubiquitously expressed glycolytic enzyme that is also highly conserved through evolution . Selected bacterial g6pis for several human - associated species present even higher identities (65~68%) and similarities (78~80%) than those observed in the stress protein bip (table iv). The human - associated bacteria include both commensals and pathogens that colonize the respiratory tract, urinary tract, or gastrointestinal tract . Given the high degree of similarity between the human and bacterial g6pis shown in table iv, it can be speculated that a large body of human - associated bacteria, including those in the normal flora, may share significant homology (greater than 30%) in their g6pis with the human protein . K / bxn mice spontaneously develop autoantibodies to g6pi and autoimmune arthritis (25). The serum autoantibody titer and autoimmune arthritis in the k / bxn mice are significantly attenuated under germ - free conditions, which are reinstated by the introduction of a single gut - residing species, asegmented filamentous bacteria (26). A homology search revealed that the g6pi of the segmented filamentous bacteria candidatus arthromitus sp . Sfb - mouse - japan has 40% homology with a mouse g6pi, supporting the role of this bacterium in anti - g6pi antibody production . It is also expressed on the surface of stimulated leukocytes, and then serves as a plasminogen - binding receptor, which assists in inflammatory cell invasion (27). The similar usage of enolase and plasminogen for the invasion of host tissue has been demonstrated by several pathogens (28). Interestingly, members of the normal flora in the oral cavity and gut express the enolase that shares a high degree of identity (51~55%) and similarity (68~72%) with the human -enolase (table v). The enolases of several important human pathogens such as treponema denticola, turicella otitidis, clostridium botulinum, bacillus cereus, and neisseria meningitidis also have high degrees of homology with the human -enolase . The hnrnp a2 is an abundant rna - binding protein that is predominantly expressed inside the nucleus and involved in pre - mrna splicing, mrna transport, and translation (29). Although bacteria do not make mrna, a homology search using the hnrnp a2 retrieved 61 bacterial proteins that share 27~49% identities and 51~73% similarities with the first rna recognition motif (rrm) superfamily domain of hnrnp a2 . Indeed, all retrieved bacterial proteins were rna - binding proteins . Among them, variovorax paradoxus is a member of the human oral flora, and acidovorax avenae and delftia acidovorans are involved in catheter - related infection (table vi). It is remarkable that most of the pathogenic bacteria listed in table ii~v have been reported to develop reactive arthritis, septic arthritis, or rheumatic symptoms (30 - 38). Accumulating evidence suggests that not only infectious but also indigenous microorganisms may be involved in the initiation and perpetuation of ra (39). Increased epithelial permeability, loss of immune tolerance, and trafficking of both microbial components and activated immune cells to the joints have been suggested as underlying mechanisms for the involvement of the indigenous bacteria (39). We explored seven autoantigens for the presence of evolutionary conserved counterparts in the bacterial protein database . Of the seven autoantigens, pr3, cii, bip, g6pi, -enolase, and hnrnp a2 have well conserved bacterial orthologs . Although there are no bacterial orthologs for human immunoglobulin gamma-1 heavy chain constant region, proteins with an immunoglobulin superfamily domain are found in bacteria . The wide distribution of the highly conserved dnak, g6pi, or enolase among the members of the normal flora and common infectious microorganisms rather raises the question on how cross - reactive autoantibodies are not produced during the immune response to these bacteria in most healthy people . Understanding the mechanisms that deselect auto - reactive b cell clones during the germinal center reaction to homologous foreign antigens may provide a novel strategy to treat autoimmune diseases.
Patients who had undergone previous keratoplasty have weakened corneal structure and are liable to have a wound dehiscence after being subjected to trauma [14]. Usually, the site of rupture globe is located at the host - graft junction [5, 6]. The explanation of this weak host - graft junction may be due to several factors such as inappropriate wound apposition, avascularity of the interface, prolonged treatment with topical steroids, and suture complications [69]. Deep anterior lamellar keratoplasty (dalk) has the advantage of no endothelial rejection because it maintains the recipient corneal endothelium . This leads to less need for long term use of topical steroids with lower incidence of related complications such as glaucoma and infection [1013]. Another advantage of dalk over pkp is that it maintains better globe integrity, thus leaving the eyes less susceptible to trauma [14, 15]. In the literature, reported cases of traumatic wound dehiscence following dalk are less than that reported following pkp [1521]. The aim of the current study was to evaluate the patients' characteristics, risk factors, complications, and visual outcome of traumatic wound dehiscence after keratoplasty . This is a retrospective case series that included 20 eyes of 20 patients who had undergone a keratoplasty procedure followed by traumatic wound dehiscence . Those 20 patients represent around 4% of the total number of keratoplasty patients' records scanned during the period between 2010 and 2014 . The data recorded included the type of the keratoplasty procedure, the indication for the keratoplasty, sex, age at the time of the trauma, type of the trauma, the time interval between the previous keratoplasty and the trauma, size of the wound dehiscence, anterior segment complications, posterior segment complications, and visual outcome . The wound was sutured with 10 - 0 nylon and if needed anterior vitrectomy and iris repositioning were performed . The mean duration of follow - up after repair was 21 months (range 13 to 48 months). Complete ophthalmic examination was done and final best spectacle corrected visual acuity (bscva) was measured . This study was approved by the local research committee of faculty of medicine, alexandria university, egypt . The ratio of males to females was 7: 3 . The procedure of previous corneal transplantation was pkp in 16 eyes (80%) and dalk in 4 eyes (20%). Thirteen eyes (65%) had interrupted sutures and 7 eyes (35%) had double running sutures . The indication for keratoplasty was keratoconus in 11 eyes (55%), corneal opacity either postinfectious (bacterial and herpetic) or due to other causes in 5 eyes (25%), and pseudophakic bullous keratopathy in 3 eyes (15%), and one eye (5%) suffered from congenital hereditary endothelial dystrophy . The topical steroid eye drops used after the previous keratoplasty were prednisolone acetate 1% eye drops given 5 times a day for three months followed by gradual tapering over three months . Pkp patients were given topical steroid eye drops once daily for additional 6 months while dalk patients were given topical steroids eye drops once daily for additional 3 months . Mean age at the time of trauma of the included eyes was 34.7 16.6 years (range from 19 to 72 years). Mean duration between the time of previous keratoplasty and the trauma was 15.5 10.7 months (range from 2 to 35 months). Ten cases (50%) of traumatic wound dehiscence occurred during the first year following the keratoplasty procedure, four cases (20%) occurred during the second year, and six cases (30%) occurred during the third year (p <0.05). The causes included accidental hit by a door or a blunt object, minor trauma by a finger, falls, assaults, accidents, and sports injury . The cause of trauma in elderly was falls in 2 cases (66.6%) and blunt trauma in one case (33.3%). None of the included patients had worn any protective eye wear following the keratoplasty procedure . The site of the globe rupture in all cases was at the host - graft junction resulting in traumatic wound dehiscence of the previous keratoplasty procedure . Three eyes (15%) had a wound involving three quadrants . In dalk cases, the extent of the wound dehiscence was as follows: 3 eyes (75%) had a wound dehiscence involving two quadrants and 1 eye (25%) had a wound dehiscence limited to one quadrant . Using fisher's exact test, there was no statistically significant difference (p = 0.283). The site of the wound dehiscence in most of the cases (15 eyes; 75%) was either superonasal or inferotemporal . In the cases of previous keratoconus, the wound dehiscence was more inferior than superior (7 eyes versus 4 eyes, resp . ). The associated anterior segment injuries included iris prolapse in 17 eyes (85%), traumatic aniridia in one eye, hyphema in 15 eyes (75%), and lens extrusion in 12 eyes (60%). The associated posterior segment injuries included vitreous prolapse in 12 eyes (60%), vitreous hemorrhage in 11 eyes (55%), and retinal detachment within the first six months after trauma in 4 eyes (20%). In dalk cases, two eyes suffered from hyphema and two eyes suffered from lens extrusion and vitreous prolapse . There was no statistically significant association relating dalk cases to lower incidence of anterior segment complications (p> 0.05). None of dalk cases had retinal detachment or needed vitreoretinal intervention (p = 0.001). Ten eyes (50%) had undergone regrafting because of graft failure (9 previous pkp patients versus one previous dalk patient). Three cases (15%) suffered from intractable glaucoma that necessitated the need for implantation of ahmed glaucoma valve . Secondary intraocular lens implantation either alone or combined with another procedure such as regrafting was performed in 11 eyes (55%). Iris lens complex was needed in the case of traumatic aniridia and was implanted in combination with regrafting . Two cases suffered from complicated posterior subcapsular cataract and one of them had undergone cataract extraction with intraocular lens implantation . Iridoplasty was performed as a part of other surgical procedures, for example, secondary intraocular lens implantation or regrafting . The other four cases had retinal detachment and underwent vitreoretinal surgery to repair the detachment . The anatomical result was satisfactory except for one case that suffered from redetachment and underwent another vitreoretinal procedure with silicone oil tamponade . This case had late graft failure and underwent regrafting and was left aphakic because of aniridia and difficult secondary intraocular lens implantation . The best spectacle corrected visual acuity (bscva) of this eye was 0.1 in the final follow - up . The final bscva was 0.1 or better in 5 cases (25%), was better than hand motions (hm) to less than 0.1 in 7 cases (35%), was hand motions (hm) or light perception (pl) vision in six cases (30%), and was no light perception vision in 2 cases (10%). Two cases of dalk had final bscva of 0.1 or better and the other two cases had final bscva between 0.1 and better than hm . Cases of dalk had better final visual outcome, but this was not statistically significant using fisher's exact test (p = 0.33). As regards posttraumatic wound repair corneal astigmatism in the cases with clear graft, the mean corneal astigmatism after resuturing and before any second intervention was 5.50 1.55 d. traumatic wound dehiscence after keratoplasty has a worse prognosis than other cases of traumatic globe rupture [6, 22]. It occurs in around 0.6 to 5.8% of patients with previous keratoplasty [14, 23]. The usual site of rupture is the host - graft junction indicating a weakness in this area despite wound healing . Cases with previous keratoplasty either pkp or dalk are liable to ruptured globe even from mild trauma . In the current case series, four cases of traumatic wound dehiscence following dalk procedure cases reported in the literature of traumatic wound dehiscence following dalk are less than that reported following pkp [14, 15]. More than two thirds of the included patients were males and the most common indication for keratoplasty was keratoconus followed by other indications . Most authors report higher incidence of traumatic wound dehiscence after keratoplasty in younger age and in keratoconus patients [3, 22, 24]. In contrast, some authors did not associate a higher incidence with younger age or keratoconus [1, 25]. Keratoconus is a common indication for keratoplasty and keratoconus is common in younger age . Also, younger age group especially males is more active and is more liable to trauma . Therefore, the previously mentioned factors are interrelated and cannot be used to relate a higher incidence of traumatic wound dehiscence after keratoplasty with a weaker wound construction or other related factors to the healing process itself . This higher incidence can be simply explained by more liability to trauma due to active lifestyle . In the current study, the type of suturing technique was interrupted in two - thirds of the cases reported . This agrees with other reports that showed continuous suturing technique to be more stable than interrupted suturing technique in preserving the globe from rupture [7, 24]. As regards the duration between keratoplasty and the traumatic wound dehiscence, half of the cases occurred in the first year followed by the third and second years . Rehany and rumelt explained that the higher incidence of traumatic wound dehiscence in the early period after keratoplasty could be related to wound weakness, visual rehabilitation following keratoplasty, and increased physical activity of the patients . In the current series, the mean duration between the time of trauma and the previous keratoplasty was 15.5 10.7 months (range from 2 to 35 months). In the literature, this duration varied from 4 months to 7 years [1, 7, 22, 24]. Although many studies reported higher incidence in the first two or three years following keratoplasty, [3, 23, 25] late occurrence has been reported indicating unstable wound that never reaches its original strength even late after keratoplasty [1, 22, 26]. As regards the mechanism of trauma, all the cases were subjected to blunt trauma from different causes . In elderly group, falls were more common . The site of traumatic wound dehiscence was more common in either superonasal or inferotemporal quadrants; this could be explained by the exposed temporal part of the globe that is less protected by bone . In keratoconus, inferior site of the dehiscence was more common; this could be explained by thinner stroma and weaker wound in the inferior part due to the keratoconus pathology itself . Deep anterior lamellar keratoplasty cases seem to have less wound extent than pkp cases, but this was not statistically significant . This needs larger number of reported cases of traumatic wound dehiscence following dalk to get a statistically significant difference . In the current series, lens extrusion occurred in 60% of the cases; this could be explained by the extent of the wound dehiscence that was large enough to allow the lens to be extruded and the severity of the trauma itself . Other studies reported similar associated anterior and posterior segments injuries with variable incidence rates [1, 3, 5, 27]. Reported similar incidence of iris prolapse (71.9%) but lower incidence of hyphema (40.6%) and lens extrusion (34.4%). Posterior segment complications included vitreous hemorrhage and retinal detachment which lead to poor prognosis and needed a further intervention . Graft failure could be explained by endothelial cell injury and corneal decompensation either from trauma or surgical manipulations . None of the dalk cases had retinal detachment or needed vitreoretinal intervention, but the number of cases is too small to get a clinical conclusion or a statistically significant difference . Apparently, dalk seems to result in better corneal structure than pkp but this needs more reported cases of traumatic wound dehiscence following dalk for proper comparison with that following pkp . As regards the final visual outcome, many studies report a poor visual outcome in cases of traumatic wound dehiscence after keratoplasty [1, 2225]. In the current series the other 75% had final visual outcome of less than 0.1 with 2 cases of no light perception vision . Jafarinasab et al . Reported that 43.7% of their patients had final visual acuity of hand motions or less . Cases of dalk seem to have better final visual outcome . This may be explained by less wound extent, decreased rate of rejection, better corneal wound integrity and preserved structure, and less posterior segment complications . In conclusion, traumatic wound dehiscence following keratoplasty results in poor visual outcome . The dehiscence seems most likely to occur during the first year . Whenever possible dalk should be used instead of pkp in young active persons especially males and who has keratoconus . As none of the cases wore protective glasses, it would be a good idea to advise cases of previous keratoplasty to wear one . Femtosecond laser - assisted keratoplasty may offer better stability due to modified and more precise host - graft junction wound configuration.
Written informed consent was obtained from 18 healthy, nonsmoking subjects (men / women 5/13, mean sd age 27.2 9.4 years, mean bmi 23.6 2.8 kg / m, mean fasting plasma glucose level 5.09 0.35 none of the participants were on chronic medication (with the exception of oral contraceptives), reported type 2 diabetes among first - degree relatives, or had a history of cardiovascular events . A pregnancy test was performed in female subjects at the screening visit to exclude pregnancy . The study was approved by the institutional review board of the radboud university nijmegen medical centre . All participants underwent two euglycemic glucose clamp experiments (13,16) to investigate the pharmacokinetics and pharmacodynamics of rapid - acting insulin delivered by jet injection or conventional pen injection, using a double - blind, double - dummy, randomized cross over study design . There was a washout period of at least 1 week between the two clamps, whereas female subjects were tested at 4- or 8-week intervals to ensure that experiments took place during corresponding periods of the menstrual cycle . Participants were admitted to the research unit at 0830 h after an overnight fast and having abstained from smoking, alcohol use, and caffeine use for at least 24 h. the experiments were performed in supine position in a temperature controlled room (2224c). One catheter was inserted in retrograde fashion in a dorsal hand vein for blood sampling . This hand was placed in a heated box, kept at 55c to arterialize venous blood (17,18). The other catheter was placed in an antecubital vein of the contralateral arm for administration of 20% dextrose . After instrumentation, a 30-min equilibration period was included before blood was sampled for baseline values of plasma glucose and plasma insulin . Subsequently, all participants received both insulin (aspart, novo nordisk, bagsvaerd, denmark) in a dose of 0.2 units / kg body wt and a comparable volume of placebo solution (test medium penfill, novo nordisk, bagsvaerd, denmark) simultaneously injected subcutaneously in the abdomen . On one occasion, insulin was administered by jet injection (insujet, european pharma group bv, schiphol - rijk, the netherlands) and placebo by conventional pen (novopen iii, novo nordisk); on the other occasion, insulin was injected by the conventional pen and placebo by the jet injector . Two - by - two block randomization was used to randomize the sequence by which the two devices were used for insulin and placebo injections . The jet injector device used in this study was equipped with a loaded spring mechanism, kept in place by a counterpressure lock / release system . After pressing the nozzle perpendicular to the skin, the jet injector releases insulin with sufficient force to enter the subcutaneous tissue to a depth equivalent to standard needle syringe . To avoid premature insulin release, both the jet injector and the conventional pen were operated by trained personnel only and were prepared by a nurse who was not involved in the trial . After administration of insulin and placebo solution, plasma glucose was maintained at euglycemic levels (5.0 mmol / l) for 8 h by a variable infusion of 20% dextrose, the rate of which was determined by plasma glucose measurements at 5-min intervals during the first 4 h and at 10-min intervals thereafter . Blood for plasma insulin levels was sampled every 10 min during the 1st hour and every 30 min for the remainder of the study . All pharmacodynamic and pharmacokinetic study end points were derived from the exogenous glucose infusion rate (gir) and insulin concentration profiles . The primary study end point was the time to maximal gir (t - girmax), corresponding to the time until the maximal glucose - lowering effect of insulin was obtained . Secondary pharmacodynamic end points were the maximal gir (c - girmax), the time to 50% of glucose disposal (t - gir50%), and the total amount of glucose administered calculated from the area under the curve (auc) (girtot). Secondary pharmacokinetic end points included the time to maximal insulin concentration (t - insmax), the maximal insulin concentration (c - insmax), the area under the insulin concentration curve (insauc), and the time until 50% of insulin absorption, calculated as 50% of the area under the insulin concentration curve (t - insauc50%). Plasma glucose levels were determined in duplicate, immediately after blood sampling by the glucose oxidase method (beckman glucose analyzer ii, beckman instruments, fullerton, ca). Blood sampled for plasma insulin measurements was collected in lithium - heparin tubes and placed on ice . Assuming a t - girmax of 94 min with a sd of 46 min for aspart insulin administered subcutaneously in the abdomen by conventional pen injection (10), we calculated that a total of 18 subjects would be needed to find a 20% reduction in the primary end point with 80% statistical power at the conventional p value of 0.05, after correction for small sample sizes . All statistical analyses were performed by spss 16.0 (statistical package for social sciences, chicago, il). A p value of <0.05 was considered statistically significant . All participants underwent two euglycemic glucose clamp experiments (13,16) to investigate the pharmacokinetics and pharmacodynamics of rapid - acting insulin delivered by jet injection or conventional pen injection, using a double - blind, double - dummy, randomized cross over study design . There was a washout period of at least 1 week between the two clamps, whereas female subjects were tested at 4- or 8-week intervals to ensure that experiments took place during corresponding periods of the menstrual cycle . Participants were admitted to the research unit at 0830 h after an overnight fast and having abstained from smoking, alcohol use, and caffeine use for at least 24 h. the experiments were performed in supine position in a temperature controlled room (2224c). One catheter was inserted in retrograde fashion in a dorsal hand vein for blood sampling . This hand was placed in a heated box, kept at 55c to arterialize venous blood (17,18). The other catheter was placed in an antecubital vein of the contralateral arm for administration of 20% dextrose . After instrumentation, a 30-min equilibration period was included before blood was sampled for baseline values of plasma glucose and plasma insulin . Subsequently, all participants received both insulin (aspart, novo nordisk, bagsvaerd, denmark) in a dose of 0.2 units / kg body wt and a comparable volume of placebo solution (test medium penfill, novo nordisk, bagsvaerd, denmark) simultaneously injected subcutaneously in the abdomen . On one occasion, insulin was administered by jet injection (insujet, european pharma group bv, schiphol - rijk, the netherlands) and placebo by conventional pen (novopen iii, novo nordisk); on the other occasion, insulin was injected by the conventional pen and placebo by the jet injector . Two - by - two block randomization was used to randomize the sequence by which the two devices were used for insulin and placebo injections . The jet injector device used in this study was equipped with a loaded spring mechanism, kept in place by a counterpressure lock / release system . After pressing the nozzle perpendicular to the skin, the jet injector releases insulin with sufficient force to enter the subcutaneous tissue to a depth equivalent to standard needle syringe . To avoid premature insulin release, the system unlocks only when sufficient pressure has been applied to the nozzle . Both the jet injector and the conventional pen were operated by trained personnel only and were prepared by a nurse who was not involved in the trial . After administration of insulin and placebo solution, plasma glucose was maintained at euglycemic levels (5.0 mmol / l) for 8 h by a variable infusion of 20% dextrose, the rate of which was determined by plasma glucose measurements at 5-min intervals during the first 4 h and at 10-min intervals thereafter . Blood for plasma insulin levels was sampled every 10 min during the 1st hour and every 30 min for the remainder of the study . All pharmacodynamic and pharmacokinetic study end points were derived from the exogenous glucose infusion rate (gir) and insulin concentration profiles . The primary study end point was the time to maximal gir (t - girmax), corresponding to the time until the maximal glucose - lowering effect of insulin was obtained . Secondary pharmacodynamic end points were the maximal gir (c - girmax), the time to 50% of glucose disposal (t - gir50%), and the total amount of glucose administered calculated from the area under the curve (auc) (girtot). Secondary pharmacokinetic end points included the time to maximal insulin concentration (t - insmax), the maximal insulin concentration (c - insmax), the area under the insulin concentration curve (insauc), and the time until 50% of insulin absorption, calculated as 50% of the area under the insulin concentration curve (t - insauc50%). Plasma glucose levels were determined in duplicate, immediately after blood sampling by the glucose oxidase method (beckman glucose analyzer ii, beckman instruments, fullerton, ca). Blood sampled for plasma insulin measurements was collected in lithium - heparin tubes and placed on ice . Assuming a t - girmax of 94 min with a sd of 46 min for aspart insulin administered subcutaneously in the abdomen by conventional pen injection (10), we calculated that a total of 18 subjects would be needed to find a 20% reduction in the primary end point with 80% statistical power at the conventional p value of 0.05, after correction for small sample sizes . All statistical analyses were performed by spss 16.0 (statistical package for social sciences, chicago, il). A p value of <0.05 was considered statistically significant . All 18 subjects completed the study . In two subjects, one of the clamp experiments had to be rescheduled because insulin levels failed to increase, with both incidents occurring when the jet injector contained insulin . In one instance, the jet injector was incompletely checked for air bubbles in the system . In the other instance, the spring was released before proper contact could be made with the skin, after which the jet injector was returned to the manufacturer and replaced . Injections were well tolerated by the participants, although some participants regarded the firm pressure required for injection with the jet injector as unpleasant . Mean plasma glucose levels during the clamps were 5.0 0.1 mmol / l with both devices . The corresponding coefficients of variation were 8.0 0.8% and 7.3 0.5% for the jet injector and conventional insulin pen, respectively . All results of pharmacodynamic end points are shown in fig . 1 and listed in table 1 . The time to maximal glucose - lowering effect, as represented by t - girmax, was reduced by> 50% when insulin was administered with the jet injector as compared with conventional insulin administration . There were no differences in maximal glucose - lowering effect (c - girmax) or the total amount of glucose administered (girtot) between the two devices . However, the time to 50% of glucose disposal (t - gir50%), representing the total duration of insulin action, was approximately 40 min shorter for insulin administration by jet injector than that by conventional insulin pen . Mean gir after administration of rapid - acting insulin by the jet injector (closed symbols, black line) or the conventional insulin pen (open symbols, dashed line) during the euglycemic glucose clamp . Pharmacokinetic and pharmacodynamic parameters for insulin administration with the jet injector and the conventional insulin pen the results of pharmacokinetic end points are also listed in table 1 . In analogy with the pharmacodynamic results, the time to reach peak insulin levels was reduced by more than 50% after jet injector insulin administration as compared with insulin administration with the conventional pen . Insulin administered with the jet injector also resulted in higher peak insulin levels (c - insmax) than insulin administered with the conventional insulin pen (fig . 2). The insauc did not differ between the jet injector and the conventional insulin pen, but t - insauc50% was significantly shorter for the jet injector, indicating faster insulin absorption from the subcutaneous tissue into the circulation . Mean plasma insulin levels after administration of rapid - acting insulin by the jet injector (closed symbols, black line) or the conventional insulin pen (open symbols, dashed line) during the euglycemic glucose clamp . There was no indication that sex modified the pharmacodynamic or pharmacokinetic differences between the jet injector and conventional pen for insulin administration . In fact, the jet injector performed significantly better than the conventional pen in both groups, when analyzed separately (data not shown but available upon request). All results of pharmacodynamic end points are shown in fig . 1 and listed in table 1 . The time to maximal glucose - lowering effect, as represented by t - girmax, was reduced by> 50% when insulin was administered with the jet injector as compared with conventional insulin administration . There were no differences in maximal glucose - lowering effect (c - girmax) or the total amount of glucose administered (girtot) between the two devices . However, the time to 50% of glucose disposal (t - gir50%), representing the total duration of insulin action, was approximately 40 min shorter for insulin administration by jet injector than that by conventional insulin pen . Mean gir after administration of rapid - acting insulin by the jet injector (closed symbols, black line) or the conventional insulin pen (open symbols, dashed line) during the euglycemic glucose clamp . Pharmacokinetic and pharmacodynamic parameters for insulin administration with the jet injector and the conventional insulin pen the results of pharmacokinetic end points are also listed in table 1 . In analogy with the pharmacodynamic results, the time to reach peak insulin levels was reduced by more than 50% after jet injector insulin administration as compared with insulin administration with the conventional pen . Insulin administered with the jet injector also resulted in higher peak insulin levels (c - insmax) than insulin administered with the conventional insulin pen (fig . 2). The insauc did not differ between the jet injector and the conventional insulin pen, but t - insauc50% was significantly shorter for the jet injector, indicating faster insulin absorption from the subcutaneous tissue into the circulation . Mean plasma insulin levels after administration of rapid - acting insulin by the jet injector (closed symbols, black line) or the conventional insulin pen (open symbols, dashed line) during the euglycemic glucose clamp . There was no indication that sex modified the pharmacodynamic or pharmacokinetic differences between the jet injector and conventional pen for insulin administration . In fact, the jet injector performed significantly better than the conventional pen in both groups, when analyzed separately (data not shown but available upon request). In this study, the pharmacodynamic and pharmacokinetic profiles of the rapid - acting insulin analog aspart, injected by either jet injection technique or by conventional insulin pen, were compared . We found that the jet injector greatly enhanced the rate of insulin absorption, resulting in a truly immediate onset of action and approximately halving of the time to reach maximal glucose - lowering effect in comparison with conventional insulin administration . In addition, insulin administration by jet injection reduced the total duration of hyperinsulinemia and insulin action by 3040 min when compared with conventional insulin administration . There were no indications that these benefits of the jet injector over the conventional pen differed between women and men . Our data are in line with previous studies that have shown a more rapid increase in insulin levels and shorter duration of hyperinsulinemia after administration of regular insulin by jet injection compared with administration by needle syringe (38). The results of the current study also extend those of a recent study performed by sarno et al . (9), who compared administration of various insulins (including lispro insulin) with jet injection to that with needle syringes . In that study, time to peak insulin levels after lispro insulin administration was shorter for the jet injector than for needle syringe injection, but a statistically significant pharmacodynamic effect could not be established . Also, the number of volunteers examined was small (n = 4) and the dose of insulin used was fixed at a relatively high level (30 units for all). Our study convincingly shows the pharmacokinetic and pharmacodynamic superiority of jet injection over conventional needle pens for administration of rapid - acting insulin at a dose that is realistic for many people with type 1 or type 2 diabetes . It is also the first time that jet injection technology was compared with an insulin pen, which most patients prefer over syringes for their ease of use and high level of accuracy (20). Insulin injected by jet injection displays a specific cone - like dispersion pattern in the subcutaneous tissue with a relatively large surface area (1,2). It seems plausible that this dispersion pattern enhances absorption of insulin into the circulation, thus explaining a more immediate glucose - lowering effect . The current jet injector uses a high - velocity jet that ensures> 90% delivery of injected insulin into the subcutaneous tissue, without risking penetration of the underlying muscle, at a jet stream diameter of 0.15 mm . These device characteristics compare favorably to the length and diameter of pen needles that typically measure 68 mm and 0.5 mm, respectively . A limitation to the use of jet injectors in comparison with insulin pens is that sufficient training is required with both air - free filling of the injection chamber and the injection procedure itself . We had to reschedule the first experiment, probably because of an air bubble in the system, and another experiment because of early discharge of the spring system, possibly related to failure of the lock / release system . However, after proper training, administration of the entire dose of insulin can be achieved in almost all instances (21). The pharmacokinetic and pharmacodynamic profile of rapid - acting insulin administered by the jet injector approached the physiological pattern of endogenous insulin secretion and subsequent glucose - lowering response more closely than insulin administered by a conventional insulin pen . Consequently, a more physiological meal insulin substitution may decrease immediate postprandial hyperglycemia, whereas the more rapid tapering of hyperinsulinemia may reduce the risk of late postprandial hypoglycemia . However, postprandial glucose may contribute less to overall glycemic control than preprandial glucose in patients with diabetes, and the role of postprandial hyperglycemia as an independent cardiovascular risk factor is still uncertain (22). Therefore, appropriately designed studies are needed to determine whether and to what extent the favorable pharmacological properties of insulin administration by jet injection found in this study translate into clinical benefit in the longer term for patients with diabetes . A strength of our study is the use of a double - dummy cross over study design, ensuring that both participants and investigators were truly blinded during the execution of the experiments . Moreover, because we used a placebo solution that contained the same ingredients as the insulin solution (except for insulin), the smell and viscosity of the two liquids were indistinguishable . A limitation of this study is that the euglycemic clamps were performed in healthy individuals rather than in patients with diabetes, the target population for such a device . In addition, only one insulin dose was investigated; it cannot be determined with certainty whether the current differences in time - action profiles can be extrapolated to other insulin doses . Finally, the ease of use of the jet injector was not tested, which is important for a device that is aimed at being used on a daily basis . In conclusion, the current study shows that when insulin is administered with a jet injector instead of a conventional insulin pen, a more rapid onset of insulin action can be achieved . Insulin administered by the jet injector resembles the pattern of endogenous insulin secretion more closely and could therefore be useful in providing a more physiologic postprandial insulin profile . Future research will need to investigate whether these results can be replicated in patients with diabetes and what the clinical implications are.
Pediatric urinary stones are rare but have lifelong consequences . Because children have a small body size and delicate tissues, and because the use of general anesthesia is likely, treatment for pediatric stone disease requires thoughtful consideration and individualized therapy . Since extracorporeal shock wave lithotripsy (eswl) for pediatric urinary stones was first introduced by newman et al . In 1986, numerous reports have demonstrated the efficacy and safety of eswl in the pediatric population [4 - 20]. Eswl is now considered a first - line treatment for pediatric stone disease because of its minimal invasiveness and high success rate . Recent reductions in the size of endourological instruments, improvements in electronic video imaging systems, and advancements in endourological skill have given clinicians alternative surgical options such as ureteroscopic surgery (urs) or percutaneous nephrolithotomy (pcnl) for first- or second - line treatment of pediatric urolithiasis, including in cases of eswl failure . Nevertheless, the identification of variables that predict successful outcomes of eswl in the pediatric population would be useful . Therefore, we aimed to determine the factors affecting the outcome of eswl for unilateral urinary stones in children by reviewing 17 years of experience at samsung medical center . A total of 81 pediatric patients with urinary stones treated by eswl from january 1995 through may 2012 at samsung medical center were retrospectively reviewed . The following clinical data were documented: age and gender of patients, laterality and location of stones, maximum size of stones, number of eswl sessions, and treatment outcomes after eswl . Evaluated treatment outcomes after eswl were stone - free rate at 3 months after eswl, success within a single session, and success within three sessions . We investigated treatment outcomes according to stone location and analyzed the factors affecting success within three sessions . Exclusion criteria were disorders of the kidney, liver, intestine, or cardiovascular system; congenital anomalies of the urinary tract or nervous system; or psychological problems . Children who underwent other surgical procedures such as pcnl or endoscopic treatment before eswl were also excluded . All stones were identified by simple kidney - ureter - bladder x - ray, ultrasonography, or computed tomography scan if necessary ., all patients were routinely evaluated through a medical history, a physical examination, urinalysis, urine culture, serum chemistry profile, and coagulation profile . Children with poor cooperation were treated under general anesthesia; others were treated with analgesia without general anesthesia . Children with renal stones or upper ureteral stones were treated in the supine position, whereas children with mid or distal ureteral stones were treated in the prone position . The mpl-9000 lithotripter (dornier medizintechnik, germering, germany) was used from january 1995 to may 2008, and the modulith slx - f2 lithotripter (storz medical ag, tgerwilen, switzerland) was used from june 2008 to may 2012 . Treatment was initiated at 8.2 kv, which was gradually increased up to 17.0 kv with a maximum of 3500 shocks . The shockwave frequency was 1 hz . The interval between treatment sessions was 2 to 4 weeks to allow passage of fragmented debris and kidney recovery . Patients were evaluated 1 and 3 months after the last session by imaging modalities such as kidney - ureter - bladder x - ray, ultrasound, or computed tomography scan, if necessary . Success was defined as stone - free status or clinically insignificant residual fragments (cirfs). Children who underwent additional procedures (urs or pcnl) were not counted as a success . Chicago, il, usa). A chi - square test and a t test were used to analyze the related parameters and treatment outcomes according to the method of anesthesia . A t test and logistic regression analysis were used to evaluate the factors affecting the outcome of eswl . This study was approved by the institutional review board of samsung medical center . Under the board's approval, a total of 81 pediatric patients with urinary stones treated by eswl from january 1995 through may 2012 at samsung medical center were retrospectively reviewed . The following clinical data were documented: age and gender of patients, laterality and location of stones, maximum size of stones, number of eswl sessions, and treatment outcomes after eswl . Evaluated treatment outcomes after eswl were stone - free rate at 3 months after eswl, success within a single session, and success within three sessions . We investigated treatment outcomes according to stone location and analyzed the factors affecting success within three sessions . Exclusion criteria were disorders of the kidney, liver, intestine, or cardiovascular system; congenital anomalies of the urinary tract or nervous system; or psychological problems . Children who underwent other surgical procedures such as pcnl or endoscopic treatment before eswl were also excluded . All stones were identified by simple kidney - ureter - bladder x - ray, ultrasonography, or computed tomography scan if necessary ., all patients were routinely evaluated through a medical history, a physical examination, urinalysis, urine culture, serum chemistry profile, and coagulation profile . Children with poor cooperation were treated under general anesthesia; others were treated with analgesia without general anesthesia . Children with renal stones or upper ureteral stones were treated in the supine position, whereas children with mid or distal ureteral stones were treated in the prone position . The mpl-9000 lithotripter (dornier medizintechnik, germering, germany) was used from january 1995 to may 2008, and the modulith slx - f2 lithotripter (storz medical ag, tgerwilen, switzerland) was used from june 2008 to may 2012 . Treatment was initiated at 8.2 kv, which was gradually increased up to 17.0 kv with a maximum of 3500 shocks . The shockwave frequency was 1 hz . The interval between treatment sessions was 2 to 4 weeks to allow passage of fragmented debris and kidney recovery . Patients were evaluated 1 and 3 months after the last session by imaging modalities such as kidney - ureter - bladder x - ray, ultrasound, or computed tomography scan, if necessary . Success was defined as stone - free status or clinically insignificant residual fragments (cirfs). Children who underwent additional procedures (urs or pcnl) were not counted as a success . Statistical analyses were performed by using spss ver . 18.0 (spss inc ., chicago, il, usa). A chi - square test and a t test were used to analyze the related parameters and treatment outcomes according to the method of anesthesia . A t test and logistic regression analysis were used to evaluate the factors affecting the outcome of eswl . This study was approved by the institutional review board of samsung medical center . Under the board's approval, the study population was 64 children, 42 boys and 22 girls (mean age, 9.25.2 years; range, 0.5 to 15.9 years). Calculi were on the right side in 34 cases (53.1%) and on the left side in 30 cases (46.9%). Of the 64 patients, 5 (7.8%) had urinary stones in the upper or mid calyx, 5 (7.8%) in the lower calyx, 9 (14.1%) in the renal pelvis, 15 (23.4%) in the upper ureter, 17 (26.6%) in the lower ureter, and 13 (20.3%) in multiple locations . Of the 64 patients, 58 (90.6%) were treated by eswl without other surgical procedures and 54 (84.4%) were successfully treated within three eswl sessions . The percentage of treatment success for a single eswl session was 80.0% when the stone was solitary and located in the upper or mid calyx, 80% if in the lower calyx, 77.8% if in the renal pelvis, 93.3% if in the upper ureter, and 70.6% if in the lower ureter . The percentage of treatment success for a single eswl session in patients with stones in multiple locations was 30.8%, which was significantly lower than that for patients with a stone in a single location . The success rate within three eswl sessions was 100% (5 of 5 patients) when the stone was solitary and located in the upper or mid calyx, 100% (5 of 5 patients) if in the lower calyx, 88.9% (8 of 9 patients) if in the renal pelvis, 100% (15 of 15 patients) if in the upper ureter, and 88.2% (15 of 17 patients) if in the lower ureter . To avoid possible injury to developing reproductive systems, 2 of 17 patients (11.8%) with a solitary lower ureter stone were treated with additional urs after a single eswl session . Four of 13 patients (30.8%) with stones in multiple locations were treated with additional surgical treatments: two with urs, one with pcnl, and one with urs and pcnl . When the shockwave - related parameters and treatment outcomes were analyzed according to the method of anesthesia, the general anesthesia group was younger (p<0.001) and was more likely to have multiple stones (p=0.005). The success rate was not significantly different between the two groups (table 3). Transient renal colic, which was managed by antispasmodic and anti - inflammatory treatment, was observed in 3 patients (4.7%). Steinstrasses occurred in 2 of 13 patients (15.4%) with stones in multiple locations and was treated successfully by urs . No other complications occurred in any patients, such as hemorrhage that necessitated transfusion, infection, or injury of other organs . In the univariate analysis, multiplicity (p<0.001) and large stone size (> 10 mm) (p=0.001) significantly decreased the success rate within three eswl sessions (table 4). In the multivariate analysis, multiplicity (odd ratio [or], 0.080; 95% confidence interval [ci], 0.012 to 0.534; p=0.009) and large stone size (or, 0.112; 95% ci, 0.018 to 0.707; p=0.020) also decreased the success rate within three eswl sessions (table 5). Since the first report of success of eswl in a pediatric population by newman et al ., numerous reports have shown the safety and efficacy of eswl for treating pediatric urinary stones [4 - 20]. The joint european association of urology / american urological association nephrolithiasis guideline panel's 2007 guideline for the management of ureteral calculi states, " treatment choices should be based on the child's size and urinary tract anatomy . The small size of the pediatric ureter and urethra favors the less invasive approach of eswl " . Therefore, eswl remains a first - line treatment option for most pediatric cases of urinary stone disease . In addition to its noninvasive nature, eswl has other advantages in the treatment of pediatric urinary stones . For younger patients, the pediatric ureter is more elastic, more distensible, and shorter, which facilitates the passage of stone fragments and compensates for the narrower lumen . The small body volume of children allows the shockwaves to be transmitted with minimal energy loss . However, the application of many eswl sessions is a burden to pediatric patients because of the likely use of general anesthesia during the procedure and the increased susceptibility of children to radiation exposure . Until now, studies on eswl for pediatric urinary stone disease have reported a wide variation in success rate resulting from variation in the methods of different studies, the age of included patients, the machines used, the definition of success, and stone characteristics including size, location, and multiplicity (table 6) [4 - 20]. Thus, care must be taken in interpreting the success rate of different series, because 1) some reports on eswl monotherapy report success rates resulting from a single session and others report results from several sessions, and 2) some series define success as only a stone - free state whereas others include cirfs . In our study, we analyzed results by several definitions, namely, stone - free rate at 3 months after eswl, success within a single session, and success within three sessions . Most previous studies defined success as a stone - free rate at 3 months after eswl, reporting success rates of 71% to 97% . In our study, the stone - free rate at 3 months after eswl was 90.6% . We believe that our analysis of treatment success within one or three eswl sessions is an innovative approach . In clinical practice, an important issue during eswl treatment for pediatric urinary stone disease is the number of eswl sessions required for success . Because eswl in pediatric patients frequently requires general anesthesia when a clinician encounters a pediatric patient with stone disease, several factors affect success, such as stone location, size, and multiplicity . We surmised that three sessions of eswl would be a generally acceptable number for patients and their parents; thus, we analyzed factors affecting treatment success within three eswl sessions . The overall success rates were 70.3% for a single session and 84.4% for three eswl sessions . When urinary stones were not found in multiple locations, the success rate was 80.4% for a single eswl session and 94.1% for three sessions . Some studies suggest that no urinary stones in children are insignificant; others define cirfs as 3 or 4 mm . Although children's ureters are more elastic, more distensible, and shorter than the ureters of adults, thus permitting easier passage of stone fragments, the narrow lumen of the pediatric ureter interferes with the expulsion of stone fragments . Our analysis revealed that factors lowering the treatment success rate were stone multiplicity and large size (> 10 mm), as expected from the results of previous reports . When patients with multiple stones were excluded, three patients did not achieve success within three eswl sessions . Of these three, one had a 22-mm staghorn stone in the renal pelvis that completely fragmented without complication in 5 eswl sessions . The remaining two patients had lower ureteral stones that were not fragmented in a single eswl session . We did not attempt further eswl because of difficulties with localization over the sacroiliac joint and to avoid possible injury to the developing reproductive systems . An interesting finding of this study was that the success rate did not differ by stone location . When stones are in the lower pole calyx, the success rate of eswl depends not only on successful fragmentation but also on stone fragment clearance . Several studies have demonstrated a significantly lower success rate after eswl for lower pole stones than for other kidney locations . However, a recent study by goktas et al . Reported that eswl was highly successful for lower calyceal stones in pediatric patients compared with adults . The study suggested that eswl can be a first - line treatment for managing lower calyceal stones in children . The authors hypothesized that the high success rate of eswl treatment of pediatric lower calyceal stone resulted from 1) less shockwave energy loss during travel through the small body volume of a child, 2) the shorter ureter length in children, and 3) the more elastic and distensible ureters in children . In our study, the success rate for stones in the lower pole calyx was not significantly different from that of stones in other kidney locations: 80% for a single eswl session and 100% for three sessions . Concurring with previous reports, we recommend eswl as a first - line treatment, even for stones located in the lower pole calyx . However, our results were from a retrospective analysis with a small number of patients (n=5); thus, definite conclusions cannot be drawn about the success of eswl for lower calyceal stones . In our study, 2 of 64 patients (3.1%) experienced steinstrasse, which was treated by urs without sequelae . Both patients initially had multiple urinary stones . Of the possible complications after eswl for pediatric stone disease, steinstrasses seem to be most challenging and mainly results from large fragments or multiplicity . However, with advances in medical technology, the miniaturization of ureteroscopes has made treatment of steinstrasses easier, resulting in fewer complications . Therefore, we recommend eswl as a first - line treatment even for large or multiple stones, although this results in a risk of steinstrasse . However, during the study period, our interpretation of stone characteristics including stone location and size did not change . Neither did the eswl protocol for stone treatment . To the best of our knowledge, this study includes the largest number of pediatric stone patients in korea . If a child has a large urinary stone (> 10 mm) or multiplicity, the parents should be informed of the probability of needing several eswl sessions for complete stone fragmentation . In our 17-year single - institution experience, most pediatric urinary stone patients (58 of 64 [90.6%]) were successfully treated by eswl alone without additional procedures . The factors decreasing the success rate within three eswl sessions were multiplicity or large stone size (> 10 mm). No significant difference in success rate was observed by stone location for patients without multiplicity.
A 60-year - old asian woman, weighing 48 kg with a height of 147 cm, was scheduled for laparoscopic wedge resection of the stomach due to a gastrointestinal stromal tumor (gist). She had suffered from relapsing polychondritis for fifteen years and had been controlled with steroid therapy . Recently she presented aggravated dyspnea on exertion and had difficulty lying on her back because of orthopnea for a few of months . Forced vital capacity (fvc), forced expiratory volume in one second (fev1) and fev1/fvc were 2.23 l (94% of predicted), 0.69 l (40% of predicted), and 31%, respectively . A computed tomography (ct) scan of the neck also showed narrowing of the trachea at c5 - 6 level (approximately 5.75 mm in maximal diameter) (fig . An arterial blood gas test showed a ph 7.41, paco2 37 mmhg, pao2 69 mmhg, sao2 94%, and hco3 24 owing to potential risks of airway compromise during intubation and/or extubation of an endotracheal tube under general anesthesia, the operation was converted from a laparoscopic surgery to an open laparotomy under epidural analgesia one day before operation . Without premedication, the patient was reassured with sufficient explanation on the procedures and anesthetic technique . In the operating room, non - invasive blood pressure, electrocardiography, and pulse oxymetry after placing the patient in the left lateral decubitus position, an 18 gauge tuohy epidural needle was inserted between the seventh and eighth thoracic vertebrae . An epidural catheter was inserted in the epidural space through a needle and advanced 5 cm toward the cephalic direction . After a test dose injection of 3 ml of 2% lidocaine containing 1: 200,000 epinephrine, after a catheter was fixed, 7 ml of 0.75% ropivacaine and 50 g of fentanyl was injected . She was comfortable and did not complain of pain in the upper abdomen when the surgeon performed a midline skin incision above the umbilicus . Intraoperative vital signs were relatively stable with a blood pressure of 105 - 120/60 - 75 mmhg and a heart rate of 70 - 80 beats / min . During the operation, the stomach was pulled taut to resect the tumor because a mass was located at the posterior wall of the fundus . Being so, we infused remifentanil at 0.03 - 0.06 g / kg / min and spo2 slowly decreased to 95% from 98% . After applying a face mask at 5 l / min, after the operation, the patient was transferred to the post - anesthetic care unit and her vital signs including saturation were within acceptable ranges in room air . The patient was discharged on the sixth day after the operation without any airway complications . Relapsing polychondritis is a disorder that has a variety of clinical manifestations and is considered an autoimmune disease resulting in cartilage breakdown . The disorder is usually presented with episodes of erythema, pain, and swelling of the ears, nose, and joints . Laryngotracheal symptoms are present in approximately 25% of the patients in the initial course of the disease, however, airway symptoms eventually occur in 50% of all patients with relapsing polychondritis . The first is a stricture due to inflammatory swelling or scar formation in the glottic and subglottic areas . Accordingly, radiographic and bronchoscopic examinations may provide incorrect information for determining the degree of tracheal obstruction, as dynamic airway collapse occurs during respiration . However, inspiratory and expiratory flow - volume loops are useful in predicting the functional degree of intrathoracic and extrathoracic obstruction . In this case, the patient demonstrated severe airway obstruction on flow - volume loop that was well - correlated with her severe respiratory symptoms, including orthopnea . The most common causes of death among patients with relapsing polychondritis are infection, airway compromise, and cardiac complications . Deaths from infection are frequently associated with laryngotracheal disease and pneumonia as well as corticosteroid therapy . Cardiovascular involvement, such as valvular disorders, aneurysmal dilatation of the great vessels and systemic vasculitis has been reported with relapsing polychondritis . Unfortunately, valve replacement surgery does not offer good prognosis because of the progression of underlying connective tissue degeneration . Physiotherapy has a favorable effect on mucociliary clearance and may be useful for conditioning patients before elective surgical interventions . A tracheostomy or surgical interventions, such as airway stenting, airway stenting leads to considerable improvement in airflow, particularly during expiration if the collapsing segment can be broadened by a stent . The anesthetic management of patients with relapsing polychondritis is challenging due to airway compromise, which is also one of the most causes of death in this disease . During induction of anesthesia, furthermore, after extubation, the potential for laryngeal obstruction may increase due to swelling, edema, and tissue injury of tracheal cartilage . Tanaka et al . Reported a case of relapsing polychondritis that underwent laparoscopic cholecystectomy under general anesthesia . After extubation, the patient showed no respiratory complications and was discharged a few days later . However, there was a distinct difference in the severity of disease between this case and tanaka's case, as the patient in tanaka's case had only mild dyspnea on exertion and no tracheal stenosis on the ct scan . The patient in this report, in contrast, suffered from orthopnea for a few months and a ct scan revealed narrowing of the subglottic area of which the diameter was approximately 5.75 mm ., we had to consider the possibility of failure of intubation and/or extubation of the endotracheal tube due to airway compromise . Even if intubation was able to be done, the risks of respiratory failure and reintubation after extubation were also high . Due to the risk of glottal or subglottal mucosal swelling induced by endotracheal intubation, local and regional anesthesia may be considered safer for patients with relapsing polychondritis than general anesthesia . Therefore, the possible side effects of endotracheal intubation should be weighed against its advantages and the expected procedure . In this case, the operation was converted from a laparoscopic surgery to an open laparotomy and was performed under epidural anesthesia after discussion with surgeon . These have included a reduction in neurohormonal response to surgical stimuli, preservation of spontaneous breathing and airway reflexes, decreased blood loss and postoperative pain, a reduced risk of thromboembolism, and a more rapid recovery of gastrointestinal motility . Many studies have evaluated the usefulness of continuous epidural analgesia as the predominant anesthetic technique in abdominal surgery [10 - 12]. Other studies demonstrated that the postoperative deterioration of respiratory function and pulmonary complications decreased with thoracic epidural analgesia compared to general anaesthesia in abdominal or breast surgery . In this case, thoracic epidural blockade provided appropriate analgesia . The patient felt sensations of nausea, discomfort or pain only when surgeons pulled on the mesentery or palpated the diaphragmatic surfaces of intraabdominal organs . Instead, we infused remifentanil at a low rate instead of a sedative bolus in order to avoid respiratory depression and this was effective in reducing discomfort and pain . Awareness of relapsing polychondritis, as a rare disorder, is significantly critical to conventional general anesthesia because dynamic airway collapse can occur . We were able to put a patient with severe relapsing polychondritis for wedge resection of stomach under thoracic epidural analgesia and found no specific complications as a result thereof . Thus, we present that thoracic epidural analgesia can be safely utilized as an anesthetic technique for patients undergoing upper abdominal surgery with airway difficulties, reduced pulmonary function, or weak respiratory muscles due to neuromuscular disease.
