Upload 963 files to main/part_1
Browse filesThis view is limited to 50 files because it contains too many changes.
See raw diff
- main/part_1/0001978655.json +0 -0
- main/part_1/0012715636.json +1 -0
- main/part_1/0013398492.json +1 -0
- main/part_1/0019514223.json +1 -0
- main/part_1/0019949525.json +1 -0
- main/part_1/0026425970.json +1 -0
- main/part_1/0029715605.json +1 -0
- main/part_1/0031737557.json +1 -0
- main/part_1/0033175946.json +1 -0
- main/part_1/0034525050.json +1 -0
- main/part_1/0084992922.json +1 -0
- main/part_1/0094800866.json +1 -0
- main/part_1/0100812993.json +1 -0
- main/part_1/0118388746.json +0 -0
- main/part_1/0125371546.json +1 -0
- main/part_1/0126091183.json +1 -0
- main/part_1/0134164822.json +1 -0
- main/part_1/0153741266.json +1 -0
- main/part_1/0157555120.json +1 -0
- main/part_1/0160857256.json +1 -0
- main/part_1/0161698066.json +1 -0
- main/part_1/0171688219.json +1 -0
- main/part_1/0181929682.json +1 -0
- main/part_1/0187955475.json +1 -0
- main/part_1/0193560733.json +1 -0
- main/part_1/0197854021.json +1 -0
- main/part_1/0202714818.json +1 -0
- main/part_1/0207484609.json +1 -0
- main/part_1/0213614304.json +1 -0
- main/part_1/0232126720.json +1 -0
- main/part_1/0260254978.json +1 -0
- main/part_1/0269590882.json +1 -0
- main/part_1/0271320117.json +1 -0
- main/part_1/0279513662.json +1 -0
- main/part_1/0286660257.json +1 -0
- main/part_1/0287641622.json +1 -0
- main/part_1/0290253354.json +1 -0
- main/part_1/0305748262.json +1 -0
- main/part_1/0316450659.json +1 -0
- main/part_1/0326233398.json +0 -0
- main/part_1/0339629449.json +1 -0
- main/part_1/0342535474.json +1 -0
- main/part_1/0348508643.json +1 -0
- main/part_1/0356205822.json +1 -0
- main/part_1/0363072903.json +1 -0
- main/part_1/0389132748.json +1 -0
- main/part_1/0407348078.json +1 -0
- main/part_1/0414550376.json +1 -0
- main/part_1/0425122559.json +1 -0
- main/part_1/0439655938.json +1 -0
main/part_1/0001978655.json
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
main/part_1/0012715636.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"6e18f791e5588104e138f5380fec2db2","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/69b01eb7-92ae-4b91-a4c1-e4816458ad26/retrieve","id":"-1347278771"},"keywords":[],"sieverID":"31702f7f-9272-433a-941a-4005e00d290c","content":"Estimates of Food Loss and Waste, associated GHG emissions, nutritional losses, land use and water footprints Food loss Solutions 1 In this document hotspots are defined as food products or food (sub) categories, eventually in combination with a supply chain link, that show the highest scores with respect to a selected (sub)set of sustainability indicators: FLW, GHGEs, nutrition, land use and water footprint.Theoretically, the world produces enough food to nourish the growing world population. Although precise data remains scarce, according to most recent studies, globally each year possibly as much as 30 per cent of the food produced is being lost or wasted somewhere between farm and fork.This not only represents a threat to food security but also severely and negatively impacts our food systems and natural resources. Food Loss and Waste (FLW) accounts for around 8 to 10 percent of our global Greenhouse Gas Emissions (GHGEs). Approximately a quarter of all freshwater used by agriculture is associated to the lost and wasted food. 4.4 million km² of land is used to grow food which is lost or wasted (FAO, 2019;WWF, 2021;Guo et al., 2020). The Sustainable Development Goal (SDG) Target 12.3 calls to 'halve per capita global food waste at the retail and consumer levels and reduce food losses along production and supply chains, including post-harvest losses' (Lipinski, B. 2022). With only 7 years to go, the world is far from being on track to achieve this target.The UN and the Champions 12.3 Coalition launched the 'Target-Measure-Act approach' calling on all governments and companies to set FLW reduction targets, measure FLW, identify hotspots 1 , and to take action to reduce FLW accordingly (Lipinski, 2020). However, with respect to primary data on FLW, much remains to be done. Just aFLW refers to all food intended for human consumption that is finally not consumed by humans. Food Loss is the decrease in the quantity or quality of food resulting from decisions and actions by food suppliers from the production stage in the chain, excluding retail, food service providers and consumers. Food Waste is the decrease in the quantity or quality of food resulting from decisions and actions by retailers, food services and consumers (FAO, 2019). Under this definition, FLW does not include food that is consumed in excess of nutritional requirements nor food that incurs a decrease of market value due to over-supply or other market forces, and not due to reduced quality. handful of mainly western countries have taken action to systematically measure and reduce FLW. Lack of data make it particularly difficult for lower-and-middle-income countries (LMIC), including China, to specify the hotspot food products and chain stages, to define smart targets and to identity adequate interventions.In order to contribute to this essential information we developed and used a mass flow model based on secondary data to derive the volume of FLW and the associated parameters accordingly (Guo et al., 2020). This approach allows to present an indicative country profile showing per food product category and chain stage not only the amount of FLW but also the GHGEs, the land-use and water footprints related to producing the FLW as well as induced nutrient losses. The sums differs per product and chain stage. Focusing on food products and chain stages which largely contribute to the aforementioned parameters can substantially lead to resource use efficiency and at the same time to climate mitigation action and nutrition security. This integrated approach towards FLW reduction can support policy makers and other food system actors taking informed decisions contributing to multiple sustainability objectives in parallel.Modelling country data on FLW and FLW-associated GHGEs, land-use and water footprints and nutritional losses FLW data was generated through a bottom-up, mass-flow model (Guo et al., 2020) that combines data on production and outputs as well as imports and exports at the country level. Estimates of losses per chain stage are derived from Porter et al. (2016) to calculate the FLW in the supply chain according to the country's production and trade. The FLWassociated GHG emissions are calculated by using the GHG emission factors derived from Porter et al. (2016) to multiply the FLW at different supply chain stages.Furthermore, a Protein and Nutrition Database developed by WUR (built on nutritional compositions derived from databases from FAO, USDA, Denmark and Japan) was used to calculate the nutritional value of the total consumed food in each country. The nutrient intakes are compared with estimated nutrition requirements per country (which is based on the composition of the population and per capita nutrient demand, according to WHO dietary recommendations).In calculating the land use footprint of plant-based food items, FAO's 'Crops and livestock products' database is utilized by combining data on yields and harvested areas. This gives a simplified estimate of how much cropland is needed to grow the produce. Country-specific land use estimates for animalbased food items are however scarce. Therefore, global estimates as published by Poore & Nemecek (2018) are used.Applying this non-differentiated data has a drawback that it not accurately takes into account country-specific farming practices. Lastly, for the water footprint the broadly recognized datasets of Mekonnen and Hoekstra are used. These cover the Green, Blue and Grey water footprint of crops and derived crop products (Mekonnen & Hoekstra, 2011), and of animals and animal products (Mekonnen & Hoekstra, 2010). Based on the country data modelling, estimates on FLWassociated GHGEs were retrieved for China and plotted with the FLW total tonnage to visualize the two components (Figure 1).Food categories were ranked according to the production of FLW-associated GHGEs. For FLW, vegetables, rice, potatoes, wheat and tomatoes are the hotspots. The five hotspot products for FLW-associated GHGEs are: vegetables, rice, poultry meat, pig meat and freshwater fish. The category 'vegetables, others'has by far the highest FLW in weight as well as associated GHGEs, 100,000 and 79,000 tons respectively. For rice 46 million FLW tons induce 64 million tons CO2-eq. GHGEs.Figure 2 presents the top 15 items with the largest land-use footprints of FLW. Bovine meat, pig meat, rice, soybeans, and wheat rank the top five. Note that land use footprints do not apply for aquatic products.With respect to the water footprints of the FLW, rice and pigmeat are the top 2 individual-item contributors followed by wheat and soybeans (Figure 3). Here also, the indicator 'water footprint' does not apply to aquatic products.From another perspective, taking the percentages of FLW in relation to production percentages, potatoes and the four aquatic products are identified as the main hotspotsshowing average losses of 45% and 44% respectively along the chains (Figure 4). Further insights in hotspots are derived from estimated distribution of the FLW along supply chains for the two hotspot product categories in the region (Figure 5). These data suggest that for potatoes, the agricultural production and the processing and packaging stages are the hotspots for FLW. The agricultural Figure 6 shows the protein losses associated with FLW where vegetables, wheat, rice, freshwater fish and pig meat are the top five items. Finally, the food supply and FLW data were used to assess nutrient supply per capita in the Chinese population in relation to recommended nutrient intake (Figure 7). These are average numbers, and it is not likely that nutrients are evenly distributed across China. Hence, there will be parts of the population that suffer insufficiencies of calcium, iron and energy (carbohydrates, fat).From nutrition security perspective, efforts for mitigating FLW in soybeans, wheat, fish and rice chains would contribute the most to population nutrient gains (Table 1). And even if the farm price is less than half the 200 billionYuan turns out to be too low.Similar calculations can be made for e.g. fruit (5.5 RMB/kg) and meat (between 15 and 20 RMB/kg).Even if farm prices would be plugged in for the calculations the conclusion turns out to be the same.The data used in Clearly there are large differences for meat and cereals and in Xue, L., et al (2021) this difference is explained by the fact that FAO FLW coefficients are not China specific but derived from industrialized Asia, including South Korea and Japan. Moreover, they do not distinguish food waste rates for different cereal types either (maize, wheat and rice). These countries are very modern and show different consumption patterns and waste figures.Note that the major FLW food categories remain fruits and vegetables, cereals and meat. The above analysis underlines that, if one considers sustainability in the context of these five indicators the greatest impact can be achieved by concentrating efforts on rice, pig meat, wheat and vegetables compared to focusing on other food products.Since the results are not on product level, it is not immediately clear, where to start your intervention. Our suggestion is to develop FLW reduction actions, with synergy on GHGEs mitigation, nutrition, land-use and water footprints, is to implement monitoring or/and gather primary data for hotspotsupply chains of the country. The results in this document guide stakeholders by focusing on the top five food (sub) categories in combination with the indicative results on FLW per supply chain link. To research interventions, it is necessary to go to product level, which can be based on production or trade data in the country. The next step is to identify business cases for FLW reduction. For this purpose, WUR's EFFICIENT protocol 2 and FLW cause and intervention tool 3 can be used.2 https://edepot.wur.nl/556214 and https://sites.google.com/iastate.edu/phlfwreduction/home/efficient-food-loss-waste-protocol"}
|
main/part_1/0013398492.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"d91a1a03388fbdb968f78e83cfbc9855","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ccde27dd-41a8-4cab-990a-f381512f881f/retrieve","id":"-346409629"},"keywords":[],"sieverID":"3342a027-53cd-4edf-9dba-69552e1220f6","content":"The Africa RISING project in the Ethiopian highlands has been demonstrating different technologies with different CGIAR, national and local partners at all its intervention sites. In Sinana district, which is one of its intervention sites, a number of technologies have been tested at farmer's field level for the last three years. In 2015 cropping season participatory varietal selection of cereals and pulse crops; improved livestock feeding and forage crops and high value fruit trees were the major ones.Community based seed multiplication, experimental research on soil nutrient amendment through soil test based nutrient amendment and improved management practices were also conducted.Beside this, transferring these technologies to the end user has also been done. To achieve this, farmer field day, mid-season evaluation, and end-season evaluations were considered as key tools for technology transfer, promotion, and knowledge sharing.The major aim of organizing field days is to promote information exchange and technology transfer easily from farmers to farmers or among different stakeholders and at the same time creating market linkages (making market value chain) in which producers can directly or indirectly benefited from processer in a mutual system. In this regard, Africa RISING Sinana site organized a big field day in collaboration with CGIAR partners, innovation plat form (IPTGs) on 1 st December 2015 at Selka kebele.On this event more than 75 participants from different stakeholders took part. Among these, 36 were farmers of which 12 Participants then visited soil nutrient deficiency trials being conducted by ICRISAT under the project.Two types of trials were demonstrated on the field. One is a fixed plot trial which is intended to see the residual effect of micro nutrients applied last year on the successive crop, i.e., potato. The second trial is soil nutrient application trial on the main crop, i.e., wheat. Dr. Chris Ojiewo from ICRISAT gave explanation about both trials, its objectives and expected outcomes. A number of questions were raised from participants which Dr. Christ replied to. These included how could you control the mixing up of those nutrients across plots before and during planting? For how long could the micro nutrients stay in the soil? How much of the micro nutrients applied taken up by the main crop and left-over in the soil for later use by the successive crop? Dr. Chris briefly explained that the trial was intended to demonstrate the correct amount of fertilizers application on the main crop and the residual effect on the successive crop. Now, it is reported that farmers used about 30% of the recommended amount of fertilizers. On this particular trial ICRISAT is trying to demonstrate application of nitrogen (N), NP, NPK, NPKS and NPKSZn. The results have already been observed so far from the fields (on station trials). By applying the correct amount of fertilizers not ignoring also Sulfur, Zink and other micro elements, it is possible to get better yields and the most important is that farmers will get better nutritional quality out of it. Potato is one of those crops for which anyone can plant after harvesting wheat and with the residual fertilizer level. Without applying the additional fertilizers to the field, farmers can plant potato and use the remaining fertilizers after the wheat harvest. By following this procedure, a farmers will get double crop from one application of the correct amount of fertilizer, correct amount of yield of wheat grain with high quality in terms of protein and micro nutrients and also batter yield and high quality potato in terms protein and other micro nutrients of potato. The other issue raised was disease tolerance. The application of these micro nutrients also rise its level of disease tolerance. It helps to produce healthy seed. However, this does not mean that it is not necessary to apply fungicides or other chemicals at all, but rather, reduces application frequency. Following that faba bean post-harvest management, lentil and filed pea PVS trials, tree Lucerne, raised bed trial relayed with early maturing lentil and vetch, mechanized seeding of wheat, chick pea PVS trials, CSP (potato, food barley, faba bean and wheat) and oat-vetch demonstration trial for animal feed were visited one after the other. The objective of establishing the high value fruit tree nursery site in collaboration with woreda office of Agriculture was also explained to the participants by Dr. Kindu Mekonnen and Hadia Seid. In addition to apple, introduction of walnet from china and avocado adaptation trials were explained to the participants by Hadia Seid from ICRAF. Farmers at Ilu-Sanbitu kebele have started to taste apple fruit from the apple on farm trials.At the end of the field visit, general discussion was made at Salka oda under tree shade where all participants including farmers were able to raise questions, forward comments and suggest on the technologies to be scaled up in the future. The discussion was facilitated by Ahmed Aliyi. Kindu Mekonnen on behalf of Africa RISING project gave feedback to the questions raised. The major issues raised by the participants were the long-lasting mono cropping problem in Bale, its consequence on livelihood of Bale farmers and the future collaborative effort of all stakeholders in breaking this bad culture. It was suggested that the participatory approach of doing action research through IPs which is introduced by Africa RISING project from planning stage to implementation stage has to be strengthened; working out the cost benefit analysis of best technologies before scaling; the future role of partners and IPs in identifying scalable technologies and scaling up to the wider community; focusing on proven technologies; considering the local context during the protocol development and prioritizing problems of the community were also the main issued raised.Bale Zone office of Agriculture V/head and representative of Zonal administration appreciated the participatory approach of doing action research introduced by Africa RISING project and requested to be strengthened. He also assured that scaling up of best technologies will be the assignment of all local stakeholders and requested the project leaders to broader the activity and continue working by focusing on proven technologies, share the results timely, considering the local context and prioritizing problems.Generally speaking, all partners were very happy with the work that was done by Africa RISING.Finally, zonal and woreda level higher officials, SARC director, farmers and others gave words of thanks to Africa RISING project for organizing this kind of field day where all responsible partners were fully represented to provide feedback, shared experience and take assignments for future scaling.Q1. Africa RISING Project has been testing different soil nutrients and crop response to the micronutrients applied. We understood that these micro nutrients help the crop to develop resistance to disease. If this experiment will be fruitful, how and where can we get fertilizers blended with these micro nutrients?Ans. This trial is to give piece of recommendation for police maker. Currently different fertilizer producing companies are there. So they can produce the blended form of fertilizer and make available for the farmers. Q2. Some trials , for example, raised bed trials should be applied on black soil having high water holding capacity/water logged area/. But, this is not the problem of Salka and Ilu-Sanbitu kebeles.How much the protocols developed considered the local condition of Salka and Ilu-Sanbitu?Ans. This is exactly where we have to see the responsibility and functionality of IP. For any protocols that will be developed, the IP should go through and dealt with its applicability to the local context.The number of female farmers engaged in Africa RISING protocols is low. Why this's so?Ans. Africa RISING is majorly open to female farmers at first and encourages their participation but the problem in sinana is that male farmers take the chance of managing on farm activities whereas limiting female farmers to home work and taking care for children.Currently Africa RISING is furnishing different best bit technologies in order to benefit local farmers and started scaling up of these technologies. But, does cost benefit analysis is done before going for scaling? Ans. For any technology, there should be cost benefit analysis prior to provide to farmers or any end users.What is going on regarding market issue for technologies we are developing to benefit farmers?Ans. As a Government, market value-chain study is undergoing by clustering oromia region especially the two wheat belt area of Arsi and Bale on major 3 crops (i.e. wheat, Barley and Teff).Thus, I think it is time to bother about production rather than market issue.Q7. Since we are doing participatory on farm trials, the technology we are testing shouldn't confusing farmers (i.e. decreasing its complexity as much as we can)?Ans. Yes, as far as our technology is participatory they should be less complex and participatory.To what extent are is the IP functioning? Every research proposal should have to pass through IP meeting where multi-stakeholders participat and share their responsibility.Ans. IP is an important tool for developing a collaborative effort of different organization where varieties of stakeholders come together and discuss on problems and opportunities related to their local context. Thus, as you remember Africa RISING conduct IP meeting once in every year before implementation of research protocols to amend and see its applicability in the area.Q9. Some technologies tested on farmers field is unproven and complex in their nature. How do you see this? (Case of ICRISAT Soil nutrient trails)?Ans. This trial is mainly focused to get recommendation for police maker through practically tested on farmer's field by clustering farmers land into different soil classes. Africa RISING project demonstrated diversified technologies at both kabeles that can be scaled up to wider community which can be considered as a good beginning. Today, all responsible partners (Zone and woreda extension, SARC and MWU) are here on this field day. So all stakeholders need to give due attention for future scaling up of these technologies Farmers mostly do not need to engage themselves on labor intensive works so that rotating wheat with pulse and root crops requires high labor cost than wheat. In order to get better production for future from wheat , crop rotation is a must for Bale farmers Woreda IPs have full mandate to amend and even reject the research protocols developed for the area, in case when it doesn't address the local condition. In order to avoid such gaps and some miss understandings, all IP members has to actively participate during review meetings.Finally, Kindu Mekonnen from ILRI/Africa RISING project indicated the future direction of the project activities. In his speech, he pointed out that : Working out cost benefit analysis of best technologies will be the assignment of the project before starting the second phase (scaling). "}
|
main/part_1/0019514223.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"5d68148008bec6002a1220b270a832cc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/09296afc-cb6f-435b-b547-f3202c1b359c/retrieve","id":"-1743536409"},"keywords":[],"sieverID":"2db97ac5-d546-4797-bcc7-d64e84df9b54","content":"• Food insecurity and malnutrition are major challenges in Ethiopia.• About 10% of the country are chronically food insecure, with higher rates during drought seasons. • Small ruminants are an important asset and source of income for women.• Women invest the income from sale of small ruminants and products in household consumption needs as well as for their children's education. • Small ruminants derived foods have a high protein quality found to promote growth and prevent stunting, underweight and chronic malnutrition in toddlers and children.The study aimed to investigate the role of small ruminant production from a food security angle and explores the different perspectives of women and men on small ruminant importance in alleviating food insecurity.Gender disaggregated data collected in four regions of Ethiopia:• 92 focus group discussions; 23 each with men, women, youth male and youth female. • A household survey involving 429 households; 216 men and 125 women in male household and 88 women in female headed household. In male headed households, a subset of questions was asked to the interviewees and their spouses.To assess the importance of livestock species participatory tools, such as simple ranking and proportional piling were used. Participants were asked to explain their scores, and obtained statements were mapped to the four dimensions underpinning food security:• Availability: The amount of food that is present in a household through own production or bought from the local markets; • Accessibility: All households have enough resources to obtain food in sufficient quantity, quality and diversity for a nutritious diet; • Stability: Available, accessible and nutritional remains constant during the year and in the long-term and • Utilization: Safe and nutritious food which meets households dietary needs.• Small ruminants are important assets, source of income and animal-source food for smallholder farmers, especially for women. • Small ruminant production can greatly increase food security and thus improve health and malnutrition of families. • Women contribute significantly to food security through production, economic access to available food, and nutritional security. • Gender targeted interventions are a good entry point to improve food security and nutrition as women have a key interest in investing in household consumption needs.Importance of small ruminants and food security:• Livestock contributes to food security in several ways: direct access to animal source foods, cash income, which can in turn be used to purchase food. • When mapping explanations for ranking of different livestock species, interestingly food security related arguments were most prevalent for goats followed by poultry.This document is licensed for use under the Creative Commons Attribution 4.0 International Licence. October, 2017.• Women FGD: 'Sheep are fast growing cabbage in the homestead' indicating their availability for home consumption. 'Sheep are like 'Injera' ready to be eaten' indicating their accessibility for household needs. • Men FGD: 'Sheep are like money in a pocket' stronger focus on economic reasons, linked to income generation."}
|
main/part_1/0019949525.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"1506e6c83e953fb2e21e95a28e2f4c93","source":"gardian_index","url":"https://repository.cimmyt.org/server/api/core/bitstreams/2d0653bb-6758-43b6-ba29-2ee227e05c57/content","id":"-1692548352"},"keywords":[],"sieverID":"e0b9057e-b4e4-4736-8b57-c5ff208ec0bb","content":"Introducci6n 2 Cuadro 1. Cultivares de trlgos 6 harineros semienanos y lineas avanzadas producidas por el CIMMYT y/o INIA, Mexico, y cultivares de progenitores del CIMMYT que ban sido liberados desde 1962 por cooperadores de paises colaboradores Cuadro 2. Cultivares con origenes 29 comunes Cuadro 3. Abreviaturas que indican el 32 lugar donde se realizaron las cruzas Cuadro 4. Abreviaturas que indican el 33 lugar donde se realizaron las selecciones Cuadro 5. Abreviaturas utilizadas para 34 identificar lineas avanzadas que no fueron desarrolladas en el CIMMYT y/o INIA, MexicoUna de las funciones principales del CIMMYT es la producci6n de germoplasma para ser utilizado por programas nacionales de mejoramiento de cultivos que colaboran con esta instituci6n. En el desarrollo del germoplasma de trigo se pone enfasis en la producci6n de materiales avanzados que pueden ser integrados rapidamente a los programas nacionales de mejoramiento de trigo. Tambien hay materiales segregantes de generaciones tempranas que estan disponibles para los cooperadores. Cada af10, el CIMMYT hace miles de cruzas de trigos harineros y genera cientos de lineas avanzadas. Estos materiales son distribuidos anualmente a programas nacionales mediante nuestro sistema de ensayos internacionales: cerca de 40 viveros formados por ensayos avanzados de rendimiento, viveros de selecci6n y poblaciones segregantes de F2 son distribuidas a mas de 200 cooperadores alrededor del mundo. Los programas nacionales pueden usar el germoplasma en sus viveros en la forma que mejor se adapte a sus necesidades. Las opciones van desde cruzas con variedades locales hasta multiplicar materiales directamente para su eventual liberaci6n como variedades. El lector debera saber que el CIMMYT no libera ni nombra variedades; ese es el derecho y responsabilidad de los programas nacionales cooperadores, y cada programa nacional tiene su propio sistema para nombrar los cultivares liberados. El CIMMYT nombra sus lineas de mejoramiento avanzado; y nuestro sistema de diferenciaci6n entre estas lineas normalmente utiliza solamente los nombres de pajaros de tierra. Anteriormente se utilizaban nombres de montafias, lagos, rios, islas y ciertas combinaciones foneticas, algunos de las cuales todavia se siguen usando.Este folleto contiene una recopilacion de todos los cultivares de trigos harineros semienanos y de lineas avanzadas producidas por el CIMMYT y por el Instituto Nacional de Investigaciones Agricolas (INIA); tambien contiene nombres y genealogia de cultivares con progenitores del CIMMYT que han sido liberados desde 1962 por cooperadores de programas nacionales. Nuestro prop6sito al publicar este folleto es facilitar el intercambio de informaci6n mas exacta entre investigadores de trigo que trabajan con estos materiales, y ayudarlos en sus anotaciones y actividades de registro.Con la publicaci6n de este folleto revisado, el CIMMYT ha optado por un cambio en su sistema para indicar el orden de las cruzas en cada genealogia, con el prop6sito de coincidir con el sistema actualmente utilizado por la mayoria de las otras organizaciones mejoradoras de trigo. Este sistema no solo hara mas facil el movimiento de datos, sino que es en si mismo mas facil fie usar. El Cuadro que aparece a conti-nuaci6n contiene una comparaci6n entre el viejo y el nuevo sistema. Debido al gran numero de cruzas que se realizan anualmente en el CIMMYT yen instituciones cooperadoras, este folleto requiere de ac-tualizaci6n y revision, cuando menos cada dos aftos, para agregar materiales adicionales. Agradecemos la informaci6n y sugerencias para hacer que esta recopilaci6n de datos les resulte util y facil de comprender a las investigadores de trigo de todo el mundo. "}
|
main/part_1/0026425970.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"2d3e9d7bfece1901ac30ed599cf7f97f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/10df5c60-feb4-441b-a381-8c036f1432f2/retrieve","id":"-26655371"},"keywords":[],"sieverID":"72ff5d32-6ede-40d0-b102-f5278f21b545","content":"1. This report summarises the process, achievements and lessons learnt from the ECAPAPA-ILRI Phase II project on Promoting uptake of new institutional approaches and appropriate technology to transform informal (\"raw or traditional\") milk markets and integrate them into domestic and regional supply chains in the ASARECA Region. This was the dialogue and action phase following the data gathering and analysis conducted under Phase I of the project.2. The rationale for this work is the recognition that:a. Small-scale milk traders dominate milk supply in the eastern and central Africa region, where they supply over 85% of marketed milk that often reaches the consumer prior to pasteurization. They flourish because they are favoured by current trends in supply and consumption of dairy products, which is mainly driven by cost considerations and traditional tastes b. The quality of milk traded in raw milk markets which is a concern at the moment, can be improved. This can be achieved through training and licensing. of informal traders, while can improve quality of raw milk, and allow \"bridging the gap\" with formal traders c. Training and licensing could contribute to the evolution of informal markets towards formal, and \"bridging the gap\" d. Incorporation of a BDS approach and a quality assurance scheme supervised by regulatory authorities makes the implementation of the strategy feasible, by overcoming current capacity constraints within national dairy development boards and allowing them to concentrate on supervising the scheme e. Endorsement of a common strategy among counterpart regulators would contribute to greater access to quality milk within and across national borders f. Many regulatory authorities could begin to implement this strategy, others need strengthening first 3. Standardisation of curriculum for training of informal milk traders in participating countries of Kenya, Tanzania Uganda and Rwanda would contribute to a harmonised policy change that allows the certification of informal milk traders following a standardised training programme of various carders operating in the informal dairy market chain.4. The objective of this phase of the work was to develop generic training guides that would form the basis for dialogue and reaching of regional agreements on training and certification. This was achieved through a consultative process involving National Resource Persons (NRPs) and dairy sub-sector regulators in each participating country under the overall coordination by a Regional Resource Person (RRP) and consultants based at ILRI. This team of experts undertook the following tasks:i. Developed appropriate national guidelines by national consultants in Tanzania, Kenya, Uganda and Rwanda;ii. Consolidated common issues from the national guidelines into a generic manual for training of marginalized but majority small-scale traders in milk quality control;iii. Defined common minimum standards for competence in hygienic milk handling and equipment necessary for cross-border trade by small traders;iv. Based on the above and a related consultant report on innovative approaches and processes for business development services (BDS) opportunities in the region, facilitated the development of a generic work plan for improved service delivery and quality assurance in the milk marketing chain.5. The opportunities for improving training in dairy technology for small scale milk trades in each country (as was recommended under Phase I) have been documented. It was established that in all countries, training was not a prerequisite for anyone to be licensed to operate as a milk trader in the informal sector. On the other hand studies in Kenya had shown that training coupled with use of more hygienic metal containers helped improve the microbiological quality of milk handled by informal milk traders.6. After establishing training and competence needs for each cadre of dairy chain operators, the following harmonised six training modules have been developed by the team of experts and later discussed and endorsed for use in training and certification by dairy sub-sector regulators in Kenya, Tanzania, Uganda and Rwanda:i. Module 1 -Hygienic milk production: a training guide for farm level workers in Eastern Africa. 28 pages.ii. Module 2 -Hygienic milk collection and testing: a training guide for milk collection centre operators in Eastern Africa. 28 pages.iii. Module 3 -Hygienic milk handling and transportation: a training guide for milk transporters in Eastern Africa. 32 pages.iv. Module 4 -Hygienic milk trading: a training guide for small scale milk traders in Eastern Africa. 32 pages.v. Module 5 -Hygienic milk processing: a training guide for small scale milk processors in Eastern Africa. 40 pages.vi. Module 6 -Hygienic milk marketing and dairy business management: a training guide for dairy farmers, milk traders, transporters and processors in Eastern Africa. 28 pages.7. Each of the above modules includes a training curriculum to be followed in conducting the training. In addition, two trainer guides with more elaborate information have been developed for the trainers: 8. Lessons learnt from this project include: the importance of using science based evidence to influence policy on informal milk markets in East Africa; peer pressure as an important driver of change among informal milk traders in Uganda; the importance of facilitated dialogue and learning from experiences in neighbouring countries by regulatory authorities as a basis for achieving harmonised policies. A memorandum of understanding agreed by dairy subsector regulators in Rwanda, Kenya, Tanzania and Uganda to apply these training guides in regulating dairy sectors and facilitating cross-border recognition of certified traders is evidence of the commitment to the harmonised policy.9. The BDS market assessments to identify opportunities for implementing a training and certification scheme in each of the above countries noted that as of now, BDS may only be viable in certain locations with high market access. To expand the services, the assessment recommended various approaches to stimulate BDS demand, strengthen BDS supply and regulatory support services.Where the BDS approach was found to be viable at present, it is recommended that follow-up actions be undertaken to pilot test the concept of training and certification of informal milk traders by involving BDS providers in each of the participating countries. This is in light of the limited capacity of the regulatory authorities to effectively provide the needed services directly. The following specific actions need to be undertaken to ensure the success of the pilot. 10. At an appropriate stage and lapse of time, an assessment of the impact of the policy changes should be quantified in terms of the distributional impacts on the welfare of producers, traders and consumers.The report is divided into 6 chapters. Chapter 1 is an introduction that gives the background of the work and the context. Chapter 2 highlights the methodologies and processes which were used in implementing the work towards achieving the objectives of the Phase II. Chapter 3 highlights the achievements made. Chapter 4 summarises the outcomes of a lesson-learning session conducted at a meeting with dairy sub-sector regulators. Chapter 5 gives an outline of future action plan for piloting of improved service delivery and quality assurance in the informal milk marketing chain. Conclusions and recommendations are presented in Chapter 6. In view of the fact that informal milk traders handle over 80% of milk marketed in the EAC and COMESA member states, it was recommended that efforts be undertaken in the region to assist informal sector stakeholders acquire the necessary skills and knowledge to handle milk as hygienically as possible as a way of safeguarding public health as well as to enable them to be legally recognised and licensed to conduct their businesses within and across borders.ECAPAPA and ILRI took up the challenge of spearheading this process and developed Phase II of the Dairy Policy Harmonisation Project with a focus on promoting dialogue and action, primarily to address the issue of training for certification of informal milk traders so that they can begin to participate in dairy markets in a manner that is acceptable to dairy industry regulatory authorities and consumers in respect to quality and safety standards of traded milk. Under this phase, dairy industry experts from Kenya, Tanzania, Uganda and Rwanda were brought together to develop training programmes that would enhance the competence of informal milk traders in hygienic milk handling, marketing and small scale processing.The implementation of this phase was undertaken by a team of dairy industry specialists from Kenya, Tanzania, Uganda and Rwanda under supervision by ILRI. This report gives a brief overview of the process, achievements and lessons that can be learnt from the approach that was used towards achieving the project's objectives.The overall objective of the work by the consultant was to promote the uptake of new institutional approaches and appropriate technology to transform informal milk markets and integrate them into domestic and regional supply chains in the ASARECA Region focusing on training and certification of informal milk traders through business development services.The specific tasks were to:i. Develop appropriate national guidelines by national consultants in Tanzania, Kenya, Uganda and Rwanda;ii. Consolidate common issues from the national guidelines into generic manual for training of marginalised but majority small-scale traders in milk quality control;iii. Define common minimum standards for competence in hygienic milk handling and equipment necessary for cross-border trade by small traders; iv. Based on the above and a related consultant report on innovative approaches and processes for business development services (BDS) opportunities in the region, facilitated the development of a generic work plan for improved service delivery and quality assurance in the milk marketing chain;v. Summarise the process, achievements and lessons in a brief synthesis report.Chapter 2: MethodologyThe work was carried out in four countries, namely, Kenya, Tanzania, Uganda and Rwanda. A policy change cycle approach was used. The first phase involved data collection and analysis and subsequently this was followed up by dialogue and action phase. The first phase was conducted in 2004 and involved a comprehensive review of policies, rules and regulations affecting the performance of the dairy sub-sectors in five selected countries in the region and documented factors limiting domestic and cross-border movement of dairy inputs and products. During 2005, a second phase that aimed to promote dialogue and action among scientists and dairy sector development and regulatory agencies to realize pro-poor institutional reforms in milk marketing by small-scale milk traders in the region, was initiated.The dialogue was promoted by engaging national experts with experience in dairy technology and training, to collect and collate the needed background information in each participating country, and comparing the information across countries in regular meetings. The experts worked in close consultation with the national dairy regulatory authorities to define minimum requirements for competence and hygienic handling of milk, for inclusion in milk training guidelines and curricula. This information formed the basis for developing a harmonized generic guide and curriculum for certification of small milk traders that would in turn be tailored to specific national needs without altering the minimum competence requirements agreed upon. A key objective was the cross-border recognition of the certification issued by counterpart regulatory authorities which would promote greater market access. The over-arching aim was that the generic training materials would be availed for adaptation and adoption by other ASARECA countries not directly participating in the initial exercise.In order to achieve a more sustainable training programme, a private-public sector partnership between business development services (BDS) providers and regulatory authorities was envisaged to be a central component of a work plan to institute the proposed policy and technological changes. This was in light of the limited capacity of the regulatory authorities to effectively provide the needed services directly, but to instead limit their role to facilitating the provision of the services.From the regulatory viewpoint, the adoption of the approach of training and certification of informal milk traders for purposes of integrating rather than alienating them in dairy markets is a major policy change. The dialogue phase brought all the regulatory authorities into the discussion. A workshop to this effect that was attended by heads of dairy regulatory agencies and key experts from Kenya, Uganda, Endorse the materials as a basis for certification of small-scale milk traders in the region. iii.Draw lessons from the process and related on-going policy and institutional changes in dairy sub-sectors in the region iv.Facilitate dialogue and development of modalities for co-operation between regulatory authorities of Eastern African countries At the above workshop, a decision was taken by the regulators to form an Eastern Africa Dairy Regulators' Association Council (EADRAC) to provide the mechanism for following up issues raised in harmonisation of dairy policies in the region. A memorandum of understanding (MoU) that was recommended as a basis for the interaction in the Council was drafted shortly thereafter and signed at another meeting convened in Dar es Salaam in September 2006.The training and certification policy dialogue was conducted through a series of programmed steps as follows. The study team met twice in Kampala Uganda and once in Dar-es-Salaam, Tanzania to develop and agree on minimum competencies of various carders of milk value chain. The following six groups of key players were identified.Individual farmers/farm level worker owning/handling at least one cow and producing milk for the market 2)Self-help groups/Farmer groups/Coops/CBOs operating milk collection and/or cooling centres 3)Hawkers or milk vendors 4)Milk transporters 5)Milk bar /Milk cooler operators 6)Small scale milk processors The farm level worker should be able to perform the following tasks: There is an emerging group of milk traders who are becoming spcialised milk transporters, especially in Kenya and increasingly so in Uganda and Tanzania as well. Milk transporters need to have the following competencies:1.Carry out basic quality tests on milk 2.Distinguish between poor and good quality milk 3.Transport milk in appropriate containers and in a timely manner 4.Deliver high quality milk from the milk collection centres outlets and dairy factories in the urban areas 5.Operate milk transport business in compliance with regulations and good hygienic practices 6.Keep records and operate transport as a profitable businessTo become competent milk transporters, the following subject content need to be mastered:1. Knowledge on approved design of transport vehicles and milk equipment 2.How to take care of transport vehicles 3.Factors affecting milk quality and how to maintain quality during transportation 4.Milk sampling 5.Characteristics of good quality milk 6.Basic quality tests (organoleptic, clot on boiling and alcohol test 7.Cleaning and sanitation of milk handling equipment 8.Provisions of dairy regulations, traffic and road safety provisions and environmental regulations 9.Good business practice (Milk deliveries and financial records)The above knowledge and skills may be imparted in 1-2 day short residential or outreach training programmeThe necessary training programme is shown in Appendix Table 3.Small milk traders and vendors operate between remote farmers and milk collection points or cooling centres. Some supply milk directly to consumers in urban centres. A milk trader must be able to:1. Distinguish between poor quality milk and good quality milk 2. Use appropriate equipment and deliver milk timely 3. Clean and sanitize milk handling vessels adequately 4. Conduct simple quality tests on milk 5. Observe the legal regulations regarding hygienic handling of milk including use of appropriate equipment, and absence of added water and antibiotic residues in milk 6. Keep simple financial and milk records To have the above competence, a milk trader needs to be knowledgeable on the following:1. Characteristics of good quality raw milk 2. Factors influencing the quality and safety of raw milk 3. Simple milk testing techniques 4. Legal requirements and standards on milk handling and hygiene 5. Cleaning and sanitation of milk storage vessels 6. Dairy and financial record keeping Knowledge on the above subjects can be imparted in 1-2 day short course residential or outreach training programme.The necessary training programme is shown in Appendix Table 4.Small scale dairy processors should be able to:1. Perform basic raw milk quality tests 2. Perform basic quality tests on various types of dairy products 3. Distinguish between poor and good quality milk 4. Handle and process milk hygienically 5. Maintain and operate processing equipment 6. Practice good hygienic practices including personal hygiene and good manufacturing practices 7. Produce wholesome and safe dairy products that meet set standards for quality and safety 8. Keep good records and be knowledgeable in basic dairy accounting For small scale dairy processors to develop minimum competencies to handle and process milk safely, they need to be knowledgeable and skilled in the following;1. Milk quality control and testing 2. Factors that influence the quality and safety of milk and dairy products 3. Good hygienic practices during handling, transportation and processing of milk 4. Hygienic processing of specific dairy products 5. Cleaning, sanitation and preventive maintenance of dairy processing equipment 6. Quality control and testing of dairy products, including written protocol for product recall 7. Personnel hygiene and code of hygienic practices 8. Dairy records and accounting These topics can be covered in 1-2 day short course, residential or outreach training programme, which may be tailored for specific dairy products.The necessary training programme is shown in Appendix Table 5.All dairy chain business operators need to have the following competencies 1. Basic marketing and business management 2. Business plan preparations 3. Marketing and distribution skills and consumer careTo be competent in the above skills, all dairy chain operators need to master the following:1. Fundamentals of marketing and business management 2. Fundamentals of business planning 3. Marketing fundamentals 4. Essential financial and dairy recordsThe necessary training programme is shown in Appendix Table 6.Based on the above areas of competency for each cadre, training curricula were developed for each cadre as shown in Appendix 1 to 6.Based on the above areas of competence, six guides were developed by each national resource person. These were then synthesised by the Regional Resource persons (RRP) into six generic training guides (see Appendix 2a-2f). These are: Module 1: Hygienic milk production (for farm level workers) Module 2: Hygienic milk collection and testing (for milk collection/cooling centre operators) Module 3: Hygienic milk handling and transportation (for milk transporters) Module 4: Hygienic milk trading (for Small-scale milk traders) Module 5: Hygienic small scale milk processing (for small-scale processors) Module 6: Fundamentals of marketing and dairy business management (for all dairy chain actors)The above modules have been approved by dairy regulatory authorities for certification of informal milk traders who successfully undertake the prescribed training and follow the approved code of hygienic practices. They may be adapted to each country's specific situation and circumstances. They are designed to ensure that dairy chain operatives have the minimum competences required to undertake hygienic milk handling and marketing while guaranteeing quality and safety.Two generic guides for training of dairy advisory service providers and trainers so as to enable them acquire the necessary competence to train/advise: a) Milk producer groups in hygienic milk handling on the farm b) Milk transporters in hygienic milk transportation business practices c) Small scale traders in hygienic milk handling and marketing d) Milk bar/parlour/kiosk operators and retailers in hygienic milk handling and profitable milk bar operation and retailing. e) Small-scale processors in hygienic and profitable small-scale milk processing f) All small-scale dairy industry operators on basic and essential regulatory procedures, standards and regulations governing the technical and business operations in the dairy industry. g) All small-scale dairy chain operators on milk marketing and business planning.To be able to deliver on the above core competence outcomes, trainers would require knowledge and understanding on: a) Milk quality management at the production farm, milk quality management at farmers' group owned milk collection/cooling centres b) Milk quality and management during milk transportation and small scale milk trade. c) Appropriate technologies for small scale milk processing and preservation d) Appropriate record keeping and business management for small scale milk traders, transporters and processors. e) Code of hygienic practices and regulations governing milk handling, transportation and processing. The developed Trainers guides are given as Appendix 3a and 3b.In line with current legislation in respective countries, the dairy regulatory authorities are empowered to register and licence dairy industry stakeholders operating in the formal sector. At the same time quality improvement in the dairy value chain is also a primary responsibility of the regulatory authorities, which include the Dairy Boards, and Government Ministry responsible for Livestock development. Hence, in order to improve and nurture the transformation of the informal value chain operators, licensing and registration should be accompanied by training and certification of the various cadres. The provision of this service should not be confined to public sector dairy training institutions alone. To be more sustainable and reach as many people as possible, the involvement of private Business development service providers (BDS) would be worthwhile. Their involvement could involve training of trainers courses where competence to provide such services is lacking followed by accreditation by regulatory bodies i.e. the national Dairy Boards/Development Authorities.The milk quality assurance scheme to be facilitated by the regulatory authority through privately provided business services would involve the following:The BDS provider: Provides training and other services to milk traders on milk safety and quality control and hygienic handling Issues certificates of competence to trained traders Reports his/her activities to the regulatory authority Pays cess fee to the regulatory authority upon showing a certificate of competence Conducts his/her business within norms accepted and approved by regulatory authorityThe regulatory authority: Accredits BDS providers based on agreed minimum standards of competence for trainers Issues licences to trained traders based on the evidence of a certificate of competence Monitors compliance of accredited BDS providers to approved trainers competence level Monitors compliance of certified milk traders to approved minimum standards for milk handling. Adapted from Omore, 2005.The outcome of the lesson learning session conducted during the last consultative meeting of the ECAPAPA team with dairy regulatory authorities from Kenya, Tanzania, Uganda and Rwanda revealed a number of lessons and experiences that are driving policy changes regarding informal dairy markets in East Africa during the last 10 years. In particular, the following were noted:a) The macro economic policies changes (privatization, trade liberalization) that have reduced direct government involvement in dairy marketing and promoted the participation of the private sector have spurred the dairy policy changes through the proactive engagement of different stakeholders to improve and transform informal markets. Elements that have been at the forefront of this proactive engagement include: i. Small-scale farmers ii.Stakeholder associations iii.Small-scale traders iv.Central government/regulatory authorities v. Processors vi.Researchers and viii. NGOs b) Key influences and events that have led to or facilitated proactive engagement of key stakeholders include i.Overarching government strategies for poverty reduction ii.Lobbying by farmers iii.Lobbying by traders iv.Lobbying by formal milk processors against informal sector actors v.Research to improve milk safety vi.Research showing social benefits of informal milk markets vii.General realisation that informal sector is important and should be addressed viii.Consumers and traders kept doing the same thing even under difficult circumstances and challenges. ix.Specific government policy on engaging the informal sector x.Observing experiences in neighbouring countries Among the above drivers of change, the following have had profound influence on attitudinal and policy change towards the informal sector:i) The general realization that informal sector is important and should be addressed rather than ignored or excludedAlthough the general realisation that that the informal sector is important, and should be addressed, has been there for some An important underlying factor to the positive changes in mindsets is the value of evidence based knowledge in influencing policy changes. In this case the risk analysis studies on milk-borne public health risks from milk markets in Kenya and Tanzania have been critical. This shows the benefits of integrating research with development projects.Observation of experiences in neighbouring countries, especially the way traders in Kenya had been engaged for training, helped catalyse the change. Specific government policies varied between the different countries, and actual engagement with the informal sector reflected this.One of the experiences that is positively influencing adoption of 'good practices' is Uganda's experience in improving quality in its informal milk markets after the dairy sector was liberalized. Prior to the establishment of the Dairy Development Authority (DDA) in 1998, milk quality control among small scale traders and regulatory systems tailored for their needs were non-existent and raw milk was commonly handled in plastic containers and heated by open-pan boiling, often under unhygienic conditions. Following appropriate sensitization and training by the DDA, informal traders jacketed batch pasteurizers to replace the open-pan boiling system. Plastic containers for handling milk have increasingly been replaced with metal containers, thus improving milk quality. One of the key factors contributing towards this high level of quality compliance among informal traders within the relatively short span of DDA's existence has been its adoption of a \"peer pressure\" approach to sensitize groups of traders to join training programmes, with rewards for attendance. The traders now regard DDA as partners working for their good, as long as they adhere to the set code of hygienic practice. This progress forms a good basis for further dissemination and uptake of appropriate milk handling Box 2 96 -100% milk consumers boil milk >50 of pasteurized milk at point of sales exceed official standard of 30,000 c.f.u/ml> poor storage conditions Antimicrobial residues present above MRLs in 8.2% of pasteurized milk and 15% in milk from rural households Antibodies for brucella present in both pasteurized milk and raw milk samples Milk in clean metal containers bacteriologically better than from plastic containers In recent years there has been a general policy shift towards supporting poverty reduction strategies in most sub-Saharan countries. These include the Poverty Eradication Action Plan in Uganda, the Economic Recovery Strategy for Wealth and Employment Creation in Kenya, and the Poverty Reduction Strategy Paper (PRSP), the Agricultural Sector Development Strategy (ASDS) in Tanzania). These national strategies have helped the focus on small-scale agricultural product operations and employment issues, together with the issue of poor consumers' access to affordable food and nutrition security. However, this also needed a mechanism to make it realistic, which the research and experiences in other countries helped to provide.The positive development towards transformation of the informal dairy sector in Uganda is providing an important lesson that other countries in the region and are showing eagerness to emulate. In Tanzania the newly created Tanzania dairy Board has a place for representation of Milk traders on the Board of Directors, provided they have a national association of milk traders. This is yet to happen but shows the government policy of transformation of the informal business across all sectors of the economy.Lobbying by traders had been identified as an important influence, yet on the whole, informal sector players were poorly organised, and lacked a mechanism for their voice to be heard. On the other hand, lobbying by formal processors against alleged unfair competition posed by informal traders had the opposite effect of highlighting the plight of informal sector actors and the important role they play in linking poor rural milk producers and poor urban consumers!. The economic returns in dairy trade provided a strong incentive for informal actors to apply peer pressure on colleagues to adapt technologies and practices recommended by regulatory authorities and researchers and form associations. This has been particularly evident in Uganda and to some extent in Kenya and Tanzania.Bringing on board the regulatory authorities to discuss the concept of training and certification and accreditation of BDS providers has shown that involving policy makers can bring about policy changes more quickly than through formal government policy making machinery. The engagement of top-level regulatory stakeholders in developing informal milk markets through a more effective quality assurance scheme also indicates a willingness to transform the sector. This is particularly evidenced by the action taken by KDB to include the project's outputs in its recently released Strategic Plan to 2009. Already, the KDB has partnered with a local NGO to implement a quality assurance scheme based on the institutional framework outlined here. This noteworthy attitudinal change being witnessed among the top-level staff at KDB is encouraging but still needs to trickle down to the level of field staff, some of whom still carry out their activities with an \"anti-raw milk marketing\" mindset. This pilot project is being monitored through qualitative and quantitative approaches to evaluate both technical and behavioral changes among project implementers and boundary partners, through Outcome Mapping (Earl et al., 2001) to learn lessons that would inform the development of generic work plans for the other countries in the region.ECAPAPA's Rationalisation and Harmonisation of Policies and Standards in Dairy Industry in Eastern Africa\" Phase I programme dealt with harmonization and rationalization of milk and dairy products standards within Eastern Africa targeted and engaged mainly engaged the formal sector processors. The interest of the formal processing sector, regulators and standards agencies is often limited to product microbial compositional specifications, processes and procedures for product manufacture and quality control and testing. Yet, in the informal sector, the lack of training is one major factor leading to lack of the necessary knowledge and skills in hygienic milk handling and processing or milk and dairy products to the required standards. Hence the need for standardising training curriculum for this level of training cannot be overemphasised. Hence phase II of the ECAPAPA programme on rationalisation and harmonisation of policies and standards in Eastern Africa focused on developing and recognising common levels of training and certification for small scale traders and accreditation of BDS providers for dairy training and certification The process outlined in Section 2.2 provided room for dialogue and engagement of key stakeholders at all levels. At the end of the day, the regulatory authorities were unanimous in endorsing the standardised curricula for use in their respective countries.Regular meetings by those involved have provided a useful forum for learning from each other's experiences in streamlining the activities of informal milk markets. However, a very important catalyst has been the process supported by ECAPAPA. Experiences from other countries need to be observed, or reported on, before they are likely to be acted upon. The ECAPAPA initiative had exposed the regulators from the different East African countries to the situations in their neighbouring countries, as well as comprehensive reports on their own country. Whilst participants had been aware of all these issues to a large extent, the ability to obtain comprehensive reports, and then have facilitated processes for discussing these with their peers from neighbouring countries, enabled progress to be made which would have been very difficult without this support. It also enabled the development of a curriculum for training that was acceptable across the different countries.Therefore, the major influences that have lead to the agreement to recognise common training standards for small scale traders were: Realisation of country-to-country variances Recognition of regional cooperation and integration Box 6Specifically, Kenya's proactive engagement to train and licence small scale traders provided a specific model around which harmonisation and rationalisation of policy could form Lack of standardised training curricula at national level ECAPAPA project, which has facilitated exchange of ideas and experiences in other countries and the development of common training curricula. Acceptance of the fact that unregulated cross-border dairy trade is on-going and is likely to continue hence the need to legitimise and facilitate control of these trade activities.The influence already identified as \"Observing experiences in neighbouring countries\", which had been discussed above, was very relevant here. When such experiences are observed, good practices and successful engagement is likely to be replicated, and unsuccessful initiatives dropped. This inevitably leads towards similar initiatives occurring, and pressures for similar policies to emerge in countries with similar issues and circumstances. Specifically, Kenya's proactive engagement to train and licence small scale traders provided a specific model around which harmonisation and rationalisation of policy could formSince the uptake of the quality assurance scheme depends on active participation of traders and regulatory authorities, the current consultation with them will be extended to meetings among them and exposure to promising pilot projects in the region. This is expected to make them more willing to openly engage in activities geared towards the development of informal milk markets. Further changes towards harmonized and rationalized dairy policy can be expected in the short to medium term if the following action lines are implemented:1. The incorporation of the harmonised training guides in individual countries' work plans. This was agreed by participants from all countries. The agreement at the current meeting to have harmonised training curricula and guides was a big step forward towards this. 2. The bodies that should be responsible for taking this forward were the national dairy boards. These bodies should take the lead in implementing training. 3. However, funding of training was raised as an issue. Payment for training by the traders themselves would be the ideal situation, and this would have to be the medium to longer term aim. But initially there would be need for some support of training costs. This may be difficult within existing budget limitations. 4. A suggestion from Uganda's representatives was that the Uganda National Dairy Traders' Association (UNDATA) might be a source of funding for this training. 5. A specific issue of quality control at borders was raised by the Rwandan representative. He expected quality control procedures at the borders to be improved in the near future. However the is a general feeling among dairy regulators that for zoosanitary reasons, raw milk trade across borders should not be encouraged, although an evidence based opinion on this is still required. An alternative is cross border transportation of pasteurised milk in bulk for onward re-pasteurisation and retail packaging in the recipient country. These issues are still under discussion.The BDS market assessments to identify opportunities for implementing a training and certification scheme in each of the countries noted that as of now, BDS may only be viable in certain locations with high market access. To expand the services, various approaches to stimulate BDS demand, strengthen BDS supply and regulatory support services are needed (Box 7).Box 7.What needs to be done1. Raise awareness of the potential clients ~ On the value of DBDS in their respective dairy enterprises ~ On the availability of the services i.e. where to get them, ~ On the regulations that require them to use the DBDS, 2. Raise awareness of consumers on milk quality and why they should buy only from certified sources. 3. Establish/ reinforce laws and regulations that stimulate demand for DBDS 4. Develop DBDS packages that are appropriate, relevant, affordable and available. 5. Make the difference between those demanded/utilized the DBDS from those who haven't (promote and give identity to the DBDS users for increased recognition and profit 1. Accredit qualified DBDS providers 2. Harmonize DBDS provision with other stakeholders, 3. Promote DBDS packages and the providers, 4. Reduce bureaucracy in licensing, 5. Monitor performance of both users ad providers and act accordingly, 6. Tie DBDS utilization to licensing. Source: Mugittu, V., (2006) Where the BDS approach was found to be viable at present, it is recommended that follow-up actions be undertaken to pilot test the concept of training and certification of informal milk traders by involving BDS providers in each of the participating countries. Activities that should precede a pilot exercise on training and certification of informal milk traders are: 1) Printing of copies of the generic guides already approved by regulators in the region. Further tailoring or adaptation of the guides to suit specific circumstances may be needed in some cases e.g., translation 2) Conducting national consultations forum with key potential BDS providers, development partners, ministries responsible for livestock development, farmers and processors associations, informal milk traders in individual countries 3) Conducting training of trainers courses for potential BDS providers and their accreditation 4) Piloting of BDS provision of each of the six modules 5) Monitoring and evaluation of the impact of training and certification on milk trade practices and milk qualityThe objectives of each activity and key players are outlined in the table below. In order to test the applicability of the developed training modules it is important that pilot phase of the institutional approach to training and certification executed in each participating country. This should start with a baseline study on practices and quality of milk in the informal sector followed by training with regular monitoring and evaluation of changes in practices and quality of milk handled by trained versus untrained milk chain actors.Further, an assessment of the impact of the policy changes on the welfare of producers, traders and consumers would be useful in quantifying the benefits of the un-written (change of mindsets) and written policy changes. Note: Make training of processing personnel a pre-requisite for licensing. For supervisors formal dairy certificate/diploma training is essential.Require processors to employ operational personnel who have undertaken basic tailor made training for specific products they are employed to process (Butter making, Cheese making, Fermented milk, Liquid milk etc) which would lead to certification as Competent Butter makers, Cheese maker, Milk processor, Ice Cream maker etc) see for example 5 day DTI Naivasha modules on cheese, Butter, Cultured products. Products such as Cheese may require longer residential training (e.g. 4 weeks) coupled with industrial attachments (1-2 months) leading to \"Certified Cheese Maker\" qualifications "}
|
main/part_1/0029715605.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"99bb2245ea442b37a4ccd1294f18ae6c","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f8999ee5-4925-4ee0-a6c4-5c772d10f234/retrieve","id":"-1661340329"},"keywords":[],"sieverID":"ae7bfc46-c704-43ad-b78e-893be435f0fb","content":"Bean flour products consumption has improved the last five years from zero in 2017 to 5.2 million people in 2022 (3.387,719 women and 1,824,156 men).CGIAR Innovation Packages and Scaling Readiness (IPSR)The nature of this innovation isInnovations that already exist and undergo constant, steady progress and improvement.Innovations that strengthen capacity, including farmer, extension or investor decision-support services; accelerator/incubator programs; manuals, training programs and curricula; online courses. The innovation is validated for its ability to achieve a specific impact under uncontrolled conditionsThe innovation is being tested for its ability to achieve a specific impact under uncontrolled conditionsThe innovation is validated for its ability to achieve a specific impact under semi-controlled conditionsThe innovation's key concepts have been validated for their ability to achieve a specific impactThe innovation is being tested for its ability to achieve a specific impact under semi-controlled conditionsThe innovation's key concepts are being formulated or designedThe innovation is validated for its ability to achieve a specific impact under fully-controlled conditionsThe innovation's basic principles are being researched for ability to achieve a specific impactThe innovation is being tested for its ability to achieve a specific impact under fully-controlled conditionsThe innovation is at idea stage "}
|
main/part_1/0031737557.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"cc071f81f10f8e9be7ea4cde16e1114f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/315d745f-acf5-4e25-a845-b362ec6e49e3/retrieve","id":"668372716"},"keywords":[],"sieverID":"9b7f23a2-31b1-4cf9-b0f5-87c814b13ada","content":"The study was carried out to evaluate the genotype by environment (G × E) interaction on physicochemical and functional properties of ten (10) cassava advanced genotypes and improved varieties. The genotypes and varieties were collected from a multi-location trial (Uniform yield) of the IITA breeding program at four research stations in Malawi. Based on the results, G × E interaction was highly significant (P ≤ 0.001) in explaining the variance of the physicochemical parameters and functional properties. Thus, G × E interaction highly influenced starch and amylopectin contents, swelling power, and water binding capacity. Additive main effect and multiplicative interaction (AMMI) analysis identified I010040, MM06/0045 and TMSL110080 genotypes and Mbundumali, Mpale and Sagonja varieties as the most stable with high yield performance hence recommended for cultivation in a wide range of environments for the production of high quality cassava flour (HQCF) and starch for various industrial applications such as the production of ethanol, biofuels, starch and glucose syrup in chemical industries; thickeners, stabilizers, and texture modifiers in food, bakery and confectionery industries.Cassava (Manihot esculenta Crantz) is a starchy tropical root crop that is the staple food of an estimated 800 million people worldwide (Matchaya and Nhlengethwa, 2014;Nassar and Ortiz, 2006.). Cassava is grown almost exclusively by low-income, smallholder farmers, as it is one of the few staple crops that can be produced efficiently on a small scale, without the need for mechanisation or purchased inputs, and in marginal areas with poor soils and unpredictable rainfall (Nilusha et al., 2021). On the other hand, high quality cassava flour (HQCF) and cassava starch can be used for various industrial applications such as the production of ethanol and biofuels, starch and glucose syrup, and sweeteners in chemical industries; thickeners, stabilizers, and texture modifiers in food, bakery and confectionery industries; binders and adhesives in paper making and plywood industries; and fillers as well as stiffeners in textile and packaging industries (Chitedze et al., 2012;Chimphepo et al., 2021a,b). However, the recommendation of preferred cassava genotypes and varieties for such industrial applications is highly based on their functional properties, which are influenced by physicochemical parameters. As such, cassava genotypes and varieties with high yield and desirable physicochemical and functional properties will be identified for targeted industrial uses, positively influencing the commercialization of the cassava roots for industrial applications.The physicochemical parameters and functional properties of flours from advanced cassava genotypes and improved cassava varieties for industrial applications were evaluated by Chimphepo et al. (2021a,b). However, there is a need to identify further cassava genotypes and varieties with high yield and stability performance (with desirable physicochemical and functional properties) that can survive in a diverse range of environments to produce HQCF and starch for targeted industrial uses. Since Malawi has diverse agro-ecological zones, in terms of edaphic and climatic factors, the genotype by environment interaction (G × E) effect is inevitable (Benesi et al., 2008)and,therefore,complicates the recommendation of genotypes based on yield, physicochemical parameters and functional properties alone (Akinwale et al., 2011;Hugh and Gauch, 2013). In this context, the study was undertaken to evaluate the G × E interaction on cassava qualities desirable for industrial applications: root dry matter content, bulk density, starch and amylopectin content, water binding capacity, oil absorption capacity, swelling power and solubility of cassava flour (Chimphepo et al., 2021a,b). As such, the results of this study will contribute to efforts to fast-tracking the suitable cassava genotypes and varieties with high yield and stable performance for various industrial applications. 1, 2 and Table 1). In Malawi, the agro-ecological zones are categorised, mainly according to elevation (Fig. 1a), as Lower Shire valley (altitude below 200 m.a.s.l), Lake shore, middle and upper Shire valley (>200 to 760 m.a.s.l), mid-elevation (>760 to 1300 m.a.s.l) and highlands (>1300 m.a.s.l) (Matchaya and Nhlengethwa, 2014). The spatial variation of climate variables (temperature, humidity and rainfall) depends on elevation, and therefore, the agro-ecological zones represent the spatial climatic zonation of the country (Ngongondo et al., 2011).Chitala and Mkondezi research stations are located in the lake shore, upper and middle Shire valley agro-ecological zone, whereas Chitedze and Njuli are situated in the mid-elevation agro-ecological zone (Fig. 1a). All locations have a tropical wet and dry \"savanna\" climate (Ngongondo et al., 2011), characterized by a distinct rainy season between November and April and hot and cool from October to December and May to July, respectively (Fig. 2). In general, the lake shore, upper and middle Shire valley agro-ecological zone (Mkondezi and Chitala stations) is characterized by higher mean monthly temperatures than the mid-elevation zone (Fig. 2). Monthly mean temperatures at Mkondezi, Chitala, Chitedze and Njuli fall in the range [19][20][21][22][23][24][25][26][27][28]respectively (Figs. 1c and 2). In terms of rainfall, the area of Mkondezi research station receives higher total annual rainfall of over 1500 mm per year than the other stations (Fig. 1b), which peaks in March (Fig. 2). For the 2016-2017 growing season, total annual rainfall of 1021 mm, 982 mm, 965 mm and 940 mm were received at Mkondezi, Chitala, Chitedze and Njuli stations, respectively. For the same period, the average monthly L. Chimphepo, M. Monjerezi, E.O. Alamu et al. Annals of Agricultural Sciences 67 (2022) 147-157 temperatures were in the range of 22-28 °C, 22-29 °C, 17-24 °C and 17-24 °C at Mkondezi, Chitala, Chitedze and Njuli, respectively. At Mkondezi, the dominant soils are strongly acidic sandy loam to sandy clay, with variable low to medium nutrient levels because of leaching. They are low in nitrogen, phosphorous and cation exchange capacity (CEC). Exchangeable potassium is marginally adequate (Table 1), whereas calcium and magnesium are favourable only at selected sites (Bationo et al., 2012). Chitala and Chitedze soils are slightly acidic sandy clay and sandy clay loam with lower phosphorus (P) levels (Table 1). Chitedze soils have relatively higher levels of potassium (K). The soil texture varies from sand clay to sand clay loam (Table 1), and these differences may cause significant moisture and nutrient holding capacity variations.The cassava samples comprised of Mpale, Mbundumali, Sauti and Sagonja varieties (hereafter referred to as genotypes), and I010040, I010085, I020452, TMSL110080, TMEB419 and MM06/0045 genotypes which were planted on 22 December 2016 in a randomized complete block design with four replications. Four replicates of the sample were harvested at 12 months later from only two middle rows and then processed within 24 h of harvesting. The cassava roots were washed, peeled and sliced into 20 mm (thickness) pieces oven-dried at 60 °C for 48 h (Kehinde et al., 2014). The dried chips were ground into flour using a laboratory mortar and pestle, sieved through a 0.25 mm metal mesh to produce a consistent 0.25 mm particle size and then packaged in polythene bags and stored awaiting analysis.Fresh root dry matter content was determined using the oven method as described by Chimphepo et al. (2021a,b). 10 g of fresh cassava sample, weighed in pre-weighed dishes, dried in an oven at 110 °C overnight, cooled the following morning in a desiccator for 2 h and weighed again.Bulk density was estimated following the method used by Iwe et al. (2017).Theflour sample (10 g) was put into a 25 mL volumetric cylinder. The lower surface of the cylinder was tapped several times on the laboratory bench until there was no more diminution of the sample level. The sample weight was then determined, and bulk density was expressed as the weight/volume of the sample (g/mL).Total starch (anthrone reagent) content and amylose (iodine reagent) content were determined by UV/VIS spectrophotometry (Oladayo et al., 2016). For starch analysis, 100 mg of the flour samples (cassava and HQCF) were weighed into 50 mL centrifuge tubes and homogenized with 30 mL of hot 80 % ethanol to remove sugars and then centrifuged for 10 min (Gallenkamp, England. CAT. No: CF 405. App. No: 8A 8840E) and residue retained. The residue was washed repeatedly with hot 80 % ethanol until the washings did not give the colour with anthrone reagent. The residue was dried well over a water bath. 5.0 mL of water and 6.5 mL of 52 % perchloric acid were added to the dried residue, and then total starch was extracted at 0 °C for 20 min. After 20 min of total starch extraction, the sample was centrifuged for 5 min, and the supernatant was saved. The supernatant was made up to 100 mL by distilled water. Then 0.1 mL of the supernatant was pipetted into a boiling tube using a micropipette and made up to 1.0 mL with distilled water.Thus, to determine total starch content, calibration curves were derived using D (+) Glucose Anhydrous (SAAR2676020EM, Merch, Wadeville, Gauteng, RSA), where the stock solution was prepared by dissolving 100 mg of glucose in 100 mL of distilled water, and then working standards of glucose were prepared (by diluting 10 mL of stock solution into 100 mL flask to its mark) as 0.2, 0.4, 0.6, 0.8 and 1 mL of working standard of D (+) Glucose Anhydrous (SAAR2676020EM, Merch, Wadeville, Gauteng, RSA) which were also made to the mark of 1 mL volume and \"0\" served as a blank. Then 4 mL of anthrone (400 mg dissolved in 200 mL of ice cold 98 % sulphuric acid) were added to the samples, as well as to the standard solutions of glucose and boiled (100 °C) for 8 min on a water bath, after cooling, standards and samples were read on UV/VIS Spectrophotometer (S/N: 20-1901-0351; Model: T90+; PG instruments Ltd) at 630 nm. Glucose concentration in the sample was estimated using a calibration curve and Eq. (1).where m = Slope of calibration curve Then starch content was calculated by multiplying the value of glucose content estimated from above by a factor of 0.9.Amylose content was determined by UV/VIS spectrophotometry (Oladayo et al., 2016), 100 mg of cassava flour sample was added to 1 mL of 99.9 % ethanol, and then 10 mL of 1 N NaOH (4 g of NaOH pellets was dissolved in 100 mL of distilled water) was added and left overnight. Then the volume was increased to 100 mL using distilled water. A 2.5 mL of the extract was taken, and 20 mL of distilled water was added, followed by 3 drops of phenolphthalein. Then 0.1 N Hydrochloric acid was added drop by drop until the pink colour just disappeared. Then 1.0 mL of iodine reagent (1.0 g of Iodine and 10 g of KI dissolved in distilled water and made up to the mark of 500 mL volumetric flask) was added and blue black colour developed and the volume was increased to 50 mL using distilled water.Calibration curves were derived using pure amylose from potato (A0512; Sigma-Aldrich, St. Louis, MO, USA), prepared (100 mg amylose was dissolved in 10 mL of 1 N NaOH and the volume increased to 100 mL using distilled water) as 0.2, 0.4, 0.6, 0.8 and 1 mL, and the colour was developed as in the case of the sample. For a blank, 1.0 mL of iodine reagent was diluted to 50 mL with distilled water. Hence the colour developed for samples and amylose standards was read on UV/VIS Spectrophotometer (S/N: 20-1901-0351; Model: T90+; PG instruments Ltd) at 590 nm. Eq. ( 2) was used to calculate the amount of amylose in cassava flours.Absorbance that corresponds to 2:5 mL of the test solutionwhere x = Glucose concentration The amylopectin content of a flour sample was calculated as a difference between total starch content and amylose content of the flour sample (Oladayo et al., 2016).Swelling power and water solubility were determined using methods described by Kusumayanti et al. (2014). To determine the swelling power of cassava flours, a 0.1 g flour sample was mixed with 10 mL distilled water and heated at 90 °C for 1 h, with constant mixing. Then, the suspension was cooled rapidly, equilibrated at 25 °C and centrifuged for 30 min at 1600 rpm (Gallenkamp, England. CAT. No: CF 405. App. No: 8A 8840E), and then the sediments were weighed. For solubility, a 0.5 g flour sample was heated in 10 mL distilled water at 60 °C (in a water bath) for 30 min, without mixing. The sample was centrifuged at 1600 rpm for 10 min rpm (Gallenkamp, England. CAT. No: CF 405. App. No: 8A 8840E). The supernatant (5 mL) was separated, dried and weighed. The flour's swelling power and water solubility were calculated using Eqs. ( 3) and (4), respectively. Water binding capacity and oil absorption capacity were determined according to methods described by Agyepong and Barimah (2018) and Iwe et al. (2017), respectively. 2.0 g of the flour sample was dissolved in 40 mL of water in a centrifuge tube for water binding capacity. The suspension was agitated for 1 h at room temperature on a shaker and centrifuged for 10 min at 2200 rpm. The free water was decanted from the pellet, drained for 10 min, and pellet weighed. For oil absorption capacity, 1 g flour sample was mixed with 10 mL soybean oil (Specificgravity: 0.9092) and allowed to stand at ambient temperature (30 ± 2 °C) for 30 min centrifuged for 30 min at 300 rpm. Water and oil absorption capacities were determined using Eq. ( 5).ðÞ Absorption Capacity g=100 g ðÞ ¼ Weight of absorbed water Oil ðÞ Weight of initial flour  100 ð5ÞSoftware R version 4.1.0 (A language and environment for statistical computing) was used for the analysis of variance (ANOVA) and all other statistical analyses such as phenotypic and genotypic correlations across L. Chimphepo, M. Monjerezi, E.O. Alamu et al. Annals of Agricultural Sciences 67 (2022) 147-157 all trials (multi-environment trial analysis, META R Ver 5.0) (Alvarado et al., 2020). ANOVA was performed on physicochemical and chemical parameters (root dry matter content, bulk density, starch and amylopectin content of flour) and functional properties of cassava flour (swelling power, water binding capacity, oil absorption capacity and solubility) of each of the individual trials. After that, an additive main effect and multiplicative interaction (AMMI) analysis was performed to identify the most stable genotypes and location (Akinwale et al., 2011;Hugh and Gauch, 2013) and allocate all unstable genotypes to the most suitable location (Hugh and Gauch, 2013). The bi-plots of IPCA1 vs mean response variable were produced using the ggplot2 package to visually evaluate the performance and stability of genotypes (and varieties) and environments. In addition, stability tests such as Shukla's stability variance and Kang's yield-stability statistics were calculated to identify most stable genotypes by simultaneous selection for stability and yield performance variable. The selected genotypes were then ranked according to AMMI yield stability index (YSI) (Sabaghnia et al., 2008) to identify most stable cassava genotypes and varieties with high yield according AMMI.3.1. Correlations and variations of fresh root dry matter content and cassava flour quality parameters with genotype and location Data used in this study are deposited in a Mendeley public repository (Chimphepo et al., 2021b). Phenotypic correlations of physicochemical parameters and functional properties revealed high significant (P ≤ 0.05) positive correlations for starch content with amylopectin content, bulk density with swelling power (SP), and dry matter content with water binding capacity (WBC) (Fig. 3). On the other hand, genotypic correlations showed high significant (P ≤ 0.05) positive correlations for bulk density with oil absorption capacity (OAC) and dry matter content with solubility and OAC (Fig. 3). Both correlations showed a relationship between physical parameters (bulk density and dry matter content) and functional properties (OAC, WBC, SP and solubility). Chimphepo et al. (2021a,b) found that starch and amylopectin content were the major determinants of variability in cassava flours' functional properties, such as water and oil absorption capacities, solubility, and swelling power. However, the study further looked at the expression of the crop in terms of functional properties, where the phenotypic correlation may be more appropriate (Benesi et al., 2008).Variations for bulk density, root dry matter content, chemical parameters such as starch and amylopectin contents, and functional properties, namely; swelling power, solubility, water binding capacity and oil absorbance capacity, were highly significant (P ≤ 0.001) for the main effects of genotype (G) and environment (E) as well as G × E interaction (Table 2). The results further show that the environment highly influenced fresh root dry matter content, bulk density, and solubility, and contributed 49.82 %, 85.10 %, and 85.10 %, respectively, to the total sum of squares (Table 2). Furthermore, fresh root dry matter content strongly depends on the edaphic-climatic and agronomic conditions (Benesi et al., 2008). On the other hand, genotype and environment interaction played a major role in influencing starch content, amylopectin content, swelling power, and WBC, with contributions of 49.97 %, 45.07 %, 58.42 %, and 50.17 %, respectively, of the total sum of squares (Table 2). OAC was influenced by genotype, location, and interaction with contributions of 22.19 %, 30.49 %, and 30.82 %, respectively, of the total sum of squares (Table 2).In general, the results from this study were in agreement with similar studies that reported variations in starch and dry matter content across genotypes (or varieties) and locations (Benesi et al., 2004;Sriroth et al., 2000). Variations in dry matter content, starch and amylopectin content and bulk density were highly significant (P ≤ 0.05) for genotypes and locations (Fig. 4). Mkondezi was the best site for dry matter content, followed by Njuli, with TMEB419, Mpale and Mbundumali as the highest yielding varieties and genotypes (Fig. 4). Chitala was the best site for bulk density, starch and amylopectin content (Fig. 4). Cassava genotypes and varieties that gave the highest starch content, amylopectin content and bulk density at Chitedze were Sagonja, I020452, TMSL110080, TMEB419 and I010040 for bulk density, I010040, TMSL110080 and I010085 for starch content and amylopectin content (Fig. 4). In addition, most flour properties obtained in this work were comparable with previous studies registering high starch ranging from 72.39 g/100 g to 84.15 g/100 g and high amylopectin content ranging from 64.49 g/100 g to 74.50 g/100 g, high bulk density ranging from 0.65 g/mL to 0.69 g/mL (Agyepong and Barimah, 2018;Benesi et al., 2004;Sriroth et al., 2000).In terms of functional properties, Mkondezi was the best site for WBC, whereas Njuli was the least performing site. Chitala was the best site for oil absorption capacity, swelling power and solubility (Fig. 5). Cassava genotypes and varieties that gave high values at Chitedze were Mbundumali, Mpale, Sagonja, TMSL110080 and I010040 for OAC; Mbundumali, MM06/0045, I020452, TMSL110080, I010040 and I010085 for swelling power; and starch content while TMEB419, I010085, Mbundumali, MM06/0045, I010040 were for solubility (Fig. 5).The results show that the best sites for bulk density, dry matter content, chemical parameters (starch and amylopectin content) and functional properties (swelling power, solubility, water binding capacity and oil absorbance capacity) were Chitala and Mkondezi sites L. Chimphepo, M. Monjerezi, E.O. Alamu et al. Annals of Agricultural Sciences 67 (2022) 147-157 located in the Lake Shore agro-ecological zone. Genotypes TMEB419, MM06/0045, I020452 and varieties of Sauti, Mbundumali and Mpale had high dry matter content in Mkondezi. Dry matter content is closely related to soil moisture content during 6-18 months of plant growth, which is a function of the amount and distribution of rainfall and soil properties (Byju and Suja, 2020). Most of the sites have sandy loam and sandy clay loam soils (Table 1), which are the most preferred soil types for tuberous root development (Bationo et al., 2012)andalsoprovide better soil nutrient retention (Byju and Suja, 2020). On the other hand, all these analysed functional properties gave high values consistent with what other studies found (Agyepong and Barimah, 2018;Benesi et al., 2004;Iwe et al., 2017). Generally, the Mkondezi research station receives higher (>1500 mm per year) (Fig. 1) and well-distributed rainfall than the other stations (Benesi et al., 2008). For optimum growth and production, cassava requires an annual rainfall of >1000 mm (El-Sharkawy and Cadavid, 2002). However, it can survive in a wide variation of rainfall conditions ranging from <600 mm in semi-arid tropics to >1600 mm in subhumid/humid tropics (Allem, 2002). High temperatures are also known to accelerate the growth and formation of tuberous roots of cassava (Nassar and Ortiz, 2006), and cassava is adapted to tropical semi-arid conditions. The Lake Shore agroecological zone has a relatively higher annual temperature than the mid-elevation agro-ecological zone. In Malawi, cassava is mainly grown along with the lake shore areas of the central and northern regions (Benesi et al., 2008). Optimum annual mean temperatures for growth and tuberous root production range from 25 to 30 °C for cultivars adapted to cool climates and 30-36 °C for cultivars that come up well in hot-climate (El-Sharkawy, 2006). The higher dry matter content and water binding capacity at the Mkondezi site correspond to higher rainfall and soil organic matter content (Howeler, 2002)t h a nt h e other sites. Potassium content in soil influences bulk density, starch and amylopectin content, solubility, swelling power and oil absorption capacity (Benesi et al., 2008). Table 1 confirms what Benesi et al. (2008) found that Chitala has high potassium content. Chitedze also shows higher soil potassium content (Benesi et al., 2008; Table 1), giving high bulk density, starch and amylopectin content, solubility, swelling power and oil absorption capacity (Figs. 4 & 5). The critical level of L. Chimphepo, M. Monjerezi, E.O. Alamu et al. Annals of Agricultural Sciences 67 (2022) 147-157 exchangeable soil potassium for cassava is reported to be in the range of 0.15-0.25 cmol/kg (Fernandes et al., 2017). Potassium is important for starch synthesis, translocation, and tuber initiation and bulking (Howeler, 2002). Therefore, potassium is associated with total starch yield, root diameter and weight, storage cell size and number, and dry matter (Chua et al., 2020;Fernandes et al., 2017).According to Sabaghnia et al. (2008), the stability analysis was required for the interaction of genotypes by locations (Table 2) for bulk density, dry matter content, chemical parameters (starch and amylopectin content), and functional properties (swelling power, solubility, water binding capacity and oil absorbance capacity) of the cassava flours were highly significant (p < 0.001). AMMI analysis indicated that the first interaction principal component (IPC1) explained 62.4 % of the variation for dry matter content. IPC scores revealed that the most stable genotypes and varieties were MM06/0045, Mpale, TMEB419 and TMSL110080, with Chitedze as the most stable site. TMSL110080 had the highest fresh yield root dry matter content at Mkondezi, and therefore, Mkondezi is the most suitable for high yield of dry matter content. The most unstable genotype was I020452 and was most suited at Chitala (Fig. 6). Chitala and Njuli were the most unstable sites for growing cassava with high dry matter content (Fig. 6).AMMI analysis for bulk density of cassava flours from the genotypes and varieties for genotype interactions by location indicated that IPC1 explained 75.20 % of the G × E interaction. IPC scores revealed that the most stable genotypes and varieties were I010085, I010040 and Mbundumali. Mkondezi was the most stable site, whereas Chitala was the most unstable site for bulk density (Fig. 6). The most stable genotypes for amylopectin and starch were TMSL110080, I010040, Sauti, TMEB419 and I020452. Mkondezi and Chitala were the most stable sites, with Chitala presenting a better opportunity for higher starch and amylopectin content. MM06/0045 and I010085 were the most unstable genotypes (Fig. 6).The results showed that IPC1 explained 58.80 % and 59.80 % of the swelling power and solubility variance, respectively. TMSL 110080, I010040, I020245, Sauti and Sagonja were the most stable genotypes for swelling power (Fig. 7). Mpale was best suited at Mkondezi and Chitedze, whereas Chitala was the most unstable location for swelling power (Fig. 7). For solubility, IPC scores show that the most stable genotypes were I010040, Sagonja, MM06/0045, Mpale, I020452 and Mbundumali. TMEB 419 and Sauti were best suited at Chitala and Njuli, respectively. Chitedze was the most unstable location for solubility (Fig. 7).For OAC and WBC of flours from the cassava genotypes and varieties studies, the IPC1 explained 83.1 % and 71.5.80 % of the variance from G × E interaction, respectively. TMSL110080 was the most stable genotype for WBC, followed by I010040 and TMEB 419 and the varieties of Mpale and Mbundumali. Njuli was the most unstable location for water binding capacity (Fig. 7). IPC scores showed Sauti, Sagonja, I010085 and I010040 as the most stable genotypes for OAC, with Mkondezi as the most stable location. Chitala and Chitedze were the most unstable location for oil absorption capacity (Fig. 7).Rankings of genotypes for the fresh root dry matter content and cassava flour qualities varied from one location to the other and with the particular quality parameter. The summary of the rankings of stability for genotypes was obtained by calculating the stability tests such as Shukla's stability variance (Shukla, 1972) as well as Kang's yieldstability statistics (Kang, 1993) where the most stable genotypes and varieties with high yield performance were identified in a simultaneous selection. Then AMMI stability value (ASV) and Yield stability index (YSI) were used to rank as well as identify those selected genotypes as most stable with high yield performance (Sabaghnia et al., 2008). The most stable genotype is the one with the lowest ASV score and is ranked 1. The YSI is based on the sum of the ranking due to ASV scores and yield or performance ranking. Genotype with low YSI value is the most stable with high mean yield performance, ranking 1.The results of the ranking and selection are shown in Fig. 8,with Mbundumali and I010040 being the most stable with high yield performance. I010040 yielded high starch and amylopectin content, bulk density, OAC, solubility and swelling power, whereas Mbundumali yielded higher fresh root dry matter content and water binding capacity (WBC) (Fig. 8). They are followed by Mpale, Sagonja, MM06/0045 and TMSL110080 genotypes (Fig. 8), with TMSL110080 having the highest yield performance of fresh root dry matter content (Fig. 8).The location influenced the fresh root dry matter content, bulk density, and solubility. In contrast, G × E interaction influenced the starch content, amylopectin content, swelling power, and water binding capacity. The appreciable influence of location supports that cassava genotypes' fresh root dry matter content depends on the edaphic-climatic and agronomic conditions. Growing cassava genotypes in well-suited environments will definitely achieve high fresh root dry matter content, starch and amylopectin content, and their associated functional properties. For instance, Mkondezi and Chitala are well suited for genotypes with high fresh root dry matter content, starch and amylopectin content, bulk density and the functional properties, probably because of the role of high temperatures, rainfall and soil organic matter and potassium content in accelerating cassava growth and bulking of tuberous roots.Based on the principal component analysis, MM06/0045, Mpale, TMEB419 and TMSL110080 were the most stable genotypes for dry matter content, and Chitedze was the most stable site. I010085, I010040 and Mbundumali were the most stable genotypes for bulk density, and Mkondezi was the most stable site. For amylopectin and starch, the most stable genotypes were TMSL110080, I010040, Sauti, TMEB419 and I020452. Mkondezi and Chitala were the most stable sites, with Chitala presenting a better opportunity for higher starch and amylopectin content. MM06/0045 and I010085 were the most unstable genotypes for amylopectin and starch and were best suited at Chitedze. Mbundumali and I010040 were the most selected for both improved stability and better yield performance according to AMMI. I010040 showed higher starch-related properties (starch and amylopectin content, bulk density, OAC, solubility and swelling power), whereas Mbundumali yielded higher dry matter content and WBC. They are followed by Mpale and Sagonja varieties and MM06/0045 and TMSL110080 genotypes, with TMSL110080 as the highest yielding in dry matter content. To this end, the high-yielding improved genotypes in the trial did not completely outperform the released and local varieties in terms of stability. Generally, most advanced genotypes showed comparable stability but yielded the same functional properties as the released and local varieties. The lack of association between high root yield and stable performance of advanced genotypes suggests further research into the nature of stability of performance of cassava genotypes destined for industrial applications. "}
|
main/part_1/0033175946.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"6f6499040123e52b7b09ad019b5d522f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/e750174a-bbeb-4eda-b8e9-76a6493502e1/retrieve","id":"-958430609"},"keywords":[],"sieverID":"0731c14d-fac3-4936-a526-3f3694957944","content":"Targeted pest control -Highly selective and target specific pests, such as aphids, whiteflies, thrips, and fungus gnats. -Capture pests without harming beneficial insects like bees, ladybugs, and predatory insects.-Minimizes the reliance on chemical pesticides -Reduces the pesticide residues in the environment, food, and water sources.Early detection and monitoring -Sticky traps serve as monitoring tools for detecting pest infestations at an early stage. -They provide visual evidence of pest activity, allowing growers to implement timely control measures before infestations become severe.-Captures adult pests before they lay eggs or feed on plants. -Helps reduce crop damage and yield losses caused by pest infestations.-Non-toxic and do not rely on chemical pesticides to control pests. -Help to reduce the risk of harmful pesticide residues on the environment, food, and surrounding ecosystems.Cut plastics into rectangles (20x30cm) -Make two small holes at the top and in the middle of the plate.-Thread the twine through the two holes -Attach the plate to the stake -Spread glue or motor oil on pieces of plastic using the brushes -Instal 40 traps per hectare just after transplanting.-Maintenance involves cleaning and replenishment of the glue or motor oil. • Faire deux petits trous en haut• Passer la cordelette à travers les deux trous.• Fixer la plaque au piquet.Passer de la colle ou de l'huile de moteur sur des morceaux de plastique à l'aide des brosses.Installer 40 pièges par hectare juste après la transplantation.L'entretien implique le nettoyage et le rechargement de la colle ou de l'huile de moteur. "}
|
main/part_1/0034525050.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"cad8e8d9aad6b66e66a6a95d03c2bb4a","source":"gardian_index","url":"https://repository.cimmyt.org/server/api/core/bitstreams/b6dd2584-b429-4c45-8a8e-7f9725542afa/content","id":"-669858194"},"keywords":[],"sieverID":"2912ed21-ddbb-4f6a-9ecd-bfb77fe62419","content":"In Bangladesh's south-central coastal zone, there is considerable potential to intensify crop production by growing dry winter season 'Boro' rice, maize, wheat, pulses and oilseeds using irrigation from southward flowing and predominantly freshwater rivers. However, the impacts of surface water withdrawal for sustained irrigation and its safe operating space remain unclear. We used field measurements and simulation modeling to investigate the effects of irrigation water withdrawal for Boro rice-the most water-consumptive crop-on river water flow and salinity under different climate change and river flow scenarios. Under the baseline conditions, about 250,000 ha could potentially be irrigated with river water that has salinity levels below 2 dS/m. The impact on river water salinity would be minimal, and only between 0.71 to 1.12% of the cropland would shift from the 0-2 dS/m class to higher salinity levels. Similarly, for the moderate climate change scenario (RCP 4.5) that forecasts a sea level rise of 22 cm in 2050, there would be a minor change in water flow and salinity. Only under the extreme climate change scenario (RCP 8.5), resulting in a sea level rise of 43 cm by 2050 and low flow conditions that are exceeded in 90% of the cases, the 2 dS/m isohaline would move landward by 64 to 105 km in March and April for the Tentulia and Buriswar Rivers. This would expose an additional 36.6% of potentially irrigable cropland to salinity levels of 2 to 4 dS/m. However, Boro rice will already be well established by that time and can tolerate greater levels of salinity. We conclude that there is considerable scope to expand irrigated crop production without negatively exposing the cropland and rivers to detrimental salinization levels while preserving the ecosystem services of the rivers.Bangladesh, a deltaic country in South Asia, has a land area of 14.5 million ha and a human population of over 170 million. While the population is still growing at about 1% per year, agricultural land availability decreased from 9.4 million ha in 1976 to 8.5 million ha in 2011, resulting in 0.05 ha of arable land per person [1]. Food security remains a concern, especially in the coastal zone [2]. New avenues are needed for low-cost and sustainable food production and to create opportunities for farmers to generate more income, as poverty and hunger are closely interlinked [3]. The United Nations' sustainable development goal (SDG) 2, \"Zero hunger,\" advocates that increased agricultural productivity must be achieved in a sustainable manner. Expansion of the cropland area entails risks, including further encroachment into forests and other natural habitats [4]. In response, sustainable intensification (SI) has been proposed as a set of principles to increase crop and livestock yields and associated economic returns without negative impacts on soil and water resources or the integrity of non-agricultural ecosystems [5,6]. The diversion of river water for irrigation in a delta region is risky, as it can alter water flow and thus cause saltwater intrusion, which is likely to get exacerbated by sea level rise caused by global warming [7]. This study explores whether it is possible to intensify crop production with irrigation in the delta region of Bangladesh while staying within the safe operating space and thus preserving the ecosystem services of the rivers [8,9]. Exempting Bangladesh's coastal zone and mountainous eastern fringes, most land is already cropped with 2-3 crops per year, mainly rainfed rice during the monsoon 'Aman' season, and irrigated rice and other crops during the dryer winter months ('Rabi' season). In the north, groundwater is the primary source of irrigation water. However, in the low-lying coastal zone in the south, which is about 1 to 3 m above sea level, easily accessible groundwater is generally too saline for irrigation [10]. About 0.24 million ha of cropland is left fallow during the dry winter months in southwestern Bangladesh [11][12][13]. Most of the winter fallow land (0.074 million ha) is in the Barisal division in the south-central hydrological coastal zone, with a cropland area of approximately 0.54 million ha [14]. In that division, about 0.32 million ha are cultivated under low input conditions with little to no irrigation and fertilizer in the winter. Only 0.15 million ha are cropped using higher rates of water and nutrients [14]. Krupnik et al. [14] also mentioned that, using diversified crop (maize and wheat instead of 'Boro' rice) with proper irrigation management at least 20,800 and 103,000 ha of fallow and rainfed agriculture can be converted into enhanced double cropping, respectively. Hence, there is a considerable potential to intensify crop production by growing Rabi season rice (also known as 'Boro'), maize, wheat, pulses and oilseeds during the winter in this division. However, most of these crops will require irrigation, which can potentially be supplied using surface water when and where it is sufficiently fresh [15][16][17]. Schulthess et al. [18] reported yields as high as 7 t ha -1 for maize and higher than 2 t ha -1 for wheat for this area. Bhattacharya et al. [19] concluded that by draining surface water just before monsoon rice maturity, it is possible to practice highly productive and profitable triple-cropping systems in low soil salinity portions of the coastal zone by including maize or sunflower in the winter season, a short duration rice in pre-monsoon (Kharif-1) season, and a medium duration rice in the full monsoon (Kharif-2) season. The use of surface water for irrigation responds to Bangladesh Government's priorities articulated in a policy that encourages substantial investments to increase cropping intensity on currently winter fallow and rainfed croplands and to expand the use of surface water irrigation during the dry season [20]. Such developments could be a logical place to start defining the environmentally sound 'envelope' for intensification potential in this region.In the Barisal division, five major rivers and numerous canals cross the landscape. Canals are natural and assist in bringing tidally mediated water inland and drain out excess water during the rainy season, both of which are important ecosystem services [21]. Considering the ecosystem service of freshwater supply, Krupnik et al. [14] reported that nearly 0.06 million ha of land could be irrigated in this division with surface water pumps using river and canal water during the winter. That study limited the area that can be irrigated to a buffer of 0.4 km on both sides of the rivers and major canals due to the limited lift and water conveyance capacity of most surface pumps. In our study region, canals have been partially used for irrigation, transport, and supply of fish species, but many have become silted up, rendering some sluice gates that have been installed to manage fresh and saline water flow inactive [22,23]. However, with rehabilitation and appropriate water flow infrastructure, rivers and canals could be utilized efficiently by irrigating most of the land [14]. Hence, an ex-ante analysis of the safe operating space is a prerequisite for their restoration, as it would require a significant investment. Conversion to large scale irrigation during the winter months may need a considerable amount of water, which in turn could reduce river flow. This, combined with sea level rise (SLR), may cause an increase in salinity conditions at the downstream end of these tidal rivers.The dense network of canals and rivers, tidal amplitude and flow dynamics, the extent of landward entry of tides, the volume of freshwater flow from upstream catchments, and salinity fluctuations in the river basins strongly govern the availability of fresh water for dry season cropping in the southern delta [24,25]. Assessment of water flow and salinity of the regions' rivers and interlinked natural and man-made canal systems are essential starting points to determine the quantity of available freshwater during the Rabi season. The water flow and salinity could be estimated by field sampling and measurements, although such measurements and monitoring at every point of interest would neither be feasible nor costeffective. Instead, well-calibrated simulation models can be applied to understand and quantify the water flow, as well as soil and water salinity under the current and future climate change.Hence, the objectives of the current study were to (i) improve the river water flow and river water salinity models for their applications in southern coastal Bangladesh and (ii) apply those models under different climate change scenarios to quantify the effects of river water withdrawal on surface water availability and salt intrusion to assess the potential for crop intensification in the coastal region at present and under future climate change conditions. These objectives were achieved by calibrating the models for the rivers and canal systems of the south-central coastal area based on field measurements and secondary data and applying them under various scenarios of climate change and SLR. The overall goal was to determine the safe operating space for expanding irrigated dry-season agriculture using available surface water. We wanted to determine whether critical levels of river flow could be maintained to safeguard the river ecosystem and prevent the intrusion of saline water into the delta under various climate change scenarios. We present it as a case study that links different disciplines and addresses SDG 2 (Zero hunger), SDG 6.4 (sustainable freshwater withdrawals) and SDG 13 (combat climate change and its impacts). Such a study could largely be applied to most deltas globally exposed to SLR and salt intrusion and with a scarcity of quality irrigation water for sustainable crop intensification.The manuscript is divided into the five sections. Section 1 is introduction. Section 2 describes the climate conditions, river data collection plan (water level, flow and salinity), description of river basins and hydrological situation of the study area, description of the mathematical model framework, calibration and validation of the model, and scenario generation with climate change projection and upstream flow condition. Section 3 elaborates on the calibration and validation of the models that simulate water level, river flow and surface water salinity and quantifies the impact of climate change on salinity intrusion due to potential abstraction of river water for irrigation. The discussion (section 4) puts the study results in a larger context and section 5 summarizes the outputs of the study and mentions topics that require further inquiries.The southern coastal region of Bangladesh consists of three major zones: south-west, southcentral and south-east. Polders embark the southern halves of the south-west and south-central zones. Their construction began in the 1960s to reclaim large tracts of land for agriculture. This study focuses on the south-central zone, which covers most of the Barisal division. Water and soil salinity levels in this zone are generally much more conducive to crop production than in the south-west zone [14]. That zone depends mainly on the Gorai River (shown in S1 Fig), which tends to run almost dry during the winter months, which in turn causes the intrusion of saline water.2.1.1. River network of study area. The south-central zone possesses several tidal rivers and an extensive network of surface water irrigation and navigation routes, with tidal effects extending inland as far as 150 km [26]. The river system exhibits the highest flow rates during the monsoon (June/July to September/October) season, whereas the flow rates are lowest between January and March. The study area covers five major river basins (Baleswar, Bishkhali, Buriswar, Lohalia and Tentulia) within four districts (Barisal, Jhalokhati, Patuakhali and Pirojpur) in the south-central zone (Fig 1). Being the most active hydrological zone in which surface water irrigation has potential [14], these adjacent basins were chosen for our study.The Baleswar River basin in the upstream gets flow from the Arial Khan River, which is fed by the Padma River (Fig 1). The Bishkhali, Buriswar, Lohalia and Tentulia River basins are mainly linked with the Arial Khan and the Lower Meghna Rivers. The Padma River contributes about 90% to the flow of the Lower Meghna River, the latter also carrying the flow of the Upper Meghna River [25,27]. There are many small, narrow and shallow canals of varying lengths, with their water draining into various flowing rivers. These rivers and canals and their water depths are strongly influenced by river discharge and tidal phenomenon in the Bay of Bengal (BoB).2.1.2. Climate. The climate of the study area is tropical with three main seasons: summer or pre-monsoon (Kharif-1) from March to May, monsoon or Aman (Kharif-2) from June to October, and dry winter (Rabi) from November to February. The maximum daily temperature in the region can exceed 35˚C in April, while the minimum temperature can be below 10˚C in January. The average annual rainfall in the region is 1950 mm. Peak rainfall (75-80%) occurs from June to September, with maximum monthly rainfall varying from 296 to 693 mm. The annual average potential ET is 1275 mm, which is quite evenly distributed, though generally highest during March-April [28]. Daily rainfall, evaporation and sunshine hours data were collected from the Bangladesh Meteorological Department (http://live4.bmd.gov.bd/).Previous simulation studies had focused on the south-west zones using the South-West Regional Water Flow (SWRM) and salinity models [29,30]. As described below, we collected additional data to parameterize these models for our study area.2.2.1. Water level, water flow, and water salinity measurements. Water flow conveyance data are needed to calibrate the water flow model and to simulate the water levels. A field campaign was carried out during the dry season of 2014/15 to measure the time series river water level, flow and salinity at selected river stretches in the study region (Fig 2). Rivers and canals cross-sectional data with close intervals (250 m and 500 m) were ascertained by considering the width, depth and bends of the rivers. They were used to assess the water flow conveyance, water flows and water salinity concentrations. In addition, daily water flow time series data were collected from the Bangladesh Water Development Board (BWDB; http://www. hydrology.bwdb.gov.bd/) and Bangladesh Inland Water Transport Authority (BIWTA).A cross-sectional survey of the rivers and canals was carried out using a differential global positioning system (GPS), echo sounder, total sounder, and pressure sensor to assess the conveyance and surface water availability. About 775 cross-sections were surveyed in different rivers and internal canals to collect the bathymetry data. The leveled machine was used in the non-navigable while echo sounder was in the navigable rivers/canals. In both cases, the position and alignment of the rivers/canals cross-sections were maintained by satellite-based GPS.Water level and water flow. Water level was measured at various river locations to examine the tidal characteristics and water level variation, provide input data as the model boundary, and calibrate the water flow model. The tidal water level was measured at hourly intervals for four months in 11 locations of all five river basins using pressure sensors and staff gauges. Water flow was measured for a full tidal cycle (one cycle of 12 hrs and 50 min) in spring and neap tides in February and April for flow characterization and calibration of the water flow model. The flow duration curve provides the probabilistic description of stream flow at various percentages at a given location. HYMOS, an information system for storing, processing and presenting hydrological and environmental data [31], was used to prepare cumulative maximum, average, and minimum 90%, 50% and 10% hydrographs.Water salinity. Salinity in river and canal water was measured to understand its spatial variation over the year and to calibrate the surface water salinity model. The locations of salinity monitoring stations were selected based on variations in historical salinity, tidal amplitude, and upstream freshwater flow. Salinity was measured using a salinity meter at low and highwater slack (twice a day) on alternate days from February 2015 to May 2016 at 30 locations downstream of the Bishkhali and Khaprabanga Rivers. The salinity model was used to generate salinity time series data and characterize the baseline condition to assess the likely impacts of salinity (exposure of cropland to salinity intrusion) in the future.To establish the upstream boundary flow conditions for the simulation model, we analyzed 30 years of daily water flow/ discharge time series data prior to 2015 that had been collected by the BWDB at the Baruria station in the Padma River (Easting: 480650; Northing: 629040). This is the only flow/discharge gauging station at this river, which contributes about 90% to the flow of the lower Meghna River. Fig 3 shows the water flow hydrograph, depicting the 10 th , 50 th and 90 th percentile of dependable water flow and the water flow in 2015, the reference year used for this study. The 10th percentile indicates conditions with a high flow, as this threshold is exceeded only 10% of the time. In contrast, in the case of the 90th percentile, representing a low flow, the threshold is exceeded in 90% of the time or in 27 out of the 30 years used in the baseline.Assessment of field water requirement entails the delineation of the command area, selection of crops, and estimation of crop water requirement. The command area of five major river basins was delineated considering land topography, internal road network, river/canal systems, and conveyance capacity of the major rivers and canals (Fig 1, S1 Table ). For the Tentulia river basin, only the western part of the river was considered. Cropland was delineated using a supervised classification of RapidEye satellite images with a resolution of 5 m. They had been acquired between January and March 2015. We followed the methodology outlined by Krupnik et al. [14].To estimate the potential water withdrawal, we assumed that all croplands would be planted with Boro, the crop with the highest irrigation water demand [28,32]. Portable flow meters (6\" diameter) were installed at the pump locations for two independent irrigation schemes in Kalapara (21.938 N, 90.175 E) and Patuakhali (22.319 N, 90.327 E) districts. Farmers had dug various canals to transport water by pumps to the paddy fields. They were submerged throughout the growing season. The areas of the irrigation scheme were 0.98 ha in Kalapara and 0.14 ha in Patuakhali. At each location, water application for land preparation and posttransplanting and each irrigation during the Boro rice growing period was measured. They lasted from January 23 to March 26, 2016 in Kalapara and from January 22 to April 14, 2016 in Patuakhali. Water flow was measured for each of the 13 irrigations in Kalapara and 16 in Patuakhali. It should be noted that the field-level irrigation can be misleading as it could underestimate total irrigation requirements at the irrigation scheme and landscape level [33]. The non-consumptive seepage, percolation and evaporation losses were assumed to be accounted for from the irrigation flow meter measurements. We were, however, unable to measure water losses from canals. Hence, we estimated the losses based on Brouwer et al. [34], who suggested that irrigation water losses from canals vary according to canal length and soil type. The majority of the soils in the study area are loamy. Canals typically are unlined with varying lengths. Hence, as per Brouwer et al. [34], we chose the mean efficiency loss of 77% and increased all measured irrigation flows accordingly to compensate for the loss. Based on the field measurements, Patuakhali had a total irrigation water requirement for Boro rice of 13,272 m 3 ha −1 , while Kalapara had a 9,930 m 3 ha -1 . 