text
string
size
int64
token_count
int64
from quickkart_api import app from quickkart_api.models import Users from flask_jwt import JWT, jwt_required, current_identity from flask import abort def authenticate(username, password): user = Users.query.filter_by(username=username).first() if user and user.check_password(password): return user return abort(500, "Authentication failed") def identity(payload): return Users.query.filter(Users.id == payload['identity']).scalar() jwt = JWT(app,authenticate,identity)
497
144
# -*- coding: utf-8 -*- import sys, os # If your documentation needs a minimal Sphinx version, state it here. #needs_sphinx = '1.0' # Add any Sphinx extension module names here, as strings. They can be extensions # coming with Sphinx (named 'sphinx.ext.*') or your custom ones. extensions = ['sphinxcontrib.seometatwitter'] # Add any paths that contain templates here, relative to this directory. templates_path = ['_templates'] # The suffix of source filenames. source_suffix = '.rst' # The encoding of source files. #source_encoding = 'utf-8-sig' # The master toctree document. master_doc = 'index' # General information about the project. project = u'sphinx-seometatwitter' copyright = u'2021' # The version info for the project you're documenting, acts as replacement for # |version| and |release|, also used in various other places throughout the # built documents. # # The short X.Y version. version = '0.6.0' # The full version, including alpha/beta/rc tags. release = '0.6.0' # List of patterns, relative to source directory, that match files and # directories to ignore when looking for source files. exclude_patterns = ['_build'] # The name of the Pygments (syntax highlighting) style to use. pygments_style = 'sphinx' html_theme = 'default' html_static_path = ['_static'] # Output file base name for HTML help builder. htmlhelp_basename = 'tweettestdoc' # -- Options for manual page output -------------------------------------------- # One entry per manual page. List of tuples # (source start file, name, description, authors, manual section). man_pages = [ ('index', 'tweettest', u'tweettest Documentation', [u'test'], 1) ]
1,665
514
from omnia_timeseries.api import TimeseriesAPI, TimeseriesEnvironment
69
17
from dimagi.utils.couch import CriticalSection from corehq.apps.receiverwrapper.util import submit_form_locally def form_requires_input(form): """ Returns True if the form has at least one question that requires input """ for question in form.get_questions([]): if question["tag"] not in ("trigger", "label", "hidden"): return True return False def process_sms_form_complete(session, form): result = submit_form_locally(form, session.domain, app_id=session.app_id, partial_submission=False) session.submission_id = result.xform.form_id session.mark_completed(True) session.save() def critical_section_for_smsforms_sessions(contact_id): return CriticalSection(['smsforms-sessions-lock-for-contact-%s' % contact_id], timeout=5 * 60)
799
252
import numpy as np from scipy.integrate import simps def get_wss_magnitude(wss_vector): if (wss_vector.shape[-1] != 3): return wss_vector return np.sum(wss_vector ** 2, axis=-1) ** 0.5 def get_tawss(wss, dt): x = np.arange(0, len(wss)) x = np.asarray(x) * dt wss_int = simps(wss, x, axis=0) return wss_int / (x[-1] - x[0]) def get_osi(wss_vector, dt): eps = 1e-12 if (wss_vector.shape[-1] != 3): return np.zeros((wss_vector.shape[1], wss_vector.shape[2])) x = np.arange(0, len(wss_vector)) x = np.asarray(x) * dt # numerator wss_x = simps(wss_vector[...,0], x, axis=0) wss_y = simps(wss_vector[...,1], x, axis=0) wss_z = simps(wss_vector[...,2], x, axis=0) wss_mag = (wss_x ** 2 + wss_y ** 2 + wss_z ** 2) ** 0.5 # denominator denom = get_wss_magnitude(wss_vector) denom = simps(denom, x, axis=0) frac = (wss_mag + eps) / (denom + eps) osi = 0.5 * ( 1 - frac) return osi def get_osi_discrete(wss_vector): if (wss_vector.shape[-1] != 3): return np.zeros((wss_vector.shape[1], wss_vector.shape[2])) # numerator wss_x = np.sum(wss_vector[...,0], axis=0) wss_y = np.sum(wss_vector[...,1], axis=0) wss_z = np.sum(wss_vector[...,2], axis=0) wss_mag = (wss_x ** 2 + wss_y ** 2 + wss_z ** 2) ** 0.5 # denominator denom = get_wss_magnitude(wss_vector) denom = np.sum(denom, axis=0) frac = wss_mag / denom osi = 0.5 * ( 1 - frac) return osi
1,531
724
#!/usr/bin/env python -OO # encoding: utf-8 ########### # ORP - Open Robotics Platform # # Copyright (c) 2010 John Harrison, William Woodall # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in # all copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN # THE SOFTWARE. ########## """ servermanagement.py - Contains components related to remote server management Created by William Woodall on 2010-11-03. """ __author__ = "William Woodall" __copyright__ = "Copyright (c) 2010 John Harrison, William Woodall" ### Imports ### # Standard Python Libraries import sys import os import logging import thread import xmlrpclib import copy import traceback # Other libraries import lib.elements as elements try: # try to catch any missing dependancies # wx for window elements PKGNAME = 'wxpython' import wx import wx.aui as aui del PKGNAME except ImportError as PKG_ERROR: # We are missing something, let them know... sys.stderr.write(str(PKG_ERROR)+"\nYou might not have the "+PKGNAME+" \ module, try 'easy_install "+PKGNAME+"', else consult google.") ### Functions ### def sync_files(files): cc_files, hwm_files = files sync_files_helper(cc_files, "files", elements.MAIN.files[0]) sync_files_helper(hwm_files, "modules", elements.MAIN.files[1]) # buildListing() elements.MAIN.project_drawer.updateList() def sync_files_helper(files, root_folder, base_array): local_array = copy.deepcopy(base_array) for file in files: try: path_array = file.split(os.sep) parent_array = file_array = local_array file_index_reference = None try: if len(path_array): for x in path_array: parent_array = file_array file_array = file_array[x] file_index_reference = x except KeyError as filename_error: pass # this is supposed to happen, we handle it below if file_array[1] == files[file]: # Same file, pass elif file_array[1] > files[file]: # Local copy is newer contents = open(file_array[0], 'r').read() elements.REMOTE_SERVER.write(os.path.join(root_folder, file), contents, file_array[1]) elif file_array[1] < files[file]: # Server Copy is newer # this is handling the key error above file_path = os.path.join(os.getcwd(), root_folder, file) with open(file_path, 'w+') as fp: fp.write(elements.REMOTE_SERVER.getFileContents(os.path.join(root_folder, file))) os.utime(file_path, (files[file], files[file])) del parent_array[file_index_reference] except KeyError: try: if file.find(os.sep) != -1: os.makedirs(os.path.join(os.getcwd(), root_folder, os.path.split(file)[0])) file_path = os.path.join(os.getcwd(), root_folder, file) with open(file_path, 'w+') as fp: fp.write(elements.REMOTE_SERVER.getFileContents(os.path.join(root_folder, file))) os.utime(file_path, (files[file], files[file])) except Exception as e: traceback.print_exc(file=sys.stdout) walk_and_send_files(root_folder, local_array) def walk_and_send_files(root, list): """Walks a hash and sends the files to the remote server.""" if isinstance(list, dict): for file in list: if file[0] == '.': continue new_root = os.path.join(root, file) walk_and_send_files(new_root, list[file]) else: file_handler = open(list[0], 'r') elements.REMOTE_SERVER.write(root, file_handler.read(), list[1]) def connect(event): """Connects to the remote server, using the info in remote server text box""" # Connect to the remote server location = elements.TOOLBAR.server_addr.GetValue() try: elements.REMOTE_SERVER = xmlrpclib.Server('http://' + str(location) + ':7003/') elements.REMOTE_SERVER.connect() elements.TOOLBAR.connect_button.SetLabel('Disconnect') elements.TOOLBAR.connect_button.Bind(wx.EVT_BUTTON, disconnect) elements.MAIN.SetStatusText('Connected') except Exception as error: elements.MAIN.log.error(str(error)) return # Activate Buttons elements.TOOLBAR.send_button.Enable() elements.TOOLBAR.config_button.Enable() elements.TOOLBAR.run_button.Enable() elements.TOOLBAR.shutdown_button.Enable() elements.TOOLBAR.restart_button.Enable() elements.TOOLBAR.RC_button.Enable() # Synchronize Files sync_files(elements.REMOTE_SERVER.fileSync()) def disconnect(event): """Attempts to disconnect from the remote server""" elements.TOOLBAR.connect_button.SetLabel('Connect') elements.TOOLBAR.send_button.Disable() elements.TOOLBAR.run_button.Disable() elements.TOOLBAR.shutdown_button.Disable() elements.TOOLBAR.restart_button.Disable() elements.TOOLBAR.connect_button.Bind(wx.EVT_BUTTON, connect) elements.REMOTE_SERVER.disconnect() elements.REMOTE_SERVER.remote_server = None elements.MAIN.SetStatusText('Disconnected') def restart(event): """Calls the remote server to restart""" elements.REMOTE_SERVER.restart() def shutdown(event): """Shuts down the remote server""" elements.REMOTE_SERVER.shutdown() disconnect(None)
6,511
2,051
import inspect import sys from uma import message from rrtest.check import Error, get_protocol_response from rrtest import Unknown from oictest import check __author__ = 'roland' CLASS_CACHE = {} class MatchResourceSet(Error): """ Verify that the returned resource set is as expected """ cid = "match-resource-set" msg = "" def _func(self, conv): res = get_protocol_response(conv, message.ResourceSetDescription) inst, txt = res[-1] rset = self._kwargs["rset"] # All but _id and _rev should be equal for key in message.ResourceSetDescription.c_param.keys(): if key in ["_id", "_rev"]: continue try: assert rset[key] == inst[key] except AssertionError: self._message = "Not the resource set I expected" self._status = self.status break except KeyError: try: assert key not in rset and key not in inst except AssertionError: self._message = "Not the resource set I expected" self._status = self.status break return {} def factory(cid, classes=CLASS_CACHE): if len(classes) == 0: for name, obj in inspect.getmembers(sys.modules[__name__]): if inspect.isclass(obj): try: classes[obj.cid] = obj except AttributeError: pass if cid in classes: return classes[cid] else: classes = {} return check.factory(cid, classes)
1,661
440
import os import cv2 import glob import logging import numpy as np from pathlib import Path import torch from torch.autograd import Variable import torch.distributed as dist class strLabelConverter(object): def __init__(self, alphabet_): """ 字符串标签转换 """ self.alphabet = alphabet_ + 'Ω' self.dict = {} for i, char in enumerate(self.alphabet): self.dict[char] = i + 1 def encode(self, text): length = [] result = [] for item in text: item = item.replace(' ', '').replace('\t', '') length.append(len(item)) for char in item: if char not in self.alphabet: print('char {} not in alphabets!'.format(char)) char = '-' index = self.dict[char] result.append(index) text = result return torch.IntTensor(text), torch.IntTensor(length) def decode(self, t, length, raw=False): """Decode encoded texts back into strs. Args: torch.IntTensor [length_0 + length_1 + ... length_{n - 1}]: encoded texts. torch.IntTensor [n]: length of each text. Raises: AssertionError: when the texts and its length does not match. Returns: text (str or list of str): texts to convert. """ if length.numel() == 1: # 元素个数只有一个 number of elements length = length[0] assert t.numel() == length, "text with length: {} does not match declared length: {}".format(t.numel(), length) if raw: return ''.join([self.alphabet[i - 1] for i in t]) else: char_list = [] for i in range(length): if t[i] != 0 and (not (i > 0 and t[i - 1] == t[i])): char_list.append(self.alphabet[t[i] - 1]) return ''.join(char_list) else: # batch mode assert t.numel() == length.sum(), "texts with length: {} does not match declared length: {}".format(t.numel(), length.sum()) texts = [] index = 0 for i in range(length.numel()): l = length[i] texts.append( self.decode( t[index:index + l], torch.IntTensor([l]), raw=raw)) index += l return texts class averager(object): """Compute average for `torch.Variable` and `torch.Tensor`. """ def __init__(self): self.reset() def add(self, v): if isinstance(v, Variable): count = v.data.numel() v = v.data.sum() elif isinstance(v, torch.Tensor): count = v.numel() v = v.sum() self.n_count += count self.sum += v def reset(self): self.n_count = 0 self.sum = 0 def val(self): res = 0 if self.n_count != 0: res = self.sum / float(self.n_count) return res def generate_alphabets(alphabet_path): """ 读取文本标签,生成字符表。 :param alphabet_path: 文本标签. :return: 字符表. """ with open(alphabet_path, 'r', encoding='utf-8') as file: alphabet = sorted(list(set(repr(''.join(file.readlines()))))) if ' ' in alphabet: alphabet.remove(' ') alphabet = ''.join(alphabet) return alphabet class AverageMeter(object): """Computes and stores the average and current value""" def __init__(self, name, fmt=':f'): self.name = name self.fmt = fmt self.reset() def reset(self): self.val = 0 self.avg = 0 self.sum = 0 self.count = 0 def update(self, val, n=1): self.val = val self.sum += val * n self.count += n self.avg = self.sum / self.count def __str__(self): fmtstr = '{name} {val' + self.fmt + '} ({avg' + self.fmt + '})' return fmtstr.format(**self.__dict__) class ProgressMeter(object): def __init__(self, num_batches, meters, prefix=""): self.batch_fmtstr = self._get_batch_fmtstr(num_batches) self.meters = meters self.prefix = prefix def display(self, batch): entries = [self.prefix + self.batch_fmtstr.format(batch)] entries += [str(meter) for meter in self.meters] print('\t'.join(entries)) def _get_batch_fmtstr(self, num_batches): num_digits = len(str(num_batches // 1)) fmt = '{:' + str(num_digits) + 'd}' return '[' + fmt + '/' + fmt.format(num_batches) + ']' def lev_ratio(str_a, str_b): """ ED距离,用来衡量单词之间的相似度 :param str_a: :param str_b: :return: """ str_a = str_a.lower() str_b = str_b.lower() matrix_ed = np.zeros((len(str_a) + 1, len(str_b) + 1), dtype=np.int) matrix_ed[0] = np.arange(len(str_b) + 1) matrix_ed[:, 0] = np.arange(len(str_a) + 1) for i in range(1, len(str_a) + 1): for j in range(1, len(str_b) + 1): # 表示删除a_i dist_1 = matrix_ed[i - 1, j] + 1 # 表示插入b_i dist_2 = matrix_ed[i, j - 1] + 1 # 表示替换b_i dist_3 = matrix_ed[i - 1, j - 1] + (2 if str_a[i - 1] != str_b[j - 1] else 0) # 取最小距离 matrix_ed[i, j] = np.min([dist_1, dist_2, dist_3]) # print(matrix_ed) levenshtein_distance = matrix_ed[-1, -1] sum = len(str_a) + len(str_b) levenshtein_ratio = (sum - levenshtein_distance) / sum return levenshtein_ratio def set_logging(): logging.basicConfig( format="%(asctime)s %(message)s", # 指定输出的格式和内容, %(message)s: 打印日志信息 level=logging.INFO) # 设置日志级别 默认为logging.WARNING def get_latest_run(search_dir='./runs'): # Return path to most recent 'last.pt' in /runs (i.e. to --resume from) last_list = glob.glob(f'{search_dir}/**/last*.pt', recursive=True) return max(last_list, key=os.path.getctime) if last_list else '' def check_file(file): # Search for file if not found if os.path.isfile(file) or file == '': return file else: files = glob.glob('./**/' + file, recursive=True) # find file '**'匹配所有文件、目录、子目录和子目录里的文件 assert len(files), 'File Not Found: %s' % file # assert file was found return files[0] # return first file if multiple found def increment_dir(dir, comment=''): # Increments a directory runs/exp1 --> runs/exp2_comment n = 0 # number dir = str(Path(dir)) # os-agnostic d = sorted(glob.glob(dir + '*')) # directories if len(d): n = max([int(x[len(dir):x.find('_') if '_' in x else None]) for x in d]) + 1 # increment return dir + str(n) + ('_' + comment if comment else '') def xyxy2xywh(x): # Convert nx4 boxes from [x1, y1, x2, y2] to [x, y, w, h] where xy1=top-left, xy2=bottom-right y = torch.zeros_like(x) if isinstance(x, torch.Tensor) else np.zeros_like(x) y[:, 0] = (x[:, 0] + x[:, 2]) / 2 # x center y[:, 1] = (x[:, 1] + x[:, 3]) / 2 # y center y[:, 2] = x[:, 2] - x[:, 0] # width y[:, 3] = x[:, 3] - x[:, 1] # height return y def xywh2xyxy(x): # Convert nx4 boxes from [x, y, w, h] to [x1, y1, x2, y2] where xy1=top-left, xy2=bottom-right y = torch.zeros_like(x) if isinstance(x, torch.Tensor) else np.zeros_like(x) y[:, 0] = x[:, 0] - x[:, 2] / 2 # top left x y[:, 1] = x[:, 1] - x[:, 3] / 2 # top left y y[:, 2] = x[:, 0] + x[:, 2] / 2 # bottom right x y[:, 3] = x[:, 1] + x[:, 3] / 2 # bottom right y return y def denoise(image): """ 对灰色图片进行降噪(注:cv2.fastNlMeansDenoising函数处理时间较长,因此不宜采用该降噪函数) """ image = cv2.cvtColor(image, cv2.COLOR_BGR2GRAY) dst = cv2.fastNlMeansDenoising(image, None, h=10, templateWindowSize=7, searchWindowSize=21) ret, image = cv2.threshold(dst, 0, 255, cv2.THRESH_BINARY + cv2.THRESH_OTSU) return image def resize_padding(image, height, width): # resize h, w, c = image.shape image = cv2.resize(image, (0, 0), fx=height / h, fy=height / h, interpolation=cv2.INTER_LINEAR) # padding h, w, c = image.shape img = 255. * np.ones((height, width, c)) if w < width: img[:, :w, :] = image else: r = height / h img = cv2.resize(image, (0, 0), fx=r, fy=r, interpolation=cv2.INTER_LINEAR) return img def padding_image_batch(image_batch, height=32, width=480): aspect_ratios = [] for image in image_batch: h, w, c = image.shape aspect_ratios.append(w/h) max_len = int(np.ceil(32 * max(aspect_ratios))) pad_len = max_len if max_len > width else width imgs = [] for image in image_batch: img = resize_padding(image, height, pad_len) img = np.transpose(img, (2, 0, 1)) imgs.append(img) img_batch = torch.from_numpy(np.array(imgs)) / 255. return img_batch.float() logger_initialized = {} def get_logger(name, log_file=None, log_level=logging.INFO): """Initialize and get a logger by name. If the logger has not been initialized, this method will initialize the logger by adding one or two handlers, otherwise the initialized logger will be directly returned. During initialization, a StreamHandler will always be added. If `log_file` is specified and the process rank is 0, a FileHandler will also be added. Args: name (str): Logger name. log_file (str | None): The log filename. If specified, a FileHandler will be added to the logger. log_level (int): The logger level. Note that only the process of rank 0 is affected, and other processes will set the level to "Error" thus be silent most of the time. Returns: logging.Logger: The expected logger. """ logger = logging.getLogger(name) if name in logger_initialized: return logger # handle hierarchical names # e.g., logger "a" is initialized, then logger "a.b" will skip the # initialization since it is a child of "a". for logger_name in logger_initialized: if name.startswith(logger_name): return logger stream_handler = logging.StreamHandler() handlers = [stream_handler] if dist.is_available() and dist.is_initialized(): # True False rank = dist.get_rank() else: rank = 0 # only rank 0 will add a FileHandler if rank == 0 and log_file is not None: file_handler = logging.FileHandler(log_file, 'w') handlers.append(file_handler) formatter = logging.Formatter( '%(asctime)s - %(name)s - %(levelname)s - %(message)s') for handler in handlers: handler.setFormatter(formatter) handler.setLevel(log_level) logger.addHandler(handler) if rank == 0: logger.setLevel(log_level) else: logger.setLevel(logging.ERROR) logger_initialized[name] = True return logger
10,959
3,964
#!/usr/bin/env python from smoothie.plugins.interfaces import run as interfaces from smoothie.plugins.list_networks import run as list_networks from smoothie.plugins.target_network import run as target_network
211
57
import asyncio import threading import time import pytest from aiohttp import ClientSession from mmpy_bot import Settings from mmpy_bot.threadpool import ThreadPool from mmpy_bot.webhook_server import NoResponse, WebHookServer @pytest.fixture(scope="function") def threadpool(): pool = ThreadPool(num_workers=1) yield pool pool.stop() # if the pool was started, stop it. class TestWebHookServer: def test_start(self, threadpool): # Test server startup with a different port so it won't clash with the # integration tests server = WebHookServer(port=3281, url=Settings().WEBHOOK_HOST_URL) threadpool.start_webhook_server_thread(server) threadpool.start() time.sleep(0.5) assert server.running asyncio.set_event_loop(asyncio.new_event_loop()) # Run the other tests sequentially self.test_obtain_response(server) self.test_process_webhook(server) # Test shutdown procedure threadpool.stop() assert not server.running @pytest.mark.skip("Called from test_start since we can't parallellize this.") def test_obtain_response(self, server): assert server.response_handlers == {} # Wait for a response for request id 'test await_response = asyncio.get_event_loop().create_future() server.response_handlers["test"] = await_response assert not server.response_handlers["test"].done() # We have no futures waiting for request id 'nonexistent', so nothing should # happen. server.response_queue.put(("nonexistent", None)) time.sleep(0.1) assert not server.response_handlers["test"].done() # If a response comes in for request id 'test', it should be removed from the # response handlers dict. server.response_queue.put(("test", None)) time.sleep(0.1) assert "test" not in server.response_handlers @pytest.mark.skip("Called from test_start since we can't parallellize this.") def test_process_webhook(self, server): """Checks whether an incoming webhook post request is correctly handled.""" assert server.event_queue.empty() assert server.response_queue.empty() assert server.response_handlers == {} async def send_request(data): async with ClientSession() as session: try: response = await session.post( f"{server.url}:{server.port}/hooks/test_hook", json=data, timeout=1, ) return await response.json() except asyncio.exceptions.TimeoutError: return None asyncio.run(send_request({"text": "Hello!"})) # Verify that a WebHookEvent corresponding to our request was added to the # event queue. assert server.event_queue.qsize() == 1 event = server.event_queue.get_nowait() assert event.webhook_id == "test_hook" assert event.text == "Hello!" # Since there is no MessageHandler, we have to signal the server ourselves server.response_queue.put((event.request_id, NoResponse)) time.sleep(0.1) # Upon receiving the NoResponse, the server should have emptied the response # queue and handlers. assert server.response_queue.empty() assert server.response_handlers == {} # Test whether the web response is correctly passed through, if there is one response = {"text": "test response"} def provide_response(): event = server.event_queue.get() server.response_queue.put((event.request_id, response)) thread = threading.Thread(target=provide_response) thread.start() assert asyncio.run(send_request({"text": "Hello!"})) == response
3,912
1,069
import urllib.request import json import pprint url = 'http://localhost:18080/kabusapi/ranking' #?type=1&ExchangeDivision=ALL params = { 'type': 15 } #type - 1:値上がり率(デフォルト)2:値下がり率 3:売買高上位 4:売買代金 5:TICK回数 6:売買高急増 7:売買代金急増 8:信用売残増 9:信用売残減 10:信用買残増 11:信用買残減 12:信用高倍率 13:信用低倍率 14:業種別値上がり率 15:業種別値下がり率 params['ExchangeDivision'] = 'S' #ExchangeDivision - ALL:全市場(デフォルト)T:東証全体 T1:東証一部 T2:東証二部 TM:マザーズ JQ:JASDAQ M:名証 FK:福証 S:札証 req = urllib.request.Request('{}?{}'.format(url, urllib.parse.urlencode(params)), method='GET') req.add_header('Content-Type', 'application/json') req.add_header('X-API-KEY', 'f2a3579e776f4b6b8015a96c8bdafdce') try: with urllib.request.urlopen(req) as res: print(res.status, res.reason) for header in res.getheaders(): print(header) print() content = json.loads(res.read()) pprint.pprint(content) except urllib.error.HTTPError as e: print(e) content = json.loads(e.read()) pprint.pprint(content) except Exception as e: print(e)
1,023
590
from flask import Blueprint, jsonify, make_response from flask.views import MethodView from sfa_api import spec, json from sfa_api.schema import ZoneListSchema from sfa_api.utils.storage import get_storage from sfa_api.utils.request_handling import validate_latitude_longitude class AllZonesView(MethodView): def get(self, *args): """ --- summary: List climate zones description: List all climate zones that the user has access to. tags: - Climate Zones responses: 200: description: A list of climate zones. content: application/json: schema: type: array items: $ref: '#/components/schemas/ZoneMetadata' 401: $ref: '#/components/responses/401-Unauthorized' """ storage = get_storage() zones = storage.list_zones() return jsonify(ZoneListSchema(many=True).dump(zones)) class ZoneView(MethodView): def get(self, zone, *args): """ --- summary: Get zone GeoJSON description: Get the GeoJSON for a requested climate zone. tags: - Climate Zones parameters: - zone responses: 200: description: The GeoJSON definition for the climate zone content: application/geo+json: schema: type: object 401: $ref: '#/components/responses/401-Unauthorized' 404: $ref: '#/components/responses/404-NotFound' """ storage = get_storage() geojson = storage.read_climate_zone(zone.replace('+', ' ')) response = make_response(json.dumps(geojson), 200) response.mimetype = 'application/geo+json' return response class SearchZones(MethodView): def get(self, *args): """ --- summary: Find zones description: Find all zones that the given point falls within tags: - Climate Zones parameters: - latitude - longitude responses: 200: description: Sucessfully retrieved zones. content: application/json: schema: type: array items: $ref: '#/components/schemas/ZoneMetadata' 400: $ref: '#/components/responses/400-BadRequest' 401: $ref: '#/components/responses/401-Unauthorized' """ lat, lon = validate_latitude_longitude() storage = get_storage() zones = storage.find_climate_zones(lat, lon) return jsonify(ZoneListSchema(many=True).dump(zones)) spec.components.parameter( 'zone', 'path', { 'schema': { 'type': 'string', }, 'description': "Climate zone name. Spaces may be replaced with +.", 'required': 'true', 'name': 'zone' }) spec.components.parameter( 'latitude', 'query', { 'name': 'latitude', 'required': True, 'description': 'The latitude (in degrees North) of the location.', 'schema': { 'type': 'float', } }) spec.components.parameter( 'longitude', 'query', { 'name': 'longitude', 'required': True, 'description': 'The longitude (in degrees East of the Prime Meridian)' ' of the location.', 'schema': { 'type': 'float', } }) zone_blp = Blueprint( 'climatezones', 'climatezones', url_prefix='/climatezones', ) zone_blp.add_url_rule('/', view_func=AllZonesView.as_view('all')) zone_blp.add_url_rule('/<zone_str:zone>', view_func=ZoneView.as_view('single')) zone_blp.add_url_rule('/search', view_func=SearchZones.as_view('search'))
3,905
1,115
from random import randint n = (randint(1, 9), randint(1, 9), randint(1, 9), randint(1, 9), randint(1, 9)) print('Os números sorteados foram: ', end='') for c in n: print(c, end=' ') print(f'\nO maior valor sorteado foi: {max(n)}') print(f'O menor valor sorteado foi: {min(n)}')
283
117
import requests from localstack.http import Response, Router from localstack.http.adapters import RouterListener from localstack.utils.testutil import proxy_server class TestRouterListener: def test_dispatching(self): def endpoint(request, args): resp = Response() resp.set_json({"args": args}) return resp router = Router() router.add("/foo/<bar>", endpoint, methods=["GET"]) with proxy_server(RouterListener(router, fall_through=False)) as url: response = requests.get(f"{url}/foo/ed") assert response.ok assert response.json() == {"args": {"bar": "ed"}} # test with query response = requests.get(f"{url}/foo/bar?hello=there") assert response.ok assert response.json() == {"args": {"bar": "bar"}} # test invalid endpoint response = requests.get(f"{url}/foo") assert not response.ok assert response.status_code == 404 # test non-allowed method response = requests.post(f"{url}/foo/bar") assert not response.ok assert response.status_code == 405 # method not allowed
1,228
327
from cx_Freeze import setup, Executable import sys base = None if sys.platform == "win32": base = "Win32GUI" executables = [Executable("Archer.py", base=base, icon="favicon.ico")] setup(name="Archer", version="1.0.0", options={"build_exe": {"packages": ["tkinter", "mysql", "PIL", "time", "requests", "os", "smtplib", "datetime", "pyAesCrypt"], "include_files": ["Screen_image.jpg", "favicon.ico", "Admin_screen.jpg", "Screen_image_small.jpg", "Journal.jpg", "db.sqlite3"]}}, description="", executables=executables, requires=['requests', 'PIL', 'mysql', "smtplib", "tkinter", "time", "pyAesCrypt"])
647
240
# Übung 11 - Aufgabe 1 # Mitarbeiter-Kartei # Bereitgestellt von M. Drews im Wintersemester 2021/22 # Funktionen def trenner(anzahl_striche): for i in range(anzahl_striche): print("-", end="") print() def fehler(): print("\nFehler: Bitte geben Sie nur Zahlen an, die zur Auswahl stehen.") def formular(): global vorname, nachname, geburtsort vorname = input("> Vorname: ") nachname = input("> Nachname: ") geburtsort = input("> Geburtsort: ") def suche(): global index suche = input("Suchbegriff (Nachname eingeben): ") index = next((i for i, item in enumerate(ma_kartei) if item["Nachname"] == suche), None) def eintrag_neu(): print("\nBitte fügen Sie einen neuen Eintrag zur Mitarbeiter-Kartei hinzu: ") formular() gueltige_eingabe = False while not gueltige_eingabe: try: auswahl = int(input("\n(1) Speichern (2) Abbrechen\n")) if auswahl == 1: gueltige_eingabe = True eintrag = {"Vorname": vorname,"Nachname": nachname,"Geburtsort": geburtsort} ma_kartei.append(eintrag) print("Ihr Eintrag wurde gespeichert und der Kartei hinzugefügt.") trenner(80) elif auswahl == 2: gueltige_eingabe = True except: fehler() def eintrag_bearbeiten(): print("Welchen Eintrag möchten Sie bearbeiten?") suche() print("\nBitte überschreiben Sie den alten Eintrag:") formular() ma_kartei[index] = {"Vorname": vorname,"Nachname": nachname,"Geburtsort": geburtsort} print("Ihr Eintrag wurde gespeichert und der Kartei hinzugefügt.") trenner(80) def eintrag_loeschen(): print("Welchen Eintrag möchten Sie löschen?") suche() print("\nFolgender Eintrag wurde gelöscht:") print(ma_kartei[index]) ma_kartei.pop(index) # Programmablauf print("\n") trenner(120) print("Mitarbeiter-Kartei") trenner(120) trenner(120) ma_kartei = [] programm = True while programm: print("Was möchten Sie tun?") gueltige_eingabe = False while not gueltige_eingabe: try: auswahl = int(input("\n(1) Eintrag hinzufügen\n(2) Eintrag bearbeiten\n(3) Eintrag löschen\n(4) Kartei anzeigen\n")) if auswahl == 1: gueltige_eingabe = True eintrag_neu() elif auswahl == 2: gueltige_eingabe = True eintrag_bearbeiten() elif auswahl == 3: gueltige_eingabe = True eintrag_loeschen() elif auswahl == 4: gueltige_eingabe = True print(ma_kartei) trenner(80) except: fehler()
2,772
953
import maya.api.OpenMaya as om from . import asciitreemixin, asciiattribute, asciiplug from .collections import hashtable, weakreflist, notifylist import logging logging.basicConfig() log = logging.getLogger(__name__) log.setLevel(logging.INFO) class AsciiNode(asciitreemixin.AsciiTreeMixin): """ Overload of AsciiTreeMixin used to interface with scene nodes. """ __slots__ = ( '_scene', '_name', '_namespace', '_uuid', '_type', '_parent', '_children', '_locked', '_default', '_attributes', '_plugs', '_database', '_connections' ) __attributes__ = {} # Used for static attributes def __init__(self, typeName, **kwargs): """ Private method called after a new instance is created. :type typeName: str :keyword scene: asciiscene.AsciiScene :rtype: None """ # Call parent method # super(AsciiNode, self).__init__() # Declare private variables # self._scene = kwargs.get('scene', self.nullWeakReference) self._name = '' self._namespace = '' self._uuid = '' self._type = typeName self._parent = self.nullWeakReference self._children = notifylist.NotifyList(cls=weakreflist.WeakRefList) self._locked = False self._attributes = hashtable.HashTable() # Used for dynamic attributes self._plugs = hashtable.HashTable() self._connections = [] self._default = kwargs.get('default', False) # Setup child notifies # self._children.addCallback('itemAdded', self.childAdded) self._children.addCallback('itemRemoved', self.childRemoved) # Declare public variables # self.parent = kwargs.get('parent', None) self.name = kwargs.get('name', '') self.namespace = kwargs.get('namespace', '') self.uuid = kwargs.get('uuid', om.MUuid().generate().asString()) # Initialize node attributes # self.initialize() def __str__(self): """ Private method that returns a string representation of this instance. :rtype: str """ return f'<{self.__class__.__module__}.{self.__class__.__name__} object: {self.absoluteName()}>' def __getitem__(self, key): """ Private method that returns the plug associated with the supplied key. :type key: str :rtype: asciiplug.AsciiPlug """ return self.findPlug(key) def __dumps__(self): """ Returns a list of command line strings that can be serialized. :rtype: list[str] """ # Evaluate which commands to concatenate # commands = [] if self.isDefaultNode: commands.append(self.getSelectCmd()) else: commands.append(self.getCreateNodeCmd()) commands.append(self.getRenameCmd()) # Concatenate lockNode command # But only if the node has actually been locked! # if self.isLocked: commands.append(self.getLockNodeCmd()) # Concatenate attribute related commands # commands.extend(self.getAddAttrCmds()) commands.extend(self.getSetAttrCmds()) return commands @property def scene(self): """ Returns the scene this object is derived from. :rtype: mason.asciiscene.AsciiScene """ return self._scene() @property def name(self): """ Getter method that returns the name of this node. :rtype: str """ return self._name @name.setter def name(self, name): """ Setter method updates the name of this node. :type name: str :rtype: None """ # Check for redundancy # newName = self.stripAll(name) oldName = self._name if newName != oldName: self._name = newName self.nameChanged(oldName, newName) def nameChanged(self, oldName, newName): """ Callback method for any name changes made to this node. :type oldName: str :type newName: str :rtype: None """ # Remove previous name from registry # absoluteName = f'{self.namespace}:{oldName}' hashCode = self.scene.registry.names.get(absoluteName, None) if hashCode == self.hashCode(): del self.scene.registry.names[absoluteName] # Append new name to registry # absoluteName = f'{self.namespace}:{newName}' self.scene.registry.names[absoluteName] = self.hashCode() @property def namespace(self): """ Getter method that returns the namespace this node belongs to. :rtype: str """ return self._namespace @namespace.setter def namespace(self, namespace): """ Setter method updates the namespace this node belongs to. :type namespace: str :rtype: None """ # Check for redundancy # oldNamespace = self._namespace newNamespace = '' if namespace == ':' else namespace if newNamespace != oldNamespace: self._namespace = newNamespace self.namespaceChanged(oldNamespace, newNamespace) def namespaceChanged(self, oldNamespace, newNamespace): """ Callback method for any namespace changes made to this node. :type oldNamespace: str :type newNamespace: str :rtype: None """ # Remove previous name from registry # absoluteName = f'{oldNamespace}:{self.name}' hashCode = self.scene.registry.names.get(absoluteName, None) if hashCode == self.hashCode(): del self.scene.registry.names[absoluteName] # Append new name to registry # absoluteName = f'{newNamespace}:{self.name}' self.scene.registry.names[absoluteName] = self.hashCode() def absoluteName(self): """ Returns the bare minimum required to be a unique name. :rtype: str """ if len(self.namespace) > 0: return f'{self.namespace}:{self.name}' else: return self.name @property def parent(self): """ Getter method that returns the parent for this object. :rtype: AsciiNode """ return self._parent() @parent.setter def parent(self, parent): """ Setter method that updates the parent for this object. :type parent: AsciiNode :rtype: None """ # Check for redundancy # if parent is self.parent: log.debug(f'{self} is already parented to: {parent}') return # Check for none type # oldParent = self.parent if isinstance(parent, AsciiNode): self._parent = parent.weakReference() elif isinstance(parent, str): self.parent = self.scene.registry.getNodeByName(parent) elif parent is None: self._parent = self.nullWeakReference else: raise TypeError(f'parent.setter() expects an AsciiNode ({type(parent).__name__} given)!') # Cleanup any old references # self.parentChanged(oldParent, parent) def parentChanged(self, oldParent, newParent): """ Callback method that cleans up any parent/child references. :type oldParent: AsciiNode :type newParent: AsciiNode :rtype: None """ # Remove self from former parent # if oldParent is not None: oldParent.children.remove(self) # Append self to new parent # if newParent is not None: newParent.children.appendIfUnique(self) @property def children(self): """ Getter method that returns the children belonging to this object. :rtype: weakreflist.WeakRefList """ return self._children def childAdded(self, index, child): """ Adds a reference to this object to the supplied child. :type index: int :type child: AsciiNode :rtype: None """ if child.parent is not self: child.parent = self def childRemoved(self, child): """ Removes the reference of this object from the supplied child. :type child: AsciiNode :rtype: None """ child.parent = None @property def type(self): """ Getter method that returns the name of this node type. :rtype: str """ return self._type @property def uuid(self): """ Getter method that returns the UUID for this node. :rtype: str """ return self._uuid @uuid.setter def uuid(self, uuid): """ Setter method that updates the UUID for this node. :type uuid: str :rtype: None """ # Check for redundancy # newUUID = self.scene.registry.generateUUID(uuid) oldUUID = self._uuid if newUUID != oldUUID: self._uuid = newUUID self.uuidChanged(oldUUID, newUUID) def uuidChanged(self, oldUUID, newUUID): """ Callback method for any namespace changes made to this node. :type oldUUID: str :type newUUID: str :rtype: None """ # Remove previous uuid from registry # hashCode = self.scene.registry.uuids.get(oldUUID, None) if hashCode == self.hashCode(): del self.scene.registry.uuids[oldUUID] # Append new uuid to registry # self.scene.registry.uuids[newUUID] = self.hashCode() @property def isLocked(self): """ Getter method that returns the lock state of this node. :rtype: int """ return self._locked @isLocked.setter def isLocked(self, locked): """ Setter method that updates the lock state of this node. :type locked: bool :rtype: None """ self._locked = bool(locked) @property def isDefaultNode(self): """ Getter method that evaluates whether this is a default node. :rtype: bool """ return self._default def initialize(self): """ Initializes the attributes and plugs for this node. :rtype: None """ # Check if static attributes exist # If not then go ahead and initialize them # attributes = self.__attributes__.get(self.type) if attributes is None: attributes = asciiattribute.listPlugin(self.type) self.__attributes__[self.type] = attributes @property def database(self): """ Getter method that returns the database for this node. :rtype: asciidatabase.AsciiDatabase """ return self._database @property def plugs(self): """ Getter method that returns the plugs that are currently in use. :rtype: hashtable.HashTable """ return self._plugs def iterTopLevelPlugs(self): """ Iterates through all of the top-level plugs. Please note that plugs are created on demand so don't expect a complete list from this generator! :rtype: iter """ # Iterate through attributes # for attribute in self.listAttr(fromPlugin=True, userDefined=True).values(): # Check if this is a top level parent # if attribute.parent is not None: continue # Yield associated plug # plug = self._plugs.get(attribute.shortName, None) if plug is not None: yield plug else: continue def dagPath(self): """ Returns a dag path for this node. :rtype: str """ if self.parent is not None: return '|'.join([x.absoluteName() for x in self.trace()]) else: return self.name def attribute(self, name): """ Returns an ascii attribute with the given name. :type name: str :rtype: asciiattribute.AsciiAttribute """ return self.listAttr(fromPlugin=True, userDefined=True).get(name, None) def listAttr(self, fromPlugin=False, userDefined=False): """ Returns a list of attributes derived from this node. :type fromPlugin: bool :type userDefined: bool :rtype: hashtable.HashTable """ # Check if plugin defined attributes should be returned # attributes = hashtable.HashTable() if fromPlugin: attributes.update(self.__class__.__attributes__[self.type]) # Check if user defined attributes should be returned # if userDefined: attributes.update(self._attributes) return attributes def addAttr(self, *args, **kwargs): """ Adds a dynamic attribute to this node. This function accepts two different sets of arguments. You can either supply a fully formed AsciiAttribute. Or you can pass all of the keywords required to create one. :rtype: None """ # Check number of arguments # numArgs = len(args) numKwargs = len(kwargs) if numArgs == 1: # Store reference to attribute # attribute = args[0] self._attributes[attribute.shortName] = attribute self._attributes[attribute.longName] = attribute elif numKwargs > 0: # Create new attribute from kwargs # attribute = asciiattribute.AsciiAttribute(**kwargs) self.addAttr(attribute) else: raise TypeError(f'addAttr() expects 1 argument ({numArgs} given)!') def setAttr(self, plug, value): """ Assigns the supplied value to the given plug. :type plug: Union[str, asciiplug.AsciiPlug] :type value: Any :rtype: None """ # Check plug type # if isinstance(plug, str): plug = self.findPlug(plug) # Assign value to plug # plug.setValue(value) def connectAttr(self, source, destination): """ Connects the two supplied plugs together. :type source: Union[str, asciiplug.AsciiPlug] :type destination: Union[str, asciiplug.AsciiPlug] :rtype: None """ # Check source type # if isinstance(source, str): source = self.findPlug(source) # Check destination type # if isinstance(destination, str): destination = self.findPlug(destination) # Connect plugs # source.connect(destination) def findPlugs(self, path): """ Returns a list of plugs from the supplied string path. :type path: str :rtype: list[asciiplug.AsciiPlug] """ return asciiplug.AsciiPlugPath(f'{self.absoluteName()}.{path}', scene=self.scene).evaluate() def findPlug(self, path): """ Returns the plug associated with the given name. If more than one plug is found then a type error is raised. :type path: str :rtype: asciiplug.AsciiPlug """ plugs = self.findPlugs(path) numPlugs = len(plugs) if numPlugs == 0: return None elif numPlugs == 1: return plugs[0] else: raise TypeError('findPlug() multiple plugs found!') def legalConnection(self, plug, otherPlug): """ Evaluates whether or not the connection between these two plugs is valid. TODO: Implement this behaviour! :type plug: asciiplug.AsciiPlug :type otherPlug: asciiplug.AsciiPlug :rtype: bool """ return True def connectionMade(self, plug, otherPlug): """ Callback method for any connection changes made to this node. :type plug: asciiplug.AsciiPlug :type otherPlug: asciiplug.AsciiPlug :rtype: None """ self._connections.append(otherPlug.weakReference()) def legalDisconnection(self, plug, otherPlug): """ Evaluates whether or not the disconnection between these two plugs is valid. TODO: Implement this behaviour! :type plug: asciiplug.AsciiPlug :type otherPlug: asciiplug.AsciiPlug :rtype: bool """ return True def connectionBroken(self, plug, otherPlug): """ Callback method for any disconnection changes made to this node. :type plug: asciiplug.AsciiPlug :type otherPlug: asciiplug.AsciiPlug :rtype: None """ self._connections.remove(otherPlug.weakReference()) def getCreateNodeCmd(self): """ Returns a command string that can create this node. :rtype: str """ # Check if node has parent # if self.parent is not None: return f'createNode {self.type} -s -n "{self.absoluteName()}" -p "{self.parent.absoluteName()}";' else: return f'createNode {self.type} -s -n "{self.absoluteName()}";' def getSelectCmd(self): """ Returns a command string that can select this node. :rtype: str """ return f'select -ne "{self.absoluteName()}";' def getRenameCmd(self): """ Returns a command string that can rename this node's UUID. :rtype: str """ return f'\trename -uid "{self.uuid}";' def getLockNodeCmd(self): """ Returns a command string that can lock this node. :rtype: str """ return f'\tlockNode -l {int(self.isLocked)};' def getAddAttrCmds(self): """ Returns a list of commands for user-defined attributes. :rtype: list[str] """ return [x.getAddAttrCmd() for x in self.listAttr(userDefined=True).values()] def getSetAttrCmds(self): """ Returns a list of commands for non-default plugs. :rtype: list[str] """ # Iterate through top-level plugs # commands = [] for plug in self.iterTopLevelPlugs(): commands.extend(plug.getSetAttrCmds()) return commands def getConnectAttrCmds(self): """ Returns a list of command strings that can recreate the outgoing connections from this node. :rtype: list[str] """ # Iterate through known connections # numCommands = len(self._connections) commands = [None] * numCommands for (i, ref) in enumerate(self._connections): # Check if ref is still alive # otherPlug = ref() if otherPlug is None: continue # Concatenate source name # plug = otherPlug.source() source = plug.partialName(includeNodeName=True, useFullAttributePath=True, includeIndices=True) # Check if destination index matters # if otherPlug.isElement and not otherPlug.attribute.indexMatters: destination = otherPlug.parent.partialName(includeNodeName=True, useFullAttributePath=True, includeIndices=True) commands[i] = f'connectAttr "{source}" "{destination}" -na;' else: destination = otherPlug.partialName(includeNodeName=True, useFullAttributePath=True, includeIndices=True) commands[i] = f'connectAttr "{source}" "{destination}";' return commands
20,230
5,622
""" (c) Copyright 2015-2016 Hewlett-Packard Enterprise Company L.P. Licensed under the Apache License, Version 2.0 (the "License"); you may not use this file except in compliance with the License. You may obtain a copy of the License at http://www.apache.org/licenses/LICENSE-2.0 Unless required by applicable law or agreed to in writing, software distributed under the License is distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF ANY KIND, either express or implied. See the License for the specific language governing permissions and limitations under the License. """ import functools from oslo_policy import policy from freezer_api.common import exceptions from freezer_api.common import policies ENFORCER = None def setup_policy(conf): global ENFORCER if not ENFORCER: ENFORCER = policy.Enforcer(conf) ENFORCER.register_defaults(policies.list_rules()) ENFORCER.load_rules() def enforce(rule): def decorator(func): @functools.wraps(func) def handler(*args, **kwargs): ctx = args[1].env['freezer.context'] ENFORCER.enforce(rule, {}, ctx.to_dict(), do_raise=True, exc=exceptions.AccessForbidden) return func(*args, **kwargs) return handler return decorator
1,325
413
""" moviepy.video.fx.all is deprecated. Use the fx method directly from the clip instance (e.g. ``clip.resize(...)``) or import the function from moviepy.video.fx instead. """ import warnings from moviepy.video.fx import * # noqa F401,F403 warnings.warn(f"\nMoviePy: {__doc__}", UserWarning)
297
105
from .resource import * from .dist_manager import * from ...utils import get_cpu_count, get_gpu_count
102
32
class AppStartingMsg(object): '''应用程序启动消息''' def __init__(self): self.ErrorMsg = ""
101
41
print "This line will be printed." x = "rachel" if x == "rachel": print "Rachel" print "Hello, World!"