Discal cysts are defined as intraspinal, extradural cysts with a distinct communication with the corresponding intervertebral disc.1 2 unlike intracanalar cystic masses, such as synovial cysts,3 that arise from the ligamentum flavum4 or from the posterior longitudinal ligament5 and may involve any spinal segment, discal cysts have only been reported in the lumbar spine . These lesions, which are extremely rare among spinal pathologies and usually occur in the third or fourth decade of life, are more prevalent in male patients with a higher occurrence reported in asian populations . Nevertheless, reliable evidence about epidemiology and natural history of this pathological entity is not available, further accentuated by the lack of large series with longer term follow - up . Indeed, the definition of these lesions was a relatively recent one, with its formal description provided by chiba et al in 2001.1 a review of the literature revealed 37 previously published articles on lumbar discal cysts; all reported cases demonstrate that the clinical picture determined by discal cysts is indistinguishable from other causes of low back pain and radiculopathy such as conventional disc herniations . Although early reports had recommended discography for presurgical diagnosis of discal cysts, advances in imaging techniques, particularly in magnetic resonance imaging (mri), made the diagnosis easier and noninvasive.6 moreover, a more accurate knowledge of their origin and pathoanatomical features has more recently become available.7 8 although nearly all reported discal cysts treated by surgery are associated with a successful outcome, their rarity makes it impossible to draw clear conclusions about its natural course history and allow for meaningful recommendations regarding the clinical management . In this article, we provide a brief literature review regarding the management of lumbar discal cysts and describe a new case . A 43-year - old man presented with a 3-month history of severe back pain, radiating down to his right leg, with associated paraesthesias in the ipsilateral l3 and l4 dermatomes . Neurological examination revealed a slight weakness (4 + /5 bmrc british medical research council) in thigh flexion as well as in the leg extension on the right side and hypomyotrophy of the right quadriceps femoris muscleascolta . Lumbar mri revealed a spherical, intraspinal, extradural cystic mass adjacent to the right dorsolateral side of the l3l4 disc and extending into the ipsilateral recess . Sagittal t2-weighted (a) and axial t1-weighted postgadolinium enhancement (b) mri of the lumbar spine demonstrates a spherical intraspinal, extradural cystic lesion originating from the l3l4 disc and extending either laterally to the right side or caudally behind l4 vertebral body . Mri, magnetic resonance imaging . On computed tomography (ct), the lesion appeared as a hypodense, slightly hyperdense, round mass sited in the right lateral recess, which appeared enlarged, causing scalloping of the posterior vertebral body's surface (fig . 2). Ct scan reveals the bone erosion and the enlargement of l4 lateral recess . Ct, computed tomography . In surgery, we performed a partial, right - sided l3 and l4 laminectomy and medial facetectomy under microscopic magnification . After incising the ligamentum flavum, a thin - walled cystic lesion, containing gelatinous material, was observed on the right ventrolateral surface of the dural sac (fig . The cyst was completely removed by sectioning its connection with the annulus fibrosus . A connection between the cyst and the l3l4 intervertebral disc, through a round defect in the annulus fibrosus, was identified . Although there was no evidence of disc herniation, a formal microdiscectomy was also performed to prevent the recurrence of the cyst and/or the extrusion of disc fragment from the opened annulus fibrosus (fig . Histopathological examination of the cyst revealed dense fibrous connective tissue, with hemosiderin deposits, without lining cell layers and disc material . No perioperative complications were observed, and the patient was discharged with complete relief of complaints . A 6-month follow - up mri scan showed the complete resection of the cyst, a good height of the degenerated disc, and a satisfactory decompression of nervous structures (fig . Six - month follow - up sagittal t2-weighted (a) and axial t1-weighted postgadolinium enhancement (b) mri of the lumbar spine demonstrating the complete resection of the cyst and the absence of recurrence . In the second half of the 1990s, some cases of cysts within the spinal canal that communicated with the intervertebral disc were reported in the japanese literature.9 10 11 these lesions were defined as cystic hematomas or premembranous hematoma . In 1997, toyama et al first highlighted the communication between such cystic lesions and the intervertebral disc.12 similarly, in 1999, kono et al13 described the intraspinal extradural cysts as well - defined, homogeneous lesions located within the ventrolateral extradural space at a lumbar disc level, displacing the dural sac dorsomedially and typically communicating with the corresponding intervertebral disc . Two years later, chiba et al1 proposed that disc cysts should encounter the following characteristics: (1) clinical symptoms related to a unilateral single nerve root compression; (2) lesions occurring at a slightly younger age and at a higher intervertebral disc level than typical disc herniation; (3) minimal degeneration of the involved disc on imaging studies; (4) communication between the cyst and the corresponding intervertebral disc; (5) intralesional, bloody - to - clear serous fluid content; and (6) absence of either disc material inside the cyst or of a specific lining cell layer on histological examination . Despite the possibility of ct scans showing indirect signs of long - standing disc cysts, such as bony scalloping in the vertebral body or the lateral recess, imaging of discal cysts lee et al6 described the mri features of discal cysts: a ventrolateral, extradural cystic mass attached to a lumbar intervertebral disc as well as rim enhancement of its wall on contrast - enhanced mri and occasional spread of the mass into the lateral recess . Such features were observed in the case we report, where further invasive radiological imaging was not deemed appropriate . Discography and/or ct discography has shown contrast flow into the cyst through a typical connecting channel, bridging the cyst and the corresponding intervertebral disc . This finding is diagnostic for discal cysts and has not been demonstrated in lumbar disc herniations or other spinal cysts.6 7 12 14 15 however, mri has replaced discography as the primary diagnostic tool; it is noninvasive and very sensitive in demonstrating the relationships between discal cysts and the surrounding structures.6 clinical symptoms of patients harboring lumbar discal cysts are indistinguishable from those patients with typical intervertebral disc herniation or other spinal cysts . Histologically, the main difference between discal cysts and other intraspinal cysts, such as synovial cysts of the facet joints or cysts of the ligamentum flavum, is based on the absence of lining cells in the discal cyst's wall.2 15 the etiology and pathogenesis of discal cysts remain unclear . Currently, two hypotheses have been suggested . Toyama et al12 and chiba et al1 proposed that an epidural hematoma is initially formed by hemorrhage from the epidural venous plexus, resulting from an underlying disc injury . This theory was supported by the reports that most of the cysts studied contained hemosiderin deposits . However, this hypothesis cannot explain the linking stalk between the intervertebral disc and the cyst through an annular defect . Kono et al13 proposed a mechanical stress induced focal degeneration of the posterior disc wall, followed by fluid collection, reactive pseudomembrane formation around the fluid collection, and subsequent development of the discal cyst . The histologically confirmed presence of fibrous connective tissue without synovial lining cells, imaging and intraoperative findings of an annular fissure, and a communicating stalk between the intervertebral disc and the cyst support the latter hypothesis . The reported mean age at diagnosis is 33.5 12.6 years, younger than the population suffering from degenerative lumbar disc herniation.16 the gradual progression of disc degeneration explains both the later onset of clinical symptoms and the patients' older age in the degenerative lumbar disc herniation population . Conversely, a more acute and stressful mechanical impact may cause even a milder disc degeneration followed by reactive pseudomembrane and/or epidural hematoma formation, both resulting in a lumbar discal cyst onset . Overall, 104 patients have been reported . Of these, 16 underwent conservative therapies or percutaneous injection / aspiration, and 88 underwent surgical microscopic or endoscopic procedures . According to the existing literature,7 16 the majority of patients are males, with few reported female patients; moreover, a large number of discal cyst cases are reported in the asian population . The sex - related incidence rate could suggest a hormonal influence in the pathogenesis of discal cysts . The predominant incidence in asia may be related to lifestyle, habits, or genetic factors . However, further demographic and genetic studies are required to explain such racial distribution.16 abbreviation: na, not available . Some reports described medical treatment as the initial management of discal cysts in cases with tolerable pain and without neurologic deficits . In their literature review, aydin et al7 showed that among 56 cases of lumbar disc cysts, 8 cases (14%) had been treated conservatively . Of these, spontaneous regression occurred in three patients (37.5%) (two after steroid injection, and one after s1 nerve block), whereas failure of medical therapies and subsequent surgical intervention was reported in five cases (62.5%). Conversely, chou et al17 reported the spontaneous regression of a discal cyst 5 months after a routine steroid epidural injection and selective nerve root block . An alternative option for management of discal cysts was proposed by koga et al18 in 2003 . They reported the successful management of a lumbar discal cyst by percutaneous ct - guided aspiration and steroid injection . Similarly, kang et al19 applied this technique, without using steroid injection, on eight patients, reporting a good or excellent outcome in seven cases . However, one patient (11%) in kang's series experienced a recurrence of the cyst . Such a circumstance, together with the relapsing clinical symptoms, may support the need for a more radical management, that is, the surgical resection of the cyst . Surgical techniques in the treatment of discal cysts include endoscopic and microscopic resection of the cyst . This literature review discovered that most cases of discal cysts (69 cases) were successfully managed by microscopic resection of the cyst . This is a simple technique with no reported related morbidity or mortality, good clinical results, and low rate of cyst recurrence.7 chiba et al1 described eight patients with discal cysts, all of whom were surgically treated . Coscia and broshears20 presented two more cases of discal cysts, also successfully treated surgically . More recently, nabeta et al2 and kim and lee21 reported other small series of cases of lumbar discal cysts treated by microsurgical resection with good outcomes . Interestingly, lee et al6 reported at 1-year follow - up one case of recurrence out of nine patients with discal cysts surgically resected . Ishii et al, in 2005, first proposed such therapeutic option.22 recently, matsumoto et al23 and it remains unclear whether or not the corresponding intervertebral disc in connection with the cyst should be excised . Even in cases with uncertain preoperative differential diagnosis, surgery has to be performed to relieve the compression of neural structures, regardless of its origin . In such cases, the intraoperative finding of an obvious connection between the corresponding intervertebral disc and the cystic lesion is useful and important to differentiate discal cysts from other intraspinal cysts . However, this point also remains controversial as highlighted by marshman, who critically commented on the pathogenetic hypotheses and anatomopathological features of discal cysts as distinct pathological entities.25 in the present case, we preferred to excise the discal cyst and also perform a microdiscectomy, as we thought that a more radical excision might decrease the risk of recurrence . At the 2-year follow - up, the patient remains asymptomatic with no mri evidence of discal cyst recurrence . It is difficult to draw evidences on the best treatment of discal cysts as the natural history and the long - term prognosis remain unclear . The thorough analysis of previously reported data on the management of discal cysts suggests that mri should be considered as the preferred diagnostic tool; discography, followed by ct scan, is essential to definitely demonstrate a communication between the cyst and the disc space . Traditional myelography and ct myelography play a marginal role in the diagnosis, confirming the extradural location of the cyst, but these studies do not add relevant information relative to mri scans . In conclusion, we report a new case of lumbar discal cysts with symptoms and findings resembling a typical lumbar disc herniation, which was successfully treated by microsurgical resection . Although it is a rare pathological entity, lumbar discal cysts should be considered in the differential diagnosis of low back pain and lower limb weakness . We submit that the operative indications and management strategy of discal cysts are likely to be similar to those applied to lumbar disc herniations; moreover, microsurgical resection appears to be the best treatment for discal cysts in patients with severe pain and neurological impairment . Ebsj appreciates the detailed case report on intradiscal cysts and the balanced commentary by dr . These contributions underscore the importance of collecting small series or rare occurrence disorders in a centralized database with an attempt at a consistent treatment protocol to maximize the possibility for scientific insight . Alternatively, a region like aospine asia - pacifica might be interested in starting a larger data collection effort given the much higher prevalence of this condition in that particular region . In the case of discal cysts, we really seem to need just about everything: imaging morphology, clinical symptomatology, natural course history, and intraoperative pathology, using consistent staining techniques and details of surgical techniques whether a formal discectomy should be preferably added, as recommended by the case - report authors, or if a simple cyst resection suffices, as recommended by moisi et al in their commentary . Hopefully, this case report will stimulate creation of a rare case database for these types of disc pathology and raise the awareness of the global aospine surgery community to this entity . Of course, any further thoughts or experiences with the diagnosis or treatment of this pathology are welcome . Commentary on: lumbar intervertebral discal cyst: a rare cause of low back pain and radiculopathy.
In addition to substantive work, the question of how the technical aspects can be optimized appears . There are three basic options for the implementation of mc - exams: exam papers with or without computer support or electronic examinations: a. traditionally, the instructor creates an exam paper with a word processing system that prints out the exam sheets, corrects the answers by hand, and transmits the results to a spreadsheet program that calculates the scores . B. a better option, for which there is already commercial software to buy, uses computers to scan the responses and to automatically insert the results in a spreadsheet program . C. a further automation is possible if the students directly write their exams on the computer with the results being transmitted to a server and automatically evaluated afterwards . A. traditionally, the instructor creates an exam paper with a word processing system that prints out the exam sheets, corrects the answers by hand, and transmits the results to a spreadsheet program that calculates the scores . B. a better option, for which there is already commercial software to buy, uses computers to scan the responses and to automatically insert the results in a spreadsheet program . C. a further automation is possible if the students directly write their exams on the computer with the results being transmitted to a server and automatically evaluated afterwards . The decision to use the most economical alternative depends on both the technical equipment as well as the selected process model whereby the risk of technical failure must be considered . In this paper we examine the efficiency of the implementation of paper - based exams with computer support (b) and compare these with the other two alternatives a and c. in contrast to b there are numerous publications about c (e.g.,), including cost analysis, whereas some different hardware versions of electronic exam designs are compared (using students own laptops vs. using university s computers in a special testing center or in cip pools vs. complete outsourcing). In some publications reference values for expenses and costs are provided for comparison with conventional tests, which we will discuss in the following . In, the total costs for a single exam which consist of investment costs, personnel costs and printing costs, are 1423 with option a, with option b 1072 and with option c 1746, under the assumption of 96 examinations per year over a period of 3 years . Concerning the time exposure a comparison of estimates from two studies is shown in table 1 (tab . 1) (, table 1 (tab . 1) and table 2 (tab . A comparison of the two estimates shows significant discrepancies, which are probably partly due to the fact that in less exam participants with fewer questions per exam are considered . Overall it is apparent that in generally much higher time expenses are calculated, whereas the estimation of 200 hours for manual evaluations of a (minutes per question with 60 questions in 400 exams) probably bases on a mix of free - text questions and closed questions, while in c only closed questions are used . Furthermore, it is striking that for exam preparation and test execution in, considerable efforts for the functionality testing of the computers and technical supervisors as well as technical support occur, while these factors are neglected in the estimates of . Significant potential for option b can be derived from both studies if it is possible to combine the advantages of a (little technical effort in preparing and carrying out the tests) and the advantages of c (minor correction time). In the following, we analyze the time required for computer - based pure multiple - choice paper exams with automatic correction of the scanned answer sheets . Other types of questions that require a number and text input can be co - managed, but they would have to be corrected manually . For implementation, a component for computer - based paper exams had been developed at the university of wuerzburg after experiences with the paid service of impp spidmed [https://www.impp.de/spidmed/ (link checked 11.7.2011; service terminated: 1.7.2011)] and a commercial program for optical mark recognition of multiple - choice exams . Since this component is based on a university - wide framework for the development of case - based training systems (see,), which is funded by tuition fees, the additional investment costs were relatively low . In section 2, the process model and the critical aspects of computer - based paper tests are described while in section 3 the technical effort for the various phases of the 12 resp . 13 exams in ss 2010 and ws 2010/11 is presented (without considering the content of the work) and in section 4, option b is compared on a qualitative level with options a and c. critical factors in the implementation of examinations are in addition to the substantial content related work, on which we do nt focus here, the logistics involved in the examination procedure, the quality, speed and cost of exam correction, the provision of documents for inspection and the statistical analysis of exam results . Below, we describe a general process model with several variations: questions in a written examination may come from one or more lecturers (e.g. Lecture series), old question files on paper or from a database can be reused or the questions can be completely or partially created anew . Often the questions are checked by different persons so that there are several iterations . The questions may relate to images or descriptions of cases and there are often several related questions (" key feature questions "). The answer alternatives can be of type a (single selection), type x (true / false) or pickn (multiple choice) (cf . While in manual exam correction (a) the lecturers usually directly format the questions in a word processing program, indirect formats are common in b and c. either the questions are selected from a database or the lecturers enter them in a specific format from which the computer generates the exam . There are two variants for this process: either input via a form or input into a word processing system with layout specifications, which is converted by a parse operation in the internal format . To discourage copying among exam participants, there are often two to four variants under option a created by swapping exam questions and answer alternatives manually . Under option b and c, the swapping is mostly automated so that each participant gets a different exam version . In our study the lecturers defined the questions and were largely relieved of the formatting by having exam texts sent as a word file to a coordinator who made the necessary formatting . Single and multiple - choice questions (type a and pickn) were both used . 2) by a " yes " in the column " multiple answers per question . " While in the winter semester 2009/2010, a relatively complicated input format with many options was used; from the following summer semester 2010 the input format was aligned with the most common templates of the lecturers and simplified . This simplified format however, the lecturers did nt have to follow them, as the coordinator was still responsible for the final editing . In our effort measurements in section 3, we therefore begin with an arbitrarily formatted exam text and measure the cost of subsequent formatting by the coordinator as a first step . This includes the expenses and costs for the printing of the exam as well as the efforts for laying out the sheets in the auditorium and the exam supervisor . The printing can be done on own printers or in a copy shop, in the latter case a pdf file is sent and then the printed exams are collected . The exams are usually put on the tables in the auditorium . While an alphabetical seating plan must be created in case of personalized exams so that participants are able to find their exams, in case of non - personalized exams the students write their name and matriculation number on the answer sheets, which has to be transferred into the analysis file afterwards . The exam requires the supervision of one or more persons depending on the number of participants . At the university of wuerzburg, the costs for printing typical medical exams can be estimated as follows: at about 140 participants and about 35 questions about 140 * 20 = 2800 pages are printed, which at a cost of 2 cents per copy makes around 56 euro per exam (which must still be paid by the lecturers; in case of the use of color copies it is accordingly more expensive). In table 2 (tab . 2) the column " personalization " indicates, whether personalized exams were used and the " randomization " column marks, if questions and answers were exchanged automatically in order to impede copying . To simplify the correction, a separate answer sheet (see figure 2 (fig . 2) left as used in summer semester 2010 and right as in winter semester 2010/11) was created on which the numbers of the answer to all questions are marked . After initial experience with scanning in ws 09/10, in ss 2010 much more value was placed on good print quality and the use of pencil and eraser for the prevention of scribbling, which markedly improved the level of automation during the correction (see section exam evaluation). The step exam preparation and implementation summarizes efforts that lie in our model with the lecturer, i.e. Printing and stapling with - 1 hour (either on own printers with stapling, or in a copy shop with pick - up time) and the preparation and supervision during the actual exam with typically two people for about an hour exam time . Since these expenses of approximately 3 hours occur for each written exam and are regardless of the coordinator, they are not separately identified in table 2 (tab . While in option a the lecturer corrects the exams and manually transfers the data into a spreadsheet program and in option c the computer instantly gives the raw results, the efficiency of option b depends on the scanning speed and quality . Since it s not uncommon for questions to be subsequently removed from the rating or the rating scheme being adapted, in all the options a, b, c the simplicity of the adaptation of the evaluation is important . Also, at options b and c statistics, e.g. Discriminative power (trennschrfe), of the questions are automatically generated . The main focus of this study is the detailed analysis of the time required for the evaluation of an exam with option b. therefore this step is broken down into smaller steps: scanning, in the simplest case, consists of the insertion of the answer sheets into a scanner . In some exams the answer sheets were tacked to the information sheets or answer sheets of different examinations were mixed, so that they previously had to be separated and sorted . These efforts were counted . While in ws 09/10 a high performance scanner was used in the university library, which was impractical because of transport times and the need for an appointment, in ss 10 an inexpensive scanner (about 1000) was purchased for exam evaluation, which, however, could only hold about 50 sheets at the same time and did nt possess very good quality . However, the lower scan quality could be compensated by better evaluation software (see next item).the analysis includes the automatic recognition of crosses on scanned papers with manual inspection and rework if necessary . The program for optical mark recognition was revised and replaced by an improved version in each of three semesters . All versions offered a clear view for manual checking, in which confidently recognized crosses were marked green, probably recognized crosses were marked with red and yellow or pink markings were used if the number of detected crosses was greater or less than the number of optical marks expected . The current version that is used since ws 2010/11 combines three different methods for optical mark recognition, which, while extending the duration of the optical mark recognition program, clearly reduces the effort of manual rework . In all versions the optical mark recognition results were put in an excel spreadsheet with the scores for each participant and each question, including various statistics such as discriminative power, as well as documents for the exam inspection . Oif some questions were unclear or needed to be adjusted or taken out of the valuation for other reasons, effort for the adaptation of the assessment scheme occurred . Although this expense is conditional to its content, we have identified it in table 2 (tab . 2) under the column " other / support " . It will naturally decrease over the semesters, when the lecturers are familiar with the process model of exam implementation, but it is higher if complications arise . Scanning, in the simplest case, consists of the insertion of the answer sheets into a scanner . In some exams the answer sheets were tacked to the information sheets or answer sheets of different examinations were mixed, so that they previously had to be separated and sorted . These efforts were counted . While in ws 09/10 a high performance scanner was used in the university library, which was impractical because of transport times and the need for an appointment, in ss 10 an inexpensive scanner (about 1000) was purchased for exam evaluation, which, however, could only hold about 50 sheets at the same time and did nt possess very good quality . However, the lower scan quality could be compensated by better evaluation software (see next item). The analysis includes the automatic recognition of crosses on scanned papers with manual inspection and rework if necessary . The program for optical mark recognition was revised and replaced by an improved version in each of three semesters . All versions offered a clear view for manual checking, in which confidently recognized crosses were marked green, probably recognized crosses were marked with red and yellow or pink markings were used if the number of detected crosses was greater or less than the number of optical marks expected . The current version that is used since ws 2010/11 combines three different methods for optical mark recognition, which, while extending the duration of the optical mark recognition program, clearly reduces the effort of manual rework . In all versions the optical mark recognition results were put in an excel spreadsheet with the scores for each participant and each question, including various statistics such as discriminative power, as well as documents for the exam inspection . Oif some questions were unclear or needed to be adjusted or taken out of the valuation for other reasons, effort for the adaptation of the assessment scheme occurred . Although this expense is conditional to its content, we have identified it in table 2 (tab . 2) under the column " other / support " . It will naturally decrease over the semesters, when the lecturers are familiar with the process model of exam implementation, but it is higher if complications arise . For all exams in table 2 (tab . 2) with one exception in ss 2010, participants were given different exam sheets with the same questions but the order of questions and response alternatives had been interchanged (" randomization = yes " in table 2 (tab . 2)). Choosing this option requires trust in the technology, since the manual correction of randomized exams would be very difficult . On the other hand, it is an important argument for the use of computer - based exams, since it obviously impedes copying and simplifies the distribution of the exam in the exam room . An overview of the process model in exam preparation and processing is shown in figure 3 (fig . Questions in a written examination may come from one or more lecturers (e.g. Lecture series), old question files on paper or from a database can be reused or the questions can be completely or partially created anew . Often the questions are checked by different persons so that there are several iterations . The questions may relate to images or descriptions of cases and there are often several related questions (" key feature questions "). The answer alternatives can be of type a (single selection), type x (true / false) or pickn (multiple choice) (cf . While in manual exam correction (a) the lecturers usually directly format the questions in a word processing program, indirect formats are common in b and c. either the questions are selected from a database or the lecturers enter them in a specific format from which the computer generates the exam . There are two variants for this process: either input via a form or input into a word processing system with layout specifications, which is converted by a parse operation in the internal format . To discourage copying among exam participants, there are often two to four variants under option a created by swapping exam questions and answer alternatives manually . Under option b and c, the swapping is mostly automated so that each participant gets a different exam version . In our study the lecturers defined the questions and were largely relieved of the formatting by having exam texts sent as a word file to a coordinator who made the necessary formatting . Single and multiple - choice questions (type a and pickn) were both used . 2) by a " yes " in the column " multiple answers per question . " While in the winter semester 2009/2010, a relatively complicated input format with many options was used; from the following summer semester 2010 the input format was aligned with the most common templates of the lecturers and simplified . This simplified format however, the lecturers did nt have to follow them, as the coordinator was still responsible for the final editing . In our effort measurements in section 3, we therefore begin with an arbitrarily formatted exam text and measure the cost of subsequent formatting by the coordinator as a first step . This includes the expenses and costs for the printing of the exam as well as the efforts for laying out the sheets in the auditorium and the exam supervisor . The printing can be done on own printers or in a copy shop, in the latter case a pdf file is sent and then the printed exams are collected . The exams are usually put on the tables in the auditorium . While an alphabetical seating plan must be created in case of personalized exams so that participants are able to find their exams, in case of non - personalized exams the students write their name and matriculation number on the answer sheets, which has to be transferred into the analysis file afterwards . The exam requires the supervision of one or more persons depending on the number of participants . At the university of wuerzburg, the costs for printing typical medical exams can be estimated as follows: at about 140 participants and about 35 questions about 140 * 20 = 2800 pages are printed, which at a cost of 2 cents per copy makes around 56 euro per exam (which must still be paid by the lecturers; in case of the use of color copies it is accordingly more expensive). In table 2 (tab . 2) the column " personalization " indicates, whether personalized exams were used and the " randomization " column marks, if questions and answers were exchanged automatically in order to impede copying . To simplify the correction, a separate answer sheet (see figure 2 (fig . 2) left as used in summer semester 2010 and right as in winter semester 2010/11) was created on which the numbers of the answer to all questions are marked . After initial experience with scanning in ws 09/10, in ss 2010 much more value was placed on good print quality and the use of pencil and eraser for the prevention of scribbling, which markedly improved the level of automation during the correction (see section exam evaluation). The step exam preparation and implementation summarizes efforts that lie in our model with the lecturer, i.e. Printing and stapling with - 1 hour (either on own printers with stapling, or in a copy shop with pick - up time) and the preparation and supervision during the actual exam with typically two people for about an hour exam time . Since these expenses of approximately 3 hours occur for each written exam and are regardless of the coordinator, they are not separately identified in table 2 (tab . While in option a the lecturer corrects the exams and manually transfers the data into a spreadsheet program and in option c the computer instantly gives the raw results, the efficiency of option b depends on the scanning speed and quality . Since it s not uncommon for questions to be subsequently removed from the rating or the rating scheme being adapted, in all the options a, b, c the simplicity of the adaptation of the evaluation is important . Also, at options b and c statistics, e.g. Discriminative power (trennschrfe), of the questions are automatically generated . The main focus of this study is the detailed analysis of the time required for the evaluation of an exam with option b. therefore this step is broken down into smaller steps: scanning, in the simplest case, consists of the insertion of the answer sheets into a scanner . In some exams the answer sheets were tacked to the information sheets or answer sheets of different examinations were mixed, so that they previously had to be separated and sorted . These efforts were counted . While in ws 09/10 a high performance scanner was used in the university library, which was impractical because of transport times and the need for an appointment, in ss 10 an inexpensive scanner (about 1000) was purchased for exam evaluation, which, however, could only hold about 50 sheets at the same time and did nt possess very good quality . However, the lower scan quality could be compensated by better evaluation software (see next item).the analysis includes the automatic recognition of crosses on scanned papers with manual inspection and rework if necessary . The program for optical mark recognition was revised and replaced by an improved version in each of three semesters . All versions offered a clear view for manual checking, in which confidently recognized crosses were marked green, probably recognized crosses were marked with red and yellow or pink markings were used if the number of detected crosses was greater or less than the number of optical marks expected . The current version that is used since ws 2010/11 combines three different methods for optical mark recognition, which, while extending the duration of the optical mark recognition program, clearly reduces the effort of manual rework . In all versions the optical mark recognition results were put in an excel spreadsheet with the scores for each participant and each question, including various statistics such as discriminative power, as well as documents for the exam inspection . Oif some questions were unclear or needed to be adjusted or taken out of the valuation for other reasons, effort for the adaptation of the assessment scheme occurred . Although this expense is conditional to its content, we have identified it in table 2 (tab . 2) under the column " other / support " . It will naturally decrease over the semesters, when the lecturers are familiar with the process model of exam implementation, but it is higher if complications arise . Scanning, in the simplest case, consists of the insertion of the answer sheets into a scanner . In some exams the answer sheets were tacked to the information sheets or answer sheets of different examinations were mixed, so that they previously had to be separated and sorted . These efforts were counted . While in ws 09/10 a high performance scanner was used in the university library, which was impractical because of transport times and the need for an appointment, in ss 10 an inexpensive scanner (about 1000) was purchased for exam evaluation, which, however, could only hold about 50 sheets at the same time and did nt possess very good quality . However, the lower scan quality could be compensated by better evaluation software (see next item). The analysis includes the automatic recognition of crosses on scanned papers with manual inspection and rework if necessary . The program for optical mark recognition was revised and replaced by an improved version in each of three semesters . All versions offered a clear view for manual checking, in which confidently recognized crosses were marked green, probably recognized crosses were marked with red and yellow or pink markings were used if the number of detected crosses was greater or less than the number of optical marks expected . The current version that is used since ws 2010/11 combines three different methods for optical mark recognition, which, while extending the duration of the optical mark recognition program, clearly reduces the effort of manual rework . In all versions the optical mark recognition results were put in an excel spreadsheet with the scores for each participant and each question, including various statistics such as discriminative power, as well as documents for the exam inspection . Oif some questions were unclear or needed to be adjusted or taken out of the valuation for other reasons, effort for the adaptation of the assessment scheme occurred . Although this expense is conditional to its content, we have identified it in table 2 (tab . 2) under the column " other / support " . It will naturally decrease over the semesters, when the lecturers are familiar with the process model of exam implementation, but it is higher if complications arise . For all exams in table 2 (tab . 2) with one exception in ss 2010, participants were given different exam sheets with the same questions but the order of questions and response alternatives had been interchanged (" randomization = yes " in table 2 (tab . 2)). Choosing this option requires trust in the technology, since the manual correction of randomized exams would be very difficult . On the other hand, it is an important argument for the use of computer - based exams, since it obviously impedes copying and simplifies the distribution of the exam in the exam room . An overview of the process model in exam preparation and processing is shown in figure 3 (fig . In ws 09/10, eleven, in ss 2010 twelve and in ws 10/11 thirteen multiple - choice papers in medicine were created and evaluated with computer assistance . All examinations but while from ss 2010 the coordinator recorded the expenditures, there were only rough estimates for a typical exam without major complications from the same coordinator in ws 09/10 . 10/11 all exams but four were personalized, i.e. Each participant's name and student number was printed on the exam (with reserve exams for undeclared stragglers). In ss 10 ws 10/11 there was an average of 143 or 137 participants per exam, which included 37 questions at average . Almost half of the exams allowed multiple answers per question, the other ones only one answer . Measured was the time required for the coordinator who helps the lecturers with exam preparation and evaluation . The average time is divided in five areas according to the information in section 2: postprocessing of the exam template: while it took 2 - 3 hours in ws 09/10, the time decreased in ss 10 and ws 10/11 to only 49 minutes, in uncomplicated exams even to 32 or 23 minutes . Here, a further drop is expected because it is just a matter of time for the lecturers to get used to the format they send to the coordinator . The more similar it is to the one shown in figure 1 (word input format), the less rework is due for the coordinator.scanning: the scanning effort mainly depends on the size of the sheet feeder and scanning speed . With the currently used, relatively simple scanner, scanning an exam with about 140 answer sheets without complications takes 20 - 25 minutes at best . The average of all exams was actually measured at 28 minutes in ws 10/11 and 42 minutes in ss 2010, which was mainly due to the fact that the scanner settings had to be adapted for each exam in order to achieve an optimal result . The necessary steps are now either carried out by the analysis software or are unnecessary because the answer sheet contains no gray values.evaluation: the most critical step is the evaluation of the optical mark recognition on the answer sheet because this determines the practicality of the whole process . To ensure the quality of the optical mark recognition, a manual verification step with representation of the detected crosses in the traffic - light colors (see section 2) is part of the evaluation . In ss 10 and ws 10/11 the average expenditure was about 50 minutes per exam with approximately 140 participants and 37 questions each . Since different optical mark recognition programs were used, it is more informative to consider the evaluation effort of all examinations which were corrected with the new optical mark recognition, i.e. All exams in ws 10/11 excluding the two pathology exams . Here, the average evaluation time has almost halved with only 26 minutes per exam.adaptation of the assessment scheme: the costs depend on factors that ca nt be influenced by the method of evaluation and are addressed only indirectly, because the software used should make the correction of the assessment scheme or the removal of individual questions from the valuation relatively simple . In ss 10 and ws 10/11 the average expenditure was approximately 20 minutes and in most cases at 0 . Only in the exam infectious diseases in ws 2010/11 it was unusually high with 180 minutes due to special circumstances.miscellaneous/support: the general communication in addition to the indicated times was 12 minutes in ws 10/11 and 20 minutes in ss 10 . Postprocessing of the exam template: while it took 2 - 3 hours in ws 09/10, the time decreased in ss 10 and ws 10/11 to only 49 minutes, in uncomplicated exams even to 32 or 23 minutes . Here, a further drop is expected because it is just a matter of time for the lecturers to get used to the format they send to the coordinator . The more similar it is to the one shown in figure 1 (word input format), the less rework is due for the coordinator . Scanning: the scanning effort mainly depends on the size of the sheet feeder and scanning speed . With the currently used, relatively simple scanner, scanning an exam with about 140 answer sheets without complications takes 20 - 25 minutes at best . The average of all exams was actually measured at 28 minutes in ws 10/11 and 42 minutes in ss 2010, which was mainly due to the fact that the scanner settings had to be adapted for each exam in order to achieve an optimal result . The necessary steps are now either carried out by the analysis software or are unnecessary because the answer sheet contains no gray values . Evaluation: the most critical step is the evaluation of the optical mark recognition on the answer sheet because this determines the practicality of the whole process . To ensure the quality of the optical mark recognition, a manual verification step with representation of the detected crosses in the traffic - light colors (see section 2) is part of the evaluation . In ss 10 and ws 10/11 the average expenditure was about 50 minutes per exam with approximately 140 participants and 37 questions each . Since different optical mark recognition programs were used, it is more informative to consider the evaluation effort of all examinations which were corrected with the new optical mark recognition, i.e. All exams in ws 10/11 excluding the two pathology exams . Here adaptation of the assessment scheme: the costs depend on factors that ca nt be influenced by the method of evaluation and are addressed only indirectly, because the software used should make the correction of the assessment scheme or the removal of individual questions from the valuation relatively simple . In ss 10 and ws 10/11 the average expenditure was approximately 20 minutes and in most cases at 0 . Only in the exam infectious diseases in ws 2010/11 miscellaneous / support: the general communication in addition to the indicated times was 12 minutes in ws 10/11 and 20 minutes in ss 10 . In sum, the effort of the exam process without printing and exam supervision for an exam with about 140 participants and about 35 questions has decreased for the coordinator from 5 - 7 hours for " good " exams without complication in ws 2009/2010 to about 2 hours in ss 2010 and finally was at 1.5 hours in ws 2010/11 . For the most efficiently corrected exam " general medicine " in ws 10/11, the expenses even were just 65 minutes at 121 participants and 30 questions . With complications the average time increased to 160 or 179 minutes per exam in ws 10/11 or ss 2010; in ws 2009/2010, the number was much higher and not reported . The figures clearly show that for the overall average efficiency, the existence and treatment of complications is almost as important as the basic model . Overall, it can be said that in ss 2010 and even more in ws 10/11 the time effort for instructors and coordinators is pretty low . Although there is always room for improvement, the average values of the 9 uncomplicated exams in ws 2010/11 should be pretty close to the optimum of about 1 to 1.5 hours of time effort per exam (excluding the content - related effort). Additionally to that, the time needed for printing the exam, which is 0.5 to 1 hour, has to be added . The total time is comparable to the minimum time required for exam supervision, which is approximately 2 hours and cannot be optimized . However, these numbers were not achieved immediately, as in the introduction phase in ws 2009/2010, the time effort for exams without complications was with 5 to 7 hours for the lecturers and also the coordinator had significantly higher expenses, being very high for exams with complications . It seems that the number of exam participants and the number of questions per exam have a relatively small influence on the overhead costs because although more questions require increased formatting effort, and more questions and more participants increase the scanning and evaluation effort, the additional effort in comparison to the basic effort is limited . However, the empirical data do nt allow clear statements because the exams are relatively homogeneous concerning the number of questions and participants and the exams with deviations had complications and therefore were not comparable . Based on this data, we pick up the cost models for the options a, b and c from and and compare them on a qualitative level with our outlined expenses of option b. in the comparison of options a and b the efforts for the creation of the exam and for the exam procedure remain about the same . The differences result from the exam evaluation: the correction time for option a, which was estimated 13.5 hours per exam in, and in even longer, drops to 1 to 1.5 hours in our analysis of option b when there are no complications . Additional costs for the scanner (about 1000) and the development or acquisition of software and its maintenance (which were very low at the university of wuerzburg, because the software used for correction was only one additional component of a large blended learning project, see above) have to be added . In comparison of options b and c, the correction times are roughly comparable and in both options the development or acquisition of software and its maintenance is necessary . While in b time expenses for the creation and printing of the document examination incur (about 0.5 hours for the formatting of the exam and 0.5 to 1 hour for printing), at c function tests of the computers must be included, which are nt reported in but include 8 to 32 hours in . The same applies to the exam procedure, as with c additionally to the exam supervision technically skilled personnel should be present, which does not apply to b. there are other differences regarding the printing costs (a minimum of 56 per exam) and scanner investment in option b in comparison with investments in infrastructure, which is necessary for the realization of purely electronic exams in option c. the latter are difficult to quantify, since there are many variations, ranging from a fully equipped test center with own computers to the use of student s laptops . In this context the study suggests that lower investment costs lead to (much) more time effort . After all, the risk and severity of complications, which carry much more weight in c than in b, also have to be considered . Therefore, the aim to relieve the lecturers as inexpensively as possible in the correction of multiple - choice exams can be achieved in the best way with option b, which means paper - based exams with computer support . According to our investigations, electronic exams currently only pay off when the opportunities of new types of tasks beyond conventional multiple - choice will be used, such as long - menu questions or other types of questions, the showing of videos, working with virtual microscopes or solving interactive training cases.
