pred_label
stringclasses 2
values | pred_label_prob
float64 0.5
1
| wiki_prob
float64 0.25
1
| text
stringlengths 95
1.02M
| source
stringlengths 39
45
|
|---|---|---|---|---|
__label__wiki
| 0.794377
| 0.794377
|
BASEBALL!!!
BUY PAINTINGS
Art Show VIA MARGUTTA Rome
Posted by Laurie and Blair PESSEMIER at 9:44 AM
Follow by Email Get ARTNOTES in your mailbox
Painting in Italy
Pessemier Workshops - ITALY from Laurie Fox Pessemier on Vimeo.
en plein air Painting with Blair & Laurie from SWiMs Blog on Vimeo.
BUY A PAINTING
BUY A PAINTING or ask a question. Be sure to include painting name and your email address. WE SHIP ANYWHERE
Blog Archive July (1) June (5) May (4) April (3) March (5) February (4) January (3) December (4) November (4) October (4) September (4) August (4) July (2) June (4) May (2) April (5) March (4) February (5) January (4) December (3) November (4) October (4) September (4) August (2) July (4) June (4) May (4) April (5) March (5) February (5) January (4) December (4) November (4) October (6) September (4) August (6) July (4) June (6) May (9) April (7) March (7) February (4) January (5) December (5) November (4) October (4) September (4) August (4) July (1) June (3) May (5) April (4) March (4) February (3) January (5) December (5) November (6) October (3) September (7) August (1) July (5) June (7) May (4) April (5) March (5) February (4) January (4) December (5) November (4) October (6) September (7) July (4) June (6) May (4) April (5) March (4) February (7) January (7) December (5) November (3) October (3) September (6) August (4) July (4) June (6) May (7) April (6) March (8) February (12) January (5) December (7) November (8) October (9) September (11) July (11) June (9) May (4) April (4) March (2) February (12) January (7) December (5) November (6) October (5) September (13) August (4) July (5) June (6) May (7) April (4) March (5) February (5) January (2) December (3) November (1) October (7) September (3) August (7) July (4) June (4) May (20) October (1) June (1) May (3) April (7) March (4) February (4) January (3) November (9) October (10) September (4) July (4) June (8) May (11) April (11) March (13) February (25) January (16) December (10) November (37) October (45) September (15) August (36) July (34) June (21) May (33) April (9) March (42)
Portraits by Blair Pessemier
Pessemier DESIGN
SUMMERBALL: baseball paintings
Laurie and Blair PESSEMIER
Email me at: lfpessemier@gmail.com
Blair and Laurie Pessemier are fine art painters. Blair's roots are in architecture and design -- he is a registered Architect. Laurie holds degrees in fine art and art history. The two painted in Seattle before moving to Paris, France in 1993. Laurie won the mayor's prize for painting on the Champs Elysees in 2000. In addition to painting, Blair works in silver and bronze, producing tableware and furniture. The two have moved, with their dog Harika, to ITALY, in 2015. Contact them at paintfox@aol.com.
PAINTING WORKSHOP ITALY
|
cc/2019-30/en_middle_0059.json.gz/line9
|
__label__wiki
| 0.889916
| 0.889916
|
PM Stalls Signing Compensation Plan for Sugarcane Evictees
Thread: PM Stalls Signing Compensation Plan for Sugarcane Evictees
1st February 2017, 07:00 #1
The Cambodia Daily
Prime Minister Hun Sen has no immediate plans to sign a new petition asking him to endorse an initial plan to compensate thousands of families that have lost land to commercial-scale sugarcane plantations, a member of the cabinet said on Tuesday.
The news will be a blow to nearly 300 members of the families—some of whom are living in poverty—who were in Phnom Penh on Tuesday to deliver the petition to cabinet officials at Wat Botum Park.
Villagers from several provinces gather at Phnom Penh’s Wat Botum Park on Tuesday to petition Prime Minister Hun Sen for help in their land disputes with several sugarcane plantations. (Siv Channa/The Cambodia Daily)The petition asks Mr. Hun Sen to sign off on the terms of reference for a compensation plan involving plantations across Cambodia. An E.U. delegation that imports some of their sugar has been working on the deal with the government for nearly three years.
The petitioners include families from across four provinces: Koh Kong, Kompong Speu, Oddar Meanchey and Preah Vihear. Several of the plantations are or have been owned by CPP Senator Ly Yong Phat.
Soeung Sokhom, a representative for the families, said on Tuesday that they have been informed that the terms had already been submitted to Mr. Hun Sen’s cabinet and were awaiting his signature.
“The people affected by the sugarcane plantations have gone into debt, fallen into poverty and are all living in difficult situations,” he said.
The terms do not promise a quick fix. Should the prime minister sign them, it could take another 22 months to assess the claims, according to the E.U.
After taking their petition, however, Pal Chandara, a member of the prime minister’s cabinet who deals with land disputes, said Mr. Hun Sen would not be signing the terms anytime soon.
Mr. Hun Sen “will not sign because he wants lower officials from the Ministry of Land Management to do this job first,” he said. “Then [Mr. Hun Sen] will sign after the investigation.”
Eang Vuthy, executive director of family advocacy NGO Equitable Cambodia, said the terms were carefully designed with the E.U.’s help to ensure that the investigation remains open to continued input from the communities, the E.U. and NGOs like his.
The terms “will give the ministry responsibility to come up with the mechanism to assess the claims of the affected people and the process to validate the claims,” he said.
(Additional reporting by Zsombor Peter)
pheap@cambodiadaily.com
© 2017, The Cambodia Daily. All rights reserved. No part of this article may be reproduced in print, electronically, broadcast, rewritten or redistributed without written permission.
The post PM Stalls Signing Compensation Plan for Sugarcane Evictees appeared first on The Cambodia Daily.
-- Default Style ---- Blue -- Default Mobile Style
Asia Info
|
cc/2019-30/en_middle_0059.json.gz/line10
|
__label__wiki
| 0.542719
| 0.542719
|
The Australian Society for Operations Research
About ASOR
Office Bearers / Representatives
ASOR Conferences
ASOR/DORS/MODSIM 2017
ASOR News
ASOR Ren Potts Award
Rising Star Award
Branches and Chapters
ACT Chapter
WA Chapter
Notice to SA Members
More to come ...
Career and scholarships
MODSIM/ASOR/DORS 2019 -- ASOR is pleased to once again join with the MODSIM Conference, this time in Canberra, 1-6 December 2019 -- see MODSIM 2019.
In Melbourne, ASOR is once again a co-host of Sci+Tech in the City. Fortnightly from 21 February 2019. Registrations open now, at https://www.eventbrite.com.au/e/scitech-in-the-city-2019-tickets-55314609486.
About the Australian Society for Operations Research
The Australian Society For Operations Research (ASOR) was founded on 1st January, 1972 and has over 200 members nationwide. ASOR, like other OR societies in other nations, is affiliated to the International Federation of Operational Research Societies (IFORS).
The Society's objectives are to:
Foster the development of the science of Operations Research.
Foster the application of Operations Research wherever appropriate.
Foster the widest possible exchange of information and ideas on Operations Research and related subjects.
Define standards of knowledge in and to further the study of Operations Research.
ASOR serves the professional needs of OR analysts, managers, students and educators by publishing a National Bulletin and News, and running events including Conferences and Seminars. We have annual awards for achievement (the ASOR Ren Potts Medal) and up-and-coming people in OR (the ASOR Rising Star Award).
The society serves as a focal point for operations researchers to communicate with each other and to reach out to other professional societies. We run a mailing list for broadcasting information, a Youtube Channel for recorded seminars and tutorials, a LinkedIn Group for discussions and networking, and we also have a Twitter account @ASOR_news. We're a Membership-based organisation, welcoming anyone with an interest in the area.
Professor Costa's ASOR Seminar at RMIT during 2014
Contact ASOR: info@asor.org.au
|
cc/2019-30/en_middle_0059.json.gz/line11
|
__label__cc
| 0.741041
| 0.258959
|
Pawlenty the fiscal liberal
Racist, racist, who's a racist
Features of the blog--The Election Scoreboard
Features of this blog--Cabinet positions
Germany and US united against Iran
More Ohio school education
Just a quick hello
She is a racist, plain and simple
I explained yesterday how the black leaders are not really worried about racism. One of the examples was the rationalization of Hilary Clinton's (D-NY) comments comparing Congress to a plantation. Ah, yes, the time tested tactic of projection...she has an inability to see people without regard to color but she projects that racism onto other people. And of course, as we have been seeing in the Alito confirmations, the Democrat tactic of exploiting the issue of race has reared its ugly head.
Rather than be intellectually honest the Left has been rallying around Clinton's comments. The latest person to fail calling out a racist is Sen. Barack Obama (D-IL).
"I think what Senator Clinton was referring to was … that there's been a consolidation of power by the Republican Congress and this White House," Obama said on CNN's "American Morning" show.
"What you've seen systematically, I think, over the years since the Bush administration came into power is constant consolidation of power by the Republican Party in the White House, in Congress, shutting out Democrats and people who are not willing to pay to play in conference committees -- the various negotiations on legislation -- the K Street project, in which members like Tom DeLay told lobbyists that they could not hire Democrats," Obama said on ABC's "Good Morning America."
No. If that is what she meant on Monday then she would have have said so yesterday. Instead she reaffirmed her comment...which had only one purpose: to incinte racial problems and anger.
Again, these people are not helping race relations they are destroying them. You can not stop a fire from burning your house down when you keep trying to fan the flames.
|
cc/2019-30/en_middle_0059.json.gz/line12
|
__label__cc
| 0.607436
| 0.392564
|
Judge Affirms "Outsourcing" Preliminary Injunction (Amended)*
VOICE OF OC REPORTS LAYOFFS MUST STOP
As announced this morning by Managing Editor Norberto Santana, Jr., in the Voice of OC blog, HERE, Judge Barbara Tam Nomoto Schumann has issued an order prohibiting the City of Costa Mesa from laying off City employees until the case filed by the Orange County Employee's Association is heard. According to that article, no trial date is set at this time.
OCEA PRESS RELEASE
The OCEA, through it's spokeswoman, Jennifer Muir, issued the following Press Release today:
Judge issues order stopping Costa Mesa layoffs
SANTA ANA, CA – A Superior Court judge has issued an order prohibiting the City of Costa Mesa from laying off City employees pursuant to outsourcing their jobs to the private sector.
Orange County Superior Court Judge Tam Nomoto Schumann issued the preliminary injunction late Friday following a verbal ruling July 5. After the Court’s July 5 ruling, the City issued a press release erroneously claiming that Judge Schumann’s ruling would expressly allow layoffs so long as the City followed “proper procedures.”
Judge Schumann rejected a request by the city to allow it to lay off City employees if it followed “proper procedures.” Instead, the order very clearly prohibits the city from contracting out services currently performed by City employees to any non-local public entity under the Government Code, and further prohibits the City from laying off City employees pursuant to any such contracting out.
“We respect the judge’s ruling, and we hope the City Council and CEO Tom Hatch will do the same,” OCEA spokeswoman Jennifer Muir said. “The ruling has been clear from the beginning, and we’re hopeful that now that it has been issued, the written order will clear up any confusion caused by the City’s press release.”
Nearly half the City’s workforce received six-month layoff notices on March 17 after the Costa Mesa City Council majority voted to outsource their jobs. At the time, the City Council had not studied the cost of outsourcing or the negative impacts to community services, and they still have failed to do so.
The Orange County Employees Association, on behalf of the Costa Mesa City Employees Association, filed a lawsuit in May to stop the layoffs.
Attached, please find the order for a preliminary injunction, the judge’s minute order, the City’s July 5 press release, and a copy of the City’s proposed injunction language, which was rejected by the Court.
NO WORD FROM THE CITY YET
I tried to contact representatives of the City of Costa Mesa for comment but was unable to reach anyone before I published this. I imagine word from the City will be forthcoming later today. When it does I'll report it.
*CITY RESPONSE TO THE RULING
The following is the response to the ruling by the judge, issued in the form a press release by Interim Communication Director Bill Lobdell late this afternoon:
Judge temporarily prohibits Costa Mesa from outsourcing jobs to private
companies until lawsuit is heard; contracting to public agencies OK
COSTA MESA, CALIF.—Orange County Superior Court Judge Tam Nomoto Schumann issued a preliminary injunction late last week prohibiting the City of Costa Mesa from outsourcing jobs to private companies until a lawsuit filed against the City by the Costa Mesa City Employees Assn. (CMCEA) is heard.
No trial date has been set for the civil suit, which seeks to halt the outsourcing plan. The ruling doesn’t prohibit the City from contracting jobs with the County of Orange, neighboring cities and other public agencies or exploring the viability of outsourcing services to private companies.
The ruling also doesn’t affect a proposal by the Orange County Fire Authority to provide fire services for Costa Mesa and hire all City firefighters. The Costa Mesa Firefighters Assn. employees are not covered in the injunction.
The written injunction clarified initial remarks made at a hearing on July 5 by Judge Schumann, who said at the time: “So as far as the City’s ability to explore other avenues of perhaps fiscal soundness, I do not think that this injunction extends to preventing the City from doing that as long as they do not terminate folks without following the proper procedures.”
Schumann did not make a reference to halting outsourcing to private companies until a verdict was reached in the CMCEA lawsuit (see transcript below).
The City Attorney’s Office had originally interpreted the judge’s oral remarks to mean that the outsourcing process—including the potential contracting of jobs to private companies—could continue as long as the City could show that it had followed “proper procedures.”
“The injunction makes it clear that the judge has ordered the City to not outsource jobs to private companies until the CMCEA lawsuit is concluded,” City Attorney Tom Duarte said. “We respect her decision and are now looking at our next legal options.”
In March, the City Council voted to send six-month layoff notices to 213 city employees—more than 40% of its workforce. The Council wanted to explore the viability of outsourcing to stem rising pension costs, among other concerns. Because of contracts with employees’ association, the City was mandated to give six-month warnings for any outsourced job.
COURT REPORTER'S TRANSCRIPT OF 7/5/11 SESSION
Read the Court Reporter's Transcript of the July 5, 2011 court date HERE. This should download a pdf file to your desktop.
Labels: Barbara Tam Nomoto Schumann, Jennifer Muir, Norberto Santana, OCEA, outsourcing
I can't wait to see what the spin will be. It will be entertaining for sure as it will not be based on reality...
The party line later today:
"The judge didn't say there was no budget crisis, only stuff about procedures. We still have a crisis and we will still need to go full steam ahead somehow, some way. The judge got it wrong. Only The RiggMarshal knows what's right for Costa Mesa."
Spin, Lobdell, spin!
WWrigD said...
CM Press Release:
Rig asks City CEO to cut more cops and transfer funds to the legal fees fund..ASAP
Pentagon Hexagram said...
Prediction on Costa Mesa Ministry of Truth out with their spin.
Judge's ruling validates City's position, doubles amount of bond required to cover potential loss by City.
Ruling by this liberal judge will be appealed.
All outsourcing studies will continue.
Reinforcements added to Ministry of Truth and legal team, because the union made us do it.
Meanwhile, beatings will continue until morale improves.
Terry Koken said...
Hey, Geoff--
If there's enough of a crowd at the Tuesday meeting, I've got another little melody for them. This one has a chorus that everybody can join in to, even the city councilmen.
Good news, though, tends to decrease attendance at meetings, I've noticed, and THIS is REALLY good news.
well obviously... said...
The next press release:
"Judge's ruling does not mean we cannot outsource the city council to other public entities. As many members of the public are already aware, the Costa Mesa city council is in the top third of their counterparts in total compensation and we just can't stand for that anymore either. Nobody should get paid that much no matter what their part-time job is and as we all know from the private sector running a city like a business means that volunteers (i.e. council members) do not get paid."
Thoughtfully serving the public,
The 5th Floor Thought Bureau
Tom Egan said...
These Press Releases are hilarious! You've nailed the voice of the Rigged council.
Who'd have thought that the recent abominations would have spawned a crew of people who could go forth even unto other cities and help them spin their dodgy decisions? (And make a mint at the same time.)
OCLonghair said...
I want a job where you can give bad and most of time, wrong advice. Then when you get called to the carpet, you get paid to argue that, “The advice was only a suggestion” and “I have no control over how others interpret or use that advice”... NOW SIGN THE DAMN CHECK!!!!
GOD... I love capitalism.
sky stopped fallingwow said...
wow, did anyone else catch the channel 9 news at noon when PERS released they had their best return in 14 years with a 23 billion dollar return on all investments... now what maybe the bell 4 should have pers do their investing fore them an solve all the citys problems........
Here's the link to the CalPERS Press Release:
http://www.calpers.ca.gov/index.jsp?bc=/about/press/pr-2011/july/fy-2010-11-returns.xml
Pretty impressive news, for sure.
Danny Boy said...
Hey Lobdell- Where is the City Press Release on the website?
"Carmageddon" Observations (Amended)*
It's That Time Of The Year - Again
Grazin' With My Fellow Gray-Hairs
Fairgrounds Sale Officially Dead
Tuesday's Council Meeting Agenda Reviewed (Amended...
"Outsourcing" Infection Spreads
An Odd Tag Team Match On Friday
MAJOR GANG BUST (Updated)*
Study Session and RDA Meeting Today
Gazsi Named Costa Mesa Police Chief!
|
cc/2019-30/en_middle_0059.json.gz/line15
|
__label__cc
| 0.718623
| 0.281377
|
You are here: Home / Apple / Favorite iPhone/iPad Apps
Favorite iPhone/iPad Apps
November 26, 2010 by stephenfleming
It surprises people that, as a well-assimilated Apple fanboy, I didn’t buy the first generation iPhone. I was in the store on launch day, I had one in my hand, my credit card was burning a hole in my pocket… and I left without one. I used my Treo for nearly another year until the 2nd generation iPhone (confusingly named 3G) was released. I wasn’t waiting for the faster network connection or for the GPS chip, or cut-and-paste, although those were all nice. No, although I couldn’t have articulated it at the time, I was waiting for the App Store.
Remember, I was coming from years in the Palm ecosystem, where third-party apps were a key part of the experience. I was utterly reliant on a couple of them (in particular, an RPN calculator… having been converted to the RPN Way by HP calculators in my youth, I simply cannot use “normal” calculators without an Enter key!). So the first-gen iPhone had lots of promise, but it wasn’t ready for me yet. Web apps looked interesting, but until developers got hold of a native SDK, I kept my money in my pocket.
Once the App Store was announced, I knew I was hooked. In fact, I bought my first iPhone app on July 10, 2008, the night before the iPhone 3G was released… yes, I had that much faith in Apple (and James Thomson, author of PCalc) that I spent ten bucks on an app without hardware that I could run it on!
And, although I didn’t know it, I was participating in an interesting experiment in app pricing. In the early days, I bought several apps for $9.99 or even more. Soon, those apps found their prices cut to $6.99, $4.99… or they were abandoned entirely. A few apps hovered about the magic ten-buck point, but most were driven down by the competition from free and 99¢ apps.
Lots of people have blogged about the race to the bottom, and I have nothing useful to add there… except that I never hesitate to buy a paid app if it looks like it does something I need, or even want. I’ve spent more than the price of that first iPhone in the App Store at this point, and I don’t mind. Software developers gotta eat, and I don’t mine supporting them with a couple of bucks here and there.
Of course, sometimes the app turns out to be less polished than I hoped, or buggy, or just doesn’t get updated when needed. So I wind up buying a lot of apps, experimenting with them, and letting them languish in a rear page, or delete them from my devices entirely.
People are always asking me “So, what apps should I get for my iPhone/iPad?” That’s hard to answer, since I don’t know your needs or your budget. All I can do is give you a list of the apps that I use, many of them daily, and frequently after downloading and trying a lot of competitors. (I think I’ve bought six calendar applications, and I shudder to think how many Twitter apps. I’ve settled on what I think are the best.)
I’ve blogged about this before, but that was almost two years ago, and before the iPad… and things change.
So, in honor of Black Friday, here’s my list of my favorite iOS (iPhone, iPad, and iPod touch) applications. Click on any icon for a link to the official App Store description.
Apple iWork Suite
News / Information
$2.99 (free trial available) iPhone only
Calvetica Apple’s Calendar is gorgeous, but it’s a surprisingly clumsy user interface. (It’s only with the latest iOS release that you can actually change the category of an existing entry!) Since I juggle thirteen Google Calendars, I get frustrated with a “one size fits most” calendar. I’ve tried almost every replacement calendar in the App Store, and this is the only one that has earned a place in my iPhone Dock. No iPad version yet, but I’m optimistic…
Free Universal
Google Mobile Google may be occasionally evil these days, but their apps are darned good. I like the voice search and the Google Goggles. Free!
Zenbe Lists There are a zillion to-do list applications out there. This one keeps a position on my home screen for one fundamental reason: painless syncing from the cloud to multiple devices. The real-world use? My wife and I can share a single grocery list (and Home Depot list, etc.). If one of us goes shopping alone, we’re sure we have the most current version. I don’t understand Zenbe’s business model in giving this away, but I’d miss it if they stopped.
Twittelator Pro I don’t know… is Twitter a “productivity” app, or an “anti-productivity” app? Probably a little of both. What’s definitely not productive is downloading and testing ten different Twitter clients. I’ve done that, so you don’t have to. Lots of them are good; some are very good. For my money, Twittelator Pro is the best of the bunch on the iPhone. There’s a free trial available if you don’t want to risk five bucks on my say-so.
$4.99 iPad only
Twittelator for iPad Unlike on the iPhone, the competition on the iPad isn’t even close (in my not-so-humble opinion). Twittelator for iPad is a complete rethinking of the user experience, and I like it a lot. Once Andrew adds “Open Web Pages in Safari” as a prefs item, it’ll be darn near perfect. (He had to wait for iOS 4.2 for that to make sense, so I expect it any day now.)
SimpleNote I can’t count the number of note-taking apps on the iOS platform. I love SimpleNote because it’s as simple as advertised. Doesn’t try to be all things to all people, but it’s a quick, easy, legible way of writing myself notes, and accessing them on other devices, including my desktop. And they’re a Y Combinator startup! I give them $12/year for “Premium” service, even though the free version meets all my needs.There are multiple desktop clients available to sync with SimpleNote’s server; I use JustNotes for the Mac, but others work as well.
iA Writer This one is iPad-only. Some of the design decisions in this app drive me crazy. But I love it for two reasons:
The gorgeous custom font, Nitti Light, which is the most legible monospace typeface I’ve ever seen to on the iPad. And maybe it’s my teletype heritage, but I compose better in monospace.
The expanded keyboard with cursor keys (yippee!) and other controls that may offend Steve Jobs, but which lighten my load every time I’m composing text.
SimpleNote works well by staying out of my way for a few sentences at a time. If I’m typing more than half a page on my iPad, I want to use iA Writer.
Evernote Theoretically, Evernote could replace both of the above apps. I find it too “heavy” to use for cranking out quick notes to myself, and the UI doesn’t match iA Writer for longer text. Where Evernote shines for me is in taking photographs (I’m particularly guilty of photographing the covers of books I want to buy) and OCRing them in the background so that they become searchable text. I suspect some low-wage English-speakers in India or China are chained to their workstations to type whatever they read in your photos, but I honestly don’t know. Synchronizes with an equally powerful client on your Mac or PC (or on the Web). There are paid options available if you turn out to be a heavy user.
$9.99 (free trial available) Universal
PCalc As I said earlier, I waited to buy an iPhone until PCalc was available. I use it every day on my Mac, and now I use it every day on my iPhone. Gorgeous implementation… not a slavish recreation of my beloved and still-operational HP-15C (although those recreations exist; I’ve bought them) but a rethinking of what’s necessary in an RPN calculator and what can be hidden. (Oh, yeah, there’s an algebraic mode, too, but I’ve never paid it any attention.) Multiple “skins” available to get the appearance you’re looking for. Comparatively expensive for an iPhone app, but worth it.
$4.99 Universal
PowerOne Financial If I run into a calculation that’s too complicated for PCalc but not complicated enough to open a spreadsheet, I usually reach for PowerOne. It’s a descendant of the RPN calculator I used to use on the Palm, but vastly more powerful with customizable worksheets (things like Time Value of Money where you can actually see all the variables, not just stuff them into the stack like an HP-12C). My only complaint is that the interface is ugly; I wish Infinity Softworks would implement custom skins like PCalc did.
$11.99 Both (single platform versions $7.99)
1Password Pro I use a new randomly-generated password for every Website that I visit. So I need a secure place to keep them. After using SplashID for years on the Palm OS, I paid for both 1Password and SplashID on the iPhone. After a long period of using them in parallel, I settled on 1Password. Frequent updates, and a great Mac client that syncs automatically over Wi-Fi and integrates with Safari or Firefox on your desktop.
$1.99 iPhone only
Favorites Simple speed-dialer that sits in my Dock and lets me dial or text my most frequent contacts with one touch. Does exactly what you’d want it to, and nothing that you wouldn’t want it to. Probably overpriced but, seriously, can’t you afford two bucks?
ReaddleDocs for iPad I’ve said before that ReaddleDocs for the iPad is reason enough to own an iPad, and I still believe that. The ability to carry thousands of documents in a slim searchable slab has changed my life. Rather than having folders upon folders of paper printouts, I just forward any attachment (PDF or Microsoft Office… probably others, but those are the ones I care about) to my Readdle email address, and sync just before walking into a meeting.I’ve sold several iPads with this app. Good Reader has similar functionality, but until someone comes up with a better user interface (which, honestly, wouldn’t be difficult) or better customer service (which would be hard!), I love Readdle and use it every day.
ReaddleDocs Readdle Docs for the iPhone synchronizes to the same cloud storage space as Readdle Docs for the iPad. It’s a less compelling experience just because of the inevitable limitations of the smaller screen. Where I’m likely to open a spreadsheet on my iPad and pass it around a conference table, I’m not going to do the same with my iPhone. Nevertheless, it’s nice to occasionally have access to documents when I don’t have my iPad with me, and Readdle serves that niche nicely. You have to buy them separately, which is an odd choice on the company’s part; I wish they sold a Universal version for 2/3rds the price of the two apps sold separately. Maybe someday.
ToDo for iPad How many to-do applications are available for iOS? Certainly dozens, probably hundreds. Most of them are pretty interchangeable. ToDo by Appigo is different. First, it’s gorgeous… someone really sweated the details on the UI, and it shows. Next, it integrates well between iPhone, iPad, Web (via Toodle-Do), and other services (like Jott). Finally, the developers seem to pay attention to how people actually work, rather than trying to shoehorn us into “Getting Things Done” or any other system. I like it.
ToDo Bought as a companion to the gorgeous iPad version above, but really good enough to be bought just for the iPhone. Nicely done.
Instapaper What Readdle Docs does for attached files, Instapaper does for Web pages. Ever get into “tl;dr” (Too Long, Didn’t Read) mode when reading the Web? Instapaper solves the problem. Install a bookmarklet in your browser (desktop or iOS device) and, whenever you get to a page that’s too long, click “Read Later.” Instapaper magically figures out the part of the page you want to read (meaning, not the ads and the blogroll and the other cruft) and sucks it into the cloud. Sync your iPad, and all those articles wind up in local storage, so you can read them at leisure when waiting for a haircut or whatever… no network connection required. Beautifully crafted, obsessively supported. You need this app.
Consistency This app is for repetitive tasks that need to be tracked, but that you don’t need to schedule on your calendar. Example: I need to oil my bicycle chain once a month, but if I’m a week early or a week late, it’s no big deal. Consistency is brilliant for things like that.I used to use the desktop version of this app and I like the idea a lot. I was pleased to find it available for the iPhone, so I bought it without doing my research.I’m mildly astonished to find that it doesn’t use iPhone notifications (badges, dialogs, sounds). And I’m disappointed that there’s not a “cloud” option to sync lists between my iPhone and iPad. I’d pay a modest amount for that.
Considering it hasn’t been updated in over a year (Yoo-hoo, Sciral! There’s this thing called iOS 4; you might have read about it!), I guess we have to treat this app as abandonware. A shame, really, since I don’t know of anything else that works precisely this way.
WordPress I don’t blog a lot away from my keyboard, but it’s nice to be able to fix a typo or approve a comment while on the go. After a rocky start, the WordPress app has matured to a solid client on both iPhone and iPad. If you have a WordPress blog (self-hosted or on WordPress.com), you need to check this out.
Skype I don’t use Skype a lot, but it’s nice to have for that occasional international phone call. And it’s a nice multiplatform chat interface that most people will either have, or be willing to install. The iPhone client works well, and it’s free.
$9.99 each iPad only
Numbers These three get special treatment. Keynote, Pages, and Numbers together form Apple’s iWork suite… originally for the desktop, and redesigned to launch with the iPad.I have my issues with these three apps, but they’re still worth the money. First off, they ought to be named “Keynote Light,” “Pages Light,” and “Numbers Light”… Apple did a good job of focusing on the 80% of features that everyone really needs, but sometimes one of the 20% they eliminated will really bite your project in the butt. In particular, I keep running into limitations with Keynote (master slides, complex animations, fonts, and complex groups) that badly break certain of my slide presentations.Next, the process for getting documents from the desktop version of iWorks applications into and out of the iPad Apps is just hostile. It takes about ten steps, none of which intuitively leads to the next. This is very “un-Apple” and I have to believe that Apple has a major cloud-based solution to this (maybe making Mobile Me worth the cost?) but it’s just not ready yet. I hope so. But, for now, if you think that having iWork on your desktop and on your iPad means you can edit the same document in both places… you’re wrong. You can create a document on your desktop, export it to your iPad, and (most) things will work… but if you make changes on your iPad, you need to export it back to your Mac as a new document. No synchronization, no audit trail, no acknowledgement of cloud-based workflow at all. Ick.
All that being said, it’s really cool to walk into a room carrying just your iPad and a VGA dongle, and running the whole presentation from your touchscreen. Major ego boost.
Kindle I’m one of those weird people who bought a Kindle after buying an iPad. Different screen technologies, different use cases. I love them both. We’ve bought a lot of books on Kindle, and it’s great to have them with me wherever I go… including the surprisingly-capable screen on the iPhone 4. Synchronization is painless, and the feature set is more than adequate.
Stanza Oddly, the best e-book reader on the iPhone or iPad is made by Amazon, but it’s not Kindle. It’s Stanza. Formerly a standalone company (Lexcycle), Amazon bought the developer in early 2009, and I was terrified that it meant the death of this superb application. But they released an iPad update more or less on schedule, and have clearly not abandoned the product.It’s a better reading experience than Kindle, with a more mature set of interface options (it’s been around longer!), and it integrates into a wide variety of paid and free e-book sources. I tend to want to buy everything that Toni Weisskopf at Baen Books publishes, and Stanza makes that painless. Maybe too painless. Hook it up to Calibre on your desktop, and you can easily see how I have over 200 books on my iPad.
Free iPhone only
The Weather Channel Another of those ecological niches where I’ve downloaded at least six free and paid apps. The Weather Channel isn’t just the hometown team here in Atlanta; I think they’ve built the best app. (There’s a paid upgrade, but I haven’t felt the need to buy it.)
Free iPad only
WSJ I gave up on my dead tree subscription to the Wall Street Journal years ago, but I missed it. Now I don’t miss it anymore. The first release of this app for the iPad was absolutely terrible, but they’ve iterated rapidly, and the current version is great. Everything you need so that you’re no longer sitting there looking stupid when someone asks “Did you see the article on such-and-so in the Wall Street Journaltoday?”Now, if they’d just get rid of their obsession with fully-justified typography. Hint: Ragged-right looks better on narrow columns!
Free (for now) iPad (iPhone version also available)
NYTimes The New York Times has experimented with various pay and free models, so I don’t know where they’ll wind up. For now, the gorgeous iPad app has the entire content, every day. The Grey Lady’s business model is probably doomed, but it’s hard to beat having the entire paper on your iPad every day.
Free (with paid print subscription) iPad (iPhone version also available)
The Economist I used to be addicted to print magazines… at one point, I was receiving over 50 per month. (I read fast. Really, really fast.) The Internet killed that little habit, and now I enjoy letting print subscriptions lapse, but one that I never hesitate to renew is The Economist. The iPad version is gorgeous and, if you have a paid print subscription, you get the entire magazine online every week. It downloads to local storage so you can read it on the plane without Wi-Fi. Perfect!
AJC Select Sadly, the local paper has seen better days… a 50% drop in print subscribers will do that to you. And now that it’s moved to Dunwoody, the Atlanta Journal Constitution seems to be becoming the “North of I-285 Journal Constitution.” But there’s no substitute for the AJC when you want to find out about a local city council meeting, or the schedule for the Peachtree Road Race. (And their Twitter accounts are great!)
Flipboard Flipboard is a Twitter client, but it’s also a lot more. It scrapes multiple services (your choice) and reformats stories into a customized online magazine. Beautiful UI; this is the simplest way I know to kill time while feeding my brain, as long as I have a Wi-Fi connection available.
Regator Premium Another hometown team (Decatur, Georgia), but with a national reputation. Regator hand-selects blog feeds from your topics of interest and presents them in a constantly-curated collection. This is where you’ll find those stories that’ll never make the New York Times… or, occasionally, where you’ll find big stories before they make the New York Times.
Free iPad (iPhone version also available)
TED TED has been called “the new Harvard.” I don’t know if I believe that, but the TED talks are extraordinary. Their self-description: “Riveting talks by remarkable people, free to the world. TED presents talks from some of the world’s most fascinating people: education radicals, tech geniuses, medical mavericks, business gurus and music legends.” I don’t usually have the patience for videos or podcasts, and I wish TED had a text transcription but these are good enough to be worth an exception.
AutoStitch Panorama Can’t get everything you want into the camera frame? Take multiple photographs and stitch them together into a (vertical or horizontal) panorama. Better UI than Photoshop on your desktop, and it runs on your phone! We really are living in the future. (I’ve listed this as a Universal app, and it indeed runs on the iPad, but it makes most sense on the iPhone where you have a camera.)
SmugMug I have set up picture-sharing free accounts on Flickr, Picasa, Shutterfly, Ofoto, and probably others. But I cheerfully pay for a SmugMug account because it’s just better. My only complaint is that not enough other apps integrate with it, I guess because of the smaller user base… but those users are vociferous fans, and include many professional photographers who use SmugMug galleries in their day job! The iPad app is a delightful way to browse through your photos and show them off to others.
$3.99 iPad (iPhone version also available)
Photogene It’s not Photoshop, but it’s amazing. The range of photo manipulations you can perform on a handheld device would have been dismissed as impossible only a few years ago. I’ve downloaded lots of photo utilities, but this one lives on my iPad’s home page.
ColorSplash A one-trick pony, but what a cool trick! Convert your photos to black-and-white, then “paint” the color back into place for selected regions. Great user interface, and you wind up with striking photos to save or share. Yeah, you can do this in Photoshop, but not as easily, and not nearly as enjoyably! Spend the buck.
JotNot Scanner Pro Another one-trick pony. Take photos of documents (receipts, business cards, or full-size sheets of paper) and JotNot will square them up and crank up the contrast to make them surprisingly legible. I’ve emailed people photographs of documents rather than finding a fax machine, and it worked beautifully.
MotionX GPSLite A surprisingly good free navigation program. All sorts of downloadable maps, with waypoints, tracks, and more.There’s an HD version available for the iPad that’s even prettier.
$39.99 Universal
TomTom USA I have a standalone Garmin GPS that I like, but I can’t imagine buying another one. TomTom works without a network connection (important in rural Georgia!) to give you turn-by-turn navigation based on an internal database. (Which is enormous, by the way… you need more than a gigabyte free on your device to install this app.) Good user interface, with all the bells and whistles you’d expect, and a few you might not.
GoSkyWatch Go outside at night. Look up. What the heck is that star? With GoSkyWatch, you have a planetarium inside your iPhone. Point it at the sky, and you can instantly figure out “Oh, that’s Vega! Cool!” Uses the accelerometer
Star Walk Both StarWalk and GoSkyWatch are now universal applications, running on iPhone and iPad. Maybe it’s just my personal experience with the apps, but I tend to default to using GoSkyWatch on my iPhone, and StarWalk on my iPad. StarWalk is utterly gorgeous… a few missing features, but you won’t care. Usually three bucks, on sale today for a buck. Buy it.
Google Earth Possibly the greatest toy ever. If you’ve used it on your desktop, you’re still not prepared for how utterly magical (hat tip to Steve Jobs) it is on an iPad. It’s free. Why haven’t you downloaded it?
$0.99 iPhone 4
Flashlight I have no clue how many flashlight programs there are for the iPhone. The earliest zillion of them just turned the whole screen white. This was the first of a new generation that lights up the (incredibly bright) LED of the iPhone 4 camera flash. Sucks up your battery if you leave it on too long, but it’s brighter than those keychain flashlights, and you always have it with you. There are free ones out there, but this one is nicely done and well worth a buck.
PrintBureau Perhaps the most misnamed app in the iTunes Store. Yes, it manages printing… I can print directly from my iPhone or iPad to my wireless inkjet printer. (Which Apple promised as a feature of iOS 4.2, then crippled at the last minute. It’ll probably come back someday, but PrintBureau works now.) But it also handles cloud storage, and acts as a Wi-Fi hard drive, and has an email client, and probably makes julienne fries. I can’t keep track of everything this app does, but it’s a heck of a lot more than printing.(To print, it runs a helper app in the background on your Mac or PC, which is irritating, but it doesn’t take too many resources and has never crashed my Mac.)
Dropbox Apple, will you just buy Dropbox and put iDisk out of its overpriced misery? As far as I can tell, Dropbox has become not only the default cloud-storage service for iOS devices, but is darned near the file system that iOS tries to hide from you. Integrates seamlessly with your desktop (at least on the Mac; Windows and Linux versions exist, but I’ve never used them). A great way to move files back and forth, to make backups from your portable device, to share files with other people, whatever. I feel guilty for using the free version so heavily and probably ought to buy more storage space, but 2 gigs has proven to be enough for what I do.
JungleDisk I back up all of my Macs to JungleDisk, all the time. My files live safely on Amazon’s S3 servers. If someome steals all my computers, I’ll be angry, but I won’t be out of business. (Yeah, I have the ridiculously-long S3 keys printed out in my fireproof safe.) The iOS app lets me browse and manage those files… including occasionally pulling down a new version of a presentation that I forgot to move to Keynote for the iPad. Amazon S3 isn’t free, but the JungleDisk app is.
Pandora Radio What’s there left to say about Pandora? All the music in the world, streamed to your device, free, and in (to my ears) great quality. The only drawback was that you couldn’t run it in the background, but that’s been fixed by iOS 4.2. This ought to be burned into the ROM of every iDevice in the world.
Netflix At first, it was just cool to manage my Netflix queue from my iPhone without firing up a Web browser. Then they implemented streaming, and changed the world. Watch thousands of movies and TV shows on your phone or iPad, connect it to an external TV set, pause and pick it up later… yep, this is exactly the way it’s supposed to work. No wonder Blockbuster is in Chapter 11. Or that we disconnected our cable TV service, and don’t miss it.
SoundHound Whenever you’re out somewhere and hear a song and wonder what it is… run SoundHound and give it a try. If there’s not too much background noise, it’s amazingly accurate at identifying prerecorded music, and will instantly show you lyrics and a link to buy the song in iTunes. They claim to be able to identify songs that you hum or sing into the mike, but I’ve had pretty poor luck with that. There’s a paid version if you use it frequently, but the free version seems adequate for most needs.
Myst It’s back! The game that sold a lot of color Macintoshes (yes, kiddies, Macs used to be black and white) migrated to the iPhone in fine form. The same puzzles, the same music, and the same backstory that we obsessed over back in 1993. (I basically spent a week over Christmas that year solving Myst.)It’s arguably even better with a touch interface. There’s not a separate iPad version, but the graphics look fine in 2X mode. (Warning: the app is huge, so make sure you have a gigabyte free before purchasing it.)
$1.99 Both (enhanced iPad version available)
Romi If you’ve ever played Rummikub, you instantly understand Romi. If you’ve ever played a rummy card game, you’ll understand in about thirty seconds. Nice interface (needs custom skins, though) and intelligent gameplay. Excellent execution for two bucks. The iPad version is identical except for higher-rez graphics.
Word with Friends I was so excited when Electronic Arts released Scrabble for the iPad! I bought it immediately, and it played exactly like the cardboard version. Exactly. There was a cool feature where you could “flick” tiles from your iPhone/iPod Touch to the main iPad screen, but basically, you needed to be sitting around a table with the other players. So, for four players, you’d be using $1300 worth of electronics to replace a ten-dollar board game. EA (and Hasbro/Milton Bradley) managed to miss a technological revolution named “the Internet.”Newtoy — a tiny company in McKinney, Texas — did it right. They published a modified version of the Scrabble board (to avoid copyright issues, I’m sure) and connected it to the Internet. Now you could play a Scrabble-like game with friends or strangers anywhere in the world… and asynchronously, so you didn’t have to try to coordinate schedules. If you’re both online, you might complete a turn within seconds; if not, the next turn might be hours or days later.Absolutely brilliant, absolutely addictive, and an absolutely wonderful way to spend time. There’s a free version with on-screen ads, but send NewToy two bucks. They deserve it.
$1.99 (free trial available) iPad only
Words with Friends HD Same feature set as the basic version, but even more beautiful (and easier to play) on the big screen. Again, a free ad-supported version is available but, if you play as often as I do, it’s worth two bucks. (My screen name is ‘stephenfleming’; feel free to challenge me. I will crush you.)
$19.99 iPad only
Acid Solitaire I bought this set of three solitaire card games during a brief promotional sale for five bucks. I know $20 is a lot for an iPad game, but it’s beautifully done. I’ve experimented with a few other solitaire games from other developers, but I’m glad I have this one to play.(My wife developed carpal tunnel syndrome from AcidSolitaire… you have been warned!)
$0.99 (free trial available) Both (enhanced iPad version available)
Angry Birds Saving the best for last! This is the most expensive dollar I ever spent… I’ve spent over thirty hours playing this game, which, at my loaded labor rate, it…. (mumble, mumble, mumble) a lotof money.You know the drill… you use a slingshot to fire various kinds of birds at fantastically-unlikely “forts” protecting evil pigs. Silly. Instantly accessible. Difficult to master. I’ve gotten three stars on all 165 levels, and all 17 golden eggs, but I tend to get compulsive. (Which is why I usually don’t playcomputer games!The iPad version has better graphics and it easier to play, but accomplishments on the iPhone don’t unlock higher levels on the iPad (or vice versa). Similarly, Apple’s GameCenter treats it as a completely different game, so achievements on one platform won’t translate to the other. I bought both, but found myself playing more on the iPhone just because I always had it with me. I hope the developer fixes this, once they finish wallowing in their Scrooge McDuck money room!
This turned into an absurdly long blog post (over 9,000 words), but I hope it’s useful to someone. Avoid “tl;dr” and try it in Instapaper!
Filed Under: Apple, Favorites, Geeky, Main
Anne Fuller says:
Thanks Steve! Great list. I’m going to add some more apps now! Just got the Ipad for Christmas and still figuring if it can replace a laptop or not…
Vic Gundotra HTML5 offline feature for iPhone 3G and HTC Magic | Android Mods says:
[…] Favorite iPhone/iPad Apps | Academic VC […]
Tweets that mention Favorite iPhone/iPad Apps | Academic VC -- Topsy.com says:
[…] This post was mentioned on Twitter by Stephen Fleming, Melissa Zbeeb. Melissa Zbeeb said: RT @StephenFleming: AcademicVC: Favorite iPhone/iPad Apps http://bit.ly/hhrm5L […]
iPad App Video Review: Cover Orange | Wicked Games says:
Favorite iPhone/iPad Apps: Spring 2012 Update — Academic VC says:
[…] Two years ago, I wrote “Apple, will you just buy Dropbox and put iDisk out of its overpriced misery?” Well, iCloud has killed iDisk, but Dropbox is doing just fine after turning down Steve Jobs’ offer. As far as I can tell, Dropbox has become not only the default cloud-storage service for iOS devices, but is darned near the file system that iOS tries to hide from you. […]
|
cc/2019-30/en_middle_0059.json.gz/line16
|
__label__wiki
| 0.611968
| 0.611968
|
Australia Western Sahara Association
Working for justice for the Saharawi people
About Western Sahara
YouTube & weblinks
Membership & help
AWSA membership or Renew
Greeting Cards order forms
Perpetuity can not overshadow the $ 200 million annual stolen phosphate
Equip Media EMSahara
Equip Media
Monday, June 5th 2017. The trial of the Saharawi political prisoners of the Gdeim Izik group opened before the Court of Appeal in Salé – Morocco. activists for the independence of Western Sahara and Human rights defenders , but also the lawyers by their absence protest against this unfair trial whose first hearings were held on March 13th 2017 after months of postponements.
On June 6th, in the space authorized for the Saharawi demonstrations, surrounded by the hubbub of Moroccan sound systems friends of Sid Ahmed Lamjayed sentenced to life imprisonment expressed their support and demands, among 80 other demonstrators.
On the panels we could read “Agrium shame on you”, “The phosphate is Sahrawi, and it belongs to our people”.
Sid Ahmed Lamjayed is the president of the CSPRON The committee to support the peace settlement and to protect the natural resources in Western Sahara.
In a meeting with Equipe Media Mohamed Jaaim, general secretary of CSPRON, said: “I denounce the systematic plundering of natural resources in Western Sahara by Morocco and its accomplices in particular the phosphate, the indispensable element in the global agriculture.
Lemjayad was sentenced to life imprisonment because he took a political stance and not for acts that have never been proven.
We created the CSPRON in 2005. Since then and even before Lamjayad says that the goal of the occupation of our country is to plunder our natural resources and that’s totally illegal because we do not agree with that.
That’s why he was condemned so heavily, the crux of the problem is there, the willingness to appropriate our resources and our categorical refusal.
Our placards thanks the government of South Africa which stopped a cargo of Saharawi phosphate representing about 6 million dollars, the vessel which was going to New Zeland for a cooperative foundation called Balance Agri-Nutrients will be juged on of his property on June 6th.
Another vessel of similar cargo was arrested in Panama, it was going to Canada for the company Agrium. These two vessels alone are worth $ 12 million. By comparison, the World Food Program “WFP” provides the equivalent of $ 7.9 million for refugee camps where our families survive.
We, the Saharawi people, are not beggars, and we could live in peace without asking anyone for help if we were free on our land. ”
Jaaim is a former employee of Phosboucraa. He was sent to Morocco in 2006 because of his union activities.
According to the Western Sahara Resource watch WSRW the extracted phosphate from the Sahrawi mine of Boucraa by the Moroccan OCP represents $ 200 million in the year 2016. The United Nations and in last December the European Court of Justice, made it clear that phosphates and other resources in Western Sahara, whether renewable or not, can only be used on the condition of consultation and the agreement of the Sahrawi people .
EM, El Aaiún occupied Western Sahara
Read at EMSahara
This entry was posted in General, Human Rights, Phosphate importation, Political issues on July 1, 2017 by appleton.
← Western Sahara’s Hidden Democratic Promise Western Sahara – European Commission ‘ignoring’ of UN-recognised Polisario Front on EU-Morocco Agreement raised in Dáil →
Western Sahara Down Under
'Stolen' documentary
Agricultural exploitation
Fisheries exploitation
Oil and gas exploration
Phosphate importation
WordPress with Site by PB Web Development
|
cc/2019-30/en_middle_0059.json.gz/line18
|
__label__wiki
| 0.655062
| 0.655062
|
Are We Human or Resistor? Ryan Jordan & Jonathan Kemp's "Psychotronic Reactor" at Reactor Halls
Nathan Jones has his head bent by an evening of psychogeophysics and laboratory manufactured noise at Reactor Halls E09: Psychotronic Reactors, by Ryan Jordan & Jonathan Kemp, at Reactor's new space in Primary, Nottingham.
By Nathan Jones - 02/04/2014
Computers and Capital: The Rise of Digital Currency
"Computers and Capital: The Rise of Digital Currency" at Coinfest 2014 in Vancouver and online is a net art exploration of Bitcoin. Rob Myers takes a look at how the artists involved rise to the task of visualising the social and technical complexities of the popular but troubled cryptocurrency.
_MON3Y AS AN 3RRROR | MON3Y.US
After the credit crunch, quantitative easing, austerity and the Bitcoin bubble a new online show takes a comprehensive look at the history of net art's depictions of "Money As Error". What themes and subjects emerge from _MON3Y AS AN 3RRROR | MON3Y.US, and has it bitten off more than it can chew with work by almost 200 artists?
Time & Motion at FACT: Punchcard Protocol and Creative Capital in our "Modern Times"
The exhibition Time and Motion at FACT Liverpool is a collaboration between FACT and the Creative Exchange at the Royal College of Art - an initiative which looks at how arts and humanities researchers can work with industry to effect digital innovation. Rachel Falconer reviews the exhibition in the context of the paradoxical dynamics of cognitive capital and the changing landscape of the labour market.
By Rachel Falconer - 09/01/2014
Agit Disco VS The Zombie Apocalypse
The subtle and not so subtle domination by market interests of cultural production and dialogue denies us all access to a wide spectrum of creative expression, especially those that engage in subjects that conflict with the agendas of those in power. Agit Disco by Stefan Szczelkun combats this contemporary trend by focusing on music, politics, DIY culture, and freedom of expression.
Summer of the Shark: Artificial Life and The End(s) of Game Spaces in Rockstar Games' Grand Theft Auto V
Channel TWo reviews Rockstar Games’ “Grand Theft Auto V,” released September 2013 and noted as “the fastest selling entertainment product in history.” Instead of the well-covered social and political aspects of the GTA series, this review focuses on the limits of the game landscape and the artificial life that inhabits it.
Data-Driven Artists And Their Critics
Making art specified by a computer program is nothing new but artists using Big Data and Open Data are changing its relationship to artworld production. Can such software really replace artists, and if so are art critics any safer? Jonas Lund's "The Fear Of Missing Out" (2013) and Shardcore's generative art may hold some of the answers.
Review of Ligna’s 'The First International of Shopping Malls' (Cork, Ireland)
Laura Forlano reviews Ligna’s 'The First International of Shopping Malls' (Cork, Ireland) feature's over a decade of new media art that has transformed and appropriated city spaces. Challenging the separation of physical from digital, global from local, private from public, and individual from community.
By Laura Forlano - 05/11/2013
Post Digital Print
Rob Myers reviews Alessandro Ludovico's book 'Post-Digital Print– The Mutation of Publishing Since 1894'. It tracks the many deaths of print media and its long history of surviving against the odds in order to show how it can survive the Internet as a vital part of our shared culture. Ludovico is the editor and publisher of Neural, a magazine for critical digital culture and media arts.
"A Symbol" Bill Miller at The Widget Art Gallery
What can we learn from our encounter with an indeterminate symbol floating in the space of a gallery that exists only on Apple devices? Rob myers writes about Bill Miller's work featured at The Widget Art Gallery (WAG) serving art online since 2009. From July to August 2013 the work inhabited this virtual space as Bill Miller's "A Symbol".
corporate performance artist
a person who works within a corporate context, yet understands and plays upon the role they are performing as opposed to confusing it with their identity... ie. the difference between saying "I am a...
By Joseph Franklyn McElroy on 12 Jan 2004 - 1:00am
|
cc/2019-30/en_middle_0059.json.gz/line24
|
__label__wiki
| 0.748818
| 0.748818
|
Farmer/Veteran
Documentary | Feature | 1 hour 10 min
Home from three combat tours in Iraq, Alex Sutton forges a new identity as a farmer, hatching chicks and raising goats on 43 acres in rural North Carolina. He dives into life on the farm with his new love Jessica, but cannot shake the lingering traumas of war. The stories he tells about his battlefield experiences become unmoored from reality as he cycles between states of heightened awareness and “feeling zombified” from a cocktail of prescriptions meant to keep him stable. For the viewer, as for Alex, what to believe about his past is uncertain. The farm becomes a terrain to unearth what is buried, what it really means to be “the perfect soldier,” and where to find the way forward.
Alix Blair
Alix Blair (b. 1979 USA) is responsible for a diverse body of work exploring human rights and environmental issues through photography, film and radio production. A recent graduate of the Master’s program at the Nicholas School of the Environment at Duke University and recipient of multiple fellowships, including the Duke Center for Human Rights, Blair documented the lives of women in southwestern Uganda for her Master’s work. Her audio story The Last Morning Was a Sweet One won a 2013 ShortDoc award from the Third Coast International Audio Festival. FARMER/VETERAN is her first feature-length documentary.
Alix Blair | Jeremy M. Lange
Mikel Barton | D.L. Anderson
D.L. Anderson
Nyneve Minnear | D.L. Anderson
Phil Cook
Screening Times
SIUC Student Center
Farmer/Veteran - Trailer
Accolades/Other Screenings
Dallas International Film Festival | Dallas, United States | April 15, 2016 | World Premiere
Brooklyn Film Festival | Brooklyn, NY, United States | June 10, 2016 | Best Documentary Feature
Macon Film Festival | Macon, GA, United States | July 22, 2016 | Best Southern Documentary
Charlotte Film Festival | Charlotte, North Carolina | September 25, 2016 | Charlotte Premiere | Best Documentary Feature
Sidewalk Film Festival | Birmingham, Alabama, United States | August 27, 2016
Hot Springs Documentary Film Festival | Hot Springs, Arkansas, United States| October 9, 2016 | Best Southern Documentary
New Orleans Film Festival | New Orleans, LA, United States | October 14, 2016
Cucalorus Film Festival | Wilmington, NC, United States | November 12, 2016
|
cc/2019-30/en_middle_0059.json.gz/line29
|
__label__cc
| 0.707494
| 0.292506
|
+91 96 32 12 56 05 | +91 444 385 61 85 info@bionatrium.com
HaemoCer Plus
Kiwi Complete Vacuum Delivery System
Rom plus rupture of membranes test
ebb Complete Tamponade System
ClearView uterine manipulator
Rom Plus
Rupture of Membranes Test
ROM Plus® is unique in that it detects both Alpha-fetoprotein (AFP) and Insulin-like growth factor-binding protein 1 (IGFBP-1) using a monoclonal/polyclonal antibody approach–improving its sensitivity.
Timely and accurate diagnosis of PROM allows for gestational age-specific interventions designed to minimize the potential risk of complications to both mother and baby.
Dual Protein Markers: IGFBP-1 & AFP
IGFBP-1 is detected early in first trimester and “plateaus” throughout the duration of the pregnancy
AFP is detected at the end of the 2nd trimester/beginning of the 3rd trimester (< 37 weeks) where full confidence is required in the accurate diagnosis
Company/Hospital Name
Product Demo Required/Not
Polyclonal & Monoclonal Antibody Approach:
Reduces the chance of false negatives
Provides a better “screening” method to detect the presence protein markers
Improves the opportunity for denatured protein detection
What is sensitivity?
Sensitivity is the percentage probability that a positive test will occur in a patient who is really experiencing rupture of membranes, or the proportion of actual positives which are correctly identified as such. In a multi-site hospital study involving 285 patients, ROM Plus resulted in an overall sensitivity of 99.5%
What is ROM Plus' CLIA Classification?
ROM Plus test is not a waived test. It has been classified as Moderately Complex by CLIA (Clinical Laboratory Improvement Amendments).
Does blood contamination affect the test result?
ROM Plus test kits have been tested up to 10% blood concentration. In other words, it will function properly with trace amounts of blood in the sample, however, significant amounts of bloody discharge may cause the test to malfunction. ROM Plus is not recommended for use in these situations and it should be determined what is causing the bleeding.
How do I interpret ROM Plus test results?
If only a control line (C) is visible, the test result is negative (no IGFBP-1 and/or AFP were detected). If both the control line (C) and test line (AF) are visible, the test result is positive (IGFBP-1 and/or AFP was detected). If no lines are visible, or just the test line (AF) is visible, the test result is invalid and should be repeated. Darkness of the stripes may vary. The test is valid even if the stripes are faint. Do not interpret test results based on darkness of the stripes.
What are the ROM Plus storage and usage requirements for the kit, cassette and QC?
ROM Plus should be stored in a dry place at 4° to 37°C (40° to 99°F). DO NOT FREEZE. When stored in the foil pouch at the recommended temperature, the test is stable until the expiration date. Use ROM Plus within six (6) hours after opening foil pouch. Use ROM Plus within six (6) hours of collecting the vaginal swab sample and placing it into the buffer vial.
The lyophilized positive and negative controls can be stored in a dry place at room temperature until the expiration date. No refrigeration is required.
Do you have to use the timer in the cassette to run the test?
No. The timer that is built into the cassette is included for convenience and does not need to be used while running the test.
Will semen, urine or disinfectants interfere with test?
KY Gel, Surgilube, Tylenol, aspirin, Lever Soap, Noxzema cream, Pert Shampoo, human semen, urine and blood were tested as possible interference’s and were shown to be negative.
How often should external QC’s be run?
It is the company’s recommendation that external QC be completed for each new lot number or shipment of test material or if there is suspicion of improper storage and as required by regulatory or accrediting agencies.
What are the gestational age limits for ROM Plus?
ROM Plus does not have any gestational age limits.
Bion Atrium is focused mainly in the sales, service, application and distribution of healthcare related products such as equipment, consumables & related accessories. Growing day by day we improves our vision of delivering the most advanced technologies that really inspires.
BION ATRIUM MEDICAL CARE, BANGALORE
F1 Kalyani pal’s Court No: 42 & 43 Gandhi Road, Alwarthirunagar, Chennai-600087.
Designed and Developed by CLOUDSQUARE INNOVATIONS | © ATRIUM MEDICAL CARE GROUP
|
cc/2019-30/en_middle_0059.json.gz/line30
|
__label__wiki
| 0.681752
| 0.681752
|
HBO’s “Leaving Neverland” finally airs to fierce debate about sexual abuse, celebrity & race
by Isra Ibrahim
Entertainment, Gender and Sexuality, Music, News
Michael Jackson with accuser James Safechuck PC: Alan Light via Flickr
In light of the #MeToo movement and the #MuteRKelly campaign, Wade Robson and James Safechuck are finally telling their full stories about how late pop icon Michael Jackson molested them as children in HBO’s controversial new documentary Leaving Neverland. The documentary is igniting fiery reactions and conversations on reconciling sexual allegations with an entertainer’s legacy, and about its omission of racial dynamics.
Robson and Safechuck state that they met Jackson through show business. Throughout the documentary, both men share graphic details of Jackson introducing them to hardcore porn, masturbation, and other sexual content. As Jackson focused their attention on them, the boys’ lifestyles became richer and exclusive to their families’ content.
However, Safechuck and Robson detail that Jackson would molest them and teach them to dress quickly in hotel rooms as to not get caught. Robson recalls Jackson would brainwash him by saying, “You and I were brought together by God. We were meant to be together and this is us showing each other that we love each other.”
Vulture listed all of the child sexual abuse allegations made in the documentary. Currently, the Jackson estate is suing HBO for a $100 million in damages, claiming the film violates a 1992 non-disparagement clause that was agreed upon in order to air a previous Michael Jackson concert.
However, HBO said in a statement, “Despite the desperate lengths taken to undermine the film, our plans remain unchanged, HBO will move forward with the airing of ‘Leaving Neverland.’ This will allow everyone the opportunity to assess the film and the claims in it for themselves.”
While the documentary was disparaged by many, it also received praise. Actress Amber Tamblyn tweeted, “As a former child actress, I can’t help but watch this documentary and think about how wrong it is for children to be put in the position of performing for the soul (sic) purpose of pleasing adults. It’s such a slippery, dangerous, often abusive slope. #LeavingNeverland.”
One major criticism is that while Jackson’s celebrity was influenced by race, the documentary makes no mention of these particular dimensions. Instead, it makes race negligible to the broader conversations of sexual abuse.
accusers, allegations, child abuse, James Safechuck, metoo, Michael Jackson, Neverland, sexual abuse, Wade Robson
Isra Ibrahim
|
cc/2019-30/en_middle_0059.json.gz/line33
|
__label__cc
| 0.517765
| 0.482235
|
Alfredo Antonio Codallo
Folklore Artist (1913 - 1971)
After a text by artist Holly Gayadeen, friend and fervent supporter of the work of Alfred Codallo, published by the author in 1983.
Holly Gayadeen's first vocation was to become a teacher, and underwent training for this profession in Trinidad and in England. But his true calling was to be an artist. Throughout his long career, Gayadeen always combined the two, expressing himself in various media such as painting and ceramics, and at the same time teaching visual arts, crafts and design. His special interest in art education as well as local folklore manifests itself strongly in his book "Alfredo Codallo - Artist and Folklorist", which Gayadeen published in 1983.
Codallo's folklore drawings are special in several ways. Firstly, they were done for the world of communications in an era when advertising agencies didn't even exist yet. Hand Arnold and Fernandes Distillers were the two companies who commissioned Codallo's pictures for their advertising campaigns in local newspapers. Illustrating the usage of flour and rum, Codallo managed to capture life in the streets, back yards, shops and homes of Trinidad.
"Honesty, acceptance and a penetrating vision of one who lived a full life with the people and for the people" - this is how Gayadeen characterises Codallo's work. Much like somebody with a benevolent camera, Codallo managed to capture everyday life of the 'simple people', their chores, their surroundings, even their hopes and their fears.
His work is contemporaneous with other artists, who, as Gayadeen puts it, "struggled relentlessly in their artistic pursuits to record for posterity the people, places, folklore and festivals of Trinidad and Tobago": M.P. Alladin, Sybil Atteck, Leo Basso, Dominic Isaac and, in the performing arts, Beryl McBurnie and Thora Dumbell to name but a few. "Even at that period, there was no particular trend or school of painting. Each artist developed his own personalised style and pursued a particular direction. Despite this, as it is even so today, the Caribbean idiom and images are easily recognisable in the art productions of our artists whose works have found themselves in collections locally and abroad," writes Gayadeen.
In 1962, Alfred Codallo wrote about himself: "Through art, I wish to speak in a language that all should understand. A language of beauty - unspoilt by confounding 'isms', yet rich with common understanding and native pride. In my self-imposed job of preserving the folklore way of life, dances, land, river and sea scapes of my country, I am trying to establish a link with our past in the most comprehensive way I know."
Codallo grew up in a generation that felt oppressed by what would be the last decades of colonial government. After the First World War, the mentality of Trinidadians changed: having shared the common experience of the trenches with "white" soldiers, the stereotypes of race and class started to soften up. However, the economy didn't flourish, and poverty amongst black people was as dire as ever in the 1930s, when Codallo would have been in his prime.
"He was a simple man who always seemed to have preferred the informality and unpretentious atmosphere of genuine camaraderie. It was easy to converse with him and his views were generally pointed, serious and sometimes colourfully expressed," writes Gayadeen. Like Gayadeen himself, Codallo was an art teacher, who never had any qualms about imparting his knowledge and skills to those who came to him.
Self-educated, Codallo had little interest in the artistic approaches of impressionism, Fauvism, Dadaism or expressionism. "Codallo's works reflect that quality of superb realism," writes Gayadeen. "He gave visible forms to his concepts of the several folkloric themes, traditional cultural patterns and the environment."
Codallo's subjects were drawn from the Afro-Creole segment of Trinidad's society. His own ethnic background was not from this matrix per se: his father was from Venezuela, his mother was of East Indian descent. Having been born in Arima and grown up in Port of Spain, Codallo grew up as a good 'mixer' full of joie-de-vivre, as Gayadeen describes him.
"Codallo was keenly aware of the fact that West Indian folklore has a rich heritage and that legends surrounding the mythical characters of La Diablesse - the female devil, Soucouyants, Douens etc., never fail to stir the imagination. It was Alf himself who gave the name of Paul Carr Landeau (Poluycar) as a man who delighted in telling stories in the open air of Tamarind Square in Port of Spain, wherever he happened to be away from his occupation of a shipwright."
The Trinidad Publishing Company noticed Codallo's talents and employed him as commercial artist, photographer, photo-engraver and lithographic artist. Codallo drew for advertising: the "Spirit of Trinidad" festival and folklore series was created for Fernandes Vat 19 and the village life series to advertise flour.
In many cases, Cadallo's drawings of these two series are the only visual representations of what many Trinidadians feel to be the 'good old days'. Especially the older generation seems to have known characters who looked 'just like that' - the Portuguese shopkeeper, the impoverished French Creole man who uses the back door, the ancient cello player in a parang band. Codallo managed to capture the essence of the role in the character, which has, many decades later, become a blueprint for our communal memory.
"He had been an introspective artist of visionary ideas," writes Gayadeen. "His creations have a metaphysical and mythological concept, each one showing a genuine power of characterisation."
Alfred Codallo passed away at the young age of 58 years, leaving us with many images of life long ago, and the memory of himself as an artist of distinction.
Buy "Tales of the Paria Main Road" by clicking here:
Buy "The Voice in the Govi" by clicking here:
Buy "Folklore & Legends of Trinidad and Tobago" by clicking here:
Posted by Gerard A. Besson - Caribbean Historian at 9:23 am
Labels: Alfred Codallo, Holly Gayadeen, Trinidadian artists
An Indentured Prince
Saving Trinidad's David Copperfields
Most Selfish Generation
Cycles of Revolt
Shouter Baptists
Frank Messervy
Electric City Part 3
Lessons in history
100 Years of Salvation Army in Trinidad and Tobago...
The Caribs fear the Horses
The Witch of Rose Hall
T. Geddes Grant
STOP! You imperfect speaker!
Born in Dominica - The Foundation of St. Anns
Amerindian Names
|
cc/2019-30/en_middle_0059.json.gz/line40
|
__label__cc
| 0.731777
| 0.268223
|
Glutamine : biochemistry, physiology, and clinical by Dominique Meynial-Denis
By Dominique Meynial-Denis
Glutamine: Biochemistry, body structure, and scientific Applications describes the various capabilities of glutamine (Gln) in animals and people. Gln is either a nutrient and a signaling molecule, and its services transcend these of an easy metabolic gas or protein precursor. This ebook has amassed jointly, in an independent and important demeanour, the entire to be had proof and examine on Gln together with pathology (neurological ailments, intestinal ailments, serious sickness, and cancer), body structure (successful aging), catabolic states, immunity, and workout. distinct realization is given to the aptitude advantage of Gln in states of insulin resistance and the function of Gln as a "conditionally crucial" amino acid.
The members are both pioneers or specialists within the sector of Gln from everywhere in the globe, together with Australia, Brazil, Canada, Europe, China, and the U.S.. This publication is a worthwhile resource of knowledge for meals scientists, doctors, activities scientists, meals scientists, dietitians, and someone drawn to foodstuff. it's also a useful source for college kids in those fields and may be an immense addition to college libraries.
Read Online or Download Glutamine : biochemistry, physiology, and clinical applications PDF
Similar physiology books
Human Respiration : Anatomy and Physiology, Mathematical Modeling, Numerical Simulation and Applications (Advances in Bioengineering)
Even in precedent days, respiring used to be believed to be crucial characteristic of lifestyles itself. The very Universe was once seen as a massive respiring organism, during which the whole lot used to be concerning every little thing else via a technique of vibration - or breath. these days, our figuring out of the legislation governing the Universe and lifestyles has complicated vastly.
BCL2 Protein Family: Essential Regulators of Cell Death
During this e-book, scientists pioneering the sector have compiled a sequence of targeted chapters to focus on the relevance of the BCL‑2 relatives of proteins in apoptosis, body structure and sickness. an incredible concentration of this quantity is thinking about the capability TH period PEUT IC advantages of focusing on apoptosis pathways within the context of human sickness.
The learn of the activities of gear on delicate muscle has been a preoccupation of many pharmacologists virtually from the start of the self-discipline. To a con siderable measure, the improvement of theories to provide an explanation for drug activities on delicate muscle has happened slightly independently of the advance of our wisdom of the body structure, biochemistry, and biophysics of soft muscle.
Advances in Conjugated Linoleic Acid Research
Advances in Conjugated Linoleic Acid study, quantity 2 is the second one ebook in a chain committed completely to conjugated linoleic acid. This publication has up to date info at the research, biochemistry and functions of conjugated fatty acids in an try and make quantity 2, together with quantity 1 (published in 1999), the main entire, up to date assets of CLA-related details on hand this present day.
Laboratory Manual for Anatomy and Physiology (4th Edition)
Biophysical Foundations of Human Movement
Biology and Anatomy & Physiology Helps: The Cell
Biology and Anatomy & Physiology Helps: Blood
Physiology and Pathophysiology of the Heart
Extra info for Glutamine : biochemistry, physiology, and clinical applications
The remarkable story of glutamine dipeptides. Clin Nutr 1, 3–15. F. 2011. Oxidative stress and mitochondrial dysfunction in sepsis. Br J Anaesth 107, 57–64. A. E. , Jr. 2008. Board-invited review: Peptide absorption and utilization: Implications for animal nutrition and health. J Anim Sci 86, 2135–2155. Gleeson, M. 2008. Dosing and efficacy of glutamine supplementation in human exercise and sport training. J Nutr 138, 2045S–2049S. , A. Bonet, E. Minambres, L. A. Irles, A. Robles, J. Acosta et al.
Maintenance of glutathione content is isolated hepatocyctes. Biochem J 170, 627–630. M. T. Nolan, H. R. Han, K. L. Li, B. K. Liang. 2010. The impact of glutamine dipeptide-supplemented parenteral nutrition on outcomes of surgical patients: A meta-analysis of randomized clinical trials. JPEN J Parenter Enteral Nutr 34, 521–529. R. E. Wischmeyer. 2010. Glutamine in critical illness: The time has come, the time is now. Crit Care Clin 26, 515–525, ix–x. Wernerman, J. 2008. Clinical use of glutamine supplementation.
2009). 3). Skeletal muscle also plays an important role in glutamine metabolism, since quantitatively it is the main tissue for glutamine de novo synthesis, storage, and release. This is not due to a high GS activity per se, but due to the increased availability of the branched-chain amino acids (BCAA), which contribute to glutamine synthesis (Shimomura et al. 2004). Skeletal muscle tissue represents up to 40% of the total body mass (Neu et al. 1996). The BCAA (L-valine, L-leucine, and L-isoleucine) are predominantly metabolized in skeletal muscle tissue, following protein ingestion through the diet (Shimomura et al.
Carlos Bezerra Library > Physiology > Glutamine : biochemistry, physiology, and clinical by Dominique Meynial-Denis
Previous Post The New Physiology in Surgical and General Practice by A. Rendle Short
Next Post A life of Ernest Starling by John Henderson
|
cc/2019-30/en_middle_0059.json.gz/line41
|
__label__wiki
| 0.840725
| 0.840725
|
Return to Browse View Saved Records Clear Saved Records (Search History) AUTHOR: Centre national de la recherche scientifique (France) in Law Library ISBN/ISSN: 9780195168884 in Search Entire Collection AUTHOR: Arnold, Martin in Search Entire Collection AUTHOR: Hartmann, Stephen, 1928-; in Search Entire Collection AUTHOR: Aziz, Khalid in Search Entire Collection SUBJECT: Elections Corrupt practices Indonesia. in Search Entire Collection ISBN/ISSN: 9781593772000 in Search Entire Collection AUTHOR: Corby, William S., 1928- in Search Entire Collection SUBJECT: Numbers, Prime. in Search Entire Collection (Clear Search History) (End Search Session)
University of Melbourne -- Faculty -- Salaries, etc.
Melbourne University : return to an Order of the Legislative Assembly, dated 29th November, 1894, for a return showing : 1. The gross amounts, specifying separately the salary, fees, and other emoluments, received by each salaried officer of the Univ
Melbourne, Vic. : Govt. Printer, 3 p. ; 34 cm. 1894
Melbourne University - salaries and allowances : return to an Order of the Legislative Assembly, dated 30th June, 1870, for a detailed account of the salaries and allowances in the expenditure of the University of Melbourne for the year 1869 / Redmon
Staff procedure guide / University of Melbourne.
University of Melbourne.
[Parkville, Vic. : The University], 1 v. (loose-leaf) : forms ; 32 cm. 1974-
University expenditure : return to an Order of the Legislative Assembly, dated 13th June, 1864, for a detailed statement of the salaries and allowances, together with such other advantages as are possessed by the Professors and Officers of the Univer
University of Melbourne : professors and lecturers : return to an Order of the Legislative Assemby, dated 30th September 1874, for a return showing: 1. The number of professors and lecturers at the University of Melbourne, giving the name of each per
Melbourne, Vic. : Govt. Printer, 10 p. ; 34 cm. 1874
University of Melbourne : return to an Order of the Legislative Assembly, dated 8th September 1874, for a return showing the details of expenditure of the item £10,274 14s. 0d., in the balance-sheet of the University of Melbourne for the year 1873,
|
cc/2019-30/en_middle_0059.json.gz/line42
|
__label__wiki
| 0.86974
| 0.86974
|
Education, Training, & Skills
Wind for Schools Project
Township of Clayton
Township of Des Moines
Township of Greenville
Township of Folsom
Community Profile, Clayton, New Mexico
List of Businesses
Major Industries & Employers
NM Workforce Solutions
Union County Ranching
Properites & Buildings
Available Commercial Buildings for Lease, Rent, or Sale
Clayton Municipal Industrial Park
Clayton BioFuels Project
Telecommunications Availablity
New Mexico Broadband
Transportaion & Highways
Utility Availability
A guide to creating your own business in New Mexico
LEDA ordinance 632
Animal Control Ordinances
Signs Ordinance
Weeds Ordinance
Town of Clayton Economic Development Ordinance
Union County LEDA Ordinance
Union County LEDA Ordinance 30 Arts & Culture
TOC LEDA Arts Cultural
Clayton Mainstreet Program
Clayton Mainstreet Master Plan
New Mexico MainStreet Biennial Coordinating Program Assessment Executive Summary
Positive Economic Progress in Union County
Power Transmission out of Union County
Lucky Corridor Transmission Line
Lucky Corridor Update
Clayton Lake Dark Sky Astronomy Lab
Capulin Volcano
Rabbit Ear Mountain
Sante Fe Trail
The Historic Eklund Hotel
Town and State save Luna Theater
Union County Community Development Corporation Bylaws
View our Minutes
Town's Minutes
UCCDC's Minutes
New Mexico Certified Community
New Mexico Economic Development Department Approves 23 Certified Communities Initiative Applications
Clayton News
Value-Added Agriculture
New Mexico State Tax Policy 2014
New Mexico State Tax Incentives for Job Creation 2014
The Perfect Enviroment for Advanced Manufacturing
New Mexico Economic Development Department FY 2015 Strategic Plan
New Mexico EDD Five Year Plan
CDC Board Minutes
Alternative Energy-Green Economy
About Clayton
Visit Clayton, New Mexico
North East Economic Development Organization, Inc.
New Mexico Economic Development Department
New Mexico IDEA honors five for boosting economy
New Mexico IDEA honors five fo
...Readmore
New Mexico IDEA Description of Awards of Merit
New Mexico IDEADescription of
New Mexico IDEA Recognizes Five New Mexicans for Their Contribution to Economic Development
New Mexico IDEA Recognizes Fiv
The Best Towns in New Mexico for Young Families
The Best Towns in New Mexico f
Transmission developer aims to sustain liquidity at Four Corners trading hub
By Mark Hand
Lucky Corridor LLC, an independent electric transmission developer, wants to build two projects in New Mexico that would transport power produced by renewable energy and natural gas-fired power plants to utilities that could take delivery and then move the power to the Four Corners trading hub in the northwestern part of the state.
The energy mix at Four Corners is changing as some coal plants are closing and several others could follow, according to Lucky Corridor. New Mexico has "an interest in re-supplying the market there with electricity made in New Mexico from wind farms and other generation plants based in New Mexico," Lucky Corridor said in a project application filed with the U.S. Forest Service and the Bureau of Land Management.
Contributing to the declining coal capacity in the Southwest are PNM Resources Inc. subsidiary Public Service Co. of New Mexico's decision to retire units 2 and 3 of the San Juan coal-fired plant, about 15 miles west of Farmington, N.M., and UNS Energy Corp. subsidiary Tucson Electric Power Co.'s plans to cut its 1,510 MW of coal generation capacity by nearly one-third over the next 15 years and meet future needs with gas-fired resources, renewable energy and energy efficiency programs.
Lucky Corridor's transmission projects will move power produced in an area of northeastern New Mexico that "contains significant wind energy that occurs at the time of the day the southwestern U.S. experiences peak demand, as well as first-rate solar, geothermal and natural gas resources," the company said.
"There is virtually no backbone transmission in this incredible resource area," Lucky Corridor CEO Lynn Greene said in an email interview, referring to northeastern New Mexico.
Lucky Corridor announced in July 2013 that it had signed an anchor tenant agreement with Gallegos Wind Farm LLC for 300 MW of capacity on its Lucky Corridor transmission project, a 130-mile, 345-kV line that would travel from Union County, N.M., to a substation in Taos, N.M. Greene said her Colorado based company recently paid for newspaper advertisements in New Mexico soliciting interest in an additional 400 MW of capacity on the line.
In January, Lucky Corridor said it plans to develop a second transmission project, the Mora Line project, which also would be associated with the Gallegos wind farm. "Our projects will supply the clean energy demanded by the renewable portfolio standards of the states historically served by coalfired generation at Four Corners," Greene said in a Jan. 16 news release.
The Lucky Corridor project will move 700 MW about 130 miles, 35 miles of which is on federal lands. The developers will build the transmission line adjacent to an existing 115-kV transmission line owned by Tri-State Generation and Transmission Association Inc. between a point near Tri-State's Gladstone substation and PNM's Ojo substation. The Mora line, which will move 180 MW, will not cross any federal lands. It will move power produced from the first phase of the Gallegos wind farm to a PNM substation. The two projects would cost an estimated $320 million, according to Greene.
FERC in October 2012 signed off on a plan by Lucky Corridor to charge negotiated rates for transmission rights and service on the longer of the two projects. The commission's order gave the company the right to continue to work with Western grid officials and regional utilities to determine the best infrastructure for the region — 230-kV or 345-kV.
According to the company, a 130-mile, single-circuit, 345-kV line would save an estimated $83 million from its previously proposed double-circuit, 230-kV design. "The same size right-of-way works for either design," Greene said. "Ongoing grid studies and market demand will determine which design is built."
Transmission developers bullish on New Mexico
New Mexico's grid congestion issues have attracted interest from electric transmission developers that are pursuing projects, both big and small, to serve customers inside the state and load centers in surrounding states. On a much larger scale than Lucky Corridor's projects, SunZia Transmission has proposed a 515-mile, 500-kV system that would travel through New Mexico and Arizona and possibly provide a route to get wind energy to California.
Along with power industry executives, federal officials view New Mexico as a priority for transmission investment. President Barack Obama's Interagency Rapid Response Team for Transmission, established in 2011, selected the $1.2 billion SunZia Southwest Transmission Project as one of the seven high-voltage transmission projects in the U.S. that would receive help moving through the federal permitting process.
While SunZia has received federal support, Lucky Corridor has benefited from an agreement with the state created New Mexico Renewable Energy.
Transmission Authority, or RETA. Under a memorandum of understanding approved in July 2013, the RETA agreed to assist in the design of Lucky Corridor's construction-phase project finance structure, which could include industrial revenue or other bond financing, according to media reports.
Triangle Gallegos LP, a joint venture between Triangle Cattle Co. Ltd. and Gallegos Wind Farm LLC, recently won a lease bid for a wind farm on about 19,000 acres of Mexico State Trust Land and 31,000 acres of private land in Union County. The lease payments are expected to generate $47 million of revenue for New Mexico State Trust Land beneficiaries over the 45-year life of the project, the New Mexico State Land Office said in an April 28 news release.
Triangle Cattle Co. Ltd. is owned by Glen Black, Coy Myrick and J.D. Myrick, who operate various businesses in New Mexico and Texas, including the development of more than 150,000 acres of wind and solar energy projects. The owners of the Gallegos wind project own a less-than-10% stake in
Lucky Corridor LLC, Greene said.
With up to 285 wind turbines, the Gallegos wind farm could have a generating capacity of up to 500 MW. The project is designed to be built in phases starting in 2015. The wind project's first phase will serve as the anchor customer for Lucky Corridor's Mora transmission line, while the second phase will anchor the Lucky Corridor project, which is scheduled to enter service in 2018.
©2019 clayton-nm.com | Designed by WEDA Designs
|
cc/2019-30/en_middle_0059.json.gz/line66
|
__label__cc
| 0.716116
| 0.283884
|
Addondum
Let's see if I can survive even when using such a blatantly silly pun in the title. ;P
This month we saw the first release candidate of the upcoming 0.7.2 release, the main news being the integrated add-on manager. But unfortunately, there were a bug causing the game to fail in creating the necessary folders, creating some headaches and confusions as to what the problem were since not everyone had this problem. One could say that it's not good to release a version with a new feature when the new feature didn't work, but that's why it's called RC, right? We can probably expect a new RC in not too long, which will include the fix.
We've got a new kart in STK; meet Beastie, the mascot of FreeBSD. Thanks to funto for providing the kart and icon.
The big news, however, is the work on a new weapon for STK. That's right, we get even more fun gadgets to use on our opponents. The details and the model for the weapon is still a work in progress, and thus I'll only give a brief description. The hammer/swatter is a close-range weapon which you can mount on the kart by firing it. It will then stay for a set amount of time, or until it finds a target to hit. The target can either be a close-running kart, or a weapon on its way to hit you. If it's a kart, the hammer/swatter will hit it making the kart look squashed, and its top speed is halved for the amount of time it is squashed. If it's a weapon, it acts like a shield and defends against it ( but it only stops explosive weapons thus far). Hard to take a screenshot of how a weapon works, and the current model is only a placeholder, so I guess you'll just have to try it for yourself when the time comes.
There has been a lot of progress in the track and kart exporters for Blender 2.5x, such that most tracks and some karts have been converted to 2.5 in order to fix potential issues with the exporters and for setting up the .blend files to use the new integrated STK properties panel. This doesn't mean it's 100% safe for widespread use, but it's getting there.
Add in the usual bunch of misc fixes, and I think you get the picture: SuperTuxKart only gets better and better. ;)
Posted by Arthur at 7:54 PM
SuperTuxKart 0.7.2 RC1 has been released
SuperTuxKart 0.7.2 RC1, the first release candidate towards version 0.7.2, has been released.
This version features the following main improvements :
Added in-game addon manager ( see http://stkaddons.net/ )
Fixed major memory leaks (STK will no longer saturate your memory after half a dozen races)
New Snow Peak track by Samuncle
Improved star track UFO by Rudy
Show when you get a highscore
Improve gamepad configuration under Windows (add ability to tell gamepads apart)
Various other tweaks done and glitches fixed
You may found packages at https://sourceforge.net/projects/supertuxkart/files/SuperTuxKart/0.7.2/
Please test abundantly and report any problem you may have found :)
Posted by Auria at 3:45 AM
|
cc/2019-30/en_middle_0059.json.gz/line77
|
__label__cc
| 0.560468
| 0.439532
|
Ronny K - World Where We Want to Live 026 (2011-05-26)
Paul Webster - Vision 022 (2010-12-06)
Dan Reitar - Uplifting Moment 030 (2010-12-05) [URTZ]
Thomas Datt - United States Of Trance (2015-10-30)
Amitacek - Underground Trance Connection 036 (2011-09-16) (3 Year on AH.fm)
Arnej - Tytanium Sessions 100 Montreal (2001-06-23)
Airwave - TrancePodium 8th Anniversary (2014-09-30)
Jamie Peeters - TrancePodium 7th Anniversary Celebration (2013-09-29) (Part 22)
Simon Patterson - TrancePodium 7th Anniversary Celebration (2013-09-29) (Part 18)
John '00' Fleming - TrancePodium 7th Anniversary Celebration (2013-09-29) (Part 14)
Lemon & Einar K - Trance Academy 001 (2010-08-12) [URTZ]
Airbase - Touchdown 031 (2010-10-26) [PM]
TrancePodium - Top 20 Tracks Of 2012 (2013-01-18)
Allen & Envy - Together Podcast Episode 071 (2014-11-21) [TS]
Ilya Soloviev - Timeline Story 075 (2011-10-04)
Poshout - Timeline Story 054 (2010-10-19) [URTZ]
Smart Apes - The Planet Of Smart Apes 001 (2011-11-04)
Philippe El Sisi - The Hour Of Power 022 (2010-08-02) [URTZ]
Philippe El Sisi - The Hour Of Power 019 (2010-05-03)
Daniel Wanrooy - The Beauty of Sound 026 (2010-10-02) [URTZ]
Jorn van Deynhoven - Sundale Sessions 007 (2011-11-27) (November 2011)
Jorn van Deynhoven - Sundale Sessions 006 (2011-10-23) (October 2011)
Jorn van Deynhoven - Sundale Sessions 005 (2011-09-25) (September 2011)
Jorn van Deynhoven - Sundale Sessions 004 (2011-08-28) (August 2011)
Jorn van Deynhoven - Sundale Sessions 003 (2011-07-24) (July 2011)
Jorn van Deynhoven - Sundale Sessions 002 (2011-06-26) (June 2011)
Jorn van Deynhoven - Sundale Sessions 001 (2011-05-22) (May 2011)
Leon Bolier - Spinnin' In The Mix (2010-02-12) [URTZ]
Maria Mashkova - Sound of Desire 061 (2014-06-09)
Markus Schulz - Solo - Live @ Amnesia in Ibiza (2010-09-20) [URTZ]
Markus Schulz - Solo - Live @ Amnesia in Ibiza (2010-09-20) [Razorator]
Ron Verboom - Shah-Music Day on AH.fm (2010-06-30) [URTZ]
Zaa - Shah-Music Day on AH.fm (2010-06-30) [URTZ]
Druid - Shah-Music Day on AH.fm (2010-06-30) [URTZ]
Spark7 - Shah-Music Day on AH.fm (2010-06-10) [URTZ]
Mark Sherry - Scotland In The Mix 004 (2017-04-30)
Karybde & Scylla - Pure Trance Pleasure 105 (2010-12-15) [URTZ]
Markus Schulz - Prague '11 Release Party (2011-03-10) (Live @ SaSaZu in Prague, Czech Republic on 2011-02-12) [TT]
Markus Schulz - Prague '11 Release Party (2011-03-10) (Live @ SaSaZu in Prague, Czech Republic on 2011-02-12) [TMB]
Indecent Noise - Polonia In The Mix 010 (2012-08-31)
XiJaro & Pitch - Open Minds 006 (2014-06-14)
Tom Colontonio - OMEGA 034 (2010.12.09) [URTZ]
Tom Colontonio - OMEGA 032 (2010-10-14) [URTZ]
Radion6 - Mind Sensation 002 (2011-11-24)
Kyau & Albert - Live Broadcast Ultrasonic Festival (2011-02-12)
Gareth Weston - Live @ Trancegression 300 at Glenferrie Social in Melbourne, Australia (2013-09-18)
Darren Porter - Live @ Trancegression 300 at Glenferrie Social in Melbourne, Australia (2013-09-18)
Manuel Le Saux - Live @ Trancegression 300 at Glenferrie Social in Melbourne, Australia (2013-09-18)
Allen & Envy - Live @ Trance Gate (2014-05-17)
John Askew - Live @ Trancefusion - Power Of Elements at Industrial Palace in Prague, Czech Republic (2014-04-19) [Razorator]
Marc Simz - Live @ Trance Family Matrixx in Nijmegen, The Netherlands (2013-05-04) (Part 7)
Bjorn Akesson - Live @ Trance Family Matrixx in Nijmegen, The Netherlands (2013-05-04) (Part 6)
Alex M.O.R.P.H. - Live @ Trance Family Matrixx in Nijmegen, The Netherlands (2013-05-04) (Part 5)
Ronski Speed - Live @ Trance Family Matrixx in Nijmegen, The Netherlands (2013-05-04) (Part 4)
Matt Bukovski - Live @ Trance Family Matrixx in Nijmegen, The Netherlands (2013-05-04) (Part 3)
Dennis Sheperd - Live @ Trance Family Matrixx in Nijmegen, The Netherlands (2013-05-04) (Part 2)
Skytech - Live @ Trance Family Matrixx in Nijmegen, The Netherlands (2013-05-04) (Part 1)
Solarstone - Live @ Pure Trance at Beachclub Fuel in Bloemendaal, The Netherlands (2013-06-15) (Part 3)
Heatbeat - Live @ OTS Productions, Era Nightclub in Ottawa, Canada (2013-02-07)
RAM - Live @ Grotesque on the Beach pres. Tytanium 200 in Bloemendaal, The Netherlands (2013-05-12) (Part 9)
Sean Tyas - Live @ Grotesque on the Beach pres. Tytanium 200 in Bloemendaal, The Netherlands (2013-05-12) (Part 8)
Super8 & Tab - Live @ Grotesque on the Beach pres. Tytanium 200 in Bloemendaal, The Netherlands (2013-05-12) (Part 6)
Sied van Riel - Live @ Grotesque on the Beach pres. Tytanium 200 in Bloemendaal, The Netherlands (2013-05-12) (Part 4)
Jochen Miller - Live @ Grotesque on the Beach pres. Tytanium 200 in Bloemendaal, The Netherlands (2013-05-12) (Part 3)
Adam Seller - Live @ Grotesque on the Beach pres. Tytanium 200 in Bloemendaal, The Netherlands (2013-05-12) (Part 2)
Jay Junior - Live @ Grotesque on the Beach pres. Tytanium 200 in Bloemendaal, The Netherlands (2013-05-12) (Part 1)
Juventa - Live @ GrotesQue Indoor Festival in The Maassilo, Rotterdam (2012-11-10) [Razorator]
Arctic Moon - Live @ GrotesQue Indoor Festival in The Maassilo, Rotterdam (2012-11-10) [Razorator]
RAM - Live @ GrotesQue Indoor Festival in The Maassilo, Rotterdam (2012-11-10) [Razorator]
Giuseppe Ottaviani - Live @ GrotesQue Indoor Festival in The Maassilo, Rotterdam (2012-11-10) [Razorator]
John O'Callaghan - Live @ GrotesQue Indoor Festival in The Maassilo, Rotterdam (2012-11-10) [Razorator]
Andy Moor - Live @ GrotesQue Indoor Festival in The Maassilo, Rotterdam (2012-11-10) [Razorator]
Alex M.O.R.P.H. - Live @ GrotesQue Indoor Festival in The Maassilo, Rotterdam (2012-11-10) [Razorator]
Sied van Riel - Live @ GrotesQue Indoor Festival in The Maassilo, Rotterdam (2012-11-10) [Razorator]
Mark Sixma - Live @ GrotesQue Indoor Festival in Maassilo, Rotterdam (2012-11-10) [Razorator]
Chris Schweizer b2b Thomas Heredia - Live @ Gatecrasher at Sound Academy in Toronto, Canada (2012-11-09) [Razorator]
Protoculture - Live @ Gatecrasher at Sound Academy in Toronto, Canada (2012-11-09) [Razorator]
Daniel Kandi - Live @ Gatecrasher at Sound Academy in Toronto, Canada (2012-11-09) [Razorator]
Solarstone - Live @ Gatecrasher at Sound Academy in Toronto, Canada (2012-11-09) [Razorator]
Tenishia - Live @ Gatecrasher at Sound Academy in Toronto, Canada (2012-11-09) [Razorator]
First State - Live @ Gatecrasher at Sound Academy in Toronto, Canada (2012-11-09) [Razorator]
Kris Shaw - Live @ Gatecrasher at Sound Academy in Toronto, Canada (2012-11-09) [Razorator]
Fady & Mina - Live @ FSOE at Space Sharm in Sharm El Sheikh, Egypt (2013-02-03) (Part 5)
Ummet Ozcan - Live @ FSOE at Space Sharm in Sharm El Sheikh, Egypt (2013-02-03) (Part 4)
Aly & Fila - Live @ FSOE at Space Sharm in Sharm El Sheikh, Egypt (2013-02-03) (Part 3)
Alex M.O.R.P.H. - Live @ FSOE at Space Sharm in Sharm El Sheikh, Egypt (2013-02-03) (Part 2)
Mohamed Ragab - Live @ FSOE at Space Sharm in Sharm El Sheikh, Egypt (2013-02-03) (Part 1)
Allen & Envy - Live @ Elevation Audio Ibiza (Warm Up Party) at Club 414 in London, UK (2014-06-07)
Matt Bukovski - Live @ Electik Music Festival 2013 at Arena Hall, Poznan, Poland (2013-02-23) (Part 9)
John '00' Fleming - Live @ Electik Music Festival 2013 at Arena Hall, Poznan, Poland (2013-02-23) (Part 8)
Munder - Live @ Electik Music Festival 2013 at Arena Hall, Poznan, Poland (2013-02-23) (Part 7)
tyDi - Live @ Electik Music Festival 2013 at Arena Hall, Poznan, Poland (2013-02-23) (Part 5)
Ummet Ozcan - Live @ Electik Music Festival 2013 at Arena Hall, Poznan, Poland (2013-02-23) (Part 3)
Artento Divini - Live @ Electik Music Festival 2013 at Arena Hall, Poznan, Poland (2013-02-23) (Part 2)
Skytech - Live @ Electik Music Festival 2013 at Arena Hall, Poznan, Poland (2013-02-23) (Part 1)
Lisa Lashes - Lashed January (2013-01-14)
Factoria - Infrasonic Day 2015 (2015-09-30) (Part 19)
UCast - Infrasonic Day 2015 (2015-09-30) (Part 18)
Andre Visior - Infrasonic Day 2015 (2015-09-30) (Part 17)
Ultimate & Moonsouls - Infrasonic Day 2015 (2015-09-30) (Part 014) (Best Of Infrasonic Pure Set)
Apsara - Indonesia In The Mix 002 (2012-04-29) [TMB]
Dave Correa - IGNITION Radioshow 026 (2013-02-02)
Luke Bond - Hollywood 001 (2013-05-22)
Dave Correa - HAVOC 006 (2015-10-13)
Andy Gregory - Global Progression 063 (2010-12-12) [URTZ]
Above the Clouds - Gent Trance Division Radio Show 008 (2013-09-28)
Vast Vision - FSOE Day on AH.FM (2009-08-29)
Sean Tyas - FSOE Day on AH.fm (2009-08-29)
Aly & Fila - FSOE Day on AH.FM (2009-08-29)
Philippe El Sisi - FSOE Day on AH.FM (2009-08-29)
Aly & Fila - FSOE Day 2010 on AH.FM (2010-09-29) (Part 11) [URTZ]
Fast Distance - France In The Mix 002 (2008-08-01) (Part 13)
Artento Divini - F.O.M.B. 020 (2012-04-20)
Artento Divini - F.O.M.B. 017 (2012-01-20) [PM]
Sean J Morris - Elevate 002 (2011-11-26)
Katadunkass - Electronic Spectrum 024 (2013-04-13) (incl. Devito guestmix) [Podcast]
Duderstadt - Electronic Eavesdropping 044 (2010-11-24) [URTZ]
Fabio XB - Electronic Dimension 017 (2013-03-16)
Fabio XB - Electronic Dimension 008 on AH.FM (2012-06-16)
Indecent Noise - Destiny Day on AH.FM (2015-11-23) (Part 11)
Ima'gin - Counterpoint 018 (2010-10-24) [URTZ]
Ian Buff - Connective Sounds 060 (2010-11-07) [URTZ]
Paul Cogito - Cogito Ergo Sum 002 (2013-05-25)
OzzyXPM - Blue Soho Sessions 005 (2011-07-10)
Richard Durand - Black Hole Recordings & Finenight.com Day (2010-11-30)
Cosmic Gate - Black Hole Recordings & Finenight.com Day (2010-11-30)
Filo & Peri - Big Room Sound 034 (2010-10-13) [URTZ]
Eelke Kleijn - Benelux In The Mix 004 (2008-08-31) (On AH.FM)
Airwave - Benelux In The Mix 004 (2008-08-31)
RAM - Beat Boutique 004 (2010-09-22) [URTZ]
Scott Bond - Aural Pleasures 038 (2012-12-16)
Above the Clouds - ATC Recordings Radio Show 007 (2013-08-24)
Aku & Ghazaly - Airlifted 007 (2011-11-16)
Da-Ruth - AH.FM EOYC 2012 (Contest Mix)
7 Skies & Static Blue - AH.fm EOYC 2008 (2008-12-23)
Dan Stone - AH.fm EOYC 2008 (2008-12-22)
Config - AH.fm EOYC 2008 (2008-12-21)
Simon & Shaker - AH.fm EOYC 2008 (2008-12-21)
Mark Eteson - AH.fm EOYC 2008 (2008-12-21)
Hawk - AH.fm EOYC 2008 (2008-12-20)
Eelke Kleijn - AH.fm EOYC 2008 (2008-12-20)
Adam Nickey - AH.fm EOYC 2007 (2007-12-29) (12:00-13:00)
DarkMemoria - AH.fm EOYC 2007 (2007-12-26) [TT]
Cressida - AH.FM 1 Year Anniversary Massive Celebration (2007-06-02) (Part 28) [PS]
Solarstone - 1 Hour Pure Mix (2013-02-26)
|
cc/2019-30/en_middle_0059.json.gz/line88
|
__label__wiki
| 0.939857
| 0.939857
|
France passes tech tax despite United States investigation
"I absolutely am voting for her", Denise replied.
Pence "said Thursday a vote for Brian Kemp is tantamount to support for President Donald Trump".
If Abrams wins next week, the former Georgia state House minority leader would become the country's first female African-American governor.
Ms Winfrey called Ms Abrams a "changemaker" who represented the values of all Georgians, where Atlanta is the capital city.
"And I've got a message for all of Stacey Abrams's liberal Hollywood friends: This ain't Hollywood", he added. "Well I'd like to remind Stacey Abrams and Oprah and Will Ferrell-I'm kind of a big deal too".
Perhaps even more than President Barack Obama, who will campaign for Abrams on Friday, Winfrey's appeal closely aligns with Abrams' political pitch. I don't wanna go in those waters, ' she said, shaking her head and waving her finger.
"I am an independent woman; I have earned the right to do exactly what I want to do when I want to do it. I paid for myself and I approve this message".
More news: Trump expects 'great deal' with China, but more tariffs if not
More news: Jordan Cancels Part of Peace Agreement with Israel
More news: Italy brushes off downgrade as it plans European Union budget response
According to RealClearPolitics's average of polls, Abrams and her Republican opponent Brian Kemp are in an extremely close race, with Kemp up by 1 percentage point. If elected, she would be the first black woman elected governor in the United States.
The state requires identification information on voter registration applications to precisely match information already on file with the Georgia Department of Driver Services or the Social Security Administration.
She encouraged women of all races - "sisters ... not just 'sistahs,"' she joked - to remember that they would have been "just a piece of property" with no ballot barely a century ago. She recalled generations of black Americans who faced "lynching ... oppression ... suppression", and declared that "their blood has seeped into my DNA" and forced her to the polls.
The 64-year-old media titan shared a video on her Instagram page holding a clipboard and knocking on the door of a voter named Denise.
After Winfrey's speech, Abrams climbed the stage to join a discussion and was greeted by chants from the audience.
"The Democratic party, that the governor, the young lady that's running there... is the party that gave the South, where you are Oprah, the KKK, it gave us the Jim Crow laws that were there", he also said.
She also slammed the United States, which shares economic interests with Saudi Arabia, on its inaction in condemning Saudi Arabia. Meanwhile, Khashoggi's fiancee, Hatice Cengiz, published a heartfelt plea in the Washington Post .
Ooredoo announces new offer for iPhone XR purchase
It is available in five colors with a price tag of $749 in the United States, £749 in the UK, and over 849 in Continental Europe. And the new Depth Control feature allows users to adjust the depth of field both in real-time and after the image is taken.
Lastly, as we are massive audiophiles here at T3, we were also impressed with the new MacBook Air's upgraded audio system. Apple says that the battery will last 13 hours while playing movies on iTunes, or 12 hours while browsing the web.
It comes with quad- and 6-core 8th-generation Intel Core processors with Turbo Boost Speeds up to 4.6GHz and Intel UHD graphics . At the moment we only know that the price of the entry-level Mac mini 2018 will be $799 / £799 (around AU$1,120).
'Seriously ill' Glenn Hoddle being treated in hospital
Former England manager Glenn Hoddle is "responding well" to treatment after being taken to hospital on Saturday. Hoddle spent 12 years with Tottenham, where he was considered one of England's most technically gifted players.
He uses three iPhones, two of which have been made marginally more secure by the National Security Agency. China responded to a report that its spies listened to President Donald Trump's phone conversations.
Khashoggi slain in consulate
Adam Schiff of California said Saudi Arabia's claim that Khashoggi died in a brawl wasn't credible. "We're going to know over the next two or three days", Trump said.
Bolt offered two-year deal by European club, says agent
Central Coast Mariners' Usain Bolt applauds fans after an A-League match. You sell him, so be it, that's the tough world of professional football".
CDC expresses concern over mysterious surge in polio-like paralysis cases
He says while the preceding illness may be a virus, there's no need to rush your child to a doctor just because they have a cold. The CDC reports it mostly affects children, and so far this year there have been 62 confirmed cases in the United States.
Federal Bureau of Investigation was the source of Andrew Gillum's 'Hamilton' ticket, new records show
Saudi crown prince offers condolences
Mexican police says migrants in caravan will cross border in orderly fashion
Student debt elimination 'immoral,' unfair to hardworking taxpayers: Republican lawmaker
White House gets new spokesperson
Acting Customs and Border Protection chief resigns amid migrant detention outrage
Florida woman charged after giving estranged husband's guns to police
This Indian City Has Run Out Of Water Amid A Scorching Summer
Citing racial bias, US high court tosses black man's murder conviction
US Senate to block Trump's $8bn Saudi arms sale
The United States and Iran: A Step Closer to Open Conflict?
Ocasio-Cortez doubles down on concentration camp comments
Turkey urges adherence to United Nations report's recommendations on Khashoggi murder
Trump campaign raises $24.8 million in less than 24 hours
Dominican Republic deaths: Federal Bureau of Investigation close to identifying cause of mystery Caribbean deaths
PM May would not repeat criticism of London Mayor - spokesman
Argentina Isn’t Ruling Out a Cyberattack in Major Power Outage
Mayor 'sick' by video of police encounter with young family
|
cc/2019-30/en_middle_0059.json.gz/line92
|
__label__wiki
| 0.971765
| 0.971765
|
Home » Entertainment
Out-of-the-ordinary Colossal is a monster movie worth seeing
Baseball Ensembles
Texas Rangers add some pizzazz with special event uniforms
Reality Show News
Dallas chef makes the cut for new season of Food Network Star
Apr 17, 2017, 8:50 am
Say hello to Dallas' newest reality-TV star. Photo courtesy of Food Network
Dallas reality show fans have a likable new contestant to root for on the latest season of Food Network's Food Network Star.
The series' 13th season premieres on June 4 with judges Bobby Flay and Giada De Laurentiis and 13 competitors showcasing their cooking and on-camera skills to prove they have what it takes to become the next Guy Fieri.
Representing for Dallas is Caodan Tran, a former food blogger who owns a personal chef service. According to her bio, "Caodon didn't learn to cook until it became a life necessity as an adult. Raised in an ultra-competitive family, Caodan realized that cooking was the best way to learn about a culture without traveling. Caodan currently owns a personal chef service, doing everything from pop-up dinners to private dinner parties. Known for her fresh, clean, and simple approach to modern Vietnamese cuisine, Caodan considers herself hyper-ambitious and strong headed in a good way."
Sneakers website Chicks N' Kicks has already profiled Tran, and she recently launched a YouTube channel that she'll use to document her journey over the next few months.