109
42
# pyonms.py from dao import api, alarms, events, nodes class pyonms(): def __init__(self, hostname, username, password): self.hostname = hostname self.api = api.API(hostname=hostname, username=username, password=password) self.nodes = nodes.Nodes(self.api) self.events = events.Events(self.api) self.alarms = alarms.Alarms(self.api) def __repr__(self): return self.hostname
434
140
""" Utility functions for Neural network """ import pandas as pd from keras.callbacks import EarlyStopping, ReduceLROnPlateau, ModelCheckpoint from sklearn.preprocessing import StandardScaler from keras.layers import Dense, BatchNormalization, Input, LeakyReLU, Dropout from keras.models import Model, load_model from keras.optimizers import Adam def plot_history(history, label, loss_str='sc_outp_mean_absolute_error'): import matplotlib.pyplot as plt plt.plot(history.history[loss_str]) plt.plot(history.history[f'val_{loss_str}']) plt.title(f'Loss for {label}') plt.ylabel('Loss') plt.xlabel('Epoch') _ = plt.legend(['Train', 'Validation'], loc='upper left') plt.show() def create_nn_model(input_shape): inp = Input(shape=(input_shape, )) x = Dense(256)(inp) x = BatchNormalization()(x) x = LeakyReLU(alpha=0.05)(x) x = Dropout(0.2)(x) # x = Dense(1024)(x) # x = BatchNormalization()(x) # x = LeakyReLU(alpha=0.05)(x) # x = Dropout(0.2)(x) # x = Dense(1024)(x) # x = BatchNormalization()(x) # x = LeakyReLU(alpha=0.05)(x) # x = Dropout(0.2)(x) x = Dense(512)(x) x = BatchNormalization()(x) x = LeakyReLU(alpha=0.05)(x) x = Dropout(0.2)(x) # x = Dense(512)(x) # x = BatchNormalization()(x) # x = LeakyReLU(alpha=0.05)(x) # x = Dropout(0.4)(x) x = Dense(256)(x) x = BatchNormalization()(x) x = LeakyReLU(alpha=0.05)(x) x = Dropout(0.2)(x) out1 = Dense(20, activation="linear", name='int_outp')(x) #2 mulliken charge, tensor 6, tensor 12(others) x = Dense(128)(x) x = BatchNormalization()(x) x = LeakyReLU(alpha=0.05)(x) x = Dropout(0.2)(x) # x = Dense(128)(x) # x = BatchNormalization()(x) # x = LeakyReLU(alpha=0.05)(x) x = Dense(64)(x) x = BatchNormalization()(x) x = LeakyReLU(alpha=0.05)(x) x = Dropout(0.2)(x) out = Dense(1, activation="linear", name='sc_outp')(x) #scalar_coupling_constant model = Model(inputs=inp, outputs=[out, out1]) # model = Model(inputs=inp, outputs=[out]) return model def train_nn(nn_config, train_X, train_Y, val_X, val_Y, test_X): model_name_wrt = f'molecule_model_{nn_config["type_enc"]}.hdf5' assert isinstance(nn_config['load_model'], bool) if nn_config['load_model'] is False: model = create_nn_model(train_X.shape[1]) model.compile(loss='mse', metrics=['mae'], optimizer=Adam(lr=nn_config['lr'])) # tensorboard_callback = TensorBoard("logs/" + datetime.now().strftime('%H:%M:%S'), update_freq='epoch') val_loss = 'val_sc_outp_mean_absolute_error' es = EarlyStopping(monitor=val_loss, mode='min', patience=30, verbose=0) rlr = ReduceLROnPlateau(monitor=val_loss, factor=0.1, patience=25, min_lr=1e-6, mode='auto', verbose=1) sv_mod = ModelCheckpoint( model_name_wrt, monitor='val_sc_outp_mean_absolute_error', save_best_only=True, period=1) train_Y = train_Y.values val_Y = val_Y.values history = model.fit( train_X, [train_Y[:, 0], train_Y[:, 1:]], validation_data=(val_X, [val_Y[:, 0], val_Y[:, 1:]]), epochs=nn_config['epochs'], verbose=0, batch_size=nn_config['batch_size'], callbacks=[es, rlr, sv_mod]) plot_history(history, nn_config['type_enc']) else: print('Loading from file', model_name_wrt) model = load_model(model_name_wrt) output_dict = { 'model': model, 'train_prediction': model.predict(train_X)[0][:, 0], 'val_prediction': model.predict(val_X)[0][:, 0], 'test_prediction': model.predict(test_X)[0][:, 0], } return output_dict def get_intermediate_Ydf(mulliken_df, magnetic_shielding_tensors_df, raw_train_df): interm_Y_atomdata_df = pd.merge( mulliken_df, magnetic_shielding_tensors_df, how='outer', on=['molecule_name', 'atom_index']) Y_cols = interm_Y_atomdata_df.columns.tolist() Y_cols.remove('molecule_name') Y_cols.remove('atom_index') interm_Y_df = raw_train_df[['molecule_name', 'atom_index_0', 'atom_index_1']].reset_index() interm_Y_df = pd.merge( interm_Y_df, interm_Y_atomdata_df, how='left', left_on=['molecule_name', 'atom_index_0'], right_on=['molecule_name', 'atom_index']) interm_Y_df.rename({c: f'{c}_0' for c in Y_cols}, axis=1, inplace=True) interm_Y_df.drop('atom_index', axis=1, inplace=True) interm_Y_df = pd.merge( interm_Y_df, interm_Y_atomdata_df, how='left', left_on=['molecule_name', 'atom_index_1'], right_on=['molecule_name', 'atom_index']) interm_Y_df.rename({c: f'{c}_1' for c in Y_cols}, axis=1, inplace=True) interm_Y_df.drop(['atom_index', 'atom_index_0', 'atom_index_1', 'molecule_name'], axis=1, inplace=True) interm_Y_df.set_index('id', inplace=True) # Normalization interm_Y_df = pd.DataFrame( StandardScaler().fit_transform(interm_Y_df), columns=interm_Y_df.columns, index=interm_Y_df.index) return interm_Y_df
5,195
2,108
"""============================================================= ~/fn_portal/fn_portal/tests/api/test_FN026.py Created: 26 May 2021 18:01:30 DESCRIPTION: This file contains a number of unit tests that verify that the api endpoint for FN026 objects works as expected: + the fn026 list returns all of the spaces associated with a specific project + the space detail endpoint will return the space code, space description, dd_lat, dd_lon. ============================================================= """ import json import pytest from django.urls import reverse from fn_portal.models import FN026 from fn_portal.tests.fixtures import api_client, project from rest_framework import status from ..factories import FN026Factory @pytest.mark.django_db def test_fn026_list(api_client, project): """""" prj_cd = project.prj_cd url = reverse("fn_portal_api:fn026-list", kwargs={"prj_cd": prj_cd}) response = api_client.get(url) assert response.status_code == status.HTTP_200_OK data = [ (x.get("space"), x.get("space_des"), x.get("dd_lat"), x.get("dd_lon")) for x in response.data["results"] ] assert len(data) == 2 expected = [("S1", "Space 1", 45.1, -81.1), ("S2", "Space 2", 45.2, -81.2)] assert data == expected @pytest.mark.django_db def test_fn026_detail(api_client, project): """""" prj_cd = project.prj_cd space = "S1" expected = { "space": "S1", "space_des": "Space 1", "dd_lat": 45.1, "dd_lon": -81.1, } FN026Factory(project=project, **expected) url = reverse( "fn_portal_api:fn026-detail", kwargs={"prj_cd": prj_cd, "space": space} ) response = api_client.get(url) assert response.status_code == status.HTTP_200_OK for k, v in expected.items(): assert response.data[k] == expected[k] expected_fields = { "project", "label", "space", "space_des", "area_lst", "grdep_ge", "grdep_lt", "sidep_lt", "sidep_ge", "grid_ge", "grid_lt", "site_lst", "sitp_lst", "dd_lat", "dd_lon", } assert set(response.data.keys()) == expected_fields args = [ ("LHA_IA19_FOO", "S1"), # bad project code, good space ("LHA_IA19_000", "99"), # good project code, bad space ] @pytest.mark.django_db @pytest.mark.parametrize("prj_cd,space", args) def test_fn026_detail_404(api_client, project, prj_cd, space): """If we ask for space or project that does exist we should get back a 404. """ url = reverse( "fn_portal_api:fn026-detail", kwargs={"prj_cd": prj_cd, "space": space} ) response = api_client.get(url) assert response.status_code == status.HTTP_404_NOT_FOUND
2,809
1,034
# Copyright Amazon.com, Inc. or its affiliates. All Rights Reserved. # # Licensed under the Apache License, Version 2.0 (the "License"). You # may not use this file except in compliance with the License. A copy of # the License is located at # # http://aws.amazon.com/apache2.0/ # # or in the "license" file accompanying this file. This file is # distributed on an "AS IS" BASIS, WITHOUT WARRANTIES OR CONDITIONS OF # ANY KIND, either express or implied. See the License for the specific # language governing permissions and limitations under the License. import base64 import subprocess from pathlib import Path from unittest.mock import Mock, patch import pytest from braket.jobs.local.local_job_container import _LocalJobContainer @pytest.fixture def repo_uri(): return "012345678901.dkr.ecr.us-west-2.amazonaws.com" @pytest.fixture def image_uri(repo_uri): return f"{repo_uri}/my-repo:my-tag" @pytest.fixture def aws_session(): _aws_session = Mock() return _aws_session @patch("subprocess.check_output") @patch("subprocess.run") def test_start_and_stop(mock_run, mock_check_output, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), ] with _LocalJobContainer(image_uri, aws_session): pass mock_check_output.assert_any_call(["docker", "images", "-q", image_uri]) mock_check_output.assert_any_call( ["docker", "run", "-d", "--rm", local_image_name, "tail", "-f", "/dev/null"] ) assert mock_check_output.call_count == 2 mock_run.assert_any_call(["docker", "stop", running_container_name]) assert mock_run.call_count == 1 @patch("subprocess.check_output") @patch("subprocess.run") def test_pull_container(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" test_token = "Test Token" mock_check_output.side_effect = [ str.encode(""), str.encode(local_image_name), str.encode(running_container_name), ] aws_session.ecr_client.get_authorization_token.return_value = { "authorizationData": [{"authorizationToken": base64.b64encode(str.encode(test_token))}] } with _LocalJobContainer(image_uri, aws_session): pass mock_check_output.assert_any_call(["docker", "images", "-q", image_uri]) mock_check_output.assert_any_call( ["docker", "run", "-d", "--rm", local_image_name, "tail", "-f", "/dev/null"] ) assert mock_check_output.call_count == 3 mock_run.assert_any_call(["docker", "login", "-u", "AWS", "-p", test_token, repo_uri]) mock_run.assert_any_call(["docker", "pull", image_uri]) mock_run.assert_any_call(["docker", "stop", running_container_name]) assert mock_run.call_count == 3 @patch("subprocess.check_output") @patch("subprocess.run") def test_run_job_success(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" env_variables = { "ENV0": "VALUE0", "ENV1": "VALUE1", } run_program_name = "Run Program Name" expected_run_output = "Expected Run Output" mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), str.encode(run_program_name), str.encode(expected_run_output), ] with _LocalJobContainer(image_uri, aws_session) as container: container.run_local_job(env_variables) run_output = container.run_log assert run_output == expected_run_output mock_check_output.assert_any_call(["docker", "images", "-q", image_uri]) mock_check_output.assert_any_call( ["docker", "run", "-d", "--rm", local_image_name, "tail", "-f", "/dev/null"] ) mock_check_output.assert_any_call( ["docker", "exec", running_container_name, "printenv", "SAGEMAKER_PROGRAM"] ) mock_check_output.assert_any_call( [ "docker", "exec", "-w", "/opt/ml/code/", "-e", "ENV0=VALUE0", "-e", "ENV1=VALUE1", running_container_name, "python", run_program_name, ] ) assert mock_check_output.call_count == 4 mock_run.assert_any_call(["docker", "stop", running_container_name]) assert mock_run.call_count == 1 @patch("subprocess.check_output") @patch("subprocess.run") def test_customer_script_fails(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" env_variables = { "ENV0": "VALUE0", "ENV1": "VALUE1", } run_program_name = "Run Program Name" expected_error_output = "Expected Error Output" mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), str.encode(run_program_name), subprocess.CalledProcessError("Test Error", "test", str.encode(expected_error_output)), ] with _LocalJobContainer(image_uri, aws_session) as container: container.run_local_job(env_variables) run_output = container.run_log assert run_output == expected_error_output assert mock_check_output.call_count == 4 mock_run.assert_any_call(["docker", "stop", running_container_name]) assert mock_run.call_count == 1 @patch("subprocess.check_output") @patch("subprocess.run") def test_make_dir(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" test_dir_path = "/test/dir/path" mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), str.encode(""), ] with _LocalJobContainer(image_uri, aws_session) as container: container.makedir(test_dir_path) mock_check_output.assert_any_call(["docker", "images", "-q", image_uri]) mock_check_output.assert_any_call( ["docker", "run", "-d", "--rm", local_image_name, "tail", "-f", "/dev/null"] ) mock_check_output.assert_any_call( ["docker", "exec", running_container_name, "mkdir", "-p", test_dir_path] ) assert mock_check_output.call_count == 3 mock_run.assert_any_call(["docker", "stop", running_container_name]) assert mock_run.call_count == 1 @patch("subprocess.check_output") @patch("subprocess.run") def test_copy_to(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" source_path = str(Path("test", "source", "dir", "path", "srcfile.txt")) dest_path = str(Path("test", "dest", "dir", "path", "dstfile.txt")) mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), str.encode(""), str.encode(""), ] with _LocalJobContainer(image_uri, aws_session) as container: container.copy_to(source_path, dest_path) mock_check_output.assert_any_call(["docker", "images", "-q", image_uri]) mock_check_output.assert_any_call( ["docker", "run", "-d", "--rm", local_image_name, "tail", "-f", "/dev/null"] ) mock_check_output.assert_any_call( [ "docker", "exec", running_container_name, "mkdir", "-p", str(Path("test", "dest", "dir", "path")), ] ) mock_check_output.assert_any_call( ["docker", "cp", source_path, f"{running_container_name}:{dest_path}"] ) assert mock_check_output.call_count == 4 mock_run.assert_any_call(["docker", "stop", running_container_name]) assert mock_run.call_count == 1 @patch("subprocess.check_output") @patch("subprocess.run") def test_copy_from(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" source_path = "/test/source/dir/path/srcfile.txt" dest_path = "/test/dest/dir/path/dstfile.txt" mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), str.encode(""), str.encode(""), ] with _LocalJobContainer(image_uri, aws_session) as container: container.copy_from(source_path, dest_path) mock_check_output.assert_any_call(["docker", "images", "-q", image_uri]) mock_check_output.assert_any_call( ["docker", "run", "-d", "--rm", local_image_name, "tail", "-f", "/dev/null"] ) mock_check_output.assert_any_call( ["docker", "cp", f"{running_container_name}:{source_path}", dest_path] ) assert mock_check_output.call_count == 3 mock_run.assert_any_call(["docker", "stop", running_container_name]) assert mock_run.call_count == 1 @patch("subprocess.check_output") @patch("subprocess.run") @pytest.mark.xfail(raises=ValueError) def test_run_fails_no_program(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" env_variables = { "ENV0": "VALUE0", "ENV1": "VALUE1", } mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), str.encode(""), ] with _LocalJobContainer(image_uri, aws_session) as container: container.run_local_job(env_variables) @patch("subprocess.check_output") @patch("subprocess.run") @pytest.mark.xfail(raises=subprocess.CalledProcessError) def test_make_dir_fails(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" test_dir_path = "/test/dir/path" mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), subprocess.CalledProcessError("Test Error", "test", str.encode("test output")), ] with _LocalJobContainer(image_uri, aws_session) as container: container.makedir(test_dir_path) @patch("subprocess.check_output") @patch("subprocess.run") @pytest.mark.xfail(raises=subprocess.CalledProcessError) def test_copy_to_fails(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" source_path = "/test/source/dir/path/srcfile.txt" dest_path = "/test/dest/dir/path/dstfile.txt" mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), subprocess.CalledProcessError("Test Error", "test", str.encode("test output")), ] with _LocalJobContainer(image_uri, aws_session) as container: container.copy_to(source_path, dest_path) @patch("subprocess.check_output") @patch("subprocess.run") @pytest.mark.xfail(raises=subprocess.CalledProcessError) def test_copy_from_fails(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" source_path = "/test/source/dir/path/srcfile.txt" dest_path = "/test/dest/dir/path/dstfile.txt" mock_check_output.side_effect = [ str.encode(local_image_name), str.encode(running_container_name), subprocess.CalledProcessError("Test Error", "test", str.encode("test output")), ] with _LocalJobContainer(image_uri, aws_session) as container: container.copy_from(source_path, dest_path) @patch("subprocess.check_output") @patch("subprocess.run") @pytest.mark.xfail(raises=ValueError) def test_pull_fails_no_auth(mock_run, mock_check_output, repo_uri, image_uri, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" mock_check_output.side_effect = [ str.encode(""), str.encode(local_image_name), str.encode(running_container_name), ] aws_session.ecr_client.get_authorization_token.return_value = {} with _LocalJobContainer(image_uri, aws_session): pass @patch("subprocess.check_output") @patch("subprocess.run") @pytest.mark.xfail(raises=ValueError) def test_pull_fails_invalid_uri(mock_run, mock_check_output, aws_session): local_image_name = "LocalImageName" running_container_name = "RunningContainer" mock_check_output.side_effect = [ str.encode(""), str.encode(local_image_name), str.encode(running_container_name), ] aws_session.ecr_client.get_authorization_token.return_value = {} with _LocalJobContainer("TestURI", aws_session): pass @patch("subprocess.check_output") @patch("subprocess.run") @pytest.mark.xfail(raises=ValueError) def test_pull_fails_unknown_reason(mock_run, mock_check_output, repo_uri, image_uri, aws_session): test_token = "Test Token" mock_check_output.side_effect = [ str.encode(""), str.encode(""), ] aws_session.ecr_client.get_authorization_token.return_value = { "authorizationData": [{"authorizationToken": base64.b64encode(str.encode(test_token))}] } with _LocalJobContainer(image_uri, aws_session): pass
13,534
4,483
#!/usr/bin/env python # -*- coding: utf-8 -*- from __future__ import with_statement # Required in 2.5 import subprocess import os import fnmatch import gzip import re import commands import getopt import sys import signal import resource import time import struct import random from random import choice from subprocess import Popen, PIPE, STDOUT #from optparse import OptionParser import optparse sys.path.append('../../cnf-utils/') from xor_to_cnf_class import * maxTime = 40 maxTimeDiff = 20 class PlainHelpFormatter(optparse.IndentedHelpFormatter): def format_description(self, description): if description: return description + "\n" else: return "" usage = "usage: %prog [options] --fuzz/--regtest/--checkdir/filetocheck" desc = """Example usages: * check already computed SAT solutions (UNSAT cannot be checked): ./regression_test.py --checkdir ../../clusters/cluster93/ --cnfdir ../../satcomp09/ * check already computed SAT solutions (UNSAT cannot be checked): ./regression_test.py -c myfile.cnf -s sol.txt * fuzz the solver with fuzz-generator ./regression_test.py -f * go through regression listdir ./regression_test.py --regtest --checkdir ../tests/ """ parser = optparse.OptionParser(usage=usage, description=desc, formatter=PlainHelpFormatter()) parser.add_option("--exec", metavar= "SOLVER", dest="solver" , default="../build/cryptominisat" , help="SAT solver executable. Default: %default" ) parser.add_option("--extraopts", "-e", metavar= "OPTS", dest="extra_options" , default="" , help="Extra options to give to SAT solver" ) parser.add_option("--verbose", "-v", action="store_true" , default=False, dest="verbose" , help="Print more output" ) parser.add_option("-t", "--threads", dest="num_threads", metavar="NUM" , default=1, type="int" , help="Number of threads" ) #for fuzz-testing parser.add_option("-f", "--fuzz", dest="fuzz_test" , default=False, action="store_true" , help="Fuzz-test" ) #for regression testing parser.add_option("--regtest", dest="regressionTest" , default=False, action="store_true" , help="Regression test" ) parser.add_option("--testdir", dest="testDir" , default= "../tests/" , help="Directory where the tests are" ) parser.add_option("--testdirNewVar", dest="testDirNewVar" , default= "../tests/newVar/" , help="Directory where the tests are" ) parser.add_option("--drup", dest="drup" , default= False, action="store_true" , help="Directory where the tests are" ) #check dir stuff parser.add_option("--checksol", dest="checkSol" , default=False, action="store_true" , help="Check solution at specified dir against problems at specified dir" ) parser.add_option("--soldir", dest="checkDirSol" , help="Check solutions found here" ) parser.add_option("--probdir", dest="checkDirProb" , default="/home/soos/media/sat/examples/satcomp09/" , help="Directory of CNF files checked against" ) parser.add_option("-c", "--check", dest="checkFile" , default=None , help="Check this file" ) parser.add_option("-s", "--sol", dest="solutionFile" , default=None , help="Against this solution" ) (options, args) = parser.parse_args() def setlimits(): #sys.stdout.write("Setting resource limit in child (pid %d): %d s\n" % (os.getpid(), maxTime)) resource.setrlimit(resource.RLIMIT_CPU, (maxTime, maxTime)) def unique_fuzz_file(file_name_begin): counter = 1 while 1: file_name = file_name_begin + '_' + str(counter) + ".cnf" try: fd = os.open(file_name, os.O_CREAT | os.O_EXCL) os.fdopen(fd).close() return file_name except OSError: pass counter += 1 class Tester: def __init__(self): self.check_unsat = False self.testDir = options.testDir self.testDirNewVar = options.testDirNewVar self.ignoreNoSolution = False self.needDebugLib = True def random_options(self) : cmd = " " #extra = ["polarity-mode","rnd-freq","verbosity","randomize" #,,"maxmatrixrows","minmatrixrows","savematrix" #,,"threads", "maxconfl"] #"maxsolutions" opts = ["nonormxorfind","nobinxorfind" ,"noregbxorfind","doextendedscc","noconglomerate" ,"nosimplify","greedyunbound" ,"novarreplace" ,"pavgbranch" ,"nofailedlit","noheuleprocess","nosatelite","noxorsubs" ,"novarelim","nosubsume1","nomatrixfind" ,"noordercol","noiterreduce" ,"nohyperbinres","noremovebins" ,"noremlbins","nosubswithbins","nosubswithnbins" ,"noclausevivif","nosortwatched","nolfminim","nocalcreach" ,"nobxor","norecotfssr","nocacheotfssr","nootfsubsume" ,"plain"] for opt in opts: if random.randint(0,3) == 1 : cmd += "--%s " % (opt) cmd += "--gaussuntil=%d " % random.randint(0,50) cmd += "--maxnummatrixes=%d " % random.randint(0,10) cmd += "--restart=%s " % random.choice(["auto", "static", "dynamic"]) cmd += "--switchoffsubs=%s " % random.choice([20, random.randint(0, 200000)]) return cmd def execute(self, fname, newVar=False, needToLimitTime=False, fnameDrup=None): if os.path.isfile(options.solver) != True: print "Error: Cannot find CryptoMiniSat executable. Searched in: '%s'" % \ options.solver print "Error code 300" exit(300) #construct command command = options.solver command += self.random_options() if self.needDebugLib : command += "--debuglib " if options.verbose == False: command += "--verbosity=0 " if newVar : command += "--debugnewVar " command += "--threads=%d " % options.num_threads command += options.extra_options + " " command += fname if fnameDrup: command += " --drupexistscheck 0 " + fnameDrup print "Executing: %s " % command #print time limit if options.verbose: print "CPU limit of parent (pid %d)" % os.getpid(), resource.getrlimit(resource.RLIMIT_CPU) #if need time limit, then limit if (needToLimitTime) : p = subprocess.Popen(command.rsplit(), stderr=subprocess.STDOUT, stdout=subprocess.PIPE, preexec_fn=setlimits) else: p = subprocess.Popen(command.rsplit(), stderr=subprocess.STDOUT, stdout=subprocess.PIPE) #print time limit after child startup if options.verbose: print "CPU limit of parent (pid %d) after startup of child" % \ os.getpid(), resource.getrlimit(resource.RLIMIT_CPU) #Get solver output consoleOutput, err = p.communicate() if options.verbose: print "CPU limit of parent (pid %d) after child finished executing" % \ os.getpid(), resource.getrlimit(resource.RLIMIT_CPU) return consoleOutput def parse_solution_from_output(self, output_lines): if len(output_lines) == 0: print "Error! SAT solver output is empty!" print "output lines: ", output_lines print "Error code 500" exit(500) #solution will be put here satunsatfound = False vlinefound = False solution = {} #parse in solution for line in output_lines: #skip comment if (re.match('^c ', line)): continue; #solution if (re.match('^s ', line)): if (satunsatfound) : print "ERROR: solution twice in solver output!" exit(400) if 'UNSAT' in line: unsat = True satunsatfound = True continue; if 'SAT' in line: unsat = False satunsatfound = True; continue; print "ERROR: line starts with 's' but no SAT/UNSAT on line" exit(400) #parse in solution if (re.match('^v ', line)): vlinefound = True myvars = line.split(' ') for var in myvars: if (var == 'v') : continue; if (int(var) == 0) : break; vvar = int(var) solution[abs(vvar)] = (vvar >= 0) #print "Parsed values:", solution if (self.ignoreNoSolution == False and (satunsatfound == False or (unsat == False and vlinefound == False)) ): print "Error: Cannot find line starting with 's' or 'v' in output!" print output_lines print "Error code 500" exit(500) if (self.ignoreNoSolution == True and (satunsatfound == False or (unsat == False and vlinefound == False)) ): print "Probably timeout, since no solution printed. Could, of course, be segfault/assert fault, etc." print "Making it look like an UNSAT, so no checks!" return (True, []) if (satunsatfound == False) : print "Error: Cannot find if SAT or UNSAT. Maybe didn't finish running?" print output_lines print "Error code 500" exit(500) if (unsat == False and vlinefound == False) : print "Error: Solution is SAT, but no 'v' line" print output_lines print "Error code 500" exit(500) return (unsat, solution) def check_regular_clause(self, line, solution): lits = line.split() final = False for lit in lits: numlit = int(lit) if numlit != 0: if (abs(numlit) not in solution): continue if numlit < 0: final |= ~solution[abs(numlit)] else: final |= solution[numlit] if final == True: break if final == False: print "Error: clause '%s' not satisfied." % line print "Error code 100" exit(100) def check_xor_clause(self, line, solution): line = line.lstrip('x') lits = line.split() final = False for lit in lits: numlit = int(lit) if numlit != 0: if abs(numlit) not in solution: print "Error: var %d not solved, but referred to in a xor-clause of the CNF" % abs(numlit) print "Error code 200" exit(200) final ^= solution[abs(numlit)] final ^= numlit < 0 if final == False: print "Error: xor-clause '%s' not satisfied." % line exit(-1) def test_found_solution(self, solution, fname, debugLibPart=None): if debugLibPart == None: print "Verifying solution for CNF file %s" % fname else: print "Verifying solution for CNF file %s, part %d" % (fname, debugLibPart) if fnmatch.fnmatch(fname, '*.gz'): f = gzip.open(fname, "r") else: f = open(fname, "r") clauses = 0 thisDebugLibPart = 0 for line in f: line = line.rstrip() #skip empty lines if len(line) == 0: continue #count debug lib parts if line[0] == 'c' and "Solver::solve" in line: thisDebugLibPart += 1 #if we are over debugLibPart, exit if debugLibPart != None and thisDebugLibPart >= debugLibPart: f.close() return #check solution against clause if line[0] != 'c' and line[0] != 'p': if line[0] != 'x': self.check_regular_clause(line, solution) else: self.check_xor_clause(line, solution) clauses += 1 f.close() print "Verified %d original xor&regular clauses" % clauses def checkUNSAT(self, fname) : a = XorToCNF() tmpfname = unique_fuzz_file("tmp_for_xor_to_cnf_convert") a.convert(fname, tmpfname ) #execute with the other solver toexec = "../../lingeling-587f/lingeling -f %s" % tmpfname print "Solving with other solver.." currTime = time.time() p = subprocess.Popen(toexec.rsplit(), stdout=subprocess.PIPE, preexec_fn=setlimits) consoleOutput2 = p.communicate()[0] os.unlink(tmpfname) #if other solver was out of time, then we can't say anything diffTime = time.time() - currTime if diffTime > maxTime-maxTimeDiff: print "Other solver: too much time to solve, aborted!" return None #extract output from the other solver print "Checking other solver output..." (otherSolverUNSAT, otherSolverSolution) = self.parse_solution_from_output(consoleOutput2.split("\n")) #check if the other solver agrees with us return otherSolverUNSAT def extractLibPart(self, fname, debug_num, assumps, tofile) : fromf = open(fname, "r") thisDebugLibPart = 0 maxvar = 0 numcls = 0 for line in fromf : line = line.strip() #ignore empty strings and headers if not line or line[0] == "p" : continue #process (potentially special) comments if line[0] == "c" : if "Solver::solve" in line: thisDebugLibPart += 1 continue #break out if we reached the debug lib part if thisDebugLibPart >= debug_num : break #count clauses and get max var number numcls += 1 maxvar = max(maxvar, self.get_max_var_from_clause(line)) fromf.close() #now we can create the new CNF file fromf = open(fname, "r") tof = open(tofile, "w") tof.write("p cnf %d %d\n" % (maxvar, numcls + len(assumps))) thisDebugLibPart = 0 for line in fromf : line = line.strip() #skip empty lines and headers if not line or line[0] == "p" : continue #parse up special header if line[0] == "c" : if "Solver::solve" in line: thisDebugLibPart += 1 continue #break out if we reached the debug lib part if thisDebugLibPart >= debug_num : break tof.write(line + '\n') #add assumptions for lit in assumps: tof.write("%d 0\n" % lit) fromf.close() tof.close() def get_assumps(self, fname, debugLibPart) : f = open(fname, "r") thispart = 0 solveline = None for line in f : if "Solver::solve" in line : thispart += 1 if thispart == debugLibPart : solveline = line break f.close() assert solveline != None ret = re.match("c.*Solver::solve\((.*)\)", solveline) assert ret != None assumps = ret.group(1).strip().split() assumps = [int(x) for x in assumps] print "Assumptions: ", assumps return assumps def check_assumps_inside_solution(self, assumps, solution) : for lit in assumps: var = abs(lit) val = lit > 0 if var in solution : if solution[var] != val : print "Solution pinted has literal %s but assumptions contained the inverse: '%s'" % (-1*lit, assumps) exit(-100) print "OK, all assumptions inside solution" def checkDebugLib(self, fname) : largestPart = -1 dirList2 = os.listdir(".") for fname_debug in dirList2: if fnmatch.fnmatch(fname_debug, "debugLibPart*.output"): debugLibPart = int(fname_debug[fname_debug.index("t") + 1:fname_debug.rindex(".output")]) largestPart = max(largestPart, debugLibPart) for debugLibPart in range(1, largestPart + 1): fname_debug = "debugLibPart%d.output" % debugLibPart print "Checking debug lib part ", debugLibPart if (os.path.isfile(fname_debug) == False) : print "Error: Filename to be read '%s' is not a file!" % fname_debug print "Error code 400" exit(400) #take file into mem f = open(fname_debug, "r") text = f.read() output_lines = text.splitlines() f.close() (unsat, solution) = self.parse_solution_from_output(output_lines) assumps = self.get_assumps(fname, debugLibPart) if unsat == False: print "debugLib is SAT" self.check_assumps_inside_solution(assumps, solution) self.test_found_solution(solution, fname, debugLibPart) else: print "debugLib is UNSAT" tmpfname = unique_fuzz_file("tempfile_for_extract_libpart") self.extractLibPart(fname, debugLibPart, assumps, tmpfname) #check with other solver ret = self.checkUNSAT(tmpfname) if ret == None : print "Cannot check, other solver took too much time" elif ret == True : print "UNSAT verified by other solver" else : print "Grave bug: SAT-> UNSAT : Other solver found solution!!" exit() #delete temporary file os.unlink(tmpfname) def check(self, fname, fnameSolution=None, fnameDrup=None, newVar=False, needSolve=True, needToLimitTime=False): consoleOutput = "" currTime = time.time() #Do we need to solve the problem, or is it already solved? if needSolve: consoleOutput = self.execute(fname, newVar, needToLimitTime, fnameDrup=fnameDrup) else: if not os.path.isfile(fnameSolution) : print "ERROR! Solution file '%s' is not a file!" % fnameSolution exit(-1) f = open(fnameSolution, "r") consoleOutput = f.read() f.close() print "Read solution from file " , fnameSolution #if time was limited, we need to know if we were over the time limit #and that is why there is no solution if needToLimitTime: diffTime = time.time() - currTime if diffTime > (maxTime - maxTimeDiff)/options.num_threads: print "Too much time to solve, aborted!" return else: print "Within time limit: %f s" % (time.time() - currTime) print "filename: %s" % fname #if library debug is set, check it if (self.needDebugLib) : self.checkDebugLib(fname) print "Checking console output..." (unsat, solution) = self.parse_solution_from_output(consoleOutput.split("\n")) otherSolverUNSAT = True if not unsat : self.test_found_solution(solution, fname) return; #it's UNSAT and we should not check, so exit if self.check_unsat == False: print "Cannot check -- output is UNSAT" return #it's UNSAT, let's check with DRUP if fnameDrup: toexec = "drupcheck %s %s" % (fname, fnameDrup) print "Checking DRUP...: ", toexec p = subprocess.Popen(toexec.rsplit(), stdout=subprocess.PIPE) #,preexec_fn=setlimits) consoleOutput2 = p.communicate()[0] diffTime = time.time() - currTime #find verification code foundVerif = False drupLine = "" for line in consoleOutput2.split('\n') : if len(line) > 1 and line[:2] == "s " : #print "verif: " , line foundVerif = True if line[2:10] != "VERIFIED" and line[2:] != "TRIVIAL UNSAT" : print "DRUP verification error, it says:", consoleOutput2 assert line[2:10] == "VERIFIED" or line[2:] == "TRIVIAL UNSAT", "DRUP didn't verify problem!" drupLine = line #Check whether we have found a verification code if foundVerif == False: print "verifier error! It says:", consoleOutput2 assert foundVerif, "Cannot find DRUP verification code!" else: print "OK, DRUP says:", drupLine #check with other solver ret = self.checkUNSAT(fname) if ret == None : print "Other solver time-outed, cannot check" elif ret == True: print "UNSAT verified by other solver" else : print "Grave bug: SAT-> UNSAT : Other solver found solution!!" exit() def removeDebugLibParts(self) : dirList = os.listdir(".") for fname_unlink in dirList: if fnmatch.fnmatch(fname_unlink, 'debugLibPart*'): os.unlink(fname_unlink) None def callFromFuzzer(self, directory, fuzzer, file_name) : if (len(fuzzer) == 1) : call = "{0}{1} > {2}".format(directory, fuzzer[0], file_name) elif(len(fuzzer) == 2) : seed = struct.unpack("<L", os.urandom(4))[0] call = "{0}{1} {2} {3} > {4}".format(directory, fuzzer[0], fuzzer[1], seed, file_name) elif(len(fuzzer) == 3) : seed = struct.unpack("<L", os.urandom(4))[0] hashbits = (random.getrandbits(20) % 79) + 1 call = "%s %s %d %s %d > %s" % (fuzzer[0], fuzzer[1], hashbits, fuzzer[2], seed, file_name) return call def create_fuzz(self, fuzzers, fuzzer, directory, file_name) : #handle special fuzzer file_names_multi = [] if len(fuzzer) == 2 and fuzzer[1] == "special": #create N files file_names_multi = [] #sometimes just fuzz with all SAT problems fixed = random.getrandbits(1) == 1 for i in range(random.randrange(2,4)) : file_name2 = unique_fuzz_file("fuzzTest"); file_names_multi.append(file_name2) #chose a ranom fuzzer, not multipart fuzzer2 = ["multipart.py", "special"] while (fuzzer2[0] == "multipart.py") : fuzzer2 = choice(fuzzers) #sometimes fuzz with SAT problems only if (fixed) : fuzzer2 = fuzzers[0] print "fuzzer2 used: ", fuzzer2 call = self.callFromFuzzer(directory, fuzzer2, file_name2) print "calling sub-fuzzer:", call out = commands.getstatusoutput(call) #construct multi-fuzzer call call = "" call += directory call += fuzzer[0] call += " " for name in file_names_multi : call += " " + name call += " > " + file_name return call, file_names_multi #handle normal fuzzer else : return self.callFromFuzzer(directory, fuzzer, file_name), [] def file_len_no_comment(self, fname): i = 0; with open(fname) as f: for l in f : #ignore comments and empty lines and header if not l or l[0] == "c" or l[0] == "p": continue i += 1 return i def get_max_var_from_clause(self, line) : maxvar = 0 #strip leading 'x' line2 = line.strip() if len(line2) > 0 and line2[0] == 'x' : line2 = line2[1:] for lit in line2.split() : num = 0 try : num = int(lit) except ValueError: print "line '%s' contains a non-integer variable" % line2 maxvar = max(maxvar, abs(num)) return maxvar def generate_random_assumps(self, maxvar) : assumps = "" num = 0 varsInside = set() #Half of the time, no assumptions at all if random.randint(0,1) == 1: return assumps #use a distribution so that few will be in assumps while (num < maxvar and random.randint(0,4) > 0) : #get a var that is not already inside the assumps thisVar = random.randint(1, maxvar) while (thisVar in varsInside) : thisVar = random.randint(1, maxvar) varsInside.add(thisVar) #random sign if random.randint(0,1) : thisVar *= -1 assumps += "%d " % thisVar return assumps def intersperse_with_debuglib(self, fname1, fname2) : #approx number of solve()-s to add if random.randint(0,1) == 1: numtodo = random.randint(0,10) else: numtodo = 0 #based on length and number of solve()-s to add, intersperse #file with ::solve() file_len = self.file_len_no_comment(fname1) if numtodo > 0: nextToAdd = random.randint(1,(file_len/numtodo)*2+1) else : nextToAdd = file_len + 1 fin = open(fname1, "r") fout = open(fname2, "w") at = 0 maxvar = 0 for line in fin : line = line.strip() #ignore comments (but write them out) if not line or line[0] == "c" or line[0] == 'p': fout.write(line + '\n') continue at += 1 if at >= nextToAdd : assumps = self.generate_random_assumps(maxvar) #assumps = " " fout.write("c Solver::solve( %s )\n" % assumps) nextToAdd = at + random.randint(1,(file_len/numtodo)*2+1) #calculate max variable maxvar = max(maxvar, self.get_max_var_from_clause(line)) #copy line over fout.write(line + '\n') fout.close() fin.close() def fuzz_test(self) : fuzzers = [ ["../../sha1-sat/build/sha1-gen --attack preimage --rounds 18 --cnf", "--hash-bits", "--seed"] \ , ["../../sha1-sat/build/sha1-gen --xor --attack preimage --rounds 18 --cnf", "--hash-bits", "--seed"] \ , ["build/cnf-fuzz-biere"] \ #, ["build/cnf-fuzz-nossum"] \ #, ["build/largefuzzer"] \ , ["cnf-fuzz-brummayer.py"] \ , ["multipart.py", "special"] \ , ["build/sgen4 -unsat -n 50", "-s"] \ , ["cnf-fuzz-xor.py"] \ , ["build/sgen4 -sat -n 50", "-s"] \ ] directory = "../../cnf-utils/" while True: for fuzzer in fuzzers : file_name = unique_fuzz_file("fuzzTest"); fnameDrup = None if options.drup : fnameDrup = unique_fuzz_file("fuzzTest"); #create the fuzz file call, todel = self.create_fuzz(fuzzers, fuzzer, directory, file_name) print "calling ", fuzzer, " : ", call out = commands.getstatusoutput(call) #adding debuglib to fuzz file self.needDebugLib = True #delete old debugLibPart files dirList = os.listdir(".") for fname in dirList: if fnmatch.fnmatch(fname, 'debugLibPart*'): os.unlink(fname) file_name2 = unique_fuzz_file("fuzzTest"); self.intersperse_with_debuglib(file_name, file_name2) os.unlink(file_name) #check file self.check(fname=file_name2, fnameDrup=fnameDrup, needToLimitTime=True) #remove temporary filenames os.unlink(file_name2) for name in todel : os.unlink(name) if fnameDrup != None : os.unlink(fnameDrup) def checkDir(self) : self.ignoreNoSolution = True print "Checking already solved solutions" #check if options.checkDirSol has bee set if options.checkDirSol == "": print "When checking, you must give test dir" exit() print "You gave testdir (where solutions are):", options.checkDirSol print "You gave CNF dir (where problems are) :", options.checkDirProb dirList = os.listdir(options.checkDirSol) for fname in dirList: if fnmatch.fnmatch(fname, '*.cnf.gz.out'): #add dir, remove trailing .out fname = fname[:len(fname) - 4] fnameSol = options.checkDirSol + "/" + fname #check now self.check(fname=options.checkDirProb + "/" + fname, \ fnameSolution=fnameSol, needSolve=False) def regressionTest(self) : if False: #first, test stuff with newVar dirList = os.listdir(self.testDirNewVar) for fname in dirList: if fnmatch.fnmatch(fname, '*.cnf.gz'): self.check(fname=self.testDirNewVar + fname, newVar=True, needToLimitTime=True) dirList = os.listdir(self.testDir) #test stuff without newVar for fname in dirList: if fnmatch.fnmatch(fname, '*.cnf.gz'): self.check(fname=self.testDir + fname, newVar=False) tester = Tester() if options.checkFile : tester.check_unsat = True tester.check(options.checkFile, options.solutionFile, needSolve=False) if options.fuzz_test: tester.needDebugLib = False tester.check_unsat = True tester.fuzz_test() if options.checkSol: tester.checkDir() if options.regressionTest: tester.regressionTest()
31,261
9,314
""" ******************************************************* * Copyright (C) 2017 MindsDB Inc. <copyright@mindsdb.com> * * This file is part of MindsDB Server. * * MindsDB Server can not be copied and/or distributed without the express * permission of MindsDB Inc ******************************************************* """ import struct import pprint # import logging from libs.helpers.logging import logging from libs.constants.mysql import MAX_PACKET_SIZE class Packet: def __init__(self, length=0, seq=0, body='', packet_string = None, socket = None, session = None, proxy = None, parent_packet=None, **kwargs): if parent_packet is None: self.mysql_socket = socket self.session = session self.proxy = proxy else: self.mysql_socket = parent_packet.mysql_socket self.session = parent_packet.session self.proxy = parent_packet.proxy self._kwargs = kwargs self.setup() if packet_string is not None: self.loadFromPacketString(packet_string) else: self.loadFromParams(length, seq, body) def setup(self, length=0, seq=0, body=None): self.loadFromParams(length=length, seq=seq, body=body) def loadFromParams(self, length, seq, body): self._length = length self._seq = seq self._body = body def setBody(self, body_string): self._body = body_string self._length = len(body_string) def loadFromPacketString(self, packet_string): len_header = struct.unpack('>i', struct.pack('1s', '') + packet_string[:3])[0] count_header = struct.unpack('b', packet_string[3])[0] body = packet_string[4:] self.loadFromParams(length=len_header, seq=count_header, body=body) def getPacketString(self): body = self.body len_header = struct.pack('<i', self.length)[:3] # keep it 3 bytes count_header = struct.pack('b', self.seq) packet = len_header + count_header + body return packet def get(self): # packet_string = self._socket.request.recv(4) # if len(packet_string)<4: # val = 'Expecting packet, but header len is <0' # logging.error(val) # raise ValueError(val) len_header = MAX_PACKET_SIZE body = b'' count_header = 1 while len_header == MAX_PACKET_SIZE: packet_string = self.mysql_socket.request.recv(4) if len(packet_string) < 4: logging.warning('Packet with less than 4 bytes in length') return False break len_header = struct.unpack('i', packet_string[:3] + b'\x00')[0] if len_header == 0: break count_header = int(packet_string[3]) body += self.mysql_socket.request.recv(len_header) self.session.logging.debug('Got packet') self.session.logging.debug(body) self.session.count = int(count_header) + 1 self.setup(len(body), count_header, body) return True def send(self): self._seq = self.proxy.count string = self.getPacketString() self.session.logging.debug('Sending packet string') self.session.logging.debug(string) self.mysql_socket.request.sendall(string) self.proxy.count += 1 def pprintPacket(self,body = None): if body is None: body = self.body print(str(self)) for i,x in enumerate(body): part = '[BODY]' print('''{part}{i}:{h} ({inte}:{actual})'''.format(part=part, i=i+1, h=hex(ord(x)), inte=ord(x), actual=str(x))) def isEOF(self): if self.length == 0: return True else: return False @property def length(self): #self._length = len(self.body) return self._length @property def seq(self): return self._seq @property def body(self): return self._body @staticmethod def bodyStringToPackets(body_string): """ The method takes a string and turns it into mysql_packets :param body_string: text to turn into mysql_packets :return: a list of mysql_packets """ ret = [] body_len = len(body_string) mod = body_len % MAX_PACKET_SIZE num_packets = body_len / MAX_PACKET_SIZE + (1 if mod > 0 else 0) for i in range(num_packets): left_limit = i * MAX_PACKET_SIZE right_limit = mod if i + 1 == num_packets else MAX_PACKET_SIZE * (i + 1) body = body_string[left_limit:right_limit] ret += [Packet(length=right_limit, seq=i+1, body=body)] return ret def __str__(self): return str({'body': self.body, 'length': self.length, 'seq': self.seq}) def test(): import pprint u = Packet() #u.setBody('test') pprint.pprint(Packet.bodyStringToPackets('abdds')[0].getPacketString()) #pprint.pprint(u.getPacketString()) # only run the test if this file is called from debugger if __name__ == "__main__": test()
5,182
1,621
import pygame from random import randint from time import sleep import data SCREEN_SIZE = 700 STAGE_SIZE = 175 # 175 is largest size without bezels for 700 x 700 window sizeof_rect = int(SCREEN_SIZE / STAGE_SIZE) bezel = int((SCREEN_SIZE - (STAGE_SIZE * sizeof_rect)) / 2) def draw_bordered_square(x, y, filled, size): pygame.draw.rect(screen, (0, 0, 0), (x, y, size, size)), filled if not filled: pygame.draw.rect(screen, (255, 255, 255), (x + 1, y + 1, size - 2, size - 2)) def grid_to_screen(x, y): return x * sizeof_rect + bezel, y * sizeof_rect + bezel def screen_to_grid(x, y): return int((x - bezel) / sizeof_rect), int((y - bezel) / sizeof_rect) def flip_cell(x, y): cells[x][y] = not cells[x][y] draw_bordered_square(*grid_to_screen(x, y), cells[x][y], sizeof_rect) def draw_cells(): for x in range(bezel, STAGE_SIZE * sizeof_rect + bezel, sizeof_rect): for y in range(bezel, STAGE_SIZE * sizeof_rect + bezel, sizeof_rect): coord = screen_to_grid(x, y) draw_bordered_square(x, y, cells[coord[0]][coord[1]], sizeof_rect) directions = [] for x in [-1, 0, 1]: for y in [-1, 0, 1]: directions.append((x, y)) directions.remove((0,0)) def get_neighbours(x, y): total = 0 for d in directions: try: if cells[(x + d[0]) % STAGE_SIZE][(y + d[1]) % STAGE_SIZE]: total += 1 except: print(x, y, d, (x + d[0]) % SCREEN_SIZE, (y + d[1]) % SCREEN_SIZE) raise IndexError return total pygame.display.set_mode((SCREEN_SIZE, SCREEN_SIZE)) pygame.display.set_caption("Game of Life Classic Demo") pygame.init() screen = pygame.display.get_surface() cells = data.grid pause = True round = 0 while True: for event in pygame.event.get(): if event.type == pygame.KEYDOWN and event.key == pygame.K_SPACE: pause = not pause if event.type == pygame.MOUSEBUTTONDOWN: x, y = pygame.mouse.get_pos() x = int(x / int(SCREEN_SIZE / STAGE_SIZE)) y = int(y / int(SCREEN_SIZE / STAGE_SIZE)) flip_cell(x, y) print(x, y) if event.type == pygame.QUIT: exit(0) if not pause and round < 50: new_cells = [] for x in range(STAGE_SIZE): new_row = [] for y in range(STAGE_SIZE): neighbours = get_neighbours(x, y) cell = cells[x][y] if cell: if neighbours < 2 or neighbours > 3: cell = 0 elif neighbours == 3: cell = 1 new_row.append(cell) new_cells.append(new_row) cells = new_cells draw_cells() round += 1 pygame.display.flip()