Which drug for which patient? Because a patient must wait weeks according to some studies upwards of 12 weeks [1, 2] for an antidepressant to be effective for unipolar depression, and because the initial drug prescribed often benefits only about 50 - 70% of patients [3, 4], many patients continue to suffer from depression for significant time periods while waiting for an effective drug to be found . Current bases upon which the choice of an initial antidepressant is made include cost, side effect profiles, propensity for drug interactions, availability on formularies, physician preferences, severity of depression [5, 6], presence of psychotic features and presence of a comorbid condition, such as attention - deficit hyperactivity disorder (adhd), obsessive compulsive disorder (ocd), and certain anxiety or substance abuse disorders [8 - 11]. Although physicians do consider certain symptoms reported by patients in selecting among antidepressants, usually the quality of the depression and the premorbid personality of the patient are not factors in drug selection . There is currently no brief, office - based rating instrument designed specifically to determine which antidepressant medication should be given to which patient . This paper proposes that patients who are particularly likely to respond to bupropion have certain premorbid personality characteristics . They are hard - driving, " high - powered " individuals, often entrepreneurs or successful business people, who relate to life in terms of accomplishments and achievements . By contrast, it is observed that patients who are most likely to respond to fluoxetine have different premorbid characteristics . They rarely report exercise as meaning much to them, either in their premorbid state or when depressed, and their depression is not as connected with the notion of body movement . They do not relate to life in terms of accomplishments to the same degree as do bupropion responders . In addition to a different premorbid history, the fluoxetine - responding patients describe their depression with a different cluster of symptoms . When they present for treatment, their depression has more " darkness " associated with it, more moodiness, more swings in mood, and they " cling " more . Increased irritability is often prominent . Ruminating more often than bupropion responders, they often ask questions such as, " how do i get out of this? " Or state, " i see no way out of this . " The premise of this paper is that bupropion - responding patients report depression in a characteristic way and selective serotonin reuptake inhibitor (ssri)-responding patients report depression in a characteristic way, and the two ways are different . These patients often report a loss of something of drive, of purpose . The above traits and symptoms are not reported to the same degree in ssri - responding patients, who seem to fall into something . The ssri - responding patients often describe weepiness, mood changes, irritability, darkness, being up and down, being in a pit, and self - esteem difficulties . Not all patients presenting for treatment of unipolar depression may be categorized as described, and many patients respond to either ssris or to bupropion . The authors have noticed clinically, however, that when patients can be categorized as ssri or bupropion responders, the patients response to medication is more predictable and more complete, and the medication for that category becomes the drug of choice . This paper proposes using personality traits not personality disorders per se to guide antidepressant selection . It identifies two characteristics that predispose to bupropion response achievement orientation and history of response of mood to exercise . The achievement orientation category is similar to the premorbid personality described by akiskal, as " hyperthymic temperament, " which he described as " very successful, eminent people who run the world " . Akiskal describes these patients as over - talkative, extroverted, over - involved, uninhibited, " full of plans, " over - confident, irritable, cheerful, over - optimistic, exuberant, meddlesome and promiscuous . The hyperthymic temperament, which is described as including habitual short sleep (often three to four hours per night), seems much closer to hypomania or mania than are the traits described in this paper, however . The characteristic personality type associated in this paper with fluoxetine response is similar to the " depressive personality " described by various clinicians . Chronic pessimism, loneliness, dissatisfaction, guilt, feelings of inadequacy, and certain other characteristics common in " depressive personality " and chronic low - level depression may describe a more serotonergic subgroup of this disorder . Ravindran, et al reported that " subaffective dysthymia, " a chronic depressive syndrome described by akiskal, seems to respond well to fluoxetine, which is similar to the authors findings . Kramer believes that rejection sensitivity responds to fluoxetine, which also coincides with this report . There are similarities between the above observations of bupropion - responding patients and bipolar ii patients . However, the hypomanic episode required for diagnosis of bipolar ii disorder is described as an unequivocal change in functioning that is uncharacteristic of the person when not symptomatic in dsm 4-tr, in contrast to this paper s describing long - term traits . The premorbid high - energy level that this paper associates with bupropion response has some similarity to adhd . This paper is not, however, simply promoting better diagnosis of adhd, as it reports other traits predicting bupropion response, such as exercise response . Furthermore, the authors observe that many bupropion responders in their premorbid condition, in contrast to adhd patients, were highly focused; it is only in their depressed state that these patients experienced impaired concentration . One author (dsb) developed a 10-question, self - administered rating scale, the fluoxetine bupropion assessment scale (fbas), to further assess these traits and the observed correlation . After the scale had been utilized to guide treatment in one author s practice for several years, it was decided to retrospectively review charts in this psychiatrist s practice to see if use of the scale had improved patient outcomes . It was hypothesized that use of the fbas by a psychiatrist to select an antidepressant for patients had improved treatment outcomes . In the scale, questions 1 - 5 evaluated traits which were hypothesized to predict bupropion response . The first two questions examined the importance of exercise in the pre - depressed state and mood response to exercise . While exercise has health benefits for most patients, only some individuals report an " endorphin release " or mood benefit from exercise, while others simply feel tired afterward . This paper postulates that exercise - responding patients are biochemically different and are likely to respond to bupropion, possibly because bupropion causes a mild increase in dopamine and norepinephrine, neurotransmitters which increase during exercise . In the scale, questions 3 and 4 were designed to assess achievement orientation; question 5 asked about hyperactivity, which could include either adhd, which in some studies has shown a limited response to bupropion treatment [19, 20] or simply pre - depression high energy, which the authors also postulate is associated with bupropion response . Questions 6 - 10 assessed symptoms of depression hypothesized to indicate fluoxetine response: rumination, feelings of darkness, tendency to cling to others, or a feeling that other people do not meet one s interpersonal needs . Because the authors describe the fluoxetine - responding traits more as rumination than as hopelessness per se, not all postulated fluoxetine - responding traits could be included in a scale of this brevity self - esteem difficulties and irritability were not assessed . For ease of scoring, the questions were designed so that low numerical answer scores (0 - 2.5) would indicate fluoxetine response, and high scores (3 - 5) would indicate bupropion response . Thus, for some questions, the answer, a great deal would score 5, and on other questions, not much would score 5 . Charts for this retrospective study were screened by clerical staff at the outpatient office of one author (dsb). One before the psychiatrist was informed of the above - stated theory by another author (wms), and the other after he was informed of the theory, developed the fbas, and began administering and using it to guide treatment . Staff utilized scheduling books, accounting records, and examination of current and stored charts to create a sequential list, in order seen at the office, for each of the time periods, to obtain approximately 50 sequentially seen charts for each time period . Inclusion criteria included outpatients with depressive spectrum illnesses (major depression or depression nos) with beck depression inventory scores 17, who were prescribed fluoxetine or bupropion as the initial drug prescribed by the psychiatrist . Patients with intake diagnoses of schizophrenia, bipolar disorder, obsessive compulsive disorder, or panic disorder were excluded from the study, as were patients with substance abuse in the two months prior to intake, and patients assessed to have depression due to a medical condition . Patients were excluded who had received fluoxetine or bupropion at any time prior to initial evaluation, or who had received any antidepressant treatment in the two months prior to their initial evaluation . After the above - mentioned exclusions, there were 33 patients in the non - fbas group, of whom 42.4% were male, with a mean age of 33.8 years . In the fbas - guided treatment group were 39 patients, 56.4% male, with a mean age of 30.4 years . Charts meeting criteria were photocopied and prepared so that the reviewers were blinded as to the time period involved . Raters reviewed charts using clinical global impression (cgi) criteria to assess severity of illness, drug efficacy (therapeutic effect / side effect) and global improvement from clinical information in the charts . The cgi rates treatment response as 0-not assessed, 1-very much improved, 2-much improved, 3-minimally improved, 4-no change, 5-minimally worse, 6- much worse, 7-very much worse . Intent - to - analysis was performed to determine if the physician utilized the fbas score for drug allocation during the fbas - guided treatment phase . Logistic regression was used to model drug allocation on each fbas item independently and on all items in a stepwise approach using a best - subset selection method . Ordered logistic regression because of the small number of patients in each cgi cell, the data were further analyzed by combining treatment responses into three larger groups by cgi score: good response (1 - 2), minimal to no improvement (3 - 4), and worse (5 - 7). It was hypothesized that individuals scoring high on the bupropion - oriented questions 1 - 5 would score low on the fluoxetine - oriented questions 6 - 10, and vice - versa . To determine if the questionnaire did identify two separate groups of depressed patients, the two domains (1 - 5 and 6 - 10) were labeled and dichotomized as high or low based on the average score, and cross - tabulated . The median score of the two groups was also used to dichotomize the two groups . The data were coded for this analysis the same way as in the questionnaire, in that a patient s strong endorsement of fluoxetine items results in a low numerical score on fluoxetine items, and a patient s strong endorsement of bupropion items results in a high score on bupropion items . Therefore, a high total score on the questionnaire was postulated to predict bupropion response and a low total score, fluoxetine response . Total fbas was a strong predictor (p = 0.017) of treatment allocation, indicating that the physician did utilize the scale to determine which medication to prescribe . The evidence is in the correct direction, but the data do not provide sufficient evidence at the 5% level to support the hypothesis that fbas - guided treatment allocation improves patient outcome as measured by efficacy or global improvement (p = 0.175 and p = 0.128, respectively). However, the odds that a patient receiving fbas - guided treatment had a higher efficacy score were 76% greater than for a patient receiving a non - fbas - guided treatment . Similarly, the odds that a patient receiving fbas - guided treatment had a greater global improvement score were 92% greater than for a patient receiving non - fbas - guided treatment (table 1). Similar results were obtained after adjusting for severity of illness (efficacy p = 0.139, global improvement p = 0.147), and for differences in age, gender, and marital status (efficacy p = 0.087, global improvement p = 0.122). When global improvement was reclassified into three groups based on the score: (1 - 2, 3 - 4, and 5 - 7), the fbas - guided treatment group had a statistically significant improvement compared to the non - fbas - guided treatment group, at the 5% level (p = 0.047). To evaluate if the questionnaire identified two separate groups, an analysis was performed for both the average and median trait scores for questions 1 - 5 (bupropion - responding personality style) and questions 6 - 10 (fluoxetine - responding personality style). These results are shown in table 2 (for average trait score) and in table 3 (for median trait score). This is a preliminary study, designed to see if an easily administered questionnaire based on premorbid traits and certain depressive symptoms could improve the aim of a psychiatrist in selecting an antidepressant . The data were in the direction of better results in the fbas - guided group, particularly after adjusting for differences in age, gender, and marital status . When global improvement data were grouped, there were statistically significant better results in the fbas - guided group . The analysis for internal consistency, designed to evaluate if the questionnaire identified two different subgroups of patients, did not show that the questionnaire differentiated the two hypothesized groups, perhaps due to small sample size . Sample size was not sufficient to determine which individual questions were driving the overall tendency of the questionnaire to predict bupropion versus fluoxetine response . Some of the ten scale questions numbers 4 and 5 in particular may identify undiagnosed bipolar patients . This seems unavoidable, as traits of bipolar disorder overlap traits of other diagnostic categories, including personality disorders . Since this study was performed, the scale has been revised to better assess premorbid traits . The revision also assesses irritability and self - esteem, and quantifies exercise participation prior to the onset of depression . The study was limited by the modest sample size, which diminished the statistical power to test the hypotheses related to efficacy and global improvement . Studies to validate the scale (with akiskal s temps - a or cloninger s tci) and a larger study initially randomized to treatment protocol, with subsequent randomization to fluoxetine and bupropion treatment in the non - fbas - directed group, are indicated . Replication of the study with a larger sample could better inform the relationship of fbas - guided treatment with efficacy and global improvement . If these results are positive, the use of a brief, easily administered, office - based questionnaire could increase the likelihood that physicians will select the optimum antidepressant for patients, thus speeding patients recovery from depression . After reading each question carefully, please circle the number corresponding to the answer which best describes your experience:
The organism was isolated from a soil sample collected from rajshahi, bangladesh at the depth of 0.75 m using crowded plate technique (hammond and lambert, 1978). The organism was identified as a novel, streptomyces species on the basis of morphological, physiological, biochemical (shirling and gottlieb, 1969) and 16s rdna studies (genbank accession number bankit1256035 gq500975) and designated as streptomyces sp . Pure culture of the strain was maintained on czapek dox (alkaline) agar slant . Shake flask fermentations were run in 500 ml flasks containing 100 ml czapek - dox (alkaline) broth . The flasks were allowed to cool and the liquid media inoculated with spores of the organisms from previously prepared agar slant were poured into it . Then they were incubated at 37 for optimum yields on a rotary shaker at 250 rpm . At every 24 h interval, the flasks were harvested and antimicrobial metabolites production determined in terms of their antimicrobial spectrum . The concentrates were tested for antibacterial activity by disc diffusion method (bauer et al ., 1966) against b. subtilis for 15 consecutive days . The effect of ph and temperature on the antimicrobial production by the strain was studied by inoculating 24 h old culture in czapek - dox (alkaline) broth . The ph of the media was adjusted using hydrochloric acid (1 m) and sodium hydroxide (1 m). For temperature study, after sterilizing and inoculating with spores the flask were incubated at different temperatures (25~45). The production of antimicrobial metabolites was tested for antimicrobial activity after 120 h of incubation by disc diffusion method against b. subtilis . To determine the effect of carbon sources on antimicrobial metabolites production, different carbon sources such as sucrose, d - glucose, d - fructose, mannitol, d-(+) galactose, xylosa, lactose, d (+) mannose, rhamnose and maltose were added to the basal medium containing kcl (0.05%), kh2po4 (0.1%), mgso4, 7h2o (0.05%) and feso4, 7h2o (0.001%). Carbon sources were added in 3% concentration to the basal medium supplemented with nano3 (0.2%) as nitrogen source . The effect of various nitrogen sources such as nano3, yeast extract, kno3, ammonium sulphate, ammonium chloride, peptone, casein, l - asparagine and beef extract was studied by adding nitrogen source (0.2%) to the basal medium containing glucose (3%). Final ph of the medium adjusted to 8 and antibacterial activity was checked by disc diffusion method against b. subtilis for 15 consecutive days . Salt concentration has a profound effect on the production of antibiotic from microorganism due to its effect on the osmotic pressure to the medium (pelczer et al ., 1993). To observe this effect nacl was added to culture media at different concentrations such as 0%, 0.5%, 1%, 2%, 3%, 4% and 5% respectively . Glucose (3%) and yeast extract (0.2%) was used as carbon and nitrogen source respectively . The organism was isolated from a soil sample collected from rajshahi, bangladesh at the depth of 0.75 m using crowded plate technique (hammond and lambert, 1978). The organism was identified as a novel, streptomyces species on the basis of morphological, physiological, biochemical (shirling and gottlieb, 1969) and 16s rdna studies (genbank accession number bankit1256035 gq500975) and designated as streptomyces sp . Pure culture of the strain was maintained on czapek dox (alkaline) agar slant . Shake flask fermentations were run in 500 ml flasks containing 100 ml czapek - dox (alkaline) broth . The flasks were allowed to cool and the liquid media inoculated with spores of the organisms from previously prepared agar slant were poured into it . Then they were incubated at 37 for optimum yields on a rotary shaker at 250 rpm . At every 24 h interval, the flasks were harvested and antimicrobial metabolites production determined in terms of their antimicrobial spectrum . The concentrates were tested for antibacterial activity by disc diffusion method (bauer et al ., 1966) against b. subtilis for 15 consecutive days . The effect of ph and temperature on the antimicrobial production by the strain was studied by inoculating 24 h old culture in czapek - dox (alkaline) broth . The ph of the media was adjusted using hydrochloric acid (1 m) and sodium hydroxide (1 m). For temperature study, after sterilizing and inoculating with spores the flask were incubated at different temperatures (25~45). The production of antimicrobial metabolites was tested for antimicrobial activity after 120 h of incubation by disc diffusion method against b. subtilis . To determine the effect of carbon sources on antimicrobial metabolites production, different carbon sources such as sucrose, d - glucose, d - fructose, mannitol, d-(+) galactose, xylosa, lactose, d (+) mannose, rhamnose and maltose were added to the basal medium containing kcl (0.05%), kh2po4 (0.1%), mgso4, 7h2o (0.05%) and feso4, 7h2o (0.001%). Carbon sources were added in 3% concentration to the basal medium supplemented with nano3 (0.2%) as nitrogen source . The effect of various nitrogen sources such as nano3, yeast extract, kno3, ammonium sulphate, ammonium chloride, peptone, casein, l - asparagine and beef extract was studied by adding nitrogen source (0.2%) to the basal medium containing glucose (3%). Final ph of the medium adjusted to 8 and antibacterial activity was checked by disc diffusion method against b. subtilis for 15 consecutive days . Salt concentration has a profound effect on the production of antibiotic from microorganism due to its effect on the osmotic pressure to the medium (pelczer et al ., 1993). To observe this effect nacl was added to culture media at different concentrations such as 0%, 0.5%, 1%, 2%, 3%, 4% and 5% respectively . Glucose (3%) and yeast extract (0.2%) was used as carbon and nitrogen source respectively . The production of antimicrobial metabolites at different days was determined by disc diffusion assay method measuring the zone of inhibition against b. subtilis . The highest level was obtained after 10 days of incubation and then production was declined gradually (fig . 1). Thus the organism was allowed to incubate for 10 days for the production of antimicrobial metabolites . The effect of ph and temperature on antimicrobial metabolites production by the strain is presented in fig . 2 and 3 . The organism produced high levels of antibiotic production when culture medium incubated at 39. therefore the strain was strictly mesophilic for secondary metabolites production . Extreme ph and temperature were unfavorable for antibiotic production (fig . 2 and 3). The effect of different carbon sources on antibiotic production by the strain is presented in fig . 4 . Among the carbon sources, glucose proved to be the best carbon source for both cell growth as well as antimicrobial metabolites production by the strain . Sucrose also gave a similar pattern result followed by mannose, fructose, mannitol, rhamnose and xylose respectively . No antibiotic was produced when the medium was supplemented with galactose, lactose, raffinose and maltose as a sole carbon source . Carbohydrates such as glycerol, maltose, lactose and some others are known to have interference with the production of secondary metabolites (demain and fang, 1995). In the present study, the strain was found to produce high levels of antimicrobial metabolites in the medium supplemented with glucose (2%) as sole carbon source . In case of streptomyces species, with regards to carbon sources species specific variation may occur for cell growth and secondary metabolites production (jonsbu et al ., 2002). Medium supplemented with nano3 and peptone gave similar results followed by kno3, beef extract, casine, l - asparazine, ammonium sulphate and ammonium chloride . It was observed that the production of antimicrobial metabolites was maximum in presence of 1% nacl . 6 . Among different minerals tested only k2hpo4 and mgso47h2o had positive effects on antibiotic production followed by nacl, kcl and kh2po4
Copd is a common respiratory condition, which occurs with pulmonary and extrapulmonary complications, accompanied by systemic inflammations and is characterized by irreversible airflow limitations.1 it has been predicted that by 2020, it would be the third most common cause of death and the fifth most common cause of disability worldwide.2 smoking and factors such as contamination of the workplace, environmental pollution, and genetics are found to be the main causes of this disease.3,4 extrapulmonary complications that occur in copd patients are appetite reduction, decrease of caloric intake, and malnutrition.5 malnutrition leads to increased risks of mortality among these patients.6 the increase of inflammatory factors such as serum level of c - reactive protein7 and inflammatory interleukins (ils) such as il1, il6, and also tumor necrosis factor- has been found to be among the possible causes of malnutrition.8 in various studies, the increase in the serum level of ils such as il1 and il6 as well as tumor necrosis factor- has been reported in these patients.911 the increase of il1 strongly causes anorexia, increased energy consumption, loss of muscle protein, and leptin release of adipose cells, which, in turn, lead to malnutrition.12,13 the use of dietary supplements is usually recommended for the treatment of malnutrition after copd diagnosis, and it has been reported that the nutritional supplementations can improve nutritional status, anthropometric factors, and body weight,14,15 reduce disease symptoms,16 and improve quality of life.17 one of the supplements used along with treatment is conjugated linoleic acid (cla; polyunsaturated fatty acid), which is naturally found in animal sources.18 in recent years, increasing attention has been paid to the beneficial effects of cla on individuals health status.19 to mention a few findings, researchers have discovered that it improves food sufficiency, energy metabolism,20 and anti - inflammatory properties.21 the effect of cla on some of the inflammatory factors has been demonstrated in previous studies;21 however, scant studies have examined its effect on the nutritional status and caloric intake of copd patients . Therefore, this study aimed to evaluate the effects of cla supplementation on the nutritional status of copd patients . Ninety - three male copd patients were studied in a double - blind clinical trial at the pulmonary ward of the imam khomeini hospital in ardabil in april december 2015 . To do so, the patients suffering from copd were selected based on the american thoracic society criteria.22 the selected patients had chronic cough, sputum production, and dyspnea with the spirometry results of forced expiratory volume at first second / forced vital capacity ratio <70%, and their age range was 4080 years . The copd patients suffering from other chronic diseases such as cardiovascular diseases, diabetes, and malignancies were excluded from the study . Before the study, all the participants signed an informed consent and completed a reliable and validated questionnaire, which was designed to gather anthropometric and demographic information . The information obtained through the questionnaires contained each participant s name, age, literacy level, job, address, history of smoking and quitting it, and the number of exacerbations experienced in the previous year . Eventually, 90 patients accomplished the study (45 patients in each of the placebo and supplementation groups) (figure 1). This study was ratified in the research department of ardabil university of medical sciences (iran) with the ethical code of the patients weight and height indices were recorded, and their body mass indices (bmis) were obtained by calculating the ratio of their weight (kg) to their height squared (m) at the beginning and at the sixth week of the study . The individuals fasting weights were measured with the accuracy of 0.1 kg using seca scales while they were without shoes and had light clothes on . Each time at certain stages, accuracy and precision of the seca scales were calibrated using a standard 5 kg weight . Moreover, the participants stood upright while their heels, buttocks, shoulders, and heads leaned on the wall . Then, by placing a ruler horizontally on their head, their height was measured with the accuracy of 1 cm . The patients nutritional intake levels were assessed using a 24-hour dietary recall 3 days a week (2 weekdays and 1 weekend day) at the beginning, at the 4th week, and at the 6th week of the study (nine times in total). The content of the nutrients (macronutrients and micronutrients) and the energy intake of the patients were measured and analyzed by the nutritionist iv software . A standard form was used to determine the appetite score of the participants at the beginning, at the fourth week, and at the sixth week of the study . Information on biochemical parameters of the patients blood: 3 cc of venous blood sample was taken from each of the patients with 12 hours of fasting at the beginning and at the end of the study . The samples were gently transferred to test tubes, labeled, and then taken to a laboratory for serum separation . They were centrifuged at 4,000 rpm for 5 minutes and then poured into microtubes for il1 test . Il1 was measured with enzyme - linked immunosorbent assay (elisa) method using a kit produced by the german company of zelbio . According to the instructions of the manufacturer of the kit, il1 was diluted one in ten . In order to increase the accuracy of the results, then, the colors formed at the frequencies of 450 nm and 630 nm were identified by anhos 2000 microplate reader, and the concentration of the blood samples was calculated by multicalc (wallac, turku, finland) software . The supplementation group received a daily amount of 3.2 g cla soft gel (with 80% purity, which includes c9-t11 and c12-t10 isomers (50/50) and is manufactured in the form of tablets in the us with the commercial name of nutrex), while the control group received the same amount of placebo for 6 weeks . Before the beginning of the study, the boxes containing cla and placebo were coded as a and b, so that the researchers and the patients cannot identify the kind of supplementation offered to each group and so that the study can be conducted in a double - blinded manner . During the study, the patients were called every week to obviate any problems that might arise for them as well as to ensure that they take the supplementation . In order to both control the consumption of supplementation and prevent the loss of samples, the follow - up was also done through face - to - face visits, in addition to making telephone calls . The pills needed for 6 weeks were distributed to the patients and they were reminded that they should return the rest of the pills if they stop consuming them . Ninety - six percent of the patients took the pills regularly and were, therefore, investigated during the study . The patients compliance with the consumption of the pills was evaluated by the remaining pills at the end of the sixth week . The patients were informed about the possible complications of the pills, and the telephone number of the researcher was given to them to report any problems they might encounter during the study . Smirnov test was employed to investigate the normality of the distribution of data for each variable . The results obtained from them were analyzed by spss v11 software, and t - test, chi - square test, and analysis of variance were employed to determine the relationship between the variables . In addition, wherever possible, the results were expressed in the form of deviations () from the mean . Ninety - three male copd patients were studied in a double - blind clinical trial at the pulmonary ward of the imam khomeini hospital in ardabil in april december 2015 . To do so, the patients suffering from copd were selected based on the american thoracic society criteria.22 the selected patients had chronic cough, sputum production, and dyspnea with the spirometry results of forced expiratory volume at first second / forced vital capacity ratio <70%, and their age range was 4080 years . The copd patients suffering from other chronic diseases such as cardiovascular diseases, diabetes, and malignancies were excluded from the study . Before the study, all the participants signed an informed consent and completed a reliable and validated questionnaire, which was designed to gather anthropometric and demographic information . The information obtained through the questionnaires contained each participant s name, age, literacy level, job, address, history of smoking and quitting it, and the number of exacerbations experienced in the previous year . Eventually, 90 patients accomplished the study (45 patients in each of the placebo and supplementation groups) (figure 1). This study was ratified in the research department of ardabil university of medical sciences (iran) with the ethical code of the patients weight and height indices were recorded, and their body mass indices (bmis) were obtained by calculating the ratio of their weight (kg) to their height squared (m) at the beginning and at the sixth week of the study . The individuals fasting weights were measured with the accuracy of 0.1 kg using seca scales while they were without shoes and had light clothes on . Each time at certain stages, accuracy and precision of the seca scales were calibrated using a standard 5 kg weight . Moreover, the participants stood upright while their heels, buttocks, shoulders, and heads leaned on the wall . Then, by placing a ruler horizontally on their head, their height was measured with the accuracy of 1 cm . The patients nutritional intake levels were assessed using a 24-hour dietary recall 3 days a week (2 weekdays and 1 weekend day) at the beginning, at the 4th week, and at the 6th week of the study (nine times in total). The content of the nutrients (macronutrients and micronutrients) and the energy intake of the patients were measured and analyzed by the nutritionist iv software . A standard form was used to determine the appetite score of the participants at the beginning, at the fourth week, and at the sixth week of the study . Information on biochemical parameters of the patients blood: 3 cc of venous blood sample was taken from each of the patients with 12 hours of fasting at the beginning and at the end of the study . The samples were gently transferred to test tubes, labeled, and then taken to a laboratory for serum separation . They were centrifuged at 4,000 rpm for 5 minutes and then poured into microtubes for il1 test . Il1 was measured with enzyme - linked immunosorbent assay (elisa) method using a kit produced by the german company of zelbio . According to the instructions of the manufacturer of the kit, il1 was diluted one in ten . In order to increase the accuracy of the results, then, the colors formed at the frequencies of 450 nm and 630 nm were identified by anhos 2000 microplate reader, and the concentration of the blood samples was calculated by multicalc (wallac, turku, finland) software . The supplementation group received a daily amount of 3.2 g cla soft gel (with 80% purity, which includes c9-t11 and c12-t10 isomers (50/50) and is manufactured in the form of tablets in the us with the commercial name of nutrex), while the control group received the same amount of placebo for 6 weeks . Before the beginning of the study, the boxes containing cla and placebo were coded as a and b, so that the researchers and the patients cannot identify the kind of supplementation offered to each group and so that the study can be conducted in a double - blinded manner . During the study, the patients were called every week to obviate any problems that might arise for them as well as to ensure that they take the supplementation . In order to both control the consumption of supplementation and prevent the loss of samples, the follow - up was also done through face - to - face visits, in addition to making telephone calls . The pills needed for 6 weeks were distributed to the patients and they were reminded that they should return the rest of the pills if they stop consuming them . Ninety - six percent of the patients took the pills regularly and were, therefore, investigated during the study . The patients compliance with the consumption of the pills was evaluated by the remaining pills at the end of the sixth week . The patients were informed about the possible complications of the pills, and the telephone number of the researcher was given to them to report any problems they might encounter during the study . Kolmogorov smirnov test was employed to investigate the normality of the distribution of data for each variable . The results obtained from them were analyzed by spss v11 software, and t - test, chi - square test, and analysis of variance were employed to determine the relationship between the variables . In addition, wherever possible, the results were expressed in the form of deviations () from the mean . There was no significant difference between the two groups in terms of their average age, smoking history, forced expiratory volume at first second (table 1), weight, height, and bmi at the beginning of the study (table 2). Paired t - test showed that the average bmi of the patients in the supplementation group increased during the study, but it was not statistically significant (p=0.13). The results showed that, at the beginning of the study, there was no significant difference between the two groups in their serum level of il1; however, at the end of the study, the difference appeared to be significant (p=0.02). Paired t - test revealed that in the supplementation group, the serum level of il1 decreased significantly in the sixth week compared to the beginning of the study (p=0.008), while in the placebo group, it increased significantly during the same time (p=0.02; table 3). According to the results, at the beginning of the study, there was not any significant difference between the patients of the two groups in their appetite score and the average caloric intake . Yet, this difference was found to be statistically significant at the end of the study as the results of independent t - test revealed (p<0.05). Furthermore, the analyses showed that although the difference in the appetite score of the patients in the supplementation group was not significant in the fourth week (p=0.07), it was significant in the sixth week (p=0.001) as compared to the beginning of the study . As for the placebo group, the overall changes throughout the study were not found to be statistically significant (p=0.06; figure 2). In addition, repeated measures analysis of variance demonstrated a significant increase in the average caloric intake of the patients in the supplementation group during the study (p=0.01). As regards this variable, the difference observed between the fourth week and the beginning of the study was not significant (p=0.06), while the difference between the end of the sixth week and the beginning of the study as well as between the end of the sixth week and the fourth week appeared to be significant (p<0.05). In the placebo group, the average changes throughout the study were not found to be statistically significant (figure 3). The results revealed that the average amount of carbohydrate, protein, fat, fatty acids (saturated, unsaturated with one double bond, and polyunsaturated), cholesterol, and fiber intake was not significantly different between the two groups at the beginning of the study, but, at the end of the study, the results of independent t - test revealed that the difference between carbohydrate, protein, fat, fatty acids (saturated, unsaturated with one double bond, and polyunsaturated), cholesterol, and fiber intake is significant (p<0.05). In addition, repeated measures analysis of variance demonstrated a significant increase in the average carbohydrate, protein, and fat intake (p<.05) in the supplementation group during the study; the changes observed during the study in the average intake of fatty acids (saturated, unsaturated with one double bond, and polyunsaturated), cholesterol, and fiber were not significant . In the placebo group, the trend in carbohydrate and protein intake showed significant decrease during the study (p<0.05; table 4). For both the groups under study, the analysis through post hoc least significant difference test did not show any significant differences in the average fatty acids (saturated, unsaturated with one double bond, and polyunsaturated), cholesterol, and fiber intake neither in the fourth week nor in the sixth week compared to the beginning of the study . Similarly, in the placebo group, the decrease in the intake of these during the study was not significant (table 4). Regarding the average serum electrolytes intake, the results did not show any significant difference between the two groups at the beginning of the study . In addition, at the end of the study, significant differences between the two groups were only observed in the average calcium, potassium, and selenium intake (p=0.04; table 5). Based on the obtained results, there was no significant difference between the two groups in their average vitamin intake at the beginning of the study . Furthermore, at the end of the study, significant differences between them were only observed in vitamins b2, b6, and e intake (p<0.05). In addition, in the supplementation group, only average vitamins b2, b6, and e intake increased significantly during the study (p=0.02; table 6). Studies investigating the effect of cla on copd patients are scant . To the best knowledge of the researchers, a number of studies have been conducted investigating the effect of this supplement on healthy people, chronic diseases, and different types of cancers some of which are discussed briefly later . This study demonstrated that the consumption of cla reduces the serum level of il1 in copd patients . Several other studies have shown that some cytokines such as serum il1 increase in these patients.9,11 sapey et al23 indicated that the serum level of il1 is strongly related to copd disease severity . Hammad et al24 found that there is a strong significant relationship between copd severity and serum level of il1, which shows that it plays an important role in the process of systemic inflammation experienced by the copd patients . In their case control study, hegab et al25 found that the serum level of il1 in copd patients is considerably higher than that in the healthy people, which indicates that il1 is involved in the pathogenesis of copd . In their study, deboer et al26 injected il1 into mice and observed that after 312 hours, nutritional intake significantly decreased . Therefore, they concluded that il1 is one of the important mediators in this process . It is one of the pre - inflammatory cytokines, which is produced from activated macrophages, and is one of the important mediators of inflammatory response, which causes expression and demonstration of many genes.13,26 the increase of this inflammatory mediator in copd patients causes appetite reduction, which contributes to weight loss, and reduction of bmi, which, in turn, leads to increased risks of malnutrition.12,27 cla supplementation with different isomer percentages and sometimes a relatively special isomer is considered as an agent that is antioxidant, anti - inflammatory, anti - obesity, anticancer, anti - atherosclerosis, stimulator of immune system, stimulator of growth factor, changer of body composition from fat to muscle, etc, in animal and human models.28,29 with its anti - inflammatory properties, it can also inhibit inflammatory mediators such as il1 and decrease their serum level and, thereby, lead to appetite improvement in patients.18,20 the findings of this study are in line with those of the study of wendell et al.30 they showed that long - term consumption of cla could reduce inflammatory mediators such as il1, which exacerbate disease, though it should be noted that their study was conducted on asthma patients . The findings were not in concordance with those reported by kelly31 and tavakkoli darestani et al.32 in their studies, the consumption of cla supplementation by healthy females did not affect the serum level of il1, which might be related to the sample they studied . In this study, however, the use of cla supplementation for 6 weeks significantly increased caloric intake and the absorption of macronutrients, such as carbohydrate, fat and protein, in the patients, which lead to an increase in their weight and bmi . However, the changes were not found to be statistically significant, one reason for which seems to be the limited intervention time . Zambell et al33 realized that the consumption of cla by young females for 64 days significantly increased their caloric intake . Although the mechanism of action of cla is not exactly known, one of the many possible mechanisms proposed in this regard is that, through changing the composition of cell membrane phospholipids, they can alter the cell membrane functions such as secondary messages, neurotransmitter receptors, and transport proteins and inhibit the production of pre - inflammatory cytokines.34 changes in membrane phospholipids as well as the regulation of cytokines production might affect the synthesis of neuropeptides related to nutritional intake and eventually lead to the improvement of anorexia, which, in turn, can improve patients nutritional status and prevent weight loss that causes mortality to increase among copd patients.35 one of the limitations of this study was the limitation that the researchers encountered in the process of identifying patients compatible with the criteria for entering this study . Another limitation was that, due to the lack of financial resources, the level of linoleic acid in the patients blood was not checked . Limitations in financial resources that did not allow the investigation of the levels of other effective inflammatory cytokines and the use of drugs for longer periods of time as well as the lack of similar studies about the effect of cla on this disease made it impossible to compare the results of this study with other similar ones . Therefore, the authors had to refer to the studies conducted on other chronic diseases . In this study, cla supplementation, in addition to significantly reducing the serum level of il1, increased appetite score, average caloric intake, and average macronutrients intake in copd patients . Considering the findings of this study, it can be concluded that cla supplementation increases appetite and nutritional intake and improves nutritional status of copd patients, which, in turn, lead to decrease in malnutrition, slow progression of the disease, and may reduce the mortality.
A networked virtual environment (nve) is a computer - supported collaborative work (cscw) environment where multiple participants can interact with each other through computer networks for enhancing performances of their collaborations . Since, nve can overcome limit of time and space differences during face - to - face collaborations, nve has been widely researched for collaborative computer - aided design [1, 2]. In a collaborative three - dimensional (3d) computer - aided design (cad) system, distributed participants can work together in order for creating or modifying a 3d model in a virtual environment . A 3d biomolecular modeling system is one of promising collaborative applications, and it has also been popularly researched and developed by various research groups . In order to design new materials and new drugs, we need to understand functions of proteins through analysis of a 3d protein structure at atomic resolution . First, it is generally determined by x - ray crystallography or nmr . Second, we can simulate the behaviors of the 3d molecules with equations of quantum and physics through computer simulations . Third, the 3d model of an enzyme, which is a candidate material or drug, can be used to design a higher binding affinity inhibitor against a target enzyme . Last, we can simulate the designed enzyme to have better characteristics such as higher activity and stability for industrial purpose [3, 4]. Since molecular modeling is a large and complicated process the participating biologists generally use their own favorite molecular modeling systems among many available systems . Therefore, real - time collaborations of the participating biologists using nve systems are not smoothly realized in general . In this paper, we propose a collaborative experiment environment with different molecular modeling systems . The environment consists of two collaborative systems, vrmms (virtual reality molecular modeling system) [57] and co - coot . Since the biologists can use their favorite systems with their designated roles, the proposed environment provides with a tunneling service for integrating the different collaborative applications . There have been several researches on collaborative molecular modeling systems for studying and analyzing 3d biomolecular structures . It performs molecular energy simulations, real - time monitoring, communication among participants, and document management . Biocore can also combined with existing software tools such as vmd (a visualization tool) and namd (a computational system). However, biocore strictly requires a high performance pc for effective and efficient exercises of collaborations, and the network system of biocore is not an open standard . As a result, most researchers cannot easily combine biocore with other applications . In our previous papers, vrmms was also coined a nve system to provide various collaborative device environments such as a cave and a laptop [6, 7]. It is specialized to edit 3d biomolecular structures for finding a best enzyme model in a crystallography process . Using coot as a platform, we developed a novel real - time collaboration tool, co - coot, to study 3d biomolecular structures . Co - coot can represent 3d structure models simultaneously at multiple displays in remote places, and enable multiple users to manipulate the models and conveniently communicate with other users with co - coot . Even though, co - coot is a good example of research approach to combine a collaboration module with existing open source software, it can restrict possible participations from other applications with different roles . We designed a system architecture of the collaborative environment as a client / server network topology . After the registration, other remote users can join the created project using co - coot or vrmms . The participated clients can create various collaborative messages such as manipulation, rendering, editing, and ownership . If the collaborative server receives the messages from user 1, it directly distributes them to user 2 and also translates the co - coot format messages into the vrmms format messages for user 3 and user 4 . The proposed agents of co - coot and vrmms provide open apis for the collaborative tunneling services . The participating researchers can perform their collaboration simultaneously to share their intermediate experimental results, discuss a future direction, or solve their difficult problems via the proposed networked virtual environment . The proposed environment offers a pessimistic concurrency control mechanism, which allows accesses and manipulates shared 3d molecular models with permission from the collaborative server . During the collaborative works, any user can request the collaborative server for his / her authority over a shared molecular model . If other user already owns the shared molecular model, the server denies the request from the user . The proposed networked virtual environment also provides a private workspace if the denied user still wants to manipulate the shared molecular model privately . With the private workspace, the user can manipulate every features of the biomolecular model and the intermediate result can be stored in a file after using the private workspace . In order to provide transformations between two different applications, we analyzed both vrmms and co - coot in order to extract important functions in a collaborative 3d molecular modeling process . We modeled six functions of vrmms and co - coot as described in tables 1 and 2, respectively . Table 1 shows the selected important functions of vrmms and table 2 shows the extracted important functions of co - coot . Function, the file transferring function, and the chatting function can be equally treated between vrmms and co - coot . A user of vrmms can monitor 3d molecular models with various visualization methods such as wire frame, ball and stick, and surface modes in rendering function . Vrmms also provides a simulation function to calculate energy values of the 3d molecular models . In co - coot, a user can visualize molecular models as a wire frame mode . So, a surface rendering model in vrmms can be converted and expressed as a the same conversion strategy can be applied to the ball and stick rendering model of vrmms . Though vrmms has the simulation function, co - coot does not, on the other hand . Then, the simulation results from vrmms could be translated into a text format and read by the co - coot users as shown in figure 4 . As described in table 1, the proposed environment conducted through using a real molecular model . Table 4 shows its related information such as its pdb code, name, and number of atoms . First, we compared the rendering speed of co - coot and vrmms with various visualizations using the same molecular models . The experiment was conducted on a desktop pc with core 2 quad cpu and an nvdia gtx 265 graphic card . We tested rendering speeds of co - coot and vrmms for 100 seconds in terms of the fps (frames per second) values with four possible visualization modes . As shown in figure 5, the results showed a feasible rendering speed even though it is dependent on visualization modes or modeling systems . Second, we measured the number of transformations and average delivering times . In order to measure the values, we conducted a collaborative molecular design process within different environments through network connections as shown in figure 6 . The design computers were placed in different locations, and connected by a 10 mbps lan . They conducted the collaborative design tasks as described in tables 1 and 2 for 40 minutes . A total number of transformed operations was 1004, and most occurred transformations were manipulation and chatting as shown in figure 7(a). As shown in figure 7(b), the proposed transformation strategies as described in table 3 showed different delivering performances . Manipulation, ownership, file transferring, and chatting showed fast delivery times . Since modification needs more times to convert different data, the average delivering time of rendering showed medium performances . Simulation and editing generally showed the worst performances in the experiment because the proposed environment consumed lots of times to transform the operations . However, they required more collaborative tunneling services such as a voice chatting and a sharing movie . They also answered if the proposed environment could be applied to support other famous molecular modeling systems, then it would be feasible to utilize the proposed environment in the real collaborative molecular modeling processes . In this paper, we propose a new collaborative molecular modeling environment to connect different modeling systems based on an approach with a collaborative tunneling service and transformation strategies . With our approach, the results of another performance evaluation of the pilot tests showed that the proposed environment could successfully transform collaboration data with stable delivering times through network . An additional user study showed that the participants would like to adopt the proposed system in their collaborative molecular modeling environment . For our future works, we will expand the tunneling services to the other popular molecular modeling systems using ontology to support semantic transformation strategies.
Acute anaemia can also result from excessive blood loss and this can affect healing of tissues after surgery . Maxillofacial surgical procedures can be classified as minor, intermediate, major, or supramajor cases based on the type and duration of the procedures [29]. These procedures may be associated with excessive blood loss from the facial microvasculature and major blood vessels within the operation field of the surgeon [3, 1014]. Quite often, the lesions have also invaded the walls of the vessels or lie close to these vessels, thereby making them vulnerable to injury during surgery with consequent loss of blood . Furthermore, a significant amount of bleeding can occur during dissection of the capillary - rich skin, subcutaneous tissue, and muscles in the maxillofacial region . Various strategies for preventing excessive blood loss have been applied to maintain haemostasis and these also include the use of hypotensive anaesthesia and tranexamic acid . Patients may be required to donate varying number of units of blood prior to surgery which may or may not be used . The potential blood loss and these include haemoglobin or hematocrit levels, body weight of the patient especially for paediatric cases, extent of the lesion, age, and gender as well as the type and extent of procedure . The experience of the surgeon and possibly the duration of surgery must also be considered . Evaluated intraoperative blood loss by thromboelastography (teg) and they stated that it was an objective method of assessing and predicting intraoperative blood loss . Much attention has been given to blood loss following general and orthognathic surgeries in the literature, but little work has been done on other maxillofacial procedures [59, 1520]. The aim of the study was therefore to assess the amount of blood loss and the number of units of whole blood required for oral and maxillofacial procedures and also to evaluate any relationship between the amount of blood loss and duration of surgery . Ethical approval to carry out the study (upth / adm/90/s.ii / vol.x/371) was provided by the university of port harcourt hospital's ethics and research committee (chairperson professor anthony okpani) on january 27, 2014 . All cases of maxillofacial surgical procedures done under ga in the mfu theatre, from january 2007 to december 2013, were included in the study . Patients' demographics and haematological profile retrieved from the case files and theatre records by the house officer and cross - checked by one of the consultants (b. o. a) were documented in a retrospective review chart . Pre- and postoperative haematocrit values, number of units of whole blood requested, cross - matched, and used, procedure, amount of blood loss, and duration of surgery were recorded . The cases were divided into two groups which were diseases or procedures on soft and hard tissues . The total blood loss estimation was done by calculating the amount of blood in the suction bottle and adding this to the estimated value from all the blood soaked gauze . Chicago, il) version 16 . Means and standard deviation of haematocrit values, estimated blood loss, and duration of surgery for each category of disease were determined and the means within groups and between the two groups were compared with paired sample t - test . Linear regression analysis was used to analyze the association between blood loss and duration of surgery . A total of 139 patients were analyzed, out of which 75 (54.0%) were males and 64 (46.0%) were females; age range was 2 months to 78 years; mean (sd) was 21.3 (18.5) years . Isolated cleft palate 19 (13.7%) and cleft lip 18 (12.9) constituted the highest number of cases seen . Cases of malignant soft tissue tumours presented with the lowest preoperative haematocrit and cases of soft tissue tumours had the highest mean value . Up to 3 units of blood were requested for malignant tumours, but we mostly used 2 units for the less extensive resections . Lowest preoperative haematocrit level taken for elective surgery was 21% and this was in cleft lip . Eighty - three cases involved hard tissues . Range and mean haematocrit values of bony lesions are reflected in table 2 . Cases with multiple fractures presented with the lowest preoperative haematocrit and cases of cysts / fibroosseous lesions had the highest mean value . Up to 3 units of blood were requested for resection and reconstruction in mandibular tumours, but we mostly used 2 units . Isolated unilateral cleft lip had the lowest mean value of estimated blood loss of 10.4 (10.8) mls and also the lowest duration of surgery of 58 (76) mins . There was no significant relationship between both parameters for cleft lip (table 3). Comparison of mean values of blood loss and duration between isolated cleft lip and isolated palates gave p> 0.05 . Complete cleft of primary and secondary palate recorded blood loss of 400 mls with a mean duration of 4 hrs 23 mins, but the correlation coefficient, 0.327, was not significant, with a p> 0.05 . The association between blood loss in benign soft tissue tumours, 360 mls, and duration of surgery, 2 hrs 10 mins, was the least significant, p> 0.05 . For fractures of the mandible blood loss was 352 mls and duration was 175 min, significance: p <0.05 (table 4). Zygomatic complex fractures recorded blood loss of 248 mls and duration of 185 mins, significance: p <0.05 . In mandibular tumours, blood loss was 1214 mls and duration was 5 hrs 30 min . In maxillary tumours treated by hemimaxillectomy, mean blood loss was 627 mls and duration was approximately 2 hrs; the relationship was not significant with p value as reflected in table 4 . Comparison of mean values of blood loss and duration between mandibular and maxillary tumours gave p> 0.05 . When the mean blood loss in the two groups was compared, there was significant difference, r coefficient of 0.935, p <0.05 . By comparison of means of duration of surgery, r coefficient was 0.817 and p <0.05 also showed significant differences between the two groups . Intraoperative blood loss can be predicted by preoperative thromboelastography which measures the interaction between coagulation factors, platelets, and fibrinolytic agents . Parameters measured included the clot formation time, maximal clot firmness, fibrinolytic resistance of clot, and angle . Separated their patients into 2 groups based on intraoperative bleeding volume (400 mls and> 400 ml); they found no significant associations between routine anticoagulant tests and intraoperative blood loss . When the teg results for the two groups were compared, there was significant association between clot formation time, maximum clot firmness, and alpha angle, but the fibrinolytic resistance of blood clot was not related to intraoperative blood loss and they concluded that alpha angle greater than 67 degrees was suggestive of blood loss of 400 mls or less with 95% certainty, but such predictions may not reflect actual values . Eipe and ponniah opined that differences in pre- and postoperative haematocrit values and deductions of blood loss by the gross formula are invaluable; the formula stated that actual blood loss equals blood volume multiplied by the difference in pre- (initial) and postoperative (final) hematocrit values and divided by mean of both hematocrit values; blood volume was calculated by multiplying body weight in kilograms by 70 ml / kg; however, the values are usually difficult to correlate with exact intraoperative loss due to intraoperative blood transfusion and crystalloid infusions as well as postoperative blood losses / fluid dilutions . Hence clinical estimates of intraoperative blood loss are quite useful and this is done before irrigating wounds with any fluid . In the operating room, considering the controversy surrounding the use of a discrete concentration of haemoglobin as a transfusion trigger for managing acute blood loss, the anaesthetists mainly depend on the clinical estimation of blood loss which includes checking for pallor and the trends of the patient's oxygen saturation, capillary perfusion, blood pressure, and heart rate patterns . Therefore, each patient was assessed individually and blood transfusion was patient - specific . In this study, the higher blood loss as well as the longer duration of surgery recorded during operations on hard tissues when compared with soft tissues was likely due to the significant amount of blood loss while dissecting the soft tissue overlying bone before resecting the affected bone itself . Although our result showed that operations for the excision of malignant soft tissue tumours recorded the highest amount of blood loss and the longest duration of surgery on the whole, this was mainly due to the large dimensions and extent of the tumours involved . Revascularization of abnormally proliferating cells and local spread of the lesion also contributed to increasing bleeding episode seen in our patients . It is not surprising that, in the hard tissue category, the amount of blood loss and duration of surgery were particularly highest for mandibular tumours undergoing resection and reconstruction of the jaw . The association between these primary and secondary outcome variables was quite significant for mandibular and zygomatic complex fractures but not for tumours of the jaws . Treatment of these fractures involves the dissection and detachment of soft tissues and reflection of the mucoperiosteum overlying the bones and these result in appreciable bleeding . Open reduction and internal fixation of these bone segments are actually major surgeries especially when multiple sites are involved and the number of fracture sites will determine the duration of surgery and amount of blood loss . Our findings will serve as baseline studies for comparison with future studies on intraoperative blood loss from surgical management of facial fractures . Mandible documented a median blood loss of 300 mls with an interquartile range of 1501100 mls whereas we had an average of 1214 mls with a range of 3002800 mls . While the study carried out by pogrel et al . Documented a longer duration of operation for vascularized bone grafts (vbg), they however documented equal blood loss (1,100 mls) during reconstruction of mandible with vascularized and nonvascularized bone grafts . The main reason why our patients bled more may be accounted for by the extent of the benign and locally aggressive nature of ameloblastomas of the mandible seen in our environment . Also contributing to the bleeding, the relatively less bleeding seen in operations involving maxillary tumours may be due to the fact that most of the tumors were removed by intraoral approach . For maxillary tumours, resections were performed, after which the defect was covered with sofra - tulle - wrapped gauze while rehabilitation was accomplished with obturators . However, the amount of blood loss during maxillary tumour resection will also depend on the size and extent of the lesions . We always use infiltration of adrenaline 1: 200,000 for up to 15 min prior to the wound incision in addition to hypotensive anaesthesia for major surgeries and these contribute to reduction in blood loss . The meta - analysis of hardwicked et al . Has proven that adrenaline infiltration can reduce bleeding during reduction mammoplasties and the outcome, safety, and efficacy do not depend on the extent / size of the lesions or the tissues involved . Experience has shown that a wider nasal floor mucosa repair in the palate causes more bleeding which is further exacerbated by the diffuse and multiple blood supply of the palate when compared to the skin of the lip . The american college of physicians recommended that rbc transfusions should be done unit by unit and reassessment should be done between each transfusion . According to tartter and barron excessive intraoperative blood transfusion during surgeries for colorectal malignancies, without reevaluating the haemoglobin concentration in between transfusions, resulted in 90% of the unnecessary transfusions . In our center, the anaesthetists habitually request for a few more units of blood than required which may not be used . This is due to the correct assumption that most maxillofacial procedures are associated with excessive blood loss . On the contrary, our evaluation showed that the highest number of units needed during surgeries for extensive malignant lesions was 3 units while reconstructive surgery for benign tumours of the mandible required 2 units of whole blood . Essentially, blood transfusion may be indicated in cases where the preoperative haemoglobin value used as the transfusion trigger was less than 8 mg / dl . The lowest preoperative packed cell volume taken for elective surgery in our study was 21% . The benefits of performing operations on patients with low pcv or haematocrit values should be weighed against the risks while blood must be made available in case intraoperative transfusion is required . Notwithstanding, the decision to operate despite a low preoperative haematocrit value as in this case was guided by the favourable anticipated amount of blood loss and duration of surgery . Apart from maintaining haemostasis, care must be taken to prevent excessive blood losses by avoiding major blood vessels . The approach of lesions via avascular planes, as well as subperiosteal dissections for noninvasive lesions, and safety margin sacrifice of tissues in infiltrative lesions are excellent techniques for preventing intraoperative bleeding . Considering that blood transfusion has potential complications [2529] and that blood is also a limited resource, inappropriate use of blood blood wastage can be avoided by paying more attention to the expected blood loss and using preset criteria for homologous blood administration [23, 30, 31]. In maxillofacial patients, autologous blood transfusion and intraoperative blood salvage, commonly used for intracavity operations such as abdominal and thoracic operations, may not be technically amenable to maxillofacial surgeries in our centre . The initiatives taken by the national blood transfusion committees and the use of patient blood management guidelines, according to goodnough and shander, have shown that patient's outcome can be improved by evidence - based transfusion practices, minimization of blood loss, and optimization of patient red blood cell mass . To provide flexibility, as well as avoid the complications and cost of transfusion, the authors prefer the group and save policy rather than the type and cross - match protocol for lesions with expected blood loss of 500 mls or less . This blood can then be made available and cross - matched for use in case of unexpected high loss [16, 17, 23]. In conclusion, in this study, there was significant relationship between estimated blood loss and duration of surgery for mandibular and zygomatic complex fractures . The number of units of whole blood requested for was a little higher than the blood loss estimates except for malignant soft tissue tumours, multiple fractures, mandible fractures, and tmj disorders . The decision was based on precaution, considering the fact that blood may not be available if needed . Multiple factors may be responsible for blood loss during maxillofacial operations, but much still has to do with the physiological status and normal clotting mechanisms of the patients, nature of the lesions, and the use of anaesthetic and surgical control measures.
Mice were maintained and used for experimentation according to the guidelines of the institutional animal care and use committees of the university of california, davis and the middlebury college animal facility . The hei10, mlh3, rnf212, spo11 and sycp1 mutant lines and primer sequences for genotyping were previously described . Tissues from adult mice were sonicated in ripa buffer, protein concentration was measured by the bradford assay and 100200 g of protein was separated by sds - page . After protein transfer to nitrocellulose membranes (waterman), blots were incubated overnight with the following antibodies: mouse monoclonal anti - ccnb1ip1/hei10 (ab118999 abcam, 1:2000 dilution), rabbit polyclonal anti - ccnb1ip1/hei10 (this study, 1:2000), or mouse anti - tubulin (biolegend, 625902, 1:2,000). Secondary antibodies (1:10,000 dilution) were goat anti - rabbit or anti - mouse iggs conjugated to horseradish peroxidase (hrp; southernbiotech, 4050 - 05 and 1031 - 05, respectively). A polyclonal antibody against mouse hei10/ccnb1ip1 was raised in rabbits against a mixture of two c - terminal peptides . Antibodies were purified from serum using protein a / g spin columns (ge healthcare). Testes and ovaries were dissected from freshly killed animals and processed for surface spreading as described . For all quantification, images from at least two animals (25) were analyzed . All cytological analyses were performed by two observers; the second observer was blind to which group / genotype was being analyzed . Immunofluorescence staining was performed as described, using the following primary antibodies with incubation overnight at room temperature: mouse anti - sycp3 (sc-74568 santa cruz, 1:200 dilution), rabbit anti - sycp3 (sc-33195 santa cruz, 1:300), guinea pig anti - syce1 (1:2000)(generously provided by chist hg, karolinska institutet), guinea pig anti - rnf212 (1:50), rabbit anti - rnf212 (1:200), rabbit anti - msh4 (ab58666 abcam, 1:100), mouse monoclonal anti - ccnb1ip1/hei10 (ab118999 abcam, 1:150), rabbit polyclonal anti - ccnb1ip1/hei10 (this study,), mouse anti - mlh1 (1:50, 550838 bd pharmingen), mouse monoclonal anti-h2ax (05 - 636 millipore, 1:500), mouse monoclonal anti - cdk2 (sc-6248 santa cruz, 1:200), guinea pig anti - h1 t (a gift from m.a . Slides were subsequently incubated with the following goat secondary antibodies for 1 h at 37 c: anti - rabbit 488 (a11070 molecular probes, 1:1000 dilution), anti - rabbit 568 (a11036 molecular probes, 1:2000), anti - mouse 555 (a21425 molecular probes, 1:1000), anti - mouse 594 (a11020 molecular probes, 1:1000), anti - mouse 488 (a11029 molecular probes, 1:1000), and anti - guinea pig fluorescein isothiocyanate (106 - 096 - 006 fitc, jackson labs, 1:200). For chiasma counts, air - dried preparations of diakinesis / metaphase i stage cells were prepared as described and stained with dapi . Testes were fixed in formalin, embedded in paraffin, sectioned and processed using the apoptag plus peroxidase in situ apoptosis detection kit (chemicon). Immunolabeled chromosome spreads and dapi - stained diakinesis / metaphase i nuclei were imaged using a zeiss axioplan ii microscope with 63 plan apochromat 1.4 objective and exfo x - cite metal halide light source . Images were captured by a hamamatsu orca - er ccd camera and processed using volocity (perkin elmer) and photoshop (adobe) software packages . Sim analysis was performed using a nikon n - sim super - resolution microscope system and nis - elements 2 image processing software . Msh4-rnf212 colocalization was determined using nis - elements and co - foci were confirmed by visual inspection . Testes sections were imaged using an axiovert 200 microscope and axiocammrc camera using axiovision 4.4 software . Mice were maintained and used for experimentation according to the guidelines of the institutional animal care and use committees of the university of california, davis and the middlebury college animal facility . The hei10, mlh3, rnf212, spo11 and sycp1 mutant lines and primer sequences for genotyping were previously described . Tissues from adult mice were sonicated in ripa buffer, protein concentration was measured by the bradford assay and 100200 g of protein was separated by sds - page . After protein transfer to nitrocellulose membranes (waterman), blots were incubated overnight with the following antibodies: mouse monoclonal anti - ccnb1ip1/hei10 (ab118999 abcam, 1:2000 dilution), rabbit polyclonal anti - ccnb1ip1/hei10 (this study, 1:2000), or mouse anti - tubulin (biolegend, 625902, 1:2,000). Secondary antibodies (1:10,000 dilution) were goat anti - rabbit or anti - mouse iggs conjugated to horseradish peroxidase (hrp; southernbiotech, 4050 - 05 and 1031 - 05, respectively). A polyclonal antibody against mouse hei10/ccnb1ip1 was raised in rabbits against a mixture of two c - terminal peptides . Antibodies were purified from serum using protein a / g spin columns (ge healthcare). Testes and ovaries were dissected from freshly killed animals and processed for surface spreading as described . For all quantification, images from at least two animals (25) were analyzed . All cytological analyses were performed by two observers; the second observer was blind to which group / genotype was being analyzed . Immunofluorescence staining was performed as described, using the following primary antibodies with incubation overnight at room temperature: mouse anti - sycp3 (sc-74568 santa cruz, 1:200 dilution), rabbit anti - sycp3 (sc-33195 santa cruz, 1:300), guinea pig anti - syce1 (1:2000)(generously provided by chist hg, karolinska institutet), guinea pig anti - rnf212 (1:50), rabbit anti - rnf212 (1:200), rabbit anti - msh4 (ab58666 abcam, 1:100), mouse monoclonal anti - ccnb1ip1/hei10 (ab118999 abcam, 1:150), rabbit polyclonal anti - ccnb1ip1/hei10 (this study,), mouse anti - mlh1 (1:50, 550838 bd pharmingen), mouse monoclonal anti-h2ax (05 - 636 millipore, 1:500), mouse monoclonal anti - cdk2 (sc-6248 santa cruz, 1:200), guinea pig anti - h1 t (a gift from m.a . Slides were subsequently incubated with the following goat secondary antibodies for 1 h at 37 c: anti - rabbit 488 (a11070 molecular probes, 1:1000 dilution), anti - rabbit 568 (a11036 molecular probes, 1:2000), anti - mouse 555 (a21425 molecular probes, 1:1000), anti - mouse 594 (a11020 molecular probes, 1:1000), anti - mouse 488 (a11029 molecular probes, 1:1000), and anti - guinea pig fluorescein isothiocyanate (106 - 096 - 006 fitc, jackson labs, 1:200). Coverslips were mounted with prolong gold antifade reagent (molecular probes). For chiasma counts, air - dried preparations of diakinesis / metaphase i stage cells were prepared as described and stained with dapi . Testes were fixed in formalin, embedded in paraffin, sectioned and processed using the apoptag plus peroxidase in situ apoptosis detection kit (chemicon). Immunolabeled chromosome spreads and dapi - stained diakinesis / metaphase i nuclei were imaged using a zeiss axioplan ii microscope with 63 plan apochromat 1.4 objective and exfo x - cite metal halide light source . Images were captured by a hamamatsu orca - er ccd camera and processed using volocity (perkin elmer) and photoshop (adobe) software packages . Sim analysis was performed using a nikon n - sim super - resolution microscope system and nis - elements 2 image processing software . Msh4-rnf212 colocalization was determined using nis - elements and co - foci were confirmed by visual inspection . Testes sections were imaged using an axiovert 200 microscope and axiocammrc camera using axiovision 4.4 software.