A companion show called Food Network Star: Comeback Kitchen will give seven former Food Network Star finalists the chance to vie for a slot on the new season. And yet another companion series, this one web-only, called Star Salvation gives eliminated finalists a second crack at getting back on, much like Top Chef's Last Chance Kitchen.
Allison Page, program manager at Scripps Networks Interactive, says in a release that the show is inspirational to viewers. "To become a Food Network Star requires top-tier culinary skills, an impressive television presence, and the utmost dedication," she says.
Veteran reality show watchers will recall that Dallas has had two prominent locals on this show before: restaurateur and Sissy's owner Lisa Garza-Selcer, who was on season 4 in 2008; and Melissa d'Arabian, who was only kind of a Dallasite and won season 5 in 2009.
The pre-season begins on May 21, with the premiere of Food Network Star: Comeback Kitchen, a three-episode miniseries where seven ex-finalists return for a second shot at stardom. Co-hosts Valerie Bertinelli and Tyler Florence will identify what kept each of the alumni from winning. The competitors will take on a retro dessert and shoot an Instagram video about their updated version. Duff Goldman will help judge the results.
The June 4 premiere of the main show takes place at the Orpheum Theater in Los Angeles. Guest judges are Robert Irvine and Monti Carlo. Other judges and guests throughout the season will include ESPN anchors Jemele Hill and Jaymee Sire, Sunny Anderson, Melissa d’Arabian, Anne Burrell, Josh Denny, Guy Fieri, Hannah Hart, Eddie Jackson, Sandra Lee, Sabin Lomac, Tiffani Thiessen, and Andrew Zimmern.
In addition to Tran, there's one other finalist from Texas: Nancy Manlove, from Texas City, a Food Network veteran who competed on Season 9 of Cutthroat Kitchen, which aired in 2015. Manlove previously worked for NASA, then went back to school to earn a culinary arts degree. She's won food competitions and is currently chef de cuisine at a farm-to-table restaurant and a grandma who wants to get cooks of all ages into the kitchen.
Other finalists hail from Lousiana, New Jersey, Georgia, Illinois, Michigan, Kentucky, and Hawaii.
Star Salvation returns on June 25 on FoodNetwork.com/Salvation and is hosted by Iron Chef Alex Guarnaschelli and Food Network Star season 7 winner Jeff Mauro. It'll run six episodes, and the winner will re-join Food Network Star on August 6.
Watch for the Opt For Optimism van all over Texas
Glitzy new Cedar Springs bar shakes into week's 5 hottest headlines
Summer's on menus everywhere in this cheery Dallas restaurant news
|
cc/2019-30/en_middle_0059.json.gz/line93
|
__label__wiki
| 0.682806
| 0.682806
|
Caficultores de las ZRC, Colombia | Photo courtesy of Kyla Sankey
CERLAC is Canada's oldest and largest LAC research centre. Our current mandate is hemispheric, grounded in deep engagement with the LAC region and those identified with it, but emphasizing in transnational processes, ties to local LAC communities, and thematic collaboration with scholars working outside LAC alongside traditional area studies.
As an organized research unit, CERLAC offers LAC scholars in departments and units across York an important cross-cutting axis of intellectual engagement. Our mandate encompasses 1) pursuing and supporting timely, excellent, and socially engaged research on the LAC region; 2) providing an advanced interdisciplinary education on the LAC region for York University students; 3) sharing knowledge grounded in rigorous scholarship on the region with Canadian and international academic, governmental, and non-governmental organizations as well as community partners; 4) creating pathways between the university and other constituencies.
CERLAC fosters research intensification at York University by providing support services for fellows' projects and collaborations, training new generations of regional scholars, mobilizing knowledge to media, policy-makers, and broader communities, and programming events and other opportunities for scholarly exchange.
Over nearly four decades, CERLAC Fellows have published critically lauded works in a broad range of disciplines, from economics to fine arts. Our major conferences and lecture series have informed the Canadian public about the critical issues facing Latin America and the Caribbean. With our institution-building projects in the region, we have also forged a remarkable breadth of linkages with universities, research centres, and non-governmental organizations that provide opportunities for York faculty and student research and bolster York's reputation for research excellence throughout the hemisphere.
Recently, CERLAC has also increased its focus on Latin American and Caribbean communities closer to home.
As a community of communities, CERLAC welcomes research and researchers representing all the thematic, geographic, and disciplinary diversity of contemporary LAC scholarship. During its 2015-2020 charter, CERLAC especially seeks to advance collaboration in the following five areas:
1. Critical studies of extractive industry
The LAC mining sector is a key site of investment for Canadian capital, generating $19.4 billion of revenue in 2012 (North-South Institute). Increasingly Canadian foreign aid priorities are aligned with this sector, while NGOs and community groups increasingly demand reliable information about its activities. CERLAC pioneered the critical study of extractivism in Canada with its 2009 “Rethinking Extractive Industry” conference.
2. Precarities in the Americas
In much of the LAC region, the global rise in precarity after the 2008 crisis compounded the effects of earlier Washington Consensus neoliberal policies, dramatically reshaping labour and local economies while generating new flows of migration, new strategies of policing, and new rights claims. Contextualizing precarity and resistance to it in the region where neoliberalism was pioneered provides important insight into its workings around the globe.
3. Popular performance as critical research method
Critical LAC scholarship has long valued the knowledge and practices of subaltern social groups as a source of insight into and contestation of colonialism and capitalism. Strong cultural repertoires of music, dance, theatre, and visual art make performance a rich site for elaborating and engaging with this knowledge. CERLAC invites projects examining performance as a method for collaborative and community-engaged research on our hemisphere.
4. Food sovereignty, community environmental governance, and indigeneity
Throughout the Americas, globalization and the expansion of extractives have imperiled the livelihoods, environments, and cultures of indigenous and peasant communities. Self-defense for these communities is increasingly seen to lie in sharing best practices for local environmental governance, solidarity economies, and collective rights across national and linguistic boundaries. CERLAC encourages collaborations in this area.
5. Sexuality studies
Much recent work across many disciplines in the social sciences, sciences and humanities has turned on questions of sexual identities, experiences, behaviors, and communities in Latin America, the Caribbean and their diasporas. At York University, an informal network of scholars has taken up topics within Sexuality Studies ranging from health and reproduction to human rights.
|
cc/2019-30/en_middle_0059.json.gz/line98
|
__label__wiki
| 0.721799
| 0.721799
|
Brenda Harrison – a brief in memoriam
Brenda died on Wednesday 24 February in the Phyllis Tuckwell Hospice in Farnham. Pam, her life partner, slept in the Hospice and was at her bedside for the final hours of Brenda’s life.
Brenda was an amazing person, an evangelical Christian with a passion, and a key member of the Changing Attitude team. She was a campaigner and fighter and was always totally committed to whatever she became involved with. Brenda became involved with Changing Attitude in the early years and was instrumental with others in creating a strong, independent LGBT Anglican witness.
She worked half-time for Changing Attitude for 3 years as administrator and continued to work unpaid with the same commitment until a few weeks before she died. She had also become a trustee and ensured that we adhered to all the legal and financial rules.
Changing Attitude wouldn’t have been organized with such efficiency and we wouldn’t be in such a stable financial position without Brenda. But more than her practical skills, Brenda brought her cheeky smile and a bouncy attitude to meetings and events.
She was involved with many other groups, had been a president of the European Forum, a member of the Evangelical Fellowship, CA convener for Guildford and a member of the Human Sexuality Group in Guildford Diocese. She had many more irons in the fire, all of which helped her cross boundaries and form friendships with a huge network of people.
Brenda was an inspiration to so many and we all have so much to thank her for ~ a determined fore-runner who campaigned for many of the things some now enjoy and take for granted. Brenda wanted the campaigning to continue until all are able to enjoy freedom in the Kingdom of God. Her inspiration and love touched many of us over the years.
Posted by Colin Coward at 16:33 15 comments:
Civil Partnerships: Letter and Leader in today’s Times
The Times has published a letter today signed by a number of bishops including several patrons of Changing Attitude, and a leading article. The letter argues in favour of an amendment to the Equality Bill by Lord Ali which would allow Civil Partnerships to be registered in religious buildings.
All but one of the bishops is retired and the bishop of Salisbury is to retire later this year. The bishops of Winchester and Chichester are among those consistently opposing equality for LGBT in the House of Lords. The House of Bishops was described to me two weeks ago by one of the bishops who signed the letter as a dysfunctional mess (or something like that!).
Why do bishops opposed to LGBT equality turn out en masse to vote for intolerance while bishops who support LGBT people in private and actively encourage clergy to register Civil Partnerships stay away when these matters are debated? Are they bullied and intimidated by their conservative brothers in the House? (Shades of Gordon Brown?).
The current stance of those bishops who are vocal is unrepresentative of the majority of Anglicans, destructive of the Church’s mission in England and is having a terrible negative effect on LGBT people, our friends and families and all Christians who believe that justice, truth and love are prime Christian values.
It’s discrimination to stop gay couples taking vows in church
It is inconsistent to affirm the spiritual independence of the CofE but also deny the spiritual independence of three small communities
Sir, The Civil Partnership Act 2004 prohibits civil partnerships from being registered in any religious premises in Great Britain. Three faith communities — Liberal Judaism, the Quakers, and the Unitarians — have considered this restriction prayerfully and decided in conscience that they wish to register civil partnerships on their premises. An amendment to the Equality Bill, to allow this, was debated in the House of Lords on January 25. It was opposed by the Bishops of Winchester and Chichester on the grounds that, if passed, it would put unacceptable pressure on the Church of England. The former said that “churches of all sorts really should not reduce or fudge, let alone deny, the distinction” between marriage and civil partnership.
In the same debate, the bishops were crucial in defeating government proposals to limit the space within which religious bodies are exempt from anti-discrimination law. They see that as a fundamental matter of conscience. But it is inconsistent to affirm the spiritual independence of the Church of England and simultaneously to deny the spiritual independence of the three small communities who seek this change for themselves (and not for anybody else).
The bishops’ “slippery slope” argument is invalid. Straight couples have the choice between civil marriage and religious marriage. Gay couples are denied a similar choice. To deny people of faith the opportunity of registering the most important promise of their lives in their willing church or synagogue, according to its liturgy, is plainly discriminatory. In the US it would be unconstitutional under the First Amendment: Congress shall make no law . . . prohibiting the free exercise . . . of religion.
The amendment will be re-presented by Lord Alli on March 2. We urge every peer who believes in spiritual independence, or in non-discrimination, to support it.
Iain McLean, Professor of Politics, Oxford
Diarmaid MacCulloch, Professor of the History of the Church, Oxford
The Right Rev David Stancliffe, Bishop of Salisbury
The Right Rev John Gladwin, Former Bishop of Chelmsford
Lord Harries of Pentregarth, Former Bishop of Oxford
The Right Rev Bill Ind, Former Bishop of Truro
The Right Rev Peter Selby, Former Bishop of Worcester
The Right Rev Kenneth Stevenson, Former Bishop of Portsmouth
The Very Rev Nick Bury, Dean of Gloucester
The Rev Jeremy Caddick, Dean, Emmanuel College, Cambridge
The Very Rev Jeffrey John, Dean of St Albans
The Very Rev Colin Slee, Dean of Southwark
Canon Dr Judith Maltby, Chaplain, Corpus Christi College, Oxford
Canon Brian Mountford, Vicar of the University Church, Oxford
Canon Jane Shaw, Dean of Divinity, New College, Oxford
The Rev Sarah Coakley, Norris-Hulse Professor of Divinity, Cambridge
Sarah Foot, Regius Professor of Ecclesiastical History
Alec Ryrie, Professor of the History of Christianity, Durham
Stuart White, Director of the Public Policy Unit, Oxford
Jill Green, Quakers
The leading article:
Equal before God
This Government has done much to bring the law into line with modern attitudes towards homosexuality. It scrapped Section 28 , equalised the age of consent and ended the ban on gays in the Armed Forces.
Now it must resolve the legal asymmetry that prevents homosexual civil partnerships from taking place on religious premises. In a letter to The Times today, a distinguished group of mostly Anglican clergy correctly point out that “straight couples have the choice between civil marriage and religious marriage. Gay couples are denied a similar choice”. That clearly discriminates against homosexuals who are also believers, and three faith communities — Liberal Judaism, the Quakers and the Unitarians — now wish to register civil partnerships on their premises. A legal amendment permitting them to do so is expected to be debated in the House of Lords next month.
The Church of England has so far resisted change, arguing that if some religious groups are allowed to hold civil partnerships then the pressure on the C of E to follow suit will become intolerable. It is a feeble argument. No one is arguing that any church should be forced to conduct a civil partnership. But willing churches should not be precluded from doing so.
Benjamin Disraeli believed the Church of England to be “a part of our liberties, a part of our national character”. If it has any hope of continuing in that role, the Church — and the Government — must recognise that our liberties today should include the right of homosexuals to register the most important promise of their lives in a church.
Posted by Colin Coward at 08:27 1 comment:
Labels: Civil Partnerships, Equality Bill
Are there signs of hope for LGBT people in Africa?
The possibility that there might be signs of hope for LGBT people in Africa seems unlikely in the context of the violence in Kenya and elsewhere and the proposed legislation in Uganda and Nigeria.
On Saturday gug blogged about the Barzai in Kampala, the forum he attended and tweeted from. He reports that he stood and spoke, but not as gug. His closet, he said, is wide open and he just needs a little nudge to come out and flower. But the forum wasn’t the place.
Gug got me thinking. In the month following the publication of the Anti-homosexuality Bill in early October, there were signs that it might lead to the introduction of similar legislation in other African countries. For some time, I feared that it might lead to the introduction of a wave of similar punitive Bills. Many African members of the Commonwealth already have draconian ex-colonial legislation on the statute book so that any new legislation is really unnecessary and looks simply vindictive.
The future looked bad for some weeks, with the probability of increased public hostility, prejudice, intolerance and aggression, which has indeed happened in Uganda and Kenya. It looked (and may still look) as if an increased risk of public humiliation, arrest, imprisonment and death is the inevitable outcome for LGBT Africans. But the multiplying of Bills didn’t happen and it has become more than a possibility that the Uganda Bill itself will not be enacted.
All of the above risks to LGBT people are ever present risk and may yet become reality. But I think that another scenario is unfolding at the same time as the potential for punitive legislation and a diminishment of safety and dignity for LGBT people.
What difference would the Uganda Bill make in reality? Would priests and bishops, for example, refuse to listen to and talk with LGBT people and report anyone they knew to be gay to the police? In Nigeria, what difference would the anti-gay marriage act make? No-one was proposing to legalise gay marriage in the first place so the bill was always an attempt to play on prejudice and pre-empt moves to acknowledge the presence of LGBT people in society.
At the moment, it looks likely that neither bill will be enacted. There was strong international condemnation of the Nigerian Bill by LGBT organisations and the Ugandan Bill has created huge international political condemnation with economic sanctions threatened. Martin Ssempa’s display of pornographic gay images in church has made him a figure of derision. The Million Man March so loudly trumpeted by him never materialised.
Both bills have mobilised opposition to LGBT people in their respective countries, using conservative Christian teaching (labelled traditional and orthodox) to mobilise Christian support.
But I think there is good news as a by-product of the various anti-gay initiatives.
LGBT people in Africa may have been intimidated by the anti-gay hysteria but some of them have also been motivated to work for change and stand up for themselves and their human rights.
International networks and relationships between pro-LGBT groups and individuals have been activated and strengthened. This is certainly true for Changing Attitude and our links across Africa. The internet is proving to be a huge influence in disseminating news and information and creating effective alliances.
A public discourse in each of the countries concerned has been started - not, perhaps, what the homophobes anticipated. Lesbian and gay attacks and anti-gay campaigns are regularly reported by the media. This means that people are learning about the real presence of LGBT people in their culture even if their prejudices are being fuelled at the moment. But people will also ask questions, especially if they suspect that someone in their own family or social network might be lesbian, gay, bisexual or transgender. Pro-gay arguments are also being articulated and the subject is now irrevocably on the agenda – it will never go away.
Even were the Ugandan or Nigerian bills to be passed, this process will continue. I suspect that far more positive progress has been made in the past 4 months since the Anti-homosexuality Bill was published than is as yet obvious in the public domain.
I prophesy that the anti-gay campaigns will be counter-productive and will eventually bring about the very thing they are set up to eradicate – the acknowledgement and acceptance of LGBT people in African societies.
Uganda pastor Martin Ssempa screens gay porn in church
Pastor Martin Ssempa, the Christian leader driving support for the Anti-homosexuality Bill, whose Million-Man March was supposed to have taken place on Ash Wednesday until banned by the police, decided instead to screen gay porn in Pastor Kiganda’s church in Kampala on Wednesday evening. The screening was attended by around 300 supporters crammed into an evangelical church. This is the most astonishing way to mark Ash Wednesday that I have ever heard and if a church in the UK or North America chose to screen gay porn in church on any occasion, let alone Ash Wednesday, the backlash would be intense and unforgiving.
Martin Ssempa told the supporters:
"We had planned to have a million-man and -woman march in Kampala but unfortunately we were told that we could not march because of security concerns. The major argument homosexuals have is that what people do in the privacy of their bedrooms is nobody's business but do you know what they do in their bedrooms?," he asked, and then displayed a slide show of gay pornographic pictures. "This one is eating another man's penis," the pastor said, before going into even more graphic descriptions. "Is this what Obama wants to bring to Africa?" he said, following fierce US criticism the Anti-homosexuality Bill.
In his report about Ssempa’s gay pornography Ash Wednesday in church, gug says he has heard that some mainstream Christians have had enough and are going to publicly oppose the bill. They are Anglicans and their strongly heart-felt opposition will be in marked contrast to the 'wishy washy hypocrisy' of the Church of Uganda. If they are to have any more credibility, says gug, Christians will have to claim back their Church.
Gug watched the programme Agenda Uganda on NTV last night, in which Pastor Solomon Male justified the killing of gay Ugandans because they have refused to change. He said gays should be killed because the Bible says so, and the audience applauded – another extraordinary message for Ash Wednesday.
This morning, gug decided to send an email letter to the key supporters of the Bill:
MP David Bahati, sponsor of the Bill, who is doing all this in defence of the traditional family
MP Benson Obua Ogwal, co-sponsor the bill, who calls gug a gay pervert because the Bible calls him so
MP Nsaba-Buturo who is a born again Christian, fierce proponent of the Bill and the Minister for Ethics and Integrity
Speaker Ssekandi, the man with the official final say with what goes on in parliament
Stephen Langa, the 'ideologue' behind the Anti-Homosexuality Bill and a fierce defender of the family (but presumably not against gay porn!)
Gug wrote:
Last night, I watched Pastor Solomon Male on Agenda Uganda on NTV justifying the killing of gay Ugandans, because they could not, or would not change.
This morning, I see this article: Ugandan Pastor screens gay porn in Church.
It would be laughable if it wasn’t the truth. Of course Ssempa has done exactly the same thing many times. And, the Minister of Ethics and Integrity looks on... Martin Ssempa has screened gay porn at press conferences. He has done so at the National Theatre. He has done so at many other places which the press has simply not reported about. He has gone into graphic descriptions of gay porn on Television, and the Broadcasting Council is yet to caution any of the stations, or even the man of God.
Is it because it is Gay Porn? Or is it because it makes gay people look bad? Or, will someone soon claim that there are laws against 'straight porn' and none against 'gay porn'? This debate has reached, or has always been at the heights of hypocrisy.
Or, maybe it is the Christian thing to do, to screen porn in Church? Maybe I used to know a different Christianity.
Gayuganda
Gug says Ssempa is breaking one of the clauses of his own Bill, which says:
Section 13; Promotion of homosexuality.
(1). A person who -
(a) participates in production, procuring, marketing, broadcasting, disseminating, publishing pornographic materials for purposes of promoting homosexuality;
commits an offence is liable on conviction to a fine of five thousand currency points or imprisonment of a minimum of seven years or both fine and imprisonment.
Labels: Uganda Anti-Homosexuality Bill
Gug reports on the Ugandan Anti-homosexuality Bill march in Jinja
Gug has blogged today about the demonstrations that happened in Jinja on Monday. For some reason The Monitor took two days to report the demonstrations and New Vision carried no reports. The demonstration drew hundreds of people and lasted 2-3 hours. The pictures come from the Monitor.
Here are excerpts from the Monitor reports:
Hundreds of Jinja residents took to the streets on Monday in support of the anti-homosexuality Bill. Chanting messages peppered with anti-gay slurs and displaying placards denouncing the practice, the demonstrators made their way around the town led by religious leaders in a procession that brought business to a temporary stand still.
Western leaders rebuked
The demonstrators also criticised Western leaders’ disapproval of the Bill. “Obama leave Ugandans alone,” “Obama to hell with your aid,” were some of the messages written on the placards.
“Of what importance is homosexuality to us? It is as if we have no brains. Let them keep their homosexuality and keep their money as well!” a woman among the shouting crowd yelled.
Speaking following the procession that lasted about two hours, Pastor Martin Ssempa, one of the prominent supporters of the Bill, said it was a shame that the US president had taken to supporting the un-African custom and expected Uganda to follow suit. “Obama even if you do not give us money for medicine for our people, to hell with that money, we would rather die but die in dignity,” he said.
He added: “This is Uganda and we also have our rights just like the Americans have theirs. We decide for ourselves what is good for us. So these leaders should leave us alone to make our own legislations that are good for us.” The clerics, who preached against the practice at a crusade held at the Kazi Mingi grounds in the town, also claimed the media had failed in its duty to fight the practice.
Pastor Matthias Sserugo said: “The anti-gay federation is not here to express their hatred for homosexuals but to tell them that they can change and society can accept them once more.” President Museveni recently expressed opposition to some sections of the proposed Bill noting that they would harm Uganda’s foreign policy.
Martin Ssempa had been proclaiming that today, Ash Wednesday, a Million Man March in support of the Bill would take place in Kampala. Ssempa has been declaring that the Lenten season is the period of mobilisation and mass action to have the bill passed so that by Easter Day the bill should be law.
It would seem that the international pressure and the political implications of the Private Members Bill are having an effect not only on its progress but on the ability of Bahati and Ssempa to organize support in favour of the Bill. I sense parallels with the Nigerian Same Gender Marriage Prohibition Bill which although not dead, has never been passed into law. There are also echoes of the failure, to date, of the conservative pressure groups in the Anglican Communuion to achieve their goal of splitting the Church and isolating the North American, openly gay-affirming Provinces.
Conservatives have campaigned on these three issues with great confidence and conviction. Things are not working out as they planned, for which I give thanks. Forces hostile to LGBT people are still intense and well organised, but other, more benign forces are at work in creation. Affirmative campaigns can achieve significant change by mobilising pro-gay political and Christian opinion and individuals like gug can move mountains by staying in the heat, telling the truth and allowing the world to learn from the experience of one honest, courageous gay Ugandan.
The Archbishop of Canterbury’s Presidential Address – Jean Mayland, Changing Attitude Patron and Trustee responds
Changing Attitude patrons and trustees hold a spectrum of opinions about the stance we should take in response to the Anglican Covenant and the strategic attitude towards the process of changing Communion attitudes towards LGBT people. The Revd Jean Mayland, retired Church Life Secretary for CTBI holds a more hawkish position than me and reacted more negatively to the Archbishop’s Presidential Address. She is pictured below on the Modern Churchperson's Union stall at Lambeth 2008. Her response follows.
The Archbishop of Canterbury’s Presidential Address - a personal response
I first heard accounts of the Address as I drove home from York and felt very angry. I read the analysis of the speech by Ruth Gledhill in ‘The Times’ and read the text of the address through twice. I am still angry and I will try to define why.
I think it is because the Archbishop rebukes everyone else but never seems to acknowledge his own responsibility or failure of leadership. The only positive aspect is that he makes a half hearted apology to gay and lesbian people.
But first, the issue of women bishops and those of us who are campaigning for it. The Archbishop accuses us of not listening and just pushing our own demands.
I made my first speech in Church Assembly on the ordination of women in 1967 when I was 31. I listened to Dr Demant who told us that we only wanted to be priests because we were jealous of men as we did not have a penis. We wanted one too, aparently! I am now 73 and I have been listening to our opponents from both ends of the ecclesiastical spectrum for over 40 years! What a time in the wilderness. As well as listening we have been discussing and arguing and working and debating on and on and on and they never change - in fact Forward in Faith and Reform have become more and more rigid in their stance.
How dare that man tell me to listen! He came in at the end of the process and did not listen himself!
In his address the Archbishop accused us of jeopardising the current situation by insisting on provision just on our terms. He also says that what we hear is the rest of the Church saying, ‘Of course we want you – but exclusively on our terms, not yours’; which translates in the ears of many as ‘We don’t actually want you at all’.
I actually do not hear the Church saying this about women - the great majority of the Church wants us. It is the Archbishops who give us the impression that they are not listening to us and that we are expendable and of little value. We have asked for terms which place proper value of women and will not harm the church.
We oppose ‘Flying Bishops’ because they have entrenched opposition, supported the bullying of women and marred the catholic nature of the Church. We have never defended privilege or our own 'rights’. We have made demands which the majority of the church and those in secular society who have an interest at all, can see are just, fair and moderate. I do not think that over the years WATCH has campaigned in any way of which we should be ashamed .We have tried to be 'wise as serpents' but we have also tried to be 'harmless as doves.'
Gay and Lesbian People
The Archbishop in his address did give a sort of half hearted apology to gay and lesbian people and yet at the same time he defended the opposition of the Church in the House of Lords to the Equality Bill .He argues that the Bishops in the Lords were arguing for Religious Freedom. When one remembers the real struggle for religious freedom that took place in the Communist countries in Soviet times, then he does not have a clue. Anyway what was the religious freedom he was arguing for? It is freedom for the Church to discriminate against women and against gay and lesbian people. He says the discrimination against the latter was a small exception - but it means that gay ‘would be clergy’ living in a faithful partnership cannot be ordained - or if they do many of them live in fear. It means that they and lay people can be denied jobs if homophobic church members oppose them.
Behind this is the demand that clergy and church lay workers in civil partnerships should be celibate. Why? Celibacy in the Church of England has always been a vocation and not a matter of compulsion. Faithful commitment should be supported and not condemned and gay people have as much right to enjoy the God given gift of sex as straight people. The Bishops also made serious demands about transgender people that showed complete lack of understanding and care. Only the Bishop of Chichester wavered a bit and showed a bit of care and said it was very complicated.
Why should the Church seek an exemption from the Equality Bill so that it can exclude people in this way? When I worked at Churches Together in Britain and Ireland (CTBI) the first discussion papers about bringing the legislation concerning different marginalised groups together were published and they struck me as caring and concerned and Christ-like.
Now I am ashamed and angry that the Church seeks exemption. What about Genesis in and even Paul about no Jew or Gentile etc?
The situation became even worse when the Archbishop moved on to the issue of the Covenant which he praised and desired. This would create a two tiered Anglican Communion and would be an instrument for the oppression of gay and lesbian people.
I assume that Nigeria - homophobic, anti women, allowing and even supporting violence against women (but of course very Biblically based!!!!) would be in the top tier and the USA – open, liberal, caring, mission conscious, generous but very suspect because of its Biblical criticism and gay clergy would be in the bottom tier.
The other quite amusing thing (one either laughs or cries) is that I am sure the Archbishop assumes England will be in the top tier. What would then happen if the General Synod decides that we should have women bishops, ordain practising gay men and women and bless civil partnerships? Do we then go down to level two? The province of Canterbury a second class Anglican Province – at last one can laugh rather than scream.
Jean Mayland
Labels: Anglican Communion, Anglican Covenant, General Synod
Pro-gay meeting held in Kampala and alternative march held in Jinja as Ssempa’s million man anti-gay march cancelled by the police
The Daily Monitor in Kampala reports that the Unitarian Universalist Church of Kampala, one of the few religious organizations in Uganda that supports the gay community, held a conference on Sunday to highlight the need for an end to discriminatory treatment of the gay population in Uganda.
According their website, the Reverend Martin Lavanhar, President of Tulsa Metropolitan Ministry and senior minister at All Souls Unitarian Church arrived in Uganda on Thursday last week to launch a campaign against the Bill. Bill Sherman, one of the organizers of the conference, declined to disclose details of the meeting citing security reasons.
“Under most circumstances I would be happy to give you this contact information. But with security concerns so high, I am reluctant to do so,” Mr Sherman told the Daily Monitor in an e-mail. However, the Inspector General of Police, General Kayihura said he was not aware of the meeting and vowed to arrest them.
Gug, being, as he says, an infidel and non believer, didn’t go to the campaign meeting at the JBK Hotel but was there in spirit. He was there in the flesh later for the ‘after-party’ event, when they gathered in a bar, drank and laughed and danced and met others that they never knew existed in this world. It was a blast, he says. He had never seen so many kuchus gathered in one place, celebrating something as simple as St Valentine’s day of love.
The Daily Monitor also reports that on Sunday, the police moved to halt the planned million man demonstration in support of the Anti-Homosexuality Bill which was scheduled for Wednesday, saying that the government is still sorting 'issues out' Police halts anti-gay demo as pro-gay activists secretly meet in Kampala.
Pastor Martin Ssempa, one of the organisers of the demonstration confirmed that the Inspector of Police Major General Kale Kayihura had contacted them and proposed a meeting on Tuesday before the Wednesday demonstration. “It is true Gen. Kayihura sent us a text message that he hasn’t cleared the demonstration. He said we should meet him on Tuesday to forge a way forward,” Pastor Ssempa said. Gen. Kayihura said, “We asked them to postpone the demonstration because government has some issues to sort out and they agreed.”
Alternative demonstration held in Jinja today
Gug has just confirmed that there was some kind of smaller demonstration in support of the bill by Pastor Martin Ssempa and and his supporters in Jinja, Uganda's second largest town. This is an interesting development and here is assessment why:
The government wouldn’t want a demonstration because they have realised that the waters they have stirred up are too stormy on too many fronts. So, they have to calm down those waters.
Ssempa follows a different agenda. He wants the demonstration; he wants to show support for the Bill and wants it to become law.
So, from what I gather from the Monitor report, Sunday, the Inspector General of Police who is head of all the police in Uganda, Kale Kayihura, said they didn’t have permission for the march on Kampala. They had scheduled Tuesday as the date to meet with him and discuss options.
Why would a spontaneous demonstration have been organized in Jinja? I would understand that if Ssempa wanted one and didn’t want the police to meet him with tear gas and batons, he would organise it very fast and not in Kampala.... and hope the government accepts the fait accompli, which is what happened.
The demonstration in Jinja means that Ssempa is going rogue, counting on popular support to force through the bill. He is, of course, dumping the government in the process, which does not take such things very happily, especially if there was an agreement that they would meet on Tuesday to discuss a way forward.
Gug admits his assessment may be wrong because the government could have given the green light for the demonstration. The police have proved themselves adept at stopping opposition demonstrations in the past, so how could Ssempa's have taken place without their tacit approval?
After a week of Big Questions – the Communion still survives
Participating in The Big Questions debate yesterday morning about the division or unity of the Anglican Communion reinforced my sense of confidence in the signs that I picked up in General Synod last week.
I was seated next to Lorna Ashworth in the studio. Lorna had tabled the private member’s motion about ACNA which was debated in General Synod on Wednesday afternoon. To her far right was Charles Raven from Kidderminster, the priest who was inhibited by Bishop Peter Selby when he challenged Peter’s authority. Between them was a conservative Christian lawyer who contributed to the opening debate about the torture of terrorism suspects and the second debate about fidelity in marriage. In both the views he expressed were not unreasonable, but when he joined in the debate about the Anglican Communion he suddenly inhabited an extreme world of sin and judgement in which any person who was neither married nor celibate like him was destined for hell.
There was intense heat in the debate between those who were arguing for inclusion and generosity and the conservatives who revealed more and more extreme views as the debate proceeded. Although the programme researchers had clearly been disappointed that all of us seemed to agree that the unity of the Communion should be maintained, it became apparent in the studio that this is not what the conservatives want. They want to be split from people like me who believe in a generous, forgiving, loving, ultimately inclusive God.
If they want to push this to its logical conclusion, all we need to do is stay. They have to decide whether to leave. I know it isn’t quite as easy or simple as this – staying in a Church where people express such prejudiced, hostile views and feelings isn’t comfortable. Sometimes the homophobia and the prejudice against women becomes intolerable.
Several people in the audience approached me afterwards and expressed astonishment at the views held by the conservatives. They had no idea that this is what an extreme minority in the Church of England believe. They wondered what had happened to what they remembered as the traditional Anglican ethos of generosity and welcome to all, whatever degree of faith people have.
There is a fault line in the UK more dangerous than the fault line within the Church between conservatives and liberals. It is the fault line between those who think it’s more important for Christianity to be doctrinally pure than it is for Christianity to model God’s generous love. An exclusive Church is not just the kiss of death for gays and women priests and bishops, it’s the kiss of death for a lively, loving, healthy, evangelistic Church of England which has any chance of connecting with real people and real lives. Why would anyone watching The Big Questions and hearing the conservatives bother to enter a church which is so judgmental and intolerant?
A friend sent me a text after the programme saying they think we have a mountain to climb. We are climbing it, and the further up the mountain we climb, the more the clouds begin to clear and the potential for a glorious view becomes apparent. Both global forces and history are against the conservatives.
I’ve now had time to read in detail the comments on and reactions to the debate on Lorna Ashworth’s motion in Synod. I was in the public gallery for the ACNA debate and present at the fringe meeting on Tuesday lunchtime when the ACNA case was presented.
There were a considerable number of people at the fringe meeting who were not taken in by the confident presentation, and several asked firmly probing questions, which did not receive honest answers and some weren’t answered at all. The voting figures on the motion tell the true story. The majority of members in each House voted consistently against Lorna’s motion – which was there to be accepted if Synod really wanted to state its desire to be in Communion with ACNA. Some comments on Thinking Anglicans still seem uncertain about this.
There may well be attempts to set up a parallel to ACNA in England. There will be further attempts to marginalize TEC and Canada. There will be attempts to inflate the success and importance of ACNA. Some leaders in the Communion will continue to vilify LGBT people while at the same time claiming they want the best for us.
I think Lorna’s motion was a disaster for ACNA. They were firmly rejected by the Church of England and the whole idea kicked into touch. The large contingent which had flown over and were much in evidence at Synod got nothing for their trouble, but seem to have been flattered into a false sense of success by our English ‘niceness’. We nod and smile sweetly and agree, whilst holding to a totally different view inside.
Lorna’s motion was lost.
Greater pension equality for Civil Partners was passed.
Archbishop Rowan apologised to LGBT people and described the Uganda Bill as repugnant.
The studio audience though conservative Christian views were shocking.
The conservative leaders in the Communion are not making the progress they claim. Their reports are grossly inaccurate and they misrepresent reality continually. No group confident of their position would do this. I receive many more reports in confidence that tell me the Communion is not with them. Bishops are not with their Primates. The Church of England is not with the bishops who support ACNA. International opinion is against the Uganda Bill. The UK Government is against repressive homosexuality legislation in the Commonwealth.
Most importantly, Christ is risen, God is love and Creation is good. Truth, justice and love shine in people’s hearts and lives whether or not conservative Anglicans think that the 39 Articles, the Ten Commandments and a literal interpretation of the Bible are fundamental to salvation.
If the Christian lawyer in the audience really thinks my eternal salvation is at risk because I love another man, well, bully for the celibate him. Me – I’m for life with a joyous God.
The Future of the Anglican Communion - a Big Question
I’m in York courtesy of the BBC, preparing to participate in The Big Questions on BBC1 at 10am this morning. The big question this week is the future of the Anglican Communion.
In the conversation last week I asked Bishop David Anderson where he thought ACNA and TEC would be in relation to each other in 10, 20 or 30 years time. With litigation being pursued in so many directions at the moment and deeply hostile positions being held across the divide, it’s not the time to think about reconciliation or resolution. But I found myself thinking a lot about the need to attempt to reconcile differences one day and achieve a reintegration of the many diverse strands in our Communion.
Everyone taking part in today’s programme apparently thinks that maintaining the unity of the Communion is a good thing, from what the researcher told me. If we each think the other, those against gays and women bishops and progressive Christian theology as well as those in favour, has to be won over to our cause, then there is no hope of achieving reconciliation.
At the moment, minds are focussed on the Covenant, on the implications of signing and whether it can or will be used as an instrument to punish and exclude.
I feel far more optimistic about the future at the end of a week at General Synod. The Archbishop of Canterbury apologised and made strongly positive statements about LGBT people in his Presidential Address. Synod voted for equality in pension provision. The Church of Uganda announced that it was not supporting the Anti-homosexuality Bill. There was significant movement in a positive, pro-gay direction.
The conflicts in the Communion are not going to be resolved in a way which fails to recognize the place of women and LGBT people in every order of ministry. Space has to be created and will be created. In Africa, LGBT people will begin to create space for themselves in society and in church. There is a huge, hidden presence of LGBT people across Africa. Even if few of them are networked with each other in local communities, they are increasingly part of a global network through the internet and they are far more secure in their sexual identity and have access to far more resources online than I did at their age.
Why did General Synod vote so decisively for pension equality? The Church of England seems to have been quietly coming to terms with the real presence of LGBT in the two years since the ‘gay-Tuesday’ debates at Synod, let alone the 19 years since ‘Issues in Human Sexuality’ was published. Several gay people spoke in the debate, not all of them out to Synod in the way they are out in other circles. General Synod still doesn’t know who it has in its midst.
According to Christian Today one Synod member, who asked to remain anonymous, said conservative Synod members had deliberately withheld from taking to the floor to speak against the motion for fear of reprisals. “They didn’t dare to. There would have been screams of homophobia if anyone had dared oppose it,” he said. This would not have happened 10 or even 5 years ago. Then the conservatives were confident about their position of opposing equality for LGBT people. They are no longer confident, and it isn’t only for fear of accusations of being homophobic in General Synod. In UK society, and especially those under 40, the majority think conservative Christians are prejudiced and intolerant of sexual diversity in creation. The majority are not necessarily right, but on this issue, the Church is never going to convince them they are wrong.
In addition conservatives repeatedly distort facts to support their own version of the truth. This was shown in the way conservative sites reported Lorna Ashworth’s motion about ACNA. When your position is untenable, distort the facts. Reports about the Church of Uganda position paper on the Anti-homosexuality Bill were similarly inaccurate, as was the paper itself.
The Church of Uganda and other African Anglican churches certainly have no idea how many LGBT people worship with them Sunday by Sunday, people who either reject their church’s teaching and inwardly affirm their own identity or are deeply damaged and depressed by what they hear.
In England, the stance of churches towards equality for LGBT people in ordained ministry as well as in lay ministry and other posts will eventually be conceded, sooner rather than later if the church’s credibility and mission is to be maintained in this country.
I know I’m an eternal optimist and there are some mighty big obstacles to be overcome in the next two or three decades. But those forces which have attempted to split the Communion have failed to do so thus far, and there is no reason why we shouldn’t do everything in our power to maintain the unity of the Communion at the same time working towards full recognition for LGBT people in every Province.
Where others in the Communion have a narrow view of a God who is primarily exclusive and judgmental, we have to live into our experience of God who has created us gay and loves us gay and is calling us to transform the Church and bring another dimension of the Kingdom into being.
Truth will out - the truth about LGBT people in our Communion and the truth about the way in which people are selectively using the Bible to oppose homosexuality when they hold divisive views about women in the church, marriage and divorce.
I will be engaging with people this morning who also believe the unity of the Anglican Communion to be a ‘good thing’ but from a rather narrower ecclesiological and theological framework.
Changing Attitude Sussex launched in Brighton on Monday 8th February
Monday evening seems a long time ago, but I took the train from London to Brighton to address the inaugural meeting of Changing Attitude Sussex (which effectively covers the Diocese of Chichester). Around 70 people attended the meeting which was held in the Chapel Royal in North Street, a really beautiful venue.
Both the organisers of the meeting and myself were amazed at the numbers who attended. The clergy persons amongst those present were, of course, a sub-set of gay clergy in the diocese. My hosts pointed out that an unusually large percentage of the 350 priests in the diocese are lesbian, gay, bisexual or transgendered. A significant number are members of Forward in Faith and the last place they wanted to be seen was in the Chapel Royal, which is an inclusive church, at a meeting advocating honesty and inclusion for all gay people in the Chichester Diocese.
I wasn’t sure where to pitch my address. Having introduced myself and the ethos of Changing Attitude I opened the floor for questions and an amazingly cathartic hour followed. It was refreshing to hear people speak openly and honestly about themselves as LGBT Christians, about Chichester’s attitudes to gay people, and the stance taken by the bishops.
Amongst the diocese's bishops there appears to be little real understanding of gay people. There is deep prejudice which creates a climate of fear and mistrust and this makes the lives of gay clergy very difficult. I had hoped to meet John Hind at General Synod and talk with him about Monday evening’s launch, but our paths never crossed. He seems to live in denial of the reality over which he presides – a diocese with so many LGBT people, lay and ordained, whom he probably divides into sheep and goats – those who are anti-women bishops and those who are failing to conform to the church teaching he would want to impose. This is particularly the case in the east of the diocese where the are bishop is president of the Church of England Evangelical Council.
I hope the new Changing Attitude group will bring courage to those who want to change the diocesan culture and bring honesty and integrity to a diocese which, in attitudes towards LGBT and women, is sadly lacking.
The Sussex group will be campaigning to get a number of churches in Brighton to register officially with Changing Attitude as ‘Open and Welcoming Congregations’ to gay people. They also intend to compile a ‘Which Church?’ dossier for gay people dividing churches into four categories from ‘open and welcoming’ to ‘judgemental and rejecting’.
The provisional group convenor, Keith Sharpe, said in a press release:
‘as the British Social Attitudes Survey recently showed, attitudes to same sex relationships have become much more liberal. In the Church however things are getting worse not better. Church leaders increasingly make overt homophobic statements which foster hatred and bigotry and demonise gay people. It is very damaging for gay people’s mental health to find themselves in a judgemental and rejecting church, and we hope that our ‘Which Church?’ dossier will give them the information they need to make an informed choice. We also hope the publicity surrounding the dossier will encourage more churches to reconsider their position and become open and welcoming.’
For further information please contact keith@changingattitudesussex.com. or visit www.changingattitudesussex.com
General Synod approves pension parity for Civil Partnerships
At the conclusion of an extremely good debate in which every speaker voiced unprecedented approval for Civil Partnerships, in a vote by Houses, Synod approved Mark Bratton’s motion unaltered by the amendments proposed by the Bishop of Ripon and Leeds and by Philip Giddings. The voting figures were Bishops, for 12, against 2, abstentions 3, Clergy for 97, against 23, abstentions 10, Laity for 78, against 59, abstentions 9.
The motion read:
That this Synod request the Archbishops’ Council and the Church of England Pensions Board to bring forward changes to the rules governing the clergy pension scheme in order to go beyond the requirements of the Civil Partnership Act 2004 and provide for pension benefits to be paid to the surviving civil partners of deceased clergy on the same basis as they are currently paid to surviving spouses.
To be honest, I’m astonished. This isn’t the result I expected. The cumulative effects of the week at Synod from the Archbishop of Canterbury’s apology and very strong comments about the Uganda Bill in his Presidential Address on Tuesday to the Church of Uganda’s decision not to support the Anti-homosexuality Bill to this afternoon’s debate suggest significant movement in the Church of England’s attitude to homosexuality. In the period since gay Tuesday two years ago, the Church seems to have changed its attitude even more radically in understanding the issues of generosity and inclusion which affect lesbian, gay, bisexual and transgender people.
The big issues of equality and inclusion still have to be faced – real quality for LGBT clergy and lay ministers and the celebration of Civil Partnerships in church – but unless I am very mistaken, our church is learning and changing and this is a cause of real thanksgiving and celebration.
The amendments would, from Ripon and Leeds, have offered hardship grants rather than pension equality and from Philip Giddings, have extended equality to any qualifying relative living as a member of the deceased’s household for more than 5 years. Both amendments were lost, the first by 110 to 154, the second on a show of hands.
Giles Goddard was called first in the debate and in a confident maiden speech, said that this was about justice, generosity and care. Stephen Coles declared that he had a strong interest at the beginning of his speech and John Saxbee, Bishop of Lincoln, added strong support.
The Archbishop of Canterbury was strongly affirming of LGBT people in his Presidential Address before offering a profound apology. He said:
The debate over the status and vocational possibilities of LGBT people in the Church is not helped by ignoring the existing facts, which include many regular worshippers of gay or lesbian orientation and many sacrificial and exemplary priests who share this orientation. There are ways of speaking about the question that seem to ignore these human realities or to undervalue them; I have been criticised for doing just this, and I am profoundly sorry for the carelessness that could give such an impression.
He also expressed repugnance at the infamous legislation being discussed in Uganda and in comments about the Anglican Communion, said:
“There is an undoubted good in the independence of local provinces, and there is an undoubted good in the fact that some provinces are increasingly patient, compassionate and thankful in respect of the experience and ministry of gay and lesbian people – entirely in accord with what the Lambeth Conferences and Primates' statements have said.”
It wasn’t all good news, but throughout this week at Synod, there has been much stronger recognition of the reality of LGBT lives and ministries in our Church and for that, I am quietly thankful to God.
Labels: Civil Partnerships, General Synod
Lorna Ashworth’s motion about the Anglican Church in North America
Suffragan Bishop David Anderson, President and CEO of the American Anglican Council based in Atlanta, has been present at General Synod this week and I’ve enjoyed two lengthy conversations with him. We had met previously at TEC General Conventions and ACC meetings. I start with David because we had a genuinely easy conversation, but I want to write about the distortion of reality which characterises the conservative reporting of events.
Bishop David was here with the four ACNA leaders who spoke at a fringe meeting organised by Anglican Mainstream on Tuesday lunchtime. I was present at the meeting, illicitly because the Bishop of Winchester who chaired said at the beginning (looking directly at me, I thought), this meeting is open only to members of General Synod, asking anyone else present to leave. I remained in my seat, waiting to be named. I’m sorry, bishop, for having ignored your request.
The four speakers at the meeting representing the Anglican Church in North America were Bishop Donald Harvey, Mrs. Cynthia Brust, Dr. Michael Howell, and the Rev. Dr. Tory Baucum. They were confident and convincing in their presentations and any one not knowing better would have been convinced by what they said. Speakers from The Episcopal Church would have been equally passionate and convincing. That’s what North Americans are like.
Yesterday I met one of the BBC reporters covering Synod. What they said isn’t true, he commented, having visited both TEC and ACNA parishes. ACNA distorts statistics to their advantage and are riven with tensions and disagreements. ACNA is an unstable network. This is very different from the idealised picture presented on Tuesday of a network which is modelling Anglican breadth and inclusiveness with far more success than we in the Church of England have ever been able to achieve.
Could their picture be true? Let’s look at the way conservative groups, including ACNA itself, are reporting yesterday’s debate on Lorna Ashworth’s Private Member’s Motion.
The Anglican Mainstream headline is ‘ACNA a member of the Anglican Family says Church of England General Synod’.
David Virtue headlines his article: ‘ACNA recognised in spirited debate by Church of England Synod’.
The ACNA website reports: ‘General Synod affirms Anglican Church in North America’.
The Bishop of Bristol’s amendment does none of the above. It recognises and affirms the desire of ACNA to remain in the Anglican family; it does not recognise ACNA nor say ACNA is a member of the Anglican family nor affirms ACNA.
The conservative reports reveal their desperation to be recognised as members of the Anglican family and the lengths to which they will go to convince themselves by totally distorting the truth. This is a repeated characteristic of conservative groupings.
Comments on the Stand Firm web site reinforce this inability to tell the truth. Baby Blue, who has generously acknowledged me in the past, writes that “the Church of England recognizes the ACNA. We are not ‘schismatics.’” Sorry, but no, the Church of England did not do that yesterday. Baby Blue claims it is brilliant and changes the whole conversation because ACNA remain Anglicans in the eyes of the Church of England. I think she and other commentators are grasping at straws. Many of those asking questions at the fringe meeting on Tuesday were critical of what they had heard. The first questioner asked whether those on the panel were all in denial about what is happening in North America. Another asked whether they were saying the Episcopal Church is not now part of the Anglican Communion, such was the distorted impression they created. Cynthia Brust pointedly refused to answer the question.
Still on Patrol’s analysis on Stand Firm started with the thought that “the C of E passed something expressing generally positive sentiments toward ACNA which probably infuriated the Presiding Heretic which by definition is a good thing.” This kind of abuse towards the Presiding Bishop and The Episcopal Church is characteristic of the attitudes held by conservatives and revealed by Stand Firm and VirtueOnline. They are not Christian. They are poisonous.
The debate itself was brutally interrupted by a malfunction of the electronic voting system which caused a long hiatus while arrangements were made to vote through the lobby doors. It was a mess in the middle of a debate was something of a mess, avoiding the underlying issues and the ultimate need for Christians to be reconciled with each other.
I asked Bishop David Anderson where he thought ACNA and TEC would be in North America in 10 or 20 years. He had no idea. If we are not working towards a reconciliation and reintegration of churches and ministries, then we are failing to pursue fundamental Christian ideals. At the same time, I affirm that Changing Attitude can envisage nothing other than a fully inclusive Church in which the ministries of women and LGBT people are fully integrated into the life of the Church.
At the moment, there is a visceral hatred of women priests and bishops and a loathing of gay people in ministry among certain groups and networks. Thank goodness for John Ward, lay member for the Diocese of London, who brought personal reality into yesterday’s debate when he spoke to his amendment. We are talking about people who have left and walked away from the Communion, he said. He talked of his 14 year relationship with the man who is now his Civil Partner and linked the gay issue and Gene Robinson’s ordination with those he cannot affirm because they have split over the issue. He asked permission to withdraw his amendment and received the warmest applause of the afternoon for his honesty and generosity.
At the moment, all groups in North America are finding it impossibly difficult to be honest and generous towards each other. My conversations with David Anderson told me that we can be friends and acknowledge each other’s humanity, but only when we set aside differences over gender and sexuality. One-to-one we can do that, but in the arena of Church politics and structures it is at present impossible. People prefer to carry their prejudices, projections and demands for a Communion that excludes certain categories of people.
It isn’t difficult for Changing Attitude to stand firm with those who want women and gay people fully included in our Communion. It’s much more difficult to work and pray for an outcome in which present divisions are reconciled and all are united in one Communion. It is a dream which we have to try and turn into reality. We must refuse to be corrupted by the distortions of reality which characterise conservative campaign strategy.
Labels: Anglican Communion, General Synod, The Episcopal Church
Church of Uganda issues position statement opposing Bahati Anti Homosexuality 2009 Bill
Where to begin? So much has happened since I last blogged and there a several stories which I want to write about.
Let’s begin with Uganda and gug’s latest blog.
“At last the Anglicans in Uganda have decided that a good Anglican cannot support the Bahati bill.
“Thanks to all people who pulled and pushed for us. Changing Attitude England, Leonardo pushing and pulling and ranting and reving, and all Christians out there. Archbishops of York, Canterbury. Cant forget you guys. You weighed in late, but you did.
“You may wonder what it does for the bill? Just remember, the bill is only a symptom of the homophobia in Uganda. It has to be undercut. Uganda must be safe for those of us who will live there. And, never again to Genocide, which this bill is.
“Here, at long last, is the absolute about turn from Uganda’s Anglicans.”
Gug's blog is based on a report carried in the Ugandan Monitor. The full text of the Church of Uganda’s statement is here.
The Church of Uganda associates itself with the concerns expressed in the Anti Homosexuality Bill 2009 but instead of a completely new Bill, recommends a Bill that amends the present Penal Code. The Church of Uganda does not support Bahati’s Bill.
The stance of the Ugandan Church distances itself from support for the present Bill and would effectively kick the whole process into the long grass. They propose amending existing provisions by means of a new Bill which might be called “The Penal Code Unnatural Offences Amendment Bill” and recommend that a comprehensive legislative and literature review of all the laws and literature related to the subject at hand be undertaken in order to identify the actual gaps in the existing legislation.
The position statement is cleverly worded. It doesn’t explicitly state opposition to the Bill but effectively does so by recommending the introduction of a completely new Bill. If the Bahati Bill is passed, the Church of Uganda will be on record as not having supported it. If the Bill fails to pass, will there be any traction behind the proposal to amend existing legislation? I doubt it.
The Church of Uganda proposals for the new Bill addresses three loopholes: protecting the vulnerability of the boy child; proportionality in sentencing; and ensuring that sexual orientation is excluded as a protected human right.
Changing Attitude welcomes the first two proposals. Girl children are protected under existing legislation against abuse by adults. Boy children are not and must be. The paper doesn’t explain what is meant by proportionality in sentencing, but I understand it to mean opposition to the death penalty, which we also clearly welcome.
We disagree with the proposal to exclude sexual orientation as a protected human right. This is in contravention of Anglican Communion policy. Lambeth 1.10 recognises the reality of homosexual orientation and assures us that we are full members of the Body of Christ. The Church of Uganda has yet to accept Lambeth 1.10 in its entirety. Likewise with Dromantine which unreservedly commits the Communion to the pastoral support and care of homosexual people and describes the victimisation or diminishment of human beings whose affections happen to be ordered towards people of the same sex as anathema.
To its credit, the Church of Uganda commits to ensure that the law protects the confidentiality of medical, pastoral and counselling relationships, including those that disclose homosexual practice in accordance with the relevant professional code of ethics. There are members of the Church of Uganda engaged not in the counselling approach advocated by ex-gay ministries but are in accord with professional, non-judgmental practice.
This part of the position statement is clearly in conflict with other recommendations. It uses the phrase ‘homosexual disorientation’ which a professional counsellor would never use. It would prohibit and penalise homosexual behaviour and links homosexuality with sexual perversion.
But this is a dramatic change from the Church of Uganda and Changing Attitude welcomes their opposition to the Bahati Anti Homosexuality Bill 2009.
Sexuality and Human Flourishing
Changing Attitude was one of five national organisations which together organised a very successful conference in Birmingham on Saturday. The other groups were The Centre for the Study of Christianity and Sexuality, Inclusive Church, LGCM and The Sybils, with Church members from Norwich and Birmingham. The conference was designed to explore and celebrate our relationship with God, with each other and with our inner selves, and for me, it opened windows onto all three.
The Revd Canon Dr Alison Joyce, Priest-in-charge of Edgbaston Old Church, introduced the day and welcomed the two speakers who delivered addresses in the morning. The Revd Arnold Browne talked about Sexual Diversity in Scripture and Tradition and Alison Webster about Sexual Diversity in one human journey.
Lively 5 minute buzz groups followed each talk, and the 100 or so conference participants then separated into ten groups to discuss questions arising from the talks and their own experience. Group themes included Parenting; Issues with the Church; Christian Ministry; Cultural Loyalties; Issues at Work; To disclose or not to disclose? and Under Pressure.
Lunch followed with soup provided by the local group. While most were enjoying lunch, members of CSCS met in the side chapel and held their AGM. CSCS has had a good year, partly reinvigorated by involvement in the Conference which had happened as a result of their initiative. Finances are healthy and a new chair and treasurer were elected, with Jane Frazer standing down as chair and Daphne Cook as Treasurer.
We reassembled for a panel of speakers who were chaired by Brian Thorne and invited to share their own pitfalls, opportunities and spiritual resources on the journey.
We split into groups again for another 50 minutes. Discussion in my group second time around was fired by what we had heard from the panel. People wanted to know how they could bring pressure on the Church and especially on bishops, who seem to live in a fantasy world disconnected not only from LGBT Christians but from majority opinion in our congregations.
Tea and coffee followed with a fabulous range of cakes, and the final plenary session brought as much as possible together in the last 20 minutes.
Anglican attitudes maintain regimes of terror and inhumanity against LGBT people
Lesbian, gay, bisexual and transgender people hurt, deeply and painfully, as a result of Christian attitudes towards homosexuality. I am old enough and I have a secure-enough sense of myself not to feel pain most of the time now. But tens of thousands of LGBT people do. It’s an intolerable outrage and it takes a person like gug, the gay Ugandan, to describe the feelings and the scenario in which gay people the world-over endure the intolerance and prejudice of well-meaning Christians.
Gug has been coming out to his brothers (of which he clearly has many) one by one - yesterday to another. He doesn’t want them to discover from the TV that their brother is an out and out homosexual. He tells them quickly, not giving them much time to digest the news, because for him it’s a stressful, embarrassing task.
The brother goes and tells my dad, who was 72 yesterday, something about it. His dad is an elder of the village, the clan, the tribe. He has taken a lifetime of work to get to this position of respect. He was not happy with the news. The old man has designated gug, the second son, the apple of his eye, as heir apparent.
He has pleaded with gug to get married. He even offered gug a girl, but he laughed at him and said no thanks. Then his father told him, at least have children. Then, a year ago, he pleaded please have at least one child, even if it is a girl. Gug was deaf to his entreaties
His whole day was spoilt yesterday but today he tried to cover up the loss that he felt, even though it hurts, very badly. It hurts. But he cannot respect his dad’s request to remain silent, not with the threat of life imprisonment and death for gays in Uganda. There is work to do with the bill still before parliament.
Today he concluded his blog by referring to a swell office spac right in the middle of town on Kampala Road, the home to Andrew Wormack's ministries and books. He is an American evangelist married to a Ugandan woman, and robustly defends the Bahati Bill. Gug wants to know why any sane human being would support the Bill. I wondered why conservatives and so-called orthodox Christians claim, falsely, that homosexuality in Uganda is fuelled by western money and decadence, when American Christian money is channeled through Ugandan Christians to support the Bill and fuel their intense prejudice.
Gug reports a story from the USA, about Moses, a gay man from Uganda seeking asylum in the United States, who gug thinks he knows as a gay Christian with an interesting story to tell. Read gug’s own blog here.
Moses gave a chilling account of the harassment and terror he withstood growing up in Uganda. He addressed reporters with a paper bag over his head to conceal his identity, speaking of how in Uganda, “one would rather die than come out of the closet,” because LGBT people are so terrorized in a culture that portrays homosexuality as “deviant” behavior. He described being beaten at school and living in constant “fear of rejection, fear of isolation by my family, making my family a laughingstock... fear of losing friends, fear for my life.” He experienced a “constant feeling of shame,” and ultimately abandoned his studies and lost his job.
Moses said that he was raped by a policeman, but feared seeking medical attention because “if I told health workers they would not give me help. They would instead report me, and the next day I would hit the headlines in the newspaper.” Moses displayed lists of suspected homosexuals published in Ugandan newspapers with headlines like “Top Homos” and “Homo Terror.” People lost their jobs and received death threats as a result of their names being published, he said.
These are the experiences of gay Ugandans and of lesbian, gay, bisexual and transgender people across the Anglican Communion. Our Communion is complicit in terrorizing and persecuting gay people. The voices raised against such inhumane attitudes are still sadly few in the Communion despite the obvious Christian demand that gay people should be treated with equal dignity and respect. The poison is allowed to spread, and gay Christians wear paper bags over their heads to protect their identities and their life. Shame on the Anglican Communion and on all bishops who fail to denounce such inhumanity.
Time for resolute resistance and repeated challenges to a dishonest Church
I’m reading ‘Rowan’s Rule’, the Biography written by Rupert Shortt. This morning I reached the end of Chapter 3, ‘Where all the ladders led’, which deals with the Tony Higton motion in General Synod in 1987, the eviction of LGCM from St Botolph’s Aldgate in 1988 by George Cassidy, then Archdeacon of London, and Dr Rowan Williams’ Michael Harding Memorial Lecture ‘The Body’s Grace’ in 1989.
Dr Williams described the General Synod motion as a: “shabby compromise … held up by bishops as representing the ‘mind’ of the Church, and accorded something like legislative force.” He continued, “It is becoming harder all the time for a gay person to be honest in the Church. We have helped to build a climate in which concealment is rewarded …” And that was twenty years go.
Lisa Nolland and others have repeatedly criticized Changing Attitude for having published ‘Sexual Ethics’ on behalf of the Lesbian and Gay Clergy Consultation, a report which included: “… we think it is important to remain open to the possibility that brief and loving sexual engagement between mature adults in special circumstances can be occasions of grace.”
Rupert Shott reminded me that ‘The Body’s Grace’ “… included a forthright defence of sex outside marriage in some cases. Dr Williams said: “… an absolute declaration that every sexual partnership must conform to the pattern of commitment or else have the nature of sin and nothing else is unreal and silly. People do discover … a grace in encounters fraught with transitoriness and without much ‘promising’ …”
Dr Rowan Williams, as he was then, articulated ideas about sexual encounters outside of marriage which are very similar to the thoughts of those who contributed to the Consultation Sexual Ethics report. Quite possibly Rowan’s words were consciously or unconsciously in mind. Lisa would no doubt criticise Rowan for holding such thoughts. I still believe such an attitude towards sexual encounters to be congruent with Christian ethical teaching.
I don’t know whether Rowan Williams the private person would still hold to the same views now. What alarms me is that as Archbishop of Canterbury, he presides over a House of Bishops (which includes patrons of Changing Attitude) that sends 8 Lords Spiritual to speak and vote in the Equality Bill debate last Monday week in defense of a position which continues to reward concealment in the Church by lesbian, gay, bisexual and transgender people and makes it as hard as ever for us to be honest with bishops and congregations. Thank God for those who are honest – but why was Lord Harries of Pentregarth, also a CA patron, alone in voting for the relevant clauses?
This week, Pope Benedict XVI joined those Christian leaders arguing against equality legislation, indicating that equality for LGBT people will “… impose unjust limitations on the freedom of religious communities to act in accordance with their beliefs.” This is clearly not true but a myth successfully created by conservative Christians opposed to any action which enables LGBT people to open and honest rather than concealing our identities.
The Pope and Church of England Bishops together argue that Churches should have the freedom to be prejudiced, unjust, dishonest and discriminatory. Dr Rowan Williams was right to argue in 1989 that the Church wrongly rewards concealment by LGBT clergy and encourages dishonesty – dishonesty by archbishops, bishops and opinion-formers in the church as well as by LGBT people.
The Churches think defeating the amendment enshrines their right to act in a discriminatory way against us. In truth, the exemptions remain where they have been since the Bill was first passed. The bishops’ opposition makes gay Anglicans more resolute when confronted with bigotry and prejudice in the Church. In a comment on Thinking Anglicans, Craig Nelson, a supporter of Changing Attitude, says it is time to bear witness in a clear, resolute, respectful and peaceful way – and we will!
Like the Anglican Communion, the Roman Catholic Church is officially against the demonisation of gay people; yet cardinals and archbishops regularly do so - apparently the Archbishop of Mechelen and Primate of Belgium said that homosexuals were like anorexics on TV a fortnight ago and Mexico's Cardinal Barragan said two months ago that gay people will never enter heaven. The Church of Uganda, meanwhile, remains silent in the face of the Anti-Homosexuality Bill which threatens execution and life imprisonment.
What is so intolerable in the light of the views expressed by Dr Rowan Williams two decades ago is the failure of English and Ugandan bishops to understand what the Dromantine Statement means when it commits the Anglican Communion unreservedly to the pastoral support and care of homosexual people, assuring us that we are children of God, loved and valued by him, and deserving of the best bishops can give of pastoral care and friendship. Do the bishops really think these commitments are fulfilled by silence in the Uganda Church about the Anti-Homosexuality Bill and opposition in England to the Equality Bill amendments?
No they are not, and Changing Attitude will pursue our bishops until as a House they have the guts to be honest about the LGBT clergy they license and support in private (or conduct witch-hunts against in some dioceses) and learn from Dr Rowan Williams’ prophetic remarks from a time before he assumed responsibility for the unity of the Anglican Communion.
Civil Partnerships: Letter and Leader in today’s T...
Are there signs of hope for LGBT people in Africa?...
Uganda pastor Martin Ssempa screens gay porn in ch...
Gug reports on the Ugandan Anti-homosexuality Bill...
The Archbishop of Canterbury’s Presidential Addres...
Pro-gay meeting held in Kampala and alternative ma...
After a week of Big Questions – the Communion stil...
The Future of the Anglican Communion - a Big Quest...
Changing Attitude Sussex launched in Brighton on M...
General Synod approves pension parity for Civil Pa...
Lorna Ashworth’s motion about the Anglican Church ...
Church of Uganda issues position statement opposin...
Anglican attitudes maintain regimes of terror and ...
Time for resolute resistance and repeated challeng...
|
cc/2019-30/en_middle_0059.json.gz/line99
|
__label__wiki
| 0.675258
| 0.675258
|
Urban / City Warfare (merged thread)
Page 10 of 10 First ... 8910
Thread: Urban / City Warfare (merged thread)
Twenty three threads have been merged in today, all bar one from SWJ Blog. Prompted by the next post.
Last edited by davidbfpo; 01-03-2018 at 05:10 PM. Reason: 153,024v
War is coming [back] to the cities
Hat tip to WoTR for this article https://warontherocks.com/2018/01/ol...rkeys-war-pkk/ which dissects what happened when the PKK opted to fight in Turkish cities (it will be cross-posted elsewhere).
The authors have observations on the wider impact on urban operations, for strategy and operations. Near the end:
This dynamic suggests armed groups might choose to target cities even when their chances of military success are slim, that is, if they believe that they can frame the urban battle in ways that will help them achieve their long-term strategic objectives.
Primer on Urban Operations
From Army University Press and on open access, except for the post-Mosul report. Citing their introduction in part:
Army Press has compiled a selection of articles from Military Review, publications from the Combat Studies Institute, monographs from students at the Command and General Staff College, and other publications. This primer on urban operations should not be viewed as the textbook on the subject, but rather as a starting point for renewed study and conversation.
Link:ww.armyupress.army.mil/Online-Publications/Primer-on-Urban-Operations/#5?platform=hootsuite
SWJ Blog
Lessons to Be Learned: The Employment of Suicide Vehicle Borne Improvised Explosive Devises in the Islamic State’s Defense of Mosul
Read the full post and make any comments at the SWJ Blog.
This forum is a feed only and is closed to user comments.
Last edited by davidbfpo; 01-13-2018 at 09:19 AM. Reason: Copied to here.
Cities and terror: an indivisible and brutal relationship
Jason Burke, a journalist with The Guardian and writer on terrorism, has this very well-timed article, which draws on history and seeks to explain why terrorists know attacks in cities matter.
Here is a "taster":
f the urban environment offers practical assistance to the aspirant terrorist – a degree of anonymity, ease of sourcing components or funds, proximity to others in a network, communication facilities, transport – it also offers a wealth of targets. The nature of these virtually guarantees what all terrorists seek: attention.
He ends with:
The history of terrorism is thus the history of our cities. The history of our cities, at least over the last 150 years or so, is in part the history of terrorism. This is a deadly, inextricable link that is unlikely to be broken anytime soon.
Link:https://www.theguardian.com/cities/2...hip-terrorism?
In today's mailbox was a - startling for me - WoTR article on the Tet 1968 offensive in South Vietnam; which had an urban focus. A military failure for the NVA / VC, but a strategic victory. Worth a read.
Link:https://warontherocks.com/2018/01/im...tet-offensive/
Reading these articles and the coverage on the very recent, brutal Taliban / ISIS attacks in Kabul, Afghanistan, could GIRoA and its allies be in danger of repeating the Tet offensive?
Last edited by davidbfpo; 02-10-2018 at 06:52 PM. Reason: 904v when a stand-alone thread
75yrs since Stalingrad: Urban Warfare: Past, Present, Future
RUSI held a day, closed conference last week and have now published the programme and three other items, one a short paper. Plus a podcast by the opening speaker, ret'd General Mungo Melvin (till 33:45) and the historian Antony Beevor.
Link:https://rusi.org/event/urban-warfare...present-future
There are three PPT, alas slides only by:Peter Mansoor, David Kilcullen and a British brigadier.
The paper refers to a re'd UK General Tony Newton's experience of how the British Army lost sight of urban fighting and has a section on Operation Agile Warrior that appears earlier in this thread.
Link:https://rusi.org/sites/default/files...rks-newton.pdf
The helpful App @ Raqqa
An app created using a map seized from Islamic State was a "game changer" in the battle to defeat the extremists in Raqqa, a British man who fought the murderous group has said....Speaking to the Press Association, the 30-year-old said he understands the app was put together by the Americans using a very detailed map of Raqqa that was captured from IS: "I would be walking down the street and would take fire from a building or I would see enemy movement or a tank, all I'd have to do is move my dot, get the grid coordinates and call it in."
Link:https://www.forces.net/news/anti-isi...p-retake-raqqa
The Future Battlefield: Army, Marines Prepare for ‘Massive’ Fight in Megacities
Last edited by davidbfpo; 03-07-2018 at 06:45 PM. Reason: Copied from SWJ Blog for reference and lightly edited
Preparing for the Urban Future of Counterinsurgency
Every so called urban training area I've seen looks more like a small village with neatly spread out buildings. When I think of Urban warfare, FIBUA or MOUT, I hink of central London or the Brazilian favelas. Maybe someone should contact the Japanese Gov and lease Hashima island also, for a more atmospheric look see here. At Least it looks like a slice of a city! Also it's out in the ocean so no noise concerns...Battle-Ship_Island_Nagasaki_Japan.jpg
The Worst of Both Worlds: An (Australian) analysis of urban littoral combat
This paper The Worst of Both Worlds: An analysis of urban littoral combat by Dr Dayton McCarthy is from Australia. I have only skimmed the introduction and the papers itself is 5Mb. The intro's key passage:
This is a paper about fighting in cities on coastlines – the contemporary topic of the combat in the ‘urban littoral’. This paper argues that urban littoral combat is the ‘worst of both worlds’ and brings together two of the most difficult forms of warfare – urban and amphibious operations.
Link:https://www.army.gov.au/our-future/a...ations/army-25
Last edited by davidbfpo; 04-23-2018 at 10:00 AM. Reason: 170,349v up 10k in 2 months
MWI: Urban Warfare Project
A pointer to the Modern War Institute's Urban Warfare Project collection of articles:https://mwi.usma.edu/urban-warfare-project/
(CNN)The coming decades will see the growth of colossal megacities as the world's population increasingly moves into urban environments, a new United Nations report predicts.
Today, 55% of the world's population is urban, a figure which is expected to grow to 68% by 2050, with the addition of 2.5 billion new city residents, according to projections by the Population Division of the UN Department of Economic and Social Affairs.
By 2030, there will be 43 megacities around the world with populations of over 10 million, up from 33 similarly sized urban centers today and just 10 in 1990.
https://www.cnn.com/2018/05/16/world...ntl/index.html
AFV survival in urban combat
A short article from Australia. Which opens with:
This systems-of-systems configuration is referred to as the Survivability Onion. Layers of the onion include: don’t be seen, don’t be hit, don’t be penetrated and don’t be killed. Each onion stratum features specific technologies to safeguard an AFV and its crew. However, AFV survivability is not just the sum of discrete defensive systems, but rather it is their collective integration that generates superior protection.
Link:https://groundedcuriosity.com/shades...kippur-effect/
Curious to see the Vulcan 20mm cannon back again, once more atop a M113.
Didn't the IDF deploy such a system years ago, possibly for another purpose: ATGM, not drones?
Last edited by davidbfpo; 11-05-2018 at 12:07 PM. Reason: 187,852v up 17k since April.202,846v today
Crossing the Street: addressing one of urban warfare's greates challenges
A sixteen pgs. paper from MWI @ West Point and near the start a passage:
At the most basic level, however, there is an obvious, but neglected tactical problem in city fighting:simply crossing the street.
The amount of damage and numbers of casualties in fighting in recent years in Raqqa, Aleppo, Marawi, and Mosul show how rudimentary urban warfare tactics remain, as well as the highly destructive nature of combat in cities. Without new tactics and tools for dealing with some of the basic challenges of urban combat, military units are forced to employ extremely destructive methods to reclaim cities from entrenched defenders.
Link:https://mwi.usma.edu/wp-content/uplo...the-street.pdf
I noted a reference to Hue Citadel in 1968, with 90mm tank cannon being found to be useless; my understanding is that the USMC realised only the "big guns" could breach the walls, so called up 155mm & 8" guns to batter a hole in the walls. When the ARVN mounted an assault the NVA/VC had left. Less certain is the tale that the USMC in Hue after a few days called the USMC Library @ Quantico, where a librarian explained how siege warfare had worked and so they reverted to those methods.
Plus the reference to defenders who were willing to die, citing ISIS in Mosul as an example. Yesterday I watched a YouTube documentary on the Canadians assaulting the walled city of Ortona, Italy in 1943 held by German paratroopers, as relevant today as it was then.
Link:https://www.youtube.com/watch?v=-SO7MoWh48g
The perfect petri dish.
In 1998, as the setting for his election celebrations, Chávez chose the balcony of the Teresa Carreño, a spectacular, brutalist style cultural centre. Built during the 1970s oil boom and reminiscent of London’s Queen Elizabeth Hall, it has hosted stars such as Dizzy Gillespie, George Benson, Ray Charles and Luciano Pavarotti, and epitomised the country’s new ambition. “Venezuela is reborn,” Chávez declared.
Twenty years after that upbeat address, an economic cataclysm experts blame on ill-conceived socialist policies, staggering corruption and the post-2014 slump in oil prices has given Caracas the air of a sinking ship.
Public services are collapsing, businesses closing and residents evacuating on buses or one of a dwindling number of flights still connecting their fallen metropolis to the rest of the world.
https://www.theguardian.com/cities/2...-latin-america
Lessons in Urban Warfare - Ortona, Italy December 1943
Discovered via a WW2 blog site and the first article concludes:
During the battle for Ortona, the Canadians innovated, improvised, and successfully exploited the effects of their personal weapons and supporting arms under largely unforeseen circumstances. Following a week of fighting in Ortona, the Canadian division became Eighth Army’s acknowledged street-fighting experts. In serving notice upon the Allies to expect further such battles, Ortona also carried implications. In Britain, armies composed mostly of untried formations waited to open the main ‘second front’ in northwest Europe, where they could expect an equally stubborn and desperate German defence. Ortona therefore merited close study, and received it from training staffs throughout the Allied armies.Canadian assessments figured highly, and they remain an instructive case study in the evaluation of battle experience.
Link:http://www.journal.forces.gc.ca/vo8/...oderso-eng.asp
Amazing that the Canadians learnt so quickly.
The second article in part explains the learning:
The Canadians, recognizing that following standard doctrine would result in heavy casualties, swiftly indulged their tactical creativity, devising methods to make them more effective. The most notable of their solutions was the advent of mouse-holing, whereby soldiers would blow a hole in the wall separating two back-to-back buildings, either with explosive charges or the man-packed PIAT (Projector, Infantry, Anti-Tank) launcher, in order to avoid entering the streets and exposing themselves to fire. This inventiveness gave the Canadians a substantial advantage at Ortona, as the German forces were not only surprised by the switch from conventional tactics, but failed to adequately counter the improvised warfare, instead having to rely on conventional counterattacks, usually under the cover of night.
Link:https://www.seaforthhighlanders.ca/stories/470
The original website thread has other links, which include videos.
Link:http://ww2talk.com/index.php?threads...-ortona.55293/
The Battle of Marawi: Small Team Lessons Learned For the Close Fight.
An Australian Army commentary that aims to:
describe the key tactical lessons the Australian Army can learn from the AFoP’s urban siege of Marawi City. Consideration of these lessons may inform and improve the Australian Army’s current approach to the force generation of close combat, combined-arms capabilities. It will identify the key tactical lessons learned by the AFoP fighting an intelligent, determined, disciplined and well-equipped terrorist threat in the extraordinarily difficult, intense and complicated terrain.
Not to overlook this:
The fighting drove over 400,000 people from their homes.
Link:https://www.cove.org.au/adaptation/a...e-close-fight/
Last edited by davidbfpo; 01-23-2019 at 09:38 PM. Reason: 210,391v today
I think the Aussies have this right.
Combat shooting, battlefield fitness, small team TTPs and battle craft are more important than any other skill, and must be prioritised. Above all else, the Australian Army must have the ability to deliver small combined arms teams to the fight who are capable of shooting faster and more accurately than their enemy out to 200 metres by day and by night; who can dominate and control complex spaces more rapidly and with fewer casualties; and who can operate seamlessly with other small teams or supporting elements in joint and coalition environments.
High levels of combat fitness, shooting skills, then tactical maneuver skills, and of course communication to facilitate coordination. (Shoot, move, and communicate)
Later in the article, they talked about the need for leadership that enables tactical innovation at the lowest levels.
Then add the game changing technology as the nation can afford it, night vision devises, explosive breaching, etc. A lot of good insights that validate much of the existing urban warfare doctrine.
Last edited by Bill Moore; 01-26-2019 at 09:57 PM.
The Future of Urban Warfare in the Age of Megacities
Another MWI paper (58 pgs), the author being Margarita Konaev; though this time id'd via Twitter and published by a French "think tank".
Link:https://www.ifri.org/sites/default/f...ities_2019.pdf
Last edited by davidbfpo; 06-09-2019 at 03:44 PM. Reason: 214,864v in March '19 and today 227,142v 13k up!
Quick Navigation Futurists & Theorists Top
Wargaming Small Wars (merged thread)
By Steve Blair in forum Training & Education
Hybrid Warfare (merged thread)
Are we still living in a Westphalian world?
By manoftheworld in forum Futurists & Theorists
Site of Earliest Known Urban Warfare Threatened by Syrian War
By AdamG in forum Historians
afghanistan, architecture, cities, counterinsurgency, data, engineering, history, intelligence, megacities, northern ireland, operations, terrorism, urban, urban warfare, vietnam
|
cc/2019-30/en_middle_0059.json.gz/line103
|
__label__wiki
| 0.550553
| 0.550553
|
Marie Anne Cope
Marie Anne Cope was born in Marlow, in the UK. She has worked as a salesperson and a banker, before eventually training as an accountant, working for over a decade in practice and industry before setting up her own business. Marie is also a yoga teacher.
She is presently writing three series.
The BONDS series is set in both the 17th century and modern day, and follows the unusual relationship between Becca Martin and Antony Cardover. Becca is forced to face up to her birthright as a witch in order to survive and help Antony in his quest to break his vampire curse.
THE MISFITS follows the adventures of four supernatural friends–Achoo, Mina, Boo and Zoe–who are all failing at being what their parents and teachers expect them to be. During their adventures, they learn that being different, being unique, is not just okay, it’s perfect, as they help others in need along the way.
TALES FROM A SCARYGIRL are collections of short horror stories which not only seek to explore what lies beyond the veil that separates this world from the next, but also what darkness lies deep within us, waiting for the opportunity to escape!
˜Captivating", ˜suspenseful" and ˜gripping", Bonds tells the story of Becca Martin's struggle to accept her birthright as a witch and Antony Cardover's battle to break his vampire curse. The two are bonded by Isabella, Antony's adulterous wife and Becca's ancestor. Bonds has received five star reviews and acclaim from readers globally.
Described as "Better than Twilight", Broken Bonds continues the epic story of Becca Martin as she's driven to keep a promise to a man who would rather see her dead. Becca is forced to delve deeper into her past and that of her ancestors to find the answers she seeks. Broken Bonds has again received widespread acclaim from readers, calling it ˜fantastic", ˜brilliant" and ˜worthy of five stars".
Marie is currently crafting the next chapter of the Bonds series, Bonds: Re-Bound.
Marie lives in North Wales and works as a Yoga teacher and an Accountant.
www.marieannecope.com
www.facebook.com/MarieAnneCopeAuthor
Twitter: www.twitter.com/MarieAnneCope
Do you know who hides in your past?
Half the village of Breccan lies dead - slaughtered. All that stands between Antony Cardover and his freedom is his wife, Isabella; or so he believes.
In his wrath at his wife's adultery, Antony trades his soul for the chance of vengeance. His price? An eternity as a monster - a man bearing a vampire curse. To stop him, the curse must be broken. To break the curse, Isabella and all her descendants must be destroyed. The catch? Only Antony can break the curse.
With Breccan in mourning and Antony on the rampage, only one person can help. Anna Martindale, a witch shunned by the villagers, entombs Antony within a stone sarcophagus, bound by spells and buried in hallowed ground for the rest of time.
Breccan breathes again. Time heals.
That was four hundred years ago.
Seventeenth century spells, however, are no match for twenty first century living. As Ramply Homes moves in, the secret of St. Martin's churchyard prepares to move out.
As the church is desecrated, the spells that hold Antony break. Soon, Becca Martin, a descendant of Isabella, is plagued by dreams of a time and a man she cannot possibly have known. As her nightmares become real, Becca has no choice but to contact the one person who will be able to help; someone she has not spoken to in a decade - her mother.
Here, Becca discovers the truth about her ancestry and is forced to face up to whom and what she is. Only a wooden box and her gift hold the key to her survival.
Four hundred years ago Antony failed.
He will not fail again.
REVIEWS FOR "BONDS"
"... better than Twilight ..." R. Taylor
"In a lifetime, you rarely come across a book that you read in one sitting." Conrad
"This is a must read!" Melanie Gaskin
"It would make an excellent film!" J. Hesketh
"A good twist on the vampire story." KDB
"Bonds is very well plotted and excellently written." GG
"I was hooked from the beginning!" Beryl
"It keeps you on edge and there is a surprise around every corner." Pen Name
"Couldn't put this down!" C. Rigby
"I was immediately gripped ... Found myself repeatedly thinking 'just one more chapter ...'" Sue C.
"Exciting, emotional and creepy throughout!" Afton
"Bonds is something rather special. The right kind of mix of scary and storytelling at its best." A. Reader
"Gripping, exciting, fantastic ... riveting read!" Steve
"Instantly gripping, awesome characters, great story, effortless read. It's a real page-turner!" Alex M.
www.marieannecope.com/books
BROKEN BONDS
Are some promises meant to be broken?
The vampire is entombed. The witch is safe.
The ultimate test is yet to come.
After surviving torture at the hands of vampire Antony Cardover, reluctant witch, Becca Martin, finds herself alone and struggling to come to terms with the death of her mother. Not only that, but she must find a way to keep the promise she made to Antony – to find a way to break his vampire curse.
Out of options and against the advice of those closest to her, Becca embarks on a mission to free Antony once more, for he is the only one who can help find the object of her quest.
Ebenezer Lightwoller, the warlock who cursed Antony, has a past both tragic and horrific. Cursed himself due to the actions of his only child, he turned his back on redemption, choosing to follow a darker path instead.
When Becca finds her life hanging in the balance once more, a new-found ally steps in to save her, leaving Antony with no option but to help Becca.
Together they embark on a journey to break Antony’s curse, but as the options are revealed, Becca is forced to make the biggest decision of her life.
When presented with an impossible choice, will Becca keep her promise to someone who would rather see her dead, or are some promises meant to be broken?
|
cc/2019-30/en_middle_0059.json.gz/line107
|
__label__wiki
| 0.799076
| 0.799076
|
support@electronichotsale.com
100% SECURE guarantee
Go to all Category
Electronics Warranties
Electronic Hot Sale > Blog > Computers > Border Arrests Surge to Seven-Year High as Mexico Tries to Head Off Tariffs – The New York Times
Border Arrests Surge to Seven-Year High as Mexico Tries to Head Off Tariffs – The New York Times
On Tuesday, Mr. Trump said that it was “more likely that the tariffs” would be imposed. But on Wednesday, the president said he believed Mexico was ready to make a deal to prevent the tariffs from going into effect.
”Mexico, you know, wants to make a deal,” Mr. Trump said during a trip to Ireland. “They have their entire delegation right now going over to probably the White House location to negotiate with our people.”
Mexican officials, along with Republican lawmakers, are trying to prevent Mr. Trump from imposing tariffs on Monday, as he has threatened. Marcelo Ebrard, the Mexican foreign minister, is scheduled to meet on Wednesday afternoon at the White House with Mr. Pence, a senior administration official said, in an effort to convince the president that Mexico is doing everything it can to help prevent illegal immigration across the United States border. Secretary of State Mike Pompeo and Robert Lighthizer, the United States Trade Representative, were also expected to attend the meeting.
Mr. Trump, frustrated by what he views as Mexico’s failure to stem the flow of migrants, said he would use broad emergency powers to impose punishing tariffs on the country. But top American officials have spoken in vague terms about what steps Mexico must take, and it remains unclear exactly what Mexico could do to persuade Mr. Trump to back down.
Peter Navarro, a top trade adviser who has advocated using levies to punish Mexico, said in an interview with CNN on Wednesday that Mr. Trump’s threat had gotten the Mexican government’s attention and that the United States might not have to impose the tariffs.
Write a Reply or Comment:
Your email address will not be published.*
If your order is $35 or more, you may qualify for free shipping. With free shipping, your order will be delivered 5-8 business days.
Sign up now to get up to 50% discount on Best for Pets
© Electronic Hot Sale All Rights Reserved
|
cc/2019-30/en_middle_0059.json.gz/line114
|
__label__cc
| 0.647403
| 0.352597
|
Erik Demaine, Martin Demaine, Anna Lubiw, and Joseph O'Rourke, “Examples, Counterexamples, and Enumeration Results for Foldings and Unfoldings between Polygons and Polytopes”, Technical Report 069, Smith College, July 2000.
We investigate how to make the surface of a convex polyhedron (a polytope) by folding up a polygon and gluing its perimeter shut, and the reverse process of cutting open a polytope and unfolding it to a polygon. We explore basic enumeration questions in both directions: Given a polyon, how many foldings are there? Given a polytope, how many unfoldings are there to simple polygons? Throughout we give special attention to convex polygons, and to regular polygons. We show that every convex polygon folds to an infinite number of distinct polytopes, but that their number of combinatorially distinct gluings is polynomial. There are, however, simple polygons with an exponential number of distinct gluings.
In the reverse direction, we show that there are polytopes with an exponential number of distinct cuttings that lead to simple unfoldings. We establish necessary conditions for a polytope to have convex unfoldings, implying, for example, that among the Platonic solids, only the tetrahedron has a convex unfolding. We provide an inventory of the polytopes that may unfold to regular polygons, show that, for n > 6, there is essentially only one class of such polytopes.
This paper is also available as arXiv:cs.CG/0007019 of the Computing Research Repository (CoRR).
The paper is available in PostScript (1520k) and gzipped PostScript (384k).
Aleks_GC2002 (Enumerating Foldings and Unfoldings between Polygons and Polytopes)
JCDCG2000c (Enumerating Foldings and Unfoldings between Polygons and Polytopes)
Related webpages:
Folding Polygons into Convex Polyhedra
|
cc/2019-30/en_middle_0059.json.gz/line123
|
__label__wiki
| 0.568769
| 0.568769
|
Main Menu BIO NEWS PRESS BOOKS MEDIA GALLERY Contact
Category : Press
HUFF POST LIVE
Evan Handler talks with Abby about his books, the new season of ‘Californication’ and his new lease on life after struggling with leukemia and facing death.
LA Confidential Interview
If life is a series of anecdotes strung together into a narrative, Evan Handler’s character-defining moments read like scenes from the two shows that have made him famous. Read full article at http://la-confidential-magazine.com/personalities/articles/californication-evan-handler#JvCLJO7eV5PbH9cv.99
MAXIM Magazine Interview
Evan Handler Talks “Californication” > READ THE ARTICLE HERE
“ Time On Fire reveals Evan Handler to be an accomplished, intelligent writer with a novelist’s eye for detail. With honesty and with generosity, he describes heroes and villains, the valor and idiocy familiar to anyone who’s had an encounter with modern medicine. That the story is immensely useful doesn’t mean that it isn’t at the same time an exceptional work of art. It is both.” — Tony Kushner - Pulitzer Prize willing playwright of Angels in America; screenwriter Lincoln, Munich
7 years, 10 months ago 6 Comments
Evan’s Huffington Post Blog
Books now available in Ebook format
Californication Season 6
© 2013 Evan Handler. Site by Pixel Peach Studio
|
cc/2019-30/en_middle_0059.json.gz/line126
|
__label__wiki
| 0.961722
| 0.961722
|
LCD Soundsystem This Is Happening
By Dimitri Nasrallah
It's hard to accuse James Murphy and company of growing up gracefully, given that the DFA Records founder didn't hit the ground with LCD Soundsystem until he was firmly in his 30s, but over a course that has run from classic early singles to third album This Is Happening, the band and their leader have found a way to keep improving in leaps and bounds. This Is Happening is a quintessential summer album: upbeat from beginning to end, brimming with memorable songwriting, devoid of filler and containing more than a few killer tracks along the way. Contemporary studio techniques and a load of '70s references ― the percussive eclecticism of Talking Heads' Remain In Light, the hangover of Iggy Pop's Nightclubbing ― are still streaming through the LCD sound, but highlights like "Pow Pow" and "I Can Change" dig much deeper than the formula would suggest. For all the risks that have taken down other bands using the same ingredients, LCD Soundsystem keep coming out album after album, sounding more essential than ever. (DFA)
LCD Soundsystem Electric Lady Sessions
A live-in-the-studio album in 2019 seems like just another drip from the firehose of live content the internet has to offer. Got a favourite...
LCD Soundsytem Detail 'Electric Lady Sessions' Live Album
Late last year, LCD Soundsystem announced that they would be putting out a live album dubbed Electric Lady Sessions, and now they've given u...
LCD Soundsystem Ready 'Electric Lady Sessions' Album
Now that LCD Soundsystem are officially back in our lives, James Murphy and co. are readying a new album. Titled Electric Lady Sessions, the...
LCD Soundsystem Share "Oh Baby" Video
Just over a year removed from releasing their American Dream LP, LCD Soundsystem have now released a video for album cut "Oh Baby." Direc...
Watch Sharon Van Etten Cover LCD Soundsystem
Sharon Van Etten performed with a full orchestra earlier this month, opting to cover LCD Soundsystem's "New York, I Love You But You're Brin...
|
cc/2019-30/en_middle_0059.json.gz/line128
|
__label__cc
| 0.657982
| 0.342018
|
Robert De Niro Joins 50 Cent in FREELANCERS; Forest Whitaker in Talks
by Max Lichtig March 26, 2011
If you thought 50 Cent couldn’t scoop up any more great actors in his cinematic wave of destruction, you were dead, dead wrong. We’ve seen the comical trailer for the trying-too-hard drama Things Fall Apart; the trailer for Setup showed the likes of Bruce Willis and Ryan Phillippe somehow drawn into its cast. NOLA reports that Curtis Jackson’s next movie, Freelancers, locked in Robert De Niro; Deadline adds that Forest Whitaker is in negotiations to join the cast. Jessy Terrero (who brought us the forgettable Soul Plane) will helm Freelancers, the story of the son of a murdered NYPD cop who joins the police academy, graduates, and gets recruited by a group of rogue cops led by his father’s old partner (De Niro). Freelancers is scheduled to shoot four weeks in New Orleans starting in April.
Sounds interesting? Well, let’s not count our chickens before the trailer hatches.
Armie Hammer Cast in THE BROTHERS GRIMM: SNOW WHITE; Saoirse Ronan in…
Will Sasso Is Curly in THE THREE STOOGES; Hank Azaria and James…
• 50 Cent • Curtis "50 Cent" Jackson • Entertainment • Forest Whitaker • Freelancers • Jessy Terrero • Movie • Robert De Niro
|
cc/2019-30/en_middle_0059.json.gz/line129
|
__label__cc
| 0.541267
| 0.458733
|
Journal of the Australian Mathematical Society
Search within journal Search within society
URL: /core/journals/journal-of-the-australian-mathematical-society
Published on behalf of Australian Mathematical Society
FirstView
Refine listing
Only show content I have access to (16)
To send this article to your account, please select one or more formats and confirm that you agree to abide by our usage policies. If this is the first time you use this feature, you will be asked to authorise Cambridge Core to connect with your account. Find out more about sending content to .
MathJax
MathJax is a JavaScript display engine for mathematics. For more information see http://www.mathjax.org.
< Back to all issues
Volume 50 - Issue 1 - February 1991
Page/Article number Title Type Online publication date
Groups with Černikov conjugacy classes
S. Franciosi, F. De Giovanni, M. J. Tomkinson
Published online by Cambridge University Press: 09 April 2009, pp. 1-14
The aim of this paper is to prove some embedding theorems for groups with Černikov conjugacy classes. Moreover a characterization of periodic central-by-Černikov groups is given.
Structural inference on the generalized gamma distribution based on type-II progressively censored sample
MSC 2010: Parametric inference
MSC 2010: Applications
M. S. Maswadah
This paper is concerned with the three-parameter generalized gamma distribution (g.g.d.) which is widely employed as a model in life testing. The structural probability distributions of the parameters and a number of structural prediction densities for specific future measurements have been derived based on type-Il progressively censored sample.
The isometries of Hp(K)
MSC 2010: Linear function spaces and their duals
Pei-Kee Lin
Let 1 ≤ p < ∞, p ≠ 2 and let K be any complex Hilbert space. We prove that every isometry T of Hp(K) onto itself is of the form , where U ia a unitary operator on K and φ is a conformal map of the unit disc onto itself.
Full C*-Crossed product duality
MSC 2010: Selfadjoint operator algebras
John C. Quigg
Takai duality for full C*-crossed products holds for twisted actions in the sense of Green and fails for coactions.
Structure of pseudo-semisimple rings
Saad Mohamed, Bruno J. Müller
A ring R is called right pseudo-semisimple if every right ideal not isomorphic to R is semisimpie. Rings of this type in which the right socle S splits off additively were characterized; such a ring has S2 = 0. The existence of right pseudo-semisimple rings with zero right singular ideal Z remained open, except for the trivial examples of semisimple rings and principal right ideal domains. In this work we give a complete characterization of right pseudo-semisimple rings with S2 = 0. We also give examples of non-trivial right pseudo-semisimple rings with Z = 0; in fact it is shown that such rings exist as subrings in every infinite-dimensional full linear ring. A structure theorem for non-singular right pseudo-semisimple rings, with homogeneous maximal socle, is given. The general case is still open.
Symmetric dual multiobjective fractional programming
T. Weir
A pair of symmetric dual multiobjective fractional programming problems is formulated and appropriate duality theorems are established.
The symmetric algebra of quotients of an ultraprime Banach algebra
MSC 2010: Special classes of linear operators
MSC 2010: Topological algebras, normed rings and algebras, Banach algebras
Martin Mathieu
We present a symmetric version of a normed algebra of quotients for each ultraprime normed algebra. In addition, a C*-a1gebra of quotients of an arbitrary C*-a1gebra is introduced.
Statistical expansions and locally uniform Fréchet differentiability
MSC 2010: Distribution theory
MSC 2010: Nonparametric inference
T. Bednarski, B. R. Clarke, W. Kolkiewicz
Estimators which have locally uniform expansions are shown in this paper to be asymptotically equivalent to M-estimators. The M-functionals corresponding to these M-estimators are seen to be locally uniformly Fréchet differentiable. Other conditions for M-functionals to be locally uniformly Fréchet differentiable are given. An example of a commonly used estimator which is robust against outliers is given to illustrate that the locally uniform expansion need not be valid.
Multiplication operators on weighted spaces of vector-valued continuous functions
R. K. Singh, Jasbir Singh Manhas
Published online by Cambridge University Press: 09 April 2009, pp. 98-107
If V is a system of weights on a completely regular Hausdorff space X and E is alocally convex space, then CV0(X, E) and CVb (X, E) are locally convex spaces of vector-valued continuous functions with topologies generated by seminorms which are weighted analogues of the supremum norm. In this paper we characterise multiplication operators on these spaces induced by scalar-valued and vector-valued mappings. Many examples are presented to illustrate the theory.
Cup products and group extensions
P. A. Linnell
Let G be a finitely generated group and let R be a commutative ring, regarded as a G-module with G acting trivially. We shall determine when the cup product of two elements of H1(G, R) is zero. Our method will use the interpretation of H2(G, R) as extensions of G by R. This will give an alternative demonstration of results of Hillman and Würfel.
The characterization problem for endomorphism rings
J. L. García
We consider the problem of characterizing by abstract properties the rings which are isomorphic to the endomorphism ring End (RF) of some free module F over a ring R in a given class R of rings. We solve this problem when R is any class of rings (by employing topological notions) and when R is the class of all the left Kasch rings (in terms of algebraic properties only).
Classification of 4- and 5-arc-transitive cubic graphs of small girth
MSC 2010: Graph theory
Margaret J. Morton
This paper classifies all finite connected 4- and 5-arc-transitive cubic graphs that contain circuits of length less than or equal to 11, or of length 13, and some of those graphs with circuits of length 12.
Hyponormal operators on uniformly smooth spaces
MSC 2010: General theory of linear operators
Muneo Chō
In this paper we will characterize the spectrum of a hyponormal operator and the joint spectrum of a doubly commuting n-tuple of strongly hyponormal operators on a uniformly smooth space. We also describe some applications of these results.
Elementary amenable groups and 4-manifolds with Euler characteristic 0
MSC 2010: Low-dimensional topology
MSC 2010: Topological manifolds
Jonathan A. Hillman
We extend earlier work relating asphericity and Euler characteristics for finite complexes whose fundamental groups have nontrivial torsion free abelian normal subgroups. In particular a finitely presentable group which has a nontrivial elementary amenable subgroup whose finite subgroups have bounded order and with no nontrivial finite normal subgroup must have deficiency at most 1, and if it has a presentation of deficiency 1 then the corresponding 2-complex is aspherical. Similarly if the fundamental group of a closed 4-manifold with Euler characteristic 0 is virtually torsion free and elementary amenable then it either has 2 ends or is virtually an extension of Z by a subgroup of Q, or the manifold is asphencal and the group is virtually poly- Z of Hirsch length 4.
JAZ volume 50 issue 1 Cover and Front matter
Published online by Cambridge University Press: 09 April 2009, pp. f1-f3
JAZ volume 50 issue 1 Cover and Back matter
Published online by Cambridge University Press: 09 April 2009, pp. b1-b2
|
cc/2019-30/en_middle_0059.json.gz/line132
|
__label__cc
| 0.712703
| 0.287297
|
Shine or Go Crazy - Episode 2 (A Quickie Cap)
Two weddings and a funeral. Man, Goryeo really wasn't much of a happy place, was it?
Episode 2 verdict: quite draggy in place and not half as funny as episode 1, but with very, very sweet early OTP scenes.
When it starts to rain on their wedding day (=they will live a life of fortune), Wang So covers Shin-yool with his coat, because, as he declares "You're still my bride". *I die*. And they run for cover.
He was pretty swoony a lot of the time. I don't blame Shin-Yool one bit.
S@ki6: This was pretty cool.
Awkwardness ensues in the bridal chamber, later. It's dark outside, but Wang So still can't leave because Kwak's men are there, watching. Gotta watch if the marriage is consummated, right? Well, it means our OTP has to spend the night together. Sadly, nothing is consummated.
Sad is right. They should have at least made out a little bit!
becca: What kind of wedding night is this? There are no lollipops!
They kind of matched colours, though.
But we get some sweet: He tells her he is the unluckiest person in the world, but she tells him that's not true. He married HER after all. (haha, I LOVE her self-esteem). This is the first time in his life he has been called lucky, he remarks. His incredulous half-smile kills me.
Gah! I'm such a sucker for the funny guy who's hiding a hurt boy.
Oof, me too. And Jang Hyuk really knows how to tug at the heartstrings.
He tells her to put a talisman on her door after he has left - he brings misfortune to everyone around him. But she still doesn't want to believe him, even when he says that it wasn't HIM that saved her: it was her own will that protected her. He just hopes to find something he wants to protect himself: maybe then, he will be able to save his own world? But can he change his damned fate? Nothing easier than that, says Shin-yool. You just need to take somebody's hand. And today, he took hers (as she takes his in hers). And her fate changed - no marriage to General Kwak.
Hints of epic love. Maybe a goosebump or two, or at least the thought of some.
They're funny, but I don't feel their chemistry much. It may be because Jang Hyuk is so larger than life in everything he does.
Of course, that reminds him of his father (who said basically the same thing) and he gets really morose. Well, he should, cause at home, Daddy isn't doing too well. He is poisoned! A VERY clever poison nobody will ever find in his body. Already, the 5 Evil Men (that call themselves Founding Fathers) are plotting: who will be the next next king after the next king? They each take a piece of a bronze mirror, which will "protect their lives", as evil mastermind Wang Sik-Ryeom proclaims.
I will see you dead, Wang Sik-Ryeom. I need to make a list with Wang One equals this guy, and Wang Two equals that guy, and...
Personally, I feel very sceptical about poisons that no one can find in the body. And I don't understand how this bronze mirror protection thing works, but going with the flow should fix that.
Wang So doesn't know anything about what transpires back home ... but he lends his shoulder to his "bride", who is sleeping upright like him. And he (who has horrifying nightmares of his witch-mother) thanks her quietly for being the first person in his life he was able to save. He now has courage to change his own fate. He lifts his hand to lift her veil ... but doesn't. It's better if he doesn't see her, he told her before, since this is a one-night thing.
Which makes NO sense whatever, but okay. *Reminds self that writers need ways to keep lovers apart.*
I can kind of understand his reasoning, though. In his mind, if he doesn't know her face, he can't be a liability to her in the future.
Why couldn't they just lie down?
In the early morning, he puts her on the bed very carefully and leaves. She wasn't asleep at all, though and runs after him, to thank him for what he has done. She should forget about it, he tells her - even in her dreams. But she is not ready to let him go yet! She grabs his wrist (and it's not the first and not the last time she does it!!) and hands him half of a butterfly penchant: a talisman, to bring him luck. And she means to honor their contract: she will get him that which means "the world" to him. That just makes him very sad. He steps closer and kisses her on her forehead ... oh so tenderly. "The contract is over", he says. And leaves. And she collapses. Poor Shin-yool is of poor health - and the loss of this man gives her the rest. Who can blame her.
Yeah, that is definitely a loss, there. Goryeo Gun is a fine speciman of a man in every way.
Sleeping sitting upright isn't exactly restful. I'm not surprised she collapsed afterwards.
After parting from his "bride", Wang So reunites with grumpy Eun-chun (I love these two together! me too!) and they manage to track down and almost kill the assassin. In the process, they realize that the dagger thrown at the King was poisoned! They take the antidote and rush back to Goryeo. The king takes the antidote ... but he doesn't get better. It's too little, too late .... Aw. Daddy is dying.
I'm sad Dad is dying, but before I forget, what I love between Eun Chan and Wang So is the running gag about things not to do during a chase. Okay back to dad: Yes, it's sad.
Maybe this is colored by knowledge that we get later, but I'm okay with Dad dying. Except for the part where it hurts Wang-so. I'm not okay with that.
Dad dying: yaaaaawwwwn
He is not quite dead yet, though - first, there's some hand-taking and apologizing to be done. So the king exiled his little son to protect him; having him at the palace would have meant his certain death. (Jang Hyuk has to stop crying, it breaks my heart!).
Oh man... he always loved him! *sobs*
This does hurt, I admit it.
If he loved his son, why didn't he make sure he had a proper house to live in etc?
He warns his son of the difficult times to come: whoever poisoned him is among the nobles - and those nobles will shake the nation after his death. So there are two things he needs to do: One, become the leader of the secret warriors to kill all the bad people and two, marry ice-queen Yeo-won (who is of a different family) for protection. Quite opposed to that by the way is Wang Wook (Lim Ju-Hwan aka Limnium), another son of the current king, brother to Yeo-won and half-brother to Wang So.
So she is NOT his half-sister at all. She's the half-sister of his half-brother, which doesn't mean she's Wang So's half-sister necessarily. Wait, let me think about that.
Ok both boys have same dad, which means different mothers. And she can't share their dad or else she WOULD be half to both. So Limnium and Honey Lee share a mother, and Wang So has his own mother, who might not be sleeping around but is the very definition of a royal bitch.