2,538
1,197
r""" latexnewfloat.py extension for latex builder to replace literal-block environment by \captionof{LiteralBlockNewFloat}{caption_title} command. For \captionof command (in capt-of pacakge), the new environment LiteralBlockNewFloat should be configured by newfloat pagage instead of original float package. needspace package is required, and \literalblockneedspace and \literalblockcaptionaboveskip are introduced in order to control pagebreak around caption. Usage: add following latex preambles for latex_elements['preamble'] in conf.py 'preamble': r''' % declare new LiteralBlockNewFloat. You may change `name` option \DeclareFloatingEnvironment{LiteralBlockNewFloat} % confiure additional options \SetupFloatingEnvironment{LiteralBlockNewFloat}{name=Listing,placement=h,fileext=loc} % change within option in similar to literal-block in sphinx.sty \ifx\thechapter\undefined \SetupFloatingEnvironment{LiteralBlockNewFloat}{within=section} \else \SetupFloatingEnvironment{LiteralBlockNewFloat}{within=chapter} \fi % if the left page space is less than \literalblockneedsapce, insert page-break \newcommand{\literalblockneedspace}{5\baselineskip} % margin before the caption of literal-block \newcommand{\literalblockcaptionaboveskip}{0.5\baselineskip} ''' Run sphinx with builder name 'latexnewfloat' python -m sphinx.__init__ -b latexnewfloat {intpudir} {outputdir} or - add entry in makefile - you may also override original latex builder entry using app.set_translator """ from sphinx.writers.latex import LaTeXTranslator from sphinx.builders.latex import LaTeXBuilder def setup(app): app.add_builder(LaTeXNewFloatBuilder) app.set_translator('latexnewfloat', LaTeXNewFloatTranslator) # uncomment if you want to override stadnard latex builder # app.set_translator('latex', LaTeXNewFloatTranslator) app.add_latex_package('newfloat') app.add_latex_package('capt-of') app.add_latex_package('needspace') return {'version': '0.3'} # inherited from LaTeXBuilder class LaTeXNewFloatBuilder(LaTeXBuilder): name = 'latexnewfloat' # inherited from LaTeXTranslator class LaTeXNewFloatTranslator(LaTeXTranslator): def __init__(self, document, builder): LaTeXTranslator.__init__(self, document, builder) # flag whether caption is under container[litelal_block=True] node self.in_container_literal_block = 0 def visit_caption(self, node): self.in_caption += 1 if self.in_container_literal_block: self.body.append('\\needspace{\\literalblockneedspace}') self.body.append('\\vspace{\\literalblockcaptionaboveskip}') self.body.append('\\captionof{LiteralBlockNewFloat}{') else: self.body.append('\\caption{') def visit_container(self, node): if node.get('literal_block'): self.in_container_literal_block += 1 ids = '' for id in self.next_literal_ids: ids += self.hypertarget(id, anchor=False) if node['ids']: ids += self.hypertarget(node['ids'][0]) self.next_literal_ids.clear() self.body.append('\n') self.context.append(ids + '\n') def depart_container(self, node): if node.get('literal_block'): self.in_container_literal_block -= 1 self.body.append(self.context.pop())
3,494
1,031
""" Module to fetch and parse regional NIC delegation data """ import urllib.parse import ftplib import os from functools import lru_cache import socket import ipaddress from binascii import hexlify import tempfile TWD = tempfile.gettempdir() DELEGATES = [ # America (non-latin) "ftp://ftp.arin.net/pub/stats/arin/delegated-arin-extended-latest", # Europe "ftp://ftp.ripe.net/ripe/stats/delegated-ripencc-extended-latest", # Africa "ftp://ftp.afrinic.net/pub/stats/afrinic/delegated-afrinic-extended-latest", # Asia & Pacific "ftp://ftp.apnic.net/pub/stats/apnic/delegated-apnic-extended-latest", # Latin-America "ftp://ftp.lacnic.net/pub/stats/lacnic/delegated-lacnic-extended-latest",] @lru_cache(None) def _split_url(url): "Split delegate url into host, file_path and file_name." url = urllib.parse.urlparse(url) host = url.netloc file_path, file_name = url.path.rsplit('/', 1) return (host, file_path, file_name) def _file_details(ftp, file_name): "Retrieve details of the file." details = None print('# Retrieving file details') try: listing = list(ftp.mlsd()) print('# Server support mlsd, extracting details ...') for entry in listing: name, facts = entry if name.lower() == file_name.lower(): details = facts details['name_local'] = name details['name_remote'] = name break except ftplib.error_perm: print('# Server does not support mlsd, falling back.') tmp = list() ftp.retrlines('LIST %s' % file_name, callback=tmp.append) if '->' in tmp[0]: print('# Fall back: entry is a symbolic link, following ...') link2name = tmp[0].split('->')[1].strip() tmp = list() ftp.retrlines('LIST %s' % link2name, callback=tmp.append) details = dict() tmp = tmp[0] tmp = tmp.rsplit(' ', 1)[0] details['name_local'] = file_name details['name_remote'] = link2name tmp, details['size'], month, day, time = tmp.rsplit(' ', 4) details['modify'] = '_'.join([month, day, time.replace(':', '')]) return details def download(url): "Download the url." host, file_path, file_name = _split_url(url) print('# Connecting to: %s' % host) ftp = ftplib.FTP(host) print('# Logging in ...') ftp.login() print('# Changing cwd to: %s' % file_path) ftp.cwd(file_path) details = _file_details(ftp, file_name) file_cache = '_'.join([details['name_local'], details['size'], details['modify']]) file_cache += '.csv' if file_cache in os.listdir(TWD): print('# File is already downloaded !') return print('# Downloading ...') retr = 'RETR %s' % details['name_remote'] local_file = os.path.join(TWD, file_cache) ftp.retrbinary(retr, open(local_file, 'wb').write) print('# Downloaded!') # The parsing part of the program def _address_range_ipv4(address, width): "Convert IPv4 address and amount to integer range." # The width of ipv4 addresses is given in number of addresses which # are not bounded by exact netmasks for example a width of 640 addresses. blocks = address.split('.') for index, block in enumerate(blocks): blocks[index] = bin(int(block, 10))[2::].zfill(8) blocks = ''.join(blocks) network = int(blocks, 2) broadcast = network + int(width) - 1 return(network, broadcast) def _ipv6_to_int(ipv6_address): "Convert an IPv6 address to an integer" packed_string = socket.inet_pton(socket.AF_INET6, ipv6_address.exploded) return int(hexlify(packed_string), 16) def _address_range_ipv6(address, width): "Convert IPv6 address and broadcast to integer range." network = ipaddress.ip_network(address+'/'+width) broadcast = _ipv6_to_int(network.broadcast_address) network = _ipv6_to_int(network.network_address) return(network, broadcast) def _address_range(ipv, address, width): "From an IP address create integers for the network and broadcast IP" # This is essentially the range which in between an IP address is. if ipv == 4: # IPv4, the width is given as the number of IPs network, broadcast = _address_range_ipv4(address, width) else: # IPv6, width is given by a netmask. network, broadcast = _address_range_ipv6(address, width) return (network, broadcast) def _parse_row(row): "Parse and modify the row." columns = row.strip().split('|') # If there isn't more then 6 columns I can't parse it, so skipping it. if len(columns) > 6: tmp = columns[:5] if len(tmp[1].strip()) == 0: # This is the country it is assigned to, if there is no country # I am not interested in it. return None if tmp[2].strip().lower() not in ['ipv4', 'ipv6']: # If the protocol is not an IP protocol (such as asn), I am not # interested. return None if '6' in tmp[2]: tmp[2] = 6 else: tmp[2] = 4 # Convert the IP address and netmask/number of IP's to an IP range where # the IPs are converted to a numerical value. tmp[3], tmp[4] = _address_range(tmp[2], tmp[3], tmp[4]) return tmp class CompactRanges(object): "Try to compact the ranges." def __init__(self): self.ranges = list() def add(self, *newer): "Add a line to the ranges, compacting where possible." # nic, tld, ipv, network, broadcast = *newer newer = list(newer) if len(self.ranges) == 0: self.ranges.append(newer) return # Testing if current range is a continuation of the previous one older = self.ranges[-1] if older[0] == newer[0] and \ older[1] == newer[1] and \ older[2] == newer[2] and \ older[4] == newer[3] - 1: # The older broadcast is the same as newer network - 1, thus is is a # continuation, so extending the range of the older one. self.ranges[-1][4] = newer[4] else: self.ranges.append(newer) def length(self): "return length of ranges" return len(self.ranges) def _local_file_from_url(url): "Open the file, if available from the url" file_name = _split_url(url)[2] candidates = list() for candidate in os.listdir(TWD): if file_name.lower() in candidate.lower(): candidates.append(candidate) candidates.sort(reverse=True) if len(candidates) == 0: print('# No files to parse') return None file_full = os.path.join(TWD, candidates[0]) return file_full def parse_latest(url): "Parse a file as it has been retrieved from the url." file_name = _local_file_from_url(url) if file_name is None: print('# No files available to parse !') return print('# Opening file: %s' % file_name) compacted = CompactRanges() count_linesall = 0 count_relevant = 0 with open(file_name, 'r') as file_open: for row in file_open: count_linesall += 1 parsed = _parse_row(row) if parsed is None: continue count_relevant += 1 compacted.add(*parsed) print('# Parsed %s lines' % count_linesall) print('# - of which relevant: %s' % count_relevant) print('# - reduced to ranges: %s' % compacted.length()) return compacted.ranges def _compact_string(text): "try making text compacter" # we go through the text and try to replace repeated characters with: # _c_n_ where c is the character and n is the amount of if. The underscore # in this context is guaranteed to not occur in text. As such we can use # it as an escape character. # Also we do not collapse if repeated character is below 5. tmp = list() last = '' count = 0 for character in text+'_': # Add the underscore so we make sure not to miss the last bit of the # string if it happens to end on more then 4 identical characters. count += 1 if character != last: if count > 4: tmp = tmp[:len(tmp)-count] tmp.append('_%s_%s_' % (last, count)) count = 0 last = character tmp.append(character) # Remove the appended underscore before returning. return ''.join(tmp)[:-1] def get(): "Fetch and parse data" print('#'*79) print('# Fetching data from regional NICs.') print('#'*79) tmp = list() for delegate in DELEGATES: print('# Using: %s' % delegate) download(delegate) tmp += parse_latest(delegate) print('#' * 79) print('# A total of %s IP ranges have been defined.' % len(tmp)) for nic, country, ipv, network, broadcast in tmp: hex_network = hex(network)[2::].zfill(32) hex_broadcast = hex(broadcast)[2::].zfill(32) rid = nic[:2]+country+str(ipv)+hex_broadcast+hex_network rid = rid.lower() rid = _compact_string(rid) yield rid, nic, country, ipv, hex_network, hex_broadcast
9,347
2,973
# -*- coding: utf-8 -*- from helper.resource import YuzukiResource from helper.template import render_template from config.config import SITE_DESCRIPTION from helper.content import markdown_convert_file class Index(YuzukiResource): def render_GET(self, request): with open("page/index") as f: context = { "site_description": SITE_DESCRIPTION, "content": markdown_convert_file(f), "is_index": True, } return render_template("page.html", request, context)
548
153
# -*- coding: utf-8 -*- """ Author : Jacques Flores Created : October 17th,2019 About: Script for creating datasets in Dataverse. An Empty JSON file with Dataverse structure is imported and converted into a JSON dict Metadata is imported from an excel file into a pandas dataframe and written into the empty JSON formatted string. """ from pyDataverse import api from pyDataverse.utils import read_file_json from pyDataverse.utils import dict_to_json import pandas as pd import copy def create_datasets(dataverse, xl, template): dataset = 0 entries = xl['paperID'].count() handles_list = [] while dataset < entries: #Make a copy of the dataverse json template as metadata metadata = copy.deepcopy(template) #Store metadata from excel into variables authorname = xl.loc[:, xl.columns.str.endswith('name')] authoraffiliations = xl.loc[:, xl.columns.str.endswith('organisation')] contactname = xl.loc[dataset,'submitting_author'] title = xl.loc[dataset]['title'] contactemail = xl.loc[dataset]['authors_formatted_1_email'] subject = 'Arts and Humanities' poster = xl.loc[dataset]['contribution_type'] == 'Poster' fileid = xl.loc[dataset]['paperID'] #modify metadata #title metadata['datasetVersion']['metadataBlocks']['citation']['fields'][0]\ ['value'] = title #Authorname and affiliation for author, affiliation in zip(authorname.iloc[dataset].dropna(), authoraffiliations.iloc[dataset].dropna()): metadata['datasetVersion']['metadataBlocks']['citation']['fields'][1]\ ['value'].append({\ 'authorName': {'value': author , 'typeClass': 'primitive', 'multiple': False, 'typeName': 'authorName'},\ 'authorAffiliation':{'value': affiliation , 'typeClass': 'primitive', 'multiple': False, 'typeName': 'authorAffiliation'}}) #E-mail contact metadata['datasetVersion']['metadataBlocks']['citation']['fields'][2]\ ['value'][0]['datasetContactEmail']['value'] = contactemail #Dataset contact name metadata['datasetVersion']['metadataBlocks']['citation']['fields'][2]\ ['value'][0]['datasetContactName']['value'] = contactname #Description if poster: metadata['datasetVersion']['metadataBlocks']['citation']['fields'][3]\ ['value'][0]['dsDescriptionValue']['value'] = "Abstract and poster of paper %s presented at the Digital Humanities Conference 2019 (DH2019), Utrecht , the Netherlands 9-12 July, 2019." % fileid else: metadata['datasetVersion']['metadataBlocks']['citation']['fields'][3]\ ['value'][0]['dsDescriptionValue']['value'] = "Abstract of paper %s presented at the Digital Humanities Conference 2019 (DH2019), Utrecht , the Netherlands 9-12 July, 2019." % fileid #Subject (controlled vocabulary: only set values are allowed; check dataverse for these ) metadata['datasetVersion']['metadataBlocks']['citation']['fields'][4]\ ['value'][0]= subject #converting dictionary into a json formatted string metadata1 = dict_to_json(metadata) #creating Dataset in "RDMtest"dateverse with metadata and print response dset = dataverse.create_dataset( "DH2019", metadata1) print ('-' * 40) print (dset.json()) print (dset.status_code) #store persistent identifier from newly created dataset handle = dset.json()['data']['persistentId'] handles_list.append((handle,fileid)) #upload files ( I had to edit the api upload file function (pkg: pydataverse) cause it kept raising an error, as a result it does not return a response) #if there is a poster it will upload the abstract and the poster ELSE it will only upload the abstract #The abstarct should be named as " (paperID).pdf [e.g. 100.pdf] and the poster as "paperIDp.pdf" [e.g. 100p.pdf] for it to work. #If named differently this can be changed below if poster: dataverse.upload_file(handle , 'filesa/%sa.pdf' % (fileid)) dataverse.upload_file(handle , 'filesa/%sp.pdf' % (fileid)) else: dataverse.upload_file(handle , 'filesa/%sa.pdf' % (fileid)) #publish dataset and print response pubdset = dataverse.publish_dataset(handle, type = "major", auth = True) print ('-' * 40) print (pubdset.json()) print (pubdset.status_code) #Counter for datsets and emptying metadata template dataset = dataset + 1 metadata = {} return(handles_list) def publish_datasets(dataverse, handles_list) : #publish dataset and print response dataset = 0 entries = handles_list[0].count() while dataset < entries: handle = handles_list.iloc[dataset][0] pubdset = dataverse.publish_dataset(handle, type = "major", auth = True) print ('-' * 40) print (pubdset.json()) print (pubdset.status_code) # Confidential API Token (Do Not Distribute) ****last four digits removed) apitoken = "38404b17-46f9-4fe5-808e-a4a38bd80aea" # Demo Dataverse server dtvserver = "https://dataverse.nl" #Loading connection and authentication dataverse = api.Api(dtvserver,apitoken) #reading json file as dict template = read_file_json('dataversetemplate.json') #read excel file with metadata as pandas dataframe xlfile = "DH2019_paperswithfiles.xlsx" xl = pd.read_excel(xlfile, converters={'paperID': str}) handles = create_datasets(dataverse, xl, template) handles_df = pd.DataFrame(handles) handles_df.to_excel("handles.xlsx")
6,281
1,717
from flask_script import Manager, prompt_bool # from flask_migrate import Migrate, MigrateCommand from school_api.app import create_app from school_api.db import create_tables, drop_tables from school_api.data_generator import test_db """ Refused flask_migration because it was overkill for this project """ app = create_app() # migrate = Migrate(app, db) manager = Manager(app) # manager.add_command('db', MigrateCommand) @manager.command def createtables(): drop_tables(app) create_tables(app) @manager.command def testdb(): drop_tables(app) create_tables(app) test_db(app) @manager.command def droptables(): if prompt_bool("Are you sure you want to lose all your data"): drop_tables(app) if __name__ == '__main__': manager.run()
778
257
p="\nTell me something, and I will repeat it back to you" p+="\nEnter 'quit' to end the program." active = True while active: message=input(p) if message =='quit': active = False else: print(message)
214
81
# Sample implementation of a custom layer info module def layer_info(layer, x, y, crs, params, identity): """Query layer and return info result as dict: { 'features': [ { 'id': <feature ID>, # optional 'attributes': [ { 'name': '<attribute name>', 'value': '<attribute value>' } ], 'bbox': [<minx>, <miny>, <maxx>, <maxy>], # optional 'geometry': '<WKT geometry>' # optional } ] } :param str layer: Layer name :param float x: X coordinate of query :param float y: Y coordinate of query :param str crs: CRS of query coordinates :param obj params: FeatureInfo service params { 'i': <X ordinate of query point on map, in pixels>, 'j': <Y ordinate of query point on map, in pixels>, 'height': <Height of map output, in pixels>, 'width': <Width of map output, in pixels>, 'bbox': '<Bounding box for map extent as minx,miny,maxx,maxy>', 'crs': '<CRS for map extent>', 'feature_count': <Max feature count>, 'with_geometry': <Whether to return geometries in response (default=1)>, 'with_maptip': <Whether to return maptip in response (default=1)>, 'FI_POINT_TOLERANCE': <Tolerance for picking points, in pixels (default=16)>, 'FI_LINE_TOLERANCE': <Tolerance for picking lines, in pixels (default=8)>, 'FI_POLYGON_TOLERANCE': <Tolerance for picking polygons, in pixels (default=4)>, 'resolution': <Resolution in map units per pixel> } :param str identity: User name or Identity dict """ features = [] feature_id = 123 attributes = [ { 'name': 'title', 'value': 'Feature for Layer %s' % layer }, { 'name': 'name', 'value': 'Feature Name' } ] px = round(x) py = round(y) bbox = [px - 50, py - 50, px + 50, py + 50] geometry = "POINT(%s %s)" % (px, py) features.append({ 'id': feature_id, 'attributes': attributes, 'bbox': bbox, 'geometry': geometry }) return { 'features': features }
2,512
728
from google.auth.transport.requests import Request from googleapiclient.discovery import build from googleapiclient.errors import HttpError import google_auth_oauthlib.flow import logging import os class gCalIntegratinator: """ Object for handling interactions between RADSA and Google Calendar API. This class uses the googleapiclient to interact with the Google Calendar API. AUTHORIZATION WORKFLOW: 1) Redirect user to the Authorization URL 2) User consents to Google Calendar integration and is redirected back to this application 3) The Authorization Response and State are returned from Google and used to generate user credentials 4) User credentials are returned back to the application where they are stored in the DB for later use Method Return Statuses: -5: Error Creating Google Calendar Event -4: Invalid Calendar Id -3: Invalid Credentials Received -2: Need to Renew Credentials -1: Unknown Error Occurred 0: Credentials are valid but needed refresh 1: Success Args: scopes (lst): A list containing the scopes required to interact with the Google Calendar API. The default provided are - .../auth/calendar.calendarlist.readonly - .../auth/calendar.app.created """ SCOPES = ['https://www.googleapis.com/auth/calendar.app.created', 'https://www.googleapis.com/auth/calendar.calendarlist.readonly'] def __init__(self, scopes=SCOPES): logging.debug("Creating gCalIntegratinator Object") # Name of Google service being used self.serviceName = "calendar" # API version number of Google service being used self.serviceVersion = "v3" # Set the scopes for reference self.scopes = scopes # Load the app credentials from the environment self.__appCreds = self._getCredsFromEnv() # Generate the oAuth2 flow for handling the client/app authentication self.flow = google_auth_oauthlib.flow.Flow.from_client_config( self.__appCreds, scopes=scopes) def _getCredsFromEnv(self): # This will return a deserialized JSON object that is assembled per # Google's specifications. This object will be configured for a 'web' app # This does assume the following parameters are available in the environment: # CLIENT_ID # PROJECT_ID # AUTH_URI # TOKEN_URI # AUTH_PROVIDER_X509_CERT_URL # CLIENT_SECRET # REDIRECT_URIS -> This should be the urls separated by a ',' only # JAVASCRIPT_ORIGINS -> This should be the urls separated by a ',' only logging.info("Loading app settings from environment") return { "web": { "client_id": os.environ["CLIENT_ID"], "project_id": os.environ["PROJECT_ID"], "auth_uri": os.environ["AUTH_URI"], "token_uri": os.environ["TOKEN_URI"], "auth_provider_x509_cert_url": os.environ["AUTH_PROVIDER_X509_CERT_URL"], "client_secret": os.environ["CLIENT_SECRET"], "redirect_uris": [entry for entry in os.environ["REDIRECT_URIS"].split(",")],# ["https://b03bb12e8ff3.ngrok.io"], "javascript_origins": [entry for entry in os.environ["JAVASCRIPT_ORIGINS"].split(",")] } } def _validateCredentials(self, creds): # Check to see if the client credentials are valid and that they have not # expired. This method can have the following outcomes: # # If the credentials are valid, then the credentials will be returned # If the credentials are not valid, an InvalidCalendarCredentialsError will be raised. # If the credentials have expired, an ExpiredCalendarCredentialsError will be raised. logging.debug("Checking Credentials") try: # Are the credentials invalid? if not creds.valid: # If the credentials are expired and can be refreshed, # then refresh the credentials if creds.expired and creds.refresh_token: creds.refresh(Request()) else: # Otherwise we will need to prompt the user to log in # and approve integration again. logging.debug("Manual Credential Refresh Required") raise self.ExpiredCalendarCredentialsError("Manual Credential Refresh Required") else: # If the credentials are valid, return successful logging.debug("Credentials Valid") except AttributeError: # If we receive an AttributeError, then we did not receive the expected # credentials object. # Log the occurrence logging.info("Invalid Credentials Received") # Raise an InvalidCalendarCredentialsError raise self.InvalidCalendarCredentialsError("Invalid Credentials Received") except self.ExpiredCalendarCredentialsError as e: # If we receive an ExpiredCalendarCredentialsError, then simply pass that up to # the calling method. raise e except Exception as e: # If we receive some other, unexpected Exception, then notify the calling method # Log the occurrence logging.error(str(e)) # Raise an UnknownError raise self.UnexpectedError("Calendar Credential Validation", e, str(e)) # If we made it this far without raising an exception, # then the credentials are valid. return creds def generateAuthURL(self, redirect_uri): # Generate and return an authorization url as well as a state logging.info("Generating Google Authorization URL") # Set the flow's redirect_uri self.flow.redirect_uri = redirect_uri # Return (auth_url, state) for the given redirect_uri return self.flow.authorization_url(access_type="offline", include_granted_scopes="true", prompt="select_account") def handleAuthResponse(self, auth_response, redirect_uri): # Generate authorization credentials from the authorization response logging.info("Generating Google Client Credentials") self.flow.redirect_uri = redirect_uri # Generate the token self.flow.fetch_token(authorization_response=auth_response) return self.flow.credentials def createGoogleCalendar(self, client_creds): # Create a Secondary Google Calendar using the user credentials logging.info("Creating Google Calendar") # Check to make sure the credentials are valid client_creds = self._validateCredentials(client_creds) # Build the Google Calendar service with appropriate version service = build(self.serviceName, self.serviceVersion, credentials=client_creds) # Create the body of the request to create a new Google Calendar. newCalBody = { "summary": "RA Duty Schedule", "description": "Calendar for the Resident Assistant Duty Schedule.\n\n" "Created and added to by the RA Duty Scheduler Application (RADSA)." } try: # Call the Google Calendar API Service to have the new calendar created created_calendar = service.calendars().insert(body=newCalBody).execute() except Exception as e: # If we received an exception, then wrap it in an CalendarCreationError and # pass that up to the calling function. # Log the occurrence logging.error("Error encountered when attempting to create Google Calendar: {}".format(str(e))) # Raise the CalendarCreationError raise self.CalendarCreationError(str(e)) logging.info("Calendar Creation Complete") # Return the ID of the new calendar. return created_calendar["id"] def exportScheduleToGoogleCalendar(self, client_creds, calendarId, schedule, flaggedDutyLabel): # Export the provided schedule to Google Calendar # Check to make sure the credentials are valid client_creds = self._validateCredentials(client_creds) # Create the Google Calendar Service service = build(self.serviceName, self.serviceVersion, credentials=client_creds) # Check to see if the 'RA Duty Schedule' calendar exists. If not, create # the calendar. try: logging.debug("Verifying that the 'RA Schedule Calendar' exists.") res = service.calendarList().get(calendarId=calendarId).execute() logging.debug("CalendarList().get() Result: {}".format(res)) except HttpError as e: # An HttpError occurred which could indicate that the calendar no longer exists. # If this is the case, the HttpError would be a 404 error. # Log the occurrence of this issue. logging.info("'RA Schedule Calendar' not found for client.") logging.error(str(e)) # Plan B is to create a new Google Calendar. try: # Create the calendar using the client_creds calendarId = self.createGoogleCalendar(client_creds) except self.CalendarCreationError as subE: # An error occurred when attempting to create the Calendar. # Wrap the exception in a ScheduleExportError and raise it raise self.ScheduleExportError(subE, "Unable to locate valid Google Calendar.") # Once we are able to locate the calendar, start adding the events to it! try: logging.info("Exporting schedule") # Iterate through the schedule for duty in schedule: # Check to see if this duty should be flagged if "flagged" in duty["extendedProps"].keys() and duty["extendedProps"]["flagged"]: # If so, then set the summary and description messages to include the flagged # duty label. summaryMsg = duty["title"] + " ({})".format(flaggedDutyLabel) descriptionMsg = duty["title"] + " has been assigned for {} duty.".format(flaggedDutyLabel) else: # Otherwise, set the summary and description messages to be the default summaryMsg = duty["title"] descriptionMsg = duty["title"] + " has been assigned for duty." # Create an Event Object that will handle assembling the event's body for the Google Calendar API eb = Event(summaryMsg, descriptionMsg, duty["start"]) # Call the Google Calendar API to add the event service.events().insert(calendarId=calendarId, body=eb.getBody(), supportsAttachments=False).execute() except HttpError as e: # An HttpError could indicate a number of things including a missing calendar or a # Bad Request/malformed data. If this occurs, stop processing and report back to the # server. # Log the occurrence logging.info("Error encountered while pushing Event: {} to Google Calendar".format(duty["start"])) logging.error(str(e)) # Wrap the exception in a ScheduleExportError and raise it raise self.ScheduleExportError(e, "Unable to export schedule to Google Calendar.") logging.info("Export complete") class BaseGCalIntegratinatorException(Exception): # Base GCalIntegratinator Exception def __init__(self, *args): # If args are provided if args: # Then set the message as the first argument self.message = args[0] logging.debug("BASE ERROR CREATION: {}".format(args)) else: # Otherwise set the message to None self.message = None # Set the exception name to GCalIntegratinatorError self.exceptionName = "GCalIntegratinatorError" def __str__(self): # If a message has been defined if self.message is not None: # Then put the message in the string representation return "{}".format(self.message) else: # Otherwise return a default string return "{} has been raised".format(self.exceptionName) class CalendarCreationError(BaseGCalIntegratinatorException): """GCalIntegratinator Exception to be raised when an error occurs during the creation of the a Google Calendar.""" def __init__(self, *args): # Pass the arguments to the parent class. super().__init__(*args) # Set the name of the exception self.exceptionName = "GoogleCalendarCreationError" class InvalidCalendarCredentialsError(BaseGCalIntegratinatorException): """GCalIntegratinator Exception to be raised if the provided Google Calendar credentials are invalid.""" def __init__(self, *args): # Pass the arguments to the parent class. super().__init__(*args) # Set the name of the exception self.exceptionName = "InvalidCalendarCredentialsError" class ExpiredCalendarCredentialsError(BaseGCalIntegratinatorException): """GCalIntegratinator Exception to be raised if the provided Google Calendar calendar credentials have expired.""" def __init__(self, *args): # Pass the arguments to the parent class. super().__init__(*args) # Set the name of the exception self.exceptionName = "ExpiredCalendarCredentialsError" class ScheduleExportError(BaseGCalIntegratinatorException): """GCalIntegratinator Exception to be raised if an error is encountered when attempting to export a schedule to Google Calendar.""" def __init__(self, wrappedException, *args): # Pass the arguments to the parent class. super().__init__(*args) # Set the name of the exception self.exceptionName = "ScheduleExportError" # Set the wrappedException self.wrappedException = wrappedException class UnexpectedError(BaseGCalIntegratinatorException): """GCalIntegratinator Exception to be raised if an unknown error occurs within the GCalIntegratintor object""" def __init__(self, location, wrappedException, *args): # Pass the arguments to the parent class. super().__init__(self, args) # Set the name of the exception self.exceptionName = "GCalIntegratinatorUnknownError" # Set the location of where the error occurred. self.exceptionLocation = location # Set the wrapped exception self.wrappedException = wrappedException class Event: """ Object for abstracting the Event schema that is used by the Google Calendar API """ def __init__(self, summary, description, date): self.__body = { # Taken from https://googleapis.github.io/google-api-python-client/docs/dyn/calendar_v3.events.html#insert # with supplemental information from https://developers.google.com/calendar/v3/reference/events/insert "summary": summary, # Title of the event. "description": description, # Description of the event. Can contain HTML. Optional. "start": { # The (inclusive) start time of the event. For a recurring event, this is the # start time of the first instance. "date": date # The date, in the format "yyyy-mm-dd", if this is an all-day event. }, "end": { # The (exclusive) end time of the event. For a recurring event, # this is the end time of the first instance. "date": date # The date, in the format "yyyy-mm-dd", if this is an all-day event. }, "status": "confirmed", # Status of the event. Optional. Possible values are: # - "confirmed" - The event is confirmed. This is the default status. # - "tentative" - The event is tentatively confirmed. # - "cancelled" - The event is cancelled (deleted). The list method returns # cancelled events only on incremental sync (when syncToken or # updatedMin are specified) or if the showDeleted flag is set to # true. The get method always returns them. A cancelled status # represents two different states depending on the event type: # - Cancelled exceptions of an uncancelled recurring event # indicate that this instance should no longer be presented # to the user. Clients should store these events for the # lifetime of the parent recurring event. # Cancelled exceptions are only guaranteed to have values # for the id, recurringEventId and originalStartTime fields # populated. The other fields might be empty. # - All other cancelled events represent deleted events. # Clients should remove their locally synced copies. Such # cancelled events will eventually disappear, so do not # rely on them being available indefinitely. # Deleted events are only guaranteed to have the id field populated. On the # organizer's calendar, cancelled events continue to expose event details # (summary, location, etc.) so that they can be restored (undeleted). Similarly, # the events to which the user was invited and that they manually removed continue # to provide details. However, incremental sync requests with showDeleted set to # false will not return these details. # If an event changes its organizer (for example via the move operation) and the # original organizer is not on the attendee list, it will leave behind a cancelled # event where only the id field is guaranteed to be populated. "transparency": "opaque", # Whether the event blocks time on the calendar. Optional. Possible values are: # - "opaque" - Default value. The event does block time on the calendar. This # is equivalent to setting Show me as to Busy in the Calendar UI. # - "transparent" - The event does not block time on the calendar. This is # equivalent to setting Show me as to Available in the # Calendar UI. } def getBody(self): # Return the Event Body return self.__body if __name__ == "__main__": g = gCalIntegratinator()
20,740
4,728
from random import choice from django.contrib import admin from pins.models import Batch, Pin from pins.forms import BatchForm def gen_randomdigits(size=10): return ''.join([choice('1234567890') for i in range(size)]) class BatchAdmin(admin.ModelAdmin): list_display = ('count', 'used', 'created_on', 'download_pins') form = BatchForm date_heirarchy = 'created_on' def save_model(self, request, obj, form, change): obj.save() num_pins = form.cleaned_data['number_of_pins'] count = 0 if change: return while count < num_pins: try: Pin.objects.create(pin=gen_randomdigits(), batch=obj) except: pass else: count += 1 class PinAdmin(admin.ModelAdmin): list_display = ('pin', 'batch', 'used') admin.site.register(Batch, BatchAdmin) admin.site.register(Pin, PinAdmin)
933
300
def getMinFix(K, N, signals): if K == 1: if set(signals) == {False}: return 1 return 0 startInd = 0 endInd = K - 1 lastStart = signals[0] curCount = signals[0:K].count(False) minCount = curCount for _ in range(N-K): startInd += 1 endInd += 1 if not lastStart: curCount -= 1 if not signals[endInd]: curCount += 1 lastStart = signals[startInd] minCount = min(minCount, curCount) return minCount def main(inputFile, outputFile): maxcrossInput = open(inputFile, 'r') maxcrossOutput = open(outputFile, 'w') N, K, B = maxcrossInput.readline().strip().split() N, K, B = int(N), int(K), int(B) signals = [True] * N for _ in range(B): signals[int(maxcrossInput.readline().strip()) - 1] = False # print(signals) maxcrossOutput.write(str(getMinFix(K, N, signals)) + '\n') maxcrossInput.close() maxcrossOutput.close() main('maxcross.in', 'maxcross.out')
961
374
''' Given an unsorted integer array, find the smallest missing positive integer. Example 1: Input: [1,2,0] Output: 3 Example 2: Input: [3,4,-1,1] Output: 2 Example 3: Input: [7,8,9,11,12] Output: 1 Note: Your algorithm should run in O(n) time and uses constant extra space. ''' class Solution: def firstMissingPositive(self, nums): if not nums: return 1 for i, num in enumerate(nums): if 0<num<len(nums): print(nums, i, num) nums[i], nums[num-1] = nums[num-1], nums[i] print(nums) for i, num in enumerate(nums): if num != i+1: return i+1 return len(nums)+1 s = Solution() print(s.firstMissingPositive([-1,4,2,1,9,10]))
752
280
""" Calculate the translational entropy with EW, HSM and IGM models """ import numpy as np import matplotlib.pyplot as plt from scipy import integrate plt.style.use("paper") ha2kjmol = 627.5 * 4.184 class Constants: hbar_au = 1.0 h_au = hbar_au * 2.0 * np.pi kb_au = 3.1668114E-6 # hartrees K-1 h_SI = 6.62607004E-34 # J s na = 6.02214086E23 # molecules mol-1 kb_SI = 1.38064852E-23 # J K-1 kb_JKmol = kb_SI * na # J K-1 mol-1 kb_kcalKmol = kb_SI / (4.184 * 1000) # kcal K-1 mol-1 k_b = kb_kcalKmol n_a = 6.022140857E23 # molecules mol-1 r = k_b * n_a # J K-1 mol-1 h = 6.62607004E-34 # J s atm_to_pa = 101325 # Pa dm_to_m = 0.1 # m amu_to_kg = 1.660539040E-27 # Kg c = 299792458 # m s-1 c_in_cm = c * 100 # cm s-1 ang_to_m = 1E-10 # m ang_to_au = 1.88973 # au Å-1 m_to_ang = 1E10 # Å m_to_bohr = 1.89e+10 # au m-1 amu_to_au = 1822.888486 # m_e amu-1 kj_mol_to_au = 0.00038087980 # Ha (kJ mol-1)-1 kcal_mol_to_au = 0.001593601 # Ha (kcal mol-1)-1 inverse_ang_inverse_au = 1.0 / 1.88973 # au-1 Å class Solute: def _s_t_igm(self, length_au): """ S = k_B T dln(q_t)/dT + k_B ln(q_t) = n k_B ((T / q) (3q / 2T) + ln(q)) dq/dT = 3q / 2T = n k_B (3/2 + ln(q)) :param mass_au: :param temp_K: :param length_au: :return: """ q_t = np.sqrt((2.0 * np.pi * self.mass_au * Constants.kb_au * temp_K) / ( Constants.h_au ** 2)) ** 3 * length_au ** 3 return Constants.r * (1.5 + np.log(q_t)) @property def s_t_igm_1atm(self): return self._s_t_igm(length_au=self.l_1atm_au) @property def s_t_igm_1m(self): return self._s_t_igm(length_au=self.l_1molar_au) def s_t_hsm(self, omega_au): """ S = k_B T dln(q_t)/dT + k_B ln(q_t) = (n k_B T) d ln(q)/dT + n k_B ln(q) = n k_B (3 hbar omega beta coth(hbar omega beta / 2) / 2T + ln(q)) :param temp_K: :param omega_au: :return: """ raise NotImplementedError beta_au = 1.0 / (Constants.kb_au * temp_K) q_t = 1.0 / (2.0 * np.sinh( Constants.hbar_au * omega_au * beta_au / 2.0)) ** 3 term1 = 3.0 * (Constants.hbar_au * omega_au * beta_au / 2.0) / np.tanh( Constants.hbar_au * omega_au * beta_au / 2.0) return Constants.r * (term1 + np.log(q_t)) def _q_t_ew(self): def exp_integrand(r, beta, a, b): return r ** 2 * np.exp(- beta * a * np.exp(b * r)) cap_lambda = ((2.0 * self.mass_au * np.pi) / ( beta_au * Constants.h_au ** 2)) ** 1.5 integral = integrate.quad(exp_integrand, 0.0, 10.0, args=(beta_au, self.a_au, self.b_inv_au))[0] return 4.0 * np.pi * np.exp(beta_au * self.a_au) * cap_lambda * integral @property def s_t_ew(self): beta_au = 1.0 / (Constants.kb_au * temp_K) q_t = self._q_t_ew() def integrand(r, beta, a, b): return r ** 2 * np.exp(-beta * a * (np.exp(b * r) - 1.0) + b * r) integral = integrate.quad(integrand, 0.0, 10.0, args=(beta_au, self.a_au, self.b_inv_au))[0] cap_lambda = ((2.0 * self.mass_au * np.pi) / (beta_au * Constants.h_au ** 2)) ** 1.5 term_4 = 4.0 * np.pi * (self.a_au * beta_au * cap_lambda / q_t) * integral analytic_s = Constants.r * (1.5 - self.a_au * beta_au + np.log(q_t) + term_4) # d_temp = 1E-10 # dlnq_dtemp = ((np.log( # q_t_ew(1.0 / (Constants.kb_au * (temp_K + d_temp)), self.a_au, self.b_inv_au, # mass_au)) - np.log(q_t)) # / d_temp) # numerical_s = Constants.r * (temp_K * dlnq_dtemp + np.log(q_t)) # print('Numerical derivative / analytic derivative = ', numerical_s / analytic_s) return analytic_s def __init__(self, mass_amu, k_kcal, a_inv_ang): self.mass_au = mass_amu * Constants.amu_to_au self.a_au = k_kcal * Constants.kcal_mol_to_au self.b_inv_au = a_inv_ang * Constants.inverse_ang_inverse_au # Harmonic oscillator # k_au = k_kjmol * Constants.kj_mol_to_au # omega_au = np.sqrt(k_au / mass_au) v_eff_1atm_m3 = Constants.kb_SI * temp_K / Constants.atm_to_pa l_1atm = v_eff_1atm_m3 ** (1 / 3) * Constants.m_to_ang self.l_1atm_au = l_1atm * Constants.ang_to_au v_eff_1molar_m3 = 1.0 / (Constants.n_a * (1.0 / Constants.dm_to_m) ** 3) l_1molar = v_eff_1molar_m3 ** (1 / 3) * Constants.m_to_ang self.l_1molar_au = l_1molar * Constants.ang_to_au def ST(S): return np.round(temp_K * S, decimals=3) if __name__ == '__main__': temp_K = 298.15 beta_au = 1.0 / (Constants.kb_au * temp_K) Methane_Water = Solute(mass_amu=16.04, k_kcal=1.048, a_inv_ang=2.918) Methane_Acetonitrile = Solute(mass_amu=16.04, k_kcal=0.529, a_inv_ang=2.793) Methane_Benzene = Solute(mass_amu=16.04, k_kcal=0.679, a_inv_ang=2.736) CO2_Water = Solute(mass_amu=44.01, k_kcal=0.545, a_inv_ang=4.075) CO2_Acetonitrile = Solute(mass_amu=44.01, k_kcal=0.446 , a_inv_ang=2.93) CO2_Benzene = Solute(mass_amu=44.01, k_kcal=0.415, a_inv_ang=3.431) Alanine_Water = Solute(mass_amu=89.09, k_kcal=0.53, a_inv_ang=4.083) Alanine_Acetonitrile = Solute(mass_amu=89.09, k_kcal=1.005, a_inv_ang=2.127) Alanine_Benzene = Solute(mass_amu=89.09, k_kcal=0.368, a_inv_ang=2.878) systems = [Methane_Water, Methane_Acetonitrile, Methane_Benzene, CO2_Water, CO2_Acetonitrile, CO2_Benzene, Alanine_Water, Alanine_Acetonitrile, Alanine_Benzene] rels = [] for system in systems: rel = ST(system.s_t_ew) / ST(system.s_t_igm_1m) rels.append(rel) print(ST(system.s_t_igm_1atm), ST(system.s_t_igm_1m), ST(system.s_t_ew), 'kcal mol-1', sep=' & ') print(np.average(np.array(rels)), '±', np.std(np.array(rels))/np.sqrt(len(rels)))
6,531
3,017
from .nlgsearch import templatize # NOQA: F401
53
22
############################################## # # Author: Aniruddha Gokhale # # Created: Spring 2022 # # Purpose: demonstrate a basic remote procedure call-based client # # A RPC uses message passing under the hood but provides a more # type-safe and intuitive way for users to make invocations on the remote # side because the caller makes invocations on methods (these could be methods # of a class object, which is what we show here). That object often is # a proxy of the real, remote implementation. The proxy simply offers the same # interface to the caller. Under the hood, the proxy's method will then use the # traditional message passing style where the packet is created in the # desired format using some serialization framework like Flatbuffers etc # ############################################## import argparse # for argument parsing import zmq # ZeroMQ # define a proxy class for the server that supports the same interface # as the real server. The client then invokes methods on this proxy, which # are then sent to the other side. The proxy offers exactly the same interface # to the caller as what the real implementation does on the remote side. # # Such proxies are also referred to as stubs and skeletons and are often # automatically generated from interface and packet format definitions by # interface definition language (IDL) compilers. Although, in our implementation # here, we show an extremely simple and manually created packet, one # could use Flatbuffers or similar modern serialization framework to do the # necessary packet serialization. # # Notice also that the only 3 methods one can invoke on this proxy are # connect, get and put. Thus, it is impossible to send a wrong message type # like "POST" as we did in the basic message passing client, or mess up the # packet encoding by forgetting the space after the message type keyword # because often the serialization code will be generated by frameworks like # Flatbuffer # class ServerProxy (): # constructor def __init__ (self): # get the context and set the correct socket type self.context = zmq.Context () self.socket = self.context.socket (zmq.REQ) def connect (self, args): connect_str = "tcp://" + args.ipaddr + ":" + args.port print ("Proxy::connect - Connecting to RPC server at {}".format (connect_str)) self.socket.connect (connect_str) pass def get (self, key): # Note that we don't avoid creating the message but it gets # done here inside individual supported message type. # Moreover, often this code gets generated by an interface # definition language compiler and so the chance of making # a mistake is very low print ("Proxy::get - Sending a valid GET message") self.socket.send_string ("GET " + key) reply = self.socket.recv_string () return reply # return to the caller def put (self, key, value): # Note that we don't avoid creating the message but it gets # done here inside individual supported message type. # Moreover, often this code gets generated by an interface # definition language compiler and so the chance of making # a mistake is very low print ("Proxy::set - Sending a valid PUT message") self.socket.send_string ("PUT "+ key + " " + value) reply = self.socket.recv_string () # technically, this should be just an ack print ("Received reply = {}".format (reply)) ################################### # # Parse command line arguments # ################################### def parseCmdLineArgs (): # instantiate a ArgumentParser object parser = argparse.ArgumentParser (description="Message Passing Client") # Now specify all the optional arguments we support # server's IP address parser.add_argument ("-a", "--ipaddr", default="localhost", help="IP address of the message passing server, default: localhost") # server's port parser.add_argument ("-p", "--port", default="5557", help="Port number used by message passing server, default: 5557") return parser.parse_args() ################################## # # main program # ################################## def main (): # first parse the arguments print ("Main: parse command line arguments") args = parseCmdLineArgs () print ("Current libzmq version is %s" % zmq.zmq_version()) print ("Current pyzmq version is %s" % zmq.__version__) print ("Initialize our server proxy") proxy = ServerProxy () # Now create the right kind of socket print ("Connect the proxy to the real server") proxy.connect (args) # Now send messages using RPC # # Notice that we cannot make a mistake as we are bound by what the # interface supports so sending a wrong message like POST that we # did in the message passing example is not possible here. print ("Invoking the GET RPC") retval = proxy.get ("foo") print ("Value obtained from get call is {}".format (retval)) print ("Invoking the PUT RPC") proxy.put ("foo", "bar") ################################### # # Main entry point # ################################### if __name__ == "__main__": main ()