2.3.1. Model description. Two existing regional water flow and salinity models, the South-West Regional model (SWRM) and the Bay of Bengal (BoB), were linked to simulate the current baseline as well as future scenarios under climate change (Fig 4). Both models are driven by the MIKE simulation algorithm [29,30]. The SWRM was used to estimate the water level, flow and salinity of the rivers, while the BoB model accounted for the effects of SLR on the downstream boundary conditions (water flow and salinity). Those conditions, together with the downstream flow, control the salinity intrusion. Uddin et al. [35] provided a more Previous model applications concentrated on the South-West, while the current study focused on the south-central region, for which less detailed data were available prior to this study. Simulations covered the baseline conditions in 2015, as well as different climate change scenarios in 2030 and 2050, as outlined in Table 1.The SWRM and BoB models had been previously calibrated for the southwest region [25,[36][37][38][39]. The following three model parameters were fine-tuned for the south-central region: \"Manning's roughness number (M), which is 1/n, where 'n' is Manning's roughness co-efficient. It is used in both models. The salinity requires two additional parameters: dispersion coefficient and the mixing coefficient (K mix ). For the estuarine area and in the large rivers, with widths varying from 1 to 6 km, the dispersion factor varies from 600 m 2 s -1 to 1200 m 2 s -1 , whereas in the small rivers with a width of 0.5 to 1 km, the dispersion co-efficient varies from 300 to 500 m 2 s -1 ). The mixing coefficient captures the saltwater and fresh water mixing process in the estuary.We updated the calibration using data from the above-mentioned field measurements, as well as with data obtained from different government agencies: The BIWTA provided the tidal water level data, the BMD the daily weather data, and the BWDB water flow and water level data. The calibration locations for water flow, water level, and water salinity are shown in Fig 5 . The robustness of the model was ascertained using the coefficient of determination.Changes in precipitation and SLR due to climate change can cause considerable changes in river water salinity, affecting freshwater availability in time and space [40]. We considered two climate change scenarios from the IPCC Assessment Report 5-moderate (RCP 4.5) and high (RCP 8.5) emission scenario [41]-to simulate the impact of water withdrawal for irrigation for Boro rice on water availability and salinity in the south-central coastal zone. Projections of the mean monthly temperature change (%), mean monthly precipitation change (%), and change in SLR (cm) in 2030 and 2050 were established based on IPCC reports and other [42,43]. Table 2 illustrates the projections of change in rainfall for January to April for southwest and south-central coastal zones under the extreme and moderate climate change scenarios for 2050.The changes in water flow in the upstream during the dry season depend on changes in temperature, precipitation and evaporation in the Ganges, Brahmaputra and Meghna basins. Comparing observed flows with monthly projected flows for different scenarios revealed that the peak flow could increase by 4 to 39% in the monsoon, and the low flow in the dry period could drop by 4 to 27%, indicating more pronounced seasonality [44]. These changes in discharge/water flow were incorporated in the upstream boundary of the model for simulations of salinity under different scenarios and hydrological events in 2030 and 2050 (Table 1).With the calibrated model, we simulated the impact of the scenarios outlined in Table 1 on water availability and salinity intrusion. Current water availability, i.e., the baseline condition, was assessed based on field measurements as well as simulations of water flow and salinity without considering water withdrawal or SLR or change in precipitation. Next, we simulated the impact of withdrawing water for irrigation, considering no climate change and in a last step, we considered RCP scenarios for 2030 (RCP 8.5) and 2050 (RCP 4.5 and 8.5). The upstream boundary conditions (Table 3) were modulated assuming a 10, 50 and 90 percentile dependable flow (Fig 3). Different SLR levels caused by climate change defined the downstream tidal water level boundary conditions. The following key parameters were generated with the SWRM: Water level, flow and salinity during high (flood) and low (ebb) tide. Scenarios for water withdrawal for Boro rice were based on actual field measurements as presented above. These water withdrawal estimates were fed back into the SWRM. Water withdrawal in the five major river basins was simulated at a 1 km interval. The cropland was categorized into three classes based on the degree of exposure to salinity from irrigation water. The high, moderate and marginal potential croplands were those that had water salinity levels of 0-2, 2-4, and >4 dS/m, respectively [14]. The environmental impact of irrigation water withdrawal was then assessed by comparing the simulated water flows, salinity intrusion, and change in the exposure of cropland to increased river water salinity due to SLR.Water availability in south-central Bangladesh during the dry period mainly depends on Padma and Lower Meghna River flows. They feed the five major river basins Baleswar, Buriswar, Bishkhali, Lohalia and Tentulia (Fig 1). According to 42 years of data collected by the BWDB at Baruria, the monthly mean daily discharge of the Padma River varies from 5,800 m 3 s -1 in February to 72,000 m 3 s -1 in August (Source: Department of Hydrology, BWDB). The river system in the study area, which is located between the Padma River and the BoB, accordingly, also exhibits high seasonality over a year. The highest flow rates were observed during the monsoon season from June to September, while the lowest occurred between January and March.In the south-central region, water levels are dominated by tide and seasonality. There is a distinct seasonal variation between the dry and monsoon period. Tidal differences for the Baleswar River were close to 2 m, whereas the seasonal differences were 0.84 m during 2014 (Fig 6).During the dry period, upstream freshwater flow is less compared to monsoon flow and consequently, salt water intrudes towards upstream. The main shift occurs between January and March when the salinity fronts of 2 dS/m and 4 dS/m move upstream with the decrease of freshwater flow from the upstream. The landward/upstream movement of 2 dS/m is highest for Baleswar and Tentulia rivers. It moves 28 km for the former and 18 km for the latter. Buriswar River does not show any change in the salinity front of 2 dS/m, and the Lohalia River does not experience any salinity during the dry season. The intersection of cropland with river water salinity showed that approximately a quarter of a million ha of cropland could be safely irrigated, assuming no climate change. The area of cropland that could be irrigated with water that has a salinity level below 2 dS/m dropped from 276,000 ha in January to 234,000 ha in March (Fig 8). This was mainly due to the shift of the 2 and 4 dS/m contour lines in the Baleswar River basin. River water salinity levels exceeded 4 dS/m for close to 100,000 ha in March and April. Most of the affected land was in the estuary region.The purpose of the SWRM was to establish estimates of water level, flow and salinity for the entire length of the five major rivers of the south-central region for the scenarios outlined in Table 1. For each calibration site (Fig 5 ), we compared measured and predicted estimates of river water level, flow and salinity over an extended period, ranging from several days (water levels and flow) to months (salinity). Results revealed all coefficients of determination (R 2 ) values greater than 0.80 (S2 Table ). The simulated water flow data for six locations in south-central Bangladesh generally closely matched the observed ones (Fig 9). Only for Babuganj, the most northern test site, some predicted data points were outside the range of the observed ones. Simulations of the river water salinity varied across locations, with the best match for Mohipur at the Khaprabanga River. At the other three locations, the simulated salinity estimates were within the range of the observed ones. However, the simulations did not always match the observed short-term fluctuations (Fig 10).The validation was conducted using the 2012 data as a reference. Calibration parameters were kept at the same level. Fig 11 shows that, the simulated data are in close agreement with the measured data.To calculate the exposure of cropland to the river salinity, we extracted simulated monthly maximum river salinity data at each node of the model grid points. The data were then imported into ArcGIS and krigged, which resulted in a two-dimensional salinity raster. Next, we created three salinity classes: 0-2, 2-4 and >4 dS/m and overlayed the raster on the cropland and water body data layers to calculate the areas of cropland exposed to the three salinity classes for each of the scenarios listed in Table 1. Under the baseline conditions of 2015, about 250,000 ha could potentially be irrigated with river water that has salinity levels below 2 dS/m. Freshwater flow from upstream rivers and tidal effects from the Bay determine the level and extent of salinity in the area. There is also considerable spatial variation of salinity levels in this southern coastal delta because of different upland freshwater flow, salinity at the coast, and tidal characteristics. We used simulations with the linked SWRM and BoB model to estimate the impact of water withdrawal for irrigation, which decreases upstream flow, and SLR on the dynamics of river water salinity between January and April. The changes in river water salinity, in turn, may reduce the area of cropland that could potentially be irrigated.At first, simulations were carried out considering only the water withdrawal from the five rivers for irrigation and upstream flow condition of 90% frequency of exceedance, i.e., low flow conditions. The likely impact on flow availability is assessed considering the change of exposure of cropland to three salinity ranges (0-2, 2-4, and >4 dS/m) and thus the shifting of salinity front/isohaline of 2 and 4 dS/m.The water withdrawal for irrigation caused the 2 dS/m isohaline to move by 0.8 km to 2.2 km from January to April to landward in the Bishkhali River. A similar change was also simulated for the Buriswar River, with the isohaline moving from 1.1 to 1.9 km (S3 Table). In the Tentulia River, shifting of this isohaline was less compared to Bishkhali and Buriswar Rivers since the upstream freshwater is higher in this river and pushes the salinity front downward. In the Baleswar River, the maximum upward movement of this isohaline was about 6 km because the salinity at the Baleswar coast was higher than the Bishkhali, Buriswar or Tentulia Rivers. For higher rates of water flow, i.e., for scenarios with 50% and 10% frequency of exceedance, the shifting of 2 dS/m isohaline was much less, and that of the 4 dS/m isohaline was negligible. Accordingly, abstraction of water from the rivers for irrigation under present conditions has minimal impact on the exposure of cropland to salinity. Between 0.71 and 1.12% of the cropland would shift from the 0-2 dS/m class to higher salinity levels.Considering the impact of climate change, the simulation results under low flow conditions showed that in 2050 under the moderate climate change scenario RCP 4.5, the effects of water withdrawal on salinity intrusion in the five river basins will also be insignificant. In the Bishkhali, Buriswar, and Baleswar Rivers, the 2 dS/m isohaline moves to landward by 1.02 to 8.5 km. In the Tentulia River, this salinity intrusion under the moderate scenario will only be considerable for a few days in March. As expected, the potential impact becomes even smaller when water flow increases from low flow to 50% or 10% frequency of exceedance, and almost no changes for the 4 dS/m isohaline to landward for any of the five rivers. The slight decrease, by 1.7% to 2.5% (Fig 12), of high potential cropland under the moderate climate change scenario by 2050 was evident.The response of water withdrawal under the extreme climate scenario (RCP 8.5) in 2030 will also be insignificant since salinity intrusion in the five rivers to landward will likely be within 1.15 to 9 km except for a few days in March (Fig 13). However, the likely impact under the extreme climate scenario in 2050 will be significant. Under the low flow conditions and Salinity intrusion is a significant environmental challenge for our study area. The government has implemented various policies and initiatives related to integrated water management to address the salinity intrusion issue. Our results suggest that in 2050 for RCP8.5 SLR, the 0-2 dS/m saline zone will be decreased (Fig 12) and the 2 dS/m isohaline moves upward along the Buriswar river and Tentulia river systems (Fig 13). For that reason, surface water irrigation and household use will be hampered. The Bangladesh government has planned to adopt a project titled \"Rationalization of Polders in Baleswar-Tentulia Basin\" [45] under the BDP2100 initiative. Besides this, the Bangladesh Government operates community-based water management programs such as BlueGold Program (http://www.bluegoldbd.org/). It introduces the concept of Water Management Groups (WMGs) and Water Management Associations (WMAs) in the coastal polders. These groups or associations promote the dissemination of knowledge and aim to accelerate the adoption of modern crop and water management technologies.This study, at the nexus of SDG 2 (Zero Hunger), SDG 6 (Clean Water) and SDG 13 (Climate Action), seeks to determine whether it is possible to abstract surface water for irrigation in the dry winter months to increase agricultural production, while ensuring sustainable management of river water by staying within the safe operating space. The ex-ante analysis considers the baseline water level and salinity conditions of 2015. It assesses the potential impact of Previous analyses have shown that under baseline conditions, there is plenty of fresh water for irrigation in much of the Barisal division throughout the dry season [26,46,47]. Freshwater availability is abundant due to the connectivity of these rivers to the lower Meghna River. Water abstraction for irrigation would not impact salinity levels in the rivers (Figs 12 and 13). Simulation results showed mean monthly water flow varying from 5,823 to 7,074 m 3 s -1 over the dry season (January to April) in the Bishkhali River. In the Buriswar River, the mean monthly flow ranged from 5,143 to 5,971 m 3 s -1 . Water flows are also abundant during the dry season in Tentulia, Baleswar and Lohalia Rivers. Tentulia and Baleswar Rivers have significant water flows both in the ebb and flood tides from spring to neap tides; the mean monthly water flows at the downstream river stretches of Tentulia River are within 9,456 to 12,173 m 3 s -1 .The salinity levels in the five rivers exhibit distinct seasonal variation with the change of upstream freshwater flow. Freshwater flow from upstream rivers and tidal effects from the BoB together determine the area's salinity level and extent. The daily salinity level in the river changes from spring to neap tides and with the season. The higher water levels along the coast during spring tides result in a higher volume of saline water flow to the upstream of the rivers compared to neap tides. For the Buriswar River, the salinity level remains below 0.2 dS/m over the dry season at the middle and upstream stretches, confirming a reliable source of irrigation water and other domestic and industrial uses. The salinity level at the downstream end of this river varies over the year where salinity starts to build from December, peaks in late March or early April, and drops from late May to December. For the Tentulia River, the salinity level remains below 1.8 dS/m in the upstream stretches, while it is within 3 dS/m in the downstream stretches. However, climate change may cause less favorable conditions for the people living in the Buriswar and Tentulia river basins. The simulations revealed that the salinity levels of these two rivers are likely to increase under RCP 8.5 by 2050. This is due to less flow from the upstream and the SLR by 0.43 m. Therefore, 2 dS/m salinity isohaline shifted upward by more than 100 km. Managing irrigation with water that has salinity levels higher than 2 dS/m requires careful and skillful management practices, especially during the establishment of the crops, when they are most sensitive to high salinity levels. Fortunately, the major shift of the isohaline occurs in March only, whereas maize and wheat can be established right after the harvest of the Kharif-2 season aman rice crop in December. Boro rice can be transplanted as early as late January.All in all, the exposure analysis showed that the area of high potential cropland, i.e., exposed to low salinity levels in the range of 0 to 2 dS/m, currently is 276,300 ha. This is about 78% of the total cropland of the five river basins. Thus, there is a high potential for the intensification of irrigated agriculture in the southcentral zone. As irrigation and water management experiments by Krupnik et al. [14], Bhattacharya et al. [19], and Schulthess et al. [18] and modeling scenarios by Timsina et al. [17] have shown, relatively high yield levels can potentially be achieved for Boro rice, wheat, maize, sunflower, soybean and mungbean in southern Bangladesh.Our study did not consider potential changes in upstream boundary flow due to the construction of dams along the Ganges and Brahmaputra rivers and the redirection of water into other basins. Nor did it consider salt intrusion into landward due to cyclones, storm surges, and land subsidence [9]. The salinization of large parts of the south-western zone can be taken as an example to illustrate the consequences of a reduction in upstream boundary flow. The operation of the Farakka Dam in Murshidabad district in the Indian state of West Bengal from 1975 and the diversion of fresh water from the Ganges River towards India during dry season have already decreased the amount of freshwater entering the Ganges delta. The diversion of water reduces the supply of water from rivers and ultimately threatens crop and fish diversity [48]. Tuong et al. [49] also reported that salinity intrusion during the dry season is more sensitive to transboundary flows than SLR. Hence, ensuring transboundary flows during the dry season is highly important for sustainable agriculture and aquaculture in the southern coastal regions.Managing water in the delta region is a complex task, as it needs to balance different users' interests. These resources are largely shaped by tidal dynamics and transboundary and upstream flows and are affected by natural, socio-economic, and institutional changes. Transboundary river basin management is more complex than for rivers flowing through one country due to the challenges in the design and implementation of joint monitoring programs [50]. Since rivers in Southern Bangladesh originate from the Himalayas and flow through India, a transboundary river basin management involving all countries is paramount.Water management in the coastal delta is generally planned and performed through participatory approaches involving water management organizations, local government institutions and farmers [51]. The internal canals and peripheral rivers and regulators and sluice gates form the integral parts of the water management system, and involve effective drainage and irrigation with the appropriate operation of the control structure and pumps [52]. However, in practice, there is inadequate involvement of local governments and communities in water management and a lack of maintenance of flap and vertical lift gates and regulators, many of them becoming non-functional [53]. Past studies have revealed that lack of appropriate water management at the field level is one of the crucial factors limiting the intensification of agriculture and the increase of water productivity. Tuong et al. [49] emphasized that participatory water management including water governance and equity is essential for sustainable water management in the polders of southern coastal Bangladesh. For sustainable coastal water management that would require strengthening and formalizing the role of local governments in local water management and ensuring their access to permanent maintenance funds, severe hydrological and socio-economic challenges facing the coastal zone would need to be addressed [53]. Improved governance and equity and access to water management would be important as these can play a vital role in the intensification of Rabi crops and further development of aquaculture-agriculture systems [54].Improved water resource management in coastal regions would need frameworks that recognize the importance of rivers and aquatic resources in providing various ecosystem services. Meynell et al. [55] developed a framework of ecological importance as a tool for river basin planning and water resource management, obtaining baseline information for impact assessment of infrastructure, and protecting ecologically important areas for rivers of mainland southeast Asia. The framework maps out the relative contributions of river reaches to a wide range of ecosystem services and allows prioritization of river ecosystem services to be assessed and mapped according to importance in different river reaches and basins within a region. Likewise, Tickner et al. [56] developed a conceptual framework for a coherent approach to river management research, policy and planning to encourage informed, equitable and sustainable river management. They applied it to the Great Ruaha River basin in Tanzania. The framework integrates concepts from ecosystem science, water resource management, social science and political economy, thereby linking concerns about the river ecosystem with the concerns of decision makers and allowing broader analysis that supports an understanding of how and why different groups within society benefit from the services a river provides. Such frameworks are currently lacking in Bangladesh. Similar frameworks are needed to identify and prioritize the critical ecosystems services provided by the networks of rivers and canals and applying them to policy and to plan for sustainable management of river basins in southern coastal Bangladesh.The overall goal of this study was to determine the safe operating space for the expansion of irrigated dry season agriculture using available surface water. We wanted to determine whether critical river flow levels could be maintained to safeguard the river ecosystem and prevent the intrusion of saline water into the delta under various climate change scenarios. Our results showed that the abstraction of river water, even for Boro rice, the crop with the highest water demand, would not change the salinity dynamics in the rivers under baseline conditions (2015) nor the moderate climate change scenario (RCP 4.5) in 2050 or the extreme scenario (RCP 8.5) in 2030. Only under the low flow conditions (90% frequency of exceedance) for RCP 8.5 in 2050 the 2 dS/m isohaline would shift landwards by more than 100 km for the Buriswar and Tentulia River basins. An additional 36% of the cropland in the south-central zone would be exposed to river water salinity ranging between 2 and 4 dS/m. For most crops, this may entail some yield depressions. However, water abstraction per se under the baseline scenarios would increase the 2-4 dS/m area by 0.5% only. Thus, the change would be almost entirely due to climate change, independent of water abstraction. Other factors, which we did not simulate, such as a reduced upstream boundary flow caused by the construction of dams and redirection of water into other basins, may cause further salinization in the estuarian zone. This would pose a great threat to the sustainability of crop production, endanger the entire ecosystems and reduce the ecosystem services provided by rivers and canals in the south-central region of Bangladesh.There is a need for additional research to study the impact of salt water intrusion on groundwater quality and bio-diversity of aquatic flora and fauna. In addition, the government needs to prepare and engineer interventions for the preservation of the freshwater zone, and last but not least, analyse the transboundary flow regime for managing salt water intrusion under sea level rise."}
|
main/part_1/0084992922.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"3ba1510b7bdf613ff87ffdd321dd9a47","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d5642908-4748-4bae-99dc-09a7aad1db53/retrieve","id":"1921176525"},"keywords":[],"sieverID":"d340f9f7-6baf-4d4e-8f35-fca2f2bebb2b","content":"Farmers in Volta Basin Development Challenge project sites are generally not developing brand new prac/ces on their own. Informa/on about new technologies is slowly spreading from projects to the wider community, but adop/on of these technologies could be strengthened by crea/ng an enabling environment. This would mean taking into account the five determinants of adop/on iden/fied here and programming accordingly.Determinants of Adop;on of V2 and V3 "}
|
main/part_1/0094800866.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"e580ca2b47521914270a52c1041d261e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b99242d5-441a-497f-bc42-13e14d54cca4/retrieve","id":"-1623798837"},"keywords":[],"sieverID":"29f00fcd-8aac-4a41-9961-12d8d7c6d6f7","content":"Is this OICR linked to some SRF 2022/2030 target?: Too early to say Description of activity / study: This is an in-depth analysis of PIM partnerships aiming to elicit lessons on the key factors contributing to their success in achieving outcomes. It uses a mixed-methods design, combining surveys and interviews as well as quantitative and qualitative analysis."}
|
main/part_1/0100812993.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"f3c44b4058ca8cbc0eb8a41402726bc8","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d4b48f07-d1ee-4e3b-80e1-427870428803/retrieve","id":"2041470240"},"keywords":[],"sieverID":"2abb2f93-d01b-4711-a8eb-6a345431e116","content":"The ILCA Bulletin is a quarterly publication of the International Livestock Centre for Africa. Contributions to the Bulletin are invited from livestock researchers in Africa whose work is related to that of ILCA. The ILCA Bulletin is distributed to more than 3000 researchers, policy makers, donors and extension agents throughout sub-Saharan Africa and elsewhere in the world.ILCA is one of 13 international centres for agricultural research whose work is funded by the Consultative Group on International Agricultural Research (CGIAR). The 13 centres have been established by the CGIAR to provide long-term support for agricultural development in the Third World.Animals must feed to grow; they must also be given some veterinary care to reduce their susceptibility to disease and decrease mortality. Simplistic as these statements are they lead to two profound concerns of livestock production in sub-Saharan Africa -animal nutrition and management.Poorly fed animals grow slowly and produce few offspring, the consequence being less meat and milk to feed the people who depend on them. If an animal dies, its owner loses what is possibly his or her only source of cash.But nutritional stress and high mortality are not the only aspects of livestock production in sub-Saharan Africa; when improvements are being introduced, other issues arise. For example, how do management practices and seasonal availability of feed affect animals' weight gain and income from smallholder livestock enterprises? With disease control, the issue is not so much which measures to introduce but what benefits will accrue to smallholder farmers willing to invest scarce resources in veterinary care -more money to purchase items the household needs or more food? Periodic fluctuations in rangeland productivity have prompted fears of an imminent collapse in the dry rangelands, yet the livestock populations supported by these rangelands, and the amount of milk and meat they produce, appear to have increased faster in the past two decades than in the wet areas. This contradiction in expectations and reality underscores our lack of knowledge of the long-term trends in range productivity and their causes. The question is, why do we not know more about what is happening in an area that represents half of sub-Saharan Africa? Is it because of lack of interest in the past or because of lack of an appropriate technique to monitor range resources?The research reported in this issue of the ILCA Bulletin answers some of these questions. Analysis of data on steer stall-feeding in Malawi shows that the enterprise can be profitable even under low-input management. An evaluation of a disease control scheme for small ruminants in southwest Nigeria gives an insight into both the biological effects of the treatments applied and the behavioural changes in the way farmers managed their herds. And, finally, those interested in remote sensing can learn about the progress made in calibrating a spectral vegetation index in the Gourma region of Mali.Editor, ILCA Bulletin Information Section ILCA, P.O.Box 5689 Addis Ababa, EthiopiaStall-feeding cattle to increase domestic beef production was started in Malawi in 1957. The scheme was first introduced in the Southern Region and was rapidly adopted by smallholders in other parts of the country.The stall-fed animals were mostly steers obtained on credit from the Ministry of Agriculture (MOA); only in a few cases did smallholders use steers produced from their own herds. Farmers were supplied with two steers from stock purchased at the local markets or from livestock breeding centres, particularly the Chisombezi multiplication centre in the Southern Region and the Dzalanyama ranch in the Central Region.In the early 1970s, the Ministry of Agriculture started keeping records of animals entering the fattening scheme to control the repayment of credits. In 1984, two ILCA scientists and an official of the Ministry of Agriculture extracted information on the scheme from records kept at the Ministry's Blantyre and Lilongwe offices. The data were then analysed and interpreted by the team, with help from an ILCA economist. This report presents the results of biological and financial analyses performed on a random set of data collected during the 1972-82 period.The analyses focus on cattle stall-feeding operations in the districts of Blantyre (Southern Region) and Lilongwe (Central Region). Both regions have a predominantly subtropical climate, with a unimodal rainy season from November to April followed by a long dry season from May to October. Figure 1 shows the mean annual rainfall recorded during 1972-81 at four meteorological stations representative of the areas in which smallholders and cattle multiplication centres operate. The mean monthly rainfall for one of the stations, the Chileka station in southern Malawi, is shown in Figure 2. The management system used at the stalls depends on the resources available to the smallholder. Fattened animals are housed separately in stalls constructed from eucalyptus poles and thatched with hyparrhenia grass. The stalls are frequently built in a long line to reduce construction costs and facilitate the delivery and collection of steers.Animals are fattened throughout the year, but stall-feeding during the dry season is more common, particularly in the Lilongwe District. During the wet season, steers are fed cut fodder, mainly improved Napier (Pennisetum purpureum) or Rhodes (Chloris gayana) grass and such indigenous species as Hyparrhenia, Panicum; Setaria and Digitaria. The main roughages fed during the dry season are maize stover and groundnut haulms, while maize bran (madeya) is given as a supplement.Most stall-fed cattle were from the Dzalanyama ranch in central Malawi and the Chisombezi multiplication centre in the south of the country. The Dzalanyama ranch has mainly Malawi Zebu cattle, which is an indigenous Bos indicus breed. The Chisombezi animals are of a nondescript 'offtype' breed, which is a composite of Sussex, Brahman-type and Africander crosses.In addition to these 'pure' forms, crossbred cattle of Malawi Zebu and Friesian (Bos taurus) inheritance can be found in the Central Region, where the two breeds are used in a dairy cattle crossbreeding programme. In the Southern Region, Friesian × offtype crossbreds are common (Agyemang and Nkhonjera, 1986).The steers used for fattening in the Central Region (Lilongwe area) are therefore either pure Malawi Zebu or Friesian × Malawi Zebu crossbreds. In the Southern Region (Blantyre area), three categories of steer are foundpure Malawi Zebu, offtype and Friesian × offtype crossbreds. The steer production schemes used in the two regions are shown in Figure 3. Data were extracted by random sampling: for Lilongwe, random samples were taken for each year during the 1972-82 period, and for Blantyre during 1974-81. The data were checked for incorrect and inconsistent dates of steer entry and departure from stalls. After editing, the Lilongwe data set comprised 2985 records and that for Blantyre 2498 records.Since no information was available on the genetic composition of individual steers, their weights at the start of the fattening period were subjected to frequency (10-kg interval) distribution analyses. Histograms based on these analyses indicated a distinct two-peak weight distribution for the Lilongwe steers and a three-peak distribution for those in Blantyre. This suggested that there are two steer subpopulations in the Lilongwe area and three in the Blantyre area.A truncation point of 250 kg was used to distinguish between the two subpopulations in Lilongwe: steers weighing up to 250 kg at the start of the fattening period were assumed to be Malawi Zebu and those with an initial weight of >250 kg to be Friesian × Malawi Zebu crossbreds. The three subpopulations in the Blantyre area were Malawi Zebu (250 kg), offtype (250-350 kg) and Friesian × offtype steers (>350 kg). These subdivisions correspond to the weights of Malawi cattle reported by Thomas and Addy (1977).Five age classes were established on the basis of dentition (0, 2, 4, 6 and 8 permanent incisors). There were no 0-tooth steers in the Lilongwe data set and no 8-tooth steers in the Blantyre data set.For each steer, records were assembled for all performance and economic traits. The individual traits analysed were initial weight, final weight, days on feed, daily weight gain, carcass weight, dressing percentage, grade, price on entering the stall, price on leaving the stall, and gross margin. All characters were analysed by least squares procedures (Harvey, 1977), using fixedeffects models.All continuous variables which were measured prior to grading the steers (i.e. on leaving the stall or at slaughter) and grade itself (determined on a categorical scale of 1, 2, 3 or 4) were analysed using a fixed-effects model which included breed group, number of teeth on arrival at the stall, month and year of arrival, and breed group × month interaction.The continuous variables measured at the time of grading or after were cold dressed weight (carcass weight), dressing percentage, total price on leaving the stall, and gross margin. These variables were examined using a fixed-effects model which included grade, breed group, number of teeth, month and year of arrival at the stall, and breed group × month interaction.The residual mean square was used as the error term to test the significance for each character analysed. Linear contrasts of least squares means were computed to determine the significance of differences between groups.The objective of the biological analyses was to identify environmental and genetic factors influencing the biological rate of weight gain in stall-fed steers. The Lilongwe and Blantyre data were analysed separately, but using the same statistical models. Related traits are discussed together for both areas.The mean initial and final weights of 2498 Blantyre steers were 298 ± 20 and 401 ± 48 kg, with coefficients of variation (CV) of 6.8% and 12.0% respectively. The corresponding means for 2985 Lilongwe steers were 271 ± 25 kg (CV = 9.4%) and 370 ± 48 kg (CV = 11.9%).Analyses of variance for initial and final weights of stall-fed steers are presented in Table 1. In Blantyre, initial weight was significantly (P<0.01) influenced by all variables. The results for Lilongwe were similar, except that initial weight was not influenced by number of teeth. In Blantyre, large differences in initial body weight were indicated by the significant breed group × month interaction: the weight of Friesian x offtype and Malawi Zebu steers which started fattening during the months of October -February, March -May and June -August differed by 124, 140 and 118 kg respectively. The corresponding differences in final weight were 44, 52 and 72 kg. These figures imply that Malawi Zebu steers grew relatively faster during certain periods of the year than crossbreds. Similar breed group × month effects were observed in Lilongwe for Friesian × Malawi Zebu and Malawi Zebu steers.Age of steer had no significant effect on final weight in either of the study areas. Despite differences in age, the initial weights of Lilongwe steers were similar, indicating that steers were drafted for fattening when they reached the appropriate weight. However, the lack of significant difference in steer weight was also partly due to confounding with breed effects. In Blantyre, the significant differences in initial weight observed for various tooth classes over and above those obscured by possible confounding of age and breed were due to the large difference (124 kg) in initial body weight between the Malawi Zebu and Friesian × offtype steers. The liveweight changes observed in this study were comparable to those reported by Spurling and Spurling (1972), Beale et al (1979) and Butterworth et al (1984), who in their experiments used diets similar to those fed in practice.The mean stall-feeding period in Blantyre was 188 ± 53 days (CV = 28%) and in Lilongwe 213 ± 54 days (CV = 26%). Analyses of variance for days at stall and daily weight gain are shown in Table 2. Fattening period was significantly influenced by all variables except breed × month interaction in Lilongwe. Smaller breeds had a longer fattening period than larger breeds: the average periods for Malawi Zebu steers in Blantyre and Lilongwe were 201 days and 212 days, while the respective means for the Friesian × offtype and Friesian × Malawi Zebu crossbreds were 182 and 198 days. Younger steers tended to stay at the stall longer than older ones: in Blantyre, steers with four permanent incisors at the start of stall-feeding were fattened for 191 days and those with six incisors for 178 days.The mean daily weight gain for the Blantyre steers was 0.59 ± 0.48 kg (CV = 81%); the corresponding figures for the Lilongwe steers were 0.50 ± 0.22 kg (CV = 43%). Table 2 shows that daily weight gain was significantly influenced by the month and year of the start of stallfeeding, but not by the age of the steer and breed (Friesian × offtype steers gained 0.60 kg day -1 , Friesian × Malawi Zebu 0.54 kg day -1 and Malawi Zebu 0.52 kg day -1 ).When 'pure' breeds and crossbreds were compared 1 on the basis of equal metabolic body weight, breed differences were significant. Lilongwe Malawi Zebus and Friesian × Malawi Zebu crossbreds gained 7.77 and 7.26 g day -1 kg -0.73 respectively (P< 0.05), while the Blantyre Malawi Zebu, offtype and Friesian × offtype steers gained 8.58, 7.58 and 7.16 g day -1 kg -0.73 .1Comparative figures obtained by dividing daily weight gains by average metabolic body weight (mean of initial plus final weight) 0.73 In Blantyre, Malawi Zebu steers were significantly (P< 0.01) superior to both the offtype and crossbred steers, but the difference in weight gain between the offtype and crossbred steers was not significant. These results contradict Thomas and Addy (1977) who reported that the liveweight gains of Friesian crossbreds were significantly higher than those of Malawi Zebu steers. Their study, however, did not take into account breed differences in metabolic body weight.Steers which started stall-feeding in April, May and June had the highest daily weight gains (Figure 4), benefiting probably from the high-quality crop residues available at the end of the dry season and beginning of the rainy season. Increased daily weight gain was indicated for 1977-81 (Table 3), but this trend could not be related to total precipitation for the individual years. The mean carcass weight of 2498 Blantyre steers was 210 ± 28 kg (CV = 13.1%); in Lilongwe, 2985 steers had a mean carcass weight of 194 ± 23 kg (CV = 12%). The mean dressing percentage was 52.3 for both locations, with coefficients of variation of 4.1% (Blantyre) and 2.6% (Lilongwe).Analyses of variance of carcass weight and dressing percentage are presented in Table 4.Carcass weight was significantly influenced by breed, grade, month and year of the start of stallfeeding, and breed×month interaction. Dressing percentage varied with grade (in both Blantyre and Lilongwe) and breed×month interaction (in Lilongwe). Age at the start of stall-feeding did not influence the carcass weight and dressing percentage of Blantyre steers, but exerted a significant effect on carcass weight in Lilongwe. **= p<0.01.Estimated least squares means for carcass weight and dressing percentage are given in Table 5. Larger breeds had higher carcass weights than smaller ones: the mean difference in carcass weight between the Friesian× offtype crossbreds and Malawi Zebus was 63 kg. Dressing percentage did not differ among the various breed groups. Better-grade animals had higher carcass weight and dressing percentage than animals with lower grades. This was to be expected since the former carry more 'finish', which is a function of carcass fat and is also closely associated with dressing percentage. At the end of fattening, grade of steers was determined as prime, choice, standard and (in Blantyre) common, coded as 1, 2, 3, and 4.Table 6 shows that carcass grade was significantly influenced by all variables except breed × month interaction in Lilongwe. Estimated least squares means for carcass grade are presented in Table 7. 1 Within variable groups, row means followed by the same letter do not differ significantly at the 5% level. Means without any letter following did not show a significant difference in the analysis of variance.2 n.a. = not applicable.Malawi Zebu steers had a consistently poorer grade than crossbred steers. Younger animals were graded better than older ones because the grading system used gave premium to younger animals. In Lilongwe, steers which went on feed during May through to July were graded better than those that started stall-feeding in other months. In Blantyre, better grades were associated with April to August. The month of starting stall-feeding did not affect final grade, but Thomas and Addy (1977) reported that date of slaughter affected carcass grade, the best months to slaughter being July through to September.Raw means and standard deviations of price variables are presented in Table 8. Estimated least squares means for initial price, final price and gross margin are laid out in Table 9. of variance.2 n.a. = not applicable.As expected, the smaller Malawi Zebu steers were priced lower at the start of stall-feeding than the heavier crossbreds. However, the difference in the final prices of Malawi Zebu and other breed groups was less than in the initial prices, presumably because of the superior growth rate of Malawi Zebu steers.In both study areas there was a small but significant negative correlation between the rate of weight gain per unit of body weight and grade or quality. Thus, since payments were made on the basis of liveweight and grade, the Malawi Zebus' superior weight gain per unit of body weight was not reflected in the gross margin.Younger animals were priced higher at the start of stall-feeding than older ones. At the end of the fattening period all age classes attracted equal sale price. Since growth rate was similar for all age groups, the superior final pricing of older animals was due to the pricing system, which was based on unit weight and hence favoured larger animals which were also more likely to be older.Table 9 shows that carcass grade had a significant effect on both final price and gross margin: prime and choice animals attracted higher final price, and the gross margin for these animals was consequently higher.The Blantyre and Lilongwe data sets were not uniform, the major differences occurring in the type and number of cattle breeds studied, the age of steers at the start of stall-feeding and the month in which steers began stall-feeding.Analyses of variance performed on these data showed that the effects of breed group on growth traits were similar in both areas. Smaller breeds performed as well as, or even better (on a metabolic weight basis) than larger breeds or crossbreds. Age at the start of stall-feeding was not an important factor in terms of growth rates. Starting month and year of stall-feeding significantly influenced growth traits in both areas, but at a different magnitude.The differences in breed types led to differences in traits determined in absolute terms, such as starting weight, final weight and dressing weight. Higher values were associated with Blantyre where the breeds are heavier. Since total weight gains were similar in both areas, the lower growth rate of Lilongwe steers was related to a longer fattening period.Increasing beef production on smallholder farms was one of the reasons for introducing a cattle stall-feeding scheme in Malawi; the other, equally important, was to raise the cash income of the rural population. Financial analyses were performed to determine whether smallholders in the country's Southern and Central regions benefitted from the scheme.The income derived by producers from fattening cattle for beef production can be expressed as the annual financial rate of return to fattening.Let R = revenue from selling the animal, C = purchase cost of the animal, and T = time (in days) the animal was fattened, then the annual financial rate of return to fattening (I, %) is:The financial rate of return is thus revenue less purchase cost, expressed as a percentage of purchase cost, and multiplied by the fraction of year the animal was fattened. This is an overestimate because purchase cost does not include some costs, such as of feed and veterinary supplies. The estimate does, however, include the costs of insurance and transport because these are deducted at the slaughterhouse from the sale price.The I variable in equation ( 1) was computed using the Blantyre and Lilongwe data; summary statistics for the two areas are shown in Table 10. A common log transformation was done, excluding observations with zero or negative returns. Figure 5 gives summary statistics for the transformed frequency distributions. The data show that (a) the average return to fattening was high, (b) the model producer made money, and (c) only very few producers incurred losses. Notes. The data were transformed by taking the common logarithm of each observation greater than zero. The mean and standard deviation of the untransformed data are percentages, while those of the transformed data are common logarithms of annual percentages. The skewness and the kurtosis are pure numbers. The equations for C, R and d(R) then are:Since by definition p f = p o + d (p) (5) andDividing equation ( 7) by d(R) gives:The right-hand side of equation ( 7) has three components: the price component, which is equal to the change in price multiplied by the original weight; the weight component, which is equal to the change in weight multiplied by the original price; and the interaction component, which is equal to the change in price multiplied by the change in weight.The price component is the share of revenue gains from price increases at a constant weight over the fattening period. If the price component were equal to 100%, the animal would have gained no weight during the fattening period; any income gained by the producer would then be due to the higher price paid by the purchasing agency.The weight component is the share of revenue gains from weight increases at a constant price over the fattening period. If this component were equal to 100%, the price change would have been equal to zero, and any income gained by the producer would have been due to his having fattened the animal.The interaction component is the share of revenue gains resulting from the interaction of price and weight gains over the fattening period. It cannot be equal to 100%, since that would imply that both the price and the weight component are equal to zero. A positive interaction component means that weight gains are associated with price gains, higher-grade premia presumably being given to fatter animals.Blantyre. In this area, the distribution of the components of the financial rate of return to fattening was fairly constant across years (Table 11). The price component was between 56 and 65%, the weight component between 17 and 20%, and the interaction component between 18 and 22%. This suggests that most of the returns came from a higher price being paid by the Government for fattened animals. If the animals had gained no weight, the returns would still have been roughly 60% of what they were. About one fifth of the returns came from the price/weight interaction component, which suggests that fatter animals were systematically put into higher grades and received higher prices per kg liveweight. In other words, a good producer-one who fattened his animalsreceived a quantity premium, but the sum of price and weight gains was only about 40% of the total net return to fattening.Lilongwe. As in Blantyre, the price component was dominant, but there was a slight tendency for the weight component to be higher than in Blantyre (Table 11).Total weight gain varied substantially in the two samples analysed: the Blantyre mean for all years was 102.4 kg and the coefficient of variation (CV) was 44.3%, while the Lilongwe mean and CV were 99.5 kg and 41.2% respectively.The relatively small contribution of weight gain to financial returns suggested the need to investigate this component further. A regression analysis was therefore done on the same data, with total weight gain being the dependent variable. This analysis made it possible to estimate the marginal effects of management practices on weight gain.Blantyre. One equation was estimated with no interaction terms, shown as function 1 in Table 12, and another with four interactions, shown as function 2. In function 1, most of the variables were significantly different from zero at the 1% level. In function 2, the significance levels for the same variables were generally lower, presumably due to the interactions tested. In particular, the effect of crossbreds on total weight gain (function 1) was negative in function 2, even though the absolute values of the coefficients were not very different between the two functions. Notes. The significance levels are: * = significant at the 10% level, ** = significant at the 5% level, and *** =significant at the 1% level with a two-tailed test. The dummy variables for months are calculated with reference to December and January. The dummy variables for years are calculated with reference to 1974, 1979 and 1981. The dummy variables for breeds are calculated with reference to the Malawi Zebu.The optimal number of days at stall was calculated using the regression coefficients of function 2. This was done by taking a derivative of function 2 with respect to days at stall, setting it equal to zero, and calculating the optimal value. Because a second derivative for days at stall was negative, the resulting optimum was a maximum. The solution was 317 days, which was almost 70% longer than the Blantyre sample mean of 188.5 days. The optimal value was greater than about 98% of the sample values.Lilongwe. Table 13 shows that the regressions for Lilongwe had slightly higher R 2 values than in Blantyre, and that the coefficients differed somewhat in terms of sign and significance level. Notes. The significance levels are:*= significant at the 10% level,**= significant at the 5% level, and***= significant at the 1% level with the two-tailed test. The dummy variables for months are calculated with reference to November, December and January. The dummy variables for years are calculated with reference to 1973, 1974, 1975 and 1976. The dummy variables for breeds are calculated with referenceto the Malawi Zebu.Function 1. The regressions for Blantyre and Lilongwe had about the same explanatory power, but the F-statistic of the Lilongwe function was higher because of more error degrees of freedom. Some important differences in coefficients were found: the 'weight in' coefficient for Blantyre was about 3 times larger than the Lilongwe coefficient and was significant at the 1 % level, whereas the Lilongwe coefficient was not significant at the 10% level. The 'days-at-stall' variable for Blantyre was positive, while that for Lilongwe was negativeThe month dummies for Blantyre were all negative and significant at the 1% level; those for Lilongwe were generally positive, though not significant. Because the dummies were for the same months, it was possible to compare their signs and magnitudes. The comparisons showed some very striking differences: for example, the August coefficient for Blantyre was -29.9 and for Lilongwe it was 27.1, while the respective April coefficients were -17.1 and 25.9. These figures suggest that the two areas have different seasonal patterns of feed supply.The Blantyre regressions showed that the total weight gains of steers starting fattening during December-January were higher than the gains of steers that went on feed in other months of the year. In Lilongwe, the opposite was true: steers entered for stall-feeding in November, December and January gained less than those entered during the other months. These data do not tell us much about the reasons for this difference, but they have important implications for extension work and should be investigated further.Function 2. The second function also showed some dissimilarities. Although the signs of the 'weight in' and 'days-at-stall' variables for Blantyre and Lilongwe were the same, the magnitudes were much larger for Blantyre. Moreover, the Blantyre coefficients were significant at the 10% level while those for Lilongwe were not.The Blantyre dummy for crossbreds was negative and the Lilongwe one positive, but neither was significant. The month dummies show that while the sign of the month coefficients did not change between functions 1 and 2 in either data set, the magnitudes were different, although not very much.'Weight in' × 'days-at-stall' interactions had the same sign in both areas, but neither coefficient was significant and that for Blantyre was twice as large as that for Lilongwe. 'Days-at-stall squared' was negative for Blantyre and positive for Lilongwe, but neither coefficient was significant. The 'days-at-stall' × 'crossbreds' interaction was negative and insignificant for both areas.The biological and financial analyses presented in this study show that genetic and environmental factors, particularly breed, age, and month and year entered, influence most biological and economic traits of stall-fed cattle. However, the total contribution of these factors to total variation in some traits (e.g. total weight gain) suggests that other factors (not identified in this study) may be important in stall-feeding operations.When compared on the basis of metabolic body weight, the indigenous Malawi Zebu steers performed better in terms of several biological characteristics than the Friesian × Malawi Zebu and Friesian × offtype crossbreds. This and the other finding that reasonable weight gains are possible under a low-input management system strongly suggest that the scheme would be suitable for other developing countries where smallholder farmers have access to cattle for fattening and agricultural byproducts.The financial rate of return to smallholder steer fattening in Malawi was high, but a substantial portion of the return was due to price changes. This implies that if such significant interactions as breed × starting month of feeding were exploited to increase steer weight gain, then it would be possible to pay a smaller price differential to producers and, at the same time, offer a lower beef price to consumers.Given the substantial differences between Blantyre and Lilongwe in total weight gains of stallfed steers, a survey of a relatively small subsample of producers from these two areas should be undertaken to gain better knowledge of the seasonal differences in weight gains. This information could be used by agricultural extension workers to improve the share of weight gains in net returns to steer fattening.Quantifying the temporal and spatial changes in forage resource availability has long been a stumbling block in rangeland survey and mapping. Remotely sensed data could provide a solution to the problem, if they can be turned into meaningful variables.Collaborating with the Global Inventory Monitoring and Modelling Studies (GIMMS) group of the National Aeronautics and Space Administration (NASA), ILCA's team in Mali carried out research in 1984/85 aimed at testing and calibrating a spectral vegetation index calculated from data sensed by the advanced very high resolution radiometer (AVHRR) on board the NOAA-7 satellite. This research was prompted by interest in the inter-seasonal dynamics of primary production (see Cissé, 1982;Hiernaux, 1983;Hiernaux et al, 1984;Diarra et al, 1986) and by previous remote sensing work elsewhere in the Sahel (see Tucker et al,1983;1985).The results of monitoring changes in vegetation cover in the Gourma region of Mali during the 1984 growing season were reported in Hiernaux and Justice (1986). An overview of ILCA's remote sensing activities in 1985 is given in Hiernaux and Diarra (1986). In this paper, three types of relationship are evaluatedbetween NDVI and above-ground biomass; between maximum NDVI and end-of-growing season biomass; and between the integral of the NDVI curve or NDVI increments over time and actual biomass. Atmospheric interference and technical problems affecting the spectral vegetation index are described, as are also two initial applications of the multitemporal integration technique in computerised mapping of plant biomass in the region.A normalized difference vegetation index was calculated from radiance data simultaneously measured in the visible (R) and near-infrared (IR) wavelength bands, such that:Values ranging between +1 and -1 were interpreted on the basis of relationships established between the red and near-infrared radiances and green biomass. The red radiance decreases with increased green biomass as a result of greater absorption of incident radiation by plant chlorophylls, and the near-infrared radiance increases slightly with increased green biomass because of radiation scattering by the hydrated walls of leaf cells.The index was calibrated at 30 sites in the Gourma region of eastern Mali, by comparing remotely sensed data with ground measurements of above-ground biomass taken in 1985 and recorded in Diarra et al (1986). To determine more precisely the relationship between the index and actual above-ground biomass, further comparisons were made with reflectances sensed on the ground (1.5 m above plant canopy) and from the air (610 m).Thirty 4 × 4 km 2 ground sites were selected in the central Gourma for their floristic homogeneity.Visual observations and sample clippings were repeated every 2 or 4 weeks on 12-24 one m 2 plots randomly distributed along two 1-km long, permanent linear transects.For each plot, plant species were identified and percentage green cover was estimated. Aboveground dry biomass was measured by clipping, drying and weighing. Sampling on the ground combined random sampling and stratification at two levelsby plant community and by quantitative stratum within each community. The results were weighted by the relative area covered by each stratum and community along the transect.Communities of woody species were sampled once in 1984 and again in 1985. Measurements were taken of the length of the transect segments overlayed by tree or shrub canopies and of such physical parameters as crown area, trunk circumference and height. Total foliage biomass was estimated on the basis of allometric relationships found to exist between biomass and individual physical parameters (Hiernaux, 1980;Cissé, 1980). These relationships were weighted by monthly clippings of leaf biomass on standard branchlets (values given by Cissé,1982).Ground clippings and visual observations of grass and tree samples were often preceded by in situ radiometer measurements using a hand-held Exotech radiometer equipped with a 15° lens and Thematic Mapper filters in the red (0.63-0.69 µm) and near-infrared (0.76-0.90 µm) wavebands. All measurements were taken 1.5 m above the plant canopy and replicated three times. The spectral reflectance of soil background cleaned of all vegetative material was similarly measured.For comparison, soil/vegetation reflectance mixtures were determined on 1-m 2 plots. This was done by taking hand-held radiometer measurements of whole leaves or segments of leaves clipped fromMusa sinensis, Cassia tora and Diospiros mespiliformis and arranged flat on six different backgrounds (black soil, sand, clay, loam, sandstone and water). The treatments were replicated six times.In situ measurements were complemented by aerial radiometer measurements of above-ground biomass on 24 May, 24 August, 13 October and 11 November 1985. The radiometer in this exercise was fixed to the floor of a light aircraft flying at an altitude of 610 m, enabling data sensing at an instantaneous field of view (IFV) of 160 m in diameter. In addition, aerial photographs with a field of view of 915×610 m were taken at the same sampling frequency.The advanced very high resolution radiometer on board NOAA-7 records spectral reflectances in the visible (0.58-0.68 µm) and near-infrared (0.725 -1.1µm) channels in the form of 10-bit digital data. The data were 'merged' on the Hewlett-Packard 1000 interactive image display system and mapped to Mercator grid coordinates using the geographical coordinates embedded on the AVHRR data tapes. The resultant grid image was modified by geometric corrections to the Niger course and the Gossi lake.To limit registration errors and atmospheric distortions, only full-resolution data (i.e. 1.1 km 2 at the nadir) were used to composite 'local area coverage' (LAC) scenes. Scenes were then selected that were within a scanning angle of less than 30° from the nadir and had optical thickness of <1 in the near-infrared channel. Pixels obscured by cloud cover were eliminated using a cloud mask with a threshold of 290° K in the thermal infrared.After selection, 27 scenes based on data acquisitions during July -December 1985 were available for analysis: of these 13 (July to September) were analysed. The NDVI values derived for each ground site were mean values calculated from 3 to 9 pixels, depending on the size of the site.Ground-collected reflectances from the Gourma confirm that there is a close relationship between NDVI and above-ground biomass (Table 1). But they also show that the index is specific to both the type of vegetation monitored (Grouzis and Methy, 1983) and stage of growth (Gaston et al, 1983;Wagenaar and de Ridder, 1986). The relationship between the index and actual biomass at a given site thus changes as the season progresses (Figure 1). Note: Regressions based on 24 measurements. Figure 2 shows that the maximum NDVI value occurs well before maximum biomass, which suggests that the index is not a direct function of actual above-ground biomass. As a result, simple linear regressions between the index and biomass give mediocre or even poor results, whatever the altitude from which measurements are taken (Hiernaux and Diarra, 1986). Poor correlations between NDVI and actual biomass result also from physical interference and technical constraints associated with the NOOA-7 and its sensor, both varying according to the altitude at which the radiometer measurements are taken. 1 NDVI = normalized difference vegetation index calculated from NOAA-7/AVHRR data.Transforming the IR/R ratio into a normalized difference vegetation index reduces distortions caused by differences in brightness between soil backgrounds, but does not eliminate them, especially when the soil is moist or flooded, the latter giving negative index values. Index values calculated for different soil backgrounds indicate that while the spectral responses of bare soils differ only slightly, the reflectance mixtures of green vegetation and soil background vary according to soil type (Figure 3). The mixed-response curves are almost linear for light loams and sandstones, but inflected for red and black soils and for water, the degree of the inflectance increasing with increasing light absorption by the background (Huette et al, 1985). 1 Measurements taken with a hand-held radiometer on 7 July between 13:00 and 16:00 h.These differences indicate that background-related interference will not be eliminated by merely calculating a standard increment between the index values for bare soil and vegetation/soil mixtures. The relationship between NDVI and actual biomass must be established separately for each soil background, by subtracting its reference value from the observed index.A comparison of ground, aerial and satellite data from the Gourma confirmed that, despite various technical problems, atmospheric conditions exert a major influence on NDVI (Hiernaux and Justice, 1986;Wagenaar and de Ridder, 1986).Because of the frequent presence of dust particles in the air, ground-collected soil reflectances tend to increase in the Sahel, the visible incoming radiation being reflected by dust in suspension more than the incoming near-infrared radiation. In comparison, aircraft-and, particularly, satellite-derived index values are lower, approaching those of dust which are comparable with bare-soil values. This is because radiance measured in the air consists of both radiation reflected from the ground (which is affected by the crossing of the dust-ridden atmosphere) and radiation reflected by dust in suspension, the density of which increases as the dust becomes thicker.The accuracy of remotely sensed data depends greatly on the clarity of the atmosphere, quantified in the inverse form of optical thickness (Holben, 1986). Atmospheric conditions during the 1985 growing season were not very favourable: daily measurements at 14:30 h in Gossi, central Gourma, show that in only 41% of the cases were conditions clear enough (optical thickness 0.75 in the near-infrared wave band), while 23% were cloudy and the remaining 36% were dusty. To reduce the effect of unclear atmospheric conditions on NDVI, data were selected using a cloud mask and scene compositing, in addition to calculating optical thickness.The cloud mask helps select cloud-free pixels on the basis of thermal differences in the far infrared, but it is not effective for all types of cloud and haze. The other procedure, scene compositing, involves the selection of the highest index value for each pixel in a set of consecutive days' data acquisitions, as this value is most likely to be least affected by atmospheric interference. In scene compositing much depends on the length of the period over which data are composited: using a large number of acquisitions over a long period increases the chances of selecting for clear atmospheric conditions, while using fewer acquisitions over a shorter period enables more precise monitoring of temporal changes in vegetation cover. Invariably, however, a compromise must be struck between the two options.The compositing period used in the Gourma project varied between 9 and 27 days, depending on the optical thickness at 14:30 h, the overpass time of the NOAA-7 satellite. The daily optical thickness values were calculated from ground measurements of solar radiation at seven sites in the region, as reported by Holben (1986).In remote sensing, problems due to atmospheric interference are often confounded by technical constraints associated with the characteristics of the orbit of the satellite, but also with differences in sensor instrumentation and optical fields (Figure 4). The major constraints encountered with the AVHRR on board the NOAA-7 satellite are: The two wavelength bands used, the visible and near infrared, are not ideally positioned to calculate the index. Moreover, once launched, the scanner is not recalibrated; in the Gourma project, calibration error occurred on 20 September 1985, preventing the analysis of data sensed after this date. The size of the basic pixel and the scanning angle of the sensor cause geographic distortions and increase atmospheric interference which cannot be completely corrected (Holben and Fraser, 1984). The scanning frequency of the NOAA-7/AVHRR is twice daily with one daylight crossing over the Sahel at about 14: 30 h, but the scanning angle is variable and limits the frequency of usable data to 3 consecutive days out of every 9. Resampling the data into a 'global area coverage' type of product reduces geographic resolution by a ratio of 1:15 and multiplies errors (Kidwell, 1984). In the Gourma project, only the 'local area coverage' data (pixel size 1.1 km2) were calibrated, although their availability was limited. The difference in the dates at which maximum NDVI and maximum biomass values occur (Figure 2) would support the hypothesis, already verified experimentally by Bille (1986), that there is a direct relationship between the index and the greenness density of biomass, albeit affected somewhat by soil background, vegetation pattern and shadowing. This hypothesis was also tested in the Gourma.A cause-and-effect relationship was assumed to exist between the maximum greenness density during the growing season and maximum biomass at the end of the season (Hatfield et al, 1984;Sellers, 1985;Lamprey and de Leeuw,1986). End-of-growing-season biomass depends, however, on cumulative production and the amount of losses through degradation and transfers in photosynthetically inactive vegetation. It is therefore not surprising that simple linear regressions between the maximum NDVI and end-of-growing season biomass give highly variable results, regardless of the altitude from which radiometer measurements are taken.Subtracting bare-soil reflectance values from the index only marginally improves the relationship, which is better on sandy than on clayey or conglomerate soils (Table 2). The relationship also seems to improve when actual biomass is lower, as was the case in 1984 (Hiernaux and Justice, 1986). Nonetheless, the high temporal and spatial variability in the relationship limits the relevance of the maximum NDVI parameter for forage resources assessment.Table 2. The relationship between maximum NDVI and end-of-growing season biomass at 5 sites in the Gourma, eastern Mali, 1984-85. b Index covers grass and tree foliage biomass.Assuming there are direct relationships (Figure 4) between NDVI and greenness density and between greenness density and photosynthetic activity, and assuming further that biomass is proportional to gross cumulative production, then the integral of the NDVI curve over time should correlate with actual above-ground biomass. This also assumes, however, that the other factors affecting biomassorganic degradation and transfers outare either insignificant or do not vary over time.In fact, though, the integral of the index curve calculated over the 1985 growing season did prove to be a good indicator of total biomass accumulation to which it was linearly related (Table 3), especially when soil-background reference values were deducted from the combined index values for vegetation and soil. Separate regressions were calculated for sandy and clayey soils, and the integral of index increments over the growing season was also applied to different phases of growth, irrespective of whether radiometer measurements were made on the ground or from the air (Table 4). Correlations for aerial measurements were improved by estimating the foliage biomass of trees and shrubs besides that of the field layer, in proportion to their cover. The choice of the integration period modified both the intercept and slope of the NDVI/biomass regressions, indicating that this may affect the application of the technique in general situations. Sensitivity to the dates for beginning and ending the data integration should therefore be tested for several sites, seasons and vegetation types before adopting the integrated NDVI for largescale forage resource assessment.The next stage of the calibration exercise in the Gourma included trials to map changes in above-ground biomass during the growing season and to determine the potential of the multitemporal integration technique for data extrapolation to wider ecological settings. Two distinct mapping trials were carried out: one around Gossi town (15°49' N, 01°18' W) in central Gourma, and one covering the whole of the Gourma region (about 150 000 km 2 ).The mapping trial in Gossi involved 250 km 2 of highly diverse environment. A set of seven grid maps was made, each grid cell covering an area of 1.5 km 2 , the approximate size of the local area coverage pixel of the NOAA-7/AVHRR data. The maps show changes in grass and tree foliage biomass from 2 July to 15 September.Biomass was expressed in seven classes, with limits of 75, 150, 300, 600, 1200, 2400 and 4800 kg DM ha -1 . Pixels were classified within this scale according to the integrated value of index increments at a given date. Seven soil backgrounds were distinguished from a plant ecology map derived by photo-interpretation. Soil background reflectance was taken into account twice: first, when calculating an index increment, and again when calculating separate regressions for the seven soil backgrounds identified.The index increment was calculated by subtracting the soil NDVI reference value from the combined vegetation/soil index values sensed during the growing season. Results obtained for each of the seven sub-strata were then separately applied to the observed index. The resulting biomass maps were not checked independently for accuracy, but 5 of the 30 sites used to calibrate the relationship between the NDVI and biomass lay in the area mapped, and the ground measurements carried out on them correlated well with the information on the biomass maps.This trial was carried out to investigate the applicability of the integrated NDVI for forage resource monitoring across the Gourma region. Because soil brightness was not measured, soil backgrounds were determined using NDVI values calculated for the beginning (November) and end (June) of the 1984/85 dry season. This led to distortions, as NDVI does not differentiate adequately between various types of soil background.The relationship between the integrated NDVI and above-ground biomass was calculated only for the end of the growing season (15 September), and the resulting 1.5 km 2 grid map was of value merely from a methodological standpoint. Nevertheless, the trial indicated that the multitemporal integration technique is potentially suitable for wider data extrapolation. This would add to its other advantage, namely that it requires only a few minutes of computer time, or a maximum of few hours if one counts the time spent on preliminary data processing.Monitoring of range resources has been hampered by a lack of a suitable method to quantify temporal and spatial fluctuations in plant biomass, and rangeland mapping has been limited to qualitative plant stratification. Given their wide geographic coverage and high frequency of acquisition, satellite-derived spectral data offer a possible solution to the problem, but their interpretation for practical quantitative assessment of forage resources is not straightforward.The calibration of a normalized difference vegetation index calculated from NOAA-7/AVHRR data in the Gourma region of Mali showed that, despite good correlations and linear fitting at a given site and on a given date, the relationship between the index and actual biomass is neither direct nor consistent. The integral of the index curve should theoretically be better related to actual biomass, as it is a function of the cumulative, intercepted, photosynthetically active radiation (IPAR), but the linear regressions of the integrated NDVI on biomass also varied with site and season.Part of this unreliability was associated with differences in soil background response, but the main distortions were due to atmospheric interference. Soil-related effects were reduced by calculating the relationship between the integral of NDVI increments over time and aboveground biomass separately for each soil type. Atmospheric interference can be reduced by selecting data or scenes least affected by cloud, haze or atmospheric dust. In the Gourma project, the quality of the remotely sensed data was sufficiently improved by empirical data selection procedures to allow automatic mapping of range resources at a coarse resolution.The mapping trials carried out indicate that satellite-derived digital data facilitate the analyses and calculations needed for rapid production of simple thematic maps. Combining the information such maps give on the temporal dynamics of plant biomass with information on plant stratification maps (which need to be digitalized for this purpose) would provide a better data base for improved resource management in pastoralareas.ILCA introduced a long-term health package for village goats in southwest Nigeria in 1982. The package consisted of annual vaccination against peste des petits ruminants (PPR) with tissue culture rinderpest vaccine (TCRV), and monthly dipping against sarcoptic mange using gamma benzene hexachloride.The preliminary results reported in ILCA (1985) suggested that goat mortality rates were greatly reduced by the health package, and that animal numbers in the villages increased. However, changes in the birth and mortality rates may not have been the only reason for the observed population changes. To clarify the effects of the health package tested, the data were reanalysed and the results of the analysis are discussed in this paper.Seven villages near Fashola, Oyo State, were visited monthly between December 1982 and November 1984. At the start of the survey all goats in the study villages were divided into three groups 1 : the dipping plus vaccination group (D + V), which comprised animals from three villages, the dipping group (D) and the control group (C), the last two each comprising goats from two villages (Table 1). All animals in the groups were tagged. The treatments were monthly dipping in acaricide in groups D and D +V and annual vaccination with TCRV in group D + V.1The original design included a fourth group in which goats were only vaccinated against PPR, but these animals were withdrawn by their owners soon after the start of the trial, and are not therefore included in the analysis. Entries into the herds (including births, purchases and animals accepted for caretaking) and exits (deaths, sales, loans-out, gifts, ceremonial slaughters and animals returned to owners after caretaking) were recorded monthly and tags allocated as appropriate. Births were recorded as singles, twins, triplets or quadruplets, the records showing also the sex of the offspring, the month of birth and dam number. Kidding interval was determined from records of dams that had more than one parturition during the 24 months of the trial.For the purposes of data analysis, the dividing line between young and adult animals was set at 12 months of age. Kidding rates were expressed as kids born during the trial, multiplied by 12 and divided by the sum of adult female goats present in each month. Monthly entries other than births and exits were expressed as entry or exit divided by the total goat population in that month.Overall numbers. During the 24 months of the trial, the number of goats present in the herds increased in all treatment groups (Table 2): the highest increase was recorded for group D (162%), followed by group D + V (86%) and group C (46%). In group D + V the number of adult goats increased more sharply than that of young stock, while in the control villages both age groups increased by a similar amount, and in group D the number of young stock rose faster than that of adult goats. Herd structure. The proportion of adult males increased over the trial period by about 10 percentage units across all groups (Table 2). The proportion of adult females changed little in group D + V, and decreased in groups D and C.Entries. Total entries (expressed as percentages of total animal months) were similar for all treatment groups (Table 3). The entry rate for young stock was lowest in group D (139%), compared with about 155% for group C and 152% for group D+V. The proportion of multiple births was lower in group D + V (66%) than in the other two groups (75%). In group C, a lower proportion of births occurred in the months of December, January and February, indicating that conception rates were lower during the rainy period of July -September (Figure 1). Purchases. About 12-15% of animals entering the herds were purchased, with young animals comprising over four fifths of the purchases (Table 3). Mean monthly purchases for February to July were similar in all groups (1.5-1.6%), but in the remaining 6 months of the year the mean for group C was lower (0.4%) than for the other two groups (0.9%) (Figure 2). Loans-in. Few cases of loans-in were recorded during the study period, accounting for 2.3% of animals present in group D + V and for 0.3% in group D. No animals were received on loan into the control group.Exits. Exit rates were generally lower in group D than in the other groups (Table 3). Overall exits were twice as likely to be from young stock than from adults.Deaths. The overall mortality rate (Table 3) was lower in group D (7%) than in the other groups (about 13%). Across all groups, mortality among young stock was much higher than among adult goats, the difference being most marked in group C where young-stock and adult mortalities were 25 and 3% respectively. In all groups, mean monthly mortality rates were lower during February to July than during August to January. This difference was again most marked in group C, where the mean monthly mortality for August to January was 1.8%, twice as high as in group D for the same period (Figure 3). Sales. The proportion of animals exiting through sales (Table 3) was over twice as high in groups D + V (17%) and C (19%) as in group D (8%). Compared with sales of adults, twice as much young animals were sold from groups D + V and C, and almost three times as much from group D. Sales from all groups peaked in September (Figure 4), coinciding with the Muslim festival Id-el-Kabir. Loans-out. The proportions of animals exiting the village herds on loan were similar in all treatment groups (Table 3). Young goats were given out on loan more often than adult goats, particularly in groups D + V and C. In all treatment groups, loans-out were high in January and February, with a further peak during August to October (Figure 5). Other exits. These accounted for only 24 out of a total of 433 exits, with ceremonial slaughter being the most important reason (20 cases).Offtake. Total offtake (all exits minus deaths) was highest in group C (42%), followed by group D + V (39%) and group D (29%). In group D, the lowering of offtake of young stock was more marked than that for adults (Table 3).Animal numbers in the treatment villages increased faster than in the control villages, but these population changes were due to a combination of factors, some of which may not be directly attributable to the treatment applied.The overall entry and birth rates in the villages where goats were dipped were not much different from those in the control group. Fewer adult females in group D completed more than one reproductive cycle during the trial period, but their kidding interval was shorter than in the other two groups. Compared with the control, total exits in group D were reduced: this was partly due to a lower mortality among young stock, but sales were also reduced as were loansout of young stock. Lower mortality accounted for only about one third of the reduction in exits of young stock in group D, while the lower exit rate of adult goats was due mainly to a reduction in sales.Entries in the D + V group were higher than in the control group, resulting from small increases in both purchases and births. Mean litter size in group D + V was depressed, but a higher proportion of adult females in the group had more than one parturition during the trial. No differences were observed in the overall exits from groups D + V and C, nor in the various reasons for exits. The differences in the change of herd numbers during the trial period were due to an increase in adult goats present in the D + V group, which in turn reflects a drop in the mortality rate of young stock and hence an increase in the number of kids surviving to maturity. This confirms the findings of Sumberg and Mack (1985) that dipping and vaccination improves survival rate to weaning, and to 12 months of age. Adeoye (1985) reported that a dipping and vaccination regime similar to the one used in this study reduced monthly goat mortalities in the humid forest zone by 87%. Opasina (1984) found in the derived savannah that dipping and vaccination can lead to a 40% reduction in mortalities.The results of this study in the derived savannah are less encouraging. Peste des petits ruminants is, however, a cyclic endemic disease in Nigeria. Offspring acquire immunity from the dam, which is effective for about 3 months; in adult goats, immunity acquired from a survived infection lasts for about 3 years (Obi, 1982). Thus unless an outbreak of PPR occurred during the study period, no benefits would be expected from vaccination.The overall benefits of vaccinating against PPR in addition to dipping remain unclear under the conditions of this trial. The overall entry rates in groups D + V and D were not much different, and the exit rate was higher in group D + V. About one third of the difference in exits was due to a higher mortality rate in group D + V and the remaining two thirds to a higher sales rate. Thus the change in herd numbers over the period of the trial was less in group D + V than in group D, but the cash income that farmers derived from their herds was higher.Birth rate in the early dry season (December -February) was higher in groups D + V and D than in the control group, indicating a higher conception rate during the mid-to late rainy season (July -September). The highest mortality rate was recorded in September for group C, confirming previous observations on village goats (Mack, 1982;Sumberg and Mack, 1985;Adeoye, 1984).Age of the dam affects litter size (Sacker and Trail, 1966;Wilson and Durkin, 1988). In West African Dwarf goats, litter size increases up to a dam age of 48 months (S.A.O. Adeoye, ILCA, Ibadan, Nigeria, personal communication). The age of dam was not recorded in this study, but groups D and C had a higher proportion of adult females than group D + V at the start of the trial, and this may have affected litter sizes. Mack (1982), who studied sheep and goats in a similar village environment in southwest Nigeria, reported purchases accounting for 4% of total entries and sales accounting for 7% of total exits. These values are considerably lower than the 18% of purchases and 22-33% of sales recorded in this study.Group D farmers sold fewer animals than farmers in the other groups, sacrificing immediate cash income for the longer-term benefits obtainable from additional breeding animals. Farmers will sell a sick animal in the market rather than wait for it to die. This may explain the high sales offtake in group C compared with group D, but not why sales from group D + V should also be high, since breeding animals in particular are rarely sold when in good health (Sempeho,1985).Loans-in and loans-out in Mack's study were roughly equal at around 9% of total entries and exits, but in this investigation loans-in were negligible (1%) and loans-out accounted for 40% of total exits. Farmers have a social obligation to provide animals on loan if requested, and those asking for loans may have believed that the goats in the trial were in better health than those available from other sources. The offspring of animals on loan are usually shared between the caretaker and the owner. In this study, however, farmers rejected caretaking as an option for increasing their own herds, favouring instead outright purchase.The health package tried had no effect on the number of goats slaughtered for home consumption directly or after ceremonial slaughter. This indicates that in the study area, goats are not an important source of meat for the farm household. Improvements in productivity could increase cash income, and indirectly improve household nutrition as a result of more cash being available to buy food, but there is no evidence from this trial that home consumption of small ruminant meat will increase.Working in the same area of Oyo State, Matthewman (1977) reported that 91% of the livestock owners surveyed mentioned financial gain as the main reason for keeping small ruminants, and only 5% placed priority on food. The offtake rate of weaned kids was 74%, and that of adult goats 24%, excluding females that had not kidded. These rates are similar to the control offtake rates in this trial, if allowance is made for young stock which died before weaning."}
|
main/part_1/0118388746.json
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
main/part_1/0125371546.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"7af701d981404409ecc19ec3f47991fc","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/901a487c-9fca-499e-b741-48e11dc92a78/retrieve","id":"101235755"},"keywords":[],"sieverID":"e2aac6e6-299b-4be2-82dd-265223d3ea8d","content":"Over the last 30 years or so. the single mos( urgent task of agricultura! researchers In the troplcs has been to help farmers pul food on lhe developlng world's (able. Now. we've got lo work w1th them loward a balance between three competlng obJecUves: l. Achieve and maintaln food securlty.In many parts of the developlng world. food security Is sun lenuous al besl. To help abolish hunger. agrIcultural researchers must make an all~out assault on majar constrainls of food producUon and storage. 2. Close lioks to well-targeled, participatory research on craps and their wild relat1ves ensure that whal we do lo Lhe ¡ab 1s relevanl lO Lhe needs of farmers and consumers.In Lhe accompanying Project Updates (see pocket). we describe research on selecled tapies. These exampJes ilIusLrate how biolecho ology, Integrated wiLh neld rescarch. can enhance the problem-solving power of agricultura} science.In market-oriented agnc ulture, there Is a powerful Lendency toward excesslve pesll clde use. which adds to producUon costs. causes ecologtcal damage. and may give rise to trade baniers. Ooe way biotechoology can combat this probIem is by speeding lhe development of disease-and pest-reslstant varieties that elimlnate or reduce the need for chemical controIs. Another ts to enhance natural associaUons belween plants and beneOcia l mlcroorganlsms lhal reduce populations of haTmful pathogens and pests.To help farmers malntatn the balance. we must do more Lhan simply master new technlques. We must apply íbem creaUvely lo practical ends. such as conserving plant genetlc diverslty (In gene banks, farmers' fields, and nature) and uslng valuable genes for plant tmprovement.JIgS3W puzzle wtth thousands of pleces.We take one ONA segment or probe at a lime and determine where it fits on the crop genome.\" The cassava collecllon al ClAT compt1ses nearly 6,000 accesslons from the species' pt1mary centers of dlverslty In the Americas and secondary centers In Africa. Asia. and Oceanla. The Center ts pursulng several approaches to tmprove conservatlon oC these geneUc resources.One is lo Idenlify duplicates in the collection, whlch conlains several local clones (each with a dlfferenl name) of the same genotype. Thls should increase the cost-effectlveness of germplasm conservaUon and management.Analysis of Isozyme promes (see pholo), along with morphologlcal and agronomlc desct1ptors, has shown that about 20% of the collecllon conslsts of duplicates. Among varieUes already screened on the basls of morphology and Isozymes, we're applylng DNA flngerpt1nting to detect genetic differences more preclsely. For example, In a sample of 100 apparentiy similar accessions, we determlned that 20 are geneUcally unlque (and the remalnder duplica tes), uslng the gene for protein 111 of the bactet10phage M13 as a probe . RAPO markers confirm lhese resulls.Effectlve conservation oC geneUc resources requires a combination oC in situ and ex si tu approaches, In si tu conservallon Is preferred for populations of crap wild relatives , ptimiUve cultivars. and landraces. Ex sltu conseIValion complements that approach by safeguardlng germplasm threatened with gene tic eroslon or other dangers, We can achleve thls end by vanous means, ranglng from preservation of landraces and pt1mlUve cultivars in the fleld to In vitro conservaUon, DNA storage, and cryopreservaUon.In cooperation with the Inlernatlonal Institute for Planl Genetic Resources (IPGRJ) , ClAT has developed an in vitro active gene bank thal conlalns more than 5,900 clones, representing over 950/0 of the world coHecuon of cassava germplasm (see pholo) . The Center's Genetic Resources Unll malntalns these clones under s low-growth condltions (I.e., at reduced lemperature In a speclal medium). Even so. the accesslons must be renewed every 12•18 months. The entlre In vitro bank occuples 35 m 2 of laboratory space, about a thousandth of the area needed to maintain the same maleria)s in the fleld. From [his active colieclion, we've distributed nearly 2,000 palhogen-tested cassava clones to lhe national research institutions of 35 countries In Africa, Asia, and !.alln America.An even more ideal approach 15 cryopre5ervaUon or ultrafreezing (8ee photo) . By stopplng cell funcllons and senescence, tbls technlque makes It possible to preserve tbe plant genome Indellnltely. CIAT has been workJng on tbe cryopreservation of cassava shoot lIps sine e 1989. By 1991 we were able to recover complete cassava plants from shoot Ups frozen in liquid nltrogen (-196\"C) . Furlher improvements In tbe technlque (lnvolVing changes In tissue dehydrallng trealments, tbe rate of coollng, and culture media) enable us lo conslstenUy recover plants from frozen shoot tips witb a success rate of more than 60%.CurrenUy, we're developing a simple protocol for more emcient and les s cosUy freezlng, which will open tbe way to long-term eonservallon of a base gene bank of cassava clones in IIquld nltrogen.In vitro conservaUon of cassava figures tmportantIy in CIAT trainlng on genetic resources. For example. tt was among the main tapies of a course entiUed Bioteehnolagy for the ConseIVaUon of Agrobiodlversity, whlch was held at Center headquarters In November 1994.CIAT and IPGRl JolnUy establlshed tbe In Vitro active cassava gene bank In 1991, after a 3-year study of lIs lechnical and logisllcal requiremenls. In eollaboration wtth national programs, the two centers are now plannlng a comparable pllot projeet lo Implement a base gene bank using cryogenics.GETrING A PREVlEW OF PHASEOWS GENETIC DlVERSlTIThe 26.500 Phaseolus accesslons stored In CIATs Genetlc Resources Unit contaln enough geneUe dlversity to keep bean researchers busy for decades. But because the complete eollectlon Is so large and has not been thoroughly characterized. irs an unwieldy tool for studylng the structure and dlstr1buUon of Phaseolus genellc diverslty and IdenUlYing valuable genes.To provide a more convenlent way of performtng these tasks. CIAT researchers (lncludlng speclallsts In bean genellcs. blotechnology. and agricultural geography) recenUy formed two core collecllons. The flrst. contatning 1.420 accessions. represents culuvated common beans (Phaseolus uulgaris). while the second. with 100 accesslons. covers wild P uulgaris. The core coIlecllons are intended. nol lo replace the complete holdings. bul to glve researchers a preview of them as a guide lo further InvesUgatlon .But eore colleellons are useful only If they aeeurately represent the geneUe dlverslty of the speeles sampled. To meet thls requlremenl. we based the composltion of OUT core collecUons 00 a combJnaUon of faclors re1ated lo the evolutton of common bean and lo the agroecologtes ln whlch tt 15 raund. For example. In formlng the eolleellon of culUvaled P vulgaris. we Inc1uded more accesslons rrom primary lhan secondary centers of dlverslty and gave more weighl lo primltive seed types and growth hablts than to moderno cornmercial anes.Te guarantee lhat the core collecUon covers the crop's entlre range of adaptalion. we developed a simple agroecologieal c1assifieallon. It's based on four faetors (sueh as solls and ralnfall) and Includes a total of 54 dislinet agroecologies. Uslng map coordina tes for the sltes where seed of bean landraees was eolleeted. we identiOed the agroeeology to whlch each aecesslon belongs.In cooperaUon wtth the Universily of Wisconsin , USA. we used RAPD markers to veril)' thal the genetle variabtllty of the eulllvated P uulgarts core eolleellon truly represents thal of the base eolleellon. Now we oeed to evaluate and use the eore eolleeUons. One example 15 our sereenlng of the eultlvated bean eollectlon for phosphorus use effieieney and seleetion of de51rable genolype5.In addilion. we're eharacterizing lhe eollectlon of wHd accesslons, using phaseolin and other polyrnorphlc seed prolelns as bloehemleal indicators of genetlc diverslly as well as molecular markers. such as AFLPs and RAPDs (see photo). These teehnlques help us study the gen elle structure of the wild germplasm, determine the extent to whleh cultlvated beans evolved from only a limlted fractlon of wild populatlons (referred to as the founder e.1Jec~, and trace the gene fiow between wlld and cultlvaled germplasm a nd between the Andean and Mesoamerican gene pools of common bean .We see the core collecllons and procedures by whlch they are belng formed as ne.w opportunllles for cooperaUon wlth gene banks and breedlng programs. The collectlons could provide a convenlent. cornmon focus for furtber study and evaluation of Phaseol.us dlverslly.Bul we're also seeking partners Inleres led In applylng the new procedures lo form core collecllons of other specles, whlch wllI help researchers sludy a wlde range of agroblodlverslty. Tools IIke molecular markers can magnlfy the preclslon of such sludies and the Inslghls we galn from them. Geographic Informatlon systems (GIS) can help us describe and analyze genetlc dlverslty In relatlon lo key agroecologlcal variables. TAMING THE WILD RELATlVES OF COMMON BEANIn wild fonns and dlstant relaUves of Important staples but often Ue beyond the reaeh of eonvenUonal plant breedlng. Through several proJeets at CIAT. we're exploring new ways to ease the transfer of su eh genes to domest1eated eommon bean IPhaseolus vulgaris).Sorne Important traits oeeur In wild or primltlve for ms of P vulgaris. But getting them Into domestleated eommon bean can be far from stralghtforward, even though the two are sexually compatible. Windows of cooperation: IRRl and CLAT are strongly promoting lnternatlonal cooperatlon In the development of germplasm wlth durable blast resistance, so that developlng CQuntrles can more easlly ceap its benefits lesUmated at US$210 mllllan annually. on average. In Lal1n America alone).Amer1ca. Together with SClenUsts from Cornell and Purdue univerSiUes, stalf of the two InternaUonal centers have agreed on a Jolnt breeding strategy. Our work in Colombia is critical, because 1t takes place at a site ISanta Rosa) where the causal fungus Is extremely variable.To make new flndings and technology more wldely avaUable to national Institules. CLAT held a rice blast workshop during Oclober 1994 In cooperation wlth the Programa Cooperativo para el Desarrollo Tecnológico Agropecuario IPROCISUR). It focused on molecular marker-aided analysls of pathogen dlversity and vlrulence dlverslty sludles. The participants were multtdlsciplinary teams of sclentlsts [each conslsting or a breeder. pathologist. and blotechnology speclal!st) from the flve countr1es of South Amer1ca's Sautbern Cone. But rather than stop wlth Brachiaria. why not start there? Assuming that an apomlx1s gene could be transferred from this to other crops. we could gain a convenient. inexpenslve way lo multiply hybrtds uniforrnly.Hybrids are Ihe vigorous progeny of crosses between genetlcally distlnct parents. Since only Ihe Orst sexual generatlon of Ihis seed shows hybrid vigor, it makes no sense for farmers lo adopt hybrids unless Ihey buy new seed for each crop . lo many developlng counlr1es, weak seed systems and rural poverty make Ihls pracllcally Imposslble. Anolher problem is Ihat Ihe reproductlve blology of certalo self-pollinating crops (characterized by deOclent pollen productloo or transfer) greatly complica tes large-scale producUoo of conveollooal hybrid seed.Getllng around lhe obstacles to hybrid development Is one goal of Ihe various inslltutlons already try1ng to Introgress apombds genes into major cerea1s. Eventually, 1t may be possible lo en¡¡ineer apomictlc crops by using new biotechnology lechnlques lo lransfer aporntx1s genes belween more genetlcally dlstant specles.Once farmers have Ihelr Orst supply of apomlcllc hybrids, Ihey can produce one generallon afler anolher of hybrid seed.Windows of cooperution: To genetlcally engineer apomlctlc crops, we musl complele lhree main tasks: 1) densely map Ihe Brachiarta chromosome reglo n on whJch the apomlxJs gene ts located , uslng molecular markers, 2) isolate and clone Ihe apomixis gene, and 3) geneUcally transform larget crops. Each step presents a maJor challenge and will requlre close collaborallon wilh advanced labs. But by Idenllfy1ng a molecular marker linked to Ihe apomixis gene, ClAT has begun the Orst task, and by regeneratlng Brachiaria planls from Ussue culture, we've made progress in developing a lransformaUon protocol as well. Thls technique will enable us to test the expression of Ihe apomixis gene in different Brachiaria backgrounds.Olher useful appllcaUons of molecular markers are to facllltate lhe use of exoUc germplasm In erop Improvement. Identlfy duplleatlon In germplasm collectlons. determine evolutlonary relatlonshlps among erops specles and between lhem and lhelr Wild relatlves. and measure geneUc dlverslty.In seeklng geneUc solutlons to problems of plant productlon and utilizaUon. It isn't always clear how or where we can intervene. To use gennplasm efflelently. we musl Idenllfy polnls of gene tic Inlervenllon by elucldaUng lhe bloehemleal fa clors and genetlc meehanlsms Involved In Important physlologtcaJ and quaJlty tralta [Figure 4) and In lhe InteracUons between planta and blotlc stresses. We ean lhen develop blochemlcaJ and molecular assays to detect lhose factors and eventually Isolate and clone lhe genes responslble for lhem.Uslng molecular techn lques. we can next attempt to m odlfy lhese genes. ellher enhanclng lhelr n ormal functlon [overexpresslon) or InhlblUng It (downregulaUon). Thls procedure employs a transformatlon 'cassette: comprislng lhe complete coding sequen ce of lhe structural gene of Interest. gene promoters. enhancers. gene markers. ele . [Figure 5). AH lhese elementa are n eeded for proper expresslon when lhe modlfied gene construclls relurned to lhe planl or transferred to olher specles lhrough genetic transjormalíon .The genes lo be used mus l firsl be Isolaled. c1oned. and modlned . Al lhe same time. we have lo develop a workable system or protocol for genetlc transformatlon of lhe crop . At ClAT we've em ployed two approaches successfully: Agrobaclerium-medlaled and partlcle bombardment-medlated genetlc transformatlon (Figure 6). Wllh lhe flrst approach. we've produced(1) Fruclose Glucose-6-P 1(11 (5.5 %) 5.5 ( 6.8 'Y.) 6.9 (9.4 %) 9.6 (11 .1 %) 11.3 can analyze a much larger number of ONA fragments and lhus dlsUngulsh genotypes more preclsely al lhe molecular level.New recomblnanl ONA lechnology has greaUy facIlltaled lhe development of genet1c maps. Prevlously. researchers could delecl only a few geneUc recomblnat1on evenls by observlng phenotyplc markers In plants . Wlth molecular markers. genetlc dlfferences can be delecled more thoroughly and slmply.For example. an RFLP map of lhe planl genome can be developed by uslng numerouS markers lo deterrnlne the pasillon of speclfic restrtcllon fragments relaUve lo one anolher. Thls Is accompl1shed through a procedure lermed linkage ana/ysis. In whlch markers lhal segregale togelher afler melosis are said lo be \"linked.\"Slnce lhe number of such markers Is unlimlled. Il's posslble lo lilerally salurale the planl genome and lhus obtaln InformaUon aboul alI reglons of each chromosome of a plant specles. Markers línked to parUcular genes enable us lo follow lhe transfer of lhese tagged genes from one generatlon lo another. as chromosomal segmenls are exchanged during meiosis (FIgure 2).Important advanlages of RFLP markers are lhal they can be delected al any slage in plant developmenl and In any tissue. are not affecled by the envlronmenl. and are geneUcally codomlnanl. Consequenlly. lhey provlde a rellable. direct means lO Jocate and monitor chromosome segments and tbe genes they contaln.ClAT Is currenlly developlng two molecular geneUc maps. for cassava and tepary bean . We're a150 ustng common bean and Jice molecular maps developed al the Unlversity of Florida and Cornell Unlverslty. respectively. In the USA. 5uch maps comprise sets of molecular rnarkers , referred lo as linkage groups (FIgure 3). Normally. lhe number of lhese groups equals the specles' basic chromosome number (n = xl.In addltlon lo helplng map planl genomes. RFLPs and RAPOs show great pro mise for facIlllaUng planl selecUon for Importanl tralls. Wllh a procedure referred lO as bulk segreganl analysis. we lest many RAPOs to IdenUfy lhose ly1ng closest lo genes of interesl. Though not yel w1dely pracliced. In 1991. ClAT established the lnstitutional Biosafety Committee to oversee aH research al the Center involving recombinant DNA techniques and to monitor the release and testing of transgenie organisms. In addiUon, we eoorganlzed a regional workshop on blosafety In Latln America with the Instituto Interamericano de Cooperación para la Agricultura (IlCA). Participants in this event, which was funded by DG1S and the US Department of Agriculture {USDAJ, cal!ed for partnerships In the Andean countries to develop biosafety guldelines and cooperate in properly eontrolled experimental release of transgenle organisms.The Center also contributes to the debate on intel!ectual property rights (IPR) and on policles governlng the status and international movement of plant geneUe resourees. Under our eurrent IPR poliey, bioteehnology products and methods developed at ClAT are within the public domaln. The poliey also allows for strategie allianees with institutions in developed and developing eountries to faeilitate the laUer's aeeess to information and technology. We're developing Material Transfer Agreements (MTAs) for al! exchanges of biotechnology producls and methodoIogles to guarantee their avallab1llty to natlonal instllutions in deveIoping countries. "}
|
main/part_1/0126091183.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"e3ac6be9069decd2ac6d105f0fcdbf41","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/52a25f2c-3939-4c10-8a6f-b44a5942a97c/retrieve","id":"1024084897"},"keywords":[],"sieverID":"dc9d534f-5eec-4347-b75d-87cd04c6972a","content":"Elements of informed consent (Declaration of Helsinki, 2013):1. The aims of the study and 2. The methods to be used 3. The sources of funding and possible conflicts of interest 4. The institutional affiliations of the researcher 5. The anticipated benefits and potential risks 6. The discomfort it may entail/the time it will take 7. Any post-study provisions 8. The right to abstain from participating, or to withdraw from it at any time, without reprisals 9. The opportunity to ask questions 10. The way in which the study will be reported and shared 11. The person to report any concerns about the study to -Someone from the research team and someone from the ethics committee.Considerations:• Does the participant have the ability to exercise their right to autonomy? • Is a once-off signing of a form enough? • Has the participant comprehended what is involved in the study?Informed consentA note on coercion… Ethical Principle 2 -Beneficence Two main elements:1. Do no harm 2. Maximise possible benefits and minimize possible risks There is increased complexity in One Health, where sometimes decisions need to be made around the relative value of human, animal and environmental health. "}
|
main/part_1/0134164822.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"01bac1a15ab2eda31db1226c21772561","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/5f69ca9d-d6eb-46f9-9888-1b32838ece1d/retrieve","id":"-2106034898"},"keywords":[],"sieverID":"1156d959-b8d6-410e-90c6-aa397bca5225","content":"Open creative commons licences should be applied to all ILRI information products, including reports, articles, publications, posters, presentations, slides, photos, etc. ILRI standard templates include these by default but make sure your products have them.Journal articles, books and chapters published by commercial companies require special attention to secure our open access and re-use rights."}
|