Pseudosarcomatous fibromyxoid tumor of the prostate (pfmt) first reported by hafiz et al . In 1984, is a benign fibroproliferative process that histologically resembles sarcoma . Although these benign fibroproliferative processes of the prostate are unusual, it is important to recognize these lesions in order to avoid unnecessary radical procedures . Also the pathologist should use special immunohistochemical stains to verify that it is a benign fibroproliferative process . A 70-year - old man has nearly a 2-year history of lower urinary tract symptoms (luts) such as nocturia, urgency and difficulty in voiding . Due to a high level of prostate specific antigen (psa), prostate biopsy was performed in another urology department . The psa level was 5.02 ng / ml . The measurement of the prostate volume with pelvic ultrasound was nearly 200 gr . Cystoscopy revealed a normal anterior urethra with a large protruding prostatic mass and normal bladder . Based on these findings, open adenomectomy (suprapubic prostatectomy) was performed nearly 2 years ago . The patient has been followed - up for two years and has no urinary symptoms in this period . Small gland proliferations was observed in the limited periphery place and in this place the reaction with hmw ck and p63 antibodies was seen in the basal cells (fig . 3). Staining in the spindle cells was negative for vimentin and cd 34 . The overall clinical and pathological features are consistent with pseudosarcomatous fibromyxoid tumor of the prostate . Staining for smooth muscle actin (original magnification x10). Staining for p63 in the basal cell (original magnification x10). The pseudosarcomatous fibromyxoid tumor of the prostate (pfmt) is a rare lesion, which, despite its resemblance to sarcomas, follows a benign course without the need to perform radical retropubic prostatectomy . Another lesion that has a somewhat similar histological appearance to pfmt is the postoperative spindle cell nodule (poscn), which was first described by proppe et al . . Differentiation between poscn and pfmt is based on the few mitoses in the latter and the history of operative trauma in the former . Pfmt is usually characterized by scattered stellate and spindle cells in an edematous, myxoid stroma with large number of capillaries and inflammatory cells . The nuclei of the stellate and spindle cells are hyperchromatic and pleomorphic; few, if any mitoses are seen and none are atypical . Despite the rarity of pfmt, it is important for urologists and pathologists to recognize and be aware of its benign course in order to avoid unnecessary radical procedures.
Lutembacher's syndrome refers to a congenital atrial septal defect (asd) complicated by acquired mitral stenosis (ms). It comprises of atrial septal defect (asd) [ostium secundum] with mitral stenosis (ms). If defect is in the formation of septum primium - it leads to the formation of asd (primium) and if defect is in the formation of septum secundum it forms asd (secundum). Here, we will discuss about a lady who was diagnozed as having lutembacher's syndrome during her pregnancy for the first time . A 22 year old female was referred krishna hospital as an unregistered case from a private maternity hospital in advanced pre - term labour . She also complained of exertional dyspnoea (new york heart association - nyha class ii) which was gradually progressing since a day before onset of labour pains, and orthopnoea . There was no history of accompanying chest pain, cough, palpitations, fever, or symptoms of upper respiratory infections . There was no past history of joint pains with throat infection, or any long term medications for any premorbid condition . She was married since five years, without consanguinity and had a first full term normal home delivery (a male child) 2 years ago ., she never attended ante natal care (anc) clinic . On examination in our hospital, she was afebrile with normal volume regular pulse of 86 beats / min and blood pressure 110/70 mm of hg, with respiratory rate of 20 breaths / min . In cardiac examination, there was loud mitral s1, and wide fixed split pulmonary s2 with opening snap in mitral area . There was iii / iv mid diastolic murmur in mitral area and early systolic murmur, and non - radiating short murmur in pulmonary area . Respiratory system examination revealed bilaterally equal normal breath sounds with bilateral lower zones end - inspiratory fine crackles per vaginal examination revealed patulous, minimally effaced cervix with dilation of 2 cm, with presenting part being vertex at station -3 with adequate pelvis size . Her investigation reports were as follows: hemoglobin (hb)-11.5 gm%;white blood cells (wbc) - 12,100/cu mm of blood;polymorphs - 54%;lymphocytes - 44%;eosinophils - 02%;platelet count - 1.85 lakh;random blood sugar - 76 mg / dl;blood urea - 25 mg / dl; [normal value20 40 mg / dl]serum creatinine - 0.8 mg / dl; [normal value0.8 -1.6 mg / dl]serum sodium - 135 meq / l] hemoglobin (hb)-11.5 gm%; white blood cells (wbc) - 12,100/cu mm of blood; platelet count - 1.85 lakh; random blood sugar - 76 mg / dl; blood urea - 25 mg / dl; [normal value20 40 mg / dl] serum creatinine - 0.8 mg / dl; [normal value0.8 -1.6 mg / dl] serum sodium - 135 meq / l; [normal value135 145 meq / l] serum potassium - 5.1 meq / l . [normal value3.5 5.5 meq / l] urine routine and microscopic exam was normal . Electrocardiogram [figure 1] normal sinus rhythm; incomplete right bundle branch block (rbbb); left atrial enlargement; normal pr interval / normal qtc . Electrocardiogram of patient of lutembacher's syndrome suggestive of incomplete right bundle branch block with left atrial enlargement 2d - echocardiography [figures 2 and 3] moderate mitral stenosis; mild mitral regurgitation; mitral valve area 1.42 - 1.45 cm . Large ostium secondum atrial septal defect with left to right shunt; mild pulmonary arterial hypertension . Transthoracic echocardiogram of patient of lutembacher's syndrome showing thickened mitral leaflets with doming of anterior mitral leaflet with mitral stenosis and atrial septal defect transthoracic echocardiogram colour doppler of patient of lutembacher's syndrome showing flow from left atrium to right atrium through atrial septal defect other valves- normal . No clots / no effusion / no vegetations . With the above history and findings, a medicine consult was sought by the department of obstetrics and gynaecology, and she was allowed to continue the labour after giving her injectable furosemide to relieve her of pulmonary congestion . The diuretics were then continued and she was also started on the standard prophylaxis for rheumatic fever with benzathine penicillin 12 lakh units deep intramuscular (after skin test dose) once every 3 weeks . She was advised surgical intervention at a later date, after trans - oesophageal echocardiography . She was also advised tubal ligation to avoid further cardiac compromise which she agreed to, and she was posted for the same procedure later . Later on she came for rheumatic fever prophylaxis as scheduled for initial 2 months after which she has not returned for a follow up, and at the same time she was not willing for any kind of intervention due to financial constraints . In lutembacher's syndrome, initially, high left atrial pressure due to mitral stenosis was thought to stretch open the patent foramen ovale, causing left - to - right shunt and providing another outlet for the left atrium . Now asd in this syndrome, like mitral stenosis, is recognized as being either congenital or acquired, as already described . The haemodynamic effects of this syndrome are a result of the interplay between the relative effects of asd and mitral stenosis . In its initial description, the asd was typically large in lutembacher syndrome, thus providing another route for blood flow . The direction of blood flow is determined largely by the compliance of left and right ventricles . Normally, the right ventricle is more compliant than the left ventricle . As a result, in the presence of mitral stenosis, blood flows to the right atrium through the asd instead of going backward into the pulmonary veins, thus avoiding pulmonary congestion . This happens at the cost of progressive dilatation and, ultimately, failure of the right ventricle and reduced blood flow to the left ventricle . Development of eisenmenger syndrome or irreversible pulmonary vascular disease is very uncommon in the presence of large asd and high left atrial pressure because of mitral stenosis . The incidence of this condition is very rare . In one study published in american heart journal in 1997 the ameliorating role of the asd in ms was evident in lutembacher's original report of 1916; the patient was a 61-year - old woman who had been pregnant seven times . An earlier case report in the literature in 1880 (and referred to by perloff) was of a 74-year - old woman who had endured 11 pregnancies . Survival to advanced age has also been reported; in one instance an 81-year - old woman experienced no symptoms related to her heart disease until she reached 75 years of age . These favourable reports, however, should not obscure the fact that the long - term natural history of asd is unfavourably influenced by ms, which augments the left - to - right shunt and predisposes to atrial fibrillation and right ventricular failure . The presence of ms, especially when accompanied by mitral regurgitation, increases susceptibility to infective endocarditis, in contrast to the low incidence of infective endocarditis in uncomplicated asd, just like in our case . Early diagnosis and surgical treatment bears a good prognostic value . If patient is diagnosed at late stage, pulmonary hypertension and heart failure develops and the prognosis is bad . If the patient is diagnozed earlier before the development of pulmonary hypertension and heart failure, - asd closure with mitral valve replacement bears a good prognosis and prolongs survival.
Hypercalcemia is a life threatening complication of malignant disease, and has been reported to occur in approximately 20% to 30% of patients with malignancies at some time during the course of their disease . Although hypercalcemia associated with cancer can be caused by various mechanisms, humoral hypercalcemia of malignancy (hhm) is the most common cause, accounting for 80% of occurrences . Parathyroid hormone - related peptide (pth - rp) has been identified as a mediator of hhm . Cholangiocarcinoma (cc) is a relatively uncommon tumor, accounting for 10% to 15% of hepatobiliary malignancies and 3% of gastrointestinal tract cancers . The prognosis for advanced cholangiocellular carcinoma is very poor . In a recent large randomized controlled phase iii study, gemcitabine plus cisplatin combination chemotherapy was beneficial in terms of progression - free survival and overall survival, as compared with gemcitabine monotherapy, and has become the standard treatment for advanced cc; however, the median overall survival with combination chemotherapy arm is still less than one year . Hhm, which has rarely been reported in patients with cc, represents a marker of poor prognosis of the disease . In this case report, we present two cases of cc, showing the signs, symptoms, laboratory findings, and disease course consistent with hhm . A 63-year - old male patient was referred to our hospital for evaluation of an intrahepatic mass discovered during a routine health checkup in august 2010 . He had no past medical history . Except for corrected serum calcium level of 12.1 mg / dl (normal range, 8.5 to 10.5 mg / dl), his electrocardiogram showed normal sinus rhythm and there were no other hypercalcemia - associated symptoms or signs . An abdominopelvic computed tomography (ct) scan showed a large mass measuring 13 cm in size, suggesting cc with intrahepatic metastases and invasion of the left portal vein and hepatic vein (fig . Sono - guided liver biopsy was performed and the pathologic diagnosis showed poorly differentiated carcinoma, highly suggestive of cc . Because there was no distant metastasis on the positron emission tomography ct scan, we made a diagnosis of locally advanced intrahepatic cc . Given the tumor's unresectable status and the patient's good performance, we decided to treat him with radiotherapy concurrent with capecitabine 1,000 mg / m twice daily on days 1 - 14 and cisplatin 60 mg / m day once every three weeks . The first two cycles of chemotherapy were administered with radiotherapy, a total dose of 45 gy at the main mass in the liver . Follow - up ct scan after concurrent chemoradiotherapy (ccrt) showed marked improvement in the patient's tumor status (fig . 1b). In parallel with the improvement of tumor status, serum calcium level showed a decrease to the normal range (fig . 2). We continued to administer the same treatment regimen, and the response was maintained for nine months, until may 2011, when a follow - up ct scan showed liver metastasis progression . Carcinoembryonic antigen (cea) and cancer antigen 19 - 9 (ca 19 - 9) level were elevated to 48.17 u / ml (normal range, 0 to 5 u / ml) and 97.0 ng / ml (normal range, 0 to 37 ng / ml), respectively . At the same time, his corrected serum calcium level increased again to 11.1 mg / dl . The suppressed pth level (5.1 pg / ml; normal range, 15 to 65 pg / ml) with elevated pth - rp level (6.7 pmol / l; normal range, 0 to 1.1 pmol / l) confirmed the diagnosis of recurrent hhm . Hypercalcemia was resolved in five days and the patient was performing well without any signs or symptoms related to hypercalcemia, therefore, he was treated with second - line chemotherapy with gemcitabine . After two cycles of gemcitabine, a follow - up ct scan showed liver mass progression and newly developed hematogenous lung metastasis . The corrected serum calcium level was elevated even higher (11.8 mg / dl). Although hypercalcemia was normalized after medical treatment, his poor performance hindered him from receiving additional chemotherapy . Instead, he was treated with the best supportive care . When he visited the outpatient clinic three weeks later, he was in a state of somnolence and oral intake was not possible due to severe nausea and vomiting . His corrected serumcalcium level rose upto 15.3 mg / dl . Eventually, the patient died on 10 august 2011, almost one year after initial diagnosis of cc with hhm . A 68-year - old male patient presented with weight loss of 6 kg over two months and abdominal pain for one week . Ultrasonography performed at the local hospital showed a mass lesion in the liver, and he was referred to our hospital . An abdominopelvic ct scan showed cc with innumerable liver to liver metastases and node metastases . Sono - guided liver biopsy was performed and the pathologic diagnosis was adenocarcinoma, either primary or metastatic . Because no primary mass was found by esophagogastroduodenoscopy and colonoscopy, we made a diagnosis of cc with liver metastasis and began treatment with palliative chemotherapy, gemcitabine plus cisplatin . His tumor was stable until 28 june 2011, when he visited the outpatient clinic for the eighth cycle of gemcitabine and cisplatin approximately six months after his initial diagnosis . At that time, his blood test was remarkable for a corrected serum calcium level of 11.8 mg / dl . Otherwise, there were no symptoms or signs related to hypercalcemia and he was in good performance status . After receiving treatment with intravenous hydration and pamidronate, he received the 8th cycle of chemotherapy as scheduled . We scheduled an appointment for another visit to recheck his condition as well as his serum calcium level . When he returned to the outpatient clinic one week later, his mental status was somewhat somnolent . A blood test showed an aggravated corrected serum calcium level of 14.1 mg / dl and decreased liver function; aspartate aminotransferase was three times the normal level (102 iu / ml; normal range, 13 to 34 iu / ml), alkaline phosphatase was 340 u / l (normal range, 38 to 115 u / l), and albumin was decreased to 2.8 mg / dl (normal range, 3.3 to 5.3 mg / dl). Ct scan revealed aggravation of the main mass and a metastatic lesion in the liver, and newly developed ascites . Cea and ca 19 - 9 levels were elevated to 981.32 ng / ml and 7,450 u / ml, respectively . As the pth level was suppressed to 4.8 pg / ml and pth - rp level was increased to 8.3 pmol / l, we were able to make a diagnosis of hhm . His hypercalcemia was corrected to a certain degree, but never returned to normal range . Despite improvement in his mental status, his performance status did not recover from eastern cooperative oncology group 3 . Hence we discontinued chemotherapy and treated him with the best supportive care until he expired on 24 july 2011, only approximately one month after diagnosis of hhm . A 63-year - old male patient was referred to our hospital for evaluation of an intrahepatic mass discovered during a routine health checkup in august 2010 . He had no past medical history . Except for corrected serum calcium level of 12.1 mg / dl (normal range, 8.5 to 10.5 mg / dl), his electrocardiogram showed normal sinus rhythm and there were no other hypercalcemia - associated symptoms or signs . An abdominopelvic computed tomography (ct) scan showed a large mass measuring 13 cm in size, suggesting cc with intrahepatic metastases and invasion of the left portal vein and hepatic vein (fig . Sono - guided liver biopsy was performed and the pathologic diagnosis showed poorly differentiated carcinoma, highly suggestive of cc . Because there was no distant metastasis on the positron emission tomography ct scan, we made a diagnosis of locally advanced intrahepatic cc . Given the tumor's unresectable status and the patient's good performance, we decided to treat him with radiotherapy concurrent with capecitabine 1,000 mg / m twice daily on days 1 - 14 and cisplatin 60 mg / m day once every three weeks . The first two cycles of chemotherapy were administered with radiotherapy, a total dose of 45 gy at the main mass in the liver . Follow - up ct scan after concurrent chemoradiotherapy (ccrt) showed marked improvement in the patient's tumor status (fig . 1b). In parallel with the improvement of tumor status, serum calcium level showed a decrease to the normal range (fig . 2). We continued to administer the same treatment regimen, and the response was maintained for nine months, until may 2011, when a follow - up ct scan showed liver metastasis progression . Carcinoembryonic antigen (cea) and cancer antigen 19 - 9 (ca 19 - 9) level were elevated to 48.17 u / ml (normal range, 0 to 5 u / ml) and 97.0 ng / ml (normal range, 0 to 37 ng / ml), respectively . At the same time, his corrected serum calcium level increased again to 11.1 mg / dl . The suppressed pth level (5.1 pg / ml; normal range, 15 to 65 pg / ml) with elevated pth - rp level (6.7 pmol / l; normal range, 0 to 1.1 pmol / l) confirmed the diagnosis of recurrent hhm . Hypercalcemia was resolved in five days and the patient was performing well without any signs or symptoms related to hypercalcemia, therefore, he was treated with second - line chemotherapy with gemcitabine . After two cycles of gemcitabine, a follow - up ct scan showed liver mass progression and newly developed hematogenous lung metastasis . The corrected serum calcium level was elevated even higher (11.8 mg / dl). Although hypercalcemia was normalized after medical treatment, his poor performance hindered him from receiving additional chemotherapy . Instead, he was treated with the best supportive care . When he visited the outpatient clinic three weeks later, he was in a state of somnolence and oral intake was not possible due to severe nausea and vomiting . His corrected serumcalcium level rose upto 15.3 mg / dl . Eventually, the patient died on 10 august 2011, almost one year after initial diagnosis of cc with hhm . A 68-year - old male patient presented with weight loss of 6 kg over two months and abdominal pain for one week . Ultrasonography performed at the local hospital showed a mass lesion in the liver, and he was referred to our hospital . An abdominopelvic ct scan showed cc with innumerable liver to liver metastases and node metastases . Sono - guided liver biopsy was performed and the pathologic diagnosis was adenocarcinoma, either primary or metastatic . Because no primary mass was found by esophagogastroduodenoscopy and colonoscopy, we made a diagnosis of cc with liver metastasis and began treatment with palliative chemotherapy, gemcitabine plus cisplatin . His tumor was stable until 28 june 2011, when he visited the outpatient clinic for the eighth cycle of gemcitabine and cisplatin approximately six months after his initial diagnosis . At that time, his blood test was remarkable for a corrected serum calcium level of 11.8 mg / dl . Otherwise, there were no symptoms or signs related to hypercalcemia and he was in good performance status . After receiving treatment with intravenous hydration and pamidronate, he received the 8th cycle of chemotherapy as scheduled . We scheduled an appointment for another visit to recheck his condition as well as his serum calcium level . When he returned to the outpatient clinic one week later, his mental status was somewhat somnolent . A blood test showed an aggravated corrected serum calcium level of 14.1 mg / dl and decreased liver function; aspartate aminotransferase was three times the normal level (102 iu / ml; normal range, 13 to 34 iu / ml), alkaline phosphatase was 340 u / l (normal range, 38 to 115 u / l), and albumin was decreased to 2.8 mg / dl (normal range, 3.3 to 5.3 mg / dl). Ct scan revealed aggravation of the main mass and a metastatic lesion in the liver, and newly developed ascites . Cea and ca 19 - 9 levels were elevated to 981.32 ng / ml and 7,450 u / ml, respectively . As the pth level was suppressed to 4.8 pg / ml and pth - rp level was increased to 8.3 pmol / l, we were able to make a diagnosis of hhm . His hypercalcemia was corrected to a certain degree, but never returned to normal range . Despite improvement in his mental status, his performance status did not recover from eastern cooperative oncology group 3 . Hence we discontinued chemotherapy and treated him with the best supportive care until he expired on 24 july 2011, only approximately one month after diagnosis of hhm . Hhm is usually found in patients with squamous cell carcinoma as of the head and neck, esophagus, and lung . Other tumors commonly associated with hhm include breast, renal, bladder, and ovarian cancers, human t - cell lymphotropic virus-1 lymphoma, and some endocrine tumors . Cc is rarely associated with hhm . In an early retrospective analysis conducted in 1982, when measurement of pth - rp was not available, oldenburg et al . Reported hypercalcemia of unknown origin in seven out of 40 patients (17.5%) with cc . Among them, immunoreactive parathyroid hormone (ipth) concentration levels were measured in only two patients . Both patients had normal or low pth levels, and the authors concluded their works by suggesting that secretion of ipth - like peptide is the possible mechanism for their findings . Since the introduction of pth - rp to clinical practice in 1987, only 10 cases of hhm associated with cc have been reported in the pubmed / medline database . Most previously reported cases were from japan and showed male predominance and predilection for the right lobe . In most cases, development of hhm occurred just weeks or months before the patients expired, representing a heavy disease burden and a dismal prognosis . Although there are many factors known to be associated with the pathogenesis of hhm, pth - rp is believed to be the major mediator among them; its level is elevated in 80% of patients with hhm . Pth - rp causes hypercalcemia through enhancement of tubular reabsorption of calcium and stimulation of osteoclastic bone resorption . Therefore, hhm treatment should be directed toward enhancement of urinary calcium excretion by vigorous hydration and intravenous loop diuretics, and blocking bone reabsorption with calcitonin and biphosphonates . To the best of my knowledge, these are the first two case reports in korean pubmed / medline and they are notable in several points . First, hypercalcemia was detected upon initial manifestation of the tumor in our first case . Although we did not measure pth - rp at that time, the absence of bone metastasis and the finding of hypercalcemia normalization and aggravation in accordance with the disease course lead us to postulate that this patient had an association with hhm from the time of diagnosis . Second, given the usual life expectancy of several weeks to months after detection of hhm in cc patients, the patient reported in the first case showed a remarkably long survival time, almost one year . Only two case studies showing longer survival time than one year after initial diagnosis of hhm with cc have been reported . In one case report, the patient underwent right portal vein embolization and chemoembolization followed by extended right hepatectomy, and survived three and one half years . In the other case report, although there are some studies suggesting that chemoradiation in advanced cc can prolong survival time, its role has focused mainly on symptom palliation due to local tumor effects . Until now, 5-fluorouracil (5-fu) has been the most thoroughly investigated chemotherapeutic agent in ccrt for treatment of biliary tract cancers, however, because some studies have reported that capecitabine can replace 5-fu without severe toxicity, we chose oral capecitabine . The survival prolongation observed in these patients suggests that poor prognosis in hhm associated with cc can be partly overcome when the tumor is controlled by aggressive treatment, such as surgery or ccrt . In addition, a strong correlation was observed between tumor response to ccrt and the level of hypercalcemia . Third, consistent with the previous reports, our reports showed overall dismal prognosis of hhm associated with cc . Although the first patient survived longer than one year after the first event of hhm, there was only one month until his demise since recurrence of hhm . Both cases indicated that hhm is refractory to medical treatment and led to a fatal outcome when it developed in a patient whose tumor showed progression upon active anticancer therapy . In conclusion, we herein report on two cases of humoral hypercalcemia of malignancy associated with cc . Although the condition's dismal prognosis can be partly overcome by more proactive treatment, its manifestation implicates massive overall disease burden and an adverse outcome when the tumor itself is not controlled.
The burden of peripheral artery disease continues to increase worldwide . Given the favorable results of endovascular therapy in patients with pad, also its role is increasingly important . Even patients undergoing surgical therapy or maintained on maximal medical therapy only usually undergo invasive assessment with angiography relying on administration of iodinated contrast media . Accordingly, endovascular procedures may be limited in scope or aggressiveness in patients at high risk of contrast nephropathy, or avoided altogether in patients with severe allergic diathesis . Alternatives to iodinated contrast media have been proposed over the decades, including ultrasound, gadolinium, and carbon dioxide (co2). The latter has been proposed for digital subtraction angiography several years ago, given its high dissolubility and lack of hypersensitivity or nephrotoxic adverse effects . Indeed, for most diagnostic or interventional procedures, almost unlimited cumulative volumes of co2 can be injected . Despite these theoretical and practical advantages, some of the main hurdles faced by physicians using co2 as contrast medium are: suboptimal imaging yield, discomfort, and lack of dedicated automated and digital injection systems . However, recent works suggest that dedicated injection systems with modifiable parameters are required to improve the diagnostic yield . In addition, the increasingly common performance of transcatheter renal sympathetic denervation, which requires invasive imaging of the renal arteries in patients who can be at high risk of iodinated contrast media because of refractory hypertension and chronic renal failure, calls for alternative invasive imaging approaches . A dedicated automated and fully digital injector for co2 angiography has been recently developed . It builds upon prior less sophisticated ones, and our cardiovascular catheterization laboratory has begun to use it . We hereby report our experience and learning curve, in order to provide guidance on adoption and improvement . Patients . Patients undergoing invasive angiography for peripheral artery disease or transcatheter renal sympathetic denervation with co2 as contrast of choice were retrospectively identified in our institutional database, irrespective of whether other imaging modalities had been used as well . Carbon dioxide angiography was attempted in patients with decreased renal function (glomerular filtration rate <60 ml / min), when selective renal injection was envisioned, or whenever the diagnostic or interventional procedure was deemed to require> 100 ml of iodinated contrast media . No patient was excluded, with the notable exception of those requiring only supradiaphragmatic angiography . Carbon dioxide was administered using a dedicated injection system (angiodroid, angiodroid srl, bologna, italy). Angiodroid is a digital automatic injector, which ensures stable co2 pressure and high accuracy of volumes, as well as a built - in control system to avoid air contamination . The angiodroid workstation is movable on steerable wheels and it is similar in size to a iodinated contrast media injector . The main advantages over other approaches to co2 injection, including hand injection or other co2 injectors, are: digital volume dose settings, digital pressure injection settings, fast automated reload (20 seconds) for repeatable injections, high accuracy of the set pressure injection, high accuracy of the set volume doses, dual microcontroller to ensure high safety and performance, safety limits to avoid errors and patient injury, remote controller to start injections, possibility to save injection settings for different vascular districts, and a touch screen control . Injections can vary between 1 and 100 ml in volume and between 45 and 700 mm hg in pressure (respectively 6 and 93 kpa), with an accuracy for volume delivery of 1 ml and for pressure delivery of 1.5% . Notably, no specific injection parameters are recommended, as physicians choose the better dose, the but they must remain within the above safety limits . Once the injector has been prepared for use and activated, it automatically charges the required amount of co2 from a 2 l co2 cylinder . Afterwards, the injector must simply be connected through a disposable connecting tube to the diagnostic or guiding catheter or sheath of choice and injection is already possible without further delay . Thanks to the low viscosity of co2, even 3 french catheters and 22 g tubings or syringes can be used to obtain satisfactory angiographic images with digital subtraction angiography . Despite its recent introduction into clinical practice, there are already favorable scholarly reports on the use of angiodroid all procedures were performed by a single operator (a g) with extensive (> 20 years) experience in peripheral diagnostic and interventional procedures with iodinated contrast media, performed according to the standard of care and using standard diagnostic and interventional materials . After the first two cases, the co2 delivery approach was modified, introducing a one - way check valve to prevent air aspiration and blood backflow . Since co2 is very soluble in air and lighter than blood, air or blood could fill the delivery system for co2 and make repeated co2 injections cumbersome, or increase the risk of air embolism . In addition, in arteries with a reference vessel diameter of 10 mm or less, a 7 french swan - ganz catheter was used in order to reduce antegrade blood flow and increase co2 opacification of the arterial lumen by maximizing blood displacement by co2 . For instance, when performing left lower limb arteriography, the swan - ganz was deployed uninflated through contralateral access up to the distal segment of the external iliac artery . Then, it was slowly and gently inflated before co2 injection in order to minimize competitive blood flow and ensure almost complete filling of the vessels of interest with co2 . Complete injections were administered at volumes ranging from 20 ml (for smaller vessels such as the renal artery) to 50 ml (for larger vessels such as the abdominal aorta), at a 350 - 400 mm hg pressure . Scouts were instead based on 10 ml of co2 delivered at 350 mm hg . No pain medication or sedation adequate image quality was defined as that enabling complete diagnostic appraisal of the anatomic structure of choice and, if pertinent, satisfactory guidance of the interventional procedure and eventual control of the angiographic results . Glomerular filtration rate was estimated according to the modification of diet in renal disease (mdrd) formula . Categorical variables are reported as n (%). In order to appraise the potential learning curve required to master co2 angiography, the 21-patient case series was divided in two groups, the first 10 and the subsequent 11 patients . Statistical testing was performed with the mann - whitney u test for continuous variables, with the fisher exact test for categorical variables when organized in two by two tables and chi - squared test when organized in larger tables . Computations were performed with spss 20 (ibm, armonk, ny, usa). Between march 2013 and february 2014, out of a total of 273 endovascular diagnostic or interventional procedures involving infradiaphragmatic vessels, 21 patients (8%) underwent co2 angiography as part or whole of their diagnostic or interventional procedure (table 1). * at fisher exact, chi - squared, or mann - whitney u tests . Procedures were performed in the aorto - iliac or femoro - popliteal district for diagnostic - only purposes in 3 (14%) cases and for angiography or interventions in 8 (38%) cases (figure 1; figure 2). Comparison between iodinated contrast media and carbon dioxide angiography for superficial femoral artery angiography and intervention: a) baseline iodinated contrast media angiography; b) baseline carbon dioxide angiography; c) iodinated contrast media angiography after stenting; d) carbon dioxide angiography after stenting . Angiography with solely carbon dioxide to diagnose and treat a significant stenosis of the left common iliac artery: a) baseline angiography with a standard jr 4 diagnostic catheter to also image the carrefour; b) baseline angiography with an inflated 7 french swan - ganz catheter (arrow) to increase image quality in the distal vessel; c) final angiographic result after stenting . Angiography with solely carbon dioxide to perform transcatheter renal sympathetic denervation: a) baseline angiography in the right renal artery; b) ablation with the simplicity catheter (medtronic, minneapolis, mn, usa); c) control angiography after 6 ablation runs . In 2 (10%) procedures, which were performed at the beginning of our clinical experience, co2-based angiography did not provide adequate quality images in the aorto - iliac and ilio - femoral district, due to lack of complete vessel filling with co2 . Thus, these procedures were mainly performed with iodinated contrast administration . In order to minimize co2 washout due to blood flow during digital subtraction angiography when standard injection proved unsatisfactory, the swan - ganz catheter (table 2; figure 2) was added . This lead to improved imaging yield in these small - caliber vessels . Indeed, among the subsequent cases, many procedures could be completed without using any iodinated contrast . The remaining ones could be performed exploiting co2 as main contrast agent, and reserving iodinated contrast administration only to exclude minor angiographic features such as post - procedural intimal dissection . No major or minor complications occurred in these patients, either during the procedure or up to discharge . Accordingly, no patient referred discomfort or pain, other than mild and transient symptoms . Comparison according to phase of the learning curve (i.e. Distinguishing the first 10 cases from the 11 following ones) showed that baseline patient features were similar in the two groups (table 1). Conversely, analysis of procedural features showed that the overall number of icm injections per procedure decreased over time (from 2.52.1 to 0.62.1, p=0.005). A similar trend was found also for the number of injections of icm required for lower limb procedures (from 0.7 to 0, p=0.024). Accordingly, in the second phase of our learning curve, iodinated contrast media were avoided altogether in 10 (91%) cases, in comparison to 2 (20%) procedures performed in the beginning of our experience (p=0.002). Notably, no significant increase in the duration of the procedure occurred (p=0.650). This case series, reporting on the clinical use of the angiodroid automated injection system for co2 in patients with peripheral artery disease or undergoing transcatheter sympathetic renal denervation, has the following implications: a) co2 injection for infradiaphragmatic diagnostic and interventional procedures appears feasible; b) despite an obvious learning curve, imaging accuracy could be improved with the use of simple ancillary devices, such as the swan - ganz balloon - tipped dual lumen catheter; c) co2 may be particularly appealing as a contrast medium in patients undergoing transcatheter sympathetic renal denervation, given its adequate imaging yield and lack of renal toxicity; d) based on our learning curve analysis, we may tentatively speculate that experienced endovascular specialists after only 10 cases could be confident to rely only or mostly on co2 for their diagnostic or interventional procedures in infra - diaphragmatic vessels . Despite ongoing improvements in the safety of iodinated contrast media in the last decades, even current generation agents are associated with adverse events, in particular with the risk of contrast nephropathy and anaphylactic reactions . Alternatives to iodinated media include co2, which is already produced throughout the body and can be easily expelled by the lungs . Indeed, co2 was proposed instead of iodinated media several decades ago, but being a gas it is more difficult to manage in the catheterization laboratory . Moreover, while iodinated contrast media may opacify a vessel even if it is not completely filled, co2 needs to displace all or most of the blood to achieve adequate images . Accordingly, co2 angiography is hitherto available only in few centers, and even in those institutions with a specific expertise in co2-guided procedures, it is used very selectively . Most probably, the main hurdle for a more widespread use of co2 in peripheral invasive procedures is the difficulty in handling this gas, due to the lack of user - friendly digital automated injection systems, until recently . Indeed, the present work is built upon prior experiences with other dedicated injection systems, showing that such means to deliver co2 is particularly effective . We found that, on top of sophisticated imaging algorithms, the use of the swan - ganz catheter improves the ease and imaging yield . In addition, we found that adding a simple one - way valve to the injection tubing remarkably improved the ease of use of the system, by reducing blood backflow inside the tubes themselves . Accordingly, this contrast media appears attractive for infra - diaphragmatic invasive procedures, especially in those with or at risk for contrast nephropathy or other contraindications to iodinated contrast media . Moreover, our preliminary experience suggests that co2 may be useful in patients with resistant hypertension undergoing transcatheter renal sympathetic denervation . For instance, criado et al . Have reported favorable data on co2-guided endovascular abdominal aneurysm repair in 114 patients in the us, and other positive data come from asian colleagues . Even homemade delivery systems have been proposed, but further details concerning their safety and efficacy are required . Finally, alternative imaging approaches relying only on ultrasound have also been proposed, with kusuyama and colleagues and kawasaki et al . Both recommending the combination of intravascular ultrasound and co2 to maximize imaging yield and avoid nephrotoxic contrast . Notwithstanding the above mentioned evidence, co2 is not devoid of safety issues . Supra - diaphragmatic injections are absolutely contraindicated in proximal vessels, given the risk of cerebral or coronary ischemia, even if shunt or distal upper limb procedures appear safe . In addition, co2 may cause discomfort when excessive or repeated injections are administered, and other complications, such as gas trapping and ischemia, must be borne in mind . Indeed, at least 2 - 3 minutes should pass between two repeated series of co2 boluses each building up to 100 ml . Nonetheless, these limits are difficult to overcome, as the operator typically takes time to review the images and plan the best management strategy between injections . This work has all the limitations typical of retrospective single center registries, including the small sample size, lack of control group, and reliance on surrogate clinical outcomes . In addition, all procedures were performed by a very experienced operator, thus these findings may not apply as well to less skilled colleagues (e.g. Trainees). Notably, given the few patients included and the varying patterns in the types of procedures over time, the play of chance cannot be disregarded as explanation for our results . Learning curves for co2 angiography could obviously differ substantially between trainees and experienced operators, and accordingly our findings can be extrapolated mainly to operators who are already proficient in diagnostic and interventional procedures with iodinated contrast media . Finally, as other automated injectors for co2 already exist, further studies from other centers with different expertise and patient populations will be required to verify the present findings . Carbon dioxide - based angiography using an automated injection system appears feasible in patients undergoing infra - diaphragmatic diagnostic or interventional procedures . This technology may appear particularly promising for transcatheter renal sympathetic denervation and lower limb procedures.
Colloidal iv vi semiconductor nanocrystals (also known as quantum dots, qds) are of increasing potential applications in telecommunication, photoelectronic device, and biomedical labeling, etc . Pbse qds are important materials because of the strong confinement effect due to their large bohr radius and the small band gap in near infrared region . Several approaches have been developed to prepare pbse qds with uniform size and high quantum yields [3 - 5]. Pbse / pbs and pbse / sio2 core / shell structures have been synthesized to stabilize pbse qds . But cdse should be a better shell material due to the higher stability under air condition, the lower lattice mismatch of ~1%, and the little change of the surface chemistry and physics . It is difficult to grow cdse shells upon pbse cores using typical cadmium oleate anion precursor because of high reaction temperatures needed . Hollingsworth s group recently developed a method of ion exchange to form pbse / cdse core / shell structures in which cd atoms replaced pb atoms in the outlayers of large pbse qds . However, it may not be easy to control the thickness of the cdse layers . In this work, we employed the successive ion layer adsorption and reaction (silar) technology to form air - stable pbse / cdse qds with strong photoluminescence two solutions were prepared for cdse shell growth . A cadmium injection solution (0.04 m) was prepared by heating cadmium cyclohexanebutyrate (0.1804 g) in oleyamine (8.130 g) at 60c under n2 flow to obtain a clear colorless solution . A selenium injection solution (0.04 m) was prepared by mixing selenium powder (0.0316 g) in octadecene (7.880 g) at 220c under n2 flow until a clear yellow solution was obtained ., pbse qds (4.8 nm in diameter, 1.01 10 mmol of particles) dispersed in 5 ml of hexanes were loaded into a 25-ml three - neck flask and mixed with 1.500 g of octadecylamine and 5.000 g of octadecene . A mechanical pump was employed at room temperature for 30 min to remove hexanes from the flask . Then, the predetermined amounts of the cadmium and selenium solutions were alternatively injected into the three - neck flask drop by drop with syringes using standard air - free procedures . Transmission electron microscope (tem) was used to characterize pbse and pbse / cdse core / shell qds as shown in fig . 1 . Tem images and histograms of 4.8 nm pbse (a, b) and 6.2 nm pbse / cdse (c, d) qds . The pbse and pbse / cdse qd samples shown here have narrow size distributions of 8.1% (b) and 6.9% (d), respectively figure 2 shows the evolution of absorption and photoluminescence spectra of the pbse / cdse qds upon the series growth of three monolayers of cdse shells on the 4.8 nm pbse cores . A consistent red shift of the peak wavelength was observed in both the absorption and pl spectra . The red shifts of the first excitonic absorption peak for three layers were 11, 10, and 11 nm, respectively . The red shift of absorption and pl spectra depends on several factors including (1) the connection between pbse and cdse renders the expansion of the carriers wavefunctions out of the core region with different expansion probabilities resulting in the increase of exciton distance and (2) the surface polarization due to the different dielectric constants of pbse and cdse materials . Absorption (a) and photoluminescence (b) spectra recorded during cdse shell growth . A consistent red shift of the peak wavelength (11, 10, 11 nm) was observed when one to three monolayers of cdse shells grown on 4.8 nm pbse cores the optical gap (egap) of pbse qds is the minimum energy needed to excite an electron from the valence band to the conduction band . The optical gap is given by where are bulk material kinetic energies of the electron and hole, respectively; is band gap of bulk material; are the confinement kinetic energies of electron and hole, respectively; are the surface - polarization energies of the electron and hole, respectively; and jeh is the direct electron the size of the pbse qds (4.8 nm) is much smaller than the bohr radius (46 nm); therefore, in the strong confinement realm, the energy difference between the electron and hole should be as followed where r is the radius of quantum dot particle; and mr is the reduced mass of the electron and hole . The energy of coulomb attraction is given by where are the wavefunctions of the electron and hole, respectively; and is the potential function of the electron and hole . The surface - polarization energies of the electron and hole are where is the surface polarization potential where is the screened coulomb potential of the qd at point due to a point charge located at and is the same quantity in the corresponding bulk material system . When two semiconductors contact, both electron and hole will induce tunnelling effect and the wavefunctions will diffuse into cdse shells . The transmission coefficient can be given as where e is energy barrier at the interface of core / shell structure; m is the effective mass of diffusing particle; a is the thickness of energy barrier . Because the wavefunctions diffuse into shells, the confinement energy will change with the increase in shell thickness . According to eq . 2, where t is the difference of transmission coefficients of electron and hole . From the energy levels shown in fig . 3[16 - 18], the expansion probability of electron is bigger than that of hole because of the lower barriers of electron according to the very closed effective masses of electron and hole (me = 0.070, mh = 0.068). In this case, one nanometer shell barrier will result in a decrease in 17.55 mev for the confinement energy . We have also calculated that the increase in coulomb energy is 0.068 mev for one nanometer barrier . Correspondingly, the red shifts of the first excitonic absorption peak for three individual monolayer cdse shells are counted as 10.81, 9.45, and 8.36 nm, respectively . They are in good agreement for the experimental data taking account of the effect of surface polarization energy . Lumo and homo structures for 4.8 nm pbse qds and 0.35 nm cdse shell the third term in eq . 1 is the surface - polarization energy that affects the gap energy egap, which is the stark effect . A certain number of defect states are expected on the surface of unpassivated pbse qds . Therefore, charge carriers trapped on or near the surface of qds may generate localized electric fields, where delocalized exciton states within the qds can be highly polarizable . The surface polarization energy versus local electric field is given by where and are the resolved exciton dipole and polarizability, respectively . According to muller et al.s work, the spectrum shift of cdse nanorods depends on the direction of the external electric field . The positive electric field induces red shift, and the negative one leads to blue shift . Since the qds in this work are spherical (zero dimensional), it is reasonable that their peak shifts are independent of the direction of the electric field . Both positive and negative electric field can cause the emission peak to red shift, and the red shift increases when the electric field is stronger . It has been known that unpassivated pbse qds surface is a pb atom - rich shell . Therefore, there may be polarization charges on the surface of pbse qds which generate surface - polarization energy . However, the polarization charges are neutralized, because pb atoms on the surface of pbse qds connect to oleic acid (the organic ligand used in the synthesis). When the pbse / cdse core / shell was synthesized, cdse contacted with pb atoms instead of oleic acid; this induced the increase of surface polarization charges . The spectra shift to red because of the enhancement of the stark effect (fig . Different crystal lattices and thermal expansivities for pbse and cdse will more or less induce surface defects at the interface of the two materials . The carriers will be trapped and result in the enhancement of the stark effect . Such local fields cause the first exciton peak to shift to red and suppress the emission strength due to a reduced electron hole wavefunction overlap . Unbalanced charges may also decrease the photoluminescence efficiency (quantum yield) via nonradiative auger recombination . The new traps were induced by surface defects depend on the shell growth . Compared with the photoluminescence of one monolayer core / shell qds, however, it was found that more shell layers resulted in a decrease in photoluminescence strength (fig . That is also because the tensile change at the interface is nonlinear with the shell thickness . When pbse qds were covered with two layers of cdse, the good lattice tensility at the interface reduced the lattice mismatch and therefore increased the photoluminescence strength . When pbse qds were covered by three layers of cdse, the lattice tensility was stronger and hence the photoluminescence strength decreased . Even so the quantum yield was still as high as 70% for our pbse / cdse core / shell qds (ir-26 as the reference). Pbse qds are unstable even under the ambient conditions (room temperature and room light in air) (fig . This process for each particle induces the effective particle size decrease and the blue shift of the spectrum . When the old oxidized surface is gone, the new surface will be oxidized quickly . For pbse / cdse core / shell structures, cdse shells effectively prevent pbse cores from the quick oxidation . The lifetime of pbse qds under ambient conditions therefore can be extended from a few days to at least a month (currently available data). The stability of pbse (a) and pbse / cdse (b) qds . The cdse shells prevent pbse core from the destructive oxidation . Compared with the unstable pbse core, the pbse / cdse qds remained unchanged in conclusion, pbse / cdse core / shell qds with a quantum yield of 70% were synthesized . The surface polarization and the expansion of carriers wavefunctions contributed to the spectral red shift . The spectra red shifts during the formation of cdse shells were calculated, and they exhibited a good fit to the experimental data . The funding supports from the state key laboratory on integrated optoelectronics, college of electronic science and engineering, jilin university, the worcester polytechnic institute, and the national 863 projects of china (2007aa03z112, 2007aa06z112) are acknowledged . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited . This article is distributed under the terms of the creative commons attribution noncommercial license which permits any noncommercial use, distribution, and reproduction in any medium, provided the original author(s) and source are credited.