5,300
1,343
import sys from PyQt5.QtWidgets import QApplication,QMainWindow,QDialog from PyQt5 import QtCore, QtGui, QtWidgets from ui.main_window import Ui_MainWindow # from login import Ui_dialog from lib.tcmd import TCmdClass # from SignalsE import Example class MyMainWindow(QMainWindow,Ui_MainWindow): def __init__(self,parent=None): super(MyMainWindow,self).__init__(parent) self.setupUi(self) self.cmdlists=TCmdClass() def addtext(self): _translate = QtCore.QCoreApplication.translate self.textEdit.setHtml(_translate("MainWindow",self.getText("abc"))) # 每次修改内容,自动将光标移到最后 cursor = self.textEdit.textCursor() cursor.movePosition(QtGui.QTextCursor.End) self.textEdit.setTextCursor(cursor) def getText(self,text): self.cmdlists.addText(text) return self.cmdlists.getText() # class SignalsWindow(QWidget,SignalsExample): # def __init__(self,parent=None): # super(SignalsExample,self).__init__(parent) # self.setupUi(self) # def keyPressEvent(self, e): # if e.key() == Qt.Key_Escape: # self.close() if __name__=="__main__": app=QApplication(sys.argv) myWin=MyMainWindow() myWin.show() # sig=SignalsWindow() sys.exit(app.exec_())
1,305
443
# Copyright 2014-2015, Tresys Technology, LLC # # This file is part of SETools. # # SETools is free software: you can redistribute it and/or modify # it under the terms of the GNU Lesser General Public License as # published by the Free Software Foundation, either version 2.1 of # the License, or (at your option) any later version. # # SETools is distributed in the hope that it will be useful, # but WITHOUT ANY WARRANTY; without even the implied warranty of # MERCHANTABILITY or FITNESS FOR A PARTICULAR PURPOSE. See the # GNU Lesser General Public License for more details. # # You should have received a copy of the GNU Lesser General Public # License along with SETools. If not, see # <http://www.gnu.org/licenses/>. # import logging from .mixins import MatchName from .query import PolicyQuery class PolCapQuery(MatchName, PolicyQuery): """ Query SELinux policy capabilities Parameter: policy The policy to query. Keyword Parameters/Class attributes: name The name of the policy capability to match. name_regex If true, regular expression matching will be used for matching the name. """ def __init__(self, policy, **kwargs): super(PolCapQuery, self).__init__(policy, **kwargs) self.log = logging.getLogger(__name__) def results(self): """Generator which yields all matching policy capabilities.""" self.log.info("Generating policy capability results from {0.policy}".format(self)) self._match_name_debug(self.log) for cap in self.policy.polcaps(): if not self._match_name(cap): continue yield cap
1,675
477
#!/usr/bin/env python3 # -*- coding: UTF-8 -*- """Description: """ import os import sys import comtypes.client try: ETABSObject = comtypes.client.GetActiveObject("CSI.ETABS.API.ETABSObject") print("Coneccion exitosa!.\nadjuntando a una instancia existente.") except (OSError, comtypes.COMError): print("No se encontró ninguna instancia en ejecución del programa(Etabs).") sys.exit(-1) smodel = ETABSObject.SapModel # Unlocking model | Abriendo modelo (hace referencia al candadito de etabs) smodel.SetModelIsLocked(False) # 'initialize model | Inicializa nuevo modelo en blanco res = smodel.InitializeNewModel() # create grid-only template model | Crea una nueva hoja con grilla res = smodel.File.NewGridOnly(4,12,12,4,4,24,24) # Unit Preferences | Preferencias de Unidad # N_mm_C = 6 #kN_m_c # smodel.SetPresentUnits(N_mm_C) unitOption = { 'lb_in_F':1, 'lb_ft_F':2, 'kip_in_F':3, 'kip_ft_F':4, 'kN_mm_C':5, 'kN_m_C':6, 'kgf_mm_C':7, 'kgf_m_C':8, 'N_mm_C':9, 'N_m_C':10, 'Ton_mm_C':11, 'Ton_m_C':12, 'kN_cm_C':13, 'kgf_cm_C':14, 'N_cm_C':15, 'Ton_cm_C':16 } _n_mm_n = unitOption['kN_m_C'] #, propiedad estatica y privada, deberia ser # su utilidad de estas 2 variables se usara para las funciones/metodos length="mm" # longitud force="kN" # # length can be either "m" or "mm" # force can be either "N" or "kN" if(length=="mm" and force=="N"): # smodel.SetPresentUnits(9); smodel.SetPresentUnits(_n_mm_n); elif(length=="mm" and force=="kN"): # smodel.SetPresentUnits(5); smodel.SetPresentUnits(_n_mm_n); elif(length=="m" and force=="N"): # smodel.SetPresentUnits(10); smodel.SetPresentUnits(_n_mm_n); elif(length=="m" and force=="kN"): # smodel.SetPresentUnits(6); smodel.SetPresentUnits(_n_mm_n) # .... print(smodel.GetPresentUnits()) input("Enter para cerrar Etabs!") # 'close ETABS | Cerrar aplicacion Etabs ETABSObject.ApplicationExit(False) # clean up variables | limpiamos las variables y eliminamos ETABSObject, smodel, res = None, None, None del ETABSObject, smodel, res
2,108
908
# -*- coding: utf-8 -*- from __future__ import unicode_literals from django.db import migrations, models class Migration(migrations.Migration): dependencies = [("msgs", "0039_outgoing_text_non_null")] operations = [ migrations.AlterField( model_name="outgoing", name="backend_id", field=models.IntegerField(help_text="Broadcast id from the backend", null=True), ), migrations.RenameField(model_name="outgoing", old_name="backend_id", new_name="backend_broadcast_id"), migrations.RemoveField(model_name="outgoing", name="recipient_count"), migrations.AddField( model_name="outgoing", name="contact", field=models.ForeignKey(to="contacts.Contact", null=True, on_delete=models.PROTECT), ), ]
826
252
#variables de entrada print("area del triangulo") #datos de entrada B=int(input("ingrese base:")) H=int(input("ingrese haltura:")) #proceso area=(B*H)/2 #datos de salida print("el area es: ", area)
197
79
from typing import Any, Optional from django.contrib.sessions.middleware import SessionMiddleware class SessionTestMixin: """Session Test mixin.""" def is_session_empty(self, request) -> int: """Check if request.session is empty.""" return len(request.session.values()) == 0 def assertSessionEmpty(self, request, msg: Optional[str] = None) -> None: """Assert that request.session does not contain any values.""" if msg is None: msg = "request.session contains values. request.session.values() == {}".format( request.session.values() ) assert self.is_session_empty(request), msg def assertSessionNotEmpty(self, request, msg: Optional[str] = None) -> None: """Assert that request.session contains at least one key value pair.""" if msg is None: msg = "request.session has no key value pairs. request.session.values() == {}".format( request.session.values() ) assert not self.is_session_empty(request), msg class SessionRequiredTestMixin(SessionTestMixin): """Mixin for tests with request.session requirements.""" def add_session(self, request) -> None: """Add session object to request by using SessionMiddleware.""" middleware = SessionMiddleware() middleware.process_request(request) request.session.save() def set_session_value(self, request, key: str, value: Any) -> None: """Set key value on request.session""" request.session[key] = value def set_session_values(self, request, **kwargs) -> None: """Set key values in form of keyword arguments on request.session""" request.session.update(kwargs)
1,756
468
import cloudpassage import provisioner import pytest import os here_dir = os.path.abspath(os.path.dirname(__file__)) fixture_dir = os.path.join(here_dir, "../fixture") class TestIntegrationHalo(object): def instantiate_halo_object(self, config): """Return an instance of the provisioner.Halo object.""" return provisioner.Halo(config) def instantiate_config_object_nonworking(self): """Return a dummy, non-working config object.""" conf_obj = provisioner.ConfigManager() conf_obj.halo_api_key = "ABC123" conf_obj.halo_api_secret_key = "DEF456" return conf_obj def test_instantiate_halo_object(self): """Instantiation will work, even with onoworking credentials.""" config = self.instantiate_config_object_nonworking() assert self.instantiate_halo_object(config) def test_halo_object_sanity_fail(self): """Sanity check fails gracefully.""" config = self.instantiate_config_object_nonworking() halo = self.instantiate_halo_object(config) with pytest.raises(SystemExit) as e: halo.sanity_check() assert e.type == SystemExit assert e.value.code == 1 def test_halo_object_construct_arn(self): """Ensure role ARN is constructed correctly.""" desired_result = "arn:aws:iam::065368812710:role/trusted-Newark" account_id = "065368812710" role_name = "trusted-Newark" actual_result = provisioner.Halo.construct_role_arn(account_id, role_name) assert desired_result == actual_result def test_halo_validate_object_id_string_ok(self): """Well-formed ID passes.""" testval = "92a11bcc905f11e896cb7f3cbd0e8cfd" retval = provisioner.Halo.validate_object_id(testval) assert retval is True def test_halo_validate_object_id_string_bad(self): """Badly-formed ID raises CloudPassageValidation.""" testval = "92a11bcc905f11e896cb7f3cbd0../e8cfd" with pytest.raises(cloudpassage.CloudPassageValidation) as e: provisioner.Halo.validate_object_id(testval) assert e def test_halo_validate_object_id_type_bad(self): """Badly-formed ID raises CloudPassageValidation.""" testval = {'onething': "92a11bcc905f11e896cb7f3cbd0e8cfd"} with pytest.raises(cloudpassage.CloudPassageValidation) as e: provisioner.Halo.validate_object_id(testval) assert e def test_halo_integration_string(self): """Ensure integration string constructed correctly with package name and version""" integration_string_desired = "Provision-CSP-Accounts/%s" % provisioner.__version__ config = self.instantiate_config_object_nonworking() halo = self.instantiate_halo_object(config) assert integration_string_desired == halo.integration
2,930
951
import os import sys import boto3 import boto import moto import botocore import unittest import logging import re import sure import botocore.session from datetime import datetime from moto import mock_sns_deprecated, mock_sqs_deprecated from botocore.stub import Stubber from freezegun import freeze_time from mock import patch #from moto import mock_dynamodb2, mock_dynamodb2_deprecated #from moto.dynamodb2 import dynamodb_backend2 from moto import mock_ec2, mock_ec2_deprecated, mock_route53 myPath = os.path.dirname(os.path.abspath(__file__)) sys.path.insert(0,myPath+'/..') from union_python3 import publish_to_sns, delete_item_from_dynamodb_table, get_subnet_cidr_block, get_item_from_dynamodb_table, list_hosted_zones, get_hosted_zone_properties, is_dns_support_enabled, is_dns_hostnames_enabled, associate_zone, create_reverse_lookup_zone, get_reversed_domain_prefix, reverse_list, get_dhcp_configurations, create_dynamodb_table, list_tables, put_item_in_dynamodb_table, get_dynamodb_table, create_table, change_resource_recordset, create_resource_record, delete_resource_record, get_zone_id, is_valid_hostname, get_dhcp_option_set_id_for_vpc try: import boto.dynamodb2 except ImportError: print("This boto version is not supported") logging.basicConfig(level=logging.DEBUG) os.environ["AWS_ACCESS_KEY_ID"] = '1111' os.environ["AWS_SECRET_ACCESS_KEY"] = '2222' class TestLambda(unittest.TestCase): def test_get_subnet_cidr_block(selt): mock = moto.mock_ec2() mock.start() client = boto3.client('ec2', region_name='us-east-1') vpc = client.create_vpc(CidrBlock="10.0.0.0/16") subnet = client.create_subnet(VpcId=vpc['Vpc']['VpcId'], CidrBlock="10.0.0.0/18") results = get_subnet_cidr_block(client, subnet['Subnet']['SubnetId'] ) assert results == '10.0.0.0/18' mock.stop() def test_listed_hosted_zones(self): mock = moto.mock_route53() mock.start() client = boto3.client( 'route53', region_name='us-east-1', aws_access_key_id=os.environ["AWS_ACCESS_KEY_ID"], aws_secret_access_key=os.environ["AWS_SECRET_ACCESS_KEY"], aws_session_token='123', ) response = client.create_hosted_zone( Name='test4', VPC={ 'VPCRegion': 'us-east-1', 'VPCId': 'vpc-43248d39' }, CallerReference='string', HostedZoneConfig={ 'Comment': 'string', 'PrivateZone': True } ) hosted_zone_id = response['HostedZone']['Id'] response = list_hosted_zones(client) assert response['HostedZones'][0]['Name'] == 'test4.' mock.stop() def test_get_hosted_zone_properties(self): mock = moto.mock_route53() mock.start() client = boto3.client( 'route53', region_name='us-east-1', aws_access_key_id=os.environ["AWS_ACCESS_KEY_ID"], aws_secret_access_key=os.environ["AWS_SECRET_ACCESS_KEY"], aws_session_token='123', ) response = client.create_hosted_zone( Name='string', VPC={ 'VPCRegion': 'us-east-1', 'VPCId': 'vpc-43248d39' }, CallerReference='string', HostedZoneConfig={ 'Comment': 'string', 'PrivateZone': True } ) hosted_zone_id = response['HostedZone']['Id'] response = get_hosted_zone_properties(client, hosted_zone_id) assert response['HostedZone']['Id'] == hosted_zone_id mock.stop() def test_is_dns_support_enabled(self): mock = moto.mock_ec2() mock.start() client = boto3.client('ec2', region_name='us-east-1') dhcp_options = client.create_dhcp_options( DhcpConfigurations=[ { 'Key': 'example.com', 'Values': [ '10.0.0.6', '10.0.0.7' ] } ] ) print('dhcp options: '+str(dhcp_options)) vpc1 = client.create_vpc(CidrBlock="10.0.0.0/16") print('vpc1: '+str(vpc1)) response = client.modify_vpc_attribute( EnableDnsSupport={ 'Value': True }, VpcId=vpc1['Vpc']['VpcId'] ) print('response: '+str(response)) results = is_dns_support_enabled(client, vpc1['Vpc']['VpcId']) print('results: '+str(results)) assert results == True mock.stop() def test_is_dns_hostnames_enabled(self): mock = moto.mock_ec2() mock.start() client = boto3.client('ec2', region_name='us-east-1') dhcp_options = client.create_dhcp_options( DhcpConfigurations=[ { 'Key': 'example.com', 'Values': [ '10.0.0.6', '10.0.0.7' ] } ] ) print('dhcp options: '+str(dhcp_options)) vpc1 = client.create_vpc(CidrBlock="10.0.0.0/16") print('vpc1: '+str(vpc1)) response = client.modify_vpc_attribute( EnableDnsHostnames={ 'Value': True }, VpcId=vpc1['Vpc']['VpcId'] ) print('response: '+str(response)) results = is_dns_hostnames_enabled(client, vpc1['Vpc']['VpcId']) print('results: '+str(results)) assert results == True mock.stop() @unittest.skip("moto need associate vpc added") def test_associate_zone(self): mock = moto.mock_route53() mock.start() client = boto3.client( 'route53', region_name='us-east-1', aws_access_key_id=os.environ["AWS_ACCESS_KEY_ID"], aws_secret_access_key=os.environ["AWS_SECRET_ACCESS_KEY"], aws_session_token='123', ) response = client.create_hosted_zone( Name='string', VPC={ 'VPCRegion': 'us-east-1', 'VPCId': 'vpc-43248d39' }, CallerReference='string', HostedZoneConfig={ 'Comment': 'string', 'PrivateZone': True } ) hosted_zone_id = response['HostedZone']['Id'] print('response: '+str(response)) results = associate_zone(client, hosted_zone_id, 'us-east-1', 'vpc-43248d39') assert results == 'test' mock.stop() def test_create_reverse_lookup_zone(self): instance = { 'Reservations' :[ { 'Instances': [ { 'VpcId': '123' } ] } ] } mock = moto.mock_route53() mock.start() client = boto3.client('route53', region_name='us-east-1') response = create_reverse_lookup_zone(client, instance, 'abc.', 'us-east-1') assert response['HostedZone']['Name'] == 'abc.in-addr.arpa.' mock.stop() def test_get_reversed_domain_prefix_16(self): results = get_reversed_domain_prefix(16, '10.0.0.1') assert results == '10.0.0.' def test_get_reversed_domain_prefix_24(self): results = get_reversed_domain_prefix(24, '10.0.0.1') assert results == '10.0.0.' @patch('union_python3.publish_to_sns') def test_reverse_list_with_invalid_ip( self, sns ): sns.return_value == None response = reverse_list('test') assert response == None def test_reverse_list(self): results = reverse_list('172.168.3.7') assert results == '7.3.168.172.' def test_get_dhcp_configurations(self): mock = moto.mock_ec2() mock.start() client = boto3.client('ec2', region_name='us-east-1') dhcp_options = client.create_dhcp_options( DhcpConfigurations=[ { 'Key': 'example.com', 'Values': [ '10.0.0.6', '10.0.0.7' ] } ] ) print('dhcp options: '+str(dhcp_options)) vpc1 = client.create_vpc(CidrBlock="10.0.0.0/16") print('vpc1: '+str(vpc1)) vpc2 = client.create_vpc(CidrBlock="10.0.0.0/16") print('vpc2: '+str(vpc2)) vpc3 = client.create_vpc(CidrBlock="10.0.0.0/24") print('vpc3: '+str(vpc3)) client.associate_dhcp_options(DhcpOptionsId=dhcp_options['DhcpOptions']['DhcpOptionsId'], VpcId=vpc1['Vpc']['VpcId']) client.associate_dhcp_options(DhcpOptionsId=dhcp_options['DhcpOptions']['DhcpOptionsId'], VpcId=vpc2['Vpc']['VpcId']) results = get_dhcp_configurations(client, dhcp_options['DhcpOptions']['DhcpOptionsId'] ) # Returning nothing now because moto needs fixed assert results == [] mock.stop() def test_create_dynamodb_table(self): mock = moto.mock_dynamodb2() mock.start() client = boto3.client('dynamodb', region_name='us-east-1') results = create_dynamodb_table(client, 'DDNS') assert results['TableDescription']['TableName'] == 'DDNS' mock.stop() def test_get_dhcp_option_set_id_for_vpc(self): SAMPLE_DOMAIN_NAME = u'example.com' SAMPLE_NAME_SERVERS = [u'10.0.0.6', u'10.0.0.7'] mock = moto.mock_ec2() mock.start() client = boto3.client('ec2', region_name='us-east-1') dhcp_options = client.create_dhcp_options( DhcpConfigurations=[ { 'Key': 'example.com', 'Values': [ '10.0.0.6', '10.0.0.7' ] } ] ) print('dhcp options: '+str(dhcp_options)) vpc1 = client.create_vpc(CidrBlock="10.0.0.0/16") print('vpc1: '+str(vpc1)) vpc2 = client.create_vpc(CidrBlock="10.0.0.0/16") print('vpc2: '+str(vpc2)) vpc3 = client.create_vpc(CidrBlock="10.0.0.0/24") print('vpc3: '+str(vpc3)) client.associate_dhcp_options(DhcpOptionsId=dhcp_options['DhcpOptions']['DhcpOptionsId'], VpcId=vpc1['Vpc']['VpcId']) client.associate_dhcp_options(DhcpOptionsId=dhcp_options['DhcpOptions']['DhcpOptionsId'], VpcId=vpc2['Vpc']['VpcId']) #vpcs = client.describe_vpcs(Filters=[{'Name': 'dhcp-options-id', 'Values': [dhcp_options['DhcpOptions']['DhcpOptionsId']]}]) results = get_dhcp_option_set_id_for_vpc(client, vpc1['Vpc']['VpcId']) assert results == dhcp_options['DhcpOptions']['DhcpOptionsId'] mock.stop() def test_is_invalid_hostname(self): results = is_valid_hostname( None) assert results == False def test_is_valid_hostname(self): results = is_valid_hostname( 'test') assert results == True def test_get_zone_id(self): mock = moto.mock_route53() mock.start() client = boto3.client('route53', region_name='us-east-1') client.create_hosted_zone( Name="db.", CallerReference=str(hash('foo')), HostedZoneConfig=dict( PrivateZone=True, Comment="db", ) ) zones = client.list_hosted_zones_by_name(DNSName="db.") hosted_zone_id = zones["HostedZones"][0]["Id"] # Create A Record. a_record_endpoint_payload = { 'Comment': 'Create A record prod.redis.db', 'Changes': [ { 'Action': 'CREATE', 'ResourceRecordSet': { 'Name': 'prod.redis.db.', 'Type': 'A', 'TTL': 10, 'ResourceRecords': [{ 'Value': '127.0.0.1' }] } } ] } client.change_resource_record_sets(HostedZoneId=hosted_zone_id, ChangeBatch=a_record_endpoint_payload) results = get_zone_id( client, 'db.') assert len(results) == 15 mock.stop() def test_delete_resource_record(self): mock = moto.mock_route53() mock.start() client = boto3.client('route53', region_name='us-east-1') client.create_hosted_zone( Name="db.", CallerReference=str(hash('foo')), HostedZoneConfig=dict( PrivateZone=True, Comment="db", ) ) zones = client.list_hosted_zones_by_name(DNSName="db.") hosted_zone_id = zones["HostedZones"][0]["Id"] # Create A Record. a_record_endpoint_payload = { 'Comment': 'Create A record prod.redis.db', 'Changes': [ { 'Action': 'CREATE', 'ResourceRecordSet': { 'Name': 'prod.redis.db.', 'Type': 'A', 'TTL': 10, 'ResourceRecords': [{ 'Value': '127.0.0.1' }] } } ] } client.change_resource_record_sets(HostedZoneId=hosted_zone_id, ChangeBatch=a_record_endpoint_payload) results = delete_resource_record( client, hosted_zone_id,'prod','redis.db.','A','127.0.0.1') assert results['ChangeInfo']['Status'] == 'INSYNC' mock.stop() def test_create_resource_record(self): mock = moto.mock_route53() mock.start() client = boto3.client('route53', region_name='us-east-1') client.create_hosted_zone( Name="db.", CallerReference=str(hash('foo')), HostedZoneConfig=dict( PrivateZone=True, Comment="db", ) ) zones = client.list_hosted_zones_by_name(DNSName="db.") hosted_zone_id = zones["HostedZones"][0]["Id"] results = create_resource_record( client, hosted_zone_id,'prod','redis.db.','A','127.0.0.1') assert results['ChangeInfo']['Status'] == 'INSYNC' mock.stop() def test_change_resource_recordset(self): mock = moto.mock_route53() mock.start() client = boto3.client('route53', region_name='us-east-1') client.create_hosted_zone( Name="db.", CallerReference=str(hash('foo')), HostedZoneConfig=dict( PrivateZone=True, Comment="db", ) ) zones = client.list_hosted_zones_by_name(DNSName="db.") hosted_zone_id = zones["HostedZones"][0]["Id"] results = change_resource_recordset( client, hosted_zone_id,'prod','redis.db.','A','127.0.0.1') assert results['ChangeInfo']['Status'] == 'INSYNC' mock.stop() def test_create_table(self): mock = moto.mock_dynamodb2() mock.start() client = boto3.client("dynamodb") results = create_table(client, 'DDNS') assert results == True mock.stop() def test_get_dynamodb_table(self): mock = moto.mock_dynamodb2() mock.start() client = boto3.client("dynamodb") client.create_table(TableName="DDNS" , KeySchema=[{"AttributeName": "id", "KeyType": "HASH"}] , AttributeDefinitions=[{"AttributeName": "id", "AttributeType": "S"}] , ProvisionedThroughput={"ReadCapacityUnits": 1, "WriteCapacityUnits": 1}) results = get_dynamodb_table(client, 'DDNS') assert results['Table']['TableName'] == 'DDNS' mock.stop() def test_list_tables(self): dynamodb_client = botocore.session.get_session().create_client('dynamodb','us-east-1') dynamodb_client_stubber = Stubber(dynamodb_client) response = { 'TableNames': [ 'DDNS', ], 'LastEvaluatedTableName': 'DDNS' } expected_params = {} dynamodb_client_stubber.add_response('list_tables', response, expected_params) with dynamodb_client_stubber: results = list_tables(dynamodb_client) assert results['TableNames'][0]== 'DDNS' def test_put_item_in_dynamodb_table(self): dynamodb_client = botocore.session.get_session().create_client('dynamodb','us-east-1') dynamodb_client_stubber = Stubber(dynamodb_client) response = { 'Attributes': { 'InstanceId': { 'S': '123', 'NULL': True, 'BOOL': True }, 'InstanceAttributes': { 'S': '123', 'NULL': True, 'BOOL': True } }, 'ConsumedCapacity': { 'TableName': 'string', 'CapacityUnits': 123.0, 'ReadCapacityUnits': 123.0, 'WriteCapacityUnits': 123.0, 'Table': { 'ReadCapacityUnits': 123.0, 'WriteCapacityUnits': 123.0, 'CapacityUnits': 123.0 }, 'LocalSecondaryIndexes': { 'string': { 'ReadCapacityUnits': 123.0, 'WriteCapacityUnits': 123.0, 'CapacityUnits': 123.0 } }, 'GlobalSecondaryIndexes': { 'string': { 'ReadCapacityUnits': 123.0, 'WriteCapacityUnits': 123.0, 'CapacityUnits': 123.0 } } }, 'ItemCollectionMetrics': { 'ItemCollectionKey': { 'string': { 'S': 'string', 'N': 'string', 'B': b'bytes', 'SS': [ 'string', ], 'NS': [ 'string', ], 'BS': [ b'bytes', ], 'M': { 'string': {} }, 'L': [ {}, ], 'NULL': True, 'BOOL': True } }, 'SizeEstimateRangeGB': [ 123.0, ] } } expected_params = { 'TableName': 'DDNS', 'Item': { 'InstanceId': {'S':'123'}, 'InstanceAttributes': {'S':'123'} } } dynamodb_client_stubber.add_response('put_item', response, expected_params) with dynamodb_client_stubber: results = put_item_in_dynamodb_table(dynamodb_client, 'DDNS', '123','123') assert results == response def test_get_item_from_dynamodb_table(self): mock = moto.mock_dynamodb2() mock.start() client = boto3.client('dynamodb', region_name='us-west-2', aws_access_key_id="ak", aws_secret_access_key="sk") results = create_table(client, 'DDNS') print('results: '+str(results)) results = put_item_in_dynamodb_table(client, 'DDNS', '123', '123') print('results: '+str(results)) results = get_item_from_dynamodb_table(client, 'DDNS', '123') print('results: '+str(results)) assert results == 123 mock.stop() def test_delete_item_from_dynamodb_table(self): mock = moto.mock_dynamodb2() mock.start() client = boto3.client('dynamodb', region_name='us-east-1', aws_access_key_id="ak", aws_secret_access_key="sk") results = create_table(client, 'DDNS') print('results: '+str(results)) results = put_item_in_dynamodb_table(client, 'DDNS', '123', '123') print('results: '+str(results)) results = get_item_from_dynamodb_table(client, 'DDNS', '123') print('results: '+str(results)) assert results == 123 results = delete_item_from_dynamodb_table(client, 'DDNS', '123') print('results: '+str(results)) results = get_item_from_dynamodb_table(client, 'DDNS', '123') print('results: ' + str(results)) assert results == None mock.stop() @unittest.skip("moto needs TopicArn added to publish") @mock_sqs_deprecated @mock_sns_deprecated def test_publish_to_sns(self): MESSAGE_FROM_SQS_TEMPLATE = '{\n "Message": "%s",\n "MessageId": "%s"\n}' conn = boto.connect_sns() conn.create_topic("some-topic") topics_json = conn.get_all_topics() topic_arn = topics_json["ListTopicsResponse"][ "ListTopicsResult"]["Topics"][0]['TopicArn'] sqs_conn = boto.connect_sqs() sqs_conn.create_queue("test-queue") conn.subscribe(topic_arn, "sqs", "arn:aws:sqs:us-east-1:123456789012:test-queue") message_to_publish = 'my message' subject_to_publish = "test subject" with freeze_time("2015-01-01 12:00:00"): published_message = publish_to_sns(conn, '123456789012', 'us-east-1', message_to_publish) published_message_id = published_message['MessageId'] queue = sqs_conn.get_queue("test-queue") message = queue.read(1) expected = MESSAGE_FROM_SQS_TEMPLATE % ( message_to_publish, published_message_id, subject_to_publish, 'us-east-1') acquired_message = re.sub("\d{4}-\d{2}-\d{2}T\d{2}:\d{2}:\d{2}\.\d{3}Z", '2015-01-01T12:00:00.000Z', message.get_body()) acquired_message.should.equal(expected)
22,665
7,399
import json from api.helper import json_405_response, json_error_response def no_test(func): """ Use for URLs that do not require testing, use wisely """ def inner(request, *args, **kwargs): return func(request, *args, **kwargs) inner.__name__ = func.__name__ inner.__module__ = func.__module__ inner.__doc__ = func.__doc__ inner.__dict__ = func.__dict__ inner.do_not_test = True return inner def api_get(func): def inner(request, *args, **kwargs): if request.method != "GET": return json_405_response() request.data = {} return func(request, *args, **kwargs) inner.__name__ = func.__name__ inner.__module__ = func.__module__ inner.__doc__ = func.__doc__ inner.__dict__ = func.__dict__ return inner def api_post(func): def inner(request, *args, **kwargs): if request.method != "POST": return json_405_response() try: request.data = {} if not request.body else json.loads(request.body.decode('utf-8')) except ValueError: request.data = {} return func(request, *args, **kwargs) inner.__name__ = func.__name__ inner.__module__ = func.__module__ inner.__doc__ = func.__doc__ inner.__dict__ = func.__dict__ return inner def authenticated_user(func): def inner(request, *args, **kwargs): if not request.user: return json_error_response('no user present', 401) if not request.user.is_authenticated: return json_error_response('user is not authenticated', 401) if not request.user.is_active: return json_error_response('user authenticated but inactive', 401) return func(request, *args, **kwargs) inner.__name__ = func.__name__ inner.__module__ = func.__module__ inner.__doc__ = func.__doc__ inner.__dict__ = func.__dict__ return inner
1,929
577
''' Created on Apr 16, 2012 @author: Haak Saxberg ''' from django.core.management.base import BaseCommand, CommandError from django.core.exceptions import ObjectDoesNotExist from django.db.utils import IntegrityError from ...models import Campus, Course, Professor, Section, Meeting, Timeslot, Day, Semester,\ CourseArea, RoomInfo, Log, Department, Room, Building import csv, pprint, re, datetime class Command(BaseCommand): args = '<directory_of_csv_files>' help = 'Populates the Course tables with information from csv files.' def handle(self, *args, **options): if len(args) != 1: raise CommandError("Expects a single directory as an argument.") dirs = args[0] if dirs[-1] != '/': dirs += '/' # Gather up the relevant csv files. # ENSURE THESE ARE ENCODED AS UTF-8 BEFORE RUNNING THIS SCRIPT MEETINGS = open(dirs + 'meetings 1.csv') SECTIONS = open(dirs + 'sections 1.csv') DESCRIPT = open(dirs + 'courses 1.csv') AREAS = open(dirs + 'courses 2.csv') PREREQS = open(dirs + 'courses 3.csv') # Gather campuses. We'll need them later. CAMPUS_LOOKUP = dict([ (x.code, x) for x in Campus.objects.all()]) def find_campus(string, dictionary): try: camp = CAMPUS_LOOKUP[string] except KeyError: print "Invalid campus: {}".format(string) try: camp = CAMPUS_LOOKUP[dictionary['campus']] except KeyError: print "Falling back to UN" camp = CAMPUS_LOOKUP['UN'] return camp SEMESTER_LOOKUP = dict([ ((x.half, x.year), x) for x in Semester.objects.all()]) DAY_LOOKUP = dict([(x.code, x) for x in Day.objects.all()]) self.stderr.write("{}\n{}\n{}\n".format(CAMPUS_LOOKUP, SEMESTER_LOOKUP, DAY_LOOKUP)) meetings_r = csv.DictReader(MEETINGS) sections_r = csv.DictReader(SECTIONS) descript_r = csv.DictReader(DESCRIPT) areas_r = csv.DictReader(AREAS) prereqs_r = csv.DictReader(PREREQS) # First, we go through the descriptions, since that's supposedly the # canonical list of courses that exist. # As we go, populate a dictionary with keys that are the course codes, # creating a json-like dict of dicts. courses = {} for row in descript_r: # pull out some interesting data from this csv file, for later use. #print row code = row['\xef\xbb\xbf"Course Number"'] # ugly because of unicode conversion course = {} #self.stderr.write("Parsing description for {}\n".format(code)) course['code'] = code[:4] course['number'] = code[4:9] course['code_campus'] = code[-2:] course['title'] = row['Course Title'] course['dept'] = row['Course Department Code'] course['campus'] = row['Prim Assoc'] course['minhours'] = row['Min Hrs'] course['maxhours'] = row['Max Hrs'] course['descr'] = row['Abstr'] course['requisites'] = [] # empty prereq list for later. course['sections'] = {} # empty section dict for later; every course should (?) # have at least one section associated with it; use number # as key. course['attention'] = False course['area'] = [] # a course can have more than one area associated with it courses[code] = course # populate areas; use this to filter in place of department. for row in areas_r: code = row['\xef\xbb\xbf"Course Number"'] #self.stderr.write("Parsing area for {}\n".format(code)) course = courses[code] course['area'] += [row["Course Area Code"]] # populate prerequisite/concurrent enrollment requirements for row in prereqs_r: code = row['\xef\xbb\xbf"Course Number"'] #self.stderr.write("Parsing requisites for {}\n".format(code)) course = courses[code] # C = Corequisite, P = Prerequisite, N = Concurrent Enrollment Required if row['Requisite Course Category'] in ['C', 'N', 'P']: if '*' in row['Requisite Course Number']: # a * indicates a wildcard. # Course codes are [4 letters for area][at least 3 and up to 5 characters for number][2 letters for campus] # Ex: MATH030G HM # Ex: MUS 052HNPO # Ex: CSCI005GLHM #course['attention'] = True pass requisite = {'code':row['Requisite Course Number']} if courses.has_key(requisite['code']): requisite['req_attention'] = False else: requisite['req_attention'] = True requisite['wildcard'] = '*' in requisite course['requisites'] += [(row['Requisite Course Category'], requisite)] # get sections, associate them with specific courses for row in sections_r: code = row['\xef\xbb\xbf"Course Number"'] course = courses[code] section = {} section['title'] = row['Section Title'] if len(row['Section Title']) > 0 else None section['number'] = row['Section Number'] section['semester'] = row['Session Code'] section['year'] = int(row['Year']) section['open'] = True if row['Section Status'] == 'O' else False section['starts'] = row['Section Begin Date'] section['ends'] = row['Section End Date'] section['cred_hours'] = row['Section Credit Hours'] section['seats'] = row['Maximum Registration'] section['meetings'] = {} # empty meeting dict for later use section['attention'] = False course['sections'][section['number']] = section # get meetings, associate them with specific sections for row in meetings_r: code = row['\xef\xbb\xbf"Course Number"'] course = courses[code] if len(course['sections'].keys()) < 1: continue try: section = course['sections'][row['Section Number']] except KeyError, e: pprint.pprint(course, self.stderr) self.stderr.write("ERROR: {}\n".format(e)) section = {} section['title'] = None section['year'] = Semester.get_this_semester().next().year section['open'] = 0 section['starts'] = datetime.datetime.now() # trash values section['ends'] = datetime.datetime.now() # trash values section['cred_hours'] = 0 section['seats'] = 0 section['attention'] = True section['semester'] = Semester.get_this_semester().next().half section['number'] = row['Section Number'] section['meetings'] = {} course['sections'][section['number']] = section if section['meetings'].has_key(row['Meeting Number']): meeting = section['meetings'][row["Meeting Number"]] # If we've seen this row before, don't mess with anything else: meeting = {} meeting['instructors'] = [] meeting['meet_num'] = row['Meeting Number'] meeting['days'] = row['Class Meeting Days'] meeting['start_time'] = row['Class Begin Time (24 Hour)'] meeting['end_time'] = row['Class End Time (24 Hour)'] meeting['campus_code'] = row['Campus Code'] meeting['building'] = row['Building Code'] meeting['room'] = row['Room Number'] meeting['attention'] = False section['meetings'][meeting['meet_num']] = meeting meeting['instructors'] += [row['Instructor Name']] # multiple instructors #self.stderr.write("{}\n".format(courses.keys()[-4])) #self.stderr.write("{}\n".format((courses.keys()[-4] == "SPAN033 PO"))) #pprint.pprint(courses['PHYS051 HM'], self.stderr) # We've now gleaned all the information that we can from the csv's, and put them into a monster # of a dict of nested dicts. non_base_courses = [] base_courses = [] for key in courses.keys(): #self.stderr.write("{}\n".format(key)) course = courses[key] if len(course['requisites']) > 0: non_base_courses += [course] else: base_courses += [course] pprint.pprint("{} base courses".format(len(base_courses)), self.stderr) pprint.pprint("{} non-base courses".format(len(non_base_courses)), self.stderr) #created_courses = {} repeats = 0 fucked_bases = [] for course in base_courses+non_base_courses: # First, ensure that we have the course area and the department for area in course['area']: if area in ['BIOL','CHEM','CSCI','ENGR','MATH','PHYS']: science = True else: science = False if re.match(r'^\d',area): req_status = True else: req_status = False ca, new = CourseArea.objects.get_or_create(code=area, name=area, hard_science=science, is_req_area=req_status) primary_campus = CAMPUS_LOOKUP[course['campus']] dept, new = Department.objects.get_or_create(code=course['dept'], campus=primary_campus, ) #print course['number'],course['code_campus'], course['title'] #print course['descr'] # build the course itself c, new = Course.objects.get_or_create( title=course['title'], codeletters=course['code'], codenumber=course['number'], codecampus=course['code_campus'], campus=find_campus(course['code_campus'], course), description=unicode(course['descr'],"UTF-8"), ) if not new: repeats += 1 c.departments.add(dept) c.areas.add(ca) c.code = c.construct_code() c.needs_attention=course['attention'] c.min_hours=course['minhours'] c.max_hours=course['maxhours'] if c.campus.code == "HM": c.credit_multiplier = 1.00 c.save() #Now, we add sections. for section in course['sections'].keys(): sec = course['sections'][section] #print "Section ", section try: s, new = Section.objects.get_or_create( course=c, number=sec['number'], ) s.title=sec['title'] s.credit_hours=sec['cred_hours'] s.semester=SEMESTER_LOOKUP[(sec['semester'],sec['year'])] s.seats=sec['seats'] s.openseats=sec['seats'] # assume totally free classes! s.start_date=sec['starts'] s.end_date=sec['ends'] s.needs_attention=sec['attention'] s.save() except IntegrityError, e: print e print "Adding this course to the 'fucked' list" fucked_bases += [(course, section)] continue # add meetings to sections for meet in sec['meetings'].keys(): print "\tMeeting code: ", meet meeting = sec['meetings'][meet] m, new = Meeting.objects.get_or_create(section=s, meeting_code=int(meeting['meet_num']), ) m.needs_attention=meeting['attention'] m.campus=find_campus(meeting['campus_code'],course) m.save() # Add instructors to meetings for teacher in meeting['instructors']: names = teacher.split(',') last = names[0] if len(names) > 1: first = names[1].split(' ')[1] # clears out middle initial, if extant else: first = None p, new = Professor.objects.get_or_create(last_name=last, first_name=first, ) p.departments.add(dept) m.teachers.add(p) # spatial location of this meeting #print "\tBuilding: ",meeting['building'] print "\t Building: ", meeting['building'] if not meeting['building']: # no building specified meeting['building'] = "TBA" try: b = Building.objects.get(campus=m.campus, code=meeting['building']) except ObjectDoesNotExist, e: print 'no building with code {} and campus {}'.format(meeting['building'], m.campus) b = Building.objects.get(code=meeting['building']) room, new = Room.objects.get_or_create(building=b, title=meeting['room']) is_arr = b.code == "ARR" is_tba = b.code == "TBA" # temporal location of this meeting for day in meeting['days']: if day == '-': continue # don't care about days we don't meet on #print "\t", day d = DAY_LOOKUP[day] try: starter = datetime.datetime.strptime(meeting['start_time'],"%H%M") except ValueError, e: print e starter = datetime.datetime.strptime(meeting['start_time'].zfill(2),"%H%M") try: ender = datetime.datetime.strptime(meeting['end_time'],"%H%M") except ValueError, e: print e ender = datetime.datetime.strptime(meeting['end_time'].zfill(2),"%H%M") t, new = Timeslot.objects.get_or_create( starts=starter, ends=ender, day=d ) # Finally register the meeting with a timeslot (in a room) ri, new = RoomInfo.objects.get_or_create(meeting=m, timeslot=t, room=room, ) ri.is_arr=is_arr, ri.is_tba=is_tba ri.save()
16,484
4,339
import pandas as pd classificacoes = pd.read_csv('email.csv') textosPuros = classificacoes['email'] textosQuebrados = textosPuros.str.lower().str.split(' ') dicionario = set() for lista in textosQuebrados: dicionario.update(lista) totalPalavras = len(dicionario) tuplas = list(zip(dicionario, range(totalPalavras))) tradutor = {palavra:indice for palavra, indice in tuplas} print(totalPalavras) def vetorizar_texto(texto, tradutor): vetor = [0] * len(tradutor) for palavra in texto: if palavra in tradutor: vetor[tradutor[palavra]] += 1 return vetor #print(vetorizar_texto(textosQuebrados[0], tradutor)) #print(vetorizar_texto(textosQuebrados[1], tradutor)) #print(vetorizar_texto(textosQuebrados[2], tradutor)) vetoresDeTexto = [vetorizar_texto(texto, tradutor) for texto in textosQuebrados] print(vetoresDeTexto)
858
332