main/part_1/0153741266.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"c54f27f5686980149bf42a4c6ce5be3f","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/82f4391f-f80d-4c2c-8a6b-cb518a51c0a1/retrieve","id":"1156835130"},"keywords":[],"sieverID":"65361c7d-9898-414e-966b-c9166fe2bd3b","content":"Fair dealing and other rights are in no way affected by the above.The parts used must not misrepresent the meaning of the publication. ILRI would appreciate being sent a copy of any materials in which text, photos etc. have been used.Editing, design and layout-Bahir Dar Zuria District in the Amhara Region has emerged as a potential milkshed with flourishing market-oriented dairy farms. However, there are several herd health and animal welfare issues affecting milk production and productivity in the district. To address these challenges, a community-based participatory dairy herd health and welfare management training was conducted by ILRI, SAPLING herd health, and HEARD project from 25 July 2023 to 02 Aug 2023 in Bahir Dar Zuria District.The main objective of the training was to enhance milk production and productivity by equipping female and male dairy farmers with knowledge and skills in improved dairy herd health and welfare management practices. A total of 30 dairy producer farmers from three dairy clusters, consisting of six administrative kebeles, participated in the training. The training was conducted over six days, with two days dedicated to each cluster, on a sequential half-day basis.To ensure convenience and a conducive learning environment, the training sessions were held at the community centers/FTCs. An experiential and collaborative learning approach was adopted to identify gaps in farmers' knowledge and attitudes and introduce new knowledge and improved practices to address these gaps. The training covered seven topics related to herd health and welfare management, including infectious and non-infectious diseases, parasitic diseases, calf mortality, reproductive disorders, hoof disorders, and dairy cattle welfare management.Various training tools such as checklists, flipcharts, and group discussions were used to facilitate information flow and progressive learning. Visual aids such as pictures, storytelling, and discussion questions were employed to encourage participation and interaction among the participants.During the training, several major diseases affecting dairy cattle production were identified, including foot-and-mouth disease (FMD), lumpy skin disease (LSD), mastitis, bloating, calf mortality, fasciolosis, schistosomiasis, ticks, and lice. Additionally, limited access to quality animal health services, land shortage for dairy production, and inhumane handling during herding, transportation, and slaughtering were recognized as significant animal welfare problems in the district.To mitigate the identified herd health and welfare problems, the implementation of prioritized intervention packages is crucial. The successful execution of these interventions can significantly improve the herd health and productivity of dairy farms in Bahir Dar Zuria District.Urban peri-urban dairy farming is playing an increasingly important role in milk production in Ethiopia. This sector not only contributes to employment, asset generation, and poverty alleviation, but also supports market-oriented small to medium-sized dairy farms in Bahir Dar Zuria District.Efforts have been made by the regional government and NGOs, such as the African Dairy Genetic Gains (ADGG) project, to improve the blood level of dairy animals to boost milk production and productivity.However, with the improvement of exotic blood levels in dairy animals, several herd health and welfare problems have emerged. Reports have shown that dairy farm owners in these areas lack the necessary knowledge and have gaps in implementing improved herd health and welfare practices.For example, a significant number of urban and peri-urban dairy producers in Bahir Dar milkshed do not allow their calves to ingest maternal colostrum immediately after birth due to misconceptions about colostrum causing calf diarrhea and retention of fetal membrane (Alemu et al., 2021). Additionally, substandard farm management practices, including excessive confinement, poor ventilation and barn hygiene, and inadequate nutritional and health management, contribute to major animal welfare issues in the area.Therefore, it is essential to develop the knowledge, skills, and attitudes of farmers regarding improved dairy herd health and welfare management practices. Based on this background, the Suitable Animal Productivity, Livelihood, Nutrition and Gender Inclusion (SAPLING) initiative of One CGIAR has identified Bahir Dar Zuria District as a potential site for dairy herd health interventions.The project has designed practical and context-specific intervention packages for dairy herd health. Furthermore, to ensure sustainable and quality animal health services in the area, the project will introduce and test a mobile private veterinary service delivery system through a public-private partnership (PPP) model.As part of the broader SAPLING innovation work, this pilot study will be implemented in coordination with ADGG project. One of the prioritized interventions is the training on herd health and welfare management, which aims to achieve the following general and specific objectives.• To increase milk production and productivity by developing the knowledge and skills of female and male dairy farmers in improved dairy herd health and welfare management practices.• Specific objectives• To develop the knowledge and skills of farmers on improved herd health and welfare management practices• To change farmers' attitudes and perceptions about improved herd health and welfare management practicesBecause of its commercial dairy potential, Bahir Dar Zuria District was selected to implement the dairy herd health pilot intervention. Particularly, three dairy clusters consisting of six administrative kebeles, having a total of 60 farmers having small to medium sized dairy farms were selected for the herd health intervention. Of which, 30 farmers were randomly selected as intervention, and 30 farmers as non-intervention/control groups. The training targets small-to-medium dairy farms that primarily keep cattle for selling dairy products-market oriented dairy farms. This training was given only to intervention farmers.Before the execution of the herd health and welfare management training, a comprehensive training and mentoring manual was developed by ILRI herd health team in collaboration with dairy herd health and welfare intervention implementer. Besides, the training facilitators were virtually coached how to facilitate the training and mentoring of the farmers by ILRI herd health staff. Based on the training and mentoring manual, and agreements made during the virtual coach, training objectives and key messages were addressed through a participatory training approach. Moreover, major herd health problems identified during the dairy cattle health intervention validation workshop were considered during the training (Dinede et al., 2022) The training process adopted an experiential and collaborative learning approach as described by Lemma et al. (2016). This training approach allows farmers to reflect on what they have learned, relate it to their experience, and think about how they can apply it. This would enable them to draw their pre-existing knowledge, experience, and attitude, identify knowledge, skill and attitude gaps and introduce new knowledge and improved practice to address these gaps. To effectively deliver the message, checklists, flipchart, and group discussions were used as training tools to ensure convenient information flow and progression of learning. Pictures, storytelling, and discussion questions were used to facilitate discussion and interactive training. Methods and materials used during the training include:• Flipchart and checklist• Experience sharing among dairy farmers• Dairy farm visits• Picture analysis.Besides, during the training and model farm visit, pictures and video were taken to document evidence, collect farmers opinion, knowledge, and experience (see Photos section). This will help us to assess the effect of the training on their knowledge improvement during the follow-up period.The training date and venue were arranged in consultation with the respective District livestock office, kebele extension agents and ADGG focal person. The training was conducted at farmer's community centers/farmers training center (FTC). This creates an easy access to dairy farmers, create a safe/comfortable learning environment for farmers and facilitate practical/peer-learning using farm visits. The training was implemented between 25 July and 2 Aug/2023 (Annex 1). A total of six days (2 days per cluster) on a half day sequential basis were taken to finalize the training.By the end of each training round, dairy farmers were allowed to mention key messages and action points. By the next day, before the beginning of successive training sessions, a recap of the previous session was made to ensure a logical progression between sessions and training rounds.The training was facilitated by Yeshwas Ferede, Bahir Dar University.Before the beginning of the actual training, following trainees' arrival, they were warmly welcomed by the district officials and, followed by self-introduction by the trainers. Then, farmers were briefed about the overall SAPLING's herd health and welfare management training objective. Farmers were asked to share their expectations from the training and what they hope to change due to the training.A total of 30 farmers who enrolled as intervention farmers attended the herd health and welfare management training. Female-headed household participants constituted about 13.3% (4/30).Although the training was supposed to use a mixed/or couple's training approach, due to the main crop cultivation season, bringing couples (both husband and wife) to the training session was challenging. This led a very small (16.6%, 5/30) proportion of women participants in the herd health training. These participant couples were only from Sebatamit-Yigoma dairy cluster.The training covered seven dairy herd health and welfare management topics. These include, i) prevention and control of major infectious diseases affecting dairy cattle, ii) prevention and control of major non-infectious diseases affecting dairy cattle, iii) control and prevention of major parasitic diseases affecting dairy cattle, iv) prevention and control of calf mortality in dairy farms, v) prevention and control of major reproductive disorders in dairy cows, vi) prevention and control of major hoof disorders in dairy cows, and vii) improving dairy cattle welfare management practices.As part of the brainstorming session, farmers were asked how to identify a sick dairy animal, common clinical signs of a diseased animal, and share their experience on how to manage their diseased animal. They were also asked to describe infectious diseases, their transmission method, source of infection, their impact on dairy cattle production, their control and prevention methods to understand their level of knowledge/awareness. Farmers were allowed to identify major infectious disease affecting their dairy animals through an interactive discussion. This helped us to understand farmers' current problems and accordingly deliver the training towards addressing these issues.Major infectious disease identified by farmers included: FMD, LSD, mastitis, bovine pasteurellosis and Blackleg. However, they mentioned that the prevalence of anthrax and blackleg are decreasing from time to time. Accordingly, much emphasis was given on the control and prevention of prioritized herd health problems (i.e., FMD, LSD, bovine pasteurellosis and bovine mastitis). Nevertheless, considering the dynamic nature of these infectious diseases, the training session covered anthrax, black leg, and bovine tuberculosis (bTB).All farmers have never heard about bovine Tb and didn't know its potential transmission from dairy animals through ingestion of raw milk and meat. We also noted variations among trainees in terms of knowledge and attitude regarding infectious disease prevention and control. For instance, farmers from Robit-Yibab, and Sebatamit-Yigoma have relatively better awareness of how to control infectious diseases (e.g., FMD and LSD) when compared to Yibab-Yinesa cluster dairy producers. Farmers located in the later cluster perceived that these diseases have no prevention measures. These farmers use various ritual and religious activities like the use of Holy water, and serving coffee, and porridge to get rid of these diseases. A list of common diseases affecting their dairy cattle and their local/vernacular names are mentioned in Table 1.Farmers were asked to describe mastitis, estimate the magnitude of the problem in their dairy herds, mention the potential predisposing factors, and source of udder infection, and share their prior knowledge and experiences in managing mastitis in lactating dairy herds. Almost all farmers were familiar with clinical mastitis. The recurrent occurrence of clinical mastitis was a major herd health problem in the intervention areas. However, none of them were aware of sub-clinical mastitis and its huge negative impacts on dairy production (reduced milk yield, teat blindness, reduced productivity).Most farmers wash their hands without drying towels and soap before and after milking. However, the rationale why they wash their hands was poorly understood. Some farmers wash their hands just because of their habitual practices, and some others to keep the cleanness of the milk. They never thought that a cow's udder environment and its dung are major sources of udder infection.After a series of discussions, farmers were convinced to be proactive in implementing mastitis preventative measures (i.e., follow hygienic milking procedures; wash hands before and after milking, udder washing, teat dipping, regular barn hygiene, milk infected cows last), early detection of udder infection through visual inspection of the udder (any swelling and udder asymmetry), loss of milk quality (color and consistency), milk quantity (milk yield reduction; subclinical mastitis). Dry cow therapy was mentioned as an effective means to effectively control mastitis in subsequent lactating periods. They were also advised to avoid self-medication of mastitis as they might encounter treatment failure due to lack of improper drug choice and dosage. Farmers mentioned that the reason why treat their animals by themselves is due to lack of mobile veterinary services in the nearby areas.Farmers from the two clusters (Robit-Gombat and Sebatamit-Yigoma) complained that the quality of milk from high grade cows is deteriorating from time to time. Their pooled milk didn't pass the quality standards (lactometer and alcohol test) set by the dairy cooperatives. They asked the project to support them in examining the root cause of milk quality loss in their farms. Upon examination of their milking practices, most farmers milk their pregnant dairy cows until seven months, and some others milk until eight and half months, this could lead to milk quality loss in subsequent lactation periods. Such late milking practices coupled with the hidden occurrence of sub-clinical mastitis could contribute to milk quality deterioration. Nevertheless, this needs further investigation.Under this training topic, farmers were asked to describe non-infectious diseases, explain the difference between infectious and non-infectious diseases, to mention major nutritional disorders in their herds, their impact on dairy cattle production, their control and prevention methods to understand their level of knowledge/awareness and attitude. Farmers were also asked to identify major non-infectious diseases affecting their dairy animals. Few farmers (10%, 3/30) experienced milk fever/calcium deficiency disease. Most farmers have never experienced milk fever and ketosis, and hence have no awareness about these diseases. However, emphasis was given to these metabolic diseases, as these farmers have a plan to increase the exotic blood level of their dairy cows to boost milk yield.Farmers were informed about the causes and predisposing factors (poor nutritional management during the dry period) and clinical signs of milk fever and ketosis. They noted that these diseases commonly occurred in high grade cross bred dairy cows/high yielding dairy cows in early lactation periods. To ensure a better understanding of milk fever, the role of calcium in milk production during the transition period and fetal bone formation during pregnancy was described. Farmers were also asked to mention their diet/nutritional management practices for lactating and nonlactating dairy animals to associate these problems with their nutritional management practices.Almost all farmers gave concentrate feeds (nug seed cake and wheat bran, pelleted dairy formula feed) as supplement to lactating dairy cows. However, they didn't provide special nutritional attention to pregnant dairy cows. This showed that farmers were not taking the required preventive measures to control potential metabolic disease during the dry periods. They were advised as they can avoid milk fever in dairy cows by providing calcium rich (e.g., green feeds, limestone flour) and energy (e.g., wheat/maize bran, Napier grass) rich diets with another ration during the last trimester.Farmers were asked to mention how simple indigestion and gas bloating are frequently occurring in their farms, including common seasons, affected age group, causes and their control and prevention measures. Farmers were also asked to mention their diet/nutritional management practices for lactating and non-lactating dairy animals to associate these problems with their nutritional management practices.According to farmer's view, simple indigestion and gas bloating were found as common disorders associated with abrupt dietary changes at the beginning of concentrate feeding (for dairy cows), and at the beginning of rainy season (when shifting from a dry to early green pasture in grazing cattle) and during main rainy season (grazing of succulent green pastures, they named it ''Wajima/ዋጅማ ''). Farmers used various homemade techniques by themselves, to manage bloating. These include pasture management (Whitling-for trifolium grasses) drenching of oily substances (paraffin oil), and rumen puncture using knives in severe cases. Farmers were advised to take possible precautionary measures to prevent simple indigestion/bloating and carbohydrate engorgement by avoiding cattle from potential causes of bloating. And consult veterinarians when these diseases occur in their herds.Under this training topic, to better understand the knowledge and attitude level of farmers, they were asked to identify major internal and external parasites of dairy cattle, transmission methods of these parasitic diseases, source of infection, their impact on health and production, and their control and prevention methods. This valuable information was documented through a series of interactive discussions.In all three clusters, internal parasites (especially fasciola and shistosoma) were found major dairy herd health problems, especially in grazing cattle. Almost all farmers knew that these parasites are sourced from grazing/feeding of pasture in waterlogged areas. However, they didn't have awareness about bovine lung worm, including its source. Farmers use deworming chemicals (Albendazole, tetracloza, ticlibendazole and Ivermectin) to control these internal parasites. All farmers perceived that scistosoma can be treated using these drugs.As Bahir Dar Zuria District is located around Lake Tana and the Blue Nile River, there are different wetlands serving as communal grazing land. Besides, irrigation is a common activity in dry seasons. These create a favorable microclimate for the multiplication and maintenance of intermediate hosts (snails) of trematode/fluke parasites. Hence, during the training, much emphasis was given on how to control such internal parasites. Farmers were advised to avoid grazing pasture on waterlogged environment, use cut and carry systems, to feed their animals after wilting of the harvested pasture for at least 2-3 hours. Besides, farmers were encouraged to consult veterinarians before they procure deworming chemicals, the frequency and type of dewormers to be used.In all three clusters, external parasites (especially ticks, lice, and fleas (in young stocks)) were mentioned as major cattle parasites. They knew that these external parasites cause health problems through sucking blood and skin irritation and are sourced from cattle grazing areas. However, they didn't have awareness about the role of ticks in transmitting infectious diseases (e.g., heartwater, babesiosis) from one animal to another animal. When farmers were asked how to control these external parasites, all mentioned using spraying (diazinon) and injection (ivermectin). Some of them use self-treatment, and others bring their animals to a vet clinic for treatment. They explained that tick infestation begins at the onset of the rainy season and continues until the dry season begins.From their experience, we noted that some farmers have been using authorized spray chemicals (herbicides) against tick infestation. These farmers encountered cattle deaths following the spraying of these herbicides. In earlier periods, some farmers explained that they used herbal medications (''Endod'') to control lice and fleas in dairy calves. Farmers were advised to avoid the use of selfspraying acaricides and authorized chemicals for veterinary use. Besides, farmers were encouraged to consult veterinarians about which acaricides to procure, how to use PPEs, and how to prepare and spray acaricides.The objective of this training topic is to improve the health and productivity performance of dairy calves through improving the knowledge and attitude of farmers about improved dairy calf management practices, create/raise awareness about the cause and impact of major calf diseases and calf mortality.Under this training topic, farmers were asked to describe the unique features of a newly born dairy calf, encouraged to share their experiences in pre-natal and peri-natal calf management practices, major calf diseases, source of infection and transmission methods, the impact of calf morbidity and mortality on the performance of their dairy farm. These questions were forwarded to deliver context-specific training and understand farmers' level of knowledge/awareness and attitude about calves, common diseases, and other improved calf management practices.Farmers were allowed to identify major infectious and non-infectious diseases of calves commonly occurred in their farms, and their existing mitigation strategies. Calf diarrhea was found to be the leading calf health problem in these areas. Septicemia (''Kortim''), Pneumonia (''Anfis''), omphalitis and external parasite infestation (ticks, flea, and lice) were also mentioned as major calf health problems. FMD was reported as the major cause of calf mortality in the area. Adequate emphasis was given to prioritized calf health problems mentioned by farmers. Farmers were advised to implement improved calf management strategies. Besides, farmers were advised to implement better calf milk and non-milk feeding, improved barn hygiene, and early detection when a calf gets sick for better health outcomes.Farmers were asked to share their experiences and attitudes regarding colostrum management and its role in reducing calf morbidity and mortality. These questions were forwarded to understand farmers' level of knowledge/awareness and attitude about colostrum feeding. We observed some notable colostrum management variations, offering colostrum to newly born calves across dairy clusters. Robit-Yibab, and Sebatamit-Yigoma have relatively better awareness and experience in colostrum feeding practices, most of them fed colostrum before six hours of birth. Nevertheless, they didn't know the health benefits (rich with various Immunoglobulins) and measure the amount of colostrum to be fed (as they practice hand feeding).However, farmers from Yibab-Yinesa clusters never thought that colostrum was significant for calves, rather they abstained or allowed them to ingest residual colostrum after the fetal membrane was expelled out. According to these farmers, bloating, diarrhea, and unstrictness later in life, are some of the perceived negative impacts of colostrum. Early colostrum feeding to calves before six hours of birth is critical to ensure better calf health and productivity. An interactive discussion was made to convince farmers about the importance of early colostrum feeding and that it has no side effects.Under this training topic, farmers were asked to mention major reproductive disorders encountered in their farms, impacts of calf reproductive disorders on the performance of their dairy farms. They were encouraged to share their experiences and practice how to manage reproductive disorders. Farmers were not aware of infectious causes of abortion, and their zoonotic potential.Retained Fetal Membrane (RFM), abortion, dystocia and infertility (repeat breeding) were the major reproductive disorders mentioned by farmers. Uterine prolapse was reported by some farmers following the forceful traction of the fetus. We observed some variations in managing RFM among participants. Many farmers considered that the fetal material is retained if it hangs until six hours, and few of them until 12 hours. Farmers were convinced that they needed to be proactive in providing better dietary and breeding management, and early detection of reproductive disorders. They were strongly advised to take care of them while handling aborted fetus, and how to dispose of the aborted fetus to protect themselves from potential zoonotic diseases. Farmers were also taught that the fetal membrane is said to be retained if it fails to be expelled from the uterus between 12-24 hours of birth. They are accordingly advised not to manage the fetal membrane before 12 hours of birth. They are also advised to consult veterinarians when they encounter any reproductive disorders in dairy cows.The association between RFM and colostrum feeding was discussed. Most farmers perceived that early colostrum feeding extends the removal of RFM. However, through interactive discussions, farmers understood their wrong perception, and instead, they were convinced that early colostrum feeding stimulates oxytocin release and milk letdown, which helps quick expulsion of RFM from the uterus. Other reproductive disorders (metritis and endometritis), their clinical signs, and source of infection were also described. Hence, considering the huge impact of reproductive disorders, the role of strict biosecurity measures, and good nutritional, health, and breed management practices in controlling reproductive disorders have been emphasized during the training.Under this training topic, farmers were asked to mention major hoof disorders encountered in their farms, causes/predisposing factors, and impacts of lameness on the performance of dairy cows.They have been encouraged to share their experiences and practice how to manage hoof disorders. Some farmers explained that lameness is a common problem in dairy cattle following FMD and LSD exposure. Tick infestation, mechanical hoof injury, and hoof overgrowth (stall-fed animals) were common causes of lameness in dairy cows.Dairy farmers were taught about the causes and impacts of hoof disorders in dairy cattle. They taught about the importance of maintaining good claw health in the welfare and productivity of their dairy cows. Farmers were advised that early detection and treatment of lameness is critical for minimizing the impact of this condition on the health and productivity of the herd. Claw lesions which include sole ulcers and digital dermatitis are common causes of lameness. Trauma to the hoof or leg, such as from slipping or falling, can cause lameness in dairy cows.Infectious diseases, such as foot rot and interdigital dermatitis, can cause lameness in dairy cows. These diseases are caused by bacteria and can be spread through contaminated environments or equipment. Nutritional deficiencies, such as a lack of trace minerals or vitamins, can lead to lameness in dairy cows by weakening the hoof and bone structure. Environmental factors, such as slippery floors or poor ventilation, can increase the risk of lameness in dairy cows. Regular hoof trimming, providing proper flooring (such as non-slip surfaces), proper nutrition during the pre-and postpartum period, early detection, and treatment of lameness, implementing effective biosecurity measures, proper environmental management, selecting cows with a history of good hoof health can help reduce the incidence of lameness in the herd. We noted that most farmers were not aware of animal welfare, including its role in improving the productivity and health of animals. Accordingly, emphasis was given to changing the farmers' attitudes to animal welfare. During the training, animal welfare was defined as '' the combination of an animal's physical health and psychological wellbeing'' provided by the animal welfare committee. Hence, animals can be used for human purposes, but they should be treated humanely so that discomfort is kept to a minimum.Farmers were asked to mention common welfare unfriendly practices. Limited access to quality animal health services (e.g., vaccination, quality drugs), and shortage of land for dairy production (for barn construction, exercising area) were mentioned as major welfare constraints in the study areas. Abuses (beating) during herding and transportation, mixed herding, cutting and hot iron application (traditional medication), and inhumane handling during transportation and slaughtering were common welfare unfriendly practices. Besides, farmers prohibit calves from getting maternal colostrum, provide insufficient milk to calves, and practice preferential treatment (feeding and attention) for female calves and lactating dairy cows, while male calves and other age classes receive little/no attention in the herd.Based on the identified welfare unfriendly practices, an interactive discussion was made with farmers to avoid such welfare problems. Accordingly, they were introduced with the fivefreedoms/domains of animal welfare with the respective improvement strategies. These include nutrition (freedom from hunger and thirst), health (freedom from pain injury, and disease), environment (freedom from discomfort), behavior (freedom to express normal behavior), and mental (freedom from fear and distress).The awareness of farmers about animal welfare and key welfare improvement strategies (i.e., understanding the five basic welfare domains) was raised/created through a series of interactive discussions. The relationship between animal welfare, productivity, and health was described. The five internationally recognized animal freedoms (welfare domains), which have been used to systematically identify and grade welfare problems worldwide, with their improvement strategy are described below (Table 2). Partners were cleared about the role of the private veterinarian and its service scope, as he is supposed to deliver demand driven selected preventative and curative herd health services. Partners (district officials, kebele extension agents and ADGG focal person) showed their keen interest and commitments to support the SAPLING's heard health program by integrating its herd health interventions into their regular extension activities, and monitoring program. Table 1 shows agreed shared responsibilities among partners. At the end of the training, participant farmers from each cluster were allowed to share their views, reflections and feedback regarding the training content and approach. They appreciated the training delivery methods, which allowed them to freely share their feelings, discuss their problems, and learn new knowledge with clarity and customized simple language. They also added that the training duration and venue arranged at their village helped them to save their time, and create a favorable peer-based-practical learning environment. Some farmers shared their opinions quoted below.A participant farmer from Robit kebele, said that \"I have taken trainings from different projects, but truly speaking, this one is special for me, the training approach was simple and friendly. This helped us to learn new knowledge and avoid wrong perceptions about improved animal health issues. Now, the newly acquired knowledge will enable me to effectively manage the health of my dairy animals. I have never thought that colostrum feeding has such a huge advantage in improving calf health and reducing calf mortality. This training has completely changed my mindset. I will fully offer colostrum to my calves as soon as birth\".A female household-headed participant farmer from Yibab Kebele, explained \"I have learned a lot of things from this training, how to improve the health of my dairy cows. I have been facing mastitis repeatedly in my dairy farms, and I have now learned mastitis is a preventable disease by applying hygienic milking procedures. I will keep washing my hands before and after milking and keep the cow's udder and barn clean!\" A participant farmer from Yigoma Kebele, also added that \"different projects supported us to cultivate improved forages and produce better dairy breeds. We did that! But now animal health is a priority issue for us. I lost two crossbred calves this year to FMD/አፈማዝ disease, because of a lack of access to veterinary services. We are struggling to get vaccination services against FMD and LSD diseases. I heard great news today! We are lucky to hear that this project will introduce a mobile veterinary service for us\".Partners were allowed to share their reflections and feedback regarding the relevance of training. The district livestock representative explained that ''it is a great opportunity to receive such support from ILRI, as they have a huge gap in addressing the knowledge gap of farmers, herd health gaps, and vaccination services in Bahir Dar Zuria District''. They appreciated the training material, which they found clear and well structured, and expressed their interest in using the training material in other areas having a similar production setting.Overall, the herd health and welfare management training were delivered as per the plan and the training manual. All selected intervention farmers attended the training. The content of the training material was clear, and the trainers tried to align well with farmer's real problems. The training methodology was convenient and effective in addressing farmer's real problems. The allocated time (half a day, on a sequential basis) for the training was enough to address key messages and allow farmers to go back home early in the afternoon for farming activities.The training venue was found convenient for accessing participant farmers, effectively managing time, and implementing practical learning sessions (i.e., model farm visits). This helped the trainers to effectively address messages within the provided time frame. The commitment of participants from partnering institutions was encouraging. They have been engaged from planning to implementation of the actual training. This helped us to effectively facilitate the training, have a better understanding of the project's activity, and take shared responsibilities.Despite having those notable strengths, few limitations were observed during the training period. Initially, mixed/couples-based training was planned. However, due to the main crop cultivation season, women were not allowed to attend the training alongside their husbands.It would have been better if the training was delivered in dry/off seasons, where main season farming activities are relatively simple. Due to time limitation and lack of transport arrangements, inter and intra-cluster model farm visit was not implemented as planned. A model farm visit session was arranged only in Robit Kebele. There was no electricity access in most FTCs, which made it difficult to deliver a video-based demonstration.The herd health and welfare management training was carried out between 25 July and 02 Aug 2023 in Bahir Dar Zuria District. The training was successful in meeting its objectives and achieving the desired outcomes. However, those observed gaps, limitations, and feedback identified during the training need to be analyzed and addressed. This would help us to effectively implement the upcoming herd health interventions. Besides, the introduction of subsequent herd health activities, which includes the introduction of the baseline survey, and the introduction of private mediated mobile veterinary health services along with prioritized herd health interventions, scheduled supervisions, and mentoring activities, should be implemented timely. Establishing a strong multidisciplinary monitoring and evaluation team, drawing from ILRI herd health team, ADGG and district livestock officials, would also help to ensure effective implementation of herd health interventions.Participant farmers in dairy herd health training, Sebatamit FTC (photo credit: Yeshwas Ferede/BDU). "}
|
main/part_1/0157555120.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"8606bf31f3de829506b10f41d05b0582","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/89deea54-1a57-4ea0-b26b-79564998be01/retrieve","id":"1606973125"},"keywords":[],"sieverID":"6d194cc6-ebc8-4869-8731-ce4f38b63d18","content":"En la industria avícola la principal materia prima como fuente de energía es el maíz; los productores de este cereal no cubren la demanda que acarrea el sector avícola en Colombia, por esta razón el país se ve en la necesidad de importar grandes volúmenes al precio que indique el mercado; por otra parte, la globalización abre los mercados y por lo tanto hay que buscar competitividad con materias primas que se produzcan en el trópico y sean fuentes de nutrientes en la alimentación animal; la yuca y la batata que son productos tropicales, se presentan como una alternativa que puedan reemplazar el maíz como fuentes de energía ya que poseen rendimientos productivos mejores o iguales que este cereal.Por ello, este trabajo se presenta como el resultado de una validación y ajuste a un trabajo de investigación (grado) con Harina de yuca y Harina de batata en la alimentación de pollos de engorde realizado anteriormente con el objetivo de comparar biológica y económicamente y de este modo al seleccionar la mejor o las mejores alternativas promover el uso de la harina de yuca y harina de batata como una propuestas para mejorar los ingresos de los productores pequeños y medianos y d e este modo generar empleo. Desarrollar mediante pruebas de ajuste y validación adecuación de resultados expertmentales para el empleo de harina de batata(lpomoea batatas Lam) y harina de yuca (Manihot esculen,ta Crantz) en la alimentación de aves para medianos y pequeños productores.• Evaluar el efecto en el rendimiento productivo (consumo de alimento, aumento de peso, conversión alimenticia, relación de eficiencia) debido al empleo de diferentes niveles y sistemas de suministro de harina de yuca y harina de batata en dietas para pollos de engorde de 1 a 42 días de edad.• Determinar el rendimiento de la canal y nivel de pigmentación de piel, pico y patas en pollos de engorde de 1 a 42 días de edad debido al empleo de las dietas empleadas en el punto anterior.• Establecer mediante análisis económico cual o cuales de las propuestas constituyen la m ejor opción para el productor de pollos de engorde.La batata pertenece a la familia de las Convolvuláceas ( Convolvulaceae).y especie Ipomoea batatas. La enredadera ornamental no comestible esIpomoea pandurata, (Enciclopedia Microsoft Encarta, 2000.) El camote o batata tiene lo que los botánicos llaman un centro secundarto de diversidad genética; áreas geográficas donde el cultivo evolucionó separadamente de sus ancestros americanos. En Asia, se encuentran muchos tipos de camote genéticamente distintos de los hallados en las áreas de origen. La forma cómo llegaron al sudoeste del Pacífico es tema de debate. Se cree que los exploradores europeos lo llevaron en los albores de la conquista española de América Latina; otros se inclinan a pensar que mucho antes de que ello ocurriera, el camote cruzó el Pacífico moviéndose de una a otra isla, a bordo de las embarcaciones de los indígenas. El camote o batata es rico en carbohidratos y vitamina A. Tiene una gran diversidad de usos que incluyen el consumo de las raíces frescas, o de las hojas procesadas como follaje, almidón, harina, caramelos.Debido a su versatilidad y adaptabilidad, el camote es el séptimo cultivo alimenticio más importante del mundo, después del trigo, arroz, maíz, Papa, cebada y yuca. Más de 133 millones de toneladas de batata se producen globalmente cada año. El continente asiático es el principal productor de camote o batata, con 125 millones de toneladas de producción anual. De China procede el 90 o/o de la producción total (117 millones de toneladas) cerca de la mitad de la batata producido en Asia es usado para la alimentación animal, tanto en forma fresca como en productos procesados (CLAYUCA, 2003).En contraste, aunque los agricultores africanos producen solamente alrededor de 7 millones de toneladas al año, gran parte de la producción es dedicada al consumo humano. Los rendimientos africanos son absolutamente bajos, aproximadamente un tercio de los rendimientos asiáticos, pero indican el enorme potencial de crecimiento futuro (CLAYUCA, 2003).Según Argenti, 1999 la batata es un cultivo altamente rendidor, con producciones entre 1 O y 50 ton 1 ha y un rendimiento promedio entre 6.2 y 6.8 toneladas, destinadas para consumo humano. De este producto se puede aprovechar la raíz y el follaje. Es altamente digestible, rico en carbohidratos solubles y contiene vitaminas en cantidades suficientes para cubrir parcialmente los requerimientos nutricionales de los cerdos. Se considera uno de los cultivos energéticos más completos.Además, se pueden obtener dos ciclos 1 año, es de fácil propagación y se adapta a diferentes ecosistemas. Posee un contenido de proteína en la raíz de 2,8 a 9%. dependiendo de la variedad y de 17 % en el follaje.El valor energético está entre 3.160 y 3.220 kcalED 1 kg de MS, equivalente a 90 y 96% de lo aportado por la yuca y el sorgo, respectivamente. Un contenido de extracto libre de nitrógeno (ELN) de 88,6%; 3,2% de fibra cruda; 3,5% de ceniza y 0 ,04% de fósforo disponible (ARGENTI y ESPINOZA, 1999). El primer inhibidor de proteínas encontrado en plantas es el inhibidor de tripsina cristalizado de la soya. Otros inhibidores de proteínas que se describen en variedades de plantas. especialmente las gramíneas son las pertenecientes a la familia de las Solanáceas.La función fisiológica exacta de los inhibidores de tripsina en plantas esta aun sin responder, ellos juegan un papel de protección en las plantas contra insectos o patógenos.Las primeras plantas no leguminosas reportadas con contenidos de inhibidores de tripsina fue la batata (SOHONIE Y BHANDARKAR. 1954 citado por: WOOLFE, 1992}.La fu erte inhibición de tripsina como se ha demostrado en proceso Ú1 vitro con inhibidores tripsinicos de batata puede indicare con una interferencia en la digestión de la proteína Ú1 vivo esto teniendo implicaciones en la nutrición humana especialmente en la ingesta de la proteína. Además algunos inhibidores tripsinos pueden generar enteritis necrótica. y reducir la eficiencia alimenticia (WOOLFE, 1992}.La yuca pertenece a la familia Euphorbiaceae constituida por unas 7200 especies que se caracterizan por su notable desarrollo de los vasos laticíferos, compuestos por células secretoras llamadas galactositos.Esto es lo que produce la secreción lechosa lo que caracteriza las plantas de esta familia. Un género muy importante de esta familia esManihot al que pertenece la yuca, y se encuentra distribuido desde el suroeste de los estados unidos hasta Argentina. Naturalmente solo se encuentran especies del genero Manihot en las Américas (Organización de las Naciones Unidas para la Agricultura y la Alimentación-FAO. 2003)Agrega la FAO 2003, que la mayor parte de las raíces cosechadas en el país (más de 2 millones de ton/ año) se destinan a la alimentación humana; sin embargo, su uso en la alimentación animal, como producto fresco en raciones para bovinos y porcinos, ha aumentado moderadamente ( 100 mil ton/ año en la actualidad), esta cifra se incrementará sustancialmente en el futuro cuando se establezcan las nuevas tecnologías de producción y utilización de raíces y el follaje, de procesamiento en poscosecha, y de industrialización de nuevas variedades.La yuca es una especie eficiente en la producción por hectárea de carbohidratos, según reportes suministrados por el Consorcio Latinoamericano y del Caribe de apoyo a la investigación y desarrollo de la yuca-CLAYUCA 1 hectárea de yuca puede producir 25 toneladas de raíces frescas las cuales se pueden convertir (factor de conversión de 2.51) en 9.96 toneladas de raíces secas y aportar 30 millones de calorías de EM, por lo tanto es un alimento energético básico en gran parte de la industria de alimentos balanceados para animales, ya sea en forma de harina o pellets.En el año del 2002 se estimó en 184 millones de toneladas en equivalente de raíces frescas, es decir alrededor de un 2 % más que el nivel récord alcanzado en el 200 l. debido a un aumento de su cultivo en África y en América Latina y el Caribe que ha compensado con creces la contracción registrada en Asia (FAO, 2003).La yuca en Colombia, y en general en América Latina y el Caribe, posee grandes ventajas que pueden ser utilizadas en beneficio de todos los integrantes de la cadena agroalimentaria. Es un cultivo con alto potencial de producción de raíces (25 ton/ha en promedio El almidón de las raíces es el principal alimento animal que ofrece la yuca, normalmente el contenido de materia seca (M.S.) de la raíz esta entre 34 y 38%. y el almidón entre 75 y 80%. De la producción de 25 toneladas se obtiene 9.5 de M.S. de estas son 5 de almidones. Un pequeño porcentaje esta constituido por proteínas (3%) y fibra (4%)Los componentes principales del Extracto No Nitrogenado-ENN de la raíz de yuca son los carbohidratos solubles constitu idos por almidones y azúcares, el almidón constituye el 80% de dicho extracto. El nivel de fibra cruda en la yuca presenta pequeñas variaciones según la variedad de la yuca, edad de la raíz; normalmente su valor no pasa del 1.5% en la raíz fresca y del 4% en harina. Los nutrientes grasos se encuentran en concentraciones mínimas en la raíz de la yuca, constituidos principalmente por galactosil-diglicéridos y ácidos grasos saturados. el Extracto Etéreo-EE es mayor en la corteza que en la pulpa. las xantofilas, clorofilas, resinas entre otros están más concentradas en las hojas (ARAUJO et al, s.f).Por otra parte, la raíz de yuca presenta valores de energía digestible de 3.296 Kcal/kg mientras que las hojas tienen un contenido de Proteína Cruda-PC de 30.15% y una digestibilidad del 58% con un nivel de Fibra Detergente Neutra-FDN de 41.5% (ARAUJO et al, s.f).Las concentraciones de Fósforo son mayores en la raíz y la del Calcio en el follaje. El alto contenido de humedad de las raíces de yuca diluye la energía metabolizable en los productos frescos, no así en los secos, por esta razón en casi todos los animales monogástricos el uso de los productos frescos esta limitado. El contenido de vitaminas y minerales de las raíces es mínimo.Las raíces de la yuca se caracterizan por su bajo contenido de proteína cruda y de aminoácidos; es notable su deficiencia en aminoácidos esenciales como la Metionina, Cistina, Tiiptofano, y en exceso contiene Arginina, Ácido Aspártico, Ácido Glutámico. Aproximadamente el 50% de la proteína cruda de la raíz corresponde a proteína verdadera mientras En trabajos experimentales realizados recientemente a través del proyecto conjunto CLAYUCA-MADR y la Federación Nacional de Avicultores de Colombia-FENAVI se han evaluado dietas para pollos de engorde. Las dietas fueron elaboradas con harina de yuca (raíces y hojas) y soya integral y se compararon con una ración comercial basada en maíz y soya integral. En el caso de las raciones con harina de yuca, se tuvo la oportunidad de comparar el efecto de harina deshidratada al sol con harinas deshidratadas en equipos disponibles comercialmente.Todos los grupos que consumieron harina de yuca (45 y 49%) y soya integral tuvieron un rendimiento en peso y conversión alimenticia igual o superior al grupo testigo de maíz y soya integral, este efecto se observó tanto en iniciación como en finalización. El consumo de alimento no se afectó en los tratamientos con niveles altos de harina de yuca. Los índices de mortalidad en todos los tratamientos no fueron influenciados por el tipo de dieta suministrada. Los grupos con dietas a base de harina de raíces, se caracterizaron por una pobre pigmentación de piel, picos y patas durante todo el tiempo, sin embargo el grupo con harina de raíces complementado con harina de las hojas, mostró una pigmentación igual a la del grupo testigo con maíz amarillo en calificación de 4 y los del grupo de harina sin hojas, no superaron la calificación 2 de la escala, donde (1 es pálido y 5 es más pigmentado) en una escala subjetiva propuestas por los autores (GIL y BUITRAGO, 2002).GARCÍA Y CEDEÑO (1998) compararon la adición de un 15% o 30% de harina de yuca en la dieta de pollos de engorde formulada por aminoácidos dejando la proteína libre los resultados produjeron igual aumento de peso y peso final, pero, con un menor consumo de alimento y por consiguiente una mejor conversión alimenticia y relación de eficiencia en los pollos que consumieron la dieta con el 15% de harina de yuca.VARGAS Y VI LLEGAS ( 2004) evaluaron el suministro de diferentes niveles de 0% a 50% solas o combinadas de Harina e Yuca y 1 o batata en Udietas para pollos de engorde de 1 a 42 días de edad y encontraron que la mejor opción de manejo biológica y económicamente fue la combinación de 12.5% de Harina de yuca y 12.5% de Harina de batata en la dieta en diferentes fases de producción.La parte aérea de la yuca que se considera útil para alimentación animal esta constituida, principalmente, por hojas, pecíolos, tallos secundarios y algunos tallos primarios.También debe tenerse en cuenta que la calidad de la harina esta influenciada por la variedad de la planta. edad, fertilización, medio ambiente y distancias de siembras. Uno de los factores que más influye sobre la calidad y la cantidad de nutrientes del follaje se relaciona con la edad del material al momento del corte. Cuando se realizan cortes desde una edad temprana en cultivos orientados a la producción de follaje. se logra obtener el máximo rendimientos en términos de calidad y cantidad de nutrientes. Las mayores variaciones nutricionales en la harina de follaje, se refieren a la concentración de proteína, fibra y energía metabolizable. Mientras que el nivel de fibra se incrementa con la edad de la planta, las concentraciones de proteína y energía disminuyen.El contenido de proteína puede variar desde el 25%, en cortes de follaje tiemo {2 a 3 meses), h asta valores inferiores a 20%, en follaje con madurez y poca densidad de hojas.Así mismo, las variaciones en fibra pueden flu ctu ar desde 10%, en producto con muchas hojas. hasta más de 20%, en el caso de muestras con mucho tallo. De acuerdo con el contenido de fibra y cenizas, la concentración de energía metabolizable se calcula entre 1.300 y 1.800 kilocalorías por kg. aproximadamente {BUITRAGO et al, 2001).El factor extemo más limitante, se relaciona con la característica de follaje fibroso, que, tal como sucede con otros tipos de follaje, no permite la inclusión de niveles superiores a 6-8% de la dieta final. La concentración alta de fibra y los problemas de palatabilidad de los follajes esta asociados directamente con el bajo nivel que se acepta en dietas para aves, sin embargo estos bajos niveles de inclusión proporcionan, de todas maneras, un aporte importante de proteína y de pigmentos naturales, tanto para pollos como para ponedoras (BUITRAGO et al, 200 1).El trabajo de campo se realizó en la unidad de investigación avícola de la El CIAT, cuenta actualmente con 15 hectáreas de yuca en total, 13 sembradas y 2 en proceso de siembra, y 1.5 hectáreas de batata con 18 clones de las cuales en la actualidad CLA YUCA tiene destinadas a la investigación, parte de este material fue utilizado en esta validación durante el periodo de la practica, las variedades implementadas de Yuca fue la MCol 1505 y de Batata variedad 440045.Para el desarrollo de la practica profesional se tomo como base los datos obtenidos en el trabajo de grado \"Evaluación del uso d e la harina de batata (Ipomoea batatas Larn) y de harina de yuca (Manihot esculenta Crantz) en dietas para pollos de engorde de l a 42 días de edad\", como continuación del empleo de materias primas tropicales en la inclusión de dietas para avesSe realizó un ajuste a las dietas en niveles incrementales de harina de yuca y harina de batata, se fortificó los niveles de aminoácidos en las dietas y se adicionó harina de follaje de yuca.l. Sistemas de alimentación en niveles incrementales 5% , 10% y 15% Harina de Yuca+ Harina de Batata de acuerdo a las fases l-14, 14 a 28 y 28 a 42 días de edad respectivamente.2. Requerimientos nutricionales fortificando en 10% los Aminoácidos (metionina + cistina y lisina) .3. Adición de follaje de yuca como fuente pigmentante para coloración en piel, pico y patas.Comprendió de l a 42 días de edad dividida en tres subfases: l . Cría de l a 14 días de edad.2. Desarrollo o levante de 14 a 28 días de edad.3. Ceba 28 a 42 días de edad.Luego de ser cosechadas la yuca y la batata fueron sometidas a un lavado para extraer tierra adherida a las raíces, si este proceso no se realizaba el producto fmal podría tener un alto contenido de cenizas, reduciendo la calidad, para esto se empleo una lavadora de yuca con tambor rotatorio.Figura 2. Lavadora con tambor rotatorio Para facilitar el secado de las raíces fue necesario exponer al aire una mayor superficie de las mismas, se empleo una picadora de yuca con disco de tipo tailandés.Figura 3. Picadora con disco tailandés Figura 4. Trozos de yucaEl secado de las raíces de yuca y batata permitió eliminar la mayor parte de humedad para obtener un producto que se pudiera almacenar por largos periodos sin que se deteriorara, además de ayudar a disminuir (en el caso de la yuca) factores antinutricionales.Se empleo el sistema d e secado natural (secado en patio en piso de cemento y en bandejas) para el secado de batata.Se esparcieron los trozos de batata en el suelo de cemento formando una capa uniforme; para determinar cual o cuales eran las cantidades adecu adas para secar batata por metro cuadrado se pueden secar bajo las condiciones de CIAT.Se emplearon 6 cu adros de 1 m 2 cada uno y se llenaron con cantidades crecientes de batata 4, 6, 8, 10,12 y 14 Kg.Todas las muestras estuvieron expuestas durante 4 días y en horas de la noche eran cubiertas con un plástico debido a la presencia de lluvias, las muestras fueron volteadas 3 veces 1 día cada 3 horas.Pasado estos cuatro días se determinó que la mejor opción para el secado en piso era la de 1 O kg 1 m2 porque en mayores cantidades las muestras no estaban totalmente secas, y en las cantidades de 4, 6, y 8 Kg las muestras estaban secas pero sé no se aprovechaba el espacio.Otro de los métodos de secado fue en bandejas cada una de 1.20 x 2.40 m en cada bandeja se distribuyeron 16, 18, 20 y 22 Kg del material fresco.Estas muestras también estuvieron expuestas durante 4 días y en horas de la noche fueron cubiertas con un plástico debido a la presencia de lluvias, con una frecuencia de volteo de 3 veces 1 día cada 3 horas.Luego de hacer este muestreo se determinó que la cantidad de 20 Kg por bandeja era la que mejor aprovecha las corrientes de aire y los rayos del sol para su secado, ya que al comprimir las cantidades de 22 Kg las muestras presentaban un poco de humedad y las de 18 Kg tenían una apariencia bastante deshidratada.Figura 5. Secado en Piso de cemento Figura 6 . Secado en BandejasLos trozos secos de yuca, batata, maíz y torta de soya fueron molidos en un molino de martillo con unan criba con orificio de ~ pulgada para facilitar su mezcla en las dietas a utilizar. Para la elaboración de las dietas como primer paso se procedió a seleccionar y pesar en una balanza electrónica cada una de las materias primas a utilizar; iniciando con los macro elementos (maíz, torta de soya, soya integral extruida, harina de yuca, harina de batata, harina de follaje de yuca), seguido por los micro elementos o premezcla (fosfato bicálcico, carbonato de calcio, sal común, metionina sintética al ggo;o, arena cernida) y por último el aceite de palma.Figura 21. Balanza electrónica Luego de ser pesadas cada una de las materia primas se adicionaban en una mezcladora tipo horizontal con capacidad de 500 kg la soya integral extruida como primer ingrediente para disminuir la polvosidad de la harina de yuca, harina de batata y harina de follaje de yuca, luego la torta de soya y por último el maíz esta mezcla se dejaba rotar durante 10 minutos, pasado este tiempo se le adicionaba la premezcla (fosfato bicálcico, carbonato de calcio, sal común, premezcla, metionina) que 5 minutos antes se había elaborado en una mezcladora tipo horizontal con capacidad de 25 kg y se dejaba mezclar durante 5 minutos; luego se le adicionaba la arena durante 5 minutos más y por último se le adicionaba el aceite de palma y la mezcla se dejaba 10 minutos y pasado este tiempo se empacaba en bolsas de polipropileno de 40 o SO Kg. Se utilizaron 800 pollos de un día de nacidos machos y hembras de la línea Cobb, los cuales fueron distribuidos por sexos en cubículos de 40 animales para cada dieta, para un total de 160 animales por tratamiento.Figura 25. Pollos en la prueba de validaciónLa presentación del alimento fue en forma de harina.El suministro de alimento y el agua se hizo a voluntad para todos los tratamientos.Figura 26. Alimento en forma de harina Se suministró agua fresca proveniente del acueducto de Palmira almacenada en tanques con capacidad de 250 litros.Figura 27. Tanque almacenamiento de agua 250 litrosPara la desinfección del galpón y equipos, se empleo un producto con base en hipoclorito de sodio, detergente y agua. Con esta mezcla se lavaron los equipos (comederos, bebederos, redondeles, tanque de almacenamiento de agua y lámparas de calefacción), cortinas y el piso del galpón. Adicionalmente las instalaciones fueron flameadas.A la entrada del galpón se colocó cal en una poceta para desinfección de botas y jo calzado de visitantes a la unidad.Veterinario, siguiendo los parámetros empleados por el Instituto Colombiano Agropecuario-leA.Se empleó la vacuna contra New Castle (cepa 81) a los 14 días de edad de los animales; su aplicación se hizo de forma ocular.Figura 28. Vacunación contra New Castle en forma ocularLos animales fueron alojados en galpones de ladrillo con cortinas laterales para el manejo de la ventilación y evitar las corrientes directas del aire distribuidos en 20 cubículos de 3.66 m 2 (3.03m de largo x 1.21m de ancho) en piso de cemento y a una densidad de 10 pollos por metro cuadrado, cada cubículo estaba dotado con cama de viruta, lámpara de calefacción con bombillos de 100 voltios, comedero de tolva y bebedero de galón en la fase de cría y bebederos automáticos en la fase de engorde.Figura 29. Distribución de los anima]es en cubículos de 3 .66 m2Se realizaron con troles de peso y alimento cada dos semanas ( 1 día, 14 días, 28 días y 42 días de edad) para obtener datos de incremento de peso y consumo de alimento, los pesajes correspondientes se realizaron el mismo día a todo el lote completo.Figura 30. Pesaje a los 14 días Figura 31. Pesaje a los 42 díasLos animales fueron tratados con un antibiótico (Enrofloxacina al 10°/o) con previo diagnostico del Medico Veterinario a la cuarta semana de la validación durante tres días seguidos debido a una infección respiratoria.En forma preventiva se suministró un antiestresante cada vez que se realizaban pesajes para disminuir la incidencia de estrés.f,?C20~7 Composición y análisis calculado de las dietas de validación con harina de batata y harina de yuca (raíces y follaje) en niveles incrementales para pollos de engorde en fase de cría (1-14 días de edad). Se utilizó el análisis de presupuestos parciales, análisis de dominancia y tasa retomo marginal, según la metodología del CIMMYT. México ( 1988). 4 .2 .12 .1 Análisis de presupuesto parcial: Esta técnica permite organizar los datos del experimento y ayuda a tomar una decisión sobre el tratarrúento más conveniente, destacando las alternativas que tienen más posibilidad d e ser adoptados por los avicultores y resaltando aquellas cuya utilización resultaría antieconómico; estos se denominan presupuestos parciales porque no se incluyen todos los costos y retribuciones de la producción, sino aqu ellos cuyos valores varían en las diferentes alternativas consideradas (CIMMYT, 1988). En este análisis, para cada tratamiento se considera, en la fase de cria, ceba y total, los siguientes rubros: 4 .2.12.2 Aumento de peso (g) : Se refiere a la diferencia entre el peso inicial y final promedio del ave, para cada una de las fases analizadas y para la fase consolidada. 4 .2.12.3 Beneficio bruto de campo ($/ave): Equivale al peso promedio ganado para el periodo analizado (bien sea por fase o fase consolidada), multiplicado por el precio promedio del Kg de pollo en pie al momento del mercado.Se estima considerando el consumo promedio por pollo en la respectiva fase por el costo del kilo de alimento.4 .2.12.5 Beneficio neto ($/ave) : Equivale a la diferen cia entre el valor del beneficio bruto de campo y el valor de los costos variables y se hace un orden de priorización de mayor a menor beneficio neto entre tratamientos (CIMMIT, 1988). 4 .2.12.6 Análisis marginal: Se realizará para establecer la forma en que los b eneficios n etos cambian conforme cambian los costos variables. Se realizará m ediante el análisis d e dominancia de las alternativas y la estimación del retomo marginal. 4.2. 12. 7 Análisis de dominancia de las alternativas: Permite efectuar el análisis marginal de los datos, para h acerlo se listan todas las alternativas en orden de mayor a menor beneficio neto colocando otra columna con los costos variables correspondientes, después se revisa de arriba h acia abajo la columna de costos para identificar y eliminar las alternativas domin adas, o sea, los tratamientos con los costos variables iguales o s u periores al del anterior no dominado. 4 .2 . 12.8 Tasa de retomo marginal: Es el criterio de selección del tratamiento a recomendar entre los tratamientos no dominados. Se estima mediante los valores de beneficio neto marginal y el costo variable marginal. El costo y beneficio neto marginal es el incremento correspondiente al pasar de un tratamiento no dominado a otro del menor al mayor beneficio neto y costo marginal. Para calcular la tasa retomo marginal se divide el valor del beneficio neto marginal entre los costos variables marginales correspondientes, para expresarla en forma porcentual se multiplica por cien (CIMM1Y, 1988).Para el periodo analizado Cría ( l -14 días de edad) no se encontraron diferencias apreciables en el rendimiento productivo debido a l empleo de diferentes niveles y sistemas de suministro de harina de yuca y harina de batata en dietas para pollos de engorde de l a 14 días de ed a d.No obstante, la dieta de validación con el mejor rendimiento productivo para esta fase fue la dieta 3 (Incremental 5% de Harina d e Yuca y 5% Harina de Batata), seguido por la dietas 1 (Control Convencional) y 5 (Increm ental+ 5% Follaje de yuca) .Tabla 5. Para m edir el grado de pigmentación de piel. pico y p atas como referen cia se tomó el abanico de Roch e el cual es el m ás u sado para medir la pigmentación en la yema huevo, este abanico cu enta con una escala de 1 a 14 donde l es la coloración más pálida y 14 la más intensa.El grupo de animales alimentados con las dietas a b ase de harina de follaj e de yuca, se caracterizó por su pigmentación más marcada en la piel (5) mientras que los demás grupos control convencional y demás con Harina de yuca y Harina de ba tata sin follaje no superaron la calificación de 3.En cuanto a la pigmentación d e pico y patas no se encontraron diferen cias a preciables entre las dietas implem entadas en esta validación como se muestra en la ta bla 10.Tabla 10. Efecto de la Harina de Yuca (raíces y follaje) y Harina de Batata y Harina de follaje de yuca en la pigmentación de piel, pico y patas en pollos de engorde a los 42 días de edad. Al realizar el anális is de retom o m arginal para comprobar la consisten cia de la recomendación antertor se observa que la dieta m ás ren table fue el 1 con u na tasa de retomo m arginal mayor , esto s ignifica que por cada $100 que se invierte se obtiene u na ganancia extr a d e$ 62.6 . Para la fase d e cría ( 1-14 días de edad) y la fase de desarrollo ( 14-28 días de edad) la dieta con mejor rendimiento productivo fue la 3 (5% harina de yuca + 5% harina de batata y l 0% harina de yuca + l 0% harina de b atata respectivamente) .Para la fase d e engorde (28-42 días de edad) la dieta con mejor comportamiento productivo fue la 2 ( 10% harina de yuca + 10% harina de batata}, es decir que al implementar dietas a base yuca y batata no se deb e exceder más del 10% siempre y cuando la presentación de la dieta sea en forma de harina, para obtener rendimientos productivos similares a los de un concentrado convencional disminuyendo así los costos de producción, brindando una buena opción para los pequeños y medianos productores avícolas. Se elaboró un plegable informativo sobre el procesamiento y empleo de yuca y batata en la alimentación de pollos de engorde a grupos relevantes de productores avícolas interesados en implementar el uso de estas materias primas en alimentación animal."}
|
main/part_1/0160857256.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":null,"keywords":null,"sieverID":"9c717c1e-2f30-4ca3-8ea1-f25ea91ad459","content":"\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"}
|
main/part_1/0161698066.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"691a18499e9d2b4a238d6cebae891c08","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/70f3986a-82bb-4b7a-a7a1-b1ea93d155ad/retrieve","id":"-1356852062"},"keywords":[],"sieverID":"edd7841a-356f-432c-a685-f3e0fce8d73b","content":"Influencing the Post 2020 Global Biodiversity Framework (an interim, evolving outcome) Short outcome/impact statement: CCAFS (with the Genebank Platform) developed a written submission to the 23rd session of Convention on Biological Diversity's Subsidiary Body on Technical and Technological Advise, and convened a side-event at the same meeting, arguing that the Post-2020 Global Biodiversity Framework should promote the Plant Treaty (and more use of PGRFA). The Plant Treaty and increased PGRFA use were subsequently included in the first full draft of the Post-2020 Framework (which is still subject to further negotiations),The 10 Year Strategic Plan for Biodiversity (1) adopted by the Conference of the Parties to the Convention on Biological Diversity includes goals and a monitoring framework. As far as access and benefit-sharing is concerned, the 10 year plan focusses exclusively on the implementation of the CBD's Nagoya Protocol, and ignores entirely the Plant Treaty, which provides essential policy support for CGIAR Centers R4AD and the use of crop genetic diversity for climate change adaptation. A new 10 year strategy is being developed to cover 2021-2030 (called the Post 2020 Global Biodiversity Framework). CCAFS/Genebank Platform scientists developed a written submission (2) for the 23rd session of the CBD's Subsidiary Body on Scientific Technical and Technological Advice (SBSTTA) in November 2019.The submission argued that the Post-2020 Framework should promote and monitor implementation of the Plant Treaty in addition to the Nagoya Protocol. The submission proposed a related goal and indicators for monitoring. CCAFS/Genebank Platform scientists organized a side event on the same topic, including speakers from the African Union, Plant Treaty Secretariat, and UNEP to explain the position paper to SBSTTA delegates. We also made oral interventions during plenary sessions. Some Contracting Parties supported our interventions. At the conclusion of the SBSTTA meeting, the SBSTTA Chair developed a written set of recommendations (3) for consideration in the further elaboration of the Post 2020 framework; it included word-for-word the draft Goal proposed by CCAFS.These recommendations were then used by the Co-chairs of a working group that was created negotiate the Post 2020 framework. Their first draft was published in January 2020, and it explicitly promotes and monitors implementation of the Plant Treaty along with the Nagoya Protocol (4). Negotiations will continue until October 2020 when the Post 2020 Global Biodiversity Framework will be adopted. In the meantime, our efforts to influence the development of the Post 2020 Framework have been very successful. We will continue our efforts in 2020, and report on the final outcome of the process next year.• • EA: East Africa Contributing external partners:• ITPGRFA -International Treaty on Plant Genetic Resources for Food and Agriculture (governing body)• CGRFA -Commission on Genetic Resources for Food and AgricultureThis is an example of policy innovation, under the larger Social Science innovation category. CCAFS' ability to effectively promote this international level policy change is based on, and attributable to, long standing work supporting countries to implement both the Plant Treaty and the Nagoya Protocol in mutually supportive ways. This is work that was supported through CCAFS P66 in previous years. We drew on expertise of long standing trusting partnerships with national and international organizations with whom we partnered under P66 to both a) develop our submissions, and b) promote its reception under the framework of the CBD. This past work included innovations demonstrating the utility of the Plant Treaty for accessing crop diversity needed to help farmers and national agricultural research organization gain access to crop diversity for climate change adaptation."}
|
main/part_1/0171688219.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":null,"keywords":null,"sieverID":"3caf2923-8b20-45a7-90b1-c4e715a9f92a","content":"\n\n\n\n\n\n\n\n\n"}
|
main/part_1/0181929682.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"1b148cbc696ec2d0fac6ebb5d3c0a67e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/25f54fe0-9950-4030-8883-801959a2fad5/retrieve","id":"2092803692"},"keywords":[],"sieverID":"62abb524-bcd9-4ccc-94aa-4079c09da358","content":"Ice cap melting Livestock value chain actorspotential interventions:-diversify livelihood options -Safety nets --e.g. insurance schemesMore work? --Hazard + Vulnerability mapping to determine risk • We will need to combine hazard maps with vulnerability maps for better prioritization of areas/populations for interventions"}
|
main/part_1/0187955475.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"aa13f3e89460a35c6bf2bfdb15f42597","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/7955e038-2151-4b74-8665-4cbe362ed76a/retrieve","id":"-1524647948"},"keywords":[],"sieverID":"5aaf0fdc-616f-4152-aecc-41688b39b927","content":"This work was carried out with support from the CGIAR Initiative on Climate Resilience, ClimBeR. We would like to thank all funders who supported this research through their contributions to the CGIAR Trust Fund.The frequency and severity of extreme weather events are presenting substantial challenges to communities and nations worldwide. The already escalating impact of climatic hazards is expected to persist due to ongoing climate change. While strides have been made in enhancing forecasting capabilities and establishing early warning systems, global coverage remains inadequate, with just 40% of African countries reporting a multi-hazard early warning system in place as of 2022.Even where forecasting and early warning systems are in place, the translation of early warnings into timely action remains a persistent challenge, as exemplified by past cases of delayed response to imminent disasters. Addressing this issue, the concept of anticipatory action has gained prominence in recent years. It involves the systematic connection of early warning with prearranged finance and contingency planning to enable action before disaster strikes.CGIAR's ClimBeR initiative, specifically through the development of AWARE platforms, seeks to enhance anticipatory action by fostering coordination in early warning, early action, and early finance. This report, commissioned by the International Water Management Institute (IWMI), a CGIAR member, aims to support the implementation of AWARE in Senegal and Zambia, by: (1) identifying initiatives and stakeholders that can benefit from or support the AWARE platform in both countries; (2) analysing gaps in the current early warning and action systems that AWARE could address, along with identifying potential opportunities it could leverage; and (3) outlining options and suggesting next steps for a more integrated engagement of the AWARE platform.The following table summarises main findings from the report about the gaps and challenges in anticipatory action and the enabling environment, along with strengths and opportunities for enhancing anticipatory action in both countries:Gaps and challenges in anticipatory action and the enabling environment• No government-led contingency plans or SOPs in place that specifically include anticipatory action to be taken ahead of hazard events • Many ongoing initiatives for faster disaster response, but these are missing the window to act on seasonal and medium-term forecasts • Multitude of stakeholders and initiatives with early warning and disaster response mandates, making coordination for anticipatory action challenging• No government-led contingency plans or SOPs that specifically include anticipatory action • Implementation of existing disaster response plans has been hindered by chronic underfunding, which severely limits their effectiveness • Disaster risk management coordination functions within relevant government institutions need to be strengthened • In the past, a perceived lack of reliability of forecasts and their limited translation into concrete advisory, e.g. for farmers, has represented a major barrier to local level anticipatory action• Enhancements in DRM frameworks and capacity for early warning, early action and early finance provide a strong foundation for anticipatory action in Senegal • Experience with an ad hoc anticipatory intervention by the Government of Senegal in 2019 shows the potential of acting even earlier to prevent impacts and provides proof of concept • Improvements in shock-responsive national social protection systems could be leveraged• Major national policies for DRM and social protection already promote a proactive approach to mitigating disaster risks • Zambian early warning, early action, early finance stakeholders have begun to gain practical experience in anticipatory action • Government of Zambia has established national platforms where seasonal outlooks are discussed and joint response plans developed among stakeholders from various sectors • Southern Africa already has a growing regional anticipatory action community of practice that could provide backstoppingBased on these findings, the report puts forward several recommendations towards developing or strengthening national anticipatory action frameworks in Senegal and Zambia, specifically aimed at guiding future AWARE activities in both countries:1. Forge strong partnerships with government agencies and other stakeholders early on, engaging them in all aspects of the process, to generate a sense of ownership and buy-in. 2. Validate and clearly communicate accuracy of forecasts to stakeholders so that they can understand the potential benefits and uncertainties related to the available early warnings. 3. Base anticipatory action frameworks and action plans on needs, starting from the disaster impacts they are seeking to address. 4. Prioritise incorporating anticipatory action within existing disaster risk management frameworks and processes over creating new structures. 5. Focus not only on anticipatory action frameworks, but emphasise and invest in the systems strengthening that is required to implement anticipatory action continuously and reliably through national and sub-national government structures. 6. Make use of existing guidance materials and tools to ensure efficiency in development and implementation of anticipatory action frameworks on the basis of lessons learned. Table 1: In recent decades, the occurrence and severity of extreme weather events has noticeably increased. These events, ranging from prolonged droughts to sudden floods and intense storms, have left communities and nations grappling with their far-reaching impacts. Climatic hazard events are projected to become even more frequent and intense in the future as a result of climate change (UNDRR, 2022).Alongside this trend, significant efforts have been made to enhance forecasting capacity and to establish early warning systems that can enable governments, businesses and households prepare better for extreme weather events and their likely impacts. However, early warning system coverage globally is still insufficient, and there is significant regional variation, with just about 40% of African countries reporting having a multi-hazard early warning system in place as of 2022 (UNDRR and WMO, 2022).Despite advancements in forecasting technology and early warning system coverage, the translation of early warnings into timely finance and anticipatory action remains an ongoing challenge. This has been demonstrated again and again in cases where early warnings of imminent disasters were issued, but action did not follow, or only followed late. This has been illustrated for example in the case of delayed humanitarian funding for Ethiopia, Somalia and Kenya in the 2011-2012 drought (Hillier & Dempsey, 2012) or in the 2017-2018 drought in the Sahel (Orenstein, 2018).Aiming to overcome this challenge, the concept of anticipatory action (Box 1) has attracted growing attention in recent years. In its application to disaster risk management and humanitarian response it is often used to refer to the systematic linking of early warning with pre-arranged finance and contingency planning to enable timely action before disaster strikes, to reduce or mitigate the likely impacts and enhance disaster response (Levine et al., 2020). But it can also describe 'more informal approaches, where -although a mechanism incorporating triggers, financing and activities has not been established in advance -action is taken in anticipation of a crisis or disaster on the basis of a forecast' (REAP, 2022).CGIAR's Building Systemic Resilience Against Climate Variability and Extremes (ClimBeR) initiative has started developing early warning, early action, and early finance (AWARE) platforms 1 in several countries to enable effective anticipatory action. These platforms aim to facilitate coordination in early warning, early action and early finance to trigger action and funding ahead of extreme climate events to enable effective disaster risk reduction, management and response. They do this by providing a space where forecasting, early warning, decision support and contingency planning tools can be brought together and accessed by the various disaster risk management stakeholders across and beyond government. AWARE thus supports ClimBeR's larger goal of 'increasing the resilience of smallholder production systems to withstand severe climate change effects like drought, flooding, and high temperatures' (CGIAR, 2022).The International Water Management Institute (IWMI), a member of CGIAR, commissioned this report to support implementation of AWARE in two of the ClimBeR focus countries: Senegal and Zambia. The objectives of this specific work are to:1. Identify existing initiatives and stakeholders that may benefit from AWARE or could support putting the AWARE platform into use in the two countries; 2. Analyse gaps in the current early warning, early action, early financing landscape that AWARE could help address and identify opportunities that AWARE could take advantage of; 3. Outline options and next steps for AWARE platform development.The following chapter 2 outlines the methodology employed to meet these objectives. Chapters 3 and 4 present the results of the mapping and analysis for Zambia and Senegal respectively. In line with the ClimBeR initiative and its ongoing stakeholder engagement in Zambia, the focus is on major natural hazard related disasters in both countries, in particular droughts and their impacts.This box introduces major concepts related to early warning, early action and early finance as used in this mapping report. Figure 1 shows how these concepts relate to disaster risk management more broadly, with anticipatory action between the disaster risk reduction and response stages. Early warning: 'Information provided in advance of a specific hazardous event, disaster or conflict to enable stakeholders to take timely action to reduce disaster risks. Users [of this terminology] differ on whether early warning(s) relate exclusively to warning of hazardous events (such as drought) or also include the impacts of these events (such as acute food insecurity associated with drought). Humanitarian professionals have generally tended towards the latter (impact-based) meaning, and meteorological professionals towards the former' (REAP, 2022).Early action / anticipatory action: Early actions are 'a set of actions to prevent or reduce the impacts of a hazardous event before they fully unfold predicated on a forecast or credible risk analysis of when and where a hazardous event will occur' (REAP, 2022). Early action and anticipatory action are used synonymously in this mapping report. 'The terms 'forecast based financing/action' and 'anticipatory action' are often used to describe the same or similar processes: the term that is used often depends on the organisation. However, 'forecast based financing / action' is even more strongly associated with pre-agreed funding, activities and actors than 'anticipatory action'' (REAP, 2022).Response: 'Actions taken directly before, during or immediately after a disaster in order to save lives, reduce health impacts, ensure public safety and meet the basic subsistence needs of the people affected. (…) Disaster response is predominantly focused on immediate and short-term needs and is sometimes called disaster relief' (UNDRR, n.d.).Preparedness: 'The knowledge and capacities developed by governments, response and recovery organizations, communities and individuals to effectively anticipate, respond to and recover from the impacts of likely, imminent or current disasters. (…) Preparedness is based on a sound analysis of disaster risks and good linkages with early warning systems, and includes such activities as contingency planning, the stockpiling of equipment and supplies, the development of arrangements for coordination, evacuation and public information, and associated training and field exercises' (UNDRR, n.d.). Effective and timely early action and response require disaster riskinformed preparedness measures. This mapping report includes interventions that span anticipatory action and early response stages. Especially in the case of drought, the specific point in time when an event starts, when it ends, and when it 'peaks' can be unclear and the transition gradual, meaning the lines between anticipatory action and early response post-disaster can be somewhat blurred (Levine et al., 2020). Acknowledging this ambiguity, the Zambia and Senegal country chapters also discuss index-based insurance instruments that aim to provide rapid liquidity for early response. Because they cover climate and weather-related hazards (e.g. droughts and floods), aim to pay out quickly, and share common characteristics with many anticipatory action projects (e.g. in that they release resources not on the basis of already impacts that have already been materialised and assessed on the ground, but on modelled impacts and trigger thresholds), these instruments are considered relevant to ClimBeR AWARE interventions. This is particularly important in the case of sovereign insurance, where national contingency plans, technical working groups that calibrate risk models and monitor impacts, and response coordination mechanisms already exist.This chapter presents the methodology employed to assess anticipatory action initiatives in Senegal and Zambia. The methodology encompasses four essential steps, each contributing to a holistic understanding of the landscape, followed by the development of recommendations (Figure 2).The mapping report in its current form is based on a desk review of publicly available materials. Information that is not in the public domain and that would only be identified through more indepth stakeholder engagement and interviews could therefore not be included in the analysis.Source: Authors.The initial phase focused on the collection of information from a variety of sources to establish a comprehensive foundation. Relevant materials were identified through extensive online searches using search engines and dedicated web platforms such as the Anticipation Hub, InsuResilience Global Partnership, and Global Index Insurance Facility (GIIF). Relevant institutional websites were also searched for project documents, policy papers, and reports. These institutions included the African Risk Capacity (ARC), World Bank, African Development Bank (AfDB), World Meteorological Organization (WMO), United Nations Office for Disaster Risk Reduction (UNDRR), World Food Programme (WFP), Food and Agriculture Organization (FAO), as well as relevant country-specific organizations and ministries. This process helped identify relevant information from both global and country-specific contexts.Building on the information gathered in Step 1, this step involved a mapping and discussion of existing anticipatory action and early response initiatives. Furthermore, it identified key stakeholders associated with these initiatives. This includes key stakeholders such as implementing partners and donors from the public sector, private sector, and civil society. Stakeholders of particular interest include Ministries of Agriculture, Ministries of Finance, Disaster Management Authorities, Financial Services Authorities, Civil Protection agencies, National Meteorological and Hydrological Services, and microfinance institutions. Special emphasis was placed on identifying existing coordination platforms and understanding their roles in fostering collaboration among stakeholders.To gain deeper insights into the current landscape of early warning, early action, early financing, and coordination initiatives, the report goes on to assess gaps and weaknesses as well as strengths and opportunities. The objective of this step was to identify potential entry points for the AWARE platform that are grounded in an intention to complement and coordinate with existing initiatives.The final step involves synthesizing the findings from the initiatives and stakeholder mapping to derive practical recommendations for the next stages of the AWARE platforms in Senegal and Zambia. It is important to note that the specific recommendations may vary between countries, depending on the outcomes of the assessment and the unique characteristics of each context.Drought poses a significant risk to Zambia's population and economy. Parts of Eastern, Muchinga, North-Western and Western provinces are most drought prone, but drought impacts in the form of food insecurity put people at risk countrywide (Pourazar, 2017). Other disaster events that have been occurring relatively frequently and are having large-scale impacts in Zambia are floods and epidemics, mostly Cholera (Pourazar, 2017) 2 .Zambia's drought risk is expected to further increase in the future. Current climate projections do not provide a clear picture of future trends in precipitation in Zambia, but they consistently point to an increase in temperature of between 2°C to 4°C in the medium term future and between 2.5°C and 6°C in the far future , depending on the emission scenario. They also show a likely increase in the share of the country that is prone to drought. As of 2016, CIMA Research Foundation and UNDRR estimated that, on average, about 11% of the total population (1.73 million people) was potentially affected by drought each year, and that this share of people at risk would increase to about 25% (7.3 million people) in the future (considering the 2050-2100 climate under a high emission scenario and accounting for projected population growth). Similarly, the share of GDP potentially affected was estimated to increase from 10% (USD 2 billion, relative to the 2016 GDP) each year on average to 23% (around USD 55 billion, relative to the projected total 2050 GDP) over the same period. These potential direct losses from drought are mostly driven by estimated losses in hydropower generation. Increased crop losses for maize -the major food crop (FAO, 2022) -and other crops such as cassava, sweet potato and groundnut are expected in all except the northern parts of Zambia under future climate conditions, though they remain moderate (under 6%) relative to total income from crops (CIMA and UNDRR, 2018).Drought-related early warning systems (EWS) EWS for drought and its secondary impacts on agriculture and food security require methods, tools and data that span seasonal meteorological information (climate and weather forecasting), hydrological information (river and dam levels), crop forecasting and monitoring, vulnerability and capacity assessments, as well as market, price and commodity monitoring (Braimoh et al., 2018).In Zambia, the Zambian Meteorological Department (ZMD) produces and disseminates weather and climate information, supporting a range of downstream EWS. One of them is the Zambia Drought Management System (ZADMS), which was developed by IWMI and launched by the Zambian Ministry of Agriculture in early 2023. The ZADMS online platform 3 currently provides drought early warning information in the form of seasonal to short-term weather forecasts, combined with information about past and current drought frequency and severity to predict and monitor drought. The platform incorporates functions for a drought decision making tool and contingency plan, with the aim of directly linking early warnings with modalities that enable the implementation of early actions (IWMI, 2023). As of June 2023, preparations were ongoing for supporting the Ministry of Agriculture in developing a contingency plan.Beyond immediate drought signals, national and regional analysis tools and early warning systems in Zambia and the wider region focus on providing early warning and monitoring of food insecurity, which often follows from drought, but is not solely dependent on drought conditions.One such tool are national Vulnerability Assessments and Analyses (VAA), which have been implemented in Southern African Development Community (SADC) member countries, including in Zambia. The results from VAA are owned by governments and can be accessed by public officials for public use. VAA are consolidated into Regional Vulnerability Assessments and Analyses (RVAA), a process which was strengthened through the SADC's RVAA Programme, in operation between 2017 and 2022. However, a couple of key challenges were identified in relation to the VAA, and the extent to which they are used to implement early action in southern Africa. These challenges are summarised in Box .The World Bank's 2018 Assessment of Food Security Early Warning Systems for East and Southern Africa identified a range of challenges that have hampered the use of VAA for early action in the region (Braimoh et al., 2018). They include:• Timeliness: VAA reports are only available in June. Initially they did not include projections, meaning they were too late to be effective for EWS. Since 2018, they are integrated with the Integrated Food Security Phase Classification (IPC)'s forward looking projections of food insecurity in Zambia, thus better supporting EWS.• Accessibility: Information is available to regional and national level stakeholders, but not to those at subnational level, and not in languages that are easily understood by communities.• Perceptions: VAA are perceived by some people at the local level to block them from accessing food aid, and therefore considered by them as not useful.• Political sensitivities: Food security is a politically sensitive topic in many countries. To address this, VAA reports issued by Vulnerability Assessment Committees (VACs) tend to focus on presenting facts and remaining neutral, leaving analysis, judgements and recommendations on specific actions to the user.• Practical relevance: As a result, not all VAA reports recommend relevant actions 4 , thus requiring an extra step of 'translating' VAA into advisory rather than triggering actions directly.• Financial sustainability: VAA relies on external partner funding in most countries.More recently, and reinforced by the SADC RVAA programme starting in 2017 -Zambia has adopted the IPC and integrated it into its annual Crop production forecasts are also used by the DMMU to produce an annual national food balance sheet (NFBS). The NFBS is an established tool used to understand food supply, and to enable comparison to the expected demand for food (e.g. for human consumption, livestock feed, seeds or to compensate for food storage losses) for a given reference period. Such information is used, for example to support policy and planning, as well as to inform humanitarian appeals, for instance in the case of the SADC's regional aid appeal in June 2016, which was launched in response to the El Niño induced drought (Braimoh et al., 2018). The process of NFBS production in Zambia is outlined in Table 1.Due data and responsible body contributing to NFBSBy the end of September, forecasts are generated by the ZMD and submitted to the DMMU and other relevant departments and authorities.By the end of every month, information on hydrological conditions is generated and submitted by the Department of Water Affairs and submitted to the DMMU and other relevant departments and authorities.By January 31 each year, the Ministry Responsible for Agriculture and Livestock (National Early Warning Unit), the agency responsible for national statistics, and the ZMD will generate the preliminary crop forecast report and submit to the DMMU and other relevant departments and authorities.By April 30 each year, the National Early Warning Unit in the Ministry Responsible for Agriculture and Livestock, the agency responsible for national statistics, and the ZMD will generate the final crop forecast report and submit to the DMMU and other relevant departments and authorities.The NFBS will be published by May 15 each year.By June 15 each year, the DMMU in collaboration with other multisectoral agencies will publish a report on the impact of drought and vulnerabilities.Source: Expanded from Table 2.10 in Braimoh et al., 2018, which Beyond the Ministry of Agriculture's Agricultural Marketing Information Centre -which was established to provide data to the National Early Warning Unit and the Food Reserve Agency that is in charge of the country's strategic grain reserves -Zambia National Farmers' Union and FEWS NET also collect their own data for commodity and price monitoring (Braimoh et al., 2018).Anticipatory action mechanisms that integrate early warning, early action and early finance Focusing on availability, accessibility and use of early warning information at the local level, a range of advisory outputs and community-level engagement initiatives exist in Zambia to translate weather and seasonal climate forecasts into actionable advisory for different sectors, including agriculture and water. For instance, WFP supports weather forecast workshops for the dissemination and discussion of agro-meteorological information that are aimed at helping farmers decide when and what to plant at the beginning of a season (WFP, 2020). In addition, the ZMD has been undertaking a range of measures to enhance the generation and provision of early warning information in the agriculture sector in Zambia (Republic of Zambia, 2022). For instance, ZMD established social media dissemination platforms and recently started issuing forecasts in local languages to farmers through local radio stations. This has led to a surge in farmers' interest in the ZMD forecasts, though issues around low perceived skill and limited geographic specificity remain major barriers to the use of forecasts for anticipatory action by farmers (Libanda, 2021). The department also promoted the co-production of agro-meteorological bulletins to provide advisories to farmers and trained agriculture extension officers to understand, repackage and disseminate climate information to farmers and communities (Republic of Zambia, 2022).In September 2020, the Zambia Red Cross Society (ZRCS) established an early action protocol (EAP) for floods, covering 13 districts at very high risk 5 , and 20 districts at high risk 6 of flooding. In case of a forecasted flood, the EAP activation plans to reach 1,000 households (or 6,000 people) with supporting interventions across the shelter, Water, Sanitation and Hygiene (WASH), health, food security and livelihood sectors. Key government partners of the ZRCS include the Water Resource Management Authority (WARMA), the DMMU and the Zambia Meteorological Department (ZMD) (Figure 3). The EAP covers a timeframe of 5 years (2020-2025), with a total allocation CHF 249,955 from the International Federation of Red Cross and Red Crescent Societies (IFRC)'s Disaster Relief Emergency Fund (DREF) 7 to ZRCS. The EAP can be triggered at two lead times (7 days and 3 days) to implement early actions that were pre-selected through stakeholder engagement to address expected flood impacts as feasible within these lead times (Anticipation Hub, n.d.-a;Red Cross Red Crescent Climate Centre et al., 2021a). Throughout the EAP development process, ZRCS has been engaging with relevant government agencies and other stakeholders through national dialogue platforms on forecast-based finance (FbF) and a national Technical Working Group. This has helped generate a common understanding of anticipatory action, facilitated information sharing, and supported coordinated action (Box 3).• National Dialogue Platform (DP) on FbF: The national DP brought all relevant stakeholders together and ensured a common understanding on what FbF entails. The Technical Working Group, comprising of relevant government agencies and ZRCS, was established.• Technical Working Group meetings: The regular Technical Working Group meetings were used to share information and conduct joint planning and joint operations on FbF. This ensures that work is not duplicated and resources are combined to enhance response time (efficiency) and effective collaboration.• African Dialogue Platform in Maputo: During the African Dialogue Platform in Maputo all countries attending where asked to create action plans jointly with all relevant stakeholders in their respective countries.• Early Action Protocol (EAP) development process: The EAP development was a robust process in defining when and where to take early actions for floods. This process also defined who takes what actions.• Training in the Global Flood Awareness System (GloFAS): The GloFAS training was attended to by Water Resource Management Authority (WARMA) which resulted in them appreciating the FbF process and approach more, which contributed to the creation of ownership. The training was a result of a collaboration with the University of Reading in the UK.• Approval of EAP: The approval of the EAP offered a possibility for the ZRCS to be ready to implement early actions when risk of impacts is high, in collaboration with DMMU, ZMD, and other stakeholders.• Development of standard operating procedures (SOPs): In the SOPs the roles and responsibilities of all stakeholders involved were defined.• Information sharing by WARMA and ZMD: Just before the rainy season ZMD shared information on forecast menu and WARMA shared information on water points and water levels, enabling ZRCS to communicate accurate information to affected communities.• EAP light activation and learning sessions after hazard season: After the rainy season, all stakeholders came together to discuss the work done, the challenges faced, the things that went very well, the things that could have gone better, and recommendations for the future.Source: Direct citation from Netherlands Red Cross, 2021.In January 2023, the ZRCS EAP's impact-based forecasting and the GloFAS system raised an alert for a riverine flood at the 20 year return period with a 7 day lead time and the EAP trigger was reached on 24 January 2023. Table 2 lists the areas of focus and actions prioritised for implementation in Kitwe district, which the forecast identified as the district likely to record the highest impact.Learning activities are currently ongoing to document lessons from the experience (IFRC, 2023a). Building on experiences with flood FbF, the ZRCS has plans to develop an EAP that would enable and institutionalise anticipatory action ahead of droughts (Anticipation Hub, n.d.-b).While not yet operational at the time when this mapping report was written, the development of an EAP for drought is likely to follow a similar approach to that of the flood FbF EAP development. This process -and lessons learned from it to date -is summarised in Box .In developing the EAP for anticipatory action ahead of floods, the ZRCS worked with a national technical working group along the following seven steps: risk analysis, trigger development, selection and validation of early actions, EAP development, and forecast monitoring (Anticipation Hub, n.d.-a). The working group was established as part of a sub-committee under the DMMU's pre-existing early warning systems group and meetings were government chaired and hosted by implementing partners. This meant, the EAP built on existing structures and encouraged stakeholder engagement to support ownership and institutionalisation of anticipatory action (Red Cross Red Crescent Climate Centre et al., 2021a). In developing the trigger, ZRCS collaborated closely with the DMMU, WARMA and ZMD.The following lessons were learned in the process (direct citation from (Anticipation Hub, n.d.-b)):• 'FbF promoted engagement of and embeddedness with government stakeholders and structures, which contributed to increase visibility of the National Society and is considered a positive development. Evidence suggests that the relationships established through FbF are likely to continue.• Enhanced institutional integration for synergy formulation is vital for effectiveness and sustainability. There is need to build national skillset for enhanced prediction capacities and facilitate evidence-based intervention.• Competing needs within the National society led to delays in the development of the EAP.• Creation of and working through a technical working group affiliated with the early warning subcommittee propelled the EAP development process'. Microinsurance against drought related risks in agriculture to facilitate early response By the 2015/2016 farming season, more than 60,000 farming households in Zambia were insured against drought, dry spells and other adverse weather events in Zambia (Musika, 2016) (Musika, 2016;WFP, 2021), which target different groups of farmers. These distribution channels include:• Contract farming and farmer organisations: In 2013/2014, NWK Agri-Services -A Zambian agriculture company -began offering WII to cotton farmers as part of its large contract farming scheme. Under this scheme, NWK prefinances the insurance premium payment, along with other agricultural inputs. In return, clients agree to sell their cotton produce to NWK at the end of the season, when sales proceeds and any potential WII payouts offset the outstanding loan with NWK. Surpluses are then paid out directly to farmers. ). This means a modification of existing ARC products to enable payouts straight after the sowing window that would enable earlier action (Maslo, 2022).In partnership with UN OCHA, ARC pilots 'anticipatory insurance' in Zambia by 'modifying its existing products to develop an innovative parametric insurance solution that enables payouts right after the sowing window. The amount paid would be calculated on the level of failed sowing and the forecasted impact of these failures by the end of the season. The current ARC Ltd. drought policy does cover drought impacts in the sowing window, but it does so along with other shocks that may materialise during the season, offering coverage from November to April, with activities, including planning, lasting up to six months after the payout, starting typically in May.In the case of the anticipatory insurance product, coverage is for November up to mid-January with an immediate payout still within the month, and activities taking place from February to April. The implementation is capped at three months and approval and planning processes are streamlined to enable quick action. Emphasis is also placed on preparedness and making contingency planning more anticipatory, provided for within the ARC programme and supported by UN OCHA. (…) In this way anticipatory insurance will offer dedicated sowing protection by, for example, distributing seeds for subsistence crops, e.g., potatoes that can be sowed later in the year. Farmers could grow crops mitigating the considerable impacts that late rains or periods of dryness during the start of the rainfall season have had on food and income security. (…)To be successful, these actions require an even higher level of preparedness, both operationally and financially, than ARC's usual parametric insurance because the time for action is extremely narrow. Part of UN OCHA's mandate is to support governments and partners with enhanced contingency planning and preparedness, which will be harnessed in the pilot. For financing this, a third trigger based on pre-seasonal forecast could activate anticipatory action so that, for example, if the forecast is bad at the beginning of the agricultural season, a provision on alternative seeds is made'.Source: Excerpt from Maslo, 2022.As evident from the initiatives discussed above, a number of contingency plans, SOPs and early warning plans exist in Zambia to support anticipatory action and response to droughts. However, experiences with past disaster events have repeatedly highlighted gaps and weakness in preparedness and response planning, as well as in the implementation of disaster preparedness measures such as simulation exercises. Complementing the ongoing drought management interventions and products described earlier, a range of internationally supported projects are / were recently implemented in Zambia to strengthen early warning, early action and early finance. These are summarised in Box 6.Regional risk financing framework for agriculture and food security in Southern Africa projectThis project aimed at informing public policies and programmes of countries in the Southern African Development Community (SADC) region, including Zambia, to enhance the management of systemic climate-related risks to the agriculture sector and food security. More specifically it supported the implementation of risk modelling, and identified policy actions and programmatic investments to enhance financial resilience. The project also delivered new agriculture risk financing tools and methods adopted in several SADC countries and helped create a network of institutions (including Ministries of Finance and Agriculture at the national level) working on risk financing in agriculture and food security. , 2022).Regional coordination Southern Africa has a Regional Anticipatory Action Working Group (RAAWG), which published a regional anticipatory action roadmap in August 2022 (Regional Anticipatory Action Working Group (RAAWG), 2022). This is aimed at collaboration between stakeholders to scale up anticipatory action along four priority areas: (1) Strengthening coordination frameworks for anticipatory action, (2) Harmonisation of triggers, (3) aligning anticipatory financing instruments, and (4) evidence-based advocacy and awareness raising. Compared to some of its neighbouring countries -especially Malawi, Mozambique and Zimbabwe -the roadmap shows few anticipatory action programmes operational in Zambia. The RAAWG's secretariat consists of FAO, WFP and the Red Cross Red Crescent Movement.In July 2023, a Joint Early Warning Anticipatory Action Programme in Southern Africa was launched by SADC and the RAAWG Secretariat to support implementation of the regional roadmap priorities over the coming two years. The programme aims to 'scale up early warnings and anticipatory action effectively and efficiently in the region. 2015). To support disaster preparedness, the Zambian Government developed a 2016/2017 National Contingency Plan in 2015. This was a response to risk scenarios that anticipated prolonged dry spells from rainfall shortage, as well as flash floods in low lying parts of the country with normal rainfall. However, implementation was underfunded, with the plan estimating a 60% resource gap (Pourazar, 2017).The Disaster Management Operations Manual, also issued in 2015, includes a drought code, a flood code, an epidemics code and a pests code that define disaster management activities and responsibilities for the respective hazard. The codes refer to different types of forecasting and early warning activities, but does not provide further detail, nor does it determine actions to be taken on the basis of these warnings, beyond the dissemination of early warnings. The request of funds, preparation of appeals and implementation of response activities proposed in the codes, instead, are contingent on the declaration of a disaster by the President of the Republic of Zambia (Republic of Zambia -Office of the Vice-President -DMMU, 2015), thus missing the window for taking anticipatory action ahead of a disaster.The Government of Zambia has since identified a need to develop a national drought management policy, legislation and preparedness plan to enhance drought risk reduction, preparedness and resilience of people and ecosystems to drought (Mwitwa, 2018). However, this process is not yet fully operationalised (World Bank et al., 2021) and it is unclear whether the resulting policies and plans would specify anticipatory actions.The primary national government entities focused on disaster risk management in Zambia are the DMMU, the National Disaster Management Council (NDMC) and the National Disaster Management Technical Committee (NDMTC) (see Figure 4, also for abbreviations). The NDMC's mandate is policy and the NDMTC is responsible for technical support, while the DMMU implements programmes and coordinates disaster risk management stakeholders. However, the DMMU faces capacity constraints and requires support to develop the human and financial resources required for effective coordination of disaster risk management policy and planning, including anticipatory action (World Bank et al., 2021). Beyond the disaster risk management institutions at various levels of government, several centralised institutions, line ministries and sectoral agencies are engaged in early warning, early action and early finance related to drought in Zambia. This includes the Ministry of Agriculture, the Ministry of Finance, the Water Resource Management Authority, and the Zambia Meteorological Department in core functions (see Table 4). Furthermore, the Ministry of Community Development, Mother and Child Health outlines a mandate for social protection that clearly aligns with anticipatory action in that its objective is 'to contribute to the well-being of all Zambians by ensuring that vulnerable people have sufficient income security to meet basic needs and protection from worst impacts of risks and shocks' (Republic of Zambia -Ministry of Community Development; Mother and Child Health, 2014), as outlined in the National Social Protection Policy. In particular, social assistance is highlighted in the policy as a measure to provide support in response to disasters, to people who are 'at risk of rapid deterioration in economic and social well-being and security' (ibid.). The 2018 Integrated Framework of Basic Social Protection Programmes and its Implementation Plan 2019-2023 build on this understanding under a DRM programme with the objective of strengthening DRM and mitigation for sustainable social protection. This covers covariate shocks including droughts and climate shocks, accidents and disasters and market shocks.The implementation plan activities under DRM include hazard and risk mapping, capacity building in risk awareness and early warning and the provision of coordinated relief support to affected households. The current plan does not envisage the delivery of assistance to at-risk households before a shock, but it does provide entry points for better linking early warning systems with shockresponsive social protection programming in Zambia going forward (Republic of Zambia, 2018, 2019).Table 4 lists further key stakeholders, and their involvement in early warning, early action, and / or early finance in Zambia, with a particular focus on drought. Based on the review of existing early warning, early action, early finance initiatives and stakeholders in Zambia, this section summarises key opportunities and gaps for the AWARE platform.A significant gap exists in Zambia in terms of government-led contingency plans or standard operating procedures for anticipatory action, particularly concerning clear guidelines for government entities on what actions should be taken and by whom when acting upon early warnings of drought or floods. While the country has disaster management operations manuals and contingency plans for disaster response, these documents do not adequately define specific anticipatory actions that should be initiated in anticipation of impending disasters.The implementation of existing disaster response plans has been hindered by chronic underfunding, which severely limits their effectiveness (Mwitwa, 2018;Pourazar, 2017). If not connected to a reliable budgetary instrument or financing mechanism that can release resources quickly when they are needed to implement anticipatory action, any new anticipatory action contingency plans or standard operating procedures may remain ineffective.Disaster risk management coordination functions within relevant government institutions need to be strengthened. The DMMU formally holds this function in the management of drought and flood related events, but has struggled to coordinate proactive disaster management efforts by the various sectoral stakeholders in the past. To fulfil the coordination function effectively, DMMU requires further capacity to coordinate and harness financial and human resources from the different stakeholders (Mwitwa, 2018), and to ensure anticipatory action efforts by different entities are well aligned and complementary.In the past, a perceived lack of reliability of forecasts and their limited translation into concrete advisory, for example for farmers, has represented a barrier to anticipatory action. Forecasts have been perceived as insufficiently accurate and lacking geographical specificity to be useful for local level action by many farmers, though the recent start of ZMD forecast transmissions in local language over the radio has increased interest of farmers to listen to forecasts (Libanda, 2021). These findings highlight the importance of forecast validation and substantial improvements in the delivery of early warnings to better serve end-users.In Zambia, major national policies for disaster risk management and social protection already promote a proactive approach to mitigating disaster risks, even though the terms 'anticipatory' or 'early' action may not be explicitly mentioned. One example is the Zambian National Disaster Management Policy, which emphasises the need to prioritize risk reduction takes and a proactive stance in dealing with disasters. While the terminology may vary, the underlying principles engrained within Zambia's disaster management policies align with anticipatory action objectives.Reforms such as the revision of the DMMU bill provide opportunity to further institutionalise the Government's commitment to anticipatory action and build the legal basis for expanding anticipatory action within national contingency plans (Red Cross Red Crescent Climate Centre et al., 2021b).Zambian early warning, early action, early finance stakeholders have begun to gain valuable experience in anticipatory action, notably through the ARC and UN OCHA 2022 drought anticipatory insurance pilot and through ZRCS and its flood EAP which was triggered for the first time in early 2023. In the experience of the latter, the involvement of key stakeholders, including government entities such as DMMU, WARMA and ZMD has been instrumental in the development of EAPs and the implementation of anticipatory actions over the past several years. This collaborative approach is fostering increased appreciation among government agencies for stakeholder engagement and enhanced partnerships to enable and institutionalise anticipatory action. In addition to its existing relationship with the Zambian Ministry of Agriculture through ZADMS, engagement with DMMU, ZMD, the Ministry of Finance, as well as relevant line ministries such as WARMA and the Ministry of Community Development, Mother and Child Health, and the Zambia Red Cross, a forerunner of anticipatory action in the country, will be critical entry points for AWARE in the early warning, early action and early finance space in Zambia.The Government of Zambia has established national platforms where seasonal outlooks are discussed and joint response plans developed among stakeholders from various sectors (World Bank et al., 2021). This includes the ZVAC as well as the contingency plan and national working group under ARC drought insurance coverage. These platforms aim to ensure a more effective and coordinated response and provide entry points for any anticipatory action initiative to engage and support a seamless transition across different disaster management stages, from anticipatory action to response and recovery.Southern Africa already has a growing regional anticipatory action community of practice. This includes a regional working group, the RAAWG, which in 2023 initiated a new regional program with the primary goal of enhancing inter-agency coordination around anticipatory action. This regional approach could foster greater exchange and collaboration among neighbouring countries and international partners, and provide technical backstopping for anticipatory action initiatives in Zambia going forward. At the regional level, SADC (a member of the RAAWG) and the RAAWG Secretariat are important stakeholders for the AWARE platform to engage with to promote the approach and to foster collaboration.Senegal is highly vulnerable to droughts and floods that result from erratic rainfall and long-term climate variability. Drought impacts often include food insecurity, while floods cause damage to infrastructure, public assets and private property, along with disease outbreaks (ANACIM et al., 2014;GFDRR, 2016;Peters et al., 2022). Between 2010 and 2019, the Government of Senegal implemented post-drought response interventions in half of the crop years, namely in 2011/2012, 2013/2014, 2014/2015, 2016/2017and 2018/2019(Republic of Senegal, 2021).Temperatures are likely to rise in the future in Senegal, with a mean increase of 1.17 and 1.41°C expected by 2035, and a 1 to 3°C increase by 2060 (Republic of Senegal, 2020;USAID, 2017). The Senegalese Government expects average rainfall to decrease across all regions of the country by 2035 (Republic of Senegal, 2020). While uncertainties still exist about whether overall rainfall will decrease or increase in the medium to longer term, increases in heavy rainfall events are likely (USAID, 2017). Increased temperatures together with reduced or more variable rainfall risks negatively impacting the quality of major rainfed food crops (maize, sorghum, millet) and cash crops (groundnut). It also threatens the livelihoods of large parts of the population that are dependent on rainfed agriculture (USAID, 2017). Climate change contributes to rising sea levels in Senegal (Republic of Senegal, 2020). Sea level rise combined with increasingly intense storms, in turn, exacerbates coastal erosion and flood risks (GFDRR, 2016;Republic of Senegal, 2020).Drought and flood-related early warning systems Senegal has a drought and food security early warning system in place that collects, processes and disseminates food security information to inform government authorities in managing food security risks. This is supported technically through a national multidisciplinary working group. In addition, the Ministry of Health and Social Action (Ministère de la Santé et de l'Action Sociale) and the Malnutrition Control Unit (Cellule de Lutte contre la Malnutrition) (CLM)'s Nutrition Reinforcement Programme provide nutritional monitoring and manage acute malnutrition in case of a disaster (Republic of Senegal, 2021). In Senegal and the wider region, the Harmonized Framework (Cadre Harmonisé) developed by the Permanent Interstate Committee for drought control in the Sahel (Comité permanent Inter-Etats de Lutte contre la Sécheresse dans le Sahel) (CILSS) has been used as a tool -similar to the IPC -to produce analysis of the current and projected food and nutrition situation that can help identify at risk geographic areas and populations for countries in the Sahel and West Africa (AGRHYMET, n.d.). The Government of Senegal uses the Harmonized Framework to estimate requirements for assistance that then guide disaster response operations (Jones, 2021). Through its ARC membership, Senegal also has access to Africa Risk View (ARV) and uses it as part of its early warning system (see Box 7 for further details on ARV).ARC uses the Africa RiskView model to estimate drought impacts in terms of agricultural production, number of people affected and response costs (Figure 5). Africa RiskView is used to develop country risk profiles that enable countries to select coverage options and payout amounts; it triggers payouts according to predefined thresholds; and it can be used as a seasonal monitoring tool that provides near real-time information and forecasts of end of season conditions during the agricultural season (African Risk Capacity, n.d.-a). en Eau) (DGPRE) coordinates flood EWS and issues flood alerts and updates to the public (Peters et al., 2022).ANACIM is responsible for weather surveillance and the issuance of weather forecasts. Various resilience and development projects, such as R4 (WFP, 2022), support the dissemination of early warnings and advisory to farmers -for instance through text messages or local radio stations. In the past, research and evaluations have found some shortcomings in the availability and dissemination of early warning information for agriculture risk management in Senegal. This includes gaps in the accuracy, timeliness and downscaling of seasonal and short-term weather forecasts. Addressing these gaps would make early warning information more relevant, and improve the accuracy of rainfall estimate and vegetation index modelling in the face of high spatial variability. There is great demand for seasonal and short-term weather forecasts and early warnings in the agriculture sector in Senegal (D'Alessandro et al., 2015). Research has found potential for seasonal and decadal forecasts to enhance farming practices, particularly when farmers can capitalise on conditions that are anticipated to be favourable, in contexts where they have options for intensification and varietal choice (Roudier et al., 2014). Yet, dissemination of early warnings can be hindered by challenges such as intermittent or unavailable internet and mobile network access of individuals and disseminators such as local radio stations (D' Alessandro et al., 2015). A further challenge to multihazard early warning systems has been weak inter-institutional collaboration around exposure, vulnerability and historic impact and loss data (Peters et al., 2022).Anticipatory action mechanisms that integrate early warning, early action and early finance Unlike in Zambia, there are no currently active mechanisms for anticipatory action or forecast-based finance / action put in place by the national Red Cross Society or international development partners in Senegal. However, the Senegalese Red Cross has plans to develop forecast-based action, including early action protocols, for drought and flood hazards in 2023. These plans are being supported by the Belgian Red Cross and other Red Cross Red Crescent movement partners (IFRC, 2023b).Micro and meso-level insurance against drought related risks in agriculture to facilitate early response Parametric insurance to cover farmers against rainfall variability and deficit has been available in Senegal since 2012 through the National Agricultural Insurance Company (Compagnie Nationale d'Assurance Agricole du Sénégal) (CNAAS). CNAAS is a public private partnership and the only agricultural insurer in the country. Products currently on offer can cover food crops (e.g. rice, maize, millet, sorghum) and cash crops (e.g. groundnut and cotton) through rainfall or yield indices (CNAAS, n.d.). Parametric crop insurance premiums are subsidised by the Government of Senegal at 50% and further supported through tax exemptions. This is part of the Senegalese government's strategy to manage climate and weather-related risks in agricultural development (Government of Senegal, 2014). Parametric insurance development in Senegal has been supported by a multitude of development partners, including the World Bank / GIIF, the United States Agency for International Development (USAID), WFP, the West African Development Bank and the Canadian Cooperation and -similar to Zambia -is now available via different distribution channels.These distribution channels include arrangements where organisations act as intermediaries (but not policy holders themselves) that make insurance available to individual farmers (micro-level insurance) and cases where the organisations act as the policy holder and even though insurance parameters are set at the individual farmer level, the organisation signs the insurance contract and there is no direct contractual relationship between CNAAS and individual farmers (meso-level insurance) (Syll et al., forthcoming).• Farmer organisations and processors: From the beginning, CNAAS has collaborated with farmer organisations that incorporate crop insurance into the package of inputs they supply to their membership at the start of the agricultural season. Under this model, seeds, fertilizer, the insurance policy and any other inputs are purchased on credit, and repayments made in cash or in the form of produce after harvesting. In case of a rainfall deficit or variability that is covered by the insurance policy, the payout is deducted from the outstanding loan repayment. Initially, farmer organisations acted mostly as intermediaries, offering the insurance coverage as an optional add on to the agricultural input package for their individual members or smaller local groups, but in recent years, many farmer organisations and processors have shifted to meso level insurance.• International organisation: Through the R4 Rural Resilience initiative, WFP has worked with the government of Senegal to implement interlinked risk reduction, risk transfer, risk retention and calculated risk interventions. Local savings associations deliver insurance policies, which farmers can either pay for individually, or participate in asset rehabilitation activities and WFP paying premiums fully or partially on the farmers' behalf. As of 2021, the programme -supported financially through the Green Climate Fund -covered 23,000 farmers -8,000 of them paying their own premium in cash and 15,000 through the insurance for asset rehabilitation work option (WFP, 2022).• Financial institutions: CNAAS' collaboration with financial institutions such as La Banque Agricole and Crédit Mutuel du Sénégal (CMS) in particular has helped increase coverage against rainfallrelated risks across the country over the past five years. This expansion also means that the majority of ARC's parametric insurance business is now made through larger portfolio insurance contracts with financial institutions, large farmer organisations and agricultural processors, rather than through microinsurance products offered to individual farmers or small groups of farmers (Syll et al., n.d.).Senegal has been one of the first countries to take out ARC insurance coverage and has joined most risk pools since the 2014/15 season (Table 5). Senegal's ARC policy paid out in 2014/15, 2018/19 and 2019/20. In those years, payouts supported implementation of the governments national drought response plans. Over the course of Senegal's ARC participation, the country has developed and revised its ARC operations plan, which defines how payouts will be used when the policy pays out in the event of a drought. Since 2019/2020, the Start Network has taken out ARC Replica coverage to complement the Government's policy and support a coordinated response of Start Network members involved with the ARC Replica Initiative in Senegal (Action Against Hunger, Catholic Relief Services, Oxfam, Plan International, Save the Children and World Vision International) through an operations plan that is aligned with that of the Government. Table 6 describes the different payout scenarios and response measures. This operations plan is the basis for harmonised Final Implementation Plans (FIPs) of the Government and Replica partners, which are developed and submitted to ARC the event of a payout (Republic of Senegal, 2021). Distribution of cash to the most affected households in the departments classified in phase 3 of the Harmonized Framework.If no department is in phase 3, the State and its partners will not implement the National Response Plan (NRP). The PRN and MSAS 11 will carry out standard nutritional surveillance and management of acute malnutrition activities using their own systems and with the support of their partners (...). Scenario 2: Severity of the drought event with a frequency of once every 5 years Small payout (US$1 million) (…) Cash distribution operations will be carried out to support the affected populations after distribution of the areas to be covered between the State and the members of the Start Network. The departments targeted will be those classified in phase 3 of the Harmonized Framework. If no department is in phase 3, the intervention will target the most vulnerable departments with the highest proportion of people in phase 3 of the Harmonized Framework. The Livestock Safeguarding Operation (OSB) will be implemented in the Departments with a fodder deficit. Scenario 3: Severity of the drought event with a frequency of once every 10 years Medium payout (US$7,5 millions)In this case, the NRP would integrate the pastoral and nutritional component. In total, 25% of the payment would be devoted to the purchase of feed for livestock in pastoral areas and areas hosting transhumant livestock and 5% for the nutritional component (…). The remaining funds would be used to help populations suffering from food insecurity in the departments in phase 3 of the Harmonized Framework after distribution between the State and the members of Start Network. Scenario 4: Severity of the drought event with a frequency of more than once every 30 years Large payout (US$13 million or more) (…) A vast national response plan will be implemented. It would have three components: cash distribution (60%), livestock feed distribution (30%) and nutrition activities (10%). Acute malnutrition screening campaigns and acute malnutrition management activities will take place every two months. Indepth geographical targeting will be carried out to determine the departments and communes most affected by the drought and the distribution between state agencies and Start Network partners (…).Source: Republic of Senegal, 2021. Senegal's ARC and ARC Replica payouts have been part of several monitoring and evaluation activities which shed light on major improvements and challenges to the provision of timely and effective drought response (African Risk Capacity, n.d.-c;Hillier et al., 2022;Jones, 2021;Start Network, 2020). This includes lessons learned about general progress in the Senegalese Governments' DRM capacity, and ARC's contributions towards strengthening DRM capacity that could also support future anticipatory action interventions (Box 8). In addition, ARC and ARC Replica have been found to enhance commitment and cooperation for the provision of timely drought response among DRM stakeholders through its structured preparedness processes -such as preparation of the operational plan and the FIP (Jones, 2021;Start Network, 2020). Other major lesson from past payouts in 2014/15 and 2019/20 that are also critical to consider for the provision of timely assistance in anticipation of drought include (1) the importance of expedited procurement processes and clear, fast and robust procedures for the receipt and disbursements of funds from Ministry of Finance to implementing entities that has resulted in delays in the past; (2) the need for continued DRM capacity strengthening and coordination to enable effective response funded through ARC and beyond; and (3) the critical role that perceptions of, and trust in, the accuracy of risk models can have on decisions to take out insurance, and how these issues can be compounded when basis risk materialises (African Risk Capacity, n.d.-c;Hillier et al., 2022;Jones, 2021).The standard timeline for ARC funded interventions in Senegal means that ARC payouts are available ahead of the lean season, but after the agricultural season and thus after the window of opportunity during which action could be undertaken to reduce or mitigate impacts of rainfall variability or deficit on that season's agricultural production. While ARV provides early warnings before and throughout the agricultural season, Senegal's national ARC operations plan does not currently include any standard operating procedures for how to respond to these early warnings. Nonetheless, in one instance in 2019, the Government of Senegal took early action on the basis of information from ARV before the end of the season, by funding and implementing the distribution of seeds with short maturity times 'in order to try and get a harvest in that season and thus mitigate the impact of the drought' (Hillier et al., 2022).'The main developments in Senegal's DRM capacity since 2014 relate to: (i) the intention to develop a stronger policy framework for DRM within the Sendai Framework, though the process for developing a national strategy only began in November 2020; (ii) reorganisation of responsibilities between government agencies in particular following from the abolition of the Prime Minister's Office, though these have left unresolved the status of the ARC Steering Committee and funding arrangements for the TWG; (iii) improvements in the social protection system (with World Bank support) that have improved the identification of vulnerable households and that have developed models for cash transfer for government welfare grants, although these have not been used by the Government of Senegal (GoS) for disaster response, and there are weaknesses in the quality of the [Single National Register (Registre National Unique)] (RNU) used to identify vulnerable households; (iv) the establishment of the Start Network as the ARC Replica partner; (v) strengthened capacity for risk modelling, early warning, risk transfer, and operational planning; (vi) strengthened M&E approaches introduced by the Start Network, although GoS monitoring of disaster response has not improved significantly.ARC has contributed to strengthening DRM capacity in Senegal principally through: (i) encouraging regular updates of operational plans and providing technical support to this process; (ii) ARC Replica's support to NGO initiatives through the Start Network; and (iii) provision of the ARV system, and training support for it, which has contributed to strengthened analytical capacity, although the ARV is not used for estimating support requirements, with reliance instead on the Cadre Harmonisé (CH) developed by CILSS. The effectiveness of capacity development support provided by ARC has to some extent been reduced by trained government staff moving on to other roles, but in some cases they remain working on DRM within NGOs.' Source: Excerpt from ARC independent evaluation Senegal country study in Jones, 2021. Disaster preparedness for anticipatory action and response The Government of Senegal and its partners are investing in preparedness to strengthen the foundations for effective anticipatory action and response. Box 9 provides a non-comprehensive overview of key internationally supported DRM, development and social protection programmes aimed at enhancing early warning, early action and early finance in Senegal.The objective of this 2021-2023 project is 'to support the efforts of the GoS in building resilience against select natural hazards at the national and local levels by providing technical assistance in (i) developing flood risk assessments and plans to inform investments and regulations, and (ii) strengthening flood resilience through preparedness and response capacities. Specifically, the study aims to better inform the preparation of the proposed Stormwater Management and Climate Change Adaptation Project and support the GoS's request to develop an integrated risk-sensitive urban planning and risk-informed urban investments (GFDRR, 2021b).This 2022-2023 project was funded through the GFDRR Multi-Donor Trust Fund for Supporting Disaster and Climate Resilience in Developing Countries and provided technical assistance to the Government of Senegal 'in reviewing the updating and formulation of legislative, institutional, financial, and sectoral policy and strategic documents to support government disaster resilience reforms. In particular, the grant (…) [contributed] to the preparation of the NDRR Strategy and its Operational Plan as well as a country DRM diagnostic' (GFDRR, 2022).Both projects are supported by the World Bank's regional Sahel Adaptive Social Protection Program. In Senegal, they focus on strengthening social protection systems, and on strengthening the capacity of these systems to respond to covariate shocks, particularly climate related shocks such as droughts, floods and fires. This includes the establishment of clearly defined triggers and manuals of operation for the provision of shock-responsive social assistance (World Bank, 2023b, 2023a). The 2015-2020 initiative was funded by the European Union and implemented by GFDRR and the World Bank. It supported African countries in developing risk financing strategies to enhance financial resilience and improve post-disaster response capacity for the mitigation of disaster impacts . In Senegal, the initiative provided technical assistance to risk profiling and diagnostics, development of risk information at the national level, costing of scalable social safety nets, analysis of contingent liabilities and insurance placement (GFDRR, 2018).The Global Shield was launched at COP27 in 2022 by the G7 and V20 to support countries in managing climate-related damage. It intends to provide a coherent and systematic offer for financial protection through the World Bank's Global Shield Financing Facility (GSFF) -building on the earlier World Bank Global Risk Financing Facility (GRiF) -and the Global Shield Solutions Platform (GSSP)based on the former InsuResilience Solutions Fund. Senegal is a Global Shield 'pathfinder country', which means it will be supported by the Global Shield to undertake a country-led stocktake, gap analysis and needs assessment. Through this process, Senegal then becomes eligible to submit support requests for climate and disaster risk finance and insurance to the GSSP (Global Shield Solutions Platform, n.d.).The PGISS, active from 2016 to 2023 and supported by the French Development Agency and the Green Climate Fund, aimed to enhance flood risk knowledge, risk reduction and early warning. It involved risk zone mapping as well as the provision of tools for real-time flood monitoring and helpedThe PSE and the Stratégie Nationale de Protection Sociale (2016 2035) -the national social protection strategy -define Senegal's framework for social protection. Among other objectives, one of five major objectives of the strategy is to have a safety net in place that strengthens people's resilience against shocks and disasters throughout their lifecycle. This objective is supported through different measures under the strategy: subsidised crop insurance coverage and insurance for work scheme coverage for farmers as well as cash and non-monetary assistance provided in response to shocks (Basse, 2022) (Table 7). To date, social protection measures under the national strategy do not include the provision of direct assistance in anticipation of shocks, but the Government of Senegal -supported by partners such as the World Bank -is actively enhancing the responsiveness of its national social protection systems to covariate shocks (see for example projects in Box 9). This has also included a broader political and technical transition from the provision of in-kind assistance towards cash transfers for shock response in a context where in-kind response measures have often been late in the past and markets are largely functional and supplied with imported staple foods such as rice (Cissokho, 2018). However, in the 2020 Covid-19 / ARC response, the new government decided to deliver in-kind food assistance rather than cash, showing that this transition may have been temporary (Kreidler and Ndome, 2021). Gaps in anticipatory action and the enabling environment in Senegal As in Zambia, there are currently no government-led contingency plans or standard operating procedures in place specifically for anticipatory action to be taken ahead of hazard events. The Government of Senegal has contingency plans for disaster response, but these documents do not define specific anticipatory actions that should be initiated in anticipation of impending disasters.Ongoing efforts to enhance the timeliness of disaster response such as ARC are helping to make disaster response more timely based on the projections of need, but they are currently missing the window to act on seasonal and medium-term rainy season forecasts to help farmers prepare when conditions are likely to be unfavourable, or take advantage when rainfall is likely to be favourable. Dissemination of early warnings and associated advisory, along with assistance to put advisory into practice, should therefore be a key priority to enable farmers and their networks to take anticipatory action.There are a multitude of stakeholders and initiatives with early warning and disaster response mandates in Senegal, making coordination for anticipatory action challenging. The DPC is in charge of coordinating DRM, but has grappled with capacity to fulfil this function effectively. The COGIC, which was planned to enhance interministerial coordination in early warning and crisis management, has taken a long time to operationalise. The different interventions in place to provide assistance to at-risk or affected populations across the Government of Senegal's social protection frameworks and humanitarian partners would also benefit from better alignment (Basse, 2022;Kreidler & Ndome, 2021).Enhancements in DRM frameworks and capacity for early warning, early action and early finance provide a strong foundation for anticipatory action frameworks and interventions in Senegal. This includes coordination platforms for early warning and disaster response that AWARE can build on. Senegal also has extensive experience with parametric insurance at micro, meso and macro levels. Pre-arranged finance and contingency planning processes related to these instruments, especially to sovereign insurance, have helped strengthen DRM capacity and coordination in recent years.Experience with an ad hoc anticipatory intervention by the Government of Senegal in 2019 shows the potential of acting even earlier to prevent impacts. When it became likely that the sowing window would fail in 2019, the Government of Senegal used its own resources to distribute seeds for varieties with shorter crop maturation time, so that a harvest could still be achieved within that season (Hillier et al., 2022). Parametric insurance products in Senegal currently pay out on the basis of models that estimate agricultural production, impacts and response costs at the end of the agricultural season; during a time window when hazard events (e.g. rainfall deficit) have occurred and primary impacts (e.g. crop failure) have happened, but their indirect impacts (e.g. food insecurity)have not yet fully materialised. The 2019 example demonstrates scope to include anticipatory action during or before the agricultural season, e.g. on the basis of weather and crop forecasts, more systematically within the Governments' disaster risk management and financing frameworks to get even further ahead of the curve.The Government of Senegal, with support from partners, has been strengthening the shockresponsiveness of its national social protection systems. While none of the existing social protection programmes currently provide assistance to households on the basis of hazard forecasts, they are increasingly being linked to early response mechanisms such as ARC payouts and contingency plans. Parts of the social protection system may also enable targeting and implementation of anticipatory action in the future, for instance through the RNU; though this would require regular updating and expansion of the RNU to include people on the basis of their vulnerability to disasters, rather than on poverty measures alone (Tounkara et al., 2021).The following recommendations are drawn from the mapping presented in the previous chapters and from evaluations and process learning from anticipatory action interventions globally.Forge strong partnerships with government agencies and other stakeholders early on. This is critical to ensure anticipatory action can be effective, coordinated and institutionalised within national disaster risk management frameworks and processes. The ZRCS's experience in Zambia indicates that an emphasis on strong partnerships from the start of any anticipatory action initiative can help generate a sense of ownership and supports efficient use of resources amongst stakeholders.Validate and clearly communicate accuracy of forecasts to stakeholders so that they can understand the potential benefits and uncertainties related to the available early warnings. This serves as a vital foundation for building trust and confidence in anticipatory action initiatives. When stakeholders are aware of the reliability of forecasts, they can make more informed decisions, for example about the allocation of resources. Therefore, validating and communicating the accuracy of forecasts is not merely a technical exercise; it is a cornerstone of effective anticipatory action, bolstering its credibility and increasing its impact on disaster risk management and resilience-building efforts.Base anticipatory action frameworks and action plans on needs, focusing on the disaster impacts they are seeking to address. This means, frameworks and action plans need to be designed on the basis of a robust understanding of what the impacts of droughts, floods and other major disasters are, and what actions would need to be taken at which point in time to address these impacts; rather than being driven by supply of a particular forecasting tool or finance mechanism. Early warning systems and tools aimed at supporting anticipatory action implementation -such as AWARE -should then be designed or adapted to enable those actions. However, it is also important to acknowledge that there may be limitations and mismatches between what implementers would like to do to reduce or mitigate likely disaster impacts and what forecasts are currently able to predict in specific locations, at what lead time, and with sufficient accuracy. Discussing such limitations openly among stakeholders is critical to manage expectations.Prioritise incorporating anticipatory action within existing disaster risk management frameworks and processes over creating new structures. In both Senegal and Zambia, disaster risk management policy and practice has been transitioning from ad hoc emergency response towards a greater focus on risk reduction and the prevention and mitigation of (likely) impacts of droughts, floods and other hazards. Ongoing initiatives such as ARC or FbA by the DREF provide opportunities to integrate anticipatory action within these frameworks to ensure they are complementary, considering different windows of opportunity for action, and aligned with wider government strategy; rather than duplicating efforts.Focus not only on anticipatory action frameworks, but also on the systems strengthening that is required to implement anticipatory action continuously and reliably through national and subnational government structures. While frameworks and contingency plans are important to clarify responsibilities for who should be taking anticipatory action, when and where, stakeholders need human and financial resources to fulfil these functions. Building sustainable capacity is thus critical to ensure the sustainability of any anticipatory action initiatives and tools put in place to support this. Ensuring that anticipatory action is coordinated rather than implemented through many disconnected projects by individual implementing partners backed by different donors has been a major challenge in countries where anticipatory action initiatives are being implemented globally. AWARE should thus put the government departments responsible for DRM related to the respective hazard in the driver's seat in developing and coordinating anticipatory action frameworks in Senegal and Zambia, and support them in that role.Make use of existing guidance materials and tools to ensure efficiency in development and implementation of anticipatory action frameworks. A growing body of guidance materials, tools and trainings for anticipatory action exists that AWARE can draw on in its effort to enhance anticipatory action coordination in Senegal and Zambia. Key resources that can inform the development of action plans and help pre-arrange finance for anticipatory action through AWARE include:• RAAWG roadmap and its proposed activities and materials it intends to produce, e.g. anticipatory action repository in southern Africa, or joint capacity building activities on impactbased forecasting • Red Cross Red Crescent FbF Practitioners Manual developed on the basis of Red Cross Red Crescent FbF project experience and aimed to guide national societies, but also contains relevant information to help inform anticipatory action frameworks and development of action protocols by other actors. Research and process learning on early action protocol development and implementation across 18 national societies -including Zambia -is currently ongoing and will be available by late 2023. • UN OCHA anticipatory action toolkit offering practical guidance on anticipatory action to UN OCHA staff. Similarly to the Red Cross Red Crescent FbF Manual, some aspects of the toolkit are more widely relevant beyond OCHA and can help inform other initiatives. Process learning from UN OCHA anticipatory action initiatives is available for several countries, including Bangladesh, Nepal, Malawi and Somalia. • Anticipatory action for livelihood protection: a collective endeavour discussing windows of opportunity and different types of actions to consider in defining anticipatory action frameworks aimed at livelihood protection and continuity of businesses and services, including in agriculture.• Anticipation Hub learning resources compiling a repository of training resources, guidance and webinars on the topic of anticipatory action. • Finance for early action overview produced by the Risk-informed Early Action Partnership (REAP) and guidance on quality assurance for disaster risk financing relevant to pre-arranging finance for anticipatory action developed by the Centre for Disaster Protection."}