Megalourethra is a rare congenital mesenchymal anomaly of the male anterior urethra characterized by a nonobstructive dilatation of the penile urethra . Nesbitt in 1955 defined it as a congenital dilatation of penile urethra without distal obstruction . Dorairajan classified congenital megalourethra into two types based on findings of urethrography . The more common scaphoid type with a deficiency of the corpus spongiosum is seen as bulging of ventral urethra . The fusifrom type with deficiency of both corpus spongiosum and cavernosum is seen as circumferential expansion of urethra . A 6-month - old male child presented with dribbling of urine with a noticeable swelling of undersurface of penis which increased during the act of micturition . On examination a scaphoid swelling of size 4 3 cm was seen on the ventral aspect of shaft of penis which ballooned out during micturition . Ultrasound of abdomen and pelvis showed normal kidneys and bladder with no post void residue . Retrograde urethrogram showed scaphoid dilatation of ventral aspect of distal and mid penile urethra confirming the diagnosis of congenital megalourethra [figure 1b]. Cystourethroscopy showed wide saccular dilatation of penile urethra about 1 cm from external urethral meatus . Retrograde urethrogram showing ventral saccular dilatation of urethra a reduction urethroplasty was done through circumcoronal penile incision . After degloving the penis scaphoid dilatation of ventral aspect of penile urethra was noted [figure 2]. The dilated urethra was incised in ventral midline and the redundant urethra with deficient corpus spongiosum was excised and the urethra was reconstructed over 6 fr infant feeding tube using 5 - 0 pds suture . Postoperative recovery was uneventful . On removal of the catheter after 2 weeks child voided normally without any penile swelling . Regular follow - up at 1 year showed no recurrence of penile swelling with normal voiding pattern and sonologically normal bladder and upper tracts . The most commonly held theories propose a defect in the migration, differentiation, or development of the mesenchymal tissues of the phallus . Another assumption is that delayed or deficient canalization of the glandular urethra may be associated with maldevelopment of the corpus spongiosum and corpora cavernosae . Due to the poor development of erectile tissue which normally provides support two types of megalourethra are described depending upon the extent of associated embryonic maldevelopment of erectile tissue . Jones et al ., in a review identified associated anomalies in 66 of 78 reported cases of megalourethra . In this review, associated congenital anomalies are seen in 80% of scaphoid type and 100% of fusiform type . The commonly described genitourinary anomalies include renal dysplasia - hypoplasia, hydronephrosis, hydroureter, vesicoureteric reflux, prune - belly syndrome, urethral duplication, megacystis, hypospadias, posterior urethral valves, and undescended testes . Other system anomalies including vater (vertebral, anal atresia, trachea - esophageal fistula, and renal anomalies) and vacteryl (vertebral, anal atresia, cardiac, trachea - esophageal fistula, renal, and limb deformities) are described . In view of associated anomalies, the workup of megalourethra should include renal function tests and imaging of upper and lower urinary tracts urethral anomalies mimicking megalourethra like urethral atresia, a web, duplication, and a diverticulum are considered in the differential diagnosis . Prenatally diagnosed megalourethra has to be thoroughly evaluated for associated congenital anomalies and followed up serially by ultrasound for amniotic fluid index, urinary bladder volume, and upper tract dilatation . Termination of pregnancy may be advised in cases with other severe congenital anomalies and renal impairment . In some milder forms of megalourethra spontaneous resolution has been observed in fetuses at 19 - 34 weeks gestation . The treatment of megalourethra may be one stage or two stage urethroplasty depending on the age of presentation and general condition of the patient . For scaphoid type, nesbitt described a longitudinal reduction urethroplasty . Heaton and colleagues described a technique of urethral plication for some cases of scaphoid megalourethra . The management of fusiform type is complicated ranging from sex reassignment to major phallic reconstruction . Long - term follow - up is required in these patients to see for the erectile function and fertility potential . Management has to be individualized depending on type and the presence of associated congenital anomalies . In isolated scaphoid type of megalourethra reduction
Social isolation and exclusion are associated with poor health status and premature death, while social cohesion, the quality of social relationships and the existence of trust, mutual obligations, and respect in communities, helps to protect people and their health . Since social and family relationships are embedded within the definition of a good quality of life for all age groups, and particularly for older adults, it is social isolation inversely correlates with well - being [15]. A number of social isolation factors, inadequate transportation system and restrictions in individuals' life space, have been associated with poor nutrition in older adults . Good nutrition is important for health and well - being at all stages of the life course; however, its determinants change with age . Older adults are particularly prone to slipping into a pattern of an inadequate diet because of decreased mobility associated with physical disabilities and/or fewer financial resources to spend on food [6, 7]. Moreover, past evidence support that socially isolated older adults are at a greater risk of dietary inadequacy because they lack social support, which promotes good diet . In recent years, several studies focused on the relationship between cultural access and physical and psychological health . Their results suggest that participation in social and cultural activities is beneficial for health, since it helps people to remain active and socially connected, avoiding social isolation and loneliness [8, 9]. In elderly people, the association between cultural activities and health outcomes has been analyzed in the medical field, in the context of mental health, cognitive decline, onset of dementia, and related disorders [1016]. Moreover, data are growing in support of the relationship between cultural and social engagement and well - being [1723]. Well - being is shaped by not only the absence of disease and reduced physical functioning, but also by the presence of positive physical, mental, and psychosocial state . In this view, well - being is crucial to many aspects of our daily lives, since it includes global judgments such as emotions and resilience, quality of relationships, and overall life satisfaction [2427]. In particular, cultural participation is the second predictor of psychological well - being after (presence / absence of) major diseases, and in this respect, it has a significantly stronger impact than variables such as income, place of residence, age, gender, or occupation . Finally, links have been documented between well - being and multiple aspects of physical health and mortality, cardiovascular disease, biological risk factors for infectious diseases, dementia, and disability in later life [2831]. Considering the close relationship of high well - being with key health outcomes, tracking and improving well - being is becoming increasingly important for global organizations, governments, companies, and communities worldwide [31, 32]. Therefore, recently a number of studies explored losses in well - being caused by 2008 economic crisis . The findings reveal the negative impact of gdp fall, unemployment rising, and banking crashes on subjective and psychological well - being [3338]. In addition, several reports provide evidence of an increased prevalence of suicides because of the recent great recession [3941]. Finally, according to the united nations interregional crime and justice research institute, the global economic crisis has disproportionate effects on women . The average italian household has been severely affected by the crisis, with impacts that are particularly visible when looking at household income, jobs, life satisfaction, and civic engagement . From 2007 to 2011, italy recorded a cumulative decline in real household disposable income of around 7%, one of the largest declines among the oecd countries . Market income inequality (before taxes and transfers) increased by 2% between 2007 and 2010, well above the oecd average of 1.2% . The largest impact of the crisis on people's well - being has come through lower employment and deteriorating labour market conditions . Between 2007 and 2012, the employment rate decreased by more than 1 percentage point in italy, while the long - term unemployment rate increased by almost 3 percentage points . The poor employment situation had a major impact on life satisfaction . From 2007 to 2013, the percentage of italian people declaring being very satisfied with their lives fell from 58% to 40% . Moreover, according to data from the italian institute of statistics (istat), the crisis have worsened both the north south and the gender gap in in terms of life satisfaction . The data indicate that in italy the males are on average more satisfied of their life than females (m 36%> f 34%) and in addition that both males and females living in the north, that is, lombardy region, are more satisfied of their life than those living in the south, that is, campania region, (lombardy: males 42%, females 41%; campania: males 21,9%, females 19,4%). The 2008 crisis has deeply affected the city of naples, the capital of the campania region, and its metropolitan area worsening both the north> south gap and the chronic structural local problems . In that, the report of the italian institute of statistics (istat) shows that in 2014 naples ranks 101 over the 107 italian province in terms of quality of life . In addition, istat reports that in 2014 the unemployment rate in italy was 12,4% and in naples 24,26% and that in the same year employment rate was slowly growing in northern (+ 0,4%) and central (+ 1,8%) italy, while further declining in the south (0,8%, 45.000 units). Long - lasting progressive and strong deindustrialization, high level of unemployment, and a large influx of illegal immigrants had explosive consequences on the breakdown of the social fabric that from the specific suburbs spreads like wildfire to the entire city of naples . At present, local degradation and impoverishment, overlapping with welfare cut, consequent to nation - wide crisis, make day - by - day life difficult, in particular for the more fragile part of the population such as the elderly people living in the metropolitan area of naples . On the other hand, naples and its surrounding areas display an extraordinary richness of both tangible and intangible cultural heritage . The value of naples monuments building, ancient ruins together with its location on the mediterranean sea, gained the city to be listed by unesco as a world heritage site in 1995 (http://whc.unesco.org/en/list/726/). Moreover, a number of artists, actors, directors, writers, and gallerists, some of them well - recognized world - wide, struggle every day to keep the city long history of creativity alive that represents the worldwide recognized naples intangible heritage . In this scenario, we considered the investigation of how citizens of the metropolitan area of naples react to adversities and how and if cultural tangible and intangible heritage would influence their subjective well - being valuable . The oldest - old are the fastest - growing sector in society, due to life expectancy increases and improved treatments for life - threatening diseases . Understanding the determinants of psychological well - being and their relationship with health outcomes at older ages is particularly important, since a high proportion of the budget for health and social care is devoted to the care of older people . Due to the particularly high ageing index (a.i . = 120,3 in 2014) and to the economic difficulties of the metropolitan area of naples, it is important to consider new affordable tools and strategies to promote a healthy ageing and to face the burden of this demographic change . On these bases, we decided to take a snapshot of the metropolitan area of the city of naples investigating the relationship between adherence to diet or nutritional regimen, bmi, and subjective well - being and the impact of social and cultural participation . In particular, we focused on the population over 60 years of age and on gender difference . To our knowledge, this is the first survey investigating subjective well - being in the metropolitan area of the city of naples . Within the framework of the a3 action group of the european innovation partnership on active and healthy ageing and of the getting optimize aging life quality (goal) project, fondazione gens onlus developed an ad hoc anonymous questionnaire to assess perceived well - being, resilience, and perceived health and their relation with engagement into social and cultural experiences . The questionnaire comprises the following sections: sociodemographic information, age, sex, place of birth, education, employment, and marital status.psychological well - being: investigated by means of psychological general well - being - short (pgwb - s) questionnaire developed and validated in the italian version by grossi and coworkers in 2006 . Grossi and coworkers reduced the number of items from the original 22-item pgwbi to 6 items to achieve a higher acceptability of the questionnaire in the population, to shorter time of administration and to obtain a better response rate together with lower rate of missing data . The authors reported that pgwb - s 6 showed that the pgwb - s maintained validity, reliability, and good acceptability for the use in various settings in italy . Pgwb - s 6-item questionnaire analyzes the following domains: anxiety, vitality (positive), depressed mood, self - control, positive well - being, and vitality (negative) on a 0 to 5 scale referring to the four weeks before the date of the survey .resilience according to connor - davidson resilience scale cd - risc2 2 items: item 1 (able to adapt to change) and item 8 (tend to bounce back after illness or hardship) on a scale from 0 to 4 .extent of social network.participation in cultural and social activities.life-style habits, pc use, smoke, diet, physical activity, transportation, number and type of diagnosed diseases, and self - reported perceived health status.the anonymous questionnaire was submitted to volunteer participants covering wealthy, middle class, and poor neighborhoods of the metropolitan area of naples . Sociodemographic information, age, sex, place of birth, education, employment, and marital status . Psychological well - being: investigated by means of psychological general well - being - short (pgwb - s) questionnaire developed and validated in the italian version by grossi and coworkers in 2006 . Grossi and coworkers reduced the number of items from the original 22-item pgwbi to 6 items to achieve a higher acceptability of the questionnaire in the population, to shorter time of administration and to obtain a better response rate together with lower rate of missing data . The authors reported that pgwb - s 6 showed that the pgwb - s maintained validity, reliability, and good acceptability for the use in various settings in italy . Pgwb - s 6-item questionnaire analyzes the following domains: anxiety, vitality (positive), depressed mood, self - control, positive well - being, and vitality (negative) on a 0 to 5 scale referring to the four weeks before the date of the survey . Resilience according to connor - davidson resilience scale cd - risc2 2 items: item 1 (able to adapt to change) and item 8 (tend to bounce back after illness or hardship) on a scale from 0 to 4 . Life - style habits, pc use, smoke, diet, physical activity, transportation, number and type of diagnosed diseases, and self - reported perceived health status . Student's t - test and anova with bonferroni correction were performed to test continuous variables . Within 2014, we have collected 571 questionnaires of subjects over 60 years of age and this sample population is the object of the present work . Mean age of the 571 subjects over 60 years of age (from now on> 60) is 70,05 6,94 years . The> 60 sample consists of 285 males and 286 females with a mean age of 70,35 6,923 and 69,78 6,980 years, respectively . The subjective well - being (swb) was assessed by measuring both psychological well - being and resilience . Self - reported psychological well - being referred to the past 4 weeks according to 6-item pgwb - s analyzing the following domains: anxiety, vitality (positive), depressed mood, self - control, positivity, and vitality (negative) on a 0 to 5 scale . In physics, the term resilience indicates the power or the ability of a material to return to the original form, position, and so forth, after being bent, compressed, or stretched, and also elasticity . In the health field, resilience applies to the ability to adapt to changes and to readily recover from stressful situation like illness, depression, adversity, or the like . Resilience was assessed according to connor - davidson resilience scale, 2-item cd - risc2, on a scale of 0 to 4 . According to chassany et al . And grossi et al ., pgwb scores have been grouped into the following divided categories: 060 severe distress, 6171.0 moderate distress, 7292 no distress, and 93110 positive well - being [46, 47]. Pwb score for all 571> 60 subjects was 68,22 19,71, falling in the area of moderate distress . Males and females differently contribute to the pwb score of the whole> 60 group, where the pwb score for> 60 males is 71,61 18,83 while that for> 60 females is 64,92 20,11 (p <0,0001). Our results indicate that the pwb score of> 60 males falls borderline between the area of no distress and moderate distress, while that of the> 60 female population falls within the area of moderate distress . It is interesting to note that pwb score of both> 60 males and females, living in metropolitan area of the city of naples, is largely below that reported for males and females living in northern and central italy and in particularly in the city of milan [47, 48]. To get a better insight in the pwb score gender difference the results reported in table 1 show that females score is lower than that of males in all dimensions but vitality (positive). On the other hand, resilience score of the whole> 60 group was 5,867 1,687, which resulted to be similar in> 60 males and females, 5,91 1,57 and 5,84 1,8 respectively . However, when we analyzed resilience item 1 and item 2 separately, it came out that item (1) able to adapt to change and item (2) tend to bounce back after illness or hardship differently contribute to the cumulative resilience score . In particular, both males and females> 60 are less able to adapt to change (resilience item 1 score, females 2,71 1,08 and males 2,728 1,03) but tend to bounce back after illness or hardship more easily (resilience item 2 score, females 3,15 0,9710 and males 3,20 0,87). The difference between item 1 and item 2 score resulted to be statistically significant (p <0,0001) both in> 60 males and females . Finally, our data indicate a correlation between resilience and pwb (r 0,4708, r square 0,2217, p value <0,0001). Same correlation was observed when> 60 females and males were analyzed separately (f = r 0,418, r square 0,1810, p value <0,0001; m = r 0,545, r square 0,2891, p value (two - tailed) <0,0001). Within the section related to perceived health status, participants indicated their weight and height . Body mass index (bmi), computed by dividing weight in kilograms by height in meters squared, was categorized according to who guidelines, underweight: bmi less than 18.5 (reference category); overweight: bmi 2529.9 kg / m; obesity: bmi 3040 + kg / m . Mean bmi for all subjects resulted to be 25.58 4.20 which falls in the range of overweight, according to the nih indication . Bmi distribution of the all> 60 subjects is depicted in figure 1, and it indicates that 60% of the> 60 subjects fall within the overweight and obesity category, 40% are in the range of normal weight, and only 1% are underweight . Then we examined all females and males distribution bmi classes and the results indicated that 51% of the> 60 female subjects and 64% of the> 60 male subjects fall in the range of overweight and obesity (figure 2) while 47% of female and 35% of male subjects were in the range of normal weight . Since the relation between obesity and psychological and subjective well - being is becoming a hot issue, in both the health and the economic field, we compared the bmi, well - being, and resilience in the obese group versus the normal weight one . As it is shown in table 2(a), in all the> 60 subjects, there was no significant difference in pwb and resilience score according to bmi categories . On the other hand, when we analyzed women and men separately, we found that both pwb and resilience decrease in> 60 obese females with respect to normal weight group, while bmi increases (table 2(b)). Also, in> 60 males, pwb and resilience score are almost superimposable in both the normal weight and the obesity group (table 2(c)), while bmi increases . In addition, the opposite trend of pwb and resilience score between obese males and females amplifies the gender difference that remained significant (p <0,05). Moreover, correlation analysis between bmi and pwb and resilience indicates no correlation in all the population (bmi> pwb = r 0,049, r square 0,002, p value = 0,299; bmi> resilience = r 0,056, r square 0,003, p value 0,231) and in the male population (bmi> pwb r 0,085, r square 0,007, p value = 0,191; bmi> resilience = r 0,114, r square, 0,013, p value 0,081). On the contrary, in the female population a significant correlation was found both between bmi and pwb and between bmi and resilience (bmi> pwb = r 0,171, r square 0,029, p value 0,012; bmi> resilience = r 0,173, r square 0,029, p value 0,011). Subjects indicate eventual diagnosed disease / s within the following list of diseases: diabetes, respiratory diseases, skin diseases, gastritis, anemia, depression, osteoporosis, kidney diseases, migraine, anxiety, heart failure, arrhythmias, ischemic heart diseases, cancer, allergy, arthrosis, myocardial infarction, hypertension, obesity, liver disease, back pain, and colitis . The frequency of diabetes, hypertension, obesity, cardiovascular diseases (cvd), comprising heart failure, arrhythmias, ischemic heart disease, and myocardial infarction and depression, categorized according to bmi classes, is shown in table 3 . Hypertension resulted to be the most reported diagnosed disease within normal weight, overweight, and obesity classes in> 60 females, while cvd was the most frequently reported by the> 60 male group . Among the 571> 60 subjects, 78,45% are engaged into cultural and social activities, while 21,54% are not . Within the p population 52% are women and 48% are men, while in the np population 57% are women and 43% are men . Interestingly, when we compared bmi of subjects participating (p) and nonparticipating (np) to cultural and social activities, we observed that bmi was higher in females np versus females p (<0,05) (table 4(b)). On the other hand, more importantly, the> 60 np population displays pwb and resilience score significantly lower the> 60 p. in particular, the> 60 p male population frankly falls into the area of positive well - being, while that of np goes in the area of moderate distress (table 4). As for women, the pwb of the np population dramatically crashes in the area of severe distress . These observations show an association between participation in cultural and social activities and subjective well - being, by means of pwb and resilience score . In addition, in the case of the female group, and in particular the np females, we observed an inverse relation between bmi and pwb and resilience, since bmi increases while pwb and resilience decrease . The last observation suggests an intriguing and apparently new association between bmi, subjective well - being indicators, and participation in cultural and social activities . We then analyzed answers of> 60 subjects to the question: do you follow a diet or a nutritional regimen? The results indicate that 35% of males> 60 and 43% of females> 60 follow a diet or a nutritional regimen . Thereafter, we investigated the relation between perceived well - being and resilience and adherence to diet or nutritional regimen . Interestingly, women p adhering to diet display significantly higher pwb (p = 0,013) and resilience (p = 0,043) than the np following diet (table 5). In addition, a significant difference was observed in pwb and resilience between> 60 female p and np (p <0,0001) nondieting . On the other hand, while pwb was higher in the> 60 males of the p group with respect to the np following a diet, resilience was similar in the two groups (table 5). In addition, differently from females, np males who do not follow a diet or nutritional regimen apparently are overall happier then np following a diet . The results show that obese females dieting present both pwb and resilience scores higher than the nondieting obese females (pwb 61,69 17,26> 54,72 16,69, p <0,009; resilience 6 conversely, obese males dieting show both pwb and resilience scores lower than the nondieting obese males (pwb 67,35 16,43> 81,53 17,18, p <0,05; resilience 5,842 1,46> 6,706 1,44, p <0,05). To our knowledge, this is the first assessment of pwb and resilience conducted in the metropolitan area of naples . Our data show that a sample of 571 subjects over 60 years of age resident in the metropolitan area of naples display a pwb score of 68,22 19,71 on a scale of 0> 110, largely below pwb scores previously reported for the italian population . In particular, grossi et al . [4750] reported a pwb score of 77.76 (17.73 sd) for the italian population (1500 subjects) in 2011 . The pwb score was geographically distributed as follows: north (696 subjects) 79.34 (17.71 sd), centre (293 subjects) 78.04 (17.12 sd), south (511 subjects) 75.47 (17.91 sd). Moreover, in 2013 the same authors reported that a sample of 1000 citizens of milan displayed a pwb score of 82, 14 (15.63 sd) while that of the population over 60 years was 80,39 . The questionnaires analyzed here have been collected within 2014 when, as reported above, the metropolitan area of naples was still suffering for the economic crisis . Our results are in agreement with those reporting a relationship between unemployment and low level of pwb . Thus, we cannot exclude that the low pgwb score of this sample population of residents in the metropolitan area of naples reflects the detrimental effects of the economic and social crisis at local level . In particular, of note 50% of the 571 subjects over 60 years of age are retired, and retirement benefits represent for most families in the area, in a time of high unemployment, the only income to count on . When pwb score was measured in> 60 males and females separately, a gender difference was observed . It is generally reported that women have a score higher than men do in happiness, when happiness is measured as life satisfaction . It is also reported that the advantage of women in terms of happiness and life satisfaction is not uniform along the life cycle: women are less happy than men before the age of 18, happier than men until their fifties, and less happy again thereafter . Moreover, the paradox of declining female happiness seems to indicate that the traditional gender gap in happiness (in favour of women) is progressively shrinking since the 1970s in spite of the type of technological progress, civil liberties, and gender - conscious policies that characterize modern western societies . On the other hand, it is well recognized that women score lower than men do, on measures that capture short - term positive and negative emotions and are more subject to depression symptoms . The gender difference observed in pwb score in the sample of women> 60 analyzed here is in line with results already reported by grossi et al . Grossi and coworkers reported gender difference pwb scores in 2011 for the italian population (pwb score females 74.82 and males 81) and in 2013 for citizens of milan (pwb score females 78.32 and males 83) [47, 48]. We have reported that in a sample population of people nonparticipating in social and cultural activities, women pwb and resilience scores are lower than that of nonparticipating men moreover, in 2003, ruini et al . Reported a gender difference in favour of men by assessing well - being by means of different questionnaire . Psychological well - being gender gap in favour of men was also reported by pinquart and srensen in elderly and by hori and kamo in their comparison of 33 countries the latter authors as well as ruini et al . Suggest that different socialization and expectations by gender and different role of men and women in society explain gender gap in psychological well - being . Biological factors such as hormones, neurotransmitter, and cytokines have been associated to well - being, differently in men and women [5661]. Taking into account that, in the present work, we examined a female population with mean age 69,78 6,980 living in the metropolitan area of city of naples, located in the south of italy, we cannot exclude that the pwb gender gap mainly reflects women's traditional social role in this area . According to havighurst activity theory, higher levels of participation in social and leisure activities, and role replacement when roles must be relinquished, promote well - being in older adults . Thus, to achieve a healthy aging it is crucial to have equal opportunities for health, follow healthy diets, maintain social relations, participate in meaningful activities, and enjoy financial security . Participation in social and leisure activities means being willing to reach people, to stay connected, to keep learning, and to be curios, in one word to stay alive [1723]. Social participation is closely linked to self - esteem, life satisfaction, and mental health status, which makes it a very important factor for quality of life . Engagement with community activities, friendships, and meaningful volunteer work are perceived as strategies for maintaining social participation, especially for people with a chronic disease . Thus, encouraging participation in social and cultural activities could be a key tool to fight social isolation and its health detrimental outcomes . Our results are in line with data in the literature showing positive association between engaging in leisure and well - being [1723, 4763]. In particular, through interventions focused on the development of positive emotions, it is possible to improve well - being and reduce disability in the general population, and in most, if not all, mental disorders . These data indicate that well - being can be modified and that leisure and social activities may be affordable tools to improve well - being [6472]. Moreover, data coming from research on happiness genes, suggesting a genetic root of happiness / well - being, do not rule out gene - environment interaction on the expression happiness genes . Availability and access to cultural and social activities are a key element of healthy environment and especially of urban environment [7375]. Is a social event, social isolation can have a negative effect on nutrition, and thus we speculated that social and cultural participation might influence adherence to diet [7678]. Adequate nutrition is a key factor to healthy aging and to preventing disease onset; nevertheless eating appropriately and, even more, following a diet or a nutritional regimen are never an easy task . Motivations are important factors to eat healthy or to stay on a diet, and they change with age . In> 60 subjects, dieting, by - and - large required by health problem, is perceived as a punishment . Social and cultural participation, fighting social isolation, may help> 60 to follow healthier life styles, among which is healthy eating, or to accept more easily to face stressful situation, like being forced to diet . The results presented here suggest that> 60 subjects, in particular females, participating in cultural and social activities, apparently accept diet or nutritional regimen better then np subjects as it is shown by an overall higher score in both pwb and resilience . The higher pwb score observed in p females> 60 following a diet deserves, in our view, a special consideration . Pampel in 2012 reported a more consistent association between cultural activities and low body weight in the western country than elsewhere and that the relationship emerges more consistently for women than men . Subjective well - being significantly correlates with high self - esteem, and self - esteem shares significant variance in both mental well - being and happiness . Self - esteem has been found to be the most dominant and powerful predictor of happiness . Quoting mann, indeed, while low self - esteem leads to maladjustment, positive self - esteem, internal standards and aspirations body image bears relationship to self - esteem and psychosocial adjustment (e.g., eating disturbances, depression, social anxiety, and sexual functioning). The association between body image and women's mental and physical health has been investigated with mainly focusing on young women's appearance concerns . However, in the aging society body concerns are becoming an issue also for older women, because of age - related changes in both appearance and functioning . In particular, aesthetic appearance is becoming relevant to older women and may lead some women to feel that their bodies are inadequate or lacking . Because of the association between beauty and youth, women lose their social value simply by growing old [82, 83]. The ideal of a thinner body image persists in older adult females, as also suggested by the observation that higher bmi predicts lower psychological well - being only among women . Moreover, body - image concerns are significant to self - esteem in older adulthood [8486]. Conversely, improvements in body image are related to improvements in self - esteem and psychological well - being [87, 88]. On this basis esthetic element may play a role in the higher score in pwb and resilience reported by this sample of over 60 women participating in cultural and social activities and dieting, independently and far beyond health consciousness . The aim of the study presented here was to assess subjective well - being in a sample of residents of the metropolitan area of naples, when the city is going through a very difficult time of its long history . To our knowledge, this is the first survey on this topic, and our data represent a suggestive baseline . The present study has been designed to explore the possible association between cultural and social participation and well - being, which our results apparently support . Much larger and more in - depth studies than ours failed to find a causal link between cultural and social participation and well - being and health [2989]. However, the association is well - documented and apparently is so appealing that several governments include engagement in cultural and social activities among their strategies to improve well - being and health [9092]. Since welfare costs are one of the major sources of public finance deficits in the eu, investing in cultural welfare, an affordable health preventive and promoting strategy for healthy living and aging, could result in a substantial saving of public resources.
Rheumatic heart disease (rhd), a consequence of valvular damage caused by an exaggerated immune response to group - a streptococcal infection, usually during childhood, still remains unabated in developing countries . It is currently estimated that at least 15.6 million people have clinically recognized rhd with annual mortality rate between 3 and 12.5% [25], which accounts for 200000 to 250000 premature deaths . Several population - based surveys of the school children identified high volume of clinically unrecognized cases detected by echocardiographic screening [610]. The low sensitivity of cardiac auscultation for the detection of rhd and thereby underestimation of the disease burden have been recognized in these epidemiological studies . The delay in the early detection or nondetection of subclinical disease leads to advanced stages of rhd and places heavy economic burden on the healthcare system . Thus, early detection of subclinical rhd has been emphasized as timely implementation of secondary prevention measure (penicillin administration, cornerstone of acute rheumatic fever and rhd treatment, at regular intervals to avoid further exposure to group - a streptococcal infection that triggers autoimmune response) is the only cost - effective approach . As a result of body of evidence, world health organization (who) also recommends echocardiographic screening in rhd endemic areas . In 2012, world heart federation (whf) published evidence - based diagnostic criteria for echocardiographic detection of rhd . India contributes to nearly 25% to 50% of the global burden of rhd [12, 14]. However, literature review identified the need of well - conducted echocardiography based prevalence studies which used internationally accepted standard set of diagnostic criteria . Thus, the present study was designed to obtain accurate prevalence data on rheumatic valvular abnormalities in school children using whf provided echocardiographic criteria . This population - based cross - sectional screening study was carried out in trivandrum between december 2013 and may 2014 . All the schools of the trivandrum district, kerala, were stratified into government and private (aided) schools . After the consent of the principals, all the students (of the selected schools) were invited to participate and were thoroughly informed about the study . The children whose parents or guardian gave written informed consent (in malayalam, a local language) were included in the study . The protocol of the study was approved by institutional ethics committee before the commencement of the study . A total of 2060 school children aged 515 years from five government (n = 1023 students) and two private (n = 1037 students) schools were screened during the study period . The participating children were interviewed using a proforma . As poverty and overcrowding are the risk factors for the occurrence of the disease, we included socioeconomic status, type of housing (kutcha house), and number of family members of the enrolled children . Houses made from mud, thatch, or other low - quality materials are called katcha houses . Cardiac auscultation was performed with the patients in the supine and left lateral decubitus position . Children in whom an apical systolic murmur was detected clinically underwent echocardiography for the confirmation of rhd . These criteria were designed for use in rhd endemic populations to identify asymptomatic individuals who had no history of acute rheumatic fever . According to the criteria, the children identified with rheumatic valvular abnormalities were diagnosed with either definite rhd or world heart federation criteria of echocardiographic diagnosis of rheumatic heart disease echocardiographic criteria for individuals aged 20 years definite rhd (either (a), (b), (c), or (d)) are as follows . Pathological mr and at least two morphological features of rhd of the mv.ms mean gradient 4 mmhg.pathological ar and at least two morphological features of rhd of the av.borderline disease of both the av and mv . Borderline rhd (either (a), (b), or (c)) are as follows . At least two morphological features of rhd of the mv without pathological mr or ms.pathological mr.pathological ar . Normal echocardiographic findings (all of (a), (b), (c), and (d)) are as follows . Mr that does not meet all four doppler echocardiographic criteria (physiological mr).ar that does not meet all four doppler echocardiographic criteria (physiological ar).an isolated morphological feature of rhd of the mv (e.g., valvular thickening) without any associated pathological stenosis or regurgitation.morphological feature of rhd of the av (e.g., valvular thickening) without any associated pathological stenosis or regurgitation . Definite rhd (either (a), (b), (c), or (d)) are as follows . Pathological mr and at least two morphological features of rhd of the mv.ms mean gradient 4 mmhg.pathological ar and at least two morphological features of rhd of the av.borderline disease of both the av and mv . Pathological mr and at least two morphological features of rhd of the mv . Borderline rhd (either (a), (b), or (c)) are as follows . At least two morphological features of rhd of the mv without pathological mr or ms.pathological mr.pathological ar . At least two morphological features of rhd of the mv without pathological mr or ms . Normal echocardiographic findings (all of (a), (b), (c), and (d)) are as follows . Mr that does not meet all four doppler echocardiographic criteria (physiological mr).ar that does not meet all four doppler echocardiographic criteria (physiological ar).an isolated morphological feature of rhd of the mv (e.g., valvular thickening) without any associated pathological stenosis or regurgitation.morphological feature of rhd of the av (e.g., valvular thickening) without any associated pathological stenosis or regurgitation . Mr that does not meet all four doppler echocardiographic criteria (physiological mr). Ar that does not meet all four doppler echocardiographic criteria (physiological ar). An isolated morphological feature of rhd of the mv (e.g., valvular thickening) without any associated pathological stenosis or regurgitation . Morphological feature of rhd of the av (e.g., valvular thickening) without any associated pathological stenosis or regurgitation . Criteria for pathological regurgitation pathological mr (all four doppler echocardiographic criteria must be met) is as follows . (i) seen in two views. (ii) in at least one view, jet length 2 cm. (iii) velocity 3 m / s for one complete envelope. (iv) pansystolic jet in at least one envelope . Pathological ar (all four doppler echocardiographic criteria must be met) is as follows . (i) seen in two views. (ii) in at least one view, jet length 1 cm. (iii) velocity 3 m / s in early diastole. (iv) pandiastolic jet in at least one envelope . Pathological mr (all four doppler echocardiographic criteria must be met) is as follows . (i) seen in two views. (ii) in at least one view, jet length 2 cm. (iii) velocity 3 m / s for one complete envelope. (iv) pansystolic jet in at least one envelope . In at least one view, jet length 2 cm . Pathological ar (all four doppler echocardiographic criteria must be met) is as follows . (i) seen in two views. (ii) in at least one view, jet length 1 cm. (iii) velocity 3 m / s in early diastole. (iv) pandiastolic jet in at least one envelope . In at least one view, jet length 1 cm . Velocity 3 amvl thickening 3 mm (age - specific).chordal thickening.restricted leaflet motion.excessive leaflet tip motion during systole . Definite rhd children were given secondary prophylaxis and asked to follow - up in trivandrum medical college which is a tertiary hospital . Children with borderline rhd were asked to follow up every six months for an echo to determine progression of disease . Amvl thickening 3 mm (age - specific).chordal thickening.restricted leaflet motion.excessive leaflet tip motion during systole . Irregular or focal thickening.coaptation defect.restricted leaflet motion.prolapse . Irregular or focal thickening . Restricted leaflet motion . Our sample - size calculation was based on the results of previous study of the echocardiographic prevalence of rheumatic heart disease . Estimated the echocardiographic prevalence of rhd to be 51 per 1,000 (95% confidence interval: 3864 per 1,000) in 1059 school children aged 615 years of bikaner city, india . According to the following equation, the estimated sample size was 1787 . However, we enrolled 2060 school children to estimate echocardiographic prevalence:(1)sample size=4pqd2,where p = 5.1%, echocardiographic prevalence of rhd being 51 per 1000 (published study); q = 100 p, and d is 20% of p. statistical analyses were performed using spss statistics v.15.0 . A total of 2060 school children from five government (n = 1023 students) and two private (n = 1037 students) schools were screened during the study period . The average age of the study population was 12.6 2.1 years with predominantly male subjects (n = 1335; 64.8%). All the enrolled school children underwent clinical examinations which identified pathological murmur in 184 school children (apical systolic murmur in 45 school children). Out of these 184 school children with pathological murmur, echocardiography confirmed rhd in 5 (11.1%), corresponding to the clinical prevalence of 2.4 cases per 1000 children (95% ci, 1.1 to 4.2). Echocardiographic screening was performed in all 2060 enrolled school children . Of these 2060 school children, the most common anomaly was mitral valve prolapse (n = 15) and atrial septal defect (n = 8). Thus, the echocardiographic prevalence of congenital heart disease is 7.77 cases per 1000 children (95% ci, 3.3 to 10.3). However, whf pathological mitral regurgitation and aortic regurgitation were observed in 1 and 5 school children . Mitral valve abnormalities such as anterior mitral valve leaflet thickening 3 mm, chordal thickening, and excessive mitral valve leaflet tip motion during systole were observed in 56, 39, and 12 school children . Irregular or focal thickening of aortic valve, coaptation defect, or prolapse of aortic valve was observed in 3, 5, and 5 screened school children . According to whf criteria, rhd was diagnosed in 12 school children of whom 6 had definite rhd and 6 had borderline rhd (table 3). Echocardiographic prevalence of rhd was found to be 5.83 cases per 1000 children (95% ci, 2.5 to 9.1). Rhd consolidates a spectrum of different stages of clinically silent and clinically manifest valvular degeneration culminating in congestive heart failure, increasing the risk of endocarditis and cerebrovascular events and eventually leading to premature death . It is estimated that approximately 8085% of children younger than 15 years live in the area where this disease is endemic and the disease is considered as leading cause of cardiac disease in children . As per the systematic analysis carried out by murray et al ., rhd causes highest number of disability adjusted life years (dalys) among 1014-year - olds (516.6 per 100000 people, 95% ci 425.3647.0). Hence thus, over the past decades, interest has been raised in echocardiographic screening of rhd owing to its sensitivity for the detection of valvular abnormalities . A joint who and national institute of health (nih) working party published consensus case definitions for rhd . However, these definitions do not include full spectrum of morphological features of rhd in addition to lack of evidence - support . As a result of these limitations, some of the epidemiological studies adopt different criteria (to define morphological and functional abnormalities) to estimate prevalence of rhd . In a study marijon et al they reported that currently recommended who criteria miss up to three quarters of cases of subclinically affected and therefore potentially treatable rhd children . Their results demonstrated varying subclinical evidence of rhd . At on - site examination, among the 208 children (9.6%) with echocardiographic features of at least minimal valve regurgitation, 18 and 124 children were suspected to have rhd according to who and combined criteria, respectively . Thereafter, 17 of the 18 were confirmed to have definite rhd according to who criteria (94%), whereas 66 of the 124 cases were considered to have definite rhd by the use of combined criteria (53%). The definite echocardiographic rhd prevalences were thus 7.8 per 1000 (95% ci, 4.6 to 12.5) and 30.4 per 1000 (95% ci, 23.6 to 38.5) for who and combined criteria . Thus, the set of criteria by who suffers from a substantially lower sensitivity; thus, the combined criteria were better suited for screening of subclinical rhd . Different echocardiographic criteria for the diagnosis of rhd may account for the difference of rhd prevalence and essentially make epidemiological comparisons invalid . So, to close this gap, whf published the first internationally endorsed evidence - based criteria for echocardiographic detection of rhd in 2012 . These guidelines remove clinical examination from the diagnosis and divide disease into definite and borderline as well as providing subcategories within each for different combinations of diseases (isolated valvular regurgitation, isolated morphological change, etc . ). However, it allows rapid identification of the disease in those who do not have history of acute rheumatic fever . In india the present study is the first and largest echocardiographic based screening of rhd in school children of kerala till date which utilized whf criteria for the diagnosis of rhd in children . In kerala, alleppy showed a clinical prevalence of 2.2 per 1000 school children in 1975 . In 20022005, indian council of medical research (icmr) estimated clinical prevalence of rhd to be 0.12 per 1000 school children of cochin which was based upon echocardiographic confirmation of the suspected cases . However, the present study estimated echocardiographic prevalence being 5.83/1000 (including subclinical cases), indicating a decline of rheumatic heart disease in kerala, even though it may be more in some unidentified pockets . Epidemiological studies (after 2000) in school children which estimated prevalence of rhd in india have been summarized in table 4 . However, in these studies, the incidence was based on echocardiographic confirmation of the clinically suspected cases . In india, there are few studies carried out which estimated echocardiographic prevalence of rhd in children . The prevalence of rhd was found 51 per 1,000 school children (95% ci: 38 to 64 per 1,000 school children) by using who criteria of echocardiography . Similarly, a cross - sectional survey carried out by saxena et al . Among 6270 randomly selected school children (aged 515 years) using who criteria of echocardiography demonstrated echocardiography prevalence of 20.4 per 1000 school children (95% ci: 16.9 to 23.9 per 1000 school children). However, the estimated prevalence of clinical rhd of the study (carried out by saxena et al .) Was 0.8 per 1000 school children . In our study also, echocardiographic prevalence of rhd (using whf criteria) was found to be 5.83 cases per 1000 school children (95% ci, 2.5 to 9.1 per 1000 school children) as compared to prevalence of clinical rhd 2.4 cases per 1000 children (95% ci, 1.1 to 4.2). However, direct comparison of echocardiography prevalence of rhd with earlier studies was inappropriate due to different echocardiographic criteria . Studies in various countries most often replicate the true epidemiology of rhd, however sometimes being baffled by over- or underdiagnosis . Oversimplification may perhaps impact on the ability to detect rheumatic and other pathologies, such that some rare cases of isolated aortic regurgitation may be missed by using a simplified set of criteria . Suggested a strategy to be implemented in low - income countries: to focus on cost - efficient policies such as prevention (i.e., the use of penicillin) as cardiac surgery more often becomes unaffordable in such settings . Similarly, in another study, a simple focused cardiac ultrasound (fcu) with pocket - sized devices that could be operated by nonexperts seemed feasible and yielded acceptable sensitivity and specificity for rhd detection when compared with the state - of - the - art approach and thereby opened new perspectives for mass screening for rhd in low - resource settings . Thus, our study demonstrates feasibility echocardiographic screening of rhd in school children using whf criteria in indian setting as well as providing echocardiographic prevalence of rhd in school children using whf criteria in india . The results of the current study demonstrate that echocardiography is more sensitive in detecting clinically silent cases of rhd . Thereby, systematic screening with echocardiography reveals higher prevalence of rhd as compared with clinical screening . However, our study, the largest school survey of south india till date, points towards declining prevalence of rhd (5.83/1000 cases) using whf criteria in kerala . The study also showed feasibility to carry out echocardiographic screening of rhd using whf criteria in indian setting.
The advent of combination antiretroviral therapy (art) has increased life expectancy and decreased severe forms of hiv - associated dementia and other co - morbidities in most hiv - infected individuals . However, milder forms of hiv - associated neurocognitive disorders are still estimated to affect one - third to one - half of successfully treated patients . Neurocognitive impairment has been associated with residual immune dysfunction, which persists in some individuals despite long term suppressive art . The exact mechanism of chronic immune dysfunction in these individuals is incompletely understood and most likely multifactorial . Translocation of microbial products from the gastrointestinal tract into the systemic circulation is likely an important driver of immune dysfunction and persistent inflammation during suppressive art . It may also play a role in the pathogenesis of neurocognitive dysfunction during hiv - infection . (13)--d - glucan (bdg) is a polysaccharide cell wall component of most fungal species including candida spp . Blood and cerebrospinal fluid (csf) bdg levels are useful for early diagnosis of invasive fungal infections . In the absence of an active invasive fungal infection, increased blood bdg levels may be an indicator of gut mucosal barrier disruption and microbial translocation . The objective of this study was to evaluate whether higher blood bdg levels correlate with impaired neurocognitive functioning (evaluated by global deficit score [gds]) in a cohort of adults with acute / early hiv infection, who initiated art during the earliest phase of infection and achieved suppressed levels of hiv rna in blood plasma thereafter . In this cross - sectional cohort study, we measured levels of bdg in blood plasma and csf supernatant samples in a cohort of adults with suppressed levels of hiv rna in blood plasma (<50 copies / ml), and compared them with established biomarkers of microbial translocation, immune activation, and cognitive dysfunction . All 21 subjects participated in the san diego primary hiv infection research consortium (sd pirc), which comprised of adults with acute or early hiv diagnosis, early art initiation, and suppressed levels of hiv rna in blood plasma throughout treatment . Study samples were collected prospectively as part of the sd pirc between december 2013 and june 2014 at the university of california, san diego, and stored at 80 c on the day of collection . Degree of neurocognitive impairment at the time of sample collection was measured using the global deficit score (gds), which is an established and sensitive method to determine neurocognitive functioning among individuals living with hiv . The gds has been shown to detect mild, hiv - associated cognitive impairment based on assessment of multiple cognitive domains . Briefly, individuals completed a comprehensive neuropsychological test battery consistent with frascati recommendations for neuroaids research . Raw scores were converted to demographically adjusted t - scores, which, in turn, were scaled to deficit scores ranging from 0 (normal, t> 39) to 5 (severely impaired, t <20). Nineteen plasma and 16 csf supernatant samples (paired same - day plasma and csf samples were available from 14/21 subjects, plasma samples only from 5/21 subjects, and csf samples only from 2/21 subjects) were retrospectively evaluated for bdg levels and established biomarkers of microbial translocation and immune activation . Bdg levels were measured using the fungitell assay in june 2015 at the associates of cape cod, inc, research laboratories (associates of cape cod, inc, east falmouth, ma). Soluble cluster of differentiation 14 (scd14) levels were measured by an enzyme - linked immunosorbent assay (elisa; r&d systems inc, minneapolis, mn). Interleukin (il) 8 levels were measured by an electrochemiluminescence multiplex assay (meso scale diagnostics, rockville, md), each according to the manufacturer's procedures . For statistical analysis, spss 21 (spss inc, chicago, il) was used . Correlation between levels of bdg, gds, and levels of other biomarkers were calculated using spearman correlation analysis because of the non - normal distributions of gds scores and other biomarkers . Gds scores were also squareroot - transformed to achieve a distribution close to normal to allow for additional pearson correlation analysis between normally distributed biomarkers and squareroot - transformed gds . Power analysis revealed that a sample size of 19 plasma samples provides at least 80% power (with alpha = 0.05) to detect a correlation of r = 0.351 or higher for correlations of 2 variables . The ucsd human research protections program approved the study protocol, consent, and all study - related procedures . All study participants provided voluntary, written informed consent before any study procedures were undertaken . All 21 subjects participated in the san diego primary hiv infection research consortium (sd pirc), which comprised of adults with acute or early hiv diagnosis, early art initiation, and suppressed levels of hiv rna in blood plasma throughout treatment . Study samples were collected prospectively as part of the sd pirc between december 2013 and june 2014 at the university of california, san diego, and stored at 80 c on the day of collection . Degree of neurocognitive impairment at the time of sample collection was measured using the global deficit score (gds), which is an established and sensitive method to determine neurocognitive functioning among individuals living with hiv . The gds has been shown to detect mild, hiv - associated cognitive impairment based on assessment of multiple cognitive domains . Briefly, individuals completed a comprehensive neuropsychological test battery consistent with frascati recommendations for neuroaids research . Raw scores were converted to demographically adjusted t - scores, which, in turn, were scaled to deficit scores ranging from 0 (normal, t> 39) to 5 (severely impaired, t <20). Nineteen plasma and 16 csf supernatant samples (paired same - day plasma and csf samples were available from 14/21 subjects, plasma samples only from 5/21 subjects, and csf samples only from 2/21 subjects) were retrospectively evaluated for bdg levels and established biomarkers of microbial translocation and immune activation . Bdg levels were measured using the fungitell assay in june 2015 at the associates of cape cod, inc, research laboratories (associates of cape cod, inc, east falmouth, ma). Soluble cluster of differentiation 14 (scd14) levels were measured by an enzyme - linked immunosorbent assay (elisa; r&d systems inc, minneapolis, mn). Interleukin (il) 8 levels were measured by an electrochemiluminescence multiplex assay (meso scale diagnostics, rockville, md), each according to the manufacturer's procedures . For statistical analysis, spss 21 (spss inc, chicago, il) was used . Correlation between levels of bdg, gds, and levels of other biomarkers were calculated using spearman correlation analysis because of the non - normal distributions of gds scores and other biomarkers . Gds scores were also squareroot - transformed to achieve a distribution close to normal to allow for additional pearson correlation analysis between normally distributed biomarkers and squareroot - transformed gds . Power analysis revealed that a sample size of 19 plasma samples provides at least 80% power (with alpha = 0.05) to detect a correlation of r = 0.351 or higher for correlations of 2 variables . The ucsd human research protections program approved the study protocol, consent, and all study - related procedures . All study participants provided voluntary, written informed consent before any study procedures were undertaken . The study cohort was composed of 21 hiv - infected participants without symptoms of opportunistic infections . Demographics and clinical characteristics at the time of sample collection are depicted in table 1 . All participants were virologically suppressed at the time of sampling in both compartments (blood and csf). The median cns penetration effectiveness index was 6 (iqr 47) for their current art regimens . No correlations were found between blood bdg levels and age, sex, and estimated duration of infection . Demographics and clinical characteristics of the study population median gds was 0.39 (range 02.67; iqr 0.111.11; 10 subjects [including one subject with csf sample only] had gds> 0.5, which is considered at least mild cognitive impairment). Median bdg level in blood plasma was 66 pg / ml (range: 20101 pg / ml), whereas median bdg level in csf supernatant was 5 pg / ml (range: 053 pg / ml). Higher levels of plasma bdg were associated with more severe cognitive impairment as measured by the gds (spearman r = 0.47, p = 0.042; pearson [correlation with squareroot - transformed gds] r = 0.46, p = 0.049; figure 1 and table 2]. Of the other biomarkers, a significant correlation with gds was found for il-8 (spearman r = 0.55; p = 0.014), whereas no significant correlations were found for scd14 (spearman r = 0.4, n.s . ), and nadir cd4 count (spearman r = 0.01, n.s . ). Also, we found no significant correlation between plasma bdg and both il-8 (spearman r = 0.12, n.s .) And scd14 (spearman r = 0.38, n.s . ). Scatterplots of correlation of blood beta - d - glucan levels (a) and cerebrospinal fluid beta - d - glucan levels (b) with global deficit scores . Levels of investigated plasma biomarkers (median and iqr are displayed) and correlations with gds and plasma bdg levels with regard to combinations of bdg, il-8, and scd14 and correlation with gds, bdg + il-8 (spearman r = 0.57; p = 0.01) and bdg + scd14 (spearman r = 0.58, p <0.01) were the most promising combinations of 2 biomarkers, whereas the combination of all 3 biomarkers (bdg + il-8 + scd14) had the highest correlation with gds (spearman r = 0.71; p <0.01). Plasma bdg levels, levels of other biomarkers including combinations, as well as spearman correlations with blood bdg and gds are displayed in table 2 . Using the plasma bdg cut - off recommended by the manufacturer for differentiating negative from intermediate and positive results (ie of 60 pg / ml), the sensitivity for detecting neurocognitive impairment was 78% and the specificity 50% . If bdg cut - off was increased to 70 pg / ml, the sensitivity dropped to 44%, but specificity increased to 90% . Two of 16 csf samples presented elevated bdg levels (45 and 53 pg / ml; figure 1), whereas all other samples had bdg levels <10 pg / ml . Interestingly, these 2 samples originated for the 2 subjects with the highest gds scores of the cohort . Both of these subjects had also elevated serum bdg levels (4 and 5 highest of the study cohort) and no signs or symptoms of opportunistic infections . This study correlated blood levels of the fungal polysaccharide cell wall component bdg, with cognition among hiv - infected patients . Identifying biomarkers associated with worse neurocognitive functioning among successfully treated hiv - infected individual overall, our study cohort of hiv - infected individuals with suppressed hiv rna viral loads presented with markedly higher bdg levels when compared to previously published levels from healthy patients undergoing elective plastic surgery procedures . Our study also showed, for the first time, that elevated bdg levels in the absence of fungal infections were associated with negative neurocognitive outcomes (as measured by increased gds) in virologically suppressed hiv - infected persons who started art during early hiv infection . Interestingly, gds was also correlated with il-8, but bdg and il-8 were not correlated . Importantly, combining bdg with il-8 and especially the combination of all 3 plasma biomarkers (bdg, il-8, and scd 14) further improved the correlation with gds . We hypothesize that elevated plasma bdg may primarily reflect translocation of products from natural fungal flora from the gastrointestinal tract into systemic circulation . Evidence of peripheral fungal cell wall polysaccharides in the systemic circulation has also been reported previously in an hiv - infected outpatient cohort, the majority of whom had measurable hiv rna in their blood . In that study, high serum bdg was associated with hiv - associated immunosuppression (ie, cd4 cell counts <200 cells/l), inflammation (correlation with plasma il-8 and other inflammation markers), and cardiopulmonary comorbidity . Together with these previous findings, our results support a theory that bdg translocation occurs in virologically suppressed hiv+ individuals and may relate to important outcomes such as nc impairment . Bdg levels were markedly higher (mean 142 pg / ml) in a hiv - infected cohort with lower median cd4 counts (26, iqr 1053, all without opportunistic infections), when compared with the cohort studied here (with a median cd4 count> 700 pg / ml). In contrast, lower bdg levels (median 15 pg / ml) were found in another study that evaluated chronically hiv - infected individuals with a median duration of hiv infection of 15 years and high cd4 + counts (643, range 1961740). Although elevated blood bdg levels may be associated with microbial translocation in all hiv - infected individuals (ie, independent of cd4 cell counts), interpretation of elevated blood bdg levels in patients with cd4 cell counts below 200 to 300 cells/l may be more complicated . Although it seems intuitive that deteriorating cd4 counts are associated with worse mucosal barrier function, other reasons for elevated bdg may include potential colonization or subclinical infection with candida spp or pneumocystis that may occur more frequently in individuals with lower cd4 counts . Other studies suggested that bdg may also be elevated in bloodstream infections caused by primarily enteric bacteria, such as enterococcus spp, whereas in a recent study, bdg was not elevated (i.e.> 80 pg / ml) in patients with mild - to - moderate mucositis . Whether this increase in bdg levels reflects concomitant translocation of fungal elements, major limitations of this pilot study include the small sample size, that it is single - site, cross - sectional, and restricted to patients treated in early stages of hiv infection . To further examine the role of bdg as a potential biomarker for translocation of gut luminal contents and its correlation with neurocognitive impairment bdg levels in the intestinal luminal contents are also likely to be highly variable on an individual basis, and a standardized oral bdg challenge approach may be more suitable for assessing gut leakiness . Longitudinal studies are also needed to investigate the mechanisms of blood bdg increase in individuals with translocation of gut microbes or their components . In conclusion, bdg may be an indicator of gut mucosal barrier disruption and an independent biomarker associated with neurocognitive functioning in virologically suppressed hiv - infected individuals with high cd4 counts . In particular, when bdg is combined with established markers of immune activation, diagnostic potential for neurocognitive functioning may be promising.