import copy import os import pickle import unittest from unittest.mock import patch from dgcastle import dgcastle from dgcastle.exceptions import IncompleteException from dgcastle.exceptions import ValidationException from dgcastle.handlers.challonge import Challonge TEST_TOURNAMENT = pickle.loads(b'\x80\x03}q\x00(X\x02\x00\x00\x00idq\x01J.X6\x00X\x04\x00\x00\x00nameq\x02X\x07\x00\x00\x00DG Testq\x03X\x03\x00\x00\x00urlq\x04X\x08\x00\x00\x00mwtmsdjsq\x05X\x0b\x00\x00\x00descriptionq\x06X\x1b\x00\x00\x00This is just a test bracketq\x07X\x0f\x00\x00\x00tournament-typeq\x08X\x12\x00\x00\x00single eliminationq\tX\n\x00\x00\x00started-atq\ncdatetime\ndatetime\nq\x0bC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00q\x0cciso8601.iso8601\nFixedOffset\nq\rJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x0e\x87q\x0fRq\x10}q\x11(X\x1a\x00\x00\x00_FixedOffset__offset_hoursq\x12J\xfc\xff\xff\xffX\x1c\x00\x00\x00_FixedOffset__offset_minutesq\x13K\x00X\x14\x00\x00\x00_FixedOffset__offsetq\x14cdatetime\ntimedelta\nq\x15J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x16Rq\x17X\x12\x00\x00\x00_FixedOffset__nameq\x18h\x0eub\x86q\x19Rq\x1aX\x0c\x00\x00\x00completed-atq\x1bh\x0bC\n\x07\xe1\x06\t\x10\x14$\x00\x00\x00q\x1ch\rJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x1d\x87q\x1eRq\x1f}q (h\x12J\xfc\xff\xff\xffh\x13K\x00h\x14h\x15J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q!Rq"h\x18h\x1dub\x86q#Rq$X\x17\x00\x00\x00require-score-agreementq%\x89X\x1e\x00\x00\x00notify-users-when-matches-openq&\x88X\n\x00\x00\x00created-atq\'h\x0bC\n\x07\xe1\x06\t\x0e+\x10\x00\x00\x00q(h\rJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q)\x87q*Rq+}q,(h\x12J\xfc\xff\xff\xffh\x13K\x00h\x14h\x15J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q-Rq.h\x18h)ub\x86q/Rq0X\n\x00\x00\x00updated-atq1h\x0bC\n\x07\xe1\x06\t\x10\x14$\x00\x00\x00q2h\rJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q3\x87q4Rq5}q6(h\x12J\xfc\xff\xff\xffh\x13K\x00h\x14h\x15J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q7Rq8h\x18h3ub\x86q9Rq:X\x05\x00\x00\x00stateq;X\x08\x00\x00\x00completeq<X\x0b\x00\x00\x00open-signupq=\x89X%\x00\x00\x00notify-users-when-the-tournament-endsq>\x88X\x0e\x00\x00\x00progress-meterq?KdX\r\x00\x00\x00quick-advanceq@\x89X\x16\x00\x00\x00hold-third-place-matchqA\x89X\x10\x00\x00\x00pts-for-game-winqBcdecimal\nDecimal\nqCX\x03\x00\x00\x000.0qD\x85qERqFX\x10\x00\x00\x00pts-for-game-tieqGhCX\x03\x00\x00\x000.0qH\x85qIRqJX\x11\x00\x00\x00pts-for-match-winqKhCX\x03\x00\x00\x001.0qL\x85qMRqNX\x11\x00\x00\x00pts-for-match-tieqOhCX\x03\x00\x00\x000.5qP\x85qQRqRX\x0b\x00\x00\x00pts-for-byeqShCX\x03\x00\x00\x001.0qT\x85qURqVX\x0c\x00\x00\x00swiss-roundsqWK\x00X\x07\x00\x00\x00privateqX\x89X\t\x00\x00\x00ranked-byqYX\n\x00\x00\x00match winsqZX\x0b\x00\x00\x00show-roundsq[\x88X\n\x00\x00\x00hide-forumq\\\x89X\x13\x00\x00\x00sequential-pairingsq]\x89X\x12\x00\x00\x00accept-attachmentsq^\x89X\x13\x00\x00\x00rr-pts-for-game-winq_hCX\x03\x00\x00\x000.0q`\x85qaRqbX\x13\x00\x00\x00rr-pts-for-game-tieqchCX\x03\x00\x00\x000.0qd\x85qeRqfX\x14\x00\x00\x00rr-pts-for-match-winqghCX\x03\x00\x00\x001.0qh\x85qiRqjX\x14\x00\x00\x00rr-pts-for-match-tieqkhCX\x03\x00\x00\x000.5ql\x85qmRqnX\x0e\x00\x00\x00created-by-apiqo\x89X\r\x00\x00\x00credit-cappedqp\x89X\x08\x00\x00\x00categoryqqNX\n\x00\x00\x00hide-seedsqr\x89X\x11\x00\x00\x00prediction-methodqsK\x00X\x15\x00\x00\x00predictions-opened-atqtNX\x10\x00\x00\x00anonymous-votingqu\x89X\x18\x00\x00\x00max-predictions-per-userqvK\x01X\n\x00\x00\x00signup-capqwNX\x07\x00\x00\x00game-idqxK@X\x12\x00\x00\x00participants-countqyK\x08X\x14\x00\x00\x00group-stages-enabledqz\x89X!\x00\x00\x00allow-participant-match-reportingq{\x88X\x05\x00\x00\x00teamsq|\x89X\x11\x00\x00\x00check-in-durationq}NX\x08\x00\x00\x00start-atq~NX\x16\x00\x00\x00started-checking-in-atq\x7fNX\n\x00\x00\x00tie-breaksq\x80X\x05\x00\x00\x00\n q\x81X\t\x00\x00\x00locked-atq\x82NX\x08\x00\x00\x00event-idq\x83NX$\x00\x00\x00public-predictions-before-start-timeq\x84\x89X\x06\x00\x00\x00rankedq\x85\x89X\x15\x00\x00\x00grand-finals-modifierq\x86NX\x1a\x00\x00\x00predict-the-losers-bracketq\x87\x89X\x04\x00\x00\x00spamq\x88NX\x03\x00\x00\x00hamq\x89NX\x12\x00\x00\x00description-sourceq\x8aX\x1b\x00\x00\x00This is just a test bracketq\x8bX\t\x00\x00\x00subdomainq\x8cNX\x12\x00\x00\x00full-challonge-urlq\x8dX\x1d\x00\x00\x00http://challonge.com/mwtmsdjsq\x8eX\x0e\x00\x00\x00live-image-urlq\x8fX!\x00\x00\x00http://challonge.com/mwtmsdjs.svgq\x90X\x0b\x00\x00\x00sign-up-urlq\x91NX\x18\x00\x00\x00review-before-finalizingq\x92\x88X\x15\x00\x00\x00accepting-predictionsq\x93\x89X\x13\x00\x00\x00participants-lockedq\x94\x88X\t\x00\x00\x00game-nameq\x95X\t\x00\x00\x00Disc Golfq\x96X\x16\x00\x00\x00participants-swappableq\x97\x89X\x10\x00\x00\x00team-convertableq\x98\x89X\x19\x00\x00\x00group-stages-were-startedq\x99\x89u.') TEST_MATCH_INDEX = pickle.loads(b'\x80\x03]q\x00(}q\x01(X\x02\x00\x00\x00idq\x02J\xef\xd0Z\x05X\r\x00\x00\x00tournament-idq\x03J.X6\x00X\x05\x00\x00\x00stateq\x04X\x08\x00\x00\x00completeq\x05X\n\x00\x00\x00player1-idq\x06J\xfc.c\x03X\n\x00\x00\x00player2-idq\x07J\x0e/c\x03X\x17\x00\x00\x00player1-prereq-match-idq\x08NX\x17\x00\x00\x00player2-prereq-match-idq\tNX\x1d\x00\x00\x00player1-is-prereq-match-loserq\n\x89X\x1d\x00\x00\x00player2-is-prereq-match-loserq\x0b\x89X\t\x00\x00\x00winner-idq\x0cJ\xfc.c\x03X\x08\x00\x00\x00loser-idq\rJ\x0e/c\x03X\n\x00\x00\x00started-atq\x0ecdatetime\ndatetime\nq\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00q\x10ciso8601.iso8601\nFixedOffset\nq\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x12\x87q\x13Rq\x14}q\x15(X\x1a\x00\x00\x00_FixedOffset__offset_hoursq\x16J\xfc\xff\xff\xffX\x1c\x00\x00\x00_FixedOffset__offset_minutesq\x17K\x00X\x14\x00\x00\x00_FixedOffset__offsetq\x18cdatetime\ntimedelta\nq\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x1aRq\x1bX\x12\x00\x00\x00_FixedOffset__nameq\x1ch\x12ub\x86q\x1dRq\x1eX\n\x00\x00\x00created-atq\x1fh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00q h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q!\x87q"Rq#}q$(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q%Rq&h\x1ch!ub\x86q\'Rq(X\n\x00\x00\x00updated-atq)h\x0fC\n\x07\xe1\x06\t\x0e-\r\x00\x00\x00q*h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q+\x87q,Rq-}q.(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q/Rq0h\x1ch+ub\x86q1Rq2X\n\x00\x00\x00identifierq3X\x01\x00\x00\x00Aq4X\x0e\x00\x00\x00has-attachmentq5\x89X\x05\x00\x00\x00roundq6K\x01X\r\x00\x00\x00player1-votesq7NX\r\x00\x00\x00player2-votesq8NX\x08\x00\x00\x00group-idq9NX\x10\x00\x00\x00attachment-countq:NX\x0e\x00\x00\x00scheduled-timeq;NX\x08\x00\x00\x00locationq<NX\x0b\x00\x00\x00underway-atq=NX\x08\x00\x00\x00optionalq>\x89X\x08\x00\x00\x00rushb-idq?NX\x0c\x00\x00\x00completed-atq@h\x0fC\n\x07\xe1\x06\t\x0e-\r\x00\x00\x00qAh\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qB\x87qCRqD}qE(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qFRqGh\x1chBub\x86qHRqIX\x14\x00\x00\x00suggested-play-orderqJK\x01X\x1a\x00\x00\x00prerequisite-match-ids-csvqKNX\n\x00\x00\x00scores-csvqLX\x03\x00\x00\x002-0qMu}qN(h\x02J\xf0\xd0Z\x05h\x03J.X6\x00h\x04X\x08\x00\x00\x00completeqOh\x06J\xff.c\x03h\x07J\x00/c\x03h\x08Nh\tNh\n\x89h\x0b\x89h\x0cJ\x00/c\x03h\rJ\xff.c\x03h\x0eh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00qPh\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qQ\x87qRRqS}qT(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qURqVh\x1chQub\x86qWRqXh\x1fh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00qYh\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qZ\x87q[Rq\\}q](h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q^Rq_h\x1chZub\x86q`Rqah)h\x0fC\n\x07\xe1\x06\t\x10\x123\x00\x00\x00qbh\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qc\x87qdRqe}qf(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qgRqhh\x1chcub\x86qiRqjh3X\x01\x00\x00\x00Bqkh5\x89h6K\x01h7Nh8Nh9Nh:Nh;Nh<Nh=Nh>\x89h?Nh@h\x0fC\n\x07\xe1\x06\t\x10\x123\x00\x00\x00qlh\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qm\x87qnRqo}qp(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qqRqrh\x1chmub\x86qsRqthJK\x02hKNhLX\x03\x00\x00\x002-4quu}qv(h\x02J\xf1\xd0Z\x05h\x03J.X6\x00h\x04X\x08\x00\x00\x00completeqwh\x06J\xfd.c\x03h\x07J\x02/c\x03h\x08Nh\tNh\n\x89h\x0b\x89h\x0cJ\x02/c\x03h\rJ\xfd.c\x03h\x0eh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00qxh\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qy\x87qzRq{}q|(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q}Rq~h\x1chyub\x86q\x7fRq\x80h\x1fh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00q\x81h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x82\x87q\x83Rq\x84}q\x85(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x86Rq\x87h\x1ch\x82ub\x86q\x88Rq\x89h)h\x0fC\n\x07\xe1\x06\t\x10\x13\r\x00\x00\x00q\x8ah\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x8b\x87q\x8cRq\x8d}q\x8e(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x8fRq\x90h\x1ch\x8bub\x86q\x91Rq\x92h3X\x01\x00\x00\x00Cq\x93h5\x89h6K\x01h7Nh8Nh9Nh:Nh;Nh<Nh=Nh>\x89h?Nh@h\x0fC\n\x07\xe1\x06\t\x10\x13\r\x00\x00\x00q\x94h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x95\x87q\x96Rq\x97}q\x98(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x99Rq\x9ah\x1ch\x95ub\x86q\x9bRq\x9chJK\x03hKNhLX\x03\x00\x00\x000-2q\x9du}q\x9e(h\x02J\xf2\xd0Z\x05h\x03J.X6\x00h\x04X\x08\x00\x00\x00completeq\x9fh\x06J\xfe.c\x03h\x07J\x01/c\x03h\x08Nh\tNh\n\x89h\x0b\x89h\x0cJ\xfe.c\x03h\rJ\x01/c\x03h\x0eh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00q\xa0h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xa1\x87q\xa2Rq\xa3}q\xa4(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xa5Rq\xa6h\x1ch\xa1ub\x86q\xa7Rq\xa8h\x1fh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00q\xa9h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xaa\x87q\xabRq\xac}q\xad(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xaeRq\xafh\x1ch\xaaub\x86q\xb0Rq\xb1h)h\x0fC\n\x07\xe1\x06\t\x10\x134\x00\x00\x00q\xb2h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xb3\x87q\xb4Rq\xb5}q\xb6(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xb7Rq\xb8h\x1ch\xb3ub\x86q\xb9Rq\xbah3X\x01\x00\x00\x00Dq\xbbh5\x89h6K\x01h7Nh8Nh9Nh:Nh;Nh<Nh=Nh>\x89h?Nh@h\x0fC\n\x07\xe1\x06\t\x10\x134\x00\x00\x00q\xbch\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xbd\x87q\xbeRq\xbf}q\xc0(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xc1Rq\xc2h\x1ch\xbdub\x86q\xc3Rq\xc4hJK\x04hKNhLX\x03\x00\x00\x009-8q\xc5u}q\xc6(h\x02J\xf3\xd0Z\x05h\x03J.X6\x00h\x04X\x08\x00\x00\x00completeq\xc7h\x06J\xfc.c\x03h\x07J\x00/c\x03h\x08J\xef\xd0Z\x05h\tJ\xf0\xd0Z\x05h\n\x89h\x0b\x89h\x0cJ\xfc.c\x03h\rJ\x00/c\x03h\x0eh\x0fC\n\x07\xe1\x06\t\x10\x123\x00\x00\x00q\xc8h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xc9\x87q\xcaRq\xcb}q\xcc(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xcdRq\xceh\x1ch\xc9ub\x86q\xcfRq\xd0h\x1fh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00q\xd1h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xd2\x87q\xd3Rq\xd4}q\xd5(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xd6Rq\xd7h\x1ch\xd2ub\x86q\xd8Rq\xd9h)h\x0fC\n\x07\xe1\x06\t\x10\x14\x0c\x00\x00\x00q\xdah\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xdb\x87q\xdcRq\xdd}q\xde(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xdfRq\xe0h\x1ch\xdbub\x86q\xe1Rq\xe2h3X\x01\x00\x00\x00Eq\xe3h5\x89h6K\x02h7Nh8Nh9Nh:Nh;Nh<Nh=Nh>\x89h?Nh@h\x0fC\n\x07\xe1\x06\t\x10\x14\x0c\x00\x00\x00q\xe4h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xe5\x87q\xe6Rq\xe7}q\xe8(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xe9Rq\xeah\x1ch\xe5ub\x86q\xebRq\xechJK\x05hKX\x11\x00\x00\x0089837807,89837808q\xedhLX\x03\x00\x00\x001-0q\xeeu}q\xef(h\x02J\xf4\xd0Z\x05h\x03J.X6\x00h\x04X\x08\x00\x00\x00completeq\xf0h\x06J\x02/c\x03h\x07J\xfe.c\x03h\x08J\xf1\xd0Z\x05h\tJ\xf2\xd0Z\x05h\n\x89h\x0b\x89h\x0cJ\xfe.c\x03h\rJ\x02/c\x03h\x0eh\x0fC\n\x07\xe1\x06\t\x10\x134\x00\x00\x00q\xf1h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xf2\x87q\xf3Rq\xf4}q\xf5(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xf6Rq\xf7h\x1ch\xf2ub\x86q\xf8Rq\xf9h\x1fh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00q\xfah\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xfb\x87q\xfcRq\xfd}q\xfe(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xffRr\x00\x01\x00\x00h\x1ch\xfbub\x86r\x01\x01\x00\x00Rr\x02\x01\x00\x00h)h\x0fC\n\x07\xe1\x06\t\x10\x14\x02\x00\x00\x00r\x03\x01\x00\x00h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00r\x04\x01\x00\x00\x87r\x05\x01\x00\x00Rr\x06\x01\x00\x00}r\x07\x01\x00\x00(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87r\x08\x01\x00\x00Rr\t\x01\x00\x00h\x1cj\x04\x01\x00\x00ub\x86r\n\x01\x00\x00Rr\x0b\x01\x00\x00h3X\x01\x00\x00\x00Fr\x0c\x01\x00\x00h5\x89h6K\x02h7Nh8Nh9Nh:Nh;Nh<Nh=Nh>\x89h?Nh@h\x0fC\n\x07\xe1\x06\t\x10\x14\x02\x00\x00\x00r\r\x01\x00\x00h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00r\x0e\x01\x00\x00\x87r\x0f\x01\x00\x00Rr\x10\x01\x00\x00}r\x11\x01\x00\x00(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87r\x12\x01\x00\x00Rr\x13\x01\x00\x00h\x1cj\x0e\x01\x00\x00ub\x86r\x14\x01\x00\x00Rr\x15\x01\x00\x00hJK\x06hKX\x11\x00\x00\x0089837809,89837810r\x16\x01\x00\x00hLX\x03\x00\x00\x003-4r\x17\x01\x00\x00u}r\x18\x01\x00\x00(h\x02J\xf5\xd0Z\x05h\x03J.X6\x00h\x04X\x08\x00\x00\x00completer\x19\x01\x00\x00h\x06J\xfc.c\x03h\x07J\xfe.c\x03h\x08J\xf3\xd0Z\x05h\tJ\xf4\xd0Z\x05h\n\x89h\x0b\x89h\x0cJ\xfe.c\x03h\rJ\xfc.c\x03h\x0eh\x0fC\n\x07\xe1\x06\t\x10\x14\x0c\x00\x00\x00r\x1a\x01\x00\x00h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00r\x1b\x01\x00\x00\x87r\x1c\x01\x00\x00Rr\x1d\x01\x00\x00}r\x1e\x01\x00\x00(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87r\x1f\x01\x00\x00Rr \x01\x00\x00h\x1cj\x1b\x01\x00\x00ub\x86r!\x01\x00\x00Rr"\x01\x00\x00h\x1fh\x0fC\n\x07\xe1\x06\t\x0e,\x13\x00\x00\x00r#\x01\x00\x00h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00r$\x01\x00\x00\x87r%\x01\x00\x00Rr&\x01\x00\x00}r\'\x01\x00\x00(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87r(\x01\x00\x00Rr)\x01\x00\x00h\x1cj$\x01\x00\x00ub\x86r*\x01\x00\x00Rr+\x01\x00\x00h)h\x0fC\n\x07\xe1\x06\t\x10\x14\x1d\x00\x00\x00r,\x01\x00\x00h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00r-\x01\x00\x00\x87r.\x01\x00\x00Rr/\x01\x00\x00}r0\x01\x00\x00(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87r1\x01\x00\x00Rr2\x01\x00\x00h\x1cj-\x01\x00\x00ub\x86r3\x01\x00\x00Rr4\x01\x00\x00h3X\x01\x00\x00\x00Gr5\x01\x00\x00h5\x89h6K\x03h7Nh8Nh9Nh:Nh;Nh<Nh=Nh>\x89h?Nh@h\x0fC\n\x07\xe1\x06\t\x10\x14\x1d\x00\x00\x00r6\x01\x00\x00h\x11J\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00r7\x01\x00\x00\x87r8\x01\x00\x00Rr9\x01\x00\x00}r:\x01\x00\x00(h\x16J\xfc\xff\xff\xffh\x17K\x00h\x18h\x19J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87r;\x01\x00\x00Rr<\x01\x00\x00h\x1cj7\x01\x00\x00ub\x86r=\x01\x00\x00Rr>\x01\x00\x00hJK\x07hKX\x11\x00\x00\x0089837811,89837812r?\x01\x00\x00hLX\x03\x00\x00\x001-3r@\x01\x00\x00ue.') TEST_PARTICIPANTS_INDEX = pickle.loads(b'\x80\x03]q\x00(}q\x01(X\x02\x00\x00\x00idq\x02J\xfc.c\x03X\r\x00\x00\x00tournament-idq\x03J.X6\x00X\x04\x00\x00\x00nameq\x04X\x01\x00\x00\x00Aq\x05X\x04\x00\x00\x00seedq\x06K\x01X\x06\x00\x00\x00activeq\x07\x88X\n\x00\x00\x00created-atq\x08cdatetime\ndatetime\nq\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00q\nciso8601.iso8601\nFixedOffset\nq\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x0c\x87q\rRq\x0e}q\x0f(X\x1a\x00\x00\x00_FixedOffset__offset_hoursq\x10J\xfc\xff\xff\xffX\x1c\x00\x00\x00_FixedOffset__offset_minutesq\x11K\x00X\x14\x00\x00\x00_FixedOffset__offsetq\x12cdatetime\ntimedelta\nq\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x14Rq\x15X\x12\x00\x00\x00_FixedOffset__nameq\x16h\x0cub\x86q\x17Rq\x18X\n\x00\x00\x00updated-atq\x19h\tC\n\x07\xe1\x06\t\x0e,\x0f\x00\x00\x00q\x1ah\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x1b\x87q\x1cRq\x1d}q\x1e(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x1fRq h\x16h\x1bub\x86q!Rq"X\x0c\x00\x00\x00invite-emailq#NX\n\x00\x00\x00final-rankq$K\x02X\x04\x00\x00\x00miscq%NX\x04\x00\x00\x00iconq&NX\x0f\x00\x00\x00on-waiting-listq\'\x89X\r\x00\x00\x00invitation-idq(NX\x08\x00\x00\x00group-idq)NX\r\x00\x00\x00checked-in-atq*NX\x12\x00\x00\x00challonge-usernameq+NX \x00\x00\x00challonge-email-address-verifiedq,NX\t\x00\x00\x00removableq-\x89X%\x00\x00\x00participatable-or-invitation-attachedq.\x89X\x0e\x00\x00\x00confirm-removeq/\x88X\x12\x00\x00\x00invitation-pendingq0\x89X*\x00\x00\x00display-name-with-invitation-email-addressq1h\x05X\n\x00\x00\x00email-hashq2NX\x08\x00\x00\x00usernameq3NX\x0c\x00\x00\x00display-nameq4h\x05X$\x00\x00\x00attached-participatable-portrait-urlq5NX\x0c\x00\x00\x00can-check-inq6\x89X\n\x00\x00\x00checked-inq7\x89X\r\x00\x00\x00reactivatableq8\x89X\r\x00\x00\x00check-in-openq9\x89X\x10\x00\x00\x00group-player-idsq:NX\x13\x00\x00\x00has-irrelevant-seedq;\x89u}q<(h\x02J\xfd.c\x03h\x03J.X6\x00h\x04X\x01\x00\x00\x00Bq=h\x06K\x02h\x07\x88h\x08h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00q>h\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q?\x87q@RqA}qB(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qCRqDh\x16h?ub\x86qERqFh\x19h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00qGh\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qH\x87qIRqJ}qK(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qLRqMh\x16hHub\x86qNRqOh#Nh$K\x05h%Nh&Nh\'\x89h(Nh)Nh*Nh+Nh,Nh-\x89h.\x89h/\x88h0\x89h1h=h2Nh3Nh4h=h5Nh6\x89h7\x89h8\x89h9\x89h:Nh;\x89u}qP(h\x02J\xfe.c\x03h\x03J.X6\x00h\x04X\x01\x00\x00\x00CqQh\x06K\x03h\x07\x88h\x08h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00qRh\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qS\x87qTRqU}qV(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qWRqXh\x16hSub\x86qYRqZh\x19h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00q[h\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\\\x87q]Rq^}q_(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q`Rqah\x16h\\ub\x86qbRqch#Nh$K\x01h%Nh&Nh\'\x89h(Nh)Nh*Nh+Nh,Nh-\x89h.\x89h/\x88h0\x89h1hQh2Nh3Nh4hQh5Nh6\x89h7\x89h8\x89h9\x89h:Nh;\x89u}qd(h\x02J\xff.c\x03h\x03J.X6\x00h\x04X\x01\x00\x00\x00Dqeh\x06K\x04h\x07\x88h\x08h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00qfh\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qg\x87qhRqi}qj(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qkRqlh\x16hgub\x86qmRqnh\x19h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00qoh\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00qp\x87qqRqr}qs(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87qtRquh\x16hpub\x86qvRqwh#Nh$K\x05h%Nh&Nh\'\x89h(Nh)Nh*Nh+Nh,Nh-\x89h.\x89h/\x88h0\x89h1heh2Nh3Nh4heh5Nh6\x89h7\x89h8\x89h9\x89h:Nh;\x89u}qx(h\x02J\x00/c\x03h\x03J.X6\x00h\x04X\x01\x00\x00\x00Eqyh\x06K\x05h\x07\x88h\x08h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00qzh\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q{\x87q|Rq}}q~(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x7fRq\x80h\x16h{ub\x86q\x81Rq\x82h\x19h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00q\x83h\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x84\x87q\x85Rq\x86}q\x87(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x88Rq\x89h\x16h\x84ub\x86q\x8aRq\x8bh#Nh$K\x03h%Nh&Nh\'\x89h(Nh)Nh*Nh+Nh,Nh-\x89h.\x89h/\x88h0\x89h1hyh2Nh3Nh4hyh5Nh6\x89h7\x89h8\x89h9\x89h:Nh;\x89u}q\x8c(h\x02J\x01/c\x03h\x03J.X6\x00h\x04X\x01\x00\x00\x00Fq\x8dh\x06K\x06h\x07\x88h\x08h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00q\x8eh\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x8f\x87q\x90Rq\x91}q\x92(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x93Rq\x94h\x16h\x8fub\x86q\x95Rq\x96h\x19h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00q\x97h\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\x98\x87q\x99Rq\x9a}q\x9b(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\x9cRq\x9dh\x16h\x98ub\x86q\x9eRq\x9fh#Nh$K\x05h%Nh&Nh\'\x89h(Nh)Nh*Nh+Nh,Nh-\x89h.\x89h/\x88h0\x89h1h\x8dh2Nh3Nh4h\x8dh5Nh6\x89h7\x89h8\x89h9\x89h:Nh;\x89u}q\xa0(h\x02J\x02/c\x03h\x03J.X6\x00h\x04X\x01\x00\x00\x00Gq\xa1h\x06K\x07h\x07\x88h\x08h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00q\xa2h\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xa3\x87q\xa4Rq\xa5}q\xa6(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xa7Rq\xa8h\x16h\xa3ub\x86q\xa9Rq\xaah\x19h\tC\n\x07\xe1\x06\t\x0e+/\x00\x00\x00q\xabh\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xac\x87q\xadRq\xae}q\xaf(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xb0Rq\xb1h\x16h\xacub\x86q\xb2Rq\xb3h#Nh$K\x03h%Nh&Nh\'\x89h(Nh)Nh*Nh+Nh,Nh-\x89h.\x89h/\x88h0\x89h1h\xa1h2Nh3Nh4h\xa1h5Nh6\x89h7\x89h8\x89h9\x89h:Nh;\x89u}q\xb4(h\x02J\x0e/c\x03h\x03J.X6\x00h\x04X\x01\x00\x00\x00Hq\xb5h\x06K\x08h\x07\x88h\x08h\tC\n\x07\xe1\x06\t\x0e+8\x00\x00\x00q\xb6h\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xb7\x87q\xb8Rq\xb9}q\xba(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xbbRq\xbch\x16h\xb7ub\x86q\xbdRq\xbeh\x19h\tC\n\x07\xe1\x06\t\x0e,\x0f\x00\x00\x00q\xbfh\x0bJ\xfc\xff\xff\xffK\x00X\x06\x00\x00\x00-04:00q\xc0\x87q\xc1Rq\xc2}q\xc3(h\x10J\xfc\xff\xff\xffh\x11K\x00h\x12h\x13J\xff\xff\xff\xffJ@\x19\x01\x00K\x00\x87q\xc4Rq\xc5h\x16h\xc0ub\x86q\xc6Rq\xc7h#Nh$K\x05h%Nh&Nh\'\x89h(Nh)Nh*Nh+Nh,Nh-\x89h.\x89h/\x88h0\x89h1h\xb5h2Nh3Nh4h\xb5h5Nh6\x89h7\x89h8\x89h9\x89h:Nh;\x89ue.') class TestChallongeImport(unittest.TestCase): def setUp(self): self.dgcastle = dgcastle.DGCastle(testDb="TestChallonge") os.environ['CHALLONGE_API'] = 'test,test' def tearDown(self): del(self.dgcastle) def test_import(self): t = None with patch('challonge.tournaments') as mock_tournaments: mock_tournaments.show.return_value = TEST_TOURNAMENT with patch('challonge.participants') as mock_participants: mock_participants.index.return_value = TEST_PARTICIPANTS_INDEX with patch('challonge.matches') as mock_matches: mock_matches.index.return_value = TEST_MATCH_INDEX t = self.dgcastle.challonge_import(1) self.assertEqual(len(t.participants), 8) self.assertEqual(len(t.matches), 7) def test_incompleteBracket(self): with patch('challonge.tournaments') as mock_tournaments: ret_val = copy.deepcopy(TEST_TOURNAMENT) ret_val['state'] = 'not complete' mock_tournaments.show.return_value = ret_val self.assertRaises(IncompleteException, self.dgcastle.challonge_import, 1) def test_incorrectResultsData(self): with patch('challonge.tournaments') as mock_tournaments: mock_tournaments.show.return_value = TEST_TOURNAMENT with patch('challonge.participants') as mock_participants: mock_participants.index.return_value = TEST_PARTICIPANTS_INDEX with patch('challonge.matches') as mock_matches: ret_val = copy.deepcopy(TEST_MATCH_INDEX) ret_val[0]['scores-csv'] = '1-0,2-1' mock_matches.index.return_value = ret_val self.assertRaises(ValidationException, self.dgcastle.challonge_import, 1)
23,901
19,538
# uncompyle6 version 3.3.5 # Python bytecode 2.7 (62211) # Decompiled from: Python 3.7.3 (default, Apr 24 2019, 15:29:51) [MSC v.1915 64 bit (AMD64)] # Embedded file name: c:\Jenkins\live\output\win_64_static\Release\python-bundle\MIDI Remote Scripts\pushbase\step_duplicator.py # Compiled at: 2018-11-30 15:48:12 from __future__ import absolute_import, print_function, unicode_literals from functools import partial from ableton.v2.base import liveobj_valid, nop from ableton.v2.control_surface import Component from ableton.v2.control_surface.control import ButtonControl from .consts import MessageBoxText from .message_box_component import Messenger ALL_NOTES = -1 def get_transposition_amount(source_step, destination_step): transposition = destination_step[0] - source_step[0] if ALL_NOTES == source_step[0]: transposition = 0 elif destination_step[0] == ALL_NOTES: transposition = source_step[0] return transposition class NullStepDuplicator(object): @property def is_duplicating(self): return False def set_clip(self, _): pass def set_loop(clip, loop_start, loop_end): if loop_start >= clip.loop_end: clip.loop_end = loop_end if clip.loop_end == loop_end: clip.loop_start = loop_start clip.end_marker = loop_end clip.start_marker = loop_start else: clip.loop_start = loop_start if clip.loop_start == loop_start: clip.loop_end = loop_end clip.end_marker = loop_end clip.start_marker = loop_start class StepDuplicatorComponent(Component, Messenger): button = ButtonControl() def __init__(self, *a, **k): super(StepDuplicatorComponent, self).__init__(*a, **k) self._clip = None self._source_step = None self._notification_reference = partial(nop, None) return @property def is_duplicating(self): return self.button.is_pressed and liveobj_valid(self._clip) def set_clip(self, clip): self._cancel_duplicate() self._clip = clip def add_step_with_pitch(self, note, step_start, step_end, nudge_offset=0, is_page=False): if self.is_enabled() and self.is_duplicating: current_step = (note, step_start, step_end - step_start, nudge_offset, is_page) if self._source_step is not None: self._duplicate_to(current_step) else: self._duplicate_from(current_step) return def add_step(self, step_start, step_end, nudge_offset=0, is_page=False): self.add_step_with_pitch(ALL_NOTES, step_start, step_end, nudge_offset, is_page) def _duplicate_from(self, source_step): message = MessageBoxText.CANNOT_COPY_EMPTY_PAGE if source_step[4] else MessageBoxText.CANNOT_COPY_EMPTY_STEP from_pitch = source_step[0] pitch_span = 1 if from_pitch == ALL_NOTES: from_pitch = 0 pitch_span = 127 notes = self._clip.get_notes(source_step[1], from_pitch, source_step[2], pitch_span) if len(notes) > 0: message = MessageBoxText.COPIED_PAGE if source_step[4] else MessageBoxText.COPIED_STEP self._source_step = source_step self._notification_reference = self.show_notification(message) def _duplicate_to(self, destination_step): if self._source_step[4] == destination_step[4]: message = MessageBoxText.CANNOT_PASTE_TO_SOURCE_PAGE if destination_step[4] else MessageBoxText.CANNOT_PASTE_TO_SOURCE_STEP if destination_step != self._source_step: message = MessageBoxText.PASTED_PAGE if destination_step[4] else MessageBoxText.PASTED_STEP self._clip.duplicate_region(self._source_step[1], self._source_step[2], destination_step[1] + self._source_step[3], self._source_step[0], get_transposition_amount(self._source_step, destination_step)) else: message = MessageBoxText.CANNOT_PASTE_FROM_STEP_TO_PAGE if destination_step[4] else MessageBoxText.CANNOT_PASTE_FROM_PAGE_TO_STEP loop_start = destination_step[1] loop_end = loop_start + self._source_step[2] if destination_step[4] and not (loop_start >= self._clip.loop_start and loop_end <= self._clip.loop_end): set_loop(self._clip, loop_start, loop_end) self._notification_reference = self.show_notification(message) self._source_step = None return def _cancel_duplicate(self): self._source_step = None if self._notification_reference() is not None: self._notification_reference().hide() return @button.released def button(self, _): self._cancel_duplicate() def update(self): super(StepDuplicatorComponent, self).update() self._cancel_duplicate()
4,917
1,605
from django.db import models #Utilities from cride.utils.models import BetmatcherModel class Exchange(BetmatcherModel): user = models.ForeignKey( "users.User", on_delete = models.CASCADE, related_name = "user" ) prize = models.ForeignKey( "users.Prize", on_delete = models.CASCADE, related_name = "prize" ) adress = models.CharField(max_length = 60, blank = True, null = True) phone = models.CharField(max_length = 25, blank = True, null = True) email = models.CharField(max_length = 25, blank = True, null = True) cp = models.CharField(max_length = 25, blank = True, null = True) country = models.CharField(max_length = 25, blank = True, null = True) city = models.CharField(max_length = 25, blank = True, null = True) full_name = models.CharField(max_length = 55, blank = True, null = True) state = models.CharField(max_length = 25, blank = True, null = True) date = models.DateTimeField( "event_date", help_text = "Date of the event" ) def __str__(self): return self.user.username
1,058
371
# This macro allows changing the position of an external axis by hand or within a program as a function call. # Example of a function call (units are in mm or deg): # MoveAxis(0) # MoveAxis(100) # https://robodk.com/doc/en/RoboDK-API.html import sys # allows getting the passed argument parameters from robodk.robodialogs import * # Enter the name of the axis (leave empty to select the first mechanism/robot available MECHANISM_NAME = '' # Enter the default value: DEFAULT_VALUE = 0 # Set to blocking to make the program wait until it the axis stopped moving BLOCKING = True # --------------- PROGRAM START ------------------------- VALUE = DEFAULT_VALUE if len(sys.argv) < 2: # Promt the user to enter a new value if the macro is just double clicked print('This macro be called as MoveAxis(value)') print('Number of arguments: ' + str(len(sys.argv))) #raise Exception('Invalid parameters provided: ' + str(sys.argv)) entry = mbox('Move one axis. Enter the new value in mm or deg\n\nNote: this can be called as a program.\nExample: MoveAxis(VALUE)', entry=str(DEFAULT_VALUE)) if not entry: #raise Exception('Operation cancelled by user') quit() VALUE = float(entry) else: # Take the argument as new joint value VALUE = float(sys.argv[1]) # Use the RoboDK API: from robodk.robolink import * # API to communicate with RoboDK RDK = Robolink() # Get the robot item: axis = RDK.Item(MECHANISM_NAME, ITEM_TYPE_ROBOT) # Move the robot/mechanism axis.MoveJ([VALUE], BLOCKING)
1,540
479
import os.path import unittest from setup import iter_vendored_files class IterVendoredFilesTests(unittest.TestCase): def test_all(self): filenames = set(iter_vendored_files()) self.assertEqual(filenames, VENDORED) VENDORED = {file.replace('/', os.path.sep) for file in [ 'pydevd/pydev_run_in_console.py', 'pydevd/setup_cython.py', 'pydevd/pydev_app_engine_debug_startup.py', 'pydevd/pydevd_tracing.py', 'pydevd/pydev_pysrc.py', 'pydevd/pydevconsole.py', 'pydevd/pydevd.py', 'pydevd/pydev_coverage.py', 'pydevd/pydevd_file_utils.py', 'pydevd/pydevd_attach_to_process/attach_linux_x86.so', 'pydevd/pydevd_attach_to_process/attach_pydevd.py', 'pydevd/pydevd_attach_to_process/attach_amd64.dll', 'pydevd/pydevd_attach_to_process/_test_attach_to_process.py', 'pydevd/pydevd_attach_to_process/attach_linux_amd64.so', 'pydevd/pydevd_attach_to_process/attach_x86.dll', 'pydevd/pydevd_attach_to_process/_always_live_program.py', 'pydevd/pydevd_attach_to_process/attach_x86.dylib', 'pydevd/pydevd_attach_to_process/_check.py', 'pydevd/pydevd_attach_to_process/README.txt', 'pydevd/pydevd_attach_to_process/add_code_to_python_process.py', 'pydevd/pydevd_attach_to_process/attach_x86_64.dylib', 'pydevd/pydevd_attach_to_process/attach_script.py', 'pydevd/pydevd_attach_to_process/_test_attach_to_process_linux.py', 'pydevd/pydevd_attach_to_process/dll/attach.h', 'pydevd/pydevd_attach_to_process/dll/python.h', 'pydevd/pydevd_attach_to_process/dll/attach.cpp', 'pydevd/pydevd_attach_to_process/dll/stdafx.h', 'pydevd/pydevd_attach_to_process/dll/compile_dll.bat', 'pydevd/pydevd_attach_to_process/dll/stdafx.cpp', 'pydevd/pydevd_attach_to_process/dll/targetver.h', 'pydevd/pydevd_attach_to_process/winappdbg/module.py', 'pydevd/pydevd_attach_to_process/winappdbg/event.py', 'pydevd/pydevd_attach_to_process/winappdbg/process.py', 'pydevd/pydevd_attach_to_process/winappdbg/thread.py', 'pydevd/pydevd_attach_to_process/winappdbg/disasm.py', 'pydevd/pydevd_attach_to_process/winappdbg/textio.py', 'pydevd/pydevd_attach_to_process/winappdbg/sql.py', 'pydevd/pydevd_attach_to_process/winappdbg/util.py', 'pydevd/pydevd_attach_to_process/winappdbg/crash.py', 'pydevd/pydevd_attach_to_process/winappdbg/registry.py', 'pydevd/pydevd_attach_to_process/winappdbg/breakpoint.py', 'pydevd/pydevd_attach_to_process/winappdbg/search.py', 'pydevd/pydevd_attach_to_process/winappdbg/compat.py', 'pydevd/pydevd_attach_to_process/winappdbg/window.py', 'pydevd/pydevd_attach_to_process/winappdbg/interactive.py', 'pydevd/pydevd_attach_to_process/winappdbg/__init__.py', 'pydevd/pydevd_attach_to_process/winappdbg/system.py', 'pydevd/pydevd_attach_to_process/winappdbg/debug.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/shlwapi.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/kernel32.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/advapi32.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/__init__.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/psapi.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/defines.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/user32.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/dbghelp.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/version.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/peb_teb.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/context_amd64.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/shell32.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/ntdll.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/wtsapi32.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/context_i386.py', 'pydevd/pydevd_attach_to_process/winappdbg/win32/gdi32.py', 'pydevd/pydevd_attach_to_process/winappdbg/plugins/__init__.py', 'pydevd/pydevd_attach_to_process/winappdbg/plugins/do_symfix.py', 'pydevd/pydevd_attach_to_process/winappdbg/plugins/README', 'pydevd/pydevd_attach_to_process/winappdbg/plugins/do_exchain.py', 'pydevd/pydevd_attach_to_process/winappdbg/plugins/do_example.py', 'pydevd/pydevd_attach_to_process/winappdbg/plugins/do_exploitable.py', 'pydevd/pydevd_attach_to_process/linux/gdb_threads_settrace.py', 'pydevd/pydevd_attach_to_process/linux/compile_mac.sh', 'pydevd/pydevd_attach_to_process/linux/Makefile', 'pydevd/pydevd_attach_to_process/linux/lldb_prepare.py', 'pydevd/pydevd_attach_to_process/linux/compile_so.sh', 'pydevd/pydevd_attach_to_process/linux/python.h', 'pydevd/pydevd_attach_to_process/linux/attach_linux.c', 'pydevd/pydevd_attach_to_process/linux/lldb_threads_settrace.py', 'pydevd/_pydev_bundle/_pydev_imports_tipper.py', 'pydevd/_pydev_bundle/_pydev_getopt.py', 'pydevd/_pydev_bundle/pydev_umd.py', 'pydevd/_pydev_bundle/fix_getpass.py', 'pydevd/_pydev_bundle/pydev_is_thread_alive.py', 'pydevd/_pydev_bundle/pydev_ipython_console.py', 'pydevd/_pydev_bundle/_pydev_jy_imports_tipper.py', 'pydevd/_pydev_bundle/pydev_imports.py', 'pydevd/_pydev_bundle/pydev_override.py', 'pydevd/_pydev_bundle/pydev_monkey.py', 'pydevd/_pydev_bundle/pydev_localhost.py', 'pydevd/_pydev_bundle/pydev_log.py', 'pydevd/_pydev_bundle/pydev_ipython_console_011.py', 'pydevd/_pydev_bundle/_pydev_tipper_common.py', 'pydevd/_pydev_bundle/pydev_monkey_qt.py', 'pydevd/_pydev_bundle/_pydev_log.py', 'pydevd/_pydev_bundle/_pydev_filesystem_encoding.py', 'pydevd/_pydev_bundle/pydev_versioncheck.py', 'pydevd/_pydev_bundle/__init__.py', 'pydevd/_pydev_bundle/_pydev_completer.py', 'pydevd/_pydev_bundle/pydev_import_hook.py', 'pydevd/_pydev_bundle/pydev_console_utils.py', 'pydevd/_pydev_bundle/_pydev_calltip_util.py', 'pydevd/pydevd_plugins/jinja2_debug.py', 'pydevd/pydevd_plugins/django_debug.py', 'pydevd/pydevd_plugins/__init__.py', 'pydevd/pydevd_plugins/extensions/README.md', 'pydevd/pydevd_plugins/extensions/__init__.py', 'pydevd/pydevd_plugins/extensions/types/pydevd_plugin_numpy_types.py', 'pydevd/pydevd_plugins/extensions/types/__init__.py', 'pydevd/pydevd_plugins/extensions/types/pydevd_helpers.py', 'pydevd/pydevd_plugins/extensions/types/pydevd_plugins_django_form_str.py', 'pydevd/_pydev_runfiles/pydev_runfiles_coverage.py', 'pydevd/_pydev_runfiles/pydev_runfiles_nose.py', 'pydevd/_pydev_runfiles/pydev_runfiles_parallel.py', 'pydevd/_pydev_runfiles/pydev_runfiles_pytest2.py', 'pydevd/_pydev_runfiles/pydev_runfiles.py', 'pydevd/_pydev_runfiles/pydev_runfiles_parallel_client.py', 'pydevd/_pydev_runfiles/__init__.py', 'pydevd/_pydev_runfiles/pydev_runfiles_xml_rpc.py', 'pydevd/_pydev_runfiles/pydev_runfiles_unittest.py', 'pydevd/pydevd_concurrency_analyser/pydevd_concurrency_logger.py', 'pydevd/pydevd_concurrency_analyser/pydevd_thread_wrappers.py', 'pydevd/pydevd_concurrency_analyser/__init__.py', 'pydevd/_pydev_imps/_pydev_xmlrpclib.py', 'pydevd/_pydev_imps/_pydev_execfile.py', 'pydevd/_pydev_imps/_pydev_SimpleXMLRPCServer.py', 'pydevd/_pydev_imps/_pydev_saved_modules.py', 'pydevd/_pydev_imps/_pydev_sys_patch.py', 'pydevd/_pydev_imps/_pydev_inspect.py', 'pydevd/_pydev_imps/_pydev_SocketServer.py', 'pydevd/_pydev_imps/_pydev_BaseHTTPServer.py', 'pydevd/_pydev_imps/__init__.py', 'pydevd/_pydev_imps/_pydev_pkgutil_old.py', 'pydevd/_pydev_imps/_pydev_uuid_old.py', 'pydevd/_pydevd_frame_eval/pydevd_frame_eval_cython_wrapper.py', 'pydevd/_pydevd_frame_eval/pydevd_frame_evaluator.c', 'pydevd/_pydevd_frame_eval/pydevd_modify_bytecode.py', 'pydevd/_pydevd_frame_eval/pydevd_frame_evaluator.pyx', 'pydevd/_pydevd_frame_eval/__init__.py', 'pydevd/_pydevd_frame_eval/pydevd_frame_eval_main.py', 'pydevd/_pydevd_frame_eval/pydevd_frame_evaluator.pxd', 'pydevd/_pydevd_frame_eval/pydevd_frame_tracing.py', 'pydevd/pydev_ipython/inputhookpyglet.py', 'pydevd/pydev_ipython/inputhookgtk3.py', 'pydevd/pydev_ipython/inputhookqt5.py', 'pydevd/pydev_ipython/inputhookglut.py', 'pydevd/pydev_ipython/matplotlibtools.py', 'pydevd/pydev_ipython/inputhookqt4.py', 'pydevd/pydev_ipython/inputhookwx.py', 'pydevd/pydev_ipython/__init__.py', 'pydevd/pydev_ipython/qt_loaders.py', 'pydevd/pydev_ipython/inputhook.py', 'pydevd/pydev_ipython/README', 'pydevd/pydev_ipython/version.py', 'pydevd/pydev_ipython/qt_for_kernel.py', 'pydevd/pydev_ipython/inputhooktk.py', 'pydevd/pydev_ipython/qt.py', 'pydevd/pydev_ipython/inputhookgtk.py', 'pydevd/_pydevd_bundle/pydevd_vm_type.py', 'pydevd/_pydevd_bundle/pydevd_additional_thread_info_regular.py', 'pydevd/_pydevd_bundle/pydevd_reload.py', 'pydevd/_pydevd_bundle/pydevd_trace_dispatch_regular.py', 'pydevd/_pydevd_bundle/pydevd_cython.pyx', 'pydevd/_pydevd_bundle/pydevd_collect_try_except_info.py', 'pydevd/_pydevd_bundle/pydevd_extension_utils.py', 'pydevd/_pydevd_bundle/pydevd_stackless.py', 'pydevd/_pydevd_bundle/pydevd_constants.py', 'pydevd/_pydevd_bundle/pydevd_frame_utils.py', 'pydevd/_pydevd_bundle/pydevd_dont_trace_files.py', 'pydevd/_pydevd_bundle/pydevd_frame.py', 'pydevd/_pydevd_bundle/pydevd_xml.py', 'pydevd/_pydevd_bundle/pydevd_extension_api.py', 'pydevd/_pydevd_bundle/pydevd_comm.py', 'pydevd/_pydevd_bundle/pydevd_kill_all_pydevd_threads.py', 'pydevd/_pydevd_bundle/pydevd_traceproperty.py', 'pydevd/_pydevd_bundle/pydevd_command_line_handling.py', 'pydevd/_pydevd_bundle/pydevd_io.py', 'pydevd/_pydevd_bundle/pydevd_dont_trace.py', 'pydevd/_pydevd_bundle/pydevd_trace_dispatch.py', 'pydevd/_pydevd_bundle/pydevd_signature.py', 'pydevd/_pydevd_bundle/pydevd_import_class.py', 'pydevd/_pydevd_bundle/pydevd_custom_frames.py', 'pydevd/_pydevd_bundle/pydevd_additional_thread_info.py', 'pydevd/_pydevd_bundle/pydevd_exec.py', 'pydevd/_pydevd_bundle/pydevd_vars.py', 'pydevd/_pydevd_bundle/pydevd_exec2.py', 'pydevd/_pydevd_bundle/pydevd_cython_wrapper.py', 'pydevd/_pydevd_bundle/pydevd_plugin_utils.py', 'pydevd/_pydevd_bundle/pydevconsole_code_for_ironpython.py', 'pydevd/_pydevd_bundle/pydevd_process_net_command.py', 'pydevd/_pydevd_bundle/pydevd_resolver.py', 'pydevd/_pydevd_bundle/pydevd_utils.py', 'pydevd/_pydevd_bundle/pydevd_console.py', 'pydevd/_pydevd_bundle/pydevd_referrers.py', 'pydevd/_pydevd_bundle/pydevd_cython.c', 'pydevd/_pydevd_bundle/pydevd_breakpoints.py', 'pydevd/_pydevd_bundle/__init__.py', 'pydevd/_pydevd_bundle/pydevd_trace_api.py', 'pydevd/_pydevd_bundle/pydevd_save_locals.py', 'pydevd/pydev_sitecustomize/sitecustomize.py', 'pydevd/pydev_sitecustomize/__not_in_default_pythonpath.txt', ]}
11,035
4,891
from psycopg2 import connect from psycopg2.sql import SQL, Identifier, Literal, Composed from collections import OrderedDict from itertools import count from pgcsv.util import normalize_column class Database(object): def __init__(self, uri, table, headers): self.conn = connect(uri) self.table = normalize_column(table) self._raw_headers = headers @property def headers(self): if not hasattr(self, '_headers'): self._headers = OrderedDict() for name in self._raw_headers: normalized = normalize_column(name) if normalized is None or not len(normalized): normalized = 'column' column = normalized for i in count(2): if column not in self._headers: break column = '%s_%s' % (normalized, i) self._headers[column] = name return self._headers def drop(self): with self.conn.cursor() as cursor: stmt = SQL('DROP TABLE IF EXISTS {};') stmt = stmt.format(Identifier(self.table)) # print stmt.as_string(cursor) cursor.execute(stmt) self.conn.commit() def sync(self): with self.conn.cursor() as cursor: stmt = SQL("CREATE TABLE IF NOT EXISTS {} ();") stmt = stmt.format(Identifier(self.table)) # print stmt.as_string(cursor) cursor.execute(stmt) stmt = SQL("SELECT column_name FROM " "information_schema.columns " "WHERE table_name = %s;") # noqa cursor.execute(stmt, (self.table,)) columns = [c[0] for c in cursor.fetchall()] # columns = [c.decode(self.conn.encoding) for c in columns] for column, label in self.headers.items(): if column not in columns: stmt = SQL("ALTER TABLE {} ADD COLUMN {} TEXT;") stmt = stmt.format(Identifier(self.table), Identifier(column)) # print stmt.as_string(cursor) cursor.execute(stmt) stmt = SQL("COMMENT ON COLUMN {}.{} IS {};") stmt = stmt.format(Identifier(self.table), Identifier(column), Literal(label)) cursor.execute(stmt) self.conn.commit() def load(self, fh, delimiter): with self.conn.cursor() as cursor: headers = list(self.headers.keys()) stmt = SQL("COPY {} ({}) FROM STDIN " "WITH CSV HEADER DELIMITER AS {} NULL AS ''") columns = Composed([Identifier(c) for c in headers]) columns = columns.join(', ') stmt = stmt.format(Identifier(self.table), columns, Literal(delimiter)) print(stmt.as_string(cursor)) cursor.copy_expert(stmt, fh) self.conn.commit()
3,126
818
##Rate Coefficients import numpy as np def k1(T): T_eV = T / 11605. log_T_eV = np.log(T_eV) rv = np.exp(-32.71396786375 + 13.53655609057*log_T_eV - 5.739328757388*log_T_eV**2 + 1.563154982022*log_T_eV**3 - 0.2877056004391*log_T_eV**4 + 0.03482559773736999*log_T_eV**5 - 0.00263197617559*log_T_eV**6 + 0.0001119543953861*log_T_eV**7 - 2.039149852002e-6*log_T_eV**8) return rv def k2(T): T_eV = T / 11605. log_T_eV = np.log(T_eV) rv = np.exp(-28.61303380689232 - 0.7241125657826851*log_T_eV - 0.02026044731984691*log_T_eV**2 - 0.002380861877349834*log_T_eV**3 - 0.0003212605213188796*log_T_eV**4 - 0.00001421502914054107*log_T_eV**5 + 4.989108920299513e-6*log_T_eV**6 + 5.755614137575758e-7*log_T_eV**7 - 1.856767039775261e-8*log_T_eV**8 - 3.071135243196595e-9*log_T_eV**9) return rv def k3(T): T_eV = T / 11605. log_T_eV = np.log(T_eV) rv = np.exp(-44.09864886561001 + 23.91596563469*log_T_eV - 10.75323019821*log_T_eV**2 + 3.058038757198*log_T_eV**3 - 0.5685118909884001*log_T_eV**4 + 0.06795391233790001*log_T_eV**5 - 0.005009056101857001*log_T_eV**6 + 0.0002067236157507*log_T_eV**7 - 3.649161410833e-6*log_T_eV**8) return rv def k4(T): T_eV = T / 11605. rv = 3.92e-13/T_eV**0.6353 return rv def k5(T): T_eV = T / 11605. log_T_eV = np.log(T_eV) rv = np.exp(-68.71040990212001 + 43.93347632635*log_T_eV - 18.48066993568*log_T_eV**2 + 4.701626486759002*log_T_eV**3 - 0.7692466334492*log_T_eV**4 + 0.08113042097303*log_T_eV**5 - 0.005324020628287001*log_T_eV**6 + 0.0001975705312221*log_T_eV**7 - 3.165581065665e-6*log_T_eV**8) return rv def k6(T): rv = 3.36e-10/np.sqrt(T)/(T/1.**3)**0.2/ (1.+(T/1.**6)**0.7) return rv def k7(T): rv = 3.0e-16 * (T/3.**2)**0.95 * np.exp(-T/9.32e3) return rv def k8(T): rv = 1.35e-9*(T**9.8493e-2 + 3.2852e-1 * T**5.5610e-1 + 2.771e-7 * T**2.1826)/ (1. + 6.191e-3 * T**1.0461 + 8.9712e-11 * T**3.0424 + 3.2576e-14 * T**3.7741) return rv def k9(T): rv = 2.10e-20 * (T/30.0)**(-0.15) return rv def k10(T): rv = 6.0e-10 return rv def k11(T): T_eV = T / 11605. log_T_eV = np.log(T_eV) rv = np.exp(-24.24914687 + 3.40082444*log_T_eV - 3.89800396*log_T_eV**2 + 2.04558782*log_T_eV**3 - 0.541618285*log_T_eV**4 + 8.41077503*(10**-2)*log_T_eV**5 - 7.87902615*(10**-3)*log_T_eV**6 + 4.13839842*(10**-4)*log_T_eV**7 - 9.36345888*(10**-6)*log_T_eV**8) return rv def k12(T): rv = 5.6*(10**-11)*(T**0.5)*np.exp(-102124/T) return rv def k13(T): T_eV = T / 11605. rv = 1.067*(10**-10)*(T_eV**2.012)*np.exp((-4.463/T_eV)*((1+0.2472*T_eV)**3.512)) return rv def k14(T): T_eV = T / 11605. log_T_eV = np.log(T_eV) rv = np.exp(-18.01849334 + 2.3608522*log_T_eV - 0.28274430*log_T_eV**2 + 1.62331664*log_T_eV**3 - 3.36501203*log_T_eV**4 + 1.17832978*(10**-2)*log_T_eV**5 - 1.65619470*(10**-3)*log_T_eV**6 + 1.06827520*(10**-4)*log_T_eV**7 - 2.63128581*(10**-6)*log_T_eV**8) return rv def k15(T): T_eV = T / 11605. log_T_eV = np.log(T_eV) rv = np.exp(-20.37260896 + 1.13944933*log_T_eV - 0.14210135*log_T_eV**2 + 8.4644554*(10**-3)*log_T_eV**3 - 1.4327641*(10**-3)*log_T_eV**4 + 2.0122503*(10**-4)*log_T_eV**5 + 8.6639632*(10**-5)*log_T_eV**6 - 2.5850097*(10**-5)*log_T_eV**7 + 2.4555012*(10**-6)*log_T_eV**8 - 8.0683825*(10**-8)*log_T_eV**9) return rv def k16(T): rv = 7*(10**-8)*((T/100)**-0.5) return rv def k17(T): T_eV = T / 11605. if T_eV < 1.719: rv = 1.e-8*T**(-0.4) else: rv = 4.0e-4*T**(-1.4)*np.exp(-15100./T) return rv def k18(T): if T < 617: rv = 1.e-8 else: rv = 1.32e-6 * T**(-0.76) return rv def k19(T): rv = 5.e-7*np.sqrt(100./T) return rv
4,629
2,964
import math import numpy as np FULL_RANGE = 1024 class VectoringThrusterData(object): def __init__(self, position, axis, start, angle, offset, _reversed = False): vector_axis = np.array(axis) vector_1 = np.array(start) self.vector_axis = vector_axis / np.linalg.norm(vector_axis) self.force_1 = vector_1 / np.linalg.norm(vector_1) # Enforce orthogonality. assert self.force_1.dot(self.vector_axis) < 1e-8 # assert 0 < angle < 360 self.angle = math.radians(angle) self.force_2 = np.cross(self.vector_axis, self.force_1) self.torque_1 = np.cross(np.array(position), self.force_1) self.torque_2 = np.cross(np.array(position), self.force_2) self.torque_weight = 1 self.offset = offset self._reversed = _reversed # 1024 = 2pi rad # self.rads_per_value = self.angle / (1024 / 2 / math.pi) self.rads_per_value = 2 * math.pi / 1024 def angle_from_value(self, value): return ((value - self.offset) % FULL_RANGE) * self.rads_per_value def value_from_angle(self, angle): return (int(round(angle / self.rads_per_value)) + self.offset) % FULL_RANGE def get_angle(self, desired_output_s): force = desired_output_s[:3] torque = desired_output_s[3:] # Our thrust data, self.force_1, self.torque_1, etc. is in sub space, # The angle will be the same if we convert the incoming forces and torques # that are now in world space into sub space. opt_angle = math.atan2(self.torque_2.dot(torque) * self.torque_weight + \ self.force_2.dot(force), \ self.torque_1.dot(torque) * self.torque_weight + \ self.force_1.dot(force)) # Currently vector motor offset by pi/2 if opt_angle < 0: opt_angle += 2*math.pi # Thrusters work both ways. # TODO is it worth favoring positive thrust over negative thrust? if opt_angle > math.pi: opt_angle -= math.pi # Find the angle that most closely matches the calculated. # Note that if the angle of thrust vectoring is more than half of a # circle i.e. more than pi, all the below checks will fail so this should # work in all cases. # There is a legitmate potential here for oscillations when desires # are equally between both the negative and positive thrust cones. thresh = 0.5*(math.pi + self.angle) if opt_angle >= thresh: opt_angle = 0 elif self.angle < opt_angle < thresh: opt_angle = self.angle return opt_angle
2,525
871
# XXX verification for bug 30828 - runs ice_pbdagcon on a spurious cluster # and checks that it discards the resulting all-N consensus sequence import subprocess import tempfile import unittest import os.path as op from pbcore.io import FastaReader CLUSTER_FA = """\ >m54007_151222_230824/47383194/334_64_CCS CATTGAAGACGTCCACCTCAACGCTATGAACGTTAGTTGAGACAATGTTAAAGCAAACGACAACGTCATTGTGATCTACATACACAGTGGATGGTTAGCGTAAACATGGTGGAACGTACTTTGACTGCGCTGCAAGAAATGGTTGGGTCGATCGTAATGCTAGTCGTTACATCGGAACAAGCCAAAACAAAATCATTCGCTGGATTTAGACCTACTGCACGACGACGTCGACACAAGACATTCTTGAAAGGTAATTGACGTGGACGTTTC >m54007_151222_230824/28640158/287_60_CCS CAAACGACAACGTCATTGTGATCTACATACACAGTGGATGGTTAGGCGTAAACATGGTGGGAACGTACTTTGACTGCGCTGCAAGAAATGGGTTGGGTCGATCGTAATGCTAGTCGTTACATCGGAACAAGCCAAAAAACAAACATCATTCGCTGGATTTAGACTACTACTGCACGACCGACGTCGACACAAGACATTCTCTGAAAGGTAATTGACGTGGACGTTTC >m54007_151222_230824/49611437/382_58_CCS ACTGAACTACGGGTCAGCTTCCCCATTTGAAGTCATGTAGTGGTTGTCTACTTTTTCATTGAGACGTCCACCTCAACGCTATGAACGTTAGTTGAGACAATGTTAAAGCAAACGACAACGTCATTGTGATCTACATACACAGTGGATGGTTAGCGTAAACATGGTGGAACGTACTTTGACTGCGCTGCAAGAAATGGTGTGGGTCGATCGTAATGCTAGTCGTTACATCGGAACAAGCCAAAACAAAATCATTCGCTGGATTTAGACCTACTGCACGACGACGTCGACACAAGACATTCTTGAAAGGTAATTGACGTGGACGTT""" class TestBadCluster(unittest.TestCase): def setUp(self): self.cluster_fa = tempfile.NamedTemporaryFile(suffix=".fasta").name with open(self.cluster_fa, "w") as fa_out: fa_out.write(CLUSTER_FA) def test_ice_pbdagcon_bad_cluster(self): out_fa = tempfile.NamedTemporaryFile(suffix=".fasta").name prefix = op.splitext(out_fa)[0] args = [ "python", "-m", "pbtranscript.ice_pbdagcon", self.cluster_fa, prefix, "c5006" ] assert subprocess.call(args) == 0 with FastaReader(out_fa) as fa_out: self.assertEqual(len([rec for rec in fa_out]), 0) if __name__ == "__main__": unittest.main()
1,956
933
/home/runner/.cache/pip/pool/a5/a1/10/06eab95524f667caa51362a09c577fd5f6d45980e5390034745c0a322f
96
76
import unittest def banana(): "Yellow" return 42 def orange(): "Oran" "ge" def blackbirds(): 4 + 20 # Not a docstring def do_nothing(): pass def make_adder(n): "Function adding N" def add(x): "Compute N + X" return n + x return add class Strawberry: "Delicious" doc = __doc__ def weight(self): "Heavy" return 0.25 @classmethod def is_red(cls): "Very red" return True @staticmethod def pick(): "Picked" return None class Tangerine: def peel(): pass class Pear: "This will not be the __doc__" __doc__ = "Conference" class TestDocstrings(unittest.TestCase): def test_builtin(self): self.assertTrue(divmod.__doc__.startswith("Return the tuple (x//y, x%y)")) def test_library_function(self): # This test will need updating if/when random.seed gets a docstring. # It also fails under cpython. import random self.assertEqual(random.seed.__doc__, None) def test_function(self): self.assertEqual(banana.__doc__, "Yellow") self.assertEqual(orange.__doc__, "Orange") self.assertEqual(make_adder.__doc__, "Function adding N") def test_runtime_function(self): self.assertEqual(make_adder(3).__doc__, "Compute N + X") def test_non_string_expr(self): self.assertEqual(blackbirds.__doc__, None) def test_no_expr(self): self.assertEqual(do_nothing.__doc__, None) def test_class(self): self.assertEqual(Strawberry.__doc__, "Delicious") self.assertEqual(Strawberry.doc, "Delicious") def test_class_no_docstring(self): self.assertEqual(Tangerine.__doc__, None) self.assertEqual(Tangerine.peel.__doc__, None) self.assertEqual(Tangerine().peel.__doc__, None) def test_class_explicit_docstring(self): self.assertEqual(Pear.__doc__, "Conference") def test_method(self): self.assertEqual(Strawberry.weight.__doc__, "Heavy") s = Strawberry() self.assertEqual(s.weight.__doc__, "Heavy") def test_classmethod(self): self.assertEqual(Strawberry.is_red.__doc__, "Very red") def test_staticmethod(self): self.assertEqual(Strawberry.pick.__doc__, "Picked") def test_module(self): import bisect self.assertEqual(bisect.__doc__, "Bisection algorithms.") def test_local_module(self): import copydocstring self.assertEqual(copydocstring.__doc__, "Copy docstring") self.assertEqual(copydocstring.doc, "Copy docstring") def test_local_module_overwriting_docstring(self): import overwritedocstring self.assertEqual(overwritedocstring.__doc__, "Second docstring") def test_lambda(self): f = lambda x: 42 self.assertEqual(f.__doc__, None) def test_setting_on_function(self): def f(): "hello" return 42 self.assertEqual(f.__doc__, "hello") f.__doc__ = "world" self.assertEqual(f.__doc__, "world") # Setting to a non-string is odd but allowed: f.__doc__ = 42 self.assertEqual(f.__doc__, 42) # Attemping to delete __doc__ instead sets it to None: del f.__doc__ self.assertEqual(f.__doc__, None) def test_setting_on_method(self): class Banana: def peel(self): "Remove peel" pass self.assertEqual(Banana.peel.__doc__, "Remove peel") # We can set the doc when accessed on the class: Banana.peel.__doc__ = "Take out of peel" self.assertEqual(Banana.peel.__doc__, "Take out of peel") # But not when accessed via an instance: def set_on_method_of_instance(): banana = Banana() banana.peel.__doc__ = "this will not work" self.assertRaises(AttributeError, set_on_method_of_instance) if __name__ == '__main__': unittest.main()