|
main/part_1/0193560733.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"8f98f48b6236f0231df08877090b1ef1","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/4f36dd3f-48a0-4c30-92e4-324f982551e9/retrieve","id":"613622339"},"keywords":["agronomic traits","breeding programme","fruit quality","variation","wild relatives Indigenous breed","Sheep genetic resources","Morphological characterization","Qualitative traits","Tigray region","Ethiopia Citation: Hailu","A.","Mustefa","A.","Aseged","T.","Assefa","A.","Sinkie","S.","Tsewene","S. (2020). Phenotypic characterization of sheep populations in Tahtay Maichew district","Northern Ethiopia. Genetic Resources 1 (2)","12-22. doi: 10.46265/genresj.SHBD3744 breeding","clonal forestry","gene markers","melina","population genetics microsatellite","hybridization","alleles","pigs","polymorphism Body weight","indigenous chicken","antibody","Newcastle disease tropics","wild species","grasses","legumes","germplasm","collection","utilization","genebank"],"sieverID":"2400f93d-df2c-425b-96dd-afa97941bd0d","content":"The designations employed, and the presentation of material in the periodical, and in maps which appear herein, do not imply the expression of any opinion whatsoever on the part of ECPGR concerning the legal status of any country, territory, city or area or its authorities, or concerning the delimitation of its frontiers or boundaries. Similarly, the views expressed are those of the authors and do not necessarily reflect the views of ECPGR.Tomato (Solanum lycopersicum L. formerly Lycopersicon esculentum Mill.) is one of the most famous and broadly consumed vegetable crops throughout the world (Nowicki et al, 2013;Ajayi and Hassan, 2019). Nigeria was ranked the largest producer of tomato in West Africa and the 16 th largest producer in the World with 4.2 million metric tonnes FAO (2016). These data suggest prospects for Nigeria tomato breeding programmes to enhance production efficiency by improving the quantity and quality of tomato fruit. However, extensive breeding efforts and selection over the years have modified tomato (Blanca et al, 2015).The decline in diversity and potential of cultivated germplasm has been reported (Jatoi et al, 2008;Chen et al, 2009). To enlarge the gene pool of cultivars, breeders now focus on introgression of desirable genes from wild relatives (Singh, 2006) .Wild tomato species have a rich reservoir of useful genetic traits needed to improve cultivated toma-Seeds were sown into perforated nursery trays filled with sterilized soil and grown for three weeks in a greenhouse at NIHORT, Ibadan, Oyo State (Rain forest zone; 3 • 56'E, 7 • 33' N; 168 meters above sea level). The perforated nursery trays were kept moist by regular watering on daily basis at sunrise and sunset with tap water using a watering can. Seedlings were transplanted to the field in paired rows in plots that were 2 m long with spacing of 0.5 m between rows and 0.5 m between plants within a row. Spacing between plots was 1 m. Seedlings were arranged in a randomized complete block design with three replications. N-P-K (15-15-15) fertilizer was applied at the rate of 120 kg/ha three weeks after transplanting. The plants were trellised to prevent lodging and loss of fruits due to diseases and pests. Manual weeding was carried out at two-week intervals. To protect the leaves from defoliating pests, plants were sprayed with the pyrethroid insecticide Cymbush containing cypermethrin at 2, 6, and 9 weeks after transplanting at the rate of 450 ml of active ingredients per 100 liters of water per hectare using a knapsack sprayer. No disease infestation was observed during the experiment and data were collected on five randomly selected plants per plot.Uniformly ripe, healthy fruit at the red-ripe stage were harvested (Hanson et al, 2004). A total of 10-15 representative fruit were collected from pre-tagged plants (from the first 3 clusters) to minimise intra-plant variability (Borja et al, 1998). Tomato samples (100 g) were homogenized in 50 mL of water in a water bath at 4 • C and low light (to reduce antioxidant loss) for physicochemical analysis. All analyses were done in triplicate for each sample at the Product Development Laboratory of NIHORT. Total soluble solid ( • Brix) (g 100 g −1 ) of the juice was measured using the Eclipse hand-held refractometer [PN# 45-01 (0-15 • Brix)] and the pH of the fruit juice was measured using a benchtop pH meter (Sper scientific benchtop) with the pH meter calibrated with standard buffers pH 4 or 9. For determination of titratable acidity (g 100 g −1 ) and vitamin C content (mg 100 g −1 ), 10 mL of juice from 10 fruits was diluted in 100 mL of distilled water and titrated with NaOH (0.1 N) to pH 8.2. For vitamin C, the solution was titrated with iodine (0.1 N) until a colour change was observed (International Plant Genetic Resources Institute, 1996) .To determine lycopene content (mg 100 g −1 ), 5 mL of acetone-n-hexane mixture in the ratio 4:6 was added to 0.8 g of tomato pulp for each sample and mixed well. The mix was centrifuged at 5000 rpm for 5 min at 4 • C; the supernatant was extracted and absorbance measured with a spectrophotometer (model 6400, Jenway) at 503 nm using the acetone-n-hexane mix as blank (Rosales et al, 2006). Lycopene content was calculated using an extinction coefficient (E % ) of 3150.Data were collected on the following traits: number of leaves at maturity (NLM), plant height at maturity (PH), number of clusters per plant (NCP), number of fruits per cluster (NFC), fruit weight (FW), fruit length (FL), fruit circumference (FC), number of fruits per plant (NFP) and fruit size index (FSI). Fruit yield of tomato was adjusted to t ha −1 using the following formula: Fruit yield (t ha −1 ) = fruit yield per plot (kg) x 10,000 / plot area (m 2 ) x 1,000.The data was subjected to analysis of variance (ANOVA) using PROC GLM in SAS (SAS Institute, 2010) . Means were separated using Fisher's least significant difference (LSD) test (P < 0.05). A rank summation index (RSI) (Mulumba and Mock, 1978) was constructed to create the aggregate trait by ranking accessions with regard to high fruit weight, fruit yield, improved agronomics, nutritional and physicochemical traits. Ranks were summed for each accession to select the top five. Pearson's correlation analysis was done to determine associations among all traits measured with SAS. Hierarchical cluster analysis was performed using SAS PROC CLUSTER based on centroid distance and a dendrogram constructed by PROC TREE in SAS to identify divergent groups. To identify patterns of morphological variation, principal component analysis (PCA) was conducted. Those PCs with Eigen values >1 were selected (Jeffers, 1967). The PCA analysis reduces dimensions of a multivariate data to a few principal axes, generates an Eigen vector for each axis and produces component scores for characters (Sneath and Sokal, 1973).The ANOVA produced significant mean squares for all agronomic, nutritional and physicochemical traits of the tomato accessions indicating genetic variations for all measured traits (Table 2). The coefficient of variation (CV) used to measure the precision of the experiment indicated the data was reliable (Table 2). Phenotypic variation in the biological growth stages of tomato accessions revealed that LA4113 was tallest and LA2641 shortest (Table 3). The most fruits per cluster were observed for accession LA0103 and least for LA1041. The most fruits per plant were observed for accession LA0411, the least for LA4138. For fruit yield related traits, tomato accession LA0130 had the heaviest fruit and most fruit yield, LA1293 had the lowest fruit weight and least fruit yield. Accession LA0411 had the highest concentration of vitamin C. LA1028 had the highest levels of total soluble solids while accessions LA4113, LA4138, LA1041 had the lowest levels. Accessions LA1208 and LA4133 had the lowest titratable acidity, LA2641, LA1293 and LA0130 had the lowest fruit juice pH. Lycopene content was highest in tomato accession LA0130 and lowest in LA1208 (Table 3).Based on a rank summation index (RSI) of 13 accessions, LA0130 was identified as best performing among all tested accessions, with the best fruit yield performance, desirable agronomic, nutritional and physicochemical traits. Tomato accession LA0130 was characterized by moderate plant height, highest number of fruits per cluster, fruit weight and fruit yield (Table 3). Accession LA0130 also had the highest titratable acidity and lycopene content, but moderate fruit juice pH (Table 4).Pearson's correlation coefficient was calculated to determine associations among traits and showed variation for some trait combinations (Table 5). Fruit yield was significantly positively correlated with fruit weight coupled with a significant negative correlation with number of leaves at maturity. Fruit size index was significantly negatively correlated with fruit circumference and significantly positively correlated with vitamin C content. Total soluble solid was significantly positively correlated with number of leaves at maturity and vitamin C content. Titratable acidity was significantly positively correlated with number of fruit per plants and total soluble solid. Fruit juice pH was significantly negatively correlated with number of fruit per plant, total soluble solid and titratable acidity. Lycopene content was positively significantly correlated with vitamin C content and titratable acidity.All agronomic traits, nutritional and physicochemical parameters measured which showed significant vari-ations were adopted to construct a hierarchical cluster based on the centroid distances among the 13 tomato accessions as in Figure 1. Cluster analysis differentiated the accessions into 4 distinct groups, where LA0130 differed from the other three groups. Cluster I consisted of five accessions, cluster II had four accessions, and clusters III and cluster IV had three and one accessions, respectively indicating variation among the accessions.Additionally, contribution of each measured trait to the total variation within the accession was further determined through Principal Component Analysis (PCA) based on correlation matrix of the variables. The Scree plot of the PCA indicated six eigenvalues corresponding to the entire percent variance with eigenvalues >1. PCA1 accounted for about 22 % of variation, PCA2 for 19 %, PCA3 for 15 %, PCA4 for 11 %, PCA5 for 10 % and PCA6 for 6 % (Table 6). The first principal component axis (PCA1) was mainly loaded positively by fruit yield, fruit yield related traits and titratable acidity. In PCA2 traits which had positive contribution were number of leaves at maturity, plant height at maturity, titratable acidity and lycopene. Fruit length, fruit circumference, total soluble solids and lycopene had positive contributions in PCA3. In PCA4 plant height at maturity, number of clusters per plant, fruit weight, fruit yield and fruit juice pH had positive contributions were. In PCA5 number of clusters per plant, number of fruits per cluster, fruit length, fruit circumference and total soluble solids had positive contributions. In PCA6 traits which had positive contributions were fruit length, fruit size index and Vitamin C content.Significant phenotypic variations among the accessions for all agronomic, nutritional and physicochemical traits validate availability of genetic diversity in the collection from the C.M. Rick Tomato Genetics Resource Center (Chetelat, 2004(Chetelat, , 2006)). Previous research reported significant variations for agronomic traits for cultivated tomato varieties grown in various environments in Africa (Chernet and Zibelo, 2014;Shiberu, 2016;Regassa et al, 2016). This study indicates a wealth of genetic variability for fruit quality traits of wild tomato accessions. Accessions LA0411 and LA2641 had the highest number of fruit per plant which could be ascribed to genetic variation in flower abortion (Kanneh et al, 2017). Numbers of fruit per plant from this study were higher than the values reported by Ceballos-Aguirre and Vallejo-Cabrera ( 2012), but similar with the report of Agong et al (2001). The mean performances for fruits per cluster and fruit weight in our study were higher than the results presented by Ceballos-Aguirre and Vallejo-Cabrera (2012) who worked on wild tomato accessions from the Tomato Genetics Resources Center (TGRC), University of California-Davis. Disparities in the results from this study may be due to difference in the accessions evaluated, number of days before transplanting, agronomic practices used, and the environment. Important quality traits that determine flavor, shelf life and market-related attributes of tomato are total soluble solids, fruit juice pH, titratable acidity, lycopene and Vitamin C content. The quality of tomato fruit for industrial processing and paste production depends on a high value of total soluble solids. Total soluble solids recorded in this present study ranged from 3 to 5 ºBrix which is comparable to the minimum value of total soluble solids (4.5 ºBrix) reported by Campos et al (2006) but considered low for industrial tomatoes. Previous studies have reported a range from 4 to 6 ºBrix for total soluble solids of tomato fruits (Alcántar et al, 1999;Cramer et al, 2001;Pascale et al, 2001). High total soluble solid increases tomato paste efficiency and must be between 5.0 and 6.5 % in industrial tomatoes (Teka, 2013). The range of 4.80 -5.30 for tomato fruit juice pH reported in this study is considerably high. Tomato fruit juice pH values can vary from 4.25 to 4.78 and fruits with high pH values may not be recommended for fresh tomato consumption or industrial processing (Paulson and Stevens, 1974;Anthon et al, 2011;Rajae et al, 2018). A pH below 4.50 is desirable because it reduces proliferation of microorganisms and indicates quality (Mohammed et al, 1999;Tigist et al, 2013). However, the pH of ripe tomatoes may exceed 4.50 because a higher pH value is associated with flavor (Stevens, 1972). Titratable acidity in this study was higher than previously reported (George et al, 2004;Tigist et al, 2013;Rajae et al, 2018). Tomatoes are considered the main source of lycopene compounds and a major source of carotenoids in the human diet (Willcox et al, 2003). Lycopene imparts the red color to tomato and affects quality. The range for lycopene content reported in the literature is between 0.58-6.50 mg 100 g −1 (Rickman et al, 2007;Saha et al, 2010), which is lower than reported in this study. The Vitamin C concentrations reported in this study for all accessions were higher than reported by Aoun et al (2013), but consistent with the range reported by Franke et al (2004) and Saha et al (2010). Our results show that wild tomato accessions contain significant antioxidants and may be useful for nutritional improvement in tomato breeding programmes (Tigchelaar, 1986) . All fruit quality and nutritional traits measured in this study reveal the value of the wild tomato accession as a source of useful alleles and their utilization as interesting donor parents in cultivar development.Selection of the top outstanding five accessions with RSI may be useful as donor parent through intra and interspecific hybridization (Ghani et al, 2020) and may result in a significant increase in tomato fruit weight and fruit yield. This gain in fruit weight and yield could also be associated with improvement in number of fruits per cluster, number of fruits per plant, titratable acidity, lycopene content and fruit juice pH. To improve breeding efficiency and selection indices in crop improvement, knowledge about correlation among traits is essential (Nzuve et al, 2014). Results from Pearson's correlation coefficients indicate that as tomato fruit yield increases, number of leaves at maturity decreases significantly. Selection based on fruit weight and reduction in number of leaves at maturity could lead to tomato fruit yield improvement. There were significant negative correlations between fruit juice pH and titratable acidity. This implies that increased fruit juice pH was accompanied by a decrease in titratable acidity and acid concentrations and is associated with maturity (Teka, 2013). Significant positive correlations between total soluble solids and titratable acidity in this study corroborate findings of Aoun et al (2013), and also indicated that plants with high sugar content have more free organic acids than plants with low sugar content (Saliba-Colombani et al, 2001;Georgelis, 2002;Getinet et al, 2008). With positive correlations, genes controlling these traits could be linked to, or be under control of, pleiotropic effects (Boćanski et al, 2009). Positive and/or negative desirable relationships among some agronomic, nutritional and physicochemical traits indicate that desirable genes in these wild accessions could be exploited in further breeding activities for cultivar improvement (Sujiprihati et al, 2003).Furthermore, the wild tomato accessions were arranged in 4 clusters; with cluster IV appearing as the most phenotypically diverse. The best performing accession LA0130 in cluster IV has the highest number of fruits per cluster; highest fruit weight, fruit yield, vitamin C concentration, lycopene content, and moderate total soluble solids, titratable acidity and fruit juice pH. This accession might harbor novel traits that are lacking in cultivated tomato and may be used as potential parent in tomato breeding to develop high yielding cultivars with desirable nutritional and physicochemical traits. The eigenvalue from PCA indicates importance of each principal component axis and its contribution to variability in traits of the tomato accessions. Fruit size index and vitamin C concentration play a role in explaining the variation but are less important than the first four factors.This study identifies variability among the 13 wild tomato accessions evaluated. Accession LA0130 was outstanding for its unique attributes which included high number of fruits per cluster, fruit weight, fruit yield, total soluble solids, titratable acidity and lycopene content amongst others. Thus, this wild tomato accession may be considered promising to broaden the genetic variability for tomato improvement programmes. Consequently, this accession may be incorporated into the tomato breeding programme in the national institutes and could be used in hybridization for developing lines with desirable horticultural traits. Documentation of the agronomic, nutritional and physicochemical performance of the evaluated wild tomato accessions is informative for their utilization in breeding programmes. These results are useful for breeders working on the development and improvement of tomato, as desirable traits from these wild tomatoes can be transferred into the commercial tomato varieties suitable for the growth conditions in the rainforest agro-ecology zone of Nigeria and to boost production and diversity. Knaap, E., and Cañizares, J. (2015). Genomic variation in tomato, from wild ancestors to contemporary breeding accessions. BMC Genomics 16(1), 257-257. url: https://dx.doi.org /10.1186/s12864-015-1444-1. doi: 10.1186/s12864-015-1444-1 Boćanski, J., Srećkov, Z., and Nastasić, A. (2009).Genetic and phenotypic relationship between grain yield and components of grain yield of maize (Zea mays L.). j.1365-2621.2003.tb05770.x. doi: 10.1111/j.1365-2621.2003.tb05770.x Ceballos-Aguirre, N. and Vallejo-Cabrera, F. A. (2012).Evaluating the fruit production and quality of cherry tomato (Solanum lycopersicum var. cerasiforme).Rev. Fac. Nac. Agron. Medellín 65(2), 6593-6604. url: http://www.scielo.org.co/scielo.php?script= sci arttext&pid=S0304-28472012000200004&lng= en&nrm=iso. Chen, J., Wang, H., Shen, H., Chai, M., Li, J., Qi, M., and Yang, W. (2009) (FAO, 2012). This will fur-ther maximize sustainable food security while minimizing pressure on the environment. Ethiopia, one of the major gateways for domestic sheep to Africa (Devendra and Mcleroy, 1982), is believed to have the largest livestock population in Africa with 31.3 million sheep (Central Statistical Agency, 2018) categorized into 14 traditionally recognized and phenotypically distinct sheep populations (9 breeds within 6 breed groups) (Gizaw et al, 2008;EBI, 2016). The 9 sheep breeds of Ethiopia are Simien, Short fat tailed, Washera, Gumz, Horro, Arsi, Bonga, Afar and Black Head Somali (BHS) (Gizaw et al, 2008). In literature, sheep populations of the current study area were generally classified as Sekota traditional population and further categorized under the Short fat tailed breed (Gizaw et al, 2008). However, samples were not taken from nearby areas of the current study areas.Sekota sheep populations were characterized as short fat tail turned-up at end and fused with main part. The population is medium-sized, predominantly brown or white coat color, few blacks with brown belly. The white animals have finer hair or wooly udder-coat, semi-pendulous or rudimentary ears in Wag Himra and Tigray while predominantly rudimentary in Tekeze valley. Sekota sheep population were reared by Agew, Tigray and Amhara communities (Gizaw et al, 2008).However, due to the country's high ecological and production system variations, some of the breeds were re-characterized in more recent studies, including Simien sheep (Melaku et al, 2019), Short fat tailed sheep (Hayelom et al, 2014;Bimerow et al, 2011;Getachew et al, 2009), Washera sheep (Mengistie et al, 2010), Arsi sheep (Worku, 2018); Afar sheep (Getachew et al, 2009). In addition to these studies, some work was done in the Tigray region on Abergelle sheep (Tajebe et al, 2011) and Tigray Highland sheep (Gebreyowhens and Tesfay, 2016).Despite the efforts made to characterize the Ethiopian indigenous sheep genetic resources as mentioned above, they have not yet been exhaustive in covering all regions of the country in general and the Tigray region in particular. They also focused on only a few specifically well-known sheep populations. As a consequence, a high sheep diversity remains unstudied, along with the associated diversified ecology, production systems and ethnic groups. Therefore, there is an urgent need for continued characterization and identification to understand the relationships within and among breeds. Thus, the present study was initiated to cover these gaps and phenotypically describe the indigenous sheep populations of Tahtay Maichew district, Central Tigray zone, Ethiopia.The study was carried out in the Tahtay Maichew district, which is located in the central zone of Tigray National Regional State (Figure 1). The district covers a total area of 18,618 km 2 with estimated livestock (Atsbeha et al, 2015). The studied areas were categorized as highland, midland and lowland based on the climatic factors in Table 1.Available background information on the existence of unstudied sheep populations adapted to different agro-ecological zones was captured through short pilot survey and focus group discussions with livestock experts and keepers. Two sites (kebeles) were sampled randomly from each agro-ecological zone (see Table 1).Quantitative and qualitative data were recorded from a total of 306 adult sheep (57 rams and 249 ewes) based on data collection procedures outlined in FAO guidelines (FAO, 2012). Studied animals were carefully handled by trained personnel. Quantitative measurements were taken early in the morning of the day before feeding and watering when the animals were calm and standing in an upright position on flat ground. Eighteen quantitative measurements were collected: body length (cm), body weight (kg), heart girth (cm), height at withers (cm), chest depth (cm), shoulder point width (cm), subs height (cm) rump length (cm), rump width (cm), tail length (cm), tail width (cm), head length (cm), head width (cm), shin circumference (cm), horn length (cm), hair length (cm), canon bone length (cm), ear length (cm), testis circumference (cm). Fourteen qualitative characteristics were also collected: coat color pattern, coat color, skin color, fiber type, ear orientation, head profile, back profile, rump profile, tail type, tail shape and presence of toggle, horn, beard and ruff were recorded.Data were entered and managed using Microsoft Excel© worksheet. Detection of outliers and testing the normality of the quantitative measurements data was performed using the UNIVARIATE procedure of Statistical Analysis Software (SAS) 9.0 (SAS Institute, 2002). Analysis of data on quantitative measurements and qualitative characteristics was carried out using the General Linear Model (GLM) procedure and the frequency (FREQ) procedure of SAS 9.0 software, respectively. Linear measurements Least Square Means (LSM) were separated using the adjusted Tukey-Kramer test (SAS Institute, 2002). Quantitative and qualitative data were analyzed using the following model:Y ijk = µ + A i + B j + C k + e ijk where Y ijk is an observation, µ is the overall mean, A i is the fixed effect of environment, B j is the fixed effect of the sex, C k is the fixed effect of age group and e ijk is the random error attributed to the n th observation. Environment, sex and age group were fitted as class variables throughout the analysis, while sex effect was removed from the class variables when the analysis was done separately for each sex.Multivariate analysis was performed on quantitative measurements. Stepwise discriminant function analysis (STEPDISC) with forward selection procedure was used to find out the quantitative variables that better discriminate populations from different environment. Percentage assignment of observations to environment and probabilities of misclassifications were evaluated by discriminant function analysis (DISCRIM). Canonical discriminant function analysis (CANDISC) was also performed to find out linear combination of quantitative variables that provide maximal separations between environments. The scored canonical variables were used to plot pairs of canonical variables to get visual interpretation of environmental differences. Pairwise squared Mahalanobis distances between environments were computed as:Where D 2 (i|j) is the distances between environments zones i and j, cov −1 is the inverse of the covariance matrix of measured variables, x i and x j are the means of variables in the i th and j th populations.Level of significance (P-values) outputs of the class variables for both the overall analysis and separately for each sex are presented in Table 2. Overall, most of the studied traits were significantly affected by agroecological zone, age and sexual differences. Effect of agro-ecological zone on some quantitative traits (heart girth, height at withers, shoulder point width, rump length, tail length, head length, hair length, canon bone length, and ear length) was more significant on ewes than rams.The overall mean with the respective standard error and deviation, and the effect of agro-ecological zone, sex and age on the quantitative measurements are presented in Tables 3, 4 and 5. The highland sheep population had the shortest height at withers, widest shoulder points and longest hair, while midland sheep population possessed the shortest tail and ear. Almost half of the measured traits were affected by sex of the animals showing higher values for males.Most of the overall agro-ecological zone differences were due to the differences within the ewes. However, testis circumference, the only trait among the rams which is affected by agro-ecological zone, increases significantly as we shift from highland to lowland.The majority of the quantitative measurements were significantly affected by the age of the animals (Figures 2, 3 and 4). Accordingly, values of some traits (body weight, chest depth, shoulder point width, rump width, testis circumference, body length, heart girth, and height at withers) gradually increased towards the optimum age of three years and then decreased towards the oldest age (5 years; Figures 2 and 3). However, this was not true in some traits (head length, head width, shin circumference, hair length, canon bone length, and ear length; Figure 4). On the other hand, age did not affect subs height, rump length, rump width, tail length, and tail width.The outputs of the chi-squared tests, if the qualitative characteristics of the sheep populations from the three agro-ecological zones differ, are presented in Table 5. Accordingly, ear orientation, back profile, head profile, rump profile and coat color of the three agro-ecological zones were significantly different (Table 5). On the other hand, the coat color pattern, fiber type, skin color, tail type, tail shape and presence of toggle, horn, beard According to stepwise discriminant function analysis, canon bone length, height at withers and tail length were the three most important morphometric variables used in discriminating the sheep populations from different agro-ecological zones (Table 6). Chest depth, subs height, body length, and tail width were found not to be useful variables due to their lowest discriminatory power (Table 6).The probabilities of all main multivariate tests over the canonical structures were significant (Table 7). Canonical correlation coefficients of the quantitative variables and class means outputs from the two canonical structures are shown in Table 8. The first canonical structure (Can 1) explains the majority (69%) of the variability with eigenvalue of 0.48. The first canonical correlation (57%) was the greatest multiple correlation with the classes that was achieved by using the linear combination of the quantitative variables. The results revealed that Can 1 separates the sheep populations (class means) from different agro-ecological zones.Results of a discriminant function analysis (Table 9) shows the classification of data into a known agroecological zone. Accordingly, an average of 66% of the sampled animals were classified into their respective agro-ecological zone. The overall error rate was 34%, while higher error rates were obtained from the classification of midland sheep populations.Pairwise squared distances between agro-ecological zones are shown in Table 10. All distances were significant. Highland sheep populations are distantly related to the lowland sheep. On the other hand, midland sheep relates more towards lowland sheep than highland sheep. Along with the most observable qualitative traits, quantitative measurements produce reliable information in characterization and differentiation of sheep populations. In our current study, more traits showed significant differences among ewes than among rams in different agro-ecological zones. This might be due to either the larger sample size taken for ewe populations or due to the similarity of rams over the studied agro-ecological zones, which could be attributed to common markets where farmers select and purchase rams for sire purposes.Most of the studied traits were affected by agroecological zone differences, which might be due to the differences in physiological adaptation mechanism of sheep types to different environments, management, availability of different feed and nutrition and/or the variations being caused by genetic factors. For example, the majority of lowland sheep possess higher values for height at withers, testis circumference and short hair which might help them to adapt to a hot environment. These results are in line with the results of Getachew et al (2009) and Gizaw et al (2008) for Menz and Afar sheep who reported that such measurements of the lowland Afar sheep were higher than the highland Menz sheep populations.Most of the body measurements were higher for rams than ewes, which might be attributed to enhanced muscle mass and skeletal development in males due to testosterone hormone secretions (Baneh and Hafezian, 2009). These results follow Rensch's rule where the males of a particular species are usually heavier than the females (Rensch, 1950). Size differences may be ascribed to the differences in the endocrine system of the two sexes; estrogen hormone was shown to have a limited effect on growth in females (Baneh and Hafezian, 2009). These results are in agreement with Mustefa et al (2019) and Getachew et al (2009) who reported that males were higher than the females in most growth traits in goats and sheep respectively.In agreement with the results of the current study, most scholars report differences in traits between the sexes with rams being dominant over ewes (Rensch, 1950;Baneh and Hafezian, 2009;Mustefa et al, 2019;Getachew et al, 2009). However, differences due to sex was not observed in Tigray Highland Although the body weight of rams and ewes presented in this study were higher than those reported for Abergelle and Tigray highland sheep (Tajebe et al, 2011;Gebreyowhens and Tesfay, 2016), other traits such as body length, height at withers, heart girth and tail length were comparable between these sheep populations. On the other hand, higher values for all morphological measurements were reported by Edea et al (2010) for the country's most known sheep breeds (Bonga and Horro sheep).The results also revealed that linear body measurements among the studied sheep population differ with age. Three-year-old sheep showed the highest values for most of the measurements, reflecting the optimum growth age. These results are in contrast with results of Getachew et al (2009) for Menz and Afar sheep and Melaku et al (2019) for Simien sheep who reported that the body weight of the sheep continued to increase with age.In addition to the quantitative measurements, the qualitative characteristics of a population also allow to easily differentiate genetic resources. Among the obvious qualitative characteristics which differentiate the current sheep populations from the previously characterized sheep populations are the complete absence of beard, horn, ruff, toggle and pigmented skin. Similarly, variations in coat color were also observed among the different agro-ecological zones. Accordingly, the majority of the highland and midland Discriminant function analysis allowed the classification of an average 66% of the studied animals into their respective environments zone. Lowest classification of individuals into their respective agro-ecological zone was observed in midland sheep populations, indicating a lack of uniqueness within them. All of the pairwise comparisons between populations from different agro-ecological zones were found to be highly significant with the largest difference observed between the highland and lowland sheep populations. These results reflect the large altitudinal differences between the two agro-ecological zones. The shortest distance calculated between the lowland and midland sheep populations show their relative similarities as compared with the highland sheep. These differences among different agroecological zones show the presence of potential genetic resource variations which can be useful for maintaining diversity and further selection-based genetic improvement programs.In conclusion, using a combination of quantitative and qualitative characteristics we were able to discriminate the sheep populations from three agro-ecological zones in the Tahtay Maichew district, Tigray region of Ethiopia and to group them into two distinct populations (the highland and the lowland sheep). Sheep populations from the midland agro-ecological zone were considered to be part of the lowland group. Therefore, it is better to consider the highland and lowland sheep as different traditional populations until molecular characterization results provide further evidence for population differentiation. Additionally, the molecular characterization studies will show the within population genetic diversity and level of inbreeding which can be used for selecting appropriate genetic improvement plans (selection or crossbreeding). According to the reports of Gizaw et al (2008), the sheep genetic resources of most parts of the Tigray region were generally referred as Sekota sheep population under the short fat tailed breed. However, results from our study indicate that there are several sheep populations that cannot be categorized under the Sekota traditional sheep population. Therefore, it is advisable to include these genetic resources for further molecular studies to understand the genetic diversity within and among populations.Animal Genetic Resources Information 43,[25][26][27][28][29][30][31][32][33][34][35][36][37][38][39] Gmelina arborea (melina) is a valuable timber species that grows throughout tropical areas. Native to Southeast Asia and India, it is an important commercial timber species in tropical regions worldwide, particularly in Southeast Asia, West Africa, and South America, where G. arborea is grown in large plantations. Its low-density wood is durable and yields reasonable quantities of relatively uniform, stable, and light color pulp (Dvorak, 2004;Wee et al, 2012). The Panel of Experts on Forest Genetic Resources of the Food and Agriculture Organization (FAO) describes G. arborea as an important tree (India, Pakistan, and Bangladesh), and commercial plantations in Africa (Nigeria and Cameroon) and British Honduras (now Belize). These provenances were planted separately in >100 ha blocks, to provide a broad base for genetic improvement. More than 20 years later, seeds from this plantation were collected from healthy trees with desirable phenotypes, initiating its spread throughout the region.Breeding efforts of G. arborea in Costa Rica started in the early '90s, leading to the development of highly productive genetic stock for timber production at a regional scale ( Ávila Arias et al, 2014Arias et al, , 2015a,b),b). The most successful melina breeding programs in the region use clonal propagation to establish their commercial plantation, as this strategy provides a reliable stock of propagules that are easy to produce and plant and results in fast-growing trees and high productivity. Moreover, researchers have used variables such as trade volume and quality of wood and other indicators of each clone line's performance for the selection of the genetic stock to be planted in sites with different soil characteristics, flooding, and land use-history ( Ávila Arias et al, 2015a,b).Here, we describe fifteen microsatellite loci developed to support ongoing breeding programs of melina in Costa Rica using a small number of clones selected for their rapid growth and high productivity. These markers will be used for clone identification and potentially for marker-assisted breeding of G. arborea.The microsatellite markers were developed using the magnetic bead protocol described by Cullings (1992) and Li et al (1997) and modified by Glenn and Schable (2005). Genomic DNA from a sample of five G. arborea trees was digested using HaeIII/PshA1 restriction enzymes (Invitrogen; Carlsbad, CA). Two linkers were added to the digested genomic DNA (M28 5'CTCTTGCTTGAATTCGGACTA 3' and M29 5'pTAGTC-CGAATTCAAGCAAGAGCACA 3') and M28 was used as a primer for subsequent polymerase chain reactions (PCR). Finally, the digested genomic DNA was amplified in multiple PCR reactions and their product concentrated to gain enough DNA for the following bead hybridization process.Two arbitrary repeat motifs (CA20 and AG17) were selected as probes for the bead hybridization reactions based upon Cardle et al (2000). The short tandem repeat (STR) probes from Integrated DNA Technologies (Coralville, IA, USA) had a biotin label on the 5' end. The STR probes were added to a bead hybridization reaction to select for DNA fragments that contained the repeat motif of the probe. This bead hybridization process aimed to allow the fragments containing repeats to anneal to the biotin-labeled probes. After the hybridization, the selected fragments were isolated from the rest of the genomic DNA using streptavidin-coated magnetic beads, which bind to the biotin-labeled probes. These fragments were then eluted and re-amplified using the M28 primer in additional PCR reactions. The bead hybridization and PCR pre-amplification processes were repeated one more time to enrich for genomic DNA containing the selected repeats.After completing the bead hybridization and selection process, the repeat sequences enriched DNA was ligated into a pGEM-T vector from Promega (Madison, WI, USA) to begin the sequencing phase of this protocol. We cloned the vectors into electrocompetent Escherichia coli cells. We later plated transformed E. coli cells onto selective media containing 0.1 mg/mL ampicillin, 0.05 mg/mL X-Gal, and 1mM IPTG. All positive clones were sequenced on an ABI PRISM 377 DNA Sequencer using universal M13 forward (F) and reverse (R) primers (Schuelke, 2000). The sequencing reactions were standard 20 ml reactions using the ABI PRISM BigDye Terminator sequencing kits (Applied Biosystems, Foster City, CA, USA) and 3.2 pmol of PCR product for the template. Primers for each of the fifteen microsatellite loci were designed from sequences containing multiple copies of the repeated motif and with sufficiently long flanking regions on the 5' and the 3' end of the repeated region pairs using Primer 3.0 software (Rozen and Skaletsky, 2000).All primer pairs were tested for amplification and polymorphism using DNA obtained from 23 promising genotypes (clones) of G. arborea belonging to five different privately operated clonal breeding programs. Two ramets from each clone were gathered from a clonal collection maintained in a greenhouse at the Instituto Tecnológico de Costa Rica to validate all alleles by genotyping them separately. As described above (Doyle and Doyle, 1987;Lodhi et al, 1994), total genomic DNA was extracted at the Forest Molecular Genetic Laboratory, in the Forest Innovation Research Center (CIF) at the Instituto Tecnológico de Costa Rica, Cartago, Costa Rica. Copies of these clones are maintained in the mini clonal garden facility and could be made accessible upon request.Polymerase chain reactions were performed in a final volume of 15 µl, containing approximately 50 ng of genomic DNA, 10 mM Tris buffer, pH 8.0, 10 mM MgCl 2 , 0.2 mM dNTPs, 0.4 µM of each primer, and 1 U of Taq polymerase (Fermentas ® ) using an Eppendorf ® Mastercycler EP thermal cycler. The PCR program used included an initial step of 2 min of denaturation at 94 • C, 30 cycles of 15 s at 94 • C, 15 s at 55 • C and 30 s at 72 • C, and a final extension cycle of 1 min at 72 • C. To genotype each individual, we conducted electrophoresis for fragment separation using a QIAxcel Advanced fragment analyzer from QIAGEN ® at Centro de Investigación en Biología Celular y Molecular (CIBCM) at Universidad de Costa Rica. Once all of the data scorings were complete, random samples were re-amplified and re-ran to assess reproducibility and confirm scoring and allele sizes.GenAlex 6.3 (Peakall and Smouse, 2006) was used to calculate common indicators of genetic diversity, including the number of alleles (N a ) per locus and the expected (H e ) and observed heterozygosity (H o ). GenAlex was also used to calculate deviations from Hardy-Weinberg equilibrium (HWE) and linkage disequilibrium. Genotype errors due to stutter bands, allele dropout, and null alleles were estimated using the MICRO-CHECKER software (van Oosterhout et al, 2004).To examine the potential of these loci for discrimination among the 23 clones, the multilocus genotype of each clone was determined using the presence and absence of alleles to estimate genetic similarities for all pairwise comparisons among clones. Genetic similarity among each pair of clones was calculated based on the number of alleles common among the clones according to the following equation proposed by Dice (1945), where GSxy = 2a/(2a + b + c) , where a is the number of alleles common to clones x and y, b the number of alleles present only in clone x, and c the number of alleles present only in clone y. A cluster analysis based on sequential, agglomerative, hierarchical, and nested clustering methods (SAHN, UPGMA; NTSYS-pc-p package; (Rohlf, 1993) was conducted to describe the relationship between the clones.Table 1lists the loci names, corresponding accession numbers in Genbank, repeated motifs, forward and reverse primer sequences, the size range of PCR products, and annealing temperatures for each of the fifteen microsatellite loci isolated for Gmelina arborea. All loci were polymorphic, with the number of alleles per locus ranging from 2 to 7 (Table 2). We found 75 different alleles across all loci (Supplemental Table 1), with an average of 5.00 ± 0.41 alleles per locus. Average observed and expected heterozygosities were also high (H o = 0.504 and H e =0.645, Table 2). Moreover, our findings did not show evidence of scoring error due to stuttering or significant allele dropout for any of the fifteen polymorphic loci.Our analyses revealed significant deviations from Hardy-Weinberg proportion in most loci (Table 2). We observed heterozygote deficiencies in eleven loci and an excess of heterozygotes in one locus (Meldi-12; Table 2). However, given the small sample size used to validate these loci and the high number of alleles found in most of them, it is reasonable to expect that they will not be in Hardy-Weinberg equilibrium (HWE). Moreover, the clones used to validate these microsatellite loci do not represent a sample of a natural population of G. arborea, but a collection of promising genotypes selected by the timber industry. We also caution that two loci; namely, Meldi11 and Meldi11.2, which include different tandem repeats, were derived from the same sequence.Our analysis using the software MICRO-CHECKER did not reveal evidence for genotype errors due to stutter bands or allele dropout. Our analysis suggested the presence of null alleles in nine loci (Table 2), but such findings might result from a deviation from Hardy-Weinberg proportions. MICRO-CHECKER uses deviations of Hardy-Weinberg proportions to identify loci likely to have null alleles. We need to reiterate that our sample did not represent a natural population of G. arborea. For that reason, deviations from Hardy-Weinberg proportions are likely to occur in multiple loci.Our results also showed that all 23 clones exhibited a unique combination of alleles (Supplemental Table 1), resulting in genetic similarities (Dice) ranging from 0.36 to 0.83 (Figure 1). Overall, most of the clones clustered according to their origin or breeding program. All clones from programs PC and CA clustered together while some clones from programs MC, N, and T grouped with clones from the other programs.We described fifteen polymorphic microsatellite loci for the fast-growing timber tree Gmelina arborea. These new microsatellite loci proved to be very informative, accurate, and with a reliable discrimination power for assessing genotype identity. The process of allele validation provides confidence for utilizing this set of microsatellite loci for multiple purposes. Overall, we found high levels of allelic diversity, suggesting a broad genetic base in the original material from which these 23 clones were selected. We expected to encounter high genetic diversity among the clones used in this study because they represent a sample taken from collections of G. arborea selected by growers because of their performance. Moreover, the plantations where these clones were selected have different soil types, precipitation regimes, and topography.We found that all clones from two clonal breeding programs clustered together in the dendrogram (PC and AC; Figure 1). However, this is not true for clones from all breeding programs, as clones from the same program may not group in the same cluster. For example, clone T-27 did not cluster together with the other four genotypes in the same program (T-26, T-28, T-29, and T-30). Similarly, clones N-15 and MC-1313 did not group with the other trees from their program. However, clones from the same breeding program tended to group, suggesting that the process of selecting promising clones, based on what breeders considered desirable phenotypes, varies among breeding programs. Furthermore, this finding also implies that promising clone lines could perform well in a given environment. Therefore, it suggests that the degree of similarity of allelic composition among clones may indicate similarities in their ability to respond to environmental conditions.Ávila Arias et al (2014) conducted a field trial using different clone lines planted in two locations in southwestern Costa Rica. They found significant differences in diameter at breast height (DBH), commercial height, commercial volume of the trunk over bark, trunk quality, and the volume and quality of the wood among clone lines two years after planting. Their analysis also showed significant genotype by environment interaction in clonal performance, as some accessions grew well in their site of origin but not in other locations. Murillo-Gamboa et al (2016) reported differences in the tolerance to melina's wilt, a critical disease in Costa Rica, among clone lines used in the field trial conducted by Ávila Arias et al (2015b,a). These findings indicate that clone selection is biased toward genotypes performing well in particular environments, thus suggesting that genetic markers could play a role in identifying promising genotypes. In summary, the fifteen polymorphic microsatellite markers we described here have great potential use for the breeding of G. arborea, including genotyping the breeding collections, as well as keeping the identity and assessing the purity in clonal gardens. In this respect, there are eleven additional loci available to expand the multilocus genotype of each clonal line (Liao et al, 2010) to increase the possibilities for genetic analysis and marker-assisted selection of G. arborea.Hybridization between wild species and their domesticated relatives has been detected in multiple environments across the globe (Pierpaoli et al, 2003;Godinho et al, 2011;Goedbloed et al, 2013a). Invasive species and hybridized individuals compete with native populations, and cause negative impacts to biodiversity (Rhymer and Simberloff, 1996;Randi, 2008;Harrison and Larson, 2014). Invasive pigs are known to successfully disperse in wild environments and cause considerable impact on the gene pool of native wild boar populations (Vernesi et al, 2003;Koutsogiannouli et al, 2010;Goedbloed et al, 2013b). Multiple countries have implemented management programs to reduce wild boar population expansion (Waithman et al, 1999;Scandura et al, 2008;Saito et al, 2011), but hybrid individuals may have increased litter sizes, aggression, and growth rates (Goedbloed et al, 2013b;Dzialuk et al, 2018). Areas of suspected hybridization between invasive pigs and wild boar populations should be continuously monitored to understand the extent of introgression of pig genes in the wild boar gene pool.Microsatellite marker analysis is a well-established monitoring tool to evaluate possible introgression of invasive species and hybridization detection (Nijman et al, 2003;Randi, 2008;Uemura et al, 2018). The selection of reliable microsatellite markers by optimizing amplification protocols prior to monitoring a target population is of great importance because it has consequences for subsequent genotyping (Hoffman and Amos, 2005; Kolodziej et al, 2012). However, genotyping hybrid individuals (e.g. crossed pig and boar) can be challenging due to common or shared alleles at multiple loci (Larson et al, 2005;Grossi et al, 2006;Choi et al, 2014) and it is necessary to select suitable loci with lineage specific alleles for hybridization detection. Validating appropriate microsatellite markers with possible hybridized wild boar and the pigs involved in the hybridization will provide the necessary genetic composition data to develop a cost-efficient monitoring tool to evaluate the introgression of pig genes to the wild boar gene pool. Such cost-efficient analyses have provided monitoring opportunities to estimate abundancy of hybrids (Qi et al, 2010;Matsumoto et al, 2019), population characteristics (Goedbloed et al, 2013a;Sharma et al, 2013) and local genetic structures (Tadano et al, 2016;Touma et al, 2020) in animals.Genetic diversity and ancestry of wild boar have been well studied, including areas of South East Asia, and information from hybridization occurrences with domestic pigs is of increasing interest due to possible genetic alterations (Choi et al, 2014;Todesco et al, 2016). Wild boar populations inhabiting Fukushima prefecture, in Japan, are suggested to be threatened by hybridization following the uncontrolled release of domesticated pigs after mandated evacuations due to the Fukushima nuclear disasters in 2011 (Okuda et al, 2018;Anderson et al, 2019). Additionally, hybridization in this area has not altered the morphological characteristics of wild boar (Anderson et al, 2019) and possible hybrids can only be detected using DNA. Thus, estimating appropriate genotypes of wild boar from the period prior to 2011, after 2011, and from domestic pigs in this area, with microsatellite markers will provide an important source of information for better understanding hybridization effects with native species following such events. Adequate selection of microsatellite markers from this area will establish a cost-efficient tool to easily distinguish if a wild boar population has been impacted by hybridization.In this study, we selected robust microsatellite markers used in European and Asian pig studies (Rohrer et al, 1994;Krause et al, 2002;Karlskov-Mortensen et al, 2007;FAO, 2011) that could differentiate wild boar or pig alleles. Our goal for this study was two-fold: First, we aimed to select useful microsatellite markers for hybrid analysis between domesticated pig and wild boar populations; and second, to use these loci to perform a preliminary check of the introgression of pig alleles into wild boar populations in Fukushima prefecture following the disasters in 2011.Thirty-one muscle tissue samples were collected from three populations (hereafter referred to as Pop1, Pop2 and Pop3) and were selected based on mitochondrial DNA (mtDNA) haplotype and year sampled. Sample haplotype and date were prioritized for optimal determi-nation of reliable microsatellite screening of hybridization between wild boar and domesticated pigs after the Fukushima disasters in 2011. Pop1 samples were from 10 unrelated domestic pigs (Sus scrofa domesticus) that were collected from a local pig slaughterhouse or local markets within Fukushima prefecture in 2016-2017. Pop2 samples were from 13 wild boar (Sus scrofa) muscle samples that were collected in 2003-2004, prior to the evacuations and Fukushima disasters, from a wild boar population in northern Ibaraki prefecture, south of Fukushima prefecture. The mtDNA analysis has shown that this population is the same haplotype (D42172) and has extremely high genetic similarity to the wild boar population in eastern Fukushima prefecture (Nagata et al, 2006). Pop3 samples were collected in 2015-2016, after the Fukushima disasters, from eight suggested hybridized wild boar that had a typical mtDNA haplotype of pig (suggested pig ancestor in maternal lineage; MK801664, see Anderson et al (2019)). All animals were legally culled by licensed hunters, and this entire study was approved by Fukushima University's Institutional Animal Care and Use Committee. All experiments were performed in accordance with relevant guidelines and regulations. All samples were stored individually at −20 • C in 99.5% ethanol until extraction. Total genomic DNA was extracted from muscle tissue using the Gentra Puregene Tissue Kit (QIAGEN), according to manufacturer's instructions.A total of 52 unlinked microsatellite loci were selected from previously developed phage libraries (Rohrer et al, 1994;Krause et al, 2002;Karlskov-Mortensen et al, 2007) and recommended microsatellite markers from the Food and Agriculture Organisation of the United Nations database (FAO, 2011) and screened for amplification success on all 31 samples.PCR amplification was performed in 5 µL reactions using the QIAGEN Multiplex PCR Kit (QIAGEN) and a protocol for fluorescent dye-label (Blacket et al, 2012). Each sample reaction contained 10 to 20 ng of genomic template DNA, 2.5 µL of Multiplex PCR Master Mix, 0.1 µM of forward primer, 0.2 µM of reverse primer, and 0.1 µM of fluorescently labeled primer. Amplification conditions consisted of 95 • C for 15 minutes followed by 33 cycles of denaturation at 94 • C for 30 seconds, annealing at 57 • C for 1.5 minutes, and extension at 72 • C for 1 minute and an extension at 60 • C for 30 minutes. All thermal cycling conditions used in T100 thermal cycler (Bio-Rad Laboratories, Inc., Hercules, CA, USA). Product sizes were determined using an ABI PRISM 3130 Genetic Analyzer and GeneMapper software (Applied Biosystems, Foster City, CA, USA).Successful markers were identified after our initial screening by clear peak patterns following amplifications. Number of alleles (N A ), observed heterozygosity Hardy-Weinberg equilibrium (HWE) for polymorphic loci were tested using FSTAT version 2.9.3 (Goudet, 1995). Allele frequency in each locus for Pop1, Pop2, and Pop3 was calculated using GenAlEx version 6.41 (Peakall and Smouse, 2006). Genetic differentiation among Pop1, Pop2, and Pop3 (i.e. differentiation among pig, wild boar, and hybrids) was evaluated using AMOVA, calculating pairwise codominant genotypic distances (Smouse and Peakall, 1999), and performing principal coordinates analysis (PCoA) using GenAlEx version 6.41 (Peakall and Smouse, 2006).Of the initial 52 microsatellite loci selected, 32 loci were successfully amplified with all wild boar and pig samples. Marker information is provided in Table 1.Twenty loci were eliminated based on low amplification success or unclear peak patterns in wild boar DNA samples collected from Pop2 and Pop3. Polymorphism measurements for the 32 amplified microsatellite loci in Pop1, Pop2, and Pop3 are summarized in Table 2. For Pop1, H O and H E per locus ranged from 0.10 to 1.00 (mean, 0.64) and from 0.10 to 0.82 (mean, 0.65), respectively. The range of F IS was -0.46 to 0.47 (mean, 0). For Pop2, H O and H E per locus ranged from 0.00 to 0.77 (mean, 0.36) and from 0.00 to 0.73 (mean, 0.39), respectively. The range of F IS was -0.28 to 0.85 (mean, 0.07). For Pop3, the H O and H E per locus ranged from 0.00 to 0.88 (mean, 0.45) and from 0.00 to 0.76 (mean, 0.44), respectively. The range of F IS was -0.62 to 1.00 (mean, -0.01). All 32 loci showed no evidence of significant deviation from HWE (P > 0.05). In total, 231 putative alleles were identified that ranged from 1 to 8 per locus (mean, 4), as outlined in Table 2 (No. alleles). The mean number of alleles was 5. 1,3.2,and 3.3 for Pop1,Pop2,and Pop3,respectively. Of the 231 alleles, 52 (23%) were putative to the wild boar populations and 95 (41%) were putative to domestic pigs (Table 3). Additionally, 68 (30%) alleles were shared by pigs and one of the wild boar populations or by all three populations. Among the 68 shared alleles, 21 were shared by pigs and the wild boar population from the period after the Fukushima disasters in 2011 (bolded alleles in Table 4), indicating introgression of pig genes into the wild boar gene pool. The allele frequencies of amplified microsatellite markers, including those that distinguished these shared alleles between Pop1 and Pop3, are provided in Table 4. AMOVA suggested strong genetic differentiation between the three populations (F ST = 0.318, p < 0.001). Genetic differentiation is also well-supported by clear divisions among the three populations with PCoA (Figure 1). Pop1 is uniquely distinguished along the first axis and Pop2/Pop3 are distinguished along the second axis. Furthermore, codominant genotypic distances describe 35.40% and 7.4% of the variation with the first and second axes, respectively. Taken together, our data strongly indicate genetic differentiation of pigs, wild boar from the period prior to, and after, the disasters in Fukushima in 2011.All 32 loci selected from previous studies (Rohrer et al, 1994;Krause et al, 2002;Karlskov-Mortensen et al, 2007;FAO, 2011) showed pig putative alleles suggesting they can be useful for wild boar and pig hybrid analysis in Fukushima and elsewhere. The presence of pig-specific alleles at certain loci depends on the genetic composition of the target population and the pig population involved in the hybridization. In this study, pig samples were from slaughterhouses and farms nearby the evacuated area to improve the likelihood of detecting newly introgressive pig alleles in the hybridized wild boar. One of the pigs sampled had the mtDNA haplotype that was the same as hybrid wild boar in Fukushima (Anderson et al, 2019), and the sampled pig population in this study had high genetic variation (mean N A = 5.1). Therefore, we were confident in the representation of the pig genetic composition involved in the hybridization for this study and were able to distinguish an appropriate set of markers for hybrid analysis. Our selective use of markers with low frequencies of common alleles in source pig individuals and target wild boar populations is highly suggested for cost-effective analysis.The highest number of alleles was observed in the pig population, which was expected because of human mediated translocations of domestic populations with high genetic diversity (Scandura et al, 2008;Yang et al, 2017). Additionally, if the 95 pig putative alleles were excluded, then 27% of the detected alleles were shared by all three populations in this study (Table 3). The high percentage of shared alleles between pig and wild boar verifies the challenge of identifying appropriate markers for hybridization analysis.Seventeen of the 32 microsatellite loci distinguished hybridization between pigs and wild boar in this study and these can be used as robust markers, specifically for wild boar populations in Fukushima. These seventeen markers detected at least one of the 21 alleles that were only shared between Pop1 and Pop3 (bolded alleles in Table 4). Alleles only shared by Pop1 and Pop3, and not detected in Pop2, would suggest that the alleles were introgressive through mixing of pigs and wild boar during the period after the 2011 evacuations and Fukushima disasters. The higher percent of total shared alleles between Pop1 and Pop3 (9%), compared to Pop1 and Pop2 (4%), indicates that there is likely more genetic mixing between Pop1 and Pop3 (Table 3), which would also support the hypothesis of hybridization occurring after disasters in 2011. The loci identified in this study (Table 4) provide a unique tool to contribute to determining a timeline of hybridization for these populations. Similar frequencies of pig alleles in other wild boar populations may suggest early stages of hybridization, as our data indicates recent occurrence of hybridization in Fukushima prefecture, following the release of domestic pigs into the wild boar populations in 2011 (Okuda et al, 2018). Additionally, the identified loci can contribute to determining if the introgressive alleles are being retained or lost due to natural causes (e.g. backcross) in the hybridized wild boar population using introgressive allele frequencies over time.Studies have been published to determine wild boar and pig hybridization hotspots, recent occurrences, and genetic impacts using variable genetic markers, such as mtDNA sequence (Ishiguro et al, 2002;McCann et al, 2014), RAD-seq analysis (Goddard and Hayes, 2007;Iacolina et al, 2018) or microsatellite markers (Murakami et al, 2014). However, Next Generation Sequencing (NGS), such as RAD-seq, have disadvantages including that a large amount of high quality DNA is required, and the amount of data to be analyzed becomes demanding. Therefore, general genetic markers, such as microsatellite markers, are still useful for analysis of degraded DNA extracted from feces in the field and old specimens of bones (Kierepka et al, 2016). Selected robust markers from our study will show their advantages in future hybrid analysis and are cost-effective for immediate or continuous monitoring for small sample sizes or DNA analysis of degraded samples. Also, comparing NGS and microsatellite marker data from a common population in future studies will not only give more indepth information about that target population, but will more clearly show the advantages and disadvantages of each marker. Indigenous chicken (IC) contribute considerably to the rural farmers' livelihood by providing excellent animal protein (Gebreselassie et al, 2015). Though these birds are predominant in most Rwanda households, their production and genetic potential have not been fully * Corresponding author: Richard Habimana (hrichard86@yahoo.fr) exploited (Padhi, 2016). Low genetic potential and high occurrence of diseases like Newcastle disease (ND) are among the main features affecting IC productivity in the tropics (Lwelamira and Katule, 2005). Despite their low egg productivity and growth rate (Mbuza et al, 2016), they have a prodigious potential to improve rural livelihoods (Ministry of Agriculture and Animal Resources (MINAGRI), 2012).Growth identified as an increase in weight, length and height with age (Aggrey, 2002;Yang et al, 2006) is very significant in any IC production systems. An improvement in this trait is expected to have a countless positive impact on farmers livelihoods (Magothe et al, 2010). Several mathematical functions are used to describe growth and provide biologically interpretable parameters. In order to estimate the growth of chicken, growth models coupled with fitted longitudinal experimental data are used. The most growth models frequently used are nonlinear functions (Mignon-Grasteau and Beaumont, 2000;Hyánková et al, 2001;Karkach, 2006;Ndri et al, 2018). The nonlinear models have been utilized because of their several advantages, which include describing weight per age (Hyánková et al, 2001), and estimating the association between body weight and feed requirement (Fiengül and Kiraz, 2005). The growth curve parameters determined by the nonlinear models are used to decide the appropriate age whereat to select chicken and to design management approaches for breeding (Fiengül and Kiraz, 2005).Growth performance is influenced by genes and management practises, especially nutrition and health (Mwalusanya et al, 2002;Gondwe and Wollny, 2005;Dana et al, 2010). Newcastle disease (ND) is among the most severe problems encumbering IC growth performance in Rwanda (Mazimpaka et al, 2018). Newcastle disease, which affects many bird's species globally is brought about by single-strand, nonsegmented, negative-sense RNA virus also called Avian paramyxovirus 1 (APMV-1) (Cattoli et al, 2011). This disease is an issue of great concern to the farmers because its outbreak can cause a high economic loss of up to 100% flock mortality. Newcastle disease has no effective cure. The spread of this virus is, however, contained by appropriate management strategies such as vaccination (Alexander, 2001). The possibility of eradicating this avian disease currently is completely questionable. This is because pathogen virulence, which renders the vaccine ineffective increases with time. Consequently, requiring new vaccines to be developed (Witter, 1998). Although new vaccines lessen ND epidemics, frequent research to develop the vaccine makes the strategy expensive. Breeding using indirect selection for the development of immunological response trait is, therefore, the best long-term strategy for mitigating diseases (Gavora et al, 1983); in this case, immune response trait will be used to develop IC breeds with a high-level of biosecurity (Padhi, 2016).Although body weight and disease tolerance are the highly preferred traits by poultry farmers (Banerjee, 2012), in Rwanda there is no established structure for breeding programmes, nor for genetic improvement, nor for conservation (Mahoro et al, 2018). In an effort to improve genetic potential through within breed selection of IC in Rwanda (Shapiro et al, 2017), preliminary studies have been conducted (Mbuza et al, 2016;Mahoro et al, 2017;Hirwa et al, 2019;Habimana et al, 2020). Research on the morphological characterisation of IC ecotypes showed a very huge variation among IC in Rwanda (Hirwa et al, 2019). Subsequently, a study on genetic diversity and population structure unveiled the presence of four different gene pools among IC in Rwanda (Habimana et al, 2020). There is, however, no information on the diversity in growth performance and immune responses to ND among those four gene pools. Availability of such information would be necessary for designing breeding strategies for increased IC productivity in Rwanda. Increasing IC performance would contribute towards improved food security and secure livelihoods. This study aimed at evaluating the growth performance and ND immunity of IC among four gene pools in Rwanda.This study was conducted in line with the principles of the Declaration of Helsinki. Approval was granted by the Research Screening and Ethical Clearance Committee of the College of Agriculture, Animal Sciences and Veterinary Medicine, University of Rwanda (Ref: 031/19/DRI September 2, 2019).The study was carried out on-station at the University of Rwanda-Nyagatare campus in Nyagatare district, Rwanda. The coordinates of the area of study are 1 • 18' 0.00\"S, 30 • 19' 30.00\"E (Latitude: -1.3000; Longitude: 30.3250). The location of study is characterized by two main seasons: one long dry season that varies between 3 and 5 months with an annual average temperature varying between 25.3 • C and 27.7 • C. The monthly distribution of the rains varies from one year to another. Annual rainfalls are very low (827mm/year) and unpredictable to satisfy agriculture and livestock needs.Indigenous chickens were selected from four gene pools previously identified (Habimana et al, 2018). These gene pools are distributed across the five agro-ecological zones in Rwanda, which are Central North and North West, South West, South West and Central South and East. The aforementioned gene pools were designated as letters A, B, C and D, respectively.Seven hundred and twenty (720) fertile eggs were collected from four IC gene pools previously identified (Habimana et al, 2018) and only 707 eggs were viable to be incubated. Eggs were concurrently incubated but separated based on gene pool within the incubator (LDG-1200). After 21 days, 189-day old chicks were obtained from hatch (Table 1). Each chick was weighed, wing tagged with an identification number, and allocated into a house with four equal compartments (5m x 3m for each one). Brooding of chicks was done from hatching to week six (Ngeno et al, 2010;Sayed et al, 2016), in deep litter brooders containing infrared electric bulbs (230V, 250W). Initial brooding temperature, at the level of the chicks, was 36 to 35 • C and reduced by approximately 2 to 3 • C per week until 21 • C was reached. The IC gene pools were reared in different brooders. All birds were kept under the same environmental conditions and management practices. Feeds were provided ad libitum on a starter diet (20% crude protein and 12.9 MJ ME /kg diet) for the first six weeks and a growing diet (16.8% crude protein and 12.5 MJ ME /kg diet) from the 7 th to 20 th week. Clean water was provided daily ad libitum. Disinfection of the brooding and rearing pens was done procedurally. The IC were then immunized with two commercial ND virus live vaccines, which were AVI ND HB1 in drinking water at 2 days of age and AVI ND Lasota (Intervet International B.V., Boxmeer, Netherlands) by eye drop at 28 days of age according to manufacturer's instructions. At 7 days after the second immunization (35 days of age) as per the protocol outlined by Al-Garib et al (2003), blood samples were collected without anticoagulant for separation of sera to detect the titre of antibody against ND vaccine. The Ab responses to ND were detected using indirect ELISA (ID Screen ® Newcastle Nucleoprotein Indirect Version 2, IDvet, Grabels, FRANCE). The IDSoft TM data analysis programme was used to compute the Ab titres.Descriptive statistics were generated using the SAS Generalised Linear Models procedure (SAS Institute, 2011). Body weights and Ab response were subjected to analysis of variance (ANOVA) with gene pools as the main variable in a completely randomized design and fixed effects model (Equation ( 1)). For the analysis of body weight at hatch, egg weight was fitted in the model as a covariate, whereas in other ages; body weight at hatch was also fitted as a covariate. Tukey's test was used for means separation between gene pools.where: Y ijk : record of k th chicken at particular age from i th gene pool with j th sex, µ: overall mean;G i : fixed effect of i th gene pool; S j : fixed effect of j th sex; (GS) ij : interaction between gene pool and sex; e ijk : random error.The analysis of longitudinal growth data was performed using non-linear regression. The following logistic regression model (Equation ( 2)) using PROC NLIN of SAS (SAS Institute, 2011) was fitted to get growth curve parameters (a, b and k).where: y t : live weight at age t, a: asymptotic or mature weight, b: scaling parameter, k: maturity index and t: age in weeks. Body weights (BW) from hatch to 20 weeks of age among the four gene pools of IC in Rwanda are presented in Figure 1. The mean BW were significantly different (p < 0.001) across gene pools from week 0 to week 20. At hatch, gene pool A and B had the highest body weight (29.63±3.78 and 29.78±3.69g, respectively) and the lowest BW (24.29±3.39g) was recorded in gene pool C. At week one, Gene pool D and A exhibited higher BW (58.24±10.70 and 62.94±11.59g, respectively) followed by gene pool B (55.95±7.79g). At week 2, gene pool A showed the highest BW (116.32±27.73g) and gene pool C exhibited the lowest BW (87.51±24.06g). At week three, gene pool A showed the highest BW (208.19±56.16g) followed by gene pool D (170.69±43.43g) and the lowest BW was recorded in gene pool C (140.40±37.49g). During the remaining rearing period, the trend observed in week 3 was maintained.The least-square means of the growth parameters (a, b and k), coefficient of determination (R 2 ) are given in Table 2. The fitted parameters for the logistic model revealed a significant gene pool effect (P < 0.001) in the asymptotic weights (a), scaling parameter (b) and the maturity index (k). The lowest for these parameters were found for gene pool C.Antibody titres to Newcastle disease were statistically different (p < 0.001) across the gene pools. Gene pool C was found to be significantly higher in Ab titre for the ND virus vaccine (8,161). Lower Ab titre to ND vaccine was recorded in gene pool A (4,879) (Table 3). This experiment compared the growth performance of four gene pools of IC in Rwanda. The results of this study showed the existence of a large variation in growth between the four IC gene pools in Rwanda.Growth is a quantitative trait that is influenced by genes and production environment such as health and nutrition (Mwalusanya et al, 2002;Gondwe and Wollny, 2005;Dana et al, 2010). Since the IC were kept under the same environmental conditions in this study, the witnessed differences between the IC gene pools could result in genetic diversity among these IC populations. In addition to that, gene pool A and gene pool C are morphologically different (Hirwa et al, 2019). These results affirmed the previous study undertaken on IC genetic diversity and population structure using microsatellite markers in Rwanda (Habimana et al, 2020). The difference in growth performance of four gene pools is due to the difference in feed conversion efficiency (FCE), with heavier gene pool having higher FCE and perhaps due to smaller maintenance requirements (Tadelle et al, 2003). Feed conversion efficiency is normally influenced by the climate, feed properties, gut microbiota and genetic predispositions (Reyer et al, 2015). In this situation where the IC were kept under similar environment, the difference in FCE is likely due to their genetic constitution. Indigenous chickens in the tropics have major genes which affect their performance (Ibe, 1993).There are typically a big number of genes involved in growth which leads to differences in BW. These genes can be activated or deactivated at different stage depending on the development of the genetic background of the IC (Rouzic et al, 2008). Certain genes regulating BW in gene pool A are not found in gene pool C. This occurrence is attributed to mutations and recombination, which are the most important factors responsible for the genetic variances between breeds and populations of chicken (Weigend and Romanov, 2001). The significant differences observed between gene pools in this study for BW measured were confirmed also in Ethiopia (Tadelle et al, 2003;Dessie andOgle, 2001), Tanzania (Msoffe et al, 2001), Zimbabwe (McAinsh et al, 2004), Botswana (McAinsh et al, 2004), Kenya (Ngeno et al, 2010(Ngeno et al, , 2013(Ngeno et al, , 2014) ) and Bangladesh (Bhuiyan et al, 2011). These differences among IC gene pools enable selection of parent lines for practical IC breeding (Ngeno et al, 2010), which results in their genetic improvement (Li et al, 2002). The growth rate among gene pools varied for the first three weeks. Thus, their ranking was not consistent. This implies that a gene pool by age interaction occurred. For this reason, a constant criterion cannot be used in genetic selection for BW between the gene pools. The genetic relationship between immature BW and age when selection decisions are made and desired matured weight may not be the same for different gene pools. There was an increase in the BW measurements during the birds' maturity period, demonstrating a direct positive relationship between BW and age. This was confirmed by the observed differences in growth curve parameters among the gene pools. This result agrees with previous reports from Nigeria (Ojedapo, 2013), Ethiopia (Tadelle et al, 2003) and Kenya (Ngeno et al, 2010(Ngeno et al, , 2013)).Growth parameters were also determined to obtain a better description of the growth performance of Rwandese IC gene pools. The overall coefficient of determination (R 2 = 0.964) was high in this study, demonstrating the sufficiency of the model in fitting and describing growth data effectively. The objective of a curve fitting was to describe body weight increase in respect to age using equations with few parameters (Ricklefs, 1985). Curve parameters provide information on growth characteristics (Ndri et al, 2018) and can be used for pre-selection (Eleroǧlu et al, 2014). Growth curve patterns have been performed to increase the performance of domestic poultry. Growth parameters are also heritable (Mignon-Grasteau and Beaumont, 2000). Selection approaches have been used to change the shapes of growth curves, leading to quick growth in poultry (Hyánková et al, 2001;Maruyama et al, 2001). In addition, a detailed understanding of growth characteristics will contribute to design feeding schemes to minimise production costs while maximising production efficiency of IC.The findings showed that all IC had good immunity ranging from 4,879 to 8,161 (> cut-off: 993), but the chickens in gene pool C had a comparatively higher immunoglobulin titre against ND than the others (p<0.05) (Table 3). The high Ab found in the gene pool C may have resulted from their genetic makeup. Genetic diversity in Ab responses of the chicken could be due to the major histocompatibility complex (MHC) (Lwelamira et al, 2008), immunoglobulin allotypes, and to genes not associated with either MHC or allotypes (Gavora et al, 1983). This result complements Palladino et al (1977) study, which showed a quantitative variance between Ab responses. The Ab response to the similar virus varies between IC populations (Pitcovski et al, 2001) and selection for an Ab response may increase disease resistance in chicken (Gross et al, 1980). The levels of Ab in appropriate response to a pathogen is known as immune competence; the higher the levels, the greater the immune competence (Star et al, 2007). A standard immune response to a pathogen results in a disease resistance. This aptitude plays a key role in controlling disease occurrences (Lamont et al, 2009). The reduction of disease outbreaks contributes to increased animal production and profitability (Wakchaure and Ganguly, 2016). This result on significant differences between gene pools for Ab responses to ND virus concurs with previous reports, (Hassan et al, 2004;Chang et al, 2011;Taha et al, 2012) A noticeable trend observed in this research was that gene pool A, the heaviest had a low ND Ab titre, while the slowest growing gene pool C had the highest ND Ab titre, reinforcing the negative genetic correlation between BW and Ab response (Martin et al, 1990;Parmentier et al, 1998;Siegel et al, 2009). The negative correlation between BW and Ab response is caused by pleiotropic effects between genes associated with immunoresponsiveness (Martin et al, 1990). The negative relationship between Ab production and BW occur as a result of resources allocation to immune responses rather than growth (Hassan et al, 2004;Dunnington and Siegel, 1996). Increasing Ab response consumes large quantities of energy that the IC could have used in increasing the BW (Rauw, 2012). An animal, as an entire organism, has various physiological functions which may be competitive for its inadequate resources during its lifetime (Lamont et al, 2009). Protein secretion in antibodies and protein deposition in muscle compete for the restricted accessible nutrient resources (Hassan et al, 2004). To achieve a delicate equilibrium of optimal productivity and immunoresponsiveness, knowledge of the nutrient requirements of an activated immune system with respect to individual genes regulating protein synthesis in lymphocytes and muscle tissue is needed (Lamont et al, 2009).The existence of diversity in body weight and immune response to ND among gene pools of IC populations in this study is attributed to the geographical isolation and eras of artificial and natural selection. Earlier studies in Rwanda (Habimana et al, 2018), Senegal (Missohou et al, 1998); Ethiopia (Halima et al, 2007) and results by Hauser et al (1995) reported that ecological zones lead to the establishment of population traits with probable variations in genetic effect. This also confirms the genotype by environment interaction (GxE) revealed in previous studies (Mathur and Horst, 1994;James, 2009;Lwelamira, 2012). The genetic variances observed in these different gene pools could be utilised in crossbreeding programmes targeting IC with better growth performance and higher immunoglobulins against the ND virus. Consequently, gene pools A and C could be considered.This study revealed that gene pool A was the heaviest and the gene pool C expressed the highest immune response for Newcastle disease vaccine. This research work provides the basis for choosing a suitable IC gene pool for breeding programme. From this result, it was evident that the selection of gene pool A in breeding would yield IC with good growth performance trait whilst gene pool C could be selected for its higher immunity against Newcastle disease. For further studies, there is a need to contemplate diversity in egg production and other important poultry's diseases among IC gene pools in Rwanda. Besides, with regard to immune response, immunoglobulins Y (IgY), M (IgM) and possibly A (IgA) should be examined separately across IC gene pools in Rwanda.Research related to forage genetic resources at the International Center for Tropical Agriculture (CIAT), Cali, Colombia, has been a continuing activity since the inception of the center in 1969. CIAT was the third of the international agricultural research centers established within the Consultative Group on International Agricultural Research (CGIAR), one of its missions being the development of beef cattle production in the lowlands of tropical America (Lynam and Byerlee, 2017). When looking at the development of the CIAT forages collection and its achievements, two phases can be distinguished: the first phase focused on assembling the collection and some initial, however intensive, characterization and utilization of the collected materials (1972−1993); and the second phase consisted of continuing utilization of germplasm, diversity studies and routine germplasm management and its optimization (1993−2020).This paper summarizes the assembling of the collection during the first phase as well as its utilization and germplasm distribution. Furthermore, research on forage diversity and knowledge sharing, including training, are addressed. Data presented were compiled mainly from information accessible via the CIAT website (https://ciat.cgiar.org/), CIAT annual reports (accessible at https://cgspace.cgiar.org/handle/10568/ 35699), unpublished reports on germplasm collecting missions, research bulletins of CIAT´s national partner institutions and the like.It should be noted that in the past years there have been changes in plant nomenclature for numerous taxa of particular interest, even at the genus level (Cook and Schultze-Kraft, 2015). In this paper we are still referring to the earlier used names. Supplemental Table 1 lists new names of species mentioned in this report, following the taxonomy of GRIN, the database of the USDA Genetic Resources Information Network (https://npgsweb.ars-grin.gov/gringlobal/ taxon/taxonomysearch).At the beginning of research at CIAT in the early 1970s, a focus of the then Beef Production Systems Program was forage-based livestock production on acid, low-fertility soils in humid and sub-humid lowlands of tropical America, particularly savanna areas. The lack of edaphic adaptation of available, mainly Australian commercial pasture grass and legume cultivars, was soon identified as the main constraint to their use in Neotropical savannas. In the case of legumes, diseases, such as anthracnose in the promising genus Stylosanthes, were an additional restriction. It was consequently recognized that available species and genotype pools of grasses and legumes needed to be broadened for screening for adaptation to abiotic (mainly soil) and biotic (pests and diseases) constraints.Missions were thus initiated in 1972/73 to collect germplasm of wild species with forage potential throughout tropical America. The objective was to create a diverse germplasm pool that can be tapped for cultivar development, either by identifying suitable accessions for direct use or through genetic improvement. These collecting missions ranged from short excursions, particularly within the Center´s host country, Colombia, to field expeditions over several weeks. Another source of germplasm material was through opportunistic collecting undertaken by CIAT scientists during field visits. The missions were largely funded by CIAT, at the beginning of the collecting phase, also with support from the former International Board for Plant Genetic Resources (IBPGR; later International Plant Genetic Resources Institute (IPGRI), now part of the Alliance of Bioversity International and CIAT). There was a focus on acid-soil regions and plant genera of known value. Emphasis was on legumes, in many cases including associated rhizobia, taking into account that the Neotropics are the main center of diversification of the Fabaceae (Leguminosae) family. The particular value of legumes lies in their ability of symbiotic fixation of atmospheric nitrogen and the subsequent provision of protein-rich forage to livestock.From 1979 onwards, collecting missions within the new Tropical Pastures Program expanded to Southeast Asia, a minor yet important center of legume diversification (e.g. the genera Pueraria and Desmodium), and in 1984/85 and 1989 also to Africa, with focus on grasses (particularly the genus Brachiaria). The latter took into account that Sub-Saharan Africa is the main center of diversification of those genera with forage potential in the Poaceae family.All missions were organized as joint ventures in association with national research institutions. Table 1 provides an overview of the countries where the collecting efforts were undertaken; the main genera collected are summarized in Table 2. The germplasm collectors who participated in the missions are acknowledged in Supplemental Table 2.Alongside the collecting activities, the introduction of germplasm in the form of donations from existing collections held by national and international research and development (R&D) institutions around the globe has been an ongoing activity since the inception of the CIAT forages collection. It became the sole source of additions to the collection, when germplasm collecting with the involvement of CIAT scientists came to an end in the 1990s. A total of more than 9,000 accessions were received as donations; among them, in 2006, a significant part of the former Australian Tropical Forages Collection of CSIRO (Commonwealth Scientific and Industrial Research Organisation) (Table 3).Two factors contributed to the cessation of collecting missions: (1) a sustained decline in funding for tropicalforages research and ( 2) the fact that hardly any tropical-forage species are included in Annex 1 of the International Treaty on Plant Genetic Resources for Food and Agriculture (ITPGRFA; FAO, 2001), which streamlines germplasm distribution through the use of a Standard Material Transfer Agreement (SMTA). Instead, most tropical forage species are regulated by legal frameworks that require case-by-case negotiations of individual material transfer agreements, which would create unmanageable legal overheads given the frequent germplasm exchange in agricultural research.With more than 22,000 accessions from a total of 75 countries of origin, the CIAT collection is the largest tropical forages germplasm collection worldwide. Its particular value lies in its focus on: (1) plants adapted to acid, low-fertility soils; (2) legumes; and (3) the large and diverse collection of Brachiaria. This grass genus comprises currently the economically most important tropical forage species worldwide. The CIAT Brachiaria collection stems mainly from the Center´s collecting activities in the 1980s in East Africa and has become an important source of germplasm for selection and breeding programs throughout the tropics.It is recognized that there are still important gaps in terms of countries and regions where germplasm has been collected. The collection is likely far from being representative of the geographic diversity of tropical Poaceae and Fabaceae (Leguminosae).Table 4 provides a summary of the current tropical forages collection conserved at the CIAT genebank. Differences of numbers in Table 4 in comparison with Tables 2 and 3 are due to initial misidentifications and losses of accessions due to a range of reasons, including a limited number (or low viability) of collected seeds, lack of seed setting in the environments available for regeneration, and insufficient funds for regenerating large numbers of accessions between the 1990s and the launch of the CGIAR Research Program on Genebanks in the 2010s. As a result of the germplasm evaluation and selection research conducted by CIAT and its partners, a number of grass and legume accessions that had been provided by the CIAT forages collection were developed into cultivars by national R&D institutions worldwide, in a few cases after incorporating them in national breeding programs (Table 5). Several issues should be pointed out:• In relation to cultivars selected from genebank accessions, formal release and/or registration has been and is the exclusive responsibility of national institutions. In the case of bred lines developed at CIAT (not included in Table 5), cultivar release/registration is done by the private sector, with authorization by CIAT. • Some cases are mentioned where CIAT accessions were adopted by end users without a formal and documented cultivar release; the real number is probably much higher. On the other hand, it is most likely that not all released cultivars were or are actually used by farmers to a major extent. The use of materials from tropical forages genebanks is further discussed by Hanson et al (2020) and Duncan et al (2020) unlike the other countries where CIAT-coordinated network evaluations were instrumental for selection and release, adoption in Brazil was an entirely CIAT-independent process. • Brachiaria spp. accessions that were used by CIAT internally to produce Brachiaria breeding lines and from which hybrid cultivars were developed by globally operating seed companies (Grupo Papalotla, Dow AgroSciences) within public-private-partnership (PPP) agreements, are not included either. Information on those hybrid cultivars (e.g. 'Mulato', Mulato II', 'Cayman', 'Cobra', 'Camello') is available in Cook et al (2020). • Table 5 also provides information on the timespan between germplasm acquisition (collection or introduction) and cultivar release.In the early 1990s, CIAT gradually changed its germplasm utilization research priority from development of grass/legume pastures for acid soils to selection of multipurpose plants for smallholders. This adjustment took into account the need for forage plants to maintain and restore soil fertility, including in mixed (crop-livestock) production systems, and to contribute to increased small-farmer livelihoods. Since 2006/07 the research focus of the CIAT Tropical Forages Program was further refined and includes the adaptation of forages to climate change and their potential contribution to ecosystem services, including the mitigation of greenhouse gas emissions. Within these new developments, species selection is benefiting from the broad diversity represented in the CIAT forages collection. All accessions (CIAT 1315(CIAT , 1318(CIAT , 1342(CIAT , 1693 and 1728) collected in Brazil in cooperation with EMBRAPA and CSIRO over the last decades. Ex situ conservation of forages is substantially more expensive on a per-accession basis than conservation of other crops such as grains and pulses because cross-pollinating, wild and/or weedy accessions with long, asynchronous life cycles are substantially more expensive to regenerate thaninbred crops with short, synchronous life cycles (Koo et al, 2003), yet funding for tropical-forage research and deployment has declined considerably over the last decades. Accordingly, to ensure the long-term conservation and availability of critically important tropical-forage genetic resources, genebanks need to focus on the species with the greatest forage potential. A panel of well-known tropical-forage experts has grouped the species conserved at the CIAT and ILRI collections into priority categories based on the species' proven or suspected forage potential (Pengelly, 2015). Lowpriority accessions of both collections will be archived to focus conservation efforts on more promising species, with a view towards multiplying selected groups of 'bestbet' accessions so that larger quantities of starter seeds can be provided for research projects to shorten the path between the genebank and germplasm use in the field.Compared with tropical-forage collections at ILRI in Ethiopia (17K accessions), USDA in the US (15K accessions), KARI (Kenya Agricultural Research Institute) in Kenya (15K accessions), the Australian Pastures Genebank (APG) in Australia (13K accessions), EMBRAPA in Brazil (9K accessions), INTA in Argentina, and IGFRI (Indian Grassland and Fodder Research Institute) in India, CIAT's collection is particularly rich in legumes adapted to infertile, acid soils. A full list of accessions, including passport data, photos of plants, flowers and seeds and images of herbarium specimens, can be accessed on the Genesys web portal by filtering for 'COL003' for CIAT and 'forages' as a crop (https:// www.genesys-pgr.org).In 2021, the CIAT genebank will achieve all the CGIAR Genebank Platform's 'performance targets' for its forage collection (Crop Trust, 2016). One of these targets is making more than 90% of all accessions available for immediate distribution, which means the genebank holds sufficient numbers of seeds that have been tested and found to be free of more than 40 different pathogens of quarantine importance. The collection, therefore, will qualify for long-term funding from the Endowment Fund of the Global Crop Diversity Trust to ensure its in-perpetuity conservation.Although increasing germplasm collections by further collecting is currently difficult to justify, the policy framework may change over time, for example through an expansion of the ITGPRFA's scope to include all plant genetic resources for food and agriculture. Efforts to identify the most important collection gaps, therefore, are indicated to prepare for future collections. As suggested above, the forage germplasm collections currently conserved at the aforementioned genebanks, in addition to those at the CGIAR centers ICARDA (International Center for Agricultural Research in the Dry Areas) and World Agroforestry Centre (ICRAF) cannot be considered adequately representative of the geographic and taxonomic/ genetic diversity of the tropical and subtropical Poaceae and Fabaceae (Leguminosae), neither at the level of the individualcollections nor at that of their consolidated total. It is suggested that such gap analyses:• Consider both neglected areas/regions and genera/species of particular interest with emphasis on potential as forage and for environmental services. • Be based on ecogeographical surveys paying particular attention to regions where biodiversity loss (including danger of genetic erosion) has been identified and/or is likely to occur. • Consider the need for germplasm with focus on adaptation to the particular environmental challenges of the future in terms of the effects of climate change, such as increasing soil salinity, rising water table (including flooding), drought, temperature extremes etc. Collecting is suggested in areas of currently similar conditions under the assumption that germplasm occurring there has genetic adaptation to the respective limiting factors.Such gap analyses can be the basis for future internationally coordinated collecting actions -when they become feasible -but independently may also stimulate immediate plans of action at national levels."}
|
main/part_1/0197854021.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"48836e1123295f74ca6ee1789ac6855e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/3fa8f207-2487-44fa-8e1f-e7fe0ec071e4/retrieve","id":"-1297104338"},"keywords":[],"sieverID":"b12e4bea-7251-4d77-b18a-3c0dec33695f","content":"CGIAR Technical Reporting has been developed in alignment with the CGIAR Technical Reporting Arrangement. This Initiative report is a Type 1 report and constitutes part of the broader CGIAR Technical Report. Each CGIAR Initiative submits an annual Type 1 report, which provides assurance on Initiative-level progress towards End of Initiative outcomes. The CGIAR Technical Report comprises:• Type 1 Initiative and Impact Area Platform reports, with quality assured results reported by Initiatives and Platforms available on the CGIAR Results Dashboard.• The Type 3 Portfolio Performance and Project Coordination Practice Change report, which focuses on internal practice change.• The Portfolio Narrative, which draws on the Type 1 and Type 3 reports, and the CGIAR Results Dashboard, to provide a broader view on portfolio coherence, including results, partnerships, country and regional engagement, and synergies among the portfolio's constituent parts.The CGIAR Technical Report constitutes a key component of the CGIAR Annual Performance Report (APR).EOI-O 1: By 2025, a network of inclusive learning alliances comprised of at least 200 stakeholders and 30 organizations in each delta, and supported by at least three national/sub-national policies, actively scale up diversification of agrifood systems in deltas, to accelerate adaptation by 75,000 smallholders and improve management of 50,000 hectares of land.By 2025, national ministries and major NGOs in at least three countries use AMD co-produced knowledge and evidence to table at least three nutritionsensitive interventions to reduce mortality, DALYs, and micronutrient deficiencies, for 10,000 producers (80% women) and 50,000 consumers. EOI-O 3: By 2025, DCAS+ provided by public and private sector partners are used by at least 300,000 smallholders (at least 29% of them women), with at least one financing partnership plan established to assure sustainability and further scaling.By 2025, at least three gender-equitable and socially inclusive natural-resources informed food systems governance policies or strategies have been co-designed in partnership with national and sub-national governments, international development partners, and grassroot actors. EOI-O 5: By 2025, high-level policy-makers and development partners in at least two deltas involved in knowledge integration networks make public statements on the importance of One CGIAR and AMD and engage with AMD to help design climate adaptation-oriented policies, projects and investment plans with a nominal value of at least US$900 million.Score 2: Principal: The activity is principally about meeting any of the three CGIAR climate-related strategy objectives -namely, climate mitigation, climate adaptation, and climate policy, and would not have been undertaken without this objective.Score 1: Significant: The activity contributes in a significant way to any of the three CGIAR climate-related strategy objectives -namely, climate mitigation, climate adaptation, and climate policy, even though it is not the principal focus of the activity.Score 1B: Significant: The activity contributes in a significant way to any of the three CGIAR climate-related strategy objectives -namely, climate mitigation, climate adaptation, and climate policy, even though it is not the principal focus of the activity.https://www.cgiar.org/initiative/asian-mega-deltas/ *The Organisation for Economic Co-operation and Development (OECD) Development Assistance Committee (DAC) markers refer to the OECD DAC Rio Markers for Climate and the gender equality policy marker. For climate adaptation and mitigation, scores are: 0 = Not targeted; 1 = Significant; and 2 = Principal. The CGIAR GENDER Impact Platform has adapted the OECD gender marker, splitting the 1 score into 1A and 1B. For gender equality, scores are: 0 = Not targeted; 1A = Gender accommodative/aware; 1B = Gender responsive; and 2 = Principal. These scores are derived from Initiative proposals, and refer to the score given to the Initiative overall based on their proposal.Launched in June 2022, the CGIAR Initiative on Asian Mega-Deltas (AMD) has started implementing its activities and forging partnerships in its priority countries of Bangladesh, Cambodia, and Viet Nam. Additionally, activities have been initiated in India and in Myanmar but remain limited due to political instability. With the goal of promoting resilient, inclusive, and productive deltas, AMD, in its first year, produced new knowledge products, organized learning and capacity development events, enhanced existing innovations, and achieved capacity, policy, and investment outcomes.In 2022, AMD produced 84 new knowledge products, ranging from journal articles and research reports to policy briefs, multimedia materials, and training materials. The majority of these materials are open access and available online. AMD knowledge products focus on the Initiative's various research areas, such as building learning alliances on diversified production systems, promoting nutrition-sensitive interventions, developing digital climate advisory and bundled services (DCAS+), designing socially-inclusive policies, and supporting evidence-based delta development planning.In the area of capacity sharing for development, AMD conducted 30 capacity-building activities and learning events, reaching nearly 7,000 people. In Bangladesh, activities include: training of farmers on modern high-yielding rice cultivation with improved water management in the coastal polder zones; capacity-building of postgraduate students on thesis research focusing on agrifood systems in the polder zone; nutritional awareness program for women; and the school fair concept on climateresilient agriculture for the food and nutritional security of coastal communities. For stakeholders in Cambodia, AMD held training workshops on Section 2 Initiative progress on science and towards End of Initiative outcomes climate-smart mapping and adaptation planning (CS-MAP), learning alliances to address climate change impacts, and shared lessons learned on agro-advisory, crop insurance, irrigation management, and crop modelling. In Viet Nam, learning events include experience sharing on climate services, establishing a province-level learning alliance network, and workshops with government stakeholders on sustainable and inclusive governance and on nutrition-sensitive agrifood systems. AMD also co-organized field demonstrations, an exhibition, and conference program during the Agritechnica Asia Live event in Viet Nam on 24-26 August 2022. This event was attended by approximately 4,000 farmers, traders, scientists, and government officials.AMD is building on the technological innovations developed and introduced by the previous CGIAR Research Programs and other bilateral projects. For example, CS-MAP, a participatory approach that integrates local knowledge and science-based research in developing climate-risk maps and adaptation plans for rice production in Viet Nam's Mekong Delta, was initiated under the CGIAR Research Program on Climate Change, Agriculture and Food Security (CCAFS). Within the AMD Initiative, this approach is being expanded to incorporate all crops and the methodology is being adapted and extended to Cambodia and Bangladesh through cross-country knowledgesharing events. Under the Feed the Future Innovation Lab for Sustainable Intensification (SIIL) program in Bangladesh, AMD continues work on the improved community-led water governance approach and on diversified and intensified rice-based cropping systems. AMD has also invested in developing new innovations and business models on digital climate services and rice straw composting.AMD has achieved significant progress towards achieving its End of Initiative (EOI) outcomes. In terms of innovation use, AMD collaborated with the DeRISK SE Asia project on applying seasonal climate forecasting and innovative insurance solutions to climate risk management in agriculture in Southeast Asia. Through this collaboration, farmers have improved access to climate advisories using agro-climatic bulletins (ACB). The ACBs were disseminated via multiple communication channels reaching an estimated 130,000 farmers in Viet Nam. AMD innovations, such as crop decision trees (CDTs) for climate risk management and voice messaging weather forecasts with recommendations to avoid rainfall-induced crop damage to mung bean, were adopted in Cambodia and Bangladesh.In 2022, AMD has influenced policies at the local and national levels in Viet Nam and Bangladesh. In Viet Nam, AMD innovations were integrated in policies, such as the inclusion of CS-MAPs in the National Green Growth Strategy, ACBs in the regional directive letter of the Department of Crop Production (DCP) and in the provincial seasonal work plans, and alternate wetting drying (AWD) technology to mitigate greenhouse gas emissions in rice in the Nationally Determined Contributions (NDCs). In Bangladesh, AWD was also included as a key adaptation action in the National Adaptation Plan (NAP) 2023-2050.AMD attracted investments on climate change adaptation and mitigation in the deltas. AMD also participated in several global and national policy engagement events in 2022. In UNFCCC COP27, AMD organized two side events: an interactive dialogue event on agricultural transformations in the Asian Mega-Deltas, together with Wageningen University & Research (WUR); and an event on accelerating digital climate services for resilient food systems in the Global South, co-organized with TAFSSA. AMD presented in a main event at COP27 titled \"How to bridge the climate finance gap and support smallholders in food systems transformation\". AMD also participated in the WUR-led Delta Knowledge Days in Bangladesh, which is a learning and sharing event on delta knowledge and research.As of 2022, the AMD Initiative team is composed of approximately 85 staff from six CGIAR Centers, such as the Alliance of Bioversity International and CIAT, International Maize and Wheat Improvement Center, International Potato Center, International Rice Research Institute, International Water Management Institute, and WorldFish. Partner agreements had been signed with around 30 external research partners at international and national levels. As part of an assessment of DCAS+ to address climate and disaster risks (Output 3.1), a scoping study for Viet Nam, Cambodia, and Myanmar and a scoping and value chain study for Bangladesh were conducted to prioritize delta-oriented value chains in each country based on economic, social, and environmental criteria. Data on climate and agricultural information sources and (digital) climate advisory tools/services were also collected in preparation for an online survey among providers in 2023 to explore type of service, target users, information sources, dissemination, and business model, among others (see initial results for Viet Nam). Parallel to this, a user needs assessment was initiated among farmers and cooperatives to better understand farming systems, climate risks/impacts, key farming decisions, existing and desired use of services, and digital readiness (see initial results for farmer user needs assessment in Viet Nam).Meanwhile, further progress has been made in improving and scaling climate services based on previous projects and programs (Outcome 3.1). In Viet Nam, participatory development of ACBs scaled with government partners have reached 130,000 farmers in seven provinces in the Mekong Delta. CDTs have been developed for both Viet Nam and Cambodia as a step towards digital advisory and/or platforms. Similar developments took place in Bangladesh with expanding decision trees to livestock as part of Agvisely, an existing platform that AMD will expand. Also, several knowledge products, like manuals and tools, were developed to support implementation, capacity-building, and scaling.Based on the work, opportunities, and pathways for the further development, improvement, and promotion of DCAS+ business models (Output 3.2) will be discussed with public and private sector partners by April/May 2023. This will include an initial assessment of sustaining financing mechanisms and partnerships (Output 3.3). The activity/result contributes in significant ways to gender equality, even though it is not the principal focus of the activity.Gender equality is the main objective of the activity/result and is fundamental in its design and expected results. To create policy outcomes, AMD is working closely with National Agricultural Research and Extension Systems (NARES) in its three priority countries of Bangladesh, Cambodia, and Viet Nam. For instance, in Viet Nam, AMD's collaboration with MARD and its attached agencies resulted in a series of outcomes, such as: adoption of CS-MAP in the National Green Strategy; integration of ACBs in the regional directive letter of the Department of Crop Production and in the provincial seasonal work plans; inclusion of AWD technology to mitigate greenhouse gas emissions in rice in the NDCs; and engagement with international private and public sector partners in scaling carbon market access and incentivizing low-emission rice production.AMD is harnessing the multi-stakeholder collaboration in the priority countries in order to achieve outcomes. In Bangladesh, the partnership with government agencies (i.e., Bangladesh Rice Research Institute and the Department of Agriculture Extension), international organizations (United States Agency for International Development), and academic institutions (Kansas State University) led to capacity change among various stakeholders, particularly women and youth, on climate-resilient crop and water management practices and on food and nutritional security. For Cambodia, AMD is coordinating with the Ministry of Agriculture, Forestry and Fisheries on its work on implementing CS-MAP, building learning alliances, and developing digital climate advisory and bundled services. The International Institute of Rural Reconstruction is also providing support to AMD in the implementation of its work in Cambodia on nutrition-sensitive agrifood systems and climate risk management.Note: CGIAR Centres are excluded from the analysis. Partners and edges are sized by the number of results. Labels are shown for the partners involved in the most results. This staff member will also serve as coordinator for Viet Nam. Recently, Viet Nam updated its Nationally Determined Contributions (NDC) in the agriculture sector to develop and implement stronger greenhouse gas (GHG) emission reduction measures with its own resources, along with the cooperation and support of the international community. In the new NDC, the agriculture mitigation targets are almost doubled, specifically an 82% and 97% increase for unconditional and conditional contributions, respectively. New as a measure for methane reduction in agriculture in Viet Nam's NDC 1 . AWD and other measures in rice farming and management of agricultural by-products are projected to achieve the 30% reduction in methane emission from 2020 levels by 2033.The Climate-Smart Mapping and Adaptation Planning (CS-MAP), developed by IRRI and Viet Nam's Department of Crop Production (DCP) to promote evidence-based delta development planning under AMD, has been integrated to MARD Decision No. 3444 on the Action Plan to implement the National Strategy on Green Growth 2021-2030 2 . Effectively implemented in five agroecological regions of Viet Nam, including the Mekong River Delta (MRD) region, CS-MAP is a participatory approach that integrates local knowledge and science-based research in developing maps of climate-related risks and adaptation plans for crop production, suitable to location-specific conditions. As the action point on \"Developing a climate change adaptation map (CS-MAP) system for all localities\", CS-MAP is selected as one of the strategies under the category of environmental protection to develop green infrastructure that adapts to climate change and reduces GHG emissions."}
|