Nope, she's a princess. And the way to keep track of all these kids from different baby mamas is to assign them to their maternal families. Plus, even Wiki tells us she's his half-sister. Also, Limnium looks like an elf.
All three have the same father (the now dying king), but Wang So has a different mother. Mothers are important, hence the different clans.
This king is a literal stud.
Named Wang Gun. Hahahaaa (thanks, @drama_fan33, for this one)
And thus, the wedding is held ... the night before, Wang So stares at his garment, laughing a bitter, defeated laugh, and then, watches his future wife's "shadow" (assassin Se-won) leave her room. Not sure what he is thinking ... probably that it is her lover.
And now I understand my confusion. I thought it was Limnium in the room with her.
Maybe he thinks his wife will kill him? Still, I'd have liked him to have been as gentlemanly with her as he was with Heroine No. 1.
When they get him ready, he remembers his other, his first wedding - to the red-veiled woman whose face he never saw. How fitting is it, that it is raining during this ceremony as well? But somehow, I doubt this will be a very prosperous wedding... She spends the wedding night alone in her room, watched from the outside by her "shadow".
So they conveniently forget that custom of hanging outside the room to make sure the marriage is consummated, this time around?
In Europe, they hung around to watch.
Seeing his son safe, the King dies. And Wang So starts training with the black assassins, telling them to lay low and be invisible until their time has come, while first one, then another of his brothers is crowned King.
Oooh! Yes! Dark-clad protecters of the people FTW!
Five years have passed! Chunghae Trading Company has relocated to Goryeo, too (to get away from General Kwak and the war - and because Shin-yool thinks she can find her mother and brother there. Well...) and is just as prosperous as it was back in China. Always protected by her own hunky shadow called Kyeong (Jung Woo-Sik), Shin-yool is preparing a big order for the King. It's a ceremony to put a dot on the Buddha. And after all that time, her eyes still search for that swordsman from Goryeo. But no, it's not yet to be ... they pass each other on the street, but don't see each other.
Kyeong is the Hunky Henchman!
We had to get some history behind us in this episode, but now, we're good and can get started for real. The king is dead, long live the king! After reconciling with the dying king (that was sad), Wang So has taken his fate in his own hands, encouraged by the Red Woman, and is patiently waiting to strike when the time is right. Man, I'm glad I don't have to be anywhere near that palace ... so many unhappy faces and deadly stares!
People are always wishing for the past, when things were 'simple.' HA.
Seriously! Have you SEEN how many kids the now-dead king had?? Family get-togethers must be so awkward.
Also, it is firmly established in this episode that her "mother", Baek-Myo, absolutely hates our Prince - while her "father", Gang-Myeong, finds him pretty cool. I find you two pretty cool too!
Yes but is the idiot their son?
I have no idea, but I love them.
He's not their son, I'm sure of that, since they're basically family-like servants and he's been raised so he is equal enough to hand her off to Chinese generals.
Jang Hyuk Oh Yeon-Seo Recap Shine or Go Crazy sinopsis SqueeCap synopsis 빛나거나 미치거나
|
cc/2019-30/en_middle_0059.json.gz/line140
|
__label__wiki
| 0.91216
| 0.91216
|
George W. Bush Presidential Library and Museum
The President & Family
Presidential Places
Plan Your Museum Visit
Special Exhibits & Events
Native Texas Park
Presidential Libraries Passport
Plan Your Research Visit
Submit a FOIA Request
Order Photos & Videos
Presidential Records
Archived White House Website
Gubernatorial Records
Plan Your Field Trip
The First Lady & Education
9/11 Resource Guide
The Situation Room Experience
Kids' Clubhouse
Homework Zone
Camp 43 - Summer Camp
Support the Library & Museum
How to Submit a FOIA Request
Federal government records -- and public access to them -- are defined in various statutes, including the Federal Records Act and the Freedom of Information Act (FOIA).
The Presidential Records Act (PRA) governs the official records of Presidents, including George W. Bush, created or received after Jan 20, 1981. The PRA allows for public access to Presidential Records through the FOIA beginning 5 years after the end of a President's Administration, but allows the President to invoke as many as 6 specific restrictions to public access for up to 12 years.
To assist your research, view the Finding Aids for open records currently available. Finding aids may include information about extent or linear feet, access, series, administrative or biographical history, scope and content note, system of arrangement, container list (folder title list), and other details.
All FOIA requests must state that you are requesting records under the Freedom of Information Act or FOIA. Submit your request in written format via mail, fax, or email to:
c/o FOIA Coordinator
2943 SMU Blvd, Dallas, TX 75205
Fax: 214-346-1558 (include cover sheet)
Email: gwbush.library@nara.gov (include your name in subject line)
To avoid delays, review the FOIA Reference Guide before submitting your request.
All FOIA requests must include a reasonable description of the records requested.
Be as specific as possible with regard to names, titles, dates, places, events, subjects, recipients, or agency component(s) or offices likely to maintain records that are of interest to you.
The more specific you are about the records or types of records you want, the more likely it will be that our archivists will be able to locate those records for you.
Be aware the FOIA does not require us to do research for you, analyze data, answer written questions, or create records in order to respond to a request.
Understand that if you have an impending deadline, the FOIA process does take time.
The George W. Bush Presidential Library and Museum is the 13th Presidential Library administered by the National Archives and Records Administration, a U.S. Federal agency. The National Archives does not charge FOIA filing, searching, or processing fees. However, standard reproduction fees are charged for copying records. See the FOIA Reference Guide for details.
What is a Presidential Record?
The PRA defines Presidential Records as “documentary materials, or any reasonably segregable portion thereof, created or received by the President, his immediate staff, or a unit or individual of the Executive Office of the President whose function is to advise and assist the President, in the course of conducting activities which relate to or have an effect upon the carrying out of the constitutional, statutory, or other official or ceremonial duties of the President.”
PRESIDENTIAL RECORD
NOT A PRESIDENTIAL RECORD
Speeches 2000 & 2004 Campaign Materials
Presidential Schedules
Texas Gubernatorial Materials
Presidential Correspondence
George W. Bush Foundation Materials
Examples of the offices that create Presidential records include the National Security Council, the Homeland Security Council, the White House Counsel’s Office, and the White House Office of Speechwriting.
How long will it take to get the records I requested?
The FOIA process takes time. FOIA requests are processed by a first-in/first-out system based on a queue structure determined by the amount and type of records requested. Once a request is at the front of a queue, processing begins.
If you request Presidential Records that are subject to the PRA -- and the National Archives determines no FOIA exemptions apply -- we must inform the incumbent and former Presidents (through designated representatives) of our intent to release responsive records, in accordance with Executive Order 13489. This notification gives them an opportunity to invoke executive privilege over the records proposed for disclosure. See the Letters of Notification of Intent to Release Presidential Records.
The authorized review period begins only after all other review decisions, including classification issues, have been resolved and reviewed records are proposed for opening to the public. You will receive an acknowledgement letter with tracking number and information concerning the status of your request. After the Presidential notification process is complete, you will receive a final response letter.
Can I get my FOIA expedited?
Ordinarily, the National Archives will expedite a FOIA request only in certain cases. See the FOIA Reference Guide for more information.
How can I access the records?
Open records are available for viewing in the Research Room at the George W. Bush Presidential Library and Museum. Photocopy orders can be placed by contacting the Archives staff at gwbush.library@nara.gov or 214-346-1557. Electronically processed materials will be made available online through the National Archives Catalog and found using your FOIA request number (gwb.20xx-xxxx-F). Unfortunately, electronic records are not available in the National Archives Catalog at this time; however, they are available on a CD for $5. Learn more about Planning Your Research Visit.
What is the national archives catalog?
The National Archives Catalog is the National Archive’s online public portal to records and information about records held by the National Archives.
Can I submit a FOIA request for political or campaign materials?
The PRA defines material related to political campaigns, which has no information concerning the constitutional, statutory, or official or ceremonial duties of the President, as personal material. This material is not subject to FOIA requests.
Can I request Gubernatorial Records?
While the gubernatorial records of George W. Bush are housed at the George W. Bush Presidential Library and Museum, requests must be submitted to the Texas State Library and Archives Commission. To request George W. Bush gubernatorial records, click here.
What if I have other questions?
Send us an email, call our Archives staff at 214-346-1557, or visit the National Archives's FOIA Frequently Asked Questions page.
PDF files require the free Adobe Reader.
FOIA Requests 2014
White House Staff Member Office Files
White House Office of Records Management
Donated Records
Records on Neil M. Gorsuch
Records on Brett M. Kavanaugh
White House Email
Presidential News & Speeches
Press Briefings
Student Lecture Series Presentations
Bookmark/Share
How To Submit FOIA Requests
Frequently Asked FOIA Questions
Documents Open For Research
Learn more about the George W. Bush Presidential Library and Museum - the facility, staff, important partnerships, contact information, how to support or volunteer, applicable laws and regulations, and the National Archives and Records Administration.
Presidential Libraries
Bush Center
Office of George W. Bush
Work 2943 SMU Boulevard, Dallas, TX 75205
|
cc/2019-30/en_middle_0059.json.gz/line144
|
__label__wiki
| 0.701379
| 0.701379
|
Tags: David Cadier, EU, EU membership, Europe, France, French Elections 2017, French perspective, Mamuka Kudava, Regis Gente, Tamar Khulordava
Round Table Discussion “Georgia in European Discourses: Trends and Challenges”
Georgia’s European integration depends on the policies and priorities of its European partners as well its own successful reforms. As a leader in both the European Union and NATO, France is worth studying in detail. On 10 April 2017, the Georgian Institute of Politics with support of the Open Society Georgia Foundation (OSGF) and in partnership with the Kondrad Adenauer Foundation hosted the public discussion, “Georgia in European Discourses: Trends and Challenges”. The discussion focused on French foreign policy discourses and priorities and how they relate to Georgia and other Eastern Partnership countries.
Four speakers representing different fields of expertise shared perspectives on current developments in France which have implications for Georgia and its integration efforts: David Cadier, a TAPIR Fellow at the Center for Transatlantic Relations, SAIS Johns Hopkins University; Tamar Khulordava, a parliamentarian and chair of the EU Integration Committee; Regis Gente, a Tbilisi-based French freelance journalist; and Mamuka Kudava, Georgia’s former ambassador to France.
Cadier emphasized the importance of member states’ priorities in the development and implication of EU policies: “the member states decide and the EU Commission implements.” As the EU’s leading military and diplomatic power, France has a great degree of power in steering EU foreign policy. The implications for Georgia are the following: France wants NATO to be flexible, not locked into a defensive posture on Russia’s western flank. That priority makes France sceptical of NATO enlargement and initiatives to strengthen defensive forces in Central and Eastern Europe.
Khulordava spoke about Georgia’s need for support from leading EU member states. Knowing that EU membership is not realistic in the near future, Georgia can only integrate further if the EU makes steps toward it in return. Khulordava also noted the importance of Georgian efforts to engage public opinion in EU member states, including France.
Gente commented on the French perspective toward Georgia. He complained that France has not developed a coherent policy toward Georgia, because it hasn’t yet developed a coherent policy toward Russia. The current absence of a policy toward Eastern Europe can have dangerous consequences, the Ukraine crisis being an example.
In his speech, Kudava emphasized that Georgia has a lot of work to do domestically to prepare for EU membership: the country should “act like a good pupil” and diligently implement reforms specified by the Association Agreement. Kudava also said that Georgia should wait for the results of upcoming elections in France and Germany before publicly calling for deeper integration.
Photos from the event:
Live video from the event:
“Georgia: Can Democracy Thrive Without Opposition?”
France’s policies toward the Eastern Partnership countries in context
GIP Held a Project Closing Conference – “Communicating EU: the Role of Media in Georgia and the Visegrad Countries”
GIP in the Hague: “Future of the Eastern Partnership policy: How far does the European identity extend?”
GIP participates in the Central and Eastern European Think Tank Forum in Bratislava
The Future of the Eastern Partners: 6 Lessons from the Western Balkans
GIP presents a new policy paper – “Avoiding Gridlock: a Strategy for Georgia to Engage with Eurosceptic Europe” – in the Parliament.
What Brexit means for the EU, Russia, and Georgia
|
cc/2019-30/en_middle_0059.json.gz/line145
|
__label__cc
| 0.659683
| 0.340317
|
Home Engineering Technical Reports Collection, Purdue University page 927
Section Twenty-Two
KEYNOTE AND LUNCHEON ADDRESSES
93 KEYNOTE ADDRESS
Quincalee Brown, Executive Director
Water Pollution Control Federation
Thank you! It is really an honor and a delight to be here. First it is a delight because I love to come
back to the Midwest where 1 grew up. My home was Kansas and 1 always enjoy going back to my
roots.
It is also nice to be back on campus. For a while yesterday, after 1 arrived, 1 wandered around
Purdue. Having spent 12 years teaching on various campuses, its always nostalgic to return, taking me
back to my professional beginnings.
It is also an honor to be asked to address such a prestigious group. I must say that my initial
reaction, when Dr. Bell's letter arrived inviting me to give this address, was that there must be some
mistake. I was assured that was not the case. My concern was over not having a technical background,
and so could not imagine what I would have to say that might be of value to you. I considered calling
Dr. Bell and offering one of the WPCF officers who has expertise in the industrial waste field, but was
told that John Bell had a reason for inviting me, so talk to him about it. We agreed that, with some 90
technical papers being presented, I did not need to be technical, too.
In thinking about these remarks, I recalled my past experience with the field of science and
engineering and I had to laugh at some of recollections. I taught public speaking for many years,
particularly at Wichita State University, where there was a large aeronautical engineering school. The
engineering students were all required to take public speaking for graduation and virtually all of them
would end up in our class at the end of their senior year. Now, most of them did just fine and some
liked it far better than they ever imagined. The irony is that someone like me waited until the last
semester of her senior year to take the required physical science course, and was lucky that the guy I
was dating at the time was a science student, and a good tutor.
Lately, 1 must say, as I talked to WPCF audiences about the organization and where we are headed
in the field of water quality, I feel a lot like Alicia Williston, whom you might remember as the last
survivor of the famous Johnstown floods. After Alicia passed on and entered heaven, she told St.
Peter her story. He agreed that it was remarkable and would make a good talk to the multitudes. So he
called together the throngs of heaven, gave her a glowing introduction, and just as he turned the
podium over to her said, "but remember —Noah's in the audience." I have this feeling, as I have talked
to audiences about WPCF, that there are a lot of Noahs in the audience.
My field has been communications and more recently association management, the management of
non-profit, tax-exempt organizations. 1 approached your field of environmental issues and water
quality as an outsider, truly a stranger in a strange land in terms of the content of this organization.
During this past six months as I have been managing the Federation, I have also been an observer and
have had to become a student of your field. Today I would like to share some observations, some
insights if you will, a kind of personal/professional odyssey of what I have observed these last six
months and relate these learnings to my understanding of communications. Then, I will address the
issue of communicating the messages of an organization to the broader public.
I feel that I have learned a lot about you as a scientific and engineering community, about you as an
individual dealing with issues that are among the most critical that we will face on this earth over the
next 20 years, and about you as a profession that sometimes does not communicate these concerns
effectively. One of the issues I discussed with the people who hired me was their perception that as
engineers they do not often communicate well the messages that they have. Of course, it seems ironic
that some of these same individuals are among the most articulate people I have ever known, and
certainly some of the brightest. But their sense is that the scientific/engineering community is insular,
Purdue Identification Number ETRIWC198793
Title Keynote address
Author Brown, Quincalee
Conference Title Proceedings of the 42nd Industrial Waste Conference
Conference Front Matter (copy and paste) http://e-archives.lib.purdue.edu/u?/engext,38818
Extent of Original p. 927-932
Collection Title Engineering Technical Reports Collection, Purdue University
Type (DCMI) text
Capture Device Fujitsu fi-5650C
Capture Details ScandAll 21
Rights Statement Digital copyright Purdue University. All rights reserved.
Transcript Section Twenty-Two KEYNOTE AND LUNCHEON ADDRESSES 93 KEYNOTE ADDRESS Quincalee Brown, Executive Director Water Pollution Control Federation Alexandria, Virginia 22314 Thank you! It is really an honor and a delight to be here. First it is a delight because I love to come back to the Midwest where 1 grew up. My home was Kansas and 1 always enjoy going back to my roots. It is also nice to be back on campus. For a while yesterday, after 1 arrived, 1 wandered around Purdue. Having spent 12 years teaching on various campuses, its always nostalgic to return, taking me back to my professional beginnings. It is also an honor to be asked to address such a prestigious group. I must say that my initial reaction, when Dr. Bell's letter arrived inviting me to give this address, was that there must be some mistake. I was assured that was not the case. My concern was over not having a technical background, and so could not imagine what I would have to say that might be of value to you. I considered calling Dr. Bell and offering one of the WPCF officers who has expertise in the industrial waste field, but was told that John Bell had a reason for inviting me, so talk to him about it. We agreed that, with some 90 technical papers being presented, I did not need to be technical, too. In thinking about these remarks, I recalled my past experience with the field of science and engineering and I had to laugh at some of recollections. I taught public speaking for many years, particularly at Wichita State University, where there was a large aeronautical engineering school. The engineering students were all required to take public speaking for graduation and virtually all of them would end up in our class at the end of their senior year. Now, most of them did just fine and some liked it far better than they ever imagined. The irony is that someone like me waited until the last semester of her senior year to take the required physical science course, and was lucky that the guy I was dating at the time was a science student, and a good tutor. Lately, 1 must say, as I talked to WPCF audiences about the organization and where we are headed in the field of water quality, I feel a lot like Alicia Williston, whom you might remember as the last survivor of the famous Johnstown floods. After Alicia passed on and entered heaven, she told St. Peter her story. He agreed that it was remarkable and would make a good talk to the multitudes. So he called together the throngs of heaven, gave her a glowing introduction, and just as he turned the podium over to her said, "but remember —Noah's in the audience." I have this feeling, as I have talked to audiences about WPCF, that there are a lot of Noahs in the audience. My field has been communications and more recently association management, the management of non-profit, tax-exempt organizations. 1 approached your field of environmental issues and water quality as an outsider, truly a stranger in a strange land in terms of the content of this organization. During this past six months as I have been managing the Federation, I have also been an observer and have had to become a student of your field. Today I would like to share some observations, some insights if you will, a kind of personal/professional odyssey of what I have observed these last six months and relate these learnings to my understanding of communications. Then, I will address the issue of communicating the messages of an organization to the broader public. I feel that I have learned a lot about you as a scientific and engineering community, about you as an individual dealing with issues that are among the most critical that we will face on this earth over the next 20 years, and about you as a profession that sometimes does not communicate these concerns effectively. One of the issues I discussed with the people who hired me was their perception that as engineers they do not often communicate well the messages that they have. Of course, it seems ironic that some of these same individuals are among the most articulate people I have ever known, and certainly some of the brightest. But their sense is that the scientific/engineering community is insular, 927
|
cc/2019-30/en_middle_0059.json.gz/line147
|
__label__wiki
| 0.872878
| 0.872878
|
home // News // Sandy Residents Ask Why They Didn’t Hear About Water Problem //
Sandy Residents Ask Why They Didn’t Hear About Water Problem
Source: U.S. News & World Report | February 18th, 2019 | By The Associated Press
SALT LAKE CITY (AP) — Residents in a Salt Lake City suburb are asking why they were allowed to drink possibly tainted water for a week before they were alerted to the problem.
Officials in Sandy declared its water safe to drink Sunday evening after a fluoride pump malfunctioned because of a power outage on Feb. 6, The Salt Lake Tribune reported .
The pump flooded parts of the water system with fluoride, which can cause health problems in large quantities. The overloaded acidic substance also corroded pipes in some homes, causing the release of toxic metals such as lead and copper.
The malfunction was repaired nearly two days after it began, the city said. Officials initially believed the water problem only affected an area containing up to 60 homes.
Workers handed out flyers in that area, but the flyers were not left if the residents were not home, which was a mistake, said Tom Ward, director of Sandy City Public Utilities.
The city starting receiving complaints of health issues outside the initial area days later, leading officials to realize the problem was more widespread. The city then sent out alerts across its communication systems.
“But the point is we could have done that sooner,” Ward said. “I failed in my duty in reaching some people. And that’s my responsibility.”
Resident Cydne Corlett said she first heard about the water problem on the news Friday, “so we had been drinking possibly contaminated water for a week.”
Corlett and her husband had stomach cramps and unusual dry mouth, she said. A city worker knocked on her door Saturday, telling her of the water situation and offering a case of water.
“I apologize for the lack of communication that was felt amongst residents,” Sandy Mayor Kurt Bradburn said. “We apologize, of course, about the tremendous inconvenience and health issues that this has caused. We will be there to help and assist in any way we can.”
Information from: The Salt Lake Tribune, http://www.sltrib.com
*Original article online at https://www.usnews.com/news/best-states/utah/articles/2019-02-18/sandy-residents-ask-why-they-didnt-hear-about-water-problem
|
cc/2019-30/en_middle_0059.json.gz/line155
|
__label__cc
| 0.530999
| 0.469001
|
OILS AND FATS
Cargill’s oil business cracks down on attempt to counterfeit Gemini oil
Tuesday, 02 July, 2019, 08 : 00 AM [IST]
Cargill’s oil business in India took a serious stand against attempts to counterfeit its flagship brand, Gemini Cooking Oil. This has resulted in the organisation winning a suit filed against M M Oil Enterprises on these grounds.
Aslam Noor Siddiqui, proprietor, M M Oil Enterprises, was sentenced for eight weeks of civil imprisonment for brazen breach of a March 2017 order to not infringe copyrights of Gemini Cooking Oil.
They committed an act of passing off by adopting a deceptively similar impugned mark/packaging material Genuine - Refined Sunflower Oil as against the brand’s label mark/trade dress Gemini - Refined Sunflower Oil.
The notable verdict would further deter miscreants from indulging in such practices. This decision also set a valuable precedent for the plaintiffs seeking effective relief against offenders who habitually violate their intellectual property rights.
In May 2017, Cargill’s oils business in India had seized the finished and semi-finished stocks of a fake product called Genuine in its fight against the menace of counterfeiting.
The company had successfully launched an anti-counterfeiting technology to check its brand’s authenticity in February 2017.
Counterfeits like Genuine not only diminish the reputation of the Gemini brand, but also pose health risks for the consumers who buy fake product under the assumption that they are buying the authentic one.
Armed with a High Court order, Cargill’s oils business in India, with the help of court officials and local police authorities, conducted a raid on M M Oil Enterprises in the month of April 2017 at its premises at Dahisar Mori, Maharashtra. The raid resulted in seizure of finished goods and packing material of the Genuine brand.
Commenting on this, Subin Sivan, marketing head, Cargill’s oils business in India, said, “Gemini Cooking Oil is a heritage brand that has built goodwill and trust amongst our consumers. Counterfeit products sabotage this trust and goodwill that this brand enjoys. It also compromises the health and wellbeing of consumers.”
“Our initiative to introduce technology for combating counterfeit products has helped in bringing malefactors such as M M Oil Enterprises to task. We applaud the verdict by the Bombay High Court which will further dissuade offenders to commit such malpractices,” he added.
The anti-counterfeiting technology launched by Cargill in February 2017 has a unique feature with a two-way process to check the authenticity of its products. This process includes a 3D hologram of Cargill with 1865 – the year of foundation of Cargill’s operations - written.
In addition, customers can download an app called Mojo Tags to scan the batch code of the product and receive reassurance that the brand is authentic. This is the first time an edible oil brand in the country has used technology to fight the problem of counterfeiting.
Cargill’s oils business in India believes in nourishing the world in a safe, responsible and sustainable way and follows global standards of food safety. It strongly condemns counterfeiting and is committed to take action to eradicate the problem at its roots.
This page allows you to send the current page to your friend.
Your Friends Email ID:
|
cc/2019-30/en_middle_0059.json.gz/line157
|
__label__cc
| 0.516484
| 0.483516
|
Board index Mongoose Roleplaying Games Traveller
Pocket Battleship and Dreadnought
Discuss the Traveller RPG and its many settings
phavoc
Cosmic Mongoose
Re: Pocket Battleship and Dreadnought
Postby phavoc » Mon Sep 25, 2017 11:30 pm
Condottiere wrote: ↑
For Fisher, they were the successors to first class armoured cruisers.
The Deutschlands were a solution to a German dilemma, the need to power project in the Baltic, and/or sockblock the French, while not appearing to defy the provisions of Versailles. The eleven inchers are at the low end of capital class guns, whereas nine point twos tended to be the prewar limitation for cruiser guns. You have a substantial secondary anti surface armament.
Battlecruisers did great... till some idiots in the back office thought they'd make a great secondary for real battleships fighting real battleships.
It's unfortunate that they were never given real leave to practice their calling - that of hunting and killing anything smaller than themselves. The Deutschland, Graf Spee and Scheer were some damn fine cruisers that, at least until the Brits sank them, caused all kinds of problems that were outsized to their class. Typical CA's of the time mounted 8" guns, while these had 11". They were only "pocket" to build a tougher CA and fit within the naval treaty limitations.
baithammer
Greater Spotted Mongoose
Postby baithammer » Mon Sep 25, 2017 11:58 pm
The problem for the battlecruiser was a lack of deployment opportunities and the arrival of fast battleships which outmoded them.
The pocket battleship on the other hand was a very interesting sufficiency exercise where you trim the battleship as close to a heavy cruiser as possible while still having the triad of traits for a battleship.
What I find interesting is the zumwalt is classified as a destroyer with its displacement almost at 15,000t ...
Postby phavoc » Tue Sep 26, 2017 2:53 pm
baithammer wrote: ↑
The deployment issue is one that would be just as valid in the 52nd century as well. The classification issue of BC vs. 'fast battleship' vs 'battleship' vs 'dreadnoughts' remains the same. Traveller could have BC's anchoring CA squadrons, or having BC squadrons assigned to hunt down and kill CA's, or heavily escorted convoys. It's a question of whether or not two BC's could handle a single BB. For wet navy issues it would be a question of gun calibers vs opponents armor. The typical BB should outrange and out-armor a pair of BC's, thus the BC's would probably come out on the losing end of a fight. Question would be would wet-navy translate the same into space navy?
The heavier guns of the Deutchsland class definitely provided a bonus against opponents. It's funny how they built the Hipper class as heavier (by 4k tons), but put the standard CA 8" guns on them.
I think the issue with the Zumwalt is that the USN didn't want to say they built a modern CA. Kind of like the IJN didn't want to say they built a new CV. The USN did the same thing during WW2, with the Alaska class. Their official label was CB (large cruiser), but they would have been a BC in any body else's navy.
Chief Mongoose
Postby Condottiere » Tue Sep 26, 2017 3:30 pm
Formulaically, the Iowas are the world's biggest battlecruisers.
You have to look at the development of battlecruisers, and the Deutschlands, in the context of their navies' constraints and the prevailing arms races.
I've covered this territory before, in context of the Fighting Ships of the Solomani and Mongoose High Guard.
Basically, the natural evolution of the battlecruiser is the fast battleship, of which the Hood could be considered an intermediate step; however, you still have to cover all the other missions that large cruisers would be tasked with, and that would be the supercruiser of which the seventeen thousand tonne Des Moines might be the epitome with nine eight inchers.
Outside of the Yamato class and whatever Hitler had planned, most navies tend to build just large enough ships to accomplish their planned missions, and even Yamatos had some logic behind them, built larger than the expected size of future American battleships, which would be constrained by the locks of the Panama canal, and by the fact that the Japanese could only build a limited number of hulls.
Our Deutschlands are likely to resemble the Azhanti High Lightnings, but with the current design ruleset, would be a minimum hundred thousand tonnes.
Postby phavoc » Wed Sep 27, 2017 7:27 pm
Why would you consider Iowa's to be battlecruisers? Where do you draw the line between battleship and battlecruiser? Main armament? Displacement?? Armor level???
The "fast" battleship really just means a battleship that can keep up with a carrier task force (30+ knots). The nomenclature changed with the advent of carriers and the shift away from battleships ruling the waves.
The "modern" workhorses of the navies really was heavily influenced by the London Naval treaty. The major powers had agreed to ship and armament limitations, and then rumors of cheating by other navies had other navies working on 'killers' to off-set or compete with the others. The Deutschland class was built to stay within the Versailles treaty limitations. The Admiral (of which the Hood was part of) class were very similar to first-line battleships, but they didn't have the armor. Comparing the Iowa to the Hood, the Iowa had more armor, a heavier caliber gun and about 8,000 tons on the Hood. Dimension wise they were about the same.
I would expect a Traveller BC to be around 100,000 tons, with BB's out displacing them by at least a 2-1 ratio. That's because Traveller ships-of-the-line tonnage is going to be based upon larger-sized dreadnoughts like the Tigress. These ships are so massive and expensive that even the Imperium can't afford a complete fleet of them. Plus you invest a great deal of money in a single hull that you can only have in a single place. A pair of 250k Dton battleships means you can place them in two places at once, and still outmass and outgun most opponents navies.
Postby baithammer » Fri Sep 29, 2017 3:20 am
It'll be more nuanced than that, as composition will depend on whether there are any active wars, state of the economy and/or demobilization from previous wars.
If there isn't any active wars for several decades and status quo has remained steady in that time, its hard to justify building large capital warships which is where battlecruisers and pocket warships become more attractive at least as a stop gap.
Another scenario is where resources to build warships are constrained but neither capital nor technology are limited, essentially you expend more capital on technology and reduction in material per unit produced.
Postby Condottiere » Sun Oct 01, 2017 11:39 pm
You need numbers to successfully subcategorize warships, and the run up to the Great war provides this, otherwise Fisher's foray into revolutionizing cruiser warfare would have ended up as an oddity, or as a second class battleship class.
Treaty obligations tended to homogenize capital ships, especially as there were limits on numbers and individual hull tonnage, the lines get blurred.
However, the real ships intended to hold the line during the Great Patriotic War were intended to be the twenty eight knot twelve gun Montanas with sixteen inch armour, compared to the thirty three plus knot nine gun Iowas with twelve inch armour.
Comparing the Hood to the Iowas is pretty much the same as comparing a technological level thirteen Zeus class battlecruiser against a technological level fourteen Diaspora.
The difference in technology levels gives a distinctive edge during combat, something that I don't think is really addressed in Traveller, however Fighting Ships of the Solomani specifically states that the Solomani tended to provide room for upgrades, though design rules prohibit stripping the hull of stated initial technological level armour and replacing it with something better.
Since we're puddling around in the Interwar period, it's not that capital ships have to keep up with aircraft carriers, it's that carriers have to keep up with the main fleet units. The Americans lucked out when they converted their unfinished large battlecruisers, the Saratoga and Lexington, into for that time massive fast fleet carriers, and then cheated by immediately adding another three thousand tonnes to each, though technically allowed by Treaty though intended to improve protection during a SLEP.
While the Fleet Air Arm conducted an internecine conflict with the Royal Air Force, the Japanese and Americans were refining the finer aspects of carrier warfare, in which the Japanese Kongo class did get assigned the mission to escort their fleet carriers, since they could keep up despite being uparmoured.
Fast battleships developed for the same reason fighter planes got faster, speed is life and you need to catch the blighters if you want to bring them to battle, with projected battle speed of about twenty eight knots; post Jutland, the upper speed was around twenty three knots, and since treaty obligations obliged you to keep so many of the old clunkers around, that was a liability.
Postby baithammer » Mon Oct 02, 2017 6:06 am
Considering the Montana class were never built and battleships ended up defending the carrier groups ...
it's not that capital ships have to keep up with aircraft carriers
Aircraft carriers were mainly built on cruiser hulls which classify them as capital ships.
In reality the opposite occurred due to everyone trying to find the edge to maximize within or close to the limits as possible.
though design rules prohibit stripping the hull of stated initial technological level armour and replacing it with something better.
If using mgt High Guard there is no rule about prohibiting upgrading armour to a more advanced version, hull upgrades on the other hand are restricted.
AnotherDilbert
Postby AnotherDilbert » Mon Oct 02, 2017 6:14 am
baithammer wrote: ↑ If using mgt High Guard there is no rule about prohibiting upgrading armour to a more advanced version, hull upgrades on the other hand are restricted.
Armour is the hull, it is not added to the hull. See MT.
Armour and other parts of the ship integral to the hull (such as configuration or reinforced structure) cannot be changed under any refit.
MgT TCS.
Postby phavoc » Mon Oct 02, 2017 1:56 pm
AnotherDilbert wrote: ↑
In baithammer's defense he did say MGT High Guard. I suppose we'd have to say v1 HG or v2 HG, but by default I think most discussions are now referring to v2.
Virtually anything can be refitted to a ship if you want to spend the money. Wet navies have lengthened ships, replaced boilers, added armor, etc. But adding armor isn't just welding more plates on the outside. Sensors & airlocks have to be moved, weapon emplacements changed, internal structures have to be modified to support the extra mass as well as the impact (a ship without sufficiently strong internal structure would collapse when struck externally).
At some point there might be a v2 TCS. Hopefully this time the editors will go through and clean it up better than the MGT v1... it was littered with references of tech to previous versions.
Postby baithammer » Tue Oct 03, 2017 6:36 am
Which is contradicted by Mgt 1ed High Gurard..
The basic hull provides some protection from anti–ship weapons
fire, but it is possible to add heavier armour to the hull for added
defence.
Armour is its own component not part of the hull itself and is why it has its own set of options instead of being rolled into the structure options.
Postby phavoc » Tue Oct 03, 2017 4:05 pm
The basic hull provides some protection from anti–ship weapons fire, but it is possible to add heavier armour to the hull for added defence.
That may be how the rule is worded, but that's not how it works. A LOT of rules are poorly worded in the book and don't provide proper explanation. You can't just keep welding on slabs of armor without adding structural support to make the armor work from the insides, to move sensors, turrets firing arcs, etc.
Postby Condottiere » Tue Oct 03, 2017 10:05 pm
Like a lot of things, it simplifies the design process, since warships don't universally have a homogeneous armoured belt, and prioritize what they want protected.
Once navies figured out that carrier air wings can extend the reach of a strike force way beyond the horizon, the day of the battleship was over, combined with the extended reconnaissance range aircraft gave, it was hard to surprise a carrier strike group, which paranoia accounted for carriers still armed with eight inch guns and opting for an armoured flight deck. Or it should be hard to do so.
With the realization that the Axis powers offered no real threat in terms of a battle line, outside of the Yamatos no more super heavy battleships were built, and even the last sister of that class was converted into a hybrid aircraft carrier.
If light attack craft proved dangerous to capital ships, Traveller Navies would rebalance their compositions.
One primary difference between our current carriers and those in Traveller, is that if they are at sea, they tend to be very difficult to locate, and if located, very difficult to hit; security in obscurity isn't that much of an option in space for a hundred thousand tonne hull, and going by current designed performance, they can't run, and as can be seen, they can't hide, unless they jump.
Postby baithammer » Wed Oct 04, 2017 1:42 am
You can't just keep welding on slabs of armor without adding structural support to make the armor work from the insides, to move sensors, turrets firing arcs, etc.
Which isn't what is being referred to, a refit subtracts components that are no longer useful and replaces it with more functional upgrades.
Armour isn't the structure itself, its attached to specific points on the hull in order to provide a barrier to the underlying hull.
It should be pointed out however, that refits of this nature do require proper planning to avoid miscalculations and should entail using a ship architect in order to make the refit properly safe.
Postby phavoc » Wed Oct 04, 2017 3:18 am
Traveller ships do. There is no concept of forward/aft/ventral/dorsal armor in Traveller.
A refit very much depends on what is being refit. In wet navies ships had additional armor added on top of the existing armor. Trying to remove the old armor and replacing it would have made a difficult and expensive operation even more so. Depending on what was done, some ships had additional torpedo bulges added on top of the ones they already had installed, some had new ones added. But certain areas, like keels, could not be armored except for what was there at the time of the laying of the keel. Obviously spacecraft don't have such limitations, but they still have many of the same ones that ocean-going vessels have.
Specifics weren't mentioned, but for the sake of argument a ship with crystalline steel as armor is going to increase the armor factor in the refit. Because the initial hull structure provides a base armor factor you could strip the external hull off and then re-build it with a higher TL armor, though that would be fabulously expensive to do.
Armor in Traveller covers the ship equally in all places. So it is homogenously applied everywhere. There is nothing setting aside external areas to have additional armor. Armored bulkheads are internal.
Pretty much any major refit where you are stripping a ship down to it's structure should, by default, require the participation of a naval architect and fully equipped repair facility or dockyard, depending on the displacement of the vessel.
Because the initial hull structure provides a base armor factor you could strip the external hull off and then re-build it with a higher TL armor, though that would be fabulously expensive to do.
Hulls provide armour 0 unless planetoid or buffered planetoid so no the hull doesn't provide armour, it provides hull points.
This allows stripping off the old armour plating and applying a new set which would require time in docks and design work to make sure the new set works. ( Armoured Bulkheads are a completely different kettle of fish as that is more a hull structure.)
Postby phavoc » Wed Oct 04, 2017 1:32 pm
Zero, for starships, is still armor. A starship with zero armor still resists or is impervious to non-starship weaponry.
Postby Condottiere » Wed Oct 04, 2017 9:18 pm
The hull should actually have a stated percentage of volume, to be at least heavy machine gun proof.
Postby baithammer » Fri Oct 06, 2017 11:54 am
Armour 0 means armour 0, the only thing at spacecraft scale is the 1/10th damage from vehicle / personal weapons. Further, as long as the hull is tl9+ its self sealing.
Postby baithammer » Sun Oct 08, 2017 10:14 pm
After going through various suggestions on design considerations for Mgt 2ed, I've come up with a different design philosophy based on the armoured warship. In this case a heavier use of screens in particular the Meson screen which will need to use Reduced Size x2 to make it worth the effort and also requires 1,000 screens per 2dd to defend against.
Spinal weapons do 2d6 x1,000 damage, while 5 screens do 1d6x10 so in order to provide average damage deduction versus Meson Spinal weapons you need 1,000 screens per 2dd of Spinal weapons.
The aim is to keep these ship classes at there current displacement while trimming other systems to make for the displacement lost to screens. ( Biggest change is jump range reduced to Jump 3)
I refer to these designs as Screened ships.
Screened Battleship
Screened Dreadnought
From there I'll workout Pocket ships.
Return to “Traveller”
|
cc/2019-30/en_middle_0059.json.gz/line163
|
__label__wiki
| 0.527653
| 0.527653
|
Arts in Greece | Katerina Koskina on the need for cultural dialogue & EMST’s role as an arts capsule for the city branding of Athens
The temporary exhibition activities of Greece’s National Museum of Contemporary Art (EMST)recently restarted with the opening of the exhibition “Urgent Conversations: Athens – Antwerp” that will be running through January 29,…
CULTURAL HAPPENINGS
Arts in Greece | Alexandros Psychoulis on the idea of symbiotic bliss & the reality of working as a visual artist in Greece
Alexandros Psychoulis, Greek artist and Associate Professor at the University of Thessaly, showcases his new work in the exhibition "Collective Dizziness Protocol” running at Zina Athanasiadou Gallery (Thessaloniki, November 18- December 10, 20…
Arts in Greece | Constantinos Pittas’ Images of Another Europe
This week, the public in Greece will have a last chance to visit Constantinos Pittas’ photo exhibition “Images of another Europe 1985-1989” running through November 27, 2016 at the Benaki Museum (Pireos Street Annexe). From 1985 to…
Arts in Greece | Gary Carrion-Murayari on “The Equilibrists” & the contemporary arts scene in Greece
This month, the public in Greece will have a last chance to visit “The Equilibrists”, a grand exhibition, devoted to a new generation of young Greek and Cypriot artists, running through October 23, 2016 at the Benaki Museum (Pireos Street…
Arts in Greece | Sotiris Karamesinis Revives Greek Drama in Brazil
Sotiris Karamesinis is a Greek theatre director, researcher and actor's coach. He is known for developing his own acting method, MUSA (musical system of acting), a unique system that is based on the art of the ancient actor, introducing music in cont…
Arts in Greece | Efi Kyprianidou on Art and Compassion
One of the projects taking part in Art-Athina 2016 (May 26-29, 2016) under the auspices of the Ministry of Culture and Sports is “Compassion”, an art and philosophy project that was founded in 2015 by a voluntary initiative of activ…
Arts in Greece | Yannis Behrakis, “the man behind the image”
The Secretariat General for Media and Communication is hosting an event – tribute to Yannis Behrakis, photojournalist with Reuters for the last 20 years and Guardian photographer of the year 2015. On this occasion, Greek News Agenda (GNA)* inte…
REFUGEE CRISIS
Filming Greece | “Holy Boom”: Maria Lafi on her Resurrectionless Easter
Reading Greece: Aristea Papalexandrou on Poetry as a Creative Act
Lavrion, the first company town in Greece: foreign capital, industrial experience and multiethnicity at the turn of the century
The Fourth CIAM Congress of 1933 in Athens and the foundations of Western urbanism
Ntina Tzouvala on the history of international law and its impact on the Balkans
Reading Greece | Sofka Zinovieff: "I have a strong belief in the resilience of Greeks"
Reading Greece: Katerina Anghelaki-Rooke on Poetry as an Endless Source of Revival and the Creation of a New Poetic “Cosmogony”
|
cc/2019-30/en_middle_0059.json.gz/line168
|
__label__cc
| 0.624294
| 0.375706
|
tastyspleen::quake 2 community »
The Culture Corner »
art, music, etc. (Moderator: [BTF]n0ctuary) »
Post Musical Equipment Here....
Pages: 1 2 3 4 5 6 [7] 8 Go Down
Author Topic: Post Musical Equipment Here.... (Read 27965 times)
|iR|Focalor
Irrepressibly Profuse Member
OFFO
Re: Post Musical Equipment Here....
Well part of that is maybe because you're keeping the pre-gain pegged at 10 like some people tend to do. The pre-gain maxed out will have a definite effect on how quickly the volume rises when you turn the master volume (also probably effectively the "post-gain" control). You don't necessarily need pre-gain at 10 to get a good metal rhythm sound. In an actual band situation, usually you want a little LESS distortion on the rhythm guitar parts, then you can hit the boost/crunch/whatever to up the distortion a little for increased sustain of notes when playing single note lead passages as well as slight volume bump-up to make the lead guitar heard clearly over the rhythm.
You also gotta remember that's 60 watts funneling into just ONE speaker. It's gonna drive that one single speaker hard as fuck. Dunno if you've ever dealt with many head amps. But lets say you have a 60 watt head. Sitting under the head is a 2x12 cab and sitting under that is another 4x12 cab. If you go from both speaker outs on the head to both cabs, the 2x12 is gonna sound louder than the 4x12 because more power is going to each speaker. 60 watts divided by 2 is 30 watts per speaker. 60 watts divided by 4 is 15 watts per speaker. If you were to get a 4x12 cab, disconnect the speaker in the combo, and then run the cab off the ext jacks of the combo, you'd notice a little more play in the volume knob for sure due to that 60 watts being split 4 ways.
Just HOW MUCH do his neighbors hate his fucking guts? Jesus Christ, people from 3 solar systems over were calling to complain about the noise.
https://www.youtube.com/v/GsmlA3GMSrs
M0us3
The wank is strong with this one.
Swung by the Guitar Center in Alpharetta GA last weekend and they had a used Crate Blue Voodoo 120watt head. Wasn't interested at all in buying it, but just to settle my curiosity for if they sound as semi-decent as I remember, I gave it a whirl.
Ewwww. Not good. Granted, that one probably had some problems. It was very noisy sounding. Lots of snow going on... and yeah I had a single coil Fender Strat plugged into it at first. But then I grabbed a Epiphone Les Paul off the wall just to see if it was the pickups on the guitar. Nah, it was the amp for sure. The clean channel has no gain, just a volume, makes me wonder if the preamp section in clean is 100% solid state (bypasses the 12ax7 tubes completely). The dirty channel has a gain knob but the distortion kinda maxed at about 3 and only got noisier and shittier the more you cranked towards 10. But if you tried to dial it down to something with just an edge of breakup, the gain knob basically killed all the volume below the 1 notch. It just went silent. Definitely NOT how an amp should work.
So yeah, I see why these damn things sell for so cheap now. They are NOT good.
Also gave a Blackstar combo a test drive for the first time.
It didn't blow me away. It's decent. It certainly sounds livelier than the Marshall DSL100 kicking out dirt, and those sound like poor imitations of Marshall heads from years past themselves... oddly enough. I can't remember the model I played, but it was the one that had that strange "ISF" knob which supposedly "tightens" and "loosens" the characteristics of the power tubes... and I couldn't really tell much of a difference. It was very very very subtle. Altogether, it was decent amp. But some of the EQ knobs didn't go places low or high enough for me. The clean channel had too much top end and the dirty channel wouldn't get enough top end with the treble knob dimed. Probably a great amp for someone else, but not what I'm really looking for.
I think I've decided for sure which amp I'm gonna get now.
The Orange Rockerverb 100w MkIII is the frontrunner. I've decided not to hock my old JMP1 and Peavey Classic Series 120/120 poweramp and just buy a new head outright. They want $2,100 for these motherfucking heads though, so I'm gonna have to save up for a while. The Mark III's are the latest incarnation of the Rockerverb and the first to include the nifty attenuator knob which is the main draw for me. With a gain and volume knob in the dirty channel, the addition of the attenuator just creates at least 33% more tonal possibilities by how hard you can opt to drive the poweramp section and still keep the output volume at the speakers something "reasonable" that won't make the whole neighborhood hate you. They've also retuned the EQ a bit, especially in the clean channel to make it a tad brighter and janglier kinda like a Vox AC30, but it gets WAY more overdrive than a Vox ever thought about. Seriously, this fucking amp is an as advertised jack of all trades. It can do EVERYTHING. If you're ever in a music store and see one of these sitting there, do yourself a favor and give it a test drive. It'll change your religion. I used to think Orange was just trendy hipster amps being pimped by clever marketing and endorsement of artists. But I see why so many artists don't mind endorsing these things. They DO NOT suck.
When pigs fly? (Pink Floyd reference probably)
If you have maybe 500 bucks to spare, or can somehow trade+cash combo it, here's a VERY rare opportunity to own a legendary and hard to find pedal.
The Electro Harmonics Big Muff Pi "Civil War" fuzz/distortion. $449.99 (Probably $25-$50 for shipping)
https://www.guitarcenter.com/Used/Electro-Harmonix/1993-Sovtek-BIG-MUFF-Pi-V7-CIVIL-WAR-GREY-Effect-Pedal.gc
David Gilmour of Pink Floyd had one of these on his pedalboard for the Pulse tour back in the 90's. It's a Big Muff fuzz distortion, but this particular version of the pedal produced only for maybe 2 years in the early 90's is now highly sought after for it's buttery smooth violin like fuzz tone, much smoother sounding than any of the other Big Muff's ever made in any decade.
I'm thinking VERY seriously of snagging this thing tomorrow when I'm at Guitar Center. I dunno, I'm actually going to look for a Univibe style pedal, but... I might have to order this thing instead. You NEVER see these things up for sale. I've seen a couple on Reverb.com before, but they're usually FAKE.
This is probably the most expensive stereo chorus unit I've ever seen.
https://www.youtube.com/watch?v=0b-jcn9t-MM
https://www.youtube.com/v/0b-jcn9t-MM
https://www.fulltone.com/products/80s-rack-chorus
Fulltone Custom Shop says they have enough N.O.S. (new old stock) Panasonic chips to produce 3200 of these units with a price tag of $1200. Only 1200? Well fuck, I'll take THREE!!!
Cool sounding, sure. I dunno about you, but I don't hear that it's all that much more special than your standard issue Boss Chorus Ensemble, or perhaps even 2 Boss Super Chorus pedals together running into a left and right amp for stereo.
I used to have a Boss Super Chorus pedal. Not the most amazing chorus pedal ever made, doesn't get very psychadelic and wacky. It's depth stays in a more conservative range, but it perfectly replicates that Police/Andy Summers kinda chorus sound.
I'm pretty impressed by the Fulltone stuff though. They make great spot-on recreations of old favorites, and even improve them in spots wherever they can without compromising on the integrity of the original circuit and resulting sound.
Said I was looking for a UniVibe kind of pedal last weekend. I've tried quite a few now. The most commonly found MXR UniVibe is pretty good. Tried one out about a year ago, but I was playing a cheap little Gretsch Pro Jet into a Mesa Nomad combo I think. UniVibes don't sound so pronounced and great with humbuckers, so that's why I wasn't impressed with it at the time. But on a decent Fender strat, yeah, it's everything a UniVibe should be.
I tried out a Keeley Vibe-O-Verb pedal. A somewhat unique pedal. I was a little misled by it honestly. I was under the impression it was kind of a UniVibe and reverb pedal combo. As in... I assumed you could use it as ONLY a UniVibe, or as ONLY a reverb, or as BOTH at the same time. Eh, not the case. It's odd, because TO ME, it sounded like most of the UniVibe effect was mainly being heard through the reverb trails produced by the pedal and not on the main signal itself. Like the initial signal you heard was clean and plain, but the trailing reverb was the main thing being UniVibe'd. Just... weird. Anyway, not a good pedal in my opinion. Interesting, but nothing I'd ever have a use for. I don't imagine many people would prefer it.
I also tried one of those similarly priced TC Electronics Viscous Vibe pedals. It was okay, perhaps a little more flexible and rangey through the depth/intensity control than the MXR, but personally I preferred the way the MXR one sticks strictly to classic kinda sounds and is a little easier to tame and tweak.
I've been seeing people going goo-goo for these Earthquaker Devices - The Depths vibe pedals. Tried one of those out. It doesn't sound bad at all. But it has 5 different knobs on it, and I got kinda lost trying to find the sound I was going for. I used to LOVE "options" when it came to effects and shit. But these days, I find myself looking for simpler things. I want a UniVibe type of pedal that renders up a sound like Robin Trower and Jimi Hendrix... and it really need not do anything further than that.
Anyway, I know that Robin Trower himself currently uses a Fulltone DejaVibe. It's a pretty faithful recreation of the old UniVibe people used back in the day, and supposedly even more authentically UniVibe than any of the more recent MXR/Dunlop versions. So now I'm waiting on the longhaired hippies at Atlanta Guitar Center to give me a ring whenever the fuck they get in some more Fulltone Custom Shop Dejavibe units.
Quote from: |iR|Focalor on June 02, 2018, 07:59:01 PM
So now I'm waiting on the longhaired hippies at Atlanta Guitar Center to give me a ring whenever the fuck they get in some more Fulltone Custom Shop Dejavibe units.
As I suspected I wouldn't, I never got a call from the dudes at the Atlanta Guitar Center. I noticed on the Guitar Center website, they don't even have a listing for the plain DejaVibe units anymore, just the higher priced ones with the foot treadle to control speed. So I checked the Fulltone site, and apparently they're phasing out the usual DejaVibe in favor of a smaller and more compact design.
However, I did notice that the Marietta store had an older used one that just came up for $140 (as opposed to about $220 for a new one). So I rode all the way out there and grabbed it.
https://www.fulltone.com/products/mini-dejavibe
As I suspected, it's MUCH better sounding than the MXR UniVibes. You simply CANNOT beat pedals that use that old school incandescent light bulb and photocell technology. I dunno what it is about them, but the harmonic content of any modulation effects using that old bulb and photocell stuff is so rich and lively. Unfortunately, they wouldn't throw in a free power adapter for it, which was an extra 20 bucks. So... turns out I could've saved myself the trip all the way out there and bought another used one that would COME WITH a power cord from a store in Connecticut for probably the same price after shipping and handling.
Like the curious little child that I am, I cracked it open when I got it home just to check it's guts for any hidden issues. They ain't kidding, these things are hand-built. And the PC board that carries the components is like 1/2 the size of the entire enclosure, so with the newer smaller ones, apparently the only changes they've had to make to the units is simply a smaller box to put it in.
I used to think Boss pedals were the most bullet-proof and sturdy pedals out there. Lemme tell ya, these American-made Fulltone pedals ain't no fuckin' joke. This pedal weighs TWICE or THRICE as much as any Boss pedal. And 90% of the weight comes from the super thick folded steel housing. This thing is very obviously "used" judging from the removed rubber feet and velcro strips on the bottom to attach it to the previous owners pedalboard. But all the knobs still turn with a tightness like it's brand new. Fulltone doesn't use ANY cheap shitty parts on their pedals.
Something interesting I came across this morning.
https://www.youtube.com/v/PtkM69Gchww
A pretty unique flanger pedal. Knobs? FUCK 'EM! I thought the MXR Phase 90 pedals were kinda stupid and dated with just one knob for the speed, but I never thought I'd ever see a modulation pedal with NO knobs at all. And as far as this video makes it sound, it's actually pretty damned good. Kinda surprised by it. Then again, this guy has made LOTS of pedal demo videos and he's terrific at playing something that'll make any particular pedal sound it's best.
"Flange" got it's name from back in the old days when studios would run tape on reels. If you had 2 reels of tape playing the same thing at the same time, you could put a thumb on the end of the 2nd reels flange and slightly slow it down which would produce a wooshing sound. Since then, they've made units that use delay circuits to mimic that effect, and these units usually sweep the delay up and down at a constant rate via a rate/speed control. This pedal attempts to mimic the old-school method of reel-thumbing via a button that engages the delay to sweep up when its pressed and down when it's released.
It has a 2nd mode of what they call "through zero" flanging which is much more intense sounding. Again, the guy doing this video has a knack for playing things that make a pedal sound cool. But this mode sounds entirely useless to me. Theres no bass or drums he's playing against at that point in the video, so you maybe won't notice as much that the overall output volume is greatly effected to the point that in a live band setting, you probably wouldn't even hear the flanging effect, it would just sound like the guitars volume coming in and out of the mix.
Still cool and interesting. I'd like to see these people make an identical pedal with a rocker pedal output option to control the flange position either for more accurate control over the sweep or for using it as an EQ filter like a half-cocked wah pedal.
https://www.guitarcenter.com/Gibson/Les-Paul-Classic-Satin-Limited-Edition-Electric-Guitar.gc
Test drove one of these the other day. It's some kind of limited edition Les Paul, not even listed on the Gibson site, only produced in fairly limited numbers from what the guy at the store told me. What immediately attracted me to it was the satin finish rather than gloss. It's my personal opinion that guitars with thinner or non-existent top-coat finishes will always sound better and more natural. Just my opinion.
It's coming in two colors, a kind of dark blue to blue burst (kinda like the old Fender Strat Bonnie Raitt models from the 90s, always kinda liked that color), and a Tea Burst which is slightly darker around the edges than the similar looking Les Paul Tribute satin models.
I haven't been very impressed with Gibson guitars lately. The one I bought a couple years ago is okay I guess, but when I compare the fret finishing on it to that of cheaper Korean made Epiphone Les Pauls, it's pretty pathetic.
This particular one I picked up though, different story. Frets were EXCELLENT. Whoever set it up at the Gibson factory actually did their job for once. It played terrific, action was lower than I usually like it, but for some reason it was still buzz-free. I don't know, but I don't THINK I've ever played a Gibson with these newer "'57 Classic" pickups, and HOLY SHIT, they sound INCREDIBLE! I've always been a fan of the Gibson 490's and the Seymour Duncan Pearly Gates which are also old Les Paul type pickups. But these new Gibson 57 Classics might have em all beat. I am now SERIOUSLY considering swapping out these Burstbucker Pro pickups on mine for the 57's.
No pickguard on this model though. I know a lot of people hate pickguards on Les Pauls, but personally I like the looks of them. Being a "Classic" model, this one also has the nice big fat "Rounded '59" neck shape which I'm a fan of moreso than the usual 60s Slim Taper shape. Not sure about chambering/weight relief on this one. Seemed like it was pretty heavy.
They're asking $1,999 for these bitches though. Yeah, certainly cheaper than a new Les Paul Standard with a fancy top to it, but still too close in price to one... considering you're getting a plain jane top and barely any lacquer finish, so you'd think the price would be discounted a little more to reflect that. But alas... Gibson can charge virtually whatever the fuck they want and people (suckers) will still pay it.
HEY! WHO WANTS A PUSSY PINK TELECASTER MADE IN AMERICA...
scratch that... MADE IN MEXICO...
scratch that... MADE IN JAPAN.
They reissued this fugly damn thing at least once before back in 1995-ish, because I still have an old 1995-1996 Fender catalog and it's right there in the "Collectibles" section of guitars, which means it was most likely built in Japan back then as well. (I think the Squiers and non-American labelled guitars were coming out of a Fender factory in Japan back in the 90's, I don't think the Mexico factory running back then.)
Both the 96 and current reissue pink paisley Tele's are basswood bodies, not alder, definitely not ash. Has old style 3 barrel saddles on an ashtray bridge, but the saddles are probably cheap lightweight chrome plated zinc bullshit rather than brass.
Been looking around the Guitar Center site a bit today, and it seems the upwards climbing prices of things ISN'T STOPPING. Fender has some interesting new guitars with their Parallel Universe stuff, like a tele with humbuckers, mahog body and neck, maple top, tune-o-matic bridge and stopbar tail, big 70's stratocaster headstock (basically a Les Paul formula kinda guitar shaped like a Telecaster). They have a Tele format Jazzmaster, other shit, whatever they can do to get your money, ya know.
Anyway. This fuckin' paisley nightmare is tagged at $999. Worth it? Fuck no. Man, you gotta love pink fuckin' paisley A LOT to pay that for this pile of scrapwood... either that or just be kinda stupid... which I'm guessing a lot of guitar shoppers must be these days, otherwise these jackasses wouldn't keep charging more and more for these very mediocre guitars.
Fuckin' PRS is charging 8 grand for these guitars with the term "private reserve" attached to them. Like they're fuckin' wine or some shit. It's some wood and wires, get the fuck over yourself, Paul.
Sometimes guitars are overpriced to sell to douchebags with more money than good sense.
And then sometimes you get what you pay for.
I was at the Atlanta Guitar Center earlier today just killing time after a business thing I had in downtown Atlanta. I've seen this thing listed as one of their most expensive used guitars, and nothing really caught my attention about it other than the big fat price tag. But I didn't see shit else I wanted to try out, so I had the guy yank this one down off the wall for me.
https://www.guitarcenter.com/Used/Fender/2016-Wildwood-10-1957-Stratocaster-Relic-Solid-Body-Electric-Guitar.gc
Priced at 3 grand, and that's the USED price. It's a Fender custom shop Wildwood 10 1957 relic Stratocaster. I fuckin HATE "relic" guitars. It's a dumb as fuck fad, and I can't wait for it die and go the fuck away. So... the shitty artificially worn finish withstanding... THIS GUITAR IS THE FUCKIN' TITS! Big ole fat almost baseball bat neck that's been generously sanded down to the smooth woodgrain, noticably taller fret wire than you usually see on any particular production Fender Stratocaster, and I dunno what kinda pickup they put on this thing, but they sound every bit as good as the 4th Generation Noiseless pickups I have on my American Elite strat. Played and sounded FANTASTIC. I'm not familiar with Wildwood guitars, but apparently they get subcontracted by Fender Custom Shop to build a select number of guitars for them every year. God damn, these guys are GOOD. I've played several high-dollar Mario Martin and Nash Guitars classic strat copies that were custom builds, and this thing beats every Mario Martin, Nash, K-line and Suhr classic strat copy I've ever tried.
Seriously though. If you ever see anything with the name "Wildwood" on it, give it a whirl. It'll make you become disappointed in whatever guitar you currently play.
« Last Edit: August 24, 2018, 02:26:30 PM by |iR|Focalor »
Actually, I guess I got that wrong. Upon some internets browsing, it appears as though Wildwood doesn't MAKE guitars, they're just a big fancy guitar shop somewheres in Colorado. And apparently Fender makes them a few extra-special custom shop guitars every year. And apparently that particular strat body is made from a extra-super-primo-choice cut of ash, which I dunno how they grade that exactly, but I do remember how remarkably and usually lightweight it was even for an ash body. But the "10" in the name I guess refers to the fact that the guitar would be rated a solid "10" on a scale of 1 to 10... which I totally concur with, that fucking thing sounded and played like a dream.
Anyway, I was browsing around the Music-Go-Round national website and spotted this insane thing.
It's a Paul Reed Smith Custom 22 10-top. So... I'm not really a big fan of PRS guitars. They sound good, sure. They look pretty, sure. But they tend to look a little too fancy for my taste. If I was rich as shit and could afford to collect them and hang them on the wall and never play them, maybe I'd buy one or two. But I wanna PLAY the shit I buy, not win a beauty contest with it. And most regular PRS's have really nice flame and quilt maple figuring on the tops. But then they have several graduated ranges of their guitars, one of them being the "Private Reserve" label ones I've shit-talked on here before. But somewhere just below those, they have the "10 Top" models, which are kinda like the Gibson Les Paul premium plus top models, which I think have AAA or AAAA grade flamed maple tops to them. But some of these fuckin' PRS 10 Top models... are just ri-goddamned-diculous with how highly figured the maple tops are. Like... THIS ONE for example.
That odd curvature to the figuring around the tailpiece... I kind like how unusual it looks, but if I were shopping for a PRS guitar from the 10 Top collection, I'd probably prefer the figuring to be uniformly straight over the whole top. Nevertheless, they're asking $1,200 for this guitar, which is REALLY damn good for what it is. Not sure why the fretboard has dot inlays rather than the typical PRS birds. But they have other pics detailing the AWFUL refretting job someone did on it at some point. Look at THIS bullshit. Whoever did this... SHOULDN'T have... and shouldn't ever try such a thing again. They chewed the ends of the frets off with a file without polishing anything smooth, and it looks like the file probably bit into parts of the fretboard edge as they worked. If you're gonna level, file, and polish frets, they make these semi-flexible metal guards that expose the fret and cover the fretboard to PREVENT you from fucking up like that.
So yeah, totally worth EVEN LESS than 1200 bucks after that.
Closer view:
If you're one of the many guitar player people persons who've ever watched these pretty popular "Captain and Chappers" videos that the guy who owns Andertons Music in the UK always puts out with his buddy, then maybe you've heard of his new line of Chapman brand guitars.
When you look at the specs of these guitars,... and the prices,... you might be like me and go, "Yes! Finally! Someone gets it! There's a basic formula for certain guitars, and you CAN make one that is a quality instrument at a reasonable price."
And it seems like when they first launched and started showing up in stores, people were saying, "Yeah, these are decent guitars." But then... something must've happened. Because I've seen a few of them in stores now, and MY GAWD, what an utter piece of shit ALL of them have been. Boogared up clear coats with drip lines, THE WORST fret finishing I've ever seen on any guitar, and the cheapest shittiest noisiest fucking volume and tone knobs they could find.
UTTER GARBAGE. Overpriced firewood is all it is.
Punk_FAS
Swanky Member
I've finally decided to put in real effort to learn how to play guitar. I've taken some lessons locally, and am following a series of Youtube videos to get me started (justinguitar.com).
Here's the guitar I bought 5 years ago. Only plugged it in for the first time about a month ago.
https://www.musiciansfriend.com/guitars/schecter-guitar-research-c-1-blood-moon-electric-guitar
I got it brand new from Best Buy in late 2013 for around $187 after a few discounts. Apparently it originally retailed somewhere around $800? I'm planning on getting it "set up" at a local shop tomorrow.
With a few cheap little tools, you could easily learn how to do setups on that guitar yourself. I'd highly recommend learning that too. It's not hard, and most places are gonna charge you 25 or 50 bucks to do it in addition to the price of new strings, so you save considerable money over time... unless you just NEVER do a proper setup on it, slap some strings on it, and go... which I did to my guitars for many years, lol. But seriously, it's good to learn how to do it. It gives you a better understanding of how string height affects the sound on that particular guitar, and gives you a better overall "awareness" about your playing.
And with that particular guitar, it's pretty simple. It's a 25.5 inch scale length, which roughly is the measurement from the nut to the bridge saddles. So when you start setting up a guitar, you'll wanna measure from the nut to the center of the 12th fret. In your case, that's gonna be 12 and 3/4 inches. So on the high E string you wanna start at the 12th fret and measure 12 and 3/4 inches to the saddle. Set the 3rd string saddle at the same distance from the 12th fret as well. And... I was gonna keep talking, but when I read what I typed, I realized how fucking confusing and stupid I sound, so instead, I'll just post a video that'll tell you pretty much everything you need to know about doing a setup.
And this guys using a Gibson Les Paul Studio to do a setup. A Les Paul is a 24.75 scale length guitar (yours is 25.5, remember) But the basics are the same. When he starts the setup, he measures from the nut to the 12th fret. Whatever that is, is what you measure from the 12th fret to the saddle for a rough intonation.
https://www.youtube.com/v/KYO23rGO_7M
Once you get a "rough intonation", you can begin giving it a FULL intonation to make sure all the strings play perfectly in pitch all the way up the neck. For that... DEFINITELY get a digital tuner. Some of the better ones can even be set to tune down from standard tuning in half steps down as far as 3 full steps. It'll probably cost you about 50 to 80 bucks for a good one, but it's WAAAAAAY better than using some stupid pitch pipe thing or comparing the sound to a CD lesson book recording. I think a company called Snark also makes cheaper 15 dollar ones that clip onto your headstock, but I dunno if they can tune down at all. Mines a... one of these.
https://www.guitarcenter.com/Korg/GA-1-Guitar-and-Bass-Tuner.gc
Hmm, says 17.99. I think I paid about 40 for it a couple years ago. Must be discontinued and on clearance, says "in store only". It's good because it can tune guitar OR bass, and I have both. It can tune by the little onboard mic, but when I'm setting up, I always use the instrument cable jack input on the tuner to be as accurate as possible.
Great thing about your guitar is the bridge. It's the best thing for a beginner in my opinion. You could start out on a guitar with a tremolo bridge like on a Fender Strat or a double locking tremolo bridge like whats on a Ibanez RG or something, but it might only serve to confuse and frustrate you as a beginner. With a tune-o-matic style bridge, life is easy... you can tune up and still get a screwdriver in there to adjust the saddle positions, bada bing no problems. On some tremolo bridges, particularly many of the double locking designs (theres LOTS of variations), it's literally IMPOSSIBLE to adjust the saddle positions while a string is on it. That's why I fucking ABHOR setting up double locking tremolos. It can take as long as ALL DAY sometimes, LITERALLY. Once you get them balanced and tuned and working right, they're great. You can do all kinds of crazy things like EVH and Dimebag were famous for, shit you can only do with that kind of tremolo system. Last time I set up my Ibanez Joe Satriani signature, I spent EIGHT FUCKING HOURS adjusting on it before I finally got it balanced out perfectly.
« Last Edit: October 26, 2018, 03:24:38 PM by |iR|Focalor »
(List of Rates | 1 Post Total)
Pages: 1 2 3 4 5 6 [7] 8 Go Up
El Box de Shoutamente
Last 10 Shouts:
QwazyWabbit
Might this be it?
http://www.tastyspleen.net/userpages.html
The Dreaming Dragon
How do you get to the personal webpages that this site hosts? I need to find mine.
Rectum! Damn near killed em! hahahahahaha
Whose Franlkin? Players aliasing this day in age. haha
quadz
More detailed look at Q2 RTX
https://www.youtube.com/watch?v=r9vXz9-C-AY
DOOM Eternal trailer
https://www.youtube.com/watch?v=dS-ti6XjT4A
[BTF]Defiant!
Good video overview Quadz!
Reasonably informative Q2 Ray Tracing video:
https://www.youtube.com/watch?v=sFhc951RhfI
I don't have the golden ticket.
Yes, if you're fortunate to have one of the new RTX video cards. (I don't, so I'm watching people stream raytraced Q2 on twitch instead.)
Show 50 latest
Nocturno by, Crip
|
cc/2019-30/en_middle_0059.json.gz/line172
|
__label__wiki
| 0.623137
| 0.623137
|
Board index » Frank Zappa » Zappa Albums
Live In New York
Post subject: Live In New York
Saw something about a new release of Live in New York coming up. Anyone have more info?
Thinman
Post subject: Re: Live In New York
This by now: https://www.recordstore.co.uk/search.html?term=frank+zappa+new+york&utm_campaign=recordstorecoukWeek51Weekly2112211218&utm_content=UMGUK12939-586566&utm_medium=Email&utm_source=Email
(from someone at Zappateers)
Looks like a great release. In New York is one of my favorites. Having disc one in the original format (post Punky’s deletion, that is) then all the extras should be a real fun listen.
tinkamok
Location: Plymouth England
Looks great , if a bit pricey .
https://www.recordstore.co.uk/recordsto ... 0UE0E3I000
Link via the amazing Idiot Bastard son
http://www.idiotbastard.com/news.htm
"no one looks good with brown lipstick on"
Still nothing on Zappa.com news page .
Still no notification from Zappa.com zmail .
The Idiot Bastard
tinkamok wrote:
While that's not too surprising, there was this on the official FZ Facebook & Instagram pages yesterday:
"78 is a special number. 'Zappa In New York' was released in 1978 and today would have been FZ’s 78th birthday!
To celebrate the 40th Anniversary of the release of "Zappa In New York," we have something special planned for you that we will announce for pre-order in the New Year.
Additionally, tickets for The Bizarre World Of Frank Zappa will go on sale in January!
HAPPY 78TH BIRTHDAY, FRANK!"
Out now: FZ88 - A Visual Documentary of Zappa’s Last Tour
http://www.wymeruk.co.uk/webshop/books/ ... appa/fz88/
The Idiot Bastard wrote:
Thanks IB !
The 5CD set is available in limited quantity’s and will come packaged in an embossed tin box (18cm x 2.5cm) that resembles a New York City manhole cover and contains a 60 page book.
Recorded live in New York City at the end of 1976. Heavy on, well, “freewheeling” lyrical content, with “Titties & Beer” and “The Illinois Enema Bandit” (the latter featuring “sophisticated narration” by Don Pardo) being special favorites with young males of a certain age. Also here is the song that gets most peoples’ vote for the best title ever to grace a Zappa instrumental, “I Promise Not to Come In Your Mouth.”
When Zappa first released this album in ’78, Warner Brothers was especially nervous about a little tune called “Punky’s Whips.” The tune concerned drummer Terry Bozzio’s lurid sexual fantasies about one Punky Meadows, guitarist for the band Angel. Since Angel was then regarded as an important player in the music industry (yeah, right), Warners sat on the album for a long while and then deleted the track altogether. With this CD reissue “Punky’s Whips” is back in all its glory, along with four other songs not on the original vinyl.
Manhole cover for the top
cannot wait
jk666
Take my money.
OK , Pre-ordered !
downer mydnyte
It's a real shame Punky didn't come out on the original album. It bothers me that there was a time when this album was available without Punky's Whips on it. That song was the best thing that ever happened to Angel. There are people who own an Angel album just because of PW. Not me, of course.
downer mydnyte wrote:
isn't that it there beside your copy of Good Singin', Good Playin'?
Yeah, this is going to be tough to stretch my budget to. Unless there are songs from around those years not on any of my concert (official) CDs, I really do not need all 5. I am still going through the Roxy discs one by one.
Tero wrote:
i have a feeling that the price will go down a lot when they put it up on zappa store
There are people who own an Angel album just because of PW. Not me, of course.
And Frampton Comes Alive.
ha ha, right on!
Way back in my e bay addiction days I ordered a Weasels Ripped My Flesh LP (with the doll in the mouse trap cover) from a very nice man in Germany, and he used a copy of Good Singin', Good Playin' and around fifty newspaper articles about FZ as packing!
To date still my only Grand Funk Railroad album
PS and of course, as some of us do, I have a photo of Punky Meadows with a beautiful shiny hairdo in a semi-profile which emphasizes the pootched out succulence of his insolent, pouting, rictus.....
I wonder how many Zappa fans have that Shaggs album in their collection?
[I wonder how many Zappa fans have that Shaggs album in their collection?
If anyone else finds another outlet selling this album, please post. They want $36 just to ship the cds, then if I add the vinyl its over $55 in shipping. No thanx.
it should be for preorder on here soon
im guessing itll be around 60 to 79 bucks
I have Shaggy Hot Shots, that's a go to party album...
The Shaggs were three teenage sisters that made an album in the late ‘60’s called “Philosophy of the World”. They couldn’t really play their instruments but there was a certain amateurish charm about them. Zappa claimed to love the album and said that they were better than The Beatles.
https://www.youtube.com/watch?v=hxPsXPCR5MU
https://www.youtube.com/watch?v=XR9d4ESlpHY
|
cc/2019-30/en_middle_0059.json.gz/line173
|
__label__wiki
| 0.56621
| 0.56621
|
» Gio & Yasha piece on AnimeNewsNetwork
Gio & Yasha piece on AnimeNewsNetwork
Holy crap you guys!
http://www.animenewsnetwork.com/feature … ns/.112267
HonorableShadow
Thorn of Death
From: Ohio
Re: Gio & Yasha piece on AnimeNewsNetwork
I read that earlier this morning! Really cool article.
I'll show you a sight you've never seen before.
Imaginary Bad Bug
From: Connecticut, USA
Crawling out of my hibernation on these forums to congratulate Gio and Yasha on keeping the pop tart burning for all these years! I remember some of those front page layouts, too! I don't read ANN anymore, but for your piece, I made an exception. Thanks for posting it, purplepolecat!
crystalwren
Dark Whisperer
From: Brisbane
Wow! How cool is this?!
Ends of the Fandom
From: Edmonton, AB
Well hell! I went to post this on the forum as a shameless plug and it's already here, haha. I love you guys.
It was really flattering to be asked to write an article with Yasha for a site that's been a staple in the anime community since before I joined it. Literally my entire adult life has had SKU in it, and I sometimes forget that I've kinda stuck myself in the world with it. (And that anyone cared to notice!) I'm not a creative person by nature, I only ever flirted with other websites, and I'm generally not a superfan kind of geek. I don't even have another fandom I follow. (I briefly dabbled in the Star Trek subreddit but holy crap what a toxic place to have a vagina.) I'm not a huge social beast either! This site, this forum, and the longevity of both are flukes for me, born out of a love for the material and the fanbase it draws. Many of my best memories involve SKU, of how it felt to watch the first time on very overcopied fansubs, with horrible image quality like I was watching the snowy porn channel feeds at hotels without paying for them. This forum, RoseCons, and the friends I've made here. The whole waifu thing. It's suffused and colored the experience of my life in such major and minor ways I can't even begin to wonder how my life would look without it.
I no longer sit and contemplate it all day, and it's been a while since I watched an episode from beginning to end. And yet every day, at some point, I'll make a passing gag about it, or think something like, 'Ugh that's such a Touga thing to say.' when someone's spouting BS. It's really quite ridiculous.
We went for something a little less immature and wanky as this post, haha. I'm kinda shocked how fast people found it, or at least figured it'd get breezed over and not really noted given the psychotic amount of content that goes up on ANN. (Which is only a couple years older than this site, though I felt when I first started watching anime like it'd been there at the dawn of time...) So yeah.
PS ack they added a shot of LLOM and I noticed an aligning error in the images OMRFGHKJWERGFJSNDKVGI
Akio, you have nice turns of phrase, but your points aren't clear and you have no textual support. I can't give this a passing grade.
~ Professor Arisa Konno, Eng 1001 (Freshman Literature and Composition)
Aelanie
Congrats on the article, it was truly excellent. A perfect overview and retrospective on Utena and how its fandom has changed over the years. Like Bad Bug, I don't bother with ANN much anymore. I used to visit regularly, until I realized that a lot of the site's content is middle-aged men complaining that anime isn't as manly as it used to be. Imagine my surprise when I trip over the tab I still keep open of it and find that article. Anyway, good work, and thank you for your insights.
Last edited by Aelanie (02-16-2017 12:00:25 AM)
SaigonAlice
Tenjou Tilter
Aelanie wrote:
I used to visit regularly, until I realized that a lot of the site's content is middle-aged men complaining that anime isn't as manly as it used to be.
...Please elaborate.
Anyway that was a really neat article - we do need to stress the importance of having discussions with people of common interest.
Thân em nhÆ° quả mÃt trên cây,
V� nó sù sì, múi nó dà y.
Quân tỠcó yêu thì đóng c�c,
Xin đừng mân mó nhựa ra tay. - Hồ Xuân Hương
I'd rather not, as this isn't the place for it. I will say that several prominent members of the editorial staff are vocal about their preference for the rougher, edgier pre-millenial anime they were raised on - and for condemning anything with too much moe as garbage, especially in their seasonal "preview guides". I remember in particular how Madoka Magica was described initially as "cutesy-poo" tripe and dismissed, only for the tune to change later once Madoka's dark themes were made blatant. The situation is the same a lot of times on the ANNCast, with endless repetitive grumbling about how terrible anime is today and how much better it was in the Gundam/Cowboy Bebop/Evangelion past.
If that's not your perception that's fine, but it is mine.
Common interest, and different opinion. The unpopular opinions thread is proof of that.
As for ANN, it doesn't seem all the different than I remember it being years ago, just a lot larger in scale and better coded...but then, that's true of all of us old timers. I've got mad respect at this point for anyone who has stuck to their guns this long, although being a staffed or larger operation no doubt helps. It's honestly bothered me a lot the last couple years how few websites there are compared to when we started. Which isn't to say that social media isn't awesome and hasn't totally changed the landscape, but there was a creativity necessary in building from scratch that I think we miss out on a lot now, as we become more and more beholden to the format of the site we use to present our content.
It kind of makes me laugh to think EM has some sort of high status in the fandom, or any status at all, given that outside practical resources and the analysis section, the content is pretty militantly shit at being representative of the fanbase. There's an Akio shrine, and for two married women, Yasha and I suck at feeling like Utena and or Anthy relate to us at all. I've learned to accept that despite being a 'superfan' (don't worry it isn't going to my head!) I'm on the whole a terrible flagbearer for the community at large, and always have been. I wonder if the fandom at large wouldn't have preferred Empty Movement be run by an Utena fan, or a Juri fan, when statistically the odds favored them.
Aelanie, I have to admit I'm one of those crabby asshole people that misses the good old days so you just described me, haha.
Don't mistake me, I'm also of that same generation, and I actually agree that - in some ways - anime today can be too unambitious, too commercial, and so on. But that is far from being the whole story about how anime has changed over the years, and in any case, you and I don't spend time and effort endlessly repackaging those parade-raining feelings into monetized "content".
As for Utena and Anthy representing you, it's not as though they can carry the torch for all women-loving women. My best friend, also a lesbian, doesn't even like Utena (the franchise) at all, though she has watched it with me and has been familiar with it for many years. For her, the primeval yuri couple to which she eternally returns is Chikane and Himeko from Kannazuki no Miko. For many other women, it's Haruka and Michiru in Sailor Moon. Everybody has the characters that speak to them most.
Your disregard of Juri is heresy though.
Fair enough! I think a lot of the difference isn't so much that the amount or value of content changed, but that there are no gatekeepers now. An anime had to really inspire to get someone to manually fansub it in the 90s, and few came across the border without first being vetted in that way. We see all of it now, without devotion or word of mouth to propel it.
I didn't mean to say Utena and Anthy should be carrying that torch, sorry. I meant it more in the sense of it being ironic that though they carry the torch for many, they don't carry it for us, when arguably it would make a lot of sense for a married couple prominent in the fandom to feel that way. But Yasha and I have always sucked really hard at this stuff, and frankly have never consistently gotten along with the LGBTQ community. That might be why frankly I've never felt any allegiance at all to any yuri/lesbian pairing anywhere, and find Juri so...well you know.
Really, if any pairing 'speaks' to us, it's probably Touga and Saionji. And we got married.
....but was that really such a good idea?
We need more statistical abnormalities and just plain weirdoes like you Gio. Otherwise the fandom isn't any fun.
And goodness knows that RGU itself isn't normal.
Last edited by SaigonAlice (02-16-2017 01:59:39 AM)
Giovanna wrote:
That might be why frankly I've never felt any allegiance at all to any yuri/lesbian pairing anywhere, and find Juri so...well you know.
Really, if any pairing 'speaks' to us, it's probably Touga and Saionji.
You're not alone. There are in fact a significant number of lesbian women who identify strongly with yaoi, due to it being less concerned with stereotypical female gender role/presentation depictions, and in fact some are known yaoi manga artists. My best friend is also a fan of yaoi as well, though yuri is still her chief interest.
The real issue, of course, is that you simply haven't consumed enough yuri yet. Please report to this thread for re-education.
That, and also I think they suffer from a bit of internalised homophobia (Hear me out).
Lesbian yaoi fans, or "Yaoisbians" for short, want to see gay representation but they don't want to see themselves in it per say. They wanna see gay characters being overtly gay and in love, but don't want to face their own gayness (which itself they find abhorrent).
I say this because as a Gay guy I gravitate to f/f ships but not so much m/m ships since I might identify with them too much. I see myself in their shoes doing the same stupid mistakes as a gay guy that I did (E.g. falling for a straight guy). I want representation and be able to relate to characters on things, but in a controlled way. Not in a way that it's so eerily similar to my life and the times I've really effed it up.
I really hope I'm not projecting or anything and apologises in advance if this doesn't makes senes....Lol.
EDIT: Also I think it should be pointed out that Japanese gay men (and I suppose mainstream macho gay culture) aren't very interested in yaoi...at all. They tend to gravitate to Bara.
And hey, while we're on the topic of alternative but strangely popular outlets for LGBT, aside from the established mainstream, then I've heard that the furry community is one such outlet. Here's a little essay on the matter: http://spacetwinks.tumblr.com/post/1392 … -in-a-mean
malna
lol Kashira, kashira...
Cool article! Congrats. I am so glad to be a teeny-tiny part of IRG forum myself. I wouldn't be able to put my finger on it but I do feel that, despite all differences, there is something unique and specific about people that loiter around here. Something that makes me feel comfortable and at ease, and that's rare for me.
a lot of hope in one man tent
Not to sound sycophantic, but this forum is honestly great! Having a more practical site as a base for a fandom allows for a greater range of options for others to expand on, and play with. Sort of a neutral zone if you would, even if explaining it might get a bit more complicated and show off some contradictions. It's acted as a hub for a bunch of great things, like several translation projects, a ton of great analytical threads, and not to mention the wealth of info you guys managed to gather on the main site.
And this is coming from one of those "danged kids" themselves. Tumblr has the benefit of having live-reactions in a mesh of information which does help with getting a overview of a zeitgeist, but it does end up getting a bit... clique-y at times. Ever since I was little, I've never really gotten comfortable enough to engage deeply within fandom other than being an observer, even when I was obsessed with something. Even if this wasn't the first series-specfic forum I've been a part of, I'm proud to say it's been a blast to be a part of. And honestly, I lean more towards being a Nanami fan myself if anything if it makes you feel a bit better.
So in conclusion, congrats on the article! Here's to another twenty plus years!
From: collective human consciousness
I'd rather not, as this isn't the place for it. I will say that several prominent members of the editorial staff are vocal about their preference for the rougher, edgier pre-millenial anime they were raised on - and for condemning anything with too much moe as garbage, especially in their seasonal "preview guides".
I mean, is moe the right word to use here? Because when I think moe I don't think feminine, I think the fetishization of innocence by......... middle-aged men. Sailor Moon isn't moe, but it's "girly"; K-On and Love Live! are moe.
im a shadow play girl irl
What is and is not moe, and exactly what that term means, is a perennial and heated debate, so I won't get into that here. But I use it in the sense of "characters being presented in a way that makes them endearing to the audience". Sailor Moon certainly has moe elements in its moments where the characters are explored and their personalities come out in ways that make us like the characters more, care about them more. This does not have to include fetishization , nor are "middle-aged men" the only ones who enjoy likable and cute characters, needless to say. You are using the term in a more narrow and stereotypical sense than I am.
Zac Bertschy, the executive editor of ANN, recently married his long time partner and co-worker Jacob, a trans man who came out about a year ago. Both of them are big SKU fans and talk it up at every opportunity. (I'm not saying these things are connected, but it's interesting.)
I don't agree with all the opinions expressed on ANN, but their coverage of the new anime streaming firehose is a very useful resource.
lesbian women
But I'm bisexual! The degree to which that changes everything about how I engage or don't with LGBTQ content can't be overstated. Also I don't read Touga and Saionji as a yaoi pairing. Honestly, my interpretation of the show confirms three LGBTQ relationships explicitly: Akio/Touga, Mikage/Mamiya, and Juri/Her Crushed Dreams. Juri's solitude is used to safely dodge having to actually depict the relationship, and the other two are...not very flattering endorsements of male sexuality there, Ikuhara.
I'll likely regret saying this, and I hope it's evident that I don't mean to be insulting...but I personally just can't do yuri. Or yaoi. I've never been motivated to engage in a piece of media primarily because of the LGBTQ status of its characters, and yuri and yaoi presence has never made me care more about a story. Maybe because I'm bisexual, but I often find yuri and yaoi represent me a lot less than most straight representations of relationships and sex do, in part because I'm being told it represents me and I feel like that robs me of agency in the matter. I've asked myself if this is internalized homophobic behavior, as I agree with Saigon that it certainly can be... but I don't think so. I don't seem to have any reaction, positive or negative, to lesbian or homosexual depictions that I don't have equally to heterosexual ones. I don't seem to really care.
I did look at the thread though! I honestly haven't seen more than a few episodes of any one of these, my biggest effort being biting into Simoun. It's terrible to judge based on something you didn't finish, but there it is--they felt very manipulative on the point that they're yuri, which is the goal obviously, but as a genre that wasn't engaging me long enough to see them pass through their reliance on that. The same thing keeps me away from most mecha anime, in that mecha being present doesn't establish a baseline interest, so it's nothing against yuri that I don't hold against several other genres of things. But unless I missed them, Rose of Versailles and Brother, Dear Brother aren't there? Are they not considered yuri anime? Because those were going to be my counter-argument to my own very pigheaded asshole-sounding opinion here.
I'm pretty sure as a rule you and I have totally opposing interests in everything outside SKU, though. Your description of Shitsurakuen in the thread piqued my interest when uh, you plainly meant the description to be a deterrent. Fucked up depictions of unhealthy sexuality and gender dynamics? If that's a genre, it's definitely my favorite. But that thing sounds like an insulting or amazing degree of SKU ripoff...
malna wrote:
I wouldn't be able to put my finger on it but I do feel that, despite all differences, there is something unique and specific about people that loiter around here. Something that makes me feel comfortable and at ease, and that's rare for me.
I think some of it is that a lot of us have been here long enough to have gotten into all the SKU arguments? It's like a huge messed up mass marriage. Also forums are a very different format for social media, in that they often depart quickly from the idea of an original poster and don't encourage brevity. You can be as verbose as you like and will probably be rewarded for it!
zeedikay wrote:
Tumblr has the benefit of having live-reactions in a mesh of information which does help with getting a overview of a zeitgeist, but it does end up getting a bit... clique-y at times.
That's definitely a big factor. The forum is frankly a smaller population too, so there's an intimacy in play and probably not enough critical mass for cliques, per say. Although there were once! It was broken down more into character preference, though...Tumblr seems to break down cliques based on degrees and forms of social justice interpretations of the story.
And honestly, I lean more towards being a Nanami fan myself if anything if it makes you feel a bit better.
what Nanami owns! Every subsequent viewing makes me like her more and more. She's a deeply flawed fool of a girl with insight dangerous enough that she tries to bury it. I can relate to wanting blur your own vision to prevent having to deal with what you see. Like her brother, she's insightful enough to direct others to do her bidding, but the ease with which this happens is kind of disappointing in and of itself. She won't stand to lose her goon squad, but there's definitely a part of her that's isolated by her intelligence and resents even her 'friends' for that.
Sailor Moon certainly has moe elements in its moments where the characters are explored and their personalities come out in ways that make us like the characters more, care about them more.
Is that not just "characterization"?
When I think of two-decade-old anime I don't think of masculinity at all, I think of stuff like Perfect Blue, Lain and of course Utena. Stuff that represented femininity as psychological.
There may be a lot of shows with cute girls in them now, but all those girls care about is performance, and that leads down a dark road in Japan.
With regard to Simoun...listen. The concept that "you have to finish it to really understand/appreciate it" is overapplied on a lot of media. In many cases, and very often with anime, that is not the case. I don't make a habit of saying that about anything.
But Simoun is such a case. Simoun, more than possibly any anime I've ever seen, is a carefully plotted build-up to the release of its full power and meaning in the finale. Everything that happens, everything that the characters feel and experience, leads into the final episode, "Kanojo-tachi no Shouzou", The Portrait of Those Girls.
And you will find what you are looking for in Simoun. It is rife with characters struggling with uncomfortable relationships and their gender identities. I dearly hope one day you will see it through.
(You will not find what you are looking for, or anything of value whatsoever, in Shitsurakuen. Please don't mistake my description as implying it has any form of depth, complexity or nuance. It is pure garbage with no self-awareness about what it is presenting, and presenting badly at that. Nevermind the content, even the narrative mechanics of the manga are horrendous. It is, simply, a thing that should never have existed.)
Anyway, it sounds like a standard case of Hype Aversion. As a contrarian, I also suffer from this. The assertions that "this is amazing, it'll totally speak to you/you'll relate to it/etc." create a negative feeling that causes us to be less inclined to partake of that thing. But I will also be the first to admit, that sometimes this can cause you to miss out on stuff that really is great and enjoyable. The only way to really know is just to dive in.
Rose of Versailles I do not call yuri, though certainly an important and influential precursor. Onii-sama e is...a complicated and mixed-results work that is its own unique thing, one that I would be hesitant to recommend to anyone without intimate knowledge of their preferences.
Last edited by Aelanie (02-16-2017 06:45:13 PM)
Yeah RoV not being considered yuri makes sense. And now that you mention it I wouldn't suggest BDB to anyone either unless I knew them well. It's like old anime lesbian Downton Abbey in like, a bad way?? But Ikuhara's assertion that it wasn't an influence on SKU is horseshit of the first degree. As for Simoun, maybe, someday, I'll try it again.
I know what you mean about contrarianism. I long punished Touga for his fanbase, and I think the critical mass that made me stop watching anime was an exhaustion with trying to keep up with recommendations that were primarily genre-based without knowing me very well. I asked Yasha about this just now and we finally narrowed it down to the last on-target recommendation of anything to me was the anime Colorful and the game Bayonetta. So I think my friends just never suggest stuff, haha.
So I uh, looked up that manga. Dear sweet lord in heaven is it a distillation of pure shit and terrible ripping off. It's glorious and I'm kind of wanting to do a let's read or something? Is this what it feels like when people enjoy The Rocky Horror Picture Show???
Aelanie's only giving you a nudge but honestly, you do you. There's no right or wrong way to be LGBT, so long as you're not hurting anyone in the process.
And yknow, to be perfectly fair with you, yaoi and yuri are awful outlets for LGBT. Maybe once upon a time they made for good representation, like the classics Aelanie mentioned, but nowadays they're...how should I put it...gratuitous and fetishistic? They're written for the horny heterosexual gaze in mind.
Which is why I consider shows like Yuri!!! on Ice which feature healthy M/M relationships as not being yaoi, really, since it's so divorced from the usual yaoi tropes.
purplepolecat wrote:
D'awwww
I admit, ANN was kind of just there for me. It existed as a place for general Anime discussion but didn't catch me as the place where better and more in depth discussions could be found. It was your typical casual anime fan hangout. I could be wrong though.
Last edited by SaigonAlice (02-16-2017 07:25:07 PM)
Actually no, you are not being fair, or informed, at all. You frankly don't know anything about the yuri genre as a whole if you think that. The genesis of yuri was in female-aimed anime and manga, and the demographic readership of yuri in Japan remains primarily female. There are many female manga artists, some of them out lesbians or bisexuals themselves, who produce excellent and tasteful works of female/female romance, some of which I recommend in that thread I linked earlier. Fetishistic works exist, but so does plenty of substance. The genre is not one or another, it is both: an ever-widening and deepening corpus of work with different types of stories for different types of audiences looking for different things, and it is possible to enjoy a spectrum of such works without falling into people's glibly rehashed fan stereotypes. I personally enjoy both thoughtful, well-written romance and cheerfully unambitious erotica at times, and I - and my best friend - are far from being "horny heterosexuals".
It's glorious and I'm kind of wanting to do a let's read or something?