4,028
1,324
from __future__ import print_function import argparse import json import jsonschema import logging import numpy as np import networkx as nx import os import pandas as pd import random import sys logger = logging.getLogger(name=__file__) def _load_schema(): schema_file = os.path.join(os.path.dirname(__file__), 'participant_schema.json') return json.load(open(schema_file)) __SCHEMA__ = _load_schema() def validate(participant_data): """Check that a number of records conforms to the expected format. Parameters ---------- participant_data : array_like of dicts Collection of user records to validate. Returns ------- is_valid : bool True if the provided data validates. """ is_valid = True try: jsonschema.validate(participant_data, __SCHEMA__) except jsonschema.ValidationError as failed: logger.debug("Schema Validation Failed: {}".format(failed)) is_valid = False return is_valid def tokenize(records): """Create a token mapping from objects to integers. Parameters ---------- records : array_like of iterables. Collection of nested arrays. Returns ------- enum_map : dict Enumeration map of objects (any hashable) to tokens (int). """ unique_items = set(i for row in records for i in row) unique_items = sorted(list(unique_items)) return dict([(k, n) for n, k in enumerate(unique_items)]) def items_to_bitmap(records, enum_map=None): """Turn a collection of sparse items into a binary bitmap. Parameters ---------- records : iterable of iterables, len=n Items to represent as a matrix. enum_map : dict, or None, len=k Token mapping items to ints; if None, one will be generated and returned. Returns ------- bitmap : np.ndarray, shape=(n, k) Active items. enum_map : dict Mapping of items to integers, if one is not given. """ return_mapping = False if enum_map is None: enum_map = tokenize(records) return_mapping = True bitmap = np.zeros([len(records), len(enum_map)], dtype=bool) for idx, row in enumerate(records): for i in row: bitmap[idx, enum_map[i]] = True return bitmap, enum_map if return_mapping else bitmap def categorical_sample(pdf): """Randomly select a categorical index of a given PDF. Parameters ---------- x Returns ------- y """ pdf = pdf / pdf.sum() return int(np.random.multinomial(1, pdf).nonzero()[0]) WEIGHTING_FUNCTIONS = { 'l0': lambda x: float(np.sum(x) > 0), 'l1': lambda x: float(np.sum(x)), 'mean': lambda x: float(np.mean(x)), 'null': 0.0, 'euclidean': lambda x: np.sqrt(x), 'norm_euclidean': lambda x: np.sqrt(x) / 3.0, 'quadratic': lambda x: x, 'norm_quadratic': lambda x: x / 9.0 } def build_graph(records, forced_edges=None, null_edges=None, interest_func='l0', seniority_func='l0', combination_func=np.sum): """writeme Parameters ---------- data: pd.DataFrame Loaded participant records forced_edges: np.ndarray, or None One-hot assignment matrix; no row or column can sum to more than one. null_edges: np.ndarray, or None Matches to set to zero. interest_func: str 'l1', 'l0' seniority_func: str 'l1', 'l0' combination_func: function Numpy functions, e.g. prod, sum, max. Returns ------- graph : networkx.Graph Connected graph to be factored. """ if not isinstance(records, pd.DataFrame): records = pd.DataFrame(records) interest_bitmap, interest_enum = items_to_bitmap(records.interests) # Coerce null / forced edges for datatype compliance. null_edges = ([] if null_edges is None else [tuple(v) for v in null_edges]) forced_edges = ([] if forced_edges is None else [tuple(v) for v in forced_edges]) graph = nx.Graph() for i, row_i in records.iterrows(): for j, row_j in records.iterrows(): # Skip self, shared affiliations, or same grouping skip_conditions = [i == j, (i, j) in null_edges, (j, i) in null_edges, row_i.affiliation == row_j.affiliation] if any(skip_conditions): continue # Interest weighting interest_weight = WEIGHTING_FUNCTIONS[interest_func]( interest_bitmap[i] * interest_bitmap[j]) # Seniority weighting seniority_weight = WEIGHTING_FUNCTIONS[seniority_func]( (row_i.seniority - row_j.seniority) ** 2.0) if (i, j) in forced_edges or (j, i) in forced_edges: weights = [2.0 ** 32] else: weights = [interest_weight, seniority_weight] graph.add_weighted_edges_from([(i, j, combination_func(weights))]) return graph def harmonic_mean(values): """writeme Parameters ---------- x Returns ------- y """ return np.power(np.prod(values), 1.0 / len(values)) def select_matches(records, k_matches=5, forced_edges=None, null_edges=None, interest_func='l0', seniority_func='l0', combination_func=np.sum, seed=None): """Pick affinity matches, and back-fill randomly if under-populated. Parameters ---------- x Returns ------- y """ null_edges = ([] if null_edges is None else [tuple(v) for v in null_edges]) forced_edges = ([] if forced_edges is None else [tuple(v) for v in forced_edges]) matches = {i: set() for i in range(len(records))} for k in range(k_matches): graph = build_graph( records, null_edges=null_edges, forced_edges=forced_edges, seniority_func='quadratic', interest_func='mean', combination_func=np.mean) forced_edges = None links = nx.max_weight_matching(graph) for row, col in links.items(): null_edges += (row, col) matches[row].add(col) catch_count = 0 rng = np.random.RandomState(seed=seed) for row in matches: possible_matches = set(range(len(records))) possible_matches = possible_matches.difference(matches[row]) while len(matches[row]) != k_matches: col = rng.choice(np.asarray(possible_matches)) matches[row].add(col) null_edges += [(row, col)] catch_count += 1 logger.debug("backfilled %d" % catch_count) return matches def select_topic(row_a, row_b): """writeme Parameters ---------- x Returns ------- y """ topics_a = parse_interests(row_a[7]) topics_b = parse_interests(row_b[7]) topics = list(set(topics_a).intersection(set(topics_b))) if topics: return topics[categorical_sample(np.ones(len(topics)))] TEXT_FMTS = [ ("Find someone from %s.", 'affiliation'), ("Find someone currently located in %s.", 'country'), ("Find someone who is an expert on %s", 'topics'), ("Find someone in academia at the %s level", 'education')] TEXT = [ "Find someone who works in industry", "Introduce someone to someone else", "Help someone solve a square", "Find someone who plays an instrument.", "Find someone who has attended ISMIR for more than 5 years", "Find someone for which this is their first ISMIR"] def generate_text(rows, target_idx, matches, num_outputs=24): outputs = [] for match_idx in matches[target_idx]: outputs.append("Talk to %s" % rows[match_idx][1]) outputs.extend(TEXT) categories = { 'affiliation': get_affilations(rows), 'education': get_education(rows), 'topics': get_topics(rows), 'country': get_countries(rows) } while len(outputs) < num_outputs: fmt, key = random.choice(TEXT_FMTS) value = random.choice(categories[key]) outputs.append(fmt % value) return outputs def make_card(name, contents, outfile): """writeme Parameters ---------- x Returns ------- y """ tex_lines = [] tex_lines.append(r'\documentclass[10pt, a4paper]{article}') tex_lines.append(r'\usepackage{tikz}') tex_lines.append(r'\usepackage{fullpage}') tex_lines.append(r'\usetikzlibrary{positioning,matrix}') tex_lines.append(r'\renewcommand*{\familydefault}{\sfdefault}') tex_lines.append(r'\usepackage{array}') tex_lines.append(r'\begin{document}') tex_lines.append(r'\pagestyle{empty}') tex_lines.append(r'\begin{center}') tex_lines.append(r'\Huge ISMIR 2014 Mixer Bingo\\') tex_lines.append(r"\bigskip \huge \emph{%s} \\" % name) tex_lines.append(r'\normalsize') tex_lines.append(r'') tex_lines.append(r'\bigskip') random.shuffle(contents) c = contents[0:12] + [r'FREE'] + contents[12:24] tex_lines.append(r'\begin{tikzpicture}') tex_lines.append(r"""\tikzset{square matrix/.style={ matrix of nodes, column sep=-\pgflinewidth, row sep=-\pgflinewidth, nodes={draw, text height=#1/2-2.5em, text depth=#1/2+2.5em, text width=#1, align=center, inner sep=0pt }, }, square matrix/.default=3.2cm }""") tex_lines.append(r'\matrix [square matrix]') tex_lines.append(r'(shi)') tex_lines.append(r'{') tex_lines.append( r"%s & %s & %s & %s & %s\\" % (c[0], c[1], c[2], c[3], c[4])) tex_lines.append( r"%s & %s & %s & %s & %s\\" % (c[5], c[6], c[7], c[8], c[9])) tex_lines.append( r"%s & %s & %s & %s & %s\\" % (c[10], c[11], c[12], c[13], c[14])) tex_lines.append( r"%s & %s & %s & %s & %s\\" % (c[15], c[16], c[17], c[18], c[19])) tex_lines.append( r"%s & %s & %s & %s & %s\\" % (c[20], c[21], c[22], c[23], c[24])) tex_lines.append(r'};') tex_lines.append(r'\foreach \i in {1,2,3,4,5}') tex_lines.append( r'\draw[line width=2pt] (shi-1-\i.north east) -- (shi-5-\i.south east);') tex_lines.append( r'\foreach \i in {1,2,3,4,5}') tex_lines.append( r'\draw[line width=2pt] (shi-1-\i.north west) -- (shi-5-\i.south west);') tex_lines.append( r'\foreach \i in {1,2,3,4,5}') tex_lines.append( r'\draw[line width=2pt] (shi-\i-1.north west) -- (shi-\i-5.north east);') tex_lines.append( r'\foreach \i in {1,2,3,4,5}') tex_lines.append( r'\draw[line width=2pt] (shi-\i-1.south west) -- (shi-\i-5.south east);') tex_lines.append(r'\end{tikzpicture}') tex_lines.append('') tex_lines.append(r'\pagebreak') tex_lines.append('') tex_lines.append(r'\end{center}') tex_lines.append(r'\end{document}') with open(outfile, 'w') as f: for line in tex_lines: f.write("%s\n" % line) if __name__ == '__main__': logging.basicConfig(level=logging.DEBUG) parser = argparse.ArgumentParser(description=__doc__) parser.add_argument('a', help='writeme') parser.add_argument('--b', type=str, default='apple', help='writeme') parser.add_argument('--verbose', action='store_true', help='Print progress to the console.') args = parser.parse_args() sys.exit(0)
11,609
3,982
from dataclasses import dataclass, field from typing import List from itertools import chain @dataclass class Word: word: str wordtype: str shortdef: List[str] = field(default_factory=list) synonyms: List[str] = field(default_factory=list) antonyms: List[str] = field(default_factory=list) stems: List[str] = field(default_factory=list) @classmethod def from_response(cls, r: dict) -> object: obj = cls.__new__(cls) obj.word = r["meta"]["id"] obj.wordtype = r["fl"] obj.shortdef = r["shortdef"] obj.synonyms = list(chain.from_iterable(r["meta"]["syns"])) obj.antonyms = list(chain.from_iterable(r["meta"]["ants"])) obj.stems = r["meta"]["stems"] return obj
756
256
import os, time, datetime, threading, random import numpy as np import matplotlib.pyplot as plt import sys from cortix.src.module import Module from cortix.src.port import Port from cortix.src.cortix_main import Cortix import time from bb_plot import Plot import shapely.geometry as geo import shapely.ops from shapely import affinity class BouncingBall(Module): def __init__(self,shape=None, runtime=10): super().__init__() self.shape = shape self.runtime = runtime self.bndry = [] coords = list(self.shape.exterior.coords) #Parse the box(LineRing) to create a list of line obstacles for c,f in enumerate(coords): try: cr = geo.LineString([coords[c],coords[c+1]]) except IndexError: cr = geo.LineString([coords[c],coords[-1]]) break self.bndry.append(cr) bn = self.shape.bounds self.r=1.0 for i in range(100): #Attempt to spawn ball within boundary self.p0 = [random.uniform(bn[0],bn[2]),random.uniform(bn[1],bn[3])] self.pnt = geo.point.Point(self.p0[0],self.p0[1]) self.circle = self.pnt.buffer(self.r) if self.shape.contains(self.circle): break self.v0 = [random.uniform(-50,50),random.uniform(-30,30)] self.cor = 0.95 self.a = (0,-9.81) self.m = 1 self.KE = 0.5*self.m*((self.v0[0]**2+self.v0[1]**2)**0.5)**2 self.timestamp=str(datetime.datetime.now()) #Customize container class that is sent to other modules self.messenger = Messenger() self.messenger.circle = self.circle self.messenger.timestamp = self.timestamp self.messenger.m,self.messenger.r = 1,1 self.messenger.v = self.v0 self.messenger.p = self.p0 def run(self): t = 0.01 self.elapsed, oe = 0,0 its = round(self.runtime/t) portdic = dict() for i in self.ports: #Send initial properties if 'plot' not in str(i): self.send(self.messenger,i) for i in self.ports: if 'plot' not in str(i): portdic[str(i)] = self.recv(i) for i in range(its): self.elapsed += t if oe != int(self.elapsed): print('Time Elapsed: ', int(self.elapsed),'seconds\nVelocity: ', str(round(self.v0[0],2))+'i +'+str(round(self.v0[1],2))+'j') oe = int(self.elapsed) #Gravity calculations for timestep self.p0[1] = 0.5*self.a[1]*t**2+self.v0[1]*t+self.p0[1] self.p0[0] = 0.5*self.a[0]*t**2+self.v0[0]*t+self.p0[0] self.v0[1] = self.a[1]*t + self.v0[1] self.v0[0] = self.a[0]*t + self.v0[0] #Update position and velocity variables self.pnt = geo.point.Point(self.p0[0],self.p0[1]) self.circle = self.pnt.buffer(self.r) self.messenger.v = self.v0 for shape in self.bndry: #Detects collision with boundary if self.circle.crosses(shape) or self.circle.touches(shape) or self.circle.intersects(shape): self.wall_collision(shape) for name in portdic: #Detects collision with other objects messenger = portdic[name] shape = portdic[name].circle ts = portdic[name].timestamp for line in portdic[name].collision: #Undetected Collisions received as a message if self.timestamp == line: self.ball_collision(messenger) if self.circle.crosses(shape) or self.circle.touches(shape) or self.circle.intersects(shape): self.ball_shift(shape) #Reacts to intersection between this object and another if self.circle.crosses(shape) or self.circle.touches(shape) or self.circle.intersects(shape): self.ball_collision(messenger) self.ball_shift(shape) self.messenger.collision.append(ts) self.messenger.circle = self.circle self.messenger.p = self.p0 for i in self.ports: #Send and receive messages for each timestep self.send(self.messenger,i) for i in self.ports: if 'plot' in str(i): #Not receiving messages from plotting continue messenger = self.recv(i) portdic[str(i)] = messenger self.messenger.collision = [] #Reset list of collisions for i in self.ports: #Send 'done' string to plot module as end condition if 'plot' in str(i): self.send('done',i) print('Time Elapsed: ', self.elapsed,'seconds\nVelocity: ', str(round(self.v0[0],2))+'i +'+str(round(self.v0[1],2))+'j') print('done') return def wall_collision(self,shape): p1,p2 = shapely.ops.nearest_points(self.pnt,shape) angle3 = np.arctan2(p2.y - p1.y, p2.x - p1.x) d = shape.distance(self.pnt) self.p0 = [self.p0[0]-(self.r-d)*np.cos(angle3), self.p0[1]-(self.r-d)*np.sin(angle3)] self.circle = self.pnt.buffer(self.r) angle2 = np.arctan2(self.v0[1], self.v0[0]) v = (self.v0[0]**2+self.v0[1]**2)**0.5 theta = angle2-angle3 vbi, vbj = v*np.sin(theta), v*np.cos(theta) vbj = -vbj *self.cor v = (vbi**2+vbj**2)**0.5 angle4 = np.arctan2(vbj, vbi) angle1 = angle4 - angle3 self.v0 = [np.sin(angle1)*v, np.cos(angle1)*v] def ball_shift(self,shape): p1,p2 = shapely.ops.nearest_points(self.pnt,shape) angle = np.arctan2(p2.y - p1.y, p2.x - p1.x) d = shape.distance(self.pnt) self.p0 = [self.p0[0]-(self.r*1.01-d)*np.cos(angle),self.p0[1]-(self.r*1.01-d)*np.sin(angle)] self.pnt = geo.point.Point(self.p0[0],self.p0[1]) self.circle = self.pnt.buffer(self.r) def ball_collision(self,messenger): shape = messenger.circle v2,m = messenger.v,messenger.m v3 = (v2[0]**2+v2[1]**2)**0.5 phi = np.arctan2(v2[1],v2[0]) p1,p2 = shapely.ops.nearest_points(self.pnt,shape) angle = np.arctan2(p2.y - p1.y, p2.x - p1.x) angle2 = np.arctan2(self.v0[1], self.v0[0]) v = (self.v0[0]**2+self.v0[1]**2)**0.5 #Equation source: https://en.wikipedia.org/wiki/Elastic_collision vpx=((v*np.cos(angle2-angle)*(self.m-m)+2*m*v3*np.cos(phi-angle))/(self.m+m))*np.cos(angle)+v*np.sin(angle2-angle)*np.cos(angle+np.pi/2) vpy=((v*np.cos(angle2-angle)*(self.m-m)+2*m*v3*np.cos(phi-angle))/(self.m+m))*np.sin(angle)+v*np.sin(angle2-angle)*np.sin(angle+np.pi/2) vp = (vpx**2+vpy**2)**0.5 self.v0 = [vpx,vpy] print('Ball collision') class Messenger: def __init__(self, circle=None, collision = [], timestamp='0'): self.circle = circle self.collision = collision self.timestamp = timestamp self.m = 1 self.r = 1 self.v = [] self.p = [] #Example driver script if __name__ == '__main__': cortix = Cortix(use_mpi=False) mod_list = [] shapes = ['triangle', 'squares', 'diamond'] while True: print('Choose a shape: 1) Triangle, 2) Square, or 3) Diamond\n') shape = input('>>>') shape = shape.lower() if shape == 'triangle' or shape =='1': shape = geo.Polygon([(0, 0), (0, 60), (30, 30)]) break if shape == 'square' or shape =='2': shape = geo.box(-30,0,30,50) break if shape == 'triangle' or shape =='3': shape = geo.box(-30,0,30,50) shape = affinity.rotate(shape,45) break print('Input not recognized, try again') while True: print('Choose the number of Bouncing Balls\n') balls = input('>>>') try: balls = int(balls) if balls > 1000: print('Wow good luck') elif balls > 0: break else: print('Choose a better number') except: print('Entry invalid') while True: print('How many seconds is the simulation?\n') secs = input('>>>') try: secs = int(secs) if secs > 50000: print('Wow good luck') elif secs > 0: break else: print('Choose a better number') except: print('Entry invalid') plot = Plot(shape=shape, length=balls) cortix.add_module(plot) for i in range(balls): time.sleep(0.01) app = BouncingBall(shape,runtime=secs) mod_list.append(app) cortix.add_module(app) for c,i in enumerate(mod_list): i.connect('plot-send{}'.format(c),plot.get_port('plot-receive{}'.format(c))) for j in mod_list: if i == j: continue name = '{}{}'.format(i.timestamp,j.timestamp) name2 = '{}{}'.format(j.timestamp,i.timestamp) j.connect(name, i.get_port(name2)) cortix.draw_network('network_graph.png') cortix.run() print('bye')
9,487
3,308
# Copyright 2018 Mathias Burger <mathias.burger@gmail.com> # # SPDX-License-Identifier: MIT import os import shutil import textwrap from tempfile import TemporaryDirectory import numpy as np import pytest from pgimp.GimpFile import GimpFile, GimpFileType from pgimp.GimpFileCollection import GimpFileCollection, NonExistingPathComponentException, \ GimpMissingRequiredParameterException, MaskForegroundColor from pgimp.util import file from pgimp.util.TempFile import TempFile from pgimp.util.string import escape_single_quotes def test_create_from_pathname_with_file(): prefix = file.relative_to(__file__, 'test-resources/files/') collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/first')) assert len(collection.get_files()) == 1 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/first.xcf')) assert len(collection.get_files()) == 1 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/first.png')) assert len(collection.get_files()) == 0 assert '' == collection.get_prefix() def test_create_from_pathname_with_directory(): prefix = file.relative_to(__file__, 'test-resources/files/') collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files')) assert len(collection.get_files()) == 2 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/')) assert len(collection.get_files()) == 2 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/*')) assert len(collection.get_files()) == 2 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/*.xcf')) assert len(collection.get_files()) == 2 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/*.png')) assert len(collection.get_files()) == 0 assert '' == collection.get_prefix() def test_create_from_pathname_with_recursive_match(): prefix = file.relative_to(__file__, 'test-resources/files/') collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**')) assert len(collection.get_files()) == 4 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**/')) assert len(collection.get_files()) == 4 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**/*')) assert len(collection.get_files()) == 4 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**/*.xcf')) assert len(collection.get_files()) == 4 assert prefix == collection.get_prefix() collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**/*.png')) assert len(collection.get_files()) == 0 assert '' == collection.get_prefix() def test_ordering(): prefix = file.relative_to(__file__, 'test-resources/files/') collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**')) collection = collection.replace_prefix(prefix) assert [ 'first.xcf', 'second.xcf', 'a/third.xcf', 'a/b/fourth.xcf', ] == collection.get_files() def test_replace_path_components(): prefix = file.relative_to(__file__, 'test-resources/files/') suffix = '.xcf' collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**')) collection = collection.replace_path_components(prefix, '#', suffix, '%') assert [ '#first%.xcf', '#second%.xcf', '#a/third%.xcf', '#a/b/fourth%.xcf', ] == collection.get_files() def test_replace_path_components_with_non_existing_component(): collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**')) with pytest.raises(NonExistingPathComponentException): collection.replace_path_components('wrong_prefix', '#') def test_replace_path_components_without_replacements(): collection = GimpFileCollection.create_from_pathname(file.relative_to(__file__, 'test-resources/files/**')) files_before = collection.get_files() collection = collection.replace_path_components() files_after = collection.get_files() assert files_before == files_after def test_find_files_containing_layer_by_predictate(): with TempFile('.xcf') as with_white, TempFile('.xcf') as without_white: GimpFile(with_white)\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8))\ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) GimpFile(without_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('Black', np.zeros(shape=(1, 1), dtype=np.uint8)) collection = GimpFileCollection([with_white, without_white]) files = collection.find_files_containing_layer_by_predictate( lambda layers: 'White' in map(lambda layer: layer.name, layers) ) assert len(files) == 1 assert with_white == files[0] files = collection.find_files_containing_layer_by_predictate( lambda layers: 'Not existing' in map(lambda layer: layer.name, layers) ) assert len(files) == 0 def test_find_files_containing_layer_by_name(): with TempFile('.xcf') as with_white, TempFile('.xcf') as without_white: GimpFile(with_white)\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8))\ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) GimpFile(without_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('Black', np.zeros(shape=(1, 1), dtype=np.uint8)) collection = GimpFileCollection([with_white, without_white]) files = collection.find_files_containing_layer_by_name('White', timeout_in_seconds=10) assert len(files) == 1 assert with_white == files[0] files = collection.find_files_containing_layer_by_name('Not existing', timeout_in_seconds=10) assert len(files) == 0 def test_find_files_by_script_with_script_that_takes_single_file(): with TempFile('.xcf') as with_white, TempFile('.xcf') as without_white: GimpFile(with_white)\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8))\ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) GimpFile(without_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('Black', np.zeros(shape=(1, 1), dtype=np.uint8)) collection = GimpFileCollection([with_white, without_white]) script = textwrap.dedent( """ from pgimp.gimp.file import open_xcf from pgimp.gimp.parameter import return_bool image = open_xcf('__file__') for layer in image.layers: if layer.name == '{0:s}': return_bool(True) return_bool(False) """ ) files = collection.find_files_by_script(script.format(escape_single_quotes('White')), timeout_in_seconds=3) assert len(files) == 1 assert with_white == files[0] files = collection.find_files_by_script(script.format(escape_single_quotes('Not existing')), timeout_in_seconds=3) assert len(files) == 0 def test_find_files_by_script_with_script_that_takes_multiple_files(): with TempFile('.xcf') as with_white, TempFile('.xcf') as without_white: GimpFile(with_white)\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8))\ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) GimpFile(without_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('Black', np.zeros(shape=(1, 1), dtype=np.uint8)) collection = GimpFileCollection([with_white, without_white]) script = textwrap.dedent( """ import gimp from pgimp.gimp.file import XcfFile from pgimp.gimp.parameter import return_json, get_json files = get_json('__files__') matches = [] for file in files: with XcfFile(file) as image: for layer in image.layers: if layer.name == '{0:s}': matches.append(file) return_json(matches) """ ) files = collection.find_files_by_script(script.format(escape_single_quotes('White')), timeout_in_seconds=3) assert len(files) == 1 assert with_white == files[0] files = collection.find_files_by_script(script.format(escape_single_quotes('Not existing')), timeout_in_seconds=3) assert len(files) == 0 def test_find_files_by_script_without_required_parameters(): collection = GimpFileCollection([]) script = textwrap.dedent( """ print(1) """ ) with pytest.raises(GimpMissingRequiredParameterException): collection.find_files_by_script(script, timeout_in_seconds=3) def test_execute_script_and_return_json_with_script_that_takes_single_file(): with TempFile('.xcf') as with_white, TempFile('.xcf') as without_white: GimpFile(with_white)\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8))\ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) GimpFile(without_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('Black', np.zeros(shape=(1, 1), dtype=np.uint8)) collection = GimpFileCollection([with_white, without_white]) script = textwrap.dedent( """ from pgimp.gimp.file import open_xcf from pgimp.gimp.parameter import return_json image = open_xcf('__file__') for layer in image.layers: if layer.name == '{0:s}': return_json(True) return_json(False) """ ) files = collection.execute_script_and_return_json(script.format(escape_single_quotes('White')), timeout_in_seconds=3) assert { with_white: True, without_white: False, } == files def test_execute_script_and_return_json_with_script_that_takes_multiple_files_using_open(): with TempFile('.xcf') as with_white, TempFile('.xcf') as without_white: GimpFile(with_white)\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8))\ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) GimpFile(without_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('Black', np.zeros(shape=(1, 1), dtype=np.uint8)) collection = GimpFileCollection([with_white, without_white]) script = textwrap.dedent( """ import gimp from pgimp.gimp.file import open_xcf from pgimp.gimp.parameter import return_json, get_json files = get_json('__files__') matches = [] for file in files: image = open_xcf(file) for layer in image.layers: if layer.name == '{0:s}': matches.append(file) gimp.pdb.gimp_image_delete(image) return_json(matches) """ ) files = collection.execute_script_and_return_json(script.format(escape_single_quotes('White')), timeout_in_seconds=3) assert len(files) == 1 assert with_white == files[0] def test_execute_script_and_return_json_with_script_that_takes_multiple_files_using_xcf_file(): with TempFile('.xcf') as with_white, TempFile('.xcf') as without_white: GimpFile(with_white)\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8))\ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) GimpFile(without_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('Black', np.zeros(shape=(1, 1), dtype=np.uint8)) collection = GimpFileCollection([with_white, without_white]) script = textwrap.dedent( """ import gimp from pgimp.gimp.file import XcfFile from pgimp.gimp.parameter import return_json, get_json files = get_json('__files__') matches = [] for file in files: with XcfFile(file) as image: for layer in image.layers: if layer.name == '{0:s}': matches.append(file) return_json(matches) """ ) files = collection.execute_script_and_return_json(script.format(escape_single_quotes('White')), timeout_in_seconds=3) assert len(files) == 1 assert with_white == files[0] def test_execute_script_and_return_json_with_script_that_takes_multiple_files_using_for_each(): with TempFile('.xcf') as with_white, TempFile('.xcf') as without_white: GimpFile(with_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8) * 255) GimpFile(without_white) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('Black', np.zeros(shape=(1, 1), dtype=np.uint8)) collection = GimpFileCollection([with_white, without_white]) script = textwrap.dedent( """ from pgimp.gimp.file import for_each_file from pgimp.gimp.parameter import return_json, get_json matches = [] def layer_matches(image, file): for layer in image.layers: if layer.name == '{0:s}': matches.append(file) for_each_file(layer_matches) return_json(matches) """ ) files = collection.execute_script_and_return_json(script.format(escape_single_quotes('White')), timeout_in_seconds=3) assert len(files) == 1 assert with_white == files[0] def test_copy_layer_from(): with TemporaryDirectory('_src') as srcdir, TemporaryDirectory('_dst') as dstdir: src_1 = GimpFile(os.path.join(srcdir, 'file1.xcf'))\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8))\ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) src_2 = GimpFile(os.path.join(srcdir, 'file2.xcf'))\ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('White', np.ones(shape=(1, 1), dtype=np.uint8)*255) dst_1 = GimpFile(os.path.join(dstdir, 'file1.xcf')) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) \ .add_layer_from_numpy('White', np.zeros(shape=(1, 1), dtype=np.uint8)*255) dst_2 = GimpFile(os.path.join(dstdir, 'file2.xcf')) \ .create('Background', np.zeros(shape=(1, 1), dtype=np.uint8)) src_collection = GimpFileCollection([src_1.get_file(), src_2.get_file()]) dst_collection = GimpFileCollection([dst_1.get_file(), dst_2.get_file()]) dst_collection.copy_layer_from(src_collection, 'White', layer_position=1, timeout_in_seconds=10) assert np.all(dst_1.layer_to_numpy('White') == 255) assert ['Background', 'White'] == dst_1.layer_names() assert 'White' in dst_2.layer_names() assert np.all(dst_2.layer_to_numpy('White') == 255) assert ['Background', 'White'] == dst_2.layer_names() def test_merge_mask_layer_from_with_grayscale_and_foreground_color_white(): with TemporaryDirectory('_src') as srcdir, TemporaryDirectory('_dst') as dstdir: src_1 = GimpFile(os.path.join(srcdir, 'file1.xcf'))\ .create('Mask', np.array([[255, 0]], dtype=np.uint8)) dst_1 = GimpFile(os.path.join(dstdir, 'file1.xcf')) \ .create('Mask', np.array([[0, 255]], dtype=np.uint8)) dst_2 = GimpFile(os.path.join(dstdir, 'file2.xcf')) \ .create('Mask', np.array([[0, 255]], dtype=np.uint8)) src_collection = GimpFileCollection([src_1.get_file()]) dst_collection = GimpFileCollection([dst_1.get_file(), dst_2.get_file()]) dst_collection.merge_mask_layer_from(src_collection, 'Mask', MaskForegroundColor.WHITE, timeout_in_seconds=10) assert np.all(dst_1.layer_to_numpy('Mask') == [[255], [255]]) assert ['Mask'] == dst_1.layer_names() assert 'Mask' in dst_2.layer_names() assert np.all(dst_2.layer_to_numpy('Mask') == [[0], [255]]) assert ['Mask'] == dst_2.layer_names() def test_merge_mask_layer_from_with_grayscale_and_foreground_color_black(): with TemporaryDirectory('_src') as srcdir, TemporaryDirectory('_dst') as dstdir: src_1 = GimpFile(os.path.join(srcdir, 'file1.xcf'))\ .create('Mask', np.array([[255, 0]], dtype=np.uint8)) dst_1 = GimpFile(os.path.join(dstdir, 'file1.xcf')) \ .create('Mask', np.array([[0, 255]], dtype=np.uint8)) dst_2 = GimpFile(os.path.join(dstdir, 'file2.xcf')) \ .create('Mask', np.array([[0, 255]], dtype=np.uint8)) src_collection = GimpFileCollection([src_1.get_file()]) dst_collection = GimpFileCollection([dst_1.get_file(), dst_2.get_file()]) dst_collection.merge_mask_layer_from(src_collection, 'Mask', MaskForegroundColor.BLACK, timeout_in_seconds=10) assert np.all(dst_1.layer_to_numpy('Mask') == [[0], [0]]) assert ['Mask'] == dst_1.layer_names() assert 'Mask' in dst_2.layer_names() assert np.all(dst_2.layer_to_numpy('Mask') == [[0], [255]]) assert ['Mask'] == dst_2.layer_names() def test_merge_mask_layer_from_with_color(): with TemporaryDirectory('_src') as srcdir, TemporaryDirectory('_dst') as dstdir: src_1 = GimpFile(os.path.join(srcdir, 'file1.xcf'))\ .create('Mask', np.array([[[255, 255, 255], [0, 0, 0]]], dtype=np.uint8)) dst_1 = GimpFile(os.path.join(dstdir, 'file1.xcf')) \ .create('Mask', np.array([[[0, 0, 0], [255, 255, 255]]], dtype=np.uint8)) dst_2 = GimpFile(os.path.join(dstdir, 'file2.xcf')) \ .create('Mask', np.array([[[0, 0, 0], [255, 255, 255]]], dtype=np.uint8)) src_collection = GimpFileCollection([src_1.get_file()]) dst_collection = GimpFileCollection([dst_1.get_file(), dst_2.get_file()]) dst_collection.merge_mask_layer_from(src_collection, 'Mask', MaskForegroundColor.WHITE, timeout_in_seconds=10) assert np.all(dst_1.layer_to_numpy('Mask') == [[255, 255, 255], [255, 255, 255]]) assert ['Mask'] == dst_1.layer_names() assert 'Mask' in dst_2.layer_names() assert np.all(dst_2.layer_to_numpy('Mask') == [[0, 0, 0], [255, 255, 255]]) assert ['Mask'] == dst_2.layer_names() def test_merge_mask_layer_from_with_mask_not_available_in_files_in_both_collections_and_foreground_color_white(): with TemporaryDirectory('_src') as srcdir, TemporaryDirectory('_dst') as dstdir: src_1 = GimpFile(os.path.join(srcdir, 'file1.xcf')) \ .create_empty(2, 1, GimpFileType.GRAY) dst_1 = GimpFile(os.path.join(dstdir, 'file1.xcf')) \ .create_empty(2, 1, GimpFileType.GRAY) src_collection = GimpFileCollection([src_1.get_file()]) dst_collection = GimpFileCollection([dst_1.get_file()]) dst_collection.merge_mask_layer_from(src_collection, 'Mask', MaskForegroundColor.WHITE, timeout_in_seconds=10) assert np.all(dst_1.layer_to_numpy('Mask') == [[0], [0]]) assert ['Mask'] == dst_1.layer_names() def test_merge_mask_layer_from_with_mask_not_available_in_files_in_both_collections_and_foreground_color_black(): with TemporaryDirectory('_src') as srcdir, TemporaryDirectory('_dst') as dstdir: src_1 = GimpFile(os.path.join(srcdir, 'file1.xcf')) \ .create_empty(2, 1, GimpFileType.GRAY) dst_1 = GimpFile(os.path.join(dstdir, 'file1.xcf')) \ .create_empty(2, 1, GimpFileType.GRAY) src_collection = GimpFileCollection([src_1.get_file()]) dst_collection = GimpFileCollection([dst_1.get_file()]) dst_collection.merge_mask_layer_from(src_collection, 'Mask', MaskForegroundColor.BLACK, timeout_in_seconds=10) assert np.all(dst_1.layer_to_numpy('Mask') == [[255], [255]]) assert ['Mask'] == dst_1.layer_names() def test_clear_selection(): file_with_selection_original = file.relative_to(__file__, 'test-resources/selection.xcf') with TempFile('.xcf') as file_with_selection: shutil.copyfile(file_with_selection_original, file_with_selection) collection = GimpFileCollection([file_with_selection]) selections_before = _has_selections(collection) assert selections_before[file_with_selection] collection.clear_selection(timeout_in_seconds=10) selections_after = _has_selections(collection) assert not selections_after[file_with_selection] def _has_selections(collection): result = collection.execute_script_and_return_json( textwrap.dedent( """ import gimp from pgimp.gimp.parameter import get_json, return_json from pgimp.gimp.file import XcfFile files = get_json('__files__') selections = {} for file in files: with XcfFile(file, save=True) as image: selections[file] = not gimp.pdb.gimp_selection_is_empty(image) return_json(selections) """ ), timeout_in_seconds=10 ) return result def test_remove_layers_by_name(): data = np.array([[0, 255]], dtype=np.uint8) with TemporaryDirectory('_files') as dir: file1 = GimpFile(os.path.join(dir, 'file1.xcf')) \ .create('Background', data) \ .add_layer_from_numpy('Layer 1', data) \ .add_layer_from_numpy('Layer 2', data) \ .add_layer_from_numpy('Layer 3', data) file2 = GimpFile(os.path.join(dir, 'file2.xcf')) \ .create('Background', data) \ .add_layer_from_numpy('Layer 1', data) \ .add_layer_from_numpy('Layer 2', data) collection = GimpFileCollection([file1.get_file(), file2.get_file()]) collection.remove_layers_by_name(['Layer 1', 'Layer 3'], timeout_in_seconds=10) assert file1.layer_names() == ['Layer 2', 'Background'] assert file2.layer_names() == ['Layer 2', 'Background']
23,904
7,837
# -*- coding: utf-8 -*- """ Created on Thu Sep 29 13:07:10 2016 @author: chyam purpose: A vanila lstm model for text classification. """ from __future__ import print_function from keras.models import Sequential from keras.layers import Dense, Dropout, Activation from keras.layers import LSTM from sklearn.feature_extraction.text import TfidfVectorizer from sklearn.cross_validation import train_test_split import pandas as pd from datetime import datetime import preputils as pu def main(): ### Load data filename = "C:/git/german-emo/data/clean-data-21092016.tsv" df = pd.read_csv(filename, delimiter='\t'); print(df.shape) ### Perpare label y, le = pu.prep_label(df); ### Prepare features (word-based) -> Split data into training and test sets tfidf_vectorizer = TfidfVectorizer(analyzer='word', stop_words=None, ngram_range=(1,1), max_df=0.9, min_df=1) X_tfidf_word_11gram = tfidf_vectorizer.fit_transform(df['Text'].values.astype('U')); print(X_tfidf_word_11gram.shape); #11468x26778 X_train, X_test, y_train, y_test = train_test_split(X_tfidf_word_11gram, y, test_size=0.3, train_size=0.7, random_state=88); del X_tfidf_word_11gram X_train_array = X_train.toarray(); del X_train X_test_array = X_test.toarray(); del X_test ### LSTM nb_classes = len(le.classes_) lstm(X_train_array, y_train, X_test_array, y_test, timesteps=1, batch_size=50, nb_epoch=2, nb_classes=nb_classes) ### Clean up del X_train_array, X_test_array, y_train, y_test return def lstm(X_train, y_train, X_test, y_test, timesteps, batch_size, nb_epoch, nb_classes): """ Building a lstm model.""" print('Starting LSTM ...') print(str(datetime.now())) feature_len = X_train.shape; print(feature_len[1]) model = Sequential() #model.add(Embedding(max_features, 256, input_length=maxlen)) model.add(LSTM(input_dim=feature_len[1], output_dim=128, activation='sigmoid', inner_activation='hard_sigmoid')) model.add(Dropout(0.5)) model.add(Dense(nb_classes)) model.add(Activation('sigmoid')) model.compile(loss='sparse_categorical_crossentropy', optimizer='rmsprop', metrics=['accuracy']) model.fit(X_train, y_train, batch_size=batch_size, nb_epoch=nb_epoch) score = model.evaluate(X_test, y_test, batch_size=batch_size) print('Test score:', score[0]) print('Test accuracy:', score[1]) print('LSTM finished ...') print(str(datetime.now())) return if __name__ == '__main__': main()
2,542
983
# 1 1 2 3 5 8 13 21 .... # f(n) = f(n - 1) + f(n - 2) # f(0) = f(1) = 1 def fibonacci(n: int): if n == 0 or n == 1: return 1 return fibonacci(n - 1) + fibonacci(n - 2) print(fibonacci(5))
207
121
#pythran export entry() #runas entry() import simple_case_import def forward(a): return simple_case_import.imported(a) def entry(): return forward(1)
160
55
import torchvision.models from .resnext101_32x4d import resnext101_32x4d from .inception_v4 import inception_v4 from .inception_resnet_v2 import inception_resnet_v2 from .wrn50_2 import wrn50_2 from .my_densenet import densenet161, densenet121, densenet169, densenet201 from .my_resnet import resnet18, resnet34, resnet50, resnet101, resnet152 from .fbresnet200 import fbresnet200 from .dpn import dpn68, dpn68b, dpn92, dpn98, dpn131, dpn107 #from .transformed_model import TransformedModel from .load_checkpoint import load_checkpoint def normalizer_from_model(model_name): if 'inception' in model_name: normalizer = 'le' elif 'dpn' in model_name: normalizer = 'dpn' else: normalizer = 'torchvision' return normalizer model_config_dict = { 'resnet18': { 'model_name': 'resnet18', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'resnet18-5c106cde.pth', 'drop_first_class': False}, 'resnet34': { 'model_name': 'resnet34', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'resnet34-333f7ec4.pth', 'drop_first_class': False}, 'resnet50': { 'model_name': 'resnet50', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'resnet50-19c8e357.pth', 'drop_first_class': False}, 'resnet101': { 'model_name': 'resnet101', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'resnet101-5d3b4d8f.pth', 'drop_first_class': False}, 'resnet152': { 'model_name': 'resnet152', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'resnet152-b121ed2d.pth', 'drop_first_class': False}, 'densenet121': { 'model_name': 'densenet121', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'densenet121-241335ed.pth', 'drop_first_class': False}, 'densenet169': { 'model_name': 'densenet169', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'densenet169-6f0f7f60.pth', 'drop_first_class': False}, 'densenet201': { 'model_name': 'densenet201', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'densenet201-4c113574.pth', 'drop_first_class': False}, 'densenet161': { 'model_name': 'densenet161', 'num_classes': 1000, 'input_size': 224, 'normalizer': 'torchvision', 'checkpoint_file': 'densenet161-17b70270.pth', 'drop_first_class': False}, 'dpn107': { 'model_name': 'dpn107', 'num_classes': 1000, 'input_size': 299, 'normalizer': 'dualpathnet', 'checkpoint_file': 'dpn107_extra-fc014e8ec.pth', 'drop_first_class': False}, 'dpn92_extra': { 'model_name': 'dpn92', 'num_classes': 1000, 'input_size': 299, 'normalizer': 'dualpathnet', 'checkpoint_file': 'dpn92_extra-1f58102b.pth', 'drop_first_class': False}, 'dpn92': { 'model_name': 'dpn92', 'num_classes': 1000, 'input_size': 299, 'normalizer': 'dualpathnet', 'checkpoint_file': 'dpn92-7d0f7156.pth', 'drop_first_class': False}, 'dpn68': { 'model_name': 'dpn68', 'num_classes': 1000, 'input_size': 299, 'normalizer': 'dualpathnet', 'checkpoint_file': 'dpn68-abcc47ae.pth', 'drop_first_class': False}, 'dpn68b': { 'model_name': 'dpn68b', 'num_classes': 1000, 'input_size': 299, 'normalizer': 'dualpathnet', 'checkpoint_file': 'dpn68_extra.pth', 'drop_first_class': False}, 'dpn68b_extra': { 'model_name': 'dpn68b', 'num_classes': 1000, 'input_size': 299, 'normalizer': 'dualpathnet', 'checkpoint_file': 'dpn68_extra.pth', 'drop_first_class': False}, 'inception_resnet_v2': { 'model_name': 'inception_resnet_v2', 'num_classes': 1001, 'input_size': 299, 'normalizer': 'le', 'checkpoint_file': 'inceptionresnetv2-d579a627.pth', 'drop_first_class': True}, } def config_from_string(string, output_fn='log_softmax'): config = model_config_dict[string] config['output_fn'] = output_fn return config def create_model( model_name='resnet50', pretrained=False, num_classes=1000, checkpoint_path='', **kwargs): if 'test_time_pool' in kwargs: test_time_pool = kwargs.pop('test_time_pool') else: test_time_pool = 0 if model_name == 'dpn68': model = dpn68( num_classes=num_classes, pretrained=pretrained, test_time_pool=test_time_pool) elif model_name == 'dpn68b': model = dpn68b( num_classes=num_classes, pretrained=pretrained, test_time_pool=test_time_pool) elif model_name == 'dpn92': model = dpn92( num_classes=num_classes, pretrained=pretrained, test_time_pool=test_time_pool) elif model_name == 'dpn98': model = dpn98( num_classes=num_classes, pretrained=pretrained, test_time_pool=test_time_pool) elif model_name == 'dpn131': model = dpn131( num_classes=num_classes, pretrained=pretrained, test_time_pool=test_time_pool) elif model_name == 'dpn107': model = dpn107( num_classes=num_classes, pretrained=pretrained, test_time_pool=test_time_pool) elif model_name == 'resnet18': model = resnet18(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'resnet34': model = resnet34(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'resnet50': model = resnet50(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'resnet101': model = resnet101(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'resnet152': model = resnet152(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'densenet121': model = densenet121(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'densenet161': model = densenet161(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'densenet169': model = densenet169(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'densenet201': model = densenet201(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'inception_resnet_v2': model = inception_resnet_v2(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'inception_v4': model = inception_v4(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'resnext101_32x4d': model = resnext101_32x4d(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'wrn50': model = wrn50_2(num_classes=num_classes, pretrained=pretrained, **kwargs) elif model_name == 'fbresnet200': model = fbresnet200(num_classes=num_classes, pretrained=pretrained, **kwargs) else: assert False and "Invalid model" if checkpoint_path and not pretrained: load_checkpoint(model, checkpoint_path) return model def create_model_from_cfg(mc, checkpoint_path=''): if 'kwargs' not in mc: mc['kwargs'] = {} model = create_model( model_name=mc['model_name'], num_classes=mc['num_classes'], checkpoint_path=checkpoint_path if checkpoint_path else mc['checkpoint_file'], **mc['kwargs'] ) return model
7,584
3,002
#!/usr/bin/env python3 """ Add +x to every .sh file """ # import argparse import os import subprocess def go_recursive(search_dir: str): objects = os.listdir(search_dir) for obj in objects: if obj == ".git": continue obj_path = f"{search_dir}/{obj}" if os.path.isdir(obj_path): go_recursive(obj_path) if os.path.isfile(obj_path) and obj.endswith(".sh"): try: subprocess.run(["chmod", "+x", obj_path]) except: print("There is an exception") go_recursive(".")