main/part_1/0202714818.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"f467828918a669f87b3f15fd3554e0fb","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/cd1e3a35-2577-4aba-94fa-853a8e3320c6/retrieve","id":"1848332222"},"keywords":[],"sieverID":"475ed725-ab7e-476a-927b-59fcb4d2fc95","content":"Lever les obstacles à l'accès des femmes au foncier Collection Capitalisation d'expériences 22 CTA Technical Brief OCTOBRE 2019 Collection Capitalisation d'expériences Lever les obstacles à l'accès des femmes au foncierLe récent atelier du CTA sur le thème « Rendre l'agriculture ACP de nouvelle génération accessible aux femmes » a identifié sept facteurs de succès essentiels pour permettre aux femmes de bénéficier de l'agriculture : l'accès aux investissements et au financement ; l'accès aux marchés ; le développement des compétences, la mise en réseau et le renforcement des capacités ; l'accès à l'information, aux connaissances et aux technologies ; l'accès à la terre ; la lutte contre les obstacles socioculturels ; et la reconnaissance des femmes (dans la société, dans les politiques et par l'offre et la fourniture de services appropriés).Ce document, rédigé par Hellen Mukasa, Aurélie Reynier et Lucia Ogunsumi, examine le rôle des systèmes juridiques formels et traditionnels dans l'accès des femmes au foncier et à d'autres moyens de production. Il préconise aussi une série de réformes politiques pour renforcer la position des femmes dans l'agriculture et le secteur agroalimentaire.Les femmes représentent 43 % de la main-d'oeuvre agricole totale des pays en développement, un pourcentage qui va de 20 % en Amérique latine à 50 % en Asie de l'Est et en Afrique subsaharienne (FAO, 2011). Pourtant, elles représentent encore moins de 15 % des propriétaires fonciers (FAO, 2018). En outre, leurs rendements sont généralement inférieurs de 20 à 30 % à ceux des agriculteurs masculins, essentiellement en raison d'un accès plus limité aux moyens de production (essentiellement la terre). Faute d'accès à la terre, les femmes ne peuvent pas recevoir des prêts et des crédits et l'adhésion à certaines organisations agricoles peut même leur être refusée. Autant de facteurs qui soulignent la nécessité de concevoir des politiques foncières innovantes qui répondent aux besoins des femmes et protègent leurs intérêts.Le système juridique officiel L'égalité d'accès à la terre entre les hommes et les femmes est consacré dans la constitution, le droit foncier et le droit familial en matière de mariage, d'héritage et même de divorce de nombreux pays. Les tribunaux de différentes juridictions veillent au respect de ces textes juridiques, qui interdisent la discrimination à l'égard des femmes et des jeunes filles. L'application des droits conférés par ces lois nécessite toutefois l'accès aux tribunaux. Et c'est là où le bât blesse pour les femmes des régions rurales, qui vivent éloignées des cours et des tribunaux et sont incapables de se retrouver dans le dédale du système judiciaire ou d'obtenir une aide juridique.En Ouganda, par exemple, l'arriéré judiciaire des tribunaux est de quatre ans. Même avec une aide juridique, une procédure d'action en justice visant à faire valoir ses droits est très coûteuse lorsqu'elle dure plusieurs années.Promouvoir l'accès aux systèmes juridiques officiels -en tant qu'outil visant à améliorer l'accès des femmes à la terre -reste donc un défi, même si les lois sont pavées de bonnes intentions.Le droit coutumier n'est ni formellement documenté ni soumis à un examen législatif. Il est souvent responsable du maintien des inégalités et de pratiques discriminatoires dans l'accès à la terre. En Afrique, les dirigeants culturels, les aînés du village et les chefs de famille sont les gardiens du droit coutumier. En vertu des pratiques sociales et des normes culturelles traditionnelles, les femmes et les jeunes filles possèdent rarement des terres et rares sont celles qui en héritent. En outre, leurs droits d'utilisation des terres ne leur sont acquis que par l'intermédiaire de leur mari ou de leur père. Vu ces limites à leurs droits, les végétaux qu'elles cultivent et le bétail qu'elles élèvent ne leur appartiennent généralement pas non plus. La prédominance du patriarcat dans le droit coutumier garantit aux hommes de la famille que les terres familiales et les richesses qui en découlent demeurent leur propriété.En cas de litiges sur la propriété terrienne, survenant souvent à la suite de prises de possession illégale, de querelles de succession et de pratiques d'accaparement des terres, les parties en cause doivent connaître la législation foncière pour régler le différend. Cela pose des difficultés, en particulier pour les femmes. Le droit coutumier est en effet un droit oral, connu exclusivement par les dirigeantsn À l'échelle mondiale, seuls 15 % des propriétaires fonciers sont des femmes.n Si les lois officielles donnent généralement aux femmes les mêmes droits qu'aux hommes, elles ne sont pas appliquées de manière cohérente.n Le droit coutumier a une influence majeure sur l'accès des femmes à la terre. Les décideurs peuvent prendre un certain nombre de mesures pour s'attaquer à ces problèmes.n Mettre en place une législation facilitant l'enregistrement foncier des femmes qui possèdent des terres. "}
|
main/part_1/0207484609.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"b5fe186b9d0b483b90d1d36a4f25e1be","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/2e9fefff-d9b5-403f-9085-1a6b489077bd/retrieve","id":"2097034322"},"keywords":[],"sieverID":"6c516049-af92-444a-a5ce-d6e958bffa46","content":"This booklet presents the 'Chennai Platform for Action' to enhance the contribution of plant genetic resources to meeting the Millennium Development Goals (MDGs), especially to reducing hunger and poverty.Participants underscored the unique contribution that agricultural biodiversity makes to improve livelihoods though providing a foundation for household food and nutritional security and offering opportunities for income generation. They also addressed policies, institutional constraints and other issues that challenge the full deployment of these natural resources and hence limit the achievement of the MDGs. They also conveyed concern at the rapid loss of these resources seriously threatening the food and nutritional security of future generations. The intention of the participants was to draw greater attention of policy-makers globally and the international community to the role of agricultural biodiversity in the fi ght against hunger, poverty and malnutrition and to seek greater international commitment to conservation and use of this natural resource for achieving the fi rst of the MDGs.The action plan described in this booklet is intended to help national governments and international agencies to achieve the goal of halving hunger and poverty by 2015. It promotes the principles of giving agricultural biodiversity greater importance in national and international development strategies and creating the required enabling policy conditions for the sustainable utilization of this treasure for the benefi t of the poorest and marginalized members of our society. The action plan calls for increased international collaboration in the conservation and sustainable and equitable sharing of the benefi ts arising from the use of agricultural biodiversity. It underlines the urgent need for action in nationally appropriate ways for meeting the MDGs.The participants of the meeting were concerned about the fact that, fi ve years after the adoption of the MDGs, little progress has been made towards eliminating hunger and poverty. In some countries, the situation has even worsened. The meeting agreed to make all efforts to bring the recommendations made in this action plan to the attention of the Heads of States and Governments who will meet in September 2005 on the occasion of the United Nations General Assembly that will review the progress made towards achieving the MDGs. It is the sincere hope of the participants of the Chennai Consultation that the proposed action plan will be considered by the UN General Assembly when defi ning the next steps towards the achievement of the MDGs.The Chennai Consultation and production of this booklet were sponsored by the Canadian International Development Agency (CIDA), Ford Foundation, the International Fund for Agricultural Development (IFAD), the Swiss Agency for Development and Cooperation (SDC) and the Syngenta Foundation for Sustainable Agriculture. We wish to take this opportunity to thank these donors, without whose generosity the holding of this meeting and the development of this action plan would not have been possible.Olanrewaju Smith M.S. Swaminathan Director General, IPGRI Executive Secretary, GFAR Chairman, MSSRFFrom the earliest days of domestication of plants for human use about 12 000 years ago, agricultural biodiversity has played a pivotal role in sustaining and strengthening food, nutrition, health and livelihood security all over the world. In spite of enormous progress made in enhancing crop productivity through Mendelian and more recently molecular breeding, more than 800 million children, women and men go to bed every day under-nourished. The majority of them are in South Asia and sub-Saharan Africa, areas of the globe that are rich in endemic agricultural biodiversity. Reducing hunger and poverty by half by the year 2015 is the fi rst of the UN Millennium Development Goals (MDGs), which represent a global common minimum programme for universal human security and well-being. An assessment made fi ve years after the adoption of the MDGs indicates that progress in reducing hunger and poverty is inadequate. It is in this context that the conclusions of an international consultation on the role of agricultural biodiversity in achieving a sustainable end to hunger and poverty, recently held at Chennai, India, assume signifi cance.Endemic hunger caused by protein-energy malnutrition, hidden hunger caused by defi ciencies of iron, iodine, zinc, Vitamin A and other micro-nutrients in the diet, and transient hunger caused by drought, fl oods, and other natural disasters can be overcome through an integrated strategy for the conservation and sustainable and equitable use of agricultural biodiversity. Even during the titanic tsunami of 26 December 2004, land races of rice were found in coastal Tamil Nadu, India, which could survive seawater inundation. Many life-saving crops, like tubers and legumes, were cultivated in the past and we urgently need to rekindle such dying wisdom and take steps to save vanishing crops, which can help to heal the wounds infl icted by natural or manmade calamities. Women, in particular, are holders of such traditional knowledge and the critical role of women in the 1.The Chennai Platform for Action conservation and sustainable management of agricultural biodiversity needs to be strengthened and revitalized. Tropical fruits, beta-carotene-rich sweet potato and other vegetable crops can help to fi ght Vitamin A defi ciency in children. In other words, agricultural biodiversity provides uncommon opportunities for developing decentralized and locale-specifi c community food security systems involving fi eld gene banks, seed banks and grain banks developed and managed by local women and men. This approach will further help to enlarge the food security basket by including nutrition-rich but under-utilized crops. This is the most sustainable and affordable pathway to achieving the MDG in relation to elimination of hunger and poverty.Agricultural biodiversity offers the crucial raw material for improving in perpetuity the productivity and quality of crops, livestock and fi sh. Goals such as 'health for all' and 'fi sh for all' can be achieved only by conserving medicinal plants and genetic diversity in fi sh. Agricultural biodiversity also offers opportunities, especially to the landless poor, for entrepreneurial initiatives, which will generate employment and income from a range of value-added foods, medicines, nutraceuticals, bio-fuel and other products. Such opportunities are of particular value, since today inadequate income and purchasing power are the major causes of food insecurity at household level. The potential of agricultural biodiversity for coping with climate change is not well appreciated. In short, the fl agship role played by agricultural biodiversity in overcoming hunger in an environmentally, economically and socially sustainable manner is yet to be widely realized and integrated with national and global strategies for achieving the MDGs. Better nutrition is also vital for fi ghting pandemics like HIV/AIDS and tuberculosis, since a drug-based approach alone will not lead to the desired results. The health foods of tomorrow will be mostly the under-utilized crops of today.Agricultural biodiversity and cultural diversity have feedback relationships. Local farming systems provide the feedstock for poems, songs, dance and drama. Communityled food security systems based on the conservation, cultivation and consumption of local foods thus help to preserve cultural and ethnic diversity in crop and culinary preferences. Thus, agricultural biodiversity confers multiple benefi ts-ecological, economic, nutritional and cultural. The global struggle against poverty and hunger cannot be won now or in the long run without increased international collaboration in the conservation and sustainable and equitable use of agricultural biodiversity. International commitment is imperative for actions on some of the recommendations listed above, while national initiatives can act upon others. We urge all to employ those approaches and practices that are most relevant in their individual situation and to put in place their own detailed plans to make better use of agricultural biodiversity to achieve the Millennium Development Goal on hunger and poverty. The fact that, fi ve years after the adoption of the MDGs, most developing nations are unable to make proportionate progress in the elimination of hunger and poverty indicates that a 'business as usual' approach will not help us to achieve the goal of a hunger-free world. Equally concerning is the human population growth rate, which continues to exceed the growth rate in food production, aggravating povertyinduced endemic hunger. Where hunger rules, peace cannot prevail. Hence, the time has come to embrace the idea of a decentralized and community-managed sustainable nutrition security system based on expanded agricultural biodiversity."}
|
main/part_1/0213614304.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"21548d20009f79c1bc944d58ced78154","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/af40c1e6-104b-49d9-9f22-54758cad7334/retrieve","id":"184044631"},"keywords":[],"sieverID":"fbaa81ca-3e2c-4b6c-a7ff-d0092ad11c24","content":"The CGIAR Platform for Big Data in Agriculture was a global leader in applying big data approaches to agriculture to find new ways to reduce hunger and poverty, and to develop robust responses to challenges such as climate change, pest and disease outbreaks, and land degradation. It aimed to reduce some of the daily risks faced by farmers in low-and middle-income countries (LMICs), enabling them to thrive.The Platform worked to positively disrupt agricultural research, helping to generate impactful big data innovations that revolutionize farming in LMICs. Through global leadership in organizing open data, convening partners to develop innovative ideas, and demonstrating the power of big data analytics through inspiring projects, the Platform helped ensure that the data revolution is deep, diffuse, and democratic, reaching the most vulnerable farmers. The Platform relied on three modules -Organize, Convene, and Inspire -to deliver on its objectives.The CGIAR Centers and Research Programs were Platform partners, alongside external thought partners that included international institutions, universities, and private companies. Big Data worked with partners from a range of sectors, including the public and private sectors, and across LMICs. These partners specialized in different areas of expertise, including analytics and information and communications technology deployment.To monitor and accelerate progress toward making CGIAR data findable, accessible, interoperable, and reusable (FAIR), the Platform developed and launched a prototype data search tool in 2017 -the Global Agricultural Research Data Innovation Acceleration Network (GARDIAN). GARDIAN, which was officially launched in 2018, enables users to search for CGIAR publications and datasets.In 2018, the Platform led a CGIAR-wide assessment of digital strategy and developed an action plan for CGIAR's digital transformation.In 2019, the Platform contributed to leveraging semantic standards for describing agronomic, socioeconomic, and survey data; updating the CGIAR metadata standard; and enabling digital collection of standardscompliant agronomy data. A secure analytic environment for researchers to find data and collaborate on analyses was created in the GARDIAN ecosystem, integrating single sign-on technology with Globus, a secure data-sharing service.In 2020, the Platform led the revision of CGIAR's Open Access-Open Data (OA-OD) Policy to elevate FAIR principles for CGIAR and partner data and publications, with the CGIAR Open and FAIR Data Assets Policy approved in 2021.In 2020 and 2021, the Big Data Platform contributed to sector guidance on building data ecosystems for start-ups; mapped privacy policy to technology standards to protect agricultural data; and communicated the risks of using artificial intelligence in agricultural value chains.In 2017, the Big Data Platform established six Communities of Practice (CoPs) for dataenabling food security research: socioeconomic data, geospatial data, data-driven agronomy, crop modeling, livestock data, and data ontologies. In 2018, a seventh CoP was launched on information and data management.Since their initial launch, the CoPs have expanded dramatically, meeting a growing demand for CGIAR engagement. By 2021, the CoPs boasted more than 6,500 members. The CoPs sparked cross-boundary collaborations in areas such as artificial intelligence and risk in agricultural supply chains, inclusivity in digital technologies, the use of call records to study women's economic empowerment, and the linking of ethical data guidelines to technology standards.In 2021, the CoPs hosted more than 20 capacity building webinars on topics such as applications of digital innovations for indexbased agricultural insurance products and impacts of climate change on crop yields as soon as 2030.The first annual CGIAR Convention on Big Data in Agriculture was held in 2017 and attended by approximately 300 global innovators, researchers, and thought leaders from public, private, and non-profit partners. 2 0 1 7 -2 0 2 1 4 The convention grew larger each year, and the Big Data Platform worked to attract CGIAR and non-CGIAR participants. In 2018, the convention reached its target goal of engaging with 60% non-CGIAR participants, and in 2020, 75% of 1,300 participants were external to CGIAR. In total, the Platform's annual Conventions engaged 5,500 attendees.The Big Data Platform initiated the Inspire Challenge, an open innovation process to encourage the use of big data approaches to advance agricultural research and development. Recipients of Inspire Challenge funds developed groundbreaking innovations with real potential for developmental impact, mobilized underused or misused data, and demonstrated meaningful partnerships with CGIAR and other sector members. By 2020, 28 grants had been awarded to 21 projects, with a combined total of US$3.225 million. Demonstrating CGIAR's continued commitment to scale projects and ensure their sustainability, the Platform awarded additional scale-up funds to prior winners each year, in addition to awarding new grants. The total amount of scale-up funds granted was US$1.125 million. The Platform also awarded Rapid Response grants to proposals related to digital responses to the COVID-19 pandemic.The Big Data Platform encouraged women to attend all capacity development events and the Annual Big Data in Agriculture Convention. At the 2020 Convention, 50% of speakers were women. The 2020 Convention also hosted a gender track, which featured sessions on big data topics related to the empowerment of women in agriculture.From 2018 onward, the Platform's Inspire Challenge included a gender dimension that assessed whether and how proposals engaged with gender issues. Further gender mainstreaming components were incorporated into the 2020 round of Inspire Challenge awards and Rapid Response grants. In 2021, reporting from the Inspire Challenge showed progress had been made to ensure women's participation in projects.In 2020, the Platform developed, adopted, and implemented its first strategy for advancing gender equity in agricultural research and development. With input from the CGIAR Generating Evidence and New Directions for Equitable Results (GENDER) Platform, the Big Data Platform designed a strategy to improve our understanding of relationships among gender, agriculture, and rapidly digitizing economies and to develop FAIR data systems that enable gender data to be used to its full potential.Collaborative research between the Big Data Platform and the GENDER Platform centered on developing a novel and timely large-scale assessment of women's economic empowerment.A phone-based survey of 10,000 respondents was conducted and used to analyze billions of data points in call detail records (CDRs)anonymous data generated by the operation of mobile phone networks -to predict gender and decision-making power among female farmers in Uganda. The approach demonstrated the potential for observing changes in female farmers' economic empowerment with greater speed and scale compared with the sole use of survey-based methods. In 2021, Big Data and GENDER launched a new research collaboration using CDRs to examine gender and labor dynamics in Ghana's food systems. From 2017-2021, the majority of Big Data's reported innovations centered on research and communication methodologies and tools (57%), with significant innovations also made in production systems and management (19%).From 2017-2021, Big Data completed 83% of its 95 milestones. Gender was a principal or significant objective in the majority (71%) of the Platform's milestones.From 2017-2021, half (50%) of Big Data's six policy contributions were national, with significant contributions to global policies (33%). The Platform's contributions focused on policy or strategy. Figures 1-6 reflect reporting valid as of July 14, 2022.Between 2017 and 2021, the Big Data Platform reassessed its priorities and focus as a result of changing circumstances, opportunities, and challenges. Notable adjustments and pivots included:▸ Acknowledging the need for market research on the data uses and needs of public, private, and non-profit stakeholders to identify and prioritize particular data users and ways that CGIAR could address their data needs.▸ Investing resources into ensuring compliance with privacy recommendations and regulations in research data across CGIAR.▸ Focusing on the development of Center and CGIAR-wide digital strategies, which led to an expanded role for research examining strategic trends and organizational capabilities to build a more unified CGIAR vision for information.▸ Realigning some internal budgets to issue digital innovation grants for tools and approaches that rapidly respond to the COVID-19 pandemic.To address the reputational risks posed by late or non-delivery of data, CGIAR Centers received funds to implement their OA-OD strategies, with the distribution of funds subject to having an implementation plan.The Platform held regular meetings of the Data Management Task Force, engaged management to ensure the correct incentives were in place, and maintained communications with Centers.▸ Privacy breaches and data protection.In 2018, the General Data Protection Regulation came into effect, posing a legal and reputational risk to both the Platform and CGIAR. The Platform launched an online course and webinar to help CGIAR understand the implications of the regulation. In 2019, the Platform implemented a software tool to help CGIAR data managers avert significant regulatory and reputational risks.▸ COVID-19 pandemic. In 2020, the Platform successfully redesigned its program implementation to be virtual and digital, achieving most programmatic targets for the year. Some access to the field was limited during lockdowns, causing some programmatic delays.▸ One CGIAR Transition. In response to organizational change, the Platform team actively participated in design groups that spanned different research initiatives and provided input on the new Digital Services design and establishment.An integrated data pipeline for small-scale fisheriesWorldFish, a CGIAR Research Program on Fish Agri-food Systems (FISH) partner, developed an integrated data pipeline for small-scale fisheries in Timor-Leste in response to a need for information on fisheries and fishing activities. In 2020, the Government of Timor-Leste adopted the system and agreed to fund its use and maintenance, hiring enumerators nation-wide to gather data.The initial extrapolated data from the system allowed for the first calculation of national fisheries production, including small-scale fisheries, in the country. With the use of the system, the government was able to provide fisheries statistics to the Food and Agriculture Organization of the United Nations for the first time since 2003, and mention of the system was integrated into relevant articles of the national fisheries decree-law.The digital monitoring system enabled a better understanding of fishing activities in the country and allowed for better management of fisheries, contributing to their potential for food and nutrition security. This innovation also produced the first useful dataset for benchmarking and monitoring the impacts of climate change on coastal livelihoods. It will be used to evaluate fisheries as an important buffer to climate variability and events that affect pastoral and livestock farming in Timor-Leste. Following the success of the system in Timor-Leste, the project was scaled to additional countries in Africa and Asia.Many of the most important measures to prevent the transmission of COVID-19 are vitally important to maintaining healthy livestock. This project utilized livestock farmers as \"nodes\" to spread awareness of hygiene and infectious disease within their communities. This project rapidly deployed an interactive digital course called \"Ensuring Dairy Herd Hygiene\" to train livestock farmers on how to prevent the spread of infectious diseases, both on and off the farm.The course was created and deployed by the International Livestock Research Institute (ILRI) in less than two months using the digital training platform Learn.ink.The course was piloted in Kenya and reached nearly 10,000 livestock farmers within the first four months. Early metrics from the project's digital training courses indicated that the majority of participants were between the ages of 26 and 35, with 18-to 25-year-old participants being the second largest category.Approximately 20% of participants were women, and efforts were made to fund a targeted online campaign for women farmers to increase their participation in the digital training courses.From 2017-2021, Big Data had $28.96 million in total funding. Over this period, Window 1 & Window 2 represented 85% of funding, Window 3 represented 6%, and Bilateral represented 9% (Figure 7). The Platform's top funder (Figure 8) was the CGIAR Trust Fund, followed by the Bill & Melinda Gates Foundation, Rwanda, and the United States.CIAT $10.30MWindow 3Center FundsAccess more financial information on the CGIAR Financial Dashboards.Big Data was primarily implemented by CIAT, followed by IFPRI and other CGIAR Centers (Figure 9).In 2021, the CGIAR Advisory Services (CAS) Secretariat Evaluation Function coordinated an independent evaluative review of the Big Data Platform. Below is a selection of the review's key findings.The Platform developed a range of relevant outputs such as GARDIAN, CoPs, and the Inspire Challenge. The Platform also adapted to evolving environments and constraints with, for example, the GARDIAN syntactic interoperability and the deployment of COVID-19 Rapid Response grants.The Platform contributed to increased engagement between CGIAR researchers and stakeholders from the digital ecosystem, which resulted in standardization efforts. However, the CAS evaluation found that the Platform did not sufficiently streamline varying data management approaches or leverage the capabilities of the CGIAR Centers. The evaluation also found that consideration of gender issues was not strongly embedded in the Platform's design, and adequate resources were not systematically provided to integrate gender within the Platform.The work of the Platform added value to CGIAR's efforts to map data, methods, and tools to support the delivery of research, and the Platform was instrumental in updating the 2021 CGIAR Open and FAIR Data Assets Policy to replace the 2013 policy. However, the CAS evaluation found that much effort is still needed to advance the agenda of data interoperability and reusability."}
|
main/part_1/0232126720.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"53e2da5b59a15e51ea0967b5c341aa90","source":"gardian_index","url":"https://link.springer.com/content/pdf/10.1007%2Fs10040-019-01973-6.pdf","id":"-1799470291"},"keywords":["Nepal","Stable isotopes","Artificial recharge","Climate change","Interventions"],"sieverID":"7191cdea-5dee-40e4-b296-09db8eb7ab68","content":"Though springs are the primary source of water for communities in the mid-hills of Nepal, an in-depth scientific understanding of spring systems is missing, preventing the design of effective climate-resilient interventions for long-term sustainability of springs. This study marks the first attempt to combine environmental isotopes analysis with hydrometric and hydrogeological measurements to identify dominant recharge zones for springs in two mountainous catchments-Banlek and Shikarpur-in Far-Western Nepal. In total, 422 water samples collected from rainfall, springs and streams between March 2016 and March 2017 were analyzed for their isotopic composition (δ 18 O and δD). Isotopic composition of rainwater shows seasonality, suggesting that different sources of water vapor cause rains in monsoon and in dry season. Rainfall responses of individual springs were used to identify connections to unconfined and deeper groundwater strata. The isotopic composition of springs in the two catchments ranges from −9.55 to −8.06‰ for δ 18 O and −67.58 to −53.51‰ for δD. The isotopic signature of the spring sources falls close to the local meteoric water line for the corresponding season, indicating strong rainfall contribution to springs. Altitudinal isotopic gradients suggest mean recharge elevation of 2,600-2,700 m asl for springs in Shikarpur, which lies beyond the surface-water catchment, and a recharge elevation of 1,000-1,100 m asl for Banlek, which partially extends beyond the surface-water catchment. The demarcated recharge zones will be used by government agencies to implement recharge interventions to increase the resiliency and reliability of springs in Far-Western Nepal.Two-thirds of the global population are experiencing severe water scarcity at least 1 month of each year (Mekonnen and Hoekstra 2016), which is expected to be further aggravated by increasing demands and impacts of climate change (Palmer et al. 2008;Oki et al. 2014). Nepal has consistently ranked as one the most climate vulnerable countries globally because of increasing vulnerability to biophysical hazards and low capacity of local systems to absorb climate-induced shocks. The climate vulnerability exacerbates the condition of 25% of the people living below the poverty line and 66% of the population directly dependent on agriculture for sustenance (IDS-Nepal et al. 2014). Climate-change induced increase in temperature and uncertainties in precipitation are expected to have a direct bearing on water availability for agriculture and livelihood through changes in evapotranspiration, recharge magnitudes and discharge regimes. Water security is an imperative driver to achieve sustainable development, ensure economic sustenance and increase the climate resilience of rural vulnerable communities in Nepal, in which utilization of spring sources play a vital part (WECS 2011).A climate vulnerability assessment for watersheds across Nepal identified the mid-hills in Western Nepal as the most vulnerable region within the country (Siddiqui et al. 2012). The mid-hills-elevation 1,000-2,500 m above sea level (asl)-in Nepal account for 45% of the total population, of which over 80% depend on agriculture and livestock for their livelihood (Dixit and Khadka 2013). The mean annual precipitation in Far-Western Nepal region is 1,921 mm, signifying adequate water resources availability; however, 80% of the annual rainfall arrives during the monsoon (June-September), leading to water scarcity in the drier months (October-May). Especially in Western Nepal, the inter-annual and seasonal climate variability is considered as the main determinant of food production, market access and commodity pricing (UNWFP 2014). Hence, for 80% of rural communities perched on hilltops far from river sources, springs are the primary source of water for sustaining domestic, agriculture and livestock water demands (Tambe et al. 2012;Sharma et al. 2016).Decline in spring discharge has been reported in parts of India and in the Nepalese mid-hills due to increased water demand from changes in demographics, land use changes associated with agriculture and deforestation, and rainfall variability induced by climate change (Valdiya and Bartarya 1989;Negi and Joshi 1996;Negi and Joshi 2002;Merz et al. 2003;Tambe et al. 2012). As springs remain the main source of water for domestic and agricultural purposes, especially in dry periods, protecting their source areas and introducing interventions to manage them is critical for ensuring water and livelihood security in the region. However, data and knowledge of local meteorology, hydrology, geology, and surface-water/groundwater dynamics, imperative to designing climate resilient interventions for spring management, are scarce for the Nepalese midhills. The lack of understanding of fundamental processes governing springs in the hydrogeologically complex and ungauged Himalayan catchments is a key reason for limited impact, or even failure, of watershed interventions (Sharma et al. 2000;Government of Sikkim 2014;Vashisht 2008).Identifying dominant spring recharge zones is a prerequisite for successful management and augmentation of springs through a suite of potential interventions such as infiltration structures (ponds and trenches) and land management activities to sustain water availability and reliability (Kresic and Bonacci 2010). Depending on the objectives and scale of the intended study, appropriate choice of physical, tracer and numerical modeling-based methods can be used to delineate and estimate groundwater recharge (Scanlon et al. 2002;Chowdhury et al. 2010;Chinnasamy and Prathapar 2016). The combination of geophysical investigations, hydro-geochemistry and naturally existing tracers-the environmental isotopes ( 2 H, 18 O and 3 H)-can provide critical insights into the spatial distribution of groundwater aquifers and their recharge areas (Clark and Fritz 1997). To understand the groundwater recharge dynamics in data-scarce, small, ungauged mountain catchments, tracers (natural and artificial) and geophysical methods have been widely used to identify groundwater residence time and to locate recharge zones (Stimson et al. 1993;Mathieu and Bariac 1996;Chinnasamy and Prathapar 2016). The environmental isotopes of oxygen and hydrogen isotopes (δ 18 O and δD) have been used to determine recharge mechanisms, trace the origin of spring systems, and estimate residence time of groundwater in the Himalayan region (Jeelani et al. 2010). The δ 18 O and δD isotopic composition of rain samples collected at different altitudes and latitudes along the hillslope exhibit different isotopic signatures, which contribute to the creation of a local meteoric water line (LMLW; Gat 1971;Clark and Fritz 1997;Price and Swart 2006;Fontes et al. 1967;Jeelani et al. 2010;Kumar et al. 2010a;Fetter 2001). Dominant recharge elevations contributing to spring flow can be identified by relating the isotopic signature of spring sources to altitudinal gradient for δ 18 O and δD in rainfall and comparing to that LMLW. Evaporation and mixing of recharged water with groundwater from various sources can, however, affect the isotopic signature of springs leading to its departure from the LMWL (O'Driscoll et al. 2005).A sizeable number of stable isotope applications for spring hydrology have been carried out on the Indian side of the Western Himalayan range (Jeelani et al. 2010(Jeelani et al. , 2015(Jeelani et al. , 2017;;Shah et al. 2017). Kumar et al. (2010a) also analyze the stable isotopic ratios in precipitation for India while Kumar et al. (2010b) investigated the isotopic characteristics of precipitation in the Kumaon Himalayas located close to the India-Nepal border in the West. Previous environmental isotope studies within Nepal focused on estimating the relative contribution of various water sources to the stream, but have not been applied for delineation of spring recharge areas (Ramesh and Sarin 1992;Garzione et al. 2000;Racoviteanu et al. 2013). More recently, Wilson (2015) and Florea et al. (2017) characterize isotopic compositions in surface and groundwater in Langtang (central) and Everest (eastern) regions of Nepal; however, to the authors' knowledge, this study is the first isotopic analysis conducted with a specific focus on spring systems in Far-Western Nepal.This study utilizes stable isotopes of δ Two pilot springsheds (Fig. 1a,b)-Shikarpur and Banlek, within the West Seti River basin-were chosen from 108 sites under the BCRWME project to use environmental isotopes for spring recharge zone delineation. Key characteristics of these two catchments are presented in Table 1. Around 75 households in Shikarpur use three springs for domestic and agriculture purposes, and for operating a 3-kW micro-hydropower plant (Okwany and Khadka 2016). In Banlek, there are two well-defined channels with four springs primarily used for drinking purposes and for livestock and irrigation on the rare occasion when excess water is available (Okwany and Khadka 2016). The slope largely faces northeast and east, with aspect ranging from 23 to 113°(with 0°being north, 180°b eing south), which indicates that most runoff will head in that direction.For Shikarpur and Banlek, site specific geological data are not available. Based on information obtained from the regional geological map, the field visits and expert judgement, the local hydrogeology of these two springsheds is described. A base map of 1:50,000 scale was first prepared using a topographic map published by the Survey Department, Nepal, Topo Sheet no. 2980 15B for Banlek area and Topo Sheet no. 2980 11B for Shikharpur. A geological traverse was carried out along the stream, road cut sections and foot trials to obtain geological and hydrogeological information like rock and soil type, dip strike measurement of discontinuities, weathering conditions, geological structures and occurrence and nature of springs. The hydrogeology of the two pilot springsheds is presented in Fig. 2a,c) along with the geological cross section across the selected transect Fig. 2b,d).The geology in Shikarpur consists of fine-grained gray limestone from Lakherpata Formation overlaying calcareous quartzite and dolomitic limestone from Syanga Formation. In the upper slopes, the limestone appears highly fractured and crushed, and in some areas, small caves are visible indicating karst topography with subsurface caverns. The limestones have three joint sets and random fractures forming wedge shape blocks. The joints are close spaced and have smooth to rough surfaces. The attitude of the bedding plane has SW-NE strike with NW dipping at 24-41°. This formation is correlated with the Lakharpata Formation of the regional geological map of Far-Western Nepal. The southern part of the study area consists of quartzite and phyllite. The quartzite observed along the road cut section is medium to thickly foliated, highly fractured and moderately weathered, and gray colored. Chlorides, quartz and feldspar dominate the mineral composition of the rock. Dark gray to purple colored phyllite and phyllitic slates are also present within the quartzite with three joint sets and random fractures forming wedge shape blocks. The joints are close spaced and have smooth to rough surfaces. The foliation plane has a SW-NE strike with NW dipping at 10-30°. This quartzite and phyllite are correlated with the Syanga Formation of the geological map of Far Western Nepal. Colluvial deposits, composed of angular fragments of quartzite, limestone and phyllite, are very widely disturbed within the watershed area along the lower part of the slope and form the unconfined stratum in the area. Most of the joint sets in the Shikarpur Springshed have continuous close to tight joints, rough and irregular surfaces, and show a high degree of intersection of discontinuities.Similar to Shikarpur, colluvial deposits are widely distributed within the Banlek springshed area (Fig. 2c,d). These deposits are composed of angular fragments of quartzite and phyllite with angular fragments. At the middle part of the catchment area, an old landslide was observed also containing the same colluvial deposits. The geology consists of metasedimentary rocks of grey colored, medium to coarse grained, highly fractured quartzite and thinly bedded undulated phyllite. The bedrocks are mostly exposed along the stream cut section, road cut section and at some cultivated areas of contoured terrace. The joints are closely spaced and have smooth to rough surfaces. The bedding plane has NW-SE strike with 38-68°SW dipping. Banlek area is situated in the north of the Main Boundary Thrust which lies about 25 km south from the study area. Foliation structures in quartzite and phyllite are distinct and common in the investigated site. Foliation controls the general geography of the area. The thickness of the foliation varies from thin (<10 cm) to thick (>1 m). The foliation plane in the area is dipping towards the south to south-west, with dip amount varying from 45 to 78°. Some quartz veins are also observed along the foliation planes. In both catchments, rock exposures show a high degree of intersection and discontinuities which determines the degree of anisotropy of groundwater flow in the fracture network, as such a high degree of interconnection facilitates smooth and uniform groundwater flow.Two automatic weather stations were installed in October 2015 to capture site-specific weather phenomena consisting of rainfall, temperature, relative humidity, solar radiation, and wind speed. The automatic rain gauge in the Banlek catchment malfunctioned during the 2016 observation period resulting in reliable observations only from Jan 2017. Meanwhile, the observations in Shikarpur are available from November 2015 till November 2017. Two v-notch weirs were installed, one in each catchment in April 2016 to estimate discharge based on water level recorded above the v-notch using an automatic pressure sensor. The automatic measurements were collected at sub-daily timescales and aggregated to daily averages. Spring sources are additionally measured manually once every morning using the time-volume method.Water samples from three springs, two streams, and rainfall at four elevations were collected from Shikarpur, while similarly, a sample from four springs, one stream, two points in West Seti River and rainfall at three elevations were collected in Banlek. The isotope sampling locations are shown in Fig. 1. During the monsoon season (June-September), samples from springs and streams were collected weekly while during dry season, comprising the winter and summer months (October-May), samples were collected fortnightly. Rainfall water samples or snow samples were collected for all events greater than 5 mm. Note that Western Nepal is known to also receive rains in the winter (Bookhagen and Burbank 2010). The water sample collection Institute of Hydrology in Roorkee, India. The stable isotope composition of oxygen and hydrogen are reported using conventional delta (δ) notation (Craig 1961), δ 18 O and δD in per mil (‰) relative to Vienna Standard Mean Ocean Water, VSMOW (Gonfiantini 1981). The precision of the measurement of δ 18 O and δD was ±0.1 and ± 1.0‰, respectively. Deuterium excess, dexcess, (Dansgaard 1964) was calculated using the standard equation:Rainfall patterns and the effect on spring flowsDaily rainfall magnitude and spring flow observed in the two study catchments are presented in Fig. 3a (Shikarpur) and Fig. 3b (Banlek). The total observed rainfall from January to August 2017 was 2,025 mm in Shikarpur and 925 mm in Banlek (Fig. 3a,b). During the 2017 observation period, the total rainfall observed in Shikarpur was twice that of the Banlek catchment. The contribution of the monsoon, driven by the winds from the Bay of Bengal, to the total rainfall in 2017 stands at 81% in Shikarpur (1,781 mm) and 74.3% in Banlek catchments (688 mm). In 2016, the Southwest monsoon contribution in Shikarpur catchment was 1,778 mm, which is 83.7% of the total annual rainfall received. The maximum 1-day precipitation observed in Shikarpur is 128.6 mm and Banlek is 79.8 mm. While the observation period covers 2 years in Shikarpur and less than a year in Banlek, it is evident from the 2017 data that both catchments exhibit different rainfall patterns owing to micro-climates fueled by local convective and orographic interactions common in the Himalayan region.Mean daily discharge of 182, 176 and 51 L/min were observed in the three Shikarpur springs between November 2015 and 2017. In Banlek, the observed daily mean discharge estimated over the same observation period was 5, 6.6 and 7 L/ min. Shikarpur is located in a larger mountain range with twice as much rainfall as Banlek, resulting in such higher magnitude of spring flows. Out of the three springs monitored in Shikarpur catchment, two springs (SS-1 and SS-2) respond quickly to rainfall events, while the response from the spring SS-3 was relatively lower (Fig. 3a). Similarly, spring BS-2 and BS-3 in Banlek catchment show quick responses to rainfall events. The relatively stable nature of spring hydrographs in BS-1 and BS-4 in Banlek, and SS-3 in Shikarpur, indicates a year-round contribution from stable groundwater sources. The spring hydrographs shown in Fig. 3 indicate that the onset of increase in spring flows coincides with the occurrence of the Southwest monsoon. The rising limb of spring hydrographs in Shikarpur occurs during the first week of July, while it was observed to occur during late August/early September in Banlek. Discharge in Banlek declined significantly in 2017 and field observations confirmed that the site was facing a drought with a decline in rainfall as well as spring flows throughout the catchment.Based on the time difference in measured rainfall peak and observed peak flow in spring flows, 10 days was estimated as an approximate time taken for the rainfall response to appear in the springs in Shikarpur. Owing to limited rainfall data in Banlek catchment, residence time was not estimated; however, considering the smaller catchment size, moderate slopes, and more infiltration-related hydrogeological characteristics, it is likely that the mean residence time will be less than −9.17 and δD: −66.47‰). However, the isotopic composition observations from winter rainfall samples do not follow the same elevation-dependent isotopic depletion trend.The isotopic composition of seven springs in the two catchments exhibits similar magnitude of δ 18 O (−9.5 to −8.9‰) and δD (−67 to −56‰) within a narrow range. The maximum standard deviation of 0.25‰ was observed in SS-2 in Shikarpur and the variations of δ 18 O in other springs were less than 0.18‰, whereas in case of δD composition among the springs, the variations are less than 1.8‰. The strong inter-seasonal variations in isotopic composition observed in rainfall samples were not reflected in the spring observations in both catchments. There is loss of seasonal variations during infiltration through the unsaturated zone (Clark and Fritz 1997).In the Shikarpur catchment, the onset of monsoon caused a visible spike in isotopic composition of rainfall samples (from nearly −14 to −6‰ for δ 18 O and −104 to −42‰ for δD in the secondary axis for Fig. 4), which is still lower than the 1.45 for δ 18 O and 32.47 for δD measured during dry season months. The enrichment peak caused by the onset of monsoon subsided rapidly within the span of 17 days. The spring water samples were also enriched in heavier isotopes during Southwest monsoon months (July-August); however, the higher enrichment of heavier isotopes observed in dry season rainfall samples was not reflected in spring samples that appear depleted. In Shikarpur catchment, the lowest values in the spring water samples were observed during the months of April-May. The absolute values of isotopic composition observed in Banlek follow a similar profile to that of Shikarpur, but the absence of measurements during the in-between months forms a poor basis to derive any inference on specific trends from the intermittent time series data. More continuous sampling is needed in Banlek to deduce intra and inter-seasonal trends in the isotopic composition of the rainfall and spring water especially because the relatively lower number of rain events in Banlek limited the number of rainfall samples that could be gathered.A linear relationship between δ 18 O and δD for the rainfall samples was used to derive the LMWL for Shikarpur and Banlek catchments (Fig. 5 and Eqs. 2 and 3).The LWML for the two catchments were compared with the global meteoric water line (GMWL) (Craig 1961;Rozanski and Araguas-Araguas 1993) given by GMWL : δD ¼ 8:17The slope and intercept of the Shikarpur LMWL are in close agreement with the GMWL, while the Banlek LWML significantly differs in both slope and intercept. In addition, the distinct isotopic signature of winter rainfall events in Shikarpur located at higher elevation compared to Banlek is clearly evident from Fig. 5a. The rainfall events recorded in Shikarpur during winter season showed significant enrichment of both δ 18 O and δD isotopes. A low number of rainfall events recorded in Banlek did not show the observed seasonality in Shikarpur isotopic signature in monsoon and dry season (Fig. 5b,d). Due to this, a separate LMWL was created for Southwest monsoon (July 2016 to October 2016) for both catchments. The resultant Shikarpur and Banlek LMWLs for Southwest monsoon follow GMWL with a slope of 8.1746 and intercept of 11.703 for Shikarpur (Fig. 5b), and slope of 8.177 and intercept of 8.9882 for Banlek (Fig. 5d). The resultant values of the LMWL are however different to the LMWL from the nearest International Atomic Energy Agency's (IAEA) Global Network of Isotopes in Precipitation (GNIP) station in New Delhi, India (Datta et al. 1991), given by Delhi LMWL : δD ¼ 6:8The significance of evaporation effects on the isotopic ratio of rainwater in low-altitude semi-arid conditions prevalent in Delhi could explain the significant difference between LMWL derived for Delhi and Western Nepal catchments in this study (Eqs. 1, 2 and 4). This reiterates the complex association between δ 18 O and δD in samples derived from the monsoonal rainfall events and the impact of local effects on isotopic compositions. The isotopic signature of springs in Banlek and Shikarpur catchments lie close to the LMWL of respective catchments (Fig. 6), indicating strong rainfall contribution to infiltration. Even the isotopic signature of springs SS-3, BS-1 and BS-4, which show lower and delayed response to the rainfall events compared to other spring sources in both the catchments, lies closer to the respective LWML.Deuterium excess (d-excess) estimated from rainfall samples serves as a tool to trace the water vapor source region even across continents, including the nature of the air mass and meteorological conditions at the vapor source regions (Gat et al. 1994). The global mean value of d-excess is approximately +10‰ (Froehlich et al. 2002;Rozanski and Araguas-Araguas 1993). In this study, the d-excess ranged between 7.44 and 22.97‰ in Shikarpur and 7.76 and 14.01‰ in Banlek during the sampling period (Table 3; Fig. 7). Lower temperature and humidity values in the water vapor source region for rainfall may yield such large d-excess values. Evidence of such rainfall sourced from western disturbances contributing to spring recharge in the Western Himalayas has been found in previous studies (Jeelani et al. 2015(Jeelani et al. , 2017)).The d-excess in both catchments also exhibits strong seasonal and altitudinal variation. The d-excess in rainfall was 60 and 71% higher during the dry season compared to the samples from the monsoon season in Shikarpur and Banlek respectively. Except for the sampling period of July and August 2016, the lowest elevation of rainfall sampling (1,954 m) in Shikarpur provided the highest d-excess values. In the case of Banlek, no definite trends emerge in the monsoon season. The lowest elevation rainfall sample site of 733 m provides the highest d-excess value (14.23‰) in January 2017; however, in Banlek, the dry season rain events were only observed in the month of January 2017. Due to the lower altitude of Banlek compared to Shikarpur, it is envisaged that the difference in seasonal d-excess values will be higher during later months in the dry season. In Shikarpur, rainfall in the summer month of March 2017 showed the highest d-excess in the Secondary evaporation is another factor affecting the dexcess estimates, particularly in low altitude zones (Jeelani et al. 2017). During the monsoon, relatively low temperature and relative humidity inhibit the secondary evaporation effect, thus resulting in lower d-excess values. Although secondary evaporation is lower in the winter months in the dry season, different source areas of water vapor other than the Indian Ocean resulting in rainfall events during this season leads to higher d-excess. However, the highest d-excess values observed during the summer months in the dry season are a result of a combination of rainfall source areas originating from conventional monsoon source-the Bay of Bengal and the effect of secondary evaporation.Monthly isotopic gradients were calculated for Shikarpur and Banlek catchments to estimate altitude effects and to aid in delineating recharge areas of springs under investigation. Variations of δ 18 δD and d-excess in rainfall samples at multiple elevations were aggregated to monthly scale (Table 2). There is depletion of heavy isotopes of oxygen δ 18 O and hydrogen δD with increase in altitude observed in Shikarpur for all months under consideration. The decrease in isotopic ratios was not consistent across the elevation zones in both study catchments; moreover, in Shikarpur, the sampling location at 2,243 m, located on the northeast facing side of the hill, has different isotopic composition than the sampling locations at 2,364, 2,063 and 1,954 m on the Southwest face of the hill. In Banlek, rainfall samples collected at 733 m showed more depleted isotopic composition than the samples collected at 808 and 936 m. An average isotopic gradient of −0.25‰/ 100 m for δ 18 O and −1.73‰ /100 m for δD was estimated for Shikarpur, and −0.12‰/100 m for δ 18 O and −1.5‰/100 m for δD for the Banlek catchment. The average monthly variations of altitude-induced effects on δ 18 O and δD composition across all rainfall samples are shown in Fig. 8. In the case of Shikarpur, the rate of decrease in the isotopic composition is more prominent in September and least in October 2016. In Banlek, the rate of δD decrease with altitude is prominent in September, similar to the findings in Shikarpur, but δ 18 O altitudinal effects were pronounced in July and less variable in August 2016. The estimated altitudinal gradient for δ 18 O and δD in rainfall has been used to delineate the recharge areas of aquifers (Longinelli and Selmo 2003) feeding the spring system in Shikarpur and Banlek catchments. The altitude-effect estimates are a vital tool to delineate spring recharge areas in both study catchments because of the steep slopes. The recharge elevations for Shikarpur and Banlek springs were estimated from the Shuttle Radar Topography Mission (STRM) 30-m digital elevation model (DEM) using the linear relationship summarized in Table 4. Figure 10 visualizes the extent of suitable recharge zones to implement climate-resilient recharge interventions in the catchments to augment spring flow. The estimated mean recharge elevation ranges for springs SS-1 and SS-2 in Shikarpur fed by unconfined groundwater sources are 2,600-2,700 m (Fig. 9a-b). Similarly, for unconfined groundwater-fed springs, BS-2 and BS-3 in Banlek, the recharge elevation range is 1,000-1,100 m asl (Fig. 9c-d). The estimated recharge elevation range for spring SS-3 in Shikarpur is 2,720-2,760 m asl, which is higher than the maximum elevation of 2,681 m asl within the catchment.A l l e s t i m a t e d r e c h a rg e z o n e s a r e l o c a t e d a t elevations higher than that of the rainfall sampling locations. Such values reiterates the findings from a hydrometric analysis that the spring source SS-3 possibly emerges from discontinuities in the limestone formation or from the contact of the phyllite and the karstic limestone in the form of a spring, and the pathways have longer residence times. The difference in dominant water sources contributing to spring discharge also explains the difference in isotopic composition between SS-3 and springs SS-1 and SS-2. Similarly, recharge zones estimated from δD data for Banlek catchment provided unreasonable values for all the springs, indicating a need for more sampling. By combining insights from the hydrometric and isotope analysis, it was decided that the isotopic sampling extent within the springsheds was not sufficient to demarcate the recharge zone range estimates of springs BS-1 and BS-4 fed by discontinuities in quartzite and phyllite formations in Banlek, and, spring SS-3 from the limestone and phyllite formations in Shikarpur. Surveys to gather additional hydro-geological information on sub-surface connectivity in these two pilot sites were recommended to DFSC for further assessment.It is also possible that the recharge areas for these springs lie in higher areas beyond the immediate catchment, but connected to the same mountain range. Especially in Shikarpur, Precipitation from Southwest monsoon dominates both the catchments. Precipitation in dry season, including snow events, is more common in Shikarpur than Banlek, where rainfall is the only form of precipitation. This rainfall variation is attributed to the difference in topography and orographic effects governing the two small catchments located 21 km apart with 1,300 m mean elevation difference. Numerous studies have addressed the altitudinal effect on frequency, intensity and magnitude of rainfall events in the Hindu Kush Himalayas (Bookhagen and Burbank 2010;Palazzi et al. 2013). Specifically, the orographic effect of precipitation in upper, middle and lower Western Himalayan ranges results in significant differences in rainfall patterns with altitude across the region (Singh et al. 1995;Singh and Kumar 1997).All springs in Banlek and Shikarpur considered in this study are contact springs, which arise at the interface between two strata when the permeability of the lower stratum is relatively lower than that of the top stratum allowing water to flow horizontally and emerge at an outlet (Okwany and Khadka 2016). The three Shikarpur springs (SS-1, SS-2, and SS-3; Fig. 1a) emerge between the limestone and underlying quartzite and phyllite formations. With an inclination towards the south, the upper limestone forms the aquifer system for springs. The upper limestone has well developed joint sets and various caves. The water infiltrating through the limestone initially flows along the inclination of the rock towards the SW and emerges along the contact of the phyllite and the karstic limestone in the form of springs. Banlek spring-1 (BS-1; Fig. 1b) similarly originates in the basal slopes near the contact of colluvium soil and fractured quartzite. Springs BS-2 and BS-3 located at the toe end of the colluvium deposits, and BS-4 located further upstream, are a result of the contact between the unconsolidated porous colluvium deposits and the relatively less porous bedrock layer.Recharge from rainfall events contributes significantly to springs SS-1, SS-2, BS-1, which is evident from their fast response indicating direct recharge from colluvial deposits made of angular fragments of quartzite and phyllite in Banlek, and, of limestone and phyllite in Shikarpur. Apparent lack of rainfall response in the remaining springs signifies sources possibly arising out of discontinuities in the limestone formation in Shikarpur and heavily weathered quartzite formations in Banlek. Deeper groundwater aquifers, connected through fissures and fractures, were observed in the hydrogeological survey. Seasonal variations in the isotopic composition of rainfall in both catchments indicate that maximum enriched rainfall events occurred during dry season, consistent with previous studies in the Himalayan region, which have indicated different water vapor sources of monsoon and dry season rain (Kumar et al. 2010b). The derived LMWL for rainfall in Shikarpur and Banlek follows close resemblance to studies conducted in similar climatic and physiographic region in the Western Himalayas (Bartarya et al. 1995;Ramesh and Sarin 1992). The isotopic signature of the springs in Shikarpur and Banlek are located close to catchment LMWL, indicating the contribution of recharge fed from rainfall.The altitude effect of −0.25‰ for δ 18 O estimated for springs in Shikarpur is significantly lower than values reported in other studies in Western Himalayan range (−0.36‰, Kumar et al. 2010b; −0.38‰, Ramesh and Sarin 1992; −0.5‰, Navada et al. 1986); however, the Banlek altitude effect of −0.12‰/100 m for δ 18 O agrees with estimates by Bartarya et al. 1995 (−0.14‰). The altitude effect of −0.2 to 1.1‰/100 m for δ 18 O has been observed in other mountainous locations around the world (Kumar et al. 2010b), providing validity to the estimates for Shikarpur. The LWML for the two catchments closely resembles the GWML and LWML in similar areas, and suggests that the isotopic compositions are reasonable estimates despite the inherent uncertainties. It can also be inferred from Fig. 8 that the altitudinal effects do not show strong seasonality and are dominated by the source, amount and trajectory of the air mass bringing the precipitation (Jeelani et al. 2010).Difficult terrain impeding access to the spring source location, sampling points located some distance away from spring sources with potential mixing of surface runoff, and the piped nature of spring systems for domestic use, may impart potential sources of error into the samples collected for isotopic assessment. Thus, the sampling locations are located downstream of the spring source, which increases the possibility of change in isotopic signature due to evaporation/condensation, expensive nature of isotope analysis limit the number of samples.The hydrogeological survey of Banlek and Shikarpur lend further evidence to the delineated recharge zones. The recharge zones in Banlek fall within the rich porous colluvium deposits with gentler slopes conducive for infiltration as they increase residence time. In Shikarpur, springs are located at higher elevations on a steep slope, where the dominant recharge mechanism is through fissures and fractures and not through the unconfined aquifer; thus, the isotope-based elevation zones at the ridges of the hill far from the Shikarpur appear justified for recharging springs originating in surface water divides and subsurface fractures and fissures. In addition, springs SS-1, SS-2, BS-2, and BS-3 are contact springs lying at relatively porous upper geological layers forming the unconfined stratum. Springs SS-3 and BS-1, identified as potentially fed by deeper aquifers, lie in basal areas dominated by underlying relatively impervious phyllite and quartzite layers in Shikarpur and bedrock in Banlek respectively. Spring BS-4 in Banlek, located at the end of porous colluvium soil deposited by a previous landslide, should ideally be highly sensitive to rainfall, but such rainfall response is absent in flow measurements.The spring recharge zonation clearly signifies the difference in the surface water and subsurface divide even in a small headwater mountainous catchment like Shikarpur. Similar to Banlek, springs in Shikarpur showing fast response to the rainfall and located within the demarcated springshed boundary, are easier to augment using planned interventions. The identified recharge zone for Shikarpur, extending beyond the surface-water catchment, suggests that recharge interventions for water augmentation must be implemented beyond the current pilot area. These recharge zones, transcending the local village boundary in which the spring system is located, pose practical challenges in implementation and maintenance of the recharge interventions. Such practical considerations imply that recharge interventions are better suited in Banlek. Other proposed interventions such as piped diversions and focus on increasing water-use efficiency is recommended for Shikarpur. Field knowledge needs to be combined with evidence-based recharge zones identified using isotopes for the success of chosen interventions.The spring recharge areas in two mountainous catchments located in Far-Western Nepal, Shikarpur and Banlek, were delineated by comparing the isotopic ratios of δ 18 O and δD in precipitation with springs. Based on the observed rainfall responses in the spring flow measurements, sample sites were categorized into groups fed by unconfined groundwater (SS-1, SS-2, BS-2, and B-3) and the other sites by perennial groundwater sources or recharge locations farther away (SS-3, BS-1, and BS-4). The isotopic composition of rainfall from multiple elevations in the two catchments indicated distinct seasonal patterns with higher enriched values observed during the dry season months. Such seasonality confirms with other studies that the source of water vapor for rainfall in monsoon and dry season is different. The isotopic signature of springs did not show apparent spatiotemporal variations observed in the rainfall events, but values located close to the LMWL indicate a dominant contribution from rainfall. The isotopic signatures of rainfall and spring samples are comparable to previous studies.The recharge elevation range of 1,000-1,100 m asl for springs in Banlek, falling within the catchment boundary, and 2,600-2,700 m asl for springs in Shikarpur, were estimated. It was observed that, unlike in Banlek, the recharge zone for springs in Shikarpur lies outside the surface-water catchment boundary, necessitating conservation measures beyond the demarcated drainage boundary. In Banlek, the small and gentle sloped topographic plateau located upstream of the springs supports the recharge elevation zones identified by the isotope analysis. The demarcated recharge zones will support the BCRWME project to prioritize interventions based on their scientific and practical viability to suit site-specific conditions; furthermore, categorizing springs fed by the unconfined aquifer in each catchment can assist in augmenting recharge with climate-resilient interventions. Of the proposed interventions for Shikarpur, piped diversion may be a better investment. For Banlek, afforestation, grazing management, gully protection, on-farm conservations and recharge ponds should be concentrated in identified recharge zones. For the first time, this isotopic study provided an evidence base to derive quantitative information on spring recharge areas in small mountainous catchments in Far-Western Nepal region. This successful pilot study will be scaled up by the DFSC in future iterations of the project to delineate spring recharge zones and design interventions to build resiliency in springs. "}
|
main/part_1/0260254978.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"701d1fac0f4d048c8dde4cdf73d4d546","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/382e1969-9ec9-4471-8a7f-05581647b3bc/retrieve","id":"1336228794"},"keywords":["nitrogen fertilizer","microorganisms","nitrification inhibitor","bacteria","archaea","fungi"],"sieverID":"aa24b57f-3270-4b72-8452-9932451372cd","content":"Dicyandiamide decreased N 2 O emissions even under 40°C.• Ammonia oxidizers and nirS were well adapted to 40°C in manured soils.• Fungal nirK tolerated high temperature better in urea than manure treatment.• Compared to nosZII, nosZI adapted to all temperature regardless of fertilization.• nirS-denitrifier dominated N 2 O emissions at high temperature in fertilized soil. Heat waves associated with global warming and extreme climates would arouse serious consequences on nitrogen (N) cycle. However, the responses of the functional guilds to different temperatures, especially high temperature and the cascading effect on N 2 O emissions remain unclear. An incubation study was conducted to examine the effect of different temperatures (20°C, 30°C, and 40°C) and fertilizer types (urea and manure) on N 2 O-producers and N 2 O-reducers, as well as the efficacy of dicyandiamide (DCD) on N 2 O emissions in a vegetable soil. Results showed that ammonia oxidizers and nirS-type denitrifiers were well adapted to high temperature (40°C) with manure application, while the fungal nirK-denitrifiers had better tolerance with urea application. The nosZ clade I microbes had a strong adaptability to various temperatures regardless of fertilization type, while the growth of nosZ clade II group microbes in non-fertilized soil (control) were significantly inhibited at higher temperature. The N 2 O emissions were significantly decreased with increasing temperature and DCD application (up to 60%, even at 40°C). Under high temperature conditions, fungal denitrifiers play a significant role in N-limited soils (non-fertilized) while nirS-type denitrifiers was more important in fertilized soils in N 2 O emissions, which should be specially targeted when mitigating N 2 O emissions under global warming climate.Nitrous oxide (N 2 O) is a powerful greenhouse gas (GHG) with a global warming potential approximately 300 times that of carbon dioxide (CO 2 ) on a 100-year time horizon (IPCC, 2007(IPCC, , 2014)). Additionally, N 2 O destroys the stratospheric ozone layer (Ravishankara et al., 2009). Agriculture is the main source of anthropogenic N 2 O emissions because of N fertilizer application (Kuypers et al., 2018). N 2 O emissions are expected to increase continuously with the excessive use of fertilizer to meet the growing demand for food production (Thompson et al., 2019;Zhang et al., 2020).Nitrification and subsequent denitrification are thought to be the main pathways of N 2 O emissions in soil (Voigt et al., 2020). These pathways are mainly driven by functional microbes, including N 2 O-producers and N 2 O-reducers (Xu et al., 2020). Ammonia oxidizers (i.e., archaeal and bacterial ammonia oxidizers, respectively AOA and AOB), bacterial denitrifier (i.e., nirS-and nirK-type denitrifiers), and fungal denitrifiers (i.e., fungal nirK-type denitrfier) are common N 2 Oproducers. These functional microbes are temperaturesensitive and their relative contributions to N 2 O emissions vary, depending on their inherent sensitivity of temperature, fertilizer types, and soil types (Lai et al., 2019;Mukhtar et al., 2019;Li et al., 2021;Xu et al., 2021). For example, it was reported that ammonia oxidizers and bacterial denitrifiers were all significantly inhibited under high temperatures, while fungal denitrifiers were well adapted and might be the dominant contributor of N 2 O emissions in an acidic soil (Xu et al., 2017). Other studies have also indicated that temperature change may cause niche differentiation of these N 2 O-producers during the production of N 2 O emissions (Yin et al., 2017;Duan et al., 2019a;Lai et al., 2019). However, the responses of N 2 O-producers to different temperatures and the underlying pattern, depending on fertilizer type are still poorly understood (Stein, 2020;Yin et al., 2022).The currently known N 2 O-reducers are nosZ clade I (nosZI) and nosZ clade II (nosZII), which are responsible for encoding the N 2 O reductase, the enzyme catalyzing the last step of denitrification (N 2 O→N 2 ) (Domeignoz-Horta et al., 2018). This pathway represents the only known biological sink of N 2 O emissions (Samad et al., 2016). Compared with nosZI group, nosZII group is newly identified and less studied (Xu et al., 2020). Recent studies have indicated that these two clades have largely different characteristics, and their sensitivities to environmental variations and agricultural practices also largely differ (Stein, 2020). It was reported that nosZII group, rather than nosZI group, was better adapted to warmer and drier conditions (Xu et al., 2020), and explained the variation of in situ N 2 O emissions (Domeignoz-Horta et al., 2018). Comparably, other studies have found that the nosZI-type denitrifiers adapt to various temperature conditions and are sensitive to high temperature, playing an important role in N 2 O consumption (Cui et al., 2016;Xing et al., 2021). Thus, the niche separation of the two clades of nosZ-type denitrifiers in response to increased temperature remains unclear. Considering that these two clades dominate the only known biological sink of N 2 O emissions, their responses to different temperatures need further investigation to better predict future N 2 O emissions and develop mitigation strategies under global warming.Dicyandiamide (DCD) is an effective nitrification inhibitor which is widely used to mitigate N 2 O emissions (Di et al., 2014). The efficiency of DCD strongly depends on soil conditions, especially soil moisture contents and soil temperature (Di and Cameron, 2016;Wu et al., 2017;Guo et al., 2021). The application of DCD can effectively inhibit ammonia oxidization to decrease nitrate production, inhibit denitrification, and hence decrease N 2 O emissions (Guo et al., 2014;Di and Cameron, 2016). Since DCD is susceptible to biodegradation, it is commonly used in autumn or winter when the temperature is relatively low (Kelliher et al., 2014). In the context of global warming, extreme heat climates will appear more frequently (IPCC, 2014;Zhang et al., 2020). However, the effectiveness of DCD at the temperature higher than 30°C has not yet been tested. Additionally, the efficacy of DCD can be modulated by different fertilizer types (Sha et al., 2020a(Sha et al., , 2020b)). The interactive effects of fertilizer types and increasing temperatures on the efficacy of DCD require further investigation to provide accurate fertilization tactics and mitigation strategies under the on-going climate warming conditions.This study aimed to examine the interactive effects of temperature (20°C, 30°C, and 40°C) and fertilizer type (urea and manure) on N 2 O-producers (including AOA, AOB), nirS/ K-type bacterial denitrifiers and fungal nirK-type denitrifiers) and N 2 O-reducers (including nosZI and nosZII clade) in a vegetable soil. It also examined the efficiency of DCD on reducing N 2 O emissions under different temperature conditions. We hypothesized that 1) increasing temperature would decrease the inhibitory efficiency of DCD on N 2 O emissions; 2) AOA and fungal nirK-type denitrifier would be more adapted than other N 2 O-producers to high temperature with manure application; 3) different temperature conditions would lead to niche separation of the two clades of nosZtype denitrifiers.The soil used in this study was collected from a vegetable field in Quzhou, Zhejiang Province (28°45′ N, 118°20′ E) and is classified as Alfisol (yellow-brown soil). The sampling site was characterized as a subtropical monsoon climate, with a mean annual temperature of 17.3°C and precipitation of 1843 mm. The soil samples were collected from 0 to 20 cm surface soil at five random locations, and then mixed to make a composite sample. Fresh soil was passed through a 5-mm sieve and stored at 4°C until the commencement of the incubation experiment. About 500 g soil was air-dried to determine the physical and chemical properties. The soil had the following properties: pH (1:2.5 H 2 O) 7.2, organic C (carbon) 10.02 g kg −1 , total N (nitrogen) 1.21 g kg −1 , available P (phosphorus) 12.4 mg kg −1 and available K (potassium) 131.2 mg kg −1 .Pig manure was obtained from a local pig farm and composted with sawdust. It had pH (H 2 O) 7.3, the mean organic C, total N, total P and total K concentrations of 298.8, 15.5, 12.6 and 0.1 g kg −1 (dry matter), respectively, and the NH 4 + -N and NO 3 --N concentrations of 72.1 and 6.3 mg kg −1 , respectively.The experiment consisted of 5 fertilizer treatments, 3 temperatures and 3 replicates. The five treatments were: 1) Control (no fertilizer application); 2) Urea (400 kg N ha −1 ); 3) Manure (400 kg N ha −1 ); 4) Urea (400 kg N ha −1 ) + DCD (20 kg ha −1 ) and 5) Manure (400 kg N ha −1 ) + DCD (20 kg ha −1 ). The N amount was chosen to simulate the local management practice of the intensive vegetable production. The three selected temperatures were 20°C, 30°C, and 40°C. Two sets of parallel incubation experiments were set up, with one set for soil sampling and the other for gas sampling, according to Xu et al. (2017).For each treatment of the soil sampling experiment, 1 kg of sieved soil (dry weight basis) was placed into a 1-L plastic incubation container (12 cm diameter) with two 1-cm holes on the lid to maintain air exchange. Urea was dissolved in deionized water and added to soil evenly. Manure was passed through a 3-mm sieve and well mixed with soil. Soil sampling of each treatment was performed after 0, 5, 10, 19, 26, 41, 54, 68 and 90 days of incubation. For the gas sampling set of the experiment, 500 g of sieved soil was placed into a 1-L glass jar (10.0 cm diameter). Three fifths volume of the jars was left empty for gas sampling. Gas sampling was carried out twice a week in the first month of incubation, and then weekly until the end of experiment. During the gas sampling, the jar was sealed by a lid with rubber stopper, which was linked with a three-way valve and syringe. Gas samples were taken at 0, 20 and 40 min and stored in 9-mL glass vials.The soil water content was adjusted to field capacity (the water content was 23.4%) in all treatments. The weight of the containers was adjusted twice to three times per week to maintain the 100% field capacity of soil moisture content during the incubation period.Soil NH 4 + -N and NO 3 − -N were extracted from 5 g soil sample with 50 mL of 1 M KCl, shaken at 250 rpm for 1 h. After filtration, NH 4 + -N and NO 3 − -N in the filtrates were measured using a flow injection analyzer (SAN + + , Skalar, Netherlands). N 2 O concentration of the gas samples was determined by gas chromatography (GC-2010 Plus SHIMADZU, Japan).Soil samples from days 0, 20, and 65 were used for DNA extraction and functional gene analyses. Soil DNA was extracted from 0.5 g fresh soil using a FastDNA spin kit for soil (MP Biomedicals, OH, USA), according to the manufacturer's protocol. The quality of DNA extracts was checked by gel electrophoresis and concentrations were determined using a Nanodrop® ND-2000 UV-vis spectrophotometer (NanoDrop Technologies, Wilmington, DE, USA). Real-time fluorescent quantitative PCR analysis of the functional genes of ammonia oxidizers (bacterial and archaea amoA genes) and denitrifiers (nirS/nirK, fungi nirK, nosZI and nosZII) was performed by the LightCycler® 480II (Roche, German). The details of the primers and thermal profiles for each target gene were described in Liu et al. (2019). Each 20-μL reaction system included 1−10 ng of the template DNA, 0.16−0.3 μL of each primer, 10 μL SYBR® Premix Ex Taq™ II (TaKaRa, Japan) and milli-Q water to the final volume. Melting curve analysis was performed at the end of each run to confirm the PCR product specificity. Standard curve for qPCR were made as follows: each target gene was first PCR amplified and then purified by a PCR cleanup kit (Macherey-Nagel Inc, Germany). The purified PCR products were cloned into the pGEM-T Easy Vector (TransGen Biotech, China), and then transformed into Escherichia coli JM109 competent cells (TransGen Biotech, China). The plasmid was extracted by a MiniBEST Plasmid Purification Kit (TaKaRa, Japan). The concentration of the plasmid was measured by a Nanodrop® ND-2000 UV-vis, and 10-fold serial dilutions of plasmid with known gene copy number were used as standard curve. To avoid possible inhibitions of the qPCR reactions, a series of 10-fold dilutions of the DNA samples were included during the assessment. The amplification efficiencies reached 90%−101% after 10-fold dilution which was used for the final qPCR analysis. The reaction specificity was confirmed by the melting curve analysis at the end of each run.The AOA and AOB communities were analyzed by MiSeq sequencing of 16S rRNA genes in the V4-V5 regions with the universal primers 515F and 907R (Xu et al., 2020). A total of 2 361 339 16S rRNA gene high quality sequence reads were obtained. The raw data were processed using the Quantitative Insight Into Microbial Ecology (QIIME2).Only sequences with quality score > 20 and read length > 200 bp and without ambiguous calls were included for the subsequent analyses. These selected sequences were then binned into one operational taxonomic unit (OTUs) at a 97% identity threshold. Reads classified as AOB and Thaumarchaeota or unclassified archaea were screened out for phylogenetic trees construction by the Molecular Evolutionary Genetics Analysis (MEGA 4.0) with 1 000-fold bootstrap.The data set of gene sequences was deposited under BioProject accession number PRJCA005798 in National Genomics Data Center's Genome Sequence Archive (GSA).Hourly N 2 O emissions were calculated according to Hutchinson and Mosier (1981) by using the slope of glass jar headspace N 2 O concentration change from the collected three samples. Cumulative emissions were calculated according to Di et al. (2007) by integrating the measured daily fluxes which were calculated using hourly N 2 O fluxes.One-way analysis of variance (ANOVA) followed by Duncan-test was performed to check the differences in total N 2 O emissions and functional gene abundances (Wang et al., 2023). Two-way ANOVA was conducted to test the significance of the effects of fertilizer type and temperature and their interactions on the abundances of N 2 O-producers and N 2 O-reducers. One-way and two-way ANOVA were performed by SPSS version 20 (IBM Co., Armonk, NY, USA). P < 0.05 was regarded as statistically significant. The correlation analysis of inorganic N, functional gene abundance and N 2 O emission was calculated and visualized in GGally, ggplot2 and wesanderson packages of R. Structure equation modeling (SEM) was used to evaluate the direct and indirect effects of temperature on mineral N concentrations, functional gene abundances and N 2 O emissions using AMOS 24.The treatment during 41 days of incubation at 30°C (P < 0.05) (Fig. 1D, E). The application of DCD reduced NO 3 − -N concentrations at 20 and 30°C (Fig. 1D, E). However, the NO 3 − -N concentration at 40°C was low and was not significantly affected by fertilizer treatment (Fig. 1F).At 20°C, the application of manure significantly increased hourly N 2 O emissions compared with the urea and control treatments (P < 0.05) with a significant N 2 O peak of 0.64 mg N 2 O-N m −2 h −1 at day 20 (Fig. 2A). The hourly N 2 O emissions with urea were significantly higher than those in the control treatment between days 11 to 27 (P < 0.05) (Fig. 2A). At 30°C, significant N 2 O peaks of 0.12 mg N 2 O-N m −2 h −1 at day 20 and 0.25 mg N 2 O-N m −2 h −1 at day 27 were observed in the urea and manure treatments, respectively (Fig. 2B). However, at 40°C, the application of manure hardly affected N 2 O emissions with a small peak of 0.06 mg N 2 O-N m −2 h −1 and 0.04 mg N 2 O-N m −2 h −1 observed at days 33 and 56, respectively (Fig. 2C).Total N 2 O emissions in the manure treatment were significantly higher than those in the urea and control treatments at 20°C and 30°C (P < 0.05) (Fig. 2D). At all temperature conditions, the application of urea significantly increased total N 2 O emissions compared with the control (P < 0.05) while DCD addition significantly decreased total N 2 O emissions (Fig. 2D).The inhibition efficiency of DCD at 20°C was higher than that at 30 and 40°C in the urea and manure treatments. At 40°C, DCD decreased N 2 O emission by approximately 60% (Table 1).Fertilizer type and temperature and their interaction had significant effects on AOA and AOB abundance (P < 0.01) (Table 2). Specifically, the application of manure significantly increased the abundance of archaeal amoA gene by one to two orders of magnitude at 20°C and 40°C after 65 days of incubation (Figs. 3A and C) and at 30°C after 20 days (P < 0.05) (Fig. 3B). The application of urea significantly increased the bacterial amoA gene abundance at 20°C and 30°C by day 65 (P < 0.05) (Fig. 3D and E). Manure addition significantly increased bacterial amoA gene abundance at 30°C and 40°C compared with the control treatment after incubation for 65 days (P < 0.05) (Fig. 3E and F). The application of DCD significantly decreased the abundance of AOA and AOB in the urea and manure treatment at 20°C and 30°C after 65 days of incubation, but decreased the abundance of AOA and AOB only in the manure treatment at 40°C. Phylogenetic analysis of 16S rRNA genes showed that 98.8% of the AOA-like sequences affiliated to group 1.1b (Fig. S1A). Specifically, half of the total archaeal 16S rRNA gene sequences were affiliated with Nitrosocosmicus cluster with manure application at 30°C. In addition, at 40°C, 15.9%, and 15.2% of the total archaeal 16S rRNA gene sequences were classified into Nitrososphaera cluster in the manure and control treatments, respectively (Fig. S1). As for AOB community, most of the AOB 16S rRNA gene sequences were affiliated with Nitrosospira cluster 3 (Fig. S1B). At 20°C, the sequences affiliated with Nitrosospira cluster 3 occupied 7.7%, 29.2% and 5.6% of the total AOB 16S rRNA gene sequences in the control, urea and manure treatments, respectively. At 30°C, 6.5%, 35.3% and 5.3% of the total AOB 16S rRNA gene sequences were classified into Nitrosospira cluster 3 in the control, urea and manure treatments, respectively (Fig. S1B). Fertilizer type, temperature and their interaction had significant effects on nirS gene abundance (Table 2). There were significant increases of the nirS gene abundance in all treatments over time after incubation for 65 days at 20 and 30°C (P < 0.05) (Fig. 4A and B). At 40°C, only manure application significantly increased the nirS gene abundance which was higher than that in 20°C and 30°C (Fig. 4C). The application of DCD significantly increased the abundance of nirS gene in the urea treatments after 65 days of incubation at 20°C and 30°C. Manure application significantly increased the nirK abundance at 20°C at day 65 (P < 0.05) (Fig. 4D), but did not affect it at 30°C and 40°C (Fig. 4E and F). The addition of urea and manure significantly increased the nirK abundance after incubation for 20 and 65 days at 20°C and 20 days at 30°C in the urea and manure treatments (Fig. 4D and E). The application of DCD significantly decreased the abundance of the nirK gene abundance in manure treatment after incubation for 20 and 65 days at 20°C. Fertilizer type had no significant effect on the fungal nirK gene abundance at day 20 (P > 0.05) (Table 2). The fungal nirK gene abundances at 40°C were higher than those at 20°C and 30°C (Fig. 4G−H). Moreover, the fungal nirK gene abundances significantly increased from 5.43 × 10 5 at day 0 to 2.53 × 10 6 and 2.86 × 10 6 at days 20 and 65 with urea application at 40°C (P < 0.05) (Fig. 4I).Significant increases of nosZI gene abundance were observed in the control, urea and manure treatments at all three temperatures after incubation for 20 and 65 days (P < 0.05) (Fig. 5A−C). Fertilizer type and temperature had significant effects on nosZ gene abundance at day 20 (P < 0.01), but only fertilizer type affected nosZ gene abundance at day 65 (P < 0.01) (Table 2). Comparably, the abundance of nosZII gene was significantly affected by both fertilizer types and temperature (Table 1). After 20 and 65 days of incubation, the application of urea and manure significantly decreased nosZII abundance at 20°C, while the application of urea significantly increased its abundance at 30°C. The application of urea and manure had no significant effect on the abundance of nosZII gene at day 20, but the application of urea and manure, together with the DCD addition, significantly increased their abundance at day 65 (Fig. 5D−F).Linear and polynomial regression analysis showed that N 2 O emissions had a positive correlation with the abundances of AOA, AOB, nirK gene, nirS gene and nosZII at 20°C, with the abundance of nirK gene at 30°C and with nirS gene, fungal nirK and nosZI gene at 40°C (P < 0.05) (Fig. 6).The impact of temperature on mineral N concentrations, related microorganisms and N 2 O emissions varied, depended on fertilizer type (Fig. 7). In the control treatment, temperature had negative direct influence on NO 3 − -N concentration (P < 0.001), AOB abundance (P < 0. 01) and N 2 O emissions (P < 0.001). The concentration of NO 3 − -N had a negative effect on the abundances of nosZI (P < 0.05) and fungal nirK genes (P < 0.001). The abundance of AOB and fungal nirK respectively had direct negative and positive effects on N 2 O emissions (Fig. 7A). In the urea treatment, temperature also had direct negative effect on NO 3 − -N concentration (P < 0.01). The concentration of NO 3 − -N positively influenced the abundances of AOB (P < 0.001), AOA (P < 0.001) and nirS gene (P < 0.05), but negatively influenced the abundance fungal nirK gene (P < 0.05). AOA and nirS-type denitrifier were negative and positive direct contributors to N 2 O emissions, respectively (Fig. 7B). In the manure treatment, temperature had direct negative effects on the abundances of nirK (P < 0.001) and nirS (P < 0.001) genes and N 2 O emissions (P < 0.05), but had a direct positive effect on AOA abundance (P < 0.05). The abundance of nirS gene was positively related with N 2 O emissions (P < 0.001) (Fig. 7C).4.1 The effect of temperature on N 2 O emissions and the DCD efficacyOur results showed that the N 2 O emissions were significantly decreased with the increased temperature, and were the lowest at 40°C (Fig. 2). The decreased N 2 O emissions had mainly resulted from lower nitrification rate as indicated by the concentrations of ammonium and nitrate at 40°C (Fig. 1).In addition, increasing temperatures had a significant negative effect on N 2 O emissions in the control and manure treated soils but not in the urea-treated soils (Fig. 7). This might be because the application of different fertilizer types modulated the adaptability of the functional guilds under different temperatures and thus consequently affected the response of N 2 O emissions (Duan et al., 2019b;Jansson and Hofmockel, 2020;Stein, 2020). Our results showed that N 2 O emissions were linked to the abundances of AOA, AOB, nirK-and nirS-type denitrifiers, and nosZII group at 20°C, but only linked to the abundance of nirK-type denitrifiers at 30°C, and to the abundances of nirS-type denitrifiers, fungal nirK-type denitrifiers and nosZI clade at 40°C (Fig. 6). These findings indicate that ammonia oxidizers and bacterial denitrifiers were the dominant microbes at 20°C and 30°C, while bacterial denitrifiers and fungal denitrifiers were the dominant microbes at 40°C, showing a significant niche differentiation under different temperatures.The application of DCD significantly inhibited the N 2 O emissions at all temperature conditions, but the efficiency of DCD decreased with increased temperature, supporting our first hypothesis. The results are also consistent with a previous report that DCD was easy to biodegrade under high temperatures (Di and Cameron, 2016). It has been suggested that the DCD is better to be applied at a temperature under 10°C to achieve the maximum effectiveness and longevity (Kelliher et al., 2014). Nevertheless, under the high temperature of 40°C, DCD still had a significant effect to decrease N 2 O emission by approximately 60%.The inhibitory effect of DCD was linked to both of AOA and AOB in the urea-and manure-treated soils (Fig. 3). The targeted group of DCD could reflect the active ammonia oxidizers during nitrification (Fan et al., 2019;Prosser et al., 2020), and our results showed that both of AOA and AOB played significant roles during nitrification and N 2 O emissions under different temperatures in this slightly alkaline vegetable soil. It was previously reported that the abundance of both AOA and AOB was significantly inhibited at 40°C in an acidic forest soil (Xu et al., 2017). Comparably, the abundance of AOA and AOB was significantly increased at 40°C and was inhibited by the application of DCD. This could cause a cascading effect on denitrification and lead to a significant reduction of N 2 O emissions at 40°C.In this study, the abundance of AOA and AOB was strongly affected by the fertilizer types and temperature. The application of manure rather than urea significantly increased AOA growth at the three selected temperatures (Fig. 3). The SEM result further suggested that temperature had a direct positive effect on AOA abundance in the manure treatment. Our results were consistent with previous studies showing that organic N rather than chemical fertilizer stimulated the abundance of AOA (Zhou et al., 2015;Gao et al., 2022). The AOA preferred N-poor environments compared with AOB, and high level of urea-N input (as high as 400 kg N ha −1 ) would inhibit their growth (Di et al., 2009;Stein, 2019).This study also showed that AOA abundance in the manure treatment at 40°C was an order of magnitude higher than that at 20°C and 30°C (Fig. 3). Previous studies found some AOA were obligately thermophilic (e.g., Ca. Nitrosocaldus yellowstonii and Nitrosocaldus islandicus) which can grow well at extreme high temperature habitats (de la Torre et al., 2008;Daebeler et al., 2018) or even some moderately thermophilic AOA (e.g., Ca. Nitrososphaera gargensis) can grow at 46°C (Roland Hatzenpichler, 2008). However, phylogenetic analysis showed AOA in the manure treatment not only affiliated with Nitrososphaera cluster but also with Nitrosocosmicus cluster at 40°C (Fig. S1). Pure cultures demonstrated Nitrosocosmicus franklandus grew at 30− 45°C and the optimal temperature was 40°C (Lehtovirta-Morley et al., 2016), which concurred with our results. Thus, the Nitrososphaera and Nitrosocosmicus clusters might be the dominant ammonia oxidizer archaea which were well adapted to high temperatures with manure application.The significant growth of AOB at 20°C and 30°C with urea application demonstrated that AOB are favored with high-N environments (Xu et al., 2021). However, at 40°C, no significant increase of the AOB abundance with urea was observed, indicating that high temperature had inhibited AOB growth (Cui et al., 2016;Duan et al., 2018). Previous studies showed that the optimum temperature for AOB ranged between 20 and 31°C, and 12°C lower than that for soil AOA (Ouyang et al., 2017;Taylor et al., 2017). The community of AOB was mainly affiliated with Nitrosospira cluster 3, and the maximum ammonia-oxidation activity for the isolated strains of Nitrosospira was between 10°C and 33°C (Avrahami et al., 2003;Zhao et al., 2020). Interestingly, manure application significantly stimulated the abundance of AOB at 40°C (Fig. 3). This could be because the soil microenvironment in manured soil matrix had lower temperature than ambient temperature, thus more suited for AOB growth (Stein, 2019;Li et al., 2020;Xu et al., 2020). However, to date, no literature reported the activity of AOB at a temperature higher than 40°C.Significant increases of nirS-type denitrifiers in all treatments and nirK-type denitrifiers in the manure treatment indicated that fertilizer type had a significant effect on the abundance of nirS and nirK genes. The high content of organic C in the manure could be an energy source for denitrifiers (Kuypers et al., 2018;Stein, 2020). Furthermore, the significant amount of C in the manure could accelerate microbial activity, and facilitated soil anaerobic conditions (Zhou et al., 2017;Xu et al., 2020), creating a more suitable environment for denitrifiers. Compared with nirK-type denitrifiers, nirS-type denitrifiers could be well adapted to high temperature as evidenced by their higher abundance. Our findings are consistent with previous studies showing that the abundance of nirS rather than nirK gene increased with increasing temperature with organic fertilizer in alkaline soils (Cui et al., 2016;Xu et al., 2020).The application of manure also significantly increased fungal nirK gene abundance at 20°C and 30°C while urea addition enhanced it at 40°C (Fig. 4G−I), displaying an interactive effect of fertilizer type and temperature (Table 2). Furthermore, the fungal nirK gene abundances at 40°C especially with urea were one order of magnitude higher than those at 20°C and 30°C, suggesting some fungal nirKdenitrifiers had better tolerance to high temperature (Xu et al., 2017). However, the effect of fertilizer type on thermotolerant fungal nirK needs further investigation because the species of fungi denitrifiers have been reported to be thermotolerant with organic fertilizers (i.e., manure) rather than inorganic fertilizers (i.e., urea) (Chen et al., 2015;Xu et al., 2017;Xu et al., 2020).Fertilization affected the responses of N 2 O-producers to high temperature condition, thus modulating their dominant role in N 2 O emissions (Figs. 6 and 7). Our results indicated that the fungal denitrifiers played a significant role in N 2 O emissions under high temperature conditions in non-fertilized soil at 40°C, while the bacterial denitrifiers played a significant role in N 2 O emissions with sufficient substrates (urea-and manure-treated soils), with the nirS-type denitrifiers being specifically important under high temperatures (40°C). This was consistent with a previous observation (Cui et al., 2016), and thus nirS-type denitrifiers might be targeted microbes to decrease N 2 O emissions under the warming climate, especially in intensive agroecosystems with heavy use of fertilizers.The responses of nosZI and nosZII clade microbes to different fertilizer types and temperatures differed largely (Fig. 5). The nosZI group was well adapted to all the temperature conditions regardless of fertilizer treatment, and its abundance in both control and fertilized soils significantly increased with incubation time. Additionally, the growth of nosZI group was not affected by temperature after 65 days of incubation, indicating that this clade nosZ microbes had a strong adaptability to various temperatures (Xu et al., 2020;Xing et al., 2021). Comparably, the abundance of nosZII group microbes was significantly affected by both fertilizer type and temperature, showing a niche differentiation between these two different clades. Increasing temperature significantly decreased the abundance of nosZII in the nonfertilized soil (control), but increased it when urea or manure was applied, indicating that the nosZII clade microbes could only adapt to higher temperatures when substates were sufficient. This was consistent with a field study showing that the nosZII clade microbes were adapted to a warmer and drier condition with the application of urea and manure (Xu et al., 2020). The regression analysis showed that the nosZII group microbes were dominant at lower temperature (20°C), while the nosZI clade microbes were dominant at higher temperature (40°C) (Fig. 6). Similar results were observed in an acidic soil where the nosZI group exhibited a significant variation at 35°C, and played a significant role in N 2 O consumption (Xing et al., 2021). Comparably, the diversity of nosZII rather than nosZI explained more of the variation of in situ N 2 O emissions at relatively lower ambient temperature conditions (Domeignoz-Horta et al., 2018). Taken together, these results indicate that different temperatures could lead to a significant niche separation of the two clades of nosZtype denitrifiers as we hypothesized. We highlighted the important role of nosZII at lower temperature (< 30°C), and of nosZI at higher temperature (> 35°C) in N 2 O consumption. As these two clades represented the only known biological sink of N 2 O emissions, we suggest that this should be further studied in various agroecosystems in order to develop efficient mitigation strategies.Our results showed that temperature and fertilizer types had interactive effects on both N 2 O-producers and N 2 O-reducers. AOA, AOB and nirS-type but not nirK-type denitrifiers were well adapted to high temperature as high as 40°C with manure application. Comparably, the fungal nirK-denitrifiers had better tolerance to high temperature with the application of urea. The nosZI microbes had a strong adaptability to various temperatures while the nosZII clade microbes were only adapted to higher temperatures with fertilization, showing a niche differentiation between these two different clades. Temperature and fertilizer types also caused a cascading effect on N 2 O emissions and the dominant functional microbes. Increasing temperature and the application of DCD significantly decreased N 2 O emissions. Generally, fungal denitrifiers played a significant role in N 2 O emissions under high temperature conditions in non-fertilized soils, while bacterial denitrifiers were more important in soils fertilized with urea or manure, with the nirS-type denitrifiers being specifically important under 40°C. Our results indicate that different functional groups should be targeted to mitigate N 2 O emissions under various temperature conditions. Specifically, the important role of nirS-type and nosZI denitrifiers in N 2 O emissions under high temperature conditions should be further studied in various ecosystems to better predict future N 2 O emissions and develop effective mitigation strategies under global warming."}
|
main/part_1/0269590882.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"2acc29ad627c62988f5158273dde88ce","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/c5892788-a088-494a-96f2-65af95de6fd7/retrieve","id":"-1166297719"},"keywords":[],"sieverID":"6c7f6005-7cd5-4be6-bfd1-be3533fa2f4b","content":"The preamble to this paper highlights some of the major policy issues facing Vietnam as far as its supply of pork is concerned, in particular, the problem of its demand for pork rising at a faster rate than its supply. Some relevant background to this research project is provided by outlining selected features of Vietnam's pig industry. Then the main findings (in the view of the author) from this ACIAR-funded research are presented. These results include (1) natural protection given to Vietnam's pig producers from imports as a result of the nature of the preferences of Vietnamese consumers: (2) the importance of household labour, especially that provided by females, in the husbandry of pigs held by households; (3) the existence, or otherwise, of scale economies as a function of the number of pigs held by households and the economic efficiency of small producers, (4) the import dependence for pig food of Vietnam's pig industry and the way in which it varies with the number of pigs kept by households; (5) specialization in pig production, (6) regional differences in the economics of pig production; (7) economic discrimination in the supply of inputs to household producers of pigs and in their sale of pigs; (8) the size of pig-holdings and the use of professional services, such as veterinary services and extension services; and (9) findings about miscellaneous matters, such as the genetic composition of the pig stock. Scope for future research in relation to these aspects is also highlighted, and the need is raised for considering the economics of increasing quality standards and certifying the quality of pork. The economics of increasing the scale of pig producing units is given particular attention. Vietnam's policy options for improving the balance between its demand for pork and its supply are considered and the important role that household (small producers) have and can play in this regard are highlighted.Small household pig producers are the dominant suppliers of pork in Vietnam and currently account for about 90% of its pork supply and about the same share of its pig stock (Tisdell, 2009b). Although domestic pork supplies have more than doubled since Vietnam began its market reforms, this growing supply has been outpaced by the rising demand for pork in Vietnam. This has resulted in an escalation in the real price of pork because (as discovered in this ACIAR-sponsored research) Vietnamese have a very strong (and enduring) preference for fresh (warm) pork and therefore, avoid chilled, frozen and processed pork (CAP and ILRI, July 2010b; Lapar and Toan, 2010). Hence, they tend to avoid imported pork because of necessity, it must be chilled, frozen or be used in processed form. Consequently, any increased demand for pork in Vietnam must primarily be filled by domestic pig producers.The strong preference of Vietnamese for fresh pork also seems to have many other consequences. It results in pigs being slaughtered in Vietnam close to the places where they are consumed rather than far away. Otherwise, the meat would need to be chilled or frozen for transport. Furthermore, Vietnamese are reluctant to buy pork in supermarkets and mostly buy it frequently from traditional market outlets which have fresher meat. The penchant of the Vietnamese for really fresh meat has many implications for the development of Vietnam's pig industry. These include a high degree of natural protection for its domestic pig industry and a concentration of pigrearing close to its major cities, that is in peri-urban areas.The escalation in the real price of pork (and other livestock products) is of concern to the Vietnamese government because of its magnitude and the importance of pork in the diet of the Vietnamese. The rapid rise in the price of pork is a reflection of the growing demand for pork in Vietnam as a result of its economic growth (rising levels of per capita income, a growing population and greater urbanization) and the inability of domestic pork production to increase at a comparable rate.As a result, important policy issues have risen in relation to Vietnam's pig industry.For example, how can Vietnam further increase its domestic supply of pork in an economically efficient way? Is the main supply constraint in this supply 'shortage' the lack of competitiveness and lack of efficiency of small household pig producers, as suggested by some policy-makers? Therefore, should their competitiveness be improved or should government policy favour production by large commercial producers of pigs as is recommended in Vietnam's livestock development strategy (Ministry of Agriculture and Rural Development, 2010)? What particular measures should be adopted to further increase Vietnam's level of pork production? These issues have arisen mainly because Vietnam has been very successful in increasing and maintaining its economic growth since the start of its economic reforms -they are problems arising from Vietnam's economic success.It will be argued in this paper that in its effort to boost its pork supply, Vietnam should not neglect the needs of household producers of pigs. This is because they supply the major proportion of Vietnam's pork and although their relative importance as pork suppliers is declining, they are likely to be the major suppliers of pork in Vietnam for some time to come. This hypothesis is reinforced by quantitative conclusions from the model of N. Minot and K. Rich. They conclude that the modern pig sector is likely to remain small over the next decade and beyond (Minot, 2010). Furthermore, at this stage of Vietnam's economic development, most household producers are cost-effective suppliers of pork. Furthermore, because pig food is the major cost incurred in raising pigs, ways should be explored to keep its costs down, increase its domestic supply and ensure that it is efficiently used. The high cost of pig food in Vietnam seems to be a significant barrier to the expansion of Vietnam's pork production.Interesting results have emerged from the ACIAR-sponsored project \"Improving Competitiveness of pig producing in an Adjusting Vietnam Market,\" particularly as far as the economic status of holders of small stocks of pigs is concerned. Small pigholders account for the majority of Vietnam's stock of pigs. It is households (as distinct from registered pig farms) that account for virtually all of Vietnam's small holdings of pigs. In 2006, for example, households having 5 pigs or less accounted for 83.4% of pig stocks held by Vietnamese households and households accounted for about 90% of pig stocks and registered farms the remainder (Tisdell, 2009b). This suggests that in 2006 household pig producers supplied about 90% of Vietnam's production of pork. It may have fallen since then to around about 85%. Thus households possessing small stocks of pigs continue to dominate Vietnam's pig industry, even though their relative share of total pig production is declining slowly (Tisdell, 2010a).In the last few decades, economic mechanisms used to direct and allocate resourceuse in Vietnam have undergone considerable change as a result of this increased adoption of market mechanisms and the greater openness of Vietnam to international trade. A programme, Doi Moi (Renovation), for the reform of Vietnam's economic system so as to make it more market-oriented was adopted by the Vietnamese Government in 1986. According to Son et al. (2006), \"this was followed by a series of reforms that effectively ended the system of resource allocation by central planning by 1989. Reforms since 1990 have therefore, been aimed at adjusting the institutional and regulatory framework in order to ensure that markets can function well.\" Pig producers have had to adjust to this economic transition which potentially could have reduced the relative competitiveness of small pigholders and the comparative international competitiveness of Vietnam's pork industry. Given these changes, how have smallholders of pigs managed to remain competitive and how generally has Vietnam's pig industry been able to cope? This study (which used sample surveys to examine the retail market for pork in Vietnam and to obtain information about the production situation facing household suppliers of pigs) throws considerable light on the above question and the economic status of small pigholders.In discussing this matter, I'll first make a few observations on trends in pig production in Vietnam, outline factors that provide natural protection to Vietnam's pig producers (as discovered in this research by a survey of a sample of Vietnam's consumers) and highlight important results that have emerged from the sample survey of household pig producers in Vietnam. Differences in the nature of employment and in the use of local and home-produced pig food were observed between small holders and large holders of pigs. Regional differences in specialization in stages of pig production were also observed. Comments will be made on these and other findings about the nature of pig production and subjects that need further research will be highlighted.The results reported in this part of the research output for the ACIAR-funded research project \"Improving the Competitiveness of Pig Producers in an Adjusting Vietnam Market\" are based on research reports prepared by CAP and ILRI in connection with this project, published data of the General Statistical Office of Vietnam, and other published materials (including those of the author) and analysis, including the use of concepts developed in economics.In the period for which I have statistics (1996-2006), Vietnam's volume of pork production showed a steady upward trend with a slight tapering off in growth in 2006.During this time the volume of Vietnam's pork production more than doubled -it rose by 132% (Tisdell, 2009b). In this period, almost all of Vietnam's supply of pork came from domestic producers and per capita consumption of pork in Vietnam almost doubled. How was this increase made possible? Both increased pig stocks and greater yields played a role, but a role that varied during this period. Before 2004, increases in pig numbers (with some increase in yields) explains the trend but from 2004 onwards increased yield is the dominant contributor to the expanded production of pork in Vietnam (Tisdell, 2009b) Given their relative importance, small producers must have contributed to a major part of the upward trend in Vietnam's pork production. It can be inferred that this increased production required a substantial rise in the total amount of pig food utilised in Vietnam. Presumably, this was reflected in rising imports of grain and other food used for pigs as well as greater domestic inputs of pig food. This aspect has not yet been researched. The greater openness of Vietnam's economy would have given more scope for its import of raw materials required for the production of pig food, and the increased presence of multinational companies (integrators) in Vietnam involved in the milling and distribution of animal food would have facilitated this. It is likely that in the absence of greater import of grains required to produce pig food, the expansion in Vietnam's pork supply would have been restricted. A corollary is that Vietnam's pork production has become increasingly dependent on imports needed to supply pig food. These aspects are worthy of study, particularly constraints on increasing supply of domestically produced pig food. This pattern of Vietnam's development is not unlike that of China which has substantially increased its import of coarse grains in order to increase its supply of food for livestock (Huang et al., 2006).Although Vietnam has more than doubled its pork supply since 1995, its rate of increase has slowed since 2005. The onset of this decline can be seen in Fig. 1 of Tisdell (Tisdell, 2009b). It is further evidenced by a decline in the rate of growth of index of the gross output of meat from domestic animals (excluding poultry) since 2005. The major component of this index is pork but it also includes beef and carabeef. The yearly rate of change in this index is shown in Despite the continual growth since 1995 in the volume of Vietnam's meat production (consisting mainly of pork), meat prices have increased at a rate that has escalated in recent years. This is evident from Table 2 which shows the values of Vietnam's producer's index of meat from domestic animals, excluding poultry. Given the rising value of this index, it can be concluded that the demand for meat in Vietnam has risen at a faster rate than its supply, and it can be inferred that this is so for pork. These The lack of development of supermarkets in Vietnam (Maruyama and Trung, 2007) has also partly been favourable to the survival of small holders of pigs. Supermarkets tend to favour a standardised product and want easy traceability of their product. This may comparatively favour larger pig producers. Although supermarkets would not deal directly with individual pig producers, middlemen will and would reflect the demand of supermarkets if they want to obtain sales to these.It is worth considering some of the results from the CAP-ILRI survey (CAP and ILRI, July 2010b) of urban and rural households in Vietnam in relation to their preferences for different kinds of meat and their expenditure on these. These results have important implications for the development of Vietnam's pig industry and for the roles of household pig producers and larger commercial producers in it. Several results from the CAP-ILRI survey of households and their surveys in Vietnam are worth highlighting because of their important implications for the way in which Vietnam's pork market function.The CAP-ILRI surveys of a sample of urban households in Hanoi and Ho Chi Minh City (HCMC) and a sample of rural households reveals that pork is the preferred type of meat for urban households, and one of the two most preferred types for rural households (see Table 4). This preference is persistent. There is evidence from these surveys that it existed at least a decade ago. Furthermore, on average, pork accounts for the largest proportion of expenditure on meat by households -more than a third in urban and rural areas (see Table 3). One important finding of the CAP-ILRI meat consumer survey is that Vietnamese consumers have a strong preference for fresh pork, and an aversion to chilled, frozen and processed pork. As a result:• Vietnamese consumers do not like to buy pork from supermarkets and prefer to buy it from traditional market outlets.• They avoid imported pork because it is of necessity, chilled, frozen or used in processed pork products. Thus, most consumers demand domestic pork.• They buy pork frequently and do not store it for long.• These tastes probably result in pigs being slaughtered close to retail markets and the limited transport of pork from rural areas to large cities. The above results imply that nearly all of Vietnam's increased demand for pork has to be satisfied by its own producers of pork, and that imports of pork cannot be used to any significant extent to moderate price rises in its pork. Given the strong and growing demand of Vietnamese for pork, this is a recipe for escalating pork prices if the growth in Vietnam's supply lags behind its rising demand for pork. Furthermore, because expenditure on pork is such a large component of expenditure by Vietnamese households on meat, the rising price of pork is of political concern.Additionally, the above findings indicate that the slaughtering of pigs close to its endmarkets is necessary if consumers are to be able to buy fresh meat. This results in a concentration in their slaughter in or close to large cities and is probably one of the factors making for a concentration of pig farms close to Hanoi and Ho Chi Minh City (Tisdell, 2009b). The other factor favouring this is the proximity of these cities to ports through which pig food is imported. This tends to lower the delivery cost of imported pig food to pig farms.Given the above trends, the Government of Vietnam is searching for ways to moderate rises in the price of pork which in turn requires Vietnam's production of pork to increase at a faster rate than recently. Some policy-makers believe that this might be best achieved by encouraging a greater share of pig production to be supplied by large-scale commercial pig producers(Ministry of Agriculture and Rural Development, 2010). This could result in less state support for household producers to increase their supply of pigs. This is an important issue that requires particular consideration. However, indirectly it throws some light on the subject which has become important from a policy point of view as Vietnam searches for ways to increase its domestic supply of pork.In discussing this matter, a problem has been lack of scientific evidence for and against the role of small household pig producers as pork suppliers in Vietnam.Furthermore, the matter has probably been complicated by special interests. For example, major integrators of processed livestock food are liable to favour larger scale pig production (including production by commercial farms) because these pig producers use greater quantities and proportions of processed food. This in turn results in greater sales for integrators and higher profits for them.In addition, some individuals in developing countries are strongly in favour of 'modernizing' and believe that the best development strategy is to adopt production techniques in use in higher income countries. However, this is not always the most economic choice because the countries considered are at a different stage of economic development.From the ACIAR-sponsored research, it seems that, at this stage of Vietnam's economic development, most small pig-rearing households play a cost-effective role in Vietnam's supply of pork. This is because:• They employ labour (especially female labour) that otherwise is likely to be unemployed or under employed.