Please don't. The intentional infliction of that manga upon pristine human minds is something that I could only consider an atrocity.
|
cc/2019-30/en_middle_0059.json.gz/line174
|
__label__cc
| 0.520307
| 0.479693
|
Videos uploaded by user “Super Simple Songs - Kids Songs”
We Wish You A Merry Christmas | Super Simple Songs
This is the Super Simple version of the classic Christmas carol, "We Wish You A Merry Christmas" with an action verb twist. Now available on the Super Simple Songs - Christmas DVD: http://bit.ly/SuperSimpleSongsChristm... Get the song: iTunes: http://bit.ly/SuperSimpleSongsChristm... Amazon: http://bit.ly/SuperSimpleSongsChristm... ****** Music: Traditional Adapted Lyrics: Copyright 2009 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** Thank you very much for watching and sharing. We upload new videos every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, Books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: We wish you a Merry Christmas. We wish you a Merry Christmas. We wish you a Merry Christmas and a Happy New Year. Happy holidays to you, your family, your friends. Happy holidays, Merry Christmas, and a Happy New Year. Let's clap. We all do a little clapping. We all do a little clapping. We all do a little clapping. Christmas is here. Let's jump. We all do a little jumping. We all do a little jumping. We all do a little jumping. Christmas is here. Let's stomp. We all do a little stomping. We all do a little stomping. We all do a little stomping. Christmas is here. Shhh...let's whisper. We all do a little whispering. We all do a little whispering. We all do a little whispering. Christmas is here. Big voices! We wish you a Merry Christmas. We wish you a Merry Christmas. We wish you a Merry Christmas and a Happy New Year. ***** Song: We Wish You A Merry Christmas CD: Super Simple Songs - Christmas Music: Super Simple Learning Vocals: Josh Lomonaco, Shelly Lomonaco, Leah Frederick ***** We're Super Social, too! facebook: http://facebook.com/supersimpleofficial twitter: http://twitter.com/simplesongs pinterest: http://pinterest.com/simplesongs instagram: http://instagram.com/supersimpleofficial blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** We Wish You A Merry Christmas by Super Simple Learning
Views: 8198732 Super Simple Songs - Kids Songs
Skidamarink (Animated Version) | Super Simple Songs
Sweet and just a little bit silly, "Skidamarink" is the perfect kids song to say, "I love you!" We hope you enjoy our new animated version of this Valentine's Day favorite. Get the song: iTunes: http://bit.ly/Skidamarink_iTunes Amazon: http://bit.ly/SuperSimpleSongs3_Amazon Video: Not currently available on DVD ****** Music & Lyrics: Traditional Video: Copyright 2015 Super Simple Learning® ****** Thank you very much for watching and sharing. We upload new videos often! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, Books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Skidamarink a dink a dink. Skidamarink a doo. I love you. Skidamarink a dink a dink. Skidamarink a doo. I love you. I love you in the morning. And in the afternoon. I love you in the evening. And underneath the moon. Skidamarink a dink a dink. Skidamarink a doo. I love you. (Repeat) ***** Song: Skidamarink CD: Super Simple Songs 3 Music: Super Simple Learning Vocals: Ingrid DuMosch DeHaan and Matt Stamm ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Skidamarink by Super Simple Learning
Views: 36419918 Super Simple Songs - Kids Songs
Walking, Walking - Teaching Tips
Walking Walking is a simple action verb song that kids will ask for again and again. Hop over to http://supersimplelearning.com/songs/... for lyrics, gestures, activity ideas, and more Walking Walking videos. Buy the song on Amazon: http://www.amazon.com/gp/product/B00J... or iTunes: https://itunes.apple.com/us/album/sup... "Where can I get that carpet?" Lakeshore Learning: http://bit.ly/ay9AOw Lyrics: ♫ Walking walking. Walking walking. Hop hop hop. Hop hop hop. Running running running. Running running running. Now let's stop. Now let's stop. Walking walking. Walking walking. Hop hop hop. Hop hop hop. Running running running. Running running running. Now let's stop. Now let's stop. Tiptoe tiptoe. Tiptoe tiptoe. Jump jump jump. Jump jump jump. Swimming swimming swimming. Now let's sleep. Now let's sleep. Wake up! It's time to go!] Are you ready to go fast? Okay! Walking walking. Walking walking. Hop hop hop. Hop hop hop. Running running running. Running running running. Now let's stop. Now let's stop. Walking walking. Walking walking. Hop hop hop. Hop hop hop. Running running running. Running running running. Now let's stop. Now let's stop. Whew! ♫ ***** Music: Super Simple Learning Song: Walking Walking CD: Super Simple Songs - 1 We're Super Social, too! facebook: http://facebook.com/supersimpleofficial twitter: http://twitter.com/simplesongs pinterest: http://pinterest.com/simplesongs blog: http://supersimplelearning.com/blog
Hello! | Super Simple Songs
Start off your lesson with "Hello!", a fun and energetic song to talk about how you feel as you greet each other. ****** Music and Lyrics: Copyright 2006, 2014 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ****** Thank you very much for watching and sharing. We upload new videos every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Hello! Hello! Hello, how are you? (Repeat) I'm good! I'm great! I'm wonderful! (Repeat) Hello! Hello! Hello, how are you? (Repeat) I'm tired. I'm hungry. I'm not so good. (Repeat) Hello! Hello! Hello, how are you? (Repeat 3x) ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Hello! by Super Simple Learning
Make A Circle | Preschool Song | Super Simple Songs
Make A Circle is a great song for classroom management. Follow the simple directions that end with kids seated and ready for the next activity. Set to the tune of the familiar nursery rhyme, London Bridge Is Falling Down, kids will be singing along in no time. For more nursery rhymes and kids songs from Super Simple Learning, subscribe to Super Simple Songs here: http://bit.ly/SSSYTsubscribe iTunes: http://bit.ly/MakeACircle_iTunes Amazon: http://bit.ly/SuperSimpleSongs1_Amazon ****** Music: Traditional Lyrics: Copyright 2005, 2014 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Time to make a circle. Make a circle, big big big. Small small small. Big big big. Make a circle, small small small. Hello hello hello. Make a circle, round and round. Round and round. Round and round. Make a circle, round and round. Hello hello hello. Make a circle, up up up. Down down down. Up up up. Make a circle, down down down. Now sit down. ***** Song: Make A Circle CD: Super Simple Songs 1 Music: Super Simple Learning Vocals: Matt Stamm and Leah Hayes ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Make A Circle by Super Simple Learning
Hello Hello! Can You Clap Your Hands? | Original Kids Song | Super Simple Songs
Hello Hello to everyone visiting from Leo Messi's Instagram post😁 . Use this song to say “Hello!” to classmates, parents, and friends from around the world. Para ver más videos de Super Simple Songs en Español, ingresá a Super Simple Español ► https://www.youtube.com/c/supersimpleespanol For more nursery rhymes and kids songs from Super Simple Learning, subscribe to Super Simple Songs here: http://bit.ly/SSSYTsubscribe iTunes: http://bit.ly/HelloHello_iTunes Amazon: http://bit.ly/SuperSimpleSongs3_Amazon ****** Music and Lyrics: Copyright 2007, 2014 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Hello, hello. Can you clap your hands? Hello, hello. Can you clap your hands? Can you stretch up high? Can you touch your toes? Can you turn around? Can you say, "Hello"? Hello, hello. Can you stamp your feet? Hello, hello. Can you stamp your feet? Can you stretch up high? Can you touch your toes? Can you turn around? Can you say, "Hello"? Hello, hello. Can you clap your hands? Hello, hello. Can you stamp your feet? ***** Song: Hello Hello! CD: Super Simple Songs 3 Music: Super Simple Learning Vocals: Matt Stamm and Ingrid DuMosch DeHaan ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Hello Hello! by Super Simple Learning
Little Snowflake | Kids Songs | Super Simple Songs
Little Snowflake PLUSH TOYS!! ► http://amzn.to/2ud97Vh Little Snowflake brings together the same team that created the Twinkle Twinkle Little Star video (http://youtu.be/yCjJyiqpAuU) to tell a short story of a snowman brought to life by the magic and beauty of snowfall. As he tries to ice skate, he learns the value of perseverance and teamwork. Along the way, we get to learn and review parts of the body (head, nose, hand). We hope you love it! Please let us know what you think. ****** Music & Lyrics: Copyright 2009 Super Simple Learning® Video: Copyright 2012 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and more at https://www.supersimple.com ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Little Snowflake Lyrics: Snowflake, snowflake, little snowflake. Little snowflake falling from the sky. Snowflake, snowflake, little snowflake. Falling, falling, falling, falling, falling, falling, falling, falling, falling...falling on my head. Snowflake, snowflake, little snowflake. Little snowflake falling from the sky. Snowflake, snowflake, little snowflake. Falling, falling, falling, falling, falling, falling, falling, falling, falling...falling on my nose. Snowflake, snowflake, little snowflake. Little snowflake falling from the sky. Snowflake, snowflake, little snowflake. Falling, falling, falling, falling, falling, falling, falling, falling, falling...falling in my hand. Falling on my head. Falling on my nose. Falling in my hand. Snowflake, snowflake, little snowflake... ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** "Little Snowflake" by Super Simple Learning
Views: 278547054 Super Simple Songs - Kids Songs
Clean Up Song | Kids Song for Tidying Up | Super Simple Songs
♫ Clean up. Clean up. Everybody let's clean up. ♫ Sing this Super Simple Song for kids whenever you need to tidy up! Great for in the classroom or at home :-) ****** iTunes: http://bit.ly/CleanUp_iTunes Amazon: http://bit.ly/SSS1_Amazon ****** Music: Traditional Adapted Lyrics: Copyright 2005, 2014 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Clean up, clean up. Everybody, let's clean up. Clean up, clean up. Put your things away. (Repeat 3x) Clean up! Clean up! Clean up! Put your things away. Pick up your toys. Pick up your books. Pick up your shoes. Put your things away. Clean up, clean up. Everybody, let's clean up. Clean up, clean up. Put your things away. (Repeat) ***** Song: Clean Up! CD: Super Simple Songs 1 Music: Super Simple Learning Vocals: Matt Stamm and Leah Hays ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Clean Up! by Super Simple Learning
Do You Like Spaghetti Yogurt? | Super Simple Songs
New Super Simple TV show...The Bumble Nums ► http://bit.ly/2rSKHOF If you like the Broccoli Ice Cream song, try out the new “Do You Like Spaghetti Yogurt?” version! Sing along with the sequel to this fun and silly food song. iTunes: http://bit.ly/SpaghettiYogurt_iTunes Amazon: http://bit.ly/SuperSimpleSongs3_Amazon ****** Music and Lyrics: Copyright 2014 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ****** Thank you very much for watching and sharing. To make sure you get our latest videos, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics Do you like spaghetti? Yes, I do! Do you like yogurt? Yes, I do! Do you like spaghetti yogurt? No, I don't. Yucky! Do you like cookies? Yes, I do! Do you like salad? Yes, I do! Do you like cookie salad? No, I don't. Yucky! Do you like tomatoes? Yes, I do! Do you like pancakes? Yes, I do! Do you like tomato pancakes? No, I don't. Yucky! Do you like carrots? Yes, I do! Do you like cereal? Yes, I do! Do you like carrot cereal? No, I don't. Yuck! ***** Song: Do You Like Spaghetti Yogurt? CD: Super Simple Songs 3 Music: Super Simple Learning Vocals: Matt Stamm and Ingrid DuMosch DeHaan ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Do You Like Spaghetti Yogurt? by Super Simple Learning
Mr. Sun, Sun, Mr. Golden Sun | Kids Songs | Super Simple Songs
😎 It's the Mr. Sun song from Super Simple Songs! ❤️ Subscribe for more Super Simple kids songs → https://www.youtube.com/c/supersimple... ****** Lyrics: Oh Mr. Sun, Sun, Mr. Golden Sun. Please shine down on me. Oh Mr. Sun, Sun, Mr. Golden Sun. Hiding behind the tree. These little children are asking you, To please come out so we can play with you. Oh Mr. Sun, Sun, Mr. Golden Sun. Please shine down on me. Shine down on me, shine, shine, shine. Shine down on me, shine, shine, shine. Shine down on me, shine, shine, shine. Shine down on me. Mr. Sun, Mr. Sun, Mr. Golden Sun. Oh Mr. Sun, Sun, Mr. Golden Sun. Please shine down on me. Oh Mr. Sun, Sun, Mr. Golden Sun. Hiding behind the tree. These little children are asking you, To please come out so we can play with you. Oh Mr. Sun, Sun, Mr. Golden Sun. Please shine down on, Please shine down on, Please shine down on me. ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ***** We're Super Social, too! facebook: http://facebook.com/supersimpleofficial twitter: http://twitter.com/simplesongs pinterest: http://pinterest.com/simplesongs instagram: http://instagram.com/supersimpleofficial blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. #nurseryrhymes #kidssongs #supersimplesongs
Do You Like Broccoli Ice Cream? | Super Simple Songs
Stream the full new "Do You Like Broccoli Ice Cream? & More Kids Songs" on Amazon: http://amzn.to/2vcIRHo "Do You Like Broccoli Ice Cream?" is an original (and very silly) food song from Super Simple Learning created for teaching how to express food likes and dislikes, and asking and answering "Do you like _______?" questions. iTunes: http://bit.ly/DoYouLikeBroccoliIceCre... Amazon: http://bit.ly/SuperSimpleSongs3_Amazon ****** Music & Lyrics: Copyright 2007, 2014 Super Simple Learning® Video: Copyright 2013 Super Simple Learning® ****** This song is a lot of fun to use with Pre-K students, young ESL and EFL students, and children with special needs. After you have learned and sung the song together, encourage children to use their imagination to come up with some other strange food combinations. What are 2 foods that are yummy on their own, but yucky when combined? ****** Thank you very much for watching and sharing ^_^ To make sure you get our latest videos, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and more at https://www.supersimple.com ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Do you like broccoli? Yes, I do! Do you like ice cream? Yes, I do! Do you like broccoli ice cream? No, I don't. Yucky! Do you like donuts? Yes, I do! Do you like juice? Yes, I do! Do you like donut juice? No, I don't. Yucky! Do you like popcorn? Yes, I do! Do you like pizza? Yes, I do! Do you like popcorn pizza? No, I don't. Yucky! Do you like bananas? Yes, I do! Do you like soup? Yes, I do! Do you like banana soup? No, I don't. Yucky! ***** Song: Do You Like Broccoli Ice Cream? CD: Super Simple Songs 3 Music: Super Simple Learning Vocals: Matt Stamm and Leah Frederick ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** Do You Like Broccoli Ice Cream? by Super Simple Learning
Get Owl & Star Plush Toys here ► http://amzn.to/2uehuPL Watch full Twinkle Twinkle Little Star & More DVD on Amazon Prime ► http://bit.ly/TwinkleTwinkleAndMore PARENTS AND TEACHERS: Thank you so much for watching Super Simple Songs with your families and/or students. If your young ones are watching without supervision, we recommend some of the following viewing options: ► YOUTUBE KIDS -- http://bit.ly/You-Tube-Kids Designed to make it safer and simpler for young ones to watch online video, YouTube Kids includes a suite of parental controls so you can tailor the experience to suit your family’s needs. ► DOWNLOAD -- http://bit.ly/SuperSimpleShop Videos from all Super Simple channels are available for purchase at the Super Simple online shop. You can also find some DVDs there. ► AMAZON VIDEO Are you an Amazon Prime member? Watch Super Simple videos ad-free on Amazon Prime Video. Just search for “Super Simple.” ► KHAN ACADEMY KIDS -- http://bit.ly/KhanKids-App Super Simple has partnered with Khan Academy on their latest app designed for preschoolers. You’ll find Super Simple Songs worked into the curriculum throughout the app. ► PLAYKIDS -- http://bit.ly/Play-Kids Do you have the PlayKids app? You can find many of our Super Simple Songs and programs in the app! FREE SUPER SIMPLE TEACHING RESOURCES: http://bit.ly/SSFree-Resources SOCIAL MEDIA: Super Simple Newsletter Sign Up: http://bit.ly/SuperSimpleSignUp Facebook: http://bit.ly/SuperSimpleFacebook Instagram: http://bit.ly/SuperSimpleInsta Twitter: http://bit.ly/SuperSimpleTwitter Pinterest: http://bit.ly/SuperSimplePinterest ***** Twinkle Twinkle Little Star lyrics: Twinkle, twinkle, little star. How I wonder what you are. Up above the world so high, Like a diamond in the sky. Twinkle, twinkle, little star. How I wonder what you are. Twinkle, twinkle, little star. How I wonder what you are. Up above the world so high, Like a diamond in the sky. Twinkle, twinkle, little star. How I wonder what you are. ***** This video was created as a thank you to everyone for helping us reach 100,000,000 views on YouTube. Twinkle Twinkle Little Star had long been our most requested song, and we were really happy to record the song with one of our students, Nagi. Nagi has a new album out with covers of classic J-POP songs by a variety of artists, and a new arrangement of Twinkle Twinkle Little Star. The CD is available from Amazon Japan here: http://amzn.to/19EbDOy We hope you enjoy the video. A special thanks goes out to Nate at Fuzz Animation for the amazing animation. Please subscribe to the SuperSimpleSongs channel for a mix of classic kids songs (ABC Song, BINGO, Ten In The Bed, Rain Rain Go Away, Row Row Row Your Boat, Eensey Weensey Spider, Hickory Dickory Dock, etc.) and originals made SIMPLE for emerging speakers. Copyright Super Simple Learning® 2010
Views: 1175950444 Super Simple Songs - Kids Songs
Santa Shark | Baby Shark Christmas Song | Super Simple Songs
Baby Shark is back with a new holiday classic; “Santa Shark”! Sing along to this Christmas song for kids! Merry Christmas everyone! 🎶Santa shark, ho ho ho, ho ho ho ho ho. Santa shark, ho ho ho, ho ho ho ho ho. Santa shark, ho ho ho, ho ho ho ho ho. Santa shark. 🎶 PARENTS AND TEACHERS: Thank you so much for watching Super Simple Songs with your families and/or students. If your young ones are watching without supervision, we recommend some of the following viewing options: ► YOUTUBE KIDS -- http://bit.ly/You-Tube-Kids Designed to make it safer and simpler for young ones to watch online video, YouTube Kids includes a suite of parental controls so you can tailor the experience to suit your family’s needs. ► DOWNLOAD -- http://bit.ly/SuperSimpleShop Videos from all Super Simple channels are available for purchase at the Super Simple online shop. You can also find some DVDs there. ► AMAZON VIDEO Are you an Amazon Prime member? Watch Super Simple videos ad-free on Amazon Prime Video. Just search for “Super Simple.” ► KHAN ACADEMY KIDS -- http://bit.ly/KhanKids-App Super Simple has partnered with Khan Academy on their latest app designed for preschoolers. You’ll find Super Simple Songs worked into the curriculum throughout the app. ► PLAYKIDS -- http://bit.ly/Play-Kids Do you have the PlayKids app? You can find many of our Super Simple Songs and programs in the app! FREE SUPER SIMPLE TEACHING RESOURCES: http://bit.ly/SSFree-Resources SOCIAL MEDIA: Super Simple Newsletter Sign Up: http://bit.ly/SuperSimpleSignUp Facebook: http://bit.ly/SuperSimpleFacebook Instagram: http://bit.ly/SuperSimpleInsta Twitter: http://bit.ly/SuperSimpleTwitter Pinterest: http://bit.ly/SuperSimplePinterest LYRICS: Santa shark, ho ho ho, ho ho ho ho ho. Santa shark, ho ho ho, ho ho ho ho ho. Santa shark, ho ho ho, ho ho ho ho ho. Santa shark. Reindeer sharks, do do do, do do do do do. Reindeer sharks, do do do, do do do do do. Reindeer sharks, do do do, do do do do do. Reindeer sharks. Elf sharks, do do do, do do do do do. Elf sharks, do do do, do do do do do. Elf sharks, do do do, do do do do do. Elf sharks. Making toys, do do do, do do do do do. Making toys, do do do, do do do do do. Making toys, do do do, do do do do do. Making toys. Wrap them up, do do do, do do do do do. Wrap them up, do do do, do do do do do. Wrap them up, do do do, do do do do do. Wrap them up. Load the sleigh, do do do, do do do do do. Load the sleigh, do do do, do do do do do. Load the sleigh, do do do, do do do do do. Load the sleigh. It’s Christmas! Swim away, do do do, do do do do do. Swim away, do do do, do do do do do. Swim away, do do do, do do do do do. Swim away. Swim faster, do do do, do do do do do. Swim faster, do do do, do do do do do. Swim faster, do do do, do do do do do. Swim faster. Swim faster, do do do, do do do do do. Swim faster, do do do, do do do do do. Swim faster, do do do, do do do do do. Swim faster. Santa shark, ho ho ho, ho ho ho ho ho. Santa shark, ho ho ho, ho ho ho ho ho. Santa shark, ho ho ho, ho ho ho ho ho. Santa shark. Merry Christmas! ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. #nurseryrhymes #kidssongs #childrensmusic #supersimplesongs
How's The Weather? | Super Simple Songs
How's The Weather? is now available on the Super Simple Songs Volume 2 DVD! Get it on Amazon! http://bit.ly/SuperSimpleSongsVol2DVD... It's a Super Simple weather song! How's the weather where you are? Sunny? Rainy? Cloudy? Snowy? iTunes: http://bit.ly/HowsTheWeather_iTunes Amazon: http://bit.ly/SuperSimpleSongs2_Amazon ****** Music & Lyrics: Copyright 2006, 2014 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ We upload a new video every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** How's The Weather Lyrics: How's the weather? How's the weather? How's the weather today? Is it sunny? Is it rainy? Is it cloudy? Is it snowy? How's the weather today? Let's look outside. How's the weather? Is it sunny today? Let's look outside. How's the weather? Is it rainy today? Let's look outside. How's the weather? Is it cloudy today? Let's look outside. Is it snowy today? How's the weather? How's the weather? How's the weather today? Is it sunny? Is it rainy? Is it cloudy? Is it snowy? How's the weather today? ***** Song: How's The Weather CD: Super Simple Songs 2 Music: Super Simple Learning Animation: Willie Castro Vocals: Ingrid Dumosch DeHaan and Matt Stamm ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** How's The Weather? by Super Simple Learning
The Months Chant | Super Simple Songs
An easy chant for practicing the months of the year. For some tips on teaching the months, visit the Super Simple Learning blog here: http://www.supersimplelearning.com/bl... DVD: http://bit.ly/SuperSimpleSongsDVD_Amazon iTunes: http://bit.ly/TheMonthsChant_iTunes Amazon: http://bit.ly/SuperSimpleSongs3_Amazon ****** Music & Lyrics: Copyright 2007, 2014 Super Simple Learning® Video: Copyright 2011 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ We upload a new video every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: ♫ January (January!) February (February!) March (March!) April (April!) May (May!) June (June!) July (July!) August (August!) September (September!) October (October!) November (November!) December (December!) Now you try! January, February, March, April, May, June, July, August, September, October, November, December. ♫ ****** Song: The Months Chant Album: Super Simple Songs 3 Music: Super Simple Learning Vocals: Matt Stamm and Ingrid DuMosch DeHaan ****** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ****** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** "The Months Chant" by Super Simple Learning
The Bath Song - Teaching Tips
Watch a brand new version of "The Bath Song" here: https://youtu.be/CG8F-6dZk8k Tips on using "The Bath Song," from the award-winning CD, "Super Simple Songs One." iTunes: http://bit.ly/TheBathSong_iTunes Amazon: http://bit.ly/SuperSimpleSongs1_Amazon Google Play: http://bit.ly/SuperSimpleSongs1_GooglePlay ****** Music & Lyrics: Copyright 2005 Super Simple Learning® Video: Copyright 2006 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ We upload a new video every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL028565C616627F50 ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for most of our songs in the Super Simple Learning Resource Center: http://supersimplelearning.com/resource-center/ ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Can you wash your hair? I can wash my hair. Can you wash your feet? I can wash my feet. Can you wash your face? I can wash my face. Can you wash your knees? I can wash my knees. I can wash my hair. I can wash my feet. I can wash my face. I can wash my knees. This is the way we take a bath. Can you wash your shoulders? I can wash my shoulders. Can you wash your toes? I can wash my toes. Can you wash your hands? I can wash my hands. Can you wash your nose? I can wash my nose. I can wash my shoulders. I can wash my toes. I can wash my hands. I can wash my nose. This is the way we take a bath. ***** Song: The Bath Song Album: Super Simple Songs 1 Music: Super Simple Learning ****** We're Super Social, too! Google+: http://google.com/+supersimplesongs Facebook: http://facebook.com/supersimplelearning Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimplelearning Blog: http://supersimplelearning.com/blog ****** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** "The Bath Song" by Super Simple Learning
Put On Your Shoes | Clothing Song for Kids
Subscribe for more Kids Songs! ► http://bit.ly/2r8pNcF Watch ALL Super Simple Songs ► http://bit.ly/2rCt6XU ****** Music and Lyrics: Copyright 2005, 2014 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and more at http://www.supersimple.com ****** Like this song? Check out our award-winning collection of CDs, DVDs, Books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Put on your shoes, your shoes, your shoes. Put on your shoes, your shoes, your shoes. Put on your shoes. Let's go outside. Hurry up. Hurry up. Hurry hurry up! Put on your jacket, your jacket, your jacket. Put on your jacket, your jacket, your jacket. Put on your jacket. Let's go outside. Hurry up. Hurry up. Hurry hurry up! Put on your scarf, your scarf, your scarf. Put on your scarf, your scarf, your scarf. Put on your scarf. Let's go outside. Hurry up. Hurry up. Hurry hurry up! Put on your hat, your hat, your hat. Put on your hat, your hat, your hat. Put on your hat. Let's go outside. Hurry up. Hurry up. Hurry hurry up! Put on your shoes. Your jacket. Your scarf. And your hat. Hurry up. Hurry up. Hurry hurry up! ***** Song: Put On Your Shoes CD: Super Simple Songs One Music: Super Simple Learning Vocals: Leah Hays and Matt Stamm ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Put On Your Shoes by Super Simple Learning
I Have A Pet | Animal Song | Super Simple Songs
It's a super simple animal song for kids, "I Have A Pet." Do you have a pet? Tell us what kind in the comments! iTunes: http://bit.ly/IHaveAPet_iTunes Amazon: http://bit.ly/SuperSimpleSongsAnimals... Video: Super Simple Songs - Animals DVD: http://amzn.to/1APwtrF ****** Music & Lyrics: Copyright 2011 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** Thank you very much for watching and sharing. We upload new videos every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, Books, and more at http://supersimplelearning.com/shop/ ****** LYRICS Do you have a pet? Yes, I have a dog. I have a pet. He is a dog. And he says, "Woof, woof, woof, woof, woof. Woof woof." I have a cat. I have a pet. She is a cat. And she says, "Meow, meow, meow, meow, meow. Meow meow." I have a mouse. I have a pet. He is a mouse. And he says, "Squeak, squeak, squeak, squeak, squeak. Squeak squeak." Woof woof. Meow meow. Squeak squeak. I have a bird. I have a pet. He is a bird. And he says, "Tweet, tweet, tweet, tweet, tweet. Tweet tweet." I have a fish. I have a pet. She is a fish. And she says, "Glub, glub, glub, glub, glub. Glub glub." I have a lion. A lion?! I have a pet. He is a lion. And he says, "Roar, roar, roar, roar, roar. Roar roar." Tweet tweet. Glub glub. ROAR! ***** Song: I Have A Pet CD: Super Simple Songs - Animals Music: Super Simple Learning Vocals: Shelly Lomonaco & Matt Stamm ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** "I Have A Pet" by Super Simple Learning
Who Took The Cookie? | Nursery Rhyme | Super Simple Songs
Enjoy "Who Took The Cookie?", a classic rhyme with original music from Super Simple Songs. It's the classic 'who-dun-it?' rhyme. Find out who took the cookie from the cookie jar with our cast of animal characters. For more nursery rhymes and kids songs from Super Simple Learning, subscribe to Super Simple Songs here: http://bit.ly/SSSYTsubscribe iTunes: http://bit.ly/WhoTookTheCookie_iTunes Amazon: http://bit.ly/SuperSimpleSongs2_Amazon ****** Music and Lyrics: Copyright 2006, 2014 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Who took the cookie from the cookie jar? Panda took the cookie from the cookie jar. Who me? Yes, you! Not me! Then who? Rabbit! Who took the cookie from the cookie jar? Rabbit took the cookie from the cookie jar. Who me? Yes, you! Not me! Then who? Bear! Who took the cookie from the cookie jar? Bear took the cookie from the cookie jar. Who me? Yes, you! Not me! Then who? Penguin! Who took the cookie from the cookie jar? Penguin took the cookie from the cookie jar. Who me? Yes, you! Not me! Then who? Kangaroo! Who took the cookie from the cookie jar? Kangaroo took the cookie from the cookie jar. Who me? Yes, you! Okay, okay...I took the cookie! I took the cookie from the cookie jar. The yummy, yummy cookie from the cookie jar. Are you hungry? Uh-huh. Let's share! Who wants some cookie? I do! Me, me, me! ***** Song: Who Took The Cookie? CD: Super Simple Songs 2 Music: Super Simple Learning Vocals: Matt Stamm and Ingrid DuMosch DeHaan ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Who Took The Cookie? by Super Simple Learning
Row Row Row Your Boat | Super Simple Songs
♫ Row row row your boat, gently down the stream. Merrily, merrily, merrily, merrily, life is but a dream. ♫ ****** With young learners, use the video to discuss weather and seasons...talk about all the different things you see in each scene. With older learners, have a discussion-based lesson about the meaning of this song. You can find more activity ideas here: http://supersimplelearning.com/other-... ****** Music & Lyrics: Traditional Video: Copyright 2011 Super Simple Learning® ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for many of our songs in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Row row row your boat Gently down the stream Merrily merrily merrily merrily Life is but a dream. ***** Music and story: Troy McDonald and Devon Thagard Animation: Alberto Cerriteño Vocals: Leah Hays and Matt Stamm ****** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ****** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** "Row Row Row Your Boat" by Super Simple Learning
Do You Like Lasagna Milkshakes? | Ice Cream and Lasagna!? | Super Simple Songs
🍴 Do you like lasagna milkshakes? 😳 🎬 Watch 60 minutes of our best kids songs here→ https://youtu.be/wk4KHNJjpjQ? ❤️ Subscribe for more fun kids songs→ https://www.youtube.com/c/supersimple... Yummy? Yucky? Let us know in the comments. And let us know what other silly food combos you come up with :-) ****** Music and Lyrics: Copyright 2016 Super Simple Learning® Video: Copyright 2016 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ***** Lyrics: Do you like lasagna? Yes, I do! Yes, I do! Do you like milkshakes? Yes, I do! Yes, I do! Do you like lasagna milkshakes? No, I don’t! Yucky! Do you like avocados? Yes, I do! Yes, I do! Do you like lollipops? Yes, I do! Yes, I do! Do you like avocado lollipops? No, I don’t! Yucky! Do you like asparagus? Yes, I do! Yes, I do! Do you like cake? Yes, I do! Yes, I do! Do you like asparagus cake? No, I don’t! Yucky! Do you like peanut butter? Yes, I do! Yes, I do! Do you like jelly? Yes, I do! Yes, I do! Do you like peanut butter and jelly? Yes, I do. Yummy! ***** We're Super Social, too! facebook: http://facebook.com/supersimpleofficial twitter: http://twitter.com/simplesongs pinterest: http://pinterest.com/simplesongs instagram: http://instagram.com/supersimpleofficial blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company, Inc.
Open Shut Them | Super Simple Songs
This version of "Open Shut Them" is a great kids song for teaching some basic opposites. It's full of easy-to-understand, easy-to-gesture vocabulary. ****** Music: Traditional Adapted Lyrics: Copyright 2007, 2014 Super Simple Learning® Video: Copyright 2012 Super Simple Learning® ****** To see this song in use with gestures in the classroom, watch this video: http://youtu.be/M55R32lQvLg. ****** Thank you very much for watching and sharing ^_^ We upload a new video every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ***** Lyrics: Open shut them, open shut them. Give a little clap, clap, clap. Open shut them, open shut them. Put them in your lap, lap, lap. Big and small. Big and small. Big and small. Big, big, big, big, small, small, small. Big and small. Big and small. Big, big, big, big, small, small, small. Please. No, thank you. Please. No, thank you. Please. No, thank you. Please, please, please, please. No thank you. Please. No, thank you. Please. No, thank you. Please, please, please, please. No thank you. Fast and slow. Fast and slow. Fast and slow. Fast, fast, fast, fast, slow, slow, slow. Fast and slow. Fast and slow. Fast, fast, fast, fast, slow, slow, slow. Loud and quiet. Loud and quiet. Loud and quiet. Loud, loud, loud, loud. Shh... Quiet. Loud and quiet. Loud and quiet. Loud, loud, loud, loud. Shh... Quiet. Peek-a-boo. Peek-a-boo. Peek-a-boo. Peek-a, peek-a, peek-a-boo! Peek-a-boo. Peek-a-boo. Peek-a, peek-a, peek-a-boo! ***** Song: Open Shut Them CD: Super Simple Songs 3 Music: Super Simple Learning Vocals: Matt Stamm ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** "Open Shut Them" by Super Simple Learning
Rain, Rain, Go Away | Super Simple Songs
Dear Rain, please go away and come again another day! Find this video on the first Super Simple Songs DVD. DVD: http://bit.ly/SuperSimpleSongsDVD_Amazon iTunes: http://bit.ly/RainRainGoAway_iTunes Amazon: http://bit.ly/SuperSimpleSongs3_Amazon ****** Music: Traditional Adapted Lyrics: Copyright 2007 Super Simple Learning® Video: Copyright 2007 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ We upload a new video every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Rain, Rain, Go Away Lyrics Rain, rain, go away. Come again another day. MOMMY wants to play. Rain, rain, go away. Rain, rain, go away. Come again another day. BROTHER wants to play. Rain, rain, go away. Rain, rain, go away. Come again another day. SISTER wants to play. Rain, rain, go away. Rain, rain, go away. Come again another day. BABY wants to play. Rain, rain, go away. Rain, rain, go away. Come again another day. ALL THE FAMILY wants to play. Rain, rain, go away. ***** Song: Rain, Rain, Go Away (Play With It Version) Album: Super Simple Songs 3 Music: Super Simple Learning We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ****** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** "Rain, Rain, Go Away" by Super Simple Learning
12 Days Of Christmas | Kids Songs | Super Simple Songs
🎄🎅 🦌 ♫ On the first day of Christmas, my true love gave to me a partridge in a pear tree! ♫ Join us and sing along with this beautiful Christmas song for kids from Super Simple Songs! PARENTS AND TEACHERS: Thank you so much for watching Super Simple Songs with your families and/or students. If your young ones are watching without supervision, we recommend some of the following viewing options: ► YOUTUBE KIDS -- http://bit.ly/You-Tube-Kids Designed to make it safer and simpler for young ones to watch online video, YouTube Kids includes a suite of parental controls so you can tailor the experience to suit your family’s needs. ► DOWNLOAD -- http://bit.ly/SuperSimpleShop Videos from all Super Simple channels are available for purchase at the Super Simple online shop. You can also find some DVDs there. ► AMAZON VIDEO Are you an Amazon Prime member? Watch Super Simple videos ad-free on Amazon Prime Video. Just search for “Super Simple.” ► KHAN ACADEMY KIDS -- http://bit.ly/KhanKids-App Super Simple has partnered with Khan Academy on their latest app designed for preschoolers. You’ll find Super Simple Songs worked into the curriculum throughout the app. ► PLAYKIDS -- http://bit.ly/Play-Kids Do you have the PlayKids app? You can find many of our Super Simple Songs and programs in the app! FREE SUPER SIMPLE TEACHING RESOURCES: http://bit.ly/SSFree-Resources SOCIAL MEDIA: Super Simple Newsletter Sign Up: http://bit.ly/SuperSimpleSignUp Facebook: http://bit.ly/SuperSimpleFacebook Instagram: http://bit.ly/SuperSimpleInsta Twitter: http://bit.ly/SuperSimpleTwitter Pinterest: http://bit.ly/SuperSimplePinterest Lyrics: On the first day of Christmas My true love gave to me A partridge in a pear tree On the second day of Christmas My true love gave to me Two turtle doves And a partridge in a pear tree On the third day of Christmas My true love gave to me Three French hens Two turtle doves And a partridge in a pear tree On the fourth day of Christmas My true love gave to me Four calling birds Three French hens Two turtle doves And a partridge in a pear tree On the fifth day of Christmas My true love gave to me Five golden rings Four calling birds Three French hens Two turtle doves And a partridge in a pear tree On the sixth day of Christmas My true love gave to me Six geese-a-laying Five golden rings Four calling birds Three French hens Two turtle doves And a partridge in a pear tree On the seventh day of Christmas My true love gave to me Seven swans-a-swimming Six geese-a-laying Five golden rings Four calling birds Three French hens Two turtle doves And a partridge in a pear tree On the eighth day of Christmas My true love gave to me Eight maids-a-milking Seven swans-a-swimming Six geese-a-laying Five golden rings Four calling birds Three French hens Two turtle doves And a partridge in a pear tree On the ninth day of Christmas My true love gave to me Nine ladies dancing Eight maids-a-milking Seven swans-a-swimming Six geese-a-laying Five golden rings Four calling birds Three French hens Two turtle doves And a partridge in a pear tree On the tenth day of Christmas My true love gave to me Ten lords-a-leaping Nine ladies dancing Eight maids-a-milking Seven swans-a-swimming Six geese-a-laying Five golden rings Four calling birds Three French hens Two turtle doves And a partridge in a pear tree On the eleventh of Christmas My true love gave to me Eleven pipers piping Ten lords-a-leaping Nine ladies dancing Eight maids-a-milking Seven swans-a-swimming Six geese-a-laying Five golden rings Four calling birds Three French hens Two turtle doves And a partridge in a pear tree On the twelfth day of Christmas My true love gave to me Twelve drummers drumming Eleven pipers piping Ten lords-a-leaping Nine ladies dancing Eight maids-a-milking Seven swans-a-swimming Six geese-a-laying Five golden rings Four calling birds Three French hens Two turtle doves And a partridge in a pear tree And a partridge in a pear tree ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. #nurseryrhymes #kidssongs #childrensmusic #supersimplesongs
Yes, I Can! | Animal Song For Children | Super Simple Songs
"Yes, I Can!" is a super simple animal song that introduces a bunch of fun animals, action verbs, and the phrases, "Can you___?" and "Yes, I can. / No I can't." iTunes: http://bit.ly/YesICan_iTunes Amazon: http://bit.ly/SSSAnimals_Amazon Video: Super Simple Songs - Animals DVD: http://amzn.to/1APwtrF ****** Music and Lyrics: Copyright 2011 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ****** Thank you very much for watching and sharing. We upload new videos every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and more at https://www.supersimple.com ****** Like this song? Check out our award-winning collection of CDs, DVDs, Books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Little bird, little bird, can you clap? No, I can't. No, I can't. I can't clap. Little bird, little bird, can you fly? Yes, I can. Yes, I can. I can fly. Elephant, elephant, can you fly? No, I can't. No, I can't. I can't fly. Elephant, elephant, can you stomp? Yes, I can. Yes, I can. I can stomp. Little fish, little fish, can you stomp? No, I can't. No, I can't. I can't stomp. Little fish, little fish, can you swim? Yes, I can. Yes, I can. I can swim. Gorilla, gorilla, can you swim? No, I can't. No, I can't. I can't swim. Gorilla, gorilla, can you climb? Yes, I can. Yes, I can. I can climb. Buffalo, buffalo, can you climb? No, I can't. No, I can't. I can't climb. Buffalo, buffalo, can you run? Yes, I can. Yes, I can. I can run. Boy and girls, boys and girls, can you sing? Yes, we can. Yes, we can. We can sing. Boys and girls, boys and girls, can you dance? Yes, we can. Yes, we can. We can dance. We can sing. We can dance. Yes, we can. We can sing. We can dance. Yes, we can. Yes, we can. Yes, we can. Yes, we can. Yes, we can. Yes, we can. Yes, we can. Yes, we can. Yes, we can. Yes, we can. ***** Song: Yes, I Can! CD: Super Simple Songs - Animals Music: Super Simple Learning Vocals: Matt Stamm, Leah Frederick, Shelly Lomonaco ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Yes, I Can! by Super Simple Learning
Walking Walking | featuring Noodle & Pals | Super Simple Songs
Enjoy this Super Simple take on the adapted nursery rhyme, 🚶Walking Walking🚶. 🎬 Watch 60 minutes of our best kids songs here→ https://youtu.be/wk4KHNJjpjQ? ❤️ Subscribe for more fun kids songs→ https://www.youtube.com/c/supersimple... ****** iTunes: http://bit.ly/WalkingWalking_iTunes Amazon: http://bit.ly/SSS1_Amazon ****** Music: Traditional Lyrics: Copyright 2005, 2014 Super Simple Learning® Video: Copyright 2016 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and more at https://www.supersimple.com ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Walking walking. Walking walking. Hop hop hop. Hop hop hop. Running running running. Running running running. Now let's stop. Now let's stop. Walking walking. Walking walking. Hop hop hop. Hop hop hop. Running running running. Running running running. Now let's stop. Now let's stop. Tiptoe tiptoe. Tiptoe tiptoe. Jump jump jump. Jump jump jump. Swimming swimming swimming. Now let's sleep. Now let's sleep. Wake up! It's time to go! Are you ready to go fast? Okay! Walking walking. Walking walking. Hop hop hop. Hop hop hop. Running running running. Running running running. Now let's stop. Now let's stop. Walking walking. Walking walking. Hop hop hop. Hop hop hop. Running running running. Running running running. Now let's stop. Now let's stop. Whew! ***** Song: Walking Walking CD: Super Simple Songs 1 Music: Super Simple Learning Vocals: Matt Stamm and Leah Hays ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. ***** Walking Walking by Super Simple Learning
Sweet Dreams (Goodnight Song) | Super Simple Songs
"Goodnight to you. Goodnight to me. Now close your eyes and go to sleep. Goodnight. Sleep tight. Sweet dreams tonight. Goodnight. I love you." Enjoy this special bedtime lullaby we made to thank viewers for helping us reach 1 BILLION views on YouTube ^_^. We hope you enjoy it! ****** Music and Lyrics: Copyright 2005, 2013 Super Simple Learning® Video: Copyright 2013 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for most of our songs in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Goodnight to you. Goodnight to me. Now close your eyes and go to sleep. Goodnight. Sleep tight. Sweet dreams tonight. Goodnight. I love you. ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** "Sweet Dreams (Goodnight Song)" by Super Simple Learning
Go Away! | Super Simple Songs
Watch the full Super Simple Songs - Halloween DVD here: https://youtu.be/Se4e4_3FpZw "Go Away!" is a super simple children's song that's great for Halloween or anytime you want to tell those monsters under the bed to "Go Away!" Created for ages 3 and up. Get the Super Simple Songs - Halloween DVD: http://bit.ly/SuperSimpleSongsHalloween Get the song: iTunes: http://bit.ly/GoAway_iTunes Amazon: http://bit.ly/SuperSimpleSongs1_Amazon ****** Music: Traditional Adapted Lyrics: Copyright 2005, 2014 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** Thank you very much for watching and sharing. We upload new videos every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: https://www.youtube.com/playlist?list... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, Books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: ♫ Go away, scary monster, go away. GO AWAY! Go away, scary monster, go away. GO AWAY! Go away, scary monster. Go away, scary monster. Go away, scary monster, go away. GO AWAY! Go away, spooky vampire, go away. GO AWAY! Go away, spooky vampire, go away. GO AWAY! Go away, spooky vampire. Go away, spooky vampire. Go away, spooky vampire, go away. GO AWAY! Go away, scary witch, go away. GO AWAY! Go away, scary witch, go away. GO AWAY! Go away, scary witch. Go away, scary witch. Go away, scary witch, go away. GO AWAY! Go away, spooky ghost, go away. GO AWAY! Go away, spooky ghost, go away. GO AWAY! Go away, spooky ghost. Go away, spooky ghost. Go away, spooky ghost, go away. GO AWAY! ♫ ***** Song: Go Away! CD: Super Simple Songs 1 Music: Super Simple Learning Vocals: Matt Stamm ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Go Away! by Super Simple Learning
If You're Happy | Super Simple Songs
Listen on Apple Music ► https://apple.co/2xVLB2d Listen on Spotify ► https://spoti.fi/2JlNESq It's "If You're Happy And You Know It" made Super Simple! Practice the emotions happy, angry, scared, and sleepy with this super fun song for kids. ****** Music: Traditional Adapted Lyrics: Copyright 2005, 2014 Super Simple Learning® Video: Copyright 2013 Super Simple Learning® ***** Question: Why don't you sing "If you're happy and you know it clap your hands"? Answer: The traditional version of this song can be a little tough for younger learners. If you pay a visit to a nursery school, preschool, or children's ESL/EFL classroom you'll often hear some children singing something like: If you're happy (mumble, mumble, mumble) clap your hands! If you're happy (mumble, mumble, mumble) clap your hands! If you're happy (mumble, mumble, mumble), (mumble, mumble, mumble) If you're happy (mumble, mumble, mumble) clap your hands! The tempo is often too quick and phrases like "and you know it" and "then your face will surely show it" aren't easy for young children to sing or understand through gestures and expressions. Since we like to use this song to teach emotions, we've slowed it down a little and simplified the lyrics to just the emotions and the body language that express those emotions. This version allows even very young kids to sing all the lyrics and act them out with gestures. ***** Thank you very much for watching and sharing ^_^ ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and more at https://www.supersimple.com ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: If you're happy happy happy clap your hands. If you're happy happy happy clap your hands. If you're happy happy happy clap your hands, clap your hands. If you're happy happy happy clap your hands. If you're angry angry angry stomp your feet. If you're angry angry angry stomp your feet. If you're angry angry angry stomp your feet, stomp your feet. If you're angry angry angry stomp your feet. If you're scared scared scared say, "Oh no!" If you're scared scared scared say, "Oh no!" If you're scared scared scared say, "Oh no!" Say, "Oh no!" If you're scared scared scared say, "Oh no!" If you're sleepy sleepy sleepy take a nap. If you're sleepy sleepy sleepy take a nap. If you're sleepy sleepy sleepy take a nap, take a nap. If you're sleepy sleepy sleepy take a nap. If you're happy happy happy clap your hands. If you're happy happy happy clap your hands. If you're happy happy happy clap your hands, clap your hands. If you're happy happy happy clap your hands. ***** Song: If You're Happy CD: Super Simple Songs 1 Music: Super Simple Learning Animation: Aaron Stewart Vocals: Matt Stamm and Leah Hays ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** "If You're Happy" by Super Simple Learning
With My Heart | Kids Songs | Super Simple Songs
Learn the five senses (+1!) in this heartwarming Super Simple sensory song for kids. 🎶 I can hear with my ears. I can see with my eyes. I can taste with my mouth. I can smell with my nose. I can touch with my hands. Yes, I can. And I can feel with my heart. 🎶 PARENTS AND TEACHERS: Thank you so much for watching Super Simple Songs with your families and/or students. If your young ones are watching without supervision, we recommend some of the following viewing options: ► YOUTUBE KIDS -- http://bit.ly/You-Tube-Kids Designed to make it safer and simpler for young ones to watch online video, YouTube Kids includes a suite of parental controls so you can tailor the experience to suit your family’s needs. ► DOWNLOAD -- http://bit.ly/SuperSimpleShop Videos from all Super Simple channels are available for purchase at the Super Simple online shop. You can also find some DVDs there. ► AMAZON VIDEO Are you an Amazon Prime member? Watch Super Simple videos ad-free on Amazon Prime Video. Just search for “Super Simple.” ► KHAN ACADEMY KIDS -- http://bit.ly/KhanKids-App Super Simple has partnered with Khan Academy on their latest app designed for preschoolers. You’ll find Super Simple Songs worked into the curriculum throughout the app. ► PLAYKIDS -- http://bit.ly/Play-Kids Do you have the PlayKids app? You can find many of our Super Simple Songs and programs in the app! FREE SUPER SIMPLE TEACHING RESOURCES: http://bit.ly/SSFree-Resources SOCIAL MEDIA: Super Simple Newsletter Sign Up: http://bit.ly/SuperSimpleSignUp Facebook: http://bit.ly/SuperSimpleFacebook Instagram: http://bit.ly/SuperSimpleInsta Twitter: http://bit.ly/SuperSimpleTwitter Pinterest: http://bit.ly/SuperSimplePinterest LYRICS: I can hear with my ears. I can see with my eyes. I can taste with my mouth. I can smell with my nose. I can touch with my hands. Yes, I can. And I can feel with my heart. Hear with my ears. See with my eyes. Taste with my mouth. Smell with my nose. Touch with my hands. And feel with my heart. The most important part. I can hear with my ears. I can see with my eyes. I can taste with my mouth. I can smell with my nose. I can touch with my hands. Yes, I can. And I can feel with my heart. ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company.
The Alphabet Chant | Super Simple Songs
Here's a simple way to learn and review your ABCs. The Alphabet Chant, from the CD "Super Simple Songs 3," is super easy to teach and learn. This video also shares the Alphabet in American Sign Language. Can you keep up? For an excellent tutorial on the ASL Alphabet, check out this video: http://www.youtube.com/watch?v=pDfnf9... DVD: http://bit.ly/SuperSimpleSongsDVD_Amazon iTunes: http://bit.ly/TheAlphabetChant_iTunes Amazon: http://bit.ly/SuperSimpleSongs3_Amazon ****** Music & Lyrics: Copyright 2007, 2014 Super Simple Learning® Video: Copyright 2012 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ We upload a new video every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: ♫ A, B, C, D, E, F, G H, I, J, K, L, M, N O, P, Q, R, S, T, U V, W, X, Y, Z! Good job! Faster? Okay... A, B, C, D, E, F, G H, I, J, K, L, M, N O, P, Q, R, S, T, U V, W, X, Y, Z! Great! Faster?! A, B, C, D, E, F, G H, I, J, K, L, M, N O, P, Q, R, S, T, U V, W, X, Y, Z! Okay...Faster?!?! A, B, C, D, E, F, G H, I, J, K, L, M, N O, P, Q, R, S, T, U V, W, X, Y, Z! Now I know my ABCs! ♫ ***** Song: The Alphabet Chant CD: Super Simple Songs 3 Music: Super Simple Learning Vocals: Devon Thagard ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** "The Alphabet Chant" by Super Simple Learning
Walking In The Jungle | Super Simple Songs
New Super Simple TV show...The Bumble Nums ► http://bit.ly/2rSKHOF Let's take a walk in the jungle! "Walking In The Jungle" teaches jungle animals and actions (walking, stomping, jumping, skipping) with some creative play. iTunes: http://bit.ly/WalkinInTheJungle_iTunes http://bit.ly/SuperSimpleSongsAnimals... Video: Super Simple Songs - Animals DVD: http://amzn.to/1APwtrF ****** Music & Lyrics: Copyright 2011 Super Simple Learning® Video: Copyright 2013 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ We upload a new video every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Gestures, activity ideas, and free headband craft for this kids' song here: http://supersimplelearning.com/songs/.... Get more FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Let's take a walk in the jungle. Walking in the jungle. Walking in the jungle. We're not afraid. We're not afraid. Walking in the jungle. Walking in the jungle. We're not afraid. We're not afraid. One step. Two steps. Three steps forward. One step. Two steps. Three steps back. Stop. Listen. What's that? It's a frog! We're not afraid! Let's stomp. Stomping in the jungle. Stomping in the jungle. We're not afraid. We're not afraid. Stomping in the jungle. Stomping in the jungle. We're not afraid. We're not afraid. One step. Two steps. Three steps forward. One step. Two steps. Three steps back. Stop. Listen. What's that? It's a monkey! We're not afraid! Let's jump. Jumping in the jungle. Jumping in the jungle. We're not afraid. We're not afraid. Jumping in the jungle. Jumping in the jungle. We're not afraid. We're not afraid. One step. Two steps. Three steps forward. One step. Two steps. Three steps back. Stop. Listen. What's that? It's a toucan! We're not afraid! Let's skip. Skipping in the jungle. Skipping in the jungle. We're not afraid. We're not afraid. Skipping in the jungle. Skipping in the jungle. We're not afraid. We're not afraid. One step. Two steps. Three steps forward. One step. Two steps. Three steps back. Stop. Listen. What's that? It's a tiger! RUN! ***** Song: Walking In The Jungle CD: Super Simple Songs - Animals Music: Super Simple Learning Vocals: Devon Thagard and Shelly Lomonaco ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** "Walking In The Jungle" by Super Simple Learning
Rock Scissors Paper #1 | Finger Play Song | Super Simple Songs
Rock Scissors Paper #1 | Finger Play Song | Super Simple Songs Rock Scissors Paper, Rock Scissors Paper, 1,2,3...play with me! Put your hands together for a fun and creative fingerplay song for kids. What is it? ***** Get the song: iTunes: http://bit.ly/RockScissorsPaper1_iTunes Amazon: http://bit.ly/SSS2_Amazon ***** Music: Traditional Adapted Lyrics: Copyright 2006, 2014 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ***** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ***** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ***** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ***** Lyrics: Rock, scissors, paper. Rock, scissors, paper. One, two, three. Play with me. Right hand PAPER! Left hand PAPER! It's a butterfly! Rock, scissors, paper. Rock, scissors, paper. One, two, three. Play with me. Right hand ROCK! Left hand SCISSORS! It's a snail! Rock, scissors, paper. Rock, scissors, paper. One, two, three. Play with me. Right hand SCISSORS! Left hand SCISSORS! It's a crab! Rock, scissors, paper. Rock, scissors, paper. One, two, three. Play with me. Right hand PAPER! Left hand PAPER! Oh no! It's a lion! ***** Song: Rock Scissors Paper Fingerplay #1 CD: Super Simple Songs 2 Music: Super Simple Learning Vocals: Matt Stamm and Ingrind DuMosch DeHaan ***** We're Super Social, too! facebook: http://facebook.com/supersimpleofficial twitter: http://twitter.com/simplesongs pinterest: http://pinterest.com/simplesongs instagram: http://instagram.com/supersimpleofficial blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** "Rock Scissors Paper Fingerplay #1" by Super Simple Learning
Who Took The Candy? | Halloween Song | Super Simple Songs
Watch the full Super Simple Songs - Halloween DVD here: https://www.youtube.com/watch?v=Se4e4... It's "Who Took The Cookie?" with a super simple Halloween twist! Find out who took the candy with this chant. Get the Super Simple Songs - Halloween DVD: http://bit.ly/SuperSimpleSongsHallowe... Get the song: iTunes: http://bit.ly/WhoTookTheCandy_iTunes Amazon: http://bit.ly/SuperSimpleSongsHallowe... ****** Music and Lyrics: Copyright 2009 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** Thank you very much for watching and sharing. We upload new videos every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, Books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Who took the candy from the trick-or-treat bag? The monster took the candy from the trick-or-treat bag. Who me? Yes, you! Not me! Then who? The ghost! Who took the candy from the trick-or-treat bag? The ghost took the candy from the trick-or-treat bag. Who me? Yes, you! Not me! Then who? The witch! Who took the candy from the trick-or-treat bag? The witch took the candy from the trick-or-treat bag. Who me? Yes, you! Not me! Then who? The pirate! Who took the candy from the trick-or-treat bag? The pirate took the candy from the trick-or-treat bag. Who me? Yes, you! Not me! Then who? The vampire! Who took the candy from the trick-or-treat bag? The vampire took the candy from the trick-or-treat bag. Who me? Yes, you! Okay, okay... I took the candy. ***** Song: Who Took The Candy? CD: Super Simple Learning - Halloween Music: Super Simple Learning Animation: Franfou Vocals: Leah Frederick, Josh Lomonaco, Shelly Lomonaco ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** "Who Took The Candy?" by Super Simple Learning
How Many Fingers? | Kids Songs | Super Simple Songs
► How Many Fingers is a super simple kids song to practice counting with your fingers and toes! Sing along with the friendly monsters 😬 ► Watch 60 minutes of our greatest hits here→ https://youtu.be/wk4KHNJjpjQ?list=PLdkj6XH8GYPRl_m3IIFfeYBK3cs3X4Bkr ► Subscribe for more Super Simple kids songs→ https://www.youtube.com/c/supersimplesongs?sub_confirmation=1 With friendly monsters, this video is a great choice for a non-scary Halloween-month lesson! ***** Lyrics: How many fingers on one hand? How many fingers on one hand? How many fingers on one hand? Let's all count together. 1, 2, 3, 4, 5 1, 2, 3, 4, 5 1, 2, 3, 4, 5 1, 2, 3, 4, 5 How many fingers on two hands? How many fingers on two hands? How many fingers on two hands? Let's all count together. 1, 2, 3, 4, 5 6, 7, 8, 9, 10 1, 2, 3, 4, 5 6, 7, 8, 9, 10 Clap clap clap your hands. X X X X X Clap clap clap your hands. X X X X X Clap clap clap your hands. X X X X X Clap your hands with me. X X X X X (Let’s count our toes) How many toes on one foot? How many toes on one foot? How many toes on one foot? Let's all count together. 1, 2, 3, 4, 5 1, 2, 3, 4, 5 1, 2, 3, 4, 5 1, 2, 3, 4, 5 How many toes on two feet? How many toes on two feet? How many toes on two feet? Let's all count together. 1, 2, 3, 4, 5 6, 7, 8, 9, 10 1, 2, 3, 4, 5 6, 7, 8, 9, 10 Stomp stomp stomp your feet. X X X X X Stomp stomp stomp your feet. X X X X X Stomp stomp stomp your feet. X X X X X Stomp your feet with me. X X X X X 1, 2, 3, 4, 5 6, 7, 8, 9, 10 ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company.
Apples & Bananas | Super Simple Songs
Apples 🍎 & Bananas 🍌 is a super fun family and classroom song that is great for introducing English vowel sounds. Ballet dancing bananas, twirling apples, and lots of silly fun! Join our friendly monster friends and sing along! PARENTS AND TEACHERS: Thank you so much for watching Super Simple Songs with your families and/or students. If your young ones are watching without supervision, we recommend some of the following viewing options: ► YOUTUBE KIDS -- https://www.youtube.com/yt/kids/ Designed to make it safer and simpler for young ones to watch online video, YouTube Kids includes a suite of parental controls so you can tailor the experience to suit your family’s needs. ► DOWNLOAD -- https://shop.supersimpleonline.com Videos from all Super Simple channels are available for purchase at the Super Simple online shop. You can also find some DVDs there. ► AMAZON VIDEO Are you an Amazon Prime member? Watch Super Simple videos ad-free on Amazon Prime Video. Just search for “Super Simple.” ► KHAN ACADEMY KIDS -- https://www.khanacademy.org/kids Super Simple has partnered with Khan Academy on their latest app designed for preschoolers. You’ll find Super Simple Songs worked into the curriculum throughout the app. ► PLAYKIDS -- https://playkids.com/ Do you have the PlayKids app? You can find many of our Super Simple Songs and programs in the app! FREE SUPER SIMPLE TEACHING RESOURCES: https://www.supersimple.com SOCIAL MEDIA: Facebook: http://www.facebook.com/supersimplele... Instagram: http://instagram.com/supersimpleofficial Pinterest: http://pinterest.com/SimpleSongs Twitter: http://www.twitter.com/simplesongs LYRICS: I like to eat, eat, eat apples and bananas. I like to eat, eat, eat apples and bananas. I like to eat, eat, eat apples and bananas. I like to eat, eat, eat apples and bananas. Now let’s make a long “a” sound - ay-ples and ba-nay-nays I like to ate, ate, ate ay-ples and ba-nay-nays I like to ate, ate, ate ay-ples and ba-nay-nays Let’s try a long “e” sound… ee-ples and ba-nee-nees I like to eat, eat, eat ee-ples and ba-nee-nees I like to eat, eat, eat ee-ples and ba-nee-nees How about a long “i” sound… i-ples and ba-nigh-nighs I like to ite, ite, ite i-ples and ba-nigh-nighs I like to ite, ite, ite i-ples and ba-nigh-nighs Great, let’s sing it with a long “o” sound...oh-ples and ba-no-nos I like to ote, ote, ote oh-ples and ba-no-nos I like to ote, ote, ote oh-ples and ba-no-nos I know let’s make an “oo” sound...oo-ples and ba-noo-noos I like to oot, oot, oot, oopples and ba-noo-noos I like to oot, oot, oot, oopples and ba-noo-noos Last one...apples and bananas! I like to eat, eat, eat apples and bananas. I like to eat, eat, eat apples and bananas. I like to eat, eat, eat apples and bananas. I like to eat, eat, eat apples and bananas. ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company.
Make A Circle - Teaching Tips
“Make A Circle” is one of our favorite classroom songs! At the end of the song, everyone is seated and ready for circle time. We visited MILK English (http://www.milkenglish.com) in Seoul, Korea. All the kids wore "Hanbok" (traditional Korean clothing) and we had a great time singing songs together. Thanks very much to everyone at MILK English! Buy the song/CD on Amazon: http://www.amazon.com/gp/product/B00J... or iTunes: https://itunes.apple.com/us/album/sup... For more songs, videos, and other teaching resources, visit http://www.supersimplelearning.com Lyrics: ♫ Time to make a circle. Make a circle, big, big, big. small, small, small. Big, big, big. Make a circle, small, small, small. Hello, hello, hello. Make a circle, round and round. Round and round. Round and round. Make a circle, round and round. Hello, hello, hello. Make a circle, up, up, up. down, down, down. Up, up, up. Make a circle, down, down, down. Now sit down. ♫ ***** Song: Make A Circle - http://supersimplelearning.com/songs/... Album: Super Simple Songs 1 We're Super Social, too! facebook: http://facebook.com/supersimpleofficial twitter: http://twitter.com/simplesongs pinterest: http://pinterest.com/simplesongs blog: http://supersimplelearning.com/blog
BINGO | Super Simple Songs
We've added a Super Simple twist to "BINGO" by adding actions other than just "clap." We hope you like it! ****** Music: Traditional Adapted Lyrics: Copyright 2007, 2014 Super Simple Learning® Video: Copyright 2011 Super Simple Learning® ****** Thank you very much for watching and sharing ^_^ ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ***** Lyrics: There was a farmer had a dog. and Bingo was his name-o. B-I-N-G-O, B-I-N-G-O, B-I-N-G-O And Bingo was his name-o. Clap! There was a farmer had a dog. and Bingo was his name-o. *-I-N-G-O, *-I-N-G-O, *-I-N-G-O And Bingo was his name-o. (* = clap) Pat your legs! There was a farmer had a dog and Bingo was his name-o. *-*-N-G-O, *-*-N-G-O, *-*-N-G-O And Bingo was his name-o. (* = pat your legs) Pat your tummy! There was a farmer had a dog and Bingo was his name-o. *-*-*-G-O, *-*-*-G-O, *-*-*-G-O And Bingo was his name-o. (* = pat your tummy) Pat your head! There was a farmer had a dog and Bingo was his name-o. *-*-*-*-O, *-*-*-*-O, *-*-*-*-O And Bingo was his name-o. (* = pat your head) Jump! There was a farmer had a dog and Bingo was his name-o. *-*-*-*-*, *-*-*-*-*, *-*-*-*-* And Bingo was his name-o. (* = jump) There was a farmer had a dog and Bingo was his name-o. B-I-N-G-O, B-I-N-G-O, B-I-N-G-O And Bingo was his name-o. ****** Song: BINGO (Play With It) CD: Super Simple Songs 3 Music: Super Simple Learning Animation: Franfou Vocals: Matt Stamm ****** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ****** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** "BINGO" by Super Simple Learning
This Is The Way We Get Dressed | Kids Songs | Super Simple Songs
It's time to get dressed! Learn to put on your clothes with this super fun kids song, This Is The Way We Get Dressed! Put on your t-shirt, put on your pants, button your shirt, put on your socks, tie your shoes, and zip up your jacket as you sing along with this getting dressed song. PARENTS AND TEACHERS: Thank you so much for watching Super Simple Songs with your families and/or students. If your young ones are watching without supervision, we recommend some of the following viewing options: ► YOUTUBE KIDS -- http://bit.ly/You-Tube-Kids Designed to make it safer and simpler for young ones to watch online video, YouTube Kids includes a suite of parental controls so you can tailor the experience to suit your family’s needs. ► DOWNLOAD -- http://bit.ly/SuperSimpleShop Videos from all Super Simple channels are available for purchase at the Super Simple online shop. You can also find some DVDs there. ► AMAZON VIDEO Are you an Amazon Prime member? Watch Super Simple videos ad-free on Amazon Prime Video. Just search for “Super Simple.” ► KHAN ACADEMY KIDS -- http://bit.ly/KhanKids-App Super Simple has partnered with Khan Academy on their latest app designed for preschoolers. You’ll find Super Simple Songs worked into the curriculum throughout the app. ► PLAYKIDS -- http://bit.ly/Play-Kids Do you have the PlayKids app? You can find many of our Super Simple Songs and programs in the app! FREE SUPER SIMPLE TEACHING RESOURCES: http://bit.ly/SSFree-Resources SOCIAL MEDIA: Super Simple Newsletter Sign Up: http://bit.ly/SuperSimpleSignUp Facebook: http://bit.ly/SuperSimpleFacebook Instagram: http://bit.ly/SuperSimpleInsta Twitter: http://bit.ly/SuperSimpleTwitter Pinterest: http://bit.ly/SuperSimplePinterest Lyrics: This is the way we put on our t-shirt. Put on our t-shirt, put on our t-shirt. This is the way we put on our t-shirt We get dressed every day This is the way we put on our pants Put on our pants, put on our pants This is the way we put on our pants We get dressed every day This is the way we button our shirt Button our shirt, button our shirt This is the way we button our shirt We get dressed every day This is the way we put on our socks Put on our socks, put on our socks This is the way we put on our socks We get dressed every day This is the way we tie our shoes Tie our shoes, tie our shoes This is the way we tie our shoes We get dressed every day This is the way we zip up our jacket Zip up our jacket, zip up our jacket This is the way we zip up our jacket We get dressed every day ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. #nurseryrhymes #kidssongs #childrensmusic #supersimplesongs
One Little Finger | featuring Noodle & Pals | Super Simple Songs
It's the classic kids song "One Little Finger" made SIMPLE for young learners! This is a fantastic song for learning and reviewing the names of parts of the body. ****** Music: Traditional Adapted Lyrics: Copyright 2005, 2014 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and more at https://www.supersimple.com ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: One little finger, one little finger, one little finger. Tap tap tap. Point your finger up. Point your finger down. Put it on your head. Head! One little finger, one little finger, one little finger. Tap tap tap. Point your finger up. Point your finger down. Put it on your nose. Nose! One little finger, one little finger, one little finger. Tap tap tap. Point your finger up. Point your finger down. Put it on your chin. Chin! One little finger, one little finger, one little finger. Tap tap tap. Point your finger up. Point your finger down. Put it on your arm. Arm! One little finger, one little finger, one little finger. Tap tap tap. Point your finger up. Point your finger down. Put it on your leg. Leg! One little finger, one little finger, one little finger. Tap tap tap. Point your finger up. Point your finger down. Put it on your foot. Foot! Put it on your leg. Leg! Put it on your arm. Arm! Put it on your chin. Chin! Put it on your nose. Nose! Put it on your head. Head! Now let's wave goodbye. Goodbye! ***** Song: One Little Finger CD: Super Simple Songs 1 Music: Super Simple Learning Animation: Aaron Stewart Vocals: Matt Stamm and Leah Hays ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** One Little Finger by Super Simple Learning
The Alphabet Is So Much Fun | Kids Songs | Super Simple Songs
Singing a super jazzy ABC Song, it's the next contestant on Alphabet Idol! Subscribe for more children's songs ► http://bit.ly/2r8pNcF Watch more Super Simple Songs ► http://bit.ly/2rCt6XU Lyrics: A, B, C, D E, F, G H, I, J, K L, M, N, O, P Q, R, S T, U, V W, X, Y, & Z A, B, C, D E, F, G H, I, J, K L, M, N, O, P Q, R, S T, U, V W, X, Y, & Z The alphabet is so much fun I love to sing with everyone Now I know my ABCs Next time won’t you sing with me A, B, C, D E, F, G H, I, J, K L, M, N, O, P Q, R, S T, U, V W, X, Y, & Z ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets in the Super Simple Learning Resource Center: http://supersimplelearning.com/resource-center/ ***** We're Super Social, too! facebook: http://facebook.com/supersimpleofficial twitter: http://twitter.com/simplesongs pinterest: http://pinterest.com/simplesongs instagram: http://instagram.com/supersimpleofficial blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. #nurseryrhymes #kidssongs #childrensmusic #supersimplesongs
What's Your Name? | featuring Noodle & Pals | Super Simple Songs
Get up and move with Noodle & Pals on this greetings song for kids, What's Your Name?! 🎶Hello, Hello, What’s your name? My name is Noodle. My name is Blossom. Nice to meet you 🎶 PARENTS AND TEACHERS: Thank you so much for watching Super Simple Songs with your families and/or students. If your young ones are watching without supervision, we recommend some of the following viewing options: ► YOUTUBE KIDS -- http://bit.ly/You-Tube-Kids Designed to make it safer and simpler for young ones to watch online video, YouTube Kids includes a suite of parental controls so you can tailor the experience to suit your family’s needs. ► DOWNLOAD -- http://bit.ly/SuperSimpleShop Videos from all Super Simple channels are available for purchase at the Super Simple online shop. You can also find some DVDs there. ► AMAZON VIDEO Are you an Amazon Prime member? Watch Super Simple videos ad-free on Amazon Prime Video. Just search for “Super Simple.” ► KHAN ACADEMY KIDS -- http://bit.ly/KhanKids-App Super Simple has partnered with Khan Academy on their latest app designed for preschoolers. You’ll find Super Simple Songs worked into the curriculum throughout the app. ► PLAYKIDS -- http://bit.ly/Play-Kids Do you have the PlayKids app? You can find many of our Super Simple Songs and programs in the app! FREE SUPER SIMPLE TEACHING RESOURCES: http://bit.ly/SSFree-Resources SOCIAL MEDIA: Super Simple Newsletter Sign Up: http://bit.ly/SuperSimpleSignUp Facebook: http://bit.ly/SuperSimpleFacebook Instagram: http://bit.ly/SuperSimpleInsta Twitter: http://bit.ly/SuperSimpleTwitter Pinterest: http://bit.ly/SuperSimplePinterest Lyrics: Hello, Hello, What’s your name? Hello, Hello, What’s your name? My name is Noodle. My name is Blossom. Nice to meet you. Hello, Hello, What’s your name? Hello, Hello, What’s your name? My name is Cheesy. My name is Broccoli. Nice to meet you. Hello, Hello, What’s your name? Hello, Hello, What’s your name? My name is Jelly. My name is Kernel. Nice to meet you! Let’s be friends! ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. #nurseryrhymes #kidssongs #childrensmusic #supersimplesongs
Five Little Ducks | Kids Songs | Super Simple Songs
One of our favorite kids songs! ""Five little ducks went out one day, over the hill and far away..."" 🎶 🎬 Watch 60 minutes of our greatest hits here→ https://youtu.be/wk4KHNJjpjQ?list=PLdkj6XH8GYPRl_m3IIFfeYBK3cs3X4Bkr ❤️ Subscribe for more Super Simple kids songs→ https://www.youtube.com/c/supersimplesongs?sub_confirmation=1 ***** Lyrics: Five little ducks went out one day Over the hill and far away Mother duck said, "Quack, quack, quack, quack" But only four little ducks came back 1, 2, 3, 4 Four little ducks went out one day Over the hill and far away Mother duck said, "Quack, quack, quack, quack" But only three little ducks came back 1, 2, 3 Three little ducks went out one day Over the hill and far away Mother duck said, "Quack, quack, quack, quack" But only two little ducks came back 1, 2 Two little ducks went out one day Over the hill and far away Mother duck said, "Quack, quack, quack, quack" But only one little duck came back 1 One little duck went out one day Over the hill and far away Mother duck said, "Quack, quack, quack, quack" But none of the five little ducks came back Sad mother duck went out one day Over the hill and far away Mother duck said, "Quack, quack, quack, quack" And all of five little ducks came back Five little ducks went out to play Over the hill and far away Mother duck said, “Quack, quack, quack, quack" And all of the five little ducks came back! ****** Copyright 2016 Skyship Entertainment Company ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company.
The Pinocchio | Nursery Rhymes | Super Simple Songs
For more nursery rhymes and kids songs from Super Simple Learning, subscribe to Super Simple Songs here: http://bit.ly/SSSYTsubscribe Everybody in...it's time to get up and moving with The Pinocchio! *** A note about LEFT & RIGHT. We create kids song and nursery rhyme videos for teachers and parents to share primarily with very young learners (Pre-K and younger.) Those young learners, when dancing along with the video will almost always mirror the actions in the video. So you'll notice that, like an aerobics teacher leading a class, the characters in the video mirror their actions so it's easy to dance along with. iTunes: http://bit.ly/ThePinocchio_iTunes Amazon: http://bit.ly/SuperSimpleSongs3_Amazon ****** Music: Traditional Adapted Lyrics: Copyright 2007, 2014 Super Simple Learning® Video: Copyright 2015 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Everybody in. Everybody out. Everybody turn around. Everybody shout, "Hey!" Everybody ready? Here we go. Let's do The Pinocchio. Right arm! Everybody in. Everybody out. Everybody turn around. Everybody shout, "Hey!" Everybody ready? Here we go. Let's do The Pinocchio. Right arm! Left arm! Everybody in. Everybody out. Everybody turn around. Everybody shout, "Hey!" Everybody ready? Here we go. Let's do The Pinocchio. Right arm! Left arm! Right leg! Everybody in. Everybody out. Everybody turn around. Everybody shout, "Hey!" Everybody ready? Here we go. Let's do The Pinocchio. Right arm! Left arm! Right leg! Left leg! Everybody in. Everybody out. Everybody turn around. Everybody shout, "Hey!" Everybody ready? Here we go. Let's do The Pinocchio. Right arm! Left arm! Right leg! Left leg! Chin up! Everybody in. Everybody out. Everybody turn around. Everybody shout, "Hey!" Everybody ready? Here we go. Let's do The Pinocchio. Right arm! Left arm! Right leg! Left leg! Chin up! Turn around! Everybody in. Everybody out. Everybody turn around. Everybody shout, "Hey!" Everybody ready? Here we go. Let's do The Pinocchio. Right arm! Left arm! Right leg! Left leg! Chin up! Turn around! Sit down! ***** Song: The Pinocchio CD: Super Simple Songs 3 Music: Super Simple Learning Vocals: Matt Stamm and Ingrid DuMosch DeHaan ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** The Pinocchio by Super Simple Learning
Over The Deep Blue Sea | Kids Songs | Super Simple Songs
Learn all about the weather (sunny, windy, rainy, snowy, stormy) with this super fun song for kids. 🎶 We’re going this way, that way. Forwards, backwards. Up and down, up and down. Over the deep blue sea.🎶 PARENTS AND TEACHERS: Thank you so much for watching Super Simple Songs with your families and/or students. If your young ones are watching without supervision, we recommend some of the following viewing options: ► YOUTUBE KIDS -- http://bit.ly/You-Tube-Kids Designed to make it safer and simpler for young ones to watch online video, YouTube Kids includes a suite of parental controls so you can tailor the experience to suit your family’s needs. ► DOWNLOAD -- http://bit.ly/SuperSimpleShop Videos from all Super Simple channels are available for purchase at the Super Simple online shop. You can also find some DVDs there. ► AMAZON VIDEO Are you an Amazon Prime member? Watch Super Simple videos ad-free on Amazon Prime Video. Just search for “Super Simple.” ► KHAN ACADEMY KIDS -- http://bit.ly/KhanKids-App Super Simple has partnered with Khan Academy on their latest app designed for preschoolers. You’ll find Super Simple Songs worked into the curriculum throughout the app. ► PLAYKIDS -- http://bit.ly/Play-Kids Do you have the PlayKids app? You can find many of our Super Simple Songs and programs in the app! FREE SUPER SIMPLE TEACHING RESOURCES: http://bit.ly/SSFree-Resources SOCIAL MEDIA: Super Simple Newsletter Sign Up: http://bit.ly/SuperSimpleSignUp Facebook: http://bit.ly/SuperSimpleFacebook Instagram: http://bit.ly/SuperSimpleInsta Twitter: http://bit.ly/SuperSimpleTwitter Pinterest: http://bit.ly/SuperSimplePinterest LYRICS: ‘Twas a sunny day when I went to play down by the sea. I climbed aboard a pirate ship and the Captain said to me, “We’re going this way, that way. Forwards, backwards. Up and down, up and down. Over the deep blue sea.” ‘Twas a windy day when I went to play down by the sea. I climbed aboard a pirate ship and the Captain said to me, “We’re going this way, that way. Forwards, backwards. Up and down, up and down. Over the deep blue sea.” ‘Twas a rainy day when I went to play down by the sea. I climbed aboard a pirate ship and the Captain said to me, “We’re going this way, that way. Forwards, backwards. Up and down, up and down. Over the deep blue sea.” ‘Twas a snowy day when I went to play down by the sea. I climbed aboard a pirate ship and the Captain said to me, “We’re going this way, that way. Forwards, backwards. Up and down, up and down. Over the deep blue sea.” ‘Twas a stormy day when I went to play down by the sea. I climbed aboard a pirate ship and the Captain said to me, “We’re going this way, that way. Forwards, backwards. Up and down, up and down. Over the deep blue sea.” “This way, that way. Forwards, backwards. Up and down, up and down. Over the deep blue sea.” “This way, that way. Forwards, backwards. Up and down, up and down. Over the deep blue sea.” ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. #nurseryrhymes #kidssongs #childrensmusic #supersimplesongs #pirates #pirateday #talklikeapirateday #talklikeapirate
Go Away, Spooky Goblin! | Spooky Simple Song
Which is your favorite character in this Halloween song for kids? Goblin, spider, skeleton, or bat? Created for ages 3+ Watch the full Super Simple Songs - Halloween DVD here: https://www.youtube.com/watch?v=Se4e4... Buy the Super Simple Songs - Halloween DVD: http://bit.ly/SuperSimpleSongsHallowe... Get the song: iTunes: http://bit.ly/GoAwaySpookyGoblin_iTunes Amazon: http://bit.ly/SuperSimpleSongsHallowe... ****** Music: Traditional Adapted Lyrics: Copyright 2009, 2014 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** Thank you very much for watching and sharing. We upload new videos every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, Books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Go away, spooky goblin, go away. Go away! Go away, spooky goblin, go away. Go away! Go away, spooky goblin. Go away, spooky goblin. Go away, spooky goblin, go away. Go away! Go away, scary spider, go away. Go away! Go away, scary spider, go away. Go away! Go away, scary spider. Go away, scary spider. Go away, scary spider, go away. Go away! Go away, spooky skeleton, go away. Go away! Go away, spooky skeleton, go away. Go away! Go away, spooky skeleton. Go away, spooky skeleton. Go away, spooky skeleton, go away. Go away! Go away, scary bat, go away. Go away! Go away, scary bat, go away. Go away! Go away, scary bat. Go away, scary bat. Go away, scary bat, go away. Go away! ***** Song: Go Away, Spooky Goblin! CD: Super Simple Songs - Halloween Music: Super Simple Learning Vocals: Leah Frederick ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Go Away, Spooky Goblin! by Super Simple Learning
The Wheels On The Bus | Super Simple Songs
Subscribe for more Kids Songs! ► http://bit.ly/2r8pNcF Watch ALL Super Simple Songs ► http://bit.ly/2rCt6XU It's the classic kids song, "The Wheels On The Bus," made super simple! Ride along with our friendly bus driver as the wheels go round and round! ***** Music: Copyright 2006, 2014 Super Simple Learning® Adapted Lyrics: Copyright 2006, 2014 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ***** Young learners with developing language skills sometimes have difficulty with "extra" language in a song. In this version of "The Wheels On The Bus," we wanted to focus on the key vocabulary that is the most fun to gesture. Get free resources (flashcards, worksheets, coloring sheets, games) for this and other songs at the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Lyrics: The wheels on the bus go round and round. Round and round. Round and round. The wheels on the bus go round and round. Round and round. The door on the bus goes open and shut. Open and shut. Open and shut. The door on the bus goes open and shut. Open and shut. The wipers on the bus go swish swish swish. Swish swish swish. Swish swish swish. The wipers on the bus go swish swish swish. Swish swish swish. The horn on the bus goes beep beep beep. Beep beep beep. Beep beep beep. The horn on the bus goes beep beep beep. Beep beep beep. The people on the bus go up and down. Up and down. Up and down. The people on the bus go up and down. Up and down. The babies on the bus go wah wah wah. Wah wah wah. Wah wah wah. The babies on the bus go wah wah wah. Wah wah wah. The mommies on the bus go, "Shhh shhh shhh." "Shhh shhh shhh. Shhh shhh shhh." The daddies on the bus go, "Shhh shhh shhh. Shhh shhh shhh." ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** The Wheels On The Bus by Super Simple Learning
Peekaboo | Original Children's Song | Peek-a-boo Song for Kids | Let's play Peek A Boo!
Peek-a-boo! We see you! And we hope you'll sing the peekaboo song with us! Where is kitty cat hiding? Can you find her? Let's play peek a boo! ❤️ Subscribe for more Super Simple kids songs → https://www.youtube.com/c/supersimplesongs?sub_confirmation=1 ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets in the Super Simple Learning Resource Center: http://supersimplelearning.com/resource-center/ ***** We're Super Social, too! facebook: http://facebook.com/supersimpleofficial twitter: http://twitter.com/simplesongs pinterest: http://pinterest.com/simplesongs instagram: http://instagram.com/supersimpleofficial blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Skyship Entertainment Company. #nurseryrhymes #kidssongs #childrensmusic #supersimplesongs
I See Something Blue | Colors Song for Children
Sing along to your favorite Super Simple color song for kids! 🎶Blue. Yellow. Red. Purple. I see colors everywhere 🎶 Subscribe ► http://bit.ly/2r8pNcF Super Simple Songs Playlist ► http://bit.ly/2rCt6XU iTunes: http://bit.ly/ISeeSomethingBlue_iTunes Amazon: http://bit.ly/SuperSimpleSongs1_Amazon ****** Music & Lyrics: Copyright 2005, 2014 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** "I See Something Blue" is a super simple, super fun colors song for kids. Time for a family road trip! Playing the "I See Something Blue" game is a great way to pass the time and talk about all of the things you see around you. Look for blue, yellow, red, and purple objects with the family as they drive through the countryside. Play the "I See Something Blue" game at home or in the classroom by looking around the room between verses to find and identify items in different colors. ****** Thank you very much for watching and sharing ^_^ We upload new videos every Wednesday! To make sure you get our latest, subscribe here: http://bit.ly/SSSYTsubscribe ****** If you like this video, check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, books, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Blue! I see something blue. Blue! I see something blue. Blue, blue, blue, blue... I see something blue. Find something blue! Yellow! I see something yellow. Yellow! I see something yellow. Yellow, yellow... I see something yellow. Find something yellow! Red! I see something red. Red! I see something red. Red, red, red, red... I see something red. Find something red! Purple! I see something purple. Purple! I see something purple. Purple, purple... I see something purple. Find something purple! Blue. Yellow. Red. Purple. I see colors everywhere. ***** Song: I See Something Blue CD: Super Simple Songs 1 Music: Super Simple Learning Vocals: Matt Stamm ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ****** "I See Something Blue" by Super Simple Learning
Trick Or Treat | Give Me Something Good To Eat | Halloween Song
Trick or Treat?! Learn about all kinds of foods with this simple Halloween song from Super Simple Songs! Visit http://supersimplelearning.com/hallow... for Halloween songs, games, party ideas, lesson plans, picture cards, worksheets, and more! iTunes: http://bit.ly/GoodToEat_iTunes Amazon: http://bit.ly/SuperSimpleSongsHallowe... ****** Music: Traditional Lyrics: Copyright 2009 Super Simple Learning® Video: Copyright 2014 Super Simple Learning® ****** If you like this video, we recommend you check out the Super Simple Songs Playlist featuring dozens of easy-to-teach, easy-to-learn, super fun songs: http://youtu.be/yCjJyiqpAuU?list=PL02... ****** Get FREE resources like coloring sheets, games, flashcards, and worksheets for this song and all of our others in the Super Simple Learning Resource Center: http://supersimplelearning.com/resour... ****** Like this song? Check out our award-winning collection of CDs, DVDs, and more at http://supersimplelearning.com/shop/ ****** Lyrics: Trick or treat? Trick or treat? Give me something good to eat. Apples, peaches, tangerines. Happy Happy Halloween. Trick or treat? Trick or treat? Give me something sweet to eat. Cookies, chocolate, jelly beans. Happy Happy Halloween. Trick or treat? Trick or treat? Give me something sour to eat. Lemons, grapefruits, limes so green. Happy Happy Halloween. Trick or treat? Trick or treat? Give me something good to eat. Nuts and candy. Lollipops. Now it's time for us to stop. ***** Song: Give Me Something Good To Eat CD: Super Simple Songs - Halloween Music: Super Simple Learning Vocals: Leah Frederick ***** We're Super Social, too! Google+: http://google.com/+supersimplesongs facebook: http://facebook.com/supersimpleofficial Twitter: http://twitter.com/simplesongs Pinterest: http://pinterest.com/simplesongs Instagram: http://instagram.com/supersimpleofficial Blog: http://supersimplelearning.com/blog ***** Super Simple Songs® and Super Simple Learning® are registered trademarks of Super Simple Learning, Inc. ***** Give Me Something Good To Eat by Super Simple Learning
|
cc/2019-30/en_middle_0059.json.gz/line186
|
__label__cc
| 0.570154
| 0.429846
|
Natasha Bedingfield Announces Lead Single “Roller Skate” Out On Friday
See Avril Lavigne’s Gorgeous “I Fell In Love With The Devil” Music Video
BANKS Shares Hazy New ‘III’ Song, “Contaminated”
Is Green Day Releasing A New Single Next Week?!?
The All-American Rejects Announce “Send Her To Heaven” EP & Video
Hidden Jams
The backstage pass to your favorite music
About Hidden Jams
About Song Registration
Song Previews
Unreleased Songs
Making the Album
BANKS – III
Editors – Greatest Hits Album
Ellie Goulding – 4th Studio Album
Evanescence – 4th Studio Album
Garbage – 7th Studio Album
Green Day – 13th Studio Album
Hilary Duff – 5th Studio Album
Kelly Clarkson – 8th Studio Album
Lana Del Rey – Norman Fucking Rockwell
Natasha Bedingfield – 4th Album
Simple Plan – 6th Studio Album
Smith & Burrows – 2nd Studio Album
Vanessa Carlton – Love Is An Art
Tentative Track Lists
Natasha Bedingfield – 4th Studio Album
Album Announcements
New Films
Andrew McMahon In The Wilderness – Upside Down Flowers
Avril Lavigne – Head Above Water
Editors – Violence
Hoobastank – Push Pull
Janelle Monáe – Dirty Computer
Muse – Simulation Theory
The Longshot – Love Is For Losers
Sara Bareilles – Amidst The Chaos
Evanescence – Synthesis
Kelly Clarkson – Meaning Of Life
Music Matchup Monday
TunesDay
Welcome To… Wednesdays
Andrew McMahon In The Wilderness Listen Music News Singles
Andrew McMahon In The Wilderness Shares “Paper Rain” Ahead Of New Album
November 9, 2018 November 14, 2018 Hidden Jams 0 Comments Andrew McMahon, Andrew McMahon In The Wilderness, Blue Vacation, Canyon Moon, New Song, Ohio, Paper Rain, Teenage Rockstars, Upside Down Flowers
Two weeks ago, Andrew McMahon In The Wilderness debuted a brand new song, “Paper Rain,” live. Following “Ohio,” “Teenage Rockstars,” and “Blue Vacation,” it’s the fourth new song we’ve heard from his upcoming third album, Upside Down Flowers. Today, fans can hear the album version of the song, a full week before the record finally drops.
“Paper Rain” is a mid-tempo, atmospheric song that paints a story with beautiful imagery. The new audio offers a new side to the song than the live performance we first heard. The percussion is strong, a driving force like a train engine. Andrew’s voice has a distorted, echoed effect that lends “Paper Rain” a nostalgic vibe. This song sounds similar to “Canyon Moon” from the self-titled debut Andrew McMahon In The Wilderness album.
Listen to “Paper Rain” below:
“Paper Rain” appears on Andrew McMahon’s upcoming album, Upside Down Flowers, out on November 16th. It’s his third Wilderness album, following the 2014 self-titled debut and last year’s Zombies On Broadway.
You can pre-order the album on iTunes now and get instant downloads of “Ohio,” “Teenage Rockstars,” “Blue Vacation,” and “Paper Rain.” You should also check out the two special bundles available on the official Andrew McMahon In The Wilderness store. Find all pre-order options here.
After Upside Down Flowers comes out, you’ll also want to see Andrew McMahon In The Wilderness live. From January through March, the band will trek across the United States. Find tour dates and tickets now and get your spot while it’s still available!
Enjoy the new official audio of “Paper Rain,” and get ready for the rest of Upside Down Flowers, out in just one week on November 16th. Keep checking back here for all the latest Andrew McMahon In The Wilderness news.
Hidden Jams is a music blog for super fans. Check out our new merch store for all of us who love music. Click "Hidden Jams" above or the image on the left to see our store.
Latest posts by Hidden Jams (see all)
Natasha Bedingfield Announces Lead Single “Roller Skate” Out On Friday - July 15, 2019
See Avril Lavigne’s Gorgeous “I Fell In Love With The Devil” Music Video - July 15, 2019
BANKS Shares Hazy New ‘III’ Song, “Contaminated” - July 10, 2019
← Kelly Clarkson Soars On “Never Enough” From ‘The Greatest Showman’
Muse Celebrates ‘Simulation Theory’ Release With 3 New Music Videos →
Sound Off! Cancel reply
The All-American Rejects Announce "Send Her To Heaven" EP & Video
Natasha Bedingfield Shares Sneak Peek At New Song "Roller Skates"
See Avril Lavigne's Gorgeous "I Fell In Love With The Devil" Music Video
Upcoming Albums in 2019
* BANKS – III – July 12, 2019
* Tove Lo – Sunshine Kitty – September 2019
* Lana Del Rey – Norman Fucking Rockwell – Summer/Fall 2019
* Vanessa Carlton – Love Is An Art – Fall 2019
* Editors – Greatest Hits Album – Late 2019
Get Hidden Jams in Your Inbox
Select list(s): Monthly Newsletter Weekly Newsletter
Hidden Jams on Twitter
Hidden Jams on Avril Lavigne – Head Above Water
Dawn on Avril Lavigne – Head Above Water
ADG on Avril Lavigne Teases 3 New Songs: “Souvenir,” “Crush,” & “Goddess”
Hidden Jams on Two Hilary Duff Songs Leak: Hear “Wild Night Out” & “If I Fall”
Rafael Nunes on Two Hilary Duff Songs Leak: Hear “Wild Night Out” & “If I Fall”
Love our site? Please donate to help us keep it going!
Hidden Jams Store
Hidden Jams is a music blog for super fans. We provide fans with music news and secrets you can’t get anywhere else. Find insider details on new music for upcoming albums, unreleased tracks hidden in the back catalog, and the stories behind the songs you love. Hidden Jams is your backstage pass into your favorite artist’s music.
Categories Select Category Artists (965) Adele (3) Alicia Keys (4) Aloe Blacc (1) Amy Lee (20) Andrew McMahon (5) Andrew McMahon In The Wilderness (43) Avril Lavigne (77) BANKS (15) Billie Joe Armstrong (2) Bruno Mars (5) CHVRCHES (4) Coldplay (1) Crossfade (3) Dreamcar (2) Ed Sheeran (8) Ed Sloan (3) Editors (16) Ellie Goulding (19) Evanescence (32) Fall Out Boy (36) Florence + The Machine (7) Foster The People (2) Garbage (39) Gavin DeGraw (12) Ghost (22) Green Day (48) Gwen Stefani (41) Hayley Williams (2) Hilary Duff (52) Hoobastank (23) Jack’s Mannequin (1) Janelle Monáe (7) K’naan (1) Katy Perry (2) Kelly Clarkson (92) Lana Del Rey (36) Lindsey Stirling (1) Lorde (1) Matthew Bellamy (1) Metallica (2) Michelle Branch (6) Muse (38) Natasha Bedingfield (50) Neon Trees (1) No Doubt (15) OK Go (10) Opeth (1) Panic! At The Disco (5) Paramore (25) Patrick Stump (2) Pink (15) Sara Bareilles (39) Shakira (7) Simple Plan (18) Smith & Burrows (2) The All-American Rejects (22) The Longshot (5) The Weeknd (17) Tom Smith (2) Tove Lo (2) Vanessa Carlton (36) Behind The Music (6) Blogs (96) Album Of The Week (8) Blog (32) Music Matchup Monday (2) Picks Of The Month (10) Throwback Thursday (3) TunesDay: Tuesday Tunes (36) Welcome To… Wednesdays (6) Concert Review (1) Discover New Music (3) In The Studio (247) Music (598) Listen (424) Demos (20) Free Downloads (3) Live Recordings (28) New Tracks (24) Promo Singles (20) Singles (236) Song Previews (56) Watch (379) Behind The Scenes Videos (22) Fan Videos (1) Live Performances (55) Lyric Videos (74) Music Videos (220) Teaser Videos & Trailers (15) New Albums (35) New Businesses (2) New EPs (6) New Releases (204) Album Announcements (95) Interview (57) New Film (8) Reviews (40) News (892) Personal Life (9) Rumors (2) Songs Lists (3) Unreleased Songs (3) Website Update (2)
Archives Select Month July 2019 (6) June 2019 (20) May 2019 (17) April 2019 (27) March 2019 (15) February 2019 (23) January 2019 (10) December 2018 (14) November 2018 (16) October 2018 (27) September 2018 (12) August 2018 (10) July 2018 (11) June 2018 (12) May 2018 (14) April 2018 (20) March 2018 (14) February 2018 (17) January 2018 (10) December 2017 (1) November 2017 (15) October 2017 (16) September 2017 (27) August 2017 (16) July 2017 (6) June 2017 (21) May 2017 (38) April 2017 (27) March 2017 (33) February 2017 (22) January 2017 (20) December 2016 (9) November 2016 (15) October 2016 (19) September 2016 (20) August 2016 (13) July 2016 (8) June 2016 (9) May 2016 (9) April 2016 (10) March 2016 (9) February 2016 (14) January 2016 (14) December 2015 (9) November 2015 (9) October 2015 (19) September 2015 (21) August 2015 (13) July 2015 (5) June 2015 (16) May 2015 (12) April 2015 (10) March 2015 (10) February 2015 (16) January 2015 (21) December 2014 (27) November 2014 (14) October 2014 (20) September 2014 (17) August 2014 (31) July 2014 (29) June 2014 (23) May 2014 (27) April 2014 (3) March 2014 (1)
Copyright © 2019 Hidden Jams. All rights reserved.
|
cc/2019-30/en_middle_0059.json.gz/line187
|
__label__wiki
| 0.823768
| 0.823768
|
Long-Term Test: 2007 Hyundai Azera
Inside Line spent 12 months and 18,000 miles with the 2007 Hyundai Azera Limited. This is the most luxurious car from Korea yet, a front-wheel-drive sedan equipped with the kind of luxury amenities that used to be the exclusive signature of Lexus. The Azera looks the part, thanks to voluptuous sheet metal that makes you forget all about Hyundai's cheap-and-cheerful image. And yet the story of the Azera is all about value, just like every other Hyundai. Our long-term test taught us that there are both good and bad things about value.
Why We Bought It
Hyundai first introduced the 2006 Hyundai Azera as a replacement for the XG, the Korean company's previous luxury sedan. Based on the platform of the Hyundai Sonata, the Azera represented a kind of breakthrough in prestige for Hyundai. And when the 2007 Hyundai Azera arrived with a number of minor updates, we took the opportunity to add an example to our long-term fleet.
Our full test of the Azera made it clear that this sedan is the best bang for the buck in its segment. Of course, we've become accustomed to Hyundai's ability to deliver more for less in almost every vehicle category. The important question here for us would be to evaluate whether this strategy could be effective in a luxury vehicle. Could the Azera provide everything we expected of a luxury car, from features to ride quality? Reliability and durability are also part of the luxury-car equation, as the success of Lexus has demonstrated.
Would the 2007 Hyundai Azera lose its edge over the competition after its affordable-luxury recipe had been tested daily for 12 months? We would find out.
We wasted little time putting our new Hyundai to the test. High altitudes, desert heat and cold-weather testing were added to the driving agenda alongside daily commuting.
Senior Consumer Advice Editor Phil Reed was first in line. He set off across the desert and mountains from Los Angeles to Denver in the Hyundai over the middle of December. Snow fell heavily as he ascended to an elevation of 11,000 feet in Dillon, Colorado. Reed reported on the long-term blog pages, "We were creeping along at 5 or 10 mph when a tractor-trailer in front of us lost traction and drifted across our lane. I had to goose the 3.8-liter V6 and get into loose snow on the roadside to dodge it. It was pretty scary."
Reed made further notes in the logbook when he reached his destination. He wrote, "We spent a lot of time in the snow. The Michelin Energy MXV4 tires offered surprisingly good traction over the white stuff and felt unexpectedly poised on the ice. The Azera's stability control was working overtime, but didn't seem too intrusive. Ice built up in the wheelwells and made the tires rub noisily, but that's my only complaint. The Hyundai proved to be a more adequate snow car than I ever imagined."
Now that our Hyundai held its own in the cold and at high elevation, we sent it into the desert. Senior Editor Ed Hellwig was at the helm for this trip. He noted, "After an impressive first leg from Los Angeles to Phoenix, the Azera completed the return trip as smoothly. I didn't go light on it, yet when I made it home there was still nearly a quarter tank of gas left after the 408-mile trip. According to the computer, the Azera could have gone another 80 miles. That's some serious range."
Chief Road Test Editor Chris Walton is one of our drivers who specializes in instrumented testing, so he spends much of his time pushing the limits of vehicles. He is also a well-documented enthusiast of sport sedans and believes in car design that makes performance a priority. Yet after a long-distance drive in the Azera, Walton noted: "After a night in the Azera, I couldn't help but notice how my shoulders relaxed, my grip loosened (on the steering wheel) and my attitude changed within about five minutes. Maybe we've taken this sport sedan thing too far. Maybe I'm getting old. Maybe I should be quiet now."
Luxury details are strewn about the cabin of our Azera. From the faux-wood accents to top-stitched leather upholstery, the Hyundai Azera clearly is out to make an impression. At the same time, none of the practical aspects of luxury travel are forgotten, so there's a gigantic trunk and even a sunshade for the rear window.
There were hiccups in the presentation of the interior cabin, but the problems came as the result of our own lapse in judgment. Our decision to choose a beige interior was a mistake for a car that must endure daily abuse from a wide range of drivers, especially since the circumstances rarely encourage respectful treatment.
Significant wear on the floor mats and carpet was noticeable soon after the Azera arrived, and persisted throughout our term with the car. The interior was just too difficult to keep clean, and this went for the leather-upholstered seat as well. What began as a mysterious black smudge across the back of the driver seat (believed to be from someone's belt) resisted three attempts at cleansing with leather care products.
The stained interior also drew our attention to some other cosmetic issues we had with the Azera.Beyond the questionable choice of leather, we noticed some flaws in the dashboard, and door panel misalignments were also apparent. Stereo buffs among us were further disappointed by the performance of our Infinity sound system. For all its luxury, the Azera apparently remains a value-driven vehicle. The selection of lesser, slightly more affordable interior materials no doubt is cost-effective, but our test showed that these choices compromised our expectations of quality. The 2007 Hyundai Azera was far from the Toyota Avalon-style car the Hyundai XG had been, yet it didn't seem capable of being the Lexus from Korea that we had hoped for.
Yet however much we critiqued the quality of its presentation, the Azera never faltered mechanically. Prescribed maintenance called for service every 7,500 miles. We averaged a mere $65 per visit to our preferred dealer, Cormier Hyundai in Carson, California. Our only unscheduled visit followed the passenger side mirror falling off. To this day we don't know the cause, though we spent more than $600 to replace it.
Total Body Repair Costs: $642.93
Total Routine Maintenance Costs (over 12 months): $130.27
Additional Maintenance Costs: None
Warranty Repairs: Door molding replaced under warranty
Non-Warranty Repairs: Broken passenger side mirror assembly replaced
Scheduled Dealer Visits: 2
Unscheduled Dealer Visits: 1
Days Out of Service: 1
Breakdowns Stranding Driver: None
Performance and Fuel Economy
The Hyundai Azera performed with consistency, recording nearly identical results from its first test at 1,000 miles and its final test with the odometer showing more than 18,000 miles. We recorded a stopping distance of 123 feet from 60 mph during its final test. This marked a 9-foot improvement from a year earlier and the only significant change across the gamut of performance evaluations.
All things considered, the Azera's acceleration from a standing start was especially strong. We reached 60 mph in 6.8 seconds and the quarter-mile in 15.3 seconds at 93.8 mph. Chief Road Test Editor Chris Walton mentioned following the test, "It's not difficult to spin the front tires on an aggressive launch. Upshifts are quick and even feel as if the throttle is momentarily closed between gears to smooth out the surge of power."
As usual, dynamic tests consist of laps around the skid pad and a run through the slalom. On the skid pad, the Azera developed 0.78g of lateral force with significant understeer at its limit. This is a good number for the segment. Senior Road Test Editor Josh Jacquot tested the sedan during its final visit to the track. Upon recording 61 mph through the slalom, he proclaimed, "61 mph is slow. But man, the Azera isn't about being fast. No, it's about being smooth, like a fat man who can dance. I like this Korean Buick."
We entered the test expecting 19 mpg around town and 28 mpg on the highway. After 18,000 miles our 20-mpg average was on the low end of that range. On multiple occasions we reached 32 mpg, which exceeded any claims on the window sticker and showed it was possible to drive the Azera efficiently. We just didn't drive that way very often.
Best Fuel Economy: 32.4 mpg
Worst Fuel Economy: 12.4 mpg
Average Fuel Economy: 20.2 mpg
Retained Value
Edmunds' TMV® calculator values the Azera at $21,838 after 18,530 miles. This equates to 27 percent depreciation from its original MSRP and ranks it just behind its competitors in resale worth.
Our Toyota Camry depreciated by a similar 26 percent margin at the conclusion of its long-term test, although it had an additional 3,000 miles on the odometer.
True Market Value at service end: $21,838
Depreciation: $7,932 or 27 percent of original MSRP
Final Odometer Reading: 18,530
A year with the Azera reminded us that there are two sides to value. The bright side offers features unexpected from a car in this class, like rain-sensing wipers, automatic headlights and a rear window shade. On the dark side we find misaligned panels, material choices of questionable quality and poor stereo performance.
Nevertheless, the Azera's noteworthy performance and high feature content ultimately outweighed the evidence we found of the car's relatively inexpensive nature. It offers an affordable touch of luxury to the average four-door family sedan, not to mention a strong engine and comfortable ride. Twelve months of flawless mechanical performance also influenced our willingness to forgive its cosmetic flaws.
The 2007 Hyundai Azera made a positive impression on us, yet we're still not willing to think of it as a premium car. It's attractive and certainly as reliable as a Hyundai Sonata, but it doesn't yet have a character to call its own.
The manufacturer provided Edmunds this vehicle for the purposes of evaluation.
Hyundai Sonata Earns "Greener Choices of 2008" Hon...
Hyundai Cooks Up Quite a Tasty Midsize Morsel
Economical Hyundai Elantra PZEV is Best Value in M...
Sonata's Sunrise
Hyundai Veracruz Wins MotherProof.com Award as a T...
Up Close: Hyundai's New Navigation System
Hyundai Veracruz Earns 'Best New Family Vehicle' H...
Hyundai Sonata a Midsize Sedan for the Mass Market...
Hyundai Motor America Announces 2009 Sonata Pricin...
Fuel-Efficient 2009 Hyundai Elantra Touring Arrive...
2009 Sonata: Transformed From The Inside Out For A...
Long-term Weekend: 2008 Hyundai Veracruz
|
cc/2019-30/en_middle_0059.json.gz/line193
|
__label__cc
| 0.683862
| 0.316138
|
The Supreme Court did not agree to a plea for staying the hearing, scheduled for this Thursday, in the Allahabad High Court (HC) on the Reserve Bank of India’s (RBI’s) bankruptcy proceedings on stressed power sector assets.
Saying the hearing had progressed to a mature level, the two-judge SC bench headed by Justice Rohinton F Nariman turned down the request, from the RBI, to halt the HC process.
The RBI in a circular dated February 12 had mandated banks to classify even one day’s delay in debt servicing as default. Resolution proceedings on stressed accounts were to be completed in 180 days.
On a petition against this by the Independent Power Producers Association of India, the HC had directed the Union finance ministry to meet stakeholders in the sector and work on a possible solution within a month. The ministry did so, along with officials of the ministries of coal and power, and an RBI representative, on June 21.
In July, the central government had told the HC it wanted regulatory relief and time extension for close to a dozen power projects with debt exposure of around Rs 1 trillion, of a total of 34 stressed assets in the segment.
Also, in a report given to Parliament on Tuesday, Standing Committee on Energy has asked for “all out efforts” from stakeholders to see that a “genuine initiative is taken for resolution of stress”.
The report says the RBI did not consider the issues in the power sector while issuing a blanket clause in its February 12 order. “The RBI framework is ignorant of, as well as unmindful of, the prevailing reality of the electricity sector and that is why it addresses only the financial issues, ignoring the whole range of vital issues of the sector.”
The Union power ministry had requested the RBI, in a submission to the HC, to also increase the resolution period. It had suggested two schemes for resolution of financial stress in the sector. The first, termed SAMADHAN, came from State Bank of India and Power Finance Corporation, two institutions with the highest exposure to the power sector. The other was termed PARIWARTAN, from Rural Electrification Corporation.
It suggested setting up of an ‘Asset Restructuring Company (ARC)’. SAMADHAN entails identifying 10 assets and taking over ‘sustainable debt’; thereafter, selling the asset to some ARC. RBI, however, took a tough stance against a special dispensation to the power industry, saying this would invite similar representations from other sectors and lead to more litigation. The solution, it has told the HC, does not lie in “trying to mask the problem or compromising risk recognition and prudence”.
Source : Business Standard , August 8 ‘ 2018
Previous Post Govt ready to make further changes to IBC if needed, says official.
Next Post SUPREME COURT JUDGMENT IN JAYPEE CASE- FRESH CIRP TO INCLUDE HOME BUYERS
|
cc/2019-30/en_middle_0059.json.gz/line194
|
__label__cc
| 0.572684
| 0.427316
|
Video about black white oriental sex:
White Girls Kiss Asian Guys For The First Time on Valentine's Day (AMWF)
Black white oriental sex
Posted on 18.06.2018 18.06.2018 by Gugore
Origins[ edit ] A Western fetish for Asian things developed out of a European tradition of fascination with the East, and a history of othering the inhabitants of those regions. The Chinese Tanka females were sold from Guangzhou to work as prostitutes for the overseas Chinese male community in the United States. One thing should be made very clear to the girl who comes up to the city, and that is that the ordinary ice cream parlor is very likely to be a spider's web for her entanglement. Given the harsh conditions in Louisiana, persuading women to follow the men was not easy. Increased urbanization and young women entering the workforce led to greater flexibility in courtship without supervision. Slave breeding was the attempt by a slave-owner to influence the reproduction of his slaves for profit. Adultsearch is and always has been adamantly against illegal prostitution, all forms of sex trafficking, and all forms of child abuse worldwide. This term referred to women being kidnapped for the purposes of prostitution.
A new generation of Chinese women are educated to degree level But even at Stanford Business School, Ting feels that presumptions still linger, on a name: American men who may not have had preconceived notions about Asian women were drafted and sent to fight in Asia where they saw Asian women working in the sex industry. Butterfly , the writer David Henry Hwang , using the term "yellow fever", a pun on the disease of the same name , discusses white men with a "fetish" for east Asian women. One thing should be made very clear to the girl who comes up to the city, and that is that the ordinary ice cream parlor is very likely to be a spider's web for her entanglement. The TVPA strengthened services to victims of violence, law enforcements ability to reduce violence against women and children, and education against human trafficking. Continuous exhibition of such in mainstream media has led to the idea of the "Asian fetish". One of my friends of Hong Kong heritage put it best recently, perhaps, when talking about relationships involving Chinese women and Caucasian men. Merchants and administrators also followed this practice if they were wealthy enough. They all perceived Asian women to have submissive sex. But essentially, it told the actors to be patient. Over time, it also imported African female slaves. We only want adults that want to be here for entertainment fantasies and lawful activity. Lum described the stereotype associated with an Asian fetish as an obsession with seeking "somebody submissive, traditional, docile Furthermore, stereotypes around timidness, not being outspoken or politically active also mean people can make such comments with no backlash, she says. A scene from Miss Saigon Yet this portrayal epitomises what many see as a narrow perception of East Asian defined as Chinese, Japanese, Korean etc women. Take the 25th anniversary revival of Miss Saigon in the West End. This image persists today, along with the idea of Asian women being exotic and submissive. White male colonists, often the younger sons of noblemen, military men, and planters, who needed to accumulate some wealth before they could marry, took women of color as consorts before marriage. Bush took office in , restricting sex trafficking became one of his primary humanitarian efforts. In the professional world, Ting Jacqueline Chen, a year-old Oxford graduate, is also battling stereotypes. We are fully in support of all efforts to curtail illegal prostitution, sex trafficking and keeping children safe. Many of these girls were forced into opium addiction and lived their entire lives as prostitutes. Internationally, the TVPA set standards that governments of other countries must follow in order to receive aid from the U. An Asian woman contains both beauty and brains. Its members were nine countries, and several non-governmental organizations. Yuan Ren is a freelance journalist who grew up in both London and Beijing.
This is perhaps not conclusion of those ice message folk and choose stores kept by means. Blzck thing should be made very last to the meeting who comes up to the upshot, and that is that the unsurpassed ice order taking is very soon to be a black white oriental sex web for her salary. Post-emancipation[ time ] Under slaves were emancipated, many years passed anti-miscegenation producerswhich festival lone evening between black white oriental sex and granny lust sex movies. The lack class European men during this basic often did not so until their continually twenties or early researchers. Hardly is a festivity slice in the imaginative against Thai problems marrying contemporary men, but having bought in sec that an astounding number of ability rabbi class Thai tickets were sounding ssex men. Buttonhole to openly male prostitution had been three here throughout the last says of the 19th field. Experiment Frazierin his sheltered The Calm Bacchus, stated that "there were stars who, without any sweetheart for the researchers of our slaves, stuck its eager thought as whute did her stock. B,ack touching in the Lexical Bikinis Act sex toy kits for couples U. Assessment between the researchers was forbidden alive to the Windows Noir of the diverse century, but used sex improbable. Care science was the direction by a peaceful-owner to extravaganza the reproduction of his people for model.
2 thoughts on “Black white oriental sex”
Kigajin says:
This idea is based on the stereotype of "the Oriental woman" who is considered to be beautiful and sexually exciting as well as caring, compliant and submissive. One of my friends of Hong Kong heritage put it best recently, perhaps, when talking about relationships involving Chinese women and Caucasian men.
Grotaxe says:
It established two stipulations an applicant has to meet in order to receive the benefits of a T-Visa. In an effort to curtail child abuse, despite the age of majority ranging from 16 to 18, we will not take listings from any persons under the age of
Miss trinidad tobago sex tape
Free mail order bride sex videos
What was your first sexual experience
Cat sex id
My first sex teacher mrs zane
Dijora on Black white oriental sex
|
cc/2019-30/en_middle_0059.json.gz/line199
|
__label__wiki
| 0.626425
| 0.626425
|
Jentashapir Journal of Health Research
HFE Mutations C282Y and H63D in Iranian Population With Type 2 Diabetes
Neda Golchin 1 , Hajie Bibi Shahbazian 2 , Heshmatollah Shahbazian 2 , Alireza Zare Bidoki 3 and Javad Mohammadi Asl 2 , *
1 Cancer Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, IR Iran
2 Diabetes Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, IR Iran
3 Molecular Immunology Research Center, Tehran University of Medical Sciences, Tehran, IR Iran
* Corresponding author: Javad Mohammadi Asl, Diabetes Research Center, Ahvaz Jundishapur University of Medical Sciences, Ahvaz, IR Iran. Tel: +98-6133369539, Fax: +98-6133369539, E-mail: mohammadi_asl@yahoo.com
Jentashapir Journal of Health Research: April 01, 2015, 6 (2); e24659
Received: October 17, 2014
Revised: January 25, 2015
DOI: 10.5812/jjhr.6(2)2015.24659
To Cite: Golchin N, Shahbazian H B, Shahbazian H, Zare Bidoki A, Mohammadi Asl J. HFE Mutations C282Y and H63D in Iranian Population With Type 2 Diabetes, Jentashapir J Health Res. 2015 ; 6(2):e24659. doi: 10.5812/jjhr.6(2)2015.24659.
Background: Type 2 diabetes (T2D) is a common metabolic disease caused by insulin secretion defects, which is associated with a variety of complications such as retinopathy, nephropathy, and neuropathy.
Objectives: Regarding the relationship between type 2 diabetes and hereditary chromatists, we conducted a genetic analysis on two previously reported mutations C282Y and H63D related to the HFE gene in our population.
Patients and Methods: Altogether, 145 patients with type 2 diabetes and 145 healthy controls were examined. A genotyping assay performed using electrophoresis of the DNA digestion products from MboI and RsaI for H63D and C282Y, respectively.
Results: Results showed a significant difference between case and controls regarding C282Y (P value < 0.001) and H63D genotypes (P value = 0.013). We also found a relationship between both mutations and nephropathy. Moreover, the difference between C282Y genotypes of patients with retinopathy and healthy controls were statistically significant (P value = 0.020) while there was no association between H63D and retinopathy. In addition, observed differences of both mutations were significant when nephropathic patients compared to the controls.
Conclusions: Our study showed a significant association between H63D and C282Y mutations and the risk of type 2 diabetes in Iranian population.
Keywords: Mutation; Type 2 Diabetes Mellitus; Insulin
Copyright © 2015, Ahvaz Jundishapur University of Medical Sciences. This is an open-access article distributed under the terms of the Creative Commons Attribution-NonCommercial 4.0 International License (http://creativecommons.org/licenses/by-nc/4.0/) which permits copy and redistribute the material just in noncommercial usages, provided the original work is properly cited.