585
194
# TEXAS HOLD'EM (Program by Isaac Thompson) import random, itertools, copy, sys import os from playsound import playsound import pyttsx3 # Set to true to enable betting. do_bets = False RANKS = ['2', '3', '4', '5', '6', '7', '8', '9', 'T', 'J', 'Q', 'K', 'A'] SUITS = ['C', 'D', 'H', 'S'] SORT_RANKS = {'2': 0, '3': 1, '4': 2, '5': 3, '6': 4, '7': 5, '8': 6, '9': 7, 'T': 8, 'J': 9, 'Q': 10, 'K': 11, 'A': 12} SORT_SUITS = {'C': 0, 'D': 1, 'H': 2, 'S': 3} RANK_NAMES = {'2': 'Two', '3': 'Three', '4': 'Four', '5': 'Five', '6': 'Six', '7': 'Seven', '8': 'Eight', '9': 'Nine', 'T': 'Ten', 'J': 'Jack', 'Q': 'Queen', 'K': 'King', 'A': 'Ace'} SUIT_NAMES = {'C': 'Clubs', 'D': 'Diamonds', 'H': 'Hearts', 'S': 'Spades'} DEAL_IN = ["Deal me in.", "What are you waiting for? Give me two cards.", "You're the dealer. Go ahead and deal.", "Give me some cards please."] FLOP = ["Time for the flop.", "Put down the first three cards"] PLAYER_SPEECH_1 = ["Not bad.", "That's more than half.", "The odds are in your favor.", "You have an acknowledgable chance, my friend.", "Just you wait. This will all change."] PLAYER_SPEECH_2 = ["That's pretty good.", "How sad.", "Don't worry, the odds will change shortly.", "You hear that? It's the winds of change.", "I have to say I am not happy with you."] PLAYER_SPEECH_3 = ["I might as well fold.", "This is rather unfortunate.", "Dang.", "No. This can't be happening. No!", "Welp. This is happening."] PLAYER_WIN = ["You won this time around.", "You win. What a shame.", "You won. For the first time. For the last time.", "Welp, I've been destroyed.", "Good game.", "Let's play again so I can righteously win."] CPU_SPEECH_1 = ["Looks good for me.", "That's a good thing.", "Hopefully it stays that way.", "Flip a coin and it'll land on my side.", "Heh."] CPU_SPEECH_2 = ["Prepare to lose.", "The odds are in my favor.", "Ha ha ha ha.", "I will be beating you shortly.", "I will trump you!"] CPU_SPEECH_3 = ["You sir are doomed.", "You might as well fold", "Just give up. As far as you know I've got pocket aces", "Prepare yourself mentally to be obliterated", "This is the end for you!", "Ha! You can't win!", "You humans will never beat me!"] CPU_WIN = ["You lose. Would you like to play again?", "You have been righteously destroyed.", "Good golly. Looks like humans are being phased out.", "Rest in peace.", "I win. Let's play again so I can win again.", "Victory goes to me. What a surprise.", "Get wrecked.", "You've been destroyed by a computer. How do you feel?", "Wow, what a loser. You should have been luckier."] NEURAL_SPEECH = ["Well, this is going to be a boring round.", "The outlook is not great for either of us", "Let's both fold on three. One, two, three. Just kidding, I never fold.", "I cannot express my infinite exhilaration through my sarcastic robot voice.", "Yawn."] DRAW = ["We tied. What are the odds?", "Tie game. How embarassing for both of us."] # Set up audio engine audio_engine = pyttsx3.init() audio_engine.setProperty('rate', 210) # Synthesize text as speech def say(text): print(text) try: audio_engine.say(text) audio_engine.runAndWait() except: pass # Convert a card identity to a name (like 3H to Three of Hearts) def name_card(card): return RANK_NAMES[card[0]] + " of " + SUIT_NAMES[card[1]] # Report the calculated game odds to the player. # Includes statements of astronomical wit. def tell_odds(prediction): player_percent = str(round(prediction['player_win'] * 1000)/10) player_str = "You are " + player_percent + " percent likely to win. " computer_percent = str(round(prediction['computer_win'] * 1000)/10) computer_str = "I am " + computer_percent + " percent likely to win. " #draw = str(round(chances['draw'] * 1000)/10) if prediction['draw'] > 0.5: say("This is probably going to be a tie round.") elif prediction['player_win'] > 0.9: say(player_str + random.choice(PLAYER_SPEECH_3)) elif prediction['player_win'] > 0.7: say(player_str + random.choice(PLAYER_SPEECH_2)) elif prediction['player_win'] >= 0.5: say(player_str + random.choice(PLAYER_SPEECH_1)) elif prediction['computer_win'] > 0.9: say(computer_str + random.choice(CPU_SPEECH_3)) elif prediction['computer_win'] > 0.7: say(computer_str + random.choice(CPU_SPEECH_2)) elif prediction['computer_win'] > 0.5: say(computer_str + random.choice(CPU_SPEECH_1)) else: say(random.choice(NEUTRAL_SPEECH)) # A class that runs the game. class PredictionAlgorithm(): def __init__(this): this.turn = 1 this.next_round() # Main setup function - executed every round this.player_money = 500 this.computer_money = 500 def next_round(this): # Reset and switch turns if this.turn == 0: this.turn = 1 else: this.turn = 0 this.community_cards = [] this.computer_hand = [] this.player_hand = [] this.player_bet = 0 this.computer_bet = 0 this.deck = [] for suit in SUITS: for rank in RANKS: this.deck.append(rank + suit) random.shuffle(this.deck) this.maximum_percent_loss = round((random.random() + 0.15) * 10) / 10 # Prevents overbetting. The higher, the more aggressive. this.maximum_percent_loss = 0.5 def draw_card(this): # Allow the player to specify a card, then remove it from the deck. card = None while card == None: card = input("Draw a card: ") card = card.upper() if len(card) != 2: print("Not a valid card. Must be two characters long: one for the rank, second for the suit.") card = None elif (not card[0] in RANKS) or (not card[1] in SUITS): print("Not a valid card. Use the format: 2H for Two of Hearts, TC for Ten of Clubs, etc.") card = None elif not card in this.deck: print("That card is no longer in the deck. Choose a different card.") card = None this.deck.remove(card) print("Drew the " + RANK_NAMES[card[0]] + " of " + SUIT_NAMES[card[1]]) return card def play(this): # Go through a round until a winner is determined. if do_bets: say("You have " + str(this.player_money) + " tokens. I have " + str(this.computer_money) + " tokens.") #say("I am playing with an aggressiveness factor of " + str(this.maximum_percent_loss)) if this.computer_money == 0: say(random.choice(PLAYER_WIN)) sys.exit() elif this.computer_money == 1: say("You play the big blind this round.") this.player_bet = 2 this.computer_bet = 1 elif (this.turn == 1 or this.player_money == 1) and this.player_money != 0: say("You play the small blind this round.") this.player_bet = 1 this.computer_bet = 2 elif this.turn == 0 and this.player_money > 1: say("You play the big blind this round.") this.player_bet = 2 this.computer_bet = 1 else: say(random.choice(CPU_WIN)) sys.exit() say(random.choice(DEAL_IN)) #CardDetector.GetComputerHand() for i in range(2): this.computer_hand.append(this.draw_card()) result = this.bets() if result == 2: return if do_bets: this.state_bets() say(random.choice(FLOP)) for i in range(3): this.community_cards.append(this.draw_card()) if do_bets: if this.computer_bet != this.computer_money and this.player_bet != this.player_money: result = this.bets() if result == 2: return this.state_bets() tell_odds(this.find_winning_chances(0.35)) say("Deal another card.") this.community_cards.append(this.draw_card()) if do_bets: if this.computer_bet != this.computer_money and this.player_bet != this.player_money: result = this.bets() if result == 2: return this.state_bets() tell_odds(this.find_winning_chances(0.4)) say("Deal the final card.") this.community_cards.append(this.draw_card()) if do_bets: if this.computer_bet != this.computer_money and this.player_bet != this.player_money: result = this.bets() if result == 2: return this.state_bets() tell_odds(this.find_winning_chances(0.45)) say("Alright, show me your hand.") for i in range(2): this.player_hand.append(this.draw_card()) player_best_hand = this.find_best_hand(this.community_cards + this.player_hand) computer_best_hand = this.find_best_hand(this.community_cards + this.computer_hand) say("Your best hand was " + player_best_hand.name) say("My best hand was " + computer_best_hand.name) winner = this.winning_hand(player_best_hand, computer_best_hand) if winner == 0: say(random.choice(PLAYER_WIN)) this.player_wins() elif winner == 1: say(random.choice(CPU_WIN)) this.computer_wins() elif winner == 2: say(random.choice(DRAW)) def computer_wins(this): this.computer_money += this.player_bet this.player_money -= this.player_bet this.next_round() def player_wins(this): this.player_money += this.computer_bet this.computer_money -= this.computer_bet this.next_round() def state_bets(this): print("You have bet " + str(this.player_bet)) print("Computer has bet " + str(this.computer_bet)) # Run through a betting cycle with the player. def bets(this): if do_bets: computer_played = False player_played = False skip_player = False if this.turn == 1: skip_player = True chances = None while True: # Betting cycle this.state_bets() if skip_player: skip_player = False else: # Player bet bet = [""] # Obtain the command commands = ["bet", "raise", "call", "check", "fold"] while not bet[0] in commands: bet = input("Bet, Raise, Call, Check, or Fold: ").split() if len(bet) == 0: bet = [""] else: bet[0] = bet[0].lower() player_played = True if bet[0] == "bet" or bet[0] == "raise": # Parse the command try: bet[1] = int(bet[1]) amount = bet[1] if bet[1] + this.computer_bet > this.player_money: print("You only have " + str(this.player_money)) raise Exception() # Break out of try loop and ask for a new bet except: # Get a valid bet amount = -1 while amount < 0: amount = input("How much: ") try: amount = int(amount) if amount + this.computer_bet > this.player_money: amount = -1 print("You only have " + str(this.player_money)) except: amount = -1 this.player_bet += amount elif bet[0] == "call" or bet[0] == "check": if this.player_bet < this.computer_bet: # Raise the bet to match the computer bet this.player_bet = this.computer_bet if this.player_bet > this.player_money: # Limit calling to the player's money this.player_bet = this.player_money if player_played and computer_played: return elif bet[0] == "fold": this.computer_wins() return 2 this.state_bets() # Computer bet if chances == None: chances = this.find_winning_chances({0: 0.22, 3: 0.3, 4: 0.3, 5: 1}[len(this.community_cards)]) if this.player_bet > this.computer_bet: call_bet = this.player_bet # Match the player without exceeding the computer balance.\ else: call_bet = this.computer_bet if call_bet > this.computer_money: call_bet = this.computer_money expected_outcomes = {'fold': this.computer_money - this.computer_bet} if this.computer_money - this.computer_bet + 1 > 0: # If we can raise, calculate which raise value is the best. for raise_value in range(0, this.computer_money - this.player_bet + 1): expected_outcomes[raise_value] = {} expected_outcomes[raise_value]['win'] = this.computer_money + this.player_bet + raise_value expected_outcomes[raise_value]['loss'] = this.computer_money - this.player_bet - raise_value expected_outcomes[raise_value]['draw'] = this.computer_money expected_outcomes[raise_value]['expected'] = expected_outcomes[raise_value]['win'] * chances['computer_win'] + \ expected_outcomes[raise_value]['loss'] * chances['player_win'] + \ expected_outcomes[raise_value]['draw'] * chances['draw'] computer_played = True best_choice = 'fold' best_expected_value = expected_outcomes['fold'] for choice in expected_outcomes: if not choice == 'fold': if expected_outcomes[choice]['expected'] > best_expected_value: #if expected_outcomes[choice]['loss'] >= this.computer_money * (1 - this.maximum_percent_loss): best_choice = choice best_expected_value = expected_outcomes[choice]['expected'] if best_choice == 'fold': say("I fold.") this.player_wins() return 2 elif best_choice == 0: # Call/Check if this.computer_bet == this.player_bet: say("I check.") else: say("I call.") this.computer_bet = call_bet if player_played and computer_played: return else: # Call and raise say("I call and raise " + str(best_choice)) this.computer_bet = this.player_bet + best_choice def find_winning_chances(this, accuracy=1): # Accuracy of 1 calculates perfectly, but lower values are faster. # Increments for each possible final outcome, then calculated as percentages in the end. player_wins = 0 computer_wins = 0 draws = 0 false_deck = copy.deepcopy(this.deck) while len(false_deck) > len(this.deck) * accuracy: false_deck.pop(random.randrange(0, len(false_deck))) community_combos = list(itertools.combinations(false_deck, 5 - len(this.community_cards))) for community_combo in community_combos: community_combo = list(community_combo) for card in community_combo: false_deck.remove(card) # Temporarily remove the community cards from the deck full_community_combo = community_combo + this.community_cards # Add the cards we already know so we have a set of five player_combos = list(itertools.combinations(false_deck, 2)) for player_combo in player_combos: # Based on reduced deck, determine all possibilities for the player's hand and beating the computer player_combo = list(player_combo) best_player_hand = this.find_best_hand(player_combo + full_community_combo) best_computer_hand = this.find_best_hand(this.computer_hand + full_community_combo) winner = this.winning_hand(best_player_hand, best_computer_hand) if winner == 0: player_wins += 1 elif winner == 1: computer_wins += 1 else: draws += 1 false_deck += community_combo # Add the cards back to the deck total_scenarios = player_wins + computer_wins + draws return {'player_win': player_wins / total_scenarios, 'computer_win': computer_wins / total_scenarios, 'draw': draws / total_scenarios} def find_best_hand(this, cards): # Find the best hand out of the community cards and two personal cards. combinations = list(itertools.combinations(cards, 5)) best_hand = None for combo in combinations: hand = Hand() hand.cards = list(combo) hand.evaluate() if best_hand == None: best_hand = hand else: if this.winning_hand(hand, best_hand) == 0: best_hand = hand return best_hand def winning_hand(this, hand0, hand1): if hand0.hand_type < hand1.hand_type: return 0 elif hand0.hand_type > hand1.hand_type: return 1 else: assert len(hand0.high_cards) == len(hand1.high_cards), 'These two hands have a different number of kickers: ' \ + str(hand0.cards) + ' ' + str(hand1.cards) i = 0 while i < len(hand0.high_cards): if SORT_RANKS[hand0.high_cards[i][0]] > SORT_RANKS[hand1.high_cards[i][0]]: return 0 elif SORT_RANKS[hand0.high_cards[i][0]] < SORT_RANKS[hand1.high_cards[i][0]]: return 1 i += 1 return 2 # Draw class Hand(): # 5 card hand # Initialize an empty hand. def __init__(this, cards=[]): this.name = None this.hand_type = -1 this.high_cards = {} this.cards = cards # Add a card to the hand. def append(this, card): this.cards.append(card) # Determine the value of our hand. # Identify royal flush, straights, two-pair combos, etc. def evaluate(this): this.cards = sorted(this.cards, key=lambda card: (SORT_RANKS[card[0]], card[1])) # Sort the cards by rank first, then by suit # Flush flush = True for i, card in enumerate(this.cards): if i == 4: break elif this.cards[i][1] != this.cards[i + 1][1]: flush = False break # Royal flush if flush: if this.cards[0][0] == 'T' and this.cards[1][0] == 'J' and this.cards[2][0] == 'Q' and this.cards[3][0] == 'K' and this.cards[4][0] == 'A': this.hand_type = 0 this.name = 'Royal Flush' return # Straight (Search both ways from the beginning card to find straight from both directions straight = False r = 0 l = 0 while True: difference = abs(SORT_RANKS[this.cards[r + 1][0]] - SORT_RANKS[this.cards[r][0]]) if difference == 1 or difference == 12: r += 1 if r == 4: break else: break while True: difference = abs(SORT_RANKS[this.cards[-l - 1][0]] - SORT_RANKS[this.cards[-l][0]]) if difference == 1 or difference == 12: l += 1 if l == 4: break else: break if r + l == 4: straight = True # Straight flush if straight and flush: this.hand_type = 1 if this.cards[r][0] == '4' or this.cards[r][0] == '3' or this.cards[r][0] == '2': this.name = 'Straight Flush (Ace-High)' this.high_cards[0] = this.cards[4] elif this.cards[4][0] == 'A' and this.cards[3][0] == '5': this.name = 'Straight Flush (Steel Wheel)' this.high_cards[0] = this.cards[r] else: this.name = 'Straight Flush (' + RANK_NAMES[this.cards[4][0]] + '-High)' this.high_cards[0] = this.cards[4] return # Group cards for later disambiguation groups = [[this.cards[0]]] for i, card in enumerate(this.cards): if i > 0: new_card = True for group in groups: if group[0][0] == card[0]: group.append(card) new_card = False break if new_card: groups.append([card]) groups = sorted(groups, key=lambda group: -len(group)) # Biggest groups first # 4 of a kind if len(groups[0]) == 4: this.hand_type = 2 this.high_cards[0] = groups[0][0] this.high_cards[1] = groups[1][0] this.name = 'Four of a Kind' return # Full House if len(groups[0]) == 3 and len(groups[1]) == 2: this.hand_type = 3 this.high_cards[0] = groups[0][0] this.high_cards[1] = groups[1][0] if groups[0][0][0] == 'K' and groups[0][1][0] == 'K' and groups[0][2][0] == 'K' and groups[1][0][0] == 'A' and groups[1][1][0] == 'A': this.name = 'Full House (Nativity)' else: this.name = 'Full House' return # Flush if flush: this.hand_type = 4 this.high_cards[0] = groups[0][0] this.name = 'Flush' return # Straight - code adapted from earlier (Wheel, Sucker Straight) if straight: this.hand_type = 5 if this.cards[r][0] == '4' or this.cards[r][0] == '3' or this.cards[r][0] == '2': this.name = 'Straight (Ace-High)' this.high_cards[0] = this.cards[4] elif this.cards[4][0] == 'A' and this.cards[3][0] == '5': this.name = 'Sucker Straight' this.high_cards[0] = this.cards[r] else: this.name = 'Straight (' + RANK_NAMES[this.cards[4][0]] + '-High)' this.high_cards[0] = this.cards[4] return # Three of a Kind if len(groups[0]) == 3: this.hand_type = 6 this.name = 'Three of a Kind' this.high_cards[0] = groups[0][0] # Three of a kind this.high_cards[1] = groups[2][0] # High kicker this.high_cards[2] = groups[1][0] # Low kicker return # Two Pairs if len(groups[0]) == 2 and len(groups[1]) == 2: this.hand_type = 7 this.name = 'Two Pairs' this.high_cards[0] = groups[1][0] # Highest pair this.high_cards[1] = groups[0][0] # Lowest pair this.high_cards[2] = groups[2][0] # Kicker return # Pair if len(groups[0]) == 2: this.hand_type = 8 this.name = 'Pair' this.high_cards[0] = groups[0][0] # Pair this.high_cards[1] = groups[3][0] # High kicker this.high_cards[2] = groups[2][0] # Mid kicker this.high_cards[3] = groups[1][0] # Low kicker return # Junk this.hand_type = 9 this.name = 'Junk' assert len(groups) == 5, "Error! We have been dealt a broken hand." this.high_cards[0] = groups[4][0] # Highest card this.high_cards[1] = groups[3][0] this.high_cards[2] = groups[2][0] this.high_cards[3] = groups[1][0] this.high_cards[4] = groups[0][0] # Lowest card return if __name__ == "__main__": ALG = PredictionAlgorithm() say("Let's play Texas Hold'Em.") while True: ALG.play()
25,985
7,817
""" s="preeni" ss="e" """ s=input("enter the string:") ss=input("enter the substring:") j=0 for i in range(len(s)): m=s.find(ss) #the first occurence of ss if(j==0): print("m=%d"%m) if(m== -1 and j==0): print("no such substring is available") break if(m== -1): break else : j=j+1 s=s[m+1:] # print(s) print("no. of occurences is %s"%j)
443
191
#!/bin/usr/python # -*- coding:utf-8 -*- # 628.三个数的最大乘积 class Solution: def maximumProduct(self, nums): if len(nums) == 3: return nums[0] * nums[1] * nums[2] elif len(nums) < 3: return None else: z_num, f_num = [], [] for i in nums: if i < 0: f_num.append(i) # 负数列表 else: z_num.append(i) # 正数列表 z_num.sort(reverse=True) f_num.sort() sum1, sum2 = 1, 1 if len(f_num) < 2: return z_num[0] * z_num[1] * z_num[2] elif len(z_num) < 2: return f_num[0] * f_num[1] * z_num[0] else: sum2 *= f_num[0] sum2 *= f_num[1] sum2 *= z_num[0] sum1 *= z_num[0] sum1 *= z_num[1] sum1 *= z_num[2] return max(sum1, sum2) s = Solution() num = s.maximumProduct([-4, -3, -2, -1, 60]) print(num)
1,039
408
#!/usr/bin/env python3 # -*- coding: utf-8 -*- """ Created on Tue Feb 16 15:35:53 2021 @author: alef """ import os.path # modulo de instropecção amigável import inspect print('Objeto: ', inspect.getmodule(os.path)) print('Classe?', inspect.isclass(str)) # Lista todas as funções que existem em os.path print('Membros: ') for name, struct in inspect.getmembers(os.path): if inspect.isfunction(struct): print(name)
437
170
import sys import pyfiglet import pandas as pd import numpy as np from tabulate import tabulate import dateutil import datetime import re result = pyfiglet.figlet_format("h r s y s t e m", font="slant") strStatus = "" class UserSelection: """Handles User Selection Logic the class is used to implement a case-switch construct in python """ def switch(self, strChoice): """Builds a function name based off user choice and triggers the actions""" default = "Incorrect Selection" return getattr(self, "case_" + str(strChoice), lambda: default)() def case_1(self): """User selected print a list of all employees""" IO.print_all_employees(IO.get_employee_db()) pass def case_2(self): """User selected Print a list of employees currently employed""" IO.print_all_employees_employed(IO.get_employee_db()) pass def case_3(self): """User selected Print a list of employees who have left in the past month""" IO.print_employees_departures(IO.get_employee_db()) pass def case_4(self): """User selected Display a reminder to schedule annual review""" IO.print_review_reminders(IO.get_employee_db()) pass def case_5(self): """User selected Capture employee information""" ( employeeID, firstName, lastName, fullName, address, ssn, dateOfBirth, jobTitle, startDate, endDate, ) = IO.capture_employee_data(IO.get_employee_db()) df = Processor.append_row( IO.get_employee_db(), employeeID, firstName, lastName, fullName, address, ssn, dateOfBirth, jobTitle, startDate, endDate, ) Processor.append_to_csv(df) pass def case_6(self): """User selected Delete record""" fullName = IO.input_name_to_delete() Processor.delete_record(IO.get_employee_db(), fullName) pass def case_7(self): """User selected Exit""" print("Goodbye ") sys.exit() class Processor: """Performs Processing tasks""" @staticmethod def delete_record(dframe, name): """Generates a new DataFrame Filtering Out the record corresponding to the name to delete :param dframe: (Pandas DataFrame) DataFrame containing employee information :param name: (String) String representing the name to delete :return: nothing """ df = dframe[(dframe.FullName != name)] newdf = df.copy() Processor.update_csv(newdf) @staticmethod def update_csv(dframe): """Writes the filtered DataFrame to a csv file. This method is used when the user decides to delete record :param dframe: (Pandas DataFrame) DataFrame containing employee information :return: nothing """ dframe.to_csv("EmployeeData.csv", index=False) @staticmethod def generate_employee_id(dframe): """Generates unique employee id for the next employee to be added :param dframe: (Pandas DataFrame) DataFrame containing employee information :return next_id: (Integer) Next ID to be used for an employee record """ max_id = dframe["EmployeeID"].max() next_id = max_id + 1 return next_id @staticmethod def append_row( df, id, first, last, full, address, ssn, dob, job, startDate, endDate ): """Generates a row of data to be appended to a pandas DataFrame :param dframe: (Pandas DataFrame) DataFrame containing employee information :param id: (Integer) Next ID to be used for an employee record :param first: (String) First Name to be used for an employee record :param last: (String) Last Name to be used for an employee record :param full: (String) Full Name to be used for an employee record :param address: (String) Address to be used for an employee record :param ssn: (String) Social Security Number to be used for an employee record :param dob: (String) Date of Birth to be used for an employee record :param job: (String) Job Title to be used for an employee record :param startDate: (String) Start Date to be used for an employee record :param endDate: (String) End Date to be used for an employee record :return df: (Pandas DataFrame) a new Pandas DataFrame to be written to a csv """ new_row = { "EmployeeID": id, "FirstName": first, "LastName": last, "FullName": full, "Address": address, "ssn": ssn, "DateOfBirth": dob, "JobTitle": job, "StartDate": startDate, "EndDate": endDate, } # append row to the dataframe df = df.append(new_row, ignore_index=True) return df @staticmethod def append_to_csv(df): """Writes a new DataFarme to the csv file. This method is used when the user decides to add a new record to the csv :param df: (Pandas DataFrame) DataFrame containing employee information :return: nothing """ df.to_csv("EmployeeData.csv", index=False) @staticmethod def isValidSSN(str): """Validates the social security format :param str: (String) string that represents the social security number :return: (Boolean) """ # This code is contributed by avanitrachhadiya2155 # Regex to check valid # SSN (Social Security Number). regex = "^(?!666|000|9\\d{2})\\d{3}-(?!00)\\d{2}-(?!0{4})\\d{4}$" # Compile the ReGex p = re.compile(regex) # If the string is empty # return false if str == None: return False # Return if the string # matched the ReGex if re.search(p, str): return True else: return False class IO: """Performs Input and Output tasks""" @staticmethod def get_menu(argument): """Uses dictionaries to display options to the user :param argument: (Integer) None :return: (String) the value of the switcher dictionary """ def one(): return "1) Print a list of all employees" def two(): return "2) Print a list of employees currently employed" def three(): return "3) Print a list of employees who have left in the past month" def four(): return "4) Display reminder to schedule annual review" def five(): return "5) Capture employee information" def six(): return "6) Delete record" def seven(): return "7) Exit" switcher = { 1: one(), 2: two(), 3: three(), 4: four(), 5: five(), 6: six(), 7: seven(), } return switcher.get(argument, "Invalid Selection") @staticmethod def input_menu_choice(): """Gets the menu choice from a user :param: None :return: string """ while True: try: choice = str( input("Which option would you like to perform? [1 to 7] - ") ).strip() if choice not in ["1", "2", "3", "4", "5", "6", "7"]: raise ValueError("Choice not an option, enter 1, 2, 3, 4, 5, 6, 7") except ValueError as e: print(e) else: break print() # Add an extra line for looks return choice @staticmethod def input_press_to_continue(optional_message=""): """Pause program and show a message before continuing :param optional_message: An optional message you want to display :return: nothing """ print(optional_message) input("Press the [Enter] key to continue.") @staticmethod def print_all_employees(dframe): """Displays all employees :param dframe: (Pandas DataFrame) a Pandas DataFrame containing all employee info. :return: nothing """ IO.print_header() print("List of all employees: ") IO.print_footer() df = dframe.copy() df["StartDate"] = pd.to_datetime(df["StartDate"]) print(tabulate(df, headers="keys", tablefmt="psql", showindex=False)) @staticmethod def get_employee_db(): """Reads the csv and puts it in a pandas dataframe :param: None :return df: (Data Frame) a pandas dataframe """ df = pd.read_csv("EmployeeData.csv") return df @staticmethod def print_all_employees_employed(dframe): """Displays the employees currently employed at the company :param dframe: (Pandas DataFrame) DataFrame containing employee information :return: nothing """ # Filter out those employees who have left. # That is, the ones that have a real 'EndDate' # The employees currently employed have EndDate = None newdf = dframe[(dframe.EndDate == "NONE")] df = newdf.copy() df["StartDate"] = pd.to_datetime(df["StartDate"]) IO.print_header() print("List of all employees currently employed: ") IO.print_footer() print(tabulate(df, headers="keys", tablefmt="psql", showindex=False)) @staticmethod def print_employees_departures(dframe): """Displays a list of employees that have left the company in the past 30 days :param dframe: (Pandas DataFrame) A DataFrame that contains employee information :return: nothing """ # Filter out those employees who have NOT left. # That is, the ones that have EndDate = None # The employees who have left have EndDate = xx/xx/xxxx df = dframe[(dframe.EndDate != "NONE")] newdf = df.copy() newdf["EndDate"] = pd.to_datetime(newdf["EndDate"]) date = datetime.datetime.today().replace(microsecond=0) df_filter = newdf[newdf.EndDate > date - pd.to_timedelta("30day")] IO.print_header() print("List of all employees who have left the company in the past 30 days: ") IO.print_footer() print(tabulate(df_filter, headers="keys", tablefmt="psql", showindex=False)) @staticmethod def print_review_reminders(dframe): """Displays a list of employees that have left the company in the past 30 days :param dframe: (Pandas DataFrame) A DataFrame that contains employee information :return: nothing """ df = dframe[(dframe.EndDate == "NONE")] newdf = df.copy() date = datetime.datetime.today().replace(microsecond=0) newdf["StartDate"] = pd.to_datetime(newdf["StartDate"]) newdf['Month'] = pd.DatetimeIndex(newdf['StartDate']).month newdf['Day'] = pd.DatetimeIndex(newdf['StartDate']).day newdf['CalendarYear'] = date.year newdf['DateForReview'] = pd.to_datetime((newdf.CalendarYear * 10000 + newdf.Month * 100 + newdf.Day).apply(str), format='%Y%m%d') df_filter = newdf[(newdf.DateForReview - pd.to_timedelta("90days") < date) & (newdf.DateForReview >= date)] df_df = df_filter.drop(['Month', 'Day', 'CalendarYear', 'ssn'], axis=1) #IO.print_header() print() print('FRIENDLY REMINDER! Anual Reviews are coming up for the following employees: ') #IO.print_footer() print(tabulate(df_df, headers="keys", tablefmt="psql", showindex=False)) @staticmethod def input_name_to_delete(): """Captures the name of the employee to delete :param: None :return strName: (String) String containing the full name of the person """ while True: try: strName = str(input("Enter Full Name: ")).strip() if strName.isnumeric(): raise ValueError("Name is Numeric. Enter a valid name: ") elif strName == "": raise ValueError("Name is empty. Enter a valid Name: ") except ValueError as e: print(e) else: break return strName @staticmethod def capture_employee_data(dframe): """Captures employee data for new record :param dframe: (Pandas DataFrame) a DataFrame with employee info :return employeeID: (Integer) Unique Employee ID :return firstName: (String) First Name :return lastName: (String) Last Name :return fullName: (String) Full Name :return address: (String) Address :return ssn: (String) Social Security Number :return dateOfBirth: (String) Date of Birth :return jobTitle: (String) Job Title :return startDate: (String) Start Date :return endDate: (String) End Date """ employeeID = Processor.generate_employee_id(dframe) firstName = IO.capture_first_name() lastName = IO.capture_last_name() fullName = firstName + " " + lastName address = IO.capture_address() ssn = IO.capture_ssn() dateOfBirth = IO.capture_date_of_birth() jobTitle = IO.capture_job_title() startDate = IO.capture_start_date() endDate = IO.capture_end_date() return ( employeeID, firstName, lastName, fullName, address, ssn, dateOfBirth, jobTitle, startDate, endDate, ) @staticmethod def capture_first_name(): """Captures First Name :param: None :return: Nothing """ while True: try: strText = str(input("Enter First Name: ")).strip() if strText.isnumeric(): raise ValueError( "First Name is Numeric. Enter a valid First Name: " ) elif strText == "": raise ValueError("First Name is empty. Enter a valid First Name: ") except ValueError as e: print(e) else: break return strText @staticmethod def capture_last_name(): """Captures Last Name :param: None :return: Nothing """ while True: try: strText = str(input("Enter Last Name: ")).strip() if strText.isnumeric(): raise ValueError("Last Name is Numeric. Enter a valid Last name: ") elif strText == "": raise ValueError("Last Name is empty. Enter a valid Last Name: ") except ValueError as e: print(e) else: break return strText @staticmethod def capture_address(): """Captures Address :param: None :return: Nothing """ while True: try: strText = str(input("Enter Address: ")).strip() if strText.isnumeric(): raise ValueError("Address is Numeric. Enter a valid address: ") elif strText == "": raise ValueError("Address is empty. Enter a valid address: ") except ValueError as e: print(e) else: break return strText @staticmethod def capture_ssn(): """Captures Social Security Number :param: None :return: Nothing """ while True: try: strText = str(input("Enter ssn (000-00-0000): ")).strip() if Processor.isValidSSN(strText) == False: raise ValueError( "ssn is not in the proper format. Enter a valid ssn: " ) elif strText == "": raise ValueError("ssn is empty. Enter a valid ssn: ") except ValueError as e: print(e) else: break return strText @staticmethod def capture_date_of_birth(): """Captures Date of Birth :param: None :return: Nothing """ formt = "%m/%d/%Y" while True: try: strText = str( input("Enter Date of Birth, MM/DD/YYYY (%m/%d/%Y): ") ).strip() res = bool(datetime.datetime.strptime(strText, formt)) except ValueError as e: print(e) else: break return strText @staticmethod def capture_job_title(): """Captures Job Title :param: None :return: Nothing """ while True: try: strText = str(input("Enter Job Title: ")).strip() if strText.isnumeric(): raise ValueError("Job Title is Numeric. Enter a valid Job Title: ") elif strText == "": raise ValueError("Job Title is empty. Enter a valid Job Title: ") except ValueError as e: print(e) else: break return strText @staticmethod def capture_start_date(): """Captures Start Date :param: None :return: Nothing """ formt = "%m/%d/%Y" while True: try: strText = str( input("Enter Start Date, MM/DD/YYYY (%m/%d/%Y): ") ).strip() res = bool(datetime.datetime.strptime(strText, formt)) except ValueError as e: print(e) else: break return strText @staticmethod def capture_end_date(): """Captures End Date :param: None :return: Nothing """ formt = "%m/%d/%Y" while True: strText = ( str(input("Enter End Date, MM/DD/YYYY (%m/%d/%Y): ")).strip().upper() ) if strText != "NONE": try: res = bool(datetime.datetime.strptime(strText, formt)) except ValueError as e: print(e) else: break else: break return strText @staticmethod def activate_reminders(dframe): """Activate the reminders :param: None :return: Nothing """ IO.print_review_reminders(dframe) @staticmethod def print_header(): """Prints the header of the report :param: None :return: nothing """ print( "+--------------+-------------+------------+--------------" "+-----------+-------------+---------------+------------" "+---------------------+-----------+" ) @staticmethod def print_footer(): """Prints the footer of the report :param: None :return: nothing """ print( "+--------------+-------------+------------+--------------" "+-----------+-------------+---------------+------------" "+---------------------+-----------+" ) # Main Body of Script ------------------------------------------------------ # if __name__ == "__main__": while True: # reminder for annual review can be a separate class print(result) print("Menu of Options") print(IO.get_menu(1)) print(IO.get_menu(2)) print(IO.get_menu(3)) print(IO.get_menu(4)) print(IO.get_menu(5)) print(IO.get_menu(6)) print(IO.get_menu(7)) IO.activate_reminders(IO.get_employee_db()) # menu printed strChoice = IO.input_menu_choice() # Get menu option s = UserSelection() s.switch( strChoice ) # Calls the UserSelection class to handle the tasks in the menu IO.input_press_to_continue(strStatus) continue # to show the menu
20,610
5,588
from . import similarity from .distance import frechet_dist from .similarity import pcc, sa from . import robust from .robust import iqr, cv, fwhm, count_missing_values
169
52
import scraper.scraper as scraper import scraper.parser as parser import sys from dotenv import load_dotenv load_dotenv() if __name__ == "__main__": if "--noScrape" not in sys.argv: scraper.main() parser.main()
229
80
from __future__ import division import time import json from collections import deque import serial import redis import numpy as np def build_update_basic(info): basic_info = { "cmd": "update_basic", "clients" : "%d" % info["connected_clients"], "memory" : info["used_memory_human"], "ops/s": "%d" % info["instantaneous_ops_per_sec"], } return basic_info def build_update_advanced(info): advanced_info = { "cmd": "update_advanced", "rej_conn" : "%d" % info["rejected_connections"], "key_hits" : "%d" % info["keyspace_hits"], "key_miss": "%d" % info["keyspace_misses"], } return advanced_info def build_update_ops_sec(ops_sec_deque): arr = np.array(ops_sec_deque) arr_max = arr.max() if arr_max > 0: arr *= 40/arr_max ops_sec = { "cmd" : "update_ops_sec", "graph_values" : arr.tolist(), "max_value" : "%d" % arr_max, } return ops_sec def run_main(): print "Stat Cube Redis Monitor" stat_cube = serial.Serial("/dev/ttyUSB0", 9600) redis_conn = redis.StrictRedis(host='localhost', port=6379, db=0) ops_sec_deque = deque([0] * 40) print "Monitoring Redis..." while True: info = redis_conn.info() _ = ops_sec_deque.popleft() ops_sec_deque.append(info["instantaneous_ops_per_sec"]) basic_info = json.dumps(build_update_basic(info)) stat_cube.write(basic_info + '\n') stat_cube.flush() time.sleep(0.1) advanced_info = json.dumps(build_update_advanced(info)) stat_cube.write(advanced_info + '\n') stat_cube.flush() time.sleep(0.1) ops_sec_info = json.dumps(build_update_ops_sec(ops_sec_deque)) stat_cube.write(ops_sec_info + '\n') stat_cube.flush() time.sleep(0.1) time.sleep(1) if __name__ == '__main__': run_main()
1,928
718
from django.db import models from django.utils import timezone class Article(models.Model): title = models.CharField(max_length = 100) content = models.TextField() date_posted = models.DateTimeField(default=timezone.now) author = models.CharField(max_length = 100) def __str__(self): return self.title def get_absolute_url(self): return reverse('Article-detail', kwargs={'pk': self.pk})
433
132
from syft_tensorflow.serde.serde import MAP_TF_SIMPLIFIERS_AND_DETAILERS
73
31
#!/bin/env python # In this challenge, we are going to use regular expressions to manipulate # text data import re # 1. Compile a regular expression that matches URLs P_URL = re.compile(r'http://dlab\.berkeley\.edu', flags=re.I) # 2. Using that pattern, write a function that pulls all of the URLs out of a document and returns them as a list def get_urls(document): assert that document is a string object initialize empty list for match in re.something: get match group append match group to list return list
549
151
# ----------------------------------------------------------------------------- # WSDM Cup 2017 Classification and Evaluation # # Copyright (c) 2017 Stefan Heindorf, Martin Potthast, Gregor Engels, Benno Stein # # Permission is hereby granted, free of charge, to any person obtaining a copy # of this software and associated documentation files (the "Software"), to deal # in the Software without restriction, including without limitation the rights # to use, copy, modify, merge, publish, distribute, sublicense, and/or sell # copies of the Software, and to permit persons to whom the Software is # furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice shall be included in all # copies or substantial portions of the Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NONINFRINGEMENT. IN NO EVENT SHALL THE # AUTHORS OR COPYRIGHT HOLDERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING FROM, # OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS IN THE # SOFTWARE. # ----------------------------------------------------------------------------- import itertools import logging import pandas as pd from sklearn import ensemble from sklearn.externals.joblib import Parallel, delayed import config from src import evaluationutils _logger = logging.getLogger() ######################################################################## # Feature Ranking ######################################################################## def rank_features(training, validation): _logger.info("Ranking features...") metrics = _compute_metrics_for_single_features(training, validation) group_metrics = _compute_metrics_for_feature_groups(training, validation) metrics = pd.concat([metrics, group_metrics], axis=0) _output_sorted_by_group( validation.get_time_label(), validation.get_system_name(), metrics, validation.get_group_names(), validation.get_subgroup_names()) _logger.info("Ranking features... done.") def _compute_metrics_for_single_features(training, validation): """Return a Pandas data frame with metrics for every single feature.""" arguments = [] for feature in validation.get_features(): # each feature name is a tuple itself and # here we take the last element of this tuple training2 = training.select_feature(feature[-1]) validation2 = validation.select_feature(feature[-1]) argument = (training2, validation2, feature, ) arguments.append(argument) result_list = Parallel(n_jobs=config.FEATURE_RANKING_N_JOBS, backend='multiprocessing')( delayed(_compute_feature_metrics_star)(x) for x in arguments) result = pd.concat(result_list, axis=0) return result def _compute_metrics_for_feature_groups(training, validation): arguments = [] for subgroup in validation.get_subgroups(): # each feature name is a tuple itself and here we take the last # element of this tuple training2 = training.select_subgroup(subgroup[-1]) validation2 = validation.select_subgroup(subgroup[-1]) argument = (training2, validation2, subgroup + ('ALL', ), ) arguments.append(argument) for group in validation.get_groups(): training2 = training.select_group(group) validation2 = validation.select_group(group) argument = (training2, validation2, (group, 'ALL', 'ALL'),) arguments.append(argument) result_list = Parallel(n_jobs=config.FEATURE_RANKING_N_JOBS, backend='multiprocessing')( delayed(_compute_feature_metrics_star)(x) for x in arguments) result = pd.concat(result_list, axis=0) return result # This method is called by multiple processes def _compute_feature_metrics_star(args): return _compute_feature_metrics(*args) # This method is called by multiple processes def _compute_feature_metrics(training, validation, label): _logger.debug("Computing metrics for %s..." % str(label)) index = pd.MultiIndex.from_tuples( [label], names=['Group', 'Subgroup', 'Feature']) _logger.debug("Using random forest...") clf = ensemble.RandomForestClassifier(random_state=1, verbose=0, n_jobs=-1) evaluationutils.fit(clf, training, index) y_pred, y_score = evaluationutils.predict(clf, validation, index) validation_result = evaluationutils.compute_metrics( index, validation.get_metrics_meta(), validation.get_Y(), y_score, y_pred) # computing the feature metrics on the training set is useful for # identifying overfitting training_y_pred, training_y_score = evaluationutils.predict(clf, training, index) training_result = evaluationutils.compute_metrics_for_mask( index, evaluationutils.get_content_mask(training.get_metrics_meta(), 'ALL'), 'ALL', training.get_Y(), training_y_score, training_y_pred) training_result.columns = list(itertools.product( ['TRAINING'], training_result.columns.values)) result = pd.concat([validation_result, training_result], axis=1) return result def _output_sorted_by_auc_pr(time_label, system_name, metrics): """Output the metrics sorted by area under precision-recall curve.""" _logger.debug("output_sorted_by_auc_pr...") metrics.sort_values([('ALL', 'PR')], ascending=False, inplace=True) metrics.to_csv(config.OUTPUT_PREFIX + "_" + time_label + "_" + system_name + "_feature_ranking.csv") latex = metrics.loc[:, evaluationutils.COLUMNS] # latex.reset_index(drop=True, inplace=True) latex.to_latex(config.OUTPUT_PREFIX + "_" + time_label + "_" + system_name + "_feature_ranking.tex", float_format='{:.3f}'.format) n_features = min(9, len(metrics) - 1) selection = metrics.iloc[0:n_features] \ .loc[:, [('ALL', 'Feature'), ('ALL', 'PR')]] _logger.info("Top 10 for all content\n" + (selection.to_string(float_format='{:.4f}'.format))) _logger.debug("output_sorted_by_auc_pr... done.") def _output_sorted_by_group( time_label, system_name, metrics, group_names, subgroup_names): """Output the metrics sorted by group and by PR-AUC within a group.""" _logger.debug('_output_sorted_by_group...') sort_columns = ['_Group', '_Subgroup', '_Order', '_Feature'] ascending_columns = [True, True, False, True] metrics['_Group'] = metrics.index.get_level_values('Group') metrics['_Subgroup'] = metrics.index.get_level_values('Subgroup') metrics['_Feature'] = metrics.index.get_level_values('Feature') subgroup_names = ['ALL'] + subgroup_names # Define the order of groups and subgroups metrics['_Group'] = metrics['_Group'].astype('category').cat.set_categories( group_names, ordered=True) metrics['_Subgroup'] = metrics['_Subgroup'].astype('category').cat.set_categories( subgroup_names, ordered=True) # Sort the features by AUC_PR and make sure the subgroup is always shown # before the single features metrics['_Order'] = metrics[('ALL', 'PR')] # without this line, the following line causes a PerformanceWarning metrics.sort_index(inplace=True) metrics.loc[(metrics['_Feature'] == 'ALL'), '_Order'] = 1.0 metrics.sort_values(by=sort_columns, ascending=ascending_columns, inplace=True) metrics = metrics.drop(sort_columns, axis=1) metrics.to_csv(config.OUTPUT_PREFIX + "_" + time_label + "_" + system_name + "_feature_groups.csv") latex_names = metrics.apply(_compute_latex_name, axis=1) metrics.set_index(latex_names, inplace=True) metrics = evaluationutils.remove_columns(metrics, evaluationutils.CURVES) metrics = evaluationutils.remove_columns(metrics, evaluationutils.STATISTICS) evaluationutils.print_metrics_to_latex( metrics, config.OUTPUT_PREFIX + "_" + time_label + "_" + system_name + "_feature_groups.tex") _logger.debug('_output_sorted_by_group... done.') def _compute_latex_name(row): group = row.name[0] subgroup = row.name[1] feature = row.name[2] # Is group? if subgroup == 'ALL' and feature == 'ALL': result = "\\quad %s" % group # Is subgroup? elif feature == 'ALL': result = "\\quad\quad %s" % subgroup # Is feature? else: result = "\\quad\\quad\\quad %s" % feature return result
8,706
2,598