It is well recognized that the mealtime insulin requirement in type 1 diabetes (t1 dm) patients is driven mostly by carbohydrate content and that monitoring it can improve glucose levels . The american diabetes association recommends meal plans based on carbohydrate counting as a key strategy to achieve glycemic control . An impact of protein containing food on glycemia in diabetes has been studied for many decades; however, it is unclear whether or not the calculation of other food components can also be used to optimize glucose levels [3, 4]. Some studies have suggested that counting the amount of fat and protein (using fat / protein exchanges) may be beneficial for reaching glycemic control in t1 dm children . Such an approach could be particularly feasible in t1 dm patients treated with continuous subcutaneous insulin infusion (csii) via insulin pump . One of the features implemented in some personal insulin pumps is the dual - wave bolus (dwb) option, which delivers the combination of an instant standard premeal insulin bolus followed by a square bolus (sb) infused over several hours, helping to tailor prandial insulin delivery to the composition of a meal . This pump option may be particularly useful for mixed, fat-/protein - rich meals since such food seems to modify postmeal glucose patterns with a less rapid and more prolonged increase in plasma glucose concentration . It has recently been shown among a cohort of pediatric patients with long - lasting t1 dm, using pump therapy, that for mixed meals insulin dosing based on both carbohydrate and fat / protein counting leads to lower postprandial glycemic levels than the conventional counting of carbohydrates only . . However, the studies performed so far estimating the glycemic effect, mostly on postprandial glucose levels, of fat and protein ingestion had some serious limitations . For example, they evaluated either the effect of a meal containing both fat and protein [5, 8] or the effect of just fat added to a mixed meal . To our knowledge, until now no study has examined the effect of sole protein ingestion . The aim of this study was to estimate the impact of ingestion of a pure protein load on glucose levels in t1 dm patients treated with personal insulin pumps . We examined 10 t1 dm patients (6 females, 4 males) treated with insulin pumps (medtronic paradigm 722 or veo) equipped with a continuous glucose monitoring system (cgms) option . During the study, enlite sensors (medtronic) all of the patients were white caucasians under the medical care of the department of metabolic diseases, university hospital, krakow, poland . The selection of patients was based on good prestudy compliance as assessed by good glycemic control (hba1c level less than 7.5%, 58 mmol / mol), the patient's usage of the bolus wizard (bolus calculator) option for more than 90% of boluses, changing infusion sets according to manufacturer's recommendation, and using at least one electrode for cgms per month during the preceding year . All patients gave informed consent, and the study was approved by the bioethical committee of the jagiellonian university . Before study entry (one to two weeks preceding day 1), the patients' baseline insulin infusion was optimized to minimize the differences in fasting glucose levels to less than 30 mg / dl between any two time points between 9 a.m. and 3 p.m. the procedure of optimization was based on a retrospective analysis of cgms records and involved increasing or decreasing the rate of basal insulin infusion two hours before the observed rise or fall in glucose level . Subsequently, the new settings of the basal infusion rate were rechecked with cgms to meet the study criteria . In phase i (day 1), a fasting test (between 9 a.m. and 3 p.m.) was performed to confirm the stable glucose patterns (as defined above) on current basal insulin infusion settings . In phase ii (day 2), the patients were exposed to a single pure protein load by ingesting a commercially available preparation (protifar, nutricia, milk derived proteins). In its 100 ml volume, the product contained 88.5 grams of pure protein, 1.6 grams of fat, and less than 1.5 grams of carbohydrates (lactose), as well as minerals and micronutrients . All the patients were exposed to a dose of 0.3 g of pure protein (0.34 ml of protifar / kg dissolved in 200 ml of water) for each kg of body weight; the load was administered at 9 a.m. such a dose of protein is the equivalent of the usual protein portion in a medium - size meal, based on the dietary recommendations for patients with diabetes (1520% of total daily energy intake). Both phases were performed in home settings; the patients were given precise instructions concerning the procedure . The rate of basal insulin infusion during the protein load test was the same as that defined initially in phase i; no modifications or extra insulin boluses were permitted . Cgms record was performed in both phases, during which the patients avoided physical activity . Glucose patterns were recorded during 6 hours of phase i (fasting) and 6 hours of phase ii (protein load). There was no consistency in the age of cgm sensors during phase i and phase ii; however, we strictly avoided performing tests during the first or last (6th) day after sensor insertion . The difference between the two phases was assessed by using the dependent t - test or paired sample wilcoxon signed rank test, when applicable . The patients' mean age was 32.3 years, mean t1 dm duration was 11.7 years, and mean hba1c was 6.85% (51 mmol / mol). Mean baseline glucose levels were 119.8 and 117.6 mg / dl for phase i and phase ii, respectively (p = 0.68). Mean maximal glucose levels were 146.4 and 145.2 mg / dl for phase i and phase ii, respectively (p = 0.85). Mean maximal glucose level increment was similar for the entire 6-hour fasting and protein load test (26.6 mg / dl versus 27.6 mg / dl, resp . There was only a borderline difference between the change in baseline versus 6th hour glucose levels for the fasting state versus protein load test (12.5 mg / dl and 19.0 mg / dl, resp ., p = 0.04). The glucose variability assessed by cgms - based standard deviation of mean glucose levels was 36.4 and 38.9 mg / dl for phase i and phase ii, respectively (p = 0.01). There were no episodes of infusion set malfunctions during phase i or phase ii of the study, and no hypoglycemia was recorded during fasting or after loading . Here, for the first time, we evaluated the impact of the ingestion of a pure protein load on glucose levels in adult t1 dm subjects treated with insulin pumps . In this short - term clinical experiment, we found that protein consumption had very little effect on the glycemia of the examined cohort of patients . Contradictory to our study results, there have been several earlier papers reporting a substantial rise in glucose levels in t1 dm patients as an effect of the consumption of noncarbohydrate food components [5, 8, 10]. However, these reports involved either fat only or fat and protein combined, because, in real - life settings, they are often consumed together in products chosen by diabetic individuals, such as meat, poultry, fish, and dairy products . Thus, the discrepancy between earlier studies and our results may be explained by the variable short - term impact of fat and protein versus protein only consumption on glucose homeostasis through different mechanisms of hepatic gluconeogenesis, postmeal insulin resistance, release of glucagon and gut hormones, gastric emptying, and rate of absorption of other food components like carbohydrates and other factors [1113]. There are some earlier reports from different healthy and diabetic populations suggesting variable glycemic effects of high protein meals; for example, they promote gluconeogenesis and slow gastric emptying [13, 14]. In a recently published study in t1 dm, it was shown that a mixed meal consisting of 30 g of carbohydrate and 40 g of protein has a greater glycemic effect than a pure carbohydrate load . The study by smart was performed in a pediatric population, while ours involved adult individuals . The differences in outcomes of both studies may be associated with various physiological reactions to protein load in the examined age groups . Furthermore, there may be discrepancies in the proportion of basal versus prandial insulin doses depending on the age of patients, which could affect study outcomes . Moreover, the effect of protein when mixed with carbohydrates might be different compared to the effect of protein alone . Finally, the impact of protein may be dose - dependent, because, in the earlier study, 40 g of protein per meal was used, while the protein dose in our study was much lower . It is also important to underline that factors other than meal size or composition may influence the rate of food absorption and postprandial glucose patterns . The list of such factors includes the method of preparation (e.g., cooking, frying, or grilling), rapidity of consumption, accompanying beverages, time elapsed since the previous meal (second - meal phenomenon), and variability in individual rates of gut absorption, as well as some other factors . Moreover, various types of protein consumed as a meal component or during the load test might have affected the postmeal / load glucose patterns . The outcomes of our study may have practical clinical consequences as there are some small protein - based snacks available, such as protein bars or shakes, which are small meal options for t1 dm patients . So, it is important to provide them with information about their impact on glucose level . This is particularly important as, through their satiating effect, they may be helpful in weight management . An important advantage of our study was the carefully optimized rate of basal insulin infusion based on the earlier fasting phase of the experiment . Consequently, we were able to exclude the potential bias related to an excess or deficit of basal insulin on postload glucose patterns . Additionally, our subjects were highly preselected; they were adult t1 dm patients characterized by very good compliance prior to the study, frequent cgms use, and willingness to follow a challenging study protocol . The direct clinical implication of our study is the recommendation that small protein - based snacks may be consumed by adult t1 dm csii - treated patients without insulin bolusing . Obviously, the general guidelines concerning daily protein consumption for patients with diabetes should be followed . The results of this study cannot be generalized to other noncarbohydrate food components, especially fat . Additionally, we examined glucose patterns for 6 hours; thus, it is not possible to exclude the protein load effect on glycemia beyond this time, for example, during subsequent meal . Finally one has to underline, that we have used cgm systems that are still characterized with limited accuracy and reliability . In conclusion, the ingestion of a pure protein load does not seem to have a clinically significant impact on glucose levels in adult t1 dm patients treated with insulin pumps.
Schizophrenia is a severe mental disorder that is often characterized by disruptions in thoughts and behaviors that affect the language ability and perceptions of those afflicted with the disease and often cause psychotic experiences resulting in hearing voices or delusions.1 while the disease itself varies in severity, sufferers of schizophrenia have an increased risk of suicide with approximately one - third of sufferers attempting suicide at some point in their life and approximately 10% succeeding in taking their own life.2,3 schizophrenia typically begins early in life, first manifesting in late adolescence or early adulthood.1 the age for the first episode is typically younger for men, 21 years of age on average, than for women, for whom the average age is 27 years.2,3 the exact cause of schizophrenia is unknown, and the possible factors related to onset include chemical imbalances in the brain, genetic factors, or viral infections.4 estimates for the worldwide lifetime prevalence of the disease range from 0.5% to 1%,2,3 and it is estimated that schizophrenia currently affects 21 million people worldwide.1 in the people s republic of china, schizophrenia is estimated to occur in 0.8% of the adult population,5 and there are8 million currently diagnosed cases of the disease.6 the treated prevalence of the disease in korea in 2005 was estimated to be0.4% of the population.7 a 2009 analysis of the health insurance review and assessment service - national patients sample (hira - nps) in korea analyzed 126,961 patients with schizophrenia; of these patients, 10.5% were prescribed with antipsychotic monopharmacy, while 89.5% were prescribed with polypharmacy.8 in malaysia, the incidence rate of schizophrenia has been reported to be 7.743.0 per 100,000 population.9 the widespread prevalence of the disease is associated with significant economic burden . An international literature review found that the median health care costs from schizophrenia represented 1.1% of total national health care expenditures.10 the world health organization (who) has estimated that the health care costs associated with schizophrenia in the usa and europe may be as high as 2.6% of the total health care expenditures.11 a us study using a claims database analysis found that patients with schizophrenia had medical care costs four times that of a matched, nonschizophrenic cohort . Of these costs, 42% were inpatient expenditures.12 a canadian study estimated the direct health care and nonhealth care costs of schizophrenia to be 2.02 billion canadian dollars in 2004.13 in korea, the estimated annual, direct health care costs associated with schizophrenia were estimated to be $418.7 million in 2005.7 a 2009 database analysis of a nationally representative subset of 126,961 patients with schizophrenia in korea found that the mean total medical cost per patient was us$3,209.8 the direct health care costs per case in the people s republic of china are estimated to be $862.81.6 given the extensive health care costs associated with schizophrenia and the amount of these costs that result from hospitalization, it is likely that effective medications could help reduce the incidence of hospitalization and possibly reduce the length of stay in cases where hospitalization is required and therefore potentially result in a reduction in the economic burden associated with the disease . The primary pharmacological intervention used in the treatment of schizophrenia is antipsychotic drugs.1416 research suggests that up to 80% of patients with schizophrenia experience a psychotic relapse within the first 5 years following their initial episode.14,1719 it is thought that treatment nonadherence is a significant factor leading to relapse.14,19 in addition to the increased probability of relapse, treatment nonadherence has also been found to be correlated with inconsistent symptom control and hospitalization, potentially leading to a variety of physical and social difficulties for the patient, including progressive loss of brain tissue, possible suicide, family conflict, and loss of independence and employment opportunities.14,20 treatment adherence may be improved through the use of long - acting injectable antipsychotic medications that reduce the number of doses, relative to immediate - release medications, which may help maintain consistency through scheduled treatments.14,20 paliperidone palmitate (pp) is an atypical antipsychotic medication indicated for schizophrenia . Paliperidone was approved by the food and drug administration (fda) in 2006 for the treatment of schizophrenia . The long - acting injectable form of paliperidone was approved by the fda on july 31, 2009 for the treatment of schizophrenia, and subsequently approved in europe in 2011 . The long - acting form of paliperidone is injected into the patient by a health care professional on a monthly basis, which may help with adherence rates . The medication has been shown, in both short - term and long - term clinical trials, to delay relapse time and help provide symptom control for patients experiencing acute exacerbation of schizophrenia.21,22 as a result, the consistent use of long - acting, injectable pp may reduce relapse rates and hospitalization, potentially leading to a reduction in the economic burden associated with schizophrenia . The goal of this study is to estimate the reduction in hospitalization costs associated with the use of long - acting, injectable pp in the people s republic of china, korea, and malaysia relative to alternative treatment medications . In the analysis, we combined localized cost data for the three individual countries with data on the reduction in hospitalization rates derived from a recent phase iiib trial (clinical registry number cr016522).23 results suggest that reductions in hospital utilization cost may occur through the use of long - acting pp relative to alternatives . The study focuses exclusively on the estimated reduction in hospitalization days following treatment with pp and the associated cost savings . Cost analysis was done using a payer s perspective and only includes the direct health care costs associated with hospitalization . All monetary values were converted into us dollars to help facilitate comparisons with existing studies . The analysis was done over two time horizons: 12 months and 18 months after therapy begins . In both cases, mean per patient year hospitalization costs were compared to a retrospective period of 12 months prior to the beginning of therapy with pp . Subset analysis was performed on patients with <1 year of schizophrenia history versus those between 1 year and 5 years of schizophrenia history . Since we annualized the duration of hospital stays, this may exaggerate the length of treatment duration for those with <1 year of history . Localized, direct medical care costs per hospital day for the people s republic of china were taken from a literature review on the burden of schizophrenia in the people s republic of china.24 the review cites a 2010 study that examined the direct psychiatric hospital costs for 3,117 patients diagnosed with schizophrenia . The median total cost for patients with schizophrenia was found to be 10,765 (us$1,722) per admission or 241 (us$38.56) per day . The inpatient cost per day for korea was taken from a direct medical cost analysis in hospitalized patients with schizophrenia set in korea.25 the study used 129,171 (us$118.84) as the cost per inpatient hospitalization day in 2010 . The estimated cost per bed day for primary hospitals in malaysia for 2005 was us$68.46.26 in order to obtain the heath care resource utilization for patients diagnosed with schizophrenia, we used outcomes from a recent phase iiib study.23 the background information of the study, such as patients treatment status at baseline and recruitment methodology has been published previously.23 the primary objective of the study was to explore safety, tolerability, and treatment response of pp once - monthly injections compared to different previous antispsychotic medications in patients with schizophrenia . Enrollment in the study was limited to recently diagnosed patients with schizophrenia, defined in this case as having received the diagnosis within a 5-year period prior to screening . The health care utilization analysis set included 108 total subjects from the people s republic of china, 109 total subjects from malaysia, and 94 total subjects from korea . Hospital utilization rates were calculated for the 12-month period prior to beginning treatment with pp and for both 12 months and 18 months following the beginning of treatment . Focus was placed on full institutionalized days per year where full institutionalization was defined as a continuous 1224-hour period of hospitalization that included at least one overnight stay . The mean (95% ci) numbers of fully institutionalized days per person year in the people s republic of china were found to be 63.26 (41.16, 85.36) during the 12-month retrospective period, 17.49 (3.05, 31.94) days per person year during the initial 12 months of the prospective period, and 17.09 (2.68, 31.50) days per person year during the full 18-month prospective period . Additionally, when individuals with a diagnosed history of schizophrenia of <1 year at the time of enrollment were excluded, the mean numbers of fully institutionalized days per person year were found to be 50.70 (24.52, 76.87) during the 12-month retrospective period, 15.21 (0.00, 32.18) days per person year during the initial 12-month prospective period, and 14.82 (0.00, 31.72) days per person year during the full 18-month prospective period . In korea, the mean numbers of fully institutionalized days per person year were found to be 55.68 (32.09, 79.27) during the 12-month retrospective period, 9.41 (0.00, 20.37) days per person year during the 12-month prospective period, and 8.38 (0.00, 19.18) days per person year during the full 18-month prospective period . Excluding individuals with a diagnosed history of schizophrenia of <1 year at the time of enrollment, the mean numbers of fully institutionalized days per person year were found to be 43.99 (14.23, 73.76) during the 12-month retrospective period, 13.15 (0.00, 30.36) days per person year during the 12-month prospective period, and 12.02 (0.00, 29.04) days per person year during the full 18-month prospective period . The mean numbers of fully institutionalized days per person year in malaysia were found to be 131.40 (101.26, 161.53) during the 12-month retrospective period, 42.27 (22.86, 61.68) days per person year during the 12-month prospective period, and 40.15 (21.33, 58.96) days per person year during the full 18-month prospective period . Excluding individuals with a diagnosed history of schizophrenia of <1 year at the time of enrollment, the mean numbers of fully institutionalized days per person year were found to be 145.51 (104.83, 186.18) during the 12-month retrospective period, 49.92 (22.90, 76.94) days per person year during the 12-month prospective period, and 46.64 (20.74, 72.53) days per person year during the full 18-month prospective period . In all the cases, the reduction in full institutionalized days following the initiation of treatment with pp relative to the retrospective period were found to be statistically significant (p,0.0001) using a paired t - test . Analysis was done individually for each of the three countries by utilizing the full institutionalized days per person year results from the phase iiib study and the localized, direct inpatient health care utilization costs derived from published literature sources (table 1). Note that the variation in the costs for each country may reflect the differences in purchasing power and per capita gross domestic product across the countries . For people s republic of china, the estimated total per patient year hospitalization costs during the retrospective period were found to be $2,439 for the full sample and $1,955 for the sample excluding patients diagnosed within 1 year prior to enrollment in the sample . During the initial 12-month period following treatment with pp, the total per patient year hospitalization costs were $674 and $586 for the full sample and sample excluding newly diagnosed cases, respectively . After adjusting for different sample sizes in the study periods, this resulted in an estimated cost reduction of $1,991 and $1,567 per patient year . All of these cost reductions are due to the reduced number of hospital utilization days following treatment . During the entire 18-month period during treatment, the total per patient year costs were found to be $659 and $571, respectively, for the two samples, resulting in cost reductions of $2,007 and $1,583 relative to the retrospective period . In doing the analysis for korea, results for the retrospective period were $6,617 for the full sample and $5,228 for the sample excluding patients diagnosed within 1 year prior to enrollment in the sample . During the initial 12-month period following treatment, annual per patient costs were found to be $1,118 and $1,563 for the full sample and sample excluding newly diagnosed cases, respectively . The resulting per patient year cost reductions were $6,698 and $5,408 for each sample relative to the retrospective period . When the entire 18-month prospective period is considered, the costs were estimated to be $996 and $1,428 for each sample, resulting in per patient year cost reductions of $6,821 and $5,543 relative to the retrospective period . Analysis for malaysia resulted in estimated total per patient year hospitalization costs during the retrospective period of $8,996 for the full sample and $9,962 for the sample excluding patients diagnosed within 1 year prior to enrollment in the sample . During the initial 12-month period following treatment with pp, the total per patient year hospitalization costs were $2,894 and $3,418 for the full sample and sample excluding newly diagnosed cases, respectively . This resulted in estimated cost reductions of $6,716 and $7,444 per patient year . During the entire 18-month period following treatment, the total per patient year costs were found to be $2,749 and $3,193, respectively, for the two samples, resulting in cost reductions of $6,966 and $7,871 relative to the retrospective period . In this paper, we have attempted to further analyze the health care resource utilization costs of patients with schizophrenia in the people s republic of china, korea, and malaysia with specific focus on the reduction in hospitalization costs associated with the use of long - acting, injectable pp relative to alternative treatment medications . In the analysis, we combined localized cost data for the three individual countries with data on the reduction in hospitalization rates derived from a recent phase iiib trial . Results suggest that reductions in hospital utilization cost may occur through the use of long - acting pp relative to alternatives . There have been several studies that have looked at the costs associated with schizophrenia; however, the majority of these studies have been conducted on the us and europe populations, and there are a limited number of studies addressing this issue for asia.27 to our knowledge, this is the first paper to specifically address the reduction in hospitalization costs for patients in asia resulting from the treatment using pp relative to alternative medications currently in use for the treatment of schizophrenia . This study as implemented is a subject to a number of potential limitations, which may impact the overall results . The study was conducted from a third party payer perspective instead of using a societal perspective . As a result, we do not include the additional cost savings, such as the value of lost productivity, physical and social difficulties, and caregiver time costs, associated with treatments more likely to result in adherence . Given the substantial economic burden associated with schizophrenia, both direct and indirect, the inclusion of these costs would likely have added to the potential cost reductions from the use of pp relative to alternative medications . The analysis also required extrapolation of several localized cost parameters from published sources combined with health care utilization data from a clinical study . We note that the process of incorporating data derived from a variety of sources is subject to bias . The hospitalization costs for malaysia were drawn from who data on hospitalization costs per day and are not specific to mental health or schizophrenia . As a result, these estimates are subject to additional bias in our results . We also note that, due to cost estimates being derived from published sources, the study lacks more precise estimates on hospital utilization costs . We also note that the data on hospital utilization rates were derived from a phase iiib study using a mirror analysis approach rather than double - blind randomized control methodology . Also, not all data of patients on hospitalization rates within the 12-month retrospective period were available . As such, these patients were not included in the final data analysis . Additionally, in this study, we focused specifically on hospitalization costs . Future studies on determining hospitalization costs specific to schizophrenia are necessary to provide more precise estimates of the cost reduction associated with the use of pp . More advanced modeling techniques, such as budget impact and cost - effectiveness models, depend on such estimates and may not be accurate without these additional studies to inform the model inputs . In that context, we believe that the results of this study will be very useful for future research regarding pp relative to alternative medications for the treatment of schizophrenia in asia . Given the substantial costs associated with the treatment of schizophrenia both worldwide and in asia, it is important to fully understand costs and outcomes associated with various treatment options . In this study, we have specifically analyzed the direct health care cost savings associated with hospital utilization for patients taking pp relative to alternative treatment methods . The results suggest that per patient year cost reductions could be achieved, likely largely due to increased adherence to treatment.
Alzheimer's disease (ad) is a central nervous degenerative disease with memory impairment, aphasia, agnosia, and executive dysfunction, as well as personality and behavior changes . Pathological features of ad include amyloid (a) deposition and neurofibrillary tangles, leading to progressive neuronal damage, and ultimately atrophy of the cortex and subcortical structures . Magnetic resonance imaging (mri) however, relatively few studies are available assessing changes in other brain regions in ad patients, especially the frontal lobe . Interestingly, evaluating 41 patients with ad, harwood et al . Found that the insight and cognitive impairment as well as functional deficits in ad are associated with the glucose metabolic rate in the frontal cortex . We previously demonstrated that treatment with electroacupuncture could effectively improve the spatial learning and memory ability as well as glucose metabolism in the hippocampus of animals with ad . Other studies suggested that music therapy could contribute to a supplementary treatment of ad . In china, an innovative therapy combined electroacupuncture and music therapy, and the term musical electroacupuncture (mea) addition of musical therapy helps overcome acupuncture intolerability; therefore, the mea therapy in a way is superior to traditional electroacupuncture . In the current study, we aimed to address two questions: (1) what happens in the frontal lobe during mea? Do these changes differ from those observed in other brain regions? (2) are there differences between the two therapies for ad treatment? To this end, senescence - accelerated mouse prone 8 (samp8) mice were selected as an ad animal model, and the differences between techniques were assessed . First, morris' water maze test was used to evaluate behavioral changes in the model animals . Then, micro - pet assessment of a region of interest (roi) and glucose metabolism evaluation in different brain regions were performed . Finally, immunohistochemistry (ihc) was used to assess the changes of amyloid-1 - 42 deposition in the frontal lobe after the treatments . Senescence - accelerated mouse prone 8 (samp8) and cognate normal senescence - accelerated mouse - r1 (samr1) breeding pairs were kindly provided by professor takeda at kyoto university, japan . All animals were male and specific pathogen - free (spf), weighing 30 2 g. they were housed in a barrier facility at the experimental animal centre of first teaching hospital of beijing university of traditional chinese medicine, under controlled temperature (24 2c) and 12 h/12 h dark - light cycle, with sterile drinking water and standard pellet diet ad libitum . All experiments were performed according to the national institute of health guide for the care and use of laboratory animals (nih publications number 80 - 23). Thirty 7.5-month - old male samp8 mice were divided into three groups (n = 10 per group), including samp8 alzheimer's disease control (ad), electroacupuncture (ea), and musical electroacupuncture (mea) groups . Ten 7.5-month - old male samr1 mice composed the normal control (n) group . Electroacupuncture and musical electroacupuncture treatments were performed 20 minutes per day, once daily for 15 days (no treatment on day 8). Prescription of acupuncture points included du20 baihui, du 26 shuigou, and ex - hn3 yintang (significant extra points); the locations of these points were according to the national acupuncture society for experimental research developed by the laboratory animal acupuncture atlas . The pricking method was used for du 26 shuigou and the flat thorn method for du20 baihui and ex - hn3 yintang ., the needle handle was connected to the hans - lh202 electroacupuncture device (peking university institute of science nerve and beijing hua wei industrial development company), with sparse wave at 2 hz, 2 v, and 0.6 ma . In the mea group, the needle handle was connected to the zj-12h musical electroacupuncture device (developed by chinese acupuncture society and manufactured by harbin zhihou medical devices co., ltd . ). Clear rhythm, moderate speed, and music prescription intensity (curing dementia prescription) were selected; music intensity was adjusted so that the animals remained quiet during the treatment . In the n and ad groups, no treatment was carried out, with grabbing and fixing the mice in order to ensure the same treatment conditions, once daily for 15 days . Morris' water maze consisted of a circular tank (diameter, 90 cm; height, 50 cm), filled with water to a depth of 29 cm, maintained at 24 1c, and rendered opaque with blue - black ink . A removable circular platform (diameter, 9.5 cm; height, 28 cm) with the top surface 1 cm below the water was located inside the pool . The pool area was conceptually divided into four quadrants (ne, nw, sw, and se) of equal size . Data were collected by a video camera (tota-450d, japan), which was fixed to the ceiling and connected to a video recorder with an automated tracking system (china daheng group, beijing, china). In the behavioral test, mice were placed in the pool of water containing a platform just below the surface of the water . Distal visual cues are arrayed around the room, and, in general, mice are able to find the location of the hidden platform based on these cues . This test assesses the ability of mice to find the platform under conditions where they cannot directly see the latter but must either remember it based on external cues or perform a search . The platform was placed 1 cm under the water surface; the water was rendered opaque by a suspension of dark blue, nontoxic tempera paint . The platform was placed in a different location from that used in the visible platform testing . Each mouse was released from one of the 4 locations and had 60 s to search for the hidden platform . At the end of each trial, the mouse was placed on the platform or allowed to stay there for 15 s. prominent spatial cues were arrayed around the room . The investigator also constituted a powerful spatial cue and always sat in the same location during each trial after releasing the mouse . Six trials per day for 5 consecutive days were performed with the platform location kept constant . The time that the mouse took to find the platform was recorded and represented escape latency . The day after completion of the hidden platform test, the platform was removed; each mouse was placed in the pool once for 60 s, starting from the same starting location used first in the hidden platform test . The time spent in the platform quadrant was recorded, and the percentage of total time spent swimming to the platform quadrant was derived . The f - fdg pet tracer was provided by the chinese medicine research institute pet room; pet imaging was carried out on a siemens inveon pet / ct imaging system . Before the experiments, mice (7.5 months, 28~32 g) were submitted to blood glucose monitoring and showed levels in the normal range (7.0~10.1 mmol / l). The animals were placed in the suction chamber, inhaling oxygen mixed with 1.5% isoflurane for anesthesia . After complete anesthesia, approximately 14.8~16.5 mbqf - fdg pet were injected via the tail vein . After f - fdg pet tracer uptake for 60 min, the mice were placed in the prone position, parallel to the scanner long axis, with the head located within the scanner field of view . The mice were anesthetized by inhalation of oxygen mixed with 1.5% isoflurane (1 l / min). Filtered back projection (fbp) and ct photon attenuation correction were used for image reconstruction . Three - dimensional regions of interest were selected in the hippocampus, in transverse, coronal, and sagittal planes . After the morris water maze test, the remaining six mice in each group (four were used in micro - pet) were anesthetized by intraperitoneal injection of 10% chloral hydrate at 0.35 ml/100 g body weight . Three minutes later, the chest was opened and the heart exposed; intubation was performed from the left ventricle to the ascending aorta with quick injection of 100 ml saline . Then, the right atrial appendage was cut, and 4% paraformaldehyde was injected until the liver turned white with clear fluid flowing out from the right atrial appendage . After the perfusion, the mouse was decapitated and the whole brain extracted and placed on ice ., paraffin embedded brain tissue sections were deparaffinized with xylene and hydrated with graded alcohol . Then, the sections were treated with citric acid antigen repair buffer and washed with pbs (ph 7.4) every 5 min three times with shaking . After incubation with 3% hydrogen peroxide for 20 min in the dark to quench endogenous peroxidase, the sections were incubated with anti - a1 - 42 antibody (1: 50, ab10148, abcam) overnight . Then, secondary antibodies were added for 30 min at room temperature, and detection was performed with dab . Micrographs of brain tissue samples were obtained at 400x magnification, and integral optical density (iod) values were calculated using image - pro plus 6.0 software . Data are mean sd for each group . For the morris water maze test, the escape latency time of the hidden platform trial was analyzed by the huynh - feldt test, while one - way anova was conducted on probe trial, micro - pet test, and immunohistochemical data . All statistical analyses were performed with the spss software v.17.0 (spss, usa). The effects of electroacupuncture and musical electroacupuncture in spatial location ability of samp8 mice in the wmw test are shown in figure 1(a). With training time extension, the ad group showed a marked retardation in escape latency compared with the n group (p = 0.00), probably due to memory deficits resulting from the rapid aging process impairing learning and memory . Compared with the ad group, escape latency in the ea (p = 0.031) and mea (p = 0.023) groups was significantly reduced (p <0.05). As shown in figures 1(a) and 1(b), the mea group performed better than the ea group, although there was no statistically significant difference (p = 0.895). To assess therapeutic effects on spatial memory ability, performance on day 6 was examined by analyzing the percentages of swimming time in the expected platform position . A higher percentage of time spent in the platform quadrant is interpreted as a higher level of memory retention . In this trial, compared with the ad group, the ea (p = 0.045) and mea (p = 0.035) groups showed increased time spent in the platform quadrant (p <0.05). What is more, percentages of time spent in the platform quadrant were similar between the ea and mea groups (p = 0.907, figure 2). Besides the escape time, the average animal swimming speed is also associated with spatial learning and memory ability . In some cases, swimming speed in the normal control group was slower, with the escape time longer than in the alzheimer's disease group . Thus, escapes times cannot serve as the only indicator of learning ability and memory . The average swimming speed before getting on the platform is an important indicator of exercise ability and can reflect individual differences in experimental animals . Compared with the n group, the swimming speed in ad group was significantly reduced (p = 0.00), indicating lower exercise ability for samp8 mice compared with samr1 animals . Compared with the ad group, electroacupuncture and musical electroacupuncture both increased the swimming speed of samp8 mice (ea, p = 0.023; mea, p = 0.009). What is more, the mea group performed better than the ea group (figure 3). Micro - pet images were obtained from the hippocampus, frontal lobe, and cerebral cortex of each mouse . The same color standard and code were used from top to bottom to display the metabolic rate of glucose . After treatment with electroacupuncture and musical electroacupuncture, f - fdg levels in each brain region assessed were higher than values obtained for the nontherapy group (figures 4(a), 4(b), and 4(c)). To obtain acute differences in glucose metabolism among groups, the uptake rate of f after treatment with electroacupuncture and musical electroacupuncture, uptake rates of f - fdg per gram in the hippocampus (ea, p = 0.039; mea, p = 048), cerebral cortex (ea, p = 0.14; mea, p = 0.047), and frontal lobe (ea, p = 0.045; mea, p = 0.031) were higher than those obtained for the alzheimer's disease group (figures 5(a), 5(b), and 5(c)). In the frontal lobe, the uptake rate of f - fdg for the mea group was higher than that of the ea group, while, in the other two regions, the ea group showed higher values . After the behavioral tests and imaging, brain tissue samples were analyzed by immunohistochemistry to assess the effects of the two therapeutic variants on amyloid-1 - 42 accumulation due to neuronal damage and memory impairment . Compared with the n group, iod of amyloid-1 - 42 in the frontal lobe was significantly higher in the ad group (p = 0.00), ea (p = 0.00), and mea (p = 0.007) groups . Meanwhile, iod of amyloid-1 - 42 in frontal lobe samples from the ad group was significantly higher than those of the ea (p = 0.00) and mea (p = 0.00) groups . Interestingly, iod of amyloid-1 - 42 in frontal lobe samples from the mea group was significantly lower than that of the ea group (p = 0.01 <0.05) (figures 6 and 7). The senescence - accelerated mouse (sam) is an accelerated aging model that was established through phenotypic selection from a common genetic pool of the akr / j mouse strain . It was shown that senescence - accelerated mouse (samp8), as a model of aging, displays many features known to occur in the early stage of ad such as increased oxidative stress, amyloid - beta level alteration, and tau phosphorylation . What is more, published data and our previous research demonstrated that samp8 could undergo acupuncture therapy to improve learning and memory ability . In this study, therefore, samp8 mice were selected as an ideal animal model for alzheimer's disease . Music therapy is a nonpharmacological treatment for the behavioral and psychological symptoms of alzheimer's disease . Appropriate music formulation could provide a form of relief to the ad patient and may stimulate cognitive activities so that areas subject to progressive degeneration are maintained . In the recent ten years, increasing evidence suggests that proper music formulation could improve ad symptoms [1621], especially for mild cases . Besides, since music therapy is nonpharmacological, it is often used in combination with other therapies . Musical electro - acupuncture (mea) combines music therapy and electro - acupuncture; during symptomatic selection of music, the sound wave could be turned into a pulse current . Therefore, the effects of mea on the human auditory organ and acupoints were separately assessed . Specifically, the fundamental characteristics and advantages included two aspects: music therapy and irregular pulse current . Electroacupuncture (ea) is widely used in clinical practice and research and in experimental investigations into the mechanisms of acupuncture . This therapy has been applied for ad treatment and could improve the cognitive function and brain energy metabolism [5, 27]. The mechanism of ea tolerance is that the central nervous system releases analgesic substances (including brain norepinephrine and endogenous antiopioid substances) as well as large amounts of endogenous monoamine . Among them, cholecystokinin octapeptide (cck-8) is by far the most recognized antiopioid contributing to ea tolerance, which is caused by long - term use of the same frequency in ea . Since ad treatment requires a long - term course, it likely results in ea tolerance . It transformed musical rhythms into constantly changing frequencies and waveforms to overcome the shortcomings of human body's tolerance of general electroacupuncture . Meanwhile, patients were allowed to listen to relieving music, which plays a role of music therapy . It was shown that such therapy performs better than traditional electroacupuncture in relieving pains, improving the symptoms of dermatosis (urticarial disease, chloasma), alleviating nervous system diseases such as depression [3638], insomnia, and anxiety [40, 41]. However, there was seldom research on dementia . Studies assessing the pathogenesis of ad are currently more focused on the temporal lobe, parietal cortex, and hippocampus, with few analyzing changes in the frontal lobe . Recent studies found that transgenic mice with alzheimer's disease show early cognitive decline related to frontal atrophy, with the changes taking place even earlier than in the hippocampus . As shown above, although the mea therapy performed better than ea in the morris water maze test, differences were not statistically significant . In micro - pet, ea therapy showed higher glucose metabolism improvement in the hippocampus and cerebral cortex compared with mea . Only in the frontal lobe, these findings prompted the question whether mea therapy was more inclined to play a role in the frontal lobe . To address this, amyloid - beta levels were assessed in the frontal lobe of samp8 mice, and the results confirmed the above notion . Comparing the different therapies in iod of amyloid - beta in the frontal lobe, mea therapy performed significantly better than ea (p <0.05). Therefore, mea indeed is inclined to play a role in the frontal lobe . Using behavioral tests, in vivo imaging, and protein detection, the differences between mea and ea therapy for ad treatment were assessed in samp8 mice . Interestingly, both ea and mea could improve spatial learning and memory ability, improving glucose metabolism in different brain regions and amyloid - beta expression in the frontal lobe . What is more, the mea therapy performed better than ea in decreasing amyloid - beta amounts in the frontal lobe.
Reactive arthritis or fiessinger - leroy disease is a genetically determined disease characterized by the triad of urethritis or cervicitis, conjunctivitis, and arthritis, which closely follows lower urogenital or enteric infection . Mucocutaneous findings such as circinate balanitis (3040%), keratoderma blenorrhagicum (15%), oral ulcers (17%) and dystrophy of nails (2030%) are also associated with reactive arthritis . Our case presented with circinate balanitis as the only initial clinical finding, which otherwise is the most common finding associated with reactive arthritis, but is rarely seen as a preceding finding . A 22-year - old married male presented with asymptomatic superficial lesions present over the glans and under surface of prepuce since 1-year . He was treated elsewhere with oral antibiotics and topical antifungal preparations assuming it to be an infection, but without any relief . Patient also had mild lower back pain with morning stiffness and left knee joint pain since 6 months . Examination revealed multiple well - defined superficial erosions of size 0.52.5 cm, round to oval in shape with irregular margins, which coalesced at places to form circinate pattern over the glans and under surface of prepuce [figures 1 and 2]. From the above findings, circinate lesions present over glans before treatment lesions present on under surface of prepuce before treatment laboratory investigations showed mildly raised total leukocyte count 11,700/mm (normal 400011000). Viral markers such as hepatitis b surface antigen, antihepatitis c antibodies, human immune deficiency virus (hiv) antigen, and venereal disease research laboratory tests were nonreactive . C - reactive protein (crp) (7.31 mg / dl, normal <0.6 mg / dl) and human leukocyte antigen (hla) b-27 were positive . Radiologically magnetic resonance imaging lumbosacral spine and sacroiliac joints showed straightening of the lumbar spine and right sided sacroiliitis . Histopathology of lesions from the glans showed parakaratosis containing neutrophils forming intracorneal and superficial epidermal pustules resembling spongiform pustules . Various psoriasiform changes seen on histopathological examination based on the above clinical and histopathological findings, diagnosis of reactive arthritis was made . Patient was treated for circinate balanitis with pimecrolimus 1% cream twice daily for 3 weeks . Lesions cleared completely, and no recurrence was seen subsequently [figures 4 and 5]. Patient was referred to rheumatologist for management of arthritis . Post - treatment complete resolution of lesions from glans post - treatment complete resolution of lesions from under surface of prepuce reactive arthritis was first described by hans conrad julius reiter, a german physician during thefirst world war in 1916 . In the same year, fiessinger and leroy published similar finding as oculo - urethro - synovial syndrome . Although it is a disease of young males with hla - b27 associated with 80% of cases, other hla types that are linked with hla - b27 and other age groups are not excluded . Caucasians are the most commonly affected, probably because of higher prevalence of hla - b27 in this population group . It occurs in response to enteric infections such as salmonella, shigella, yersinia, campylobacter or urethral infection from chlamydia trachomatis . It has been proposed that damaged exogenous pathogen - associated molecular patterns, derived from microbes, can disseminate upwards via the pelvic and spinal lymphatic pathways and activate toll - like receptors (tlrs). Their activation triggers signaling pathways that result in the expression of immune response genes and cytokine production . However, recent human data suggest that tlr-2, not tlr-4, is important in determining reactive arthritis susceptibility after salmonella infection other rare factors, which can induce the disease are immunotherapy with bacillus calmette - gurin and interferon, or following hepatitis b vaccination . One of the various treatment modalities tried for mucosal lesions include use of topical steroids like hydrocortisone or triamcinolone . A combination of keratolytic agents likes 10% salicylic acid ointment with hydrocortisone 2.5% cream, and oral aspirin has also been reported to clear circinate balanitis . Topical 0.1% tacrolimus or pimecrolimus 1% cream has been used in refractory case with variable success [table 1]. Various studies showing topical calcineurin inhibitors as treatment modalities for balanitis the diagnosis in our patient rested on a constellation of signs and symptoms suggestive of reactive arthritis which included diarrhea, arthritis and circinate balanitis . However, the above mentioned clinical findings along with hla - b27 and crp positivity favored diagnosis of reactive arthritis . The interesting finding in our patient was the presence of circinate balanitis as the preceding feature, which has been rarely reported to the best of our knowledge . This case is being reported for its rarity in which circinate balanitis is the only presenting feature of reiter's disease, which was successfully treated with topical 1% pimecrolimus cream . However, further clinical trials and research is needed to study underlying mechanism of action of topical pimecrolimus in its management.