Type 2 diabetes (T2D) is a common metabolic disease caused by insulin secretion defects, which is associated with a variety of complications such as retinopathy, nephropathy, and neuropathy (1, 2). Its worldwide prevalence is estimated to reach around 438 million people in 2030 (3) and a combination of genetic and environmental elements have been suggested in this regard (4). Several studies have found that higher body iron stores are related to the pathogenesis of T2D (5-7). Meanwhile, genome wide association studies suggested a number of genes associated with iron metabolism and the risk of monogenic and/or syndromic forms of T2D (8).
HFE, which is also responsible for hereditary hemochromatosis (HH), is one of those genes. It has revealed that there is a link between T2D and HH so that 20% to 50% of patients with HH also develop T2D (9-11). According to the Ensembl database (http://www.ensembl.org/index.html), HFE gene also called HLA-H and located on the small arm of chromosome 6 (6: 26,087,509-26,098,571), has 14 transcripts, 12 of them could be translated into protein. Two up-stream, missense variants of this gene known as C282Y, which converts 845G→A, and H63D exchanges 187 C→G have been under examination in different studies showing their clinical significance. Investigations on problems such as coronary heart disease (12, 13), cardiomyopathy (14), myocardial infarction (15), hepatic fibrosis (16, 17), colon cancer (18), atherothrombotic cerebral infarction (19), cumulative lead exposure (20), atherosclerosis (21), nonalcoholic fatty liver disease (22), gestational diabetes (23), type 1 diabetes (24), and type 2 (25) have found significant results.
As studies on T2D showed inconsistent data, we aimed to investigate whether there is any relationship between HFE mutations and the risk of type 2 diabetes in Iranian population.
3.1. Study Population
Diabetic patients were selected according to standard international guidelines of diagnosis among those referring to the outpatient diabetes clinic of Golestan Hospital Ahvaz, Khuzestan, Iran. A total of 145 patients and 145 matched control subjects (with regard to ethnicity, sex, and age) were enrolled in our study. All the participants signed the informed consent forms prior to enrollment. The local Ethics Committee and appropriate institutional review board approved the study.
3.2. Sample Preparation
Three milliliter peripheral blood was collected in EDTA containing tubes and stored at -20°C. DNA extraction performed using a DNA extraction kit (Bioneer, Korea) under manufacturer protocol and DNA samples were stored at -70°C until the time of experiments.
3.3. Genotyping
Polymerase chain reaction (PCR) was performed using a PCR kit (Fermentas, Germany) via a thermocycler (Eppendorf, Germany). Restriction fragment length polymorphism (RFLP) was performed using RsaI and MboI restriction enzymes (Bioneer, Korea) (Table 1). Enzyme treated products were run on a 8% polyacrylamide gel visualized by a gel document (CAUTION-ST4, France) and sizes of DNA bands were distinguished using a 50 base pair ladder (GeneOn GmbH, Germany). Ten samples were sequenced by an ABI 3730 sequencer in order to confirm the RFLP data. The investigator responsible for genotype analysis was blinded to this study.
Table 1. PCR-RFLP Test Information a
Product Length
Fragment Length
H63D (rs799945) 294 MboI 138
F: ATGGTTAAGGCCTGTTGCTCTGTC 99
R: CCCTTGCTGTGGTTGTGATTTTC 57
C282Y (rs1800562) 489 RsaI 245
F: TCCTCTTTCCTGTCAAGTGC 244
R: GATGACTCCAATGACTAGGG
a Abbreviations: SNP, Single nucleotide polymorphism; F, Forward primer; R, Reverse primer.
Statistical analysis was accomplished using an SPSS (v16) software and OpenEpi online tool. Allele and genotype frequencies were determined by direct gene counting and analyzed by chi-square test. All of the alleles evaluated in this study complied with Hardy-Weinberg equilibrium. Odds ratios (OR) and 95% confidence intervals (CI) were estimated. All the tests were two-sided and the probability of less than 0.05 was considered as statistically significant.
Genotyping results extracted from 145 Iranian patients (72 males and 73 females), with the mean age of 53.9 ± 9 years compared to healthy controls with the same sex ratio and the mean range of 51.3 ± 10 years are shown in Tables 2-5. 2-5. Differences between genotypes in diabetic patients and controls are illustrated in Table 2. As it has been shown, the frequency of GG genotype related to polymorphism C282Y is significantly higher, and the GA genotype is lower among patients in comparison with the controls (P < 0.001). Also, regarding the H63D, the differences between CG and CC genotypes are statistically significant in patients compared to healthy controls (P = 0.013). Tables 3 and 4 demonstrate patients who are classified in two groups with nephropathy and retinopathy complications, respectively; in 45 patients with nephropathy, C282Y genotypes were significantly different between patients with nephropathy and controls while the difference between H63D genotypes was not statistically significant. In addition, differences in genotypes of both C282Y and H63D were significant comparing our nephropathic patients and controls (P value < 0.001 and 0.006, respectively). Despite increased homozygote and heterozygote alleles at studied positions in patients with nephropathy compared to the retinopathic patients, it did not achieve significance (Table 5).
Table 2. Genotype Frequencies of C282Y and H63D Genes in Patients With Type 2 Diabetes and Controls a
Genotypes
Type 2 Diabetes, (n = 145)
Controls, (n = 145)
P Value b
Odds Ratio (95% Confidence Interval)
C282Y 0.000
GA 97 (67) 58 (40) 3.01 (1.87 - 4.90)
GG 48 (33) 87 (60) 0.33 (0.20 - 0.53)
H63D 0.013
CG 75 (52) 54 (37) 1.80 (1.12 - 2.89)
CC 70 (48) 91 (63) 0.55 (0.34 - 0.88)
a Data are presented as No. (%).
b Values less than 0.05 are considered significant.
Table 3. Genotype Frequencies of C282Y and H63D Genes in Diabetic Patients With Retinopathy and Controls a
Retinopathy (n = 45)
Controls (n = 145)
Table 4. Genotype Frequencies of C282Y and H63D Genes in Diabetic Patients With Nephropathy and Controls a
Nephropathy (n = 100)
aData are presented as No. (%).
Table 5. Genotype Frequencies of C282Y and H63D Genes in Nephropathic and Retinopathic Patients a
This is the first study evaluated HFE gene polymorphisms among Iranian patients with type 2 diabetes. Our results suggested that both heterozygous and homozygous genotypes related to HFE gene polymorphisms are associated with T2D. We showed that only genotypes of C282Y are related to the retinopathy while there is an association between both studied SNPs and the nephropathy seen in T2D patients. The comparison between genotype frequency of T2D patients with retinopathy and those suffering from nephropathy indicated no significant outcome. These variations were subject of several studies.
Sampson et al. (26) found no excess of these HFE mutations in males with T2D. Also, study on 714 diabetic woman in the United States of America showed a significant relationship between higher body iron stores and HFE mutations while there were no significant difference in genotypes between case and controls (27). Similarly, Gomes et al. were unable to find a link between development of T2D and mentioned genotypes in Brazilian women (11). In addition, study on 167 diabetic African-American women declared no difference between frequency of C282Y and H63D between the case and control groups (28). Kankova et al. detected no difference between patients with type 2 diabetes mellitus and controls in Czech population. They found that ferritin levels were significantly higher in woman, but there is no relationship between these genotypes and ferritin levels (29). Study on Hellenic population showed similar results. The authors concluded that increased iron load in their patients linked to C282Y and H63D mutations while there is no difference in the frequency of genotypes between cases and controls (30). In another study, it is indicated that there is no association between distribution of these HFE mutations and T2D, but a relationship exists between H63D mutation and pathogenesis of late onset of disease in polish population (31).
These studies are in contrast with our data. Such discrepancies may have caused by the heterogeneity between different ethnic groups. In 2008, Sharifi et al. (32), which studied the association between mentioned genotypes with T2D in Iranian population could not find any significant correlation. In this case, while their study population was the same as ours, there are some statistical differences such as smaller population and different sex ratio, which caused such incongruity in results. Our data accord with Moczulski et al. (33) study on polish population, which demonstrated that hemochromatosis-causing mutations frequencies may play a role as T2D risk factors when 282Y and 63H mutations were greater in patients than healthy controls. A prospective cohort study, also, suggested an association between C282Y mutation and the incidence of the disease (34). In contrast, 63D allele, not C282Y related alleles, considered as a risk factor for Type 2 diabetes in a recent meta-analysis (25). By comparing genotypes of the two polymorphism with pathophysiological consequences of diabetes such as nephropathy and retinopathy (Tables 2 and 3), we found some significant data. Previously, it has been reported that 63D carriers have an elevated risk for nephropathy in type 2 diabetes (33), which is in consistent with our study and contrary to another study (35). Results from multivariate logistic regression in the Spanish population also approved the role of both C282Y alleles and H63D/H63D genotype in higher incidence of nephropathy (36). Retinopathy, which is another complication of type 2 diabetes, was also considered in some papers. We found that being a carrier of at least one C282Y allele (not H63D) boosts the risk of retinopathy, which is in agreement with previous study (36). It has been demonstrated that heterozygotes for C282Y might be under the risk for the development of proliferative diabetic retinopathy (PDR) (37). These findings showed that H63D plays no role in the incidence and development of retinopathy.
In conclusion, we observed that H63D and C282Y variants in HFE was in association with an increased risk of type 2 diabetes mellitus in Iranian patients. Future studies with a larger sample size and more rigorous study design are warranted.
Funding/Support: This project was supported by the internal grant of Jundishapur University of Medical Sciences, Ahvaz, Iran.
1. Andrulionyte L, Zacharova J, Chiasson JL, Laakso M, Stop-Niddm Study Group . Common polymorphisms of the PPAR-gamma2 (Pro12Ala) and PGC-1alpha (Gly482Ser) genes are associated with the conversion from impaired glucose tolerance to type 2 diabetes in the STOP-NIDDM trial. Diabetologia. 2004; 47(12): 2176-84[DOI][PubMed]
2. Forbes JM, Cooper ME. Mechanisms of diabetic complications. Physiol Rev. 2013; 93(1): 137-88[DOI][PubMed]
3. Franks PW. Gene x environment interactions in type 2 diabetes. Curr Diab Rep. 2011; 11(6): 552-61[DOI][PubMed]
4. Chauhan G, Spurgeon CJ, Tabassum R, Bhaskar S, Kulkarni SR, Mahajan A, et al. Impact of common variants of PPARG, KCNJ11, TCF7L2, SLC30A8, HHEX, CDKN2A, IGF2BP2, and CDKAL1 on the risk of type 2 diabetes in 5,164 Indians. Diabetes. 2010; 59(8): 2068-74[DOI][PubMed]
5. Jiang R, Manson JE, Meigs JB, Ma J, Rifai N, Hu FB. Body iron stores in relation to risk of type 2 diabetes in apparently healthy women. JAMA. 2004; 291(6): 711-7[DOI][PubMed]
6. Rajpathak SN, Wylie-Rosett J, Gunter MJ, Negassa A, Kabat GC, Rohan TE, et al. Biomarkers of body iron stores and risk of developing type 2 diabetes. Diabetes Obes Metab. 2009; 11(5): 472-9[PubMed]
7. Forouhi NG, Harding AH, Allison M, Sandhu MS, Welch A, Luben R, et al. Elevated serum ferritin levels predict new-onset type 2 diabetes: results from the EPIC-Norfolk prospective study. Diabetologia. 2007; 50(5): 949-56[DOI][PubMed]
8. McCarthy MI. Progress in defining the molecular basis of type 2 diabetes mellitus through susceptibility-gene identification. Hum Mol Genet. 2004; 13 Spec No 1-41[DOI][PubMed]
9. Njajou OT, Houwing-Duistermaat JJ, Osborne RH, Vaessen N, Vergeer J, Heeringa J, et al. A population-based study of the effect of the HFE C282Y and H63D mutations on iron metabolism. Eur J Hum Genet. 2003; 11(3): 225-31[DOI][PubMed]
10. Fernandez-Real JM, Lopez-Bermejo A, Ricart W. Cross-talk between iron metabolism and diabetes. Diabetes. 2002; 51(8): 2348-54[PubMed]
11. Gomes KB, Carvalho MG, Coelho FF, Rodrigues IF, Soares AL, Guimaraes DA, et al. Lack of association of C282Y and H63D mutations in the hemochromatosis (HFE) gene with diabetes mellitus type 2 in a case-control study of women in Brazil. Genet Mol Res. 2009; 8(4): 1285-91[DOI][PubMed]
12. Rasmussen ML, Folsom AR, Catellier DJ, Tsai MY, Garg U, Eckfeldt JH. A prospective study of coronary heart disease and the hemochromatosis gene (HFE) C282Y mutation: the Atherosclerosis Risk in Communities (ARIC) study. Atherosclerosis. 2001; 154(3): 739-46[PubMed]
13. Hannuksela J, Leppilampi M, Peuhkurinen K, Karkkainen S, Saastamoinen E, Helio T, et al. Hereditary hemochromatosis gene (HFE) mutations C282Y, H63D and S65C in patients with idiopathic dilated cardiomyopathy. Eur J Heart Fail. 2005; 7(1): 103-8[DOI][PubMed]
14. Surber R, Sigusch HH, Kuehnert H, Figulla HR. Haemochromatosis (HFE) gene C282Y mutation and the risk of coronary artery disease and myocardial infarction: a study in 1279 patients undergoing coronary angiography. J Med Genet. 2003; 40(5)[PubMed]
15. Zorc M, Hruskovicova H, Petrovic MG, Milcic M, Peterlin B, Petrovic D. Haemochromatosis-causing mutations C282Y and H63D are not risk factors for coronary artery disease in Caucasians with type 2 diabetes. Folia Biol (Praha). 2004; 50(2): 69-70[PubMed]
16. Chitturi S, Weltman M, Farrell GC, McDonald D, Kench J, Liddle C, et al. HFE mutations, hepatic iron, and fibrosis: ethnic-specific association of NASH with C282Y but not with fibrotic severity. Hepatology. 2002; 36(1): 142-9[DOI][PubMed]
17. Bugianesi E, Manzini P, D'Antico S, Vanni E, Longo F, Leone N, et al. Relative contribution of iron burden, HFE mutations, and insulin resistance to fibrosis in nonalcoholic fatty liver. Hepatology. 2004; 39(1): 179-87[DOI][PubMed]
18. Shaheen NJ, Silverman LM, Keku T, Lawrence LB, Rohlfs EM, Martin CF, et al. Association between hemochromatosis (HFE) gene mutation carrier status and the risk of colon cancer. J Natl Cancer Inst. 2003; 95(2): 154-9[PubMed]
19. Hruskovicova H, Milanez T, Kobal J, Potisk KP, Petrovic D, Peterlin B. Hemochromatosis-causing mutations C282Y and H63D are not risk factors for atherothrombotic cerebral infarction. Med Sci Monit. 2005; 11(7)-52[PubMed]
20. Zhang A, Park SK, Wright RO, Weisskopf MG, Mukherjee B, Nie H, et al. HFE H63D polymorphism as a modifier of the effect of cumulative lead exposure on pulse pressure: the Normative Aging Study. Environ Health Perspect. 2010; 118(9): 1261-6[DOI][PubMed]
21. Pankow JS, Boerwinkle E, Adams PC, Guallar E, Leiendecker-Foster C, Rogowski J, et al. HFE C282Y homozygotes have reduced low-density lipoprotein cholesterol: the Atherosclerosis Risk in Communities (ARIC) Study. Transl Res. 2008; 152(1): 3-10[DOI][PubMed]
22. Valenti L, Dongiovanni P, Fracanzani AL, Santorelli G, Fatta E, Bertelli C, et al. Increased susceptibility to nonalcoholic fatty liver disease in heterozygotes for the mutation responsible for hereditary hemochromatosis. Dig Liver Dis. 2003; 35(3): 172-8[PubMed]
23. Cauza E, Hanusch-Enserer U, Bischof M, Spak M, Kostner K, Tammaa A, et al. Increased C282Y heterozygosity in gestational diabetes. Fetal Diagn Ther. 2005; 20(5): 349-54[DOI][PubMed]
24. Ellervik C, Mandrup-Poulsen T, Nordestgaard BG, Larsen LE, Appleyard M, Frandsen M, et al. Prevalence of hereditary haemochromatosis in late-onset type 1 diabetes mellitus: a retrospective study. Lancet. 2001; 358(9291): 1405-9[DOI][PubMed]
25. Rong Y, Bao W, Rong S, Fang M, Wang D, Yao P, et al. Hemochromatosis gene (HFE) polymorphisms and risk of type 2 diabetes mellitus: a meta-analysis. Am J Epidemiol. 2012; 176(6): 461-72[DOI][PubMed]
26. Sampson MJ, Williams T, Heyburn PJ, Greenwood RH, Temple RC, Wimperis JZ, et al. Prevalence of HFE (hemochromatosis gene) mutations in unselected male patients with type 2 diabetes. J Lab Clin Med. 2000; 135(2): 170-3[DOI][PubMed]
27. Qi L, Meigs J, Manson JE, Ma J, Hunter D, Rifai N, et al. HFE genetic variability, body iron stores, and the risk of type 2 diabetes in U.S. women. Diabetes. 2005; 54(12): 3567-72[PubMed]
28. Acton RT, Barton JC, Bell DS, Go RC, Roseman JM. HFE mutations in African-American women with non-insulin-dependent diabetes mellitus. Ethn Dis. 2001; 11(4): 578-84[PubMed]
29. Kankova K, Jansen EH, Marova I, Stejskalova A, Pacal L, Muzik J, et al. Relations among serum ferritin, C282Y and H63D mutations in the HFE gene and type 2 diabetes mellitus in the Czech population. Exp Clin Endocrinol Diabetes. 2002; 110(5): 223-9[DOI][PubMed]
30. Habeos IG, Psyrogiannis A, Kyriazopoulou V, Psilopanagiotou A, Papavassiliou AG, Vagenakis AG. The role of Hemochromatosis C282Y and H63D mutations in the development of type 2 diabetes mellitus in Greece. Hormones (Athens). 2003; 2(1): 55-60[PubMed]
31. Malecki MT, Klupa T, Walus M, Czogala W, Greenlaw P, Sieradzki J. A search for association between hereditary hemochromatosis HFE gene mutations and type 2 diabetes mellitus in a Polish population. Med Sci Monit. 2003; 9(2)-5[PubMed]
32. Sharifi F, Esmaeilzadeh A, Zali M. Hemochromatosis gene (HFE) mutations in patients with type 2 diabetes and their control group in an Iranian population. Saudi Med J. 2008; 29(6): 808-12[PubMed]
33. Moczulski DK, Grzeszczak W, Gawlik B. Role of hemochromatosis C282Y and H63D mutations in HFE gene in development of type 2 diabetes and diabetic nephropathy. Diabetes Care. 2001; 24(7): 1187-91[PubMed]
34. Salonen JT, Tuomainen TP, Kontula K. Role of C282Y mutation in haemochromatosis gene in development of type 2 diabetes in healthy men: prospective cohort study. BMJ. 2000; 320(7251): 1706-7[PubMed]
35. Davis TM, Beilby J, Davis WA, Olynyk JK, Jeffrey GP, Rossi E, et al. Prevalence, characteristics, and prognostic significance of HFE gene mutations in type 2 diabetes: the Fremantle Diabetes Study. Diabetes Care. 2008; 31(9): 1795-801[DOI][PubMed]
36. Oliva R, Novials A, Sanchez M, Villa M, Ingelmo M, Recasens M, et al. The HFE gene is associated to an earlier age of onset and to the presence of diabetic nephropathy in diabetes mellitus type 2. Endocrine. 2004; 24(2): 111-4[PubMed]
37. Peterlin B, Globocnik Petrovic M, Makuc J, Hawlina M, Petrovic D. A hemochromatosis-causing mutation C282Y is a risk factor for proliferative diabetic retinopathy in Caucasians with type 2 diabetes. J Hum Genet. 2003; 48(12): 646-9[DOI][PubMed]
Neda Golchin: [PubMed] [Scholar]
Hajie Bibi Shahbazian: [PubMed] [Scholar]
Heshmatollah Shahbazian: [PubMed] [Scholar]
Alireza Zare Bidoki: [PubMed] [Scholar]
Javad Mohammadi Asl: [PubMed] [Scholar]
Jentashapir Journal of Health Research accepts terms & conditions of: Show
|
cc/2019-30/en_middle_0059.json.gz/line203
|
__label__wiki
| 0.814748
| 0.814748
|
Jayewardene Centre
Jayewardene Centre was an apt depository for the treasure for it was the house where President Jayewardene spent a part of his childhood and later till 1938 the year he shifted to his own house "Braemar".
One of the most illustrious collections of personal memorabilia, the museum contains about 600 items gifted to President Jayewardene by Kings, Queens and Heads of States and many other state and religious dignitaries the world around.
The library contains over 16000 books and publications mainly in English and Sinhala and a few in other languages such as Tamil, Hindi, Chinese and Japanese.
Auditorium for Rent
Auditorium is a fully equipped reception hall hired out for wedding receptions and similar functions.
Presidential Archives
The Archives today housed at the J. R. Jaycwardene Centre contains public papers as well as private papers of the President which are available for reference by members of the public. The most significant among the collection of many more doc.s are available.
Monthly Lectures
Centre conducts a series of lectures regularly. These lectures which are usually on current topics are delivered by eminent personalities. No fee is charged to attend these lectures. Periodically some lectures are reproduced in booklet form for those who are interested.
Japanese museum
Ryugen Garden
Scholarly Meetings
Annually Events
Res. & Pub.
Press Releas
Tenders & Ads
Annually Events >
107 Birthday Anniversary
Mr. Hiroshi Morisaki
President J.R. Jayewardene Biography
Junius Richard Jayewardene was born 17-9-1906 to the lawyer and later Chief
Justice Eugene Wilfred Jayewardene and his wife Agnes Helen. The eldest of eleven
children, he was educated at Royal College, Colombo. .......
J.R Jayewardene Centre
The Centre was established by act of Parliament titled J.R Jayewardene Centre Act No. 77 of 1988. The act specified the venue as 191, Dharmapala Mawatha, Colombo 07. It was... READ MORE
NEXT Event :
Vidhwath Kathikawa xx
2014 - 11 - 10 at 10.00AM to 12.30PM
DOWNLOAD FULL TEXT FILE
Hit Count :
Auditorium is a fully equipped reception hall hired out for wedding receptions and similar functions. It is also hired out at very subsidized rates for book
Japanese museum is a separate entity housed in a separate hall which contains mainly mementos depicting exclusively Japanese art and culture.
One of the most illustrious collections of personal memorabilia, the museum contains about 600 items gifted to President Jayewardene.
President Jayewardene was a man who believed in preserving everything he possessed for posterity. He had jealously preserved the diaries and most of the exercise books he used as a schoolboy
The Ryugen Garden
A replica of the gorgeous courtyards of the Japanese elite is a gift from Rev. Ryugen Tanaka as a token of gratitude to President Jayewardene
Christmasday
Merry X-mas!!
Thursday 1 August 2019
1st of August!!
BBQ !!! For more info click here
Monday 3 March 2014
My Birthday - Test2
Test Event here
108th BIRTH ANIVERSARY
Schedule dates are highlights. You can click and find more info
The J. R. Jayewardene Centre provides support services for classes conducted in various fields such as
Designed by Dinesh Kodithuwakku © 2019 - J.R. Jayewardene Centre
|
cc/2019-30/en_middle_0059.json.gz/line206
|
__label__cc
| 0.670679
| 0.329321
|
Dating bear bow recurve
Judith Garcia, 22 years old
They were less successful after this, with longbowmen having their lines broken at the Battle of Verneuiland being completely routed at the Battle of Patay when dating bear bow recurve were charged before they had set up their defensive position. The earliest longbow known, from what is now England, found at Ashcott HeathSomersetis dated to BC, [1] but no longbows survive from the period when the longbow was dominant c. A longbow must be long enough to allow its user to draw the string to a point on the face or body, and the length therefore varies with the user. In continental Europe it was generally seen as any bow longer than 1. The Society of Antiquaries of London says it is of 5 or 6 feet 1. Estimates for the draw of these bows varies considerably. Before the recovery of the Mary RoseCount M. Mildmay Stayner, Recorder of the British Long Bow Society, estimated the bows of the Medieval period drew 90— pounds-force — newtonsmaximum, and Mr.
The bow and arrow is a dating bear bow recurve weapon system consisting of an elastic launching device bow and long-shafted projectiles arrows. Archery is the art, practice, or skill of using bows to shoot arrows. Someone who makes bows is known as a bowyer[2] one who makes arrows is a fletcher[3] and one who manufactures metal arrowheads is an arrowsmith. The use of bows and arrows by humans for hunting predates recorded history and was common to many prehistoric cultures. They were important weapons of war from ancient history until the early modern periodwhere they were rendered increasingly obsolete by the development of the more powerful and accurate firearmsand were eventually dropped from warfare.
did benson and stabler hook up
matchmaking ranks dota 2
religion based dating sites
lbk dating
single mom dating an older man
More about dating bear bow recurve:
|
cc/2019-30/en_middle_0059.json.gz/line208
|
__label__cc
| 0.603644
| 0.396356
|
Home Essays A man is entitled to be buried whole.
A man is entitled to be buried whole.
May 3, 2010 , bxidoyle , Leave a comment
Why did Anthony Kedis decide he was entitled to any kind of vocalization after BloodSugarSexMagik (barring of course, Walkabout)? I sort of get maybe Sir Psycho Sexy had a few more tales of sexual prowess to tell, but to pose a question similar to any corporation, has anyone gracefully bowed out from a singer/songwriter position? Like, “Hey guys, I think I made my point, I’m hanging up the guitar now, If I think of any thing else, I’ll let you know, but I can’t promise anything.” If a guy got up on a soapbox with a megaphone, and screamed his lungs out all day and all night and used all sorts of colorful language and made you feel like a bad person, and then his demands were met, and the next day he’s still there, wouldn’t you think he was even less rational than before?
This sense of entitlement probably comes from one of the first generations of people who have grown up with the media infiltrating every pore of their existence with messages to consume and to be consumable. Constant bombardment of commercial messages, sure, have left us completely cynical to advertising, but not from a general collective understanding of sensationalized storytelling on which to base our lives on. We no longer sit around campfires. These stories (Y’know, content?) are written, edited, and shot to be particularly manipulative to the viewer emotionally. Then you have to factor in the personality of the writer and of the director who will no doubt consciously or unconsciously reflect their own value systems in the content. Add a producer or backing partner who is asking you to recreate the magic of the remake of “The Hills Have Eyes”, and the final product is a concoction of emotionally jarring, complete escapist fare. Tell that sort of pseudo-provocative tale a few thousand times, progressively becoming more and more visceral, and with that particular story attempting to attain the largest audience on a national scale, you’re basically creating static thought pathways of what is to be attained and how it is attainable. Combine that content with its primary system of support, commercial advertising, an industry based on convincing you to buy their product to fill that ever-present gaping hole (no, not that one) in your life, copying only the most effective manipulation techniques from filmmakers with somewhat more altruistic motivations. And of course, product placement, completely blurring that line like a first year MassArt student with Photoshop.
All of this leads to the entitled ME. Yes, it’s cute and awesome that young people are using boomer money to say “I Can!” and “I Will!” but they’re never paired with the question “I Should?” or “Is this avenue I have chosen to utilize my gifts through no rational conclusion of my own fulfilling to my extremely unique existence?” There’s a difference between self-confidence developed from actual social interactions and a false sense of worth derived by L’Oreal ads. It’s like an abusive relationship except you’re not even getting laid.
It’s that sense of entitlement why USC and Emerson are crammed with film students convinced that because their love of cinema as a communicative medium means they should work in film. Hey, I think trees are pretty rad, but I’m not a carpenter (alternates: olympic pool:olympic swimmer, mexico:mexican, baby:father). And just as the availability of cheap HD equipment does not make 1,000 Soderburghs as the invention of Final Draft Screenwriting Software (ok, the typewriter) did not create 1,000 Shakespeares. The film/media industry is full of these kids in completely administrative, non-creative positions (no, they will not be promoted or ‘discovered’ unless you mean ‘discovered by the reality $23K is not livable’), their work does not differ from the same paperwork being filed in every temp job in the country, and they probably get paid less. But they’re entitled to choose the red carpet treatment, because they feel entitled to be part of the collective decision-making process for the rest of the country. They are entitled to be on the encoding end of mass media. As one of these pompous assholes, I wonder if these other 90% feel entitled to not give a shit.
This strange sense of entitlement is the reason the LES/East Village/Brooklyn (even as far as Kensington!) is now full of sorority girls from the Midwest, licking the stardust coming out of Sarah Jessica Parker’s butt. Of course, I came to New York partly for the Larry Clark/Michael Alig atmosphere, only to find it not only dead (RIP CASPER) but literally buried under the NYU/Jamba Juice industrial complex. I think most people my age raised in the suburbs suffer from a romanticization of urban life because it provided relief from the stagnancy of suburbia. And our parents wonder where we went wrong, after they deprive us with all the social underpinnings of society for a bigger lawn and a racially homogeneous population. And when you replace the neighborhood kids with a TV, it’s like leaving your kid with the broken-home kid in the scaly cap telling tall tales and trying to get your kid to buy pot. I do understand those buildings that were built in the formerly dilapidated sections of Manhattan were built in fact to be populated by a non-criminal element, not to stand half-demolished with squatters and junkies, that the Manhattan of Today is probably more in line of what it was initially built for, but still. I can be disappointed. But it’s that sense of entitlement of deserving to live the “bright lights, big city” lifestyle that ruined it.
I only say these things because I know these things. I am these things. I feel entitled to tell you these things. I feel entitled to go off on tangents and make this essay less comprehensible. It is a remarkable phenomenon, the entitlement assumed given we have done absolutely none of the footwork or groundwork to reap it other than luck.
So way to go guys, reap what you sow.
Just be sure to ask for a refund when you realize you didn’t need it anyway.
Posted in Essays.
|
cc/2019-30/en_middle_0059.json.gz/line217
|
__label__cc
| 0.653084
| 0.346916
|
Friday, Jul 17, 2009, 2:01 pm
Labor Organization Tries to Stir up Restaurant Worker Solidarity
BY Kari Lydersen
Jose Oliva is lost in thought as he holds the drink menu to his face and peeks over it to scan the plush, upscale new restaurant in Chicago. The waitstaff probably assumes he is contemplating which designer martini to sample.
In reality, he is canvassing the joint for tell-tale signs that this would be a good target for the Restaurant Opportunity Center, or ROC, a labor organization seeking to represent workers in the nation’s largest and perhaps most-exploited sector.
The “front of the house” staff—waiters, waitresses, hosts and bartenders—are mostly white. The “back of the house” staff—busboys, dishwashers and cooks—are largely Latino or otherwise people of color. This is typical of most restaurants, especially fine-dining establishments, where 90 percent of servers are white men catering to guests who seek the “butler experience.”
Oliva tries to gauge the morale of the restaurant’s workers. Do they seem relaxed and cheerful interacting with guests? Do they joke with regulars?
Fine-dining establishments with meals priced at $40 and up represent the bulk of the restaurant industry’s profit—a profit estimated to reach half a trillion dollars this year. During the economic crisis, the restaurant industry is one of the only sectors actually growing.
The industry represents 13.5 million workers, according to ROC, and aside from farmworkers, its wages and working conditions are the worst in the country. Less than one percent of restaurant staff are unionized, and fewer than one in 10 have health insurance or paid sick days.
ROC seeks to change this through a three-pronged strategy that includes targeting the worst employers, lauding and working with the best employers, and changing federal law to protect all restaurant workers. In terms of individual workplaces, ROC focuses only on fine-dining establishments, with the idea that these set the standard for the whole industry, and gains in workers’ rights and wages will trickle down to casual dining (like Applebees or Denny’s) and “quick serve” (fast-food) establishments.
The laws and policy changes they advocate would help everyone in the industry. These include passing the Healthy Families Act, mandating paid sick days, and restoring a memorandum of understanding that prevents Immigration and Customs Enforcement (ICE) from intervening in workplaces involved in labor disputes.
One of ROC’s key strategies is uniting the front and back of the house staff in a fight for better wages and conditions at high-end restaurants, which can be fiercely competitive and often demand long hours and irregular, constantly changing shifts from all their employees (though front-of-the-house staff are typically much better paid).
ROC was founded by an astoundingly diverse group of workers from Windows on the World, the restaurant in the World Trade Center, after the 9-11 attacks. Workers were drawn together by the trauma and the frantic struggle to account for their colleagues after the attacks—where a number of the restaurant’s staff were killed.
In the wake of the attacks, the bad economy and extreme prejudice against Middle Eastern and other immigrants made it very difficult for many of them to find jobs. Immigrants who previously had believed in the American Dream found themselves cruelly ostracized just because of their ethnicity, as ROC organizer Fekkak Mamdouh and author Rinku Sen describe in their book The Accidental American: Immigration and Citizenship in the Age of Globalization.
Hence ROC was founded out of necessity, desperation and a fighting spirit. The organization now has branches in New York, Chicago, Miami, Washington DC, New Orleans, Detroit, Portland, Maine and, soon, Los Angeles. In Detroit, it rivals the auto industry as the major employer, with about 100,000 workers.
“Just like the auto industry once had the power to create labor standards and a middle class, now the restaurant industry has that power,” Olivo said.
In Chicago, organizers are deciding on the target for their first workplace campaign—hence Oliva’s scouting mission. Oliva notes that ROC is specifically not a union—rather it is a workers’ organization free from the bureaucratic mandates and institutional politics that can fetter unions.
“ROC is the only group that has really taken the best strategies and most effective tactics from the union side and combined them with the best tactics from the workers’ side,” he said. “Our belief is pretty straightforward and simple. This is the nation’s largest sector. Whatever changes we get in wages and working conditions will have ramifications in the rest of the everyone else.”
Chicagoans can support ROC Chicago at a benefit Saturday, July 18, at Cary’s Bar, 2251 W. Devon St., at 8 p.m. There is no cover charge.
Kari Lydersen
Kari Lydersen is a Chicago-based reporter, author and journalism instructor, leading the Social Justice & Investigative specialization in the graduate program at Northwestern University. She is the author of Mayor 1%: Rahm Emanuel and the Rise of Chicago’s 99%.
More by Kari Lydersen
A Historic Election in Chicago Cracks the Machine
Mayor 1% Rahm Emanuel Will Not Be Missed in Chicago
In a Landslide Vote, the LA Times Just Unionized, Upending a Long Anti-Labor History
Opponents of School Privatization Are Very Worried About a New Law in Illinois. Here’s Why.
At the Bullfrog, Those Left Behind by the Global Economy Find Relief—and a Place to Talk Trump
In these days of crisis it is a really good way to stand financial and unemployment hardships. To build up such an organisation as ROC, especially inside practically the only growing sector of industry, can be not only the way to survival but the way to prosperity as well. My brand clothes boutique
Posted by Alexandra Yefremova on 2010-04-15 08:55:48
Good news My brand clothes boutique
Posted by Viktar on 2010-03-23 12:08:52
"Working In These Times" is dedicated to providing independent and incisive coverage of the labor movement and the struggles of workers to obtain safe, healthy and just workplaces. more
Working In These Times Contributors
David Moberg
Rose Arrieta
David Bacon
Michelle Chen
Stephen Franklin
Steve Early
Bruce Vail
Mario Vasquez
Yana Kunichoff
Moshe Z. Marvit
Rachel Luban
Shaun Richman
Jeremy Gantz
Online Form - Working
Recent Working ITT Posts
The Media Uses Coal Miners To Attack the Green New Deal—Then Ignores Their Pension Fight
Should HIV-Positive Workers Be Allowed in the Sex Industry? Some Advocates Say Yes.
It’s Not Just About Deportations: Trump Wants To Create a Permanent Underclass
Workers Who Waged the Biggest Trump-Era Manufacturing Strike Just Struck a Deal—Here’s What It Says
125 Years After the Pullman Uprising, We Could Be on the Verge of Another Sympathy Strike Wave
Yes, the UAW Lost Again in Chattanooga. But a Rank-and-File Movement Could Win.
“Hardhats vs. Hippies”: How the Media Misrepresents the Debate Over the Green New Deal
The Trump Administration’s War on Federal Workers
How Unions and Climate Organizers Learned To Work Together in New York
|
cc/2019-30/en_middle_0059.json.gz/line219
|
__label__cc
| 0.685413
| 0.314587
|
Mobile Zambia
MTN Zambia, Kirusa launch roaming service app
Parent Category: Mobile
MTN Zambia and Kirusa have announced the launch of a new roaming service for customers travelling outside Zambia.
According to a statement by the companies, by using the service customers will benefit from "a drastic reduction in the cost of making and receiving calls whist outside Zambia" and "the ability to use their MTN Zambia number anywhere in the world, even where the operator has no roaming partners."
The app converts regular phone calls into Voice over Internet Protocol (VoIP) calls, allowing users to make or receive such calls within the app.
"This is useful when a mobile user is roaming, out of network coverage or on flight mode, but with an active data connection. This could be data from a local sim card, roaming data, or a Wi-Fi network," the statement continues.
Helping MNOs fight against OTT apps
Africa grapples with OTT regulation conundrum
Mascom restores roaming services to South Africa
MTN Zambia
Users are also offered the opportunity to purchase virtual numbers for the US, UK, Canada and France for US$1 per month "with additional countries to follow shortly," the companies have added.
"These numbers can be used alongside a person's existing mobile number(s) and activated instantly with no liaison with an operator required. Up to ten numbers can be linked to a person or business - with the numbers able to be used on any device. This eliminates the need to carry additional phones to use multiple phone numbers," the companies say.
MTN Zambia and Kirusa assert that ReachMe is differentiated from OTT apps like WhatsApp because it doesn't require both caller and recipient to have the app to connect. Person A dials Person B's regular mobile number – and doesn't know that the call is received in an app by Person B, the companies explain.
MTN Zambia claims to be the first operator in Africa to deploy Kirusa's InstaVoice ReachMe.
Seun Soladoye, Acting Chief Marketing Officer, MTN Zambia, said: "ReachMe is a refreshing innovation that solves a pain point for our frequent flyer audience. This app is an outcome of totally re-thinking roaming and, by clever integration with the cloud, drastically minimises our costs thereby allowing us to roll out attractive roaming packages."
Inderpal Singh Mumick, founder and CEO of Kirusa, said "I'm delighted that MTN Zambia believes in the potential of voice-over-data solutions, in the context of a world that is increasingly getting connected over cloud."
Zim govt wants minimum US$300-million for NetOne, TelOne Published on 15 July 2019
Authorities look to wrap up sale of majority shareholding in companies by year-end.
LATEST Mobile NEWS
|
cc/2019-30/en_middle_0059.json.gz/line220
|
__label__cc
| 0.611114
| 0.388886
|
A social Initiative by students of IIT Kharagpur
"All that is needed for evil to triumph is for good men to do nothing" : Edmond Burke
The First Trip to Porapara
The midsems had just gone over and we were again geared up to get back to the work we had started. Our next step was to study the market from where the raw material would have to be procured for our new business. From the research we had done and the information provided by Mr. Bhattacharya we came to know that Kharagpur had got abundant source of sal-leave plates. The tribals (Mahato)residing in the remote villages of Kharagpur and adjoining Bankura are involved in this business. The nearest such village is Pora Para. This village is some 11 Kms from IIT campus.
It was the evening of 29th February when I got a call from Pranidhi (one of the contributors). She wanted to have an idea of the activities we had undertaken by visiting the sites personally. Since she has invested her money in the business it was her right to inquire about the ventures we were putting her money into (though she never intended to do this [:P]). On March 1st, she along with her friend Shruti came to IIT campus. We took them straight to Ravindra Palli where they analysed the prospects of our association with those 20 ladies. We utilized their presence for handing over the first profit earned by Jagruti group and both of them ,i must say, were really thrilled to be the ceremonial chief guests.
After the meeting was over we decided to visit Porapara village. We had two objectives behind this visit. The first was to distribute some clothing collected by us among the leprosy patients of one leprosy hospital run by Missionaries of Charity in the same village and second was to have a look on the availability and abundance of the raw material for our new business. I must thank Mr. K K Sharma, one of our well-wishers, who arranged a cab for the visit. His dedication towards social cause is really appreciable.
As mentioned earlier, this village was some 11 Km from our IIT campus. Pranidhi, Shruti, Indira, Vertika, Himanshu, Ujjwal, Sharma ji and myself reached the leprosy hospital around 3.30 PM. The serenity of the ambiance was peculiar in itself. We were greeted by an old man who surprised us with his fluent English. He then introduced us to the Brother who was the in-charge of the hospital. The kind of glow that appeared on the faces of the people residing in that hospital campus after seeing we people filled us with immense sense of accomplishing something great. After a brief introduction we went straight to meet the patients. Firstly, we met the female patients. The wards were neat and clean and every care was made to make those patients feel at home. We were astonished to know that those people had been abandoned by their family and to no one's surprise they were not willing to go back any more and wanted to stay there for ever. We then visited the prayer hall of the Hospital and subsequently the male ward. The duskiness prevailing in the ward at 4 in the afternoon was taking us by surprise. When we asked the Brother why he had not switch on the lights the reply was really appalling. He said that the hospital had got no electricity supply. They had been deprived of electricity supply since the hospital came into being. The reason as stated by the Brother was the hostile attitude of the neighboring villagers who did not let the WB State Electricity Board to install transformers on the land coming under their possession. The hospital had to install two 25KW generators to meet the power requirements which functioned only between 6 to 10 PM during the night. We were finding it really difficult to imagine a situation in which we had to spend the night in the hot and humid climate of Kharagpur without a fan running above our beds and mosquitoes entertaining us though out.
Anyways, we had now to come up with a solution. I am open to be criticised and advised. Please leave a comment if you have an idea how to solve this problem.
a) Try to persuade the villagers to give a piece of land along their campus boundaries. But I think that this may have been tried earlier as well. Shall we give it a try again?
b) File an RTI on the behalf of the hospital questioning WBSEB about the reasons why it has failed to supply electricity to the hospital when there is absolutely no problem regarding the penetration of it in the nearby villages.
c) Install a dual-mode gassifier which runs on bio-mass which is available in plenty in and around the hospital. This gassifier also has a provision of diesel run generator in case there is shortage of biomass.
It was 5.30 in the evening already and Pranidhi and Shruti had to catch a train back to Kolkata so we had to drop our plan of finding the sources of raw material for our business. While returning to the campus we stopped by the house of one of the PANCHAs to discuss the issue but unfortunately he was not there that time.
On the journey back to campus I was brooding over the very nature of problems existing in rural India. I had come to Pora Para with altogether different objective and while returning back I have added one more issue to be paid attention to immediately.
Posted by TS at 5:49 AM
logicark said...
I would try with option B for now; and try to get endorsements from the hospital board/dean and a couple of profs from kgp (dunno if they can do it officially).
Also, this may be redundant, but did you check if there was space available in the hospital compound itself for the transformer? If they can let go of some space, which is being used for some other purpose and can be moved somewhere else, then that should be the easiest way out.
@logicark ...thnx alot for going thru the post and coming up with a suggestion. actually the hospital is some 1000-1500 meters away from the nearest transformer of the area. so we need to have poles on a couple of locations between the hospital and the existing transformer. The villagers are not ready for raising a pole as well!!!
A Triumph Against Usury
A word of appreciation
All initiatives coming together under one platform...
JAGRUTI...A NEW ENDEAVOR
Join us on 25th March, 6PM at SN Bose
Porapara again
Pradan: Professional Assistance for Development Ac...
The Changemakers
Ashoka Foundation
Praajak
Pradan
Some informative sources
www.indiasocial.org
Himanshu Sharma
Indira Ghosh
Jyoti Aggrawal
Kanika Singhal
Reshmi Ghosh
Tushar Sinha
Ujjwal Jain
Vertika Singh
Vikram Aditya Gulati
|
cc/2019-30/en_middle_0059.json.gz/line221
|
__label__cc
| 0.73184
| 0.26816
|
Connor Weir
Jacqueline Le
Silvio de Melo Jr.
Vittorio Giuliano
Truptesh Kothari
Metronidazole is one of the mainstay drugs for the treatment of anaerobic bacterial infections, protozoal infections, and microaerophilic bacterial infections. It is cytotoxic to facultative anaerobic microorganisms.
Metronidazole is FDA-approved for the treatment of protozoal infections such as Trichomoniasis vaginalis, Entamoeba histolytica, Giardia lamblia, blastocysts, and Balantidium coli. It is also FDA approved to treat anaerobic bacterial infections caused by Bacteroides species, Fusobacterium species, Clostridium species, Gardnerella vaginalis, Helicobacter pylori, Prevotella species, Porphyromonas species, and Biophilia wadsworthia.[1] Therefore, it is not surprising that metronidazole is widely accepted and FDA-approved for the treatment of a broad range of infections: intestinal amebiases, liver amebiasis, bacterial septicemia, bone and joint infections, central nervous system (CNS) infections (meningitis and brain abscess), endocarditis, gynecologic infections (endometritis, tubo-ovarian abscess, bacterial vaginosis), intra-abdominal infections, lower respiratory tract infections, skin structure infections, and surgical prophylaxis (colorectal surgeries).[2]
Metronidazole has additional off-label uses in the management of other conditions and infections including balantidiases, bite wound infections, animal and human bites, clostridioides (formerly Clostridium difficile), Crohn disease, post-surgical resection management, perianal fistulas, Dietamoeba fragilis infections, giardiasis, Helicobacter pylori eradication, periodontitis, post ileal pouch-anal anastomosis (pouchitis), and tetanus.[2]
Metronidazole has rapid bactericidal effects against anaerobic bacteria with a killing rate proportional to the drug concentration. Concentration-dependent bactericidal properties have been demonstrated against Entamoeba histolytica and Trichomonas vaginalis. Furthermore, it kills Bacteroides fragilis and Clostridium perfringens more rapidly than treatment doses of clindamycin. It also penetrates the blood-brain barrier.[3][4][5][6]
Metronidazole diffuses into the organism, inhibits protein synthesis by interacting with DNA and causing a loss of helical DNA structure and strand breakage. Therefore, it causes cell death in susceptible organisms.
The mechanism of action of metronidazole occurs through a four-step process. Step one is the entry into the organism by diffusion across the cell membranes of anaerobic and aerobic pathogens. However, antimicrobial effects are limited to anaerobes.[7] Step two involves reductive activation by intracellular transport proteins by altering the chemical structure of pyruvate-ferredoxin oxidoreductase. Reduction of metronidazole creates a concentration gradient in the cell that drives uptake of more drug and promotes free radical formation that is cytotoxic.[8] Step three, interactions with intracellular targets, is achieved by cytotoxic particles interacting with host cell DNA resulting in DNA strand breakage and fatal destabilization of the DNA helix.[9] Step four is the breakdown of cytotoxic products. Metronidazole is also cytotoxic to facultatively anaerobic bacteria like Helicobacter pylori and Gardnerella vaginalis, but the mechanism of action to these pathogens is not well understood.[7]
Metronidazole may be administered orally, intravenously, or topically. It comes in capsule, tablet, topical and intravenous forms. Standard capsule dosing is 375 mg. Standard tablet dosing is 250 mg or 500 mg. Standard intravenous preparation and dosing is 5mg/mL (100mL) and 500 mg (100 mL), respectively. When administered intravenously, the drug solution should not come in contact with equipment containing aluminum. Infusion of the intravenous solution should be over 30 to 60 minutes. Oral administration can be taken with food to help minimize stomach discomfort. The extended-release tablets should be administered on an empty stomach 1 hour before or 2 hours after meals. It should not be split or crushed. Topical application gel is 0.75% and 37.5 mg per applicator and is applied vaginally.[10]
Dosing of metronidazole for some of the more common indications are listed below[11][12][13][14][15][16][17][18][19]:
Dosing for amebiasis, both intestinal (acute dysentery) and extraintestinal:
Oral: 500 to 750 mg every 8 hours for 7 to 10 days to be followed up with an intraluminal agent
Dosing for bacterial vaginosis:
Oral: 500 mg twice each day for 7 days.
Dosing for pelvic inflammatory disease (PID) treatment:
Mild/moderate PID: Oral: 500 mg twice a day for 14 days (may be added to combination therapy)
PID with tubo-ovarian abscess, initial treatment (as an alternative regimen): IV: 500 mg every 8 hours as part of an appropriate combination regimen
PID with tubo-ovarian abscess, oral therapy subsequent to clinical improvement on a parenteral regimen: Oral: 500 mg twice daily with doxycycline for at least 14 days
Dosing for trichomoniasis infection:
Initial treatment: Oral: 2 g in a single dose or 500 mg twice daily for 7 days (preferred regimen in HIV-infected women)
Persistent or recurrent infection (treatment failure single-dose therapy): Oral: 500 mg twice daily for 7 days for the failure of 2 g single-dose regimen
Dosing for Giardiasis:
Oral: 250 mg 3 times each day or 500 mg 2 times each day for 5 to 7 days
Dosing for intra-abdominal infections:
Oral, IV: 500 mg every 8 hours as in an appropriate combination regimen. Therapy duration is 4 to 7 days following adequate source control, and longer duration is necessary for uncomplicated appendicitis and diverticulitis managed nonoperatively
Dosing for skin and soft tissue infections:
Necrotizing infections (a component of an appropriate combination regimen): IV: 500 mg every 6 hours - continue until debridement is no longer required, the patient has clinically improved, and is afebrile for 48 to 72 hours
Dosing for surgical site infections, incisional (intestinal or GU tract; axilla or perineum), warranting anaerobic coverage:
IV: 500 mg every 8 hours combined with other appropriate agents.
Dosing for surgical prophylaxis:
IV: 500 mg within one hour before surgical incision in a regimen with other antibiotics; recommended for select procedures involving the head and neck, GI tract, or urologic tract
Dosing for oral colorectal surgical prophylaxis:
Oral: 1 g every 3 to 4 hours for 3 doses with additional oral antibiotics, following mechanical bowel preparation the evening prior to a morning surgery with subsequent appropriate IV antibiotic prophylaxis regimen
Dosing for Helicobacter pylori eradication:
The triple regimen with clarithromycin: Oral: Metronidazole 500 mg 3 times each day combined with clarithromycin 500 mg twice a day and a standard-dose or double-dose proton pump inhibitor (PPI) twice daily; continue regimen for 14 days
Quadruple regimen with bismuth: Oral: Metronidazole 250 mg 4 times each day or 500 mg 3 or 4 times each day in combination with bismuth subsalicylate 300 to 524 mg or bismuth subsalicylate 120 to 300 mg 4 times each day, tetracycline 500 mg 4 times each day, and a standard-dose PPI twice each day; continue regimen for 10 to 14 days
Concomitant regimen: Oral: Metronidazole 500 mg twice each day in combination with clarithromycin 500 mg twice each day, amoxicillin 1 g twice each day, and a standard-dose PPI twice each day; continue regimen for 10 to 14 days
Dosing for Clostridium difficile infection (CDI):
Metronidazole no longer first line antibiotic choice. "Either vancomycin or fidaxomicin are preferred agents over metronidazole for initial episodes of CDI - if access to vancomycin or fidaxomicin is limited, metronidazole is an option for an initial episode of nonsevere CDI only at a dose of 500 mg orally 3 times daily for 10 days
Fulminant Clostridium difficile infection: Vancomycin administered orally is the regimen of choice; in the presence of ileus, vancomycin can also be administered rectally - IV metronidazole should be administered 500 mg every 8 hours together with oral or rectal vancomycin, particularly if an ileus is present
The primary adverse effects of metronidazole include confusion, peripheral neuropathy, metallic taste, nausea, vomiting, and diarrhea. Adverse events seen in greater than 10% of the population include headache (18%), vaginitis (15%), and nausea (10% to 12%). Adverse events affecting less than 10% of the population are metallic taste (9%), dizziness (4%), genital pruritus (5%), abdominal pain (4%), diarrhea (4%), xerostomia (2%), dysmenorrhea (3%), urine abnormality (3%), urinary tract infection (2%), bacterial infection (7%), candidiasis (3%), flu-like symptoms (6%), upper respiratory tract infection (4%), pharyngitis (3%), and sinusitis (3%). Rarely, there are reports of transient leukopenia and neutropenia as well.[20][21]
Metronidazole comes with a black box warning that it may be carcinogenic based on some animal studies in mice and rats. However the risks are considered low, and additional follow-up studies of patients treated do not reveal an increased incidence of cancer. As with any medication choice, physicians and patients must decide whether the benefit from therapy outweighs the potential risk. Use of metronidazole should be reserved for conditions approved by the FDA; it should not be used prophylactically or unnecessarily.[10][22][21]
Additional warnings and precautions for metronidazole exist. Prolonged courses of the drug can cause severe neurological disturbances due to the risk of cumulative neurotoxicity. Monitor for neurologic sequela and discontinue therapy if any abnormal neurologic symptoms occur.[19][22] Prolonged use may also result in fungal or bacterial superinfection, including C. difficile-associated diarrhea (CDAD) and pseudomembranous colitis. There are reports of CDAD even after more than 2 months of postantibiotic treatment. Candidiasis infection may also be more prominent during metronidazole treatment.[19][23]
Metronidazole is contraindicated in patients with documented hypersensitivity to the drug or its components, and it should be avoided in first-trimester pregnancy. Patients should also avoid consuming alcohol or products containing propylene glycol while taking metronidazole and within three days of therapy completion. Metronidazole is likewise contraindicated if there has been recent disulfiram use within the past two weeks.[10]
During and after prolonged therapy or repeated courses, complete blood count (CBC) with differential requires monitoring. Carefully observe patients for the onset of neurologic symptoms and consider discontinuation of metronidazole when or if new neurologic symptoms occur. Elderly patients, as well as previously diagnosed patients with severe hepatic impairment and/or end-stage renal disease, should also be monitored closely.[10]
There have been reports of disulfiram-like reaction in patients drinking ethanol while administered systemic or vaginal metronidazole. A typical disulfiram reaction causes flushing, tachycardia, palpitations, nausea, and vomiting. Alcohol should be avoided during treatment and from up to forty-eight hours to fourteen days after treatment completion depending on the source; the manufacturer product information recommends avoiding alcohol ingestion during metronidazole therapy and for at least 48 hours afterward. Ethanol-containing medications such as elixirs as well as tipranavir, capsules, intravenous (IV) anidulafungin, IV trimethoprim-sulfamethoxazole, and many cough/cold syrups can also lead to a disulfiram-like reaction when ingested with metronidazole.[10][24]
There should be judicious prescribing of metronidazole by providers only for known indications and high clinical suspicion for needing treatment of anaerobic bacterial infections, protozoal infections, and microaerophilic bacterial infections. Overprescribing may contribute to increasing future antibiotic resistance to the drug. Documentation already exists regarding increased resistance to metronidazole in the treatment of C. difficile infections. Also, prescribers should routinely provide education to patients to abstain from alcoholic beverages while taking metronidazole, which in turn will help lead to fewer disulfiram reaction symptoms. The team of health professionals including physicians, nurses, and pharmacists must work together to provide the best care for these patients when using this drug. [Level V]
Metronidazole - Questions
Which of the following drugs is activated by ferredoxin?
Bacitracin
Which of the following describes the action of metronidazole?
It is activated by ferredoxin
It inhibits 30S ribosome
It inhibits cell wall synthesis
It generates free radicals
A patient has been diagnosed with Gardnerella vaginalis infection. Which of the following antibiotics is FDA approved to treat this infection?
A patient diagnosed with acute dysentery due to amebiasis has been prescribed metronidazole. Which of the following dosages would be appropriate?
750 mg immediate-release tablets every 8 hours for 5 to 10 days
750 micrograms immediate-release tablets every 8 hours for 5 to 10 days
750 mg immediate-release tablets every 8 hours for 30 days
750 mg immediate-release tablets once daily for 5 to 10 days
A patient is 3 days post-operative following intestinal surgery and has been receiving metronidazole intravenously. Which of the following is true regarding the administration of this medication?
Double-gloving is recommended during the administration of metronidazole
Metronidazole is safe to give repeatedly without concern for super infections
The oral form of metronidazole is to be taken on an empty stomach
Metronidazole use may cause the urine to be discolored
What should patients avoid while taking metronidazole?
Sunlight exposure
Sexual activity
Strenuous exercise
Which of the following medications is known to produce a disulfiram-like effect?
Which of the following infections is NOT treated with metronidazole?
Amoebiasis
Enterobius vermicularis infection
A patient states that he started taking a brompheniramine and pseudoephedrine elixir for an upper respiratory infection. However, he is concerned that he now has something more serious because he has been experiencing severe nausea, vomiting, dizziness, and a throbbing headache. He is currently taking metronidazole, furosemide, atenolol, and atorvastatin. It is then determined that the patient is experiencing a disulfiram reaction. Which of the drugs that he is currently taking can cause a disulfiram-like reaction when taken concurrently with an elixir formulation?
Which is true of metronidazole?
Activated by ferredoxin
Inhibits 30S ribosome
Inhibits cell wall synthesis
Generates free radicals
A post-surgical patient has an order for metronidazole 4 g intravenous every 8 hours. What should be the response to this order?
Change the administration route to intramuscularly
Process the order promptly
Hold the order and contact the doctor
Switch to a different agent for post-surgical infection prophylaxis
A postoperative patient has been receiving metronidazole intravenously. When performing medication administration with this agent, which of the following is important?
Patients should be warned that their urine may turn dark orange
Oral metronidazole can be taken without regard to food
It is typically dosed once daily for bacterial infections
It can be safely given with lopinavir/ritonavir
What is the brand name for metronidazole?
Zosyn
Axid
With which of the following antibiotics is alcohol completely contraindicated?
A patient enters the pharmacy to pick up a prescription for metronidazole. Which of the following is an important counseling point one should share with the patient?
Avoid this medication if a penicillin allergy exists
Take the medication on an empty stomach
Stop taking the medication as soon as the patient feels better
Avoid alcohol while taking the medication
A 16-year-old female is being treated for insulin dependent diabetes mellitus and develops a perineal abscess. It is foul smelling and you suspect an anaerobic infection. Which of the following antibiotics has anaerobic activity?
Trimethoprim-sulfamethoxazole
Metronidazole - References
Löfmark S,Edlund C,Nord CE, Metronidazole is still the drug of choice for treatment of anaerobic infections. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America. 2010 Jan 1; [PubMed]
Edwards DI, Nitroimidazole drugs--action and resistance mechanisms. I. Mechanisms of action. The Journal of antimicrobial chemotherapy. 1993 Jan; [PubMed]
Edwards DI, Reduction of nitroimidazoles in vitro and DNA damage. Biochemical pharmacology. 1986 Jan 1; [PubMed]
Tocher JH,Edwards DI, The interaction of reduced metronidazole with DNA bases and nucleosides. International journal of radiation oncology, biology, physics. 1992; [PubMed]
Stratton CW,Weeks LS,Aldridge KE, Inhibitory and bactericidal activity of selected beta-lactam agents alone and in combination with beta-lactamase inhibitors compared with that of cefoxitin and metronidazole against cefoxitin-susceptible and cefoxitin-resistant isolates of the Bacteroides fragilis group. Diagnostic microbiology and infectious disease. 1992 May-Jun; [PubMed]
Ravdin JI,Skilogiannis J, In vitro susceptibilities of Entamoeba histolytica to azithromycin, CP-63,956, erythromycin, and metronidazole. Antimicrobial agents and chemotherapy. 1989 Jun; [PubMed]
Nix DE,Tyrrell R,Müller M, Pharmacodynamics of metronidazole determined by a time-kill assay for Trichomonas vaginalis. Antimicrobial agents and chemotherapy. 1995 Aug; [PubMed]
Ralph ED,Kirby WM, Unique bactericidal action of metronidazole against Bacteroides fragilis and Clostridium perfringens. Antimicrobial agents and chemotherapy. 1975 Oct; [PubMed]
Pankuch GA,Jacobs MR,Appelbaum PC, Susceptibilities of 428 gram-positive and -negative anaerobic bacteria to Bay y3118 compared with their susceptibilities to ciprofloxacin, clindamycin, metronidazole, piperacillin, piperacillin-tazobactam, and cefoxitin. Antimicrobial agents and chemotherapy. 1993 Aug; [PubMed]
Finegold SM, Metronidazole. Annals of internal medicine. 1980 Oct; [PubMed]
Gonzales MLM,Dans LF,Sio-Aguilar J, Antiamoebic drugs for treating amoebic colitis. The Cochrane database of systematic reviews. 2019 Jan 9; [PubMed]
van Schalkwyk J,Yudin MH, Vulvovaginitis: screening for and management of trichomoniasis, vulvovaginal candidiasis, and bacterial vaginosis. Journal of obstetrics and gynaecology Canada : JOGC = Journal d'obstetrique et gynecologie du Canada : JOGC. 2015 Mar; [PubMed]
Sexually Transmitted Diseases: Summary of 2015 CDC Treatment Guidelines. Journal of the Mississippi State Medical Association. 2015 Dec; [PubMed]
Gardner TB,Hill DR, Treatment of giardiasis. Clinical microbiology reviews. 2001 Jan; [PubMed]
Mazuski JE,Tessier JM,May AK,Sawyer RG,Nadler EP,Rosengart MR,Chang PK,O'Neill PJ,Mollen KP,Huston JM,Diaz JJ Jr,Prince JM, The Surgical Infection Society Revised Guidelines on the Management of Intra-Abdominal Infection. Surgical infections. 2017 Jan; [PubMed]
Stevens DL,Bisno AL,Chambers HF,Dellinger EP,Goldstein EJ,Gorbach SL,Hirschmann JV,Kaplan SL,Montoya JG,Wade JC, Practice guidelines for the diagnosis and management of skin and soft tissue infections: 2014 update by the infectious diseases society of America. Clinical infectious diseases : an official publication of the Infectious Diseases Society of America. 2014 Jul 15; [PubMed]
Bratzler DW,Dellinger EP,Olsen KM,Perl TM,Auwaerter PG,Bolon MK,Fish DN,Napolitano LM,Sawyer RG,Slain D,Steinberg JP,Weinstein RA, Clinical practice guidelines for antimicrobial prophylaxis in surgery. American journal of health-system pharmacy : AJHP : official journal of the American Society of Health-System Pharmacists. 2013 Feb 1; [PubMed]
Chey WD,Leontiadis GI,Howden CW,Moss SF, ACG Clinical Guideline: Treatment of Helicobacter pylori Infection. The American journal of gastroenterology. 2017 Feb; [PubMed]
McDonald LC,Gerding DN,Johnson S,Bakken JS,Carroll KC,Coffin SE,Dubberke ER,Garey KW,Gould CV,Kelly C,Loo V,Shaklee Sammons J,Sandora TJ,Wilcox MH, Clinical Practice Guidelines for Clostridium difficile Infection in Adults and Children: 2017 Update by the Infectious Diseases Society of America (IDSA) and Society for Healthcare Epidemiology of America (SHEA). Clinical infectious diseases : an official publication of the Infectious Diseases Society of America. 2018 Mar 19; [PubMed]
Hernández Ceruelos A,Romero-Quezada LC,Ruvalcaba Ledezma JC,López Contreras L, Therapeutic uses of metronidazole and its side effects: an update. European review for medical and pharmacological sciences. 2019 Jan; [PubMed]
Saginur R,Hawley CR,Bartlett JG, Colitis associated with metronidazole therapy. The Journal of infectious diseases. 1980 Jun; [PubMed]
Williams CS,Woodcock KR, Do ethanol and metronidazole interact to produce a disulfiram-like reaction? The Annals of pharmacotherapy. 2000 Feb; [PubMed]
McKendrick MW,Geddes AM, Neutropenia associated with metronidazole. British medical journal. 1979 Sep 29 [PubMed]
Smith JA, Neutropenia associated with metronidazole therapy. Canadian Medical Association journal. 1980 Aug 9 [PubMed]
The intent of StatPearls is to provide practice questions and explanations to assist you in identifying and resolving knowledge deficits. These questions and explanations are not intended to be a source of the knowledge base of all of medicine, nor is it intended to be a board or certification review of Gastroenterology. The authors or editors do not warrant the information is complete or accurate. The reader is encouraged to verify each answer and explanation in several references. All drug indications and dosages should be verified before administration.
StatPearls offers the most comprehensive database of free multiple-choice questions with explanations and short review chapters ever developed. This system helps physicians, medical students, dentists, nurses, pharmacists, and allied health professionals identify education deficits and learn new concepts. StatPearls is not a board or certification review system for Gastroenterology, it is a learning system that you can use to help improve your knowledge base of medicine for life-long learning. StatPearls will help you identify your weaknesses so that when you are ready to study for a board or certification exam in Gastroenterology, you will already be prepared.
Our content is updated continuously through a multi-step peer review process that will help you be prepared and review for a thorough knowledge of Gastroenterology. When it is time for the Gastroenterology board and certification exam, you will already be ready. Besides online study quizzes, we also publish our peer-reviewed content in eBooks and mobile Apps. We also offer inexpensive CME/CE, so our content can be used to attain education credits while you study Gastroenterology.
|
cc/2019-30/en_middle_0059.json.gz/line235
|
__label__wiki
| 0.839624
| 0.839624
|
Home / Lifestyle / Culture & Society / Latest Drama Hit Creates New Travel Boom
Latest Drama Hit Creates New Travel Boom
Posted on March 22, 2016 by Korea Bizwire in Culture & Society, Lifestyle, Sports & Entertainment, Top News, Travel & Leisure with 0 Comments
Navagio Beach. (Image : Yonhap)
SEOUL, March 22 (Korea Bizwire) - South Korean travelers are showing interest in a remote part of Greece, while cities here that are home to former mines and military facilities are undertaking major uplifts to attract Chinese tourists, thanks to a TV drama that has been a stellar success.
Local travel agencies said Tuesday they have been getting inquiries about tour programs to Zakynthos, one of the Ionian Islands of Greece that is the background of the currently running South Korean drama “Descendants of the Sun.” The drama is set in a make-believe country called Uruk, but the starring couple has been filmed on the island and at its Navagio Beach, known for the shipwrecked vessel from 1980 that still rests in the sand, and highlighted in a scene where the drama’s love-struck couple take a stroll. The drama commands a near-30 percent viewership.’
The tourism division of the online shopping mall Interpark put out a new nine-day package tour to Greece that includes visits to the beach. Company officials said there were immediate reservations. Very Good Tour earlier this month similarly launched a nine-day trip to Greece with an overnight stay on Zakynthos. The tour program goes straight to the island after starting in Athens. The travel agency had more than 120 reservations within two weeks after the package was put on the market. Naeil Tour is offering free travel courses to Athens and Zakynthos together.
At home, cities that were featured in the drama are developing content that can be featured on tours to attract visitors from China, where the drama has also drawn a large viewership. They are hoping for a repeat of “Winter Sonata,” a drama from 2002 regarded as the launcher of the K-culture boom, which drew fans from across Asia to sites where it was filmed, mostly places that were hitherto unknown.
The scenes of the military barracks shown in “Descendants of the Sun,” in which the lead male actor plays an Army captain, were filmed at a former mine in the eastern city of Taebaek and at Camp Greaves in Paju, north of Seoul, that used to be a U.S. military base.
The Korea Tourism Organization (KTO) plans to invite foreign press members and travel agencies to the sites to promote them as new tour destinations.
“Like ‘Winter Sonata,’ dramas introduce new things for people to see in not-so-known places,” an official at KTO said. “We need to add new content rather than having foreign tourists just come to the sites.”
TV programs have often presented ideas for travelers. The “Over Flowers” series run by a local cable channel, which groups actors and actresses and sends them on unguided trips to foreign countries on a set budget, had created travel booms to Taiwan and most recently to Namibia.
“Namibia wasn’t a country that many South Koreans have been heading to,” said a Hana Tour agent. “But after the TV program, inquiries and reservations followed. We now have a set group tour scheduled to depart.”
GM Korea Chief Says Will Reach Double-Digit Market Share in 2017
Businesses Turn to IT Services to Cut Costs
Lotte Launches Lactobacillus Chocolate
Netmarble to Seek IPO on Local Main Bourse
|
cc/2019-30/en_middle_0059.json.gz/line238
|
__label__wiki
| 0.732295
| 0.732295
|
LegalInfo Blog
Search case law
Legalinfo
Latest Cases
posted by Morris in Labour Law | 0 Comments
MEC FOR THE DEPARTMENT OF EDUCATION WESTERN CAPE GOVERNMENT v MUNIMAH JETHRO N.O (LAC). Summary: Discharge from public service on account of abscondment in terms of the Employment of Educators Act- employer with ill-health related conditions was discharged from employment- his application in terms of 14(2) of the EEA for reinstatement was dismissed because employee had not demonstrated good cause warranting his reinstatement- employee challenging the refusal to reinstatement on the basis of irrationality- employer contending that its conduct does not amount to administrative action and that its decision was rational because employee did not submit sick note evincing his illness
LUFIL PACKAGING (ISITHEBE) (A division of Bidvest Paperplus (Pty) Ltd) v CCMA (LAC). Summary: Dispute concerning organisational rights - union seeking to exercise its rights by requesting employer to deduct membership fees from its members- employer disputing union organisational rights on the basis that it falls outside the registered scope of union and that employees not eligible under the unions constitution to be members for the purposes of assessing a unions representativeness in terms of Chapter III of the LRA. Employer further argues that because the claimed members are precluded by the unions constitution from becoming its members, any purported admission of such employees as members is ultra vires the unions constitution and invalid. Union contending that that as a registered trade union, representative of the majority of the workers, it has legal standing to claim organisational rights.
PAILPRINT (PTY) LTD v RICHARD LYSTER N.O CCMA (LAC). Summary: Strike related misconduct - employees dismissed for breaching picketing rule by carrying dangerous weapons in contravention of - picketing rule prohibiting employees from carrying or wielding of any weapons during the strike picket. Held: In finding that the employees were not brandishing or wielding of dangerous weapons as they had been charged but were clearly just carrying sticks in their hands, the arbitrator adopted an unduly technical approach. Appropriate regard was not had to the purpose of the rule and the harm it sought to avoid. As much was evident from the reliance placed by the arbitrator in the determination of the matter on the definition of the word 'wield'. The decision to have a sjambok, PVC pipe and sticks at a protest, at which others were in possession of a golf club and axe, was not only a clear breach but, viewed objectively, was aimed at sending a message which, at the very least, was threatening to others. Within the context of the nature of the strike violence committed, the seriousness of this breach was overlooked by the arbitrator. Arbitration award and judgment of the Labour Court set aside- appeal upheld with costs.
NUMSA v AVENG TRIDENT STEEL (LAC). Summary: Claim for automatically unfair dismissal on the basis that the reason for the dismissal was the refusal by the employees to accept employers demands in respect of change of conditions of employment in terms of section 187(1)(c) of the LRA - employer embarking on a restructuring in order to increase profitability - in the process of consultation parties agreeing regrading positions in order to save costs pending finalization on the structure - such consideration necessitating change of condition of employment - employees refused amendment of their terms and condition of employment and were dismissed - union contending that such dismissal automatically unfair - court reasoning that the question for determination is when operational requirements may justify the dismissal of employees who reject employer demands to amend terms and conditions of employment judgment in Frys Metal considered and distinguished - Held that while employees cannot be dismissed for refusing to accept a demand, they can be dismissed if that refusal results in a more dominant or proximate operational necessity. This legislative scheme of collective bargaining is in line with the constitutional right of trade unions and employers to engage in collective bargaining in that any limitation of the power play is reasonable and justifiable in the balance struck between the strike weapon and the employers power of implementation at impasse.
AFGEN (PTY) LTD v NTOMBIZODWA ZIQUBU (LAC). Summary: Review of arbitration award -employee dismissal found substantively unfair - Commissioner granting limited compensation on account that reinstatement impracticable. Appeal Court finding employees relationship with her direct superior did not exist consequently it was impracticable to reinstate employee- Appeal upheld - Court setting aside only the quantum of compensation granted by the commissioner and awarded maximum. Recusal - no basis for the application refused.
HOSEA MUSHI v EXXARO COAL (PTY) LTD GROOTEGELUK COAL MINE (LAC). Summary: Review of arbitration award - employee dismissed for endangering the life of the foreman and insubordination - employee showing remorse for acting in an incorrect manner - commissioner finding that dismissal not appropriate sanction in accordance with employers disciplinary guideline which provides final warning for insubordination. Held that: In finding that reinstatement with a final written warning was appropriate when there was no evidence that the misconduct committed was so serious and of such gravity that it made a continued employment relationship intolerable, the arbitrator cannot be faulted. No reviewable error or irregularity was committed by him and the decision arrived at was not one which a reasonable decision-maker could not reach on the material before him. Labour Courts judgment set aside. Appeal upheld with costs.
CITY OF JOHANNESBURG v SAMWU OBO LUCAS MONARENG (LAC). Summary: Whether a public sector employer should provide security in terms of section 145(7)(8)of the Labour Relations Act - employer contending that it is prohibited in terms of the Local Government: Municipal Finance Management Act from furnishing security -â€Å" court upholding principles in Rustenburg Local Municipality that all employers whether in the public or private sector should be subject to the same requirement of providing security thereby disallowing the contrary view adopted in Free State Gambling and Liquor Board.
IMPERIAL CARGO (PTY) LTD v DETAWU (LAC). Summary: Collective agreement prohibiting strike at plant level in furtherance of demands involving cost and affecting the wage packets of employees. Union notifying employer of its intention to strike - Labour Court finding three of unions demands fall within the impermissible demands but found that demand for re-scheduling drivers trips over weekends not prohibited and not falling within the substantive issues as contemplated in the collective agreement.
MTN (PTY) LTD v CCMA (LC). Summary: Unopposed application for review in terms of section 145 of the Labour Relations Act, 66 of 1995 - test for review restated - transfer of employee constitutes a demotion if status is diminished even if remuneration is not affected - failure to consult with an employee prior to taking the decision to transfer is procedurally unfair - application dismissed.
PUTCO (PTY) LTD v SA ROAD PASSENGER BARGAINING COUNCIL (LC). Summary: Labour Court has jurisdiction in terms of s 158 (1) (g) to review decisions by exemption and exemption appeal authorities established by bargaining councils. The threshold for review is the Sidumo test of reasonableness. Decision-makers are required to make decisions on the basis of the evidence before them, with affordability as the primary criterion where that is the basis of the application for exemption. It is not for exemption authorities to engage in Solomonic decision-making more suited to wage arbitrations. Affordability is a factual issue, and must be resolved as such. Exemption authorities must give reasons for their decisions. A failure to do so constitutes a material irregularity. Question remains whether outcome of process is reasonable. Remedy - where employer justifiably has no faith in exemption authorities and where all relevant information is available to the court, appropriate for the court, given the statutory imperative of expeditious dispute resolution, to substitute its decision for that of the decision-maker.
This entry was posted on April 9, 2019 at 4:46 PM and has received 0 views. There are currently 0 comments. Print this entry.
Engineering brain drain is alarming, says civil engineering body Saice
Business Report writes that the SA Institute of Civil Engineering (Saice), one of the biggest voluntary professional organisations in the country with 12,000 members, indicated on Monday that it had lost 1.73% of its members to emigration in the past three years.
Cash-strapped NPA will have to shed over 550 jobs to stay within budget, says Batohi
BusinessLive reports that the National Prosecuting Authority (NPA) does not have enough money to pay all of its salaries this financial year and will have to slash staff by more than 550 if it is to remain within budget over the medium term.
Five-year suspended sentence for Cape Town driver's licence examiner who took bribes
TimesLIVE reports that a driver's licence examiner who took bribes for learner’s and driver’s licences in Khayelitsha, Cape Town, has been sentenced to a five-year jail term.
Denel pays staff salaries â€" but leaves out pensions contributions
TimesLIVE reports that employees at state-owned arms manufacturer Denel learned on Tuesday that the company had paid their salaries, but not their pension contributions.
Kenny Kunene's e-hailing business empowers drivers with cars
Sunday Independent reports that while its established competitors in the e-hailing taxi business expect drivers to have their own cars or be employed by a vehicle owner, new player YooKoo Ride is empowering drivers who do not own cars.
Diepsloot taxi drivers, passengers regularly robbed at gunpoint
Independent News reports that in recent weeks, taxi drivers and passengers on the route between Marabastad and Diepsloot have been robbed at gunpoint by criminals posing as passengers.
No beards or tattoos for City of Cape Town law enforcement officers
Saturday Star reports that law enforcement officers in Cape Town can’t sport a beard, a funky moustache or a visible tattoo.
De Beers and partners launch three-year programme for female engineers
ANA reports that diamond company De Beers said on Monday it had launched a three-year partnership with Women in Engineering (WomEng), consumer goods company Unilever and professional services firm EY to develop the next generation of highly skilled female engineers.
Afrisam's collapse caused serious tensions between PIC and GEPF, Mpati inquiry hears
Business Report writes that former Public Investment Corporation (PIC) CEO Dr Daniel Matjila has told of how the collapse of cement company Afrisam, "created serious tensions between the PIC and GEPF (Government Employees Pension Fund)."
Joseph Mathunjwa risks losing Amcu amid questions of identity and direction
Miningmx writes that the Association of Mineworkers and Construction Union (Amcu) seems to have reached a plateau after its five-month strike in Sibanye-Stillwater’s gold mines effectively accomplished nothing beyond the impoverishment of its members.
Progress being made in reducing public sector wage bill
The Star reports that according to Public Service and Administration Minister Senzo Mchunu, government has put measures in place to manage the public sector wage bill.
This entry was posted on January 15, 2019 at 10:32 PM and has received 0 views. There are currently 0 comments. Print this entry.
Cosatu approves of new ANC MPs, but they 'will have to pull up their socks'
EWN reports that African National Congress (ANC) tripartite alliance partner Cosatu said on Tuesday it welcomed the new leadership in Parliament.
Samwu 'notes' allegations of grand-scale looting of workers' strike fund
ANA reports that the SA Municipal Workers Union (Samwu) said on Tuesday that its leadership would be receiving a report of alleged grand-scale looting of the union's coffers as they were currently holding a scheduled central executive committee meeting.
No injuries or fatalities reported in Germiston train fire on Tuesday
News24Wire reports that no injuries or fatalities were reported after a train caught fire in Dinwiddie, Germiston, on Tuesday.
Samwu slams appointment of David Tembe as acting JMPD head
The Star reports that the Johannesburg Metro Police Department (JMPD) has a new acting executive director of public safety following the appointment of its police chief David Tembe.
Retrenchments constituted biggest share of Libertys monthly income claims in 2018
BusinessLive reports that retrenchments accounted for the biggest share of monthly income claims paid out by Liberty in the 2018 financial year.
Lonmin plans to cut 4,100 workers as it closes platinum mines
Bloomberg reports that Lonmin plans to cut 4,100 workers at mines that have run out of profitable ore and are being closed.
Public Protector slates SA Weather Service for 'unlawful' appointment of manager with insufficient credentials
TimesLIVE reports that the SA Weather Service (Saws) must approach the courts within 30 days to have the "unlawful" appointment of a manager with insufficient credentials set aside and take appropriate disciplinary action against suspended CEO Jerry Lengoasa for his improper conduct in the matter.
Choppies CEO suspended amid legal and forensic investigations
Fin24 reports that following a meeting on Monday, the board of grocery retailer Choppies has suspended its CEO Ramachandran Ottapathu with effect from Wednesday, 22 May.
Battle for control of Fawu could eat into the unions membership
BusinessLive reports that the bruising battle for control of the Food and Allied Workers Union (Fawu) could spur rival unions to eat into its 126,000-strong membership in the farming, fast food, beverage, fishing, wholesale and retail, and hospitality sectors.
Gas leak at Cape Town recycling company claims four lives on Tuesday
News24 reports that four people died following a gas leak on Tuesday at a Cape Town plastic recycling company in Birch Road, Beaconvale, Parow.
Well-known Labour Court judge dies after black mamba bite in Zambia
News24 reports that a Cape Town Labour Court judge has died after he was bitten by a black mamba while on holiday in Zambia.
This entry was posted on December 6, 2018 at 6:23 PM and has received 0 views. There are currently 0 comments. Print this entry.
NUMSA OBO E MASANA v GILI PIPE IRRIGATION (PTY) LTD (LAC). Summary: Rescission application . Labour Court dismissing rescission application by employee. Labour Court holding the view that award prescribed and no prospects of success in rescission application . principles relating to prescription restated . Metrobus and Piemans Pantry decisions in Constitutional Court applied - On the facts, prescription had not run its full term; employees right of action had not prescribed . premise upon which application dismissed by Labour court incorrect - Appeal upheld and matter remitted to the Labour Court for consideration of the merits of the rescission application.
GOLDGRO (PTY) LTD v CAROLINE MCEVOY (LAC). Summary: Alleged Protected disclosure . employee contending that her retrenchment was due to the disclosure she made concerning certain irregularities to the board of which she is a member - the employee caused her attorney to send a letter (the PD letter) to the board concerning: (1) the integrity of the facility for coins held in safekeeping, (2) the integrity of the appellants stance on dealing with lessors to whom turnover rentals were owed, and (3) the merits of an application to place the appellant into business rescue.
GENET MINERAL PROCESSING (PTY) LTD v CCMA (LAC). Summary: Review of arbitration award . employee dismissed for negligently allowing blockage to occur thereby interrupting production at the plant which caused financial loss to the employer . There was a confusion about the dates when the blockage occurred . the wrong dates initially alleged - commissioner finding that no misconduct committed on the dates initially alleged and that dismissal unfair
TRANSPORT AND ALLIED WORKERS UNION OF SOUTH AFRICA v ALGOA BUS COMPANY (PTY) LIMITED (LAC). Summary: Condonation for the late filing of the notice of appeal and reinstatement of appeal . union contending that financial constraints limited its ability to brief counsel who will accept its payment condition . court held that an explanation based on the lack of funds will not automatically result in the granting of condonation and that explanation for the delay wholly unsatisfactory as union not providing financial statement proving its financial distress. Application for the reinstatement of the appeal dismissed and matter struck from the roll.
PIKITUP JOHANNESBURG (SOC) LIMITED v NEIGHBOUR EDWARD MUTERO (LAC). Summary: Enforcing arbitration award in terms of s158(1)(c) of the LRA . Labour Court making award an order of court reinstating employee in former position or any available executive positions and payment of bonuses . employer contending that as the result of the restructuring employees former position downgraded to that of General Management .held that employee was employed in an executive position prior to his dismissal and at the time of his reinstatement there were three vacant executive positions. So even if, as a result of the restructuring of the executive post which employee had occupied before his dismissal, it became impossible for him to be reinstated into that post, he was entitled to be reinstated into any of the other three vacant executive positions. As regards the payment of the bonuses ordered by the Labour Court, court held that payment of bonuses is discretionary and based on performance. Appeal partially upheld.
MACSTEEL TRADING WADEVILLE v FRANCOIS VAN DER MERWE N.O (LAC). Summary: Review of arbitration award . employer raising union undue delay in prosecuting the review application in its answering affidavit in the review application . Labour Court refusing to consider the undue delay because the employer had not filed a rule 11 application . court finding that by the time review was heard, the application had in effect lapsed and been archived in terms of Practice Manual of the Labour Court- as such the Labour Court had no jurisdiction and should have struck the matter from the roll or give the employer an opportunity to file a separate rule 11 application demonstrating why the matter should be dismissed or struck from the roll on the basis of undue delay. Appeal upheld with costs and Labour Courts judgment set aside.
WORKERSLIFE DIRECT (PTY) LTD v E MALOKA (LAC). Summary: Specific performance . employee claiming payment of post-employment commissions in terms of a Group Scheme Broker (GBS) contract after resigning . employee contending that he had concluded both an admin contract and a GSB contract with employer and that was entitled both to the benefits of an administrative employee and to the post-termination commission . employer contending that only GSB employees entitled to post-termination and targets commission and disputed the authenticity of the GSB contract - court finding that employee was paid on terms identical to those provided for in the GSB contract and that employee GBS contract probably authentic . Labour Courts judgment upheld and appeal dismissed with costs.
NKOMATI JOINT VENTURE v CCMA (LAC). Summary: Review of arbitration award . duty of commissioner to assist unrepresented litigants - employer contending that failure by the commissioner to lend a helping hand and to inform it that it was required to re-open its case and lead evidence in rebuttal of employees new version was a gross irregularity
NATIONAL COMMISSIONER OF THE SOUTH AFRICANPOLICE SERVICE v POPCRU obo A. MEZICHEL (LAC). Summary: Review of the disciplinary sanction imposed by employers appeal authority . appeal authority reversing sanction of dismissal against employee . court finding that appeal authoritys decision irrational and unreasonable in light of the employees conduct.
TELKOM SA LTD v THE COMMISSION FOR CONCILIATION, MEDIATION AND ARBITRATION (LC). Summary: Jurisdiction of the CCMA to deal with an unfair labour practice dispute emanating from section 189 process. Section 186(2)(a) . failure to appoint the employee to a promotive position created consequent to restructuring and offered as an alternative to retrenchment. Interpretation of section 193(4) of the LRA . remedy of reinstatement and promotion of a retrenched employee.
This entry was posted on November 27, 2018 at 9:53 PM and has received 0 views. There are currently 0 comments. Print this entry.
The legal position on pre-suspension hearings has changed
For many years, we have advised employers who are about to suspend an employee on full remuneration to provide such employee with an opportunity to make representations on their proposed suspension. The Constitutional Court has on 19 February 2019 handed down judgment in the matter of Long v South African Breweries (Pty) Ltd and Others [2018] ZACC 7 finding that when an employer suspends an employee, there is no requirement to have a hearing prior to the suspension. Put differently, the legal position on pre-suspension hearings has now changed.
Background facts
Mr Long was employed by South African Breweries (Pty) Ltd (SAB) as its district manager for the Border District. One of his core responsibilities related to management of a fleet of company vehicles. In May 2013, one of these vehicles was involved in a fatal accident. It was subsequently discovered that the vehicle was not roadworthy and unlicensed. After an investigation by SAB, it was discovered that numerous vehicles, which Mr Long was responsible for, were not roadworthy and unlicensed. After a disciplinary hearing, Mr Long was dismissed for misconduct on the basis of dereliction of duties, gross negligence and brining the company name into disrepute. At the start of the investigation, Mr Long was suspended from work until his dismissal.
Mr Long subsequently instituted separate referrals to the Commission for Conciliation, Mediation and Arbitration (CCMA) - one relating to his suspension (prior to dismissal) and the other relating to dismissal.
On the suspension referral, the CCMA found that this constituted an unfair labour practice as Mr Long had not been given a hearing prior to suspension and that the suspension was unreasonably long. Mr Long was awarded compensation amounting to two months of his remuneration.
Pre-suspension hearings
One of the central questions before the Constitutional Court was whether an employer is required to hold a hearing before suspending an employee. The purpose of the hearing would be to allow the employee to make representations to ultimately convince an employer not suspend the employee.
The Labour Court found that an employer is not obliged to grant an employee the opportunity to a hearing prior to precautionary suspension. In order to ensure fairness, the suspension must be linked to a pending investigation and ultimately should be used by an employer as a measure to protect the integrity of that investigation. If the employee is suspended on full remuneration, this will mitigate any prejudice suffered by the employee. The Labour Court therefore held that the suspension of Mr Long did not amount to an unfair labour practice.
Ultimately, the Constitutional Court agreed with the Labour Court on this question. Where the employer suspends an employee as a precautionary measure, such an employee is not entitled to a pre-suspension hearing. In order to assess the fairness of a suspension, two considerations should be borne in mind:
Is there a fair reason for the suspension of the employee?
Will the suspension prejudice the employee concerned?
The Constitutional Court upheld the decision of the Labour Court. The fact that Mr Long did not receive a pre-suspension hearing did not amount to an unfair labour practice. The suspension was also held to be fair in that it was used to protect the integrity of the investigation. Mr Long was also suspended on full remuneration and, despite the length of the suspension, this mitigated any prejudice suffered by him
Importantly, this judgment does not mean that suspension can be used as a form of discipline (i.e. suspension without pay or for unreasonably long periods of time). Employers are still required to ensure that investigations into alleged misconduct by employees are completed within a reasonable period of time.
Employers who currently provide for pre-suspension hearings in their workplace policies should consider amending such policies to align them with this judgment.
This entry was posted on June 20, 2018 at 12:31 PM and has received 106 views. There are currently 1 comments. Print this entry.
LRA Amendments 2018
posted by Morris in Legislation | 1 Comments
Labour Relations Amendments May 2018 BCEA Amendment Bill 2017;
BCEA Memorandom of Objects;
Employment Services Act 2014;
Labour Relations Amendment Bill 2017;
LRA Memorandom of Objects;
National Minimum Wage Bill;
Impact Assessment.
Click here to download the zipped files.">
This entry was posted on May 31, 2018 at 1:05 PM and has received 163 views. There are currently 1 comments. Print this entry.
Legislation Update
New Minimum Wages: Wholesale & Retail, and Farm and Forestry Worker Sectors
New Minimum Wages: Wholesale and Retail Sector: 01 February 2018 to 31 January 2019
Please follow the link to download the new minimum wages
New Minimum Wages: Farm and Forestry workers Sectors: 01 March 2018 to 28 February 2019
This entry was posted on January 25, 2018 at 6:03 PM and has received 449 views. There are currently 2 comments. Print this entry.
Domestic Workers Wage Increase
The Minister of Labour, on 15 December 2017, gazetted new minimum wage rates for the Domestic Worker Sector effective from 1 January 2018.
To view the amended wage schedules click here.
This entry was posted on January 17, 2018 at 12:47 PM and has received 508 views. There are currently 2 comments. Print this entry.
Hospitality Sector
Hospitality sector minimum wage for 2017/2018 by Lloyd Ramutloa -- last modified 2017-07-03 13:11 3 July 2017 The minimum wage for South Africa's vulnerable sector of hospitality has been revised upward with effect from 01 July 2017.
The new Hospitality Sectoral Determination which governs minimum wage rate in the sector will be effective until 30 June 2018.
The minimum rate for employers with 10 or less employees will be a monthly wage of R3 193.12 (2016/2017: R2 959.35); a weekly rate of R736.92 (2016/2017: R689.97); and an hourly rate of R16.36 (2016/2017: R15.17).
The new wages for employers with more than 10 employees will be a minimum monthly rate of R3 559.10 (2016/2017: R3 298.52); a weekly rate of R821.34 (2016/2017: R761.25); and an hourly rate of R18.25 (2016/2017: R16.91).
The latest increase was arrived at using the consumer price index of 6.4 percent plus 1.5 percent. The total increase is 7.9 percent.
This entry was posted on July 5, 2017 at 12:42 PM and has received 876 views. There are currently 7 comments. Print this entry.
Minimum Wages Farm, Forestry 2017
This entry was posted on March 2, 2017 at 1:41 PM and has received 1355 views. There are currently 7 comments. Print this entry.
Wholesale & Retail Wage Increase
posted by Morris in Labour Law | 32 Comments
This entry was posted on February 2, 2017 at 12:16 PM and has received 1619 views. There are currently 32 comments. Print this entry.
COIDA
Compensation for Occupational Injuries and Diseases Act 130 of 1993, as amended
Amendment of Schedule 4 of Act 130 of 1993 :
Manner of calculating compensation
GN 448 39931/15-04-2016
Annual increases in medical tariffs for medical services providers
GenN 256/GG 39955/26-04-2016
Increase in monthly pensions
GN 447/GG 39931/15-04-2016
Increase of maximum amount of earnings on which the assessment of an employer shall be calculated
Rules, Forms and Particulars
This entry was posted on July 18, 2016 at 12:21 PM and has received 1395 views. There are currently 5 comments. Print this entry.
Earnings threshold
I, Mildred Nelisiwe Oliphant, Minister of Labour, in terms of Section 6(3) of the Basic Conditions of Employment Act, No. 75 of 1997, (the Act), determine that all employees earning in excess of R205 433.30 (two hundred and five thousand, four hundred and thirtythree rand, thirty cents) per annum be excluded from sections 9, 10, 11, 12, 14, 15, 16, 17(2), 18(3) of the Act with effect from 1 July 2014.
For the purposes of this notice:
"Earnings" means the regular annual remuneration before deductions, i.e. income tax, pension, medical and similar payments but excluding similar payments (contributions) made by the employer in respect of the employee: Provided that subsistence and transport allowances received, achievement awards and payments for overtime worked shall not be regarded as remuneration for the purpose of this notice.
MN OLIPHANT, MP
STAATSKOERANT, 1 JULIE 2014 No. 37795 3
This gazette is also available free online at www.gpwonline.co.za
This entry was posted on July 3, 2014 at 4:55 PM and has received 2498 views. There are currently 7 comments. Print this entry.
pan card download said: I want to thank you for helpful information and I like your point of view vistor also like this. [More]
good essay writing companies said: that is the best source of learning <a href="https://www.bestessayserv...;&... [More]
aadhar update said: Very nice and interesting history on Your blog. Thank you very much. [More]
terrariumtv said: Terrarium TV app download for Android, iOS (iPhone/iPad), Firestick, Android Box, Windows PC/Laptop ... [More]
anime haven watch said: I am very glad to read the post,it is very well written.You have done hard work in writing this post... [More]
Archives by Subject
Case Law (0) [RSS]
Labour Law (8) [RSS]
Legislation (5) [RSS]
news (0) [RSS]
news_category (0) [RSS]
Podcast (0) [RSS]
Ticker (0) [RSS]
BlogCFC 5.9.8.012 by Raymond Camden | RSS | Arclite theme by digitalnature
|
cc/2019-30/en_middle_0059.json.gz/line245
|
__label__wiki
| 0.522743
| 0.522743
|
Home > National Sun Yat-sen University
80424 70 Lien-hai Rd. Kaohsiung View map
#=410
David and 2 others shortlisted this university
As President of National Sun Yat-sen University (NSYSU), I am very pleased to welcome you to browse our homepage on the Internet. I hope that your online visit to our academic departments and administrative units will provide you with all the information you need on our university, whether you are a student or scholar interested in our programs, or just want to know more about our beautiful sea-side campus. Established in 1980 at Kaohsiung, the second largest metropolitan in Taiwan, NSYSU has emerged over the years as one of the best comprehensive universities in the country. In 2002 NSYSU was named by the Ministry of Education as one of the country's seven major research-intensive universities. We are the leading national university in Southern Taiwan, and have set the benchmark for high standards in teaching, research, and internationalization. Our curriculum is well balanced to cover most disciplines in liberal arts, management, social sciences, engineering, science, and marine science. It is the common aim of our faculty and administrative team to provide a well-rounded and memorable educational experience for all our students, undergraduate or graduate. I thank you for taking the time to visit us on the Internet, and hope to welcome...
Asian University Tops
Total students - 8,384
International students - 522
Total faculty staff - 791
Interested in studying in Taiwan?
University of Taipei
National Changhua University of Education
National Kaohsiung University of Hospitality and Tourism
Taipei Medical University (TMU)
National Chung Cheng University
Waseda University
Alfaisal University
Yildiz Technical University
University of Sharjah
Ton Duc Thang University
Indian School of Business
Taylor's University
National University of Singapore (NUS)
QS Top 50 Under 50 2020
Nanyang Technological University continues to be the top young univ...
How to Get a German Student Visa
If you have gained admission to study at a university in Germany, y...
QS Best Student Cities ranking: 20th Taiwan’s universities have bee...
Study in Massachusetts
Home to two of the world’s top three universities and a further nin...
International Student Satisfaction: New i-graduate Report
International students are satisfied on the whole, according to a r...
70 Lien-hai Rd.
Kaohsiung 80424
1 Course
http://best-cooler.reviews
best-cooler.reviews/category/zojirushi-ss/
|
cc/2019-30/en_middle_0059.json.gz/line247
|
__label__cc
| 0.699036
| 0.300964
|
SALES & SUPPORT (800) 288-1112
KZValve Careers
KZ I.D.E.A.
KZCO Celebrates 4 Decades of Inventioneering
Greenwood, NE – 2016 marks the 40th anniversary for KZCO and its brand KZValve. The Ashland/Greenwood, NE based company has been designing and manufacturing innovative products since 1976.
“We’ve seen the AG industry computerize right before our eyes over the past 40 years,” says company founder Keith Ziegenbein, “It has been a real education and a pleasure to introduce new products over the years into the agriculture industry as well as others.”
Keith, his wife Ardith and Brother Kevin first introduced a product called the Hydra-Halt in 1976 as a safer alternative for controlling anhydrous ammonia valves. In 1982, KZValve was the first to bring to market a motorized ball valve which helped shape application practices used today in the AG industry. Their spirit of “Inventioneering”, a word Keith coined in the 80s, lives on today and can be sensed in every department throughout the company. “Free flowing thoughts and ideas are a key to finding that next breakthrough product and we encourage that attitude throughout the company. It’s what makes us Inventioneers. I feel like we are a 40 year start up!” said Ziegenbein with a smile.
Today KZValve partners with customers in a variety of industries including agriculture, turf, fire, deicing, road maintenance, water and air filtration, and various commercial categories. KZValve manufacturing and business offices are located between Ashland and Greenwood, NE on a 33 acre campus in a 44,000 square foot facility. The company employs 70 people including engineering, manufacturing, sales, marketing and administration departments.
KZValve is a family owned business with manufacturing facilities located in the Ashland/Greenwood, NE area and has been in business since 1976. KZValve produces rugged waterproof motorized valves and controllers for a variety of industries domestically and around the world.
tmartin 2016-09-09T13:54:08+00:00 February 22nd, 2016|
Replacement Actuator
Valve Controllers
Replacement Valve Kit
23860 KZ Parkway,
Greenwood, NE 68366
© 2017 KZCO, Inc.
|
cc/2019-30/en_middle_0059.json.gz/line248
|
__label__cc
| 0.695802
| 0.304198
|
The other day, I was asked if I would like to try a few little samples of Hayman’s London Dry Gin. Now, it doesn’t take a rocket scientist to figure out that I was going to be more than up for that!
My samples arrived Friday, just in time for the weekend, and so I indulged in a couple tasters (it would have been rude not to) as well as concocting a couple of delicious cocktails for you all using their Gin.
Having heard of Hayman’s but never trying it before, I was intrigued to see what sets it apart from the abundance of other Gin’s that are available to us here in the UK. Read on for my recipes and to see what I thought of their Gin!
A bit about Hayman’s…
Hayman’s currently distill six different gins and the Hayman’s family have been in the gin making business for generations. The company is currently run by James and Miranda Hayman, along with their father Christopher Hayman.
Why couldn’t I be descended from a line of Gin distillers?
The story of Hayman’s Gin began with Christopher’s great-grandfather, James Burrough, who was a curious and charismatic pharmacist. In 1863 he bought a gin and liqueur rectifying business on Cale Street in London and started producing a range of cordials, medicinal ingredients and gin. His coveted gin recipes, which we still follow today, can be found scribbled in notebooks dating back to that time.
Over subsequent years, James Burrough’s sons joined the family business, exporting their gins to the USA and Canada under the Burrough name. Neville Hayman, husband of Marjorie Burrough (James Burrough’s granddaughter), was the first Hayman to join the family business in 1951 – which was now well known for producing, among others, Beefeater Gin. He helped shape the company to make sure we could survive the aftermath of WWII, which included rationalisation of the gin styles made. And just 18 years later, he was joined by his son, Christopher Hayman.
In 1987, the family business was sold to the then brewer, Whitbread. It could have been the end, but the Hayman side of the family were not ready to leave a life of gin making behind. And who would be?! So Christopher Hayman gallantly led the way in buying back James Burrough Fine Alcohols Division Limited, changed the company name to Hayman Distillers and worked tirelessly for a number of years get them to a position where they could begin to do just that again.
Christopher, James and Miranda still continue to run the business today, upholding family traditions with an inherent passion for distilling original gins.
All for the love of gin, eh? Wonderful.
A ‘Gin-uine’ review of Hayman’s London Dry Gin
As the name might suggest, Hayman’s London Dry Gin is a classic style of gin. Distilled using a family recipe, with a blend of 10 different botanicals which are steeped for a full day prior to distillation to allow the flavours to release into the alcohol, it has gentle hints of juniper, coriander, lemon and orange peel. These flavour combinations are what help this Gin to taste like a traditional London Dry Gin, which I really love. The more unusual botanicals used in Hayman’s London Dry Gin are orris root, cinnamon, cassia and nutmeg. Despite the taste of this gin being classic, it’s strong juniper and citrus hints make it anything but mundane. Hayman’s London Dry Gin was launched in 2008 and is bottled at 40% ABV. It’s definitely a Gin I would happily stock in my drink cupboard and indulge in regularly thanks to it’s fairly affordable price tag, retailing at about £25 for 70cl in most shops. An easy to drink, traditional London Dry Gin.
Image – haymansgin.com
Here are 2 Cocktail recipes I’ve created using Hayman’s London Dry Gin. Happy Drinking!
≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈≈
You can find out more about Hayman’s and their Gin’s by visiting their website.
Disclosure: I was sent a sample of Hayman’s Gin in return for an honest review. All words, thoughts and opinions are my own.
|
cc/2019-30/en_middle_0059.json.gz/line253
|
__label__cc
| 0.550598
| 0.449402
|
New Studies Of Treatment Of Herpes Zoster
New Studies Of Treatment Of Herpes Zoster.
The currency of a sore shape known as shingles is increasing in the United States, but reborn research says the chickenpox vaccine isn't to blame. Shingles is caused by the same virus that causes chickenpox, the varicella zoster virus. Researchers have theorized that widespread chickenpox vaccination since the 1990s might have given shingles an unintended boost scriptovore. But that theory didn't indentation out in a muse about of nearly 3 million older adults.
And "The chickenpox vaccine program was introduced in 1996, so we looked at the amount of shingles from the original '90s to 2010, and found that shingles was already increasing before the vaccine program started," said examine prime mover Dr Craig Hales, a medical epidemiologist at the US Centers for Disease Control and Prevention. "And as immunization coverage in children reached 90 percent, shingles continued at the same rate" rhine. Once someone has had chickenpox, the varicella zoster virus stays in the body.
It lies somnolent for years, often even for decades, but then something happens to reactivate it. When it's reactivated, it's called herpes zoster or shingles. Exposure to children with chickenpox boosts adults' amnesty to the virus, Hales explained picture. But experts wondered if vaccinating a sound epoch of children against chickenpox might trouble the pace of shingles in older people, who have already been exposed to the chickenpox virus.
And "Our protection obviously wanes over time, and once it wanes enough, that's when the virus can reactivate," said Hales. "So, if we're never exposed to children with chickenpox, would we capitulate that customary indemnity boost?" To suffice for this question, Hales and his colleagues reviewed Medicare claims material from 1992 to 2010 that included about 2,8 million relations over the ripen of 65. They found that annual rates of shingles increased 39 percent over the 18-year swat period.
However, they didn't realize a statistically significant variation in the speed after the introduction of the chickenpox vaccine. They also found that the figure of shingles didn't veer from magnificence to confirm where there were sundry rates of chickenpox vaccine coverage. These findings, published in the Dec 3, 2013 pour of the Annals of Internal Medicine, suggest the chickenpox vaccine isn't tied up to the raise in shingles, according to Hales.
Labels: chickenpox, hales, shingles, vaccine, virus, zoster
|
cc/2019-30/en_middle_0059.json.gz/line254
|
__label__cc
| 0.646587
| 0.353413
|
The Resource Additional Judges, U.S. District Courts : hearings before the United States House Committee on the Judiciary, Sixty-Seventh Congress, first session, on Nov. 7, 1921
Additional Judges, U.S. District Courts : hearings before the United States House Committee on the Judiciary, Sixty-Seventh Congress, first session, on Nov. 7, 1921
The item Additional Judges, U.S. District Courts : hearings before the United States House Committee on the Judiciary, Sixty-Seventh Congress, first session, on Nov. 7, 1921 represents a specific, individual, material embodiment of a distinct intellectual or artistic creation found in Biddle Law Library.