from struct import unpack, pack from math import ceil, inf, acos, degrees from vectors import Vector3, Triangle, Vector2, Matrix3x3 from re import match UPVECTOR = Vector3(0.0, 1.0, 0.0) FWVECTOR = Vector3(1.0, 0.0, 0.0) SIDEVECTOR = Vector3(0.0, 0.0, 1.0) def round_vector(vector, digits): vector.x = round(vector.x, digits) vector.y = round(vector.y, digits) vector.z = round(vector.z, digits) def read_vertex(v_data): split = v_data.split("/") if len(split) == 3: vnormal = int(split[2]) else: vnormal = None v = int(split[0]) return v#, vnormal def read_uint32(f): val = f.read(0x4) return unpack(">I", val)[0] def read_float_tripple(f): val = f.read(0xC) return unpack(">fff", val) def read_vector3(f): xyz = unpack(">fff", f.read(0xC)) return Vector3(*xyz) def read_float(f): val = f.read(0x4) return unpack(">f", val)[0] def read_uint16(f): return unpack(">H", f.read(2))[0] def write_uint32(f, val): f.write(pack(">I", val)) def write_uint16(f, val): f.write(pack(">H", val)) def write_vector3(f, vector): f.write(pack(">fff", vector.x, vector.y, vector.z)) def write_float(f, val): f.write(pack(">f", val)) def read_obj(objfile): vertices = [] faces = [] face_normals = [] normals = [] floor_type = None smallest_x = smallest_z = biggest_x = biggest_z = None for line in objfile: line = line.strip() args = line.split(" ") if len(args) == 0 or line.startswith("#"): continue cmd = args[0] if cmd == "v": # print(args) for i in range(args.count("")): args.remove("") x, y, z = map(float, args[1:4]) vertices.append((x, y, z)) if smallest_x is None: # Initialize values smallest_x = biggest_x = x smallest_z = biggest_z = z else: if x < smallest_x: smallest_x = x elif x > biggest_x: biggest_x = x if z < smallest_z: smallest_z = z elif z > biggest_z: biggest_z = z elif cmd == "f": # if it uses more than 3 vertices to describe a face then we panic! # no triangulation yet. if len(args) == 5: # raise RuntimeError("Model needs to be triangulated! Only faces with 3 vertices are supported.") v1, v2, v3, v4 = map(read_vertex, args[1:5]) # faces.append(((v1[0] - 1, v1[1]), (v3[0] - 1, v3[1]), (v2[0] - 1, v2[1]))) # faces.append(((v3[0] - 1, v3[1]), (v1[0] - 1, v1[1]), (v4[0] - 1, v4[1]))) faces.append((v1, v2, v3, floor_type)) faces.append((v3, v4, v1, floor_type)) elif len(args) == 4: v1, v2, v3 = map(read_vertex, args[1:4]) # faces.append(((v1[0]-1, v1[1]), (v3[0]-1, v3[1]), (v2[0]-1, v2[1]))) faces.append((v1, v2, v3, floor_type)) else: raise RuntimeError("Model needs to be triangulated! Only faces with 3 or 4 vertices are supported.") # if len(args) != 4: # raise RuntimeError("Model needs to be triangulated! Only faces with 3 vertices are supported.") # v1, v2, v3 = map(read_vertex, args[1:4]) # faces.append((v1, v2, v3, floor_type)) elif cmd == "vn": nx, ny, nz = map(float, args[1:4]) normals.append((nx, ny, nz)) elif cmd == "usemtl": assert len(args) >= 2 matname = " ".join(args[1:]) floor_type_match = match("^(.*?)(0x[0-9a-fA-F]{4})(.*?)$", matname) if floor_type_match is not None: floor_type = int(floor_type_match.group(2), 16) else: floor_type = None # print("Found material:", matname, "Using floor type:", hex(floor_type)) # objects.append((current_object, vertices, faces)) return vertices, faces, normals, (smallest_x, smallest_z, biggest_x, biggest_z) class BoundaryBox(object): def __init__(self): self.start = None self.end = None self.mid = None @classmethod def from_vector(cls, start, end): bbox = cls() bbox.start = start.copy() bbox.end = end.copy() bbox.mid = (bbox.start + bbox.end) / 2.0 return bbox @classmethod def from_file(cls, f): bbox = cls() bbox.start = Vector3(*read_float_tripple(f)) bbox.end = Vector3(*read_float_tripple(f)) return bbox def write(self, f): write_vector3(f, self.start) write_vector3(f, self.end) def size(self): diff = self.end - self.start diff.x = abs(diff.x) diff.y = abs(diff.y) diff.z = abs(diff.z) return diff def scale(self, x, y, z): mid = (self.start + self.end) / 2.0 p1 = self.start - mid p2 = self.end - mid p1.x *= x p1.y *= y p1.z *= z p2.x *= x p2.y *= y p2.z *= z self.start = p1 + mid self.end = p2 + mid def contains(self, triangle): p1, p2, p3 = triangle.origin, triangle.p2, triangle.p3 start, end = self.start, self.end min_x = min(p1.x, p2.x, p3.x)# - self.mid.x max_x = max(p1.x, p2.x, p3.x)# - self.mid.x min_z = min(p1.z, p2.z, p3.z)# - self.mid.z max_z = max(p1.z, p2.z, p3.z)# - self.mid.z if max_x < start.x or min_x > end.x: return False if max_z < start.z or min_z > end.z: return False return True class BJMPTriangle(object): def __init__(self): self._p1_index = None self._p2_index = None self._p3_index = None self.triangle = None self.data = None self.normal = None self.d = 0 self.binormal = None self.tangent = None self.p1 = None self.edge_normal1 = None self.edge_normal1_d = 0 self.p2 = None self.edge_normal2 = None self.edge_normal2_d = 0 self.p3 = None self.edge_normal3 = None self.edge_normal3_d = 0 self.coll_data = 0x100 def is_wall(self, normal): return degrees(acos(normal.cos_angle(Vector3(0.0, 1.0, 0.0)))) > 45 @classmethod def from_triangle(cls, triangle, coll_data=None): tri = cls() tri.triangle = triangle triangle.normal *= -1 round_vector(triangle.normal, 6) tri.coll_data = coll_data tri.normal = triangle.normal if not tri.is_wall(tri.normal): tri.binormal = triangle.normal.cross(FWVECTOR) #*-1 flip = True if tri.binormal.norm() == 0: #tri.binormal = triangle.normal.cross(UPVECTOR) *-1 #flip = True tri.binormal = UPVECTOR.copy() tri.binormal.normalize() tri.tangent = Vector3(0.0, 0.0, 0.0) tri.tangent = triangle.normal.cross(tri.binormal)#*-1 tri.tangent.normalize() if coll_data is None: tri.coll_data = 0x0100 else: tri.binormal = triangle.normal.cross(UPVECTOR) #*-1 flip = True if tri.binormal.norm() == 0: #tri.binormal = triangle.normal.cross(UPVECTOR) *-1 #flip = True tri.binormal = FWVECTOR.copy() tri.binormal.normalize() tri.tangent = Vector3(0.0, 0.0, 0.0) tri.tangent = triangle.normal.cross(tri.binormal)#*-1 tri.tangent.normalize() tri.binormal *= -1 tri.tangent *= -1 if coll_data is None: tri.coll_data = 0x810 #if flip: # tmp = tri.tangent # tri.tangent = tri.binormal*-1 # tri.binormal = tmp#*-1 tri.d = tri.normal.dot(triangle.origin) p1, p2, p3 = triangle.origin, triangle.p2, triangle.p3 #tri.p1 = Vector3(-p1.z, 0, -p1.x) tri.edge_normal1 = (p2-p1).cross(tri.normal) tri.edge_normal1.normalize() #tri.p2 = Vector3(-p2.z, 0, -p2.x) tri.edge_normal2 = (p3-p2).cross(tri.normal) tri.edge_normal2.normalize() tri.edge_normal2_d = tri.edge_normal2.dot(p2) #tri.p3 = Vector3(-p3.z, 0, -p3.x) tri.edge_normal3 = (p1-p3).cross(tri.normal) tri.edge_normal3.normalize() tri.edge_normal3_d = tri.edge_normal3.dot(p3) tri.edge_normal1_d = tri.edge_normal1.dot(p1) nbt = Matrix3x3( tri.binormal.x, tri.binormal.y, tri.binormal.z, tri.normal.x, tri.normal.y, tri.normal.z, tri.tangent.x, tri.tangent.y, tri.tangent.z ) p1 = p1 - tri.normal*tri.d p2 = p2 - tri.normal*tri.d p3 = p3 - tri.normal*tri.d p1 = nbt.multiply_vec3(p1) p2 = nbt.multiply_vec3(p2) p3 = nbt.multiply_vec3(p3) tri.p1 = p1 tri.p2 = p2 tri.p3 = p3 """nbt = Matrix3x3(tri.normal.x, tri.normal.y, tri.normal.z, tri.tangent.x, tri.tangent.y, tri.tangent.z, tri.binormal.x, tri.binormal.y, tri.binormal.z) nbt.transpose() tri.p1 = Vector3(*nbt.multiply_vec3(p1.x, p1.y, p1.z)) tri.p2 = Vector3(*nbt.multiply_vec3(p2.x, p2.y, p2.z)) tri.p3 = Vector3(*nbt.multiply_vec3(p3.x, p3.y, p3.z))""" return tri @classmethod def from_file(cls, f, vertices): tri = cls() start = f.tell() v1, v2, v3 = read_uint16(f), read_uint16(f), read_uint16(f) tri.triangle = Triangle(vertices[v1], vertices[v2], vertices[v3]) tri.normal = Vector3(*read_float_tripple(f)) tri.d = read_float(f) tri.binormal = Vector3(*read_float_tripple(f)) tri.tangent = Vector3(*read_float_tripple(f)) tri.p1 = Vector3(read_float(f), 0, read_float(f)) tri.edge_normal1 = Vector3(*read_float_tripple(f)) tri.edge_normal1_d = read_float(f) tri.p2 = Vector3(read_float(f), 0, read_float(f)) tri.edge_normal2 = Vector3(*read_float_tripple(f)) tri.edge_normal2_d = read_float(f) tri.p3 = Vector3(read_float(f), 0, read_float(f)) tri.edge_normal3 = Vector3(*read_float_tripple(f)) tri.edge_normal3_d = read_float(f) tri.coll_data = read_uint16(f) assert f.tell() - start == 0x78 return tri def fill_vertices(self, vertices: list): try: v1_index = vertices.index(self.triangle.origin) except ValueError: v1_index = len(vertices) vertices.append(self.triangle.origin) try: v2_index = vertices.index(self.triangle.p2) except ValueError: v2_index = len(vertices) vertices.append(self.triangle.p2) try: v3_index = vertices.index(self.triangle.p3) except ValueError: v3_index = len(vertices) vertices.append(self.triangle.p3) self._p1_index = v1_index self._p2_index = v2_index self._p3_index = v3_index def write(self, f): write_uint16(f, self._p1_index) write_uint16(f, self._p2_index) write_uint16(f, self._p3_index) write_vector3(f, self.normal) write_float(f, self.d) write_vector3(f, self.binormal) write_vector3(f, self.tangent) write_float(f, self.p1.x) write_float(f, self.p1.z) write_vector3(f, self.edge_normal1) write_float(f, self.edge_normal1_d) write_float(f, self.p2.x) write_float(f, self.p2.z) write_vector3(f, self.edge_normal2) write_float(f, self.edge_normal2_d) write_float(f, self.p3.x) write_float(f, self.p3.z) write_vector3(f, self.edge_normal3) write_float(f, self.edge_normal3_d) write_uint16(f, self.coll_data) class Group(object): def __init__(self): self._tri_count = 0 self._offset = 0 self.bbox = None self.tri_indices = [] @classmethod def from_file(cls, f): group = cls() val = read_uint32(f) group._tri_count = (val >> 24) & 0xFF group._offset = val & 0xFFFFFF group.bbox = BoundaryBox.from_file(f) return group def read_indices(self, indices): for i in range(self._tri_count): self.tri_indices.append(indices[i+self._offset]) def add_indices(self, indices): self._offset = len(indices) self._tri_count = len(self.tri_indices) for index in self.tri_indices: indices.append(index) def write(self, f): assert self._tri_count <= 0xFF assert self._offset <= 0xFFFFFF write_uint32(f, self._tri_count << 24 | self._offset) self.bbox.write(f) class CollisionGroups(object): def __init__(self): self.bbox = None self.grid_x = 0 self.grid_y = 0 self.grid_z = 0 self.cell_dimensions = None self.cell_inverse = None self.groups = [] #self.indices = [] @classmethod def from_model(cls, model): pass @classmethod def from_file(cls, f): colgroups = cls() colgroups.bbox = BoundaryBox.from_file(f) colgroups.grid_x = read_uint32(f) colgroups.grid_y = read_uint32(f) colgroups.grid_z = read_uint32(f) colgroups.cell_dimensions = read_vector3(f) colgroups.cell_inverse = read_vector3(f) group_count = read_uint32(f) colgroups.groups = [] for i in range(group_count): colgroups.groups.append(Group.from_file(f)) indices = [] index_count = read_uint32(f) for i in range(index_count): indices.append(read_uint16(f)) for group in colgroups.groups: group.read_indices(indices) return colgroups def write(self, f): self.bbox.write(f) write_uint32(f, self.grid_x) write_uint32(f, self.grid_y) write_uint32(f, self.grid_z) write_vector3(f, self.cell_dimensions) write_vector3(f, self.cell_inverse) write_uint32(f, len(self.groups)) indices = [] for group in self.groups: group.add_indices(indices) group.write(f) indices = [] for group in self.groups: indices.extend(group.tri_indices) write_uint32(f, len(indices)) for index in indices: write_uint16(f, index) class BJMP(object): def __init__(self): self.bbox_inner = None self.bbox_outer = None self.triangles = [] self.collision_groups = CollisionGroups() @classmethod def from_obj(cls, f): vertices = [] uvs = [] faces = [] bjmp = cls() collision_type = None smallest_x = smallest_y = smallest_z = biggest_x = biggest_y = biggest_z = None for line in f: line = line.strip() args = line.split(" ") if len(args) == 0 or line.startswith("#"): continue cmd = args[0] if cmd == "v": # print(args) for i in range(args.count("")): args.remove("") x, y, z = map(float, args[1:4]) vertices.append(Vector3(x, y, z)) if smallest_x is None: # Initialize values smallest_x = biggest_x = x smallest_y = biggest_y = y smallest_z = biggest_z = z else: if x < smallest_x: smallest_x = x elif x > biggest_x: biggest_x = x if y < smallest_y: smallest_y = y elif y > biggest_y: biggest_y = y if z < smallest_z: smallest_z = z elif z > biggest_z: biggest_z = z elif cmd == "f": # if it uses more than 3 vertices to describe a face then we panic! # no triangulation yet. if len(args) == 5: # raise RuntimeError("Model needs to be triangulated! Only faces with 3 vertices are supported.") v1, v2, v3, v4 = map(read_vertex, args[1:5]) # faces.append(((v1[0] - 1, v1[1]), (v3[0] - 1, v3[1]), (v2[0] - 1, v2[1]))) # faces.append(((v3[0] - 1, v3[1]), (v1[0] - 1, v1[1]), (v4[0] - 1, v4[1]))) tri1 = Triangle(vertices[v1 - 1], vertices[v3 - 1], vertices[v2 - 1]) tri2 = Triangle(vertices[v3 - 1], vertices[v1 - 1], vertices[v4 - 1]) if tri1.normal.norm() != 0: bjmp_tri1 = BJMPTriangle.from_triangle(tri1, collision_type) bjmp.triangles.append(bjmp_tri1) if tri2.normal.norm() != 0: bjmp_tri2 = BJMPTriangle.from_triangle(tri2, collision_type) bjmp.triangles.append(bjmp_tri2) elif len(args) == 4: v1, v3, v2 = map(read_vertex, args[1:4]) # faces.append(((v1[0]-1, v1[1]), (v3[0]-1, v3[1]), (v2[0]-1, v2[1]))) tri1 = Triangle(vertices[v1 - 1], vertices[v2 - 1], vertices[v3 - 1]) if tri1.normal.norm() != 0: bjmp_tri1 = BJMPTriangle.from_triangle(tri1, collision_type) bjmp.triangles.append(bjmp_tri1) else: raise RuntimeError( "Model needs to be triangulated! Only faces with 3 or 4 vertices are supported.") # if len(args) != 4: # raise RuntimeError("Model needs to be triangulated! Only faces with 3 vertices are supported.") # v1, v2, v3 = map(read_vertex, args[1:4]) # faces.append((v1, v2, v3, floor_type)) elif cmd == "usemtl": assert len(args) >= 2 matname = " ".join(args[1:]) floor_type_match = match("^(.*?)(0x[0-9a-fA-F]{4})(.*?)$", matname) if floor_type_match is not None: collision_type = int(floor_type_match.group(2), 16) else: collision_type = None # print("Found material:", matname, "Using floor type:", hex(floor_type))""" bjmp.bbox_inner = BoundaryBox.from_vector( Vector3(smallest_x, smallest_y, smallest_z), Vector3(biggest_x, biggest_y, biggest_z) ) bjmp.bbox_outer = BoundaryBox.from_vector( bjmp.bbox_inner.start, bjmp.bbox_inner.end ) cell_x = 150.0 cell_z = 150.0 bjmp.collision_groups.bbox = bjmp.bbox_inner bjmp.collision_groups.cell_dimensions = Vector3(cell_x, biggest_y - smallest_y, cell_z) bjmp.collision_groups.cell_inverse = Vector3( 1.0/bjmp.collision_groups.cell_dimensions.x, 1.0/bjmp.collision_groups.cell_dimensions.y, 1.0/bjmp.collision_groups.cell_dimensions.z) x_max = int(ceil((biggest_x - smallest_x) / cell_x)) z_max = int(ceil((biggest_z - smallest_z) / cell_z)) start_x = bjmp.bbox_inner.start.x start_z = bjmp.bbox_inner.start.z bjmp.collision_groups.grid_x = x_max bjmp.collision_groups.grid_y = 1 bjmp.collision_groups.grid_z = z_max for ix in range(x_max): print(ix, "/", x_max) for iz in range(z_max): bbox_x = start_x + ix*cell_x bbox_z = start_z + iz*cell_z bbox = BoundaryBox.from_vector( Vector3(bbox_x, smallest_y, bbox_z), Vector3(bbox_x+cell_x, biggest_y, bbox_z+cell_z) ) group = Group() group.bbox = bbox min_y = inf max_y = -inf for i, triangle in enumerate(bjmp.triangles): if bbox.contains(triangle.triangle): tri = triangle.triangle if tri.origin.y < min_y: min_y = tri.origin.y if tri.p2.y < min_y: min_y = tri.p2.y if tri.p3.y < min_y: min_y = tri.p3.y if tri.origin.y > max_y: max_y = tri.origin.y if tri.p2.y > max_y: max_y = tri.p2.y if tri.p3.y > max_y: max_y = tri.p3.y group.tri_indices.append(i) if min_y < bbox.start.y: bbox.start.y = min_y if max_y > bbox.start.y: bbox.end.y = max_y bbox.start.y -= 5.0 bbox.end.y += 5.0 bjmp.collision_groups.groups.append(group) return bjmp @classmethod def from_file(cls, f): bjmp = cls() magic = read_uint32(f) if magic == 0x013304E6: #self.simple = False bjmp.bbox_inner = BoundaryBox.from_file(f) bjmp.bbox_outer = BoundaryBox.from_file(f) #elif magic == 0x01330237: # self.simple = True # self.bbox = BoundaryBox() else: raise RuntimeError("Unknown/Unsupported magic: {:x}".format(magic)) vertex_count = read_uint16(f) vertices = [] for i in range(vertex_count): vertices.append(read_vector3(f)) bjmp.triangles = [] tri_count = read_uint32(f) for i in range(tri_count): bjmp.triangles.append(BJMPTriangle.from_file(f, vertices)) print("Remaining data starts at {0:x}".format(f.tell())) bjmp.collision_groups = CollisionGroups.from_file(f) assert f.read() == b"" print("sizes") print("x z size:", bjmp.collision_groups.grid_x, bjmp.collision_groups.grid_z) print(bjmp.collision_groups.bbox.size()) print(bjmp.collision_groups.cell_dimensions) return bjmp def write(self, f): write_uint32(f, 0x013304E6) self.bbox_inner.write(f) self.bbox_outer.write(f) vertices = [] for triangle in self.triangles: triangle.fill_vertices(vertices) write_uint16(f, len(vertices)) for vertex in vertices: write_vector3(f, vertex) write_uint32(f, len(self.triangles)) for triangle in self.triangles: triangle.write(f) self.collision_groups.write(f) if __name__ == "__main__": import sys in_name = sys.argv[1] if in_name.endswith(".obj"): out_name = in_name + ".bjmp" with open(in_name, "r") as f: bjmp = BJMP.from_obj(f) with open(out_name, "wb") as f: bjmp.write(f) elif in_name.endswith(".bjmp"): out_name = in_name+".obj" with open(in_name, "rb") as f: bjmp = BJMP.from_file(f) with open(out_name, "w") as f: f.write("# .OBJ generated from Pikmin 2 by Yoshi2's obj2grid.py\n\n") f.write("# VERTICES BELOW\n\n") vertex_counter = 0 faces = [] for btriangle in bjmp.triangles: tri = btriangle.triangle p1, p2, p3 = tri.origin, tri.p2, tri.p3 f.write("v {} {} {}\n".format(p1.x, p1.y, p1.z)) f.write("v {} {} {}\n".format(p2.x, p2.y, p2.z)) f.write("v {} {} {}\n".format(p3.x, p3.y, p3.z)) #f.write("vt {} {}\n".format(btriangle.p1.x, btriangle.p1.z)) #f.write("vt {} {}\n".format(btriangle.p2.x, btriangle.p2.z)) #f.write("vt {} {}\n".format(btriangle.p3.x, btriangle.p3.z)) faces.append((vertex_counter+1, vertex_counter+2, vertex_counter+3, btriangle.coll_data)) vertex_counter += 3 last_coll = None for i1, i2, i3, coll in faces: if coll != last_coll: f.write("usemtl collision_type0x{:04X}\n".format(coll)) f.write("f {0} {2} {1}\n".format(i1, i2, i3)) print("done")
25,470
8,946
#!/usr/bin/env python3 # https://open.kattis.com/problems/integerlists for _ in range(int(input())): p = input() n = int(input()) i, j = 0, n xs = input()[1:-1].split(',') front = True for c in p: if c == 'R': front = not front elif i == j: i += 1 break elif front: i += 1 else: j -= 1 if i > j: print('error') else: if front: print('[' + ','.join(xs[i:j]) + ']') else: print('[' + ','.join(xs[i:j][::-1]) + ']')
585
209
import pytest from django.http import HttpResponse from django.urls import reverse from main.middleware import IpRestrictionMiddleware def dummy_view(_): return HttpResponse(status=200) class TestIpRestrictionMiddleware: def test_middleware_is_enabled(self, client, settings): settings.IP_RESTRICT = True settings.IP_RESTRICT_APPS = ["admin"] settings.IP_SAFELIST_XFF_INDEX = -2 assert client.get(reverse("admin:index")).status_code == 401 def test_applies_to_specified_apps_only(self, rf, settings): """Only apps listed in `settings.IP_WHITELIST_APPS` should be ip restricted""" settings.IP_RESTRICT = True settings.IP_RESTRICT_APPS = ["admin"] settings.IP_SAFELIST_XFF_INDEX = -2 request = rf.get("/") assert IpRestrictionMiddleware(dummy_view)(request).status_code == 200 def test_not_enabled_ifip_restrict_is_false(self, rf, settings): settings.IP_RESTRICT = False settings.IP_RESTRICT_APPS = ["admin"] settings.IP_SAFELIST_XFF_INDEX = -2 request = rf.get(reverse("admin:index"), HTTP_X_FORWARDED_FOR="") assert IpRestrictionMiddleware(dummy_view)(request).status_code == 200 @pytest.mark.parametrize( "xff_header,expected_status", ( ["1.1.1.1, 2.2.2.2, 3.3.3.3", 200], ["1.1.1.1", 401], [ "", 401, ], ), ) def test_x_forwarded_header(self, rf, settings, xff_header, expected_status): settings.IP_RESTRICT = True settings.IP_RESTRICT_APPS = ["admin"] settings.ALLOWED_IPS = ["2.2.2.2"] settings.IP_SAFELIST_XFF_INDEX = -2 request = rf.get(reverse("admin:index"), HTTP_X_FORWARDED_FOR=xff_header) assert IpRestrictionMiddleware(dummy_view)(request).status_code == expected_status @pytest.mark.parametrize( "allowed_ips,expected_status", ([["2.2.2.2"], 200], [["1.1.1.1"], 401]) ) def test_ips(self, rf, settings, allowed_ips, expected_status): settings.IP_RESTRICT = True settings.IP_RESTRICT_APPS = ["admin"] settings.ALLOWED_IPS = allowed_ips settings.IP_SAFELIST_XFF_INDEX = -2 request = rf.get(reverse("admin:index"), HTTP_X_FORWARDED_FOR="1.1.1.1, 2.2.2.2, 3.3.3.3") assert IpRestrictionMiddleware(dummy_view)(request).status_code == expected_status settings.ALLOWED_IPS = ["3.3.3.3"] assert IpRestrictionMiddleware(dummy_view)(request).status_code == 401 @pytest.mark.parametrize( "allowed_ips,expected_status", ([["2.2.2.2"], 200], [["1.1.1.1"], 401]) ) def test_ip_restricted_path(self, rf, settings, allowed_ips, expected_status): settings.IP_RESTRICT = True settings.IP_RESTRICT_PATH_NAMES = ["main:show-bookings"] settings.ALLOWED_IPS = allowed_ips settings.IP_SAFELIST_XFF_INDEX = -2 request = rf.get( reverse("main:show-bookings"), HTTP_X_FORWARDED_FOR="1.1.1.1, 2.2.2.2, 3.3.3.3" ) assert IpRestrictionMiddleware(dummy_view)(request).status_code == expected_status
3,177
1,179
import json import re from urllib.request import urlopen ''' The use of objects has various benefits. 1. Better control of context 2. State that can be evaluated 3. Data can be created and then processing can be added 4. Clean interface ''' class TopicSummarizer(): """TopicSummarizer - Summarizes a wikipedia entry Returns: str: [Summary of entry] """ TEXT_URL_TMP = 'https://en.wikipedia.org/w/api.php?action=query&prop=extracts&exsentences=2&titles={title}&format=json' THUMB_URL_TMP = 'https://en.wikipedia.org/w/api.php?action=query&prop=pageimages&titles={title}&format=json' def __init__(self, topic): self.topic = str(topic) def process(self): self._fetch_text() self._fetch_thumbnail() return self def get_results(self, as_text=False): if as_text: return self.topic + ' summary: ' + self._text return TopicSummary(self.topic, self._thumb_url, self._text) def _fetch_text(self): self._text_api_url = self.TEXT_URL_TMP.format(title=self.topic) self._text_resp = self._get_url_json(self._text_api_url) self._text = list(self._text_resp['query']['pages'].values())[ 0]['extract'] def _fetch_thumbnail(self): self._thumb_api_url = self.THUMB_URL_TMP.format(title=self.topic) self._thumb_resp = self._get_url_json(self._thumb_api_url) self._thumb_url = list(self._thumb_resp['query']['pages'].values())[0][ 'thumbnail']['source'] def _get_url_json(self, url): resp = urlopen(url) resp_body = resp.read() return json.loads(resp_body) class TopicSummary(): def __init__(self, topic, thumb_url, text): self.topic = topic self.thumb_url = thumb_url self.text = re.sub(r'</*.>', '', text) def __repr__(self): cn = self.__class__.__name__ return '%s(%r, %r, %r)' % (cn, self.topic, self.thumb_url, self.text) def main(): from argparse import ArgumentParser prs = ArgumentParser(description='summarize topics from Wikipedia') prs.add_argument('-t', '--topic', help='the target topic', required='True') args = prs.parse_args() print(TopicSummarizer(args.topic).process().get_results(as_text=True)) return if __name__ == '__main__': main()
2,418
846
import pandas as pd import numpy as np import json from simpletransformers.classification import ClassificationModel, ClassificationArgs import sklearn from sklearn.model_selection import train_test_split import torch import re import matplotlib.pyplot as plt import matplotlib.ticker as ticker import os from tqdm import tqdm np.random.seed(2) # import the data # tweets = pd.read_csv('data/postIR_final.csv') # os.chdir('..') tweets = pd.read_csv('D:/Dropbox/Twitter/training_data/training_final.csv', encoding='latin1') # restrict to tweets with coding tweets = tweets[tweets['uncivil_final'].isin([0,1])] # subset to just text and labels, fix columns names tweets = tweets.loc[:, ['text', 'uncivil_final']] tweets.columns = ['text', 'labels'] # import other batch mike = pd.read_excel(r'D:\Dropbox\wandering-pole\wanderingpole\data\new_pull_Michael.xls') mike = mike[['full_text', 'uncivil']] mike = mike.rename(columns={'full_text': 'text', 'uncivil': 'labels'}) # extra mike_extra = pd.read_csv(r'D:\Dropbox\wandering-pole\wanderingpole\data\michael_extra.csv') mike_extra = mike_extra.rename(columns={'full_text': 'text', 'uncivil': 'labels'}) # pull a bunch of old 0's old_model = pd.read_csv("D:/Dropbox/Twitter/allMCtweets.csv", encoding='latin1') old_0 = old_model[old_model['polarizing']==0].sample(7432, random_state=619) old_0 = old_0[['text']] old_0['labels'] = 0 # combine the new data tweets = pd.concat([tweets, mike, mike_extra, old_0]) # drop incomplete data tweets = tweets[tweets['labels'].isin([0,1])] # drop duplicates tweets = tweets.drop_duplicates(subset=['text']) # delete links # TODO: convert emoticons re_url = r"(?i)\b((?:https?://|www\d{0,3}[.]|[a-z0-9.\-]+[.][a-z]{2,4}/)(?:[^\s()<>]+|\(([^\s()<>]+|(\([^\s()<>]+\)))*\))+(?:\(([^\s()<>]+|(\([^\s()<>]+\)))*\)|[^\s`!()\[\]{};:'\".,<>?«»“”‘’]))" tweets['text'] = tweets['text'].replace(re_url, '', regex=True) # remove retweet header re_retweet = r"RT\s@\w+:" tweets['text'] = tweets['text'].replace(re_retweet, '', regex=True) # double-check for weird excel handling of ampersand re_amp = r'&amp;' tweets['text'] = tweets['text'].replace(re_amp, '', regex=True) # split train/test # tweets.loc[: , 'split'] = np.random.choice(['train','validate','test'], len(tweets), p=[.85, .15]) # train = tweets.loc[tweets.split=='train'] # validate = tweets.loc[tweets.split=='validate'] # test = tweets.loc[tweets.split=='test'] tweets.loc[: , 'split'] = np.random.choice(['train','test'], len(tweets), p=[.85, .15]) train = tweets.loc[tweets.split=='train'] test = tweets.loc[tweets.split=='test'] # build / train # weights counts = train['labels'].value_counts().sort_index() weights = [(1-(ii/len(train)))*10 for ii in counts] model_args = ClassificationArgs() # model_args.use_early_stopping = True # model_args.early_stopping_delta = 0.01 # model_args.early_stopping_metric = "mcc" # model_args.early_stopping_metric_minimize = False # model_args.early_stopping_patience = 5 # model_args.evaluate_during_training_verbose = True # model_args.evaluate_during_training_steps = 1000 model_args.output_dir = r'Model_berttweet/' model_args.cache_dir = r'Model_berttweet/' model_args.overwrite_output_dir = True model_args.training_batch_size = 1024 model_args.eval_batch_size = 1024 model_args.num_train_epochs = 5 model = ClassificationModel( 'bertweet' , 'vinai/bertweet-base' , num_labels=len(tweets['labels'].unique()) # , weight=weights # DO help , weight=[.8,10] , use_cuda=True , args=model_args ) model.train_model(train) # Evaluate the model # model = ClassificationModel('bertweet' # , 'Model_berttweet/' # , num_labels=2 # , args={'eval_batch_size':512}) result, model_outputs, wrong_predictions = model.eval_model(test) y_t = list(test.labels) y_hat = [np.argmax(a) for a in model_outputs] print(sklearn.metrics.classification_report(y_true=y_t, y_pred=y_hat)) sklearn.metrics.confusion_matrix(y_true=y_t, y_pred=y_hat) # put out the results test.loc[:, 'predicted'] = y_hat
4,154
1,596
#!/usr/bin/env python3 """ A module that defines any general purpose functions used by all scripts, including loading configuration files, connecting to the database, and handling Twitch's timestamp formats. """ import json import sqlite3 from datetime import datetime from typing import Tuple, Union #################################################################################################### class CommonConfig(): # From the config file. json_config: dict client_id: str access_token: str database_filename: str def __init__(self): with open('config.json') as file: self.json_config = json.load(file) self.__dict__.update(self.json_config['common']) def connect_to_database(self) -> sqlite3.Connection: db = sqlite3.connect(self.database_filename, isolation_level=None) db.row_factory = sqlite3.Row db.execute('''PRAGMA journal_mode = WAL;''') db.execute('''PRAGMA synchronous = NORMAL;''') db.execute('''PRAGMA temp_store = MEMORY;''') db.execute(''' CREATE TABLE IF NOT EXISTS 'Channel' ( 'Id' INTEGER NOT NULL PRIMARY KEY AUTOINCREMENT, 'Name' VARCHAR(50) NOT NULL UNIQUE ); ''') db.execute(''' CREATE TABLE IF NOT EXISTS 'Video' ( 'Id' INTEGER NOT NULL PRIMARY KEY AUTOINCREMENT, 'ChannelId' INTEGER NOT NULL, 'TwitchId' VARCHAR(50) NOT NULL UNIQUE, 'Title' TEXT NOT NULL, 'CreationTime' TIMESTAMP NOT NULL, 'Duration' TIME NOT NULL, 'YouTubeId' VARCHAR(50) UNIQUE, 'Notes' TEXT, FOREIGN KEY (ChannelId) REFERENCES Channel (Id) ); ''') # VideoId can be NULL when we're storing messages from a live stream, meaning there's no VOD yet. db.execute(''' CREATE TABLE IF NOT EXISTS 'Chat' ( 'Id' INTEGER NOT NULL PRIMARY KEY AUTOINCREMENT, 'ChannelId' INTEGER NOT NULL, 'VideoId' INTEGER, 'Timestamp' TIMESTAMP NOT NULL, 'Message' TEXT NOT NULL, FOREIGN KEY (ChannelId) REFERENCES Channel (Id), FOREIGN KEY (VideoId) REFERENCES Video (Id) ); ''') return db #################################################################################################### def split_twitch_duration(duration: str) -> Tuple[int, int, int, int]: # Duration format: 00h00m00s or 00m00s duration = duration.replace('h', ':').replace('m', ':').replace('s', '') tokens = duration.split(':', 2) hours = int(tokens[-3]) if len(tokens) >= 3 else 0 minutes = int(tokens[-2]) if len(tokens) >= 2 else 0 seconds = int(tokens[-1]) if len(tokens) >= 1 else 0 total_seconds = hours * 3600 + minutes * 60 + seconds return hours, minutes, seconds, total_seconds def convert_twitch_timestamp_to_datetime(timestamp: str) -> datetime: # Datetime format: YYYY-MM-DDThh:mm:ss.sssZ # Where the following precisions where observed: # - YYYY-MM-DDThh:mm:ss.sssssssssZ # - YYYY-MM-DDThh:mm:ss.ssZ # - YYYY-MM-DDThh:mm:ss.sZ # - YYYY-MM-DDThh:mm:ssZ # Truncate anything past the microsecond precision. if '.' in timestamp: microseconds: Union[str, int] beginning, microseconds = timestamp.rsplit('.', 1) microseconds, _ = microseconds.rsplit('Z', 1) timestamp = beginning + '.' + microseconds[:6].ljust(6, '0') + 'Z' timestamp = timestamp.replace('Z', '+00:00') return datetime.fromisoformat(timestamp)
3,339
1,313
from unidecode import unidecode from unicodedata import name import ftfy for i in range(33, 65535): if i > 0xEFFFF: continue # Characters in Private Use Area and above are ignored if 0xD800 <= i <= 0xDFFF: continue h = hex(i) u = chr(i) f = ftfy.fix_text(u, normalization="NFKC") a = unidecode(u) if a != "[?]" and len(u) != 0 and len(a) != 0 and len(f) != 0: new_char = "" if u != f: for c in list(f): new_char += "{}, ".format(ord(c)) new_char = new_char[:-2] else: new_char = "Same" try: txt = name(u).lower() # print(txt) if 'mark' in txt: print( f"dec={i} hex={h} unicode_chr={u} ftfy_chr(s)={f} ftfy_dec={new_char}\n", f"ascii_chr={a} uni_len={len(u)} ascii_len={len(a)} unicode_name={name(u)}" ) except ValueError: pass
986
361
import dash_bootstrap_components as dbc from dash import html from app import app layout = dbc.Container( children=[ dbc.Card([ #dbc.CardHeader("EURONEWS (União Européia)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/sPgqEHsONK8?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("SKY NEWS (Reino Unido)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/9Auq9mYxFEE?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("FRANCE 24 (França)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/u9foWyMSATM?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("DEUTSCH WELLE (Alemanha)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/m01az_TdpQI?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("RT (Rússia)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://odysee.com/$/embed/RTlivestream/8c06ebe369b6ecf6ad383e4a32bfca34c0168d79?r=RfLjh5uDhbZHt8SDkQFdZyKTmCbSCpWH&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("TRT WORLD (Turquia)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/CV5Fooi8YJA?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("AL JAZEERA (Catar)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/F-POY4Q0QSI?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("NDTV (India)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/WB-y7_ymPJ4?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("CGTN EUROPE (China)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/FGabkYr-Sfs?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("ANN NEWS (Japão)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/coYw-eVU0Ks?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("NEWS 12 NEW YORK (Estados Unidos)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/RmmRlztXETI?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), dbc.Card([ #dbc.CardHeader("WEBCAM UCRÂNIA (Ao Vivo)"), dbc.CardBody([html.Iframe(className="ytvid", width="420", height="315", src="https://www.youtube.com/embed/3hiyVq44pK8?&autoplay=1&mute=1", allow="fullscreen")]), ], className="cardSize-vid"), html.Div(dbc.Badge(children=[ html.Span("* Todos os vídeos são transmitidos pelo "), html.A(href='http://www.youtube.com', target='new', children='YouTube'), html.Span(" exceto o canal RT, transmitido pelo "), html.A(href='http://www.odysee.com', target='new', children='Odysee'), html.Span(" .") ], className="badge-link", )) ], fluid=True ) def get(): return html.Div(layout) ''' RT RUSSIA https://rumble.com/embed/vtp5hp/?pub=4&autoplay=2 https://odysee.com/$/embed/RTlivestream/8c06ebe369b6ecf6ad383e4a32bfca34c0168d79?r=RfLjh5uDhbZHt8SDkQFdZyKTmCbSCpWH '''
4,363
1,658
# -*- coding: utf-8 -*- """ ~~~~~~~~~~~~~~~~~~~~~~ main module #author guoweikuang """ from flask import render_template from flask import redirect from flask import url_for from flask import request from flask_login import login_required from pyecharts import Bar from pyecharts.utils import json_dumps #from pyecharts import json_dumps import json from . import weibo from .forms import CrawlForm from .forms import AnalyzeForm from app import run_async_crawl from app import run_build_vsm from ..utils import filter_data from ..utils import run_k_means from ..utils import classify_k_cluster from ..utils import get_mysql_content from ..utils import get_mysql_opinion from ..utils import run_old_all_process from ..utils import get_max_hot_keyword_chart from ..utils import list_top_hot_topic from ..utils import get_hot_text_from_category from ..utils import bar_chart REMOTE_HOST = "https://pyecharts.github.io/assets/js" @weibo.route('/', methods=['GET', 'POST']) def index(): """ 首页 """ rows = list_top_hot_topic(db=1) category = request.values.get('topic') categorys = [cate[0] for cate in rows] results = [] if category: categorys.remove(category) categorys.insert(0, category) results = get_hot_text_from_category(category, db=0) else: category = categorys[0] results = get_hot_text_from_category(category, db=0) print(results) return render_template('weibo/index.html', rows=rows, categorys=categorys, contents=results) @weibo.route('/crawl', methods=['GET', 'POST']) @login_required def crawl(): """ 爬取模块 """ crawl_form = CrawlForm() result = get_mysql_content(days=1) if crawl_form.validate_on_submit(): result = run_async_crawl(start_page=crawl_form.start_page.data, end_page=crawl_form.end_page.data) return redirect(url_for('weibo.crawl')) return render_template('weibo/crawl.html', form=crawl_form, results=result) @weibo.route('/analyze', methods=['GET', 'POST']) @login_required def analyze(): """ 聚类分析 :return: """ analyze_form = AnalyzeForm() if analyze_form.validate_on_submit(): k = analyze_form.k_cluster.data run_old_all_process(start_time=analyze_form.start_time.data, end_time=analyze_form.end_time.data, k=analyze_form.k_cluster.data) #datas = run_build_vsm(start_time=analyze_form.start_time.data, # end_time=analyze_form.end_time.data) #labels = run_k_means(k=k) #classify_k_cluster(labels=labels, datas=datas) return redirect(url_for("weibo.display")) return render_template('weibo/analyze.html', form=analyze_form) @weibo.route('/display', methods=['GET', 'POST']) @login_required def display(): """ 图表展示. :return: """ result = {} keywords, img_name, rows, category = get_max_hot_keyword_chart(db=1) name = "images/%s/%s" % (category, img_name) results = sorted(keywords.items(), key=lambda d: d[1], reverse=True)[::-1] keywords = [key.decode('utf-8') for key, value in results] rows = [row.split('\t') for row in rows] return render_template('weibo/display.html', img_name=name, keywords=keywords, rows=rows) @weibo.route('/sensitive', methods=['GET', 'POST']) @login_required def sensitive(): """ 敏感词. :return: """ results = get_mysql_opinion() opinion = ['心理健康', '社会突发事件', '校园安全', '反动言论'] sen_type = request.values.get("category") if sen_type: opinion.remove(sen_type) opinion.insert(0, sen_type) rows = results[sen_type] else: rows = results[opinion[0]] return render_template('weibo/sensitive.html', rows=rows, categorys=opinion) @weibo.route('/pyecharts', methods=['GET', 'POST']) @login_required def show_chart(): """ test chart. :return: """ bar = bar_chart() return render_template('pyecharts.html', chart_id=bar.chart_id, host=REMOTE_HOST, my_width='100%', my_height=600, my_option=json_dumps(bar.options), script_list=bar.get_js_dependencies())
4,387
1,472
#!/usr/bin/env python # (C) Copyright IBM Corporation 2004 # All Rights Reserved. # # Permission is hereby granted, free of charge, to any person obtaining a # copy of this software and associated documentation files (the "Software"), # to deal in the Software without restriction, including without limitation # on the rights to use, copy, modify, merge, publish, distribute, sub # license, and/or sell copies of the Software, and to permit persons to whom # the Software is furnished to do so, subject to the following conditions: # # The above copyright notice and this permission notice (including the next # paragraph) shall be included in all copies or substantial portions of the # Software. # # THE SOFTWARE IS PROVIDED "AS IS", WITHOUT WARRANTY OF ANY KIND, EXPRESS OR # IMPLIED, INCLUDING BUT NOT LIMITED TO THE WARRANTIES OF MERCHANTABILITY, # FITNESS FOR A PARTICULAR PURPOSE AND NON-INFRINGEMENT. IN NO EVENT SHALL # IBM AND/OR ITS SUPPLIERS BE LIABLE FOR ANY CLAIM, DAMAGES OR OTHER # LIABILITY, WHETHER IN AN ACTION OF CONTRACT, TORT OR OTHERWISE, ARISING # FROM, OUT OF OR IN CONNECTION WITH THE SOFTWARE OR THE USE OR OTHER DEALINGS # IN THE SOFTWARE. # # Authors: # Ian Romanick <idr@us.ibm.com> # # $XFree86: xc/extras/Mesa/src/mesa/glapi/gl_offsets.py,v 1.2 2006/05/16 15:34:46 tsi Exp $ from xml.sax import saxutils from xml.sax import make_parser from xml.sax.handler import feature_namespaces import gl_XML import license import sys, getopt class PrintGlOffsets(gl_XML.FilterGLAPISpecBase): name = "gl_offsets.py (from Mesa)" def __init__(self): gl_XML.FilterGLAPISpecBase.__init__(self) self.license = license.bsd_license_template % ( \ """Copyright (C) 1999-2001 Brian Paul All Rights Reserved. (C) Copyright IBM Corporation 2004""", "BRIAN PAUL, IBM") def printFunction(self, f): if f.fn_offset < 0: return print '#define _gloffset_%s %d' % (f.name, f.fn_offset) def printRealHeader(self): print '#ifndef _GLAPI_OFFSETS_H_' print '#define _GLAPI_OFFSETS_H_' print '' return def printRealFooter(self): print '' print '#endif' return def show_usage(): print "Usage: %s [-f input_file_name]" % sys.argv[0] sys.exit(1) if __name__ == '__main__': file_name = "gl_API.xml" try: (args, trail) = getopt.getopt(sys.argv[1:], "f:") except Exception,e: show_usage() for (arg,val) in args: if arg == "-f": file_name = val dh = PrintGlOffsets() parser = make_parser() parser.setFeature(feature_namespaces, 0) parser.setContentHandler(dh) f = open(file_name) dh.printHeader() parser.parse(f) dh.printFooter()
2,598
1,005
from __future__ import division class Rational(object): def __init__(self, numer, denom): if denom == 0: raise ValueError('denom should not be 0') i = 2 while i <= abs(numer): if numer % i == 0 and denom % i == 0: numer = numer // i denom = denom // i else: i += 1 if numer * denom < 0: self.numer = -abs(numer) self.denom = abs(denom) else: self.numer = abs(numer) self.denom = abs(denom) def __eq__(self, other): if self.numer == 0 and other.numer == 0: return True return self.numer == other.numer and self.denom == other.denom def __repr__(self): return '{}/{}'.format(self.numer, self.denom) def __add__(self, other): return Rational(self.numer * other.denom + other.numer * self.denom, self.denom * other.denom) def __sub__(self, other): return Rational(self.numer * other.denom - other.numer * self.denom, self.denom * other.denom) def __mul__(self, other): return Rational(self.numer * other.numer, self.denom * other.denom) def __truediv__(self, other): if self.denom * other.numer != 0: return Rational(self.numer * other.denom, self.denom * other.numer) else: raise ValueError() def __abs__(self): return Rational(abs(self.numer), abs(self.denom)) def __pow__(self, power): return Rational(self.numer ** power, self.denom ** power) if power > 0 else Rational(self.denom ** -power, self.numer ** -power) def __rpow__(self, base): return base ** (self.numer / self.denom)
1,728
549
from django import forms from crispy_forms.helper import FormHelper from crispy_forms.layout import Layout, Div, Submit, HTML, Button, Row, Field from crispy_forms.bootstrap import AppendedText, PrependedText, FormActions from webui.dataforj import get_flow class SelectedStepForm(forms.Form): step_name = forms.CharField(label='Step name', max_length=100) class AddSourceForm(forms.Form): step_name = forms.CharField(label='Step name', max_length=100) step_description = forms.CharField(label='Step description') uri = forms.CharField(label='URI, i.e. location of the source data') format_type = forms.CharField(label='Format of the data (e.g. CSV, Parquet, etc)') options_text = forms.CharField(widget=forms.Textarea, required=False, label='Options seperated by newlines in the form k=v, e.g. delimiter=True') helper = FormHelper() helper.form_class = 'form-horizontal' helper.layout = Layout( Field('step_name', css_class='input-xlarge'), Field('step_description', css_class='input-xlarge'), Field('uri', css_class='input-xlarge'), Field('format_type', css_class='input-xlarge'), Field('options_text', css_class='input-xlarge'), FormActions( Submit('new', 'Add Sournce', css_class="btn-primary") ) ) class AddChildForm(forms.Form): CHOICES=[ ('sql', 'SQL'), ('pyspark', 'PySpark'), ('union', 'Union'), ('sink', 'Sink') ] step_type = forms.ChoiceField(label='Choose the type of step you wish to create', choices=CHOICES, widget=forms.RadioSelect) helper = FormHelper() helper.form_class = 'form-horizontal' helper.layout = Layout( Field('step_type', css_class='input-xlarge') ) def create_dependson_tuple(flow): depends_on_list=[step.name for step in flow._steps.values() if step.dagre_type != 'Sink'] return tuple((name, name) for name in depends_on_list) class AddSinkForm(forms.Form): step_name = forms.CharField(label='Step name', max_length=100) step_description = forms.CharField(label='Step description') depends_ons = forms.ChoiceField(label='Which step should become input for this one', choices=[]) uri = forms.CharField(label='URI, i.e. location of the source data') format_type = forms.CharField(label='Format of the data (e.g. CSV, Parquet, etc)') mode = forms.CharField(label='Mode (e.g. overwrite)') options_text = forms.CharField(widget=forms.Textarea, label='Options seperated by newlines in the form k=v, e.g. delimiter=True', required=False) helper = FormHelper() helper.form_class = 'form-horizontal' helper.layout = Layout( Field('step_type', css_class='input-xlarge'), Field('step_name', css_class='input-xlarge'), Field('step_description', css_class='input-xlarge'), Field('depends_ons', rows="3", css_class='input-xlarge'), Field('uri', css_class='input-xlarge'), Field('format_type', css_class='input-xlarge'), Field('mode', css_class='input-xlarge'), Field('options_text', css_class='input-xlarge') ) def __init__(self, *args, **kwargs): flow = kwargs.pop('flow') super(AddSinkForm, self).__init__(*args, **kwargs) self.fields['depends_ons'].choices = create_dependson_tuple(flow) class AddUnionForm(forms.Form): step_name = forms.CharField(label='Step name', max_length=100) step_description = forms.CharField(label='Step description') depends_ons = forms.MultipleChoiceField(label='Which steps should become input for this one', choices=[]) helper = FormHelper() helper.form_class = 'form-horizontal' helper.layout = Layout( Field('step_type', css_class='input-xlarge'), Field('step_name', css_class='input-xlarge'), Field('step_description', css_class='input-xlarge'), Field('depends_ons', rows="3", css_class='input-xlarge') ) def __init__(self, *args, **kwargs): flow = kwargs.pop('flow') super(AddUnionForm, self).__init__(*args, **kwargs) self.fields['depends_ons'].choices = create_dependson_tuple(flow) class AddSqlForm(forms.Form): step_name = forms.CharField(label='Step name', max_length=100) step_description = forms.CharField(label='Step description') depends_ons = forms.MultipleChoiceField(label='Which steps should become input for this one', choices=[]) sql_file_path = forms.CharField(label='Location where the SQL code will be stored') helper = FormHelper() helper.form_class = 'form-horizontal' helper.layout = Layout( Field('step_type', css_class='input-xlarge'), Field('step_name', css_class='input-xlarge'), Field('step_description', css_class='input-xlarge'), Field('depends_ons', rows="3", css_class='input-xlarge'), Field('sql_file_path', css_class='input-xlarge') ) def __init__(self, *args, **kwargs): flow = kwargs.pop('flow') super(AddSqlForm, self).__init__(*args, **kwargs) self.fields['depends_ons'].choices = create_dependson_tuple(flow) class AddPySparkForm(forms.Form): step_name = forms.CharField(label='Step name', max_length=100) step_description = forms.CharField(label='Step description') depends_ons = forms.MultipleChoiceField(label='Which steps should become input for this one', choices=[]) pyspark_file_path = forms.CharField(label='Location where the PySpark code will be stored') helper = FormHelper() helper.form_class = 'form-horizontal' helper.layout = Layout( Field('step_type', css_class='input-xlarge'), Field('step_name', css_class='input-xlarge'), Field('step_description', css_class='input-xlarge'), Field('depends_ons', rows="3", css_class='input-xlarge'), Field('pyspark_file_path', css_class='input-xlarge') ) def __init__(self, *args, **kwargs): flow = kwargs.pop('flow') super(AddPySparkForm, self).__init__(*args, **kwargs) self.fields['depends_ons'].choices = create_dependson_tuple(flow)
6,269
1,918
import logging from c8ydp.device_proxy import DeviceProxy, WebSocketFailureException from threading import Thread import threading from c8yMQTT import C8yMQTT import concurrent.futures import os logging.basicConfig(level=logging.INFO,format='%(asctime)s %(name)s %(message)s') logger = logging.getLogger(__name__) def setCommandExecuting(command): logger.info('Setting command: '+ command + ' to executing') c8y.publish('c8y/s/us','501,'+command) def setCommandSuccessfull(command): logger.info('Setting command: '+ command + ' to successful') c8y.publish('c8y/s/us','503,'+command) def setCommandFailed(command,errorMessage): logger.info('Setting command: '+ command + ' to failed cause: ' +errorMessage) c8y.publish('c8y/s/us','502,'+command+','+errorMessage) def on_message(client, obj, msg): message = msg.payload.decode('utf-8') logger.debug("Message Received: " + msg.topic + " " + str(msg.qos) + " " + message) if message.startswith('71'): fields = message.split(",") c8y.token = fields[1] logger.info('New JWT Token received') if message.startswith('530'): fields = message.split(",") tcp_host = fields[2] tcp_port = int(fields[3]) connection_key = fields[4] c8y.logger.info('Received Remote Connect.') setCommandExecuting('c8y_RemoteAccessConnect') with concurrent.futures.ThreadPoolExecutor() as executor: future = executor.submit(remoteConnect,tcp_host,tcp_port,connection_key,'https://'+url ) return_value = future.result() c8y.logger.info('Remote Connect Result:' + return_value) if return_value.startswith('success'): setCommandSuccessfull('c8y_RemoteAccessConnect') else: setCommandFailed('c8y_RemoteAccessConnect',return_value) def remoteConnect( tcp_host,tcp_port,connection_key,base_url): try: c8y.logger.info('Starting Remote to: ' + str(tcp_host) + ':' + str(tcp_port) + ' Key: ' + str(connection_key) + ' url: ' + str(base_url)) devProx = DeviceProxy( tcp_host, tcp_port, None, connection_key, base_url, None, None, c8y.token ) devProx.connect() logger.info('Remote Connection successfull finished') return 'success' except Exception as e: logger.error('Remote Connection error:' + str(e)) return str(e) stream = os.popen('sudo tedge config get c8y.url') url=stream.read().strip() logger.info('Got tenant URL: '+ url) c8y = C8yMQTT('remote_connect','localhost',1883,'c8y/s/ds,c8y/s/e,c8y/s/dt,c8y/s/dat') connected = c8y.connect(on_message) logger.info('Connection Result:' + str(connected)) if connected != 0: logger.error('Connection not possible: ' + str(connected)) exit() c8y.publish("c8y/s/us", "114,c8y_RemoteAccessConnect")
3,109
960
from context import fe621 import numpy as np import pandas as pd def convergenceSegmentLimit(): """Function to compute the number of segments required for convergence of various quadrature methods. """ # Objective function def f(x: float) -> float: return np.where(x == 0.0, 1.0, np.sin(x) / x) # Setting target tolerance level for termination epsilon = 1e-3 # Using Trapezoidal rule trapezoidal_result = fe621.numerical_integration.convergenceApproximation( f=f, rule=fe621.numerical_integration.trapezoidalRule, epsilon=epsilon ) # Using Simpson's rule simpsons_result = fe621.numerical_integration.convergenceApproximation( f=f, rule=fe621.numerical_integration.simpsonsRule, epsilon=epsilon ) # Building DataFrame of results for output results = pd.DataFrame(np.abs(np.array([trapezoidal_result, simpsons_result]))) # Setting row and column names results.columns = ['Estimated Area', 'Segments'] results.index = ['Trapezoidal Rule', 'Simpson\'s Rule'] # Saving to CSV results.to_csv('Homework 1/bin/numerical_integration/convergence.csv', header=True, index=True, float_format='%.8e') if __name__ == '__main__': # Part 3 - Convergence Analysis convergenceSegmentLimit()
1,397
439