Cervical cancer is the third most common cancer among women in the world and has been associated with loss of cell cycle control that normally delays or even arrests proliferation [1, 2]. Cyclin - dependent kinase (cdk) inhibitors have the potential to induce cell cycle arrest and apoptosis in cancer cells . As one of them, alsterpaullone was found to selectively inhibit cdk enzymes, especially in cdk1 [3, 4]. It has been reported that alsterpaullone not only causes cell cycle arrest but also induces the apoptosis of some cancer cells by activation of caspase-9 through perturbation of mitochondrial membrane potential [57]. Cdk inhibitors have been shown to possess a cytotoxic effect on tumor cells via cell cycle related proteins and caspase 3 activity . However, this pharmacologic aspect has yet to be studied in relation to alsterpaullone . In this study, we explored the roles of those proteins in the pharmacologic function of alsterpaullone in hela cells . In addition, we elucidated the mechanism of cell cycle arrest and apoptosis of hela cells treated with alsterpaullone . Our data showed alsterpaullone can inhibit the proliferation of hela cells in the dose- and time - dependent manner . Importantly, it induced cell cycle arrest at g2/m phase and apoptosis via the regulation of anti - apoptotic proteins (caspase-3) and cell cycle proteins . This finding is significant, since it suggests that alsterpaullone provides a promising chemotherapeutic tool in anticervical cancer arsenal . Alsterpaullone was purchased from sigma - aldrich (cas: 237430 - 03 - 4). Hela cell lines were purchased from the institute of basic medical sciences, chinese academy of medical sciences . Dulbecco's modified eagle medium, fetal bovine serum, and trypsin were purchased from hyclone laboratories inc ., usa . Penicillin and streptomycin were purchased from sigma chemical company, usa . Protease inhibitor cocktail (1%, cat no: 539134) was purchased from merck, usa . All reagents were chemical grade unless otherwise specified . Hela cell line was maintained in rpmi-1640 media (gibco, invitrogen corporation, usa) containing 10% fetal bovine serum (hyclon, usa), 2 mmol / l l - glutamine (gibco, invitrogen corporation, usa), 100 u / ml penicillin (gibco, invitrogen corporation, usa), and 100 g / ml streptomycin (gibco, invitrogen corporation, usa). Cells were cultured in an incubator at 37c under 5% co2 in air . A stock solution of alsterpaullone in dmso hela cells (5 10/well) were grown in 24-well plates and treated with alsterpaullone (030 m) or dmso (0.3%, final concentration) to control wells in medium for 72 h. attached cells were released by a trypsinization and combined with nonadherent cells . Hela cells were seeded in 24-well culture plates at a density of 5 10/well . At 0, 2, 4, 60, 12, 24, 48 and 72 h 500 l of alsterpaullone (final concentration: 10 m and 20 m) cell number and cell viability were determined using haemocytometer and the trypan blue dye exclusion test . Hela cells (5 10/well) were seeded into 96-well plates and incubated overnight at 37c . Alsterpaullone was added to cells (in 6 replicates) and incubated for 72 h at 37c . Stock solution (2 mg / ml) of 3-[4, 5-dimethylthiazol-2-yl]-2,5-diphenyl - tetrazolium bromide (mtt) was prepared in cell media and sterilized via filtration . Media were removed from cells, and 50 l of mtt solution was then added into each well and incubated in the dark at 37c for 4 h. mtt solution was removed, and mtt dye of each well was dissolved in 50 l of dmso with agitation . The absorbance was measured at 562 nm to determine the ic50 (concentration of alsterpaullone which inhibits cell growth by 50%). Hela cells (5 10/well) were seeded in 96-well plates and incubated overnight, pretreated with 50 l of z - vad - fmk (final concentration was 25 m) for 2 h to block caspase activity, and treated with alsterpaullone for 72 h. hela cells (5 10/well) were seeded in 96-well plates and incubated overnight and pretreated with 50 l z - vad - fmk (final concentration was 25 m) for 2 h to block caspase activity, followed by alsterpaullone treatment for 72 h. cells were evaluated by mtt assay . Cells were treated with control (0.3% dmso) and 20 m alsterpaullone . Both detached and adherent cells were harvested at 0, 12 h, 24 h, 48 h, and 72 h and washed twice with ice - cold phosphate buffered saline (pbs) and then fixed in ice - cold 70% v / v ethanol for more than 2 h. cells were washed twice in pbs to remove fixative and stained with 1 ml pi (propidium iodide)/triton x-100 pbs solution with rnase a. after incubation at room temperature for 30 min, cells were filtered through 95 m pore size nylon mesh . The fractions of the cells in g0/g1, s, g2/m phases were analyzed using cell cycle analysis software, winmdi v2.8 (windows multiple document interface for flow cytometry) (the scrips research institute, la jalla, ca, usa). Hela cells were cultured with 20 m alsterpaullone for 0, 2, 4, 6, 12, and 24 h. after incubation, the nonadherent and adherent cells were harvested . The cells were lysed in ripa lysis buffer (150 mmol / l nacl, 1% np-40, 0.5% deoxycholate, 0.1% sds, 50 mm ph 7.5 tris - hcl, 1% protease inhibitor cocktail (cat no: 539134, merck)). The protein concentrations in the different samples were determined using the bca protein assay kit (pierce, rockford, usa). Lysates (50 g) were fractionated by sds - page using 8%15% polyacrylamide gels, based upon the expected molecular weight . The resolved proteins were blotted to a nitrocellulose membrane by semi - dry electric transfer, and the membranes were blocked for 1 h in tbst buffer containing 5% blotting - grade non - fat milk . Primary antibodies against caspase-3 (cat no: 552785), parp [poly(adp - ribose) polymerase] (cat no: 556494), and mcl-1 (cat no: 559027) were purchased from bd pharmingen (bd biosciences, san jose, ca, usa). Survivin (cat no: sc-17779), bcl-2 (cat no: sc-7382), p - rb (cat no: sc-12901), and p21 (cat no: sc-817) were purchased from santa cruz (santa cruz biotechnology, inc . Membranes were washed three times in tbst for 10 min each time and then incubated in tbst containing the appropriate horseradish peroxidase conjugated anti - mouse or anti - rabbit secondary antibodies (amersham life science, usa) for 1 h. the membranes were washed three times for 10 min each in tbst . The bound antibody complex was detected using an ecl chemiluminescence reagent and xar film (kodak, japan) according to the manufacturer's instructions (amersham life science, usa). Student's t - test was used for statistical analysis . A p value of <0.05 strongly statistically significant, and p <0.01 was considered very statistically significant . The growth of hela cells was inhibited in a dose - dependent manner after exposures to alsterpaullone for 48 h and 72 h ranging from 0 to 30 m (figure 1). The antiproliferation effect was evaluated by measuring the growth rates of hela cells seeded at 5 10/well in 24-well plates and treated with 10 m and 20 m alsterpaullone (figure 2). Alsterpaullone showed a significant inhibition on hela cell proliferation from 10 m (dose dependent) while from 2 h onwards (time dependent). The results indicate alsterpaullone is a cytotoxic agent in hela cells . To explore if the alsterpaullone - induced apoptotic levels are dependent on caspase activation, we cultured cells for 72 h with or without alsterpaullone (0 m, 5 m, 10 m, and 20 m) in the presence or absence of the general caspase inhibitor vi, z - vad - fmk . The apoptotic cells decreased after pretreatment with z - vad - fmk, suggesting that z - vad - fmk blocks the alsterpaullone - induced apoptosis . The results indicated that alsterpaullone induced apoptosis via caspase - dependent process (figure 3). We analyzed the cell cycle profiles of growing hela cells exposed to 20 m alsterpaullone using flow cytometry of propidium iodide stained nuclei . We found the cell cycle arrest occurred at g2/m and then apoptosis was induced . Figure 4 showed a marked increase in the cells with g2 contents at 12 h and then the occurrence of significant cell death . The cell cycle g2/m arrest persisted and was followed by a sub - g1 content increase at 48 h as indicated with cell death . The results indicated the mechanism of antiproliferative effects of alsterpaullone blocked cell cycle progression . To understand the role of alsterpaullone in cervical cancer apoptosis, we performed a time - course study on the apoptotic proteins in 20 m alsterpaullone treated hela cells . As indicated in figure 5, the cleavage of parp started at 4 h, while the activation of caspase-3 occurred at 2 h. parp, a prominent substrate for several caspases, was cleaved in time - dependent fashion indicating the occurrence of apoptosis in alsterpaullone treated cells . Furthermore inhibition of caspase activity by the caspase inhibitor z - vad - fmk suggests that alsterpaullone induces cell death depending on caspase activity . Bcl-2 family proteins play a central role in controlling the mitochondrial pathway, including proteins that suppress apoptosis process (bcl-2, mcl-1). In this study a dramatic decline was seen in expression of mcl-1 which was undetectable at 2 h onwards . The same trend was also observed in survivin but hardly detectable until 24 h. by contrast, the expression of anti - apoptotic protein bcl-2 was unchanged all the time . These results suggest that the apoptosis induced by alsterpaullone was associated with loss in anti - apoptotic proteins such as mcl-1 and survivin but not bcl-2 . In alsterpaullone - treated hela cells, alsterpaullone, as a cdk inhibitor, competes with atp for its binding site on cdks [7, 8]. Alsterpaullone treatment induced not only cell cycle arrest but also apoptosis in various cell lines [5, 9, 10]. In this study, we showed for the first time that the novel cdk inhibitor, alsterpaullone, inhibited hela cell proliferation in a dose- and time - dependent manner . Alsterpaullone induced apoptosis rapidly in hela cells by a mechanism that regulates various proteins including anti - apoptotic proteins and cell cycle related proteins . We found that alsterpaullone exhibited significant cytotoxicity towards hela cells, using flow cytometry and western blotting: hela cells were treated with alsterpaullone arrested in g2/m phase prior to apoptosis . This inhibition also led to a drop in s - phase population in hela cells and thus disturbed cells' dna replication [9, 10]. . Cell death initiated by chemotherapeutic agents usually involves the mitochondrial pathway and releases proapoptotic factors to activate effector caspases, which cause dna fragmentation and apoptosis [11, 12]. In this study, the results demonstrated the roles of apoptotic proteins in inhibition of alsterpaullone on hela cells . Mcl-1 is a short - lived protein because the pest sequences present with the bcl-2 family member, and it is an important anti - apoptotic protein [13, 14]. In the current study, we found that mcl-1 protein was rapidly down - regulated and even undetectable as early as 2 h in hela cells . In studies by lahusen et al ., alsterpaullone did not regulate the expression of iap, a member of xiap family, in jurkat cells and mcf10a cells [5, 15]. On the contrary, our results showed alsterpaullone continuously diminished the expression of survivin within 24 h, which is a member of the inhibitors of caspase (iap) family . Therefore, in order to determine whether p21 protein plays a role in inhibiting cell proliferation, it was measured in alsterpaullone treated hela cells using western blotting . The results showed that p21 protein was up - regulated during 224 h. considering the essential role of p21 in g0/g1 cell cycle arrest and cleaved caspase-3 for apoptosis induction, we explored the parp and caspase 3 proteins expression . The results showed the regulation of p21 was significantly earlier than that of caspase 3 and parp . As such, we speculated p21 was involved in cell cycle arrest, apoptosis, and growth inhibition via activation of caspase-3 . In summary, alsterpaullone can inhibit tumour cell proliferation in a dose - dependent and time - dependent manner and exhibit significant cytotoxicity in hela cells . It can induce rapid apoptosis and block cell cycle via regulation of various apoptotic proteins and activation of caspase . The significance behind this in vitro finding is that it suggests the possibility of using alsterpaullone as a new chemotherapeutic agent in the fight against cervical cancer.
The necessary ethics approval for this study was obtained from the royal children's hospital ethics committee . We collected nasopharyngeal aspirate (npa) specimens from january 2001 through december 2004 from patients with acute lower respiratory tract infection in queensland, australia . Patients were from 3 months to 93 years of age (mean 8.2 years, median 1.37 years), and 78.1% of specimens were from children <5 years of age . Nucleic acids were extracted from 0.2 ml of each npa specimen by using the high pure viral nucleic acid kit (roche diagnostics, mannheim, germany), according to the manufacturer's instructions . Extracts were analyzed for hmpv sequences by reverse transcriptase pcr (9). For samples collected during 2001 and 2002, other viral respiratory pathogens were detected by using a direct fluorescent antibody assay (dfa) in combination with a culture - augmented dfa method (10). For samples collected in 2003 and 2004, of 10,025 npa specimens tested, 707 were positive for hmpv, for an overall incidence of 7.1% during the 4 years . The youngest hmpv - positive patient was 4 months old, and the oldest was 79 years . In children (<18 years of age) the incidence of virus was 7.4%, and the seasonal distribution of hmpv infection showed a distinctive pattern for each of the 4 years studied (figure 1). In 2001, hmpv showed broad seasonal activity; incidence was> 5% in 3 consecutive seasons (autumn, winter, and spring) and peaked at 10.6% in the spring (september november). In 2002 and 2004, most hmpv activity was in spring, (incidence of 13.6% and 15.4%, respectively), with little evidence during autumn (march may). In 2003, the peak incidence of 9.0% occurred in winter (june august) and persisted into spring (5.4%). In all years, virus was present well into summer (december february), with an incidence ranging from 2.5% to 5.2% . On examination of those samples collected in 2003 and 2004, which were all previously analyzed for common respiratory viruses by pcr, hmpv was the most frequently detected respiratory virus in children during the spring of each year . Expressed as an annual average over the 4 years studied, the predominant viral pathogen was rsv (9.2%), followed by hmpv (7.1%), influenza a (3.5%), parainfluenza virus 3 (2.3%), and adenovirus (1.3%). In 6.8% of hmpv - positive cases, evidence of co - infection with another respiratory virus was seen; 20 patients were concurrently infected with an adenovirus, 10 with influenza a virus, 8 with rsv, 9 with parainfluenza virus 3, and 1 with parainfluenza virus 2 . Su, summer (december february); au, autumn (march may); w, winter (june august); sp, spring (september november). Amplification products generated directly from 640 hmpv - positive npa specimens were genotyped as previously described (11) (genbank accession nos . Data showed that all 4 viral subtypes cocirculated during each of the 4 years studied (table 1, figure 2). However, a different subtype predominated during 3 of the 4 years: hmpv subtype a1 was dominant in 2001, subtype a2 in 2002 and 2003, and subtype b1 in 2004 (table 1). Phylogenetic analysis of the 182-nucleotide fragment of the phosphoprotein gene fragment of human metapneumovirus detected in respiratory samples collected in australia . Sequences of avian pneumovirus (apv) type c (genbank accession nos . Af176590 and af176591) were used as outgroups to root the tree . Nucleotide sequences were aligned by using bioedit version 7.0.0 and were subjected to neighbor - joining analysis with mega version 3.0 with 500 random bootstraps . Can and nc, canada; jps, japan; nl001, the netherlands; q, queensland, australia . Clinical records from 273 patients who were positive for hmpv were scrutinized, and data describing clinical features and length of hospital stay were recorded . Of these patients, 203 (74.4%) were admitted to hospital with a median length of admission of 3 days and a mean of 6.5 days . The predominant clinical features were cough (63%), rhinorrhea (61%), respiratory crackles / crepitations (60%), and fever (57%) (table 2). Ninety (33.9%) of the 273 patients had a chest radiograph, and 77 (85.6%) patients showed bilateral parahilar peribronchial infiltrates consistent with a lower respiratory tract infection . Disease severity of the 273 hmpv - positive patients was classified as mild (46.8%), moderate (42.5%), and severe (10.7%), based on the use of supplemental oxygen and fluids and length of hospital stay . The results of recent, similar studies suggested that peak periods of infection with hmpv predominate during winter in the northern hemisphere . However, this finding has not been extensively examined over an extended period with a large, continuous sample . Our study found that the peak period of hmpv infection in queensland, australia, occurs predominantly in spring (august october) but that hmpv can be detected in every month . This finding suggests that hmpv activity, like rsv activity, occurs in the community throughout the year, and peaks of infection are a result of seasonal environmental factors . Although rsv predominated in all years, hmpv was the second most frequently detected virus in each year studied . The low rate of co - infection of hmpv with other respiratory viruses (including rsv) suggests that co - infection may not be common in our community . When analyzing disease severity in this sample with a 2-sided test of proportions, we saw no significant difference between patients with a co - infection and those without . Therefore, our data did not support the suggestion by others that co - infection of hmpv with rsv or other viral respiratory pathogens is a risk factor for severe disease (6). The shift in predominant hmpv genotype observed in this study was similar to those reported for rsv and influenza viruses (6) and can be attributed to changes in immunity of the population in response to antigenic differences between the predominant circulating strains (12,13). However, a relationship between genotype and disease severity, as previously established for rsv (14,15), did not appear to apply for hmpv, but we plan to examine this relationship further . The clinical features associated with hmpv infection in this study were not sufficiently distinctive to clinically differentiate it from other respiratory viral infections in children, particularly those attributed to rsv . In addition, few patients (10.6%) had severe disease, but most (76%) were sufficiently ill to be admitted and treated in the hospital for> 3 days, which represents a substantial amount in healthcare costs . Finally, this comprehensive study, conducted for 48 months, is the first one aimed at establishing an accurate estimate of the incidence and seasonal distribution of hmpv infection and to determine the genetic variation of hmpv circulating in our population . The clinical spectrum of infection in a substantial proportion of hmpv - positive patients has been described, and studies are continuing to fully elucidate the clinical effect of infection with this virus in our community.
Testosterone is essential for the normal growth and development of the prostate gland and is also a possible risk factor for prostate cancer . Huggins and hodges's seminal work in the 1940s first demonstrated the hormone dependence of prostate cancer, consequently establishing testosterone as a key therapeutic target for managing prostate cancer . Androgen deprivation therapy to lower the serum testosterone level remains a standard treatment for advanced disease to the present day . Isbarn et al's recent studies, however, show a result opposite that of huggins and hodges, implying that testosterone neither increases the risk of prostate cancer nor causes cancer recurrence in men who have been treated successfully for prostate cancer . A recent study by morote et al showed that prostate cancer risk and tumor aggressiveness are unrelated to serum testosterone . Other recent epidemiologic studies also have found no association between testosterone and prostate cancer [6 - 10]. Our main objective was to analyze the relationship between serum testosterone, prostate - specific antigen (psa), and prostate cancer risk in high - risk patients . The study population consisted of 120 men with a psa level of 10 ng / ml or higher . The data were collected from january 2008 to january 2010 . To determine the relationship between testosterone, psa, and prostate cancer risk in a high - risk group, we limited our study population to men with a psa level of 10 ng / ml or higher . We excluded from this analysis men who were taking medications known to lower psa, such as finasteride or dutasteride . Twelve cores were obtained and two extra biopsies were taken if hypoechoic or otherwise suspicious areas were noted on ultrasound . Serum testosterone levels were measured by using a solid - phase competitive chemiluminescent enzyme immunoassay with the advia centaur immunoassay system (bayer health care, chicago, il, usa). We classified the men as hypogonadal if their serum testosterone level was <300 ng / dl, according to the criteria used by rhoden et al . For possible correlation between serum testosterone, psa, and prostate cancer, we included age, psa density (psad), prostate volume, and gleason score for patients with prostate cancer . Statistical analysis was performed by using the student's t - test, the pearson correlation test, simple linear regression, and binary logistic regression . Odds ratios with 95% confidence intervals (cis) for psa, psad, serum testosterone, and age were determined to predict prostate cancer risk . All data are presented as the mean2 sd to define and characterize quantitative variables and as percentages to characterize qualitative variables; we considered a p - value<0.05 to be statistically significant . Out of 120 patients, the samples of 85 (70.1%) patients were diagnosed as benign and those of 35 (29.2%) patients were diagnosed as being prostate cancer . There was no significant difference in the patient's average age, psa, prostate volume, or testosterone between patients without and those with prostate cancer . Only psad differed significantly between the two groups (t - test, p=0.012) (table 1). Hypogonadal and eugonadal men did not differ significantly in cancer detection rate (30.2% vs. 32.0%, respectively). The testosterone level did not differ significantly between patients without and those with prostate cancer in either hypogonadal (248.1650.41 ng / dl vs. 251.3543.61 ng / dl, respectively) or eugonadal (501.52137.06 ng / dl vs. 506.22126.40 ng / dl, respectively) men (t - test, p>0.05). Testosterone was unrelated to age, psa, psad, or prostate volume in both men without and those with prostate cancer, and prostate cancer aggressiveness also was unrelated to serum testosterone in prostate cancer patients (p>0.05) (table 2). The binary logistic regression also confirmed that none of the variables used in this study was an independent predictor of prostate cancer risk for men with a psa level> 10 ng / ml (p>0.05) (table 3). Further evaluation with simple linear regression confirmed that testosterone and psa did not show any correlation (p>0.05) (fig . When we divided the patients into 11 groups according to their testosterone level, within a 150 ng / dl range, prostate cancer prevalence did not change as the testosterone level increased (p>0.05) (table 4). In men, the leydig cells in the testes produce approximately 90% of testosterone; the adrenal glands produce the rest . Testosterone plays a key role in the development of male reproductive tissues such as the testes and prostate gland . Under testosterone influence, the prostate gland experiences two main growth periods . The first occurs early in puberty, when the prostate doubles in size . At around age 25, when the prostate is growing, testosterone is converted into dihydrotestosterone (dht), which is the androgen receptor's major activator . After dth binds to androgen receptors, it translocates to the nucleus, where it mediates the transcriptional activation of target genes . These androgen - stimulated changes in gene expression promote cellular growth, which often results in benign prostatic hyperplasia in elderly men . Long - term cessation of the prostate's exposure to androgen appears to protect against the development of cancer, but no dose - response relationship between testosterone level and cancer risk has been established . The prostate cancer risk for men with a testosterone concentration in the normal range remains unclear . Recent chemopreventive trials with 5-alpha - reductase inhibitors show the role of testosterone in prostate cancer development . Finasteride reduced the risk of prostate cancer by 24.8% compared with a placebo in healthy men . Recently, the reduce study showed that dutasteride also reduced the risk of prostate cancer by 23% compared with a placebo in healthy men . Huggins and hodges first showed the effect of testosterone on prostate cancer patients in 1941 . They showed the hormonal responsiveness of prostate cancer by reporting that markedly reducing the testosterone level by castration and estrogen treatment caused metastatic prostate cancer to regress, and injecting testosterone caused prostate cancer to grow . In 1995 wu et al found that the distribution of dihydrotestosterone - to - testosterone ratios parallels both the incidence of and mortality from prostate cancer . The demonstration that androgen suppression effectively treats advanced prostate cancer, and the fact that elevated serum androgen levels might predispose people to prostate cancer, have attracted persistent interest . However, a recent study refuted any connection between elevated testosterone levels and increased prostate cancer risk . Endogenous hormones and prostate cancer collaborative group et al meta - analyzed the serum concentrations of sex hormones from subjects in 18 prospective studies that included 3,886 men with incident prostate cancer and 6,438 control subjects . They concluded that endogenous hormones, including testosterone, were not associated with prostate cancer . Morote et al recently conducted another study of 478 patients, all of whom were assessed by trus - guided prostate biopsy because of an abnormal digital rectal examination, psa> 4 ng / ml, or both . They found no difference in serum testosterone level between patients with and those without prostate cancer and concluded that the serum testosterone level was not associated with prostate cancer risk or aggressiveness . An animal study by morgentaler and traish showed that beyond a certain serum testosterone concentration, androgens have a limited ability to stimulate prostate cancer growth . Subsequent increases in serum testosterone levels beyond that concentration did not stimulate the prostate because the binding capacity of the intra - prostatic androgen receptors had been saturated . Our results are similar to those of the above studies even though we limited our study population to patients with psa> 10 ng / ml . We found that the serum testosterone level at the time of diagnosis was unrelated to psa and prostate cancer risk and aggressiveness in both hypogonadal and eugonadal patients . Ideas about the interaction between testosterone and prostate cancer have changed considerably over the past decade . Like our study, most recent epidemiologic studies have found no association between testosterone and prostate cancer [6 - 10]. A few studies published during the past decade contrast with our results, however, and show that low testosterone levels seem to be related to an increased risk of prostate cancer and tumor aggressiveness, such as a high gleason score [23 - 28]. In our study, we compared age, psa, prostate volume, and psad with testosterone . Only a known prostate cancer predictor, psad, showed a significant difference between patients with and those without prostate cancer, even in high - risk patients with a psa level of 10 ng / ml or higher . Patients without prostate cancer had relatively lower psa and larger prostates than did patients with prostate cancer . However, our binary logistic regression showed that psad was unsuitable as an independent predictor of prostate cancer risk in men with a psa level of 10 ng / ml or higher . We measured the serum testosterone level in the patients only once, before their biopsy was done . Second, we checked only their total testosterone level and were unable to check their free testosterone level ., the present study found that the serum testosterone level at the time of diagnosis was unrelated to psa and prostate cancer risk and aggressiveness . Because testosterone levels change with age and time, a prospective study with long - term testosterone monitoring is required to find a relationship between testosterone and prostate cancer . Our results show that the serum testosterone level at the time of diagnosis was unrelated to psa and prostate cancer risk and aggressiveness . Additional studies with long - term follow - up are needed to explain the possible mechanism and relationship between testosterone, prostate cancer, and psa.
Formalin - fixed, paraffin - embedded archival tissue samples from 100 patients who underwent complete surgical resection (simpson grade i) of meningiomas between august 2003 and december 2012 were collected from the databases of the department of pathology, seoul national university bundang hospital in korea . Two pathologists (g.c . And s.y .) Independently reviewed the hematoxylin and eosin stained slides, confirmed the diagnosis according to the 2007 who classification system, and classified the histological subtypes and grading of the meningiomas . All the patients received regular follow - up after surgery, without postoperative chemoradiation therapy . The recurrence - free survival (rfs) evidence of tumor recurrence was provided by a computed tomography scan or a magnetic resonance image showing a meningioma in a location contiguous with the previous operation site . The 100 patients consisted of 23 males (23%) and 77 females (77%), with median age of 60 years (range, 36 to 85 years). Of these, bone / soft tissue invasion was observed in 12 cases, brain invasion was observed in five cases, and both bone / soft tissue invasion and brain invasion were observed in one case . We defined soft tissue invasion as invasion of the meningioma to the scalp or paranasal sinus . According to the 2007 who classification, histologically, the 100 cases consisted of meningothelial types (n=32), transitional types (n=32), fibrous types (n=16), angiomatous types (n=13), psammomatous types (n=2), microcystic types (n=4), and one metaplastic type (n=1) (table 1). We chose one representative tumor block in each case, and harvested cores with diameters of 3 mm from the most representative tumor areas of the donor blocks . The cores were precisely arranged into new recipient tissue microarray (tma) blocks using a trephine apparatus according to previously described protocols . Briefly, sections of 4 m were transferred to poly - l - lysine coated adhesive slides and dried, deparaffinized, and rehydrated . The following antibodies were used according to manufacturer instruction: c - met (pre - dilution, rabbit monoclonal antibody, ventana medical systems, inc ., tucson, az, usa) and hgf (1:100, rabbit polyclonal antibody, santa cruz biotechnology, santa cruz, ca, usa). The sections were incubated with appropriate reagents from the dako real envision detection system (dako, glostrup, denmark), and were counterstained with mayer s hematoxylin . Evaluation of c - met and hgf expression was assessed according to previous reports . As a positive control for c - met and hgf, tubular cells of a normal was categorized as positive when it showed moderate - to - strong cytoplasmic and/or membranous positivity in tumor cells . Accordingly, we scored expression as c - met and hgf (> 25% positive cells) and c - met and hgf (0%25% tumor cells) (fig . The study was conducted according to the ethics standards of the world medical association s declaration of helsinki . All statistical analyses were conducted using the spss ver . 21.0 (ibm co., armonk, ny, usa). Associations between the protein expressions of each antibody and the categorical variables were assessed using chi - square tests or fisher exact tests, if appropriate . Kaplan - meier survival curves for rfs were plotted for each antibody, and the survival comparison was determined using log rank tests . Formalin - fixed, paraffin - embedded archival tissue samples from 100 patients who underwent complete surgical resection (simpson grade i) of meningiomas between august 2003 and december 2012 were collected from the databases of the department of pathology, seoul national university bundang hospital in korea . Two pathologists (g.c . And s.y .) Independently reviewed the hematoxylin and eosin stained slides, confirmed the diagnosis according to the 2007 who classification system, and classified the histological subtypes and grading of the meningiomas . All the patients received regular follow - up after surgery, without postoperative chemoradiation therapy . The recurrence - free survival (rfs) evidence of tumor recurrence was provided by a computed tomography scan or a magnetic resonance image showing a meningioma in a location contiguous with the previous operation site . The 100 patients consisted of 23 males (23%) and 77 females (77%), with median age of 60 years (range, 36 to 85 years). Of these, bone / soft tissue invasion was observed in 12 cases, brain invasion was observed in five cases, and both bone / soft tissue invasion and brain invasion were observed in one case . We defined soft tissue invasion as invasion of the meningioma to the scalp or paranasal sinus . According to the 2007 who classification, all were cases of benign meningiomas (grade i). Histologically, the 100 cases consisted of meningothelial types (n=32), transitional types (n=32), fibrous types (n=16), angiomatous types (n=13), psammomatous types (n=2), microcystic types (n=4), and one metaplastic type (n=1) (table 1). We chose one representative tumor block in each case, and harvested cores with diameters of 3 mm from the most representative tumor areas of the donor blocks . The cores were precisely arranged into new recipient tissue microarray (tma) blocks using a trephine apparatus according to previously described protocols . Briefly, sections of 4 m were transferred to poly - l - lysine coated adhesive slides and dried, deparaffinized, and rehydrated . The following antibodies were used according to manufacturer instruction: c - met (pre - dilution, rabbit monoclonal antibody, ventana medical systems, inc ., tucson, az, usa) and hgf (1:100, rabbit polyclonal antibody, santa cruz biotechnology, santa cruz, ca, usa). The sections were incubated with appropriate reagents from the dako real envision detection system (dako, glostrup, denmark), and were counterstained with mayer s hematoxylin . Evaluation of c - met and hgf expression was assessed according to previous reports . As a positive control for c - met and hgf, tubular cells of a normal kidney and normal colonic mucosa was categorized as positive when it showed moderate - to - strong cytoplasmic and/or membranous positivity in tumor cells . Accordingly, we scored expression as c - met and hgf (> 25% positive cells) and c - met and hgf (0%25% tumor cells) (fig . The study was conducted according to the ethics standards of the world medical association s declaration of helsinki . All statistical analyses were conducted using the spss ver . 21.0 (ibm co., armonk, ny, usa). Associations between the protein expressions of each antibody and the categorical variables were assessed using chi - square tests or fisher exact tests, if appropriate . Kaplan - meier survival curves for rfs were plotted for each antibody, and the survival comparison was determined using log rank tests . Among the 100 cases of meningiomas, brain invasion was observed in five cases (5%). The median age of cases with brain invasion was 73 years (range, 47 to 77 years). Additionally, 13% (3/23) of male patients presented with brain invasion, and 2.6% (2/77) of female patients presented with brain invasion . Therefore, brain invasion was found to be more common in male patients . Even in male patients, however, statistical significance was not reached (p=.078). Bone and/or soft tissue invasion was observed in 12 cases of meningiomas, consisting of two males (8.7%, 2/23) and 10 females (13%, 10/77). Therefore, there was no significant association between bone / soft tissue invasion and sex (p=.728). The median age of patients with bone / soft tissue invasion was 58 years (range, 42 to 75 years) (table 2). Of the cases, c - met and hgf were found in 17% (17/100) and 13% (13/100) of meningiomas, respectively, and c - met / hgf co - expressions were observed in 1% (1/100) of meningiomas . C - met and hgf showed no significant correlation with the histologic subtypes of meningiomas (table 3). Brain invasion was observed in 3/17 (17.6%) of c - met meningiomas and in 2/83 (2.4%) of c - met meningiomas . Therefore, there was a statistically significant correlation between c - met and brain invasion (p=.033). Neither hgf nor c - met / hgf co - expression showed statistical associations with brain invasion (p=.375 and p=.562, respectively) (table 4). Of the cases, bone / soft tissue invasion was observed in 4/17 (23.5%) of c - met meningiomas and in 8/83 (9.6%) of c - met meningiomas . There was a tendency for c - met meningiomas to show bone / soft tissue invasion more frequently than c - met meningiomas; however, statistical significance was not reached (p=.119). Additionally, bone / soft tissue invasion was found in 15.4% (2/13) of hgf meningioma and 33.3% (2/6) of c - met / hgf meningioma . As a result, hgf and c - met / hgf co - expressions did not show a significant association with bone / soft tissue invasion (p=.653 and p=.151, respectively). To identify whether the complete removal of meningiomas from patients differently impacts rfs periods depending on the status of c - met and hgf expressions, we performed a univariate analysis of 100 cases of simpson grade i meningiomas . In the current study, the median follow - up period was 26.7 months (range, 1.1 to 106.2 months). C - met, two cases (11.8%) ex - perienced recurrence, whereas two of 83 cases (2.4%) with c - met suffered recurrence . Cases with c - met showed shorter rfs periods (meanstandard deviation [sd], 93.58.2 months) than those of c - met (meansd, 96.11.9 months); however, statistical significance was not reached (p=.139). Hgf and c - met / hgf were not correlated with rfs according to our results (fig . Among the 100 cases of meningiomas, brain invasion was observed in five cases (5%). The median age of cases with brain invasion was 73 years (range, 47 to 77 years). Additionally, 13% (3/23) of male patients presented with brain invasion, and 2.6% (2/77) of female patients presented with brain invasion . Therefore, brain invasion was found to be more common in male patients . Even in male patients, however, statistical significance was not reached (p=.078). Bone and/or soft tissue invasion was observed in 12 cases of meningiomas, consisting of two males (8.7%, 2/23) and 10 females (13%, 10/77). Therefore, there was no significant association between bone / soft tissue invasion and sex (p=.728). The median age of patients with bone / soft tissue invasion was 58 years (range, 42 to 75 years) (table 2). Of the cases, c - met and hgf were found in 17% (17/100) and 13% (13/100) of meningiomas, respectively, and c - met / hgf co - expressions were observed in 1% (1/100) of meningiomas . C - met and hgf showed no significant correlation with the histologic subtypes of meningiomas (table 3). Brain invasion was observed in 3/17 (17.6%) of c - met meningiomas and in 2/83 (2.4%) of c - met meningiomas . Therefore, there was a statistically significant correlation between c - met and brain invasion (p=.033). Neither hgf nor c - met / hgf co - expression showed statistical associations with brain invasion (p=.375 and p=.562, respectively) (table 4). Of the cases, bone / soft tissue invasion was observed in 4/17 (23.5%) of c - met meningiomas and in 8/83 (9.6%) of c - met meningiomas . There was a tendency for c - met meningiomas to show bone / soft tissue invasion more frequently than c - met meningiomas; however, statistical significance was not reached (p=.119). Additionally, bone / soft tissue invasion was found in 15.4% (2/13) of hgf meningioma and 33.3% (2/6) of c - met / hgf meningioma . As a result, hgf and c - met / hgf co - expressions did not show a significant association with bone / soft tissue invasion (p=.653 and p=.151, respectively). To identify whether the complete removal of meningiomas from patients differently impacts rfs periods depending on the status of c - met and hgf expressions, we performed a univariate analysis of 100 cases of simpson grade i meningiomas . In the current study, the median follow - up period was 26.7 months (range, 1.1 to 106.2 months). C - met, two cases (11.8%) ex - perienced recurrence, whereas two of 83 cases (2.4%) with c - met suffered recurrence . Cases with c - met showed shorter rfs periods (meanstandard deviation [sd], 93.58.2 months) than those of c - met (meansd, 96.11.9 months); however, statistical significance was not reached (p=.139). Hgf and c - met / hgf were not correlated with rfs according to our results (fig . We set out to determinate whether the expression of c - met and hgf is associated with the invasiveness of meningiomas and their clinical implications . In the present study, c - met correlated with brain invasion and bone / soft tissue invasion . To the best of our knowledge, the protein known as c - met is a receptor tyrosine kinase (rtk), and is a well - known proto - oncogene that is expressed in many organs, including the liver, pancreas, and prostate . In development and wound tissue, c - met hgf is the known ligand of the c - met rtk [13 - 15]. Previous studies demonstrate that the c - met / hgf signaling pathway, as well as c - met overexpression, has a strong relationship with tumor cell proliferation, motility, invasion, tumor angiogenesis, and poor prognosis . A therapeutic agent targeting c - met and hgf is currently receiving attention . Meningiomas, as previously described, show high recurrence rates, even after curative resection of the tumors . The recurrence rate depends on several prognostic factors, including the invasiveness of the tumor . Because invasive meningiomas show poor prognosis, the identification of their mechanism may be useful in the management of meningiomas . Several studies identify an association of c - met / hgf expression and clinical significance, and most of these studies imply an association between c - met / hgf expression and tumor recurrence in meningioma . In martinez - rumayor et al.s study, immunohistochemical co - expression of c - met / hgf kim et al . Also shows that the expression of hgf and the co - expression of c - met / hgf are associated with the histologic grade of and recurrence of meningiomas by rtpcr . In contrast, studies by karja et al . And lamszus et al . Use enzyme - linked immunosorbent assay and immunohistochemistry to argue that hgf is not related to tumor recurrence in meningioma few studies demonstrate an association of c - met / hgf with brain and bone invasion of meningiomas . The present study provides data on the expression of c - met and hgf in a large scale studies of meningiomas, as well as on the relationships of the meningiomas with brain and bone / soft tissue invasion in patients . In addition, the study shows that c - met is significantly associated with meningioma brain invasion, and that there is a tendency for increased c - met in meningiomas with bone / soft tissue invasion . Recent studies reveal that the c - met signaling cascade facilitates the invasion of cancer . The downstream cascade signaling of activated c - met, by either autocrine or paracrine interaction, leads to the dissociation of tumor cells from the surrounding stromal tissue, resulting in tumor cell invasion . Our study supports these findings that c - met is closely related to tumor invasion . One limitation of this study is that only a few cases of rare specific histologic subtypes are included in the data . Nevertheless, the results suggest that c - met may participate in tumor invasion . We also evaluate a possible association between the c - met and hgf expression and disease recurrence . In this study, the recurrence rate of meningiomas with complete tumor resection is 5%, a finding which is slightly lower than findings in previous reports . Also, we demonstrate that c - met only shows a tendency for association with shorter rfs periods . In general, the recurrence of meningiomas occurred within two years of surgical treatment, and up to 94% of patients with meningiomas experienced recurrence within five years . However, the vast majority of meningiomas are slow - growing tumors, and benign meningiomas that have been completely removed from patients recur at a rate of 19% after 20 years of follow - up . Thus our findings about recurrence rates are limited due to an insufficient follow - up period (median follow - up time in this study, 26.7 months). Several studies report an intratumoral heterogeneity of c - met and hgf expression, revealing an increase in these factors at cancer - invading fronts in breast carcinoma and cholangiocarcinoma . Accordingly, further studies are needed to elucidate intratumoral heterogeneity in meningiomas, and the association between c - met overexpression and rfs . In summary, our results demonstrate that c - met is associated with the brain invasion of meningiomas, and that c - met expression may be useful predictive markers for meningioma recurrence . Many previous studies reveal that c - met signaling is involved in the progression and spread of several cancers [16 - 19,25,28]. The collective understanding of c - met s role in cancers has evoked considerable interest in c - met and hgf as major targets in the development of cancer drugs . This has led to the development of a variety of c - met pathway antagonists with potential clinical applications . We conclude that c - met expression may be a useful predictive marker for meningioma recurrence, and that invasive meningiomas with high expression of c - met may be good candidates for targeted therapy using selective c - met inhibitors.
During the last years, the self - assembly of ordered structures at the nanoscale has been recognized as a key issue in nanotechnology,(1) opening novel perspectives for device applications . Moreover, supermolecular assemblies are ideal building blocks to design new types of devices,(2) combining nanostructures with high microscopic and macroscopic order. (3) however, the development of structures that are confined in at least one or two dimensions is still a challenge(4) giving rise to exhaustive research, particularly in the field of highly ordered organic nanostructures . It has been demonstrated that the epitaxial growth of phenylenes on muscovite mica, a representative of sheet silicates, results in a self - assembled formation of parallel aligned nanofibers, providing highly polarized emission(8) in the blue spectral range (see figure 1). Based on these optical properties, several applications have been demonstrated, e.g., waveguides, frequency doublers,(13) and lasers . Thereby, the ability to form parallel needles represents a prerequisite to optimize the achievable length of organic nanofibers . In this sense, phenylenes together with muscovite mica represent an outstanding material combination . Unfortunately, until now parallel molecular alignment on muscovite mica and thus macroscopicially polarized emission has only been demonstrated for a small group of molecules, namely, phenylenes and functionalized quater - phenylenes . Consequently, effective color tuning of these nanofibers is limited to the blue spectral range as indicated in figure 1 . Several attempts to tune the fluorescence into the green and red by depositing different molecular species resulted in a lower anisotropy of the formed organic nanofibers . In particular, it has been observed that green emitting fibers consisting of thiophene / phenylene co - oligomers grow into several directions or form rhombical structures. (20) a similar situation has been reported for orange - red emitting nanofibers built up by thiophene oligomers, where their tendency to form x - shaped assemblies finally disturbs parallel polarized emission(21) and hampers the formation of long fibers . (a) observed needle orientations on muscovite mica with respect to the fluorescence emission wavelength . (b) fluorescence images of para - hexaphenyl (left) and sexithiophene (right) nanofibers grown on muscovite mica . To achieve parallel needle growth for a variety of molecules covering the full spectral range, currently, the epitaxial relation between muscovite mica as the substrate and organic nanoneedles made from rodlike molecules has been explained by an interplay between surface electric fields and moleculesubstrate interactions . It is assumed that the presence of surface dipole moments causes a field - induced dipole interaction between organic molecules and muscovite and thus significantly influence the molecular alignment during the initial phase of the growth process. (22) in this article, we present a novel model to explain the epitaxial growth of rodlike conjugated organic molecules on sheet silicate surfaces . Our approach is able to explain all experimental results without the dominant role of a surface - dipole field during molecular adsorption . As indicated in figure 1a, the epitaxial growth of phenylenes and thiophenes on muscovite mica typifies the two characteristic growth morphologies . We have chosen para - hexaphenyl (p6p) and sexithiophene (6 t) as prototypical examples to substantiate our growth model . To further support the crucial role of surface morphology, we have selected two different substrates, muscovite and phlogopite mica . By a combined theoretical and experimental approach, comprising x - ray diffraction (xrd) measurements, atomic - force microscopy (afm), fluorescence microscopy, and force - field simulations, we demonstrate that the presented model is able to explain our and also previously obtained experimental results . It therefore represents a powerful tool to understand or even predict the growth morphology of fluorescent nanofibers, being the key to selecting proper rodlike molecules for the formation of parallel aligned waveguides and laser structures . All organic source materials used for growth experiments, namely, p6p from tci and 6 t from sigma - aldrich, have been purified by manifold thermal sublimation before being filled in a quarz tube of the hot wall epitaxy (hwe) reactor . Immediately after cleaving, the mica and phlogopite substrates from segliwa gmbh were transferred via a load lock to a hwe evaporation chamber working at a vacuum of 9 10 mbar. (23) in order to reduce any adsorbed species on the surface before evaporation of the organic molecules, a 30 min in situ preheating at the substrate deposition temperature was performed . In the case of p6p deposition, the growth time was 40 min, whereas for 6 t deposition the growth time was fixed to 90 min, keeping a substrate temperature of 90 c . During the p6p deposition, the source and wall ovens were kept at 240 and 260 c, whereas in the case of 6 t, the source material has been evaporated at 190 c and the wall was heated to 220 c . Specular x - ray diffraction was measured in the focusing braggbrentano geometry, while the x - ray diffraction pole figure measurements were performed in schultz reflective geometry. (24) both experimental techniques were performed with a philips xpert x - ray diffractometer using crk radiation and a graphite monochromator on the secondary side . Based on the observed bragg peaks of the specular scan as well as on the direction of the poles (net plane normals) within the pole figures, the involved crystallographic phases of the single crystalline muscovite / phlogopite mica substrate as well as of the p6p/6 t layer could be identified . In order to increase readability, crystallographic planes and directions of a particular substrate are denoted by subscripts (m = muscovite, p = phlogopite / pyrophyllite, t = talc). Optical microscope images have been acquired by a commercially available nikon labophot 2a microscope in combination with a nikon type 115 digital camera . Atomic - force microscopy (afm) studies of the deposited organic films were performed using a digital instruments dimension 3100 in the tapping mode . The afm characterization was performed on an area of 30 30 m with a sic tip . Epifluorescence images were acquired upon sample illumination by a hg lamp spectrally narrowed in the 330360 nm band . The vdw interaction between the organic molecule and the dielectric substrate is modeled by lennard - jones type potentials . Corresponding parameters are taken from the universal force field(25) implemented in the gulp code. (26) the molecules and substrates are assumed to be rigid where the internal structure of isolated p6p and 6 t molecules is determined by density - functional theory using the quantum - espresso code. (27) as we observed that p6p and 6 t molecules prefer to lie flat on the surface at a distance of 3.0, the energy minimization procedure is simplified in the following way . We consider only three molecular degrees of freedom: the x- and y - positions of the molecular center of mass and the angle . We perform a grid - based optimization to search for the best molecular adsorption geometry using a grid of 100 100 points for the lateral position and a step size of = 5 for the angle . This way we obtain energies with a precision of about 5 mev per molecule . To avoid finite - size effects, we employ a 11 7 supercell (based on the original substrate surface unit cell) resulting in a separation of 70 in the lateral direction . Periodical images along the surface normal are separated by 100 . Due to the rather weak interactions between sheets in the stacking direction, the changes due to surface relaxation in both pyrophyllite and talc are known to be modest, and their surfaces preserve the structural features of bulk crystals. (28) hence, the surface structure is taken to be the same as in the bulk where the corrugation is about 0.2 . While the main focus is laid on the understanding of the needle growth on muscovite mica, we also include phlogopite mica to expand our model and to prove the drastic influence of surface morphology . Whereas muscovite mica belongs to the class of dioctahedral phyllosilicates, phlogopite is a representative of the trioctahedral group. (29) muscovite and phlogopite mica surfaces significantly differ concerning their geometric properties . As indicated in figure 2a, a vacancy (white hexagon) within the octahedral layer (gray polygons) of muscovite mica causes a distortion within the tetrahedral layer (black triangles), representing the decisive interface for the epitaxial growth . Importantly, the described process leads to formation of parallel surface corrugations and reduces the substrate surface symmetry to the 2d - space group pm as depicted in figure 2b . (note that there are two equivalent cleavage planes, . (6) in both cases the surface corrugation is formed by parallel grooves along either the or [110] direction .) On the contrary, trioctahedral sheet silicates are characterized by a quasi - closed octahedral layer which leads to less distortion within the tetrahedral sheet . Consequently, the phlogopite mica surface exhibits a higher degree of symmetry which can be characterized by the 2d - space group p31 m . Both space groups can be clearly distinguished by the number of mirror axes (one / three for muscovite / phlogopite) and their rotational symmetry which has also been observed in growth experiments . Indeed, as seen in our afm images in figure 2c, p6p nanoneedles, which have been fabricated by hot wall epitaxy (hwe), nicely reflect the expected different growth behavior on the two substrates . The higher symmetry of phlogopite is clearly revealed by triangular - shaped needle structures. (33) (a) sketch of the surface geometries of (001) cleaved muscovite (left) and phlogopite (right) mica substrates . (b) symmetry elements for muscovite (pm) and phlogopite (p31 m). (c) afm images of para - hexaphenyl nanofibers grown on muscovite (left) and phlogopite (right) mica . (a) xrd pole figure measurement of 6 t nanofibers grown on muscovite mica . (b) azimuthal alignment of the long needle axes (lnas) deduced by xrd . Lmas can be grouped into two pairs (red and blue) which are aligned quasi - parallel to each other . (d) fft pattern calculated from an optical microscope image providing a perfect match with lnas deduced by xrd . (e) real space model of two 6 t crystallites as deduced by xrd . Two lnas originating from one molecular orientation (red arrows) are shown (6 t crystallites mirrored due to substrate surface symmetry are not indicated). For a complete understanding of the growth mechanisms, it is crucial to know the epitaxial relation of molecules and crystallites with respect to the substrate . While for p6p on muscovite this has been studied extensively by x - ray diffraction, such structural investigations have not been performed on 6 t nanofibers so far . To fill this gap, we have carried out x - ray pole figure measurements on hwe - grown 6 t nanofibers . In particular, the orientations of 6 t (211) as indicated in figure 3a by black arrows, xrd pole figure measurements reveal eight diffraction spots which underline a defined azimuthal order of the 6 t crystallites . This pattern can be explained by a packing of 6 t molecules in the so - called low - temperature phase(35) and a parallel orientation of the {411} planes to the muscovite mica (001)m substrate surface . The diffraction spots in figure 3a clearly reflect the geometry of the muscovite mica surface unit cell . This becomes evident by the presence of a mirror symmetry along the [110]m direction . Based on our structural analysis, it is possible to deduce the azimuthal orientations of the long needle axes (lnas) and the single 6 t molecules . The lnas can be determined directly from the xrd pole figures by analyzing the [011] direction of each of the eight 6 t crystallites . We complement these results with a 2d fast fourier transformation (fft) analysis (figure 3d) of optical microscopy images which directly reveal the needle directions . As one can see, the lnas from the two complementary techniques give a perfect match . The fact that there are no additional orientations visible in the fft image proves that all observed needle directions share the (411) contact plane, in contrast to what has been proposed previously. (21) the orientation of the long molecular axis (lma) is deduced from the molecular packing within the crystal unit cell . As evidenced in figure 3c, the lma orientations can be grouped in pairs almost parallel to m (blue arrows) and m (red arrows). In contrast, this order seems not reflected by the lna as the needles belonging to one pair (red and blue arrows) deviate in their orientations by about 40. this surprising puzzle will be solved by the growth model introduced below . We shortly note that analogous experimental investigations were performed for 6 t and p6p on phlogopite to complete the experimental characterization . It relies on the assumption that the geometric properties of molecule and substrate, and not electric fields, are the main driving force for the needle growth . The main points are summarized as follows: we assume that the initial stage of the organic needle growth is mainly dominated by the interaction between the single molecule and the substrate . In general, a molecule prefers to adsorb with its lma at a certain angle on the substrate as shown in figure 4 . It can be expected that the designated strongly depends on the chosen substratemolecule combination . The symmetry of surface and molecules can lead to more than just one . First of all, both molecules, namely p6p and 6 t, possess a twofold rotational axis . Furthermore, as indicated in figure 4, the muscovite surface possesses one mirror plane . Phlogopite has even more equivalent geometries arising from the threefold rotation axis and three mirror planes . As the density of molecules on the surface increases, this is visualized in figure 4 by the solid and dashed ovals indicating the molecules . The molecules in one needle are turned upside down (mirrored) with respect to the molecules in the other needle . Unlike for the previous point where the mirroring was carried out with respect to the substrate mirror axis, here, the mirroring is carried out with respect to the long molecular axis (the lma represents the normal of the mirror plane). In general, this will not lead to an energetically equivalent geometry . For each of the equivalent angles, hence, there are four equivalent angles, the number of possible needle directions should be eight . However, the lnas for = + 180 always coincide with the ones from . Hence, the number of needle directions on muscovite is four in the most general case . The parallel needle growth observed for para - phenylenes,(7) functionalized quater - phenylenes, and selected thiophenephenylene co - oligomers(37) represents a lucky case for which = 90 (normal to the mirror plane) or = 0 (parallel to the mirror plane). Then, also the needles from coincide with the ones from reducing the needle orientations to 2 . For phlogopite mica, the threefold rotational axis will always give at least three times more lna directions ., moleculemolecule interactions will cause a slight readjustement of the lma on the order of a few degrees to obtain a better lattice match with the substrate . This adjustement can be assumed to be different for the two needle - growth directions . In fact, in figure 3b one can recognize a sort of splitting of the lmas . This splitting was experimentally observed for all systems and is, for simplicity, omitted in the sketch in figure 4 . It is illustrated in figure 3e which shows a pair of 6 t needles as obtained from xrd . By close inspection each molecular adsorption site, characterized by the azimuthal angle, is accompanied by an equivalent position due to mirror symmetry of the muscovite mica substrate surface . Moreover, as indicated by solid and opaque ovals, in the general case two needle directions originate from each adsorption place leading to four needle directions . In the following, we will show that the angle can be obtained from force - field calculations leading to lmas in excellent agreement with experiment . The interaction between the molecules and the substrate is predominantly of van der waals character which is modeled via lennard - jones potentials and empirical parameters . To prove our alternative approach, we want to exclude the influence of electric fields originating from the substrate and just consider the effect of surface corrugation . Hence, the muscovite and phlogopite mica surfaces are replaced by two closely related compounds in the phyllosillicate class . Whereas micas are characterized by a partial cation substitution of al instead of si in the tetrahedral layer, the chosen substrates, namely phyrophyllite and talc, belong to the group of nonsubstituted phyllosilicates and consequently provide charge neutrality(29) within the tetrahedral layers . The former, belonging to the dioctahedral group as muscovite, also exhibits surface corrugations, while the latter, belonging to the trioctahedral group such as phlogopite, misses it . Adsorption energy of 6 t (left) and p6p (right) on pyrophyllite as a function of angle . The zero on the energy scale is set to the energy of the least favorable angle . For 6 t, two curves are shown, one corresponding to left - handed and the other to right - handed molecules . Middle: polar diagrams of the adsorption energy of 6 t (second from left) and p6p (second from right) on pyrophyllite . As described in the text, for 6 t the left - most and right - most plots depict the experimentally confirmed adsorption geometries . Bottom: polar diagrams of the adsorption energy of 6 t (second from left) and p6p (second from right) on talc and the experimentally confirmed adsorption geometries . We determine the optimal adsorption position of an isolated organic molecule on top of such a substrate by minimizing the adsorption energy for each angle . The molecules are assumed to adsorb flat on the substrate at a vertical distance of about 3.0 . We define the adsorption energy ead as the difference between the energies of the isolated subsystems and the energy of the combined system, i.e., the molecule and the substrate . Therefore, maxima in the ead vs curve evidence the favorable adsorption geometries . The zero on the energy scale is set to the energy of the least favorable angle . We first focus on 6 t on phyrophyllite shown in the top left plot of figure 5 . Due to the twofold rotational axis of 6 t, only an angular range of 180 is shown . Two curves are presented, corresponding to left- (eadleft, red dashed line) and right - handed 6 t (eadright, blue solid line). One configuration is obtained from the other by flipping the molecule by 180 around the lma . Due to the mirror symmetry of the pyrophyllite (001) surface, eadright() = eadleft(). Both curves show four major peaks in the considered angular range, at 0, 60, 90, and 120, where the first one is strongest . The curve of p6p on pyrophyllite is shown on the top right of figure 5 . For the p6p molecule the right- and left - handed molecules are indistinguishable due to the mirror symmetry of the molecule itself, and, hence, there is just one curve of higher symmetry . Also, here four maxima are found in the range between 0 and 180, and two peak positions, namely the ones at 0 and 90, are the same as for 6 t . The other two are found at 30 and 150, in contrast to 6 t . An additional difference is that the peak at 90 is strongest . To facilitate the subsequent investigations,, we combine the red and blue curve into one by selecting at each angle the energetically more favorable point . This simplification has no consequence for the maxima for which there is little or no difference between the two configurations . The results for 6 t and p6p on talc are also represented by polar plots . The higher symmetry of the talc surface is clearly reflected in the polar plots which exhibit a much more regular pattern as compared to phyrophyllite . When comparing the two molecules, one can see that 6 t shows one peak every 60 while p6p has one more peak in this angular range . Summarizing these findings, the differences in the surface structure of pyrophyllite and talc and lead to a different preferencial azimuthal orientation of the molecules . A closer inspection of the polar plots reveals that the difference between the substrates is more in the peak heights than in the peak positions . In fact, one can recognize that, for a given molecule, (almost) all peaks are found for both substrates at the same angles . This finding clearly underlines that the surface corrugation disturbs the hexagonal symmetry but does not completely destroy it . Indeed, from the leed pattern muscovite still shows nearly hexagonal symmetry,(37) which might be one of the reasons why surface corrugation was not considered as the driving force for growth in previous investigations . For all systems, one maximum in the calculated curves falls in between the experimentally observed molecular orientations (evidenced in figure 5 by the gray areas). For three out of the four systems (6 t on talc, p6p on pyrophyllite, and talc), this computed maximum is indeed the most pronounced one, thereby explaining the experimental findings . For 6 t on pyrophyllite, the intermediate, but not the strongest, peak is in accordance with experiment . We attribute this small discrepancy to the usage of empirical potentials which in some cases may yield the wrong energetic ordering of competing structure solutions. (41) nevertheless, it can be stated that the observed match between experiment and simulations underlines that growth mechanisms on sheet silicate substrates are not noticeably depending on the al / si substitution but are mainly determined by the geometry of the substrate surface . For completeness, the experimentally confirmed adsorption geometries are also depicted in figure 5 . For better visibility remarkably, in the case of p6p (see figure 5 upper right), the phenyl ring periodicity is quasi overlapping with the individual grooves . On the contrary, due to a smaller distance between the thiophene rings, nevertheless, it is noticeable that in the demonstrated configuration (see figure 5 upper left) the molecule spans across five grooves, where four of them perfectly coincide with the thiophene rings . Consequently, the shown situation represents again an optimized case for matching the periodicity between the molecular rings and the substrate surface grooves . This is consistent with the observation that longer phenylene(42) or thiophene(21) molecules lead to an increased regularity of organic needle structures . It can be easily explained by the fact that an increasing number of molecular rings have to match the periodicity of the substrate . Moreover, with increasing molecular length, an angular deviation from the optimized molecular adsorption angle becomes of increasing significance . So far, our calculations have addressed the first two points of our growth model . As already mentioned, this splitting of typically 510 can be assigned to a slight molecular realignment during the formation of the organic crystallites . Such interactions are not present in the calculations so far where just one molecule, but not the full organic crystallite, was considered . The splitting can indeed be obtained in calculations when replacing the isolated molecule by a cluster . A cluster of eight molecules was generated from the bulk crystal structure, and the (411) or (411) plane has been chosen as the contact plane . As indicated in figure 6, the former two peaks are shifted away from their high - symmetry position (60) resulting in a splitting of about 7. for p6p an analogous procedure reveals an even more pronounced splitting of 12. this stronger splitting is also experimentally observed and had also been predicted by lattice - mismatch calculations. (6) adsorption energy of a cluster of 6 t (left) and p6p (right) molecules a function of angle (solid lines). The adsorption energies of the isolated molecules, taken from figure 5, are also shown as reference (dashed lines). Bottom: cluster geometries of p6p (left) and 6 t (right). By combining experimental data and force - field calculations, we propose a model to explain the nanoneedle formation of rodlike molecules on sheet silicate substrates . In particular, the model reveals that perfect parallel alignment of organic molecules and hence anisotropic optical properties can only be achieved when the molecules align parallel or normal to the mirror axis of muscovite mica . Exactly this situation is fulfilled for para - phenylenes,(7) functionalized quater - phenylenes, and selected thiophenephenylene co - oligomers. (37) in all other cases at least two different molecular adsorption geometries are present due to mirror symmetry of the substrate surface . We demonstrate by comparing experimental results and simulations that electrically charged and neutral substrate surfaces cause an analogous molecular adsorption geometry . Moreover, by comparing the simulations on tri- and dioctahedral sheet silicates, it has been demonstrated that the presence of corrugations not only breaks substrate surface symmetry but also significantly influences the molecular adsorption . In that sense, the proposed model can explain the experimentally observed anisotropy of rodlike molecules on muscovite mica without the presence of electric dipole fields . The excellent overlap between experiment and simulations further promises that molecular adsorption geometries can be predicted by force - field simulations . This is an important prerequisite to select proper rodlike molecules to achieve highly polarized emission.