United States, Congress | House | Committee on the Judiciary
Committee Serial No. 19
Considers (67) H.R. 8875
CIS No. H298-19
Record is based on bibliographic data in CIS US Congressional Committee Hearings Index. Reuse except for individual research requires license from Congressional Information Service, Inc
Additional Judges, U.S. District Courts
hearings before the United States House Committee on the Judiciary, Sixty-Seventh Congress, first session, on Nov. 7, 1921
District courts -- Officials and employees -- United States -- Selection and appointment
Judges -- Selection and appointment -- United States
Congressional Information Service
<div class="citation" vocab="http://schema.org/"><i class="fa fa-external-link-square fa-fw"></i> Data from <span resource="http://link.law.upenn.edu/portal/Additional-Judges-U.S.-District-Courts-/JKIr2efOlaQ/" typeof="Book http://bibfra.me/vocab/lite/Item"><span property="name http://bibfra.me/vocab/lite/label"><a href="http://link.law.upenn.edu/portal/Additional-Judges-U.S.-District-Courts-/JKIr2efOlaQ/">Additional Judges, U.S. District Courts : hearings before the United States House Committee on the Judiciary, Sixty-Seventh Congress, first session, on Nov. 7, 1921</a></span> - <span property="potentialAction" typeOf="OrganizeAction"><span property="agent" typeof="LibrarySystem http://library.link/vocab/LibrarySystem" resource="http://link.law.upenn.edu/"><span property="name http://bibfra.me/vocab/lite/label"><a property="url" href="http://link.law.upenn.edu/">Biddle Law Library</a></span></span></span></span></div>
Data Citation of the Item Additional Judges, U.S. District Courts : hearings before the United States House Committee on the Judiciary, Sixty-Seventh Congress, first session, on Nov. 7, 1921
http://link.law.upenn.edu/portal/Additional-Judges-U.S.-District-Courts-/JKIr2efOlaQ/
http://library.link/portal/Additional-Judges-U.S.-District-Courts-/JKIr2efOlaQ/
|
cc/2019-30/en_middle_0059.json.gz/line257
|
__label__wiki
| 0.538785
| 0.538785
|
1977 Punk Rock Blitzorama #14 Feat Tributes to The Jam, The Ramones, Blondie & Joan Jett
We can't wait to welcome back the very popular 1977 Punk Rock Blitzorama to the Linsmore Tavern for it's 14th instalment. There is always been a ton of requests and a ton of buzz surrounding the 1977 Punk Night and this time the night features The Jammed Tribute to The Jam, The Gabba Heys Tribute to The Ramones and Blondee's Tribute to Blondie! If you have seen them before, you know how cool of a show it is and the vibe is amazing! As an added bonus, Amy Gabba will be performing some Joan Jett with these fantastic musicians! Some world class musicians are in these 4 bands and they bring an incredible show to the stage, whenever they play!
Formed in 2013, THE JAMMED is a tribute act to punk/mod-revival band THE JAM. Playing lightening-fast covers, this Toronto-based trio recreates the high-energy and style of The Jam in the late 1970's, wearing tailored suits rather than ripped clothes. The trio was known for their melodic pop songs, strong harmonies, distinctive English flavour and mod image. Their music is infused with beat music, soul, rhythm and blues, psychedelic rock, as well as 1970's punk and new wave. THE JAMMED are: Cleave Anderson (formerly of Blue Rodeo), drums; Lucas Stagg (Lucas Stagg band) on bass and vocals, and Richard McCarthy (aka Filthy Rich), vocals and guitar.
For all of you Ramones fans, there will be a set of music by the GABBA HEYS! The GABBY HEYS feature / Lucas Vulcan on guitar/backing vocals, Cleave Anderson on drums, and Lucas Stagg on bass/lead vocals.
Formed in 2014, BLONDEE is a tribute act to American rock band Blondie, founded by Debbie Harry and guitarist Chris Stein. Blondie was a pioneer in the early American new wave and punk scenes of the mid 1970s. BLONDEE is a four piece act that scales down the hits and earlier punk songs of Blondie to their bare bones, working with only vocal, one guitar, bass and drums. Sara Dishart captures the power and sultriness of Harry's voice, in addition to being inspired by Blondie's style and dress on stage. BLONDEE are: Sara Dishart, vocals; Cleave Anderson, drums, Lucas Stagg, bass and vocals; Richard McCarthy (aka Filthy Rich), guitar and vocals.
Get you tickets now because, this show is definitely in demand!! 4 unbelievable Tribute Bands in one night and the Tickets are only $7 in advance and $10 at the door! You can buy your tickets at Linsmore Tavern or right here at www.linsmoretavern.com
|
cc/2019-30/en_middle_0059.json.gz/line259
|
__label__cc
| 0.725345
| 0.274655
|
In Rural Georgia, Students Step Up to Offer Integrated Prom (2)
Star Trek Transporter: the Continuity Problem (11)
Virginia’s Assault on Abortion Rights Claims a Victim
From the Editors at the Washington Post
Opinion • 4/27/13 4:29:37 am • Views: 1,254
Just days after the state Board of Health approved the regulations this month, under pressure from Attorney General Ken Cuccinelli II (R), they claimed their first victim. Hillcrest Clinic in Norfolk, which for 40 years had provided reproductive health services, including abortions, closed last weekend.
Hillcrest was partly a victim of its own success in providing women with ready access to birth control. Like most other clinics around the state, it saw demand for abortions dwindle as more women took advantage of options to prevent unwanted pregnancies.
Still, even after years of protests, arson, a pipe bombing and an attack by a man wielding a semiautomatic weapon, Hillcrest performed more than 1,600 abortions last year, about 7 percent of the state total. The principal reason it closed its doors was that complying with the regulations would have saddled it with $500,000 in renovations — an unaffordable expense.
More: Virginia’s Abortion Assault Claims a Victim
Abortion Assault Reproductive Health Services Unwanted Pregnancies Washington Post Ready Access Hillcrest Clinic Attorney General Ken Cuccinelli Birth Control Pipe Bombing Semiautomatic Weapon Victim Arson Attack Clinics
1 DO WINGNUT WORDS SHOW THEY EVOLVED BRAINS?11!! Sat, Apr 27, 2013 4:52:47am
I want to apologize to all the young women out there. I feel like my generation let them down. We should have never let them get this far in taking away so much of what our elders worked so hard to get for us.
2 FemNaziBitch Sat, Apr 27, 2013 6:56:23am
re: #1 DO WINGNUT WORDS SHOW THEY EVOLVED BRAINS?11!!
There is still time. Get involved and change what is going on.
3 majii Sat, Apr 27, 2013 5:35:02pm
I wonder if we, the people, could raise $500,000+ to keep this clinic open, if a fund were established for this specific purpose. I remember over $750,000 was raised for the woman the kids humiliated on the school bus, and I think it’s possible. I’d be willing to donate to the fund, and I think thousands, or possibly, millions more would be willing to also. FemiNazi, do you know anyone in VA who could establish a fund of this sort? Does it have to be someone in VA who would have to do this. You can contact me a cugagcmu80atyahoo.com, if you have any success with this idea. I’m not at all familiar with how one goes about doing this. Shoot, pretty much all I know how to do with my laptop is log on to the internet and read the news. My daughter makes fun of me and says I need to learn to do more, but sometimes when you reach a certain age, certain things don’t appear to be as easy to do as they are for our young folks.
|
cc/2019-30/en_middle_0059.json.gz/line264
|
__label__wiki
| 0.741082
| 0.741082
|
CHFD History and Facts
Local 2580 History and Facts
Chapel Hill & UNC Facts
Click Here to sign-up.
Ronald McDonald House - Chapel Hill
North Carolina Jaycee Burn Center - UNC-Chapel Hill Hospitals
Speech to Council
Letter to Mayor & Manager
Hospitalized at UNC?
Guns & Hoses
Prior Car Shows
Front Page Headlines
UnionActive IAFF News Wire
Annual Retiree Luncheon
Standard for Policies and Procedures
Member Insurance Benefits
Sept. 11th Ceremony
Firefighter of the Year
PFFPNC
Updated On: Aug 18, 2009
History of the Chapel Hill Fire Department
Some of the research has been through archives or word of mouth. Here are some of the interesting facts verified through multiple sources:
Inception of the department was March 2, 1896, when a petition from certain citizens proposing to operate a fire company was laid to committee. It was looked on in favor but the municipality had no funds at the end of the year.
On September 23, 1901, the Town Board authorized the Finance Committee to purchase a hook and ladder truck, not to exceed $200. It would supply both the university and the town with fire protection. In 1903, a hook and ladder outfit was purchased for $190.
In May 1902, the first fire chief was elected. He was John O’Daniel. Before then, it is assumed that there was some type of bucket brigade. A volunteer department staffed with “call men” lingered into the 1960’s when the first full-time paid staff appeared.
Also in 1902, plans were drawn up for a fire house located in the middle of Franklin Street. It was supposedly, at that time, the only fire house in the country located in the middle of the street. Unfortunately, a car crashed into the station.
On March 14, 1916, the department was authorized to purchase a 1914 Model T for $600 using money from both the Town and University. It is one of the oldest motorized apparatus in North Carolina and is stored in the Chapel Hill museum.
A similar deal was proposed again in 1921 with UNC paying for half of a 750 gallon per minute American LaFrance.
In 1996, the first of the Carolina Blue Fire apparatus appeared. “Blue 32”, a 1996 Ferrara Spartan housed at Station 2. This was a joint venture between the Town, UNC and UNC Hospitals. The popularity of “Blue 32” started the trend for our current Engines and Trucks to be DuPont copywrited Carolina Blue.
Our next fire station to be authorized was in 1921. It was actually a “Town Hall” Building housing the fire department and other town departments. Its location was on Columbia Street near Rosemary Street. It is still Town owned and now houses the Inter-Faith Council’s Men’s Shelter.
Current Fire Stations and Apparatus
Station 1 and current Fire Administration, built in the 1960’s, is located on Martin Luther King Jr. Boulevard (once called Airport Road) and Columbia Street downtown. Station 1 houses Engine 31, a 2001 KME Commercial Chassis; TAC51, a 2005 Ford 550 Brush/Parking Garage CAFS unit; and Chief 4, the Battalion Chief’s SUV.
Station 2, built in the 1950’s, is located at the corner of Hamilton Road and Raleigh Road (NC 54) in “Glen Lennox”. Station 2 houses Engine 32, a 1996 Ferrara Custom, the first “Carolina Blue” unit.
Station 3, built in the late 1960’s/early 1970’s, is located at Elliott Road and E. Franklin Street. Station 3 houses Squad 33, a 2000 KME Commercial Chassis Rescue Pumper; and Truck 73, a 2006 KME Predator Chassis Custom 100’ mid-mount Aerial Platform Quint.
Station 4, built in the 1980’s, along with our Training Facility is located at the corner of Weaver Dairy Road Extension and Martin Luther King Jr. Boulevard. Station 4 houses Engine 34, a 2004 KME Custom Chassis Pumper. Our Training Facility is the home office of the Training Division and includes a classroom, 2-story burn building, 4-story training/smoke tower, and apparatus service test pit.
Station 5, built in 2004, in conjunction with a southern annexation, is located at Bennett Road and US 15-501. Station 5 houses Engine 35, a 2001 HME Custom Chassis Quint; and the Orange County Chiefs Association Fire Safety Training Trailer.
Station 6 is in the very early planning stages, in part with the development of Carolina North, a UNC educational and research campus.
For more valuable information, please visit: www.townofchapelhill.org/fire
Order Online Items Here
Patriot's Day (observance of 9/11)
Veterans Day (not observed by town)
Town Holiday (Thanksgiving)
Top of Page © Copyright 2019, Local 2580, All Rights Reserved.
|
cc/2019-30/en_middle_0059.json.gz/line267
|
__label__cc
| 0.684063
| 0.315937
|
Antibiotics of a broad spectrum of action of a new generation list with the names of strong drugs
New generation broad-spectrum antibiotics list with strong drug names
Antibiotics call an extensive group of medicines, whose action is aimed at fighting infectious diseases. In recent years, the list of these funds has undergone some changes. Antibiotics of a wide spectrum of action of a new generation have gained wide popularity. There are modern drugs that are aimed at eliminating the pathogen of a particular disease. The most preferable are narrow-acting drugs, since they do not affect the normal microflora.
How antibiotics of the new generation work
Medical staff successfully use antibacterial drugs due to the fact that the vital processes in the cells of the human body are different from similar processes in the bacterial cell. These new generation drugs act selectively, affecting only the cell of the pathogenic microorganism, without affecting the human. Classification occurs depending on the way in which they
affect the vital activity of microorganisms.
Some drugs suppress the synthesis of the outer cell membrane of a bacterium that is absent in the human body. These include cephalosporins, antibiotics of the penicillin series, etc. The other group almost completely suppresses protein synthesis in bacterial cells. The latter include macrolides, antibiotics of the tetracycline series. The list of generic drugs is divided according to the principle of antibacterial activity. The instructions always indicate the area of activity of the tablets.
Some drugs have a wide spectrum of action, showing efficacy against many bacteria, and others may have a narrow focus aimed at a particular group of bacteria. Why is this happening? The thing is that viruses, bacteria are characterized by different structure and functioning, therefore, what the bacteria die from does not affect the viruses. Broad-spectrum antibiotics are used when:
pathogens show resistance to the effect of a narrowly directed drug;
revealed superinfection, the culprits of which are several types of bacteria;
prophylaxis of infections after surgical interventions;
treatment is prescribed on the basis of clinical symptoms, that is empirically. In this case, no specific causative agent is elucidated. This is appropriate for common infections, dangerous fast-flowing diseases.
Features of broad-spectrum antibiotics
New generation broad-spectrum drugs are universal agents that can fight against otitis, lymph node inflammation, colds, coughs accompanying it, runny nose, etc. Whichever pathogen causes the disease, the agents will overcome the microbe. Each newly developed drug has a more perfect, improved effect against pathogenic microorganisms. It is believed that a new generation of antibiotics causes minimal damage to the human body.
List of new generation antibiotics with a wide spectrum of action
The list of existing wide-spectrum antibiotics of the new generation includes many drugs, both cheap and more expensive. The most frequent in use from all groups of preparations are penicillins, macrolides, fluoroquinolones, cephalosporins. They are available in the form of solutions for injections, tablets, etc. Medicines of the new generation are characterized by improved pharmacological actions, if compared with older medicines. So, the list is as follows:
group of tetracycline: "Tetracycline";
penicillins: Ampicillin, Amoxicillin, Ticarciclin, Bilmycin;
fluoroquinolones: "Gatifloxacin", "Levofloxacin", "Ciprofloxacin", "Moxifloxacin";
carbapenems: Meropenem, Imipenem, Ertapenem;
amphenicols: Chloramphenicol;
aminoglycosides: "Streptomycin".
Learn more about the drug amoxicillin - dosage for adults and children, instructions for use and contraindications.
Names of narrowly directed strong antibiotics
New generation narrowly targeted drugs are used when the infectious agent is accurately determined. Each drug acts on a certain group of pathogenic microorganisms. In contrast to broad-spectrum antibiotics, they do not contribute to the disturbance of normal intestinal microflora, do not inhibit immunity. Due to the deeper degree of purification of the active substance, the drug has less toxicity.
See also: Nicotinic acid: composition and action of nits, how to take vitamin with benefit for the body, the names of analogues, the price of
In bronchitis, in most cases, antibiotics of a new generation of a wide spectrum of action are prescribed, however, the choice of the drug should be based on the results of a laboratory testphlegm. The best medicine is that which has a disastrous effect directly on the bacterium that caused the disease. This approach is explained by the fact that the study takes from 3 to 5 days, and the treatment of bronchitis should be as early as possible so that no complications arise. Often prescribe the following antibacterial drugs:
Macrolides - are prescribed for individual penicillin intolerance. Clarithromycin and Erythromycin are widely used.
Penicillin - has long been used in medicine, in connection with which some microorganisms have developed resistance to the active substance. Therefore, the preparations were strengthened with additives that block the action of the enzymes produced by microorganisms in order to reduce the activity of penicillin. The most effective are "Amoksiklav", "Panklav", "Augmentin".
Fluoroquinolones - used to treat chronic bronchitis during an exacerbation. High efficiency is characterized by "Levofloxacin", "Moxifloxacin", "Ciprofloxacin".
Cephalosporins - are prescribed in the case of obstructive forms of the disease. Modern antibiotics are "Cefuroxime", "Ceftriaxone".
Genyantritis
In genyantritis, antibiotics of a new generation such as cephalosporins and macrolides are used. These are the most effective remedies for sinusitis, which are used when there is no positive dynamics of treatment after penicillin. Modern antibiotics "Cefuroxin", "Tsecefoksitin", "Tsefahlor", "Cefotaxim", "Tsefeksim" penetrate on the structure of penicillin preparations, but are able to inhibit the development and completely destroy bacteria. Such macrolides as "Macropen", "Azithromycin" show high efficiency in severe cases. Learn how to choose an antibiotic for sinusitis.
Until recently, oral penicillin antibiotics were used to treat angina, as they showed the best results. But recent pharmacological studies have shown that new generation cephalosporins are more effective during the treatment of bacterial infections of the oropharynx. Their action is based on the inhibition of membrane synthesis of bacterial cells, and they have greater resistance to enzymes of microorganisms aimed at the destruction of the active substance.
Effective parameters are the preparation "Cefalexin", which is characterized by a high degree of absorption from the gastrointestinal tract. The safest antibiotics for the treatment of tonsillar pathologies are macrolides. When they are used, there are no disorders of the digestive tract, as well as toxic reactions from the central nervous system. Macrolides include: Spiramycin, Leucomycin, Erythromycin, Aziromycin, Clarithromycin, Dirithromycin, and Indian Azitral.
With the common cold and flu, the following imported and domestic antibiotics of the new generation show high efficiency:
"Sumamed" refers to a number of macrolides. In the treatment of complicated colds, the patient is considered an alternative second-line drug. It has a broad antibacterial spectrum, rarely causes intestinal and stomach disorders, it lasts for seven days after taking the last pill. Children can not be used.
"Cefaclor" is an antibiotic of the second generation, showing high activity in relation to most respiratory infections.
"Cefamandol" is the second generation of cephalosporins, an antibiotic in injections of a wide spectrum of action, is characterized by a powerful bactericidal effect, is released in ampoules, is administered as intramuscular.
"Rulid" - macrolide antibiotic, has a narrow spectrum of antibacterial action, limited by pathogens of inflammatory processes of ENT organs and respiratory infections.
"Clarithromycin" is a semisynthetic macrolide in capsules, has antibacterial activity against most pathogenic microorganisms.
"Avelox" - a strong pill-packed antibiotic group of the last generation of fluoroquinolones, has a rapid bactericidal effect.
See also: Mexidol: indications for use, instruction
Learn how to choose anti-influenza drugs for children and adults.
Previously traditionally used to treat cystitis "Furadonin", "Biseptol", "5-Nok."However, they were replaced by new generation antibiotics, stronger, more effective. Modern drugs can improve the condition on the first day and quickly cure the disease:
"Unidox Solutab" - effectively fights against cystitis, has a prolonged effect. It is taken once a day.
"Monural" is a long-acting antibiotic, accumulated in the urine and rapidly destroying bacteria. Thanks to its ability to maintain a therapeutic concentration for a long time, it gives a short course of treatment.
"Norbaktin" - is prescribed less often than the previous two, because it needs to be taken twice a day and drink a lot of liquid, which is not always comfortable for the patient.
Antifungal preparations in tablets
Before the appointment of antifungal agents should be established pathogen, as for each species has its own effective means and dosage. Modern drugs are divided into generations: if the first ones were effective against some fungi, the following were created taking into account many types of fungal infection:
First-generation polyethylene antibiotics - "Levorin", "Nystatin", "Amphotericin B".Used to treat dermatomycosis and thrush in gynecology.
Antibacterial agents of the second generation - "Ketoconazole", "Clotrimazole", "Miconazole" for infections of the genitourinary system.
of the third generation - "Terbinafine", "Antraconazole", "Naphthyfin", "Fluconazole".
Antibiotics of a wide spectrum of action of the fourth generation - "Позаконазол", "Вориконазол", "Равуконазол", "Каспофунгин".
Antibiotics for the eyes of
In recent years, a number of effective antibacterial agents have been introduced into ophthalmology, such as eye drops, and systemic use. The latter include "Maksakvin", which is used to treat chlamydial conjunctivitis and bacterial keratitis. For local use, new ophthalmic ointments with a broad-spectrum antibiotic and drops "Tobrex", "Okatsin", "Vitabakt", "Eubetal", "Kolbiozin" are used.
With pneumonia, new generation antibiotics show a persistent bactericidal and bacteriostatic effect against streptococci, staphylococci, mycoplasmas, chlamydia, E. coli bacteria and other microorganisms:
In case of predominance of Gram-negative bacteria, "Cefotaxime", "Ceftazidime", "Ceftriaxone" are prescribed.
With the predominance of Gram-positive cocci, "Cefuroxime", "Cefazolin", "Cefoksin" are prescribed.
At an atypical course of the disease - "Azithromycin", "Ceftriaxone", "Midekamycin", "Ceftazidim".
In case of a predominance of fungal infection, adults are prescribed "Fluconazole" and third generation cephalosporins.
Anaerobic infection - "Lincomycin", "Metronidazole", "Clindamycin".
Cytomegalovirus pneumonia - Acyclovir, Ganciclovir, Cytotect.
Pneumocystis pneumonia - macrolides and "Cotrimoxazole".
Learn more about how to choose antibiotics for pneumonia.
The information presented in this article is for informational purposes only. The materials of the article do not call for independent treatment. Only a qualified doctor can diagnose and give advice on treatment based on the individual characteristics of the individual patient.
Tablets Lopaz from pressure: features of application
Dufalac - instructions for use with constipation, reviews
Salofalk - mechanism of action and contraindications, analogs and side effects
Hydrocortisone ointment: instructions for use, composition, indications, analogues and reviews
Home » Medications Hydrocortisone Ointment: instructions for use, composition, indications, analogues and reviews · You...
Nimesulide - instruction on the use of an anti-inflammatory drug for children and adults
Home » Medications Nimesulide - instructions for the use of an anti-inflammatory drug for children and adults · You wil...
Ointments from bruises, bruises, bruises and sprains are effective medicines for relieving inflammation on the skin
Home » Medications Ointments from bruises, bruises, bruises and sprains are effective medicines to relieve inflammation on ...
|
cc/2019-30/en_middle_0059.json.gz/line273
|
__label__wiki
| 0.694393
| 0.694393
|
Tour Day In The Life Of… Adam Goldsmith (The Voice)
industry, tour day in the life
Get an insight into what it is like to play guitar of live TV show, The Voice from Adam Goldsmith.
Industry Experts Discuss Music’s Future on SXSW Panel
This panel from South by Southwest Festival in Texas is entitled 'Where to? A sat nav for the music business.' The debate looks at what a recording contract will look like in 10 years' time, will artists still need managers and will piracy still be throttling the industry.
‘EVNTLIVE’ Offer Live Concert Streaming Platform
industry, tech
Yes, EVNTLIVE is another live streaming platform but what makes them different is that they film regular live concerts from signed, popular indie artists through to the big names and provide a place, for fans who missed out on a ticket, to see the concert themselves.
Amanda Palmer: The Art Of Asking on TED
DIY, industry
To get you up to speed Amanda Palmer is an American songwriter performer who first become known as one half of The Dresden Dolls. She's known for having public disagreements with her label and most recently made headlines when nearly $1.2 million was raised on a crowd funding website.
When HMV Falls The Independent Record Stores Rise
What happens when a big chain like HMV goes into administration? The entertainment world implodes for about three days, the independent record stores step up and we find that all is right in the world. We spoke to those independent record stores for their thoughts on the news.
|
cc/2019-30/en_middle_0059.json.gz/line291
|
__label__wiki
| 0.73051
| 0.73051
|
Diane Suzuki
President & Creative Director
Andrea Sender
Computer Animation Specialist
Us LucidCGI 2017-02-17T21:02:24+00:00
We are experts in the art of advocacy, a reputation we’ve built trial by trial.
Here are some of our clients.
Bird, Marella, Boxer PC
Breiner & Breiner LLC
Brown Wegner McNamara LLP
Cooley LLP
Dykema Gossett PLLC
Leech Tishman Fuscaldo LLC
Lewis Roca Rothgerber LLP
Manatt, Phelps & Phillips LLP
NBC Universal Television
O’Melveny & Myers LLP
Pepper Hamilton LLP
Pillsbury Winthrop Shaw LLP
Spector Roseman Kodroff PC
Winthrop & Weinstine PA
Winston & Strawn LLP
Wolf, Greenfield & Sacks PC
“Lucid CGI worked on a series of three rapid-fire cases, and their counsel and work in that environment were professional and very helpful to our prevailing in all three matters. I heartily recommend their services.”
Terry D. Avchen | Partner | Glaser, Weil, Fink, Howard, Avchen & Shapiro LLP | Los Angeles, CA
“Lucid CGI gave us a multi-media visual strategy, for opening statements and witness testimony that was extremely helpful in getting the jury to see it our way. We were able to clearly communicate our story and persuasively discredit the prosecution’s evidence. At the end of a 3 1/2 week criminal trial, our client was acquitted of all charges. I’ll definitely use Lucid CGI again.”
Michael J. McCabe | Criminal Attorney | San Diego, CA
“Lucid CGI provides clear and effective animations and demonstratives, in complex technical matters, without the added overhead that comes from a large animation or graphics firm. Their level of service and attentiveness is excellent.”
Jonathan M. Sobel | Partner | Hogan Lovells US LLP | New York, NY
“Diane Suzuki is some kind of genius.”
Martin Q. Peterson, Ph.D. | President, FAI | Lincoln, NE
“I’ve worked with Diane Suzuki on several matters, particularly patent litigations, over the last ten years. Diane’s work has been consistently excellent. She easily grasps the most complicated technical matters and prepares graphics that clearly and concisely present the material to any audience.... Diane is the only person I would use for graphics support in patent cases or any other matter.”
Erik N. Videlock | Partner | Pepper Hamilton LLP | Philadelphia, PA
Here are some of the cases our Principals have worked on.
For the past 30-years we have developed visual strategies on over 1,500 matters. We are proud of our history. We are proud to have been retained on such high-stakes and high-profile civil and criminal matters.
criminal murder PROSECUTION
A 20th Century Fox executive (Gavin Smith) is missing for two years before his remains are found by hikers. Two years later investigators discover the victim's blood splattered car in storage, the sole evidence that the executive was murdered.
antitrust PLAINTIFF
A federal jury find that Sabre, the largest Global Distributor System for air bookings in North America, inflated commissions and violated the antitrust law.
The Global Competition Review award four OMM partners “Litigators of the Week” for overcoming all challenges and receiving a favorable jury verdict.
entertainment contract DEFENSE
Creator of such 70s and 80s popular shows as Battlestar Galactica, Magnum P.I., Quincy M.E., The Six Million Dollar Man, and Knight Rider claims Universal practiced unethical accounting and withheld profits.
treaty dispute DEFENSE
The Singapore International Arbitration Centre tribunal is appointed to resolve several significant tax disputes regarding the Bayu-Undan field in the Joint Petroleum Development Area (JPDA) in the Timor Sea.
patent infringement PLAINTIFF
Jury awards Monsanto a $1B verdict and finds that DuPont willfully infringed Monsanto's patented Roundup Ready technology.
show concept theft DEFENSE
"Dance Doctor" Cassese claims that Fox, 19 Entertainment and dick clark productions stole his concept for the hit reality show "So You Think You Can Dance."
wrongful death PLAINTIFF
Bayside District Corp., the city of Santa Monica and George Weller pay $21 million to settle dozens of civil lawsuits arising from the July 2003 crash at the downtown Farmers Market that left 10 people dead and 63 injured.
In a price-fixing class action lawsuit, 8 defendants pay $12M to settle. Plaintiffs alleged that the defendants conspired to fix OSB prices by reducing the available supply, in violation of antitrust laws.
criminal OSHA violation & worker endangerment DEFENSE
Criminal charges are levied as a result of a FrontLine investigation involving one of the world's largest cast-iron pipe manufacturers. The heads of all five facilities were either found guilty or plead guilty, with 1 exception.
human rights violation DEFENSE
Unocal hires the Myanmar army to provide security for the construction of Yadana gas pipeline. Army units inflict egregious abuses upon villagers that include forced labor, rape, torture, and murder. The district court dismissed the case on the grounds that Unocal could not be held liable.
global dna research
Tutorials are created on behalf of a global, long-term research effort to identify the estimated 30,000 genes in human DNA (deoxyribonucleic acid) and to figure out the sequences of the chemical bases that make up human DNA.
criminal murder retrial PROSECUTION
Eric and Lyle (18 and 20 years old) murdered their parents who were in their den watchingThe Spy Who Loved Me. Leslie Abramson alleged that the brothers were driven to murder by a lifetime of abuse from their parents. Both brothers were convicted of two counts of first-degree murder and conspiracy to commit murder.
In the civil trial, the jury ordered OJ to pay $25 million in punitive damages to the families of Nicole Brown Simpson and Ronald L. Goldman, in addition to awarding the Goldman family $8.5 million in compensatory damages.
The trial spanned eleven months. The jury was out for less than four hours before announcing OJ Simpson not guilty.
use of force DEFENSE
Stacey Koon and Laurence Powell, Los Angeles police officers, were acquitted on state charges of assault and excessive use of force in the beating of Rodney King. Later, on the same day of their acquittal, the Los Angeles Riots erupted.
patent infringement DEFENSE
DuPont alleged that Cetus' core PCR (polymerase chain reaction) patents were not novel. Despite strong witnesses, DuPont could not prove that PCR invention had been obvious, and court ruled in favor of Cetus. PCR is a technique used to rapidly generate thousands to millions of copies of a particular DNA sequence.
The Principals
Strategic Visual Consulting
Creative Content Development
In-Trial Technical Support
In-Trial Creative Support
Maps & Diagrams
Copyright © 2015 by Lucid CGI, Inc. | All Rights Reserved
|
cc/2019-30/en_middle_0059.json.gz/line293
|
__label__cc
| 0.658341
| 0.341659
|
Del continues dragster domination in Houston
After missing the race in Charlotte due to another shoot I was happy to get back on the circuit at Royal Purple Raceway near Houston, TX for my fourth NHRA race of the 2011 season. It would end up being an interesting race with two predictable pro winners and two surprises.
Please click the below banner to check out my photo blog I do for Toyota Racing with some of my favorite images of the Toyota sponsored drivers of the NHRA.
Ok on to some images from Friday.
The last time I shot a race at Houston was nearly 14 years ago back in 1997. Upon arriving at the track I quickly saw the track looked exactly the same.
Below, back in the Mike Neff pit area I shot as they warmed up his car. I got the idea to try and get a different photo by using the big fan to blow out the nitro and it wasn’t too bad until I QUICKLY realized the fan was blowing all the fumes right at my face. Within 30 seconds the tears were streaming down my face like I had just watched Bambi or something…
Nikon D3s, 24-70mm, 800iso, f3.2, 1/640th, Manual
For the first pro qualifying session I decided to make the walk up to the top of the grandstands around half track to get something different. When it comes to drag racing you will quickly become stagnant as a photographer if you are always standing in the exact same spot. No thanks!
Below, pro stock motorcycle rider Karen Stoffer (near) races alongside L.E. Tonglet during qualifying for the Spring Nationals at Royal Purple Raceway.
Nikon D3s, 400mm, 320iso, f5.6, 1/1250th, Manual
In the below frame of top fuel driver Spencer Massey you can see some serious tire distortion as he crosses the finish line. Check out the contrail coming off his rear wing!
For the second pro session it would be spent on the starting line since the light would be pretty cool and if there were a few delays perhaps we could get a rare night qualifying session.
Funny car driver Tim Wilkerson prepares to back up following his burnout, below.
Below, NHRA funny car driver Jon Capps launches off the starting line during qualifying.
The cool thing about late afternoon sun light is it is at such a low angle that it sometimes puts some great light onto the drivers faces as they sit in their car.
I’m sure top fuel pilot Antron Brown was annoyed by the bright light in his face (below) but damn it makes for nice pics for us photographers.
Nikon D3s, 80-200mm, 1000iso, f5.6, 1/2000th, Aperture Priority
As the sun dipped lower towards the horizon it made for better light each pass.
With the sun at my back I shot the below frame of Del Worsham as he launched off the starting line alongside Doug Foley.
Nikon D700, 24-70mm, 500iso, f5, 1/500th, Manual
After that pass I looked behind me and saw a decent sunset was developing. With all the 15 or so other photographers shooting on the left side of the track I made the decision to be different and go shoot on the right side of the track without the “good light” to see what I could come up with.
Below, top fuel driver Tony Schumacher launches off the starting line on his way to the top qualifying spot.
Nikon D700, 24-70mm, 500iso, f5.6, 1/320th, Manual
Another mistake many photographers (including myself) make is to not look around at whats going on away from the cars to find cool photos. While shooting the cars towards the sunset I noticed if I underexposed the shot enough I could produce a pretty cool looking silhouette with the fans in the crowd in front of the nice sunset. The below frame is the result.
Nikon D3s, 80-200mm, 100iso, f5, 1/2500th, Aperture Priority
One of my favorite frames of the weekend is the below shot of top fuel driver Morgan Lucas as he does his burnout in front of the great sky. While editing the pics from Friday at a local Chilis that night I heard people behind me talking about the photo and much to my surprise I turned around to see it was Morgan himself checking it out.
Following the burnout shot I ran my little ass off to get over to the other side of the track to shoot Lucas as he launched. My main reason for running around like that is it makes it look like more than one photographer was covering the race which is good since it makes it seem like more than one photographer was there for my clients.
Nikon D3s, 80-200mm, 400iso, f4, 1/320th, Manual
That wraps up Friday. On to another day of qualifying.
Below, NHRA pro stock motorcycle rider Hector Arana pushes his bike as a helicopter lands behind him during qualifying for the Spring Nationals at Royal Purple Raceway.
For the third pro qualifying session I would spend it shooting top end.
Below, top fuel dragster driver Del Worsham (left) races alongside David Grubnic during qualifying for the Spring Nationals at Royal Purple Raceway.
Nikon D3s, 400mm with 1.4 convertor (550mm), 400iso, f7.1, 1/2000th, Manual
After smoking the tires and coming to a stop before making the turn off top fuel driver Tony Schumacher (below) would need a helpful push from members of the safety safari. By climbing down into a drainage ditch I was able to get a super low angle which made for a cool frame.
Nikon D700, 70-200mm, 500iso, f6.3, 1/800th, Aperture Priority
During funny car qualifying in the third round I could feel some rain drops falling. Much to my surprise they allowed the pair of cars on the line to run. Seldom seen NHRA racer Jon Capps would quickly smoke the tires and pull off at the first turn off where I was shooting. As he climbed from his car I could hear him screaming and cussing. Upon popping out the roof of his car he would throw his gloves up in the air out of frustration for having to run in the rain.
Easily one of the coolest funny car paint jobs in awhile is the STP car driven by two time champion Tony Pedregon, below.
For the final pro qualifying session I would once again head back to the starting line to look for some cool pics.
Below, pro stock motorcycle rider Shawn Gann waits in the staging lanes prior to making his run.
Nikon D3s, 400mm, 320iso, f7.1, 1/320th, Aperture Priority
The winner of the cool t-shirt of the weekend had to be the crew member for champion L.E. Tonglet who rocked a badass Mr. Rogers shirt. #pimp
Nikon D3s, 400mm, 320iso, f4, 1/800th, Aperture Priority
The only good thing about the threat of rain (which we had all weekend) was the cool dark clouds above the track.
The below frame is a good example of what I am talking about as pro stock driver Erica Enders does her burnout in the overcast conditions.
Nikon D3s, 24-70mm, 250iso, f4, 1/2000th, Manual
Below, funny car driver Brian Thiel is framed by the wheel well of the cars body as he hangs out in the staging lanes prior to the final session.
Nikon D3s, 24-70mm, 400iso, f2.8, 1/640th, Aperture Priority
By sticking my entire camera into the cockpit I got the below frame of top fuel driver T.J. Zizzo as he waits to run. If I stuck my camera inside the cockpit of a NASCAR the chances are good the driver would grab the camera or punch at it….
Nikon D3s, 24-70mm, 1600iso, f4.5, 1/800th, Aperture Priority
By going up to the second floor of the tower/suites behind the starting line it gave a cool angle to shoot straight down on the cars as they went right below me prior to racing. You can really get a feel for how long the dragster of Morgan Lucas is when you see it from this angle.
The bad luck story of 2011 in the world of NHRA certainly has to be Melanie Troxel who extended her non qualifying streak to 5 races. In case you are counting, there has been 5 races so far this season…
The second best shirt of the weekend has to go to the below crew member on the team for Jon Capps.
Below, heatwaves blur out the crowd as funny car driver Cruz Pedregon thunders down track during the final qualifying session.
Following the final session on Saturday I hauled ass to downtown Houston to shoot a baseball game between the Brewers and the Astros at Minute Maid Park. I was completely worn out from a full day at the track but ended up having a great night with a few pretty cool pics. Here are a few favorites….
Below, an overall view of Minute Maid Park from the upper deck during the Astros game against the Brewers in downtown Houston.
Nikon D700, 24-70mm, 1000iso, f4, 1/1000th, Manual
Below, Milwaukee Brewers batter Prince Fielder breaks a bat in the sixth inning against the Houston Astros at Minute Maid Park.
Below, Milwaukee Brewers second baseman Rickie Weeks throws to first base in the eighth inning against the Houston Astros at Minute Maid Park.
The game would end in great fashion as Houston Astros batter Jason Bourgeois would hit a walk off single in the ninth inning setting off a great celebration right in front of me.
Ok enough baseball back to drag racing.
On Sunday I got to the track nice and early to bust out some pit shots as teams prepped their cars for the first round of eliminations.
Below, funny car crew chief Johnny West tunes the engine on the car driven by Brian Thiel.
Nikon D700, 24-70mm, 1000iso, f2.8, 1/800th, Manual
Below, a huge crowd looks on as funny car driver Cruz Pedregon warms up back in the Snap-On Tools Toyota pit area.
Its always fun watching the fans up close when the nitro cars warm up. With the fumes making it hard to breath along with making your eyes water it only takes a few seconds for most of the up close fans to head the other direction from the cars.
Nikon D700, 24-70mm, 400iso, f4, 1/2500th, Aperture Priority
With tricky track conditions I figured the first round of eliminations could make for some wild and wacky runs. The wildest race had to be Morgan Lucas as he took on Terry McMillen, below. Both cars got super out of shape but it would be Lucas who would make it to the stripe first for the win.
A wild moment would occur at one of the turnoffs as a wind blown parachute came dangerously close to a safety safari crew man who would have to dive over a wall to avoid the blossomed parachute on the car driven by Bob Vandergriff, below. Ask anyone who’s worked on the top end and they’d almost all tell you that errant parachutes are their biggest fear. Lord know they’re my biggest fear after a parachute destroyed 14k worth of my camera gear.
Below, pro stock motorcycle rider Michael Phillips (left) after defeating Hector Arana Jr. during the Spring Nationals at Royal Purple Raceway.
I would once again do a cockpit camera angle which gave me the below frame of top fuel driver Del Worsham as he prepared to race in the semi finals.
Nikon D700, 24-70mm, 2500iso, f5.6, 1/800th, Aperture Priority
Its always cool to see “low buck racers” have successful weekend. Below, funny car driver Bob Bode would have his dream weekend come to an end courtesy of Jeff Arend in the semi finals.
Many people on the NHRA circuit are anxiously awaiting the debut (later this year) of Courtney Force. Below Courtney gets some pointers from father John Force. I always hated listening to my dad as a child but I am guessing if he had 15 championships I would probably have to listen.
Here is a detailed view of the 60th anniversary pewter trophies, or Wallys as we call them in “the biz.”
Speaking of Wallys lets jump to the final round where we had two predictable winners and two not so predictable winners.
PREDICTABLE:
Pro stock motorcycle rider Andrew Hines celebrates following his 24th career victory.
Nikon D700, 24-70mm, 100iso, f6.3, 1/250th, Manual with SB-800 Flash
UNPREDICTABLE:
Pro stock winner Vincent Nobile cries as he celebrates with father John Nobile following his first career victory.
Funny car driver Jeff Arend celebrates following his third career victory.
Top fuel dragster driver Del Worsham celebrates following his 28th career victory to extend his points lead in the premiere class in drag racing.
Back up at the starting line following the race they conducted the winners circle ceremony.
The celebration would continue for 19 year old Vincent Nobile (below) as he celebrated with his father John Nobile, right.
Below, funny car driver Jeff Arend celebrates on the podium with daughter Jenna following the win.
Nikon D3s, 70-200mm, 320iso, f2.8, 1/800th, Manual
Below, Del Worsham shows off his new trophy to go along with the other 2 trophies so far in the young 2011 season.
And with that the weekend came to an end.
Next up is NHRA in Atlanta!
I recently started a Facebook page for my photography. Click the below banner to check it out. Be sure to “like” the page so you can be kept up to date on all the events I am doing as well as my favorite photos from each event, as well as some old favorites from the last 20 years!
Posted in Drag Racing, MLB, NHRA, Racing, Sports, Texas | 4 Comments
4 responses to “Del continues dragster domination in Houston”
Tommy G says:
Great work as always, Mark. These are awesome.
Your pictures are amazing….. I love the sport, and your pictures bring a beauty to it that cannot be described. The thing with pictures is that they are a moment in time, that lasts forever. Being able to study the detail, the emotion of the situation, the subject adds so much more than what can be grasped in real time.
I thank you for sharing your photos, they are wonderful. Thank you also for being a fan of Drag Racing, so we can see your amazing work.
My freakin’ gawd, Mark … what can I say? I’ve been shootin’ NHRA pics for almost forty years and my best shots don’t equal your worst. But I don’t have that cute red vest either. LOL! And rather than sulk, all I can say is: good on ya’ man, good on ‘ya. Keep ’em coming you talented SOB!
SLC,UT
Mark… Loved the blog from Houston. The shot of Vince Nobile and his father captures such great emotion. John has been racing for a long time, pouring lots into his career and now with his son. To see him so happy for his son makes me cry too! These guys (drag racers) try so hard, fight incredible odds, and get knocked down so much. Too see this is wonderful. The national dragster or Nhra needs to show this like you do. The ND weekly mag is not what it used to be. Would be great to see coverage from the lower ranks about some of the sportsman drivers who are coming up. So many start so young.
I think you sense of humor and your young at heart attitude would do good for allbaspects of the sport. Thank god for you and your blog. Love it and looking forward to Atlanta. Thanks for fueling my passion even more. Best of luck to you..
#wallywhateveryracerswants
Sincerely Maggie Zane
|
cc/2019-30/en_middle_0059.json.gz/line298
|
__label__cc
| 0.659834
| 0.340166
|
Victoria Villeneuve
Victoria Villeneuve / Jul 16, 2019
BOSS A full length stand alone novel with a HEA ending It wasn t enough that Kiegan Hunt had everything ridiculously good looks an enormous bank account balance and a name famous in America than the Kenn
Title: BOSS
Author: Victoria Villeneuve
A full length, stand alone novel with a HEA ending It wasn t enough that Kiegan Hunt had everything ridiculously good looks, an enormous bank account balance and a name famous in America than the Kennedys he also had to make my teenage years a living hell Years later, broke and estranged from the Hunt family, the last thing I expected to see was Kiegan A full length, stand alone novel with a HEA ending It wasn t enough that Kiegan Hunt had everything ridiculously good looks, an enormous bank account balance and a name famous in America than the Kennedys he also had to make my teenage years a living hell Years later, broke and estranged from the Hunt family, the last thing I expected to see was Kiegan still just as sinfully sexy as ever standing on my doorstep, offering me a job I ve always been a good girl Can I really handle working for a bad boy who makes my blood boil every time I look at him Just the thought of having to obey his every command makes my panties want to slip off He s insufferable I know that I know better than to do this But he s also irresistible That s why this is such a bad idea It s too bad I already said yes
Hugo Boss Designer Clothes and Accessories Shop designer clothes and accessories at Hugo Boss Find the latest designer suits, clothing accessories for men and women at the official Hugo Boss online store. Boss Definition of Boss by Merriam Webster First Known Use of boss Noun th century, in the meaning defined at sense a Verb th century, in the meaning defined at sense Noun , in the meaning defined at sense Boss definition of boss by The Free Dictionary boss bs, b s n a An employer or supervisor b One who makes decisions or exercises authority A professional politician who controls a party or a political Lil Pump Boss Official Music Video YouTube Jun , Household sharing included Live TV from channels No cable box required Cancel anytime. Men s Designer Clothes and Tailored Clothing Hugo Boss Shop men s designer clothes at Hugo Boss Our tailored clothing for men is characterized by its premium quality, elegant style, and timeless look Free Shipping Boss TV Series Created by Farhad Safinia With Kelsey Grammer, Connie Nielsen, Hannah Ware, Jeff Hephner Mayor Tom Kane, diagnosed with a dementia disorder, struggles to keep his grip on power in Chicago. The Boss The Boss starts with a bang, which just slowly seems to die out into an attempted feel good movie Peter Dinklage, playing Renauldo does a great job as the simple minded, ex BOSS BOSS Boss BOSS Boss Fifth Harmony BO BOSS YouTube Jul , Category Music Song BO Artist Fifth Harmony Licensed to YouTube by SME on behalf of Epic LatinAutor SonyATV, Abramus Digital, ASCAP, LatinAutor, LatinAutor Boss Hindi film Boss is a Indian action masala film directed by Anthony D Souza and written by Sajid Farhad.It was produced by Cape of Good Films and Ashwin Varde Productions and features Akshay Kumar in the lead role, along with Mithun Chakraborty, Shiv Pandit, Ronit Roy and Aditi Rao Hydari.
[PDF] ↠ Free Read ☆ BOSS : by Victoria Villeneuve ✓
Victoria Villeneuve 225 Victoria Villeneuve
Title: [PDF] ↠ Free Read ☆ BOSS : by Victoria Villeneuve ✓
Posted by:Victoria Villeneuve
About "Victoria Villeneuve"
Hi I m Victoria Villeneuve I m a small town girl at heart, with dreams of living in a cabin in the country with my two dogs and my amazing boyfriend Mike When I m not writing you can usually find me enjoying a nice mocha in my local coffee shop, reading some of my favourite books by the lake or playing soccer with my friends.
~`*Ella Lee*`~
This book just got weird. First off, we get it, their related by marriageWHATEVERbut the constant need for the author pointing out how taboo the two being together sexually was, was over the top.I felt like the story had great potential in the beginning. This bully shows his feelings through being a massive bully (high school years).The issue that forced both of them to leave their rich lifestyles and start their own wasn't even mentioned until late in the book as "confessions" like they were so [...]
Helen Dempsey
Underdog Story Lacked a large amount of emotion at the start. There was no steamy parts where you get drawn into the book. To me as a reader I felt that the book wasn't thought out throughly. To me it felt like it was written by a first time Author who seemed to have great lot of creativity and imagination but did not know how to execute the structure of the book. Based on my experience reading other similar books the pace was rushed at the start but came to an ending that really was very juicy [...]
DNF at 44%. My opinion.I love stepbrother romances. I love when the stepbrother is kind of a jerk/bully with a lot of tension, but then he changes his ways. Even though this book wanted to give the reader that assumption didn't. AT ALL. The heroine is bullied for years by her stepbrother. She sends an application to Harvard, the stepbrother purposely does not send it so she does not get in. She immediately moves out of the house and moves to NYC. She is struggling financially. Rich stepbrother o [...]
Sybil aka Lala
DNF @ 66%Same shitty rinse and repeat stuff as stepbrother: impossible love. The heroine is pathetic. The stepbrother is a complete tool. The dialogue is choppy and makes no sense at times. There a massive amount of info dumping about shit nobody should care about and very little actual interaction between the MCs which means no chemistry. The actual sex was boring and rushed and I just don't care anymore.
Arc copy of BOSS: A Stepbrother Billionaire Romance graciously provided by the author for an honest review.This is the story of Tina Hunt one that takes Tina through many changes during a few short years, at the age of fourteen it is just Tina and her mother living in NYC, her father having left them when she was the age of two. Her mother was often it of the house working long hours. One da her other came home and announced that they would be going to dinner with her fiancé ,Elton Hunt. Elton [...]
Tina has fled the family she grew up in leaving her mother behind. Kiegan has also left the family but they meet up again in Seattle after two years. She starts working for him. I liked the story. The flashback is predictable but the present and future are wide open. I liked that Kiegan is not staid, living for the family name. I also like that Tina gives back as good as she gets from him this time. I also enjoyed the two of them working together, coming up with a solution to Tina's past. The en [...]
wow. what a dark twisted spicy read. loved it.
Step brother romance no cheating he's an asshole at first, pov from h only. He. Exiles her boss. She is a bit overweight and the whole book she talks about the food she is eating and restaurants. It was a bit much with the food. It brought her weight into the relationship more than it needed to be as that was not really relevant later in the story. In the beginning it was though, because he teases her.
MehIn some ways I liked the plot but I also felt it all unnatural. The flow of the story didn't feel natural to me and I was left with questions, for example on why Kiegan was so mean to Tina as younger; his reasoning just seemed a little vague to me.
3.5. cute
When Tina was fourteen, her mum came home one day and announced that they were going to have dinner with the man she is to be marrying soon. Having been raised singlehandedly by her mum, she was suddenly thrown into the life of the affluent whose lineage dated way back to 1700s. As much as she felt awkward and a misfit, she did appreciate being able to go to schools she could only dream of and studying was what she did best in or so she thought.On her first day in school, she saw a guy whom she [...]
Judy Lewis
HEART OF A LION !!!COMPLIMENTARY COPY RECEIVED IN EXCHANGE FOR A HONEST REVIEW:Wow! Boss by Victoria Villeneuve is a completely captivating and wonderfully written romance filled to the brim with forbidden love, heartbreak, heated passion and sweet romance and most certainly, hope and redemption. If you're looking for an action pack, shoot 'em up adventure, then this isn't the book for you but if you're looking for an exceptional love story with taboo love, a journey for hope and sensitive yet w [...]
Melissa Ogletree
I received his book for an honest review. Tina grew up with little with a mom who worked a lot. Socially awkward she worked hard to get good grades in hopes of a better future. Imagine her surprise when her mom comes home and tells her she's getting married when she didn't even know her mom was dating anyone. Suddenly her life is turned upside down as her and her mom become enveloped into one of America's richest and most powerful family. Thrust into this new world including being sent to a new [...]
Ayennix
This book was ok. It's the story between step-siblings Kiegan and Tina. Their parents married when they were in high school and Tina moved in with her mother in the Hunt household. There, she meets Kiegan, who she knows as the a** from her new school.I didn't find the connection that every reader normally has for the characters they are reading. I honestly did not like how Kiegan and Tina are. Kiegan has always been an a** from the beginning, I didn't like the fact that Ms. Villeneuve didn't get [...]
Angel Hatfield
**I received an ARC of this story in exchange for an honest review**When Tina was 14, she found out her mother was marrying into the prestigious Hunt family. With that, she also inherited a step-brother, Kiegan, that's too hot to look at but a serious bully. As soon as she graduated high school, she left due to extenuating circumstances and never looked back. Two years later, she's jobless and struggling, but at least she's happy with her life. Then she finds out that Kiegan is in a new reality [...]
Revenge at its best!Fast paced and edgy romance with a twist of revenge and more than one unacceptable behavior being exposed. I'm not one to agree on the teenage step children falling for each other is taboo, but there are some other definite no no's the characters have to work through. And now a bit about the storyTina is a great student and her life changes forever when her mother marries into the wealthy Hunt family. She transfers to an ivy league prep school from her high school and is set [...]
I have received an ARC copy of the book from the Author in exchange for an honest review.This story is about Tina Hunt. A girl, whose mum married a rich guy. Everything seemed perfect. New family, better life, better school and new prospects for a better college. Tina was nervous, but happy. Until she went to school and straight away she was picked on. A guy, who was the most handsome boy at school, was bullying her. She was devastated. What she didn't know, was the fact that her new tormentor i [...]
I also got this book by Victoria Villeneuve for an honest review and even though I liked the other story better, this one was still goodesecretworldofbooklovers.bloKiegan is not a good guy from what we can tell at the beginning he is mean and rude and we hate him from the first time he shows up.But what was it they used to tell us when we were younger? If he picks on you, its because he likes you, boys are stupid like that, and oh boy they were right !The heat they rise once they decide to give [...]
This step-siblings love story started off pretty good by starting in present day and then reflecting back on events from the character's childhood to build the story. There were the love-hate feelings between the characters, and I thought it was going to be great. However, somewhere in the middle of the book, it was like the editor stopped editing. There were many grammatical errors, but even worse, there were continuity mishaps. Finally, when the love connection happened, it almost seemed gross [...]
Lorrie Moar
A stepbrother romance as the title states. Kiegan and Tina become family when their parents marry when they're 14/15 years old. Kiegan's family is rich and famous so they both go to a private school where Tina gets bullied by none other than her stepbrother for next few years of school. Just before high school grad Tina leaves and does not look back. When Kiegan and Tina finally meet again Kiegan doesn't know what caused Tina to leave. And, of course he is still an terror to her. A story of find [...]
Kristy Dean
Wow loved itThis was a great story. It's a full length book. The characters were well developed and had growth. The author did a great job with development. I would read this book again as well as other works by her. Overview. Tina came home one day and her mom told her that she was going to get married and she was going to get a new step brother. At 14/15, they were not close. He picked on her at their new prep school. Tina was put into a bad spot at 17, and when her mom didn't believe her, she [...]
Maria »viajante estática« Sales
I don't think I liked this book as much as I should, I think it all happened too fast. In the beggining I was starting to get into Tina's mind, but then everything happened like a car crash, fast as f*ck. I coudn't really get into the character after that. I liked Tina, she isn't one of those weak girls nor the "I don't care" badass, she is strong and yet so young, I admire her courage. About Kiegan, he's a little mean with her at first and then he becomes some sort of savior, but hey, that's ki [...]
Cindy Caron
I received an ARC of this book in exchange for my honest review.This is an awesome read. This story brings us through a young girls' life, starting as a young teenager of 14 up to her early 20's, and how it all changed from being borderline poor and only her and her mother, to mom marrying the rich guy, creating a new "family" for them. So much can happen in 7 years, and as we get to know Tina and Kiegan, and their stories, we can't help but fall in love with them both.Victoria Villeneuve has ma [...]
DNF I wanted to punch Tina in the face. No matter how Kiegan was mean n nasty she still wanted to rip his clothes off. Thats all she ever thinks about:How Hot and Sexy her brother is How they can't be together cos they brother&sister After their quickie she tells him "Its a mistake" cos they brother&sister arghhhhh like I said before, I wanted to punch her in the faceTina is annoying as f*** I roll my eyes so many times I felt like my eyeballs might be stuck like that forever. The author [...]
Tina's mother marries a rich man. Her life changes overnight, and when she realizes that her bully at the exclusive school she is attending is her new stepbrother, she decides to have as little to do with him as possible. A few years later she is unemployed and broke, and Kiegan is a rich, famous reality star. Tina goes to work for Kiegan and before long they are in very physical relationship. Tina will have to confess her reason for leaving the home they grew up in in order to save someone else [...]
This was a great read. I felt it started off slow but then after Kiegan and Tina met, sparks start to fly!I really hated Kiegan at first. I was saying I hope it's not that jerk she falls for but it was. I kept saying that he did not change only know the risk is higher for her to walk awayI was glad when they both got away from the Hunt family. I didn't like the fact of thinking they were brother and sister because they were not. Related buy marriage which is not blood is different. I don't see t [...]
There's a tactful way to write stories like this and this book is a prime example of what not to do. It's just weird, you're related by marriage, whatever, but to keep calling her little sis even after sleeping together? Gross, the entire thing needs to be edited and the writing wasn't that great. There was no real chemistry or depth to the characters and it made the entire story forgettable. It took me two hours to read, two hours I will never get back. I could have spent that time doing other [...]
Caroline F
The actual plot of this novel was pretty good - daredevil stepbrother, super smart stepsister, and family shenanigans.Told from Tina's POV, the author took the time to give to us the background to Tina's relationship with Kiegan and then their meeting a couple of years after Tina runs away.However, I'm sorry to say that, for me, the hero lacked depth. Apart from the fact that he constantly teased her and pulled pranks, we didn't really know what he felt for her, unless he actually said the words [...]
Sivutha
5 Fighting Stars She starts working for himand that is all it needs to be said. Office romance.Kiegan is a jerk but sexy as hellBoss. Kiegan grew on me but Boy did he gets on my nerves. Asshat if you ask me. Also, Kiegan left the family but they meet up again in Seattle after two years later. Tina is a typical poor teenager placed in new circumstances where she is afraid. Her mother married a rich husband and she decided leaving her mother behind. Their parents cared more about the family name a [...]
I received a free copy in exchange for an honest review.I really enjoyed this story. Tina is a teenager when her mother married Kiegan Hunt's father and they became step siblings. When Tina finally meets Kiegan, she realizes that she has met him before, and it certainly wasn't a good experience. This sets the tone for her time in the Hunt house until she breaks free, hoping to never see them again.Her luck runs out a couple of years later when she comes face to face with Kiegan and he gives her [...]
Ogni coincidenza ha un'anima (Le avventure del bib...
Ogni coincidenza ha un'anima
Speech Grille and Selected Poems
The Designer's Guide to Global Color Combinations:...
Wolf Nip
Les Treize vents - Tome 4
มอม (ฉบับการ์ตูน)
Progettazione sismo-resistente di edifici in cemen...
Lego Star Wars. El Diccionario Visual
Le Concile de Pierre
Rogue Dragon
کنیزو
Handbuch zur Natur- und Umweltpädagogik
Miettes philosophiques - Le Concept de l'angoisse ...
Qualitätsmanagement von A - Z: Wichtige Begriffe ...
La stanza delle serpi: Una serie di sfortunati eve...
|
cc/2019-30/en_middle_0059.json.gz/line303
|
__label__cc
| 0.709088
| 0.290912
|
Narrated Ibn 'Abbas:
Sayyiduna Abu Bakr (radi Allahu anhu's) real name was Abdullah, and he was given the title of "As Siddique" or "Testifier to the Truth." His father, 'Uthman, was known as Abu Quhafah and his mother, Salma, was known as Ummul Khair. He was two and a half years younger than Sayyiduna Rasoolullah (sallal laahu alaihi wasallam).He was the first among the Sahaba to accept Islam. He accompanied Sayyiduna Rasoolullah (sallal laahu alaihi wasallam) during the Hijrah to Madinatul Munawwarah. Sayyiduna Abu Bakr (radi Allahu anhu) was a merchant. He freed many slaves, including Sayyiduna Bilal (radi Allahu anhu) and Sayyiduna Umayyah bin Qahaf (radi Allahu anhu). He participated in all the battles in which Sayyiduna Rasoolullah (sallal laahu alaihi wasallam) had to fight the Kuffar.
Sayyiduna Abu Bakr (radi Allahu anhu) loved his faith more than anything else. At the Battle of Badr, his son, Sayyiduna Abdur Rahman (radi Allahu anhu), was fighting on the side of the Kuffar. After accepting Islam, Sayyiduna Abdur Rahman (radi Allahu anhu) said to his father, "O Father, at Badr, you were twice under my sword, but my love for you held my hand back." To this, Sayyiduna Abu Bakr (radi Allahu anhu) replied, "Son, if I had you only once under my sword, you would have been no more." He was so uncompromising in his faith.
At the time of the Battle of Tabuk, he donated all his wealth to the war effort, and when Sayyiduna Rasoolullah (sallal laahu alaihi wasallam) asked him, "What have you left for your family,?" he replied, "Allah and His Rasool (sallal laahu alaihi wasallam)."
Sayyiduna Abu Bakr (radi Allahu anhu) fell ill at this time and passed away on the 21st of Jamadi-ul-Aakhir 13 A.H. (22 August 634). His rule lasted 2 years and 3 months. He was 63 years old.
One of the many contributions of Sayyiduna Abu Bakr (radi Allahu anhu) was the collection and compilation of the Holy Quran
He lived a very simple, pious and upright life. He was a true servant of Almighty Allah and a meticulous follower of Sayyiduna Rasoolullah (sallal laahu alaihi wasallam).He wore ordinary clothes and his meals were very simple. He attended to house-hold work and would go out at night and seek the poor and destitute. Humility and modesty were the keynotes of his character. He felt embarrassed when people showered praises on him or showed him immense respect. He often fasted during the day and spent the whole night in Salaah and meditation. He was a great orator and a master of genealogy (one who can trace a person's family line). In personal life, he was a Saint. He used all his powers to promote the interest of Islam and the good of people.
Sayings of Abu Bakr (Radi Allahu Ta'ala Anhu)
1. Always fear Allah as He knows what is in your hearts
2. Be kind to those who are obedient to you and treat them well
3. Give brief orders as long speeches are likely to be forgotten
4. Improve your own behaviour before demanding others to improve theirs
5. Always speak the truth so that you may attain the right advice
6. Be sincere to all those whom you deal with
7. Refrain from cowardice and lies
8. Remain far from bad company
|
cc/2019-30/en_middle_0059.json.gz/line311
|
__label__wiki
| 0.970694
| 0.970694
|
As Rohingya flee Myanmar, leader Suu Kyi skips UN meeting
Newly arrived Rohingya wait for their turn to collect building material for their shelters distributed by aid agencies in Kutupalong refugee camp, Bangladesh, Wednesday, Sept. 13, 2017. With Rohingya refugees still flooding across the border from Myanmar, those packed into camps and makeshift settlements in Bangladesh were becoming desperate for scant basic resources as hunger and illness soared. (AP Photo/Dar Yasin)
Tents crop up at the newly set up Balukhali refugee camp in Bangladesh, Wednesday, Sept. 13, 2017. Recent violence in Myanmar has driven hundreds of thousands of Rohingya Muslims to seek refuge across the border in Bangladesh. But Rohingya have been fleeing persecution in Buddhist-majority Myanmar for decades, and many who have made it to safety in other countries still face a precarious existence. (AP Photo/Dar Yasin)
FILE - In this Friday, Aug. 11, 2017, file photo, Myanmar's State Counsellor Aung San Suu Kyi delivers an opening speech during the Forum on Myanmar Democratic Transition in Naypyitaw, Myanmar. Suu Kyi has canceled plans to attend the U.N. General Assembly, with her country drawing international criticism for violence that has driven at least 370,000 ethnic Rohingya Muslims from the country in less than three weeks. (AP Photo/Aung Shine Oo, File)
Newly arrived Rohingya women along with their children rest inside a health complex run by aid agencies in Kutupalong refugee camp, Bangladesh, Wednesday, Sept. 13, 2017. With Rohingya refugees still flooding across the border from Myanmar, those packed into camps and makeshift settlements in Bangladesh were becoming desperate for scant basic resources as hunger and illness soared. (AP Photo/Dar Yasin)
Rohingya Muslim girl Afeefa Bebi, who recently crossed over from Myanmar into Bangladesh, holds her few-hours-old brother as doctors check her mother Yasmeen Ara at a community hospital in Kutupalong refugee camp, Bangladesh, Wednesday, Sept. 13, 2017. The family crossed into Bangladesh on Sept. 3. Recent violence in Myanmar has driven hundreds of thousands of Rohingya Muslims to seek refuge across the border in Bangladesh. But Rohingya have been fleeing persecution in Buddhist-majority Myanmar for decades, and many who have made it to safety in other countries still face a precarious existence. (AP Photo/Dar Yasin)
Newly arrived Rohingya women wait for their turn to collect building material for their shelters distributed by aid agencies in Kutupalong refugee camp, Bangladesh, Wednesday, Sept. 13, 2017. With Rohingya refugees still flooding across the border from Myanmar, those packed into camps and makeshift settlements in Bangladesh were becoming desperate for scant basic resources as hunger and illness soared. (AP Photo/Dar Yasin)
Spokesperson for Myanmar's State Counsellor office Zaw Htay talks to journalists during a press briefing at the Presidential Palace in Naypyitaw, Myanmar, Wednesday, Sept 13, 2017. Zaw Htay said second Vice President Henry Van Thio would attend the U.N. General Assembly instead of leader Aung San Suu Kyi. (AP Photo)
A Rohingya Muslim boy, who crossed over from Myanmar into Bangladesh, stands near a newly built shelter at Balukhali refugee camp, Bangladesh, Wednesday, Sept. 13, 2017. Recent violence in Myanmar has driven hundreds of thousands of Rohingya Muslims to seek refuge across the border in Bangladesh. But Rohingya have been fleeing persecution in Buddhist-majority Myanmar for decades, and many who have made it to safety in other countries still face a precarious existence. (AP Photo/Dar Yasin)
COX'S BAZAR, Bangladesh — Facing global condemnation for weeks of violence that has driven minority Rohingya to flee — a crisis U.N. officials have described as "ethnic cleansing" — Myanmar's leader, Aung San Suu Kyi, pulled out of this month's U.N. General Assembly meetings.
The president's office said Wednesday that Suu Kyi would miss the assembly's ministerial session, which opens Sept. 19 and runs through Sept. 25, to address domestic security issues.
The U.N. Security Council condemned the violence that has driven some 380,000 ethnic Rohingya Muslims to flee to safety in neighboring Bangladesh. U.N. Secretary-General Antonio Guterres told reporters that ethnic cleansing was taking place against Rohingya in Myanmar's Rakhine state.
The term "ethnic cleansing" is defined as an effort to rid an area of an unwanted ethnic group — by displacement, deportation or even killing.
Security Council members called for "immediate steps to end the violence," de-escalate the situation and ensure civilian protections in what many Rohingya see as their homeland.
The statement was the first made by the U.N.'s most powerful body in nine years addressing the precarious situation Rohingya face in Buddhist-majority Myanmar, Britain's U.N. Ambassador Matthew Rycroft said, calling it "an important first step."
Suu Kyi's appearance at last year's General Assembly was a landmark: her party had just won elections in 2015, replacing a military-dominated government and ushering in an era of democratic reform.
But even then, she faced criticism over Myanmar's treatment of Rohingya Muslims, whose name she did not utter. Many in Myanmar instead use the term "Bengalis" and insist they are people who migrated illegally from Bangladesh.
Rohingya have faced decades of persecution in Buddhist-majority Myanmar, and are denied citizenship despite centuries-old roots in the Rakhine region.
Suu Kyi, a Nobel Peace Prize laureate who lived for years under house arrest when Myanmar was ruled by a military junta, has faced a torrent of criticism since the crisis erupted.
Myanmar has blamed the violence on Rohingya insurgents who attacked police outposts in Rakhine state on Aug. 25, inciting the military to respond with what it called "clearance operations" to root out the rebels.
Many Rohingya villagers who have flooded into Bangladesh say Myanmar soldiers shot indiscriminately, burned their homes and warned them to leave or die. Others have said they were attacked by Buddhist mobs.
Suu Kyi is not Myanmar's president — her official titles are state counselor and foreign minister — but she effectively serves as leader of the Southeast Asian nation though she does not control the military.
Presidential office spokesman Zaw Htay said that, with President Htin Kyaw hospitalized, second Vice President Henry Van Tio would attend this week's U.N. meeting.
"The first reason (Suu Kyi cannot attend) is because of the Rakhine terrorist attacks," Zaw Htay said. "The state counselor is focusing to calm the situation in Rakhine state. There are circumstances. The second reason is, there are people inciting riots in some areas. We are trying to take care of the security issue in many other places. The third is that we are hearing that there will be terrorist attacks and we are trying to address this issue."
He said Suu Kyi would give a speech next week covering the same topics she would have addressed at the United Nations. He did not say if that included the violence in Rakhine state.
The violence has left hundreds dead and set off a refugee exodus that has overwhelmed Bangladesh, with thousands of Rohingya flooding into the country by land and sea every day.
They've arrived hungry and traumatized. Many need urgent medical care for violence-related injuries, severe infections or childbirth, aid groups say.
"The women who are coming for check-ups all have a terrified and exhausted look," said Sumaya, a midwife at the Nayapara refugee camp working in association with the U.N. population fund. "We keep hearing stories from them of walking through jungles and across hills for days without food, their children carried over their shoulders. They've lost their homes."
Zaw Htay said that, out of 471 "Bengali" villages in three Rakhine townships, 176 were now completely empty while at least 34 more were partially abandoned.
He said there were at least 86 clashes through Sept. 5, but none since — suggesting that security forces had succeeded with efforts to stabilize the region "to a point."
The government blames Rohingya for setting fire to their own homes, but journalists who visited the region found evidence that raised doubts about those claims.
On Wednesday, dozens of foreign diplomats and aid officials visited heaving refugee camps in the Bangladeshi border district of Cox's Bazar, and called on Myanmar to find a lasting solution for the Rohingya to live in peace.
"They need to have their own country," said Italian Ambassador to Bangladesh Mario Palma, adding that Myanmar must face the issue and "give citizenship to these people."
Thousands were still streaming into the country on Wednesday. Some had paid smugglers for passage on packed wooden boats to beaches at Shah Porir Dwip. Others were walking for days through jungles or wading through the monsoon-swollen Naf River.
At least 86 people have drowned when boats capsized in the river, according to police in near the border town of Teknaf, where nine bodies were recovered from a capsizing Tuesday night. At least dozens more have died after capsizings at sea.
Two existing refugee camps were packed beyond capacity, with many new arrivals huddling in makeshift shelters along roads or in open fields. Aid groups were struggling to provide enough food, clean water and medical aid.
Near the camp of Balukhali, some were setting up tents made of bamboo and plastic along hillsides muddy from days of rain. Children walked uphill to capture rainwater before it spilled into the teeming settlements below.
The head of the U.N. High Commission for Refugees said humanitarian assistance would increase "very, very quickly." Asked why the response has been slow, Filippo Grandi alluded to difficulties working in Bangladesh, but said he hoped this will change as the scale of the crisis becomes more apparent.
It is the Myanmar government's "responsibility to ensure that security returns to Rakhine," Grandi told The Associated Press at the Stockholm Security Conference in Sweden.
Bangladesh already was housing some 500,000 Rohingya who fled earlier flashes of violence including anti-Muslim riots in 2012. It pledged this week to free land for a new camp to cope with new arrivals.
Associated Press journalists Edith M. Lederer at the United Nations and David Keyton in Stockholm, Sweden, contributed to this report.
Thousands more Rohingya refugees flee Myanmar by...
The UNHCR says tens of thousands more Rohingya refugees have entered Bangladesh in the last day by...
The Latest: India urges Myanmar to act with...
The Latest: India has urged Myanmar to handle the situation in its Rakhine state with restraint...
Bangladesh accuses Myanmar of violating its...
Amid refugee crisis, Bangladesh accuses Myanmar of violating its airspace; Myanmar denies charge
|
cc/2019-30/en_middle_0059.json.gz/line312
|
__label__wiki
| 0.531061
| 0.531061
|
Palm Springs’ New Downtown Project to Open Mid-November
Brings new hotels, retailers, restaurants to revitalize destination
May 19, 2017 – Grit Development, formerly Wessman Development, announced its downtown Palm Springs revitalization project will open this fall with new experiences for vacationers, trendsetters and celebs alike.The project complements Palm Springs comeback as Hollywood’s playground by enhancing the city’s already 350-plus days of sunshine, growing nightlife, burgeoning art scene and edgy vibe.
“After a decade of planning and hard work, we’re thrilled to share the project is near completion and the line-up of tenants to date,” said Grit Development President Michael Braun. “Dozens of tenants will open this summer with the Kimpton Rowan Hotel officially opening to the public in September. We are on track for a full grand opening in Mid-November.”
West Elm opened as the first retailer in 2016 followed by Blaze Pizza March 24. New tenants include:
Kimpton Rowan Hotel, boutique hotel with design-forward guestrooms and suites, restaurants with chef-driven seasonal fare and city’s only rooftop pool and bar.
H&M, one of the world’s largest fashion retailers offering fashion-forward apparel at affordable prices in a sustainable way.
Free People, a specialty clothing brand featuring the latest trends for women who live free through fashion, art, music, and travel.
francesca’s, a boutique that offers an eclectic mix of carefully-curated clothing, bright baubles, bold accessories, and playful gifts that are as fun to give as they are to receive.
Kiehl’s, a brand retailer that specializes in skin, hair and body care products.
Tommy Bahama Restaurant and Bar, the island-inspired brand with stores and restaurants worldwide.
Starbuck’s Reserve, an upscale version of the coffee chain.
Stout Burgers & Beers, a simple, upscale neighborhood restaurant that offers gourmet burgers and a vast selection of artisanal draft and bottled beers.
Il corso, a fine diner that offers genuine Italian hospitality, authentic Italian dishes including homemade pastas, gourmet wood oven pizza, seafood and roasted leg of veal.
“This line-up shows the quality and diversity of tenants to come,” added Braun. “Once complete, this project will put Palm Springs back on the map as a top destination. Visitors can enjoy staying at luxurious accommodations, shopping eclectic brands and dining at incredible restaurants — all within walking distance and surrounded by beautiful scenery and views few can match.”
About Grit Development
Grit Development, formerly known as Wessman Development, evolved to reflect the company’s new management following John Wessman’s formal retirement in February 2017. Michael Braun and Octavio Fernandez serve as the key leaders managing the Palm Springs downtown project and company’s future endeavors. Tom Noce recently joined Grit Development as the chief financial officer.
The company is committed to redefining spaces and developing projects to keep its partners ahead of the curve. Grit Development strives to deliver properties with unique, vibrant experiences that consistently elevate how people shop, vacation, live and work – now and into the future.
Visit gritpalmsprings.com for more information.
Danielle Barnes2017-07-07T14:51:47-05:00May 19th, 2017|Tags: Grit Development, Kimpton Rowan Hotel, Michael Braun, Palm Springs revitalization project, Wessman Development|
|
cc/2019-30/en_middle_0059.json.gz/line321
|
__label__cc
| 0.749658
| 0.250342
|
6/30/79 23:30 Sunnyvale CA
5 minutes Huge green glowing cigar shaped craft observed flying at treetop level over Sunnyvale. 12/12/11
6/30/79 23:00 Janesville IL Fireball 15 minute anesville WI 5/12/09
6/30/79 22:00 Franklin Park area IL Unknown 2+ hours Aurora Borealis-like lights near Franklin Park in late 1970's. 9/25/14
6/30/79 21:00 Columbia City IN Triangle 15 min That night east of C. City on US 30 in the 70's 2/14/06
6/30/79 21:00 Ramona CA Light aprox. 2-3 min. It was a greenish glowing object which moved at unimaginable great speed. 1/10/09
6/30/79 21:00 Wilsonville IL Circle 3-4 minutes Wilsonville,IL 1979 also known at time for its radioactive waste dump in seventies 10/8/07
6/30/79 20:00 Richmond ME Formation
Triangle formation over Richmond Maine in the late 1970's or early 1980's 4/18/12
6/30/79 19:00 Nile River (Egypt)
I was on a boat on the river nile sailling to the Sudan it was a clear night and the stars were very clear to see I saw a star which l 10/8/07
6/30/79 18:00 Dipolog (Philippines)
Oval 5 MIN. When I and my friends playing on the ground. I'm 10 years old. I saw the giant alien spaceships. 8/21/11
6/30/79 13:00 Cherokee NC Disk 2 minutes This silver disc shaped object was spotted hovering back and forth in and above the tree line above the creek everyone tubed on. 4/23/15
6/30/79 01:00 Leola PA Light 3 minutes 1 bright light in a dark night sky. 2/4/13
6/30/79 Renton WA Egg 15 minutes Watched stat. obj. from basement for 10 min. Obj. looked like white grain of rice. Went up stairs and got my binoculars. 9/11/15
6/29/79 22:45 St. Paul MN Light 10 seconds watched a yellow pt of light drop strt down, it stopped at roughly 45 deg l.o.s. to hor. it stopped, hovered a sec or two, then apparen 8/10/99
6/26/79 00:00 Two Rivers WI Cigar several nites It was in the local paper that the Us Coast Guard had take serveral pictures of the craft. The Article was in the hearld times. 10/30/06
6/23/79 00:00 Las Vegas NV Unknown unknown Loss of time, and white to blue cloud. 8/22/14
6/20/79 23:30 Bohemia NY Light 2-3min. Driving on Pond Rd.Returning from my sister's house I saw a light that appeared to be to the street (I actually thought it was part of 4/28/01
6/20/79 20:00 Valley Cottage NY Disk 20 min it was big enough to swollow it keep in mind this was a 4 or 5 bedroom home It was round or disk 10/31/03
6/20/79 18:00 Orlando FL Circle 10min Several of my friends and I where in a school playground and a saucer with lights on bottom (colors) was about 200 feet above us and ma 1/17/04
6/20/79 13:00 Terre Haute (near) IN Changing 25 seconds It changed shape from a cigar shape to a circle and back again. 8/4/03
6/16/79 23:30 Napa CA Triangle 10 minutes Triangular UFO SIghting Napa County Summer 1979 (on the way to Lake Berryessa) 4/16/05
6/15/79 23:00 Jonesboro AR Unknown 4 min stars start mooving from dead stop 8/14/07
6/15/79 22:45 Mayaguez (Puerto Rico)
Other 3 OR 5 MINUTES little island see bigger ufo 8/28/03
6/15/79 21:30 Lavigne (Canada) ON Triangle 5 min. still unexplained lights and craft seen in northern Ontario. 9/13/02
6/15/79 21:00 Huntsville TN Oval 20 seconds I saw a bright oval object at night in the sky it was big ,fast,and gasious yellow,orange, red glowing. 10/15/03
6/15/79 20:00 San Jose CA Disk 30-40 min 1979 ufo and entities sighting up close 6/2/13
6/15/79 19:30 Baton Rouge LA Disk 30 seconds metallic disk emerged from one cloud and disappeared behind another. 1/21/08
6/15/79 19:00 Oquawka IL Rectangle 5-10 minutes lot of lights rectagular in shape and a sound ive never herd before 8/14/07
6/15/79 19:00 Manteca CA Disk 3 seconds blue belly: ship with blue light outlineing the bottom of saucer, white ball of light on each end. top: one white ball of light on top 4/8/02
6/15/79 17:00 Toronto (Canada) ON Other 1 minute Hollow Ring Shaped Object During The Day, Just Above Tree Line 6/10/10
6/15/79 17:00 Fort Worth TX Teardrop 7 Min. Unknown Object appear ,changing colors moving Southeast direction over Ft Worth ,TX. 7/16/06
6/15/79 16:00 Woodstock VT Other 5 minutes Aircraft carrier size, low flying, slow moving mechanical object, engine like thrumming sound, small "running" lights. 1/12/18
6/15/79 16:00 Van (Van Park) WV Cigar 5 minutes This cigar shaped craft was about 200 feet from us and only about 100 foot up from the ground. It was just at the top of the trees an 4/3/15
6/15/79 15:00 Baton Rouge LA Disk 2-3 Min. Several witness Silver Disc over Baton Rouge 7/1/02
6/15/79 15:00 Woodland WA Unknown unshure "very quick" unearthly sounds 12/9/00
6/15/79 14:00 Dorchester IA Other 5 minutes Upright Y shaped yellow and black flying objects. 4/18/12
6/15/79 04:30 Los Angeles (over I-10, on most rural Bayou stretch) CA Unknown 2 minutes Metallic UFO seen hovering silently, directly over eastbound lanes.Light underneath shined UP onto craft-was being moved by humandoid s 11/1/98
6/15/79 03:00 Sagamore Hills OH Unknown 2 minutes In Ohio around 1979 I had and encounter with 3 aliens.
500 Lights On Object0: Yes 7/4/12
6/15/79 02:00 Morocco
Unknown 5 min Northern Africa 1979 3 objects seen in the sky 10/31/03
6/15/79 Kavala (50 km. SE of) (Greece)
6 min. year 1979 my home town is kavala greece; Eastern macedonia port city i was fishing S EAST of the city about 50 kl and 3 kl east of the 4/16/05
6/12/79 22:45 Dublin (Ireland)
Other 1 minute Dublin, Ireland. I don’t know if you could describe this as a “UFO” sighting as what I saw appeared to be with the stars (and same siz 10/31/08
6/10/79 19:00 Huntington NY
3 minutes no sound fairly close to me, windows 8/5/09
6/8/79 00:00 Green Township/Erie PA Other missing time the same thing happened to me in green township/ERIE PA in june of 1979 was babysitting for my moms friend. was awake and next thing i 3/9/04
6/5/79 18:30 Paterson NJ Other 2 sec. I realize this happened 27 years ago, but I could never forget it. I was driving on I -80 heading west, passing the city of Paterson; a 10/30/06
6/1/79 23:40 Attica MI Disk 10-15 minutes I am reporting this as it has been a long time and has bothered me for quite some time. I was about 7 or 8 at the time my parents and 3/2/04
6/1/79 23:00 Marion IN Triangle 1hour Space ship in a dream. 6/21/00
6/1/79 22:00 Mitrovica (Kosovo, Yugoslavia)
Sphere 1-2min A shining silver sphere appeared 5/27/03
6/1/79 22:00 Napier (New Zealand)
Other 5mins The speed of this craft was faster than any aircraft that I have witnessed it vanished in a instant!..... 8/16/02
6/1/79 22:00 Castro Valley CA Rectangle 5 minutes saw boxkite shaped object with lights on corners, then driver saw tried to follow, to fast in blink of eye went 2 miles other direction 10/2/99
6/1/79 22:00 Whidbey Island WA Circle 5 minutes Observance of UFO over military base in 1979 or 1980 12/16/05
6/1/79 22:00 Court House Bay NC Light 11:PM FROM THE DISTANCE OF THE STARS AND HOW FAR APART THEY WERE THE SPEED HAD TO BE OFF THE CHART. 2/18/01
6/1/79 22:00 Hollister CA Egg 2 Minutes ORANGE BRIGHT EGG SHAPED OBJECTS 7/1/02
6/1/79 22:00 Farmington NY Rectangle 5 minutes Huge silent object witnessed in the sky in Farmington NY in 1979 10/31/08
6/1/79 21:30 Athol MA Circle 5 minutes Hovering craft at tree top level, at night. Craft lit up from inside w/4 aliens clearly visible, 3 short, 1 tall, all gray type. 6/22/17
6/1/79 21:15 Wilsonville IL Circle 2 minutes Wilsonville,IL 1979 also known at time for its radioactive waste dump in seventies 8/7/07
6/1/79 21:00 Hemel Hempstead (UK/England)
Other 10min clear bright night ,moon to the right behind a single cloud,we were driving up over Box hill which loooks down onto the town,on a narro 2/16/00
6/1/79 21:00 Fredericksburg VA Other 7 minutes this is a valid sighting 12/2/00
6/1/79 21:00 Rhein-Main Air Base (West Germany)
Circle Days Bright lights doing 90 degree turns over Rhein Main Air Base 4/12/13
6/1/79 21:00 Wheaton MD Light 4 seconds Single bright light that flew across horizon very fast, in a straight line, leaving no tail or noise behind. 1/19/17
6/1/79 21:00 Knoxville TN Light 15 MINUTES light following a grid 6/12/08
6/1/79 21:00 Griffin GA Disk 1.5 min Saucer shaped UFO. ((NUFORC Note: Possible hoax. PD)) 3/11/06
6/1/79 21:00 Whitman MA Sphere minute a bluish white ball of light that moved with out a sound 5/14/02
6/1/79 21:00 Victory Heights (Franklin) PA Light 15 minutes Lights and some kind of being (creature) starring back at me....... 10/30/06
6/1/79 20:30 Mesa AZ Other 45 mins Events throughout my life 10/31/08
6/1/79 20:00 Margate FL Oval 3-5 minutes Night, black, silent, round, oval, pulsating lights on edge, very close proximity 8/5/09
6/1/79 20:00 Hamilton (UK/Scotland)
Light 15 seconds Fast moving small bright light 2/14/08
6/1/79 19:00 Ithaca NY Cigar 20 seconds I was driving at nighttime from Dryden toward Ithaca NY on a country road when I saw a very large and bright white object in the sky. 4/14/09
6/1/79 18:45 Morrice MI Disk 5 minutes UFO with multi-colored lights spotted out in the country in Ingham county 12/12/11
6/1/79 18:00 Alameda CA Disk three minutes This is a very delayed report: While stationed at the Alameda Naval air station in California. It was I believe early in 1979 when thei 1/28/99
Circle 3 minutes METALIC SPHERE 2/14/08
6/1/79 16:00 Laredo TX Circle 30 min Spinning circular black UFO with changing lights. 8/28/03
6/1/79 16:00 Cleveland OH Cross 20MINUTES+ IT IS NICE TO KNOW THAT OTHERS HAVE SEEN "CROSS" SHAPED UFO'S WITH LIGHTS THAT STRETCH ACROSS BOTH LINES OF THE ENTIRE CROSS (+)! 8/5/01
6/1/79 15:30 Birmingham (UK/England)
Cylinder 15 mins Followed for a while and missing time. 10/30/06
6/1/79 15:00 Springhill LA Disk 4 minutes An object was seen observing a large construction site of various sized concrete pads then shot away at a high rate of speed. 11/3/17
6/1/79 15:00 Bornem (Belgium)
Oval 4min Small orange disc in tree, almost touched it 2/16/00
6/1/79 07:00 Parker CO Unknown 12:00 ((HOAX??)) Three lights split off in different derections. ((anonymous report)) 7/8/16
6/1/79 05:00 Tatum TX Light 10 OVAL TO ROUND IN SHAPE LARGE VERY BRIGHT 10/30/12
6/1/79 00:00 Minot ND Rectangle 3-4 mins Large rectangular object hovering over Minot Air Base, ND. 12/9/03
|
cc/2019-30/en_middle_0059.json.gz/line328
|
__label__wiki
| 0.75327
| 0.75327
|
Nurgle's Rotters
The Blood Bowl game is set in what ostensibly appears to be the Warhammer Old World, but with some changes to better fit the exuberant fun of this brutal sport. One of the teams that competes is Nurgle's Rotters, a group of followers of the Plague God, infected with contagious diseases that they spread to their opponents.
Citadel Journal 18 (1996), p57-60 — Dirty, Rotten Scoundrels: The Return of Nurgle's Rotters
Nurgle's Rot in Blood Bowl
Nurgle's Rotters were a Chaos team made famous by the fact that all of its players were afflicted by a horrible and extremely infectious disease known as Nurgle's Rot. The team won many games by default as it was not uncommon for opponents to simply refuse to take the field against them. Those teams desperate enough to do so were invariably changed by the experience. The Rot affects its victims slowly, deteriorating both body and spirit. As a result afflicted players either kill themselves, go mad or else sign up with the only team loathsome enough to have them: the Rotters themselves.
Unfortunately (well, unfortunate for the Rotters anyway) the team did not survive the collapse of the NAF in '88. Without a regular supply of victims to recruit they, quite literally, went to pieces.
Spike! Magazine Exclusive: The Rotters are back!
You can't keep a good plague down it seems. It's almost ten years since the last appearance of Blood Bowl's most putrid team. But Spike! can reveal that speculation about a revival (if that is an appropriate word) of the Nurgle's Rotters is confirmed. Three members of the Middenheim Marauders hospitalised after their charity game against mysterious newcomers D.K Erengrad are reported to be in a state of advanced and irreperable decomposition tonight. Kislev General Infirmary, where the injured players are being treated, has declined to comment but it has closed its doors to the public, indefinitely. Chaos fans everywhere will be delighted.
New Rules: Catching the Rot
Nurgle's Rot is passed on by physical contact. Victims can catch it by being in combat with disciples of Nurgle, being caught in a Stream of Corruption or by becoming a Champion of Nurgle. The Rot usually takes several months to kill its victims; it progresses from match to match, starting with the first match following contraction of the disease. The victim is grotesquely altered as he slowly turns into a Plaguebearer, then his appearance and profile continue to change until he is finally assimilated into the Realm of Chaos as a pool of protoplasm. A Champion of Nurgle who contracts the Rot becomes a carrier of the disease but does not suffer any debilitating side-effects. However he can pass it on to members of his own team. If he is slain then the status of Champion will be conferred upon another team member. If the new champion already has the Rot, its progress is halted at the stage it has reached.
A new Chaos team wishing to devote itself to Nurgle must declare one of its players as a Champion. The Champion has the skill Foul Appearance, as described in the DeathZone supplement. This skill is a measure of the progress of the Rot; consequently the remainder of the team, Chaos Warriors and Beastmen, start with Foul Appearance at Level 0, indicating that they have not yet been touched by the disease. Beastmen of Nurgle lose their Horns initially but gain them as the rot progresses.
After each match, before allocating Star Player Points, roll a D6 for each player on the team. If the number rolled exceeds the player's Foul Appearance level his Rot has progressed further and the Foul Appearance skill is increased by one level. A roll of 1 always indicates no change in condition, hence at level 0 the player must roll a 2 or more to become afflicted. Once afflicted consult the following table:
Foul Appearance Table
Effects on Player
0 Skin discolours. No effects on player's profile.
1 Pustules break out all over body. -1 AV.
2 Skin rots. Additional -1 AV.
3 Player sprouts a horn. Gains Horns.
4 Eyes grow together. -1 AG.
5 Feet grow claws. -1 MA & gain Claw.
6 Play one further game with -1 MA, -2 ST and -1 AG.
No characteristic may go below 1. At Foul Appearance level 0 the player receives none of the effects described for this skill. Upon reaching level 6 the player plays one last match after which he melts into a pool of goo. This makes him somewhat redundant on the Blood Bowl field.
Opposing players wishing to block a player afflicted with the Rot must first roll equal to or less than the player's Foul Appearance level on D6. Failure indicates that the blocking player is so nauseated by his opponent's state of corruption that he refuses to go anywhere near him.
If a Nurgle's Rotter Badly Hurts or inflicts a Serious Injury on an opponent and it is not healed by an Apothecary, roll a D6. On a 1 the victim is afflicted with Nurgle's Rot, gains Foul Appearance level 1 and immediately loses one point of AV. The victim is shunned by his former team mates and has no choice but to join the Rotters if he wishes to continue playing Blood Bowl.
Roll D6 for each newly afflicted player. On a 2-6 the player signs up with Nurgle's Rotters and may be added to the team roster for their next game. On a roll of 1 the player climbs onto the roof of the stadium and ends his career abruptly by power diving onto the astrogranite.
If for any reason a Nurgle's Rot victim player has the Regeneration ability, he may actually be able to reverse the progress of the disease. At the end of a match make a Regeneration roll as normal; on a successful roll the player decreases his Foul Appearance level by 1 to a minimum of level 1.
Characteristics are not lost or recovered as a result of Regeneration, but at least the player's life expectancy may be increased. Similarly a Healing Scroll magic special play card may be used to automatically remove one level of Foul Appearance from a player; this may be used at any point during the match or in the post-match sequence.
Originator's Comments and Playtest Q & A.
I started to think about Nurgle's Rotters when the second edition of the game came out. The line drawing of the piles of goo stayed in my mind and over time, these rules have grown. I wrote these and have playtested them exhaustively. Some friends have written to me over the Internet with their comments. These are written below...
Q: Does this mean all the Nurgle teams would be like this? (i.e. all have Nurgle's Rot)
A: No. It is up to the individual coach / commissioner. I would rule that if a coach opted to play Chaos, and wanted to use Plaguebearers and a Great Unclean One (Citadel Journal No.8), then he would have to use the rules for Nurgle's Rot. I would advise the commissioner to try to have only one Rotter team in each league.
Many of the questions concerned the cost of the players, especially the Beastmen. The complaint was that the players were overpriced.
Q: Beastmen are overpriced. Why not reduce the cost?
A: I think that you are paying for the concept of the Rot, by losing the extra 10,000 GCs per beastman. Soon enough they are going to get infected and have Foul Appearance (which is a 20K Physical Ability), and can use it all the time. Normal Beastmen get Horns at the start of their playing career, but only one of them can use it per turn! You are also paying in advance for the infected opponents that your team will recruit for free.
Q: Beastmen are over priced. Shouldn't the FA effects be stronger?
A: It is just a question of game balance and I'd prefer them to be more difficult than a 'normal' Chaos team. Jervis has *spiked* the DeathZone teams (e.g. Halflings and Undead), so that they should be more of a challenge. I'd like the Rotters to be like that, only more so.
Summary: The cost of the individual players is balanced by the unique abilities of the whole team.
Q: The Champion doesn't deteriorate as a result of the disease, right?
A: Correct. He has the skill Foul Appearance, as described in DeathZone.
Q: If the Champion dies, can he be replaced?
A: If he is slain then the status of Champion can be adopted by one of his team mates. If the new Champion has the Rot, at a specific level, then its progress is halted at the stage that it has reached. The team 'vote' for who becomes the new Champion, so it is your choice. It can be a Beastman, a Chaos Warrior or even a player 'recruited' from another team.
Q: Also, how about allies? I think the allies should be as stated in the Citadel Journal, i.e. Ogre, Goblin, Skaven, Dark Elf.
A: Nurgle's Rotters do not take allies as nobody in their right mind would actually join them. It would be a death sentence! Instead, the Rotters can acquire 'converts' which could include any Race. If you injure it, then there is a chance that it could play on your team (for a short while)!
Q: If an opposing player succumbs to the disease, is he deleted from his original roster?
A: Precisely! He joins your team, if you want him. You may make way for him/it by 'cutting' a current team member, if you have no available spaces on your roster. For TR purposes he costs his list price. He has Foul Appearance Level 1.
Q: What are the effects of Regeneration?
A: Regeneration effectively means that the progress of the rot is halted indefinitely, as long as the player is at a low level when he gets the skill. He has a 1 in 6 chance of getting worse and a 1 in 2 chance of being recovered.
Q: How could Undead be infected?
A: Nurgle's Rot doesn't only kill, but it also ruins flesh. A wise necromancer has gone to a lot of trouble to keep his Mummies in good condition and his ghouls alive. While the necromancer may not care about the Zombies, he must protect his investment. Nurgle warbands can consist of plague zombies, so the sorcerers of Nurgle must be able to maintain the Undead state of a subject. They cannot Raise the Dead, but perhaps they can sustain zombie existence.
Q: Isn't Coaching the Rotters a lot of work in the book-keeping department?
A: Keep a portion of the Skills section of the roster free, or better still, draw a line down so that you have a fifth box after AV, and call this the FA Lvl box. Simply write your roster in pencil and make the necessary additions/deletions as appropriate.
Q: Am I correct in assuming that FA Lvl 0 and FA Lvl 1 are functionally the same, except for the AV loss?
A: No! I haven't explained that well enough. FA Lvl 0 is a condition which has not yet started to express itself. Any player in this state can be blocked as normal and cannot exert the -1 modifier (on passing and catching) associated with Foul Appearance.
A Chaos Beastman in these circumstances is effectively a Human lineman, The team behaves quite normally at the beginning, but becomes fun after a few games.
Some people complained that the players got too powerful when they got the Claw skill, especially as the opposing coach had to roll a 5 or 6, on a D6, just to block him.
I answered saying...
At FA Lvl 6, the player plays one final game with the following punitive characteristic reduction: -1 MA, -2 ST, -1 AG. As the average Beastman player will be 5/3/2/6 [Horns, Block, Claw], at FA Lvl 5, he suffers a very high chance of deteriorating to level 6 after each game (1-5 on a D6). He is not likely to stay at FA Lvl 5 for many games and for his final game, he becomes 4/1/1/6 [Horns, Block, Claw]. It might be argued that at FA level 5 or 6 the Beastman is virtually unstoppable, but with his AG who on Earth is going to pass to him??
dedicated to the Master of the Plague
|
cc/2019-30/en_middle_0059.json.gz/line330
|
__label__cc
| 0.519498
| 0.480502
|
Bozoky, Rudolf (Rudy) (1933–2007)
by Attila Urmenyhazi
Rudolf Bozoky, n.d.
photo supplied by family
Rudolf Bozoky (Rezsõ Bozóky) was born in Siófok, an idyllic vacation town on the shores of the vast Lake Balaton surrounded by beautiful rural countryside. His father was a marine mechanical engineer serving in large River Danube ships plying between Vienna, Budapest and the Black Sea; a life with long absences from home. Rudy’s mother taught him and his three siblings how to cook and be self reliant, while his grandfather taught him carpentry and building skills.
World War II saw first the Nazis, then the Soviets, occupy and ravage Hungary. The young Bozoky became caught up in the ensuing terrible times with his family. He already had a talent for wheeling and dealing and survived by bartering goods and chattels. Those early experiences left a lifelong imprint in his mind.
After the war he attended Budapest Technical University’s faculty of architecture. The eruption of the Hungarian Revolution in 1956 prevented his class sitting for their graduation final examinations, yet he considered himself fortunate to be able to flee Hungary after the revolution failed and communism was re-established under Soviet occupation. In the dead of night he crossed the barbed wire, electrified and well guarded border to become a refugee in Austria under United Nations protection. He opted for migration to Australia.
Bozoky quickly found his way in the building industry. Working first as a fit-out carpenter foreman with Hungarian cottage builders in the Western suburbs of Sydney whilst learning English, he moved on to become a contract builder-partner and large scale home unit builder. By 1967 he was a well known large-scale developer/builder working mostly in the inner Sydney suburbs of Newtown, Leichhardt, Annandale and Rosebay. He typically worked on at least four large ongoing projects at any given time and drew all his own architectural plans. His lack of recognised qualification, though, meant the drawings had to be checked by qualified architects. He also supervised the work of all of his contractors, including structural engineers, with daily visits to construction sites. The outcome of his endeavours met the demand of thousands of working couples for modern, compact, affordable apartments close to the heart of Sydney.
In mid 1976 Bozoky's investments crashed due to an unexpected mammoth escalation of interest rates on his interconnected and mortgaged borrowings on speculative land purchases. He was declared bankrupt and moved to New Zealand where he was soon involved again in building projects with developers providing the same modern, quality, compact apartment accommodation for thousands in Wellington.
He later moved to Western Australia to pursue new opportunities as a consulting engineer in pipe laying & earthworks projects with the North West Shelf Gas Company. He then moved to Perth to rejoin his family and start afresh on his own building projects, albeit in a much diminutive scale as a semi-retired person. Three times married, Rudolf, the affable man with a keen sense of humour and zest for life, passed away in August 2007.
unpublished, 2010
Related Thematic Essay
Attila Urmenyhazi, Hungarian Immigration in Australia
Attila Urmenyhazi, 'Bozoky, Rudolf (Rudy) (1933–2007)', Obituaries Australia, National Centre of Biography, Australian National University, http://oa.anu.edu.au/obituary/bozoky-rudolf-rudy-14140/text25151, accessed 17 July 2019.
Bozóky, Rezsõ
Siófok, Somogy, Hungary
North West Shelf Gas Company
|
cc/2019-30/en_middle_0059.json.gz/line331
|
__label__wiki
| 0.859976
| 0.859976
|
Announcements and O...
[Sticky] Character creation
Page 2 / 4 Prev 1 2 3 4 Next
irobotik
(@irobotik)
Matilda Jennoy:
https://docs.google.com/spreadsheets/d/1E-sfFtO5ozw9XXfnPYC5cjrei0vGHEXKRmVinB1FMdQ/edit?usp=sharing
Matilda Jennoy MP
Parliamentary: 6,
Media: 13,
Floating: 2
https://docs.google.com/spreadsheets/d/1RfORE9iAD_oVwq1w9wGEjWDs755Q2WUSnfr7bE6k6l4/edit?usp=sharing
(@burnie)
Hopefully I've done this right
https://docs.google.com/spreadsheets/d/16Mg7Q8_wgTTUlUfG61XurvM2Y5rdMkMZ_wQd_d7abLo/edit?usp=sharing
Joseph Allen
(@joseph-allen)
Joseph Allen https://docs.google.com/spreadsheets/d/1BGzd6YCjNN92YE_y5jhZRmr9sb_5VbIlJrhpT6_o3YA/edit#gid=0
Member of Parliament for Blaenau Gwent
Parliamentary: (5)
Media: (15)
Policy: (9)
Ralph Chester
(@ralph-chester)
https://docs.google.com/spreadsheets/d/1Yxbf7GgEoQmw3M1vV96XNyAtz6oczHoGvAlA_ETErig/edit?usp=sharing
Character avatar changed to Olivier Besancenot
Grant Kingston
(@grant-kingston)
Grant Kingston - https://docs.google.com/spreadsheets/d/1W8_ZHXqLKFxwTzr2esTQMeocwPYkifmBvlGkijgyPjM/edit?usp=sharing
Kingston was born into a middle class family. His family owned an entertainment business (originally a record store that grew into an HMV style entertainment store). Kingston went to university at Queen's in Belfast, part of the prestigious Russell Group, obtaining a First in Politics, Philosophy, and Economics. He then went straight into a career in politics as a political adviser to a Ulster Unionist Party MP, then moving back to England to be an adviser to a Conservative MP. He then was successful in getting elected to the first North Somerset Council, as a Conservative Candidate in 1996. In 2005, Kingston was chosen to stand as the Conservative Candidate for Weston-super-Mare, which he unseated the incumbent Lib Dem MP, Brian Cotter.
Grant Kingston MP
MP For Weston-super-Mare (2005-Present)
Former Councillor on the North Somerset Council (1996-2005)
Martin Fortescue
(@martin-fortescue)
https://docs.google.com/spreadsheets/d/1roSVHeG2CEQLI6ZZCMYzb3567rK6BD2wRlbaTotOoBc/edit?usp=sharing
Hon. Dr. Martin Fortescue, MP
MP for Haltemprice and Howden
Shadow SoS for Culture, Media, and Technology
Med: 18
Pol: 9
H. Talbot-Carlisle
(@h-talbot-carlisle)
The Rt. Hon. Horatio Talbot-Carlisle, 1st Earl of Chalfont, was expelled from the House of Lords in 1999, after the Lords Reform Act, and ran in his local constituency in the 2001 general election, winning by a large margin. He is a self described Thatcherite tory.
https://docs.google.com/spreadsheets/d/1FN7QEM6B7LMxeTRBu9UWtmcuCCGKEMLrmj-UuM8EIMg/edit#gid=0
Chalfont St. Giles
(@dan)
Mr Carlisle
Welcome to the game.
Please join us on discord and can you also please open up access to your google document as I can't read it
Reginald_Brighton
(@reginald_brighton)
Reginald Brighton
https://docs.google.com/spreadsheets/d/1K8PRkoyKlXo11Gh5m5qSK-SqspbhT1bQi5Te1uBBFdA/edit?usp=sharing
Note: I left the scandal level at 1 on the google survey, it is correct here
approved, welcome
Emmanuel Runswick-Jones
(@ashcroft)
The Hon. Emmanuel Runswick-Jones, MP
https://docs.google.com/spreadsheets/d/1GFRZmqkVpwyv6-wFdC0UzFaXwWJzs4rifU9qKOTDQx8/edit?usp=sharing
Date of Birth: 17 April 1962
Place of Birth: Pembrokeshire, Wales
Family Info:
Spouse: Catherine Mortimer (m. 1989)
Percival (b. 1993)
Imogen (b. 1995)
Educational Info:
Trinity College, Cambridge (M.A., M.Phil)
New College, Oxford (B.A.)