• They utilize pig food available from the household or locally that otherwise would not be utilized or used for lower valued alternatives.In addition, they are less reliant on imported pig food than are larger commercial producers and the larger-sized household producers of pigs.Overall, the study did not find strong evidence that economies of scale are substantial in household pig production, although some economies of scale could exist for those specializing in farrow-to-wean production. However, the numbers of very large scale pig producers in the sample are small and it is unlikely that the results would be applicable to large commercial pig producers because these producers probably adopt different techniques of production to household producers. As a result, it seems likely that their per unit costs of production would be higher at lower scales of production than that of households.Consider the specific results from this research about female participation in pig production, rural employment generation by household pig husbandry and about scale economics and the economic efficiency of household pig production in Vietnam.Samples of household producers of pigs (931 in total) in six provinces of Vietnam were surveyed. The aim was to use purposive sampling to obtain a reasonably representative sample of conditions facing pig producers in order to specify the economics of the pig production in Vietnam taking into account regional variations.While the full diversity of conditions was not captured, significant pig producing provinces were included in the sampling. The geographical extent of sampling was limited by the amount of resources available. It might have been interesting, for example, to have included a province in the North West region where pig numbers are low and yields are well below the national average.From the sampling data, it was found that household pig producers mostly rely on family labour for the husbandry of their pigs and the degree of reliance on family labour tends to increase as their holdings of pigs become smaller. Female contribute more labour hours to tending pigs than males and the relative dependence on female labour tends to increase as pig-holdings become smaller. Hired labour involves the payment of wages whereas family labour does not. Only holders of larger pig stock tend to hire labour. Son et al. (2006) reported that registered commercial farms in Vietnam hire more labour than household farmers. Nevertheless, even in their case, family labour is a large component of their labour and their hired labour tends to be for casual employment.A number of economic inferences can be drawn from these results. Employing family numbers in the raising of pigs by households can be economically efficient if family members are unable to find paid employment elsewhere in the economy. This is often the case for rural women. This observation is supported by that of Son et al. (2006) who also point out that rural women are limited in their scope for accepting employment away from their household because of their child-rearing duties. This means that very often, the opportunity cost of employing family labour in household enterprises is much less than the going market wage rate for labour.In addition, if employment off-farm is available, the transaction cost of that employment has to be taken into account. Taking advantage of off-farm employment usually involves transport costs and sometimes relocation costs (see Tisdell, in press).There are also likely to be opportunity costs in terms of lower on-farm income.Furthermore, work on household farms may add to family security, ensuring them of at least a subsistence income in difficult economic times when job shedding may occur in market-dominated labour markets. Off-farm jobs may not be very secure, especially in an economy in transition.In some circumstances (but not all), on-farm employment of household members helps to reduce poverty, assists the employment of women and provides economic security for families. The economic desirability of (or otherwise) on-farm employment requires the overall state of an economy to be taken into account. For example, one must consider the extent to which the manufacturing and service sectors grow and are able to absorb surplus labour from the agricultural sector and provide those employees exiting agriculture with security of employment (see Son et al., 2006; Tisdell, in press).This study tried to throw light on how the costs of production for a representative (average) household pig producer might vary with its scale of operations. It was concluded that the cost data imply that there are economies of scale (in terms of the cost of production) in farrow-to-wean; diseconomies in farrow-to-finish and almost scale neutrality in grow-to-finish systems of production (see Table 5 later). The results, however, could be quite sensitive to how pig food is valued, especially householdproduced food and local supplies which account for a larger proportion of the pig food used by small holders than large holders of pigs.The largest component of the cost of raising pigs is pig food. For those specializing in the farrow-to-weaner stage of pig production or farrow-to-finish stages of pig production, feed costs exceed 70% of operating costs (excluding household labour costs) and those concentrating of grow-to-finish, these costs exceed 54% of operating costs, the imputed cost of household labour excluded (CAP and ILRI, July 2010a, p.63). It was found that those households holding fewer pigs rely much more on their own produce and local produce to feed their pigs, compared to larger producers who rely more on marketed produce supplied ultimately by animal food production mills.The economic cost of the latter is likely to be considerably higher than that of the former. The former should be costed at a much lower level than the latter. To determine this cost is not easy. When account is taken of such factors, production of pigs by smallholders may be more efficient than appears to be the case at first sight. In other words, small producers can be low-cost suppliers of pigs. However, this may not be so for those who specialize in farrow-to-weaner production because they rely heavily on purchased pig food. Nevertheless, as demand for pork increases, smallscale producers cannot efficiently supply the whole of the market for pork and their share in the market can be expected to decline for reasons outlined in Tisdell (Tisdell, 2010b).In a transitional situation, a market combination of small household pig producers and larger suppliers is likely to be most economical. However, as the economy grows and household members have more opportunities to be employed off-farm, their opportunity costs of working on a household's farm increases. This can be expected, in due course, to reduce the number of smallholders of pigs (Tisdell, 2010b, in press).Additional features of the producers' report prepared by CAP on scale economies in the production of pigs by households in Vietnam are worth commenting on (CAP and ILRI, July 2010a). First, the scale of production of all the households surveyed is fairly small and to some extent, the definition of what is small, medium and large scale is arbitrary, as can be gathered from Table 5. The division of household producers by scale is influenced by the fact that the scale of virtually all is quite small. Furthermore, producers were classified according whether their production was concentrated on farrow-to-wean, farrow-to-finish or on grow-to-finish. Using these definitions of scale, CAP estimated the average variable cost per kg of weight gain of pigs by production system and scales. In this calculation, labour supplied by households themselves is excluded. Table 6 summarises the results. For those specializing in farrow-to-wean production, there is a tendency for average variable cost to decline with scale but the differences are not statistically significant.Furthermore, there is not much decline in these costs once a household has more than two sows. In the farrow-to-finish specialization, there seem to be diseconomies of scale and the difference is statistically significant between small and large scale producers. On the other hand, those who are involved in grow-to-finish seem to experience virtual scale neutrality. Overall, it seems that household pig producers do not experience substantial cost economies of scale (based on variations in their average variable cost), except in the farrow-to-wean system. (a) Based on household producers calculation of self-produced pig food (Scenario 1)Source: Extracted from Table 3.7.9 of the Producer Survey Report.The gross margin per kilogram of output of household pig production was also investigated by CAP. This was done by production system and by scale. This takes account of the fact that the price per kg received by growers was not the same for all scales of production(see Lapar et al., 2010, Figure 5). The sample size was reduced to some extent by this because suitable data was not available for all the households surveyed. Furthermore, average variable cost was estimated for two alternative scenarios: (Scenario Tables 7 and 8 summarise the results for scenarios 1 and 2. These results suggest that economies of scale (for profitability) exist in the farrow-towean specialization in pig production. There is no evidence of substantial economies of scale (in profitability) in grow-to-finish and in farrow-to-finish. In fact, diseconomies of scale (in profitability) appear to exist in the latter case.The results raise some queries. The main one is if there are profitable economies of scale, why are these not reflected in the distribution of the sizes of the pig holdings of the households sampled? If they are not reflected, does this mean that households are irrational in their economic choices or is this because some factors (not considered in the survey) constrain their decisions?Table 9 specifies the distribution of households by production system and scale for the sample on which Table 6 is based. Table 10 does this for the sample used to derive Tables 7 and 8. It can be seen from Table 9 that the distributions by scale are highly slanted towards low scale for farrow-to-wean and for grow-to-finish and towards large scale for farrow-to-finish. This is the opposite to what might be expected from Tables 6-8 if maximizing average profit per unit of output was thought to be desirable. This is because both Tables 6 (as well as 7 and 8) indicate economies of scale in profitability for farrow-to-wean and diseconomies to farrow-to-finish. One might, therefore, expect those households specializing in farrow-to-wean to cluster towards higher scale and those involved in farrow-to-finish to cluster towards smaller scale if they aimed to maximize profit per unit of output. It should be noted that there is a problem in comparing the results in Tables 8 and 9 because over half the sampled households were 'discarded' in Table 9 for the farrowto-finish production system. Nevertheless, the observed distribution of the sampled households by scale do not accord with the distribution suggested to be desirable. It should not, however, be concluded that the majority of sampled households are irrational in their choices. More investigation is needed of the producers' decisions and factors that constrain these.Observe also that costs and returns in the above analysis are based on the averages for pig producers. There may be, however, considerable deviations of individual households from the average. Nevertheless, pig production by households is found to be profitable on average at all scales and for all production systems. An additional issue is that a firm's profit is usually not maximised by maximising its profit per unit of output.As explained in Appendix A, a producer's maximum level of total profit usually occurs for a level of output for which profit per unit of output is declining. This is because maximum profit requires marginal profit to be zero. It is therefore, possible that the 59.5% of producers involved in farrow-to-finish system and operating at large-scale could be maximizing their profit even though that profit margin per unit of output is lower than for producers of smaller scale.However, given the mathematical relationship explained in Appendix A, those involved in the farrow-to-wean system or in the grow-to-finish system could not be maximizing profit if they operated at less than large scale if all happened to have homogeneity in their profit functions and no constraints stopping them from maximizing profit. Unfortunately, there seems little likelihood that the conditions just mentioned will be satisfied in practice. Considerable heterogeneity is likely to exist in the conditions facing small household pig producers in Vietnam. Therefore, drawing policy conclusions for these empirical results based on the average situation is risky. Nevertheless, there is independent empirical evidence that increasing scale in pig production is becoming more profitable on average for household pig producers because available secondary statistical data show that pig producers in Vietnam are slowly increasing their scale of pig holdings.It seems likely that many Vietnamese household pig producers find some increase in their previous scales of pig production to be profitable because the number of pigs held on average by pigholding households is slowly increasing as is revealed by It needs to be emphasised that the data in Note further that even if household pig producers do not operate at profit-maximizing scale, that they still might make a cost-effective contribution to Vietnam's pork production by utilizing home-produced and locally accessed pig food that otherwise would be wasted or used for lower-valued purposes.Given the geographical diversity of Vietnam, it seems likely that pig producers in the sample face varying production and market conditions (see Tisdell, 2009b).Consequently, the cost and profitability relationships based on the average situation of all may fail to take adequate account of this heterogeneity. In other words, 'one shoe is unlikely to fit all'. It could, for example, be the case that pig producers close to large urban areas or cities find it more profitable to operate at a larger scale than those further away from such cities. They may, for example, receive a higher price for their product and find it more profitable to engage in industrial-type pig production. Cost curves may also differ between regions and within the same region depending on food availability and cost. This strongly suggests that Vietnam's livestock policy needs to be designed to take adequate account of such heterogeneity.If the intention of policy-makers in Vietnam is to encourage the adoption of best practices in pig husbandry, one needs to define the criteria to be used to determine best practice. If the aim is to foster the most economic pattern of pig production (one criterion for best practice) then it should be born in mind that most profitable practices are unlikely to be the same for all pig holders. Adequate attention should be paid to heterogeneity of conditions faced by pig holders in Vietnam.It was mentioned earlier that increased pork production in Vietnam was facilitated by its rising imports of pig food. This pattern of dependence may continue. An investigation of constraints on the supply of pig food domestically is needed to throw more light on this matter.The study found that smallholders of pigs make comparatively greater use of their own produce and local produce in rearing pigs than larger holders do. If this pattern persists and the structure of Vietnam's pig industry changes from one in which there are fewer small producers and more large-sized producers, this can be expected to result in rising imports of pig food by Vietnam and add to pressures on its balance of payments. Further, examination of import trends and relationships of relevance to Vietnam's pig industry could be worthwhile.It might be noted that Vietnam is responding to its rapidly rising demand for livestock products (both meat and non-meat) in two different ways. Like China, it has increased its imports of coarse grains and other types of raw materials used to produce foodstuffs for livestock. It has relied primarily on this strategy to boost its domestic pig production. The second response has been to increase imports of the products concerned. This has been the main response of Vietnam to its increased demand for dairy products (Tisdell, in press). However, not all imported dairy products are finished products. For example, milk powder is imported and then processed into end products. The second type of strategy is not currently an option for meat products in Vietnam given the very strong preference of Vietnamese for fresh meat.In Western economies, it has been found that there has been a long-term tendency towards more specialization in agricultural production and in favour of a greater scale of production on individual farms (Skolrud et al., 2009). This process has evolved over a considerable period of time. One should not expect this pattern of development to occur quickly in transitional economies, although it could occur at a faster rate than that experienced in Western economies. A major restriction on the process in transitional economics could be restrictions on farm sizes and on the transferability of property rights in these.This research project investigated some aspects of specialization in pig production in Vietnam, namely the extent to which pig producers specialize in different stages of pig production. Greater specialization in different stages of pig production was observed in the sample of producers from the Red River Delta region than in the south of Vietnam. However, the reasons for these differences in specialization are not know.This would be worthy of investigation. More research could be done on examining the economics of specialization by farmers in different stages of pig production.Comparisons with Western practice in this regard would also be interesting.There was little investigation of the extent to which householders specialize in pigs compared to other forms of agricultural production. Nevertheless, some attention was given to the revenue obtained by the rural households surveyed from different types of There is some evidence from the producers' survey of the extent to which household pig producers specialize in the different phases of pig production in the regions sampled. Just over a half of those sampled specialized in farrow-to-wean or in the grow-to-finish phase of pig production (see Table 10) and nearly a half of those sampled did not specialize but raised pigs for the whole of the production cycle. But as mentioned, the degree of specialization tended to be higher in Red River Delta than in the south of Vietnam. Regional differences exist in specialization by pig producers. Geographically, Vietnam is a very diverse country and consequently, the economics of pig production can display considerable variation. Not only do the number of pigs present vary considerably between regions but there is also substantial variation in pig yields (Tisdell, 2009b) For example, in 2006, the highest pork yields were estimated to have been obtained in the Mekong River Delta (123kgs per pig in the stock) and the lowest in the North West region (39kgs per pig in the stock). Hence, on average pork yields per pig in the regional stock were over three times higher in the Red River Delta than in the North West. What explains such differences? Are they justified on economic grounds? These issues could be investigated. In general, regional differences in Vietnam's pig industry would warrant further research.Also the way in which regional differences in pig production in different regions of Vietnam have changed and how they can be expected to alter as Vietnam's economy develops further would be worthy of research. For example, as Vietnam's transport infrastructure improves more interprovincial trade in pigs and pork is likely to occur.A problem at present seems to be that there is little available data on interprovincial trade in pigs and pork. More information about this trade would be useful.This research collected evidence about whether smallholders of pigs were being discriminated against in their purchase of inputs and in their availability of credit.Differences in the terms and conditions for the purchase of inputs were found but they do not appear to be the result of discrimination. It was possible in most cases to explain variations in these conditions, by differences in market transaction costs.Furthermore, it was discovered that larger producers received a higher price per kg of pork than smaller producers (Lapar et al., 2010). This seems to reflect differences in market transaction costs as well as possibly, quality differences. Market transaction costs per unit of sales tend to be higher for smallholders of pigs than for those with a larger number of pigs.It also appears that smallholders obtained fewer loans than larger holders of pigs.However, it seems that the former had less demand for such loans.On the whole, differences in market transaction costs tend to favour households that hold large stocks of pigs and disfavour those with smaller stocks. There is no obvious way in which smallholders can avoid this disadvantage.Perhaps surprisingly, the study found that smallholders of pigs were more likely to use veterinary services than large holders. One possible reason was that large holders are more experienced in diagnosing maladies in pigs and treating them themselves.Whether this is so is not known. Another possible factor could be the smallholders more frequently encounter veterinary problems in raising their pigs but once again, there is no concrete evidence for this. We cannot be sure that risk of disease outbreaks in pigs is greater in the case of smallholders than for those holding larger number of pigs.The study found that most households having pigs made little use of extension services. This does not appear to be due only to their limited availability but also may reflect the fact that in most cases, the extra economic value perceived by households to be provided by these services was less than the added cost required to access them.Observe that health risks encountered by households in rearing pigs probably depend on whether they raise pigs for the whole of the production cycle or whether they specialize in grow-to-finish. Those who specialize in grow-to-finish may be vulnerable to transmission of disease carried by purchased stock. As discussed below, they may also find it difficult to determine the quality of purchased stockOther interesting information also emerged from the survey of producers undertaken as a part of this project. It emerged that the most popular type of pig was that involving a cross of Large Whites and Mong Cai. However, since the provinces included in the producer survey were not amongst the most marginal producers of pigs in Vietnam, different compositions of pig varieties may be present in more outlying provinces; for example in provinces in the North West which experience harsh weather conditions such as severe cold snaps at times.Household producers surveyed perceived several constraints on the supply of pig stocks and breeds. Many complained of the high price and inadequate supply of high quality genetic stock. These constraints seem, however, to be a result of market conditions. In the longer term, the market should adjust the supply and composition of stock to reflect demand. A more serious problem is the absence of the guaranteed genetic composition of purchased stock. This seems to be a particular problem in Ha Tay province where pig producers are relatively specialized in different stages of pig production. They, therefore, have to trade more frequently in pig stocks than pig producers in most other provinces. It is well known that when buyers are uncertain about the quality of a product to be purchased that this results in economic losses (see, for example, Akerlof, 1970). However, it is not clear whether it would be economic to introduce a government-sponsored certification scheme to rectify this problem. In some countries, certification schemes are in place for seeds intended for planting crops for example, the variety and the germination rate are sometimes guaranteed.Also another interesting result from the survey is that holders of large stocks of pigs are more likely to complain about market conditions than those with small stocks of pigs. For example, large holders of pigs more frequently complained about rises in the price of pig food. This is not surprising because this food involves a major cost outlay for them.Of course, the pig industry in Vietnam will not remain stationary. To some extent, its future depends on the development of the whole of the Vietnamese economy because most industries and different markets are interdependent.One major development that could have a significant impact on Vietnam's pig industry is improvements in Vietnam's transport infrastructure. This improvement is liable to facilitate interprovincial trade and my make it more economical for provinces that are more distant from Hanoi and Ho Chi Minh City to supply these markets with pork. This could result in some changes in the regional supply of pigs and pork in Vietnam. The possibility of this occurring could be a subject for research.Furthermore, as the food chain lengthens quality and health standards can assume growing importance. For example, pork sold through supermarkets usually takes longer to reach the consumer than that sold in traditional markets and, other things constant, is more prone to growth in bacterial and similar contamination. Therefore, greater attention needs to be paid to hygiene in this case. This aspect is underlined by field results reported by Grace (2010). She found from samples taken in Hanoi and Ha Tay in Vietnam that pork in supermarkets was less likely to meet health standards than that sold in traditional meat markets. This raises the issue of quality standards for pork and the desirable degree of their uniformity throughout Vietnam.While in principle, higher quality standards are desirable, it needs to be borne in mind that ensuring such standards is not costless. Therefore, it is necessary to compare their extra benefits with the additional costs and different consumers may have different levels of demand for the government imposition of higher standards.Suppose that inspections are to be made and/or conditions are to be imposed to ensure that pork meets a particular health standard. The question then arises about the extent to which it is economical to see that this standard is satisfied. This can be assessed by reference to Figure 2. Assume that pork which meets the standard is certified as doing so. The demand of consumers for certification might be as shown by relationship ABCD. The per unit cost of certification of pork might be like line EBF. This is assumed to be of this simple form for illustrative purposes. Given this relationship, it is only economical to ensure that X 1 of the supply of pork satisfies this standard. If X 2 is the total supply of pork, requiring all pork to meet the standard would result in disbenefit to buyers equal to the area of quadrilateral BCDF, which has been cross hatched, it being assumed that consumers pay for the higher standard. However, in practice, the incidence of the cost of the higher standard will normally fall partly on consumers and partly on producers. The main point however, is that enforcing the same standards on all pork supplies is unlikely to be economic.The introduction of quality standards for pork involves economic considerations. It may not be economic to ensure that all pork supplies meet a targeted standard. If that is done in the case illustrated, an economic loss equivalent to the hatched area occurs.The demand for high quality standards is likely to be related to income levels. As income levels rise, the demand curve shown in Figure 2 is liable to shift upward.Higher income groups in cities may have a strong demand for higher quality standards but it would not be economically desirable to impose these standards on all consumers.The above model involves several simplifications. However, its main purpose is to show that the adoption of food standards has economic implications. For one thing, the model assumes that consumers are knowledgeable about food standards and food quality. However, as research by Delia Grace from ILRI indicates, this is frequently not so. For example, consumers of milk in Assam were found to be poor judges of milk quality (Grace et al., 2007).An alternative economic approach to deciding on appropriate food standards would be to apply health economic models to the problem. In principle, cost-benefit models of the type applied to controlling environmental health problems are relevant (see, for example, Tisdell, 2009a, Ch. 13). These models can be expected to indicate that higher food quality standards tend to become more economic as incomes rise.Conversely, they are less economic, the lower are incomes in a society. Note that if economies of scale exist in compliance with food standards, imposing standards for a food item will tend to become more economic as the size of market for the food item subject to a standard increases. Thus both scale economies and higher incomes make it more economic to adopt higher food standards.Pig Industry More Competitive Internationally?Many policy-makers in Vietnam seem to believe that by increasing the scale of production of its pig-producing units, Vietnam's pig industry will become more competitive internationally and that this will also improve quality standards in the industry. An FAO report (Son et al., 2006) also states that increased scale of production by individual agricultural units in Vietnam will lower per unit costs of Vietnam's agricultural production. However, it does not provide concrete evidence about these economies.There is little available evidence that larger scale production units for livestock in Vietnam will substantially lower Vietnam's average cost of livestock production given the current stage of its economic transition.In fact, large production units may experience higher costs of production than smaller units and they are likely to be more dependent on commercial food purchases and imports of commodities for feeding livestock. However, even if they do have high per unit costs, Vietnam may need supplies from such units to help meet its increasing demand for livestock products, as I have argued elsewhere (Tisdell, 2010b).The following question also arises: If large scale livestock units are more profitable (economic) than small-scale units, why do they not evolve naturally at a desirable pace? Is it because such units require a greater land area than that which is available to households and is the required amount of land is difficult to secure? If this is so, why is it difficult to secure? Have the land reforms in Vietnam (Son et al., 2006) proved to be inadequate in freeing up the market in land and if so, why? Are there still too many constraints on transfers of agricultural land and if so, what are they? Or is it that households are very reluctant to transfer their land? These are all questions to which it is worthwhile seeking answers.Despite continuing uncertainty about the magnitude of economies of scale in household pig production in Vietnam, there has been a trend toward larger scale of production by households, even though their scales still remain relatively small. This suggests that on the whole, households are finding larger scales of production to be more economic. At the same time as this has been happening, the number of household producers of pigs has declined.There appear to be two main policy issues facing Vietnam's Government as far as its pig industry is concerned:1. the cost of production of pork in Vietnam remains relatively high by international standards; and 2. Vietnamese pork prices are rising rapidly because Vietnamese households rely on domestic pig producers to satisfy their demand for pork (because of their strong preference for fresh pork) and with Vietnam's rapid economic growth, its increased demand for pork has outstripped its growing supply of pork. The result has been an escalation in the price of pork. This is also influenced to some extent by intensified demand for low fat pork.How might these problems be addressed? One option is for the government to do nothing and leave it to market system to bring about adjustment. This might not happen quickly and could result in pork prices continuing to rise and remaining at high levels for some time. Furthermore, given the importance of pork in the Vietnamese diet, some Vietnamese could criticize the government for doing nothing.Secondly, the government could intervene on the supply side and adopt measures aimed at stimulating supply. Measures that improve economic efficiency in the pig industry would be the most desirable way of doing this. These measures should be considered for producers of all sizes. Ways to reduce the cost of pig food deserve particular attention because the largest expenditure item in pig production is for pig food. Special attention could be given to the cost and utilization of domestically produced pig food taking into account agro-ecological variations in Vietnam and the fact that many of its crops differ from those utilized in Western countries.Supply might also be increased by subsidizing pig production but that will not necessarily increase economic efficiency and the supply response rates are not known.If the subsidy is given only to large commercial pig producers, it may be that this supply response rate would be greater than if given to households. However, their response would need to be much greater because registered commercial pig producers produce less than 15% of the pork output of household suppliers.A third policy option would be to try to convince Vietnamese consumers to be more favourable to the consumption of chilled, frozen or processed pork. This may be difficult to do. An important step in designing such a policy would be to discover whyVietnamese have such a strong preference for fresh pork in comparison to chilled, frozen or processed pork. Is it because they believe fresh pork is safer from a health point of view? Is it because they can judge the quality of fresh pork more easily? Is it because fresh pork is found to be tastier? If the problem is to do with the safety of pork then this might be addressed by improving or imposing health standards to be satisfied by fresh and chilled pork. If these alternatives to fresh pork can be made more acceptable to Vietnamese consumers, then imports will become more acceptable and this will help to cap pork prices. It may also result in more slaughtering of pigs away from major urban areas in Vietnam.A number of the above mentioned policies could be adopted in conjunction. The choice depends in the end on political considerations.In my view, several important findings have emerged from this research project. They include the following: (7) Research was conducted to find out if small holders of pigs are disadvantaged by economic discrimination in relation to supply of inputs and their sale of pigs. While small holders suffered economic disadvantage to some extent in accessing input markets, these are largely explained by the higher per unit market transaction costs arising from small market exchanges. Economic discrimination does not seem to be a major problem.(8)The survey results revealed that small holders of pigs are more likely to access veterinary services than larger holders. This result seems to be contrary to popular opinion. The reasons for this relationship are not completely known but one reason given was that those with a large number of pigs are more knowledgeable about pig husbandry and, therefore, do not require as much veterinary assistance. Most holders of pigs were found to make little use of extension services.The majority of pigs held by the households surveyed were crosses of Large Whites and Mong Cai.(10) Households holding larger stocks of pigs complained most frequently about price variations, particularly the rising price of pig food. This is not surprising because they are more market dependent than smallholders as revealed by this research. (11) In view of the fact that pig food is a major cost in pig production, attention should be given to possible ways to reduce this cost and improve the utilization of available pig food.Significant results have emerged from this research and a number of areas have been identified that would benefit form future research. These matters include the domestic supply of pig food versus imports of this food, further consideration of supply chains for pig food, inter-provincial trade in pigs, pork and pig food, the extent and economic reasons for specialization (diversification) by those holding pigs, and the likely changes in the pattern of regional pig production. More attention could be given to regional differences in systems of pig production and variations in the economics of this production. Another significant issue is the economics of enforcing higher standards and quality control in the industry and the certification of the quality of pork.It could be claimed that one of the contributions of this project has been to identify issues in Vietnam's pig industry that would benefit from future research. It was An additional point is that variations in profit per unit of output are of limited value in determining a business' most profitable level of output. In order to maximize profit as a function of a firm's output, it is necessary to produce a level of out put such that marginal profit is zero and declining. As a result, a business will normally find it most profitable to produce an output which is greater than that which maximizes its profit per unit of output. This is illustrated in Figure 4. There the curve marked AΠ represents the profit per unit of output of the business and that marked MΠ is that for its marginal profit as a function of its level of output. From mathematics, it is known that when an average value is rising the marginal value must exceed it. When the average value declines, the marginal value must be below it. Hence, the type of relationship shown in Figure 4 applies. It follows that a business cannot be maximizing its profit in the situation illustrated if it produces an output less than that maximizing its profit per unit of output (x 1 , in this instance). Usually, its profit will be maximized when it produces an output greater than that which maximizes its profit per unit of output. This occurs in the case illustrated, when it produces x 2 of its product. It makes a profit of OA per unit of its output which is lower than its maximum profit per unit of output, OB.In most cases, the most profitable level of output for a business is a level of output greater than that which maximizes its profit per unit output, as in the case illustrated below.It is well known that firms may achieve falling per unit costs with great volume of output for engineering and technical reasons or because they obtain discounts when buying larger volumes of inputs. Some evidence that this occurs for pig producers in Vietnam was found as a result of this project. In addition, it was found that pig An illustration of profit maximization in the case where a producer receives a higher price per unit of sales as his/her sales volume increases.The technical illustrations in this appendix underscore the need to be careful in drawing policy recommendations from the empirical results of this ACIAR-sponsored research about the optimal scale of pig production by individual pig producers. This is so even if it is agreed that the cost and profit relationships obtained are representative of those for Vietnamese household pig producers. It is, however, doubtful whether they are sufficiently representative to provide firm policy recommendations because they do not take account of the diversity of conditions facing pig producers in Vietnam in different parts of the country.An interesting result from the research is that pig producers selling larger volumes of pigs tend to get a higher price per kg for their pigs. As shown, this provides an economic incentive for pig producers to produce beyond their minimum efficient scale. By doing so, they will maximize their profit. It should also be clear from this analysis that to operate at minimum efficient scale usually does not maximize the profit of a pig producer. Furthermore, maximizing profit per-unit of output does not maximize profit because this occurs when the rate of change of profit (marginal profit is zero.Following Vietnam's market reforms, its domestic production of pork and its per capita consumption of pork have risen substantially 1 . Vietnamese demand for pork has risen due to higher incomes, an increasing population and growing urbanization. Vietnam's increased pork supply occurred as a result of an increase in its stock of pigs and greater pork yields, the relative importance of which has varied 2 . However, at least since 2000, Vietnam's domestic supply of pork has grown more slowly than its demand for pork and there has been a substantial rise in the real price of pork. This has happened because Vietnamese consumers have strong and persistent preference for fresh (warm) pork 3 and therefore, most avoid imported pork. There are natural barriers to pork imports and so the rise in pork prices had not been moderated by imports 4 .Given the importance of pork in the diet of Vietnamese, this trend is of concern to Vietnam's Government. Some policy-makers think that the main problem is the inefficiency of small household suppliers of pigs and believe the answer to the problem is to expand production by larger-sized commercial producers 5 . However, at this stage in Vietnam's development, small household producers still make an important contribution to Vietnam's supply of pork -they account for about 90% of supply. In many cases, their costs of production are lower than can be achieved by larger commercial producers because they utilize inputs that otherwise may be unused or under utilized. They are also much less reliant on imported pig food than large commercial producers.In the current situation, ways should be explored to reduce the cost of production for both household and non-household producers. Attention should be given for example, to increasing the supply and reducing the cost of domestically produced pig food and utilizing available supplies more efficiently.The real price of pork in Vietnam has risen rapidly in recent years. According to data in the Statistical Yearbook of Vietnam 2008 (p.471) the producer's prices index for products from domestic animals (mainly pigs and cattle) have increased at a faster rate than that for all other categories of agricultural products, and this increase has accelerated. Between 1995 and 2008, this index increased by 174% and between 2000 and 2008 it rose by 148.5%. That means it more than doubled in these periods. The producer's price index for agricultural products gives a measure of the real prices (excluding taxes and levies) which farmers received for their products when they sold them to consumers. Also note that the producer's index for agricultural products has risen in recent years at a faster rate than the general price index. Therefore, agricultural goods have become more expensive in relation to other goods.The results reported in this part of the research output for the ACIAR-funded research project \"Improving the Competitiveness of Pig Producers in an Adjusting Vietnam Market\" are based on research reports prepared by CAP and ILRI in connection with this project, published data of the General Statistical Office of Vietnam, and other published materials (including those of the author) and analysis, including the use of concepts developed in economics. There is a failure of increased supply of these meats to match rising demand.Small households rearing pigs are a major source of pork supply in Vietnam and on the whole, they make an efficient contribution to Vietnam's pork production given its present stage of development 8 . That is not to say that the efficiency of their production cannot be increased.• Household pig producers still supply about 90% of Vietnam's pork and account for around 90% of its pig stock 9 .• The number of household producers is declining, their proportionate contribution to pork supply is slowly falling 10 and the average size of household pig herds is rising (see Fig. 3).• In comparison to larger producers, most households raising pigs in Vietnam play a cost-effective role in the supply of pork because:− They employ household labour (especially female labour) that otherwise is likely to be unemployed or under employed.− They utilize pig food available from the household or locally 11 that otherwise may not be utilized or be used for lower value alternatives.− They are less reliant on imported pig food than larger commercial producers.• The number of household producers of pigs can be expected to continue to decline with Vietnam's economic growth but for some time, they will be an important source of pork supply for Vietnam 12 . They should be neglected in policies designed to increase Vietnam's level of pork production 13 .Accelerating Prices The following are the main conclusions that can be drawn:• As a result of Vietnam's economic growth and the strong preference of Vietnamese for fresh pork, the rising demand for pork has outstripped its increasing supply. The result has been an upward trend in the real price of pork which has started to accelerate at a worrying rate.• Given the importance of pork in the diet of Vietnamese and their strong preference for it, the trend is a policy concern. However the view that household pig producers are to blame for the situation because they are inefficient seems to be misplaced at this stage of Vietnam's development. It should also be borne in mind that household pig producers have made a substantial contribution to increasing the level of Vietnam's pork production in recent decades.• A combination of household and large commercial producers of pigs is likely to be efficient in meeting Vietnam's demand for pork in the present stage of its development 14 .• The major cost for pig producers is pig food and its rising price seems to be a major restriction on expanding pork supply. Particular attention should be paid to increasing Vietnam's supply of pig food, reducing its costs of production, and better utilizing Vietnam's available supplies of pig food, including self produced food and locally available food.• The government should invest in R and D and extension services to improve the efficiency of pig producers of all sizes, especially households, because they are still the major pork suppliers."}
|
main/part_1/0271320117.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"93b98f8e31bb425b243e4c0dd6b9fd55","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/0a007480-c361-414e-9594-40e2ec336e0d/retrieve","id":"-857463677"},"keywords":[],"sieverID":"afb93918-29c3-493f-b535-95de9aaca155","content":"Repatriation material from international collections Identification of promising plant material National collections +/-921 accessions Biochemical characterisation & evaluation (farmers' fields) Product development and testing Promising material +/-50 accessions Marketing guidelines Biochemical characterisation & evaluation (controlled conditions)Focusing on Capsicum (chili pepper), this project will develop a model approach to enhance the use of native underutilized crop genetic diversity in order to achieve more diversified and sustainable production and increase income of poor farmers in developing countries.A key strategy in reaching Millennium Development Goal 1, which aims at eradicating poverty and hunger, is the generation of additional income to support and improve the livelihoods of poor farmers. The Bolivian and Peruvian Andes and the Upper Amazon are contrasting areas as they are among the poverty pockets of Latin America while being the centre of origin and diversity of various important crops. Except for major crops such as wheat, maize or rice, most crop diversity in its centre of origin is still poorly studied, let alone utilized. This is the case for Capsicum or chili peppers.The GTZ-financed project \"Linking Genebanks and Small Farmers to High-value Markets: The example of Capsicum in Bolivia and Peru\" (2010-2013) will combine innovative germplasm-selection methodologies with multidisciplinary market and value-chain assessments in order to demonstrate how chili pepper farmers' income can be increased by exploiting diversity that is currently underutilized. The research is designed to bridge the gap between supply and demand by bringing together different stakeholders across sectors who can provide critical knowledge. Although the project focuses on a specific geographic region and crop, it will demonstrate approaches and technologies capable of effectively harnessing agricultural diversity around the world. Farmers growing mangoes in India or sweet potatoes in Uganda are also struggling with declining commodity prices and are looking for opportunities to increase their incomes through access to high-value, high-quality markets.Upgrading strategy "}
|
main/part_1/0279513662.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"0403b6cbac8033cb58f4379ffe0658ec","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/ee47c450-b934-497f-a1e7-6d16eb933390/retrieve","id":"43044917"},"keywords":[],"sieverID":"b62d2565-11d9-4e07-9207-51f448bc0068","content":"The International Livestock Research Institute (ILRI) conducted an assessment of institutional dimensions of adaptation to climate change in Makueni county, Kenya. A mixed methods approach was used that included semi-structured interviews with key informants, focus group discussions with a variety of demographic and other stakeholders groups, multi-stakeholder workshops and participatory scoring techniques. Analysis was based on framework developed by ILRI, and included assessment out at two levels: assessment of overall institutional system operating within a particular landscape and assessment of one or more particular governance mechanisms. The landscape level site for the research was identified primarily on a watershed basis but also being determined by the areas of operation of both KAMUKIMA Community Forest Association (CFA) and Ngutwa Nduenguu Water Resource Users Association (WRUA), particularly where these two organization's territories overlap. The site traverses locations of Kilala, Wote, Ukia, Nziu and Unoa in Wote district.The most pressing challenges for adaptation to climate change in the study area boil down to four main issues which respondents consistently emphasized, and, in a scoring exercise in our first workshop with them, prioritized. Three of these relate to natural resources, were closely interconnected, and had at least some connection to watershed management and upstream-downstream interactions: availability of water, soil erosion and illegal resource use.It was determined that KAMUKIMA CFA and Ngutwa Nduenguu WRUA were critical governance mechanisms for these issues. They were each assessed according to five criteria: legitimacy, direction, performance, accountability, and fairness. An assessment of the CFA by respondents in the research suggested that it is strongest on legitimacy and direction and weakest on accountability. Participants assessed the WRUA as being strongest on legitimacy, direction and fairness and weakest on accountability.Assessment of the overall institutional system that is relevant to this landscape and its main challenges for climate change adaptation similarly identified accountability as a critical challenge. This can be understood in terms of capacity. Neither representatives within the local organizations-WRUA, CFA, buffer zone groups, etc.-nor community members at large sufficiently understand their rights or ways in which they could demand for accountability from those in leadership positions. Another challenge relates to institutional and organizational linkages. NGOs such as PAFRI and CESPAD have been promoting collaboration among WRUAs and between WRUAs and CFAs, and the development of a joint management plan by KAMUKIMA and Ngutwa Nduenguu is an important step. Such linkages are important in providing synergies and complementarity. However, both the CFA and the WRUA lack the necessary resources to implement the best practices in responding the issues and challenges of climate change and resource management. The required linkages to institutions that have resources, such as at county level, are very weak. There is a nominal recognition among officers in the county government that they need to work with and rely on communitylevel organizations such as WRUAs in order to have an impact on the ground; however, no signs of such connections being institutionalized were observed. This disconnect is a critical weakness, because it is at county level where the capacity to mobilize physical and financial resources is relatively higher and where authority for land use planning lies. This study's assessment is that many of the components needed for an effective institutional system for the middle Kaiti landscape are in place and have the potential to manage natural resources and to deliver sustainable benefits to the community, ensure the integrity of the landscape, enable the community to adapt to changing climate and enhance food security. This is a case, perhaps, of the whole being less than the sum of the parts.Climate change affects agriculture and food production in complex ways. It affects food production directly through changes in agro-ecological conditions and indirectly by affecting growth and distribution of incomes, and thus demand for agricultural produce. Climate change will, itself, affect food yields around the world unevenly. Although some regions, mostly at mid-to-high altitude, could experience gains, many, especially sub-Saharan Africa, are likely to be adversely affected with impairment of both nutrition and incomes (Parry et al. 2007). Rural communities in Africa in particular are faced with far-reaching changes in terms not only of climate change but also population growth, economic changes, and the erosion of traditional practices and institutions. The challenge of adapting to these changes is great, with vitally important implications for livelihood and food security. A fundamental aspect of the capacity to adapt to such changes is the performance and structure of institutions, and, more generally, governance (Adger et al. 2004). Fostering effective natural resource management and governance, for example, is critical to building capacity for climate change adaptation.The institutional environment for climate change adaptation includes not only formal government organizations and institutions, but also traditional institutions and decision-making procedures, a variety of other formal and informal organizations, and the networks and patterns of communication that connect them all. Cultural values, local norms and practices, and various sorts of formal and informal policies and procedures are also important. These factors interact in complex governance environments, where formal and informal dimensions of governance within and between sectors and levels of decision-making affect each other and ultimately the capacity of individuals, households and communities to adapt to climate change. One element in this complexity, for example, is the distribution of authority among sectoral agencies and different levels of government, each having their own systems for further structuring where, how, and by whom decisions are made. Thus decisions around management of the natural resources which farmers rely on can be split between local governments, several different national government agencies for forests, water and wildlife, and community-based organizations such as Community Forest Associations (CFAs), Water Resource Users Associations (WRUAs), and others. From the perspective a household's livelihood, or from the perspective of an ecosystem, such divisions are, of course, artificial. Sharing of information, coordination of decision-making, and the interplay among institutions are all, therefore, central to the effectiveness of an overall institutional system.In the research program on Climate Change, Agriculture and Food Security (CCAFS), the International Livestock Research Institute (ILRI) is working to enhance local institutional capacity for supporting climate change adaptation. One way in which it is doing this is by working with local communities and other partners and stake¬holders to assess those aspects of their institutional environment most relevant to the change and adaptation issues that they are facing.The ILRI institutional assessment work has focused on institutional and governance issues affecting the adaptation of farmers and pastoralists to climate change, with a particular emphasis on governance at the landscape level. One of the sites where the methodological framework for institutional assessments has been applied was in the vicinity of Iuani in Makueni county, Kenya. This report presents the findings at that assessment.The research approach was based on a methodology developed by ILRI for assessment of institutional and governance dimensions of climate change adaptation (Robinson et al. 2014). The framework drew on past research on environmental governance, in particular work by Gupta et al. (2010) and Graham et al. (2013). In the analytical framework adopted by the methodology, governance is not treated as synonymous with government. Rather, the governance is understood to be a set of social functions relating to collective decision-making, the resolution of trade-offs, shaping how power can be exercised, setting collective direction within a community or society, and building community. It can be carried out by governments but also by other kinds of organizations and by norms, values, networks and formal and informal institutions of various kinds. The assessments are carried out at two levels: assessments of overall institutional systems operating within a particular landscape and assessments of one or more particular governance mechanisms. Governance mechanisms are the organizations, institutions and processes which deliver governance. An institutional system is a set of governance mechanisms that function together, along with values, networks, and power relationships, within a social environment. Some aspects of institutional systems may be consciously designed, but often much of any institutional system is emergent.The methodology is made up of five analytical tasks: initial system analysis, identification of the underlying governance issues and mechanisms of the top priority adaptation issues, identification of the most relevant policies and policy issues affecting governance and adaptation, assessment of the institutional system, and assessment of the identified governance mechanisms. The activities that were carried out for this assessment are summarized in Table 1. In this way, the initial stages of the research served to identify a landscape which corresponded to people's adaptation issues and challenges, the relevant organizations and institutions for dealing with these issues and challenges, and the key interconnections among all of these. The key considerations in delineating the relevant landscape in this case are discussed in the Description of middle Kaiti watershed section below.Field research was conducted from August 2013 to June 2014. A mixed methods approach was used that included semi-structured interviews with key informants, focus group discussions with a variety of demographic and other stakeholders groups, multi-stakeholder workshops and participatory scoring techniques. A plan was developed detailing the activities for each stage in the institutional assessment process. The first step was to identify and classify or analyse stakeholders. Stakeholder analysis enabled the research team to know who are the most important people or groups of people, those that are relevant to the work intended to be done and those that influence social processes in a society. The research team visited the community in Wote area for a reconnaissance assessment, mainly to identify communities or institutions that shared a common natural resource as a source of livelihood, and faced similar challenges within a given landscape, where the assessment could feasibly be conducted. (See Appendix 1 for a summary of organizations working in the area.) These visits included identification and interviewing of potential key informants to see where these criteria would be met. A number of non-governmental organizations (NGOs) and community based organizations (CBOs) working in the area were visited and classified based on their formation and objectives/work.Once the initial site selection was done, 8 focus group discussions were held with participants from locations within the area. These initial focus group sessions were used to identify issues and challenges for climate change adaption and to further the stakeholder analysis. Some of the focus groups were comprised of members of particular buffer zone groups (KAMUKIMA CFA's are of operation is divided into 15 buffer zones). There were also focus groups made up of women and youth as separate groups. Two researchers facilitated the discussions on each occasion, one acting as a note-taker. On a few occasions the research team had a dedicated observer but in most of the interviews, the notetaker doubled as an observer. A workshop was then held, with participants drawn mainly from members of KAMUKIMA CFA and Ngutwa Nduenguu WRUA, but also including other stakeholders. At that workshop, participatory scoring techniques were used to prioritize key issues for climate change adaptation.Assessment of two particular governance mechanisms-KAMUKIMA CFA and Ngutwa Nduenguu WRUA-was carried out primarily at a second multi-stakeholder workshop using participatory scoring. Workshop participants were divided into stakeholder groups to each independently score the CFA or WRUA.Assessment of the overall institutional system was based primarily on interviews key informant. Purposive sampling was used to ensure that a wide variety of perspectives were included, and interviewees included personnel from national and county government agencies, Members of the county Assembly, personnel from NGOs, representatives of KAMUKIMA CFA, Ngutwa Nduenguu WRUA and other community groups, and others. Audio recordings of interviews and focus groups were transcribed and analysed using NVivo 10 software according to sixteen dimensions of governance as specified in the assessment methodology. Two researchers each independently scored the institutional system for each of the sixteen dimensions. The scores were then compared. For 9 of the 16 criteria, the two researchers independently arrived at the same score. For the others, the scores were discussed and a consensus reached.As described above, initial site selection was purposive, based on factors such as the existence of natural resourcelivelihood challenges and of local level efforts to address these challenges in some way, and the willingness of local stakeholders to engage in the assessment. During initial reconnaissance visits, the research team found that CFAs could be an effective entry point to the issues and for engaging with communities. There are three CFAs in Makueni county. Two of them, however-MAKURI and Nzaui/Kathonzweni-exist as little more than organization names, having nominal management committees but are not active. KAMUKIMA CFA, on the other hand, is quite active. Its members share a common natural resource: forests on hilltops. KAMUKIMA CFA's territory is composed of the Katende, Mutula, Kilala and Mataa forest blocks. The communities around these hilltop forests are involved in activities that depend on or threaten the existence of the natural resource and which in the end have an impact on their capacity to cope or adapt to climate change. The CFA has 8 registered user groups including charcoal producers associations, water user associations, firewood collection and groups, the Chemwea water project, herbalists, grazers association, resin gum harvester association and bee keepers. The CFA is also subdivided into 15 Buffer Zone groups representing the villages adjacent to the forest. These are structured as self-help groups.The demarcation of the landscape level study area was further refined in an iterative way as analysis of climate change adaptation issues and stakeholder groups, and an initial institutional scan were carried out (Task One in the assessment methodology). This included focus group discussions to further characterize the CFA and identify key adaptation issues in the area. 1 This process made it clear that all of the main challenges for climate change adaptation had at least some connection to watershed management and upstream-downstream interactions. Another important organization that was identified was the Ngutwa Nduenguu WRUA. The WRUA's area of operation covers a 115 square kilometre portion of the watershed of Kaiti River, which traverses the Makueni county from west to east.The hilly landscape of middle Kaiti.1. Identification and prioritization of climate change adaptation issues is discussed in greater detail in the Institutional and climate change adaptation issues at middle Kaiti section below.Hills, including those where KAMUKIMA CFA operates, form the catchment zones for the watershed. Hence, the landscape level site for the research finally demarcated primarily on a watershed basis but also being determined by the areas of operation of both KAMUKIMA CFA and Ngutwa Nduenguu WRUA, particularly where these two organization's territories overlap. The site traverses locations of Kilala, Wote, Ukia, Nziu and Unoa in Wote district.The landscape is mostly a valley terrain with hills to the southwest and the northeast (where KAMUKIMA operates) with two major seasonal rivers: Kaiti and its tributary the Muinga River. The two main natural resources available at the valley bottom are the water and the sand on the river basin. The upper, hilltop part of the landscape is endowed with many species of wildlife including small wild mammals, reptiles and birds and has many shrines and camping sites. People practice small scale mixed, crop/livestock farming.Institutional and climate change adaptation issues at middle Kaiti CCA issues at the study siteAfter initial reconnaissance including a handful of meetings with selected government and NGO personnel and CFA representatives, focus group discussions and key informant interviews were conducted to collect information on key adaptation challenges and issues. For the focus group discussions eight (8) buffer zones were sampled from the fifteen (15) that make up KAMUKIMA CFA. Respondent selection was stratified by buffer zones and then choosing the participants for the focus groups based on gender, level of education and perceived level of participation in CFA activities. In cases where the random sample did not have a representation by women, we purposefully selected a female representative. In the community, youth are culturally restricted from saying some issues before older men. This necessitated interviewing the youth separately.The guide prepared for the focus group discussions included questions exploring people's knowledge of changes in weather patterns and activities associated with those changes. Some of the climate change issues identified include the following:• Lack of water-Every focus group mentioned lack of water as the key climate change issue. Most of the respondents said there used to be water in the rivers/creeks and wells. The area used to have both seasonal and permanent rivers. The situation has changed in the recent past with most of the rivers that were permanent now becoming seasonal. They attribute the change to many reasons including the change of land use practices. About 20% of the respondents did not identify any connection between lack of water with anthropogenic activities.• Soil erosion-In recent times, people have experienced huge amounts of soil erosion on their land, particularly those on the hills sides. The erosion is by wind during the dry seasons and storm water whenever it rains. This has left most of their land poor in nutrients and therefore low crop yields. Gully erosion is also a problem.• Unreliable rainfall-The respondents provided an historical timeline in rainfall variations. Before 1980, the rainfall was regular and predictable, but since the 1980s, the rains have diminished with prolonged periods of drought.Respondents state that it is hard to predict the rainfall in the area nowadays. This makes it hard for the farmers to plan their agricultural production programs, with most of them losing total investments whenever they fail to predict properly.• Illegal resource use-Participants identified the illegal use of resources and the inability to enforce rules around natural resource harvesting-particularly illegal felling of trees and sand harvesting-as important problems contributing to resource degradation.• Forest fires-Forest fires have become more common during the dry seasons. Most are usually accidental but once they start, they cause huge losses. Reforestation efforts that have been going on in the area to mitigate the negative impacts of weather variation are frustrated by these fires.• Pests, diseases, and post-harvest storage-These were mentioned by some of the focus groups.• Infrastructure and market access-The poor state of infrastructure, especially roads, constrains market opportunities and hinders people's ability to cope. This is a big challenge higher up in the hills in that when rains are heavy the roads can become completely impassable.• Social consequences-The problems have, in turn, caused social problems including stress and suspected impacts on mental health. The livelihoods of many households have been destroyed by among other calamities, the forest fires. Young men who are supposed to be productive in the community have resorted to drugs or are depressed because of lack of livelihoods.From key informant interviews and focus group discussions, a number of issues affecting the community's ability to adapt to change and to address the above-mentioned challenges were identified. When respondents identified some particular challenge for adaptation, they were asked why they have not been able to address the problem. The responses often touched on governance. The following is a summary of the issues identified:• Lack of or low learning capacity-Most community members said they may not be aware what their limitations to adapting to climate/weather variations are. Key informants stated that most people have a low level of formal education and low ability to use technological innovations for adaptation. For example in Iuani, the buffer zone representatives said 'our biggest problem is water. If we have sand dams, we may not need to sell sand, we will preserve the river bed. But now, we do not know how to construct the sand dams.'• Failure of responsible government institutions to provide the required state support.• Illegal and unsustainable resource extraction-The main natural resource in the area is the forest on the hills. The community members have access to the forest for purposes of timber harvesting.• Lack of sub-catchment management plans-When the landscape is poorly planned, utilization of resources is random and disorganized. The respondents said the community members would not use their land properly since there was no properly spelt out management plan. As a result, there was excessive erosion and forest degradation in the area.• Poor leadership at local and national levels.• Lack of transfer of traditional ecological knowledge-Traditionally people knew a lot about the trends of weather patterns and what needed to be done on every season. They had traditional skills and knowledge the flowed informally from generation to generation. Such knowledge helped people reduce their vulnerability to risks related to adverse weather. Such knowledge is not in the community any more. With the advent of modern, formal education, traditional ecological knowledge disappeared.• Lack of effective authority for regulation-Most of the respondents said they know what the remedy to some environmental degradation would be but they do not have the power to set and enforce regulations.At the first multi-stakeholder workshop, issues identified in focus groups and key informant interviews were written on cards and clustered by workshop participants in a participatory manner. The six main clusters were then prioritized by workshop participants through a voting exercise according to how important and pressing they judge each issue to be. During the voting process participants were advised to vote based on their knowledge and understanding of issues. Each participant was given 3 votes to distribute among the issues according to how important they viewed those issues. The results are summarized in Table 3. The most important issues were then discussed in breakout groups. These activities also served the purpose of validation, as the workshop discussions mostly confirmed what had been discussed in focus group discussions.Participants in the breakout groups also engaged in analysis of the issues through the construction of influence diagrams (Figure 1). Institutional and governance dimensions of the top four prioritized adaptation issues were also discussed (Table 4). Based on these results and information gathered from the preliminary stage of the research, two main governance mechanisms were identified for the assessment:• KAMUKIMA Community Forest Association• Ngutwa Nduenguu Water Resource User Association.Other relevant governance mechanisms included the Forest Management Plan, the Kaiti Watershed Integrated Management Plan Sub Catchment Management Plan and the county Spatial Planning procedures.At the second multi-stakeholder workshop, participants were divided into breakout groups according to their organizational affiliation to assess KAMUKIMA CFA and Ngutwa Nduenguu WRUA according to five criteria: legitimacy, direction, performance, accountability and fairness. A simple scoring criteria was devised and agreed upon by the participants. The scores ranged from negative two (-2) to positive two (+2). Members of KAMUKIMA CFA and Ngutwa Nduenguu WRUA each did self-assessments while the other participants not belonging to either of these two organizations-mostly government and NGO personnel-assessed both. Each of the five criteria are discussed below based on discussions at the workshop, but also enriched by comments made during focus group discussions and key informant interviews that were conducted prior to the workshop.The researchers sought to know if KAMUKIMA CFA and Ngutwa Nduenguu WRUA were widely understood and accepted by the stakeholders/community members and if they appropriately address people's needs while respecting the local cultural norms.The CFAs are established based on the Kenya Forestry Act 2005, which gives communities an opportunity to take part in the management of the state owned resources, the forest. Members of the CFA and the community around them demonstrated their knowledge of the existence and functions of the organization. They are actively involved in the routine activities of the CFA. The youth in the CFA areas know about the CFA but are not actively involved.The women and the men understand the operations of the CFA and can positively identify with it. They know that the activities of the organization are responding to the environmental degradation issues that affect their livelihoods directly. The organization has a sound legal foundation. It was established as per a government policy on forest management. The CFA, by its nature and formation, gives room for all the members to participate in decision making processes. However, women and youth have limited contribution in making decisions affecting the running of the CFA and hence management of the resources. They have a legal recognition at the forestry department and are also registered as a local CBO.On the other hand, the Ngutwa Nduenguu WRUA is an organization that was formed and registered and the Water Act (2002, amended in 2012) and is well recognized, and appreciated by the members. The WRUA is an association mandated to serve the interests of water resource users in a subcatchment/subbasin area as per rules stipulated in the act and enforced by the subcatchment area Management Board. The rules for the management of the WRUA are set by the Water Resource Regulatory Authority or the Water Resource Management Authority (WRMA). This gives the Ngutwa Nduenguu WRUA a clear definition of purpose and an appropriate legal standing. Members of the WRUA are continuously involved in activities of the WRUA including meeting to deliberate on processes and major milestones.The leadership is composed of a committee that is democratically elected. People in the area and government authorities in addition to WRMA and the Ministry of Water and Irrigation recognize the WRUA and their work in the area. All the members and leaders who were interviewed understand the WRUA as a vehicle for responding to the adverse effects of changing environmental conditions.For both the WRUA and the CFA, it was clear from the discussions that the organization has the required legitimacy to operate in the area but it was hard to evaluate some elements including the process of electing leaders. The cultural barriers seem to be in play hence leading to the election or selection of some people who are thought to be opinion leaders even when they do not have the required skills. Neither organization has had any major transition in leaders.The CFA has a forest management plan that spells out the roles of the organization for its members. In the management plan, the roles of the CFA include enhancing the ability of people to realize their potential to adapt to changing climate or cope with the adverse conditions as a result of climate change. While the management of the organization has been trained on how to run the activities of the CFA in a way that can support their members, only a few understand or follow the guidelines provided in the management plan. Most of the leaders interviewed seem to have forgotten the details of the plan and therefore do not positively identify with it. This would mean they may have tried practicing or operationalizing the training. More than 50% of the people interviewed seemed to know what is required of the CFA in supporting the members but highly doubted if the CFA is actually doing the same. The older men respondents seemed to agree they can trust the CFA leadership to deliver benefits including training on how to adapt to changing environment. Older women have respect and trust the CFA leaders and feel they know how to guide them to the right direction. The youth agree with the principle of the CFA but do not agree with the style of leadership. They feel the leaders do not use the right strategies and it would be better if they were included in the leadership. Three of the five middle-aged key informants (men) said they have confidence in the management structure but doubted the ability of some of the committee members. They propose a faster adoption of appropriate technology including energy stoves, making and use of briquettes, generation of biogas among other climate smart interventions. The Kenya Forest Service, a government body that is mandated with conserving forests feel the CFA is a good link between them and the community where forest resources exist. In many occasions, the forest conservator referred to the CFA as their eyes on the ground and that they are there to complement their work.Since inception the WRUA has been operating on the direction provided by the water regulatory authority and the community aspirations to achieve sustainable water supply for their livestock and irrigation. The Water Resources Management Authority (WRMA) facilitated the capacity building of the WRUA in areas of identifying the key issues and solutions to challenges associated with their water resources. For the last three years, the WRUA has been trying to bring the community together in order to use a common strategy to reduce threats to their water resources. They have assisted the members to learn how they can tackle common problems like planting trees on their land adjacent to river basin to protect it from erosion. A common goal of minimizing or stopping unsustainable sand harvesting from the river basin has been in place and WRUA members seem to respect that. However, the challenges facing the WRUA suggest that more needs to be done to strengthen the focus of the WRUA. Community members suggest more training to enhance their understanding of various modern strategies on mitigation and adaptation to climate change. While training has been provided, particularly on the running of an organization, most committee members may not have the required capacity to learn. It may be necessary to sensitize the members on what the requirements of the committee may be before they can conduct an election. There should be regular annual general meetings to allow for election of fresh members or re-election of those that proof capable of meeting the leadership goals.The performance of both the CFA and WRUA as governance mechanisms was assessed. The CFA, since its formation has achieved various kinds of support including the community members' training on tree planting on their land, planting of fruit trees (agroforestry), beekeeping and making of rascal and regular terraces on their hilly land. Upon its formation, the CFA with support from an NGO operating in the area acquired funding to conduct training for the members on tree planting, tree nursery preparation, bee keeping and fruit growing. The tree nurseries were for fruit and forest trees. So far, there is evidence of afforestation on every member's land. Eco-enterprises including beekeeping and honey production and marketing are also ongoing on a few farmers' farms. Ngutwa Nduenguu WRUA has been able to mobilize community members to form the organization, register it and has encouraged people to carry out minimal activities aimed at protecting the water catchment area. The WRUA has been funded by the Water Resources Management Authority (WRMA) to conduct capacity training activities for the members. Individual members have been encouraged to use the various interventions on their own lands.Accountability generally refers to public process of evaluation and record-keeping through which members can make corporations/organizations and governments answerable to them.While legislation and regulations lay out some guidelines for ensuring accountability within CFAs, at our study site, the understanding and capacity of the members for creating effective accountability procedures is low. The community members have not been empowered to participate in any detailed process to ensure the tools and process for reporting takes care of their interests. Although the leaders interviewed said they have records, most of them did not seem to know where they are kept. The leaders feel they are operating in a transparent manner but some members say they are not aware of how some things are done. They have not been accessing the records if at all they exist. The leaders do not have detailed records of finance related transactions. Meeting minutes are not kept all the time and whenever they are taken, they may not be accessed in the next meeting. The leaders feel they have been implementing activities impartially. Some members feel more should be done to ensure impartiality in the CFA's activities. Since the activities are done on individual land, partiality may not be practiced.The CFA does not have a lot of financial resources. Whatever little funds they get from donor agencies, are usually for a specific activity, such as travel and are spent without formal accounting. The CFA is supposed to mobilize resources from members and outside agencies including government. It is hard to establish whether this is happening since there are no records and most reports are verbal. There are no records for a grant that the CFA received from Community Development Trust in 2008. The project activities closed down in 2008 when the funding ended. Ideally, there should have been records and reports for the project.The Ngutwa Nduenguu WRUA demonstrates a good degree of accountability to the members and to the WRMA. The members, including women and youth understand their rights and participate in activities and processes that enhance exercising their rights in an open and equitable manner. The members have received training from PAFRI on how to participate in and what to expect from the WRUA processes. There are regular meetings between the WRUA officials and the member groups. From these meetings, minutes are taken and can be accessed whenever needed.Most of the leaders of the WRUA are fairly educated and more youthful. They understand basic principles of running an organization like this and they understand they are accountable to the members and society. The WRUA has not had much financial resources to report on or to account for as they have been in operation for only two years.Fairness is achieved when a community or social process treats all the stakeholders in the same manner. It is often complex to assess fair treatment especially where people are receiving services only as opposed to where goods are involved. Rural and indigenous communities have a way of ensuring impartial treatment of subjects. Much of this is in play in the communities in Makueni. The KAMUKIMA CFA is designed to operate in a way that will ensure equal benefits to all members. The executive committee ensured equal distribution of services and resources so far. For example, beehives were given equally to all buffer zones. Since communication is mostly by word of mouth, information is sent to all members in all the buffer zones. However, some community members feel they are not treated equally. Community members have been appropriately mobilized to take part in the activities of the CFA. This is not very successful as some members are not contributing appropriately to most of the required social costs. Scouting or supporting Kenya Forest Service (KFS) rangers in tackling issues like illegal harvesting of forest products and putting off forest fires when they happen are some of the activities that require community input. Most of the community members do not have the inspiration to participate since they do not associate their input with any benefits they receive. A cross section of the members still think that should be a state/government function and if they participate, they should be directly compensated.Ngutwa Nduenguu WRUA, just like the CFA has provisions for equitable distribution of benefits and costs amongst members. The fact that most of the activities taking place are on individuals' farms enhances the achievement of equal distribution of ecosystem benefits. The funds that have been received so far were meant to mobilize and capacitybuild the members. All organization members received the training as required. Members also contribute their time whenever there is a group activity taking place. This young organization has potential for achieving high level of fair distribution of benefits and costs, which will enhance the people's ability to cope with climate variability.A summary of the scoring done at the second workshop is presented in Tables 5 and 6.The participants recorded comments as well. The remarks show that the overall governance at this landscape level is weak in most of the criteria. The most common recommendations across the groups include institution of a proper accountability system, provision of appropriate training, provision of funds to conduct activities and training or capacity building of the members. Based on our delineation of the landscape being studied (see Methods section above), we identified the various organizations, institutions and other elements making up the institutional system that corresponds to that landscape and the issues of concern. This was found to include KAMUKIMA CFA, Ngutwa Nduenguu WRUA, Members of the county Assembly, and the National Government Administrative Office (formerly Provincial Administration). Departments and agencies of the national and county governments and NGOs also play important roles. Based on the interconnected natural resource management issues which respondents identified as top priority challenges for climate change adaptation, this study devoted particular attention to the WRUA, the CFA and the county land use planning process which were just getting underway.The institutional system was assessed according to eight main dimensions: the ability to generate resources, room for autonomous change, variety, promotion and development of leadership, learning capacity, institutional linkages, fair governance, and effective decision-making. Overall, the assessment aimed at understanding ways in which the institutional system promotes, or hinders, the enhancement of capacity for adaptation to climate change. In the following sections we provide a detailed assessment of the institutional system according to the 8 main criteria and 16 subcriteria.Whether the institutional systems allows adequate space for dialogue, deliberation and analysis Within the WRUA and the CFA, there are opportunities for deliberation and dialogue both at the level of the executives and also among the representatives of the user groups or buffer zone associations which make up the respective organizations. At higher levels, the forums and networks which have recently been formed have created numerous opportunities for deliberation, particularly among WRUAs and between CFAs and WRUAs. PAFRI and CESPAD, in collaboration with WRMA and other agencies, have put a great deal of emphasis bringing the CFAs and WRUAs together to discuss problems, share ideas and concerns, and gradually work toward coordinated action. How well these opportunities for deliberation and collective analysis and problem solving extend down to the grassroots level is less clear. The people who participate through the user groups and buffer zone associations in the activities and decision-making of the WRUA and CFA, respectively, are activists and leaders. Comments from our respondents suggested that more work is needed to involve community members at large in the deliberation and planning that are part of WRUA and CFA activities.In the recent past, there was some lurking mistrust between the CFA and the WRUA, according to some respondents more so here than elsewhere in Makueni. The collaborative discussions and joint planning activities, however, have been gradually building up trust between them and also with organizations such as PAFRI. They are now working together constructively. Relations between the WRUA and WRMA are also positive. However, trust between the community-based organizations and other government agencies and their personnel is still not strong. For example, opinions about the capacity of WRUAs and CFAs among government technical staff vary, but on the whole express a low opinion of the capacity of these organizations. This lingering mistrust goes the other way as well. The relationship between KFS and the CFAs is a case in point: the slowness of KFS to empower the CFAs for management of forest resources has deepened community mistrust of KFS.So I must say the initial meetings were not that easy, because I realized some people in WRUA didn't understand what CFAs are, some people in CFAs didn't understand what WRUAs are, then they were blaming each other, some were saying the people in CFA are the ones who destroyed the catchment.-An NGO leaderThe communication [between the CFA and the WRUA] has been quite okay. We had a workshop together and made a PIC-Project Implementation Committee-which is drafting the management plan for the WRUA and CFA …. CFA used to work alone and WRUA alone but this time round now is when we want to work together because, WRUA cannot work without CFA.-An executive of KAMUKIMA CFAMost of the respondents who commented on this issue suggested that different types of knowledge are available, but suggested that the linkages for sharing that knowledge do not seem to be in place. Respondents involved in community-based organizations for natural resources management (the CFA and the WRUAs) mentioned the need for research and technical knowledge, and that they seem not to get access to the right knowledgeable people. Other respondents commented how in the past decisions have been made without consultation, including without consultation with the appropriate technical persons in government technical departments. Under the new constitution, with more important decisions now being made in the county Assemblies, this consultation and information flow seem still to be weak.At the county level, there are procedures for monitoring and evaluating the policy processes. In the previous provincial/national government, development plans included a logical framework spelling out objectives, activities and outcomes that could be monitored or evaluated. That system has been inherited by the new county governments with more powers given to the Members of the county Assembly (MCAs) in making decisions and monitoring the implementation. At the community level however, the CFA and the WRUA have not demonstrated an elaborate system of planning and implementation that can be monitored or evaluated without consulting the leaders. There are no project planning documents or logical framework that can be independently audited to establish what has been happening. The capacity building and facilitation work that PAFRI is carrying out is helping to put in place a system that enhances institutional memory. For example, the integrated resource management plan which links the operations of the WRUA with those of the CFA and the county government will allow for evaluation of policy interventions.If the institutional system facilitates the involvement of diverse perspectives and pursuit of diverse solutions.The institutional system in the landscape allows for different perspectives of opinion to be tried in trying to deal with issues affecting the community. A number of NGOs offering different services and products have been allowed to work in the community over time. However, issues touching on water and forest resources are regulated by the WRMA and KFS respectively. The CFA allows for the individual members to try different interventions on their lands without interference. Women groups in the CFA region have been trying a number of new innovations in upgrading their local chicken and dairy breeds to increase productivity and food security. In trying to mitigate land degradation, tree planting and establishment of nurseries is advocated for by the CFA leaders. However, the members are free to try different species of fruit trees on their land.The WRUA has room for trying new and diverse strategies in enhancing member livelihoods in the face of climate variations.For example, if they say that they would like to have beehives in the forest and they don't have the knowledge neither trained, they don't have the clothes, the smokers, you expect them by the time they are harvesting their honey to cause problem with an outbreak of fire and that causes an alarm, therefore we cannot allow that.-Chairman of CFABased on the nature of the system, stakeholder organizations have little control over the actions of individuals. Individuals have a free hand in trying new ideas and innovations on their own but there are instances where the organizations give guidance on the new innovations or ideas that need to be adopted.The CFA structure allows for the buffer zones and the individual members to experiment on their farms but the CFA does not have similar autonomy to try out new ideas without consulting the government institution responsible, the KFS.The institutional system fosters the emergence of leaders and champions, of different types, within its various communities, sectors and stakeholder groups.A few different organizations-WRMA and PAFRI, for instance-have done capacity building for local leaders, which has been helpful. Generally, however, while new initiatives from emerging local leaders seem not to be opposed, neither do the key organizations go out of their way to foster emerging leadership. The local leaders such as in the CBOs for community-based resource management, tend to be drawn from local elite, with little attempt to incorporate and support potential leaders from other segments of the community.The presence of appropriate linkages among organizations and institutions Some important institutional linkages exist within the organizations in the system but communication is not very effective among the stakeholders. For example the WRUA members understand little about what the CFA members are doing. In the past, they have blamed each other for failure to implement actions that would have benefited the community. With the new county system, coupled with the efforts to integrate activities by PAFRI, the situation is improving. For example, there is an understanding and agreement that river catchment includes forest land and rivers and therefore the different statutory provisions guiding the use of the forest and water resources require harmonization. The CFA and WRUA have good linkages with the NGO PAFRI, KFS, and WRMA. There seems not to be a strong link between KFS and WRMA and the NGOs. Other NGOs and development agencies working in the area such as the United States Agency for International Development (USAID), Heifer International and Anglican Development Services have very weak linkages with the CFAs and WRUA in Kaiti watershed.While, in the recent past, there has been some mistrust particularly between the CFA and the WRUA, through various recent initiatives information sharing and coordination amongst WRUAs and CFAs have been improving.With the exception of linkages between KFS and the CFA and between WRMA and the WRUAs, institutional and organizational linkages between county and national government stakeholders on the one hand and these communitybased structures on the other remain very weak. While some respondents in county government expressed the importance of CFAs and WRUAs, there is little that has been done thus far to include them in the county's planning processes or in the implementation of the plans.On the side of collaboration between the major stake holders i.e. WRUAs, NEMA, Provincial administration, NGOs, CFAs and KFS at the time we are collaborating very well on the issue of tree poaching because we are withinProvision of accepted or legitimate forms of power that provides the institutional system with authority to act; whether or not institutional rules are embedded in constitutional laws. Includes 'political resources': support for the institutional system from the political realm.The institutional system has limited authority or legitimate forms of power required to provide it with the authority to act. Part of this is a result, particularly in the case of the relationship between KFS and CFAs, of an unwillingness to cede authority to lower levels. The CFA has an agreement in place with KFS but KFS has been slow to implement it. Certain activities require action on the land, and this necessitates seeking buy-in from the landowners-their members. The CFA and the WRUA aim at implementing interventions on individuals' land, as there are few common property resources. However, the CFAs and WRUAs have a legal recognition. They are both established by acts of parliament and are appropriately registered. Their ability to raise financial resources for the implementation of their mandate is very limited. The system has been able to mobilize human resources to undertake activities at the community (WRUA/CFA) level. Both the WRUA and CFA have been able to link themselves up with agencies with special skills for capacity building like PAFRI. However, they have not been able to mobilize human resources for long term activities, even from their own people with such skills. Locally, the organizations do not have skills to fund raise and therefore depend on consultants, particularly on occasions where the donor is providing finances to pay for consultant time. The county government (and its predecessor the provincial/central government) has some limited ability to mobilize and access funds. Under the previous constitution, the local CBOs did not appropriately benefit from the financial and human resources provided by the government. In the current system there is a general feeling that things may be better.The institutional system is able to mobilize expertise, knowledge and human labourThe communities have not been able to appropriately mobilize and utilize the required technical human resources.The lack of a reward system that can attract and retain human expertise is a big hindrance. Young people from the area who get educated and trained at higher levels of learning get jobs elsewhere and are not willing to come work for the community mainly due to lack of finances and opportunities for personal growth. The system is however endowed with the required human labour to implement adaptation interventions. The community members are always willing to provide labour sometimes for free or at a very low wage. For example, the CFA members have volunteered as scouts to police the community forest, put off forest fires and do anti-poaching patrols for free. The WRUA members also provide free labour on sand dam construction or building of shallow wells that benefit the community.The institutional system is able to mobilize financial resources to support policy measures and financial incentivesThe organizations in the system have varied levels of ability to raise the required finances for their work. The county government is able to raise a budget for natural resources development in the county. The county government system through the MCAs can incorporate the activities of the CFAs and WRUAs in their budget through the participatory annual budget processes. However, this has not been appropriately coordinated, mainly due to the fact that the system is new. The CFA and WRUA lack the ability to raise funds from sources other than the government.They require support to enhance the building of the technical skills required for raising funds, management and accounting for it.Whether there is public support for the institutional systemThe degree of legitimacy was a big challenge in the early days of the CFA and WRUA, but they have steadily been gaining acceptance by community members at large. The sense of ownership of these organizations and their plans, however, remains weak.Whether or not institutional system is inclusive and its rules are fairFor the key organizations and institutions within the system, the structures and procedural rules are fair. In devising the rules for use of natural resources there seems to have been a deliberate effort to have appropriate representation in the organizations management committees. Women are included in the committees. The CFA has not managed to include the youth in their committees. The youth feel the older men have sidelined them while the older men claim the youth are just lazy and do not want to take responsibilities. On the whole, there is little effort by those in leadership position to uplift the level of understanding of those without such capacity, to know their rights and hence take part in the decision-making process. Greater effort must be made to proactively improve inclusivity: youth, women and the poorest are still not well represented.Whether or not institutional patterns provide accountability proceduresThe county government and the Ngutwa Nduenguu WRUA are fairly new. The CFA has been in operation for a few years but it was not easy to assess accountability for resources they have accessed so far. While the leadership say they keep records of all the events and transactions, the members do not confess being in a position to query or audit anything. There are regular meetings by committee members but the minutes do not get presented to the members regularly. Most members have a low capacity to understand all the necessary procedures of holding the leadership accountable for their actions and resources. The WRUA on the other hand has a fairly educated membership and leadership, and have accessible records. A challenge in this area seems to be the capacity for accountabilitycommunity mem¬bers neither understand their rights well, nor the responsibilities of their representatives in the CFA or WRUA, nor how to hold them accountable. The challenge of accountability appears to be one primarily of the capacity to hold representatives and the relevant organizations accountable. Neither community members nor the representatives themselves have strong ideas of what community members' rights in relation to the organizations are, or the kinds of procedures to institute which could ensure accountability. The only obvious moment for accountability is when representatives for these bodies are periodically selected.One reason why we have really had no great impact is because of lack of resources, we do almost on voluntary basis… -Chief, IuaniInstitutional linkages up to county level, together with the fact that the Governor and MCAs are directly elected, have created a certain degree of responsiveness. However, at community and landscape levels, as the institutional system is very new, there has been little experience upon which the responsiveness of the system at those levels can be assessed. It is clear that responsiveness is hampered by lack of funds. It is still early to assess the responsiveness of the system to people's needs but generally is not strong. The KFS have their officers (rangers) on the ground but it is reported some problems requiring their interventions have not been appropriately coordinated. The CFA members have had to battle a few instances of forest fires alone. The KFS say they are not well resourced to respond as required to community needs like putting out forest fires and dealing with illegal harvesting of forest (timber and non-timber) resources.Efficiency and effectiveness of decision-making processes themselvesThe institutional system sets clear scope, goals and objectives for actors, is efficient (does not spend disproportionate time and resources producing decisions, and fits the social-ecological system (is adapted to spatial, temporal and other characteristics of the social and ecological environment).The existence of shared visions and a clear scope, goals and objectives for key decision-making bodies within the institutional system is somewhat lacking, in part because of the weakness of institutional linkages. While the situation has been changing, the key players are often working at cross purposes and shared direction has not been established. The community members, the community based organizations, the county government and other development agencies have structures for decision making, mainly community meetings (Barrazas) and seminars. Some deliberation and consensus building with community members take place but mostly, the organization management or government representatives inform the people on what has been decided. The WRUA and the CFA provide good ground for deliberation at the community level. At the higher level, collaborative decision making takes place where the organizations have been assisted to network. There is a platform and goodwill for collaboration in planning processes but at present the organizations are not communicating appropriately.At the community level, members have been mobilized and trained to undertake sustainable activities. Evidence from the KAMUKIMA CFA show that some of the activities and eco-enterprises have not only uplifted community livelihoods but also in the processes of restoring derelict landscapes. The members of the WRUA have initiated activities aimed at restoring the degraded river banks and increasing availability of water during the long dry spells. Decision-making processes within the landscape seem to be relatively efficient, although are constrained by insufficient experience and capacity and lack of access to technical knowledge.Two researchers each independently scored the institutional system for the 16 governance criteria, after which the resulting scores were discussed. From the independent scoring, the researchers arrived at identical scores for nine out of the sixteen criteria. The scores were discussed and for the other scores a consensus was reached. The table below provides the agreed score and a summary of the comments.The criteria which scored weakest were accountability, responsiveness, ability to generate resources, learning capacity and leadership. The degree of legitimacy was a big challenge in the early days of the CFA and WRUA, but they have steadily been gaining acceptance by community members at large. The sense of ownership of these organizations and their plans, however, remains weak 13. Are institutional rules within the IS fair?For the key organizations and institutions within the system, the structures and procedural rules are fair. However, greater effort must be made to proactively improve inclusivity: youth, women and the poorest at not well represented 14. Do the various components of the IS respond to the concerns, needs, and aspirations of society?-1 Institutional linkages up to county level, and the fact that the Governor and MCAs are directly elected has created a certain degree of responsiveness. However, at community and landscape levels, as the institutional system is very new, there has been little experience upon which the responsiveness of the system at those levels can be assessed. The weaknesses of vertical institutional linkages has constrained the ability of the institutional system to establish a clear vision and direction for community members and stakeholders at higher levels to buy into. However, with recent efforts to facilitate collaboration at landscape and watershed scales, there is a strong degree of fit with social and biophysical conditions. For example, the coming together of the CFA, WRUA and KFS to develop an Integrated Resource Management Plan facilitated by PAFRI is a move in the right direction. Decision-making processes within the landscape seem to be relatively efficient, although are constrained by insufficient experience and capacity and lack of access to technical knowledge The most pressing challenges for adaptation to climate change in the study area boil down to four main issues which respondents consistently emphasized, and, in a scoring exercise in our first workshop with them, prioritized. Three of these relate to natural resources and were closely interconnected: availability of water, soil erosion and illegal resource use. Challenges in availability of water result both from unsustainable land management practices and the changing weather conditions, with rainfall becoming more unpredictable. There is rampant land degradation in the area which threatens the integrity of the agro-ecosystem and the livelihoods of the people. This degradation has been precipitated by unsustainable activities by the local community to meet requirements of food security and development.Capacity for adapting to these challenges is weak. There is generally a low level of formal education among the community members and traditional ecological knowledge is not adhered to as may be appropriate. There are a few farmers who have adopted technologies that are sustainable in enhancing food security. These isolated successes give hope to this vulnerable community and threatened landscape. However, the challenges are great.The management of the upper catchment is an important concern here as this affects erosion and availability of water for everyone downhill and downstream. KAMUKIMA CFA is making progress in this regard but still struggles.Ngutwa Nduenguu WRUA has a direct mandate for watershed management, but will need to partner with the CFA in order to be effective. Management of forests, however, is only one dimension of these challenges; another relates to the soils on people's farms in a highly fragmented landscape. With every generation, farms are subdivided, further constraining the opportunities for investment in conservation measures. Overall, few if any of the challenges can be addressed primarily at farm or village level. Rather, the interconnections among all these issues across space, and among the organizations and institutions with the mandate to address them, are strong and together define a landscape level 'problemshed' for which at least some level of collaborative planning and institutional coordination will be needed. Our assessment examined the emergent institutional system for this landscape, which we have been referring to as 'middle Kaiti', and two of the key governance mechanisms within that system: KAMUKIMA CFA and Ngutwa Nduenguu WRUA.Increasingly, the need for institutional arrangements that reflect the fact that landscapes are interconnected and that ecological functions go beyond social boundaries is being recognized. Organizations such as PAFRI and CESPAD have been promoting collaboration among WRUAs and between WRUAs and CFAs, and the development of a joint management plan by KAMUKIMA and Ngutwa Nduenguu is an important step. Such linkages are important in providing synergies and complementarity. However, WRUAs and CFAs are not the only components of the institutional system. Both the CFA and the WRUA lack the necessary resources to implement the best practices in responding the issues and challenges of climate change and resource management. The required linkages to institutions that have resources, such as at county level, are very weak. Linkages are also required processes such as land use planning which is in the docket of the county government. At the time of the research, the progress of the county government toward being able to implement activities on the ground was still moving very slowly. There is a nominal recognition among officers in the county government that they need to work with and rely on communitylevel organizations such as WRUAs in order to have an impact on the ground; we saw no signs, however, of such connections being institutionalized. This disconnect is a critical weakness, because it is at county level where the capacity to mobilize physical and financial resources is relatively higher and where authority for land use planning lies. The lack of clarity around who has authority for what, which emerged with the 2010 Constitution, still persists and is another element of this disconnect. Taken together, the capacity of the institutional system is greatly constrained by the lack of appropriate, institutionalized linkages.Another crucial issue which began to unfold during the course of the field research and after was the disarray within Makueni county government. There was conflict between the county government and many of the MCAs. This conflict escalated to the point that, at the time of writing, steps are underway to dissolve the county Government. This will delay further any possibilities for addressing the above-mentioned weaknesses.Within the institutional system, fair governance, while apparently improving, still faces critical challenges.Representation, inclusivity and participation by all social groups have been insufficient. Downward accountability at county level occurs only through election of Governor and MCAs every five years. Accountability is also somewhat weak at community and landscape level. We do not refer here to corruption. Rather, these weaknesses can be understood in terms of capacity. Neither representatives within the local organizations-WRUA, CFA, buffer zone groups, etc.-nor community members at large sufficiently understand their rights or ways in which they could demand for accountability from those in leadership positions. While the institutions show intentions of doing this, there is still a weakness in demonstrating accountability especially at levels where financial resources have been involved. The CFA and the WRUA did not have adequate records system for any financial transactions. This in turn weakens their legitimacy and their ability to be trusted organizations that can steer the communities in sustainably managing the landscape. For instance, sense of ownership of the CFA and WRUA and their management plans is weak.Although the overall institutional system is viewed positively, important areas including legitimacy, learning capacity, resources, fair governance and leadership are weak implying a low capacity to cope with changes and adapt to changing climate at the landscape level. Our assessment is that many of the components needed for an effective institutional system for the middle Kaiti landscape are in place and have the potential to manage natural resources and to deliver sustainable benefits to the community, ensure the integrity of the landscape, enable the community to adapt to changing climate and enhance food security. This is a case, perhaps, of the whole being less than the sum of the parts. The weaknesses which we have highlighted are critical ones, and appropriate steps are required to address those weaknesses and meet existing challenges. The necessary linkages to the county government and other national institutions need to be strengthened. The new county government has a potential of strengthening the capacity of the local organizations especially through involving them in the land use planning process. PAFRI's efforts to build capacity, facilitate collaboration, stimulate emergence of local leaders, and establish accountability measures within the organizations should be supported. The processes of bringing WRUAs, CFAs and other key actors together should be strengthened through the provision of more sustainable funding from the government and by having such collaboration institutionalized in the county government processes and structures. "}
|