A combination of resistance training and proper diet elicits several physiological responses that enhance the structure and function of skeletal muscle . Research has clearly defined the benefits of resistance training (i.e., increased muscular endurance, strength, power, increased metabolism, decreases in body fat, etc) [1 - 3]. However one of the most profound changes seen is muscular hypertrophy, or more specifically myofibrillar and sarcoplasmic hypertrophy . Sarcoplasmic hypertrophy involves the growth of the sarcoplasm and non - contractile proteins (-actinin, desmin, dystrophin, myomesins, nebulin, titin, and vinculin) that do not directly contribute to muscular force production . Filament area density decreases while cross - sectional area increases, without a significant increase in strength . Myofibrillar hypertrophy occurs due to increases in the number of myosin / actin filaments inside each sarcomere . This leads to increased strength and size of the contractile unit (actin, myosin, troponin, and tropomyosin) of muscle . Thus, minimal increases in the number of contractile proteins may significantly increase the size of a fiber . In normal humans, 50% of total body weight, with as much as 50% of the total body protein being housed in the skeletal muscle . The myosin molecule is made up of 6 subunits, 2 very large heavy chains, and 4 smaller light chains . In a given muscle fiber the 2 large subunits are identical, although there are different heavy chain isoforms in different types of muscle fibers . Due to the large amount of skeletal muscle that is composed of myosin, changes in this fiber the purpose of this review is to evaluate the current literature on the effects of dietary protein and resistance training on the expression of the myosin heavy chain (mhc). Although the focus of this review is the effects of dietary protein and resistance training on mhc changes, it is necessary to establish the foundation of the particular role that resistance training and protein intake play on skeletal protein balance . Thus, when synthesis of contractile proteins is occurring at a faster rate than degradation the net result is a positive protein balance or more specifically myofibrillar hypertrophy . Biolo and colleagues studied the effects of protein turnover and amino acid transport after resistance training in healthy untrained individuals . They found that after a bout of resistance training rates of protein turnover and amino acid transport were increased . However protein degradation was also increased above baseline values . Even though the net protein balance was increased over baseline, protein synthesis increased by approximately 100% over baseline levels, where degradation increased 50% over baseline . In another resistance training study phillips and colleagues found similar findings to the biolo study . The fractional synthesis rate (fsr) post exercise had increased significantly over baseline . However fractional breakdown rate was also increased . The results indicated a decrease in protein turnover, but still a negative turnover balance . After eight weeks of resistance training the acute exercise induced increases in muscle protein synthesis are reduced . These findings concur with that of chronically resistance trained individuals . In a 1999 study, the response of untrained subjects was compared to that of subjects with at least five years of resistance training . As previously noted, the results indicated that resistance trained individuals had a depressed protein turnover rate post - training when compared to the untrained . However, eight weeks of resistance training resulted in chronic resting muscle protein synthesis (meaning a net positive muscle protein status was achieved). Several studies have also investigated the duration of the elevated protein synthesis as a result of resistance training . Chesley and colleagues investigated the magnitude and time course for changes in muscle protein synthesis after a single bout of resistance exercise . Their results indicated that a single bout of heavy resistance exercise can increase biceps muscle protein synthesis for up to 24 h post exercise . A study done by macdougall and colleagues examined the time course for elevated muscle protein synthesis by examining its rate at 36 hrs following a training session . At 36 hrs post exercise, muscle protein synthesis in the exercised muscle had returned to within 14% of the control . One conclusion from these studies is that following a bout of heavy resistance training, muscle protein synthesis increases rapidly and stays elevated for 24 hrs, and then declines rapidly so that at 36 hrs it is not significantly different from baseline . Thus, these studies demonstrate the effectiveness of inducing changes in protein synthesis with resistance training . In fact, ferrando et al found that moderate - resistance exercise can counteract the decrease in muscle protein synthesis seen during bedrest . One group adhered to strict bed rest, and the secondgroup engaged in leg resistance exercise every other day throughoutbed rest . After 14 days of bed rest, muscle protein synthesis in the bed rest plus exercise group did not change and was significantlygreater than in the bed rest group . Thus we can only speculate to the actual percentage of that synthesis rate that is specific to muscle proteins such as mhc . That said, very few studies have actually evaluated the synthesis of mhc . Collectively, these studies suggest that resistance training will increase protein synthesis and slow degradation; however depending on the nature of the exercise stimulus, protein turnover may remain negative . Thus it is possible that resistance training combined with nutritional intervention may enhance the effects on protein synthesis . It is interesting to note that previous studies have concluded that acute protein synthesis following resistance training is similar in fed and fasted subjects . Only the rate of turnover changes slightly, but still remains in a negative balance . However, studies have found that with dietary protein or amino acid supplementation, muscle protein synthesis rate is increased . Biolo et al evaluated the interactions between resistance training and amino acid supplementation and the corresponding effects on protein kinetics . Each participant was infused with a mixed (phenylalanine, leucine, lysine, alanine, glutamine) amino acid solution approximately 0.15 gkghfor 3 h. baseline and post resistance training (5 10 sets leg press and 4 8 sets of nautilus squat, leg curl, and leg extension) measures were taken . The results revealed increased protein synthesis and no change in protein degradation . As noted previously, these results differ from that of the models that did not use amino acid supplementation . In those studies, the findings of the biolo study might indicate that increased availability of amino acids to the muscle after a bout of resistance training might contribute to enhanced anabolism . However in the biolo study amino acids were infused in the subjects, which is hardly a realistic option for day - to - day resistance training . Tipton and colleagues recently investigated the effects of orally administered amino acids (40 g cho (placebo solution), 40 g mixed amino acids (eaa + neaa) or 40 g essential amino acids (eaa only + arginine)) on post exercise net protein synthesis . They also sought to determine whether there would be a difference in the anabolic effect of amino acid supplementation if they used a mixed amino acid source or essential amino acids alone . The findings of this study indicated that post - exercise amino acid supplementation elicits a positive protein balance as compared to the negative balance seen with resistance training alone . In fact, the results of this study were very similar to the infusion model . The tipton study also concluded that supplementation with the essential amino acids alone is equivalent to that of a mixed amino acid supplement . Although research has concluded that post exercise amino acid supplementation has positive effect on protein synthesis, amino acid supplementation is not always an option . Thus esmark et al investigated the timing of protein intake after exercise on muscle hypertrophy and strength . This study used a milk and soy protein supplement (containing 10 g protein (from skimmed milk and soybean), 7 g carbohydrate and 3.3 g lipid) instead of an amino acid mixture . Although protein synthesis was not calculated in this study, measurements of hypertrophy were made . The results of the esmark study indicated that skeletal muscle hypertrophy was significantly increased after resistance training when a protein supplement was taken . The findings also suggested that when the supplement was taken immediately after the training versus two hours later the hypertrophic response was greater . In the most recent study by tipton and collegues, they evaluated the effects of casein and whey protein ingestion on protein balance after resistance training . Twenty three subjects consumed one of three drinks 1 hour after a bout of leg extensions . Subjects consumed either placebo, 20 g of casein protein, or 20 g of whey protein . The results indicated that ingestion of whey or casein protein after a bout of resistance exercise increases net muscle protein synthesis . In a recent review rennie and collegues concluded that there is no doubt that increasing amino acid concentrations by intravenous infusion, meal feeding, or ingestion of free amino acids increases muscle protein synthesis . They also concluded that in the post exercise period increased availability of amino acids enhances muscle protein synthesis . First, resistance training decreases the net negative protein balance . By increasing protein synthesis at a greater rate than protein degradation second, these findings suggest that resistance training decreases net negative protein balance regardless of fed or fasting state . Finally, amino acid or protein supplementation enhances protein synthesis and suppresses degradation, resulting in net protein synthesis . Recent studies have highlighted the importance of consuming different nutrients in varying quantities before or after resistance training . While a detailed breakdown of these considerations are beyond the scope of this review, the interested reader is encouraged to read the following articles that focus specifically on these considerations [19 - 23]. This review has established the role of resistance training and protein intake on muscle protein synthesis . There are at least three non - muscle mhc isoforms, two smooth muscle isoforms, and at least eight skeletal muscle isoforms . The focus of this review will be on the adult isoforms: 1 .) Alpha cardiac beta or slow type i (as expressed in skeletal muscle); 2 .) Fast type iia; 3 .) Fast type iix / iid; and 4 .) The majority of slow muscles (such as the soleus and vastus intermedius) express the slow type i mhc isoform with a proportion of type iia . Type iia is the slowest of the fast mhcs . In humans the mix of type i and these isoforms are expressed in the small fast muscles such as the gastrocnemius - plantaris complex, the vastus, the extensor digitorum longus (edl), and the tibialis anterior . The proportion of the isoform type varies from muscle to muscle and animal to animal . Thus, in the human model fast muscle such as the vastus lateralis, edl, and tibialis anterior type i, type iia, and type iix are expressed . Protein expression of mhc genes is highly plastic and can be modulated by mechanical activity / inactivity factors . Changes in isoform composition are common as a result of exercise training . In fact, many hybrid patterns of mhc have been seen as a result of training . A moderately active individual might have a mhc profile of the quadriceps (vastus) muscle that is ~50% slow type i, 40% type iia, and 10% type iix . Where a world - class marathon runners and ultra - endurance athletes might have as much as 95% type i. muscles of sprinters and powerlifters predominantly consist of the iia / iix mhc . As discussed previously, protein turnover is the rate at which protein is synthesized minus the rate at which it is degraded . Although this formula is quite simple, the process is complicated, and the protein turnover can occur on many levels . Protein turnover can be evaluated as whole - body (as discussed previously), as mixed muscle proteins, or as individual proteins (such as actin or myosin). Although the effects of mixed muscle protein synthesis give us information about exercise programs or dietary intervention, it does not speak to the specificity of the protein changes . By determining the synthesis rate of individual proteins we may gain a greater understanding of the adaptive response of exercise, bed rest, dietary intervention, and muscle wasting that occurs in a microgravity environment . A landmark study done on the synthetic rate of individual muscle proteins in humans was completed in 1997 . This study found that although the mhc composes at least 25% of muscle protein content, it contributed only 18% to the mixed muscle synthesis rate . Thus the synthesis rate of mhc is slower than that of the mixed muscle proteins . However hasten et al found a direct correlation between mixed muscle and mhc protein synthesis rates after exercise, reporting that mhc synthesis rate accounted for 80% of the mixed muscle synthesis rate . The role of dietary protein intake on protein turnover has been well established . As discussed previously the adequate requirement of essential amino acids is of paramount importance to reaching a net positive protein turnover . It is also clear that the ramification of restricted dietary protein intake is muscle wasting . Recently a study found that consumption of an isoenergetic diet at the mean adult minimum protein requirement for 4 wk produced an 81% lower fractional synthesis rate of myosin heavy chain (mhc) proteins in vastus lateralis muscle than did consumption of an ample protein diet . They also found that protein deprivation altered the skeletal muscle myosin composition such that the proportion of the total myosin content represented by fast - twitch mhc iix was 51% lower than with ample intake . The most interesting finding was that the steady state content of mhc iix messenger rna did not differ in subjects consuming the minimum requirement of protein . They also found that a marker of protein degradation (3-methylhistidine) was lower in the protein restricted group, suggesting that it is possible that both synthesis and degradation of mhc are slowed on a low protein diet . The resultsshow that after 19 weeks of heavy resistance training, iib fiber composition decreased significantly, where, type iia fiber increased . In a follow up study the authors of the same study used the samples to investigate the changes in the fast twitch fiber subtypes . The resultsshow that after training, iib mhc composition decreased and iia mhc, in contrast, increased . Although it is not the focus of this review it is important to note that similar adaptations to resistance training are seen at the mrna level as well as the protein level . Willoughby and pelsue found that after 8 weeks of heavy resistance training mhc i, and iia mrna was significantly greater than the control group . These findings agree with the findings of the previous studies that show a shift in the protein expression of mhc isoforms . Another study analyzed the distribution of mhc isoforms, fiber type composition, and fiber size of the vastus lateralis in a group of adult sedentary men before and after 3 months of heavy - load resistance training and, subsequently, after 3 months of detraining . Following the period of resistance training, mhc iix content decreased significantly, with a corresponding significant increase in mhc iia . After 3 months of detraining the amount of mhc iix reached values that were higher than before and after resistance training . The results of this study indicated that there was a shift from type iix fiber to type iia after 12 weeks of resistance training . The findings of andersen mirrored the results of the two previous studies, only they used sprinters as the subject group . Jurimae et al investigated whether 12 weeks of resistance training, which increased arm girth (5%) and forearm extensor strength (39%), also altered the mhc characteristics of the triceps brachii muscle . The results indicated that resistance training changed the contractile protein profile of trained skeletal muscle . However, changes in mhc isoform composition in the first 12 weeks of training were not implicated in the development of 1rm triceps pushdown strength . The results of this study might infer that changes in mhc composition contribute to increases myofibrillar hypertrophy . For this to be true, resistance training could not only change the composition of the mhc, but it would have to increase the synthesis of the mhc . Welle and collegues investigated the synthesis of myofibrillar proteins in young and older adults after three months of resistance training . Chesley found that muscle protein synthesis was increased significantly after resistance training as did hasten et al . Hasten investigated the changes in mixed muscle protein, myosin heavy chain, and actin proteins before and after two weeks of resistance training . They evaluated seven subjects with a mean age of 27 and seven subjects with a mean age of 80 years old . In the young subjects the mhc synthesis rate increased 88% and the mixed muscle protein increased 121% . In the older group, mhc synthesis rates increased 105% and mixed muscle protein synthesis increased 182% over baseline . Thus mhc synthesis accounted for 80% and 65% respectively in the younger and older individuals total mixed muscle protein synthesis . After three months of resistance training the fractional synthesis rate of mhc increased 47% and mixed muscle protein synthesis increased 56% . It is clear that much of the current literature agrees that resistance training increases the synthesis of myofibrillar proteins and that mhc accounts for a large portion of that synthesis rate . The purpose of this review was to evaluate the current literature on the role and importance of dietary protein and resistance training on the expression of the skeletal muscle isoforms of the myosin heavy chain . The importance of the mhc can almost be quantified by its sheer size, accounting for 2530% of all muscle proteins essentially, the mhc dictates how the muscle will react to an induced load, such as that of exercise . The adaptability of the mhc allows for the muscle to conform (to some degree) to the given stress placed on the muscle . The research has clearly defined that resistance training increases the synthesis rate as well as impacting the specific isoform expression of the mhc gene . Although further research needs to be done, past research has also determined that adequate protein intake is a necessity for mhc isoform expression . The role of specific amino acids and dietary protein on protein turnover is well established, however there needs to be further investigation into the role of dietary intervention on the mhc family . Future studies may investigate the role of various dietary supplements as well as various resistance training paradigms on expression of the myosin heavy chain family.
This rate is increasing owing to greater numbers of elderly, immunocompromised patients.1) in uncomplicated pyelonephritis cases, appropriate antibiotics improve fever within 72 hours and reduce leukocytosis and elevated c - reactive protein (crp) levels . Uncomplicated pyelonephritis generally requires 714 days of antibiotic therapy.23) however, when staphylococcus aureus is the pathogen, dissemination can occur, and a prolonged duration of antibiotic treatment is required.4) s. aureus rarely causes pyelonephritis in the general population . In 1997, s. aureus accounted for only 0.5% and 1.3% of isolates obtained from urine in general populations from great britain and france, respectively . 5) in south korea, s. aureus is classified as a rare cause of community - acquired pyelonephritis.3) we describe a patient who was diagnosed with complicated epidural and paraspinal abscesses after insufficient evaluation and treatment of acute pyelonephritis due to s. aureus . A 62-year - old man was admitted with a 5-day history of fever, increased urinary frequency, and left flank pain . He had no specific medical or surgical history, except for a 5-year history of type 2 diabetes treated with insulin and oral hypoglycemic agents . Physical examination revealed a blood pressure of 120/70 mm hg, temperature of 38.4, heart rate of 76 beats / min, and respiration rate of 20 breaths / min . The initial laboratory data revealed a white blood cell (wbc) count of 14,680/mm, hemoglobin level of 12.2 g / dl, platelet count of 373,000/mm, crp level of> 12 mg / dl, and hemoglobin a1c level of 12.5%, indicating that his diabetes was poorly controlled . Blood urea nitrogen, serum creatinine, alanine transaminase, and aspartate transaminase levels were within the normal range . Urinalysis showed white and red blood cell counts of 35/high - power field (hpf) and 1015/hpf, respectively . Contrast - enhanced abdominal computed tomography (ct) scans showed a multifocal decreased perfusion defect of the left kidney . Blood and urine culture samples were obtained, and intravenous ceftriaxone (2 g / d) was administered immediately . Five days after admission, the initial urine and blood cultures revealed growth of methicillin - sensitive s. aureus (mssa). However, the patient declined further evaluation, as his discomfort had subsided, and his poor socioeconomic status impeded the payment of additional medical costs . Eight days after admission, laboratory data demonstrated further improvement (wbc count, 8,760/mm; crp level, 1.95 mg / dl). Follow - up urine and blood cultures obtained on day 5 revealed no bacterial growth . The patient was therefore discharged with oral ciprofloxacin (500 mg every 12 hours) for 7 days . He was asked to attend the outpatient clinic for 1 month to receive maintenance ciprofloxacin, but he failed to attend . Approximately 1 month later, the patient presented with a 7-day history of symptoms consistent with those at his initial visit . His vital signs were as follows: a blood pressure of 110/70 mm hg, temperature of 38.4, heart rate of 115 beats / min, and respiration rate of 20 breaths / min . Bilateral costovertebral angle tenderness was noted . Laboratory data revealed a wbc count of 15,870/mm, hemoglobin level of 9.6 g / dl, platelet count of 375,000/mm, and crp level of> 12 mg / dl . Blood urea nitrogen, serum creatinine, alanine transaminase, and aspartate transaminase levels were within the normal range . Urinalysis showed a wbc count of 3050/hpf with many bacteria and a red blood cell count of 510/hpf . A ct scan showed a multifocal decreased perfusion defect of both kidneys (figure 1) with bladder distension . An oral alpha blocking agent and intravenous ciprofloxacin (400 mg every 12 hours) were administered . Two days after readmission, his left lower flank pain persisted, despite a fentanyl patch (12 g / h). Although there were no neurologic deficits, a neurosurgeon was consulted regarding his severe pain and the possibility of concomitant spinal disease . Magnetic resonance imaging (mri) with gadolinium enhancement was performed, revealing epidural abscesses at l45 and paraspinal abscesses of the muscles at l3s2 (figure 2). Ultrasound - guided aspiration of the paraspinal muscle layer was performed using an 18-gauge needle, and approximately 10 ml of yellow - white mucoid fluid was aspirated . Cultures of blood and drained fluid revealed mssa growth (table 1) with antimicrobial sensitivity identical to that of the initial culture . Urine cultures revealed growth of <1,000 colony forming units / ml, although the bacterial strain could not be identified . However, neutropenia occurred, and nafcillin was replaced with vancomycin for an additional 30 days . On day 57 after readmission, mri showed the abscesses had decreased in size (figure 3). Laboratory data were nearly within the normal range (wbc count, 6,490/mm; crp level, 0.35 mg / dl). On day 59, he was discharged without neurologic sequelae and was prescribed ciprofloxacin (500 mg every 12 hours) until a repeat mri showed no remnant abscesses . According to the infectious diseases society of america guidelines, uncomplicated s. aureus bacteremia (sab) is defined by five factors: the exclusion of endocarditis, no implanted prostheses, s. aureus - negative blood cultures 24 days after initial presentation, defervescence within 72 hours of therapy, and no evidence of metastatic infection sites . These guidelines suggest administering antibiotic treatment for a minimum of 2 weeks for uncomplicated sab, and a minimum of 4 weeks for complicated sab, personalized to the patient's condition.4) s. aureus can disseminate, and it is therefore difficult to differentiate primary pyelonephritis caused by s. aureus from secondary s. aureus bacteriuria (sabu).56) there is controversy regarding the appropriate diagnostic tests required to exclude occult foci caused by sab . Consequently, it is difficult to determine the minimum duration of antibiotic treatment required for sab.4) in 2009, choi et al.6) showed that patients with sab and sabu had higher rates of urinary tract infection, bladder obstruction, and spinal infection compared with patients with sab only . The association of sabu with spinal infection may result from the venous system acting as a route for propagation of infection between the pelvic organs and spinal region without systemic dissemination.7) in agreement, our patient had concomitant pyelonephritis, neurogenic bladder, and epidural and paraspinal abscesses without infective endocarditis . On initial admission, the patient's fever and pain subsided within 72 hours of treatment, and laboratory data showed significant improvements . The patient declined additional examinations to assess bladder obstruction and metastatic infection, as his poor socioeconomic status impeded the payment of additional medical costs . However, his condition worsened after readmission, and he agreed to undergo the required examinations . Epidural abscess is rare, with a frequency of 0.22 cases/10,000 hospital admissions and a mortality rate of 10% to 30% owing to potentially permanent neurological deficits . However, the incidence is increasing, owing to increased numbers of immunocompromised patients and advancements in diagnostic imaging techniques . Epidural abscesses characteristically have an insidious onset of symptoms, with the classic symptom triad being localized pain, fever, and neurological deficits . Overall, 74%, 64%, and 10%15% of patients reportedly present with pain, fever, and all three symptoms, respectively . Hence, the diagnosis of an epidural abscess is often missed on initial examination, and delays in treatment dramatically worsen prognosis owing to the risk of neurologic sequelae . Therefore, a high level of clinical suspicion is important for timely diagnosis and treatment.8) as the patient in this case had both epidural and paraspinal abscesses, his pain was likely more severe than it would have been due to an epidural abscess alone, and therefore, the suspicion of spinal infection was relatively high . The current gold standard for the diagnosis of an epidural abscess is mri with gadolinium contrast, and the most common causative pathogen is s. aureus . Infection with s. aureus can be managed successfully with conservative treatment comprising antibiotics and spinal bracing . Surgical intervention is indicated when neurologic deficits are present.9) it is uncertain whether the abscesses were present initially, in which case they may have been partially treated and then worsened after the cessation of antibiotics . However, this case emphasizes the importance of investigating concomitant bladder obstruction and metastatic infection in patients diagnosed with community - acquired pyelonephritis due to s. aureus . The adequate treatment of bladder obstruction with antibiotics, despite improvements in patient symptoms and laboratory tests, should be carefully considered by the primary care physician.
Generally, low back pain (lbp) is one of the most common problems . Lbp is a common disorder with a lifetime prevalence of 85% . In addition, it is one of the most common surgical practices performed by a spine surgeon . The surgical treatment of ruptured lumbar intervertebral discs is sometimes discouraging to both the surgeon and the patient . Although, decompression of the nerve root and, therefore, the improvement of radicular pain is the mainstay of disc surgery, pain may persist or recur despite well - indicated and well - performed surgery . Spinal imbalance may be important in all these situations, because one of the essential roles of the spine is to support mechanical loads in the upright position . Balance of the body essentially depends on how far the head is to the midline . While in this position, humans are never completely immobile but are, in fact, continually adjusting their balance by means of micromovements, thereby ensuring that the body's center of gravity remains harmoniously within a base of support in a fashion requiring minimal muscular effort . Developmental dysplasia of the hip is a condition in which the hip joint does not develop normally, and in this pathology, abnormality in size, shape, orientation, and organization of femoral head, acetabulum, or both anatomical structures are seen . Demonstrated that subtle anatomic abnormality in the pelvis is associated with altered mechanics in the lumbar spine . However, human coronal balance may additionally be one of the causes of operative failure after disc surgery . The leg on the side of the dysplastic hip is usually shorter than the other side . Inequality in leg length may lead to abnormal transmission of load across the endplates and degeneration lumbar spine and the disc space . . A better understanding of etiology is required to determine and develop effective surgical management protocols . Any contribution to our knowledge of this cause of these operative failures is always welcome . A total number of 39 patients with inequal leg length and dysplasia of the hip and 43 normal subjects who had visited the outpatient clinic orthopedic and neurosurgical department for lbp treatment between january 2012 and july 2013 were retrospectively analysed . Were not questioned, because the aim of this article is an investigation of relationship of lbp patients with dysplasia of the hip and disc degeneration . The inclusion criteria were: adult male or female patients, 20 years or older, with chronic lbp symptom duration of at least 6 months . The exclusion criteria were patients who had spinal trauma and spinal tumor or other malignancy . Once the subject was entered in the study, multiplanar magnetic resonance imaging (mri) and plain films were done from the first lumbar to the first sacral vertebra with a 1.5-tesla imaging system . All magnetic resonance (mr) disc degeneration reportedly causes lbp and is often observed concomitantly with end plate signal change and/or schmorl's nodes on mri . Controversy persists regarding the association of abnormal mri findings with chronic axial and mechanical back pain . The degree of disc degeneration on mri was classified into five grades based on the pfirrmann classification system, with grades 4 and 5 indicating disc degeneration . The causes of shortness of leg length discrepancy were congenital hip dysplasia in all cases . Extremity length was calculated by measuring the distance between the anterior superior iliac spine and the medial malleolus . A frequently used technique to measure leg length is the supine tape measure method . Demographic data is described with means standard deviations, median, minimum, maximum, and ranges by descriptive statistics . Demographic data is described with means standard deviations, median, minimum, maximum, and ranges by descriptive statistics . The group consisted of 31 women (81,5%) and seven men (18,4%), aged 26 - 69 years [table 1]. In the control group, there were 25 females and 18 males with a mean age of 42,3 years (range, 26.3 - 55.0 years). Short extremity length and lumbar disc herniation (ldh) (24 versus 15) were more prominent on the right than the left side (p = 0,663). The type of disc hernias were as follows: no disc in nine cases (23.07%), bulging in 20 cases (51.2%) protrusion in eight cases (20.5%), extrusion in two cases (5,1%). Inequality in leg length and severity of lumbar disc crosstabulation was shown in table 2 . Occurrence of disc herniation is statistically different between patients with short leg and controls (p <0.05). Shows disc herniation in patients with hip dysplasia and control groups inequality in leg length and severity of lumbar disc crosstabulation was shown at present, neurosurgical practice is confronted by an explosion of technology . In the 1990s, the advent of mri and the progressive increase in definition of this modality of imaging have considerably contributed to the knowledge of spinal disorders . With the time and in parallel to the technological advancement, new and more complex spine procedures were performed the evolution of bipedal posture and ambulation in humans has transformed the horizontal vertebral column of vertebrates into a load - bearing erect spine that is required to efficiently transfer weight, provide stability, and permit motion . Through the spinal column, the body load is shifted to the base of the sacrum and then, through the pelvic girdle to inferior extremities . Due to the erect position, the pelvic bone system is subjected to new static and dynamic relations that play a very important role in definite formation of this region . Theories propose that this transformation in the mechanics of locomotion is the inciting evolutionary event that made the lumbar spine susceptible to degenerative disease . Inequality in leg length is important for the understanding of the pathophysiology of lumbar disc degeneration and herniation . In a degenerate disc, where the load is transferred to the vertebrae, found that the patients with intervertebral disc disease are characterized by asymmetrical leg loading our study, the first time, showed that patients with hip dysplasia are not same with control groups in terms of the ldh . An asymmetrical loading pattern may deteriorate spine biomechanics . Figures 1 and 2 show ipsilateral disc herniation of a patient with left hip dysplasia . Shows conventional x - ray of patient with left hip dysplasia and short left leg lumbar mri of same patient . He has left l4 - 5 disc herniation the pathophysiology of lbp can be various, depending on the underlying problem . Only in about 10% of the patient's specific underlying disease processes can be identified . Patients with scoliosis, spondylolisthesis, herniated discs, adjacent disc disease, disc degeneration, failed back surgery syndrome, or pseudoartrosis, all have symptoms of lbp in different ways . To the best of our knowledge, there are no studies on ldh in patients with leg length discrepancy . The x - ray and mri presented in this study [figures 1 and 2] demonstrates a case of leg length discrepancy due to dysplasia additionally demonstrates significant degenerative changes . This study shows that if an individual has a short leg, stress on the lumbar spine will be increased; the lumbar disc degeneration could in fact be the more significant issue than a leg length inequality in these patients . It is difficult to explain why the surgical treatment of ldh does not always lead to improved outcome . In these patients correction of abnormal load transmission across the spine and degenerated disc may, therefore, be benecial; however, it is not easy . In this if correction of abnormal load transmission is an important factor, our study suggests dynamic stabilization systems have not theoretical advantages over rigid spinal implants . However, to our knowledge, hip dysplasia and ldh have not been well - investigated in humans . Investigated the association between leg length discrepancy and the side of the radiating pain in ldh . Investigated the side of the radiating pain in ldh . In this paper, we compared the occurrence of ldh between patients with leg length discrepancy and controls . All these 39 patients showed a typical walking pattern featured by their one short lower extremity . We acknowledge the lack of assessment of level and number of disc degeneration, cobb angle of patients . However, this study, for the first time, first time shows that disc herniation is actually a result of some underlying congenital and morphological issue that was additionally affected by the leg length . The recognition of this fact may be important . If indeed one is the first to report something and that something is of value . The pathophysiology of lbp can be various, depending on the underlying problem . Only in about patients with scoliosis, spondylolisthesis, herniated discs, adjacent disc disease, disc degeneration, failed back surgery syndrome, or pseudoartrosis, all have symptoms of lbp in different ways . To the best of our knowledge, there are no studies on ldh in patients with leg length discrepancy . The x - ray and mri presented in this study [figures 1 and 2] demonstrates a case of leg length discrepancy due to dysplasia additionally demonstrates significant degenerative changes . This study shows that if an individual has a short leg, stress on the lumbar spine will be increased; the lumbar disc degeneration could in fact be the more significant issue than a leg length inequality in these patients . It is difficult to explain why the surgical treatment of ldh does not always lead to improved outcome . In these patients, correction of abnormal load transmission across the spine and degenerated disc may, therefore, be benecial; however, it is not easy . In this if correction of abnormal load transmission is an important factor, our study suggests dynamic stabilization systems have not theoretical advantages over rigid spinal implants . However, to our knowledge, hip dysplasia and ldh have not been well - investigated in humans . Ten brinke et al . Investigated the association between leg length discrepancy and the side of the radiating pain in ldh . In this paper, we compared the occurrence of ldh between patients with leg length discrepancy and controls . All these 39 patients showed a typical walking pattern featured by their one short lower extremity . We acknowledge the lack of assessment of level and number of disc degeneration, cobb angle of patients . However, this study, for the first time, first time shows that disc herniation is actually a result of some underlying congenital and morphological issue that was additionally affected by the leg length . The recognition of this fact may be important . If indeed one is the first to report something and that something is of value . Our study suggests that ldh may implicate abnormal loading due to leg length discrepancy rather than motion as the primary source of pain . A coronal imbalance of the spine is usually noted in patients with leg length discrepancy, however, the disc herniation secondary to leg length discrepancy has not been well - documented in humans . Abnormal patterns of load transmission may be accepted as a principal cause of degenerative changes in these cases . The concept is particularly appealing with greater recognition of the negative effects of abnormal patterns of load transmission on l4 - 5, l5-s1 spinal segments . Our observations suggest that lbp may have etiologies related to abnormal load transmission due to coronal imbalance . It seems that a successful treatment may sometimes exist beyond good surgery . In these situations
Alzheimer s disease (ad) is a neurodegenerative disorder characterized by progressive cognitive and functional impairment and behavioural and psychological symptoms of dementia (bpsd). These neuropsychiatric symptoms commonly include delusions, hallucinations, agitation, disinhibition, apathy, irritability, anxiety, depression, sleep disturbances, and elation . Bpsd are highly common in severe dementia, with 90% of individuals exhibiting at least one behaviour . Up to 50% of patients exhibit it has previously been shown that even modest improvements in these behaviours can result in significant improvement in the quality of life (qol) for the patient . Although there is still a lack of agreement about how qol should be defined and measured, it is generally considered to be a multidimensional construct that includes the individual s subjective experience of life, as well as objective criteria related to activities valued by society . Engagement in positive activities, presence of positive affect, absence of negative affect, participation in meaningful activity, and a sense of community are assumed to be correlated with qol in late - stage dementia . There is a growing consensus about the need to measure qol in dementia trials, as such assessments allow researchers to evaluate the benefits and harms of a treatment and elements of health not detected by standard clinical outcomes . However, it is very difficult to determine qol in persons with late - stage dementia as they cannot communicate reliably and are not involved in activities widely accepted by others as rewarding . Due the severity of cognitive impairment of patients with moderate to severe ad, assessment must rely on proxy reports or direct observation . Unfortunately, both of these approaches tend to exclude consideration of the patient s subjective experiences, which many believe to be an inherent feature of qol . The quality of life in late - stage dementia (qualid) scale was originally developed by weiner and co - workers in 2000 . The qualid is a late - stage, dementia - specific questionnaire with a one - week window of observation . It provides information about the patient s quality of life through assessments made by proxy informants . The scale consists of 11 items, comprising both positive and negative dimensions of concrete and observable mood and performance, thought to be indicative of qol in late - stage dementia . The items are rated by frequency of occurrence on a five - step scale, and scores are summed to range from 11 (best qol) to 55 (worst qol). While the qualid scale has been shown to obtain reliable estimates of qol and validated in patients with severe dementia residing in long - term care facilities, little is known about the scale s responsiveness to change due to therapeutic intervention . The objective of this study was to assess the responsiveness of the qualid scale to changes in bpsd due to a therapeutic intervention in a population of long - term care residents with moderate to severe ad . As well, this study evaluated the relationship between the qualid scale and the severity of bpsd as determined by standard validated research scales . Patients with moderate to severe ad (mini - mental state examination [mmse] score 15) and agitation / aggression (neuropsychiatric inventory nursing home version [npi]-total score 10, npi - agitation / aggression score 1) at two long - term care sites were recruited to enter a three - month, open - label trial of 10 mg bid memantine, which has been shown to have a beneficial effect on memory and behaviour in ad patients . This study was approved by the sunnybrook health sciences centre research ethics board, and was conducted in compliance with all relevant federal guidelines . Assessments were conducted four times throughout the study: at baseline and months 1, 2, and 3 . Npi clinical global impression caregiver (cgi), and cohen - mansfield agitation inventory (cmai) were assessed at each visit by a trained research assistant with the patient s primary nurse . The designated primary nurse working with the patient also completed the qualid at baseline and endpoint (either month 3 or at time of discontinuation if the patient terminated early). The npi assesses behavioural disturbances in nursing home patients with dementia and consists of 12 subscales examining specific symptom domains, including agitation / aggression and depression . The cgi is a seven - point, observer - rated scale that measures global improvement or change and therapeutic response . The cmai is a measurement of agitated behaviour in patients with dementia consisting of 29 behaviours rated on seven - point frequency and disruptiveness scales . The mmse, used extensively in clinical research on patients with dementia as a measure of cognition, is scored on a scale of 030 based on various domains of cognitive functioning . The analysis was based on the intent - to - treat (itt) population using last - observation - carried - forward (locf). Repeated measure anova was conducted on assessments that were conducted monthly (npi, cmai, cgi). Paired sample t - tests were used to compare assessments that were conducted only at baseline and endpoint . The p value was not adjusted for multiple comparisons due to the exploratory nature of the study . Kendall correlation coefficients were obtained between the npi, cmai, cgi, and mmse scales with the qualid scale . Statistical calculations were performed using ibm spss statistics 20 (spss inc ., chicago, il). Patients with moderate to severe ad (mini - mental state examination [mmse] score 15) and agitation / aggression (neuropsychiatric inventory nursing home version [npi]-total score 10, npi - agitation / aggression score 1) at two long - term care sites were recruited to enter a three - month, open - label trial of 10 mg bid memantine, which has been shown to have a beneficial effect on memory and behaviour in ad patients . This study was approved by the sunnybrook health sciences centre research ethics board, and was conducted in compliance with all relevant federal guidelines . Assessments were conducted four times throughout the study: at baseline and months 1, 2, and 3 . Npi clinical global impression caregiver (cgi), and cohen - mansfield agitation inventory (cmai) were assessed at each visit by a trained research assistant with the patient s primary nurse . The designated primary nurse working with the patient also completed the qualid at baseline and endpoint (either month 3 or at time of discontinuation if the patient terminated early). The npi assesses behavioural disturbances in nursing home patients with dementia and consists of 12 subscales examining specific symptom domains, including agitation / aggression and depression . The cgi is a seven - point, observer - rated scale that measures global improvement or change and therapeutic response . The cmai is a measurement of agitated behaviour in patients with dementia consisting of 29 behaviours rated on seven - point frequency and disruptiveness scales . The mmse, used extensively in clinical research on patients with dementia as a measure of cognition, is scored on a scale of 030 based on various domains of cognitive functioning . The analysis was based on the intent - to - treat (itt) population using last - observation - carried - forward (locf). Repeated measure anova was conducted on assessments that were conducted monthly (npi, cmai, cgi). Paired sample t - tests were used to compare assessments that were conducted only at baseline and endpoint . The p value was not adjusted for multiple comparisons due to the exploratory nature of the study . Kendall correlation coefficients were obtained between the npi, cmai, cgi, and mmse scales with the qualid scale . Thirty - one patients were enrolled in the study, with an average age of 85.83.7 years . Twenty - nine (94%) were men . The mean (sd) mmse score at baseline was 8.76.7, reflecting moderate to severe cognitive impairment . Twenty - four patients (77.4%) completed the study; two died of causes unrelated to the memantine treatment, three discontinued due to increasing agitation, one for significant physical deterioration, and one for significantly increased somnolence . At baseline, patients had a mean qualid score of 21.36.2, with a range from 13 to 40 . Table 1 provides the results of changes in outcome measurements over the course of the trial . There were statistically significant differences in scores for npi total (f3,90 = 4.035, p = .010) and its subscale items: agitation / aggression (f3,90 = 3.721, p = .014), and irritability (f3,90 = 3.899, p = .011); and cmai total (f3,90 = 6.301, p = .001) and its subscale items: physical aggression (f3,90 = 5.928, p = .001) and verbal aggression (f3,90 = 3.961, p = .011). No significant improvements were found for qualid (t = 0.278, p = .783), mmse (t = 0.819, p = .419), or cgi (f3,84 = 0.760, p = .520). Outcome measures at baseline and endpoint qualid scores were compared with scores on the npi, cmai, and cgi at baseline and endpoint (table 2). At both baseline and endpoint, the qualid scale was correlated with npi total score (baseline: = 0.270, p = .037; endpoint: = 0.404, p = .002), npi depression (baseline: = 0.332, p = .022; endpoint: = 0.381, p = .008), npi irritability (baseline: = 0.288, p = .034; endpoint: = 0.346, p = .011), and cmai verbal aggression (baseline: = 0.349, p = .009; endpoint: = 0.294, p = .028). The qualid was correlated with npi agitation / aggression only at endpoint (= 0.414, p = .002), as was npi anxiety (= 0.290, p = .049), npi hallucinations (= 0.456, p = .002), npi disinhibition (= 0.322, p = .026) and cmai total (= 0.277, p = .032). Kendall correlations between qualid and other measures correlations between change scores of qualid and other measures between baseline and endpoint correlations were calculated between change scores for the qualid and npi total, npi subscales, cmai and cgi (table 3). Qualid change scores were correlated with change scores in npi apathy (= 0.345, p = .012). However, there were no significant correlations between qualid and cmai, cgi, npi total or any subscales that were correlated with qualid scores at either baseline or endpoint . Concurrent validity was tested by comparing changes scores in patients who improved (n = 19) based on the npi and patients who did not . A decrease in 4 points in baseline score mean change in qualid was similar between groups (t = 0.873, p = .390). It has been suggested that treatments designed to alleviate bpsd may have beneficial effects for patients qol, as a strong relationship between bpsd and qol has been previously observed . The significant relationship between the npi and cmai with the qualid scores at baseline and final assessment suggest that qol is associated with behavioural symptoms in moderate to severe ad . This result supports conclusions drawn by previous studies examining the relationship between the qualid scale and bpsd at a single point in time; however, changes in the qualid score from baseline to endpoint did not correlate with change scores on the npi, cmai or cgi . This lack of relationship suggests that the qualid scale may not be responsive to changes in bpsd . Concurrent validity was also tested, by comparing qualid change scores in patients who improved based on the npi and patients who did not . As the mean change in qualid scores was similar between both groups, this once again suggests that the qualid may not be responsive to changes in bpsd . A previous study looking at the responsiveness of the qualid scale to drug treatment found that the qualid was responsive to the changes in bpsd . The discrepancy in this finding may be due to the difference in study length (i.e., 14 days in the previous study compared to three months in the current). It is possible that any short - term benefits from decreased behavioural problems are washed out by deterioration in overall health status over the long term . The population in the previous study included 31 late - stage dementia patients residing in long - term care facilities who were given either olanzapine or risperidone . The patients had a mean baseline qualid of 30.94 and mean npi of 53.48, both of which are higher than those of the current study and other papers that have studied the qualid scale . This study design reflects a more realistic timeframe for a therapeutic intervention, and is comparable to many other studies using antipsychotics, with a drug that has been shown to improve behavioural symptoms in moderate to severe ad . The population is similar to most other studies in terms of mean qualid and mmse scores, even though the npi scores were slightly higher than those previously shown . Therefore, this analysis presents an appropriate design for a study involving patients with moderate to severe alzheimer s disease residing in long - term care facilities and, as a result, should provide more applicable conclusions regarding the responsiveness of the qualid scale to change when a therapeutic intervention is implemented . It is also unclear whether family caregiver assessment of qol would differ from nurses assessments . It is possible that results attained from the qualid scale are accurate, and that to make an impact in patients qol over the long term, larger changes in behaviour, cognition, and function are necessary . Another possibility is that the effects of memantine were not strong enough to elicit a change in qol in the long - term, despite significant improvements in behaviour rating scales . Another limitation is the fact that the majority of the patients in this study were male, and therefore the results may not necessarily be applicable to the general population of institutionalized patients with dementia . However, gender does not appear to have a significant effect on quality of life in those with dementia . While one study did find that being female was a significant predictor of lower quality of life as measured by the qualid, there was no difference between males and females in actual qualid scores, and the authors did not consider the results robust . It is also unclear whether family caregiver assessment of qol would differ from nurses assessments . It is possible that results attained from the qualid scale are accurate, and that to make an impact in patients qol over the long term, larger changes in behaviour, cognition, and function are necessary . Another possibility is that the effects of memantine were not strong enough to elicit a change in qol in the long - term, despite significant improvements in behaviour rating scales . Another limitation is the fact that the majority of the patients in this study were male, and therefore the results may not necessarily be applicable to the general population of institutionalized patients with dementia . However, gender does not appear to have a significant effect on quality of life in those with dementia . While one study did find that being female was a significant predictor of lower quality of life as measured by the qualid, there was no difference between males and females in actual qualid scores, and the authors did not consider the results robust . Qol assessments provide another format for individuals and their caregivers to express whether an intervention made an important difference in the patient s life . As important clinical decisions may be drawn from perceived qol effects, it is vital that the qol data be reliable, valid, and responsive to change . Although the qualid scale demonstrated that qol is associated with bpsd in moderate to severe ad, it was unable to reflect change when a therapeutic intervention for bpsd was implemented . These results suggest that methods of assessing qol in moderate to severe ad that are responsive to change are still needed, especially if they are to play an important role in assessing treatment benefits.

Subsets and Splits

No community queries yet

The top public SQL queries from the community will appear here once available.