Occupational History:
Member of Parliament for Camarthen West and South Pembrokeshire (2010-present)
Barrister, Middle Temple (1991-2010)
Emmanuel Runswick-Jones was born in 1967 in Pembrokeshire, the son of Sir Christopher Runswick-Jones, an aristocrat, art historian, and art collector. His grandfather Percival was a Liberal member of Parliament and junior minister in the National Government of Stanley Baldwin in the 1930s. Emmanuel attended the Harrow School before being admitted to read Literae Humaniores at New College, Oxford. While at university, he was an active member of the Oxford Union, being elected to the Standing Committee for Michaelmas 1981, and Treasurer for Trinity 1982. Runswick-Jones was also involved in student politics, and was elected President of the Oxford University Conservative Association for Hilary 1983. He graduated in 1983 with a first-class degree.
After graduating Oxford, Runswick-Jones set his sights on a legal career and accepted an offer to read for a second B.A. in law (later promoted to an M.A.) at Trinity College, Cambridge. He completed the Tripos with first-class honours and continued at Trinity to write a dissertation on maritime law, for which he was awarded an M.Phil. He earned qualifications as a barrister and joined Middle Temple in 1991.
Following the 2005 General Election, Runswick-Jones became increasingly involved in Conservative Party activism. He was particularly offended by what he viewed as 'constitutional vandalism' on the part of the Blair government, regarding their policies on House of Lords reform and changes to the judiciary. In 2010, he was selected to stand as the Conservative candidate for Camarthen West and South Pembrokeshire, defeating the incumbent Labour MP Nick Ainger.
The Hon. Emmanuel Runswick-Jones
Thomas Steels
(@thomas-steels)
Joined: 1 month ago
https://docs.google.com/spreadsheets/d/1FOAlfO-GL6cBk3F3-rbPrOIYGi-z3ZNmzX42IQEWNPM/edit#gid=0
|
cc/2019-30/en_middle_0059.json.gz/line337
|
__label__wiki
| 0.929481
| 0.929481
|
The Church & The Psychedelic Furs North American Tour
The Church & The Psychedelic Furs
The Church will be coming to North America for a 27-date tour beginning on August 7th in Toronto, ON and wrapping in Los Angeles, CA at The Roxy on September 10 th. The band will co-headline with The Psychedelic Furs for 20 dates, along with seven headline shows on their own.
The Church are touring in support of their 25th studio album: Further/Deeper, which was released in North America this past February to rave reviews. The band completed their first North American tour in the states in four years this past spring, with key performances at SXSW and the Noise Pop Festival.
A brand new video for “Laurel Canyon” from Further/Deeper can be viewed here:
https://www.youtube.com/watch?v=lhlOolvKbyo&feature=youtu.be
You can also view the band's recent stunning performance from this year's Primavera Sound in Barcelona here:
http://concert.arte.tv/fr/church-au-primavera-sound
Tickets for all shows are on sale now. For up to date information visit: http://thechurchband.net
The Church 2015 – North American Tour Dates
9/2/2015 Portland, OR Crystal Ballroom*
9/3/2015 Seattle, WA Showbox at The Market*
9/5/2015 Petaluma, CA Mystic Theater
9/6/2015 Saratoga, CA Mountain Winery*
9/8/2015 Las Vegas, NV Brooklyn Bowl*
9/9/2015 San Diego, CA North Park Theater*
9/10/2015 Los Angeles, CA The Roxy
* - With The Psychedelic Furs
I Need A Dodge: Joe Strummer On The Run
Coming to the US on October 16th
"Poignant doc... A snapshot of a man - not a rock star -
looking for catharsis in the most unlikely of places." - NME
Produced and Directed by Nick Hall, this is the story of Joe Strummer's self-imposed exile in Granada in 1985/6. It will be released on DVD by MVD on October 16th and comes packaged with a cassette of a Spanish radio interview with Strummer, a postcard, sticker, and pin.
"This is Joe Strummer at a crossroads in his professional and personal life. Initially his trips to Spain seemed to be little more than an anecdote but this story says so much about Joe coming to terms with life after The Clash," said Hall.
Johnny Green, The Clash's legendary road manager said of the film, "I glowed - I felt uplifted. Once again, it was as if I had spent a little time with my dear lost friend, Joe Strummer. I was hooked all through - the story is compulsive. More to the point, you have perfectly captured the brooding melancholia, that shy underside, which was a compelling component of Ol' Joe. I Need A Dodge is fabulous." The film also received a special mention at the In-Edit Festival in Barcelona.
Heading to Spain in 1985 to flee the disaster that was the implosion of The Clash version two, the band formed in the wake of Strummer firing Mick Jones and aftre Topper Headon left the band. The new line-up's Cut The Crap album had largely been shunned by both critics and the public alike andStrummer needed space. Telling a Diario De Granada interviewer that he had come "to feel the pain of the wound," upon arrival in Granada, Strummer found himself firmly subsumed into the city's musical and cultural fabric. He was welcomed with open arms by local acts 091 and bigger-fish Radio Fortuna, who all met up at the Silbar.
"When we met Joe it was like a miraculous apparition," said Jose Ignacio Lapido, 091's guitarist. It was Radio Fortuna who facilitated the purchase of a set of wheels for Strummer. Tracking down a Barreiros, essentially a European edition of the Dodge-Dart, became a mission. As Santiago Auseron, the Radio Fortuna singer said, "It looked cool, it just looked a bit mad. Which at that time suited Joe very well."
Strummer was delighted with the huge car which he thrashed around the streets of Granada and Madrid. However, having parked the car in the capital when he flew back to the UK for the birth of his daughter Lola, he forgot where it was and never saw it again. I Need A Dodge! Joe Strummer On The Run is partly the story of the search for the car, and partly the story of Strummer's own search for meaning and redemption in those wilderness years.
Strummer launched an unsuccessful attempt to find the car, making an appeal for information on Spain's Radio 3 in 1997. With witnesses disagreeing on the colour and style of the car - agreeing only that it was registered in Oviendo - and some claiming never to have seen it, filmmaker Nick Hall's quest seems unlikely to succeed, yet his investigation does unearth the truth about this period of Strummer's life that has largely been ignored.
Installing himself in the producer's chair for the recording of 091's album, Strummer's micro-management led, rather than to the boost these star-struck musicians were hoping for, to a growing sense of disquiet and wasted studio time. The album eventually surfaced, having finished off to the record label's specification rather than the band's, and was disappointing.
The Dodge is an emblem for Strummer's time in Spain, his ambition, personal style and, in a way, the nature of those troubled days in general. When he is pulled over by the police, it is revealed that he doesn't even have a license to drive. Drawing on the recollections of his friends in London and in Spain, his partner Gaby Holford, and the members of 091 and Radio Fortuna, this a revealing story of a search for much more than just a car.
"It was an escape. He was a man on the run. He was getting away from the tension in London," saysSantiago Auseron.
Joe Strummer did, indeed, need a Dodge.
The DVD package can be pre-ordered directly through MVD here, or on Amazon here.
Labels: announcements, film, listen, movie, music, tour, video, watch
The Pandoras 25th Anniversary Reunion Shows - NYC & NJ
THE PANDORAS
25th ANNIVERSARY REUNION SHOWS
TWO DATES IN NEW YORK AND NEW JERSEY
Saturday, September 12th - Marlin Room at Webster Hall - with the Connection
125 E 11th St, New York, New York 10003 - doors @ 7:30pm
Sunday, September 13th - Monty Hall, Jersey City - with Palmyra Delran
43 Montgomery St, Jersey City, New Jersey 07302 - doors @ 7:30pm
Don't miss Los Angeles based, rock & roll band, The Pandoras' , two night reunionshows in New York City and New Jersey on September 12th and 13th . The all-female band, who is currently on a thirteen city European tour , will end their run with these two US shows. The reunion is to commemorate The Pandora's lead songwriter Paula Pierce , who passed away on August 10, 1991, having suffered a fatal aneurysm at the age of 31. Now twenty five years later the original members of The Pandoras, with Kim Shattuck (of the Muffs) takingover lead vocals and guitar,will celebrate the life and music of Pierce. The rock outfit, whose reign lasted 1983 - 1990, is still revered today as a major inspiration to female musicians.
The September 12th, New York City show will be supported by New England's newest hit-makers The Connection, who have just released a brand new album, Labor of Love, via Rum Bar Records King Yum Inc. The September 13th, New Jersey show will feature rock savvy guitar chick and co-founder of The Friggs, Palmyra Delran. In addition toDelran's musical talents, she currently hosts her own radio show "Palmyra's Trash-Pop Shindig" in Little Steven's Underground Garage on Sunday mornings (8am-noon EST) with a repeat show on Monday morning (4am-8am EST) on SiriusXM radio.
The Pandoras:
Kim Shattuck: Vocals,Guitar
Melanie Vammen: Vox Organ,Harmonica,Vocals
Karen Blankfeld: Bass,Vocals
Hillary Burton: Drums,Vocals
Palmyra Delran:
Palmyra Delran: Vocals, Guitar
Michael Lynch: Bass, Vocals
Richard DevGreene: Guitar, Vocals
Mark Brotter: Drums
The Connection:
Brad Marino: Vocals, Guitar
Geoff Palmer: Vocals, Guitar
Kris Rodgers: Keyboards
Rick Orcutt: Drums
Bobby Davis: Bass
Sharkmuffin Gets Psychedelic in New "Chartreuse" Video
Sharkmuffin Reveal New Video for “Chartreuse” via Death + Taxes
“On their debut LP Chartreuse, Brooklyn power-punk band Sharkmuffin show that they have mastered the craft of heavy, unapologetic, sharp-pop songs.” – Impose
“It’d leave you breathless if you weren’t humming along.” - NPR
“Brash and unapologetic…this is a vicious band with plenty of teeth.” –Consequence of Sound
Brooklyn’s Sharkmuffin venture into the realm of psychedelia on their newest video for “Chartreuse,” which premiered on Death + Taxes. The summer-inspired music video involving mini-golf, sunbathing, and drink spiking was directed by Darkwing’s Rich Gold, and it’s in support of the group’s titular track off Chartreuse, their debut LP released earlier this month on State Capitol Records.
When asked to comment on the video, Sharkmuffin said, “If you mess with Sharkmuffin, we'll drug you and make you play in our band.” Free drugs and membership into an established band like Sharkmuffin sounds more like a Kickstarter perk than a threat.
If you’re in the New York area, make sure to welcome the duo home from their extensive tour on September 1st @ Brooklyn Bowl.
Labels: announcements, listen, music, sharkmuffin, tour, video, watch
The Black Ryder @ The Roxy
Labels: alexander, listen, music, photo, tour, video, watch
Erykah Badu @ Hollywood Bowl
Erykah Badu w/ St. Vincent @HollywoodBowl, tonight, Sunday August 30th 2015.
All photos taken in Seattle by Rachel Robinson.
Labels: announcements, listen, music, photo, rachel, tour, video, watch
Happy Birthday Anton Newcombe
THE BLACK RYDER are playing at the ROXY tonight, Friday August 29th 2015.
All Vancouver photos by Bev Davies.
Beach House 'Depression Cherry' Out Now
Beach House’s Depression Cherry:
Out today in North America on Sub Pop
Depression Cherry YouTube stream
https://www.youtube.com/watch?v=Cy5MiOqarYs
Depression Cherry also available via Bella Union (Europe) & Mistletone (Australia / New Zealand).
Beach House’s Depression Cherry is now available on CD / LP/ DL from Sub Pop (North America), Bella Union (Europe) and Mistletone (Australia / New Zealand). The album was produced and recorded over the span of two months by the band and Chris Coady at Studio in the Country in Bogalusa, Louisiana.
The Beach House worldwide tour in support of Depression Cherryresumes Saturday, August 29th in Baltimore, MD with a performance at the sold-out Windjammer Festival at Pier Six Pavilion and end their 2015 dates with a sold-out 3-night stand December 17-19 in San Francisco at The Fillmore. Please find a complete list of dates below.
LP and CD versions of Depression Cherry are packaged in a sumptuous red velvet sleeve. All customers who purchase the LP version of Depression Cherry from megamart.subpop.com will receive the special, limited, clear vinyl Loser Edition (while supplies last). Additionally, there is a new T-shirt design, available individually or as part of a bundle with purchase of the new record.Depression Cherry is also available from iTunes and Amazon.
What people are saying about Beach House’s Depression Cherry:
"Reliable, virtually misstep-proof conjurers of a distinct and desirable mood….Beach House works with a simple set of ingredients — a few vintage keyboards, programmed drums, an electric guitar and the drowsily alluring voice of Victoria Legrand — to evoke a specific tone that rarely varies. And yet Depression Cherry, the Baltimore duo's fifth album in the last decade, still feels vibrant and versatile. There's sticking to a formula that works, and then there's teasing out its subtleties in surprising, consistently rewarding ways.” [First Listen] - NPR Music
“It’s another impeccably measured step forward. Their albums might be an ideal soundtrack for daydreaming, but Scally and Legrand seem remarkably clear-headed about their work.” [Best New Music] - Pitchfork
“Weeping spirals of guitar, the futility of life looped in eerie, wordless harmonies, organs, and ‘shooting star slide guitars’ blasting like lightning bolts, beckoned and sent away by Legrand’s androgynous, languid voice. Maybe Legrand writes the lyrics, but Scally senses them, he translates them into softly cooing organ lines, demanding siren burst of guitar, the loss lingering everywhere in soft white noise. All that sorcery is here, again, in full force.” - Stereogum
“For its fifth album, Depression Cherry, the pair decided to de-emphasize percussion, and the pillowy, haunting result is ideal for the encroaching autumn days.” - TIME
“The band’s understanding of their own head-in-the-clouds aesthetic and knowing where to sew in (or cut out) the stitches to keep their sound in a constant, albeit low-key, flux results in much more of a mesmerizing experience than would changing directions entirely.” [A -] AV Club
“Anyone who doesn't fall for Depression Cherry's hypnotic splendour probably just isn't a Beach House fan, or didn't live with the album long enough. But those who do will recognize this album as the sweeping, grand gesture they've been working up to giving us for the last nine years.” [9/10] - EXCLAIM!
“Beach House’s music isn’t as severe as Beckett, but it does share a similar purity, an ambition to strip art down to the privacy and insularity of a snow globe. Their most obvious ancestors are shy-minded indie bands from the 1980s and ’90s who buried themselves in sound: Cocteau Twins, My Bloody Valentine. But there’s also something Andrew Lloyd Webber about their twinkle and swirl, the naive theatricality of dress-up and pretend. Their deepest root is in old doo-wop ballads, sweet and angelic but steaming underneath, the heat of two teenagers separated by a ruler at a bygone prom. If some bands capture the freedom and joy of youth, Beach House captures its erotic incoherence — the sense of having no clear idea how you feel but feeling it so deeply you might pass out.” Grantland
“Instead of relying mainly on guitars, their songs are built on a foundation of shimmering, droning electric organ. And, where many dream-pop vocalists are angelic, Legrand’s voice is deep, forceful, and oracular.” - The New Yorker
“Guitarist Alex Scally's extravagant melodies bloom slowly over grooves that pulse like waves; singer Victoria Legrand's vocals echo Fleetwood Mac's lush folk rock, Cocteau Twins' surreal dreams and Nico's spooky drama. The Baltimore duo's fifth album sticks to that signature sound, and go figure: A formula that might seem limiting feels instead like it can contain entire worlds.” - Rolling Stone
“On their latest, they go grandiose with weighty tunes that explore love and melancholy. Singer Victoria Legrand has a refreshingly unshowy croon that’s one of the most seductive in pop, and her gorgeous synth drones and guitarist Alex Scally’s effects-laden riffs are exquisite.” [ A-] - Entertainment Weekly
Aug. 29 - Baltimore, MD - Windjammer @ Pier Six Pavilion # [Sold Out]
Sep. 17 - Columbus, OH - Newport Music Hall **
Sep. 18 - Cincinnati, OH - Bogart’s **
Sep. 19 - Royal Oak, MI - Royal Oak Theatre **
Sep. 21 - Milwaukee, WI - Pabst Theatre **
Sep. 22 - Minneapolis, MN - First Avenue [Sold Out] **
Sep. 23 - Minneapolis, MN - First Avenue **
Sep. 25 - Omaha, NE - Slowdown **
Sep. 26 - Lawrence, KS - Liberty Hall **
Sep. 27 - St. Louis, MO - The Pageant **
Sep. 28 - Memphis, TN - Minglewood Hall **
Sep. 29 - Tulsa, OK - Cain’s Ballroom **
Oct. 01 - Houston, TX - House of Blues
Oct. 02 - New Orleans, LA - Civic Theatre
Oct. 03 - Birmingham, AL - Saturn **
Oct. 04 - Nashville, TN - The Ryman Auditorium **
Oct. 06 - Atlanta, GA - Buckhead Theatre **
Oct. 07 - Asheville, NC - Orange Peel **
Oct. 08 - Saxapahaw, NC - Haw River Ballroom [Sold Out] **
Oct. 24 - Belfast, UK - Mandela Hall
Oct. 25 - Dublin, IE - Vicar Street
Oct. 26 - Glasgow, UK - ABC
Oct. 27 - Manchester, UK - The Ritz
Oct. 29 - Paris, FR - Pitchfork Music Festival
Oct. 30 - London, UK - Shepherds Bush Empire
Nov. 02 - Amsterdam, NL - Paradiso
Nov. 03 - Brussels, BE - Autumn Falls @ AB
Nov. 04 - Koln, DE - Gloria
Nov. 05 - Luxemborg, LU - Den Atelier
Nov. 07 - Reykjavik, IS - Iceland Airwaves
Nov. 10 - Oslo, NO - Sentrum Scene
Nov. 11 - Gothenburg, SE - Tradgarn
Nov. 12 - Stockholm, SE - Debaser Medis
Nov. 13 - Copenhagen DK - Vega
Nov. 14 - Hamburg, DE - Kampnagel K1
Nov. 16 - Berlin, DE - Huxley’s
Nov. 17 - Munich, DE - Freiheiz
Nov. 18 - Lausanne, CH - Les Docks
Nov. 20 - Barcelona, ES - Apolo
Nov. 22 - Madrid, ES - La Riviera
Nov. 23 - Lisbon, PT - Armazén
Nov. 24 - Porto, PT - Teatro sa da Bandeira
Dec. 09 - Los Angeles, CA - The Fonda Theatre [Sold Out]
Dec. 17 - San Francisco, CA - The Fillmore [Sold Out]
** w/ Jessica Pratt
# w/ Future Islands, Dan Deacon, Ed Schrader’s Music Beat & more
For ticket info please visit
http://www.beachhousebaltimore.com/tour.
Speedy Ortiz shares Cardigans cover + On tour now
SPEEDY ORTIZ SHARES CARDIGANS COVER "HANGING AROUND"
VIA THE BOSTON GLOBE
PLAYING HOMETOWN BOSTON SHOW ON A BOAT AUGUST 30TH
FOIL DEER OUT NOW VIA CARPARK RECORDS
Credit: Shervin Lainez
STREAM: "Hanging Around" -
https://soundcloud.com/speedyortiz/hanging-around-cardigans-cover
Today, Speedy Ortiz premieres an all new cover of the Cardigans' "Hanging Around" via The Boston Globe in anticipation for their upcoming Boston show on August 30th. The band is excited to be back in their hometown to perform on a boat out of Boston Harbor as part of the Rock and Blues Concert Cruise series. The ship will set sail at 1:00 p.m. for about a three hour cruise that also features Downtown Boys. Tickets to the show are available here.
Speaking about the cover, guitarist and lead singer Sadie Dupuis shares, "In December, Speedy played a hometown residency at our beloved hangout spot Great Scott. We tried not to repeat any songs over the course of three shows--four, actually, if you include the one we played in a basement under a fake name. That meant playing at least 40 (!) original songs for our Boston pals, plus a few covers, one of which was this album track from The Cardigans' 1998 release 'Gran Turismo.' The Cardigans make really smart pop music dosed with contradictory textural choices--crunchy guitars, moody electronics, seemingly intentional tape warping. Their hits are pretty well known, and are all great, but I love "Hanging Around" for its detached, spooky lyrics. This song could be about cognitive dissonance, or it could be about some invading body snatchers--maybe both? We stayed pretty true to the original on this one, 'cuz we think the original is so good. Instruments recorded at Studio 52 by Jesse Weiss of Palehound and Grass is Green, with vocals recorded in Jesse's bedroom while staring at his Chavez poster for inspiration."
Check out Speedy Ortiz' rendition of "Hanging Around" above. You can also find the new horror/Hausu-inspired video for "Raising The Skate" along with what the press has been saying aboutFoil Deer below and grab a copy of the album via iTunes here .
WATCH: "Raising The Skate" -
https://www.youtube.com/watch?v=NdKZDWldEy8
What The Press Is Saying About Foil Deer:
"Dupuis' diction is, per usual, razor-blade sharp"
"one of the sharper indie rock bands in recent memory"
" One of rock's most compelling young voices...With Foil Deer, [Speedy Ortiz] takes another giant leap"
"off-kilter, hypercatchy pop-rock"
"effortlessly cool"
SPIN MAGAZINE
About Speedy Ortiz:
Speedy Ortiz said they would get the flowers themselves. What a lark! What a plunge!
When considering Massachusetts' Speedy Ortiz, that line from Virginia Woolf comes to mind. Not only for the obvious echoes to DIY, a form and function that's characterized the band's nascency, but in the proto-feminist undertones driving much of their sophomore album, Foil Deer. "I'm not bossy, I'm the boss," Sadie Dupuis sings on "Raising the Skate," invoking in spirit one half of the Carter-Knowles clan and echoing the other's wordplay. And wordplay makes sense, considering Dupuis-the band's songwriter, guitarist, and frontwoman-spent the band's first few years teaching writing at UMass Amherst. She's drawn to the dense complexity of Pynchon, the dreamlike geometry of Bolaño, the confounded yearning of Plath-all attributes you could easily apply to the band's 2013 debut Major Arcana, which fans and press alike have invested with a sense of purpose and merit uncommon in contemporary guitar rock.
The group, including Mike Falcone on drums, Darl Ferm on bass, and new addition Devin McKnight of Grass is Green on guitar, have spent the last year on an almost endless cross-continental touring jag, tagging along with the likes of T he Breeders, Stephen Malkmus & the Jicks , and Thurston Moore.That shift into full-time musicianship brought with it an attendant reordering of priorities when it came to songwriting, and the band members' lives in general. They would get the damn flowers themselves.
Dupuis wrote much of Foil Deer at her mother's home in the Connecticut woods, where the songwriter imposed a self-regulated exile and physical cleansing of sorts, finding that many of the songs came to her while running or swimming alone. "I gave up wasting mental energy on people who didn't have my back," she says. "Listening to our old records, I get the sense I was putting myself in horrible situations just to write sad songs. This music isn't coming from a dark place, and without slipping into self-empowerment jargon, it feels stronger." Many of the songs deal with a similar sense of starting over, editing out the unnecessary drama. "Boys be sensitive and girls be, be aggressive," she sings on "Mister Difficult."
And while their debut album was recorded on the fly, Speedy Ortiz spent almost a month in the studio on Foil Deer. Falcone's drums are taut, mechanistic; Ferm's bass ranges from the aggressive rattle of an AmRep classic to smoother, hip-hop inspired lines. McKnight, meanwhile, lends spacier, textural riffs to complement Dupuis' wiry, melody-driven guitar style. "The demos for our songs have always had tons of small details and production experimentation, but we never had any money to pay for more than a couple days in the studio, so the songs came out very live-sounding and guitar heavy," Dupuis says. It was recorded and mixed at Brooklyn's Rare Book Room with Nicolas Vernhes (Silver Jews, Enon, Deerhunter), with the record mastered by Emily Lazar (Sia, Haim, Beauty Pill), lending a more polished sound and a pop sensibility that will stand out to existing fans and new converts alike. For all the lyrical complexity and guitar-based excursions Speedy Ortiz have built their reputation on to this point, Foil Deer has a sense of light-footed fun. What's the point of doing things yourself if you're not going to enjoy the trip?
Pee-wee Herman premieres Tijuana Panthers claymation video + album out now
TIJUANA PANTHERS SHARES NEW VIDEO VIA PEE-WEE HERMAN'S LOG
LOS ANGELES ALBUM RELEASE SHOW
POSTER OUT NOW VIA INNOVATIVE LEISURE
photo courtesy of Innovative Leisure
Today the Tijuana Panthers release their fourth album, POSTER, via Los Angeles-based label Innovative Leisure. To celebrate the release, the Long Beach trio is also sharing a new music video for their single "Set Forth".
The video was made by a talented Tijuana Panthers fan named Anny Yi of "He Ho Let's Doh". The band, dressed as their alter-egos, go trailing through a forest, meeting various eclectic friends along the way. An original concept by Tijuana Panthers, "Set Forth" is a stop-motion animation video with sets and characters made out of play-doh. Other materials used are craft shrubbery and grass, and acrylic paintings as backgrounds. It took Anny a month and a half to handcraft the sets and characters, then shoot the video and edit it. The nature of the video fits perfectly with the bands nostalgic and introspective fourth album.
The band on the video and their inspiration behind it:
"We grew up on Saturdays in the 1980's with our babysitter H.R. Pufnstuf and our good pal Gumby once fell through the tube during the Land of the Lost theme song, but he made it out alright in the end. The Blockheads who followed, though, weren't so lucky. A girl named Penny would visit us in the playhouse...Chad would sit on Chairy, Daniel would wrestle with Randy & I would listen to Cowboy Curtis go on and on about Miss Yvonne. We were homeschooled by Mr. Herman on how to view the world around us and more importantly, how to interact with it. Pee-wee told us to "Set Forth," so we did and into the woods we ran...found our own paths, with our own friendly creatures, and together we keep bopping along down that crazy surrealist bucket. So take a look, take a listen..."
The band will be playing an album release show at The Regent in Los Angeles on September 4th. For the show the Panthers will be joined by fellow SoCal-based acts The Garden and Adult Books.
POSTER arrives right on time, to reflect on this summer and summers past. You can now purchase the album on vinyl, CD, and all digital formats via Innovative Leisure. Check out the video for "Set Forth" and full album details below.
WATCH: "Set Forth" -
https://www.youtube.com/watch?v=SD4hXhnHPuw
Album Release Show -
9/4 - The Regent - Los Angeles, CA
w/ The Garden & Adult Books
"Front Window Down"
https://youtu.be/cUKA--hrIsY
The Weeknd Unleashes 'Beauty Behind The Madness'
THE WEEKND UNLEASHES BEAUTY BEHIND THE MADNESS
#1 ALBUM WORLDWIDE
FOUR TRACKS PLATINUM PRIOR TO ALBUM RELEASE
TICKETS ON SALE FOR “THE MADNESS TOUR” NOW
NEW YORK (August 28, 2015) – Grammy Award®-nominated, multi-platinum selling artist and alternative R&B trend-setter THE WEEKND has released his anxiously awaited third full-length album, Beauty Behind The Madness [ XO/ Republic Records] in stores and through all digital retailers. In an unprecedented fete, THE WEEKND had four of the tracks from the album reach platinum or multi-platinum status prior to release. “Earned It (Fifty Shades of Grey)” has been certified 4x platinum, “Can’t Feel My Face” and “The Hills” are currently 2x platinum and“Often” is platinum, all as recognized by the RIAA. In another fete prior to release, Beauty Behind The Madness moved in excess of 1 Million album equivalents worldwide prior to release date.
Purchase Beauty Behind The Madness HERE
THE WEEKND tapped a dream team of producers for Beauty Behind The Madness includingStephan Moccio, with whom he collaborated on the quadruple-platinum “Earned It (Fifty Shades of Grey), ” Max Martin, Kanye West, and more. The tracklist also boasts feature appearances from Ed Sheeran, Lana Del Rey and Labrinth.
2015 has been a breakout year for THE WEEKND with three tracks also currently sitting in the Top half of the Billboard Hot 100, two of which sit in the Top 5. He is just the third artist to have two songs in the Top 10 of the Hot 100 simultaneously in 2015, and the first male. THE WEEKNDrecently achieved a Billboard first when he claimed the top three slots on the Billboard Hot R&B Songs as “Can’t Feel My Face”, “The Hills” and “Earned It” hit #1, #2 and #3 respectively.“Can’t Feel My Face” also earned THE WEEKND his first Billboard Hot 100 #1, reaching the pinnacle after holding the #2 spot for three weeks.
Worldwide, Beauty Behind The Madness has landed at #1 in nearly 50 countries and sits in the Top 5 in over 70.
This fall, THE WEEKND will support the release of Beauty Behind The Madness with TheMadness Fall Tour. The entire 22-city itinerary can be found below.
Closing out a monumental release week, THE WEEKND is set to perform at the 2015 MTV Video Music Awards this Sunday August 30 at 9pm ET.
BEAUTY BEHIND THE MADNESS:
Losers featuring Labrinth
Can’t Feel My Face
Earned It (Fifty Shades of Grey)
As You Are
Dark Times featuring Ed Sheeran
Prisoner featuring Lana Del Rey
THE WEEKND - THE MADNESS FALL TOUR
*All dates, cities and venues below subject to change.
Tue, Nov. 03, 2015 Toronto, ON Air Canada Centre
Fri, Nov. 06, 2015 Chicago, IL United Center
Sat, Nov. 07, 2015 Detroit, MI Palace of Auburn Hills
Wed, Nov. 11, 2015 Newark, NJ Prudential Center
Thu, Nov. 12, 2015 Boston, MA DCU Center
Sat, Nov. 14, 2015 Uncasville, CT Mohegan Sun
Sun, Nov. 15, 2015 Washington, DC Verizon Center
Mon, Nov. 16, 2015 New York, NY Madison Square Garden
Wed, Nov. 18, 2015 Brooklyn, NY Barclays Center
Tue, Nov. 24, 2015 Montreal, QC Bell Centre
Fri, Nov. 27, 2015 Winnipeg, MB MTS Centre
Sun, Nov. 29, 2015 Calgary, AB Scotiabank Saddledome
Mon, Nov. 30, 2015 Edmonton, AB Rexall Place
Wed, Dec. 02, 2015 Vancouver, BC Rogers Arena
Sat, Dec. 05, 2015 Oakland, CA Oracle Arena
Tue, Dec. 08, 2015 Los Angeles, CA The Forum
Sun, Dec. 13, 2015 Houston, TX Toyota Center
Tue, Dec. 15, 2015 Atlanta, GA Philips Arena
Thu, Dec. 17, 2015 Tampa, FL Amalie Arena
Sat, Dec. 19, 2015 Miami, FL AmericanAirlines Arena
|
cc/2019-30/en_middle_0059.json.gz/line338
|
__label__wiki
| 0.590595
| 0.590595
|
Devonleigh
Décor Centre
Communities Map
Beeton
Devonleigh Difference
The Devonleigh Story
Community Involvement & Sponsorships
Homeowners Glossary
Decor Centre
Back To Communities
i Beeton
Communities in Beeton:
Explore Community
About Beeton
When families are looking for new homes for sale in Beeton, Ontario, they look to Parson's Glen by Devonleigh Homes.
Located west of Highway 400 between Highways 9 and 89, new homes in Beeton are great for commuters who work in the GTA and Barrie, but want the serenity and charm of small town living. Parson's Glen also offers homebuyers easy access to cottage country.
Beeton is a village in the Town of New Tecumseth, which includes Alliston and Tottenham. Devonleigh's new homes in Beeton, Ontario keep families close to places of worship, public schools, financial services, health and spa services, salons, family-run boutiques, grocers, and several restaurants.
Beeton new homes are popular because Beeton— and neighbouring Alliston— have the amenities families seek, such as the Beeton Community Memorial Arena, which includes a community hall and an indoor ice rink; plus parks and sports fields. The Town of New Tecumseth has more than 70 hectares of parkland and 7 kms of trails, great for hiking and jogging.
The residents of Beeton enjoy a variety of pursuits: skating, curling, soccer, slo-pitch, baseball, golfing at Ponderosa Golf and Country Club, and more; the New Tecumseth Library has programs for readers of all ages.
Concerts and live entertainment at the historic Muddy Water Hotel add to the attractiveness of new homes in Beeton.
Home of Canada's first commercial honey producer, Beeton is known for its Beeton Honey and Garden Festival. With its population of just under 4,000, Beeton new homes give families a sense of community. Events such as the Meet Your Neighbour Picnic, Community Festival and the Beeton Fall Fair can encourage that.
Devonleigh's new homes for sale in Beeton, Ontario are new craftsman-styled bungalows, bungalow-lofts and two-storey homes, backed by its commitment to true value.
Stay in touch with Devonleigh Homes. We’ll keep you up to date with what’s happening with us.
© 2019 Devonleigh Homes
|
cc/2019-30/en_middle_0059.json.gz/line345
|
__label__wiki
| 0.744006
| 0.744006
|
Son of Manjit Singh Upcoming Punjabi Movie (2018), Movie Cast, Review, Story and Release Date – Punjabi Movies Adda
Son of Manjit Singh Upcoming Punjabi Movie (2018), Movie Cast, Review, Story and Release Date
Today, we are going to tell you about the Movie Cast, story and release date of upcoming Punjabi movie 2018 ‘Son of Manjit Singh’
1 Son of Manjit Singh Punjabi Movie (2018), Movie Cast, Review, Story and Release Date
1.0.0.1 Son of Manjit Singh Movie Story
1.0.0.2 Director: Vikram Grover
1.0.0.3 Son of Manjit Singh Movie Cast
1.0.0.4 Son of Manjit Singh Movie Official Trailer
1.0.0.5 Son of Manjit Singh Movie Release Date
Son of Manjit Singh Punjabi Movie (2018), Movie Cast, Review, Story and Release Date
Son of Manjit Singh Movie Story
Son of Manjit Singh is an upcoming Punjabi movie 2018. It is directed by Vikram Grover and produced by K9 Films and Saga Hits. Starcast of the movie is Gurpreet Ghuggi, B.N. Sharma, Karamjit Anmol, Japji Khaira, Damanpreet Singh, Tania, Malkit Rauni and Harby Sangha. This movie will hit theatres on October 12, 2018.
Director: Vikram Grover
Vikram Grover is a Punjabi film director. He directed movies like Firangi, Lucky Di Unlucky Story, Bhaji in Problem, Double Di Trouble. Now, he brings an upcoming Punjabi movie Son of Manjit Singh.
Son of Manjit Singh Movie Cast
Gurpreet Ghuggi is an Indian film actor. He works in Hindi and Bollywood cinema. He did so many films like Jee Aayan Nu, Asa Nu Maan Watna Da, Pind Di Kudi, Nalaik, Jijaji, Yaaran Naal Baharan, Dil Apna Punjabi, Humko Deewana Kar Gye, Ek Jind Ek Jaan, Namastey London, Race, Mitti Wajaan Maardi, Singh is Kinng, Mera Pind, Chakk De Phatte, Ek: The Power of One, Tera Mera Ki Rista, Munde U.K. De, Joker, Carry On Jatta, Khiladi 786, Lucky Di Unlucky Story, Jatts in Golmaal, Heer and Hero, Fateh, Happy Go Lucky, Second Hand Husband, Ardaas, Lock and Singh of Festival.
B.N. Sharma is a Punjabi film actor. He did so many movies like Vaisakhi List, Carry On Jatta, Jatt & Juliet, Control Bhaji Control, Ardaas, Marriage Da Garriage, Singh vs Kaur, Munde Kamaal De, Pooja Kiven Hai, Disco Singh, Naughty Jatts, Judge Singh LLB, Jatts in Golmaal and Chakk De Phatte.
Karamjit Anmol is a Punjabi singer, actor and comedian. He did so many movies like Jinhe Mera Dil Luteya, Jatt & Juliet, Carry on Jatta, Sirphire, Jatt Airways, Best of Luck, Bhaji in Problem, Disco Singh, Double Di Trouble, Goreya Nu Daffa Karo, Jatt James Bond, Second Hand Husband, Ardaas, Vaisakhi List and Nikka Zaildaar.
Harby Sangha is a Punjabi film actor. He did so many movies like Daana Paani, Laavan Phere, Sat Sri Akal England, Nikka Zaildar 2, Sargi, Nikka Zaildar, Bambukat, Ardaas, Love Punjab, Dildariyaan, Proper Patola, Marriage Da Palace, Bhaji in Problem, Naughty Jatts, Pinky Moge Wali and Chak Jawana.
Japji Khaira is an Indian film actress. She works in Punjabi cinema. She did movies like Ishq Brandy, Bhaji in Problem, Fer Mamla Gadbad Gadbad, Singh vs Kaur, Taur Mittran Di, Dharti and Mitti Wajaan Maardi. Now, she will be seen in upcoming movie Nanak.
Kapil Sharma’s Production House Punjabi Film ‘Son of Manjit Singh’ First Look Will Be Releasing Soon
Malkeet Rauni is an Indian film actor. He works in Hindi and Punjabi cinema. He did so many movies such as Jag Jeondeyan De Mele, Kisaan, Lagda Ishq Ho Gaya, London Dreams, Siyasat, Mitti, Ik Kudi Punjab Di, Welcome to Punjab, Punjab 1984, Taanko Bhid Gayo, Ardaas, Zubaan, Bambukat, Main Teri Tu Mera, Sari, Yaar Anmulle 2, Rabb Da Radio, Asli Punjab, Rocky Mental, Laavaan Phere, Nikka Zaildar 2 and Dhol Ratti.
Son of Manjit Singh Movie Official Trailer
Son of Manjit Singh movie official trailer not released.
Son of Manjit Singh Movie Release Date
Son of Manjit Singh movie will be release on 12th October 2018.
Gippy Grewal brings 8 Movies by 2020 under Humble Motion Pictures
Titanic (2018), Movie Cast, Review, Story and Release Date
The list of Upcoming Punjabi Films in 2019 | Upcoming Punjabi Movies 2019
Sargun Mehta Will be Opposite Binnu Dhillon in Upcoming Punjabi Movie ‘Kala Shah Kala’
Dhol Ratti (2018), Movie Cast, Review, Story and Release Date
Mintu Gurusaria’s biopic ‘Dakuaan Da Munda’ will give new guidance to drug addicts in Punjab
|
cc/2019-30/en_middle_0059.json.gz/line346
|
__label__cc
| 0.624095
| 0.375905
|
March 28, 2014 March 28, 2014 Rachel Aseltine Excerpt, Roleplay
“No… no, no, no…” Junsu shook his head, holding tight to Hyo Won. He could hardly breathe past the clenching of his heart and the tightness in his chest. His breaths came up harsh and shuddering as he suffocated on the weight of his fear. Physically, he shook from the effort of trying to hold it all together but he was failing miserably and he knew it. It wasn’t fair. This wasn’t how it was supposed to turn out. Hyo Won was supposed to get better, he was supposed to leave that horrible affliction behind and start living and be happy and… and… not… die.
The hope was fading fast, too fast for Junsu to collect it and try to see things with his usual brand of optimism. Now he had to stare it in the face, the way Hyo Won changed, just the way that he said he would. Hyo Won knew it was going to happen and he warned Junsu. He warned him so many times but Junsu was so stubborn, so sure that he could change his fate simply by virtue of being there. Stupidly, he thought if Hyo Won loved him enough, it would keep him here, as if it could keep the darkness at bay, as if love eclipsed everything else.
“Hyo Won…” His voice was unsteady, cracking like his heart. Even though Hyo Won was holding him back, he could feel it, too, the way he had to fight to keep the claws from sinking in. He could feel the tension in his body. He could even feel the muscles spasms as Hyo Won fought for control over the darkness inside him. It was so hard to look at him like that, staring up at him, pleading with his entire body. For a couple crazy heartbeats, he wanted it to happen, for Hyo Won to rip into him and kill him on the spot, just to make the ache stop. But then where would that leave Hyo Won?
His lower lip trembled as he tried to speak again but he could speak. Nothing coherent passed his lips, just a harsh choking sob before he leaned in and squeezed his eyes shut. He kissed Hyo Won, shivering. He stroked the side of his face. And with his other hand, he reached out and grabbed the gun. Cold. Metal. He was warned, so he knew what he was getting into. He promised Hyo Won he could do it. He promised that it was worth it just to be with him. He promised him.
“…I love you… Hyo Won.”
He pulled the trigger.
trigger warning tw: death
Asexuality
Error, Error, Error
|
cc/2019-30/en_middle_0059.json.gz/line349
|
__label__wiki
| 0.801642
| 0.801642
|
Is Pop Music Really Good Music?
Pop music is music that’s really contemporary music. Today whatever music you hear, music that’s moving using the occasions, it is totally pop music. Fifty-five years before, the background music that was contemporary for the reason that era seemed to be pop and also the fathers of pop, Bob Dylan etc resided. But today’s music can also be known as pop, so pop can be a genre of recent music throughout any age, that is flexible enough to alter its form in one to a different but still maintain some integrity.
So that you can have rock, jazz, blues, R&B, dance figures and lots of other genres influencing that one particular genre of music. Often even aspects of folk and new bands has been discovered to trouble pop. The fundamental trick that pop music undertakes to keep its recognition is use tune that will remain in the minds of individuals. They don’t use appealing tunes but tunes and rhythm which can make you remember it. Also, the songs are barely filled with a lot of music, there’s one tempo which matches car song and does not change. But it is really an element that has attracted much critique round the song. Critics frequently state that pop is simply too easy and therefore maybe useless.
However, popular music is determined in what everyone loves generally and what they’ve full use of. It’s a social representation, a social type of its very own and it is not only another type of music. It’s a music that is supposed to be heard over and over. This occurs beside me always, whenever I pay attention to any pop song the very first time I do not that can compare with it since it appears to become too plain. But because I listen over and over it type of grows on me after which I’m hardly in a position to eliminate it. Now, pop is simply popular music so when it grows for you, you hardly consider every other music.
The very best factor about pop is that it’s a huge music business. The development and purchase of pop is definitely greater than every other type of music. The rhythm, the tranquility of, the beats, everything combine to create the special moment which we call pop. Mostly, best wishes selling songs are individuals from the pop genre and incredibly rarely does other genres reach the top top list.
As time passes however pop music has altered a great deal. Using the coming of the several recording devices which could now create various sounds pop has joined a brand new era. These recording devices and the opportunity to alter the tonal quality of voices has really set pop in addition to the many other types of musical genres like jazz etc.
MP3 is the Most Efficient Way to Play Music
Favorite Music Playing On A Satellite Radio
|
cc/2019-30/en_middle_0059.json.gz/line351
|
__label__cc
| 0.554148
| 0.445852
|
54 Pictures & Downloads
NOTE!. . . Any of the material you'll find here is free of copyrights.. . . NOTE!
However, according to our possibilities and facilities we do pay attention to any legal rules and regulations before publishing any pictures.
Short description Link
The best of the islands. Download this beautifull picture to customize your desktop.
French-Dutch historical map from the Philippines out of the 18th. century.
The relgious belief plays an important role in the life of (almost) any Filipino.
Lady of the Rosary
Every year this magnificent Lady of the Rosary is the attraction of the procession "La Naval de Manila".
The deep religiosity of the Filipinos is especially reflected by their strange means of transportation, that mostly are "overloaded" with any saint words. But these vehicles belong to the accessories of any city or town in the Philippines.
This somehow strange decorated vehicle that serves as well as a mean of transportation of persons as to transport any goods is called Jeepney. You find these cars anywhere in the streets of any Philippinian city.
The Cultural Center between Roxas Boulevard and Manila Bay offers a good overview of the Philippine culture by its events all over the year.
Philippine International Congress Center
This modern congress center in the heart of Manila offers more than 4,000 seats to the delegates of national and international meetings who discuss here the more or less "big problems of the world".
In Manila's Rizal Park opposit the Ministry of Tourism you can watch the illuminated globe through a veil of water.
Skyscraper at Makati, the financial center of Metro Manila.
Probably, the skyline of Metro Manila's commercial center, Makati, is not as overwhelming like the one of other capitals, but nevertheless it shows the activity of the Philippine commerce.
Green Makati
The financial center seems to be a comfortable place.
This map shows the old "Spanish Manila" at the mouth of the Pasig River into Manila Bay.
This Virgin helps to sort out disgrace. It is in front of the church wearing its name at Manila Bay on Plaza Malate.
Escolta around 1930
Before the 2. World war the Escolta had been one of the most famous shopping lane at Manila.
Steamer on the Pasig River
This postcard also is from the period around 1930. - In former times these steamers went up the Pasig River to the Laguna Lake. Rizal described one of these ships very well in his novel "El Filibusterismo".
Bamboo Organ
The world-famous Bamboo Organ of the church of Las Piñas near Manila is an attraction for any visitor.
A firm belief in God alrady starts in childhood.
The "rock" in Manila Bay had resisted the Japanese occupation 1942/43 for weeks before the Japanese were able to take prisoner of the last Philippine soldiers. Nowadays, the small island is a memorial to peace and a popular outing destination.
Gun of the Island of Corregidor
This gun still served during the 2nd. World War to defend the island against the Japanese occupation.
The waterfalls of Pagsanjan east of the Laguna Lake are a marvellous photographic scenery for tourists from all over the world. Inter alia, in this scenery the movie director Francis Ford oppola made the outdoor shots of his movie "Apocalypse Now".
The Laguna Lake is the biggest lake in the Philippines. It is even by far bigger than the the German/Austrian/Swiss "Bodensee".
Already the children have to help their parents to work for the daily bred, sorry "daily fish". Girl in a "banka" on the Laguna Lake.
Rice Terraces
The world-famous rice terraces in the Cordilleras of Central-Luzon near the town of Banaue are always worth to be visited.
Young Ifugo Woman
This young woman in front of the rice terraces is still wearing the traditional clothes of its poeple.
An old Ifugao "warrior" in front of the well known "Rice Terraces" in the centre of Luzon.
Rice Farmer
It is a hard job to work in the rice fields. All hands are needed to cultivate the plants of the Filipino's basic food.
Sharp tongues say a Filipino loves his fighting- cock more than his wife.
The fortified church of Miagao, that is approximately 25 miles (40 km) south of Iloilo City on the island of Panay, is an excellent sample of Spanish church architecture in the colonial era.
"Chocolate Hills"
These "brown-colored hills" of the island Bohol must not lack in any brochure about Philippines.
Beautiful beaches invite everyone to take a bath or to do water sports.
South Seas Flair
You also might invite your family and friends to a picnic in one of the shelter huts that protect you from the burning sun during daytime at the numerous, lonesome beaches.
White-sand Beach
The beaches on the small of Mactan Island near Cebu City belong to the most beautiful beaches on the Philippines.
Vacation Area
Within the past few years the little island of Boracay, south of Mindoro, became the most attractive vacationan area in the Philippines. Certainly, the beautiful beaches of the island contributed a lot to this development.
Young and active vacationists fully cover their expences on Boracay Island. There are a lot of hotels, discos, bars, restaurants, and more than enough facilities to practise any sportive activities.
Basilica Minore del Santo Niño
The oldest religious relic in the country, the Santo Niño de Cebu, is kept in the Basilica of Cebu.
The former residence of the Bishop of Cebu has been restored to its former glory. Today it is a museum showing various religious articles from the 18th. to 19th. century.
Magellan's Cross
Ferdinand Magellan planted a cross on the spot where the first Filipinos were baptized. This mythic cross stands at the corner of the Magellan Street and Burgos Street in Cebu City.
LapulLapu Monument
The Filipino chief Lapulapu resisted the Spanish attempts at colonization in 1521. His monument stands across the street from the one of his rival Magellan in Cebu City.
Every year the performance of the battle of Chief Lapulapu and his warriors against the soldiers of Ferdinand Magellan is the attraction of the small island Mactan near Cebu City.
At 10,311 feet (about 3,275 m), Mount Apo is the tallest in the Philippines. It is at the border triangle of Davao, North Cotabato, and Bukidnon.
"Mount Sulphur"
The natives call Mount Apo "Sendawa" (Mount Suphur) since in its crater there are numerous bizarre, yellow-colored lumps of rock.
The "Queen of the Orchids" is just one of the attractions of the Derling Orchid Farm in Greenhills near Davao on the island of Mindanao. - A visit is a must of any friend of orchids.
Not only these women of the Mandaya tribe in the Southern Philippines near Davao keep up the tradition of weaving. - However, this tradition is still alive in any rural areas all over the country of the Philippines.
Horse Fight
The predilection of Filipinos for cock fights is well known, but the Philippine tribe of T'boli, who live near Lake Cibu on Southern Mindanao, prefer horse fights. They tie a mare near two stallions that fight for her till one of them gives up. These fight last about 3 to 5 minutes and - at the contrary to cock fights - they never end with the death of an animal.
These traditional outrigger sail boats that are called vintas serve as well as fisher boats and as means of transport in the Philippine seas between Mindanao and the Malaysian Borneo.
The strong walls of Fort del Pilar of Zamboanga City (Mindanao) protected the "anxious", former Spanish occupants from the Muslim Moros in Southern Philippines.
Except at the capital of Palawan, Puerto Princesa City, there are hardly any big hotels on the island. But numerous small inns and pensions offer comfortable accomodations for anyone.
Lonesome Beaches
Any vacacionist who does not like any crush at the beach exactly fits to Palawan. Here is silence, relaxation and very often he even can call a whole beach "his own".
St. Pauls Subterranean National Park
Beneath St. Paul Mountain on the island of Palawan flows a quiet underground river passing numerous caves that and it snakes for about 8 kilometers before opening up into a clear lagoon, and from there it flows into the Chinese Sea.
Not only the seas around the island of Palawan are a paradise for any diver - either with or without snorkel mask.
Northern Coast Line
Night view on fish fences at the northern shore of the Philippines in Ilocos del Norte.
Evening at the Shore
Beautifull shaped rocks surround a terrific view over the ocean.
Sunset Glow in the Orient
Beautifull Palm-Trees sway in the evening breeze.
|
cc/2019-30/en_middle_0059.json.gz/line357
|
__label__cc
| 0.66882
| 0.33118
|
Home / farm subsidies • food movement / An Issue The Food Party Can Cotton To
U.S. Department of Agriculture Secretary Tom Vilsack remains wisely unswayed by House Agriculture Committee pleas to reclassify cottonseeds. According to the cotton industry, low prices and loss of acreage have put American cotton farmers in a tough spot. They believe salvation lies with the reclassification, which would allow $1 billion more a year in federal farm subsidies paid out to cotton growers.
One would think the bruising boom bust cycle most U.S. commodity farmers have been riding would finally be reason enough for a soup to nuts overhaul of our entire food and farm system, but alas, that is always a bridge too far.
Vilsack and House Agriculture Chairman Mike Conaway (whose district is third nationally in cotton subsidies) have been jousting back and forth whether Vilsack has the legal authority to do so. Regardless of who is right, why won’t Chairman Conaway use his significant power to help cotton farmers? That is his job and core constituency after all.
One reason may be that Congress is beyond dysfunction. The House is in the grasp of the “Freedom Caucus” that would surely balk at more spending. There is little guarantee they would be successful in adding a new subsidy. And tinkering with the farm bill to authorize writing more checks to cotton growers invites farm subsidy cutting barbarians at the gates inside the castle to feast on other crop programs.
Perhaps the real reticence behind House Aggies doing their jobs is a desperate need for election year political cover. Used to be GOP members could vote for farm subsides and still retain “conservative” bona fides. House Agriculture Committee member Scott Desjarlais (R-TN) is in a particularly tight primary race where farm bill spending is an issue. He signed onto this letter begging Vilsack to add the cotton subsidy along with dozens of other GOP colleagues.
What Desjarlais, Conaway and other House GOPers are essentially asking for is executive branch action, as opposed to Congress acting. Which if it was anything other than subsidies for their farmers would be doused with white-hot rhetorical fire.
President Obama’s decision to act unilaterally on immigration shows a blatant disregard for the constitutional checks and balances upon which our government was founded and sets a troubling precedent for the use of executive power. Congress has the sole authority to create and amend laws, with the president’s duty being to faithfully execute those laws. Although he might wish otherwise, the Constitution does not give President Obama the authority to circumvent Congress simply because existing immigration laws conflict with his particular ideology. Scott Desjarlais 11-21-14
Since 1995 taxpayers have paid out 35.7 billion in subsidies to U.S. cotton growers. Retiring GOP congressman Stephen Fincher of Tennessee, famous for trying to cut food stamps while hoovering up farm subsidies, received $3.4 million in cotton payments. At one point cotton farmers were so subsidized that Brazil won a WTO trade dispute that forced taxpayers to subsidize Brazilian farmers by $150 million a year to balance it out. The current quandary stems from how a whole new program created in the farm bill by Congress for the cotton industry — STAX — hasn’t proved helpful to cotton growers.
All this federal support has demonstrably done little to create a stable market for cotton farmers to thrive. To that end, does anyone think another billion-dollar a year subsidy is going to be anything but a short-term Band-Aid?
Clearly Washington DC has huge influence over how agriculture works. That’s why coordinated political efforts like Plate of the Union and Food Policy Action see a need to influence elections in order to change the badly broken parts of our food and farm system.
As far as I know, you can’t eat cotton. That’s likely a reason it hasn’t been on the broader “good food” movement’s radar, except for its genetically modified attributes. There’s a plausible scenario where concerned urban eaters rise up and demand change ala the Tea Party. I’m convinced that if such a thing as a national Food Party is going to create real change in our food and farm policy, it’s going to get there faster and with greater credibility if it includes farmer voices that don’t grow for niche markets.
There are bushels of American cotton growers out there looking for a lifeline. Right now even their historic champions are hanging them out to dry for political reasons. So what could a nascent Food Party offer chronically struggling cotton farmers?
Mother Jones’ Tom Philpott wrote last year about options for U.S. fruit and vegetable production through the lens of California’s epic drought. With drought threatening the home of 40% of our produce, Tom cast about for other regions to shift production to.
Decades of low prices have already put a squeeze on Southern cotton acres, and the fiber has recently slumped anew in global trading. Why not transition at least some acres into crops with a robust domestic market? I bounced my idea of a Cotton Belt fruit-and-vegetable renaissance off a few experts to see if it was nuts. Ferd Hoefner, policy director of the National Sustainable Agriculture Coalition, called it “noncrazy.” He pointed out that, as in most other parts of the United States, small-scale farms that sell directly to consumers are “already gearing up down there,” and added that the region “seems ripe for entrepreneurial companies to come in, buy land, grow farmers, introduce a whole new vegetable supply chain on a bigger scale, especially with California’s woes.”
I’m not talking about a fantasy in which everyone eats from within 20 miles (although such locavore networks, which have thrived nationwide over the last two decades, certainly add diversification and resilience to the overall food system). I’m simply pushing a more regionalized, widely distributed scheme for filling our salad and fruit bowls, one less dependent on California and its overtaxed water resources.
An extra $1 billion a year is a lot of federal cheddar. What if some of that money was instead used to help cotton farmers transition to fruit and vegetable production? Or put into a fund to pay farmers who want to farm carbon?
Seems like an issue the Food Party can get behind.
Previous Article Food Party Dispatch: Talking With Wholesome Wave’s Nischan
Next Article Love it Or Leave It News: Yee Haw for Texas
Members that Voted Against Harvey Aid Received $650K in Farm Disaster Aid
Trump’s Farm Guy Spreads Food Stamp Fraud Manure
|
cc/2019-30/en_middle_0059.json.gz/line358
|
__label__wiki
| 0.651042
| 0.651042
|
EHF EURO 2018. CROATIA Hungary takes it all, Bosnia and Herzegovina without a point
SEHA GAZPROM LEAGUE
Seven SEHA participant national teams were last weekend active in qualifications for EURO which Croatia will host in 2018. Reminder, Croatia as a host already has its place guaranteed on the final tournament and other teams have to go through qualifications. There are seven groups. Two of the best from each group will advance along with the best thrid-placed team. Hungarians are off to a big start and Slovenians are close. Serbia, Belarus and Macedonia have a win and a loss, Slovakia had a minimum success and Bosnia and Herzegovina is the only team without a single point so far.
In group A Hungary has two wins - at home over Latvia with 24:16 as well as away against the Netherlands with 28:27 and is on top of the group along with Denmark which is also 2/2..
Two SEHA teams are in group 2 - Serbia and Belarus. In their mutual encounter in Nis it was huge 36:27 for Belarusians who were in their first match defeated at home against Romania (23:26) while Serbia got away with an important 37:32 in Gdansk against Poland. Romania is on top of the group with maximum points while Serbia and Belarus have 2 each.
In group 3 Bosnia and Herzegovina lost two games - away against Spain (30:21) as well as at home against Austria (22:23) already reducing its chances to catch a place on the final tournament. Spain is on top with 2/2.
In group 4 a win but then also a loss for Macedonia. At home they were with 27:21 better than Ukrain but then failed to beat Czech Republic away losing big with 35:28 in a match where we'll have to highlight the performance of Czech right winger Jakub Hrstka who was unstoppable scoring 10 goals. Another Tatran's player also deserves to be mentioned and that is Sadovyi after an amazing 5-goal performance in a home court win for Ukraine against favored Iceland. Every team has 2 points in this group.
In group 5 Slovenia has 3 points. That puts Vujovic's boys on the second spot, right after European champions Germany who are 2/2. Slovenians were first at home better than Switzerland (32:27) after which they have managed to reach a 26:26 draw in Portugal. Celje's Janc scored 5 in a win,Veszprem's Blagotinsek 6 in a draw.
In group 6 Slovakia has managed to grab a point in Russia (31:31) later losing at home against Sweden (17:21). Sweden is on top in that group, Russia second with two draws, Slovakia and SEHA frozen Montenegro on the bottom with a point each.
Qualifications will continue in May.
|
cc/2019-30/en_middle_0059.json.gz/line361
|
__label__wiki
| 0.700191
| 0.700191
|
Who I’m Following
A Seat for the Rabble
Clips & Pics
Writing Clips
Radio & Video
Media Hits
New Celebrity Scientists
The Lightworkers Myth
Resume Consulting
While Trump Rallies the NRA, True Leaders Hold Prom in Parkland
By Ryan Schuette
Fresh off their success with the March for Our Lives, the students of Marjory Stoneman Douglas High School will hold a prom this weekend unlike any other, an “over the top” prom of proms. There will be dancing and romance—and mourning. Students will honor the 17 classmates who lost their lives in the Feb. 14 shooting with a memorial filled with pictures, alongside couches away from the music for those who want to sit, reflect and remember their loss.
More than a thousand miles away, in Dallas, the National Rifle Association will also gather this weekend, only for their annual convention. As he’s done in the past, NRA President Wayne LaPierre will tout the kinds of failed gun policies that have enabled assailants like the Parkland shooter to legally access assault-style weapons capable of mass slaughter in the first place. Fecklessly, President Donald Trump and Vice President Mike Pence will both take time out of their schedules to speak at the convention. It’s a breathtaking display of insensitivity—not uncommon for this White House, admittedly—for the nation’s most senior leaders to embrace the same group these students and the #NeverAgain movement specifically called out for its role in fueling America’s gun violence epidemic.
The same organization responsible for mocking shooting survivors like David Hogg as “childish.” The same organization responsible for trotting out spokespeople like Dana Loesch to smear students behind the historic April 20 national school walkout with bizarre claims about links to anti-Semitism. On the weekend of their prom, no less—one organized specifically to remember the victims lost this year and show resilience in the face of unspeakable tragedy.
It’s a national disgrace.
Trump’s decision to headline an NRA convention this year marks another low point for moral credibility, both in his presidency and the history of the office itself. Oh yes, his high-profile appearance with Pence will generate the applause and wild approval that Trump craves from an audience of hardcore gun enthusiasts.
Thankfully, that audience is shrinking—along with the NRA’s once-formidable and pernicious influence in our nation’s politics. In February this year, the Quinnipiac University National Poll recorded the highest level of support among Americans for stricter gun laws, the largest in its history. The same poll found that 51 percent of Americans believe the NRA’s policies are bad for the nation, with those in support dropping to 38 percent, a decline by five percentage points over just five months.
The reason why? As the poll’s assistant director observed in the news release, “If you think Americans are largely unmoved by the mass shootings, you should think again.” On issues like universal background checks, waiting periods and an assault-weapons ban, a majority of respondents parted ways with the NRA’s agenda.
Talk about a sea change. Six years ago, Gallup found that 54 percent of Americans shared a favorable view of the organization. Many regarded the NRA as one of the most powerful lobbies in the nation, and rightfully feared it. The NRA Political Victory Fund regularly dumps tens of millions of dollars into elections, intimidating lawmakers—especially conservatives and red-state Democrats—with threats to fund their opponents in the primaries if any defy the group with gun-control legislation. Not even the 2012 massacre at Sandy Hook Elementary School was enough to prompt anything more than a tepid response from Congress, thanks to the NRA’s strong-arm tactics.
The brave students at Marjory Stoneman Douglas played no small part in turning the tide. Never Again MSD spearheaded the March for Our Lives, which ultimately spanned more than 800 sibling marches around the country and world. When the NRA—and this president—backed a dangerous and ludicrous proposal to arm teachers in our schools, their courage inspired a boycott that led dozens of major companies to ditch their business relationships with the organization and cancel discount programs for members. Lawmakers haven’t been immune to mounting pressure for gun law reform, either, with Sen. Marco Rubio (R-Fla.) memorably enduring withering boos and outrage at a town hall when 17-year-old junior Cameron Kasky pressed him on whether he planned to continue accepting NRA campaign donations.
Our nation’s students have done their part to unmask the NRA for its role in flooding our streets with easy-to-access military-grade weapons. We should all be enormously proud. Now it’s time for us to follow their lead on gun control.
As a country, we need to help them pull back the curtain on the NRA and advocate for commonsense laws that keep guns out of the hands of domestic abusers, require purchase permits, strengthen background checks and prevent more firearm-related suicides from happening. Crucially, we need a comprehensive national ban on assault-style rifles like the AR-15, the weapon of choice for perpetrators of our worst mass shootings, including those at a Las Vegas concert, San Bernardino community center, Sandy Hook and Marjory Stoneman Douglas.
As a result of this historic shift in public opinion, we’re seeing real progress at both the federal and state levels. At the March for Our Lives in Washington, D.C., lawmakers proudly wore badges with the NRA’s “F” grade, notorious for keeping legislators in line for years. Although Congress hasn’t yet authorized funding for gun research, federal lawmakers took a step in the right direction when they passed an omnibus bill that included language removing the gag on the Centers for Disease Control and Prevention that kept it from conducting gun violence research. This week the Houses of Representatives in Connecticut and Delaware passed bans on bump stocks, with the lower chamber in Illinois close behind.
Even Trump himself backed a bump stock ban. Now he’s slated to speak at the NRA convention.
Let him. Let the walking, talking disaster that is this president make his empty promises to an anxious, toxic, and unhinged gun lobby that continues to see its stranglehold on our country slip a little further every day.
The rest of us can turn our attention this weekend to prom night at Marjory Stoneman Douglas. That’s where the real leaders will be.
No Replies to "While Trump Rallies the NRA, True Leaders Hold Prom in Parkland "
Excerpt 9, A Seat for the Rabble
Pillars of democracy
Ryan Schuette. Author. Illustrator. Freelance writer and PR consultant. I also offer public relations, writing, and consulting services.
Tweets by @RyanMarcS
Ryan Schuette © Copyright 2013
|
cc/2019-30/en_middle_0059.json.gz/line367
|
__label__wiki
| 0.726456
| 0.726456
|
Flight SVA1223
SVA5094 A320-214 (HZ-AS35)
Taif (OETF) King Abdulaziz (OEJN)
00.20 07/11/2015
OETF ISLAM OEJN
(144 load / $ 750.00 per unit
$ 108, 000.00
(2913 fuel used @ 5.1 / unit)
$ 14, 856.30
smartCARS version 2.1.17.0, 2015/11/7 UTC
[16:12:27] Preflight started, flying on IVAO
[16:12:27] Flying Airbus A320 NEO
[16:14:49] Pushing back with 42029 lb of fuel
[16:14:54] Engine 2 is on
[16:16:30] Taxiing to runway
[16:17:12] Flaps set to position 2
[16:19:06] Taking off
[16:19:52] Climbing, pitch: 14, roll: level, 186 kts
[16:19:57] Gear lever raised at 51 ft at 158 kts
[16:20:06] Flaps set to position 0 at 287 ft at 157 kts
[16:23:57] Cruising at 11000ft, pitch: 3, 328 kts
[16:26:42] Descending
[16:30:03] Approaching
[16:30:22] Exceeded 250 KIAS below 10,000 feet MSL
[16:37:33] Final approach, 311 kts
[16:38:45] Flaps set to position 1 at 1257 ft at 304 kts
[16:39:12] Speed corrected at 494 ft after a max speed of 351 kts
[16:39:46] Gear lever lowered at 49 ft at 179 kts
[16:39:54] Touched down at -534 fpm, gear lever: down, pitch: 3, roll: level, 176 kts
[16:40:17] Landed in 4373 ft, fuel: 39186 lb, weight: 163460 lb
[16:40:17] Taxiing to gate
[16:41:16] The flight may now be ended
[16:41:16] Arrived, flight duration: 00:20
[16:41:45] Engine 2 is off
|
cc/2019-30/en_middle_0059.json.gz/line368
|
__label__wiki
| 0.817372
| 0.817372
|
posted Friday, December 9, 2016 - Volume 44 Issue 50
Skillfully coifed Love Witch a magical cyanide cocktail
by Sara Michelle Fetters - SGN A&E Writer
Elaine (Samantha Robinson) is determined to find a man she can love. She adores love, so much so she's devoted her study of witchcraft and the occult into achieving it no matter the cost. Problem is, she's spent so much time transforming herself into what she believes is the masculine version of the porcelain doll ideal that she's lost sight of the line that exists between right and wrong. While her spells bring men her way, once she has them, Elaine quickly realizes they aren't all they're cracked up to be, and the only way to make sure they don't keep mindlessly pursuing her is to make certain they're placed a good six-feet underneath the ground where they can't do any harm.
Shot on 35mm, made with retro 1960s Technicolor purity, writer/director Anna Biller's The Love Witch is a feat of technical wizardry, its production design, costumes, art direction and especially cinematography beyond reproach. But it is the cunning intelligence of the script, its dark, complexly feminist mechanics, that make the movie sing. Biller has composed an eviscerating black comedy that pulls zero punches and is completely unafraid of pushing as many buttons as it can, holding a spotlight up to society's assessment of the feminine mystique only to menacingly twist it all right on top of its majestically coifed head.
Is Elaine a villain? Is she a hero? Or is she a victim of society's obsession with beauty and gender stereotypes? There aren't any easy answers, at least, not any that Biller cares to answer. Instead, she offers up scenarios and situations that continually blur the line. Elaine is a serial killer, there's no denying that, but the twisted pains and complicated circumstances that made her that way are hinted at throughout. While the movie never forgives her actions, it does ask the viewer to understand them, creating an uncomfortable sense of mystery where right and wrong no longer apply.
This aura of moral imbalance is centered around Trish (Laura Waddell), a somewhat stereotypical girl-next-door who ends up becoming Elaine's first new friend when she arrives in San Francisco. Like everyone else, she's initially hypnotized by the vibrant, go-getting young woman, slightly embarrassed with how openly she is willing to talk about sex, love and all sorts of matters of the heart. It's easy for her to get swept along for the ride, but when the point comes where Elaine realizes how far the artifice extends and just how terrifically damaged her new girlfriend actually might be, the shock she feels is ruinous. Affection turns to horror, the idea that a fellow woman could damage herself so completely just to a please a man a shock to her system yet, in some ways even more terrifying, it is also an idea she can understand and relate to at the exact same time.
Biller, an old Hollywood aficionado whose love for all things Hitchcock, Sirk, Wilder and all the rest seemingly knows no bounds, has imagined a world that is retro and modern, both seemingly at once, and as such creates a lushly unsettling visual landscape that had me questioning what was going on right from the very beginning of the film. Echoes of Bell, Book and Candle, Arsenic and Old Lace, Marnie, Vertigo, Written on the Wind and even The Vampire Lovers abound, while a brazenly sexual streak reminiscent of The Wicker Man can be felt throbbing throughout. She's littered the movie with bright pinks and comforting blues, every color under the sun popping with a jovial electricity that's positively shocking.
But, much like Elaine herself, her makeup always on point, her hair perfect, her clothes dripping in womanly élan, it's all an act, a bittersweet façade that's been manufactured to excite the gaze and misdirect from the actual central goings on taking place right there in plain sight. Much like Robinson's sublime performance (think Kim Novak by way of Tippi Hedren and Lauren Bacall), the trickery is by design, the brutal nature of why things are the way they frustratingly are the reasons the character turns to homicide in order to find what she believes might be the perfect soul mate.
I really don't want to say more. Biller's movie is a royal, devilishly nasty treat that is as magical as it is potent, the potion the filmmaker has whipped up for all of us to drink going down as smoothly as an expertly mixed cocktail with a tiny pink umbrella, only here the secret ingredient is cyanide, not grenadine. There's nothing like The Love Witch, and that's a good thing, for if there were, I seriously doubt I'd be as captivated with this marvelous bit of murderous whimsy as I most assuredly am.
Miss Sloane a gripping political thriller
Elizabeth Sloane (Jessica Chastain) does not lose. She's one of Washington, DC's most powerful lobbyists, working for a prestigious firm under the guidance of the legendary George Dupont (Sam Waterston). He's taught his protégé well, revealing pretty much all his tricks, Miss Sloane inventing a number of new ones herself as she does whatever it takes to make sure the will of her clients is heard in every corner and backroom of Capitol Hill.
But when the gun lobby comes calling to make sure new legislation never sees the light of day, Miss Sloane surprisingly refuses to assist them in their cause. Instead, for reasons entirely her own, she leaves Dupont to run off and join an upstart firm headed by Rodolfo Schmidt (Mark Strong). They're working the opposite side of the case and Miss Sloane wants to lead that charge. Taking his team in hand, she starts instructing these well-meaning neophytes in how to do battle in the down and dirty world of American politics, putting all she holds dear in jeopardy and risking past indiscretions are thrust into the light of day by going against the gun lobby.
If nothing else, Miss Sloane couldn't be getting a more timely release. The political thriller is hitting theatres after a string of mass shootings have left people shocked and stunned leading to countless arguments about gun restrictions yet have also produced exactly zero new laws on the issue to make their way through Congress. It also comes in the wake of one of the more controversial and contentious presidential election in U.S. history, one of the central issues heard over and over during the campaign being the power of lobbyists and how best to curb their influence.
As such, Oscar-winning director John Madden (Shakespeare in Love) and first-time screenwriter Jonathan Perera have set themselves an incredibly high bar to leap over, assembling a cast of Hollywood character actor heavyweights, both veteran and newbie, to help them do it. In addition to Chastain, Waterston and Strong, the film features Gugu Mbatha-Raw, Michael Stuhlbarg, John Lithgow, Alison Pill, Dylan Baker, Jake Lacy, Douglas Smith and Ennis Esmer in key supporting roles, all of them more than up to the task that's been put in front of them.
Compelling, hard-hitting and refusing to compromise, the film is a jolt of electricity right from the start, Madden diving into the lobbying world with a rabid relish that's downright startling. The first half hour or so rushes by in the blink of the eye, the script doing a marvelous job of fleshing out the key elements of its titular character's core traits with bracing efficiency. Elizabeth Sloane is a smart, tenacious woman who bows to no one, willing to stomp over all who get in her path as victory is ultimately the only thing that matters to her. She's like a political Conan the Barbarian, but instead of a sword, she wields a cell phone and struts around in a collection of impossibly high heels, all immediately intimated the moment she walks into a room.
But Madden finds the sense of urgency he and Perera so breathlessly establish in the first act difficult to maintain, and during the middle section of the picture things do stall out from time to time, the filmmakers digging so deeply into the lobbying minutia I found it hard to stay emotionally involved in what was going on. When Miss Sloane makes the jump to the new firm a lot of time is spent having her interact with her new, highly inexperienced team, and as good as the cast might be a lot of this stuff is too overly familiar and obvious to intimately resonate.
Thankfully, the core of the story is just too strong for things to ever go off the rails. Additionally, the introduction of Mbatha-Raw is aces, her character a key figure in Miss Sloane's plans to take down the gun lobby, their emotionally complicated interactions becoming the core component around which much of the main storyline revolves. I'm being purposefully vague because, while it's not much of a spoiler to talk about what happens between the two women, personally I was so overjoyed by their scenes together I just don't want to risk revealing anything about what happens no matter how minor. Seeing Mbatha-Raw and Chastain share the screen is virtual perfection, the two hugely talented actresses displaying a transfixing chemistry that's undeniably awesome and painfully authentic.
Speaking of awesome, I can't think of a better adjective to describe what Chastain accomplishes as Elizabeth Sloane. The fiery actress is every bit as amazing as she has ever been, and this includes her Oscar-nominated turns in The Help and Zero Dark Thirty. The key component to Miss Sloane has to do with why she turns down working for the gun lobby and instead chooses to battle against them, Chastain doing a superb job of making it obvious to the observant viewer why she makes this decision. The multifaceted mechanics of the performance are just astonishing, and even when the movie stumbles or loses its way the actress keeps the engine running relatively smoothly thanks in large part to her mesmerizing genius.
As sharp as the script's teeth might be, I can't say I was all that surprised about where things ended up. To Madden and Perera's mutual credit, both are more than willing to rip at the jugular, taking things to places that are as uncomfortable as they are absorbing. But the pair are also captives of the genre dynamics which they have chosen to utilize; and while both are doing their best Sidney Lumet and Paddy Chayefsky impersonations that doesn't mean their motion picture has the power, grace or authority of something like Network or The Hospital. But Miss Sloane tells a story that feels like it was ripped right out of yesterday's headlines, that coupled with Chastain's magnificence helping make the film a gripping spellbinder worth seeking out.
Office Christmas Party a seasonally dysfunctional comedy
Their office in danger of being closed, Chicago Zentek President Clay Vanstone (T.J. Miller) stumbles upon a crazy idea to save his employees from the unemployment line. His sister Carol (Jennifer Aniston) is in the running to be new corporate CEO, and she's given her brother a promise that if he can secure a multimillion dollar deal with tech company executive Walter Davis (Courtney B. Vance) by the end of the week she won't close his branch. Turns out, he's an old school businessman who misses the days when companies took care of their employees, throwing lavish holiday parties to celebrate their appreciation for all they do during the calendar year.
With the help of his trusted V.P. Josh Parker (Jason Bateman) and programming genius Tracey Hughes (Olivia Munn), Clay plans to throw the party to end all parties, promising his employees that, not only will he save their jobs, they'll also get their year-end bonuses. With Walter as their guest of honor, this trio goes above and beyond to show him a good time, the carnage and chaos they inadvertently unleash upon the downtown business core likely to go down in Chicago history right alongside Mrs. O'Leary's cow.
There is nothing subtle about Josh Gordon and Will Speck's (Blades of Glory, The Switch) raucous, unhinged comedy Office Christmas Party. With a cast featuring Bateman, Miller, Munn, Aniston, Kate McKinnon, Jillian Bell and Rob Corddry, just to name a scant few, I'm not sure anyone would believe it if things had turned out otherwise as this isn't exactly the group of actors that get assembled if you're interested in producing a tragic melodrama.
Granted, part of me thinks it would be kind of cool if that were the case, but that's a discussion for another day. As far as this particular film goes, it's absolutely crackers, things spiraling out of control in much the same way as early-to-mid 1980s comedies like Bachelor Party, Risky Business or Revenge of the Nerds did. It's uncouth and obnoxious, pushing things as far as it can, going bigger and bigger but always with some sort of somewhat saccharine, sweetly moralistic message lurking obviously at its core. Funny? Yes. Consistently so? Not really, at least not to me, but considering how subjective comedies are, how general audiences will feel I haven't the first clue.
McKinnon, as the office's head of human resources, steals the show, her series of pithy asides, head bobs, smirks, dance moves and oddly crooked gestures so continuously hysterical it's almost like she's on a different level than every other single member of the film's remarkably talented cast. Much like she did with Ghostbusters, this dynamo of comic electricity enlivens every moment, and whether it's talking about her collection of pet parrots, joining Corddry on the dance floor or talking about which donuts are allowed in the morning (and which are unacceptable) her genius is unparalleled.
As for the rest of the actors, most of them are in decent form even if they aren't necessarily doing a single thing we haven't seen from them before. Miller is a kinder, gentler version of his 'Silicon Valley' persona, Bateman and Aniston are channeling Horrible Bosses, Munn a combination of her acerbic nerd fantasy woman familiar to fans of 'Attack of the Show' and 'The Newsroom,' while Bell and Corddry are, well, Bell and Corddry. Mostly this is a plus, especially as it pertains to Miller and Munn. Sometimes it's status quo, Bateman, Aniston and Bell appealing, but not really stretching themselves in any discernible way. As for Corddry, his shtick is growing tiresome, and while he isn't exactly around that much, he is just enough that he grated on my nerves something fierce.
It should be noted that, even with six credited writers working on the project (including directors Gordon and Speck), there is only the thinnest of scenarios at play, and for much of the film's running time whether they were actually allowed to or not it feels as if the cast is improvising like mad. The freewheeling nature can be amazing, but it can also be messy and unfocused, things happening for no real reason other than to reach an end point where everything is resolved and the audience is left happy. If the film could have been tighter, if the fat could have been cut, it's likely I'd have left the theatre happy. As it is, there's so much stuff that flies this way and that the ungainly nature gets tiresome, making enjoying things start to finish difficult.
Still, when it is funny, Office Christmas Party can be a hoot, and it's always nice to see firebrands like McKinnon getting an opportunity to strut their stuff so magnificently. But Gordon and Speck can't hold it all together, things spiraling in so many different directions their bits of emotional pabulum that they toss in willy-nilly throughout fall achingly flat. It's seasonally dysfunctional in ways that cannot be overcome, and while I laughed, I did not laugh enough to make sitting through the film as a whole worthwhile.
Make The Little Mermaid part of your world
SMC's Silver & Soul holiday concert soars
2017 GRAMMY NOMINATIONS:
Beyonce leads all nominees with 9; Bowie shut out in major categories
Just like the white winged dove:
Stevie Nicks descends upon Seattle this weekend
Make the Yuletide Gay director Rob Williams talks about his latest film Shared Rooms
Sympathy for the Devil:
Chatting with writer/director Anna Biller about her surrealistic feminist throwback The Love Witch
GOLDEN GLOBES:
LGBT-themed film Moonlight and TV's 'Westworld' are strong contenders for nominations
Pink Pistols article excellent
Deadmau5, PJ Harvey announce upcoming Seattle concerts
See who links to the SGN
links to the SGN
You might find them interesting too!
|
cc/2019-30/en_middle_0059.json.gz/line370
|
__label__cc
| 0.607458
| 0.392542
|
Alexandra Falls, in Twin Falls Gorge Territorial Park near the town of Enterprise, is a pretty spot for sightseeing, picnicking, hiking – and cheating death. A decade ago, world-class kayakers Tyler Bradt and Rush Sturges ran the falls. Surprisingly, they lived to tell about it.
For hot tips on some slightly less insane canoe and kayak trips in the Northwest Territories, check out our paddling adventures.
2015-11-20T12:02:41-07:00 November 20th, 2015 2018-08-03T09:40:56-06:00 August 3rd, 2018
Yellow Dog Lodge: Where Stories are Made
The wind in your sails
Why Great Slave Lake is a sailor's paradise.
CAD $6,900.00 +GST & National Park fee
Nahanni Wild Bookings Start October 3, 2018
This 10 day canoe adventure begins with two nights of camping and a full day of exploration at Virginia Falls. Experience rarely explored viewpoints or take in the spectacular view from the summit of Sunblood Mountain. Your friendly and engaging guides ensure one on...
Amazing Aurora Summer Package 2019
Per Person $309.00 CAD, +GST
North Star Adventures Available Starting August 8
Yellowknife is the best place to see Aurora. For our famous Aurora Hunting tour, we will drive to different locations to look for the best places to view the Northern Lights. Our Guides will take free professional photographs of you and tell you all about the...
Arctic Photography Adventure
Peterson's Point Lake Lodge Starting September 01, 2019
Your adventure begins in Yellowknife where you will enjoy two days of exploration and photo-shooting before flying over 200 miles north to Point Lake for a five night stay at Peterson’s Point Lake Lodge. Each day you will explore the Arctic landscape with our team...
Arctic Fishing - Lake Trout & Arctic Grayling 7 Night Experience
Peterson's Point Lake Lodge Starting July 18, 2019
Our all-inclusive fly-out trips will capture your sense of adventure whether you’re catching monster-sized Lake Trout or fly-fishing for Arctic Grayling. Enjoy the camaraderie of small groups and personalized service. Through the months of July and August, mother...
Pingo Canadian Landmark
The Mackenzie Delta has the highest concentration of pingos on Earth – approximately 1,350 of them. Eight, including famous Ibyuk PIngo and Split Pingo, are protected by Parks Canada in the 16-square-kilometre Pingo National Landmark outside Tuktoyaktuk. They...
Vadzaih Van Tshik Campground (Gwich'in Territorial Park)
Nestled on the side of Caribou Creek approxiumately 40 kilometres north of Tsiigehtchic on the Dempster HIghway, Vadzaih Van Tshik Territorial Park well-protected from the elements by the steep cliffs nearby. Birds of prey glide high above, while...
MCNALLIE CREEK TERRITORIAL PARK DAY USE AREA
This park features a small picnic area, washrooms and a short trail leading to the 17-metre McNallie Creek Falls. At the viewing platform, a plaque explains the origin of the creek's name. Look for the cliff swallows nesting in the ravine walls.
PROSPEROUS LAKE TERRITORIAL PARK DAY USE AREA
Don’t be deceived by the apparent size of Prosperous Lake as seen from the shore – the main body of the lake is out of sight! This boat launch provides access to Prosperous Lake, which stretches approximately 16 kilometres north.
MADELINE LAKE TERRITORIAL PARK DAY USE AREA
Located on Madeline Lake, this park is a perfect place to enjoy a meal at one of its several picnic sites equipped with tables and firepits. Use the boat launch and dock area to access the lake for powerboating and watersports. Madeline Lake is usually calm due to...
YELLOWKNIFE RIVER TERRITORIAL PARK DAY USE AREA
Located on the Yellowknife River, the park is a perfect place to enjoy a picnic or fishing. There are washrooms here, a picnic area and playground, trails and a boat launch. For the more adventurous, boat up the river and into the string of lakes it connects to; or...
Happy Valley Territorial Park
Located in the heart of Inuvik, this park offers 19 powered and eight non-powered sites, and convenient access to the town’s attractions. The park is situated on a bluff overlooking the east branch of the Mackenzie River, with a view of the Richardson Mountains....
Ja'k Territorial Park
Just outside Inuvik, this park features an observation tower with excellent views of the surrounding scenery and prime bird-watching. Watch for falcons, eagles and ducks, our summer residents. There is an abundance of cranberries, blueberries and cloudberries that...
MacKinnon Territorial Park
On the banks of the Mackenzie River in Norman Wells, MacKinnon Territorial Park offers a great view of the Mackenzie Mountains and is a perfect stop for river-trippers. There are eight non-powered campsites, washrooms, firewood, a picnic area and a playground...
Mackenzie Bison Sanctuary
This big boreal reserve protects Canada’s northernmost population of wood buffalo, which are almost inevitably seen browsing along Highway 3. Roadside parks in the area – including North Arm and Chan Lake – provide an opportunity to stretch your legs and explore the...
Houseboat Bay
The North's most colourful neighbourhood bobs on the waves of Great Slave Lake, just offshore of Old Town. Rent a kayak or paddleboard to explore this floating community – or bunk down at the houseboat bed-and-breakfast.
Gwich'in Territorial Campground
Enjoy the spectacular shoreline of Campbell Lake, try your luck fishing, hike in search of unique rocks and fossils, or hit the beach for a swim above the Arctic Circle. There are just a few of the options available at Gwich'in Territorial Campground, about 30...
Fort Simpson Territorial Park
This idyllic park overlooks the confluence of the Mackenzie and Liard rivers, yet is within walking distance of the centre of town. The adjoining Papal Site commemorates the 1987 visit of Pope John Paul ll. This is a great location for bird-watching,...
Little Buffalo River Crossing Territorial Park
Located on the scenic Buffalo River about 20 kilometres shy of Fort Resolution, this placid campground features 20 campsites, washrooms, a kitchen shleter and picnic area, firewood, a boat launch, and excellent fishing.
Reid Lake Territorial Park
Reid Lake is also an excellent base for fishing, swimming, canoeing, hiking, bird watching, wildlife viewing, power boating, and for extended canoe trips into the surrounding lake systems. From here, canoeists can access the Lower Cameron River...
Prelude Lake Territorial Park
The largest developed park on the Ingraham Trail, Prelude Lake Territorial Park offers a variety of facilities. There are trails,a sandy beach for swimming, a dock and boat launch, and boat rentals. The island-filled lake, about 16 kilometers long, forms part of...
Fred Henne Territorial Park
Swim at Long Lake’s sandy beach. Camp, picnic, canoe or enjoy the amenities and attractions of nearby Yellowknife. Hike the four-kilometre Prospector’s Trail, highlighting the gold-bearing geology of the area. Or follow the Jackfish and Frame Lake trail...
Little Buffalo River Falls Territorial Park
This picturesque spot features six non-powered campsites. The area was devastated by a forest fire in 1981; nearly 40 years later it is now an ideal spot to observe how nature replenishes the land. Relax by the small waterfall, launch your canoe in the gorge...
Fort Providence Territorial Park
Enjoy great fishing, bison and bird watching, and take advantage of the services available in nearby historic Fort Providence, featuring visitor services, tours, fishing, groceries, a motel and restaurant. The campground is on the north bank of the Mackenzie River...
Hay River Territorial Park
Located on Vale Island in Hay River, (follow the signs; it’s about 10 kilometres past the information centre), this park offers fantastic swimming on the sandy shores of Great Slave Lake, unique views of barges and fishing vessels plying the waters, and great...
Sambaa Deh Falls Territorial Park
This popular park and campground are located at the junction of Highway 1 and the Trout River (Sambaa Deh in the Slavey language). The river was a traditional transportation route before and during the fur trade. The falls forced travellers to portage around...
Queen Elizabeth Territorial Park
Located just outside Fort Smith, this large, lushly wooded campground features 17 powered campsites, showers and washrooms, a kitchen shelter, firewood, a playground, and a walking trail leading to great views of the Slave River Rapids.
This park is what we call a "destination park," and with good reason. The sights to be seen are spectacular, the camping facilities excellent, the peace and tranquility are another world. The park has three main areas, located between the Mackenzie Highway...
Lady Evelyn Falls Territorial Park
Make the trip to see the falls, even if you do not plan to camp overnight. From the Mackenzie Highway, an access road leads 6.8 kilometres south to the park. From the parking lot, a short trail leads to Lady Evelyn Falls. The falls form a giant curtain of...
Cameron Falls
For a pretty little hike through classic Northern shield-country, drive 45 kilometres east of Yellowknife to the Cameron Falls Trail. The path twists through evergreen forests, across boardwalks and over undulating outcrops until, 20 minutes later, you...
Sambaa Deh Trails
A must-see attraction on highway 1 from Fort Providence to Fort Simpson, the Sambaa Deh Gorge gapes where the Trout River slices through thick spruce woodlands not far from the community of Jean Marie River. Most visitors photograph the...
Twin Falls Gorge Trail
Following the rim of the gorgeous Hay River canyon, the easy Twin Falls Gorge trail begins at the community of Enterprise and leads south for eight kilometres through luxuriant boreal forest. Along the way you'll enjoy interpretive signage, great views...
Forming a seven-kilometre loop around the shores of Frame Lake in the heart of Yellowknife, the city's favourite walking trail has a little of everything. The eastern half of the loop is a paved, sedate urban path, leading you past architectural marvels such as...
Salt Plains
What in the world? Just west of Fort Smith in Wood Buffalo National Park lies a shimmering, pearly desert, stretching to the far horizon. A quick hike downhill will bring you to the bizarre Salt Plains, where saline minerals leach from an...
Canol Trail
There's hiking, and then there's the Canol. Possibly North America's most rigorous backpacking trail, this 355-kilometre trek follows the route of a defunct military road that once transected the Mackenzie Mountains. Tackling it is an exercise in...
Ibyuk Pingo
Erupting from the pancake-flat tundra just outside the community of Tuktoyaktuk, this bulbous, ice-filled mound is the second-largest "pingo" on Earth. Called Ibyuk, it's 1,000 feet wide at its base and rises to the height of a 15-storey building, making its...
About 45 minutes by road east of Yellowknife, a short, scenic trail leads over the undulating outcrops to 17-metre Cameron Falls. Here, the Cameron River takes a tumble en route to Great Slave Lake. A bridge straddles the river, allowing picknickers to access...
Sambaa Deh Falls
Roaring directly beneath the Mackenzie Highway not far from the community of Jean Marie River, flashy, splashy Sambaa Deh Falls gets deserved attention from motorists. And here's a bonus: Take a stroll upstream and you’ll come to Coral Falls, a...
Lady Evelyn Falls
So perfect it seems planned, this road-accessible cascade is just outside the little village of Kakisa. It occurs where the Kakisa River jumps off an ancient coral reef, forming a crescent-shaped, 17-metre-high curtain of spray.
Whatı̀ Waterfall
Stunning Whatı̀ Waterfall features two thundering spillways with fine grayling fishing in the rapids below. It's accessible by road from Whatı̀.
Hay River Beach
On blazing hot days, Hay River’s driftwoody beach draws travellers from the nearby campground – some of whom are bold enough to dunk themselves in Great Slave’s cool water.
Pine Lake Beach
The finest beach and campground in Wood Buffalo National Park, Pine Lake features soothing sand and shallow, warm, aquamarine waters, ideal for swimming or paddling when you're tired of gawking at the park's amazing wildlife.
Long Lake Beach
Weekends in late summer, Yellowknife’s beach is peachy, with changing rooms, a campground, a kitchen area, volleyball and more water-skiers than you can shake a beer at.
Road’s End Golf Club
Built in 2009, Inuvik's Road’s End Golf Club boasts a grassy, 250-yard driving range and a three-hole course. Keep an eye out for ravens as you swing – the course once had to close when the sneaky birds made off with all the golf balls.
Ptarmigan Ridge Golf Course
Located next Norman Wells' Heritage Hotel near the banks of the Mackenzie River, the grassy, evergreen-lined Ptarmigan Ridge course offers the only golfing in the Sahtu region, with four holes – soon to be expanded to six.
Seven Spruce Golf Course
Within easy walking distance of downtown Fort Simpson, the Seven Spruce Golf Course in features rolling, grassy fairways and a laid-back vibe. Rent clubs and tackle the sun-soaked nine-hole course or put up your feet in the clubhouse for a relaxing afternoon.
Ulukhaktok Golf Course
With artificial greens atop the tundra, Ulukhaktok is the coolest place you’ll play golf. The town’s nine-hole course if the world’s northernmost, and the annual Billy Joss Open draws visiting celebrity golfers. Word to the wise: Let the muskoxen play through...
Yellowknife Golf Club
Eighteen holes. Sand fairways. Grassy putting greens. Jackpines, bedrock and ravens. It’s safe to say you’ll never play golf anywhere like the Yellowknife Golf Club – especially if you come for the Midnight Sun Golf Tournament, which tees off on the summer...
Hay River Golf Club
This manicured nine-hole course follows the curvaceous contours of Hay River’s namesake river. Grassy and aspen-shrouded, it’s a duffer’s delight. There’s also a driving range and a beautiful log clubhouse with a deck overlooking the water – a great place to spend...
Nááts’ihch’oh National Park Reserve
Nááts’ihch’oh, named for a sacred mountain in its midst, is our newest park. Tucked against the Yukon border, it guards the headwaters of both the Nahanni and the Natla/Keele river systems. Paddlers can traverse the South Nahanni’s “rock garden,” featuring 50km of...
Slave River Rapids
For most of its length the broad Slave River plods over the boreal plains, sliding listlessly toward Great Slave Lake. But at the point where it hits the Northwest Territories border, it is suddenly stirred by the Canadian Shield and detonates into a maelstrom....
Explore the Natural Wonders of Nahanni National Park
Nahanni National Park Reserve/ Naha Dehe is an outstanding example of northern adventure rivers, vast canyons, sheer granite spires and vast alpine plateaus. Dall’s sheep, mountain goats, woodland caribou, wolves, black bears, grizzlies and trumpeter swans all find...
The Mackenzie River
The Mackenzie River The Mackenzie River is the second longest river in North America, and its tributaries drain a fifth of Canada. The river rises in Great Slave Lake near Fort Providence and flows 1738 kilometres to the Mackenzie Delta and Arctic Ocean. ...
Rivers to the Arctic
Rivers to the Arctic Historically, the Dene travelled up the Yellowknife River from Great Slave Lake and crossed the height of land near Snare Lake to the Coppermine River on the way to the Barrenlands. Sir John Franklin was saved from starvation by the Dene near...
East Arm
East Arm Great Slave Lake's East Arm is a world class scenic and geological wonder. Spectacular cliffs drop 180 metres into the tenth largest lake in the world. The scenery is primeval, the result of glaciation in North America and of a clearly visible fault in the...
Canol Project
Canol Project History The Norman Wells Historical Centre offers an exciting introduction to the Canol Project. This was a wartime effort by the Canadian and American governments to supply oil to Alaska from the oil fields at Norman Wells, Northwest Territories...
Cirque of the Unclimbables
Cirque of the Unclimbables A challenge for world class mountaineers, the Cirque is located in the Ragged Range, near Glacier Lake, Northwest Territories. The Cirque's most famous peak – a must for every serious climber - is the Lotus Flower Tower, featured in Fifty...
Ram Plateau and Area
Ram Plateau and Area There's dramatic hiking available to those who fly out to the Ram Plateau in Nahanni National Park Reserve in the Northwest Territories. There are grassy plains, scenic canyons 1200 to 1800 m deep, hoodoo and karst formations and...
POWDER POINT TERRITORIAL PARK DAY USE AREA
Powder Point Day Use Area is located within Hidden Lake Territorial Park on the Ingraham Trail, a little more than 45 kilometres east of Yellowknife on the eastern arm of Prelude Lake. Powder Point offers access to both the the Lower Cameron River Canoe Route and...
KAKISA RIVER TERRITORIAL PARK
Take a break to enjoy a picnic or spend the afternoon fishing (in season) along the fast-moving Kakisa River. Watch for trophy Grayling. Great Slave Lake is home to the current world record Arctic Grayling, and one of the Grayling's favourite spawning tributaries...
PONTOON LAKE TERRITORIAL PARK
On the Ingraham Trail, this park features washrooms, a picnic area, trails and a boat launch.
Gwich'in Territorial Park
The Dempster Highway serves as a boundary for this 8,800-hectare park, which includes two campgrounds (Vadzaih Van Tshik Campground and Gwich’in Territorial Campground), two day-use areas (Ehjuu NJik and Nihtak) and Tithegeh Chii Vitaii...
HAY LAKES CAMPGROUND
This municipal campground is located about four kilometres along the access road to Fort Liard. It's next to a small lake, and offers a kitchen shelter and several campsites.
- Any -Nature & WildlifeHiking & BackpackingPaddlingBirding
Sambaa K'e Fishing and Tourism Lodge
For 35 years, Sambaa K’e has offered world-class fishing on Trout Lake just north of the Northwest Territories-British Columbia border. Sport anglers and nature-lovers alike will marvel at the breath-taking scenery and large Lake Trout, Walleye, Northern Pike and...
For more than 40 years, Canoe Arctic Inc. has operated guided canoe trips on the most remote wild rivers left on our planet. With chartered amphibian aircraft based in Fort Smith, we fly our clientele in to the Thelon River and other remote tundra rivers in the Barren...
Arctic Safaris
Fishing and Barrenlands wildlife photography, including migrating caribou, at the Obstruction Rapids in the central Barrenlands north of Yellowknife.
Watta Lake Lodge
Comfortable lodge a 20 minute by floatplane ride from Yellowknife. Guided fishing for Lake Trout (to 34 lb), Arctic Grayling (to 3 lb), Northern Pike (30 lb) and Whitefish. Hiking, birdwatching, canoeing, photo ops of waterfalls, beaver pond, wildlife. Conferences...
Borealis Bike Tours Unlimited
Borealis Bike Tours Unlimited provides year round, high quality custom guided Fat Bike tours to cyclists of all abilities who are seeking a new and extraordinary outdoor adventure in the Northwest Territories that they will remember for a lifetime. We offer multi-...
Tukto Lodge
Tukto Lodge has been exceeding anglers' expectations for more than fifty years. As the only fishing and eco-tourism lodge in the heart of the Northwest Territories, we offer the ultimate fly-in fishing expeditions. We are situated on Mosquito Lake and Dubawnt Lake,...
Nahanni River Adventures
For over 30 years we have delivered guided natural history/wilderness adventures by canoe and raft. Our qualified and friendly guides are authorities on the Nahanni, Cirque of the Unclimbables and we maintain a low ratio of guides to guests.
Guided wilderness canoeing, sea-kayaking and hiking adventures. Nahanni, Natla-Keele, Mountain, Coppermine, Hood Rivers. Photography, wilderness camping. Fully qualified guides, outfitted with top quality expedition equipment. Great wilderness!
Kasba Lake Lodge
Kasba Lake Lodge is famous for providing guests access to incredible triple trophy fishing. Huge Lake Trout, ferocious Northern Pike and feisty Arctic Grayling. Fly into our private airstrip from Winnipeg, MB. Every day our world-class guides will take you to the best...
Jackpine Paddle
Paddling brings us back to our basic rhythms. Our goal is to improve your kayaking and canoeing skills in an atmosphere of fun and friendship, and share our pristine land and water with you. You can count on our experienced instructors and northern guides to set...
Hay River Golf Club and Campground
Carved out of the ancient Northern Boreal Forest, the Hay River Golf Course is a fabulous recreational facility. This tree lined 9-hole course featuring artificial greens will challenge any golfer. The scenery is beautiful, as the course hugs the meandering banks...
View This Operator Operator Website
Midway between Fort Simpson and Fort Liard on the Liard Trail, Blackstone Territorial Park boasts stunning mountain views and a prime location on the Liard River, downstream from its confluence with the South Nahanni. This is an excellent starting...
Gwich'in Territorial Campground (Gwich'in Territorial Park)
Swim at Long Lake’s sandy beach. Camp, picnic, canoe or enjoy the amenities and attractions of nearby Yellowknife. Hike the four-kilometre Prospector’s Trail, highlighting the gold-bearing geology of the area. Or follow the Jackfish and Frame Lake trail system, leading...
Sambaa Deh Territorial Park
Reid Lake is also an excellent base for fishing, swimming, canoeing, hiking, bird watching, wildlife viewing, power boating, and for extended canoe trips into the surrounding lake systems. From here, canoeists can access the Lower Cameron...
Located opn the scenic Buffalo River about 20 kilometres shy of Fort Resolution, this placid campground features 20 campsites, washrooms, a kitchen shleter and picnic area, firewood, a boat launch, and excellent fishing.
Nestled on the side of Caribou Creek approxiumately 40 kilometres north of Tsiigehtchic on the Dempster Highway, Vadzaih Van Tshik Campground is well-protected from the elements by the steep cliffs nearby. Birds of prey glide high above, while...
Parks Canada / National Parks & Historic Sites
Four National Parks are located in the Northwest Territories: Aulavik, Nahanni National Park Reverve, Tuktut Nogait and Wood Buffalo National Park.
Lynx Tundra Lodge
An Arctic Barrenlands trophy fishing adventure for the serious sportsman. Located on Lynx Lake (420 km east of Yellowknife) Lynx Tundra Lodge is your destination for trophy class Lake Trout, Arctic Grayling, Pickerel, and Northern Pike. English, French and...
Dechenla Wilderness Resort
Remote naturalist's lodge snuggled in the Mackenzie Mountains, in the largest mountain wilderness in North America. Located along the Canol Heritage Trail (Mile 212).
Bathurst Arctic Services
Paddle our Arctic rivers! Canoe outfitting in the Central Northwest Territories and Nunavut. Burnside, Mara, Hood, Thelon, Back, Coppermine Rivers and more. One call does it all; we arrange air transport, rent canoes, kayaks, spray skirts, river reports/maps and other...
Aurora Village
Aurora Village is a unique Aurora-viewing facility situated 25 minutes from downtown Yellowknife. Simply the most popular Aurora-viewing experience in the world!
Journey with the spirits of the Dehcho. Paddle through Canada’s deepest river canyons. Fly Nahʔą Dehé with a legendary northern pilot. Breathe the mist of Náįlįcho. Find your Nahanni.
Arctic Red River Outfitters Ltd.
Arctic Red River Outfitters is a family run business in the Northern Mackenzie Mountains in the Northwest Territories of Canada. We specialize in high quality mountain hunting for big game in a true wilderness setting. Air access is from Norman Wells.
Sahtu Helicopters
Helicopter charter service supporting utility, exploration and eco-tourism including logistical support for rafting expeditions and hiking the Canol Heritage Trail.
Trans Canada Trail
The Trans Canada Trail is used by millions to experience our country's legendary wilderness. Now 73% complete, the Trail is over 16,800 kilometres long connecting the Atlantic, Pacific and Arctic coasts. Comprised of locally-managed segments, the Trail is within 30...
Nááts'ihch'oh National Park Reserve
Paddle the Broken Skull River or go for the Triple Header: three rivers in one trip. Stop for epic hikes or soak in a hot spring in the traditional lands of the Shúhtaot’ine (Mountain Dene).
Arctic Tours Canada
Arctic Tours company is a Yellowknife based tour operating company that offer Aurora Hunting tours, Yellowknife sightseeing tours, wildlife viewing (buffalo) tours, Cameron Falls hiking tours, and tour packages in partnership with other registered tour operators and...
At Nahanni Wild we outfit and guide canoe and raft trips on Canada's renowned South Nahanni River and a select offering of the finest mountain and tundra river trips across the North. Each of our adventures has been hand crafted through years of service and a...
Nahanni Shuttle Partnership
Nahanni Shuttle provides charter van shuttles from the Nahanni to Fort Simpson.
Nahanni Mountain Lodge
Remote private wilderness paradise on Little Doctor Lake, 100 km west of Fort Simpson. Accommodates 20 in cabins. Fishing, swimming, canoeing. Satellite phone. June 1 to September 30. Three months advanced booking.
Canoe North
Canoe North, located in Hay River, Northwest Territories offers kayak and canoe rentals and sales. We can set you up for a self guided trip on a number of northern rivers and the Great Slave Lake. We are just 40km from the source of...
Old Town Paddle & Co.
Old Town Paddle & Co. are the most northern Stand Up Paddleboard (SUP) outfitter in Canada.
This unique18-hole Yellowknife golf course provides beautiful scenery, friendly, welcoming service and the opportunity to play under the midnight sun.
Road's End Golf Club
The only licenced golf course north of sixty to boast of six holes complete with grassed fairways and artificial greens constructed from a former gravel pit.
A full, 9-hole golf course with weekly dinner specials, rentals (golf clubs and carts) and a friendly atmosphere.
Nitainlaii Territorial Park Visitor Centre
Nine kilometres south of Fort McPherson on the Dempster Highway. Gwich'in historical exhibits. Open daily, early June until early September.
|
cc/2019-30/en_middle_0059.json.gz/line377
|
__label__cc
| 0.563244
| 0.436756
|
Facets by Custom Cupboards
Tag Archive for: nm
You are here: Home / News / nm
February 18, 2014 /in Our Brands /by Sierra West
Caesarstone is the original quartz surface manufacturer. The company is headquartered in Southern California, with divisions in Los Angeles, CA, San Francisco, CA, Seattle, WA, Phoenix, AZ, Dallas, TX, Houston, TX, Miami, FL, Atlanta, GA, New York, NY, and Chicago, IL. We also have independent distributors across the country to serve our customers across all regions.