main/part_1/0286660257.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"be8b22aa8c5bc32841bc14cd6090286f","source":"gardian_index","url":"https://www.tropenbos.org/file.php/2481/financiamiento-gestion-integrada-del-paisaje-fondo-rotatorio-bolivia-final.pdf","id":"-1432387622"},"keywords":[],"sieverID":"5c243763-67d2-4e72-9884-ccbc4ccd58d0","content":"Este reporte hace parte de una serie de estudios de caso que brindan información sobre varios mecanismos utilizados para aumentar el acceso a la financiación de los pequeños agricultores, las PYMES y las comunidades en sus esfuerzos por contribuir a los paisajes sostenibles. Los estudios de caso se centran en las estrategias utilizadas por diversas partes interesadas para reducir los riesgos de determinados flujos financieros para inversores, intermediarios y destinatarios. Estos estudios de caso dan seguimiento a las recomendaciones formuladas por los participantes en el proceso consultivo sobre financiación innovadora para paisajes sostenibles (Louman et al. 2020). El objetivo es proporcionar más evidencia de estrategias exitosas para aumentar el acceso a la financiación para los pequeños agricultores, las PYME y las comunidades.Este estudio describe el instrumento financiero, fondo rotatorio, utilizado por la Asociación Forestal Indígena \"Ascensión\" en Bolivia para el cumplimiento de los objetivos sociales del paisaje integrado, el flujo financiero en el cual se desarrolla y los mecanismos para mitigar los riesgos asociados y compartidos, en apoyo a las Organizaciones Forestales Comunitarias de la zona.Las opiniones y puntos de vista expresados en esta publicación son responsabilidad de los autores y no reflejan necesariamente las opiniones y puntos de vista de Tropenbos Internacional o el Programa de Investigación de CGIAR sobre Bosques, Árboles y Agroforestería (FTA) o NWO-WOTRO.Este es un estudio de caso de una serie sobre cadenas de valor financieras implementados por socios del Programa de Investigación del CGIAR sobre Bosques, Árboles y Agroforestería (FTA) y coordinado por Tropenbos Internacional. Estos estudios de caso tienen como objetivo proporcionar una mayor comprensión de las estrategias aplicadas por sus diversas partes interesadas para aumentar la participación de los pequeños agricultores y apoyar la transformación hacia paisajes resilientes.La mayoría de los paisajes rurales tropicales todavía están sujetos a altas tasas de deforestación y degradación forestal, lo que los hace vulnerables al cambio climático y otras crisis. Si bien los pequeños agricultores son actores importantes en estos procesos, rara vez se benefician de los flujos financieros existentes. Estos deben tenerse en cuenta al invertir en paisajes rurales tropicales.La metodología utilizada por los estudios de caso (Primo et al. 2021) fue diseñada para ser implementada por FTA y sus organizaciones asociadas que están estudiando el financiamiento para la gestión integral del paisaje. Aunque la metodología es útil en una amplia gama de casos, los autores pretenden específicamente que se aplique a los procesos que informantes clave consideraron exitosos para apoyar iniciativas de paisaje y / o aumentar el acceso a la financiación para todos los posibles destinatarios, incluidos los grupos marginados y desfavorecidos, dentro de los paisajes. La aplicación de esta metodología en una variedad de casos como este contribuirá a generar una base de información de resultados comparables. Las personas pueden extraer aprendizajes de esta base de información para diseñar procesos que apoyen el financiamiento inclusivo para iniciativas integradas de paisaje.Cabe señalar que los estudios de caso tienen como objetivo aprender de ejemplos exitosos, ver qué se logró, cómo se logró y qué más se podría lograr mediante mejoras en las estrategias aplicadas. No incluyen una evaluación del desempeño general de los casos estudiados y, por lo tanto, no brindan muestras estadísticamente representativas de todos los impactos de los casos estudiados en todos los agricultores involucrados.La metodología consta de tres fases.La Fase 1 implica una entrevista detallada con la agencia implementadora (AI), que juega un papel central como mediador o intermediario de los flujos financieros para las iniciativas de paisaje existentes. Esta fase tiene como objetivo definir seis cosas: 1) las principales fuentes de financiación y sus características; 2) los principales grupos de beneficiarios; 3) los flujos financieros asociados a las diversas fuentes y beneficiarios; 4) el proceso de gestión y canalización de fondos; 5) los mecanismos financieros aplicados y sus reglas subyacentes; y 6) los riesgos y barreras involucradas desde la perspectiva de la AI. Además, la entrevista en la Fase 1 identificará a las partes interesadas que serán entrevistadas en las fases posteriores.La Fase 2 comprende la recopilación de datos relacionados con las fuentes de financiación, los beneficiarios (grupos e individuos) y los proveedores de servicios no financieros que se relacionan con ellos. Incluye entrevistas con cuatro tipos de informantes clave, que fueron identificados durante la Fase 1: 2a) representantes de las fuentes de financiamiento; 2b) representantes de grupos beneficiarios; 2c) proveedores de servicios comprometidos con los beneficiarios; y 2d) beneficiarios individuales seleccionados y no beneficiarios (en particular, pequeños agricultores). La Fase 2 se centra en los riesgos y barreras percibidos por cada uno de los grupos de interés y las formas de reducirlos. También busca determinar en qué medida los flujos financieros han cumplido las expectativas de los grupos de interés, así como los efectos percibidos de los flujos financieros sobre las metas de sostenibilidad en relación con el paisaje.La Fase 3 implica validar la información recopilada en la Fase 2. Las discusiones de los grupos focales que se llevan a cabo en la Fase 3 involucran a representantes de los principales beneficiarios y grupos de beneficiarios, proveedores de servicios, la agencia implementadora y otras partes interesadas que son relevantes para los flujos financieros.Este estudio describe el instrumento financiero, fondo rotatorio, utilizado por la Asociación Forestal Indígena \"Ascensión\" en Bolivia para el cumplimiento de los objetivos sociales del paisaje integrado, el flujo financiero en el cual se desarrolla y los mecanismos para mitigar los riesgos asociados y compartidos, en apoyo a las Organizaciones Forestales Comunitarias de la zona.Las iniciativas de paisajes integrados han demostrado un potencial prometedor para movilizar y apoyar a diversos interesados en todos los sectores para trabajar conjuntamente hacia objetivos compartidos del paisaje que satisfagan una amplia gama de necesidades humanas, metas económicas y objetivos de ecosistemas. Estos marcos de colaboración permiten unir recursos humanos, financieros y de otro tipo para apoyar los objetivos a nivel de paisaje.Este estudio de caso busca resaltar uno de los mecanismos subyacentes a los flujos financieros que fluyen hacia iniciativas de paisaje integrado. La metodología utilizada permite identificar los actores clave vinculados con dichos flujos financieros, sus perspectivas y motivaciones, y los mecanismos utilizados para canalizar el financiamiento a través de intermediarios hacia receptores o beneficiarios. Se hace hincapié en evaluar los riesgos y barreras percibidos por los diferentes grupos de interés, las diferentes estrategias que han utilizado para superarlos o reducirlos, así como sus expectativas y el grado de cumplimiento de éstas. Se espera que los hallazgos informen el diseño de mecanismos para financiar iniciativas de paisajes integrados y, en última instancia, facilitar el flujo de financiación en apoyo de los objetivos de paisaje compartidos en la región.Proporcionar información sobre el instrumento financiero (fondo rotatorio) utilizado por la Asociación Forestal Indígena \"Ascensión\" para el cumplimiento de los objetivos sociales del paisaje integrado, el flujo financiero en el cual se desarrolla y los mecanismos para mitigar los riesgos asociados y compartidos, en apoyo a las Organizaciones Forestales Comunitarias de la zona.• Determinar las expectativas del grupo interesado con respecto al financiamiento del fondo rotatorio, los acuerdos subyacentes y la medida en que estos ayudan a su cumplimiento respectivo. • Identificar oportunidades para fortalecer los mecanismos de gobernanza financiera de los flujos financieros clave. • Identificar las percepciones de riesgo en relación con los fondos rotatorios, las estrategias de mitigación y la exposición al riesgo resultante según el grupo de interés y para analizar su potencialidad y sostenibilidad. • Definir las principales barreras para expandir el financiamiento al fondo rotatorio y las opciones para superarlas.En Bolivia, con la aprobación de la Ley Forestal No. 1700No. (1996)), comunidades indígenas y campesinas vieron en el manejo forestal comunitario la oportunidad de recuperar y mantener para sí sus bosques como recurso vital. El potencial forestal de Bolivia se traduce en aproximadamente 53 millones de hectáreas, que representan el 48% de la superficie del país. Según estimaciones, entre 6 y 7 millones de hectáreas de estos bosques se ubican en Tierras Comunitarias de Origen (TCO), que pueden potencialmente ser integradas a la cadena productiva del sector forestal comercial (El Pais, 2014). Las TCO son tierras de propiedad colectiva, de comunidades o mancomunidades a las que se aplican las reglas y costumbres de la comunidad, mismas que son inalienables, indivisibles e irreversibles, inembargables e imprescriptibles (FAO, 2021). (Tamburini, 2019).La COPNAG como representante legal demandante de la TCO Guarayos, es quien autoriza y asigna un área para la elaboración de un Plan General de Manejo Forestal (PGMF) a las diferentes comunidades indígenas Guarayas. La COPNAG representa a las comunidades indígenas Guarayas que se organizan en seis centrales repartidas en áreas específicas de la demanda y a doce comunidades sin adhesión a centrales, como se muestran en la tabla 1. Las Centrales constituyen la representación política. Tienen como objetivo luchar por la defensa de los derechos políticos, económicos, sociales y culturales. Participan activamente junto con la COPNAG en la consolidación de su territorio y la defensa de sus recursos naturales y, en el ámbito municipal, en la incorporación de las principales demandas y necesidades de las comunidades. En una situación de conflicto, las Centrales son las primeras instancias en ser notificadas, y dependiendo de la gravedad del caso, inician el proceso de toma de decisiones junto a las autoridades locales o derivan la situación a instancias pertinentes (Nicolas et al. 2007).La Asociación Forestal Indígena Guarayos (AFIG) es un ente de representación económico-productivo de las Organizaciones forestales Comunitarias (OFC) de la TCO Guarayos que forman parte de la COPNAG y básicamente se constituye en su brazo técnico. Su función principal es fortalecer a sus OFC afiliadas en la gestión de sus recursos forestales a través de un manejo forestal sostenible y constituirse como una instancia representativa de las OFC que promueve la integración a la economía regional, generando desarrollo comunitario a través del uso integral y sostenible del bosque (Fundacion PROFIN, 2019).Para su funcionamiento, estas instituciones matrices reciben aportes de las asociaciones forestales indígenas representadas por la venta de la madera. Sin embargo, es importante mencionar que actualmente existen problemas de paralelismo directivo en las grandes instituciones de las que dependen las asociaciones forestales indígenas de la TCO Guarayos, especialmente de la COPNAG y la AFIG.El Plan General de Manejo Forestal (PGMF) está contemplado en la Ley Forestal 1700 como un instrumento técnico de gestión forestal que permite el aprovechamiento sostenible de los recursos forestales maderables y no maderables. Asimismo, permite la comercialización legal de los productos obtenidos (maderables y no maderables) permitiendo su transporte con Certificados Forestales de Origen (CFO) emitidos por la Autoridad de Fiscalización y Control Social de Bosques y Tierra (ABT) (Boletin Tecnico para el productor).El Área de Manejo Forestal de la Asociación Forestal Indígena Ascensión (AFI -ASC) perteneciente a la TCO Guarayos, está ubicado en el Municipio de Ascensión, Provincia Guarayos del Departamento de Santa Cruz (ver Figura 1).Figura 1. Mapa de ubicación del Plan de Manejo Forestal Ascensión en la TCO GuarayosEl objetivo del PGMF de la TCO Guarayos es conservar el bosque a través del aprovechamiento sostenible de productos forestales maderables y no maderables, mantener la Certificación Forestal Voluntaria de la Asociación Forestal Indígena \"Ascensión\" -TCO Guarayos respetando y fortaleciendo la organización, usos y costumbres indígenas, con la finalidad de lograr una rentabilidad continua, que permita generar ingresos económicos para mejorar la calidad de vida de la comunidad.El PGMF ha sido implementado desde el año 2008, cuenta con una superficie total de 15.332,94 hectáreas, de las cuales 14.889,61 hectáreas corresponden a bosque de producción y 443,36 hectáreas a bosques de protección. Según la actualización decenal del PGMF a junio de 2020, en los primeros 10 años se han aprovechado hasta la fecha 6.848,02 hectáreas quedando un saldo de superficie sin aprovechar de 8.041,59 hectáreas de bosque productivo para los restantes 10 años (AFI-ASC, 2020)La administración del PGMF es llevada a cabo por los mismos socios, y se enmarca en el marco legal vigente, especialmente porque se garantiza a los comunarios la exclusividad en el aprovechamiento forestal en la TCO y el establecimiento de mecanismos para la distribución equitativa de los beneficios a ser obtenidos.Debido a la naturaleza del derecho y el respeto a la organización, el PGMF debe estar inmerso dentro de la estructura de las instancias orgánicas del pueblo Guarayo. La Figura 2 muestra la estructura organizativa de COPNAG y su articulación con el PGMF de la Asociación Forestal Indígena \"Ascensión\" (AFI-ASC).Figura 2. Estructura de COPNAG y su articulación con Plan General de Manejo Forestal Indígena.La Asamblea de la COPNAG es la máxima instancia de planificación, regulación, fiscalización y de aprobación de reglamentos para el aprovechamiento de recursos naturales en la TCO Guarayos. El directorio de COPNAG, debe cumplir y hacer cumplir todas las decisiones emanadas de la asamblea de COPNAG para lo cual tiene las siguientes responsabilidades:• Elaborar y proponer las políticas y reglamentos para el uso de los recursos naturales. La actividad económica desarrollada por la AFI-ASC está inmersa en el primer eslabón o producción primaria de la cadena de valor de la madera, dado que actualmente se dedica a la venta de árboles en pie a aserraderos, quienes realizan el corte y son prestadores de servicios tanto en aserrío, extracción y transporte de la madera para su posterior comercialización a barracas, carpinterías u otras empresas que realizan la transformación final de la madera en función a la demanda del mercado. Adicionalmente los socios y sus familias desarrollan actividades alternativas como la agricultura y/o ganadería a pequeña escala, comercio de abarrotes, elaboración de artesanías, asalariados de empresas públicas o privadas, trabajos eventuales, entre otros.De las utilidades por la venta de madera, se destina una parte para cubrir los costos operativos del aprovechamiento forestal de la siguiente gestión (censo forestal). Asimismo, se destina otra parte para aportes a las entidades matrices, gastos en salud, educación y repartición de beneficios como esta establecido en el reglamento interno (ver tabla 3). Como se muestra en la tabla 3, cumpliendo con los objetivos sociales del paisaje integrado, actualmente la AFI-ASC destina una parte de sus utilidades para salud y educación de sus asociados a través de un mecanismo financiero denominado fondo rotatorio, mismo que será objeto del presente Estudio de Caso.El fondo rotatorio consiste en una \"caja de recursos\" autogestionados que circulan entre sus asociados en forma de préstamos. La fuente de financiamiento proviene de las utilidades generadas al cierre de cada zafra forestal y el retorno de los préstamos otorgados es descontado a cada prestatario al momento de la distribución de utilidades de la siguiente zafra forestal.El monto asignado para este fondo por gestión es variable de acuerdo con las utilidades generadas, mismo que se define en cada asamblea de cierre de gestión y se va acumulando año a año. A la fecha existe un saldo acumulado de aproximadamente Bs. 50.000 (USD 7.184) y en la actualidad por gestión se destina aproximadamente Bs. 16.000 (USD 2.300), distribuido en partes iguales a los fondos de salud y educación.La gestión de este fondo se encuentra a cargo de la directiva de la AFI-ASC, que está conformada por: un representante legal, encargado(a) de Economía y Finanzas, un sistematizador, Secretario(a) de Actas, Secretario(a) de Salud, Secretario(a) de Educación, Control Social y Vocal. La directiva se renueva cada 5 años y es elegida por votación en asamblea ordinaria. Cabe mencionar que son los secretarios de Salud y Educación quienes manejan los recursos financieros de cada fondo y aprueban las solicitudes de otorgación de los préstamos con plena autonomía, exceptuando algunos casos especiales en los que se eleva la aprobación a una instancia superior que comprende a toda la directiva. En el caso de los préstamos destinados para educación, éstos se dan en forma equitativa a cada socio en la época de compra de materiales escolares (febrero de cada año). En el caso de préstamos destinados para salud, éstos son otorgados a los socios en el momento de su necesidad y previa aprobación por parte de la encargada de salud, debiendo respaldar su solicitud mediante recetas médicas, estudios médicos u otros.Canaliza fondos Recibe fondosFase I: Entrevista detallada con la Agencia ImplementadoraFase II: Entrevistas con informates clavesFase III: Grupos focales para retroalimentación y validaciónPara una mayor comprensión de la metodología, es necesario describir los principales actores que intervienen en el flujo financiero del fondo rotatorio en estudio.Fuente de financiación: Corresponde al proveedor de fondos del Flujo Financiero.Al ser el fondo rotatorio una fuente de financiamiento proveniente de las utilidades de la AFI-ASC, se ha identificado como financiador a la asamblea general de la asociación, que a su vez está constituida por todos los socios.Agencia Implementadora (AI): Es la organización que canaliza dinero directamente a las partes interesadas en el paisaje. En este estudio de caso, se ha identificado como AI a la directiva de la AFI-ASC.Receptores o beneficiarios: Se ha identificado como receptores individuales a todos los socios prestatarios de la AFI-ASC beneficiados con el financiamiento del fondo rotatorio.El proceso del flujo financiero y sus actores, se exponen en la figura 3.La metodología empleada para obtener los resultados presentados en el presente informe puede dividirse en tres fases consecutivas de levantamiento de información y su respectiva validación, tal como se muestra en la figura 4.Figura 4. Fases en el proceso de levantamiento y validación de la informaciónComienza con una entrevista detallada con la Agencia Implementadora (AI), que juega un papel central como intermediario de los flujos financieros orientados hacia los objetivos sociales del paisaje. Esta fase tiene como objetivo definir: 1) la fuente de financiación del fondo rotatorio y sus características; 2) los principales receptores o grupos de receptores;3) los flujos financieros asociados a las fuentes y receptores; 4) el proceso de combinación y canalización de fondos; 5) el mecanismo financiero aplicado y sus reglas subyacentes; y 6) los riesgos y barreras involucradas desde la perspectiva de la AI. Además de esta información, la Fase 1 dará como resultado una lista de partes interesadas que serán entrevistadas en las fases posteriores.Comprende la recopilación de datos relacionados a las fuentes de financiación, los receptores individuales y proveedores de servicios. Si bien la metodología incluye adicionalmente a receptores grupales como informantes claves, se aclara que para este estudio no se tomarán en cuenta puesto que no intervienen en el flujo financiero de la organización, tomando en cuenta que los recursos del fondo rotatorio son autofinanciados por la misma y los préstamos son otorgados de manera individual.Esta fase se centra en las percepciones del riesgo y las estrategias de mitigación, las barreras percibidas por cada uno de los grupos de interés y las formas de superarlas.También busca determinar en qué medida se han cumplido las expectativas de las partes interesadas y los efectos percibidos o anticipados de los flujos financieros sobre los objetivos de sostenibilidad en relación con los paisajes en cuestión.Permite validar la información resultante de la Fase 2 a través de discusiones de grupos focales que involucran a representantes de los principales grupos de receptores, proveedores de servicios, la agencia implementadora y otras partes interesadas en relación con los flujos financieros.Luego de concluir con el trabajo de campo, se realizó un proceso de sistematización de toda la información obtenida para su posterior análisis. Para ello se siguió la metodología presentada en el documento \"Financiamiento para la Gestión Integrada del Paisaje\" (Primo et al. 2021).4.1 Fase I: Entrevista detallada con la Agencia Implementadora (AI)Se entrevistó en primera instancia al representante legal de la AFI-ASC, quien derivó como delegado al sistematizador para proveer toda la información necesaria relacionada al fondo rotatorio en estudio.Según la entrevista, la AFI-ASC tienen como objetivos de su paisaje: mejorar la calidad de vida de sus socios a través de un manejo sostenible del bosque; generar beneficios económicos para sus socios y mitigar el cambio climático.De acuerdo con la entrevista, la Agencia Implementadora del fondo rotatorio está conformada por el equipo técnico de la AFI-ASC (que a su vez forma parte de la directiva), quien capta, gestiona y canaliza los recursos del flujo financiero.Estos recursos tienen como fuente de financiamiento a la asamblea de socios y como beneficiarios a cada uno de los socios de manera individual. Las entradas de dinero del flujo financiero provienen de una parte de las utilidades de la AFI-ASC y las salidas de dinero corresponden a los préstamos otorgados para salud y educación de sus asociados. El monto del fondo rotatorio es variable en función a las utilidades generadas en la gestión y el cual es consensuado en la asamblea de socios.El nivel de riesgo percibido por la AI es medio y está relacionado con la provisión de fondos, debido a que ésta depende de una sola fuente de financiamiento (utilidades de la actividad forestal) que a su vez está expuesta a los siguientes riesgos:Riesgo de producción: Factores climáticos (lluvias tempranas) que impiden sacar la madera oportunamente para su venta, debido a que los caminos para el transporte de la madera cortada se vuelven inaccesibles. Para mitigar el riesgo de pérdida de madera por la inaccesibilidad de caminos en época de lluvias, la AFI-ASC busca compradores que tengan la capacidad productiva necesaria (maquinaria, transporte) para la extracción oportuna de la madera para la venta, o que, en caso de lluvias tempranas, tengan las condiciones para su rápida extracción.Riesgo Financiero: Retrasos en los pagos por parte de los compradores, lo que afecta directamente la liquidez de la AFI-ASC y por ende, la distribución de las utilidades. Para mitigar este riesgo, la AFI-ASC realiza la gestión de cobranza por cuenta propia, dado que contratar a un abogado le significaría un costo considerable. Como estrategia futura, se tiene pensado solicitar a las organizaciones matrices (COPNAG, AFIG) asesoría legal a través de la contratación de un abogado.Riesgo de mercado: Disminución del precio de la madera, lo cual incide significativamente en la generación de utilidades y, por ende, en la inyección de recursos para el fondo rotatorio. Como estrategia ante el riesgo de disminución de precios de la madera, la AFI-ASC intentó unificarse con otras OFC para estandarizar los precios de acuerdo a la distancia. Sin embargo, no se ha logrado este objetivo debido a que muchas de las OFC todavía tienen un limitado poder de negociación con sus compradores por los elevados anticipos adeudados.Riesgo institucional: Paralelismo directivo en las centrales matrices (por ejemplo: COPNAG, AFIG) que afectan el respaldo institucional ante posibles conflictos de distinta índole (Por ejemplo: avasallamientos, baja de precio de la madera, entre otros). Si bien este riesgo no afecta directamente al funcionamiento del fondo rotatorio, su incidencia radica principalmente en la solidez para la resolución de conflictos externos, que en muchos casos pueden ser ajenos al control de la AFI-ASC.Las barreras percibidas por la AI tienen un nivel bajo y también están relacionadas a la captación de recursos para el fondo, específicamente al consenso de los miembros de la asamblea de socios para definir el monto que se va a destinar de sus utilidades.Si bien el reglamento interno especifica el porcentaje de las utilidades que deben destinarse para el fondo, en la práctica este monto es negociable y consensuado en la asamblea de socios.Respecto a los efectos percibidos a partir de la implementación del fondo rotatorio, la AI indica que existe un efecto positivo en el ámbito social del paisaje, dado que satisface parte de las necesidades humanas de los socios de la AFI-ASC.II a. Entrevistas con informantes clave identificados durante la fase ISe realizaron entrevistas a miembros de la Asamblea de Socios de la AFI-ASC, los cuales representaron el 16% de dicha entidad. Cabe aclarar que la época en la que se realizaron las entrevistas corresponde a la temporada alta de la actividad forestal de la AFI-ASC por lo que gran parte de sus socios se encontraban en el campo y sin disponibilidad de tiempo.De acuerdo a su percepción, la AFI-ASC tiene como objetivos de su paisaje:• En lo social, mejorar la calidad de vida de sus socios. • En lo económico, mejorar los ingresos de sus socios. • En lo ambiental, conservar el medio ambiente.La única fuente de financiamiento del fondo rotatorio es la asamblea de socios de la AFI-ASC y está conformada por 25 personas, quienes destinan cada año una parte de sus utilidades provenientes del manejo forestal al financiamiento de gastos de salud y educación de sus socios.De acuerdo al reglamento interno y el PGMF de la AFI-ASC, cada año se debe dejar un 20% de las utilidades generadas para el fondo de salud y educación (en partes iguales). Sin embargo, en la práctica este importe es definido y consensuado en la asamblea de socios al cierre de cada gestión forestal, dependiendo de las utilidades generadas en dicha gestión. El tiempo del acuerdo es de un año, y es otorgado bajo el mecanismo financiero de préstamo sin intereses. El monto del financiamiento del fondo varía entre Bs. 5.000 (USD 718) y Bs. 36.000 (USD 5.172) por gestión, teniendo una tasa de recuperación de capital del 100% anualmente, sin riesgo de no ser devuelto en su totalidad porque este es descontado a cada asociado al momento de la distribución de sus utilidades.El 100% de los entrevistados coinciden que los riesgos percibidos por la fuente de financiamiento del fondo rotatorio están relacionados a la actividad forestal de la AFI-ASC, puesto que existe una dependencia total de las utilidades de esta actividad para la provisión de los recursos del flujo financiero, predominando los riesgos de mercado y financieros:Riesgo de mercado: El 75% de los entrevistados coinciden que el principal riesgo que afecta la provisión de recursos al fondo rotatorio proviene de la disminución de los precios de la madera en el mercado debido a la oferta que realizan otras OFC que enfrentan problemas financieros y que venden su madera a precios bajos. Sin embargo, la AFI-ASC dispone de mayor poder de negociación con sus compradores en virtud de la certificación de buen desempeño con la que cuenta otorgada por el Sistema Boliviano de Certificación de Bosques e Incentivos (SBCBI). Asimismo, otra estrategia para mitigar este tipo de riesgos ha sido la espera de mejores precios, recurriendo a la búsqueda de nuevos clientes.Riesgo Financiero: El 75% de los entrevistados indican que el retraso de pago por parte de los compradores afecta la liquidez de la AFI-ASC, y, por consiguiente, la provisión oportuna de recursos al fondo rotatorio. La mitigación de este riesgo se realiza mediante la adecuada selección de sus compradores, tomando en cuenta los antecedentes y llevando la cobranza a instancias legales, en caso de ser necesario.Riesgos de producción: El 50% de los entrevistados indican que existen factores climáticos (lluvias tempranas) que pueden impedir la extracción oportuna de la madera para la venta debido a la inaccesibilidad de los caminos, aspectos que inciden directamente en la generación de utilidades que inyectan los recursos al fondo rotatorio. Como estrategia de mitigación, la AFI-ASC busca compradores que cuenten con la capacidad productiva (maquinaria, transporte) que permitan sacar oportunamente la madera, o en caso de ser necesario, adelantar la zafra.De acuerdo a su percepción, el 75% de los entrevistados indican que no perciben barreras para la aplicación del fondo rotatorio desde la fuente de financiamiento. El 25% indica que percibe una mínima barrera con relación al consenso de los socios para definir los montos a asignar al fondo de educación, principalmente, porque existe una minoría que prefiere recibir más utilidades o no cuentan con hijos en edad escolar. En los casos en los que haya socios que decidan no obtener los préstamos para educación, ese importe no utilizado les queda como un ahorro y pueden retirarlo cuando lo necesiten.Los efectos esperados en el paisaje desde el punto de vista de la fuente se centran en un bienestar social a través de una buena salud y educación de los socios y sus familias.Respecto a los efectos percibidos a partir de la implementación del fondo rotatorio, la fuente indica que existe un efecto positivo en el ámbito social del paisaje, dado que brinda seguridad a sus asociados al disponer de estos recursos ante una emergencia o necesidad de salud o educación.Para el mejoramiento del fondo rotatorio, la fuente de financiamiento sugiere, por un lado, ampliar el uso al financiamiento de actividades productivas y por otro, buscar nuevas fuentes de financiamiento, para no depender únicamente de la actividad forestal.Como se puede evidenciar, existe una relación directa entre los ingresos por venta de madera de la AFI-ASC y su fondo rotatorio, dado que todas las entradas de este flujo financiero provienen de las utilidades generadas por la actividad forestal desarrollada. Por lo tanto, toda afectación en la actividad forestal incide de alguna manera tanto en la provisión como en la sostenibilidad del fondo rotatorio.En representación de los beneficiarios del fondo rotatorio, se entrevistó al 24% de dicha entidad. Cabe aclarar que la época en la que se realizaron las entrevistas corresponde a la temporada alta de la actividad forestal de la AFI-ASC por lo que gran parte de sus socios se encontraban en el campo y sin disponibilidad de tiempo.De acuerdo con las entrevistas realizadas, los receptores o beneficiarios del fondo rotatorio son todos los socios de la AFI-ASC, quienes pueden recibir individualmente entre Bs. 1.000 (USD 144) y Bs. 10.000 (USD 1.437) al año, en forma de préstamos de corto plazo sin interés. Estos recursos tienen como único fin el financiamiento de gastos de salud y educación de sus asociados. El monto recibido del fondo rotatorio es variable en función a las utilidades generadas en la gestión.Respecto al riesgo percibido por los receptores del fondo, el 50% de los entrevistados indica que es un riesgo medio debido a que la sostenibilidad y crecimiento del fondo para los beneficiarios depende de las utilidades de una actividad que está expuesta a su vez a riesgos de producción (factores climáticos) y riesgos financieros (disminución de precios de venta que afectan la utilidad). El 33% de los entrevistados indica que el riesgo percibido es bajo y está relacionado a la disponibilidad inmediata de los recursos en caso de emergencia (salud), dado que los encargados de la entrega de los mismos deben apersonarse a las entidades financieras en los horarios y días establecidos para hacer los retiros de dinero correspondientes. Finalmente, el 17% restante percibe un nivel de riesgo alto y está enmarcado en el riesgo de producción y financiero que envuelve a la actividad forestal de la que provienen los recursos del fondo rotatorio.El 50% de los receptores individuales entrevistados expresan no percibir ninguna barrera para acceder al fondo rotatorio. El restante 50% tienen algunas diferencias entre sí. Por un lado, se percibe un nivel alto de barrera y está relacionado con la sostenibilidad a través del tiempo para sus beneficiarios, dado que la captación de los recursos depende únicamente de la generación de utilidades de la actividad forestal de la AFI-ASC. Por otro lado, se percibe un nivel de barrera bajo, y se refiere principalmente a limitaciones en el monto para los préstamos de salud, dado que para montos considerables se debe solicitar la autorización de otros socios para hacer uso de la parte de su cuota del fondo y poder cubrir su necesidad. Finalmente, se menciona como una barrera la disponibilidad inmediata de los fondos, puesto que el dinero debe ser retirado por los encargados del fondo (AI) en horarios y días de atención de entidades financieras.Respecto a los efectos percibidos a partir de la implementación del fondo rotatorio, los entrevistados coinciden que existe un efecto positivo puesto que crea un beneficio económico y fortalece el capital social de la AFI-ASC a través de la cooperación y solidaridad.Se entrevistó al Instituto Boliviano de Investigación Forestal (IBIF), uno de los proveedores externos de la AFI-ASC que trabaja conjuntamente para el cumplimiento de los objetivos de su paisaje.El Instituto Boliviano de Investigación Forestal (IBIF) es una ONG del sector Forestal y de conservación de la naturaleza que tiene un término medio de familiaridad con el flujo del fondo rotatorio de la AFI-ASC. Su opinión hacia el flujo es positiva, y según su apreciación, existen condiciones propicias para el desarrollo de este mecanismo financiero debido a la buena organización interna y el buen cumplimiento de sus estatutos y normas que posee la AFI-ASC.Respecto a los efectos percibidos en el paisaje de la AFI-ASC, el fondo rotatorio cumple un fin social puesto que ayuda a los socios y sus hijos a mejorar su salud y educación. Asimismo, el proveedor de servicios manifiesta que estos aspectos ayudan a su vez al cumplimiento de objetivos de su propia entidad en cuanto a la buena gestión de paisajes de la región.El proveedor de servicios externo menciona como fortalezas del flujo la transparencia y buena gestión de la AFI-ASC, lo que a su vez genera seguridad y credibilidad de sus asociados (fuentes y beneficiarios del fondo). Respecto a las debilidades percibidas, se menciona el no pago de las empresas compradoras, lo cual repercute en la captación de recursos para el fondo.Para mejorar la sostenibilidad del fondo, se sugiere a la AFI-ASC hacer contratos de venta con empresas responsables, con capacidad de extracción (contar con maquinaria y transporte propio) y capacidad de pago, lo cual permita asegurar la captación y devolución de los recursos del fondo rotatorio y, por ende, su continuidad a través del tiempo.Para esta fase se realizaron dos grupos focales para la validación y retroalimentación de la información recopilada en las entrevistas y encuestas individuales.El primer grupo focal contó con la presencia de siete representantes de los actores claves del flujo financiero del fondo rotatorio: tres representantes de la fuente, dos representantes de la AI y dos representantes de los beneficiarios o receptores individuales. El segundo grupo focal contó con la presencia de cuatro representantes de los actores claves del flujo financiero del fondo rotatorio: un representante de la fuente, un representante de la AI y dos representantes de los beneficiarios o receptores individuales.A través de los dos grupos focales, se logró validar y retroalimentar gran parte de la información obtenida en las entrevistas y encuestas individuales (Fase I y II), respecto a los efectos, riesgos y barreras percibidos por los distintos grupos de actores clave del flujo financiero. Asimismo, se pudo relevar información sobre el funcionamiento del mecanismo financiero en estudio y las oportunidades de mejora.-25 -SECCIÓN VLa información de las entrevistas y encuestas realizadas y su posterior validación mediante los grupos focales sobre el mecanismo objeto de estudio denominado fondo rotatorio, se resume a continuación.El principal objetivo que persigue la AFI-ASC es el manejo sostenible y conservación de su paisaje (territorio, bosques). Seguidamente se encuentra la mejora de la calidad de vida y generación de beneficios económicos para sus socios.El fondo rotatorio de la AFI-ASC es un mecanismo financiero destinado a cubrir las necesidades de salud y educación de sus socios. La fuente de financiamiento proviene de las utilidades generadas al cierre de cada zafra forestal que circulan entre sus asociados en forma de préstamos sin costo (intereses), y cuya devolución es descontada a cada prestatario al momento de la distribución de utilidades de la siguiente zafra forestal.El monto asignado para este fondo por gestión es variable de acuerdo con las utilidades generadas, mismo que se define en cada asamblea de cierre de gestión y se va acumulando año a año. Cabe mencionar que en las dos últimas gestiones no se han destinado recursos para el fondo debido a la reducción considerable de sus ingresos y utilidades por los precios bajos de la madera. Sin embargo, para la presente gestión se indica que se ha conseguido mejorar los precios de venta, estimando generar utilidades y lograr destinar parte de las mismas al fondo rotatorio, como indica su reglamento.Respecto a la transparencia del fondo, la directiva de la AFI-ASC realiza una rendición de cuentas en la asamblea de cierre de cada gestión, siendo los encargados de salud y educación los responsables de informar sobre la administración y gestión de cada fondo.Según la consulta realizada, todos los socios se benefician de al menos uno de los dos fondos, sin embargo, los pocos socios que no acceden a los préstamos normalmente se debe a que en ese momento no tienen la necesidad de salud o educación y prefieren que esos recursos queden como un ahorro para ellos o se utilicen para cubrir alguna necesidad mayor de algún otro socio (en el caso de salud).Efectos esperados y percibidos de los flujos financieros sobre los objetivos del paisaje (sociales, económicos y ambientales)De acuerdo con la información validada, la AFI-ASC espera cumplir los siguientes objetivos de su paisaje: manejo sostenible del bosque para su conservación y mitigación del cambio climático, mejora de la calidad de vida y de los beneficios económicos de sus asociados.Respecto a los efectos percibidos del fondo rotatorio en su paisaje, todos los grupos de interés coinciden que genera un impacto social positivo, dado que cubre parte de necesidades básicas (salud y educación) de sus asociados, promoviendo el bienestar humano, la solidaridad y el fortalecimiento del capital social.Percepciones de riesgo en relación con los fondos rotatorios, las estrategias de mitigación y la exposición al riesgo resultante según el grupo de interés.Como resultado del grupo focal realizado, los distintos grupos de interés coinciden en su mayoría que el riesgo percibido es bajo, y está centrado principalmente en la captación de los recursos del flujo financiero.Por lo tanto, los principales riesgos percibidos están relacionados a la actividad forestal de donde provienen los recursos del fondo rotatorio, entre los más destacados se mencionan: precios bajos de la madera, retrasos en los pagos por parte de los compradores y factores climáticos que afecten el aprovechamiento oportuno de la madera, aspectos que se han logrado mitigar con estrategias adecuadas.Una de las principales barreras para expandir el financiamiento del fondo rotatorio es la dependencia de una única fuente de financiamiento, proveniente de la actividad forestal de los socios de la AFI-ASC, y la opción para superarla es la búsqueda de nuevas fuentes de financiamiento del fondo. En menor importancia, otra de las barreras que experimenta la AI en la captación de los recursos para el fondo, radica en el consenso de los socios para definir cuánto destinar de sus utilidades al fondo rotatorio, debido a que hay algunos socios que prefieren recibir un mayor porcentaje de utilidad.Las oportunidades identificadas por los distintos grupos de interés radican principalmente en mejorar las condiciones del acuerdo: por un lado, se sugiere ampliar el monto de los préstamos del fondo rotatorio y, por otro lado, ampliar el uso a otras actividades productivas de los asociados, lo cual generaría un impacto social y económico mayor en el paisaje. En ambos casos, será necesaria la búsqueda de nuevas fuentes de financiamiento, ya sean estas internas (aportes de socios) o externas (entidades financieras, ONG, entre otros).Como se mencionaba anteriormente, este estudio de caso busca resaltar uno de los mecanismos subyacentes a los flujos financieros que fluyen hacia iniciativas de paisaje integrado, esperando que los hallazgos informen el diseño de mecanismos para financiar iniciativas de paisajes integrados y, en última instancia, faciliten el flujo de financiación en apoyo de los objetivos de paisaje compartidos en la región.Para visibilizar el potencial que tiene el fondo rotatorio tanto para la AFI-ASC como para otras organizaciones similares, se ha partido de la propia experiencia de la AFI-ASC en la implementación de este mecanismo, la cual ha sido contrastada con otros estudios sobre el uso de fondos rotatorios en organizaciones de pequeños productores de Argentina y Colombia.Se consultó como referencia práctica de este mecanismo financiero un trabajo de investigación acerca de las experiencias de fondos rotatorios de 17 organizaciones del sector de la pequeña agricultura familiar en el área rural de Argentina (INTA, 2010) y una tesis acerca del diseño de un modelo de fondo rotatorio que permita incrementar la competitividad y sostenibilidad de asociaciones agropecuarias, basado en un estudio de caso de una asociación de productores de plátano de Colombia (Montoya, 2016). Asimismo, se tomó como referencia conceptual, una guía metodológica para la implementación de fondos rotatorios desarrollada por la Unidad para el Cambio Rural (UCAR) del Ministerio de la Agroindustria (Yangosian y Colombet 2016), documento que a su vez se originó y perfeccionó a partir de la implementación de este mecanismo en distintas áreas rurales de Argentina.La experiencia de la AFI-ASC y de otras organizaciones en el uso de Fondos Rotatorios da muestra de la existencia de una profunda diversidad, tanto en los procedimientos operativos como en los sentidos atribuidos a los mismos. Al mismo tiempo, también se pudieron evidenciar muchas similitudes en cuanto a aspectos generales que facilitan, condicionan u obstaculizan la implementación y el desarrollo de experiencias de Fondos Rotatorios, lo cual nos permitirá plantear una serie de conceptos, condiciones e instrumentos guía que puedan generar interés acerca del uso y/o financiamiento de este mecanismo financiero.A partir del estudio de caso realizado acerca del fondo rotatorio que maneja la AFI-ASC, se ha construido una matriz (ver tabla 4) para la identificación de dificultades y oportunidades de mejora que pueden facilitar y potenciar su aplicación tanto en la misma asociación como en otras regiones y/o contextos de trabajo. Esta matriz permite formular mejoras necesarias para incorporarlas a un modelo de fondo rotatorio, se contemplan algunas sugerencias realizadas por los propios socios de la AFI y buenas prácticas que pudieron extraerse de la literatura consultada.Tabla 4. Matriz de dificultades y oportunidades de mejora identificadasDificultades Oportunidades de mejoraEl uso del fondo rotatorio actualmente está limitado a financiar gastos de salud y educación de los socios de la AFI-ASC, excluyendo otras necesidades de financiamiento importantes de los beneficiarios.Se sugiere ampliar el uso del fondo rotatorio para financiar otras actividades de los socios alternas a la actividad forestal de la AFI-ASC, toda vez que existe la necesidad de los socios de generar mayores ingresos para su subsistencia. Con esta ampliación, se estaría aportando a la reactivación económica de la comunidad y generando un mayor impacto social y económico en los beneficiarios. Según manifiestan varios de los socios, el monto de los préstamos del fondo rotatorio es insuficiente para cubrir todas las necesidades de salud y educación que experimentan.Para promover el crecimiento del fondo y, por ende, la ampliación de los montos de los préstamos, se sugiere la generación de ingresos adicionales, por ejemplo: cobro de interés sobre los préstamos, realización de alguna actividad de los socios para recaudar fondos, entre otros.La provisión de fondos al flujo financiero, así como el retorno de los préstamos otorgados a los beneficiarios, dependen de una única fuente (utilidades de la actividad forestal de la AFI-ASC), aspecto que dificulta la sostenibilidad del fondo rotatorio en el tiempo. Un claro ejemplo de esta dificultad es que en los últimos dos años no se ha podido inyectar recursos económicos al fondo.Se sugiere la diversificación de la fuente de financiamiento del fondo rotatorio, para lo cual se propone la búsqueda de fuentes alternas a las utilidades de la actividad forestal, por ej.: aportes adicionales de los socios de actividades paralelas a la actividad forestal o la búsqueda de financiadores externos como ser: Alianzas con ONG, Entidades Financieras, entre otros.No existe una disponibilidad inmediata de los recursos para los beneficiarios, dado que los encargados de cada fondo (salud y educación) deben apersonarse a las entidades financieras en los días y horarios de atención al público. Digitalización de la herramienta por medio del uso de pagos virtuales.Existe escasa reglamentación e instrumentos operativos que rijan el uso y administración del fondo rotatorio (únicamente se tiene escrito en el PGMF que la AFI -ASC debe destinar un % de sus utilidades a salud y educación de sus socios). Respecto a los respaldos de las entradas de dinero al fondo, éstas se respaldan con un acta. Por otro lado, las salidas del fondo, se respaldan con carta de solicitud de préstamo.Se sugiere contar con un reglamento e instrumentos operativos que permitan un adecuado manejo y control de los recursos del fondo rotatorio. Se adjunta en los anexos del presente Estudio de Caso un reglamento e instrumentos modelo que pueden servir de base.Es importante resaltar que los fondos rotatorios se enmarcan en una alternativa local contra la exclusión financiera, que tiene el objetivo de facilitar el acceso al crédito a una población (personas, familias, grupos y organizaciones) que cuenta con dificultades para acceder al sistema financiero formal, y que por lo general es destinado a actividades productivas individuales y colectivas, y a necesidades de tipo familiar (Montoya, 2016).En el caso de la AFI-ASC, el fin del fondo rotatorio es netamente familiar, ya que está destinado a cubrir necesidades de salud y educación de sus socios y sus familias. Si bien este mecanismo cumple un importante fin social dentro del paisaje, éste podría potenciarse ampliando su impacto social y económico en sus beneficiarios al destinar una parte de su uso al financiamiento de actividades alternas. Esta sugerencia de mejora se puede fundamentar también en la experiencia de los fondos rotatorios consultados que financian capital de trabajo de actividades productivas y han obtenido resultados positivos en su aplicación, indicando como una estrategia clave para la recuperación de los préstamos el realizar algún tipo de acompañamiento con posterioridad a su otorgamiento (seguimiento, formación y asistencia técnica, siendo este último componente el más frecuente). Una de las dificultades más relevantes y que afecta de sobremanera la sostenibilidad del fondo rotatorio de la AFI-ASC, radica en la dependencia total de la actividad forestal como fuente de financiamiento del fondo y de retorno de los préstamos otorgados. Para ello se sugiere la búsqueda de fuentes alternas como pueden ser: aportes adicionales de los socios de actividades paralelas a la actividad forestal o la búsqueda de financiadores externos por ejemplo alianzas con ONG, entidades financieras, entre otros. Con relación a la sostenibilidad, los estudios referenciados mencionan algunas estrategias utilizadas como el trabajo voluntario, la participación directa, la apropiación, la proximidad, la flexibilidad de la operatoria, las inyecciones de nuevos fondos, los períodos de gracia y la tasa de interés diferenciada, entre otras (INTA, 2010). Específicamente con relación a la inyección de nuevos fondos, se expone un marcado predominio en las fuentes de financiación provenientes de la cooperación internacional y en menor importancia, subsidios nacionales, aspecto que valida la posibilidad de conseguir fuentes alternas de financiamiento para la AFI-ASC que permitan la sostenibilidad y crecimiento de su fondo rotatorio.Adicionalmente, se sugiere la generación de ingresos adicionales que alimenten el fondo rotatorio de la AFI-ASC para poder otorgar mayores montos de préstamos, por ejemplo: cobro de interés sobre los préstamos, realización de alguna actividad de los socios para recaudar fondos (rifas, venta de comida, entre otros eventos). Esta sugerencia emerge de experiencias percibidas por la Fundación PROFIN en la implementación de mecanismos similares (Grupos Autogestionados de Ahorro y Crédito) en la Ciudad de La Paz y también coincide con algunas estrategias utilizadas por los Fondos Rotatorios consultados para evitar su descapitalización o pérdida de valor (Yangosian y Colombet 2016).En cuanto a la reglamentación y registro de la información del fondo rotatorio de la AFI-ASC, se sugiere crear un reglamento específico que rija su uso y mejorar los instrumentos operativos existentes para llevar un mejor control y gestión, más aún si se tiene considerado ampliar en un futuro los montos y usos del mismo. Tal como se sugiere, los estudios consultados coinciden que, para llevar adelante la gestión operativa de un fondo rotatorio, es conveniente establecer algunos procedimientos que ayuden a manejarlo de un modo eficiente y con transparencia hacia los integrantes de la organización (Yangosian y Colombet 2016). Basado en lo anterior y en la observación de experiencias de organizaciones similares, se proponen instrumentos guía para el uso y gestión de un fondo rotatorio, ver anexo 1.Por otro lado, es importante destacar las ventajas, así como las desventajas, que tiene el fondo rotatorio de la AFI-ASC con relación a otras fuentes de financiamiento disponibles, ver tabla 5. Como se puede evidenciar, el fondo rotatorio para la AFI-ASC representa una importante fuente de financiamiento para sus asociados con importantes ventajas y algunas limitaciones con relación a una fuente de financiamiento formal. Asimismo, hay que destacar que esta herramienta se constituye en alternativa de inclusión financiera para beneficiarios que no pueden acceder al financiamiento tradicional, reforzando el impacto social percibido.Dicho todo esto, y apoyado en la literatura consultada acerca de la implementación de fondos rotatorios, se presenta la siguiente información conceptual, condiciones e instrumentos generales que se espera incrementen el interés de posibles usuarios y/o financiadores de este importante mecanismo financiero.El fondo rotatorio es un instrumento de gestión de recursos para organizaciones que cuentan con reducidas posibilidades de acceso a financiamiento (Yangosian y Colombet 2016).Funciona básicamente como una \"caja de recursos\" que gestiona una organización y que \"circulan\", o \"rotan\", entre ella y los asociados en forma de créditos. Estos créditos se destinan principalmente a financiar las actividades productivas de los miembros de la organización, entre otras necesidades familiares. Cuando ellos devuelven los créditos, los recursos regresan al fondo para poder volver a prestarse a otros miembros del grupo (Yangosian y Colombet 2016).La garantía de los créditos que otorga el fondo rotatorio, a diferencia del crédito bancario habitual, está basada en la solidaridad y el compromiso de los integrantes de la organización (Yangosian y Colombet 2016).Una característica importante de este instrumento es que se presenta en comunidades y grupos de personas que tienen procesos organizativos, y en donde se ha tomado conciencia de su realidad y se ha decidido afrontarla con iniciativas de desarrollo propias. Organizaciones comunitarias y gremiales como juntas de acción comunal, juntas de vecinos, asociaciones de productores y de mujeres, organizaciones indígenas y tiendas comunitarias, entre otras (Montoya, 2016).Por lo general, los fondos tienen en cuenta la cultura local, las condiciones de vida, las necesidades productivas, las motivaciones, los intereses y los planes de vida de las comunidades y las personas, así como las características y particularidades de los procesos de las comunidades y asociaciones de las cuales han surgido. En este sentido, los fondos tienen diferentes dinámicas y objetivos de acuerdo con los grupos y personas que los conforman (Montoya, 2016). El desarrollo de este mecanismo en organizaciones del sector de la Pequeña Agricultura Familiar, tiene un rol relevante en términos de soberanía y seguridad alimentaria, sobre todo porque promueve la producción variada de alimentos en el ámbito local, tanto para consumo como para venta (INTA, 2010).A través de los fondos se potencian valores como la solidaridad, el trabajo en equipo, la responsabilidad, la honestidad, el sentido de pertenencia, la autonomía, la auto ayuda y el respeto (Montoya 2016).Tomando en cuenta lo anterior, se puede inferir que este mecanismo contribuye al cumplimiento de iniciativas del paisaje integrado, promoviendo la producción sostenible, el bienestar humano y la buena gobernanza. Una estrategia para reducir el riesgo de incobrabilidad es la diversificación de actividades, es decir, dar créditos para diferentes actividades de los socios.Finalmente, para cubrir la pérdida por inflación es importante no dejar el dinero inmovilizado, porque el mismo va perdiendo su valor. Por eso, cuanto mayor sea la rotación de los recursos, el fondo rotatorio se descapitalizará menos. La tasa de interés también puede ajustarse en función de la inflaci��n.Las ventajas de la aplicación y manejo adecuado del fondo rotatorio significan un incentivo, tanto a nivel de la organización como a nivel individual para los socios, debido a que:• Representa una alternativa para el acceso a financiamiento. • Mejora la relación de los productores socios de forma individual en cuanto a la economía familiar y su capacidad de gestión familiar. • Mejora la relación de la organización en cuanto a: participación, autogestión, compromiso, crecimiento colectivo, autonomía productiva. • Estos fondos tienen un gran impacto en el mantenimiento de la sustentabilidad ecológica ya que las economías campesinas e indígenas involucran formas de producción y reproducción de sus condiciones materiales de existencia, a partir de un metabolismo equilibrado con la naturaleza, lo que contrasta fuertemente con los impactos ambientales de otras actividades económicas (extractivismo, agricultura industrial, minería a cielo abierto, etc.).¿Cómo se conforma un fondo rotatorio?El fondo rotatorio deberá ser funcional, operativo, viable, transparente y sostenible, para lo cual se debe elaborar un reglamento de fácil entendimiento y aplicación, mismo que debe ser difundido y de conocimiento de todos los miembros de la organización.En reunión de la directiva de la organización se deben definir los siguientes aspectos: El balance general sobre la realización del Estudio de Caso fue positivo, puesto que se logró ilustrar uno de los mecanismos subyacentes a los flujos financieros de la AFI -ASC que fluyen hacia iniciativas del paisaje integrado. La metodología utilizada permitió identificar los actores clave vinculados con dichos flujos financieros, sus perspectivas y motivaciones, sus riesgos y barreras percibidas por los diferentes grupos de interés, las diferentes estrategias que han utilizado para superarlos o reducirlos, así como sus expectativas y el grado de cumplimiento de éstas.Sin embargo, existieron algunas limitaciones en la aplicación de la metodología como la poca disponibilidad de tiempo de varios socios que se encontraban en el área rural por ser una época alta de la actividad forestal, misma que fue paliada por la gran predisposición de los socios entrevistados de la AFI -ASC para brindar toda la información solicitada. A pesar que el grupo entrevistado no es homogéneo en cuanto a edad y nivel de formación, todas las entrevistas llegaron a los receptores con un lenguaje claro y sencillo, logrando así el objetivo trazado.El fondo rotatorio de Salud y Educación de la AFI -ASC se muestra como un mecanismo financiero que ayuda al cumplimiento de los objetivos sociales de su paisaje, dado que satisface parte de necesidades básicas (salud y educación) de sus asociados, promoviendo el bienestar humano, la solidaridad y el fortalecimiento del capital social.Además de representar una alternativa de acceso al financiamiento de sus socios, fomenta el ejercicio de la participación, la gobernabilidad y la discusión comunitaria sobre el destino y la distribución de los recursos comunitarios, en el marco de valores de la economía social y solidaria.La fuente de financiamiento del fondo proviene de las utilidades generadas al cierre de cada zafra forestal que circulan entre sus asociados en forma de préstamos sin costo (intereses), y cuya devolución es descontada a cada prestatario al momento de la distribución de utilidades de la siguiente zafra forestal. Cabe destacar la creación de este fondo con recursos propios de la AFI -ASC y cuyo nivel de recuperación de préstamos es del 100%.El nivel de riesgo percibido por la fuente y la AI está relacionado con la provisión de fondos, debido a que ésta depende de una sola fuente de financiamiento (utilidades de la actividad forestal). Si bien actualmente no se cuenta con una estrategia de mitigación a este riesgo, se tiene pensado proponer a la Asamblea la búsqueda de nuevas fuentes de financiamiento para asegurar la sostenibilidad del fondo.Respecto al riesgo percibido por los receptores individuales del fondo, una parte de los entrevistados indica que es un riesgo alto debido a que la sostenibilidad y crecimiento del fondo para los beneficiarios depende de las utilidades de una actividad que está expuesta a su vez a riesgos de producción (factores climáticos) y financieros (disminución de precios de venta que afectan la utilidad). Sin embargo, la otra parte de los entrevistados indica que el riesgo percibido es bajo y está relacionado a la disponibilidad inmediata de los recursos en caso de emergencia (salud), dado que los encargados de la entrega de los mismos deben apersonarse a las entidades financieras en los horarios y días establecidos para hacer los retiros de dinero correspondientes.Las barreras percibidas por la AI tienen un nivel bajo y también están relacionadas a la captación de recursos para el fondo, específicamente al consenso de los miembros de la Asamblea de Socios para definir el monto que se va a destinar de sus utilidades. Asimismo, las barreras percibidas por los receptores entrevistados tienen un nivel bajo, y se refiere principalmente a limitaciones en el acceso físico para acceder a los préstamos del fondo, que puede ser paliado con el uso de medios virtuales de pago.Las oportunidades de mejora identificadas por los distintos grupos de interés radican principalmente en mejorar las condiciones del acuerdo: Por un lado, se sugiere ampliar el monto de los préstamos del fondo rotatorio y, por otro lado, ampliar el uso a otras actividades productivas de los asociados, lo cual generaría un impacto social y económico mayor en el paisaje. En ambos casos, será necesaria la búsqueda de nuevas fuentes de financiamiento, ya sean estas internas (aportes de socios) o externas (entidades financieras, ONG, entre otros). Como parte del Estudio de Caso, adicionalmente se sugiere la digitalización de la herramienta por medio del uso de pagos virtuales y la creación de un reglamento específico e instrumentos operativos que rijan el uso y gestión de los recursos del fondo rotatorio.En resumen, el fondo rotatorio que maneja la AFI -ASC es una herramienta muy útil con gran potencial de réplica que permite incrementar la inclusión financiera y el acceso al financiamiento de miembros de organizaciones, y que se puede adaptar a distintas regiones y contextos de trabajo. Para el sector rural, los Fondos Rotatorios representan una alternativa de autoayuda y de desarrollo endógeno de carácter local e informal, que beneficia a comunidades marginales y pobres, dirigida a movilizar recursos, disponer de crédito y mejorar el escaso acceso a servicios microfinancieros, contribuyendo con el mejoramiento de la calidad de vida y la reducción de la pobreza (Montoya, 2016). "}
|
main/part_1/0287641622.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"070fc5fe6165d27ffb120363fae2c255","source":"gardian_index","url":"https://repository.cimmyt.org/server/api/core/bitstreams/dd4d3e67-4dd5-4f3e-89bf-c4337a0998aa/content","id":"780070117"},"keywords":[],"sieverID":"20c71dae-5e7b-4a64-9845-8f26934ab758","content":"Headquartered in Mexico, the International Maize and Wheat Improvement Center (known by its Spanish acronym, CIMMYT) is a not-for-profit agriculture research and training organization. The Center works to reduce poverty and hunger by sustainably increasing the productivity of maize and wheat in the developing world. CIMMYT maintains the world's largest maize and wheat seed bank and is best known for initiating the Green Revolution, which saved millions of lives across Asia and for which CIMMYT's Dr. Norman Borlaug was awarded the Nobel Peace Prize. CIMMYT is a member of the CGIAR Consortium and receives support from national governments, foundations, development banks, and other public and private agencies. CIMMYT 2012. All rights reserved. The designations employed in the presentation of materials in this publication do not imply the expression of any opinion whatsoever on the part of CIMMYT or its contributory organizations concerning the legal status of any country, territory, city, or area, or of its authorities, or concerning the delimitation of its frontiers or boundaries. The opinions expressed are those of the author(s), and are not necessarily those of CIMMYT or our partners. CIMMYT encourages fair use of this material. Proper citation is requested.The CIMMYT Socioeconomics Program (SEP) Working Papers series contain preliminary material and research results from CIMMYT social scientists and its partners. The papers are subject to an internal peer review. They are circulated in order to stimulate discussion and critical comment. The opinions are those of the authors and do not necessarily reflect those of their home institutions or supporting organizations. For more information on this series contact the CIMMYT website.Correct Citation: Krishna, V. V., S. Aravindakshan, A. Chowdhury, and B. Rudra. 2012 The present study was carried out with the broad objective of assessing the patterns of adoption and farm profitability potentials of conservation agriculture (CA) in the three northern \"disadvantaged districts\" of West Bengal, namely Malda, Uttar Dinajpur and Dakshin Dinajpur.The eastern region of the Indo-Gangetic Plains (IGP) of South Asia, which encompasses the study area, is considered relatively unfavorable for wheat production. Late-sown wheat is grown here, mostly under rain-fed conditions. The per-unit cost of production of wheat in West Bengal is the second highest in India, indicating the prevalence of rather adverse farming conditions. The farmers are extremely resource-constrained and income-poor, with limited market infrastructure for inputs as well as implements. In this background, it is anticipated that the production cost-and labor-saving CA technology, such as zero-tillage (ZT) wheat, would generate significant positive livelihood impacts. Owing largely to the short history of the ZT technology diffusion in this region, its adoption and farm-level impacts are hardly examined.The data source for the present study is a survey among 160 wheat growing households. These farmers were selected, employing a stratified random sampling procedure and household census of 10 purposively selected villages of the aforementioned districts. Both landholding size and technology adoption were employed for the household selection. The details on adoption of ZT technology and the input-output relations in wheat from the winter (rabi) crop of 2009-10 were collected during the personal interviews conducted in May-June 2010. In addition, the secondary data on wheat production and agro-climatic characteristics of the study area were assimilated to provide the necessary background.During the rabi season, wheat occupies about 40% of the cultivated area in the sample villages.Percentage of on-farm use of drills was found ranging from 0 to 85% in the wheat acreage, with partial adoption of the technology being common. Farming was subsistence-oriented and the respondents were resource-poor. The average land-holding of the sample household was 1.05 ha. One-fourth of the respondents practiced leasing-in of land for cultivation. About one-third of farmers were indebted due to crop failure in at least one of the previous three years of survey. An equal share of respondents was also reported to have faced hunger during this period. Even in the face of such economic backwardness, the low productivity of wheat allowed them only a partial dependence on the farm produce for home consumption. Enhancement of wheat productivity through input-saving, yield-enhancing CA-based resource conserving technologies (RCTs) gained social significance in this milieu.Despite the economic potentials of the technology, two major factors were found limiting the wider dissemination of the ZT wheat in the study area:1. Limited availability of ZT seed drills. Only a small share of the farmers, who are willing to adopt ZT (that constitutes about 90% of the survey respondents), have actually adopted the technology. Scarcity of seed drills is one of the major reasons behind nonadoption and dis-adoption. 2. Lack of information on the working of no-till practice among farmers. About 29% of ZT drill adopters were using the drill as a mere wheat seeding equipment after ploughing the land. Such variant use or partial adoption of this \"bundled technology\" comes with a significant cost increase, given the high prevailing wage rate for human labor and custom hiring charges for land preparation.Scarcity of quality seeds of system-specific wheat varieties was another major constraint in wheat production in the study area. The major variety found in the farmers' field was PBW-343, one of the popular wheat varieties developed by Punjab Agricultural University (PAU) for the northwest plain zones for timely sown, irrigated conditions. Although this long-duration variety is not highly congenial for the late sown wheat cultivation of West Bengal, about one-third of the sample farmers were found to be adopting this. The varietal adoption is also closely related with adoption of drills. The major source of wheat seeds for the drill adopters is Krishi Vigyan Kendra (KVK; the grass-root level agricultural training and extension centers) and government extension offices, who are also promoting the wheat. These public sector agencies provide the wheat seeds at a subsidized rate to the potential users of drill as a mechanism to promote the technology. Lack of locally adaptable wheat varieties prompts these agencies to supply \"older variety seeds\" like PBW-343 and Sonalika. However, it should be noted that in the absence of these public sector agencies, chances of getting quality seeds for farmers would be lower.The supply-and demand-side factors behind access and no-till adoption and the factors determining full/partial adoption of the technology are further examined, employing a multinomial logit model. The model results are summarized as follows: Access to information from public extension is found to be facilitating ZT drill use, but not the no-till practice per se. However, farmer communication networks are found not to be aiding the diffusion of no-till practice. Status of land tenancy, although having no impact on no-till adoption, favors ZT seed drill use against broadcasting of wheat seeds. Cattle ownership enhances tillage adoption, and additional animals owned reduce the chances of following ZT over conventional tillage (CT) by 33%. However, if a cattle owner prefers to use ZT drill, he may go for no-till, and not partial adoption (till + drill). Number of adult members in the household is found positively affecting the ZT drill adoption. However, this variable does not distinguish farmers adopting no-till with those following partial adoption. Education is found to have a significant and positive role in adopting both no-till as well as the drill use as seeding device. The aggregate community/village adoption of drills is found helpful for increasing the chances of resident farmers adopting the no-tillage practice. The total number of wheat farmers in a given village, which indicates competition for the limited number of drills, is found to reduce the chances of drill adoption for an individual farmer. This factor is also found to raise the probability of adopting no-till over partial adoption. Increase in the number of drills per village could overcome this constraint for rapid diffusion of the technology.The impacts of ZT technology were studied using mean-variance analysis and kernel-density function. The no-till farmers are found to save about 12% of the paid-out cost per-acre, even when public-sector assistance/subsidy factor is accounted. There is a significant reduction in family labor use alongside ZT adoption. When the family labor cost is imputed along with the paid-out costs, the cost-savings widens to 19%. Cost of cultivation under partial adoption, using drills with tillage, is higher than that of wheat cultivation under CT, although the difference is statistically insignificant. No significant difference is found in wheat yield in ZT plots. Thus, despite having remarkable cost-saving effects, gross margin effect of ZT technology is less pronounced due to the insignificant mean yield difference. In sum, against the average farm-gate price of Rs. 9.24 (US$ 0.18) 1 for 1 kg of wheat grain, Rs. 6.13 (US$ 0.12) was the cost of wheat production under ZT and Rs. 6.00 (US$ 0.11) under CT. The cost of production is Rs. 8.46 (US$ 0.16) and Rs. 8.98 (US$ 0.17) per kg, respectively, when the family labor cost is imputed. However, cultivation of wheat variety PBW-343 is found to be critically limiting the wheat yield.Although the study is based on a single-year observation and the technology assessed is at its early phase of diffusion, it is evident that the existing limitations in the infrastructure and service/extension institutions are found to play a crucial role in defining the success of the CA Program in the subsistence cereal production system of the eastern IGP.In India, the cereal production sector has registered only sluggish productivity growth for both rice and wheat during the last two decades (GoI 2009). 2 Along with other factors, degradation of the natural resource base resulting from inappropriate land and input use is widely documented as one of the root causes of this yield stagnation (Ali and Byerlee 2000;Erenstein et al. 2008a: 254). There is an increased scientific interest in developing environmentally sustainable agricultural technologies that are resource conserving, while ensuring financial profit to the farmers. This paradigm shift is closely associated with an increased awareness about the environmental externalities of the conventional farming practices in the public and policy arena.Most prominent of such CA-based resource conserving technologies (RCTs) in the cereal system of South Asia is the zero and minimum tillage of wheat (Gupta and Sayre 2007). By minimizing the soil disturbance and providing residue soil cover, the zero tillage (ZT) or no-till practice is found to increase the soil fertility and water use efficiency, thus helping cereal farmers to sustain the crop yield over a longer term (Benites 2008: pp. 59-72;Ortiz et al. 2008).Although ZT has never been a strange concept to farmers (it was followed by indigenous cultures, for example, Incas in the Andes), the initiation of scientific attention can be traced back to the 1970s in Brazil, where the first ZT field trials were conducted (Derpsch 2008: 9-10). At present, the ZT practice is popular in Latin America, the United States and Canada. Research on ZT for wheat also started in the 1970s in India, but was soon abandoned due to technical constraints (Ekboir 2002). However, with the involvement of the Consultative Group for International Agricultural Development (CGIAR) in the South Asian region under the Rice-Wheat Consortium (RWC) program of the Indo-Gangetic Plains (IGP), the technology gained momentum in the late 1990s in the NW Indian States. 3 Despite having a relatively short history of adoption, the technology is reported to have helped the farmers overcome the constraint of late sowing of wheat after the harvesting of late maturing basmati rice and the widespread incidence of the weed Phalaris minor (Mehla et al. 2000;Erenstein and Laxmi 2008). 4 At present, ZT and reduced tillage wheat occupies about 2 million ha in the IGP (Erenstein et al. 2008b). However, the overall growth rate figures often conceal the significant regional difference in adoption across the region.Most of the zero and reduced tillage adoption is concentrated in the NW IGP. The Indian States of Haryana, Punjab and Western Uttar Pradesh account for more than 90% of the area under the technology (Erenstein and Laxmi 2008). The extent of technology diffusion diminishes towards the eastern IGP, and this pattern corresponds to the significant social and economic disparity existing across the region. An average Punjab farmer owns about 4 ha of land (>85% of which is irrigated), while his West Bengal counterpart has only 0.8 ha, largely rain-fed (Erenstein and Thorpe 2010). The downstream eastern Plains (Bihar, West Bengal etc.) have double the population density of the NW upstream Plains (Punjab, Haryana). The high population density in the eastern region is not only expected to make land a scarce factor of production, but also provide a greater labor force for agriculture.However, significant seasonal labor migration is being reported from the eastern states to the south and west of India in the recent past (de Haan 2011), which possibly offsets the relative advantage of this region with respect to population density. Although the wage rate of human labor is generally less in the eastern IGP, the cereal productivity is also low in comparison to NW Plains. More importantly, the interregional wage rate difference is much below the value of productivity difference in absolute terms. Due to these factors, the livelihood impact of ZT technology could possibly be more pronounced amongst the subsistence farmers of West Bengal than in the NW region.As shown in subsequent chapters, most of the respondents in the survey are resource poor, subsistence farmers. The agricultural technology diffusion process is expected to differ in this region as compared to the capital-intensive farming system in NW of India. The key issue in this regard are the characteristics of the technology adoption pattern in the subsistence farming system. This gains special relevance as the impact of ZT technology is more pronounced in cost reduction than in yield enhancement (Erenstein and Laxmi 2008). An adoption-impact assessment of ZT wheat was carried out under the World Bank supported National Agriculture Innovation Project (NAIP). A sub-project titled 'Resource conserving technologies and livelihoods in the northern disadvantaged districts of West Bengal,' which is a consortiuminitiative led by the Uttar Bangla Krishi Vishwavidyalaya (UBKV) in collaboration with CIMMYT has been implemented with the specific objectives of assisting in livelihood analysis, its temporal and spatial dimensions, and in identifying the corresponding opportunities and threats for poverty alleviation. In this regard, comprehensive household surveys were conducted, focusing on the adoption of ZT among wheat farmers of Malda, Uttar (North) Dinajpur and Dakshin (South) Dinajpur districts. Capital-intensive, labor-saving technologies are expected to be less popular in these districts, making the case of adoption of tractor-drawn, labor-saving drill an interesting case-study.The potential welfare gain from such a technology could be more pronounced amongst the poor farmers than their richer counterparts, owing largely to the financial inability of the former to invest. However, these poor households are also relatively laggards in the adoption of a particular technology (Rogers 2003). Empirical findings by Erenstein and Farooq (2009) reinforce this association of income poverty and adoption of CA practices. ZT adoption was found strongly linked to the wealth of the farm household, possibly due to the risk bearing ability of the households and uncertainty of technology impacts. However, if the uncertainty issue can momentarily be ignored, the ZT adoption in the study area is accompanied by the provision of subsidies (free use of seed drills and seeds) to the farmers, which could also facilitate the faster rate of initial adoption. 5 Poor farmers could be more attracted to the subsidy component than the technology per se, although their access to the technology becomes an issue when demand for machines, within a short period of the wheat sowing season, exceeds the supply. The present study, in this regard, examines the access/adoption pattern of ZT wheat, keeping the associated institutional framework in the backdrop.This working paper is organized as follows: Section 2 details the characteristics of the study area while Section 3 includes the sampling frame of primary data collection. Subsequently, the findings of the empirical estimation are organized in Sections 4-6, which include wheat production system characteristics, adoption pattern and factors affecting the technology adoption, and farm-level impacts of the technology, in that order. Section 7 concludes the findings.The study covered the wheat growing northern disadvantaged districts of West Bengal state, situated in the eastern IGP between 21°10' and 27° 38' N latitude and 85° 50' and 89° 50' E longitude. Stretching from the Himalayas to the Bay of Bengal, the state is bordered by Bangladesh in the east, Assam and Sikkim states and Bhutan in the northeast, Orissa state in the southwest, Nepal in the northwest and the states of Jharkhand and Bihar in the west. Geographically, the NAIP project intervention districts (Malda, Uttar Dinajpur and Dakshin Dinajpur) belong to the northern Bengal Plains (Figure 1). The state has a sub-humid climate with about 75% of the annual rainfall during the monsoon season from June to September (IMD 2010). Agriculture is the main source of income with 63% of the land area allocated to the primary sector (cf. GoWB 2004: 175). Although West Bengal occupies only 2.7% of India's land area, it supports over 7.8% of the country's population, being the most densely populated state. 6 The state has also witnessed significant internal migration from neighbouring states like Assam and also across the Indo-Bangladesh borders (GoWB 2004: 9-10) especially to urban areas like Kolkata. The high population density is often pointed out as one of the major reasons for the widespread income poverty prevailing in West Bengal.Despite being located in the rich and fertile Indo-Gangetic region, West Bengal is one of the poorest states in terms of development indicators. Large sections of the district's rural population do not have access to basic amenities. Poverty is also gendered, with large gender disparities in literacy and low participation of women in the work force (GoWB 2004: pp. 4-5). The Gram Panchayats (the local self-governments at the village) and Rural Development Department of West Bengal figures show a higher incidence of poverty with 45% of families living below the poverty line. In the study districts, the population density is lower than the state average (881/km 2 in Malda, 778/km 2 in Uttar Dinajpur and 677/km 2 in Dakshin Dinajpur; cf. GoWB 2004: 10), but is ranked low with respect to Human Development Indices (HDI). Malda is the most \"unfavored\" district in West Bengal, and (undivided) Dinajpur ranks 13 th out of 17 districts in accordance with the HDI. The proportion of Muslims, scheduled castes and scheduled tribes is relatively high in these districts. The three disadvantaged groups are vulnerable and suffer multiple deprivations (GoWB 2004: 5).Rice-based cropping system is prevalent in West Bengal, which is the largest producer of rice in India. With the introduction of boro (dry winter) rice in the 1980s, West Bengal's rice production has increased rapidly. In 2007-8, rice was cultivated on 5.6 million ha in the state, and provided 15% of the national rice production (GoI 2009). Cropping patterns include rice-(boro) rice, ricejute, rice-potato-(boro) rice, rice-potato-onion and rice-wheat (Varma et al. 2007). Relative to rice, wheat area is limited, with 0.34 million ha in 2007-8. The state wheat production share constitutes only 1.17% of the national figure, and again unlike rice, wheat productivity in West Bengal (0.92 quintals/acre or 0.23 tons/ha) is below the national average (1.09 quintals/acre or 0.27 tons/ha) (GoI 2009). The area under wheat shows high fluctuation, for which one of the main determinants could be the large number of competing crops. In the recent past, maize, potato and vegetables have emerged as major competing crops against wheat in the state.In West Bengal, wheat occupies a relatively important position in the northern districts compared to the other regions. In Malda, 22% of the net sown area is under wheat. This share reduces while moving to the northern districts (Uttar Dinajpur with 13% and Dakshin Dinajpur with 5% of area) possibly due to competition from other winter crops and plantations (e.g. tea). The productivity of wheat is also high in these districts (1.19 quintals/acre in Malda, 1.09 quintals/acre in Uttar Dinajpur and 1.20 quintals/acre in Dakshin Dinajpur) compared to the state average. 7 It is also noteworthy that the wheat area trend is almost stagnant in these districts compared to the steep decline at the state-level. In other words, the shortening of the winter season in recent decades has meant that wheat cultivation is concentrated in the few northern districts of eastern IGP. However, as about 30% of the cultivable land is kept fallow during the rabi/winter season in the northern districts of West Bengal, there is still ample scope to enhance the wheat cultivation. UBKV is involved in the extension activities in this regard. As the famers are resource scarce with limited access to credit, they prefer low-cost wheat cultivation. This highlights the scope of ZT among the wheat farmers of this region.ZT wheat in the study area 8 The ZT wheat in West Bengal has a relatively short diffusion history. The technology was introduced in the 2006/07 wheat season in the state, and the subsequent year in the study villages. The CGIAR and Indian Council of Agricultural Research (ICAR) projects played key roles in popularizing the technology. For example, the drills were first introduced in the study area as part of the Rice-Wheat Consortium activities, and now through the outreach of Cereal System Initiative for South Asia (CSISA). Also within the ICAR project, entitled 'Rashtriya Krishi VikasYojana', drills and related information were disseminated to farmers. The private sector involvement is limited to the sale of herbicide chemicals. Although ZT is largely a laborsaving technology and wheat is cultivated widely using the household labor in the study area, the cost-cutting effect of the technology is found attractive for the farmers. There are a number of factors that distinguishes the ZT adoption in eastern IGP from the NW IGP: Land holding is significantly smaller in West Bengal. As the plot size is strongly correlated with land holding, and small plot size restricts the operation of tractor-drawn drills, there could be unique technical constraints in the adoption of ZT in the state. West Bengal agriculture is less capital intensive compared to NW IGP states. Number of tractors is limited. More importantly, the number of 45 HP tractors that are compatible with 11-tine drill is less popular in the state. Higher custom-hiring charges offered by the winter potato farmers are also found to induce scarcity of the tractors for wheat cultivation. The 9-tine drills, which are compatible with the locally popular 35 HP tractors, are limited in availability with the service providers. Unlike in Punjab and Haryana states, the drill ownership is largely public in West Bengal.The offices of Assistant Director of Agriculture (ADA) and Krishi Vigyan Kendras (KVKs) are the major service providers of the drill. However, the number of drills is limited (around five drills per KVK), compared to the potential ZT wheat area. The private sector service providers are largely absent as the diffusion process is in the early stages. In addition, during the early phases of CA technology diffusion, the state's previous political regime preferred service provision through public institutions rather than the private sector, as in NW India. One of the major reasons for low productivity of wheat in West Bengal is the late sowing of the crop, which again is due to the preceding long-duration rice. The popular wheat varieties like PBW-343 are meant for early sowing, and if the sowing is delayed beyond mid-November, the yield would be severely affected by terminal heat. ZT reduces the time required for field preparation, and hence potentially creates a yield advantage. Farmers' inability to purchase inputs for production due to financial constraints is more severe in the eastern IGP. The diffusion of ZT is mainly accomplished through two different channels that consist of two different sets of institutions. One of them is directed via the State Department of Agriculture and another through the Agricultural Universities and KVKs. The degree of collaboration among these institutions is at the minimum. In the case of the State Department, the agricultural field staff (Krishi Prajukti Sahayak) help the Assistant Director identify the contact farmers and farmer groups to whom the drill with tractor will be rented out. 9 In the early stages of technology introduction (2-4 years), the farmers are provided with a significant amount of subsidy, which includes custom-hiring of drill and tractor at zero charge and free supply of wheat seed at times, to encourage their participation in the technology adoption program. Number of beneficiaries and length of the subsidy are limited by the budget availability in the public sector.On the other hand, in the University-KVK diffusion system, the subject matter specialists (SMS) work in the \"adopted\" villages and provide the drills to the farmer clubs, organized by the National Bank for Agriculture and Rural Development (NABARD). Farmer clubs are grassroots level informal forums consisting of 25-40 farmer members. They are organized by the rural branches of commercial banks with the support and financial assistance from NABARD (cf. www.nabard.org). There are also no custom-hiring charges of drills in this mechanism, at least in the first years of technology introduction. The free supply of wheat seeds is often found to be associated with the drill adoption. Along with the provision of drills, ADA and SMS also transfer the information on aspects of wheat cultivation under ZT practice. However, it should be noted that in both the systems, only a minority of all wheat farmers could be provided with the ZT technology owing to the limited availability of funds and drills.The supply side of ZT drills is a major issue worth mentioning at this juncture. As the existing number of drills can be hired out only by a very small share of potential adopters during the wheat sowing season, it is only self-evident that sustainability of the ZT diffusion program depends highly upon the increased provision of drills in the study area. As the farmers are extremely resource poor, availability of drills at subsidized prices to the farmer groups would be an important step in popularizing the technology. The previous government policy was to promote the public sector service provision by restricting the private sector involvement in the drill manufacturing, sale and custom hiring.The machines marked by the government agencies are priced at Rs. 65,000 per unit (US$ 1,235), although through certain government schemes, a subsidy worth up to Rs. 30,000 (US$ 570) is provided, reducing the cost to Rs. 35,000 (US$ 665) per unit. This price is at par with the existing price in the neighboring state of Bihar and NW Indian states, where the private sector is involved in drill manufacturing and marketing. However, the availability of subsidy is limited to a certain number of machines (for example, in 2009/10, the subsidy covered only 150 machines in the entire state). In addition, manufacturing and marketing of machineries by the private sector would not be sufficient unless there is an established system for private service provision and maintenance and repairing centers. Absence of such a system restricts the ZT machine ownership only to the government agencies and larger/richer farmers of the study area.The primary data was collected from 10 villages, where ZT promotion programs were active under the leadership of UBKV scientists and KVK subject matter specialists. Household interview questionnaire was developed and pre-testing done in Malda and Uttar Dinajpur villages in March 2010. The field activities included, Village census, which was done during April-May 2010 in the 10 villages selected from three districts (U&D Dinajpur and Malda). Selection of households following stratified random sampling procedure. Village census datasets were developed from all the farming and non-farming households. Basic household details, including name of household head, landholding, cereals cultivated and ZT adoption (among wheat farmers), were gathered using a short questionnaire. The wheat growing households were first grouped into ZT adopters and non-adopters during season 2009/10, and within each group, farmers were sorted based on the size of farm land owned by the households. A systematic random sampling procedure was adopted to select households from each of the groups across the landholding categories for the data collection. Care was taken to include sufficient number of both ZT and conventional tillage (CT) farmers so that the \"with and without\" technology impacts can be calculated. Sample size varied (9-19 households) across the study villages, depending on the number of wheat growers. Household level data collection was conducted during May-June 2010 after the wheat harvesting using the personal interview method. The time was selected to minimize the possible recall bias. The primary data collection was carried out by agricultural graduates and monitored by CIMMYT consultant, UBKV scientists and KVK Subject Matter Specialists.Following data entry and preliminary analysis, the key results were presented in front of the UBKV scientists and KVK-extension fellows (July 2010). This helped to delineate the factors behind the trends observed. In addition, the brainstorming session assessed the institutional framework associated with the dissemination of ZT technology.Details of the ZT adoption and sampling are provided in Tables 1 and 2. The census data reveal a high variability not only with respect to the number of wheat cultivators, but also the percentage of adopters of ZT technology in the sample villages. The total number of wheat farmers per village during the 2009/10 rabi season ranged from 10 in Bansthupi, Uttar Dinajpur, to 180 in Bahirkap, Malda, (Table 1). There is also notable difference in adoption with regard to both the number of households and area under ZT technology.Generally, the cultivation of wheat under conventional and ZT in a single farm is common. As the study deals with the livelihood impacts, a measure of percentage of farmers adopting the technology in a village would be ideal to characterize the technology acceptance than acreage share of wheat under the technology. The ZT diffusion pattern is highly village-specific: it ranges from about 6% in Bahirkap (Malda) to 85% in Lakshmidangi (Uttar Dinajpur) village. Initially, it was planned that the sample framework would include eight ZT and eight CT wheat farmers per village. However, in some villages (e.g., Bahirkap), the number of ZT farmers was less than eight, and hence more farmers were purposefully selected from those villages where ZT adoption was significantly high (e.g., Lakshmidangi and Gotlu) in order to compensate the reduction in sample size. The respondents are resource poor in comparison to other parts of IGP in the country and farming is subsistence-oriented. The average land-holding of sample household is 1.05 ha. In addition, leasing-in of land for cultivation is practiced by one-fourth of the respondents. Wheat occupies 40% of the cultivated area. About one-third of farmers are indebted, owing to crop failure in the last three years. An equal share of respondents is also reported to have faced hunger. 10A higher share of respondents (about 50%) indicated their inability to treat one or more illnesses during the preceding three-year period due to financial constraints. Even under such economic backwardness, the low wheat productivity allows them only a partial dependence on ownproduction for home consumption. On average, about 40% of home consumption of wheat is purchased from the market. Enhancement of wheat productivity through cost-cutting technology gains significance in this milieu of economic backwardness. However, accessibility remains an important factor that determines the development potential of this RCT.Large scale wheat cultivation started expanding in West Bengal and other parts of the eastern IGP, north of the Tropic of Cancer, only in the recent decades (Erenstein 2009). The state wheat productivity has always been below the national average (by about 14% in the last decade) and there has been noticeable yield stagnation. However, during the study period (2009-10) the yield difference to national average narrowed down to about 6%. The status of wheat productivity in West Bengal, compared to the national average and to a leading producer of NW India (Punjab), is shown in Figure 2. The wheat productivity realized in West Bengal is only 50% of what is being produced in the NW states. The yield potential of wheat in West Bengal is lower than the NW India, due to higher winter temperature and shorter wheat growing season. Further, the low-input use per hectare, largely rain-fed production process, and late sowing of crop prevents the farmers from attaining even the yield potential. The average cost of production in West Bengal is compared with that in different wheat-growing states to examine the state's status in relative terms (Figure 3). Across India, there are both low-input/low-productive states (e.g., Chhattisgarh and Jharkhand) and high-input/high-productive States (e.g., Punjab, Haryana). However, it is only in West Bengal that a higher cost of cultivation (Rs. 9.8 thousand/acre) is associated with a relatively low yield (2.5 tons/ha). Against the Minimum Support Price (MSP) announced by the At the time of sampling, in West Bengal, as in the case of wheat in general, the ZT technology had only a relatively short history of diffusion. This is one reason why the adoption pattern and potential technology impacts of ZT wheat in the eastern IGP are infrequently studied. It can well be expected that in a region like eastern IGP where late sowing of wheat is prevalent, ZT could be associated with a significant yield benefit by ensuring timely sowing of the crop. However, as 11 The government procurement system in the eastern IGP is not as strong as in the NW states. Hence many farmers obtain grain market prices lower than the MSP announced for that season. Per-quintal cost of production the cereal production system in West Bengal is labor-abundant as compared to most of the other wheat growing areas and ZT wheat being a labor-saving technology, its impact may be of unique economic dimensions. Keeping the inter-regional variations across the IGP in the backdrop, wheat production system of the study area is being examined here with respect to cropping patterns, credit and information availability, and varietal-and labor-use in general. The details of use pattern of other inputs with respect to ZT adoption are included in Section 6, which discusses the production impacts of the technology.At this juncture, an issue highly pertinent to the ZT adoption is that only a small share of potential adopters have so far actually adopted the technology due to the limited availability of the drills. Majority of wheat farmers (about 90%), as observed during the household survey, are interested in adopting the technology, partly due to the net revenue increase associated with it and partly due to the coupled subsidy availability. However, the constrained supply of drills leads only to a limited number of beneficiaries, and the selection is done by the contact farmer or the farmer group. In other words, farmer self-selection does not happen largely with respect to the technology adoption, although tillage (with or without drill) adoption is still largely a farmerdependent decision.As the development agencies and farmer clubs choose an interested farmer as adopter of drill, it is highly relevant from the equity point of view to assess the resource status of users (who access the technology) against the non-users (majority are willing to adopt the technology, but cannot access it). It is found that the larger and higher educated farmers have a greater chance to be the beneficiaries of the program (Table 3). In addition, larger household size increases their \"approachability\" to the agencies that provide ZT technology. These farmers could possibly be the early adopters of the technology in the initial stage of its introduction (during rabi seasons of 2007/08 and 2008/09) as being less risk-averse, and might have continued as perpetual beneficiaries of the program thereafter. However, appreciating the high willingness of a farming community to adopt the ZT technology in wheat, it is only imperative in an egalitarian perspective to take up necessary measures to ensure its reach to the smaller and less educated farmers.Another important consideration rests with the distinction between no-till adoption and drill use. Many farmers, who were recognized as ZT adopters during the village census, were found to be the adopters of ZT drill only, and not the \"'no-till practice as they use the ZT drill as a seeding machine after removing the crop residues and ploughing the field (Table 2). For example, although eight farmers in the Harinkole village (Malda) had adopted the drill, four had ploughed the land and used the drill afterwards for sowing.Further, only some farmers were aware of the difference between drill adoption and no-till practices, making farmer categorization and the data analysis more complicated. Although the ZT drill users were 51% of the total sample, only 40% were adopting no-till practice. Such partial adoption of technology could occur due to a number of factors and often the practice even undermines the efficiency of the technology by modification. This deviated use pattern was unexpected during the study formulation. However, the analysis later developed in such a way that the factors and effects of \"defective reinvention\" can be evaluated along with that of the typical no-till practice. Since use of ZT seed drill after ploughing the land goes against the CA principles and reduces or nullifies the associated financial and environmental benefits, factors that lead to this \"deviant practice\" deserve greater research and extension attention. We postulate that there are both supply and demand factors that lead to the reinvention of \"drill + till\", which will be addressed in forthcoming sections. The cropping systems in the eastern IGP are mainly rice-based. However, in the study area wheat is popular during the winter season as a subsistence crop. About 60% of the farm produce is used for home consumption and 30% of farmers are dependent on wheat cultivation entirely for this purpose. Depending on the irrigation water availability, jute is being taken up after the winter crop. About 81% of the wheat cultivation takes place in one of the three cropping systems:1. Rice-Wheat-Jute (high cropping intensity; 31% of wheat area) 2. Rice-Wheat-Fallow (medium cropping intensity; 33% of wheat area) 3. Fallow-Wheat-Fallow (low cropping intensity; 17% of wheat area)Further expansion of wheat cultivation is attainable as about 50% of the non-wheat systems are kept fallow during the winter season. Boro rice, mustard and tea pose a certain degree of competition for land, but accounts only for 20% of the cropped area during this season. Financial capital and input (e.g., quality wheat seed) scarcity are found to be the two major factors limiting wheat cultivation. To promote the wheat program, the microfinance institutions and commercial banks may come up with crop-specific credit programs for shorter durations of time, preferably coupled with a crop insurance scheme. Under the prevailing scenario, about 32% of farm households were indebted in the last three years due to crop failure and were forced to limit even food consumption due to lack of resources (Table 4). The financial constraints and reduced farm investments further contribute to the reduced productivity of cereal crops. On the one hand, services of the public sector financial institutions do not have a wide reach across all the needy farmers as only <7% sample households could obtain farm credit from commercial banks and cooperatives (Table 5). On the other hand, dependence on the village money lenders, the major private credit source in Indian agriculture-is also not observed.Even though the private input dealers are the prominent source of credit for wheat farming, only about 17% of farmers utilize this source. The interest rate charged by the dealers (9%) is the highest among all categories of credit sources. The informal source of credit (friends, relatives and neighbors), is also used by the sample farmers to generate low-interest credit. But its reach is rather limited, possibly due to the prevalence of poverty in the study area. Financial bottlenecks are thus found to be severely affecting the prospects of intensifying production in the rice-wheat system here, limiting the generation of additional farm income from existing land resources. Another major production constraint commonly found in the cereal systems of eastern IGP is the inability of farmers to access quality farm information. The sample farmers also identify lack of information as one of the major constraints in wheat production. However, the pattern of information supply is possibly different in the study villages compared to the rest of the state as the survey has been conducted where the ZT wheat was actively propagated by the state KVKs. Public extension network is found prominent in disseminating farm information and KVKs and agricultural universities are found to be the most prominent information source (Table 6). Source: Household survey (2010). Note: # The figures show % of adopters (N = 64).Both the frequency of contact with the extension agents and the perceived utility of information thus obtained are indicated as high, irrespective of their technology accessibility. Without exception, all the adopters indicate government extension agents as the source of information on the ZT technology. A significant share of farmers also gained knowledge on ZT from other farmers, and this informal information network is found to be disseminating information on the technology. Nevertheless, whether the information so passed actually helps ZT dissemination is an issue that deserves in-depth examination. Further, it is found that the role of private dealers was insignificant for this purpose, as was that of NGOs and the mass media.Availability of quality seeds of suitable wheat varieties is observed to be another major constraint for wheat production in eastern IGP. The few existing late-sown, rain-fed varieties suitable for the region (Gomti, HDR-77 etc.) are found to be poorly disseminated. The wheat seed supply system is highly disorganized in India, but its magnitude is most critical in the eastern IGP. The major wheat variety found in the farmers' field is PBW-343, developed by Punjab Agricultural University (Ludhiana) in 1994 for the NW Plain zone for timely-sown, irrigated wheat. Although this long-duration variety is not congenial for the late sown wheat cultivation of West Bengal, about one-third of the sample farmers adopted it (Table 7). Another commonly found variety, Sonalika (also known as S-308), was released in 1967 for all zones in India for late sown irrigated conditions. The only variety released in the recent past (2001) that is widely adopted in the location is HD-2733. It was developed for the NE plain zone for timely sown, irrigated conditions (Sharma et al. 2004). In addition, some varieties with unrecognized or mixed lineage are also found to be cultivated in the area. The reasons behind varietal adoption from the farmers' perspective are also provided (Table 7). Compared to others, less percentage of farmers indicated high yield as the criterion of selection of PBW-343, for its (lack of) location adaptability. However, a few local varieties and HD-2773 are found to be popular due to local adaptability. Cultivation of PBW-343 and HD-2773 is closely related with the use of ZT drills (Table 8). The major source of wheat seeds for the drill adopters is KVK/ government extension offices (81% of adopters depend on this source; cf. Table 9). About 46% of the ZT farmers get some subsidy on seed purchase from the public extension offices. The lack of availability of locally adaptable wheat varieties with these agencies, prompt them to supply available seeds that may not be congenial for the local agricultural system. However, it should also be noted that in the absence of these agencies, chances of getting quality seeds for farmers is further minimized. For example, the supply of the HD-2773 variety, which is preferred by farmers for yield and local adaptability, is confined to the public sector.Line sowing using seed drills reduces seed requirement per acre and it is, therefore, quite unsurprising to find that the seed demand by non-users of drills (following broadcasting) over drill users is higher by 9% (Table 9). Majority of the non-users of ZT drills (65%) depend on private dealers for obtaining wheat seed. The extent of use of farm-saved seeds is also high amongst the farmers of this category. Notes: (i) # Varietal adoption is measured in terms of households adopting particular variety (and not by area under cultivation). Since 10% of farmers cultivate two varieties, the sum of % can be more than 1.00. (ii) ***: Significant difference exists between categories at 0.01 level; ns: no significant difference at 0.10 level. (iii) *, **, ***: Significant difference exists between adopters and non-adopters at 0.10, 0.05 and 0.01 levels; ns: no significant difference at 0.10 level. The wheat system characterization, with respect to adoption of CA practices, demands an examination of human labor availability pattern. Although labor is conventionally assumed to be a factor relatively abundant in the East compared to the North-West of IGP (Erenstein 2009), our survey found that the peak wage rate in Malda and Uttar and Dakshin Dinajpur districts are high even when compared to Punjab and Haryana. The prevailing wage rates during the survey were Rs. 165 (US$ 3.13) and Rs. 125 (US$ 2.40) per day for male and female laborers respectively, which is 11-18% higher compared to the normal wage rate existing in the above mentioned NW Indian states. 12 Two possible reasons for increased wage rate are: Labor migration to cities (e.g., Kolkata) and other parts of India (e.g. South India) for non-agricultural occupation (e.g., construction) and Inter-crop competition for labor. (Proliferation of tea plantations in the study area absorbs majority of the available local labor for tea-plucking, which is more remunerative and less-seasonal in demand.) Due to the scarcity of labor (both human and machine) and high wage rates, wheat farmers in the study area were found to be largely using family labor for cultivation. Priced at the existing wage rate, family labor accounts for 66% of the labor cost in conventional wheat cultivation. The major activities that demand labor are harvesting (which is done manually, unlike in most parts of NW India), land preparation (for conventional wheat) and irrigation. Manual weeding is not found to be commonly practiced among the sample farmers. The weed menace is relatively low since the period of survey was a drought year. However, weed infestation is generally a major constraint that limits wheat production and unavailability of chemical measures, coupled with scarcity of labor and/or high wage rate, worsens its adverse yield impact (Table 10). Source: Household survey (2010).Adoption studies, in which the technology in question involves employment of a bundle of innovations rather than a single element of yield-enhancing or input-saving attributes, poses special challenges (Becerril and Abdullai 2010). In the case of ZT, the innovation involves use of drills, minimum soil disturbance, weed management, residue retention etc. Such package-nature of CA-based RCTs makes the examination of their adoption and evaluation of associated farmlevel impacts rather challenging. Nevertheless, across the sample farmers, not much inter-farm differences were evident in terms of weed management and residue retention. However, this is not the case with tillage or soil disturbance. The defective reinvention of the ZT technology, where the drills are used in the field after tillage for line sowing, is being followed by a significant share of sample farmers. Although the frequency of adoption of drill use seems to decline slightly with the number of tillage operations in the study area (Figure 4), there is no significant difference in the average number of tillage operations followed by the reinventing and nonadopting farmers (Table 11). Such defective reinvention comes with a significant cost increase, given the prevailing high wage rate for human labor and custom hiring charges of animal and machine labor. The average hiring charge of a pair of bullocks is Rs. 388/acre per operation (US$ 7.40), whereas that of a tractor is Rs. 586/acre (US$ 11.13). A multiple of this cost, depending on the number of tillage operations being performed before adoption of ZT, is saved with the technology adoption.Residue retention in ZT plots is found to be mostly partial (Table 11). In the eastern IGP, rice straw forms the major fodder for cattle and buffalos and hence full retention of the crop residue for ZT as mulch may not be practical and/or economically feasible. This is an additional constraint to CA diffusion in the eastern plains in contrast to the NW IGP, where mostly wheat straw is used as fodder. However, most of the no-till adopters (87%) retain partial residue (about 25%), and residue burning is not practiced. Again, in contrast to the situation in NW IGP, late sowing is generally practiced in West Bengal for conventional tillage wheat. The extent to which ZT helped farmers sow the crop early was not estimated due to the limitation of primary data collected. The survey has shown that within the two years of its introduction in the sample villages, ZT technology has gained huge popularity among the wheat farmers (Table 12). About 90% of the sample farmers are seen to have expressed willingness to adopt the technology in the next wheat season (2010/11). However, availability of drills is conceived as a major challenge. Again, many of those farmers, who had shown dis-and non-adoption behavior, indicated the difficulty of getting drills at the required time as one of the major reasons. An overwhelming share of farmers (89%) indicated the difficulty of obtaining drills as medium to high, amongst the constraints to follow ZT wheat. The absence of active private sector service providers, unlike in Punjab and Haryana, and high cost of drills are the two major factors that restrict the diffusion of ZT technology in West Bengal. Hence, should the institutional environment be congenial for provision of machineries, the CA-based RCTs will spread rapidly even in the most disadvantaged regions of eastern IGP. The supply-and demand-side factors are further examined using the econometric tools detailed in the next sub-section. Knowler and Bradshaw (2007), through a meta-analysis of 23 studies in countries viz. Nigeria, Rwanda, Canada, US, Panama, Peru, Honduras and Burkina Faso, attempted to delineate the factors (farmer and farm household, biophysical, and financial/management characteristics and exogenous factors) affecting the adoption of CA practices.The study reveals only a few, if any, universally significant explanatory variables. For example, although some commonly included explanatory variables, such as education of the household head and farm size owned, show convergence towards a significant and positive influence, the incidences of insignificance and negative association were also quite frequent. In addition, the number of studies on ZT adoption in South Asia is rather limited, in the best knowledge of authors, with only Farooq et al. (2007) and Erenstein et al. (2007) examining the factors influencing ZT adoption in the irrigated rice-wheat systems of Punjab (Pakistan) and Haryana (India)respectively.In the literature, factors affecting technology adoption are traced through a number of econometric tools, including ordinary least squares (OLS), probit/logit, tobit, duration, and selection models. Most of these models were also employed to study the adoption pattern of CA techniques (Knowler and Bradshaw 2007). For example, Erenstein et al. (2007) have studied the factors affecting zero tillage adoption in the irrigated tract of Haryana using logit analysis. However, when partial adoption of the technology occurs through selective adoption of certain elements from a bundle of innovations, conventional adoption models are found inadequate in estimation. The method that is employed in this paper to capture the occurrence of reinvention is similar to that of de Herrera and Sain (1999) to study the elements of ZT adoption. In our study context, the farmers can be classified into three groups, as adopters of: CT and broadcasting (c); partial adoption or CT and seeding using drill (r); and no-till and seeding using drill (z). Accordingly, we formulated the econometric model of multinomial logit model (Greene 2008: 843-845), where the outcomes recorded unordered in , and vector of explanatory variables, .Here, we estimate a set of coefficients , and corresponding to each outcome category. The model, however, is unidentified with more than one solution to , and , which lead to the same probabilities for , , and ). To identify the model, one of the -values is arbitrarily set to zero. For the estimation, we have first run the model keeping 0 to obtain coefficients and that will measure the change relative to the group . Equally important is to measure the relative probability of to the category ), which is estimated by re-running the model with as base category. The exponential value of a coefficient is the 'relative risk ratio' (rrr) for unit change in the corresponding variable.The dependent variable in the aforementioned adoption model is qualitative in nature as it classifies a sample farmer into one of the three categories. The sample was collected randomly after stratifying the farmers based on drill adoption. The sample contained about 56% of adopters of drill in the rabi season of 2009/10, but 25 of these households (16% of total sample) have used the drill only for seeding, after ploughing the soil (defective reinvention of the drill technology). Hence, the percentage composition of c (44%), r (11%) and z (40%) groups, and the dummy variables representing these groups form the dependent variable in the multinomial logit model.The explanatory variables used in the model can be grouped into four categories: Information variables (N = 2). They indicate the relevance of information from public sources (KVK, agricultural university, government extension etc.) and farmer-to-farmer networks. Each of these variables is measured on a scale of 0-9, which is constructed by multiplying the frequency of contact (0-3) and perceived relevance of the information obtained (0-3). In the sub-scales a 0-value indicates no relevance or infrequent contact, while 3 stands for high relevance or very frequent contact with the particular information source. Farmer proximity to the government extension agents is hypothesized to have a positive impact on adoption, while the impact of farmer networks is rather ambiguous. Asset variables (N = 3). The set includes variables viz. land owned by the household (measured in acres), number of large ruminants (cow, buffalo and bullock) in the farm, and share of leased-in to cultivated acreage. These variables represent the household's resource/wealth status. Tenancy is hypothesized to limit the CA technology adoption, as tenant farmers may not be interested in improving the soil quality over longer periods through technology adoption. The other variables, which stand as proxy to the wealth of the household and hence the risk bearing capacity, could be facilitating the technology adoption. Household characteristics (N = 3). Assuming that the decisions are taken jointly by the adult members of the household, the models were estimated with household characteristics, instead of individual characteristics of the household head. Number of adult members in the household, experience in wheat cultivation (years) and the highest education obtained by a household adult (measured in years of schooling) were included in the model. These factors are expected to have positive impact on adoption decision. Village attributes (N = 4). The technology adoption status in the village represented by the share of wheat farmers adopting ZT technology and number of wheat farmers in the village are included in the model to provide insights into the aggregate demand for drills.In addition, the location variables (district dummies) were included. Given that the number of drills with the service providers like KVKs is limited, village level adoption and number of wheat farmers would raise the intra-village competition for the equipment.As the nature of reinvention in agriculture is not widely studied, the hypotheses on factors that distinguish categories, namely and ), are not developed. The summary statistics of these variables are provided in Table 13. The model estimation results are detailed in the next sub-section. Source: Household survey (2010). Note: 1 acre = 0.405 haThe estimation results of the access (to drill) and adoption (no-till practice) model are shown in Table 14 and the associated rrr values in Appendix I. The multivariate model used was found to be highly significant with a χ 2 value of 75.55 at 24 degrees of freedom. The decision to use drill [ and )] against broadcasting [ )], and the decision to follow no-till practice are found to be significantly influenced by information, asset, household and location-specific variables.As expected a priori, the information variables are found influential in determining the tillage option selected by the wheat farmers. It is proven that the general positive link between provision of information and technology adoption also holds the case for CA (de Herrera and Sain 1999; Erenstein et al. 2007). However, the source of information matters equally or more, as indicated by the model estimates. The (perceived relevance of) information from the public extension is found facilitating the drill adoption, but not the no-till practice. Although unit increase in the \"scale of relevance\" raises the relative probability of adoption of ZT over CT ( / ) by 67%, the variable is also associated with a diminished chance of adopting no-till over the option of reinvention ( / ).The ZT technology has a relatively short history of diffusion in the study area, and the information on benefits of no-till practice might not have yet percolated into the farming community as that of the drill adoption (including subsidy availability). However, the strength of farmer communication networks is found to be negatively affecting drill adoption, both for the no-till adoption and the drill access (as the seeding device). This is somewhat surprising given the technology's popularity in the study area. But the farmer networks might have helped faster diffusion of information on subsidy availability with ZT adoption than that on farming impacts of the technology. Many of the economic benefits of CA practices are realized only over a longer period of time, and hence they may not be recommended by the farmers at the early stages of diffusion. As a strategic behavior, the perceived scarcity of drills could also be preventing the farmers from spreading the positive information on ZT across the farming community. In sum, although the farmer networks are effective in general by introducing the technology across the farming community during the early stage of technology diffusion, it may also cause undesirable implications by withholding crucial technical information regarding the technology impact. The mean-variance analysis has already indicated that the drill adoption is positively determined by the farm size. However, the econometric model does not show any such pattern. Further, the status of land tenancy, although having no impact on no-till adoption, favors drill use against broadcasting of seeds. Tenant farmers may increasingly recognize the relevance of line sowing to enhance the short-run farm profits, but not the sustainability of economic benefits associated with ZT technology. The number of adult members in the household is found to be positively affecting the drill adoption, which might be through increased contact with the extension agents. This variable does not distinguish farmers adopting no-till from those getting access to the drills (partial adoption).The impact of large ruminants on ZT with (at least partial) residue retention is largely ambiguous, given the fact that crop residue after rice cultivation (which is the preceding crop in kharif season in about 65% of the farms surveyed) forms the major component of cattle-feed in the eastern plains. Also the draught power of owned bullocks might facilitate land preparation. On the contrary, the supplementary income assured from livestock production could allow the wheat farmers to experiment with new production technologies. The model estimates indicate that, in general, the cattle owner prefers CT, and each additional animal owned reduces the chances of following ZT over CT by about 33%. However, if a cattle owner were to get access to the drill, he/she may go for no-till and not for partial adoption. This could be due to the increased risk bearing ability associated with resource entitlement in form of cattle and buffalos.Education is found to have a significant and positive role in adopting both no-till and drill use as seeding device. The chances of adopting / and / are found to be increasing by 18% and 10% respectively, with one year increase in the maximum education of households, which is measured as years spent for schooling by the highest educated member of the household.Nevertheless, the impact of location-specific variables was the most prominent amongst all the different sets of explanatory variables. The aggregate community/village adoption levels of drills were found to be facilitating the partial adoption practice over no-till, possibly due to the excess demand for the drill and resulting in the delayed availability of drill. However, the total number of wheat farmers in a given village, which again represents the strength of competition for limited drills available at the KVKs and other public sources, is found to be reducing the chances of drill adoption. This factor is also found to raise the probability of adopting the no-till over reinvention practices. Other location-specific variables like district dummies are also found to be significant. Although there were no differences in drill adoption across districts owing to the stratified sampling procedure, the reinvention of drill is found to be comparatively higher in Malda district, thus increasing the number of tillage operations in wheat cultivation. The farm impact of the drill access and no-till adoption is examined in the next section.On-farm impacts of ZT wheat in the NW Indo-Gangetic Plains are examined by Erenstein et al. (2008b), confirming the existing on-station and on-farm trial findings that significant -induced resource-and cost-saving effects occur in the farmers' fields. However, the financial impacts of this technology are hardly examined in the Eastern IGP cereal systems. Given that the major yield benefits from ZT are accrued due to early planting of wheat, the technology could enact a crucial role in increasing the wheat productivity of the Eastern IGP, where late planting and terminal heat are major causes of reduced yield. However, there are certain constraints in evaluating the production impacts of ZT in the present study. Partly, it is the nature of the dataset, built upon single-year observation of the early phase of technology diffusion, that limits the generalization of study findings. In addition, the issues associated with the technology dissemination system that pose further challenges to the impact assessment are: Supply of inputs at subsidized rate from the ZT promotion agency Coupling of technologies (ZT drill with PBW 343 variety) and Partial adoption (use of drills with tillage). The subsidy element is separated from the cost-return statements, and additional analyses performed to identify the impacts of individual technologies. The cost-return figures are estimated separately for the group of farmers, who follow reinvention of drills, to distil the financial effects of this unique practice. The cost of cultivation details are given in Tables 15 and 16, while yield impact is given in Table 17 and Figure 5. The gross margin of wheat farming for different groups of farmers is shown in Table 18. Despite the aforementioned limitations, the data indicate unique resource use patterns that are crucial in determining the profitability of wheat in the existing production system.Major ZT-induced effects are through altering the establishment and production costs of the wheat crop. Erenstein et al. (2008b) estimated that the technology is associated with a costsaving of 7-10% in Haryana (India) and Punjab (Pakistan). In the present study, the farmers are getting other inputs like seeds, along with the drill, under subsidy from the promotional agencies. Although the cost impacts of the subsidy element can easily be removed by a simple addition procedure, the effect of the quality of inputs on yield cannot be nullified in this manner, and hence the yield impacts are not covered in detail in the present study. Due to the subsidized provision, cost of seeds paid by the no-till farmers is about 36% less than that by the CT farmers. Most of the adopters also get the drills free of cost, which results in almost no cost for land preparation and seeding, thus saving about Rs. 1,135/acre (US $ 21.6/acre). The cost-saving is also significant with respect to the family labor component. When imputed at the prevailing wage rate, ZT adopters are found to save about 34% or Rs. 1,000/acre (US $ 19/acre) over their CT counterparts. This may have greater system-wide implications (viz. intensifying the production system by cultivating the rabi fallows), which does not come under the purview of the present study.Interestingly, the use of plant protection chemicals is found to be higher among the drill adopters. Infection of the tea loopers is found to be a production threat of increasing magnitude in the study area, especially in Uttar Dinajpur. Since the study was conducted after a drought year, in which there was significant increase in tea leaf shedding, the loopers are found to be migrating to the wheat crop. The use of chemicals like Carbosulfan, found to be prevalent among the sample farmers, was mainly to manage this pest menace. The study carried out in the KVK of Uttar Dinajpur estimated about 10-12 larvae per square meter of wheat plot. 13 [The farmers can access the plant protection chemicals from the public sources with relative ease, and with their increased awareness about the pest control, this increased accessibility could lead to a higher degree of chemical management. One of the possible explanations for increased pesticide use with ZT adoption is based on the relative availability of working capital with the farmers, which is saved from land preparation and seeding operations for chemical management of the pests. The greater access of information from government extension sources may be another factor behind this trend. However, whether the rice residue retention has any impact on the increased insecticide use is an issue to be addressed further.In sum, the no-till farmers are found to be saving about 12% of the paid-out cost when subsidy effect is nullified (Table 15). However, when the family labor cost is imputed into the paid-out cost figures, the cost-savings widens to 19% over the CT wheat. Both these figures are significantly higher than what is found in the existing literature on NW IGP (Erenstein et al. 2008b). (iii) *, **, ***: Significant difference exists between comparing categories at 0.10, 0.05 and 0.01 levels; ns: no significant difference at 0.10 level.However, none of the benefits accrue to the reinvention farmers, who pay significantly higher amounts for hiring out human labor and for plant protection chemicals. The family labor saved among the reinventing farmers is insignificant. In fact, the cost of cultivation using drills and tills together is higher than that of CT, although the difference is statistically insignificant.Analysis of the yield impact of ZT in the mean variance framework necessitates an examination of the associated input use. We have already observed a significant difference with regard to family labor employment and plant protection chemical use across the tillage categories. There are no significant differences with respect to manure and fertilizers, in either monetary or quantity terms (Tables 15 and 16). The farmers are using the NPK at 49:17:22 kg/acre, which is almost at par with the recommended dosage (40:20:20 kg/acre). 14 ZT drill adoption is found to be helping the farmers to reduce seed rate by 8% (no-till) to 11% (reinvention) over broadcasting practiced by CT farmers. There are no differences across adoption groups with respect to the number of irrigation and weeding practices followed. However, per-operation, 57% more cost is incurred to weed the no-till plot as compared to the CT. This could be an indication of high weed growth associated with no-till practice, especially since the sample farmers seldom depend on chemical measures for weed management. The yield averages across different technology categories are given in Table 17. The wheat yield average in the study area ranges between 9-10.5 quintals/acre (2.2 to 2.6 tons/ha). No significant difference is found in the wheat yield in ZT plots, compared to the CT ones. This pattern is also evident in the Epanechnikov Kernel Density Estimates (Figure 5). The defective practice of reinvention is found to be associated with significantly lower yield averages; 17% lower as compared to CT. It is also hypothesized that the adoption of the PBW-343 variety, which was coupled with the drill adoption by the promotion agencies in the 2009-10 season, has a significant impact on wheat yield. It is observed that the decline in yield with PBW-343 is greatest (40%) among re-inventing farmers. Negative technology-variety interaction effect is also observed in case of, but with statistical insignificance. Despite having remarkable cost-saving effects, gross margin effect of ZT technology is less pronounced, owing largely to insignificant but negative yield effect of the technology (Table 18).It is observed that due to the scarcity of the drills during the wheat sowing season, early planting of wheat has not taken place with technology adoption. When the subsidy element is removed from the cost structure, Rs. 613 (US$ 11.65) is spent to produce 1 quintal of wheat under ZT, whereas Rs. 600 (US$ 11.40) is the cost of production under CT. The cost of production will be Rs. 846 (US$ 16.07) and Rs. 898 (US$ 17.06) per quintal respectively when the family labor cost is imputed. Nonetheless, the difference remains insignificant. Unsurprisingly, the marginal revenue is significantly low in drill reinvention. Cost of production under reinvention is more than double that of CT wheat. In sum, a loss of Rs. 2,776 (US$ 52.74) is accrued per acre due to defective reinvention (tilling the plot instead of ZT use alone), which is mainly due to unavailability of drills on time.The financial implications of technology access and no-till adoption in the study area are clear only from the cost-side through the simple mean-variance analysis. The yield effect is marred due to differences in input use with tillage technology adoption. In addition, there could also be farm-household factors, determining the wheat productivity through improved managerial practices. Lack of effective instrumental variables to proxy the drill access and no-till adoption prevent the study from analysing the production effects using econometric modeling tools. This is one of the major limitations of the study. The present study has been an attempt to examine the early-stage adoption profile of ZT wheat in the northern disadvantaged districts of West Bengal, along with associated short-run farm impacts. The ZT technology was introduced in the State in the 2006/07 rabi season, and the short history of technology diffusion restricts detailed adoption as well as impact assessments.Having said that, the initial evidence gained from a farm survey conducted among 180 farmers of 10 villages of Malda, Uttar Dinajpur and Dakshin Dinajpur districts, where the ZT diffusion program is on-going, have clearly indicated the farm income potential, alongside the various institutional factors limiting the spread of the technology. In all of the sample villages, majority of wheat farmers were found to favor ZT. Technology diffusion also has been facilitated by the local KVKs, with the help of an effective subsidy program.The farmers are provided with drills for free as well as subsidy on wheat seed. However, even in the absence of this promotional subsidy, significant cost reduction is attainable with adoption. Nevertheless, under the existing institutional framework and infrastructure limitations, the scope of spreading the economic benefits across the districts is limited. The economic potential of ZT technology is being marred by a critical scarcity of ZT equipment (drill) during the short wheat sowing season. The public service is constrained by financial and man-power limitations, and hence policies to encourage private sector service providers (including farmer-cum-service provider) are inevitable. Scarcity of drills has pushed some of the farmers to follow a practice of combining drills with tillage operation, which is found to strip off the economic benefits of ZT technology, and undermine the CA associated principles. Lack of technical information on working of the CA-system could be one of the reasons behind combining drills with tillage. In addition, the flaws in the seed supply system not only limit the wheat productivity in general, but also impede the relative performance of the technology. In conclusion, the existing limitations in the infrastructure and institutions are found to play a crucial role in defining the success of the CA program in the subsistence cereal production system of the eastern IGP.Due to the aforementioned constraints, predictably, the major policy recommendations focus on increasing the supply of drills, possibly through altering the machine price structure. The existing price of drills (without subsidy) in West Bengal is almost double what is prevailing in Bihar, the neighboring wheat producing state. Although the government subsidy contributes to a substantially lower machine price, the number of drills available with subsidy is largely restrictive to meet the demand. This factor further limits the emergence of private sector service providers, as in the case of NW IGP. On the other hand, the machines available with the public sector (KVKs, agricultural universities) are limited in number to effectively address the farmer demand for them. In order to attain the critical mass of adopters for self-sustenance of the diffusion process, the number of service providers of the drills should be rapidly increased, potentially through ensuring the participation of the private sector.Making low-interest credit available to smallholder farmers to procure the locally compatible 9tine drills could be one of the ways to ensure the participation. Equally important is the provision of other key farm inputs, which have special relevance in CA package. For example, although weed management is critical in defining the success of the CA, most of the sample farmers are not familiar with the chemical measures of weed control, and manual weeding is restricted by labor scarcity and prevailing high wage rate. Nevertheless, the single most important limiting factor is the availability of quality seeds of varieties that are adaptable to the local agroclimatic conditions. At present, farmers are dependent on the age-old wheat varieties developed for the irrigated NW IGP conditions. This practice reduces wheat yield critically, under the late sowing practice prevailing in eastern IGP. Further, coupling of locally less adaptable varieties like PBW-343 by the extension agronomists with drill technology, through the subsidy mechanism, has resulted in partial realization of the economic potential of the technology. Farmer welfare in a subsistence production system, as of the study area, can be effectively enhanced through different CA packages, provided there is an effective coupling of necessary institutional provision of inputs and services with information on cultivation practices."}