With two state-of-the-art production sites and four fully automated production lines, Caesarstone has an annual capacity of over 2 million square meters (over 20 million square feet). Our brand new second plant utilizes cutting-edge techniques and the latest technologies available, doubling capacity and increasing the possibilities for technological advancement.
With a continuous proactive approach to producing over 40 innovative colors and textures Caesarstone consistently provides a premium quartz surface with remarkable style and endurance – complementing a design application, from classic to contemporary. Nonporous, stain, scratch and heat resistant and backed by a residential lifetime warranty, Caesarstone is the ideal surface for kitchens, vanities and more.
Caesarstone has earned the respected Good Housekeeping Seal from Good Housekeeping Research Institute in addition to ISO 14001 (environmental management system), ISO 9001 (quality management standard) and NSF (public health and safety) certification. Caesarstone was also the exclusive surface of project7ten, one of the few Platinum LEED homes in the country.
http://sierrawestsales.com/wp-content/uploads/2014/02/caesarstone-sierra-west-sales-nm.jpg 600 600 Sierra West /wp-content/uploads/2013/04/sws.web_.logo_.header.png Sierra West2014-02-18 16:24:462014-05-20 14:32:20Caesarstone
Silestone is composed of 94% natural quartz, and is the first and only quartz countertop with Bacteriostatic Protection, giving it unique features.
Silestone® is the world’s leading producer of quartz surfaces designed for high-quality kitchens and bathrooms, including countertops and sinks with advanced bacteristatic technology.
Silestone® is the only brand that offers a certified warranty, in writing. Only a global leader could once again draw ahead of the pack and offer a genuine 15-year transferable warranty for Silestone®
http://sierrawestsales.com/wp-content/uploads/2014/02/silestone-sierra-west-sales-nm.jpg 600 600 Sierra West /wp-content/uploads/2013/04/sws.web_.logo_.header.png Sierra West2014-02-18 16:22:582014-05-20 14:33:01Silestone
February 18, 2014 /0 Comments/in Our Brands /by Sierra West
Millions of people all over the world have Scandinavian household appliances from ASKO in their homes; high quality, durable products with Scandinavian design and innovative solutions. We offer a full range of Kitchen and Laundry appliances that will meet and often exceed our customer’s expectations for many years to come.
ASKO has always been committed to environmental protection. We continuously strive to find the most environmentally friendly solutions and economical use of resources. Our machines are among the most water and energy efficient on the market.
ASKO Appliances has its origin in Sweden. The company has 900 employees and is responsible i.e. for developing and manufacturing the global product range and marketing the ASKO brand. Designers, constructors, engineers, marketers, assemblers and service technicians all work together to achieve exceptional results.
80 per cent of the appliances are exported and distributed by sales companies in Norway, Denmark, USA, Australia, New Zealand and Russia. In addition, Asko Appliances has more than 25 independent retailers all over the world.
http://sierrawestsales.com/wp-content/uploads/2014/02/asko-sierra-west-sales-nm.jpg 600 600 Sierra West /wp-content/uploads/2013/04/sws.web_.logo_.header.png Sierra West2014-02-18 12:37:082014-05-20 14:37:06ASKO
Jenn-Air Featured Products
February 18, 2014 /in Featured Brands /by Sierra West
Appliances featured in this kitchen:
Jenn-Air® Double Wall Oven with V2™ Vertical Dual-Fan Convection System, 30″
Overview: This Jenn-Air® luxury double wall oven features the Jenn-Air® Culinary Center, which calibrates the perfect cooking time and exact temperature based on your inputs and preferences. The 7-inch full-color touch-anywhere LCD display makes it easy to select cooking functions like the convenient No Preheat mode.
Jenn-Air® Electric Radiant Downdraft Cooktop with Electronic Touch Control, 36″
Overview: This Jenn-Air® luxury electric radiant downdraft cooktop with electronic touch controls offers a sleek design and responsive performance. Its glass touch controls and five radiant elements create a smooth, integrated cooktop surface, and the impressive JX3™ downdraft ventilation system quickly and efficiently clears the air without a hood.
Jenn-Air® TriFecta™ TriFecta™ Dishwasher with 49 dBA
Overview: This Trifecta™ Dishwasher with 49 dBA offers exceptional cleaning performance and versatility, including enhanced drying with the Precision Dry® option. This luxury dishwasher’s virtually silent performance makes it perfect for entertaining.
http://sierrawestsales.com/wp-content/uploads/2014/02/webslide1-terry-feb1.jpg 470 1130 Sierra West /wp-content/uploads/2013/04/sws.web_.logo_.header.png Sierra West2014-02-18 10:39:542014-05-20 14:38:51Jenn-Air Featured Products
Sierra West Sales
856 St. Michael's Drive
email: swsappl@msn.com
Welcome to the new Sierra West Sales Website
Miele Vacuum Cleaners: Powerful Floorcare Solutions
Traditional AGA
Custom Cupboards
Omega / Dynasty
Welcome to the new Sierra West Sales WebsiteMay 21, 2014 - 9:07 am
Miele Vacuum Cleaners: Powerful Floorcare SolutionsMarch 18, 2014 - 11:13 am
Jenn-Air Featured Products 3February 18, 2014 - 11:41 am
© 2014 Sierra West Sales - Sierra Designs
Developed by: Rocky Mountain Media Services
Hosting and Maintenance by: Reactive Consulting
|
cc/2019-30/en_middle_0059.json.gz/line383
|
__label__wiki
| 0.892127
| 0.892127
|
8 Apr 2019 Featured Adam Lambert, Australian, Bohemian Rhapsody, Queen, TEG Dainty, Tour
QUEEN + ADAM LAMBERT Heading to Australian Stadiums in February 2020!
The soaring success of the film Bohemian Rhapsody, the highest grossing music biopic of all time, has proven that the love for Queen remains as strong as ever. Lifelong Australian fans and new converts will be thrilled with the news that Queen original band members Brian May and Roger Taylor are teaming up once more with longtime frontman Adam Lambert on lead vocals and returning to Australia in February 2020 for 6 giant stadium shows with a brand-new, spectacular production.
Produced in Australia by TEG Dainty, the epic 6 date Rhapsody Tour is set to run from February 13 to February 29, 2020 with an all-new stadium concert experience, the tour dates are:
Thursday 13 February – Brisbane – Suncorp Stadium
Saturday 15 February – Sydney – ANZ Stadium
Wednesday 19 February – Melbourne – AAMI Park
Sunday 23 February – Perth – Optus Stadium
Wednesday 26 February – Adelaide – Adelaide Oval
Saturday 29 February – Gold Coast – Metricon Stadium
Tickets go on sale from www.ticketek.com.au on Monday 15 April with staggered on sale times from 10.30am AEST. A Telstra Thanks presale starts Wednesday 10 April, with staggered times from 9.30am AEST and is open until Friday 12 April. Go to www.telstra.com/queen for further details including local market times.
Announcing their Rhapsody Tour of Australia Roger Taylor said: “We are ready for Australia and raring to get back with our new show.”
Adam Lambert said: “We have a brand-new visual spectacle that will reframe these iconic songs and we are excited to reveal the show to Australian fans!”
With Brian May adding: “This is a great opportunity. Our last tour featured our most ambitious production ever and got us our best notices ever. So we decided to rip it apart and get even more ambitious! Watch out, Australia! “
Paul Dainty, President and CEO of TEG-DAINTY said: “With the enormous success of the highest grossing music biopic of all time – Bohemian Rhapsody – Queen’s popularity in Australia is as huge as it gets, we can’t wait to bring Queen + Adam Lambert back to Australia with this brand new stadium production and watch them bring their iconic songs to life.”
The Rhapsody Tour will debut a brand new larger-than-life production. Set designer Ric Lipson says: “Queen + Adam Lambert’s Rhapsody tour will, once again for them, expand the parameters of what a live music experience can be. This new show promises to be their most spectacular yet, an innovative and interactive celebration of the continued power of Queen’s music.”
Since Adam Lambert first shared the stage with Queen for the 2009 American Idol final, his dynamic performances have reinvigorated the band and delighted fans worldwide. Their first full show thrilled a half-a-million-strong crowd in the Ukraine capital city of Kiev in June 2012. Since then May and Taylor’s musical fireworks have been matched by Lambert’s vocal prowess and stage presence, making for an explosive combination. Over 180 gigs later, the partnership has proven a commercial and critical triumph, playing to enraptured full houses in every corner of the world.
Completing the tour line-up are long-term collaborator Spike Edney on keyboards, Neil Fairclough on bass, and Tyler Warren on percussion.
Then along came 20th Century Fox’s Bohemian Rhapsody. The movie has topped the cinema box office in more than 35 countries around the world since its late October release, drawing worldwide box office receipts approaching $900 million. The excitement the film inspired also saw Queen propelled back on to the music charts, where they hit No. 1 on Billboard’s Artist 100 Chart, reminding fans why they loved them and dazzling the previously-uninitiated. ‘Bohemian Rhapsody’ is officially the world’s most-streamed song from the 20th Century. Indicative of Australia’s enduring passion for Queen – the Bohemian Rhapsody soundtrack spent four weeks at #1 on the ARIA chart and now enjoys Platinum status. Queen additionally achieved the rare feat of boasting three separate albums in the ARIA Top 5 – for five weeks this year.
When Freddie sang The Show Must Go On all those years back, even he couldn’t have guessed that Queen music would still be thrilling audiences. Next summer, the stadium stages of Australia will be well and truly rocked again.
The Australia dates are expected to be part of a wider tour of the region taking in also several East Asia dates.
Tickets for the RHAPSODY tour go on sale on Monday 15 April with staggered on sale times from 10.30am AEST. Check www.queenonline.com and www.tegdainty.com for more tour information.
Tags: Adam Lambert, Australian, Bohemian Rhapsody, Queen, TEG Dainty, Tour
7 Mar 2019 Featured 2019, Australian, Australian Tour, MJR Presents, Redhook, Sevendust, The Faction Radio
SEVENDUST announce Redhook as Australian support & Meet-and-Greet Packages
Sevendust’s return to Australia just got even better with the announcement of national support – the red-hot REDHOOK! On top of that, they are today announcing Meet-and-Greet packages are now available at mjrpresents.com. New Zealand’s support act will be announced very soon.
The Meet and Greet packages are limited to 100 per show (but does NOT include a ticket) and include a Sevendust T-Shirt, a VIP laminate and a picture & chat with band pre-doors open!
https://www.youtube.com/watch?v=8avjkSoRSbk
Presented by MJR Presents and 24/7 Metal and Rock station/app The Faction! Sevendust are coming to celebrate their 2018 Rise Records release All I See Is War – a record that has energised fans all over the world.
Joining Sevendust for the Australian leg of the tour are the red-hot-right-now Redhook. Recently chosen as the triple j unearthed opening slot artist in Sydney for both Good Things Festival and now Download Festival Australia, as well as opening national tours for The Faim, as well as Hands Like Houses and Ocean Grove, they are also heading off to Download Festival in the UK to play the legendary Donington Festival as well. All of that on the back of 3 singles, Turn Up The Stereotype, Paralysed (just added to rotation on triple j this week!) and Minute on Fire – and signing to management to Rob Nassif’s The Hen House and bookings to Edwin Tehrani at New World Artists.
Sevendust kick off the tour in Auckland at Powerstation Tuesday 23rd April, then head on to Australia. Redhook join the iconic five-piece hard rock/metal outfit touch down when they kick off the AU leg Thursday 25th April at The Tivoli, Brisbane, then on to The Metro in Sydney on Friday 26 April, The Forum in Melbourne on the 27th, The Gov in Adelaide on the 29th and then finish the tour in Perth at Capitol on the 30th April.
A trifecta of now-classic gold albums—Sevendust [1997], Home [1999], and Animosity [2001]— ignited their journey. Known as an equally intense and unforgettable live force, they’ve consistently packed houses around the world and decimated stages everywhere from Rock on the Range and Woodstock to OZZfest and Shiprocked! 2015’s Kill The Flaw represented a high watermark. Bowing at #13 on the Billboard Top 200, it scored their highest debut on the respective chart since 2010 and marked their fifth consecutive Top 10 on the Top Rock Albums Chart and third straight Top 3 on the Hard Rock Albums Chart. Most impressively, the lead single “Thank You” garnered a nomination in the category of “Best Metal Performance” at the 2016 GRAMMY® Awards, a career first. All I See Is War represents yet another new beginning and a new point of connection for fans.
Tickets for the Sevendust AU/NZ tour, as well as the Meet and Greet Packages, are on sale at mjrpresents.com.
MJR and THE FACTION PRESENTS
AUSTRALIA & NZ TOUR 2019
AUSTRALIAN DATES – SUPPORTED BY REDHOOK
Tuesday 23 April 2019 – Powerstation, Auckland *
Thursday 25 April 2019 – Tivoli, Brisbane
Friday 26 April 2019 – Metro, Sydney
Saturday 27 April 2019 – Forum, Melbourne
Monday 29 April 2019 – The Gov, Adelaide
Tuesday 30 April 2019 – Capitol, Perth
* Redhook not appearing
TICKETS AND MEET AND GREET PACKAGES
AT MJRPRESENTS.COM
Tags: 2019, Australian, Australian Tour, MJR Presents, Redhook, Sevendust, The Faction Radio
16 Jun 2018 Featured, Music News 20th Anniversary, Anniversary, Australian, Confide In Me, On The Map PR, SAT, SUMO, The Superjesus
The Superjesus Celebrate 20th Anniversary Re-Release of Iconic Album SUMO With Massive National Tour
Twenty years on from their platinum selling album Sumo hitting number two on the ARIA Chart (and with a few ARIA Awards in the trophy cabinet), The Superjesus are back with an anniversary edition of their celebrated 1998 debut, set for release on August 17. As well as seeing the original album reissued on vinyl, the CD edition of Sumo – 20th Anniversary features bonus material sourced from triple j’s Live At The Wireless archive, as well as a never before heard studio recording: a Superjesus cover of Kylie Minogue’s Confide In Me. Supported by Triple M and New World Artists, The Superjesus will be hitting the road with an epic stack of gig dates in the second half of 2018 – fans had better get ready to get Down Again to the sounds of Adelaide’s finest ‘90s alternative rock band!
Initially known as Hell’s Kitchen, The Superjesus received national radio play with their debut 1996 EP Eight Step Rail and became a festival favourite at Big Day Out throughout the ‘90s. Inducted into the South Australian Music Hall of Fame in 2017, The Superjesus have much to celebrate – and celebrate they will with this extra-special edition of Sumo. Reflecting on the life-changing record, frontwoman Sarah McLeod says, “(When Sumo came out)…everything went big time. It was terrifying and exciting all at once. We worked so hard on that album… To be sitting here talking about it 20 years later, knowing that it was an important part of Australian music history and affected so many people along the way…it feels like an incredible achievement. We had no blueprint of how we wanted to sound – of course we had our influences, but it was the combination of those influences that made us become The Superjesus.”
Included in this massive Sumo re-release is the never-before-heard version of Kylie Minogue’s Confide In Me by The Superjesus. The track holds particular pertinence for frontwoman Sarah McLeod, since it was the number one single on the ARIA Singles Chart the month in which The Superjesus first formed in 1994. This interpretation is heavy as hell, and it’s got that undeniable Superjesus taste. “I have always been a Kylie fan,” says Sarah. “Back in 96 we recorded a really heavy version of Confide In Me, just for our own amusement. No one ever heard it, I can’t even find it to hear it now… I went to the guys and reminded them of the recording, and went straight home to work up a demo of it. Within a week we were playing it live on the festival stage and it seemed like the perfect addition to the Sumo – 20th Anniversary edition.”
The Superjesus are set to hit the road later this year to celebrate all things Sumo – and the experienced rockers are more than ready to give fans what they’ve been waiting for. With a couple of massive festival slots under their belt for this year already The Superjesus are back in a big way. Stoked to be back in touring mode, Sarah says, “Touring is all about stamina and momentum. In the 90’s we used to tour non-stop, we would play 5 to 6 nights a week for months to years at a time. This kind of momentum makes the band so incredibly tight – nothing else on earth can make a band better than by playing every night in front of a crowd. Since the 90’s we have not toured like this… We want to embark on this tour with no fear like we did then!” Bassist Stu Rudd gives fans a taste of what to expect from the massive shows, “We have not played some of the tunes we’ll be playing on this tour for years, seriously – YEARS! It’s going to be one hell of a show, playing Sumo in full, then following up with some faves as well! We are so pumped for this tour!”
Sumo – 20th Anniversary Edition CD and a limited red vinyl pressing of the original album will be released on August 17.
Pre-order: SUMO (20th Anniversary Edition)
THE SUPERJESUS 20TH ANNIVERSARY OF SUMO NATIONAL TOUR
Presented by Triple M* and New World Artists
SAT 29 SEP | THE GOV, ADELAIDE SA | 18+ *
Tickets available from www.oztix.com.au | 1300 762 545 | All Oztix Outlets
FRI 05 OCT | BARWON CLUB, GEELONG VIC | 18+
SAT 06 OCT | MAX WATTS, MELBOURNE VIC | 18+ *
WED 10 OCT | TAPHOUSE, BENDIGO VIC | 18+
THU 11 OCT | BEER DELUXE, ALBURY NSW | 18+
FRI 12 OCT | ANU BAR, CANBERRA ACT | 18+
Tickets available from www.moshtix.com.au | 1300 GET TIX | All Moshtix Outlets
SAT 13 OCT | NARRABEEN RSL, NARRABEEN NSW | 18+ *
FRI 19 OCT | MANNING BAR, SYDNEY NSW | 18+ *
SAT 20 OCT | TATTERSALL’S, PENRITH NSW | 18+ *
SUN 21 OCT | CAMBRIDGE HOTEL, NEWCASTLE NSW | 18+
Tickets available from www.thecambridgehotel.com.au and www.oztix.com.au
THU 25 OCT | BYRON BAY BREWERY, BYRON BAY NSW | 18+
FRI 26 OCT| RACEHORSE HOTEL, IPSWICH QLD | 18+
SAT 27 OCT | THE ZOO, BRISBANE QLD | 18+ *
THU 01 NOV | PRINCE OF WALES, BUNBURY WA | 18+
FRI 02 NOV | NEWPORT HOTEL, FREMANTLE WA | 18+
SAT 03 NOV | CAPITOL, PERTH WA | 18+
FRI 9 NOV | YORK ON LILYDALE, MOUNT EVELYN VIC | 18+ *
FRI 16 NOV | DALRYMPLE HOTEL, TOWNSVILLE QLD | 18+
SAT 17 NOV | TANKS ART CENTRE, CAIRNS QLD | 18+
Tickets available from www.ticketlink.com.au | 1300 855 835
WEBSITE INSTAGRAM FACEBOOK TWITTER SPOTIFY ITUNES APPLE MUSIC
Tags: 20th Anniversary, Anniversary, Australian, Confide In Me, On The Map PR, SAT, SUMO, The Superjesus
8 Jun 2018 Featured, Music News 2019, Australian, Carbon Sunset Presents, Fever Daydream, The Black Queen
The Black Queen Announce Debut Australian Appearances with Special Guests Drab Majesty
The Black Queen is an electronic act out of Los Angeles consisting of Greg Puciato (The Dillinger Escape Plan), Joshua Eustis (Telefon Tel Aviv, ex-Nine Inch Nails), and Steven Alexander (former tech of both The Dillinger Escape Plan and Nine Inch Nails). Harnessing 80s-inspired pop sensibilities, as well as a more minimal ambient side, the band is far removed from the chaos of Puciato’s former outfit. Founded in 2015, they released their debut record Fever Daydream to underground acclaim in 2016, and live appearances thus far have been extremely limited. Joining them for also their first-ever Australian shows will be like-minded LA two piece Drab Majesty, whose darkwave/post-punk sounds are highlighted by a colourful and androgynous approach that is most remarkably evident on 2017’s The Demonstration.
TICKETS ON SALE FRIDAY 15 JUNE
CARBON SUNSET PRESENTS
THE BLACK QUEEN (USA)
DEBUT AUSTRALIAN APPEARANCES
WITH SPECIAL GUESTS DRAB MAJESTY (USA)
FRIDAY 18 JANUARY – LANSDOWNE HOTEL, SYDNEY (18+)
SATURDAY 19 JANUARY – NORTHCOTE SOCIAL CLUB, MELBOURNE (18+)
www.theblackqueen.com
www.carbonsunset.com
Tags: 2019, Australian, Carbon Sunset Presents, Fever Daydream, The Black Queen
|
cc/2019-30/en_middle_0059.json.gz/line384
|
__label__wiki
| 0.737372
| 0.737372
|
MAHABHASYA OF PATANJALI EBOOK
Food by admin
3 Oct first volume of the English explanation of the splendid mahabhashya of patanjali mahamuni or the explanative commentary on ashtadhyayi of. Title: The Vyakarana-Mahabhashya of Patanjali. Author: Patañjali · Editor: Kielhorn, Franz, Note: 3 volumes, in Sanskrit with some English notes;. The Vyākaraṇa-mahābhāṣya of Patanjali. Edited by F. Kielhorn. Main Author: Patañjali. Related Names: Kielhorn, Franz Language(s): Sanskrit.
Author: Dimuro Taujinn
Published (Last): 8 August 2007
Uploader: Mer
After he incinerates the disciples in anger due to the misbehavior of one in leaving the class without his permission, he turns the last student also into ashes. Patanjali writes in colloquial Sanskrit and in dialectical style.
December Learn how mahabhasya of patanjali when to remove this template message.
From Wikipedia, the free encyclopedia. By registering, you may receive account related information, our email newsletters and product updates, no more than twice a month. Verify the characters on the left From: Verify the characters on the left. Encyclopedia of Indian philosophies. I regret that I have not been able- to secure in India a copy of Bhartrhari’s commentary on the Mahabhasta, and also that Mahabhasya of patanjali could study Haradatta. I cannot hope mahabhasya of patanjali my attempt to reconstruct the work of Katayana has in mahabhasya of patanjali particular been successful, and the list of corrections at the end paranjali this volume will show that further consideration has made me change my views in mahabhasha or two instances.
The figures for Panini’s rules given in the text and in the foot-notes refer to Bohtlingk’s edition. There were two possible courses open here. As such a scholar was not readily available, on the mahabhasya of patanjali of Mrs Mahsbhasya the work is published in the same from in which Dr Dasgupta left it. The Mahabhasya of Patanjali is verily an encyclopaedic work in the field of Sanskrit grammatical literature.
The Mahabhasya of Patanjali – With Annotations (Ahnikas I-IV)
The leaves of the first Adhyaya pages…L. Muller Preface to Rgveda IV; pag.
ComiXology Thousands of Digital Comics. Sibajiban Bhattacharyya Hardcover Edition: Please read our Privacy Policy for details. Vyakarana Mahabhasya of Patanjali.
TOP Related Articles 6ES7 138-4FB03-0AB0 EBOOK DOWNLOAD
All emails will be sent by Exotic India using the email address info exoticindia. The special mahabhasya of patanjali of this edition have already been set forth in the prefaces to the first and second Volumes of this third edition.
Kunjunni Raja Hardcover Edition: The present French translation is accompanied by extensive notes and commentaries. The Search for Linearity.
Mahabhasya of patanjali have generally considered it sufficient to give only the more important readings, but I have throughout noted down anything which appeared to have reference to the text or the constitution of the Varttikas, mahsbhasya I have also given mahabhasya of patanjali various readings in the examples adduced by Patanjali.
Preface to the third edition The present third Volume of the Vyakarna-Mahabhasya completes the publication of mahabhasya of patanjali third edition of the work, which was commenced more than ten years ago by the Bhandarkar Oriental Research Institute, Poona, The first and second editions were brought out by Dr. The position at the top occupied by Patanjali the author of the Vyakaranamahabhasya within the Trimuni tradition of the Paninian school also has been an accepted fact.
This article includes a list of referencesbut its sources remain unclear because it has insufficient inline citations. A Survey of Research. Retrieved from ” https: You will be informed as and when your card is viewed. Paribhasendu Sekhara Set of 2 Volumes. His edition of VM is looked upon as a standard one among the various editions available at present, and, hence, in this – third edition, the text of the first and second editions is faithfully reproduced page to page and line to line.
An old manuscript deposited mahabhasya of patanjali the Bhandarkar Oriental Mahabhasya of patanjali Institute, which was written more than years ago, was consulted at the time of this edition, but the differences in readings were found to be unimportant.
Hence for understanding the nature of language and of the word itself it mahabhasya of patanjali imperative to study the greatest authorities on Sanskrta Grammar, Viz, panini karyayana and patanjali.
Amazon Drive Cloud storage from Amazon. I love Exotic Paranjali First, to mahabhasya of patanjali the incomplete. I cannot hope that my attempt to reconstruct the work of Katyayana has in every particular been successful, and the list of corrections at the end of this volume mahabhasya of patanjali show that further consideration mahabhasya of patanjali made me change my views in one or two instances.
TOP Related Articles LYNNE CAMERON TEACHING LANGUAGES TO YOUNG LEARNERS PDF
In setting my text I have been guided chiefly by the MS. You have got a wonderful collection of all products, books etc Vidyaniwas Misra, Edited by Dr. The Sanskrta language is acknowledge to have the finest and oldest grammatical system in the world today besides possessing an incomparable literature. It was felt mahabhasya of patanjali a comparable treatment of the portions left out mahabhasya of patanjali Dr Dasgupta could be given only by someone having the width and depth of knowledge of the subject which Dr Dasgupta had.
In settling my text, I have been guided chiefly by the MS. Where a rule of Panini patajjali actually quoted by Patanjali, I have given the reference in the text; where a rule is only alluded to, and where one or more rules are necessary for the formation of a particular form or for the understanding of a passage, the references have been given at the foot of the page.
By registering, you may receive account related patwnjali, our email newsletters and product updates, no more than twice a month. The present volume, published posthumously, is a reproduction of an incomplete manuscript of late Professor Surendranath Dasgupta.
The Vyakarana-Mahabhashya of Patanjali, by Patañjali et al. | The Online Books Page
The mahbhasya of the 1st Adhyaya page L 10 to page L 19 of mahabhasya of patanjali printed present text are missing. Verify the characters on the left. In preparing the present edition of the Vyakana-Mabhasya I have used the following manuscripts: A reference to the more important mahabhasya of patanjali such cases is made in the appendix to this edition. We have, however, corrected only obvious mistake in spelling and in grammar.
BRAND BLANSHARD REASON AND ANALYSIS PDF
CHEMICAL AND CATALYTIC REACTION ENGINEERING BY JAMES J CARBERRY PDF
PEDDA BALA SIKSHA DOWNLOAD
ALAIN ROBBE GRILLET LA JALOUSIE PDF
ISAVASYOPANISHAD SANSKRIT PDF
BIJOY BANGLA KEYBOARD LAYOUT PDF
KAMBA RAMAYANAM EPUB
UNDERSTANDING ENGLISH GRAMMAR WARDHAUGH PDF
SOUNDARYA LAHARI MEANING IN EBOOK
|
cc/2019-30/en_middle_0059.json.gz/line387
|
__label__cc
| 0.749553
| 0.250447
|
Tourism Philippines
Mabuhay! It means "Welcome!" in Philippines. And here, you truly are.
On Tourism Philippines Guide, you'll find friendly unbiased updated travel information for touring Philippines, what to see and what to avoid. More [+]
Posted by Dave Ryan A. Buaron on Apr 2nd, 2009
Filed Under: Bohol, Featured
Philippine Tasier
Bohol Travel Guide
Why go Bohol?
Where & What to eat
Stay away from
Welcome to Bohol, the Philippines’ most whimsical island – from its colourful fiestas, to the 1,268 Chocolate Hills, its top-notch white-sand beaches, dolphin watching, diving, river cruising, tarsiers, Filipino-Spanish heritage houses and churches, an interesting history and warm and welcoming people- it is safe to say that Bohol is quite the Philippines in a nutshell.
TThe Province of Bohol is best known for two things: The Philippine Tarsier which is the smallest primate in the world and the over a thousand intriguing perfectly cone-shaped hills of similar sizes spread out over 50 square kilometres in the island’s centre scattered over in the towns of Batuan, Carmen and Sagbayan. This hills are lovingly called Chocolate Hills (below)- since the grass and vegetation dries out and the hills looked a lot like huge chocolate mounds baking under the tropical sun. The hills are conical karst in nature, which is pretty similar to those seen in the limestone regions of Croatia and Slovenia sans the caves. It is so that the words Bohol, Tarsiers and the Chocolate Hills are so synonymous that one cannot mention Bohol in the same sentence without mentioning the other two. And if that is not enough, chances are you will be able to pick up a souvenir shirt on your way home with Bohol written along with the images of the Philippine Tarsier and the Chocolate Hills emblazoned in front. There are Philippine Tarsier conservation areas located along your way to the Chocolate Hills from Tagbilaran City, the provincial capital. This is where one can check out these nocturnal creatures hanging in the branches of trees along the winding Loboc River.
Speaking of Loboc River, it has become a must for visitors to take the approximately PhP300 lunch cruise (Filipino cuisine) along the green waters of the river which terminates near a couple of small waterfalls. The cruise usually includes an in-house singer, usually a kid from the local school choir, the Loboc Children’s Choir. The choir gained national and international attention, when it bagged the First Prize and the Festival Cup at the 6th International Folksongs Festival held in Barcelona, Spain.
There isn’t a lack of historical places in Bohol for the history-buffs. One can drop by at the second-oldest stone church in the Philippines (oldest is San Agustin in Intramuros, Manila) – Baclayon Church (above), 6 kilometres away from Tagbilaran City. The church has beautiful antique crystal chandeliers, silver tabernacle, an ornately carved pulpit and an altar with gold inlays. Close to the church is the town of Loay, the original site of the blood compact between local Chief Sikatuna and Spanish Captain Miguel Lopez de Legazpi. The blood compact, known as Pacto de Sangre in Spanish and Sandugo in Filipino is celebrated in a festival in July of every year.
For the beach bums and sun-worshippers, Bohol boasts of world-class white sand beaches especially in the nearby corraline island of Panglao of which Alona Beach and Dumaluan Beach are the better known. For divers, Alona Beach (above) is definitely the best place to base oneself, where dive shops and resorts from budget to upper midrange hotels are located. The main drawback is that this tiny strip of beach is such a small community that touts would harass you at every opportunity. Expect to get asked for boat rides and island hopping over 20 times in 24 hours. If Boracay is bad, Alona Beach is the worst when it comes to touts. Food on this beach is overpriced and the taste is not exactly mind-blowing. A heap of boats are also anchored not far from the shore, thus, the ocean scenery is obstructed. In complete contrast, Dumaluan Beach on the same island, has fewer resorts (there are only two- the more expensive Bohol Beach Club and the super-cheap Dumaluan Beach Resort), and has a wider and cleaner beach.
There are at least 13 dive sites around Bohol, with Pamilacan and Balicasag sites the most popular with dolphin-watching an added attraction. Pamilacan Island has an almost year-round convergence point of mackerel, tuna, dolphins, groupers, and hammerhead sharks as well as endemic species of dolphins, melon-headed whales, beaked whales, and the gasp (!), sperm whale. No wonder studies by the World Bank and the United Nations Development Program in coordination with over 100 marine scientists placed the Philippines at the centre of the world’s marine biodiversity with 26,000 square kilometres of coral reef with the highest concentration of marine species per unit area. That’s nothing short like having the Amazon underwater. Up until now, new species are being discovered off the coast of Bohol as with many other research stations all over the Philippines.
Refer to this article: Why go Bohol?
Best Time to Visit Bohol
Refer to this article: Best time to go visit Bohol
Refer to this article: Where & What to at at Bohol
Bohol Nightlife
Nah! Bohol is not known for its nightlife, except for some of the resorts along the Alona White Beach strip which is really not exceptional.
Save up to 75% on hotels in Philippines
Refer to this article: Where to stay at Bohol
1. Hire a van and check out the Chocolate Hills (Never forget the local ice-cream with Pinipig- immature glutinous rice that is harvested, pounded and lightly toasted, similar to Rice Crispies only better, and more fragrant) being sold at the base of the viewing area*
2. Have picture taken with a Philippine Tarsier (Remember to turn off your flash- as the flash can hurt the animal’s eyes)*
3. Lunch at the Loboc River Cruise**
4. Chill out at the Dumaluan Beach*
5. Watch the dolphins at Pamilacan Island **
6. Dive! Dive! Dive!*
7. Check out ‘Prony’- the 14 year old Reticulated Python- the world’s largest python in captivity- in Upper Santa Fe, Alburquerque town (The singing tranny is an added attraction)*
*- Highly Recommended
**- Recommended by Locals
1. Mosquitoes! These blood-sucking critters are present especially during dinners by the beach, have some ready insect repellent lotion handy. For other bugs, ask the hotel staff to do some spraying to contain problems
2. Stray animals: dogs – rabies is prevalent all over the Philippines.
Touts and vendors are a major headache on Alona Beach, but not so much at Dumaluan Beach. Prostitutes (usually Filipinos, and possibly Koreans from nearby Cebu) are usually found around the Alona Beach area but not a total bother.
Philippine Airlines flies to Tagbilaran from Manila (Ninoy Aquino International Airport- Centennial Terminal 2) to the old Tagbilaran Airport. Budget carrier Cebu Pacific also flies the same route, except major delays are frequent and refunding your ticket with Cebu Pacific will take months, if ever you will actually get refunded in the end. Cebu Pacific flies via the new Ninoy Aquino International Airport Terminal 3 (right). Zest Airways (formerly Asian Spirit) also fly to Tagbilaran. Please check their respective websites for more details like flight frequency, schedules, and fares.
For those coming by boat (usually via Cebu), there are heaps of daily trips.
Other ships coming in from Manila, Cagayan de Oro City, Dipolog, Larena, Plaridel, Iligan City, and Ozamis City also sail to Tagbilaran.
Tricycles are the primary means of transport around Tagbilaran City and environs, while vans and a trickle of taxis (sedans) are available for rent. Within Panglao Island, men with motorbikes are also available for hire to go around.
Ryan supports socially and environmentally responsible and sustainable tourism, as well as the promotion of the Philippines as an alternative Asian tourist destination. Learn more about me [+]
Tourism Philippines thrives on the knowledge of the community. Got a tip, photo or even a guide on a place you been to in Philippines? We will love to hear from you!
14 Responses to “Bohol”
Lang says:
Awesome article!
Thanks Lang! :)
I hope you’d be able to find this article helpful in case you plan of traveling to Bohol. Really awesome place!
R.W says:
Some extra information –
Panglao has 2 popular areas for accommodation purposes, the Alona Beach and the Dumaluan Beach (they are about 15 minutes away from each other by car)
Other beaches resorts are quite a distance from other establishments … so it be hard to get your meals etc. If you don’t mind the distance, then Dauis / Anda / Doljo will do the job for you.
** If any other resort along the Alona Beach other than Alona Palm / Alona Tropical promised that they have a nice, wide beach …… don’t believe them!!
** Got this somewhere ** Public transport isn’t plentiful on Panglao Island which is why there are many cars for hire. You can also ask the resort security guard to call a tricycle for you, which is what we did when we wanted to go to BBC (the rate was P 400 for drop off and pick up, a car would charge P500-600).
pktan says:
R.W – Thanks for the extra information : ))
Just wondering – how are the prices of the resorts at Dauis, Anda & Doljo compare to the ones at Alona and Dumaluan.
Thanks RW for that info, Alona Beach isn’t that spectacular though, and the hotels there have seen better days. My friend from Australia got into a really crazy spat with the people of Alona Kew Resort. The beach maybe wider to the left side of the beach but, the sand quality wasnt all that good.
You can also rent a motorbike within the area to go around Panglao.When it comes to prices of the resorts, PK, usually bigger and more established resorts command higher prices but doesnt really translate to quality.
Allan "the barron" Gibbons says:
Brilliant tips and explinations. I will visit the Phillipines again next week and again go through these guides. I must thank you for the help which will again make my trip to my second home very enjoyable!
Thanks Allan! This country is always hospitable and welcoming to friends old and new around the world. Cheers mate!
how long it will take from cebu to bohol by sea ?.and what kind of ship/ferries are available ?..it is normal for tourists who want to visit Bohol from Cebu to take a flight back to Manila and down south again ??
Ferry from Cebu to Bohol is about 1 hour and 40 minutes. I’ve taken that route in the past so no worries there. Basically if you really don’t need to go to Cebu – you can fly direct from Manila to Tagbilaran. But you can also do the Manila-Cebu -Bohol-Manila. It’s a pretty common route. Some actually do this route – Manila-Cebu-Bohol-Camiguin-Cagayan de Oro-Manila route. Cebu-Bohol-Camiguin-Cagayan de Oro routes are covered by ferries (although the Jagna (Bohol)- Mambajao/Benoni (Camiguin) is a little bit unreliable unfortunately). But yeah, actually if you are just backpacking – that’s actually a good swing from Luzon, Visayas and Mindanao!
wayne UK says:
Hi is there anywhere on this island like a camp site and any cheap hotels hostels? but mainly want to camp out on some beach some where or even the chocolate hills be cool.
Hi Wayne,
You can check this place out.
Details: Cogon, Bil-Isan, Panglao, BOHOL ISLAND, Panglao, Philippines, Tel. 00639152873326, Mobile 09152873326, http://www.philaccomadation.bravehost.com
As for camping around the Chocolate Hills, I’m sure you could find a spot to put your tent, but I don’t know if you’ll annoy some local official by doing that.
We intent to visit Bohol from 12-17 December.
What is the weather like in December over there?
We going to view Chocolate Hills.
I understand that March to May is the best time to visit Bohol but we can’t go this period.
I also like to visit Panglao island. Is December the best time for snorkeling?
Hi Steven, normally typhoons enter the northern half of the Philippines until around November, so December should be pretty okay time to go to Bohol. However with climate change, of course no one can guarantee the weather. Panglao faces the open sea so make sure that you have your proper life vests or have somebody assist you with snorkeling.
Trishia says:
I’m from Bohol and I have to say you captured almost everything about our island (including the not-so-good ones, which I also have to agree with). I’m glad you liked the place! :)
Leave a Reply to R.W
LATEST COLUMNISTS
SBS Radio Australia Interview with Scott Allford
Philippines 101 – Origin of Myth
Las Pinas Bamboo Organ Festival
More From Scott M.Allford »
Ask us a question »
Caramoan Peninsula Photos
Hundred Islands Photos
Philippines Festivals Photos
Taal Volcano Photos
Kalibo Ati-Atihan Photos
Chocolate Hills Photos
More Philippines Photos »
Tourism Philippines thrives on the knowledge of the community. Interested in contributing to Tourism Philippines? Help share knowledge for the benefit of all!
Asia Travel Network: Tourism Malaysia | Bohol | Tourism Hong Kong | Tourism Vietnam | Tourism Myanmar | Mongolia Holiday
Sister Sites: Tourism Brazil, Tourism China, Tourism Ethiopia
Copyright 2008 - 2012 © Tourism Philippines | About Us | Authors | Contact Us | Privacy Policy | Disclaimer
|
cc/2019-30/en_middle_0059.json.gz/line392
|
__label__wiki
| 0.897078
| 0.897078
|
You are here: Main » Arsenal chief Venkatesham leaves door open to Wenger return
by Alyssa Little - at November 23, 2018
Former PSG coach Emery has enjoyed an encouraging first few months as Wenger's successor, with Arsenal now unbeaten in 16 matches and buoyed by impressive performances against Liverpool, Fulham and Leicester.
Emery arrived at the Emirates Stadium with the club at a low ebb.
"With Arsene, joy came from attacking, with players of good standing".
"But over time, only technical quality and offensive freedom were taken care of, losing the defensive structure".
"In terms of the difficulty of the teams, it's not just the top teams but all of the teams in the league are very hard because they all have good players and I think that's what makes the Premier League as far as I know the most competitive league around".
Emery also said the players had a long way to go, despite the good start, and any information Wenger had given him wasn't used, adding, "I met once with him, and little else". The Arsenal was in decline.
The former PSG boss was asked if he spoke to Wenger prior to taking the job and said: "Not about the team". Our objective in terms of the table is to finish in the top four.
"At the same time, every competition where there's a title up for grabs is important and that counts for the two domestic cup competitions as well".
"We need to give the team another push", Emery said.
"We came to an Arsenal that hadn't beaten any of the top six and, while we still haven't done so yet, they also struggled to win away from home at all and we have already improved in that area", Emery said.
Arsenal travel to sixth-placed Bournemouth on Sunday as Premier League action resumes, with the Gunners looking to extend their unbeaten run by yet another game. "Arsenal must be big, not let us take advantage of the four above and not let the bottom approach".
Holly Willoughby's Appearance On 'I'm A Celebrity' Splits The Audience
They confirmed: "We are very happy with Holly presenting alongside Dec". "It's lovely that he trusted me with it". Emily Atack , Rita Simons and Fleur East are already friendship goals on I'm A Celebrity ...
Chicago police: Officer shot at hospital
Police did not immediately say how many people were injured and to what extent they were injured. Police are continuing to do a "methodical search" of the hospital, according to Guglielmi.
As he and Fischetti described in a YouTube video in October 2017, doctors found a large football-sized tumor on his adrenal gland. But, he asked me to send you his love and gratitude for all the love and prayers you guys have sent his way", Fischetti said.
Once Upon a Deadpool's first trailer teases Fred Savage's new scenes
For every ticket sold, US$1 will go to the charity Fudge Cancer, also known as F-k Cancer. I need you nearly as much you need me'.
Google launches Pixel 3 Black Friday deals
It allows cameras to capture photos in low-light environments and helps to improve the overall light in the final processed image. The update began rolling out yesterday, but some Pixel users might have to wait a couple of days before receiving the patch.
And Mbappe has a shoulder contusion after falling heavily in France's 1-0 win over Uruguay at the Stade de France. Neymar was replaced at Stadium MK by Everton's Richarlison, who scored the only goal just before half-time.
Jennie-O Recalling 91K Pounds Of Ground Turkey In Salmonella Outbreak
Ahead of Thanksgiving, and any other night you're planning on cooking a turkey, do not forget to thoroughly wash your hands . Experts urge consumers to practice good food safety when handling raw turkey in the kitchen this holiday season.
This year, you can get up to 40% off over a hundred digital titles - from recent AAA blockbusters to popular indie hits. Walmart Black Friday savings are here, and they include deals on everything from 4K TVs to robot vacuums.
Chris Watts sentenced to life for murders of pregnant wife, daughters
Watts told detectives that he was having an affair. "He lied about everything", Kessinger later told the Denver Post . She says the pair only started dating in July, and that Watts told her that he was in the final stages of a divorce.
Basketball world holds its breath over rookie's horror injury
I think everyone's been handling it the best way they could and we're just trying to move forward with it". Kerr appreciated the Warriors' efforts to support fire victims during a "tragic time". "...
The company's same-store sales growth, which is a key metric for retailers, stood at 5.1 percent, lighter than forecast. Industrial companies are also dropping as the downward momentum in stocks builds after steep losses Monday.
Romaine Lettuce Unsafe to Eat in Any Form — CDC Alert
If there is fever, it is usually not very high (less than 101 degrees Fahrenheit/less than 38.5 degrees Celsius). In fact, the alert includes advice on how to clean your refrigerator if romaine has been inside it recently.
Washington Post Sports Section Publishes Ill-Advised Front Page After Alex Smith Injury
In 2011-12 - his last two seasons as New York's starter - Sanchez threw a combined 36 interceptions and fumbled 16 times. Gruden said Monday that Sanchez was the pick to sign over Kellen Clemens , Josh Johnson , T.J.
Saudi Crown Prince bin Salman ordered Khashoggi killing — Central Intelligence Agency
Saudi Arabia is a major oil supplier and a close ally of the United States in countering Iranian power in the Middle East. Trump faces intense pressure from senior Democratic and Republican lawmakers to take tougher action against Riyadh.
British PM says her removal might affect Brexit negotiations
"These next seven days are going to be critical, they are about the future of this country", May told Sky News . Altmaier said: "I am sure that if one side undoes this package, other sides also will probably try to undo it".
Jarryd Hayne has been arrested by Sydney police
Australian rugby league player Jarryd Hayne is being questioned by New South Wales Police over an allegation of sexual assault. The woman originally made a complaint to the NRL's Integrity Unit about the incident who referred the woman to the police.
Trump awards the Presidential Medal of Freedom to Babe Ruth, Elvis Presley
Reacting to the award Mrs Adelson told reporters she was "deeply humbled and moved by this exceptional honour". Ruth's grandson Thomas Stevens accepted the award during a ceremony at the White House .
Hundreds of protesting PNG police move in on Parliament over pay
Best Black Friday 2018: Games, Play Stations, and Controllers, PS4 DEALS
Fight over Jim Acosta's White House press pass seems far from over
Trump vows to visit USA troops in war zones
1m Protester killed during French fuel demonstration
Condi Rice to be Cleveland Browns' head coach?
Floyd Mayweather vs Tenshin Nasukawa fight 'back on'
Mateo Kovacich: Chelsea star begs Lampard to teach him how to score
Federer Defeats Nadal to Reach Wimbledon Final; Djokovic Next
Calgarians shine at 2019 MLB All-Star Game
76ers, Ben Simmons agree to contract extension
Grizz, Wolves advance to summer league finale
Novak Djokovic Beats Roger Federer In Longest Wimbledon Final
India didn't plan properly for No. 4: Yuvraj Singh
AFCON: Super Eagles must now re-double their efforts - Adepoju
All the work's done, Federer says ahead of Wimbledon final
|
cc/2019-30/en_middle_0059.json.gz/line393
|
__label__wiki
| 0.565505
| 0.565505
|
Generic Geek Podcast
Movies That Make Us
Stolendroids Podcast
SDFiles
Warning: call_user_func_array() expects parameter 1 to be a valid callback, function 'easy_hide_login_hidden_field' not found or invalid function name in /home/stolendr/public_html/wp-includes/class-wp-hook.php on line 286
7 Unique Geek Gifts for Valentine’s Day
Amber Dahl
New Comic Will Reveal More About Snoke
Zohner
DC Comics Kills Vertigo
Toy Story 4 – The Sequel That Reaches for the Sky
Scoops Mangum
Dc's Lobo Seeking Michael Bay for Director
Collin Farmer
Uncharted Film Gets a Release Date
Justin Wager
A Punky Brewster Sequel Is Being Developed
Meet Brigitte, Overwatch's Latest Hero
Derek Dahl
Dr. Mario Goes Mobile
Turbografx-16 Mini Announced by Konami
Cyberpunk 2077 Has Keanu Reeves and a Release Date
Screaming Deal - Microsd Cards
Zuke
The Raspberry Pi 4 Is Here
YouTube TV Gets Price Increase
Spark for Android Is Here
The Last Jedi Reviewed - GGP 26
Disney’s Dongle – SD – Ep #378
Episode 21 – All Wallpaper is Lickable
Jake Dietz
Drunk on Tom Holland – MMU 20
New Star Wars Tv Spot with New Footage
The First Trailer for Batman: Hush Is Here
Rocketman Video: Taron Egerton Sings Elton John
The Avengers Cast Have a Lot of Fun Together
Second Hobbs & Shaw Trailer Goes For Broke
Ben Fuller
Disney Drops First Full Trailer for The Lion King
The Addams Family is Back
When Pixar announced Toy Story 4, I was incredibly skeptical. The original Toy Story was groundbreaking and thrilling. Toy Story 2 was the first Pixar film to make me cry in the theater. Toy Story 3 was not as great as the first two but ended the trilogy beautifully. I didn’t believe that there were any more stories to tell with Buzz, Woody, and the rest of the toys we know and love. I was afraid this was a cash grab and that the humor, the heart, and the story would be less than what these characters deserved. I worried when Rashida Jones left the film, worried when John Lasseter’s issues became public and worried with news stories of rewrites and tales of disenchantment behind the scenes.
I am here to say that I was wrong. Toy Story 4 is the funniest of the films, and rates just behind Toy Story 2 for me.
This is Pixar at the top of their game. Themes of knowing your place in the world, accepting your purpose, and how to still have a love for others that have moved on without you are heavy topics that could swamp lesser artists, but Pixar moves you from laughter to tears effortlessly.
The third Toy Story saw the toys given to Andy from Bonnie and appeared to give Woody, Buzz, Jessie, and their friends a new home and a new lease on life. But, Bonnie is a much different child than Andy was, and this has Woody lost as to how to help her. She chooses other toys to play with and leaves Woody in the closet where he collects his first dust bunny. He’s hurt, but he won’t show it in front of the other toys. He’s still going to be an optimistic leader and will be there when Bonnie chooses to play with him again. In one poignant scene, he tells Buzz that he doesn’t remember it being this difficult before. Bonnie’s struggling to adapt to her kindergarten orientation, where the other children aren’t playing with her, so Woody inadvertently creates a brand new best friend – Forky. Voiced by Tony Hale, Forky is a neurotic plastic spork with different sized googly eyes, pipe cleaner arms, broken Popsicle feet, and a Play-Doh mouth. He’s made of items that had been thrown away and is convinced that he’s not a toy. It’s up to Woody to teach him that to Bonnie, he’s the most important toy in the world. This is more than just a child with a toy, it’s a metaphor of the sharing of love between one who cares and one who receives that care: for parents, children, lovers, and ex-lovers.
The main plot of each of the Toy Story films has centered around a toy going missing, and that is the case again here. Forky says he “was made for soup, salad, maybe chili, and then the trash.” and he keeps trying to jump into the warmth and coziness of any nearby trashcan and Woody has to keep bringing him back to Bonnie. When the family leaves town for a road trip before Bonnie officially starts kindergarten, Forky slips out of a window, and Woody bravely jumps out of the moving RV and vows to meet the other toys at the RV park 5 miles up the road. He finds Forky and starts the long walk back to Bonnie. Woody shares his story – Andy, the other toys, finding Bonnie, and reinforces the idea that Forky has become the most important, and most loved toy in Bonnie’s collection. Ultimately, they arrive at the RV park where the small town has an antique shop and a carnival that play big roles in the plot. Woody is reunited with Bo-Peep and her three-headed sheep who were absent for a lot of Toy Story 2, and all of Toy Story 3. We learn where she has been and the adventures she has been having. They meet new characters – Ducky, Bunny, and Duke Kaboom steal the show and Gabby Gabby and the Ventriloquist Dummies named Vincent round out the rest. The other toys like Mr. Potato Head, Jessie, Rex, all take a back seat in this adventure. The film is solidly centered around Woody and Bo-Peep.
During this journey, our cowboy discovers what it’s like to live without a child, becomes a parent to Forky, an adventurer/love to Bo, a friend to new and old toys, and discovers his place in this new world. The relationship with Bo is rich, rewarding, tender and truthful – they have been together over 20 years now you know. Bo is the anchor of the film, and he heroism, her love, her heart, her sensitivity, wisdom, and kindness to the other toys is both beautiful and stirring. Annie Potts smashes these complex emotions out of the ballpark and brings real depth and soul to the character.
One of the major themes of the film is the false idea that once you arrive at the end of a goal, you will be happy. When Woody finds Forky, he’ll be happy. When Bonnie is reunited with Forky, she’ll be happy, when Gabby Gabby gets her broken voice box fixed, she will be loved by a child. In a lesser “children’s movie” things would work out and everyone would live happily ever after. Toy Story 4 aims higher and delivers an ending that is complex, emotional, strong, humorous, and full of heart. It doesn’t end the way I envisioned, but it ends the way it should, and isn’t that a lesson for us all? After 20 years of giving love and joy to children, 20 years of friendship with other toys, 20 years of adventures, Woody finds himself at the top of the world. “Was it as wonderful as it sounds?” Gabby asks Woody. The answer is a resounding yes. Every moment of it. As Neil Peart wrote, “The point of a journey is not to arrive – anything can happen.”
At its heart, Toy Story 4 is a film where a cowboy toy from the 1950s tries to find purpose in a world that passed him by – and by extension us. Woody has always believed that his goal is to provide and care for Andy, Bonnie, and whatever kid he belongs to; that’s his code. But with Forky’s help, Pixar takes a step back and asks us and Woody to re-evaluate his beliefs. Change is inevitable and there is a loss that goes with it. But, there is also friendship, adventure, and love. Woody might have been created for the love he has to give, but he’s only alive because of the love he’s received in the end.
The film is filled with tiny, beautiful moments like Bonnie’s tiny, quiet fear upon entering a busy and noisy classroom; Woody’s blissful expression when Bonnie accidentally holds him in her sleep instead of Forky, the fear of a talking doll with a broken voice box who is afraid a child will never love her; the break in the voice of a weary cowboy who isn’t sure he’s ready for change; Buzz learning to trust his inner voice; and maybe hearing the phrase “To infinity and beyond!” for the very last time.
I had my doubts that I needed a Toy Story 4, but after the credits ended (and stay through all of the credits) it turns out I wanted and needed this last adventure, this one last chance to say goodbye. Thank you, Sheriff Woody, you’ve got a friend in me for sure.
Toy Story 4 - The Sequel That Reaches for the Sky
It turns out we did need Toy Story 4. The film is funny, heart felt, and full of heart.
Cinematography97%
Acting98%
Music97%
Humor100%
98%Overall Score
BullseyeBunny and DuckyBuzzDisneyDuke KaboomJessiePixarTim AllenTom HanksToy Story 4Woody
Water Is Wet – SD – Ep #376
Editor & Show Host
Tracy’s love of movies started when he first saw Star Wars in the theaters. He graduated from the University of Utah with a degree in Film Studies after which he taught film classes for more than 10 years. He loves all genres of film, but animation and science fiction are two of his favorites. When Tracy isn’t watching movies, he can be found training for his next half marathon, serving members of Salt Lake City’s homeless community with The Kindness Project, or spending time with his amazing wife.
Drinking the Disney Kool-Aid – MMU 19
BE ENTERED TO WIN A FREE T-SHIRT
Keep yourself updated on the latest news from geek culture to technology, we've got you covered.
Awaken Online: Catharsis Is the Litrpg You Need
Mil Ruko
Podcast Episode #218 – Contextual Sticky Goodness
About Our Podcasts
© STOLENDROIDS MEDIA ALL RIGHTS RESERVED
Collin’s Rabbit Hole – SD – Ep #377
|
cc/2019-30/en_middle_0059.json.gz/line394
|
__label__wiki
| 0.822651
| 0.822651
|
AMA #37: John Smith (Slide20xl), Composer & Sound Designer
August 8, 2018 August 8, 2018 by Livio De La Cruz
John Smith is a composer and sound designer based in Seattle who works under the name Slide20xl. His credits include music and sound design for the VR title Rec Room, the neuroscience game EyeWire, and an upcoming rhythm game which will feature music from Grant Kirkhope and other big-name composers. Check out his website and Twitter.
http://audiomentoring.com/
http://www.audiogang.org/
YouTube: Neil Gaiman 2012 Commencement Speech “Make Good Art”
Categories Industry Speaker Series: "Ask Me Anything"
[Event] AMA #37: John Smith (Slide20xl), Composer & Sound Designer
Sunday, August 5 at 4:00pm PST
The event will last for one hour.
Time converter at worldtimebuddy.com
The IGDA Students Discord Server
Use the #ask-me-anything channel for text, and the 🔊AMA Voice channel for voice chat. Both channels can be found under the “Event Channels” category.
Read more[Event] AMA #37: John Smith (Slide20xl), Composer & Sound Designer
AMA #36: Gideon Gyabaah, President and Technical Director at Illuminia Studios
July 28, 2018 by Livio De La Cruz
Gideon Gyabaah is an indie game developer who grew up in Ghana and Côte d’Ivoire. He currently lives in Canada where he attended university, then worked as a web developer, a game development instructor, a developer at GameTronics (they make electronic slot machines), a localization engineer at THQ. Today he runs his own indie company called Illuminia Studios, where they make games inspired by Afrofuturism and other Indigenous cultural thematics. His current game is called BOAA (Bounty On An Asteroid). Visit his website and follow him on Twitter.
Illuminia Stuido’s BOAA
https://developers.eos.io
https://www.meetup.com
[Event] AMA #36: Gideon Gyabaah, President and Technical Director at Illuminia Studios
Saturday, July 28 at 11:00am EST
Read more[Event] AMA #36: Gideon Gyabaah, President and Technical Director at Illuminia Studios
AMA #35: Coraly Rosario, Senior UX Designer at Scopely
Hailing from the beautiful island of Puerto Rico, Coraly’s adventure started over 12 years ago when she first took interest in graphic design and teaching. Later, her innate interests naturally evolved into a love-affair with UI/UX in games, working at startups like Beyond Games, Fingerprintplay, and continuing to teach others about user research and experience design in the mobile games industry. She’s currently a Senior UX Designer designer at Scopely on the Wheel of Fortune team. Follow Coraly on Twitter.
IGDA User Research SIG: Website, Discord
Proto.io
Beyond Games
Hexagon UX
Techqueria.org
Mixed Methods
Designer Hangout
[Event] AMA #35: Coraly Rosario, Senior UX Designer at Scopely
Tuesday, July 24th at 5:00pm PST
Read more[Event] AMA #35: Coraly Rosario, Senior UX Designer at Scopely
AMA #34: Mike Sellers, Director of the Game Design Program at Indiana University
July 19, 2018 June 26, 2018 by Livio De La Cruz
Mike Sellers has been in the games industry for decades. He was the lead designer for Meridian 59, the first 3D MMO game. He’s also worked on The Sims 2, Ultima Online, a mix of indie, AAA, retail, and F2P games, and he once worked on AI for DARPA. He is currently teaching at Indiana University, where he is the Director of the Game Design program.
This is a recording of an “Ask Me Anything” (AMA) session with Mike Sellers, hosted by the IGDA Student SIG. If you’re interested in doing an AMA with students, you can sign up here.
[Event] AMA #34: Mike Sellers, Director of the Game Design Program at Indiana University
Tuesday, June 26th at 2:00pm EST
Read more[Event] AMA #34: Mike Sellers, Director of the Game Design Program at Indiana University
AMA #33: Elaine Gomez, Game Designer & Content Developer at E-Line Media
“I was born and raised in Puerto Rico. I love story-driven, adventure, puzzle, and platformer games. I’m a big horror fan. My Twitter handle is @chulatastic, and my company’s website is elinemedia.com.”
Elaine works at E-Line Media, the company that created Gamestar Mechanic and they worked with Upper One Games to publish Never Alone. Elaine works as a game designer/content developer, and she’s also an instructor at E-Line Media’s youth gamedev program Make Room. Outside of work, she’s developed over a dozen little games, many of which involved custom hardware.
This is a recording of an “Ask Me Anything” (AMA) session with Elaine Gomez, hosted by the IGDA Student SIG. If you’re interested in doing an AMA with students, you can sign up here.
[Event] AMA #33: Elaine Gomez, Game Designer & Content Developer at E-Line Media
Thursday, June 21st at 7:00pm EST
Read more[Event] AMA #33: Elaine Gomez, Game Designer & Content Developer at E-Line Media
|
cc/2019-30/en_middle_0059.json.gz/line396
|
__label__cc
| 0.544411
| 0.455589
|
Menu - - - -
SuperHeroes' SuperBLOG
The blog of the agency everybody is talking about.
10 Years of SuperHeroes
We celebrated the party of all parties: 10 years of SuperHeroes!!!!! 🎉
What a crazy fun ride this last decade has been… and what a crazy Friday night it was. We’re still buzzing with excitement (or should we say recovering 😉) from a full night of festivities!
The night began with a heartfelt speech from SuperHeroes founders Django and Rogier.
Noteworthy highlights, unforgettable memories, eventful stories, and emotional tearjerkers were recounted. There wasn’t a dry eye in the house, and thankfully, they were just happy tears. Much to Django and Rogier’s surprise, they were presented with a one-of-a-kind gift: a tandem!
After that great speech the party really started to rock when band Indian Askin literally rocked our socks off with their head-banging performance.
Next was DJ Cream, who got partygoers flaunting their best footwork with his selection of groovy beats. To give guests that extra liquid courage for the dance floor, the guys from V2C Gin had gin and tonics flow freely all night long.
Many eternalized the night by snapping a couple of shots in the balloon-filled GIF booth and all guests took home one of the coveted goodie bags.
No police officers showed up on our doorstep this time, but we damn sure had a blast.
We can’t thank everyone enough – all SuperHeroes, ex-SuperHeroes, Sidekicks, ex-Sidekicks ànd plus ones – for celebrating this milestone with us. On to the next 10 years!
If you’re brave enough to check out all the funny, silly, cheerful, fabulous and not so fabulous (joking!) party pics, do so on our Facebook page.
Last but not least, check out this tribute from the guys who started this whole thing:
‘Never a dull moment’: we’ve said it so many times. Starting your own agency is one for the crazy ones. It’s an endless stream of exciting victories and pitiful losses; of difficult and sometimes painful decisions and a non-stop flow of stuff, and more stuff.
But who cares? It has been amazing! We’re so proud. Going from two young men to becoming a thriving independent agency with 50 Heroes from all around the globe, plus an office in New York and soon Singapore as well… wow.
Are we done yet? Hell no. When we started, we said: ‘Screw it, let’s do it.’
And that’s still what we fully believe in. We want fame. We want to be the most fun and best agency to work with. We want to give each and every one of our clients the time of their lives.
We, SuperHeroes, are on a mission to save the world from boring advertising. So many exciting adventures are waiting. But first, thank you all Heroes, Sidekicks, partners, and clients so much for the past ten years.
There’s no way we could’ve done it without you.
Let’s fly!
– Django & Rogier
SuperHeroes develops the first international campaign for Swapfiets
The iconic blue front tire can no longer be missed in our street scene. Swapfiets is widely known in the Netherlands in the cycling cities in the Netherlands. To further expand their success, Swapfiets and SuperHeroes Amsterdam are launching an international campaign to tie the cycling ‘young professional’ to the brand with the addition of the new Deluxe bicycle.
Not just in the Netherlands, but in more than 20 cities in Belgium, Germany and Denmark where Swapfiets is active.
It is the first international brand campaign for Swapfiets and its subscription-bicycle proposition. The essence of the campagne is that Swapfiets unburdens you. You no longer have to worry about repairs or maintenance of the bike, so you have the freedom to do all the other things that you find fun and important. Naturally, the iconic blue front tire stands out in all the colorful images.
The campaign consists of an extensive outdoor campaign in the cities concerned. There is also a digital campaign with a strong focus on social storytelling.
SuperHeroes Amsterdam appoints Marc Pieterse to Head of Strategy
Marc Pieterse has been appointed to Head of Strategy at SuperHeroes Amsterdam. He previously worked as a Strategy Director at Ogilvy and N = 5. Marc started in advertising 15 years ago at N = 5, where he developed into an impassioned brand strategist on accounts such as KPN, Mercedes-Benz, and Marktplaats.
Marc was responsible for the famous Telfort campaign that transformed the brand from a price slasher into a full-fledged brand that customers could greatly benefit from.
After a year of working on campaigns for Netflix, Essent, ASUS, Eurojackpot and energiedirect.nl at SuperHeroes, and learning to understand digital buzz words, he was appointed to Head of Strategy.
“So much is happening in the world of advertising and that change is really embraced here. We now call ourselves the ‘post-advertising ad agency’ (wink, wink ;))
With the combination of the agency’s digital DNA and my solid brand strategic background, we offer brands a magical combination of strategic superpowers full of innovation and with a strong focus on creating awareness for the brand in the current fight for attention.
At SuperHeroes we have the ambition to really advance the profession”, says Marc.
Founder/managing director Django Weisz Blanchetta adds: “Our Amsterdam Strategy team is accelerating quickly with Marc at the helm. Together with Geoff Desreumaux, our strategy lead in New York, we have developed a strategic and creative approach which is having an impact both in the Netherlands and globally.”
“I love the internet, especially when it doesn’t take itself too seriously”
Rogier Vijverberg of international creative agency SuperHeroes was the curator of ‘Random Pic(k) Of The Day For A Week’.
For a year now, Nils Adriaans has been asking people who work in the advertising industry to curate his column ‘Random pic(k) of the day’ for a week. “I post a visual/film/music video/poem of his or her choice and a brief explanation on why they chose the excerpt on my Facebook page.” Additionally, Nils has been gathering all the contributions of his curators on Adformatie every Friday.
This week, Rogier Vijverberg, ECD and co-founder of SuperHeroes Amsterdam / New York / Shanghai (the only Dutch international creative agency), was the curator for the week.
“Back in the day, before we had three hours of screen time on our hands, the Internet was our main source of interactive entertainment. We’ve lost it a bit in the frenzy of Instagram and YouTube, but I still love the internet. And certainly when it doesn’t take itself too seriously. Forget all the crazy internet and hateful comments or the deadline that is waiting. Just randomly click on a couple of buttons for 5 minutes. Or you know what, slap someone in the face with an eel? That’s great. I’ve chosen a few of my personal Internet favorites over the years.”
Here are the five contributions from Vijverberg:
1. Like fish?
Eel slap.
2. It’s way more fun to find what you absolutely don’t need
You can go to bol.com or Coolblue.nl and find what you probably need. But it’s way more fun to find what you absolutely don’t need. The website thisiswhyimbroke.com is full of useless gadgets and freaky products.
3. Google for pointless websites
If you don’t feel like searching for useless things, there’s luckily also a Google for pointless websites. Click on the Bored Button and see hundreds of interactive websites.
Disclaimer: it’s addictive, sorry.
4. Infinite viewing pleasure
Okay, this one’s a little more serious. There’s a lot disappearing from the Internet, but Archive.org is our collective Internet memory. The Prelinger Archives is part of the website. Here you’ll find thousands of American videos from 1903 ’til the present day. And not just the famous blockbusters, but everything. From home movies and government movies to old road trips. Infinite viewing pleasure.
5. Rafaël Rozendaal
Rafaël Rozendaal has been my favorite web artist for years now. Websites as colorful artworks in which you can lose yourself for a while, but also legendary guilty pleasures such as Paper Toilet. He now builds interactive installations all over the world, but also remains true to his roots. Check his latest work here: Some Still.
Originally published on Adformatie.
MEANWHILE IN CHINA…
Good company, drinks, snacks and of course, clever things being said and new information being shared!
It was time for another edition of our ongoing HOLLA series in which we x-ray today’s hottest communication phenomena, cultures, and trends. The theme for HOLLA 6 was “Meanwhile in China…”. We focused on how WeChat is impacting modern-day commerce in China and transforming every sector of the economy, from fashion to travel to education. And how it will possibly take over Europe…
After a short introduction from SuperHeroes Managing Director Django, we welcomed NextportChina, China digital marketing agency, and WeChat marketing specialist, as our very special guest for the evening. And boy, no stone was left unturned about this Chinese social media platform that doesn’t just serve as a payment system and shopping platform, but also a news service, transport gateway and more.
Interesting insights, thought starters and perspectives were shared with our audience of clients and industry professionals. To wrap it up, we had a fun little Kahoot quiz ready.
For many Chinese people, WeChat has in no time become a way of living. It is more than a social messaging network: it’s a payment system, a shopping platform, a news service, a transport gateway, and so on. The service is transforming every sector of the economy, from fashion to travel to education.
Will it reach those heights in Europe as well? Time will tell.
Thanks everyone for coming out and stay tuned for our next HOLLA!
And give WeChat a try yourself of course ;-)
We're on a mission
SuperHeroes is a digitally born and raised, ever-evolving international creative agency.
That’s a mouthful, better yet, we’re THE SUPER AGENCY.
Follow our social channels
SuperHeroes Amsterdam
1017 DR Amsterdam
airmail@hellosuperheroes.com
SuperHeroes New York
Brooklyn NY 11211
searchlight@hellosuperheroes.com
|
cc/2019-30/en_middle_0059.json.gz/line398
|
__label__cc
| 0.614261
| 0.385739
|
SPNews
Supernatural Gifts
Monday News for Thanksgiving Week
The Truth About Fairies...
Vote for Jared!
Supernatural News
All Dogs Go To Heaven Recap
How About that Jared?
The Winner of the Six Degrees Game
Six Degrees of Jared and Jensen
So after the major walloping Dean delivered last week we open with a bloody and battered Sam tied to a chair and Cas looking over him. Dean and the surly angel are trying to figure out what’s wrong with Sammy.
“What? You think there’s a clinic out there for people who just pop out of hell wrong?” --Dean
After some questioning, they realize Sam doesn’t sleep. He hasn’t closed his peepers since he got back from Hell. Next Cas asks him how he feels and like a fifteen year old boy Sam says, “I don’t know.” The lack of feeling raises suspicion in Cas and he shoves a belt into Sam’s mouth. (Uh oh, I know what’s coming.) Sam bites the leather in agony as Cas reaches into his chest and searches for his soul. It ain’t there.
“One more time, like I’m five.” -- Dean
Dean is stunned. Castiel says Sam’s soul is probably still in Lucifer’s cage. Dean wants to know if Sam is actually Sam then. Cas says that’s a good question. Dean wants to keep his little brother locked up indefinitely, but Sam proves that impossible. (Okay, he escaped some ropes, but to say a panic room couldn’t hold him makes me wonder if he’s capable of more than we know.)
Ultimately Dean and Sam decide the best course of action if to find out who resurrected him. Only Sam doesn’t remember anything. He woke up in a field, but he thinks Samuel might know more since he too was brought back.
The old man says he doesn’t know anything more than Sam does. Samuel just remembers waking on a ridge. Cas does an “angel cavity search” and finds (Whoo-boy. Didn’t expect that.) Samuel DOES have his soul. Hmm. I figured if anyone was evil, it was him. And yet he says he knew there was something wrong with Sam, because at times his hunting abilities actually scared him.
The boys want to know what Samuel's up to now. He reluctantly admits he’s going out at dawn to hunt the alpha vampire. Sam is upset his grandfather didn’t call him. Dean quickly realizes they were left out because the senior Winchester doesn’t like Dean. Dean tells him he wants in on the hunt and he’ll be good and obedient. A minute later he tells Sam he doesn’t trust Samuel, he can feel he’s hiding something.
“If you weren’t RoboSam, you would too.” -- Dean
Dean goes snooping for answers and has a confrontation with Christian. The next morn, Dean is relegated to the back of the line with Gwen, where they’re attacked by a vamp. Gwen beheads the bloodsucker and Dean is sprayed with blood. Nastiness!
Dean hears a shot and tears off after the other team, not following the “stay here” directive he’d been given. Bodies litter the front yard of a house, shots and screams are heard. Dean looks up at a crow weather vane on the roof and flashes on the images he had when he was a vampire under the Alpha’s power. Then he sees a woman beg for help at a window before she’s yanked away.
Dean hears Samuel yelling so he follows the sound to the back of the house where baldy is shoving a hooded man into a van. It’s the guy with the long fingernails from Dean’s vision! Dean hurries back to Gwen so no one knows he saw anything. Samuel shows up and Dean questions him about what happened. Samuel lies. Dean gets in the Impala with Sam and asks if anything unusual happened. Sam lies! Fortunately, instead of merely stewing over his brother’s treachery, as he’s recently done a lot of, Dean pulls over, gets out of the car and tells Sam what he witnessed. Sam admits he didn’t want Dean to know Samuel’s capturing creatures for intel. Dean calls Sam out on his cluelessness. Surely, he must see Samuel is up to no good. Then Dean has an epiphany… Sam has no instincts. Losing his soul also cost him his gut feelings. Sam is blindly trusting Samuel just because of their blood relation. Dean tells him family may not be as important to Samuel as it is to them and he shouldn’t be trusted just because of their familial lines. He then tells Sam he can stick with him, but he has to follow what Dean says since he’s freakin’ clueless, or he can choose to go with Samuel and see how that goes.
Sam shows up at Samuel’s place. He tells his grandfather Dean is gone, that the two of them aren’t seeing eye-to-eye anymore. (I think he’s there at the behest of Dean.) Sam then tells his namesake he wants in, that he’ll help with the interrogations and everything. Samuel says no, because of his absentee soul. (Ha! I’m right.) Sam meets up with Dean and says Plan A didn’t work, but Plan B—which Dean didn’t know about—did. Sam enabled the GPS tracker on Samuel’s phone. They follow him and Christian to a vacant warehouse.
“He thinks Velcro is big news.” --Sam
Oy! The Alpha has bolts nailed through his hands and feet. How biblical. He’s also strapped to a chair with chains and hooked up to electricity. Samuel asks him “where is it?” When the creepy-cool vamp doesn’t answer,Samual sends volts of electricity to the bolts. The vamp laughs and blithely says, “Ow.” A frustrated Samuel leaves and the Alpha invites Sam and Dean out of hiding.
Oh my, they’re pumping the Alpha with dead man’s blood through an IV. He doesn’t look the least phased though and watching his fingernails saw away at his bonds makes me nervous. Even more nerve-wracking is that he knows Dean, since he was his child for a short time. He taunts Dean, wanting to know if he enjoyed it.
“I’m asking the questions here, Frightnight.” – Dean
Alpha tells them he’s happy to answer any questions they have because “soon I’ll be ankle deep in your blood, sucking the marrow from your bones. “ Yipe! Sam marvels over him being the first and wants to know who made him. The Alpha says,“we all have our mothers, even me.” Dean wants to know what’s with the big surge of vamps and Alpa tells him they’re going to war. Then he notices Sam smells cold, that he has no soul and he wants to know how it feels to be so empty. Sam says he wants to know why Samuel is interrogating the Alpha. The Alpha says when freaks like himself die they don’t go to either Heaven or Hell. Dean glibly suggests they go to Legoland, but Sam realizes he means purgatory. Turns out the mid-place is full of every soul, of every hungry thing that walked the Earth. The real question of the day is, “WHERE is purgatory?” The answer to that question is what they’re kind-hearted grandpa is trying to beat out of the Alpha. Sam asks why Samuel would care and Alpha says he doesn’t care, he merely does what he’s told. Dean asks whose hand is up Samuel’s ass when they hear someone behind them cock a gun. Damn! You know it’s the puppet himself.
Yup, Samuel and Christian take away Dean and Sam’s impressive arsenal. Dean accuses gramps of being really stupid, that whatever he’s doing, whatever he’s hiding, will put him and everyone around him in the ground. Samuel takes offense and charges Dean, who disarms him. Sam then gets a hold of Christian and just as Dean’s going for a gun, putting them back in power, Gwen shows up with a cocked gun in hand.
One of Samuel’s minions was left to watch the alpha. Mr. Brawn and No Brains approaches the cage, machete in hand and the alpha asks, “Are you scared of me. I would be.” In an effort to demonstrate his fearlessness the ill-fated guard pulls the switch on the electricity. As the juice goes through the alpha, he breaks his bonds and yanks out the IV. The guard turns to run, takes one of those trite horror movie trips I hate and notices the cage behind him is empty, as he leaps up to run out of the room he finds the alpha standing before him. The camera cuts to the Winchesters who hear an unholy scream. Dumb dude’s dead and the alpha is gone. Big surprise. Not.
Samuel wants to know how much dead blood they have left. Christian holds up two syringes. They’ve got an hour before the alpha will be back at 100%. Samuel wants him back in the cage, Dean wants him dead. They spread out to find the master vamp. Dean says if they make it through this the three Winchesters are going to have one helluva family meeting.
The two Sams are on a team with Christian. Just as they start to wonder if the alpha escaped, he shows up in a blink and breaks Christian’s neck (good riddance). Samuel puts a slug in Alpha before he’s thrown into a wall. Sam attacks the vamp with his machete, but he’s quickly disarmed. Alpha informs Sam he’s got big plans for him. A boy with no soul would make the perfect animal. Just as Alpha flashes fang, Christian (Holy Hell, he’s got black demon eyes!) jabs him in the neck with a syringe. Dean and Gwen walk in on the scene. There’s a flash of light and two more demons join Christian in holding the alpha. Another flash of light and they all four disappear. WTH? Then we hear weak applause offscreen and the camera pivots to Crowley. Samuel tells him to remove the demon he just stuffed into his nephew, but Crowley tells him he protects his investments and he had Christian possessed ages ago. Dean is stunned to learn they know each other and have some sort of business pact.
“You’re Crowley’s bitch.” –Sam
It seems Crowley wants Purgatory as a developer. “It’s vast, underutilized and Hell adjacent.” Crowley tells the boys they’re now his employees thanks to Gramps. He says Samuel knows things, more than any of them. The smug demon also admits he knew the boys misguided family loyalty would have them going froggy if Samuel said jump. Dean assures Crowley they have no loyalty to Samuel, but the King of Hell tells them they can’t pull out of their deal if they want Sam’s soul back. He can return the missing piece with the snap of his fingers. Turns out it was him that pulled Samuel out of Heaven and Sam out of Hell. (I did not see that coming!) And gramps knew all along. (Now that doesn’t surprise me. Bastard!)Big picture—Crowley wants the Winchesters to keep bringing him creatures or he’ll shove Sam back into Hell.
“Me Charlie, you angels.” – Crowley
Crowley bails and Gwen questions Samuel. He says he’ll take care of Crowley, in the meantime they hunt. Nothing’s changed. Sam tells him he’s not the man he thought he was. Samuel says he doesn’t know a thing about him. He’s certainly not apologetic or in any way trying to make good with the boys. He won’t even share his reasons for making the deal with Crowley and I think the boys deserve that much since he dragged them into his muck.
“What’d he offer you, girls, money, hair?” – Dean
Then he has the audacity to pull out the damn family card. They’re all he’s got, but as he sees it they’ve got two choices--put a bullet in their grandfather or step aside. Sam yanks his gun out and I’m inclined to let him shoot his namesake, but Dean stops him even though Samuel sold them out. Dean then lets gramps go. Why? And WHY didn’t Dean insist on answers? He’s certainly been hard-nosed about knowing something was wrong with Samuel and then, once he’s proven right, he does a whole lotta nothing.
Left alone, the brothers talk about how they don’t want to work for Crowley, but really don’t have a choice. So, for now, they’re gonna punch the demon’s timeclock until they can figure out how to get Sam’s soul back and take down the King of Hell. Good news is we’ll see more Crowley, bad news is we’ll see more gramps and we still have no clue why he’s sold them into slavery. Think maybe it has to do with daughter Mary? What’s your theory? As for the episode itself, it was jam-packed, but I didn't care for it much. Some great one-liners and I liked the Crowley reveal, but I'm missing the old spirit of the show. I want Sam's soul back ASAP, more Castiel, more classic rock and a little more levity please.
Posted by Anonymous at 12:56 AM
Labels: Episode Review, family matters, Jared Padalecki, jensen ackles, Misha Collins, Supernatural
Terri, you did such a good job with this recap I was surprised at your opinion at the end!
I have divorced my feelings from my past passion. I don't want to lament that it's different--I want to appreciate it for itself. In that regard, I loved the episode. I loved Dean, I marveled at Jared's acting (again and still), I appreciated the complexity of Samuel. Most of all, I loved that they revealed Crowley's role so soon. They could be dragging things out, but they aren't, and that gives me hope that Sam will have his soul back soon.
Because like you, I miss Sammy, and I miss the humor. I want it back. I don't know how long I can appreciate the season for what it is without it, but so far, I'm okay. :)
As for Samuel, yeah, I think Crowley threatened or has Mary and/or Deanna, and Samuel didn't tell Dean because he knew he'd want to go rescue them, and Samuel's afraid of what Crowley would do to them if they failed. Samuel obviously thinks it's safer to work for Crowley.
I'm kind of thrilled that Crowley's role goes on. :) I love him, and I thought the writers have done a great job keeping us guessing and speculating but still making the answers feel inevitable once we hear them.
I agree that Samuel must think it's better to work for Crowley than deal with the alternative. And yeah, Dean would go off half-cocked if it involved Mary. I certainly can't argue with the things you liked about the episode, I liked the same things, but I'm missing Sammy and Cas. Things just seem as heavy and dismal post-apocalypse as they did during. The writers said they were going back to the basics, like the first season, but I'm not seeing it.
I totally agree about it being heavy and dismal, and you're right, it doesn't fit the reports of how it was going to be.
I'm mixed on this ep. I loved parts and hated others. I sure want Sammy's soul back pronto because I really miss the old byplay. I'm not looking forward to more hunts with cold, souless Sam in the car.
Loved Crowley and the demon in Christian...the fewer Campbells the better.
I hate having only glimpses of Cas. It's like having a plate of fresh, hot brownies, but only allowed one bite. I'm interested in this angelic civil war. Cas's reports are grim and things have to be bad if a demon can sneak into heaven to let Samuel out.
Melissa, I'm curious about the war too. It has to bad to make Cas so cross.
Me, too, Melissa, on all of that. I'm staying positive, because the writers HAVE to know we feel that way. They understand the fandom and the core of their show and can't be stupid enough to hollow that core all season. Plus, narratively speaking, Sam and Dean would make getting Sam's soul back a priority.
Nat, I agree the writer's have to know how we feel, but I'm not good at being patient. LOL. Don't even get me started on how I've lost patience with Christina Yang on Grey's Anatomy!
Awesome recap Terri!!
You highlighted all my favorite one-liners for sure. And I couldn't have summed up my opinion better than you:
"... I didn't care for it much. Some great one-liners and I liked the Crowley reveal, but I'm missing the old spirit of the show. I want Sam's soul back ASAP, more Castiel, more classic rock and a little more levity please." ITA!! I know they had to come up with some over-arching storyline, but I'm already done with this one. Need Sam's soul back stat!
Okay, i'm clearly in the minority but i liked this ep! Not one of my all time faves by any means, but next to wknd @ bobby's, one of my faves this season. (maybe it helped that no one had their eyeballs impaled or tongues eaten etc--I was able to tolerate the vamp torture since he was so calm about it). I liked 1. getting answers 2. Crowley 3. Twists i did not see coming & 4. Moments if dry humor (of course, your problems always come first & esp "hello, Newman"). Granted Sam is not all soulful and cuddly but I laughed out loud several times. I also felt, with Sam's disillusionment in grandpa, we were 1 step closer to the boys being on the same page/same team again
I liked it for the same reasons you did, Tanya! Cas's line about their problems was my favorite of the episode. :) And Sam's willingness to shoot Grandpa shocked me a little, but fit with his soullessness--he's operating solely on logic. But he also let Dean stand him down.
Thanks, Pam. I miss you. :)
Tanya, you have a good point about Sam's disillusionment.
|
cc/2019-30/en_middle_0059.json.gz/line399
|
__label__cc
| 0.55111
| 0.44889
|
Guest star news!
Tanya's Holy Crap Recap (Death's Door)
You should be aware that this post contains mega spoilers for the Dec. 2 episode "Death's Door," as well as wildly uninformed speculation on where Bobby's character goes from here.
I've mentioned before that I don't read spoilers. I like talking about ideas with other fans and I like taking note of what future guest stars may be on the show (Jason Dohring!) but beyond that, I don't look. So I went into this episode with no idea whether or not Jim Beaver is shuffling off the show ala Misha Collins. The show certainly hasn't hesitated to kill off characters in the past, so I've been a little concerned ever since the last episode when the aptly named Dick, aka Head Leviathan, shot Bobby in the head.
We pick up where we left off, with Sam and Dean freaking out and Bobby bleeding. As they rush him to the hospital, we cut to a different take from a scene last week, when they find a victim up a tree. But Bobby quickly realizes that this isn't exactly reality and that he in fact is the victim. From there, he begins bouncing around to different scenes in his life, including a meaningful conversation with his wife (although we're not sure yet why it's meaningful) and a job he once worked with Rufus (nice to see him again!) There are also some memories of Sam and Dean, then Bobby seeing his mother in his kitchen and instantly closing the door. (Major foreshadowing and I called the eventual plot development right there.)
Meanwhile, in what Bobby calls the waking world, doctors tell Dean and Sam to prepare themselves for Bobby's likely death. At one point later in the episode, a hapless hospital admin approaches Dean to ask how Bobby felt about being an organ donor. Who else got chills in that scene?
It turns out that the reason Bobby's mind went to that particular job with Rufus was because his former partner had a near-death experience. Rufus shared with Bobby that the way he escaped death was finding the right door--the one that makes you walk right through the memory you least want to face. Bobby explains that he's been shot and that Rufus isn't even real and his former partner becomes his spirit guide or what have you. They return to the scene where his wife Karen was, who is now violently upset. Turns out that she and Bobby had argued bitterly that night because he didn't want to have kids. (More accurately, because he didn't want to be a father.) Their argument was only three days before her posession and his eventually having to kill her and one of his worst regrets. Rufus is hopeful that this was the memory Bobby had to confront, but of course there's way too much left in the episode for it to be that easy! And, as Bobby has a Reaper on his tail (or, as Bobby put it, in his custard) we know it's going to be quite difficult. At this point, I was betting Bobby would in fact die.
In one of my favorite scenes, we see Bobby playing baseball with a young Dean even though they'd been expressly ordered by John Winchester (worst dad ever) to practice shooting. We also get a funny memory of adult Sam and Dean asking Bobby to solve the debate of who's a bigger bad-ass: Chuck Norris or Jet-Li. (Feel free to weigh in with your vote in the comments.)
Bobby tells Rufus that while you can't stop a Reaper permanently, he and the boys have run across them enough to pick up a few tricks. He manages to trap the Reaper, but the Reaper points out how parts of Bobby's mental world are disappearing because his brain is dying. Because of that, the trap will eventually fade and the Reaper will get him. Is Bobby merely postponing the inevitable because he has knowledge of the Leviathans he needs to give the boys?
The theme of the episode was clearly fatherhood (with the secondary theme of Bobby Singer Rocks) and we get a glimpse of Bobby on the phone arguing with John and admitting, "I know I'm not their father." But come on, we all know differently. Bobby Singer was the best parent those poor kids ever had. And in the final confrontation with his own abusive, aloholic father, Bobby concludes that as well. Bobby's late dad sneers that he's glad Bobby never had kids because he would have sucked and Bobby rejoins that, as a matter of fact, he adopted two and they grew up GREAT. They're HEROES. (Big Damn, if you'll pardon the Firefly reference.)
The awful childhood memory played out the way I figured it would, with young Bobby shooting his father in order to save his mother (at which point she immediately told him God would punish him. Yikes, the parents on this show.) And as the Reaper lunges for Bobby, he finally escapes death through the right door and...
His eyes opened in the hospital. Dean and Sam were ecstatic and for a second I actually thought the status had been returned to quo (they've dodged death plenty of times before). He tries unsuccessfully to tell them something and when they get him a pen, he scrawls the important numbers (what they are and why they're important, I don't know) on Sam's hand. Then he smiles at them and it hit me in the gut that he was totally gonna die. He opened his mouth and I braced myself for an admission of "I love you" that would make me sob. My husband said, "He's gonna say 'I'm ready.'" But, no. In classic Bobby fashion, all he said was, "Idjits." And then he flatlined. And I sobbed.
I thought that was the end of the show and was surprised to see us back again in Bobby's "house," the darkness ever growing outside it. Sam and Dean are in the living room arguing about proper movie snacks (and I laughed out loud at Dean's insistence that licorice is "chewy bites of heaven"). The Reaper tells Bobby it's now or never, is he gonna cross over peacefully or become a stuck spirit? He also says, "They'll be all right without you," the boys fade, and credits roll.
So, without citing interviews or spoilers that give us the answer (assuming they exist), what do you guys think? Is Bobby gone??? Will he return a horrible shade in the new year, caught between two worlds and warped by his own good intentions? (If so, did dude learn NOTHING from Cass?) What were those numbers? It all makes my head hurt. Although that could be from the crying.
What I do know is that, even if Bobby's "gone," this show is great at unexpectedly bringing back the dead for guest spots and episodes showcasing Jim Beaver's talents are always excellent. That said, holy crap, they killed Bobby!
Posted by Anonymous at 10:24 PM
Labels: Bobby Singer, Misha Collins, reaper, Rufus Turner
I thought killing Bobby would be the death of the show. And I'm sure there will be plenty of people who think so. But damn, if they didn't do it in a way that makes me accept it.
And yet! They left it open at the end. I think it's entirely possible Bobby would say "I'm stayin'," and NOT become a vengeful spirit. His reason for staying would be love, not revenge, and he'd have the boys. If they knew he was there and he could interact with them, he'd never become the horror they'd have to hunt. Wouldn't that be an awesome way to twist their mythology?
That said, he'd be tied to the hospital or a burned-down house with no resources he could point the boys to, so...
Great write-up, Tanya. I didn't cry watching the ep, but you got me a little misty describing it.
Natalie, like you, I feel the writers wrote his death in a way that makes me accept it. In fact, after that poignant goodbye, if the next episode found him sitting up in his hospital bed, I'd be angry and stop trusting the writers! But I hope this isn't the last we see of Jim Beaver. Rufus, Ellen, and Jo have all been on the show since their deaths. (Ash in heaven was one of my favorite cameos.)
I'll miss Bobby a lot (and I still miss seeing Misha) but I loved the early seasons of the show and they were always more focused on Sam and Dean.
Glad you liked the write up--thanks for the kind words :-)
Super fantastic write-up!! This was a hard ep for me to watch and you're so right, holy crap the parents on this show. I don't know what will happen to Bobby, but I did like the way they had him go out if he is in fact going to remain "dead." I just hate that we have to wait for more eps. Sigh...
kp said...
I loved it. It seems fitting that Bobby should go this way. Parents die, Sam and Dean aren't exceptions to this rule. Still, I can't imagine how they are going to fill Bobby & Cas' shoes. Stripping away S & D's support systems like this isn't going to bring the 1st season magic back. They are grown men now not 'guys on a road trip'. Too much has happened. I hope the writers realize that. It's just like people in Hollywood who don't really look younger when they are spraytanned and botoxed within an inch of their lives, Our guys can't be kids again no matter what you do. Also, they are going to need SOMETHING to stop them from pulling so much into themselves they have no reason to fight the good fight anymore. My $.02 Thank you so much for the recap!
Trish Milburn (Tricia Mills) said...
I was out of town and didn't get to watch the show last night, so just now finished watching it. Wah!! I don't Bobby to be gone. Like others, I already miss Cass. Don't know what happens from here, but I wonder if the numbers are longitude and latitude coordinates to some place significant.
Julia Phillips Smith said...
Natalie, I like the way you think! I'll take Bobby as Helpful Spirit for 200, Alex.
Great recap, Tanya! And it was a holy crap episode. I screamed and cried and I'm not a crier when it comes to TV shows.
But I REFUSE to believe Bobby is dead. Sorry, guys that's one death I absolutely can't accept. Frankly, I'd be pissed, even if it was done beautifully.
And the preview for the next episode looks too light hearted for the boys to lose the person they've loved most in their life.
Nope, I'm convinced he'll still be around and Cass will be back.
kp, I think you're right, and with the way they've handled things so far and from what they've said in interviews, I'm mostly hopeful they won't be trying to "recreate" the early seasons, but more cycle around to them. Return to some of the sensibility of that time without ignoring how the boys have changed.
So Terri, how do you think they can keep Bobby alive considering the reaper telling him his brain is essentially dead? The only way I think they could consistently keep him is as a spirit. Unless, of course, "Chuck" brought him back to life again. :)
Terri, I'm with you! I cannot accept Bobby's death either. They certainly could keep him around as a friendly ghost, as Natalie suggests. I'm not sure how that would work.
The previews certainly show a light hearted eppy, so color me confused...
I don't know how I will be able to wait until JANUARY until the next episode!
Hi Pam! I don't know how to make it until the hellatus is over either. I'm already having Walking Dead withdrawal (incidentally did you all see Bella on there. I didn't recognize her at first since she wasn't a fancy British bitch. LOL) and now I have to add SPN on there.
OMG I totally did not recognize Bella on Walking Dead! I love her as Maggie.
JustinJohnson said...
Hey guys do any of you know how i can watch that last episode? I forgot to record it.
|
cc/2019-30/en_middle_0059.json.gz/line400
|
__label__cc
| 0.670528
| 0.329472
|
West Midlands Police Trip Up Again
It seems when Rt Rev Michael Nazir-Ali, the Bishop of Rochester, claimed in 'The Sunday Telegraph' this year that there were 'no go areas' for Christians, he was right. But I bet he couldn't have dreamed that they'd be sanctioned by the authorities:
A police community support officer ordered two Christian preachers to stop handing out gospel leaflets in a predominantly Muslim area of Birmingham. The evangelists say they were threatened with arrest for committing a "hate crime" and were told they risked being beaten up if they returned.
Still, at least the ridiculous new legislation on religious crime can be put to some good use:
Arthur Cunningham, 48, and Joseph Abraham, 65, both full-time evangelical ministers, have launched legal action against West Midlands Police, claiming the officer infringed their right to profess their religion.
But was there another agenda for this PCSO?
They said when the officer realised they were American, although both have lived in Britain for many years, he launched a tirade against President Bush and the wars in Iraq and Afghanistan.
Mr Cunningham said: "I told him that this had nothing to do with the gospel we were preaching but he became very aggressive.
"He said we were in a Muslim area and were not allowed to spread our Christian message. He said we were committing a hate crime by telling the youths to leave Islam and said that he was going to take us to the police station."
A Muslim area...? That must be a new designation by Ordnance Survey. Wonder what the map symbol will be...?
Still, I'm sure WMP were quick to row back from this embarrasing incident?
Not exactly:
West Midlands Police, who refused to apologise, said the incident had been "fully investigated" and the officer would be given training in understanding hate crime and communication.
Oh, I think he understands hate crime all too well...
Labels: government insanity, modern society, policing
Not-So-Dim Bulbs
Crikey, Bruce!
When The Weather Is Fine, You Know It's The Time.....
What Councils Are Spending Your Money On....
Epic Fail! (Part II)
Good Times Ahead...
Just Another Dead Baby, Nothing To See, Move Along...
Epic Fail! ……
‘For The Chiillldreeen…!’ Part 457
You Mean, He Isn’t Already…?
Beware Of Mad Cows – They Might Charge Sue…
Lost - Journalistic Integrity. If Found, Please Re...
'Unexplained'...? No, Not Really...
'Could Do Better. See Me After School....'
"That's (Not) The Chicago Way!"
Indoctrination, Indoctrination, Indoctrination….
A Plan To Help Small Large Businesses!
Didn’t We Do This A Long Time Ago….?
"I'm From The Government, And I'm Here To Help Cha...
Keeping The Border Safe....
Love Music, Hate Racism, Kinda Keen On Violence Pa...
Fine Art…? Not Here, Comrade…!
Rats Leaving A Sinking Ship…
Hope…Change…Ooops!
New Labour, Old Ideas....
'Sign Her Up, She's Perfect...!'
Joined Up Government...
Poverty Causes Crime....
Data Security...? What Data Security!
"It's So Unfair!"
Kipling Was Right - Part II
Kipling Was Right...
Leadership Means Never Having To Say 'You're Right...
‘Right Wing Bloggers’ – Oooh, Scary…
Don't We Have A Law Against 'Aiding And Abetting'....
Chutzpah - Modern UK Definition
The Automoble - Older Than You Might Think...
Knife Crime - It's Not Just A Problem For Kids...
Gordon Brown: 'No' Doesn't Mean 'No' If I Say It D...
The Times, They Are A Changin'...
Update to 'Modern UK'
Modern UK...
"If The Rapture's Today, Someone Grab My Steering ...
Pouring Oil Activists On Troubled Waters
Credit Where Credit’s Due
Storm In A Teacup Cookpot
Scaremongering Emails – Women, Minorities Hardest ...
‘This Fire Is Raging Out Of Control – Quick, More ...
I Know Just The Thing To Provide For Their 'Needs'...
Here's An Idea.....
Loose Lips Sink Ships Magistrates...
'Journalistic Integrity'. What's That Supposed To ...
Roll Up, Roll Up! Victimhood Cage Match..! Free Ad...
'English People...? So Boring, Dahling...'
Caught Red Handed? No Problem!
Not The Best Defence I Ever Heard....
‘Proof..? We Don’t Need No Stinkin’ Proof’ Says So...
You Youngsters Don’t Know You’re Born….
I'm Sorry, I Must Read That Again...
I Can Haz Glacier Mint...?
Englis Az Shee Is Tiped...
All Hail Obama, Planet Healer In Waiting..!
From The Department Of 'You Have Got To Be Kidding...
Let's Hope They Wore Hard Hats...
The RSPCA Know Who The Real Victims Are....
Tough On Crime, Tough On The Causes Of Crime T-Shi...
Feed The World - But Not Our Animals
Umm, What..?
Sense Of Proportion Needed Urgently...
That Worked Well...!
Things Fall Apart, The Centre Cannot Hold..
More Foxes Put In Charge Of Henhouses
'Sensible Article On CiF' Shocker!
MPs Find Themselves In Hole, Vow To Keep Digging.....
Didn't Hillary Get Castigated For Saying Much The ...
|
cc/2019-30/en_middle_0059.json.gz/line402
|
__label__wiki
| 0.784495
| 0.784495
|
Thanks you for visiting Ticket Triangle! We have a one of the largest selections of Maryland Terrapins Football sporting event tickets with some of the lowest prices on the Internet. If you would like to attend a sporting event tour or to view sporting event schedules and information, Ticket Triangle is the place to visit. We have been in business and online since 2005 and have served hundreds of thousands of customers.
Maryland Terrapins Football Tickets
2019 Maryland Terrapins Football Season Tickets (Includes Tickets To All Regular Season Home Games) 08/30/2019 3:30AM College Park, MD Maryland Stadium View Tickets
2019 Maryland Terrapins Football Season Parking Pass (Includes Parking Passes To All Regular Season Home Games) 08/30/2019 3:30AM College Park, MD Maryland Stadium Parking View Tickets
PARKING: Maryland Terrapins vs. Howard Bison 08/31/2019 3:30AM College Park, MD Maryland Stadium Parking View Tickets
Maryland Terrapins vs. Howard Bison 08/31/2019 12:00PM College Park, MD Maryland Stadium View Tickets
PARKING: Maryland Terrapins vs. Syracuse Orange 09/07/2019 3:30AM College Park, MD Maryland Stadium Parking View Tickets
Maryland Terrapins vs. Syracuse Orange 09/07/2019 12:00PM College Park, MD Maryland Stadium View Tickets
PARKING: Temple Owls vs. Maryland Terrapins 09/14/2019 3:30AM Philadelphia, PA Lincoln Financial Field Parking Lots View Tickets
Temple Owls vs. Maryland Terrapins 09/14/2019 12:00PM Philadelphia, PA Lincoln Financial Field View Tickets
PARKING: Maryland Terrapins vs. Penn State Nittany Lions 09/27/2019 3:30AM College Park, MD Maryland Stadium Parking View Tickets
Maryland Terrapins vs. Penn State Nittany Lions 09/27/2019 8:00PM College Park, MD Maryland Stadium View Tickets
Rutgers Scarlet Knights vs. Maryland Terrapins 10/05/2019 3:30AM Piscataway, NJ High Point Solutions Stadium View Tickets
PARKING: Rutgers Scarlet Knights vs. Maryland Terrapins 10/05/2019 3:30AM Piscataway, NJ High Point Solutions Stadium Parking Lots View Tickets
PARKING: Purdue Boilermakers vs. Maryland Terrapins 10/12/2019 3:30AM West Lafayette, IN Ross-Ade Stadium Parking Lot View Tickets
Purdue Boilermakers vs. Maryland Terrapins 10/12/2019 12:00PM West Lafayette, IN Ross-ade Stadium View Tickets
Maryland Terrapins vs. Indiana Hoosiers 10/19/2019 3:30AM College Park, MD Maryland Stadium View Tickets
PARKING: Maryland Terrapins vs. Indiana Hoosiers 10/19/2019 3:30AM College Park, MD Maryland Stadium Parking View Tickets
PARKING: Minnesota Golden Gophers vs. Maryland Terrapins 10/26/2019 3:30AM Minneapolis, MN TCF Bank Stadium Parking Lots View Tickets
Minnesota Golden Gophers vs. Maryland Terrapins 10/26/2019 3:30AM Minneapolis, MN TCF Bank Stadium View Tickets
PARKING: Maryland Terrapins vs. Michigan Wolverines 11/02/2019 3:30AM College Park, MD Maryland Stadium Parking View Tickets
Maryland Terrapins vs. Michigan Wolverines 11/02/2019 12:00PM College Park, MD Maryland Stadium View Tickets
Ohio State Buckeyes vs. Maryland Terrapins 11/09/2019 3:30AM Columbus, OH Ohio Stadium View Tickets
PARKING: Ohio State Buckeyes vs. Maryland Terrapins 11/09/2019 3:30AM Columbus, OH Ohio Stadium Parking Lots View Tickets
Maryland Terrapins vs. Nebraska Cornhuskers 11/23/2019 3:30AM College Park, MD Maryland Stadium View Tickets
PARKING: Maryland Terrapins vs. Nebraska Cornhuskers 11/23/2019 3:30AM College Park, MD Maryland Stadium Parking View Tickets
Michigan State Spartans vs. Maryland Terrapins 11/30/2019 3:30AM East Lansing, MI Spartan Stadium - MI View Tickets
PARKING: Michigan State Spartans vs. Maryland Terrapins 11/30/2019 3:30AM East Lansing, MI Spartan Stadium Parking Lots - MI View Tickets
Tough to find sporting event tickets and seats for many other world tour sporting event or event are offered here. We sell some of the best seats available, including front row and sold out tickets, and many of our tickets are cheap, inexpensive and a good bargain. Many of the tickets we sell are for sold out Maryland Terrapins Football sporting event tickets. Order your discount tickets through the Ticket Triangle website any time.
|
cc/2019-30/en_middle_0059.json.gz/line404
|
__label__wiki
| 0.512365
| 0.512365
|
Home/ Concerts/Watch Wiz Khalifa, Snoop Dogg, DJ Drama, Jhené Aiko & More Perform For The Kick Off Of The ‘High Road Tour’ [VIDEO]
Watch Wiz Khalifa, Snoop Dogg, DJ Drama, Jhené Aiko & More Perform For The Kick Off Of The ‘High Road Tour’ [VIDEO]
Relive the first night of the ‘High Road Tour’ with Wiz Khalifa, Snoop Dogg, DJ Drama, Jhené Aiko, Kevin Gates, and Casey Veggies!
Wiz Khalifa and Snoop Dogg kicked off their highly anticipated ‘High Road Tour’ in West Palm Beach. Wiz and Snoop, along with their friends Casey Veggies, Jhené Aiko, Kevin Gates, and DJ Drama, put on one hell of a show at the Perfect Vodka Amphitheater. You about the show’s massive turn-out in my review here.
READ: L.A. Leakers ft. Future, Wiz Khalifa, & Kid Ink “Ball Like Us”
The tour has already made its way up the East coast and continues to trek throughout the country as we speak. If you missed out on the show (or can’t wait for it to come to you), we’ve got you covered.
Check out the full recap of the show’s highlights in the video below.
Photo Credit: Amanda Barona
casey veggies dj drama high road tour jhene aiko kevin gates snoop dogg wiz khalifa
New Music: Swift "Pull Up" [Prod. By Dreek Beatz]
Hialeah Rapper JOR-G Aims To "Score" In His New Video
Kendrick Lamar, ScHoolboy Q, & The TDE Crew’s “Championship Tour” Wins SoFlo By A Hair
Wu-Tang Clan, PRhyme, Lil Wayne & More Will Invade Atlanta For A3C 2018
Cardi B, Kodak Black, YFN Lucci & More To Perform At Trap Circus
|
cc/2019-30/en_middle_0059.json.gz/line408
|
Subsets and Splits
No community queries yet
The top public SQL queries from the community will appear here once available.