|
main/part_1/0290253354.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"1e92d4e89c579251e8446ee36ddb1c5d","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/99a91a86-21e5-4f21-a670-3b93aae13e5f/retrieve","id":"1404143885"},"keywords":[],"sieverID":"34860e51-4bef-4092-b86d-7229151c0b05","content":"Vòng TTNT này thành công tức là ra kết quả đời con (chọn) Có Không Không chắc chắn Số lần TTNT (chọn) 1 2 3 4 5 Vật nuôi có phù hợp để thực hiện tiếp TTNT không (chọn) Có Không Ghi chú khác NGÀY (Ngày/ tháng/ năm) ĐIỂM THỂ TRẠNG 1 = rất gầy 2 = gầy 3 = tối ưu 4 = béo 5 = rất béo SỨC KHỎE VẬT NUÔI Các ghi chú khác về tình trạng sức khỏe vật nuôi CHỈ ĐIỀN THÔNG TIN VỀ CÁC DỊCH VỤ CUNG CẤP Ở ĐỢT THĂM KHÁM ĐÓ ĐỢT THĂM KHÁM TIẾP THEO Ngày và mục đích Phát hiện động dục Vật nuôi động dục (có/ không), Các lưu ý khác Gây động dục đồng pha Tên hormone, liều dùng, các lưu ý khác TTNT Nhà cung cấp tinh, số lượng cọng tinh, giống đực, liều tinh Phát hiện có thai Phương pháp và kết quả (chửa, không, không chắc), các lưu ý khác Thông tin chi tiết về sinh đẻ Ngày, số lượng con sơ sinh sống, các lưu ý khác Khác Chi tiết THÔNG TIN KHÁCH HÀNG Họ và tên Số điện thoại Địa chỉ -Xã Bản Giới (chọn) Nam Nữ Khác: Vòng TTNT này thành công tức là ra kết quả đời con (chọn) Có Không Không chắc chắn Số lần TTNT (chọn) 1 2 3 4 5 Vật nuôi có phù hợp để thực hiện tiếp TTNT không (chọn) Có Không Ghi chú khác NGÀY (Ngày/ tháng/ năm) ĐIỂM THỂ TRẠNG 1 = rất gầy 2 = gầy 3 = tối ưu 4 = béo 5 = rất béo SỨC KHỎE VẬT NUÔI Các ghi chú khác về tình trạng sức khỏe vật nuôi CHỈ ĐIỀN THÔNG TIN VỀ CÁC DỊCH VỤ CUNG CẤP Ở ĐỢT THĂM KHÁM ĐÓ ĐỢT THĂM KHÁM TIẾP THEO Ngày và mục đích Phát hiện động dục Vật nuôi động dục (có/ không), Các lưu ý khác Gây động dục đồng pha Tên hormone, liều dùng, các lưu ý khác TTNT Nhà cung cấp tinh, số lượng cọng tinh, giống đực, liều tinh Phát hiện có thai Phương pháp và kết quả (chửa, không, không chắc), các lưu ý khác Thông tin chi tiết về sinh đẻ Ngày, số lượng con sơ sinh sống, các lưu ý khác Khác Chi tiết THÔNG TIN KHÁCH HÀNG Họ và tên Số điện thoại Địa chỉ -Xã Bản Giới (chọn) Nam Nữ Khác: Vòng TTNT này thành công tức là ra kết quả đời con (chọn) Có Không Không chắc chắn Số lần TTNT (chọn) 1 2 3 4 5 Vật nuôi có phù hợp để thực hiện tiếp TTNT không (chọn) Có Không Ghi chú khác NGÀY (Ngày/ tháng/ năm) ĐIỂM THỂ TRẠNG 1 = rất gầy 2 = gầy 3 = tối ưu 4 = béo 5 = rất béo SỨC KHỎE VẬT NUÔI Các ghi chú khác về tình trạng sức khỏe vật nuôi CHỈ ĐIỀN THÔNG TIN VỀ CÁC DỊCH VỤ CUNG CẤP Ở ĐỢT THĂM KHÁM ĐÓ ĐỢT THĂM KHÁM TIẾP THEO Ngày và mục đích Phát hiện động dục Vật nuôi động dục (có/ không), Các lưu ý khác Gây động dục đồng pha Tên hormone, liều dùng, các lưu ý khác TTNT Nhà cung cấp tinh, số lượng cọng tinh, giống đực, liều tinh Phát hiện có thai Phương pháp và kết quả (chửa, không, không chắc), các lưu ý khác Thông tin chi tiết về sinh đẻ Ngày, số lượng con sơ sinh sống, các lưu ý khác Khác Chi tiết THÔNG TIN KHÁCH HÀNG Họ và tên Số điện thoại Địa chỉ -Xã Bản Giới (chọn) Nam Nữ Khác: Vòng TTNT này thành công tức là ra kết quả đời con (chọn) Có Không Không chắc chắn Số lần TTNT (chọn) 1 2 3 4 5 Vật nuôi có phù hợp để thực hiện tiếp TTNT không (chọn) Có Không Ghi chú khácCGIAR là đối tác nghiên cứu toàn cầu vì một tương lai an toàn thực phẩm thông qua việc chuyển đổi các hệ thống lương thực, đất đai và nước trong bối cảnh khủng hoảng khí hậu."}
|
main/part_1/0305748262.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":null,"keywords":null,"sieverID":"5fd64e8d-f8a6-451d-9ccb-af4c2ecbcf38","content":"\n\n\n\n\n\n\n\n\n\n"}
|
main/part_1/0316450659.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"27439f552a4833cd4692b5637ac0e68e","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/39c6f93f-1d11-4ef2-8a0a-c5faaf829ce0/retrieve","id":"-166843185"},"keywords":["3","Collaborative studies with CIAT's Programs and Units","Summary Table 3","1 Collaboration with Beans 3","2 Collaboration with Cassava 3","3 Collaboration with Rice 3","4 Collaboration with Tropical Forages 3","5 Collaboration with Tropical Lowlands 3","6 Collaboration with Hillsides 3","7 Collaboration with Biotechnology 3","8 Collaboration with Virology 4","Future Plans"],"sieverID":"b71eb508-78ff-4987-9fcf-0e325d9ede54","content":"The Bio mctry Unit is a rcscarch-suppo rt Unit of advisory, training and methodological nature, dealing with Applicd Statistics and Mathcmatics in suppo rt lo C lA T's agriculture and enviro nmental research. Functions indudc: • Statistical/ mathcmatical advice lo C lA T researchers. • Collabo rative methodological studics with CIAT scicntists. * Training in biomctrical mc thods/rcscarch data ana lysis to ClA T and sclcctcd gro ups of NARS rcsearchers. • Assistance lo C IA T in delining cenlcr-wide standars fo r statistical software. * ldcntilication of arcas of C lA T's research where exte rna! Biometrician Consultants could add use fui contributio ns. Highlights 1995 Activities planned and executed by the Unit, independently or in partnership with CIAT's Programs • lnte rnatio nal Symposium in \"Statistics in Agriculture and Environmental Research\", and training courscs prcvious lo the Symposium. CIAT,Biometry Unit l.As a science-based institution, CIAT relies heavily on statistical and mathematical sciences and tools for research design and analysis of research results. The Biometry Unit is a research-support U nit of advisory, training and methodological nature dealing with Applied Statistics and Mathematics in the area of agriculture and environmental research.Functions include:1) Statistical/ mathematical advice in experimental design, dC;lta analysis methodology, interpretation of results, their forecasting a bility, and final presentation.Collaborative methodological studies and data analysis projects with CIA T scientists, aimed at responding relevant questions of CIAT research.Th~se studies utilize data generated by a given research project through the years, combine experimental results of a given research discipline, or combine data generated by various disciplines within a Program: a) to evaluate a research strategy and provide guidelines on future planning; b) to evaluate and recommend appropriate experimental designsjevaluation criteria/performance indicators/ statistical analysis methodology for a given research; e) adopt or adapt tatistical methods used in other areas of science to particular agricultura! research problems of CIA T in the tropical developing world. Brief summaries of collaborative studies -which continued or sta rted in 1995in support to research projects, in the areas of Germplasm Development, Genetic Diversity, IPM and agroecosystems research, are presented in this report.3) Oevelopment of software programs for end-users to implement specific statistical analysis methodologies. These are called 'MACROS'.Training of personnel from CIA T's research programs and selected groups from NARD's, in biometrical methods and statistical data analysis techniques applied to their particular research needs.Assistance to CIAT in defining cente r wide standards for statistical/mathematical software. Present standards include SAS/BASICS, SAS/STATS, SAS/ ETS, SAS/ IML, SAS/ GRAPH, SAS/ OR, GENSTAT, MSTAT, GLMM, and AGROBASE/ 4.ldentification of new are as of CIA T's research where externa! Biometrician Consulta nts could add usefu l contributions.Activities planned and executed by the U nit in 1995, independently or in partnership with other CIAT's Programs.International Symposium on \"Statistics in Agriculture and Environmental Research\", he ld at C IAT in June 5-9, 1995. 1 am pleased to info rm that Colombia accepted to be the host country for th is lnternational event. It was a Joint Meeting of the \"Biometry Network for Central America, the Caribbean, Colombia and Venezuela\" (4th Annual Meeting), the \"Interamerican Statistical Institute\" (IASI, 6th Annual Meeting) and the \"National Symposium of Statistics\". It was held in two phases: a) A Satellite Meeting at CIAT, June 5-9/ 95 with more than 180 participants, where three specific topics of high relevance to CIA T's and NARD's research we re discussed through invited conferences and discussions sessions:-Statistical Methods in Env ironmental Research (\"Environmentrics\").-Statistical Methods in Biotechnology and Molecular Biology -Statistical Methods in Agricultura! Epidemiology. b) The full Joint Meeting at Santa Marta, at \"Pozos Colorados\" Convention Center, Ju ne 11-15/95, with about 250 participants, v.:here a \\vide r variety of statistical topics were discussed.The CIAT Biometry Uni t was responsible for the organization and financia! support fo r the Satellite Meeting. The Department of Statistics, Un iversidad Nacional de Colombia, was responsible for organizing the Plenary Meeting at Santa Marta. Biometricians and researchers from NARD's and commercial enterprises from Colombia and ot her Latinamerican and Caribbean countries were invited to attend. CIAT Pri ncipal Staff, associates and assistants interested in these scientific topics, also attended. There was simultaneous translation. An insc ription fee of US $ 70/person was established to partially cover operati onal costs. lnstitutions in Colombia and outside Colombia contributed as sou rces for financia! support.Given the present emphasis on conservation and enhancement of biodiversity, on understanding, monitoring and controlling epidemiological problems in agriculture, and natural resources conservation and monitoring, the role and application of modern developments in quantitative sciences, such as statistics and biometry, needs to be discussed. The \"International Symposium on Statistics in Agriculture and Environmental Research\", offe red to participants the opportunity to do so.22 lnvited speakers and more than 180 part1c1pants (biometricians, researchers, unive rsity professo rs and students) from England, USA, Mexico, Central America and The Caribbean, Colombia, Venezuela, Brazil and Argentina, attended. This number included 76 CIA T's research personnel.Scie nti fic activities covered during the Symposium included a) two intense 3day training courses--Spatial Variability Techniques and Statistics in Epidemiology--b) 22 invited conferences and discussion sessions and e) specialized consultancy sessions with sorne of the invited speakers.This i nternational event was organized by the CIAT Biometry Unit and cosponso red by CIAT, COLClENCIAS, ODA, ICETEX, FES, CENICAÑA and the Environment Division of the Mayo r's office for Cal i.We trust that it helped the participants in their understanding and application of recent statistical methodological developments in the three selected research areas, in their continuous search for practica! sol utions to resea rch problems.agro-pastoral research, he ld at Santacruz, Bolivia, September 25-29, 1995.The Agro-pastoral Network was created 4 years ago as a response to the i ncreasi ng i rnportance and revelance of agro-pas toral resea rch in the Sava nn a Eco ystem of Tropical America. Agro-pastoral research is conceived as a way to provide the farmer with economic alternatives as well as to maintain and better manage the natural resource base. The output of this Methodological Workshop was: a) A more focussed view of important concepts and methodologies to be implemented within the Agropastoral Network; and b) A series of methodological papers leading to concrete decisions to be implemented within the different types of agropastoral experiments. A CIAT-published book containing these contributions will be prepared in 1996 togethe r with a Manual on Methodologies. These two publications are expected to he ready for the V International Meeting of the Agro-pastoral Re sea rch Network, to be held in Colombia in late 96.Publication of RABAOC years experime ntal results of RABAOC trials and its interpretation, to end-up with practica! conclusions and research recommendations.The complete se t of results of the statistical analysis per site and across-site analysis conforms the body of the publication.The RABA OC trials are multilocational agronomic evaluation experiments for forage ecotypes with potential for the African subhumid and humid shrubsava nna envi ronment. 35 ecotypes were evaluated : 8 grasses, 21 herbaceo us legumes and 6 woody legumes. In each experimental site, three indepe nde nt expe riments were conducted, one for grasses, o ne for he rbaceous legumes a nd one for woody legumes. Each experiment was a split-plot design with 3 rep lications, where 'ecotypes' were assigned to main plots and 'age at cutting' ( 4,8 and 12 week during the establishment phase and 3, 8, 9 and 12 wee k during the production phase) as su b-plots. The experimental period cove rs a n establishment phase of 12 weeks after planting followed by 1, 2 or 3 years of obse rvation, wi th two production periods per year. The production periods were defined as 12 weeks of growth fo llowing an uniformity cut, one during the maxi mum rainfall period, and one during the mín imu m rainfall period.Data has bee n provided to CIAT from 10 of the 18 trials establíshed. This info rmat io n vary ing in degree of completeness, was incorporated into the RABAOC darabase and is sufficient to allow a comprehensive multilocational statistical ana lys is. In this publication, the methodology for the a nalysis of a si ngle locatio n and the mu\\ti\\ocational statistical analyses is prese nted.Indepe nde nt analys is fo r grasses, herbaceous legu mes and tree legumes were performed pe r location and across-locations.The statistical methodology included: a) definition of establishment and production ind ica tors; b) Statistical analysis a nd presentation of results per loca tion: a nd e) multilocational statisti cal analysis.This publication was presented and made avai lable to participants at the 5th Annual Meeting of RABAOC, held in Lome, Togo, April3-9, 1995.Two 3-d ay tratm ng courses were offe red to CIAT's research personnel, previous to the lnternational Symposium on \"Statistics in Agriculture andSrudv 1:Análisis de genotipos de frijol de origen mejicano con datos provenientes de RFLP.S. Beebe, E. González, M.C. Duque, (en progreso)Con datos de 260 bandas ob tenidas por RFLP sobre 181 genotipos de frijol elegidos aleato riamente de la colección CORE y otros 90 del Banco de Germoplas ma, se inici ó un estudio descr iptivo que pretende de scubrir e inte rpre tar estructuras suge ridas por los datos.T~cnicas de Análisis de Co rrespo ndencia Múltiple y de Anál isis de C lasificación sobre una matriz de distancias ge né ticas, permitieron detectar una clara separación entre genotipos de origen Andino y de o rigen Mesoamericano, además, en un último grupo, la subdi visión e n lo que podría llamarse Tropicales y T emplados. Además, se detectaron los \"p rimers\" de las bandas que permitieron realizar ésta clasi ficaci ón en cada caso.Adicio na lmente, se realizaron los siguientes análi sis:-Estudio de los grupos en términos de variables mo rfológicas y bioquímicas con propósitos de varificación. -Matrice~ de simi laridad y clasificación de los materi a les con índices de Jaccard.Ide ntificación de las bandas que por su ausencia o prese ncia definen los grupos. -Estudio de la va riabilidad genética mediante técnicas de remuestreo.Como comp lemento a l est udio anterior se realizó e l proceso de selección de materiales de frijo l para tratar de evaluar e l efecto del tipo y ca ntidad de faseolina y lectina en la digestibi lidad del frij o l. Pa ra e llo se tomó de la base de datos de frijo l e l conjun to de variedades q ue tenía n esta información disponible, se estudiaron estratos y se seleccionaro n los genotipos que en trar[tn en el proceso de evaluación.Di versidad de la virulencia de poblaciones de Phaeoisaiopsis fri seola en América Latina y Africa.C. Jara, M. Pastor-Corrales, M.C. Duque (en progreso)Se utilizaron 12 cultivares diferenciales de frijol para evaluar la virulencia de 77 aislam ientos provenientes de América Latina y Africa. Con evaluaciones e ntre los 10 y los 16 d í as después de sie mbra se obtuvo un perfil de la curva de progreso de infección, a partir de la cual se estimó un área, qu e co njuntame nte co n el nivel de daño final const ituye ron las vari ables para la cl asificación del aislami e nto. La categorización de la virul e ncia se hizo co n una funció n discri minante calibrada sobre el espacio muestra ! de la patoge nicidad. La dive rsidad de las ca lificacio nes obtenidas po r los cultivares permitió la detección y cuantificación de las ce pas, su unicidad, su di stribució n geográfica y su virul encia.Study 3: Evaluación con cepas Andinas y Mesoamericana de Phaeoisariopsis griseo la del vivero internacional de frijol 1994-1995.M. Pastor-Corrales, C. ./ara, M. C. DuqueLas 647 líneas de frijol correspondientes al vivero internacional de frijol de 1994 y 1995 fueron evaluadas por su comportamiento en términos de resistencia a mancha angular. Para ello se definieron 5 tratamientos: 1) mezcla de aislamientos 94b:PG3 y PG61; 2) aislamiento andino: PG3; 3) aislamiento mesoamericano: PG61; 4) mezcla de aislamientos de Darién: PG66, PG67, PG81, PG85 y PG24; 5) mezcla de aislamientos de Quilichao: PG l. PG3. PG 15. PG32 y PG65, bajo un diseño en BCA con 4 evaluaciones de daño en el ti e mpo. Dada la naturaleza del ensayo no hay testigos únicos, por lo tanto, para cada uno de los tratamientos se definieron los propios.Como metodología de análisis se siguió la siguiente: a) Estudio de los testigos -Criterios de evaluación de daño: 1) Para cada día de evaluación se estudió la distribución de frecuencia de la variable daño, eligiendo el valor modal. Con todos los valores así seleccionados se determinó el comportamiento modal de los testigos y se calculó para ellos el área bajo la curva modal de daño. 2) Para cada repetición de los testigos se calcula el área bajo la curva de daño. y se hacen promedios. Se califica como estable, una variedad testigo donde coincidan los criterios 1 y 2. Con base en este conjunto se toma como punto de referencia para testigos susceptibles, a quel que presente menos área bajo la curva y para los testigos resistentes el que presente mayor área entre los testigos resistentes del tratamiento.b) Estudio de las líneas. La definición del Indice de Susceptibilidad en el tratamiento i permite la clasificación relativa de las 1 í neas de acuerdo con su comportamiento. Area bajo la curva¡ ---------------' i= Tratamiento: 1,2, ... 5Area bajo la curva testigo susceptible¡ La correlación entre los índices obtenidos para cada tratamiento permite ver el comportamiento de las mezclas frente a los tratamientos puros. Se utilizó una definición similar para Indice de Resistencia. Se definieron como resistentes las variedades con IR 1 ~ 1 y como susceptibles si IS¡ >l. Un Cluster Análisis sobre las áreas bajo la curva de cada variedad en los 5 tratamientos permitió estudiar la estabilidad en las respuestas.Study 4: Fuentes de resistencia a P. gri.'ieola en invernaderoCon 76 1 íneas provenientes del Vivero Internacional de resistencia a mancha angular (BALSIT) y otras del banco de germoplasma, se formó un conjunto de 212 líneas a ser probadas frente a 9 aislamientos que cubren todo el espectro de patogenicidad. Estos 9 aislamientos son: 2 andinos, 4 mesoamericanos y 3 africanos.El objetivo es identificar 1 in e as resistentes o intermedias al mayor número de aislamientos, con el propósito de identificar fuentes de resistencia. De cada línea se sembraron 2 potes con cuatro plantas cada uno, en las cuales se hicieron 4 evaluaciones en el tiempo. Como va riables de respuesta se tomaron el área bajo la curva de infección, la evaluación 3, la 4 y el promedio de las evaluaciones 3 y 4. Además de la clasificación del material se prete ndió determinar la mejor época de evaluación al correlacionar las distintas eva lu aciones con e l valor del área. Se definió para cada línea su estado así: R si la evaluación ::::3, IS¡ 3 < evaluaci ó n ::::6 y S si evaluación > 6 serán.Estudio de Diversidad de P. gri'leo/a -Santander de Quilichao.Con metodología similar al ensayo de fuentes de resistencia se condujo este con 8 evaluaciones en el tiempo. Buscando no solo la respuesta en términos de la clasificación de material vegetal, sino la orientación sobre la o las mejores fechas de evaluación. Asesoría en el diseño y análisi s de los ensayos: 1) de campo con tratamientos definidos por diferentes medios de control.1) de invernadero con tratamientos conformados por niveles de infestación. 3) en campo para el estudio fenológico del insecto (Parcelas sin tratamiento donde se eva lúan huevos, larvas, pupas, parasitismo y área minada por el in secto).Los ensayos permitieron evaluar la magnitud de las pérdidas causadas por el ataque del insecto en parcelas sin control, y la eficacia de las alternativas de control evaluadas.StuLiy h: Optimizing genetic progress with the use or selection indexes in a cassava breeding program.C. Iglesias wzd E. Mesa (Presented at 10th ISTRC meeting Brazil October 1994.) ln for mation generated during 10 years in cassava breeding programs for different ecosystems in Colombia was used to define se lection indexes that maximize genetic progress in p roductivity of dry matter. A four-step procedure was employed: 1) The variables to be included in the index were determinated using stepwise procedure and factor analysis. Variab les found as hi ghly determinant were:harvest index, number of commercial roots, hranching index, plant heigh t and leaf retention. 2) Heritability was estimated from a weighted regression analysis of traits evaluated on the same genotype in consecutive years. With the exception of number of commercial roots and leaf retention, other component traits presented heritability higher than 0.50. 3) Three methodologies were employed to derived a se lection index maximizing the expected genetic gain: Free Weights (Elston), Base Index (Williams) and Modified Base Index (Smith). All indexes assigned higher weights to branching index and plant height. Greater emphasis should be given to the enhancement of biomass, maintaining an adequate plant architecture. 4) Actual genetic progress has been .. based on a more increased root production and harvest index. Selection indexes provided a more balanced criteria for improving the potential of cassava dry matter production.Phenotypic plasticity and ontogenetic variation: A quantitative genetic study of Manihot esculenta Crantz M. Bonierbale, P. Orson y E. Mesa (en progreso)Objetivo: Determinar dife renc ias de heredabilidad, va riación fenotípica y ge né tica para Palmira (suelo rico) y Quilichao (sue lo pobre) en cuanto al desarrollo, crecimiento, rendimie nto y características de fotosíntesis de 357 genotipos incluyendo 24 padres y 29 cruces.Cá lcu lo de heredabilidad usando regresión de padres e hijos Cálcu lo de heredabilidad usando matriz de covarianza Cálcu lo de varianzas fe notípicas y genéticas Co mparación de las dos formas de estimar heredabilida d .( Los resultados forman parte de una tesis de doctorado). -9, 1995). The rel a tive ly recent deve lopme nts o n statistical methods for the analysis of categorical variables a llows parameter est ima tion and hypothesis testing of linear models on functions of response frequencies. A particular case is the Logit Model, which uses as d epende nt variable the logi t function, expressed as In (rr / 1-rr), where 1r is the proportio n of success o n a binary variable, a nd externa! factors as independent variables. The purpose of this pape r is to illustra te a n application of the logit model to compa re biotechnology methods (Anther C ulture) with the traditional breeding method (the Pedigree Method) in their efficiency to ge ne rare rice lines with stable res istance to blast, the most important disease of rice world-wiJe. An initial number of 17917 F 2 plants submitted to selection for blast resistance through the Pe digree Method (PM), together with 441 and 740 lines obtained by anther culture methods (AC-F 2 and AC-R 2 ) respective ly, were evaluated for blast resistance and resista nce sta bility. The analysis confirms tha t AC was more efficient than PM across crosstypes in genera ting blast resistant lines; in terms of resistant stability, AC was superior to PM o nly o n a give n cross-type. Model assumptions are discussed in the light of this particula r study. Genera l recommendations of methodo\\ogical nature a re made tending to gu arantee valid s tatistical infere nces. A three-phased segment regression model was found appropriate to describe the observed patterns in share of area planted in a 20-year period (197 1-1990) of 9 irrigated rice varieties commercially released in Brazil and Colomb ia. The model quantifies the initial growing phase (parabo lic phase ), the period of stabil ity (pla teau ) and period of decrease (negative expo nential phase).A methodology to determ ine the mínimum evaluat ion period for disease-resistance characterization in rice.M.C.Amezquita, E. Guimaraes, G. Lema and F. Correa (submitted fo r publ ication ). 12-semesters data on blast resistance evaluation of 70 varieties is used as data source for this study. Various simulated lengths for the evaluation period a re considered. Corresponding characteriza tion parameters--mean disease-severity (M) and response to increased levels of di se ase pressu re (b )--are used to statistica lly se lect the set of 'best varieties' wit hin each period length. Each set is cornpared to the ' ideal best set' prod uced by the 12-semester periud. Based on the value of a Similarity Coefficient between period lengths, the mínimum evaluation period is established.A logit model to evaluat e genetic progress in disease resist a nce. A logit Model to analyze the 3-level ca tegorical response va riable ( R = resistant, 1 = interme diare, S = suscep tibl e), is utilized to quantify progress in blast resistance between 2 cycles of recurrent se lection. The powerful CATMOD procedure of SAS is used. With an appropriate re-parametrization of the model, parameter estimares provide desired compa risons. A simi lar methodology has been utilized in 1995 for the a na lysis of other recurrent se lection expe riments with upland rice.Study 12: Predicción de pérdidas por competencia con ma lezas en el c ultivo de arroz bajo el sistema de riego intermitente A. Fislzer, ./. Flórez, E. Mesa (en progreso)Objetivos: Establecer una rnetodologia para definir umbral es de daño económico por competencia de ma lezas: 1) D e fin ir un modelo que permita predecir la pérd ida de re ndimiento para diversos nive les de enma lezam iento. 2) Cuantificar el efecto de la época • de emerge ncia de malezas con respecto a la competencia que ejerce sobre el cultivo. Informac ión considerada: El á rea ele expe rime ntación se dividió en tres parte iguales cada una de las cuales representa un pe riodo diferente ele enmalezamiento: 15 y 30 dias , después de la emergencia y un lote testigo. Dentro de cada lote se establecieron cinco parce las correspondientes a cinco densidades de siembra de ar roz las cuales fueron asignadas a l azar a cada parcela. Para dos de los lotes se permitió la libre emergencia de malezas para los cinco niveles de densidad de siembra; el tercer lote se mantuvo siempre limpio y se consideró como lote testigo. Para cada densidad de siembra y en los tres lotes se consideraron puntos con diferente nivel de in festación de maleza. Bajo un criterio visual para los lores con emergencia de maleza a los 15 y 30 días se consideraron 10 puntos, mientras que para el lote testigo sólo fueron necesarios 4 puntos.Se estimó e l porcentaje de cobe rtura de maleza con respecto al á rea total cubierta por la maleza + e l cu ltivo, el número de ta ll os e l área foliar y el peso seco tanto para malezas como para el cultivo. Metodología Estadística: Se ajustaron modelos que permiten explicar e l rendimiento del cul ti vo en función de los niveles de infestación. Se consideraron diferentes formas de expresar el nivel de infestación de maleza, lo que hizo necesario ajustar un modelo para cada caso. Se consideró que el índice de área fo liar, la materia seca (g/ m\\ el número de rallos/ m 2 , el área foliar relativa, la materia seca relativa, el número de tallos relativo y la cobertura visual son formas d iferentes de expresar e l nivel de infestación. Se consideraron rres mode los en fo rma separada para cada una de las épocas en las cuales se rea lizó el ensayo (primero y segundo semestre de 1993) y para cada uno de los períodos de emergencia de malezas.Los modelos considerados fueron: Modelo l. ( R. Cousens 1985Modelo 3 se consideró el más eficie nte pues incluye en su fó rmula el parámetro t, • período de eme rgencia de las malezas, permitiendo ajustar un so lo modelo para las dos épocas de emergencia.Morpho-agronomic characterization of the Brachiaria collection G. Keller-Grein, G. Lema, M.C. Amézquita (in progress) CIA T has the largest Brachiaria collection in the world comprising about 700 accessions from at least 23 known species. A morphologic an agronomic classifications of this collection are required for its effective utilization. 585 accessions of this collection have been evaluated in terms of 30 morphologic traits in the field of Quilichao experimental station. Parts of the collection have also been evaluated at o ther e nvironments: Campo Grande, Brazil (163 accessions with 25 morphologic and 12 agronomic traits) and Carimagua, Co lombia ( 186 accessions, 15 morphologic and 10 agronomic traits)The purpose of this study to be ínitiated in November 95, is to perform a morphologic classification of the complete collection, using a set of traits which are stable across e nvironments and non-corre lated among themselves. Also, the study aims at detecting possible relations between the morphologic groups and environmental characteristics of the sites of origin of the accessions.In addition, using those accessions that have been morpho-agro nomically evaluated at Campo Grande ancl Carimagua, an agronom ic classification will be performed to study possible relationships between both classification criteria. Agropastoral research is characterized by: a) dealing with multiple components (soil, crop, pasture, animal) which apart from demanding their own specific research in genetic material and management practices, they interact among themselves; b) Long-term nature, as it pursues the increase of the productivity of a system with a perennial component (the pasture) together with the improve ment of soi l quality in the long run; e) ls a research field of multidisciplinary nature .The paper describes five phases of agropastoral research: l. Exploratory research; 2. Pastures establishment with crops; 3. Pasture renovation with crops; 4. Pasture -crops rotations and 5. Demonstration tria ls under commercial systems. Also, as a result of literature review, the most important research hypothesis are stated. In the light of this, the pape r discusses important aspects to be considered in the planning and design stages:* Bolivia, Sept. 25-29, 1995) Data source for this study corresponds toa 7-months rice-pastures multifactorial experiment co nducted by the Rice Program at Villavice ncio, Colombia. The statistical analysis was performed with the following methodological objectives: a) to identify the most important respo nse variables to be measured in more advanced research stages ( crop response variables and pasture response variables). b) To identify optimum evaluation period s. e) To identify those experimental factors which can be tested under short-duration satellite experiments, vs. those factors th at need to be studied in long-term agropastoral experiments. T he analysis proved useful in identifying key factors, response variables and measurement periods. But more importantly, it showed the importance of making use of the information ge nerated by exploratory short-duration experiments as a tool to guide more advanced agropastora l research.Objetivos:Weed population ecology with prototype sustainable cropping systems for the Colombian Llanos E. Mesa, A. Fischer, J./, Sanz (in progress) a) Estudi ar dinámica de las poblaciones de malezas relacionadas con el sistema de cultivo arroz-pastura, su manejo y relacion arlo con parámetros de suelo. b) Determinar qué especies de malezas se presentan, cómo es su ciclo y cómo se ven afectadas por la degradación del suelo en los diferentes sistemas. e) Establecer su importancia económica de acuerdo a su grado de competitividad.El es tudio se inició en Matazul en 1994 y se consideraran datos experimentales de 3 expe rimentos: EX PTO 1. : Tres niveles de fertilización (P, K, Zn y Cal) combinados con dos sistemas de cultivo (arroz en monocul tivo y arroz + Stylosantlzes capitata); EXPTO 2.: Dos sistemas de cultivo: arroz solo y arroz en asocio con especies forrajeras; EXPTO 3.: Diferentes formas de incorporar residuales en sabana nativa.Se tomaron 10 cuadrantes de 0.5 m 2 por parcela en cada experimento. Dentro de cada uno se definieron 3 subparcelas que corresponden a controles de malezas: tradicio nal, con maleza y limpio. En cada caso se registra\"ron las siguientes variables: rendimiento de arroz, densidad de maleza (número/ m 2 ) y cobertura.Metodología Estadística: (sobre expto. 1 por ahora)La Abundancia R e lativa (que es un promedio de la densidad relativa y la frecuencia relativa para un especie dada), fué analizada mediante Análisis Discriminante Canónico, el cual permite establecer cómo afectan los factores bajo estudio la composición relativa de las de malezas. Dada una variable de clasificación, el ADC deriva combinaciones lineales, las cua les cuantifican la variabi lidad entre los niveles de la variabl e de clasificación. Los coeficie ntes de la va ri a bl e canónica indican la contribución relativa de cada especie en la conformación de la misma. Se e nco ntraron 12 especies de malezas; el a rroz en monocultivo desarrolló poblaciones de malezas que red uje ro n seve ramente el rendimiento de arroz. Se encontró que Axonopus purpurii y Digitaria sanguinalis fueron especies fuertemente asociadas con baja fertilidad mientras que Centrosema pubescens y Paspalum multicanley se asociaron con alta fertilidad. Análisis y Resultados: l) Descripción de vegetación: se encontraron 43 familias, 100 géneros y 158 especies. 2) Se realizó un Análisis de Correspondencia con la presencia/ ausencia de cada una de las especies en las diferentes comunidades, el cual permi tió ide ntificar especies características en cada una de las comunidades; se observó que las comunidades con las mismas especies características corresponden a una agrupación por características físicas del sue lo. 3) Se consideraron tres índices ele diversidad: Simpson, Shannon y Estadística Q; los índices mostraron un comportamiento similar para este estudio, sin embargo, la Estadística Q, permite discriminar facilmente la diversidad entre comunidades, mientras que los otros dos no. 4) Se identificaron comunidades con alta y baja biodiversiclad , lo cual permite plantear estrategias de manejo.Study IX:Collaboration with Hillsides C uantificación de la microfauna de suelos de laderas en la s ubcuenca del Río Cabuya!, en el Departamento del Cauca. R. Knapp, A. Fetjoo, C . L ema (en progreso) Los rnicroinvertebrados tales corno lombrices, coleópteros, hormigas, termitas, etc., juegan un importante papel en la regulación d~ los procesos del suelo por e\\ intercambio de pan iculas orgánicas y minerales, principalmente por la excreción, además de que han desarrollado una digestión rnutual ística que les permiten digerir sustancias complejas como taninos, proteína, lignina, compuestos lignínicos, etc., que producen diversas y abundantes estructuras en los suelos, incidiendo directamente en su composición química y física. Objetivo: Agrupar sitios con similar abundancia y biomasa de Unidades Taxonómica y caracte riza r los grupos de acuerdo con los parámetros de suelo.El estudio se llevó a cabo en la época seca de l994, entre Abril y Septiembre, en diez sitios se leccionados por el equipo de trabajo del Programa de Laderas del CIAT en el municipio de Caldono, tomando en cada sitio 10 muestras en un volúmen de suelo de 25x25x30 cm. Se torna ron datos de 19 unidades taxonómicas (lombrices, hormigas, termitas, arácnidos, coleopteros, dípteros y otros) y los tipos de suelo (sitios) fueron: 1-Selva secundaria, 2-Sucesión de 40 años, 3-sucesión secundaria, 4-matorral con helecho, S-cultivo estratificado, 6-cultivo de pino, 7-cultivo asociado, 8-pradera de Kikuyo, 9-pradera de Yaraguá, lOpradera de Brachiaria.Ad icionalme nte se obwvieron datos de suelo de cada uno de estos 10 sitios con el fin de ;_¡portar en su caracterización.Anftlisis estadístico: Se utili zó el Análisis de Componentes Principales para reducir la dirnensionalidad del problema, resu ltando 2 factores que fueron usados como entrada al análisis de Conglomerados (Cluster Análisis), del cual se escogieron 3 grupos con un R2= 77% .El grupo 1 formado por el matorral de helecho y las praderas de Yaraguá y Kikuyo, prese ntan suelos franco-arenosos y co n alta saturación de Aluminio en cua nto a ca racterísticas de suelo y gran prese nci a de hormigas y ausencia total de miriápodos y arác nidos. en lo qu e re specta a la fauna. El grupo 2 constituido únicamente por la Selva Secundaria se caracterizó por la presencia de abundantes comunidades de coleópteros y de te rmitas ade más de una alta presencia de carbono. El grupo 3 integrado por los Cultivos Estratificados. los de pino, los asociados, las sucesiones de más de 40 años, las secundarias y las praderas de Brachiaria, mostraron un dominio amplio de lombrices, con alto contenido de arena y bajo pH. June 5-9, 1995 ) La colección Core se propuso como un medio útil para el estudio y uso de la diversid ad ge nética de grandes colecciones de ge rmoplasma, ya que debe representar la mayor parte de la dive rsidad de la Colección de reserva. En consecuencia, la colección Core de frijol lH silvestre se sometió a un análisis nuclear de DNA mediante técnicas de AFLP para determ inar la estructura ge nética de las especies. Se logró alto grado de polimorfismo con es ta técnica y avanzar un poco más que con el uso de isoenzimas. Se confirmó la existencia de los grandes grupos: Andino y Mesoamericano y surge e l nuevo grupo del Norte de los Andes.1\\letodología Estadística: La matriz de datos binarios obtenidos correspondientes a los 114 ge notipos. eva lu ados en 203 bandas fue analizada bajo los lineamientos del Análisis de Correspondencia Múltiple, y como un complemento a la explicación de los grupos, se construyó la matriz de distancias genéticas que dice que permitieron la construcción de dendogramas donde se manifestó una alta concordancia con un patrón geográfico. Objetivo: Estudiar e l comportamiento de la Mosca Blanca (MB), evaluando el número acumu lado de adu ltos med idos cada 3 días, durante dos periodos : 1979-1984 y 1987-1994, en función del clima: precipitación, temperatura y humedad relativa, tomados en dos lotes: con frijol y sin cultivo.Las hipótesis bajo estudio son: dos relacionadas con época de lluvia (H 1 = La lluvia fuerte hace que la MB disminuya; y H4 = La lluvia moderada después de sequía prolongada.aumenta la población de MB) y dos relacionadas con época seca: (H3 = La sequía prolo ngada, hace que la MB disminuya y H2 = Si la lluvia disminuye, la MB aumenta)Análisis exploratorio inicial : Se grafica ron las series de tiempo para cada una de las va riables consideradas, para cada uno de los ciclos y lotes en consideración. La precipitación y el número de MB presentan distribuciones asimétricas en todos los casos; el 90% de los conteos de adultos de MB presenta valores por debajo de 70 y 30 para los lotes con frijol y sin cultivo respectivamente. Con respecto a la precipitación, el 90% de los datos están por debajo de 10mm en los dos ciclos y para los dos lo tes, indicando periodos de sequía.Se definieron tres niveles de precipitación: sequía (::;2.5mm), lluvia moderada (2.5-10mm) y lluvia fuerte ( > 10mm). Se consideró como 'periodo de se quía' aquel en el cual había como mínimo JO días secos consecutivos.i')Como resultado inicial del análisis exp loratorio de las se ries de tiempo, se muestran en la tabla ~nex a, las prohahilidades de ocurrencia (p) de cada una de las cuatro hipótesis. N= Número total de periodos considerados para verificar la hipótesis correspo ndiente. P= Prohabilidad de ocurrencia de la hipótesis Util izando la información de los periodos de sequía unicamente, se planea ajustar modelos 4u e describan el comportamie nto de MB en función del número de días secos y de humedad relativa con el fin de determi nar umbrales de daño y dar recomendaciones de con trol.In re sponse to the needs of C IAT's research Programs and Units, the Biometry Unit efforts in 1996 wi ll be focusse d on the fol lowing aspects: a) Methodological aspects of agro-pastoral research; b) Environmetrics, that is the quanti tive analysis of environmental impact, trends and rnonitoring of environmental interve ntion studies; e) Genetic Diversity studies, including field data and bio technology / molecular bio logy analysis and d) Quantitative analysis of ¡.>opul ati on dynamics"}
|
main/part_1/0326233398.json
ADDED
|
The diff for this file is too large to render.
See raw diff
|
|
|
main/part_1/0339629449.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"f2e48a9514017603452dc10e7372526b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/6419f744-b311-49e6-9e34-f3583c5a63d0/retrieve","id":"1524808507"},"keywords":[],"sieverID":"b8810342-5d56-48a6-901a-043ee9bfeb82","content":"Separación fase orgánica Extracción Concentrador N 2 (g) Cromatograma Homogenización Centrifugado Lavado Determinación Carotenos totales UV/vis 450nm HPLC Agilent 1200 series1) Evaluar la cinética de degradación térmica de los compuestos carotenoides 2) Analizar las propiedades funcionales de las harinas de batata y yuca 3) Evaluar la retención de compuestos carotenoides desde el material en fresco hasta el producto final Mean values (n = 2), f.w. = fresh weight, T (°C) = temperature, % R = percentage of carotenoids retention, nq: not quantifiable.TBC: all trans-β-carotene, TCC: Total carotenoids content.Tabla. Efecto de la temperatura y el tiempo de cocción en el contenido de carotenoidesDiseño experimental de mezclas ❖Mezcla para pan 25% harina de batata, 5% harina de yuca y 70% harina de trigo.❖Mezcla para tortas y galletas 45% harina de batata, 5% harina de yuca y 50% harina de trigo. "}
|
main/part_1/0342535474.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"36cf80b58be93aaf6fcb14eab60f4374","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/d097ac71-68d2-4ce5-9e8f-06bc08a7f6f5/retrieve","id":"1928553056"},"keywords":[],"sieverID":"9932bccd-5dc5-48ef-b48e-2756bfa7759e","content":"approaches. This targeted support ensures that interventions are better aligned with the specific needs and dynamics of each community, thereby improving outcomes and fostering sustainable peace and development across the region. 8. Expand climate finance towards fragile and conflict-affected settings to support climate adaptation efforts. Although the Mediterranean region received about 4.6 billion Euros in 2016 from public, private, bilateral, and multilateral sources, the distribution of these funds is highly imbalanced, favoring stable and secure areas. Particularly as far as public finance is concerned, more efforts should be made to reach fragile and conflict-affected populations as well as the most vulnerable.Increasing evidence indicates that climate change is likely to amplify risks and insecurities, leading to increased fragility and conflict (IPCC, 2022). Climate change can exacerbate food insecurity and fosters climate-induced mobility, thereby straining socio-economic systems and increasing the potential for disputes over dwindling natural resources. At the same time, conflict and fragility have proven to impede efforts to enhance climate resilience and adaptive capacity, leaving populations more vulnerable to climate impacts and exacerbating food insecurity (Scartozzi, 2020).The Mediterranean is one of the most vulnerable areas to climate risks. The region is exposed to recurrent droughts, heat waves and other slow-onset climate events, which are leading to soil degradation and water shortages. Moreover, the region already accommodates half of the global populace grappling with water scarcity-a situation projected to further deteriorate due to climate change (ARLEM, 2021). Scientists warn that absent robust measures to manage and mitigate climate change, its adverse impact could overwhelm the adaptive capacity of the Mediterranean countries, weakening institutions and potentially exacerbating conflicts over natural resources (Scheffran, 2020).Currently the agricultural output in the Mediterranean is declining due to climate change, unsustainable agricultural practices, and water scarcity. These issues, combined with the region's growing population, pose significant challenges to sustaining living standards and development opportunities. Furthermore, food security is threatened by unsustainable human activities, such as deforestation, excessive water use in irrigation, and overuse of chemical fertilizers and pesticides. These actions, compounded by climate change impacts, exacerbate the region's growing demand for food, which in turn heightens its reliance on imports, making it increasingly susceptible to international price fluctuations. Climate change, socio-economic insecurity and political instability are pushing countries to critical levels of fragility. In the most affected regions, these factors are fostering grievances that can result in forms of organized violence and conflict. While the food-land-water nexus represents a potential intersection where to mitigate these tensions, conflict, poverty, and a lack of opportunities for youthexacerbated by environmental and climate change-compel migration within and across regions, which often occurs through unsafe channels, including the perilous journey across the Mediterranean Sea. Additionally, the challenge is intensified by the lack of cohesive long-term governance and a common vision among agricultural resource management authorities and policy actors, leading to disparate efforts in addressing these issues (ARLEM, 2021). Improving people's resilience in the region strongly depends on the ability to enhance the regional adaptive capacity to climate risks. The way governments and communities manage resources and food systems is a determinant factor in whether the Mediterranean area can endure development and peace. With no peace, there is no space for development. With no development, economic opportunities and food security, peace cannot last. This white paper is the result of a high-level discussion carried out at the event \"Towards a Common Vision of the Climate, Migration and Security Nexus in the Mediterranean Region,\" organized by the CGIAR Focus Climate Security and the Alliance of Bioversity & CIAT, and held in Rome in June 2023. The discussion collected opinions of scientists, politicians, experts and representatives of relevant international organizations on the climate-security-mobility nexus in the Mediterranean. The purpose of the discussion was to analyze current and foreseen vulnerabilities, risks and hazards affecting livelihoods in the region, and identify potential solutions and integrated approaches to increasing climate adaptation capacities, reducing involuntary and unsafe migration, and sustaining peace and stability.With this aim in mind, a number of recommendations have emerged:1. Strengthen governance to enhance policy coherence across climate, agriculture, and migration sectors in Mediterranean countries amid the climate crisis. It is essential to adopt a comprehensive and coherent approach that recognizes the interconnectedness of climate change with food insecurity, human (im)mobility, conflict, and fragility. Policy frameworks should aim for holistic and integrated objectives across various pillars and dimensions, enhancing coherence and coordination across relevant sectors. Key government actors in the region should also have access to necessary knowledge, data, and tools to enhance adequate and systematic climate action. It is also critical to embrace the logic and structures of multilevel governance, where decision-making is polycentric and distributed across scales of governance and stakeholders, ensuring that actions are coordinated, inclusive, and adaptable to the varied and specific needs of different communities. Finally, the countries' legal framework should be strengthened and be rule-based, aligned with international standards and norms, and address the overlapping provisions and gaps that hinder effective implementation. 2. Empower youth, women, and minorities as champions of change. To enhance climate adaptation in the Mediterranean, it is essential to include women, youth, and minorities, not only for the diversity of perspectives they bring but also for the tangible socio-economic benefits and contributions to peace and stability their involvement can foster. By focusing on inclusive and gender-sensitive policies, and equipping these groups with access to education, science, and technology, their potential to drive meaningful climate action can be unlocked. However, it is crucial to address systemic barriers, such as access to financing, so that their contributions can be sustainable and scalable. 3. Promote investments in climate adaptation through remittances. Leveraging the potential of remittances and diaspora investments is crucial to promote local entrepreneurial activities and climate adaptation schemes in the Mediterranean. To this end, the remittance flows should be made faster and safer by reducing transfer costs. Mediterranean governments and hosting countries should take the initiative to develop an effective mass payment system, including determining funding and technical assistance requirements. Beyond financial contributions, adaptation capacity could also be enhanced through the transfer of skills, knowledge, and in-kind remittances from the diaspora. Additionally, promoting financial inclusion and literacy among migrants would improve their capacity for investment, thereby contributing more effectively to local resilience. 4. Enhance climate-resilient agrifood systems and sustainable rural livelihoods to mitigate migration drivers and support development. Interventions should focus on developing climate-resilient agrifood systems and enhancing rural livelihoods through initiatives like supporting pastoralism, developing value-added crops, engaging local cooperatives and market chains, fostering skills and opportunities in rural areas for the youth, and promoting economic inclusion for refugees and IDPs in camp and settlement settings. Emphasizing the sustainable, inclusive, and equitable management of natural resources in peripheral territories and rural populations is vital to mitigate conflict risks over territory control. Adopting a systemic approach, which transcends specific project interventions to include collaboration with governments and investors, is crucial for fostering ecosystems that support resilient food production and comprehensive natural resource management. This strategy aligns with climate-resilient development goals, enhancing adaptive capacity and reducing mobility pressures by addressing the broader social and economic factors influencing migration decisions. 5. Promote an efficient justice system for equitable resource sharing and peaceful cohabitation. Effective justice systems across the Mediterranean should be strengthened, incorporating and aligning informal and customary justice with international human rights standards to ensure equitable resource sharing and peaceful cohabitation. Aligning these systems is essential to address social norms that limit rights, particularly in relation to indigenous people and women's land tenure rights. Legal education, access to justice, and digitalization of registration processes, along with the development of laws from a human rights-based perspective, can be effective ways to improve transparency and accountability. 6. Support the production of scientific evidence on the climate-security-mobility nexus to inform policymaking. Funding should be made available to promote research on the connections between climate, security, and mobility, focusing on contexts affected by multiple crises and on the indirect pathways underlying the nexus. Efforts should be made to enhance accessibility to scientific knowledge through communication and translation of research to relevant audiences, engage with policy institutions more effectively, and develop transdisciplinary research and knowledge co-production processes to engage potential endusers and to build on local and indigenous knowledge. 7. Increase investments and support for local actors to enhance the reach, effectiveness, and accountability of the humanitarian, development, and peacebuilding action. As the Mediterranean is a highly complex and diverse region, both climatologically as well as sociopolitically, more local engagements will allow for more customized and responsiveAccording to FAO (2022b), conflict continues to be a significant driver of acute food insecurity. In 2021, approximately 70 percent of the global population affected by food security crises lived in countries where conflict was the leading cause of food insecurity (FAO, 2022a). At the same time, as noted by the ICRC (2020), approximately 60 percent of the 20 countries that are most vulnerable to climate change are affected by armed conflicts (ICRC, 2020). Specifically, 142 million households and 527 million individuals residing in conflict-prone or fragile areas also urgently require climate adaptation interventions and financial support (Läderach et al., 2021). The compound effect of climate risks, fragility, and conflict erodes resilience, perpetuating a cycle of deepening food insecurity, poverty, hunger and further fragility and conflict. Breaking this vicious cycle is then crucial in the current accelerating climate crisis.The Southeastern Mediterranean region -which in this paper specifically refers to Northern Africa (Egypt, Libya, Tunisia, Algeria, Morocco) and Western Asia (Iraq, Syria, Lebanon, Israel, Palestine, Jordan) -is disproportionately impacted by climate change. The Mediterranean Sea is warming at a projected rate that will exceed global averages of 20 percent on an annual basis (MedECC, 2020). At the same time, erratic rainfall patterns, increasing temperatures, and climate extremes are increasingly contributing to water scarcity, droughts, and floods (Price, 2019). These climatic conditions concur with socio-economic and political factors, influencing adaptive pathways and mobility choices. While climate change is not the sole driver of migration, it has been shown to significantly amplify existing socio-economic challenges that play an important role in shaping migration decisions (Desai, et al., 2021;IPCC, 2022). Likewise, climate change has also been linked, via intermediate and mediating factors, to increases in conflict onsets and structural violence, which can be contributing factors to migration (Scartozzi, 2020). Overall, the feedback loop created by the interactions of the climatesecurity-mobility nexus can have compounding and destabilizing effects, making populations more vulnerable and likely to migrate in search of stability and safety.Promoting peace-positive climate adaptation and sustainable development is essential in mitigating the adverse effects of the climate-security-mobility nexus. By addressing the root causes of vulnerability, such as poverty, lack of access to resources, and governance challenges, communities can better withstand and coordinate to climate-related shocks and slow onset events. However, more needs to be done, especially on financing adaptation (UNEP, 2023a). Despite the urgent need, fragile and conflict-affected regions receive minimal climate finance-only 2.1 USD per capita, compared to 162 USD in peaceful countries (UNDP, 2021). There's a critical need to prioritize support for these vulnerable areas.This white paper stems from a high-level stakeholder discussion aimed at establishing a common vision of the climate, migration, and security nexus in the Mediterranean region. Recognizing our collective responsibility, we aim to provide guidance and shape policies that effectively address the highlighted challenges in the region, ultimately leading to a sustainable and prosperous future for the Mediterranean region and its inhabitants.The Mediterranean is increasingly becoming a climate change hotspot, progressing at a rate above the global average, and where impacts pose direct and indirect risks to the region's population (Giorgi 2006;Lionello et al. 2014;IPCC, 2022). The mean annual surface temperature of the region is warming 20 percent faster than the global average (MedECC, 2020). Direct risks from climate change include extreme heat, wildfires, droughts, storms, sea level rise and ocean acidification. These impacts can interact with human-made changes, stemming from urbanization, pollution, and changes in land use, resulting in compound and cascading consequences for livelihood systems, water scarcity, and food provision (IPCC, 2022).Projections indicate further temperature rises, an increase in evapotranspiration, and a fall in precipitation levels, impacting water availability (IPCC, 2022;Lange, 2020). The IPCC Sixth Assessment Report projects that at the end of the century the annual mean warming on land, compared to the last 20 years of the 20th century, will be in the range of 0.9-5.6°C depending on the emission scenario (IPCC, 2022). It also projects a reduction in precipitation levels of 20 percent in parts of the basin by 2050 (Lange, 2020). The temperature increase heightens the risk of heatwaves and droughts (IPCC, 2022;Philip et al. 2023;UNEP, 2021), becoming a serious threat to the region where water demand is expected to double by 2050 (UNEP, 2021).Despite the projected overall decrease in precipitation levels, flash floods are still a threat because of more rapid water cycle and dry/urbanized soil, particularly in coastal areas on the basin's northern rim (IPCC, 2022;Lange, 2020). Moreover, sea level is reported to have risen at a rate of 1.4±0.2 mm yr-1 during the 20th century (IPCC, 2022), though it has risen at a greater rate in more recent years. Projections indicate that up to 130 percent more people will be exposed to sea level rise by 2100, which has occurred throughout the 20th century to the present day and is projected to continue (Vecchio et al., 2024;IPCC, 2022).When accounting for the compound effects of heat, drought and flood, Mauritania and the eastern sector of the Arabian Peninsula (Oman, Iraq, United Arab Emirates, Qatar, Kuwait) are the most exposed to severe risk of hazards under baseline conditions (Figure 1, a). By 2040, the compound effect of hazards will intensify dramatically over all countries within the MENA region, particularly those in West Africa and the Arabian Peninsula (Figure 1, b). Black dots represent current locations of known forcibly displaced persons (Craparo et al., 2024, in review).The effects of climate change are of particular concern in parts of the basin already strained by significant population growth and dependence on agriculture, such as the eastern Mediterranean and north Africa (Lange, 2020). In addition, the Mediterranean region is home to millions of forcibly displaced and stateless populations including refugees, asylum seekers, internally displaced persons and stateless people. Displaced populations in some countries, such as Iraq and Syria, are located in areas of high risk of flooding and potentially dangerous composite hazards in future (World Bank, n.d.). Moreover, the populations living in the eastern and southern rim of the basin, such as the Nile Delta in Egypt, are particularly vulnerable to the projected impacts of sea level rise (Kheir et al., 2019;Lange, 2020).Migration has long shaped the Mediterranean region, with countries often simultaneously representing points of origin, transit and destination. At mid-year 2020, the northern African subregion hosted an estimated 3.2 million international migrants, nearly 61 percent of whom were either from the same sub-region or other African sub-regions (UN DESA, 2020). An estimated 49 percent of all international migrants in the region were refugees and asylum seekers. Globally, an estimated 12.3 million international migrants -4.4 percent of the global migrant population -were from Northern Africa. Of these emigrants, 48 percent and 13 percent were hosted in Europe and Western Asia respectively (UN DESA, 2020). Western Asian Mediterranean countries are also characterized by intense mobility patterns. Jordan alone, for instance, hosts the world's second-highest number of refugees per capita. Some 730,000 refugees are registered with UNHCR, predominantly from Syria, with large groups from Iraq, Yemen, Palestine, Sudan, and Somalia (UNHCR, 2023d).The migratory journeys in the Mediterranean are often highly risky, as they may involve crossing remote terrains such as the Sahara Desert and/or residing, at least temporarily, in politically fragile countries such as Libya where conditions of migrants are often dangerous. Crossing the Mediterranean is also associated with severe risks and life-threatening dangers, as the Mediterranean Sea witnesses a rising number of migrant fatalities. In particular, the Central Mediterranean route -from North Africa to Italy and, to a lesser degree, Malta -is the deadliest known migration route in the world, with more than 17,000 deaths and disappearances recorded by the IOM Missing Migrants Project since 2014. This is due both to the length of the overseas journey, which can take days, as well as increasingly dangerous smuggling patterns and gaps in search-and-rescue capacity (IOM, 2023c).Broadly, the Mediterranean migration context can be characterized as consisting of three closely interrelated patterns: (a) mobility and displacement as a result of multiple, acute and protracted crises across the region, particularly in Iraq, Libya and Syria; (b) complex irregular migration flows, driven by economic and other factors, within and transiting through the region, particularly to and through North Africa and towards Europe, as well as towards Gulf countries; and (c) the movement of (regular and irregular) labor migrants both within and from far beyond the region, with Gulf countries acting as the principal magnet for migrant labor (IOM, 2023d). Common countries of origin include West African countries such as Nigeria, Côte d'Ivoire, Niger, or the Gambia, from which a mixed landscape of drivers appears to be contributing to out-migration. These include -but are not necessarily limited to -escalating tensions over resource sharing, religious or ethnic tensions and conflicts, a lack of livelihood opportunities and poverty, an emergent culture of migration (particularly amongst youth), extant social networks in potential destination countries, some of which are heightened/ amplified by the negative impacts of climate change (Crawley et al., 2016;Huddleston, Karacay, & Nikolova, 2014).The role of climate change in exacerbating mobility patterns is mostly indirect, due to its detrimental impacts on, for example, livelihoods, health, and security (Horwood, 2023). It is clear that in the areas from which most Mediterranean migrants originate -particularly in the Maghreb, West Africa, the Levant, and other sub-Saharan countries -the intersection of climate change, livelihoods and income generation opportunities, physical safety and the threat of violence, as well as individual and household aspirations continue to affect human mobility within and out of said regions. This is especially the case in contexts reliant on climate-sensitive economic sectors and activities, such as agriculture. Climate change is likely to further exacerbate a range of such drivers, particularly in how it may interact with and sometimes serve to further engender conditions of fragility.Security in the Mediterranean -deeply interconnected with migration dynamics -is multi-faceted both in the diversity of issues and threats that are arguably present within and tangential to the region, as well as in the multitude of (predominantly sub-regional and ad-hoc) security mechanisms and platforms that have emerged over the years. Historical fault lines and unresolved conflicts -such as the continued absence of a genuine Middle East Peace Process, the absence of a twostate solution between Israel and Palestine, and dissent between Algeria and Morocco on the Western Sahara -have been increasingly complemented by the geopolitical interests of newer players, such as Russia, China, Saudi Arabia, Iran, and the United Arab Emirates (UAE) (Pierini, 2020;Alexandrova-Arbatova, 2018;van der Putten, 2016;Scartozzi, 2022). Whilst there have been attempts to create and sustain a coherent regional Mediterranean security architecture -see, for instance, the 1995 Barcelona Process, the Barcelona +10 conference in 2005, the subsequent establishment of the Euro-Mediterranean Partnership (rebranded as the Union of the Mediterranean in 2008), and the 5+5 Defence Initiative -such efforts have tended to result in a rather fragmented and incoherent assortment of relations and networks (Cohen-Hadria, 2016).patterns is mostly indirect, due to its detrimental impacts on, for example, livelihoods, health, and security.\"Factors relating to conflict and fragility are also critical in understanding the emergence of available mechanisms that may influence the decision to engage in migration, as well as particular routes that can incentivize the selection of a destination area. In the context of the Mediterranean, this notably includes the collapse of the Libyan government since the overthrow of Muammar Gaddafi in 2011 and the disintegration of its governance and border security, which has created near-perfect conditions for the emergence of human smuggling networks (Hammond, 2015;Jeandezbog & Pallister-Wilkins, 2016). Yet, despite the instability in Libya opening up the opportunity to attempt crossings, it has crucially not diminished the risks faced by those undertaking such efforts, as the elevated number of fatalities in the Mediterranean Sea document. In addition, some -such as Mezzadra and Stierl (2019) have accused the European-funded Libyan coastguards of engaging in forms of mass abduction, as migrant boats setting off from the coast are forcibly returned and those on board to detention centers, where they are often detained in abject conditions and exposed to human rights violations (Adesina, 2021).As such, in order to properly understand how actors seek to engage with, manage, and cooperate on security issues -particularly concerning climate security, natural resource management and territory governance, it is critical to comprehend the practical functioning of the existing array of security mechanisms. This involves delving into the underlying climate-security mechanisms and discerning how they give rise to what can be considered pragmatic and at times intricate diplomatic responses.The climate-security-mobility nexus refers to the trans-spatial interplay between climate change, human mobility (including migration and displacement), and conflict dynamics, which manifests itself through a complex web of pathways.In the Mediterranean, one of the main pathways through which climate impacts conflict and mobility relates to (climate change-induced) natural resource scarcity. Resource scarcity resulting from the impacts of climate change is particularly pronounced in the North Africa and Middle East region, especially with regards to the availability of and access to water. The region's major river basins (Nile, Jordan, Tigris, Euphrates) are expected to experience a significant surge in water demand, partially driven by demographic growth, industrialization, and urban expansion. The consequences of climate change amplify these challenges by further exacerbating water scarcity, whilst the fact that approximately 60 percent of surface water resources are trans-boundary in nature makes the design and implementation of effective governance structures for managing resource allocation and enacting effective adaptation interventions even more challenging. This degree of water insecurity may spark tensions and conflicts at both the sub-national and inter-state level which may, in turn, further escalate migratory pressures within and towards the Mediterranean region (Sokou, 2022).Climate-related natural resource scarcity may also affect mobility dynamics through the impacts it may have on the viability of (rural) livelihoods. Inadequate access to water and food resources exacerbates poverty and can encourage individuals to migrate from rural areas to urban centers or even other countries. As noted elsewhere in the paper, the North African region serves as both a destination and transit point for migration, with population pressures from the Sahel region amplifying this trend.Migration in this context is driven by a confluence of factors, including environmental and climate change impacts, limited water resources, reduced agricultural productivity, and shifts in economic and demographic conditions (Schefferan, 2020).Moreover, historical precedents exist with regards to instances of migration related to water scarcity, such as the drought-driven rural exodus observed in Morocco during the period between 1980and 1990, and in Algeria and Tunisia in 1999(de Haas, 2007;García-Nieto et al., 2018). This, combined with the resource scarcity, can induce migration from rural to urban areas, exemplified by cities such as Cairo and Casablanca, driven by the increasing challenges of sustaining livelihoods in the countryside. These escalating urbanization patterns are intrinsically linked to the depopulation of rural regions (McLean & Ben Brahim, 2023;IOM 2022).Particularly in the MENA region and the Southeastern Mediterranean basin, it is important to highlight the Water-Energy-Food security (WEF) nexusparticularly evident in the context of a growing population and where demand for food, energy and water resources is consequentially increasing. Water management is, for instance, critical for regional food security as the agricultural sector is the biggest user of water in the region. Potential trade-offs and connections must also be considered regarding the energy sector. This is especially true when considering the energy requirements involved in practices such as desalinization of water for agriculture (IOM, 2023a). Particularly in the context of the region's rapid population growth and urbanization rates, demand for food and imported agricultural commodities (FAO, 2022c) is expected to continue to increase, whilst sustainable food production systems reliant on land-and sea-based ecosystems are also threatened by climate change. As highlighted by the WEF nexus, access to water, energy, and food is crucial for human well-being, poverty alleviation, and sustainable development. However, global food production and supply chains consume a high percentage, estimated to be around 30 percent, of the world's energy (FAO, 2014;IRENA & FAO, 2021). The rising demand for these resources intensifies potential trade-offs across various sectors, including water, energy, agriculture, fisheries, livestock, forestry, mining and transportation, leading to unpredictable consequences for both livelihoods and the environment.Water plays a pivotal role in the daily routines of households, with women from the MENA region often bearing a disproportionate burden in securing this essential resource for their families. Consequently, many of the challenges associated with water scarcity -including those related to mobility and conflicttend to disproportionately affect women. While mobility is an inherent part of daily existence for individuals globally, the availability of mobility is frequently marked by inequality based on factors such as gender, ethnicity, race, religion, age, and social class (Klepp & Fröhlich, 2020). For instance, reports from humanitarian aid agencies operating in MENA countries highlight the heightened vulnerability of women and girls to sexual assault and violence in conflict zones and refugee settlements, where access to water often necessitates walking long distances. Research further demonstrates how the departure of men due to out-migration can leave women dealing with escalating water scarcity while simultaneously caring for children in conflict and war-torn areas. Paradoxically, this situation sometimes results in women assuming greater decision-making authority within households and communities (IOM, 2023a). Women and girls face unique human security challenges, especially considering that they make up 80 percent of the population displaced by extreme weather events globally (CGIAR, 2022).The climate-security pathways in the Mediterranean also relate to how disaster-related risks and impacts may cause displacement and directly or indirectly contribute to insecurity and tensions. The ability of a state to mitigate suffering and deliver emergency assistance in destination regions emerges as a crucial element in averting the escalation of social conflicts triggered by natural and human made disasters into full-blown violent conflicts. Typically, displacement due to disasters is internal, of short duration, and directed towards regions where humanitarian aid is accessible or where pre-existing migrant social networks are established. As highlighted earlier, certain population groups are most affected, particularly women and girls. In case of natural disasters and displacement, they may encounter disparities in obtaining emergency assistance. In extreme cases, the breakdown of social networks can occur and exacerbate preexisting vulnerabilities while also engendering new ones, thereby amplifying poverty and socioeconomic disparities (CGIAR, 2022).A significant example of how disasters-related impacts affect countries already characterized by weak governance in the context of the Mediterranean Region is the one of Libya, a country where social and political tensions merge with the visible effects of climate change. It is widely recognized that political instability and fragility in Libya exacerbated the impacts of Storm Daniel, which devastated northeastern Libya, and as a result of which an estimated 44,862 individuals remain displaced as of October 2023 (IOM, 2023b). With governance challenges and a fractured political landscape, governing authorities struggled to coordinate effective disaster response and failed to invest in longerterm infrastructure maintenance (Baseman & Said, 2023). The civil conflict has more broadly left Libya more vulnerable to climate change, particularly exemplified by the Derna dam collapse linked to infrastructure damage from a siege. Indeed, Derna experienced significant conflict, including a twoyear siege in 2017-2019, as part of General Haftar's campaign to eliminate Islamist groups in Libya. Post-conflict development efforts, however, were limited (England, 2023). Sustainable peace is urgently needed to prepare for future disasters and heal a decade of turmoil, requiring a political settlement to restore effective governance. Without a comprehensive solution, the humanitarian crisis in Derna may fuel further instability and the risk of renewed violence (England, 2023). Furthermore, although disaster-related displacement is rarely cross-border in nature, a failure to deliver sustainable and durable solutions for internally displaced communities and facilitate recovery and reconstruction efforts may similarly serve to further exacerbate existing fragility.Finally, compounding climate-and conflict-related risks may cause individuals and communities to be significantly constrained with regards to their ability to engage in migration or in their choice of migration routes. Enhancing adaptive capacity serves to mitigate the risks linked to involuntary migration and immobility, ultimately affording individuals greater agency in their migration choices. Policy interventions, in turn, have the potential to eliminate obstacles and broaden the range of secure, organized, and regular migration options, thereby empowering vulnerable populations to adapt to the challenges posed by climate change (IPCC, 2023). Conversely, individuals or households that lack social networks, or financial capacity, or that face significant security risks whilst on the move may become 'trapped', thereby being forced to remain in what are often climate vulnerable areas. Populations residing in these contexts are potentially more likely to become associated with armed groups or be drawn into specific conflict dynamics (CGIAR, 2023). Like mobility, immobility in the context of climate change is understood to exist on a spectrum, ranging from voluntary to involuntary (Thornton et. al, 2023). The former implies immobility by choice, while the latter denotes forced immobility. Individual decisions and outcomes related to immobility may be influenced by varying levels of vulnerability and resilience.The accelerating impacts of climate change, and the need to mitigate these impacts in the future, bring urgency to scaling up action on adaptation and security. Action must prioritize climate resilience, sustainable development, and peacebuilding to secure the region's future. Achieving this requires ambitious and coordinated efforts, informed by scientific research and driven by a shared vision. As the Mediterranean confronts the daunting consequences of climate change, the effectiveness of implemented transformative measures will shape the fate of its people and determine their level of security and stability. Below are key action points discussed at the event highlighting critical elements in this endeavor.Governments must recognize the critical links between climate, mobility, and security as a pressing political issue and act to integrate these considerations into legislation and policy. Achieving climate security requires a 'whole of government' and 'whole of society' approach, acknowledging the interconnectedness of climate change, human (im)mobility, and conflict. Policy frameworks should aim for holistic and integrated objectives across various domains, including climate resilience, peace, and social cohesion. This may be challenging in the context of regions such as the Sahel and the Mediterranean, where key actors -such as relevant ministerial staff -can at times lack the necessary knowledge and tools for climate-sensitive actions amidst complex risk landscapes. Moreover, integrating policies in line with the Global Compact for Migration (GCM), which identifies environmental degradation and disasters as key drivers of mobility and calls for mitigating actions, is essential for a comprehensive strategy (IOM, 2018).By integrating environmental, demographic, migration, and cohesion policies, particularly at the local level as highlighted in an IOM (2023f) study from Italy's mountain regions, we can harness the positive impacts of migrants on climate strategies. Moving towards a multisectoral approach that includes migration, trade, agriculture, and economic considerations encourages a shift from isolated policy development. This method promotes inclusivity and leverages insights from those directly affected by climate change. It also underscores the importance of international cooperation and regional collaboration, which are vital in enhancing awareness, addressing climate risks, and tackling challenges like food insecurity, climate change, and biodiversity loss more effectively.Addressing the climate-security nexus necessitates that climate policy instruments adapt to multi-level governance structures, where decision-making is polycentric and spans various governance levels (national, sub-national, local). This approach involves diverse government stakeholders in all policy stages-from agenda setting to evaluation-and promotes both vertical and horizontal coherence in achieving collective targets. A clearer focus on vertical coherence is crucial, especially in decentralized \"the climate-security nexus necessitates that climate policy instruments adapt to multi-level governance structures, where decision-making is polycentric and spans various governance levels\"countries where agriculture might be managed at a local level, while migration governance remains centralized, leading to mismatches in capacities and priorities.From this perspective, fostering the relationship between the state and society is crucial, particularly in fostering participatory and inclusive approaches. There is still a lack of dialogue and engagement between central state and local actors, including traditional and religious leaders, business associations, and women's groups. In these contexts, it is fundamental to invest in cultural awareness and preparedness to cope with a changing environment. Similarly, it is important to help relevant stakeholders to understand the impact of climate change from an onsite perspective.The legal framework of Mediterranean countries should also be strengthened and aligned with international human rights standards and norms, while also addressing gaps and overlaps that hinder effective implementation. Despite being those most affected by climate change and migration, young people continue to pave the way in developing solutions, contributing with a wealth of ideas and energy. As Ayisha Siddiqa, a member of the UN Secretary-General's Youth Advisory Group on Climate Change, states, \"young people aren't just a quota to fill\" (United Nations, 2023). Including young people as active stakeholders in climate action, both in civil and public society, is critical to a just transition.As climate change forges ahead, children and young people face increasing risks. Climate change's environmental and social consequences have particular impacts and experiences for young people, often differing from those of adults. Droughts and flooding places youth at particular risk of food insecurity and waterborne disease.Climate change does not only affect our ecosystems, but increasing evidence points to the link between climate change as an amplifier for migration, displacement and conflict. Young migrants often face different challenges and opportunities from their adult counterparts, such as being left behind, travelling unaccompanied, having different needs, and facing challenges concerning education and employment (UNICEF, 2023). As such, it is important that these differences and distinct impacts are accurately accounted for in climate adaptation policies and that young people's voices are amplified in the process.One way to manage the Mediterranean climate change challenges is to empower youth and minority communities. According to the UNDP's 2021 Peoples' Climate Vote, almost 70 per cent of young people identify climate change as a global emergency. Young people are also more likely to experience anxiety surrounding climate change and are more motivated to take action (UNICEF, 2022). Young people are agents of change, entrepreneurs and innovators. Whether through education, science or technology, young people can scale up their efforts and use their skills to accelerate climate action. Developing multi-disciplinary and action-oriented education programs at scale is crucial for empowering children and young people, enabling them to leverage their skills to navigate current and future challenges. This broad-based educational empowerment will also enhance youth participation in decision-making processes, ensuring policies are inclusive and effective for all. It is essential that these programs extend beyond project-based initiatives to reach wider groups, including youth and women, for greater impact.It is also essential to consider the needs of women and minorities in the MENA region, who are often disproportionately affected by climate change and migration challenges (IOM, 2024a). Vulnerabilities to climate change are reflected in the structural inequalities and marginalization rooted in our social structures, such as gender, age, ethnicity, and low income. Due to gender norms, women are overrepresented in the management of food and water systems, areas particularly affected by climate change. Globally, 70 per cent of households have women and girls as their primary water collectors ( UN Women, 2023). Additionally, women make up of 43 per cent of the agricultural sector (FAO, 2011), yet, they are often excluded from land ownership, owning only 20 per cent of land globally (The Wilson Center, 2022). The Mediterranean region is no exception to these trends. Securing women's land rights can thus be a powerful tool for climate adaptation, to limit gender vulnerabilities and strengthen women's ability to conserve and protect land. As water availability decrease, significant impacts will be seen in the Mediterranean agricultural sectors as crop yields are expected to decrease and 20 per cent of all exploited fish and invertebrates expected to disappear (MedECC, 2020). Due to women's leading role in the agricultural sector, these changes will have disproportionate gender impacts. This can already be seen through the lens of migration where 80 per cent of those displaced by climate change are female (UNDP, 2016; UN Women, 2023).Including women, girls and other minorities in climate adaption initiatives leads to improved outcomes and far-reaching benefits. Investing in women's empowerment and inclusion leads to greater success of climate adaption programs as women are more likely to participate, draw on social networks and successfully manage finance which leads to the success and longevity of gender sensitive climate projects (Bisung, 2011). Empowering women and other marginalized groups is a climate adaption tool. Climate adaptation needs to happen at all levels, both national, regional and global. The empowerment of women can aid in strengthening community-based initiatives and as such community climate adaption and resilience (UNEP, 2023). Empowerment fuels innovation and leads to greater community resilience. Moreover, women's inclusion in national decision-making processes may lead to lower carbon emissions (Mavisakalyan & Tarverdi, 2019) due to their varied impact and perceptions of climate change. Thus, gendered inclusion on all pollical levels will strengthen climate adaptability.Inclusive and gender sensitive climate adaptation policies are also key for sustaining peace. Climate change may exacerbate violence both on a household, community and national level. Using a gendered lens allows us to identify gender specific vulnerabilities to climate change, such as increased cases of gender-based violence (The World Bank, 2022;Nunbogu & Elliott, 2022). Due to the close link between climate change and conflict, climate adaption has the potential to both sustain peace (Morales-Muñoz, 2022) as well as exacerbate conflict (Tänzler et al., 2010;Scartozzi, 2020;Läderach et al., 2021). Natureoriented projects may increase underlying power structures, either through working in patriarchal structures or re-enforcing existing societal inequalities to resource access. However, including conflictsensitive measures in nature-oriented projects may increase the chances of a more successful contribution to peace (Läderach et al., 2021).As the Mediterranean adapts to the climatic changes ahead, inclusivity and diversity should be a key issue for all stakeholders involved. Understanding and recognizing the multifaceted web of intersectional disparities that lingers in all walks of life will be essential to ensure that climate adaptation is successful and long lasting. This can only be done alongside the empowerment and inclusion of marginalized groups. Investment in women and young people's empowerment is key to ensure the inclusion of these groups in all sectors. As climate change will have multifaceted impacts on all sectors, without adequate representation, climate adaptation risks exacerbating already existing inequalities and conflicts. Instead, inclusive innovation and decision-making leads to inclusive outcomes, benefiting everyone, including the planet.The nexus between migration and climate change has been explored in previous studies (Desai, et al., 2021;IPCC, 2022)., but the contribution of migrants to climate adaptation and resilience through remittances and investment is still quite underestimated. The International Day of Remittances highlights the significant support and contribution that migrants provide for the sustainable development of their countries of origin. Only in 2022, migrants have sent $647 billion to their low and middle-income countries, with over $100 billion going to Africa alone (IFAD, 2023). This is done with small transactions of US$200 on average, 10 to 12 times a year. In these countries, the combined value of Official Development Assistance (ODA) and foreign direct investment is substantially less than the funds sent by migrants to their households. Remittances are of considerable economic importance also for the Mediterranean. A study on the remittance flows from Europe to eight Mediterranean countries 1 indicates that remittances through formal channels can vary between 2 and 20 percent of GDP of the origin country (FEMIN, 2006). Still, the channels of transmissions in the Mediterranean predominantly go through the informal sector, with the notable exception of the German-Turkish corridor (FEMIN, 2006).Migrants and diaspora communities should be seen as active actors for the development of origin and host countries, and their significant contribution to rural development, climate adaptation and resilience through remittances and investments should be recognized and promoted. Remittances allow families to fight poverty, put food on the table, pay medical and education expenses and improve their housing, water and sanitation. It is also estimated that recipients manage to either save or invest 25 per cent of the money they receive. One-quarter of these savings (US$25 billion annually) goes into agriculture-related investments (IFAD, 2023).From this perspective, it would be important to establish partnerships between governments, international organizations, relevant stakeholders and diaspora communities, as IOM has done with the iDiaspora platform, to leverage the potential of remittances and diaspora investments as critical sources of socioeconomic development, climate adaptation and resilience in low and middle-income countries (iDiaspora, 2023). In the Mediterranean, for example, the pooling of resources domestically through local associations should be envisaged. The purpose would be to finance local infrastructure projects, as well as local entrepreneurial activities and productive investments. Larger cooperative pooling schemes could also be devised, whereby the NGOs (i.e. diaspora organizations) in host and recipient countries could help pool resources and work with banks and multilateral organizations to finance projects and develop financial services to the remittance industry. The Mediterranean governments could also help sponsor the transfer of knowledge and know-how of migrants and help establish and recognize diaspora organizations to stimulate business development. The development of a think tank to deal with remittance issues should also be considered (FEMIN, 2006). Also, while the cost of sending remittances has been significantly reduced, there is still the need to make the remittances flow faster, and safer while reducing transfer fees. In Africa, the average transfer fee to send $200 was 8.85 per cent in 2022, making the continent the most expensive region in the world to send money to. Africa remains far from the 3 per cent target set in the SDGs to be achieved by 2030. Sending money within Africa is even more expensive at 11 per cent transfer fee on average (IFAD, 2023). Also in the Mediterranean, a number of market imperfections and information deficiencies are encountered, including lack of transparency on transfer costs, inadequate payment systems and limited usage of bank accounts, that result in high transaction costs (FEMIN, 2006). Payment systems in Mediterranean countries need to be improved and links with hosting countries need to be strengthened in order to reduce transaction costs and provide better services. The Mediterranean governments and hosting countries should take the initiative to develop an effective mass payment system, including determining funding and technical assistance requirements. The banking system is an effective way for channeling remittances into productive investments. Banking services specifically targeted at migrants, including mortgage products, remittance-tailored bank accounts, and investment funds, should be encouraged to attract remittance funds through the banking sector (FEMIN, 2006).Financial inclusion and literacy among migrants need to be promoted to enhance their capacity for investment and sustainable development in their home countries. Despite an overall improvement in financial inclusion in Africa, driven largely by the growing ownership of mobile money accounts, South Sudan, Egypt and Sierra Leone are still below the 30 percent, presenting the lowest levels of financial inclusion in the continent (IFAD, 2023). Migrants may not be aware of the climate finance tools and terminology, despite being already important contributors of climate adaptation through investments in climate-smart agriculture and other climate-related activities. Migrants should be provided with the necessary tools and accompaniment to invest back home. Financial instruments should be designed and tailored to the specific resources and preferences of migrants, enabling them to invest in climaterelated activities and rural development in their home countries. Financial mechanisms such as equity,programming platforms, and investment funds can facilitate migrant investment in rural agriculture and businesses.4. Enhance climate-resilient agrifood systems and sustainable rural livelihoods to mitigate migration drivers and support development.People whose livelihoods directly depend on ecosystem services, such as farmers, pastoralists, fishermen, and forest dependent people, are identified as particularly vulnerable to climate change impacts (Mogomotosi et al., 2020;Otto, 2017). Climate change impacts are having real and tangible impacts on agricultural and pastoral livelihoods, leading farmers to change their agricultural practices, sell their land and livestock, or abandon agriculture as a livelihood altogether (AWC & WFP, 2022). The loss of agricultural livelihoods represents a significant factor in the context of migration movements towards Europe, exacerbated by inadequate investment in rural development (FAO, 2017). Additionally, policies promoting the sedentarization of pastoralists and restricting their movement, particularly in the MENA region, critically impact these communities' ability to adapt to climate change. Recognizing and addressing this sensitive issue is crucial for developing informed and effective solutions that meet the specific challenges and needs of pastoral communities.As resource scarcity, climate change impacts, and insecurity compound in many places, migration processes can challenge the resilience of host communities. Hosting states for refugees and displaced people are often located in countries struggling with poverty or resources insecurity themselves, which highlights the importance of supporting transit and destination, and addressing the multiple challenges they face. CGIAR research in Jordan has shown that in refugee host communities Jordan, a country that hosted more than 730,000 refugees in 2022 (UNHCR, 2023d), finding work on the agricultural labor market represents an adaptation strategy for farmers who have lost farming or animal production businesses. However, the labor market, especially in sectors like agrifood essential for green transitions, is increasingly reliant on migrant labor. This necessitates a focus on promoting social cohesion and strengthening efforts for the social and economic integration of migrants, refugees, IDPs, and host communities to ensure mutual benefits and harmony.Climatic factors, such as droughts, might contribute to migration and potentially heighten grievances and conflicts, particularly among pastoralists and sedentary farmers. This suggests a complex interplay between environmental stressors and social dynamics, underlining the importance of participatory resource management and conflict resolution strategies. Inadequate management of natural resources and policies toward peripheral territories and rural populations may also exacerbate existing challenges and provide fertile ground for the emergence of conflicts over the control of the territory by armed groups and insurgent groups. Moreover, the high vulnerability of rural communities can also create fertile ground for recruitment into non-state armed groups as a maladaptive strategy for survival. In this way, insurgent groups can capitalize on the impacts of climate change on local livelihoods and food security for recruiting the local population to join their ranks (Caus & O-Neil, 2021;NUPI & SIPRI, 2023).Investments in rural development and attention to interventions that support livelihoods can help diversify adaptive and migratory choices, and improve food security. Building resilient and inclusive agrifood systems in rural areas will require the development and testing of replicable models and solutions, providing farmers with the knowledge, information, and access to climate-smart farming and technology solutions, and helping farmers access funding to implement such solutions. While many successful climate-smart farming solutions exist, including eco-solutions to small-scale farming systems (Lamonaca et al., 2022), rangeland rehabilitation and water harvesting in drought affected areas (Strohmeier et al., 2021), as well as smart farming solutions based on technology advances including sensors, remote sensing, and the Internet of Things (Adamides, 2020), facilitating a largescale uptake of these solutions in origin countries of migration movements remains a challenge.Enhancing agrifood value chains and helping local farmers produce more climate-resilient crops to achieve can generate more resilient agricultural livelihoods. Other important strategies include engaging with local cooperatives and market chains, emphasizing skills development and opportunities for the youth population, and promoting the economic inclusion of refugees in camp settings. Skills mobility partnerships (SMPs), for example, can help local populations build the skills needed to boost new food production technologies, for example in modern food production systems based on hydroponic, aquaponic, and aeroponic growing. Such skill transfer programs can help make migration a choice, as migrants can help remove labor force shortages in innovative food production sectors. Moreover, they can provide the capacities young people need to engage in food sector entrepreneurship in their countries of origin, thus potentially making migration unnecessary by providing more resilient and climate smart agricultural livelihoods in place (IOM, n.d.).A point often highlighted is the need for inclusivity in forming more sustainable and climate resilient livelihoods (CGIAR, 2023). Many studies highlight the advantages of including vulnerable individuals themselves -including pastoralists, internally displaced persons (IDPs), refugees, migrants, women, children and others -when designing and implementing projects and programs, not only as beneficiaries but as parties with decision-making and leadership roles (CARE, 2018;Mercy Corps, 2019;World Vision, 2020;ICVA, 2022). On this regard, the Alliance of Bioversity and CIAT (2017) has been involved in developing and testing in several countries the so-called Climate Smart Villages, which build on local-level discussions, active participation of local population and awareness about the link between climate change and security to enhance localized strategies of climate resilience.Bottom-up approaches to operationalizing the HDP nexus such as the one of the Climate Smart Villages Projects, which may include projects or investments that help build sustainable agricultural livelihoods, are likely to yield more responsive, effective, and targeted resilience and peacebuilding interventions, as affected population groups can be involved in problem-solving, decision-making, and the priority-A climate-smart village is a community or a collection of communities that brings together interested groups from various sectors, including members of the community themselves, the public sector, agricultural research institutes, and non-governmental organizations, to understand how and what makes climate-smart agriculture work. The purpose is to spread the adoption of climate-smart practices. When we talk about climate-smart agriculture, we're talking about three objectives: to sustainably increase food production, and that covers improving nutrition; to enable farmers to adapt to climate change; and to reduce greenhouse gas emissions. Practices vary from one village to another. Families in one climate-smart village may decide to plant crop varieties that are resilient to drought and resistant to pests, while households in another may opt to produce and use organic fertilizers on their farms in order to cut greenhouse gas emissions. The idea is that they decide what works best for them... We generate evidence that shows when, where, and how climate-smart agriculture practices work\". On the basis of this evidence, key partners and funding institutions can be convinced of where upscaling the climatesmart village approach makes sense (Alliance of Bioversity and CIAT, 2017) setting of measures. As such, understanding local, place-specific preferences and needs is a critical precursor to the effective design and implementation of a given program or intervention, as well as its sustainability.5. Promote an efficient justice system for equitable resource sharing and peaceful cohabitationThe interconnectedness of climate, security and migration is evident in particularly fragile contexts and communities. In such contexts, the application of an efficient customary justice system could make a difference. Two relevant examples in Africa are the communities around the Lake Chad and the displaced population in Burkina Faso. In the first example, the reduction in the lake's surface, droughts, sandstorms, and the impact on agricultural activities have influenced the vulnerability of those communities, exposing them to exploitation by Boko Haram. In the second example, the displaced people face difficulties in sustaining themselves and lack basic resources such as water. The exploitation of the situation by adversarial individuals and the burden on small communities become major problems in the area.In Africa and the Mediterranean, justice systems, including customary and informal mechanisms, are pivotal in preventing and resolving conflicts related to natural resource management, land rights, and property issues. These systems can offer tailored solutions for vulnerable groups like women, youth, and indigenous people, ensuring their access and ownership rights are protected. Moreover, enhancing access to justice, improving transparency, and digitizing registration processes can bolster the implementation of laws that safeguard women's rights and land tenure. To develop such systems effectively, actions must encompass multiple areas, focusing on integrating customary solutions that specifically address the unique challenges faced by these groups in securing land access and ownership.As part of climate action, it is fundamental to foster the emergence of dialogue spaces that allow affected populations to question and challenge laws and institutional structures that sustain underlying sources of vulnerability and conflict. Programs ought to incorporate reflexive dialogue approaches throughout the whole project management cycle, accounting for appraisal, design, implementation and evaluation. Actions prioritized through participatory appraisals conducted with community members themselves will need to integrate development models that challenge structural and intersectional sources of vulnerability and instability, as perceived by local populations, such as inequality, political exclusion, gender-based violence, and resource entitlements.In the Mediterranean, recognizing and facilitating the role of customary institutions in natural resource management and conflict resolution is critical. Many effective forms of collective action build upon customary institutions. Efforts towards strengthening collective action for natural resource management and the resolution of resource-based conflict need to assess the complementarity between customary and statutory mechanisms, while acknowledging and addressing weaknesses in both (see: IOM, 2024b). The legitimization of legal pluralism through hybrid governance arrangements can support institutions and communities also in navigating the complexities of postcolonial contexts.It is also important to ensure the support of formal policy processes and the willingness of government actors to advocate for required reforms. Embedding sustainable peacebuilding strategies in climate action requires addressing legal structures -like resource entitlements-and embedded economic practices -such as informality of land leasing -that act as structural drivers of vulnerability. However, these lie frequently beyond the scope of action adopted by resilience building interventions. For this reason, subnational governments need to play a more active role during the assessment phases of programme design, and actively participate throughout implementation so as to advocate for reforms that support conflict transformation and systemic resilience. It is also necessary to empower local constituencies, women, indigenous people, civil society organizations through legal education. This involves offering legal training to enhance their understanding of their rights and the essential legal mechanisms available for reporting rights violations and seeking redress and remedies.Finally, there is a need to support the rights of marginal groups to access justice. Both community-and government-led institutions for resource allocation and management commonly evidence the exclusion of marginalized groups, among others, on the basis of gender, ethnicity, cultural norms, and social class. The limited capability of marginalized groups to access multiple spaces for resource management and conflict resolution restrains their adaptive capacity and fuels grievances within and across communities. Resilience programmes looking to foster a sustainable peace hence need to identify existing spaces for the resolution of disputes, recognize their exclusive nature, invest in legal literacy for the protection of rights, and build capacities for the deployment of equitable and inclusive institutions.Research is a fundamental pillar in informing policy and decision makers to develop and implement solutions that equitably and effectively respond to climate change challenges. Nevertheless, translating science into actionable policy is a challenging process, both due to divergences between scientific knowledge production and policy cycles, as well as to the complexity of how the effects of climate change are embedded in non-linear, multi-actor, dynamic socio-ecological systems (Carneiro et al., 2022). As such, efforts in improving the interface between science and policy, must include enhancing accessibility to scientific knowledge through communication and translation of research to relevant audiences, engaging with policy institutions more effectively, and developing transdisciplinary research and knowledge co-production processes to engage potential end-users (Clark et al, 2016). Key government actors designing policies and devising strategic priorities must have ready access to real and almost real time multivariate datasets and tools capturing intersectional and compounding vulnerabilities, accurate climate projections and modelling, and appropriate assessment tools and frameworks capable of reflecting context-specific manifestations of the climate, peace, and security nexus. From that perspective, leveraging scientific knowledge to enable a deep understanding of the climate-security-mobility nexus can guide policy makers towards the right political decisions. Still, divergent viewpoints about the interlinkages between climate change, migration, and security persist within the scientific community, which can become further convoluted due to often inconsistent media coverage of climate change. As such, a significant component of the science-policy interface is a deep understanding of the discourses and framings of policy actors, to identify potential evidence gaps and enable effective knowledge exchanges.To provide robust evidence to policymakers, research on the connections between climate, security, and mobility should focus particularly on contexts of multiple crises. This requires comprehensive and integrated approaches that recognize the complexity of poly-crises contexts, shed light on the indirect pathways underlying the climate-migration-conflict nexus, and build on local and indigenous knowledge. Furthermore, co-creation processes that draw on firsthand experiences are essential to complement theoretical approaches, as they provide a more tangible and nuanced understanding of the challenges faced on the ground. Such comprehensive scientific approaches should be reflected in interlinked and complementary strategies and actions at the policy level. Within the Agenda 2030 framework, it is important to pursue all 17 Sustainable Development Goals (SDGs) as interconnected and necessary for achieving a sustainable society. Actions taken in one area, such as mitigating or adapting to global warming, must consider the impact on other dimensions, such as food production, land degradation, biodiversity, and human health. No single goal, taken alone, is sufficient to achieve climate security.Science should support policy makers in transforming climate adaptation strategies and aligning resilience objectives with peace-building objectives to create climate-resilient societies. Traditional climate adaptation approaches, which lack conflict sensitivity, have proven insufficient in reaching the most vulnerable populations. For this reason, it is necessary to develop decision support tools that inform policy and programming decisions from an integrated perspective, such as the CGIAR Climate Security Observatory (CSO) are needed (CGIAR, n.d.). The CSO is a platform that presents rigorous scientific evidence on how, where and for whom compound risks of climate insecurity are occurring and provides tailored solutions to improve climate resilience capacities while contributing to reducing fragility and insecurities.Collective local action is a requisite for accountability and leadership in local adaptation and risk management. Its importance is magnified further as financial and human resources are becoming increasingly stretched, seeking to respond to growing demand. To build climate resilience across the Mediterranean region, political local resources play a particularly vital role: they are key to managing human mobility, negotiating potentially contentious issues around property ownership, access to land and land use, and to ensure coherent priority setting and planning. Leadership is also required to counter institutional and public discrimination of vulnerable groups, including migrants and displaced people, by establishing rules and incentives for positive actions, as well as potential consequences for negative actions. This means sensitizing and collaborating with mid-level officials and municipal frontline staff in how to support marginalized populations, sometimes including through migrantspecific programmes (OECD, 2020). However, often it may require strengthening a sector or whole area rather than targeting specific population groups. Thus, taking a territorial approach based on political legitimacy may provide long-term solutions for development and climate security.In general, long planning horizons at the local level are necessary to support reforms on land ownership and access as well as public participation that can contribute to building climate resilience over the long-term. As political leadership may wax and wane, setting up public mechanisms for dialogue and policy development and connecting central states and local actors through transparent planning as well as funding instruments, can provide a more sustainable framework for linking climate change adaptation, management of human mobility and social inclusion. More direct support may need to be channeled to local authorities and community organizations for policy engagement too, and their efforts more closely connected to global policy discussions. Initiatives, such as the Euro-Mediterranean Regional and Local Assembly (ARLEM) are calling for greater inclusion in regional and global decisionmaking processes around climate action as well as unlocking climate funding for sub-national governments, fostering a more locally sensitive green transition and responses to climate impacts and their related security risks (ARLEM, 2022a). Furthermore, local evidence, experience and technologies need to contribute more directly to science on climate risks and resilience in the region. Scientific efforts, such as those of the Mediterranean Experts on Climate and environmental Change (MedECC), will benefit from more granular data and local perspectives (MedECC, 2020). As the Mediterranean is a highly complex and diverse region, both climatologically as well as socio-politically, more local assessments can contribute to better tailored approaches. Finally, the active participation of citizens in both evidence generation and decisionmaking, as well as the inclusion of the private sector in local planning, will be crucial for appropriate solutions to emerge.Climate finance is a key instrument to improve climate security and address many of the root causes of fragility in the Mediterranean. The United Nations Framework Convention on Climate Change (UNFCCC) has set an annual target of mobilizing $100 billion globally to assist developing countries in their climate action efforts. While quantifying financial flows to the Mediterranean region is complex due to the intricate and blended nature of climate finance, a study by the Union for the Mediterranean (UfM) revealed that the region received about 4.6 billion Euros in 2016 from public, private, bilateral, and multilateral sources (UfM, 2017). However, the distribution of these funds is highly imbalanced, with a significant proportion directed towards countries that are more stable and secure (Scartozzi, 2023). Moreover, while there are positive trends in bilateral finance, multilateral finance appears to be failing in reaching the most vulnerable populations (Scartozzi et al., 2023).Positive trends in bilateral finance are evident through several successful initiatives and investments. For example, the European Union aims to mobilize up to €300 billion in investments for sustainable and high-quality projects between 2021 and 2027 (European Commission, 2023a). The Global Gateway and the Great Green Wall Initiative have both demonstrated significant impacts in areas such as food security, water management, and sustainable agriculture, especially in Africa. The Africa-Europe Bioclimatic Collaboration (ABC 21) has also made strides in sustainable building and energy efficiency (European Commission, 2023b). Closer to the Mediterranean, the Italian Climate Fund has committed 4.2 billion Euros for projects in countries eligible for Official Development Assistance, exemplifying the effectiveness of bilateral commitments (IFAD, 2022).In contrast, multilateral climate finance has shown significant bottlenecks, particularly in reaching fragile and conflict-affected states (FCS). The complexities of multilateral funding mechanisms often involve stringent conditions and technical prerequisites, making it difficult for some countries to access resources. As a result, multilateral climate finance has proven to date to be less effective in mobilizing funds toward the Mediterranean region. Data reveals that multilateral financial mechanisms under the UNFCCC have so far been less successful in directing funds to the Mediterranean's Non-Annex I countries, mobilizing only around a billion dollars (Climate Funds Updates, 2023). This funding has largely gone to a few countries, with Egypt and Morocco receiving the lion's share at USD \"multilateral climate finance has shown significant bottlenecks, particularly in reaching fragile and conflict-affected states\"473 million and USD 293 million, respectively. Most telling is the per capita distribution of these funds. FCS countries like Libya and Syria received just USD 0.25 per person, in stark contrast to an average of USD 5.97 per person in other coastal Mediterranean countries that are not classified as FCS.The data form dedicated multilateral climate funds serve as an indicator for broader issues in the climate finance landscape. Firstly, FCS struggle to access climate finance due to a range of factors including institutional limitations and ongoing conflicts. Secondly, many countries lack the absorptive capacity to effectively utilize large-scale financing, often due to weak governance structures, lack of technical know-how, or inadequate infrastructure. These two core issues often intersect, making it doubly challenging for vulnerable nations to leverage climate finance for meaningful impact. At the same time, the under-mobilization of climate finance towards FCS in the Mediterranean not only highlights existing disparities but also signifies untapped potential for impactful investments. For instance, readiness activities aimed at building institutional capabilities can go a long way in helping these countries navigate the complexities of climate finance. Strengthening governance structures and enhancing technical expertise can, in turn, enable these nations to implement larger-scale projects effectively, thus elevating their ability to absorb and utilize available funding. Given the stark imbalances in per capita funding, there is also a clear opportunity for targeted climate investments. Such investments can be directed at initiatives that build resilience against both climate change and conflict, thereby achieving dual benefits. Effective deployment of climate finance in these areas could be a game-changer, offering a pathway to stability and sustainability in a region plagued by both environmental challenges and socio-political unrest.This white paper critically examines major issues and potential solutions concerning climate security and mobility in the Mediterranean. The discussion stems from a high-level debate occurred during the event \"Towards a Common Vision of the Climate, Migration and Security Nexus in the Mediterranean Region\", organized by the CGIAR Focus Climate Security and the Alliance of Bioversity & CIAT, and held in Rome in June 2023. This event has involved scientists, politicians, experts and representatives of relevant international organizations, and focused on the climate-security interplay in the region.The Mediterranean is particularly exposed to shifting climatic conditions, characterized by recurrent droughts, heat waves and other extreme events. This vulnerability extends to the impact on land, water, food security and economic development. Climate change could exacerbate potential socioeconomic insecurities and political instability, forcing people to migrate and potentially triggering tensions and conflicts in the most affected regional hotspots, due to agricultural shortages and the intricate food-land-water nexus.To foster the development, the stability and the climate resilience of the region, it is critical to implement effective strategies enhancing the region's adaptive capacity to climate risks. Through the dialogue among major experts in the field, key strategies have been identified to advance peace positive climate adaptation while managing mobility in the Mediterranean:1. Strengthen multi-level governance and the rule of law: Strengthening governance across climate, agriculture, and migration sectors in Mediterranean countries requires a comprehensive approach that recognizes their interconnectedness. Policies should aim for integrated objectives, enhancing coherence and enabling key actors to access necessary knowledge and align legal frameworks with international standards.2. Empower youth, women, minorities as change agents: For climate adaptation in the Mediterranean, the involvement of youth, women, and minorities brings diverse perspectives and socio-economic benefits. Policies should be inclusive and provide access to education and technology, while systemic barriers, especially in financing, need addressing for their contributions to be sustainable. "}
|
main/part_1/0348508643.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"56377af0852d24602281b9ba6aa034bf","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/b8b0bd5d-a4f1-427b-bcb5-0903ba2ddadd/retrieve","id":"-1993589127"},"keywords":["Frijol","Forrajes (trópico bajo)","Yuca Maiz","Trigo Papa","Camote","Raices y tubérculos Cereales","Forrajes","Garbanzo","Lenteja","Haba Árboles agroforestales Sorgo","Mijos","Gandul","Garbanzo","Cacahuete Guisante","vigna","Yuca","Caupí","Batata","otros Forrajes (trópico mediano-alto"],"sieverID":"ce28b5b3-514d-46aa-b9f6-a3190d7f8e0a","content":"Centros/Ubicación Cultivos Accesiones (No.) (Órgano Rector del Tratado Internacional sobre los Recursos Fitogenéticos para la Alimentación y la Agricultura) FUENTE; SINGER, 2010 COLECCIONES CONSERVADAS EN LOS CENTROS DEL CGIARBienvenidos todos !"}
|
main/part_1/0356205822.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"5714c7305734fdddc0c746981d35408b","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/f1b710cb-0607-4062-8c05-717f09d68623/retrieve","id":"280314531"},"keywords":[],"sieverID":"13b90dc5-bc99-4afc-89c7-4e1ae8c56e94","content":"Por qué un estudio de adopción de variedades y género?• En ocasiones las tasas de adopción no son las esperadas. -Importantes estudios de adopción que identifiquen las causas socioeconómicas.• Estudios han mostrado que género puede ser un determinante socioeconómico de la probabilidad de adopción de una variedad mejorada/moderna (Doss y Morris, 2001;FAO, 2011).-Hombres y mujeres tienen preferencias distintas.-Hombres y mujeres no acceden en la misma proporción a recursos claves (ej. crédito, servicios de extensión, insumos, educación, mano de obra, tierra etc.) o tienen menor educación, habilidad para tomar riesgos y/o menor acceso al mercado (FAO, 2011).Por qué un estudio en arroz en Ecuador?• Poca literatura sobre género y arroz en América Latinacerrar brechas de información.• CIAT con el apoyo de GRiSP, ha generado información sobre lo roles de las mujeres en la producción de arroz en Bolivia y Perú en donde se han encontrado aspectos como: La contribución de las mujeres es \"invisible\" en la producción de arroz. Los lotes de mujeres tienen menores rendimientos que el de hombres -Perú. Las mujeres parecieran participar en labores manuales como trasplante y control de maleza manual.• Ecuador es un país con bajos rendimientos, a pesar de contar con un sistema de investigación en variedades modernas (A través del INIAP).Identificar si género es determinante para la adopción de variedades modernas de arroz.Recomendaciones para que los procesos de diseño y diseminación de tecnologías agrícolas sean inclusivos a género.Contribuir a cerrar brechas de género: acceso a información y tecnología agrícola.• Encuesta a nivel de hogar con datos desagregados por sexo, implementada a 1.026 hogares en 4 provincias del Ecuador-Datos representativos.• Se realizó un muestreo estratificado con información proporcionada por INIAP -3 mujeres por comunidad.• Comparar productores que adoptan y que no adoptan tecnologías del arroz• La mayoría de los encuestados fueron hombres, por lo que la información es sobre lo que hacen hombres y mujeres, desde la perspectiva de los hombres (estándares mínimos para los datos desagregados por género).Participación femenina en toma de decisiones y en propiedad de activos productivos• En 7.7% de los casos, hay mujeres que se reconocen como productores principales.• Al preguntar por cada actividad agronómica, los casos en donde hay mujeres tomando decisiones es de 46.9%.• La contribución de las mujeres en la toma de decisiones, está relacionada a que sea dueña de un activo productivo (tierra y maquinaria).• La participación de las mujeres en mano de obra familiar y contratada, no supera 58 hogares.-estudios cualitativos demuestran cómo las mujeres pueden estar participando en \"actividades secundarias\" (ej. supervisión de mano de obra y maquinaria).• Son más los hogares en los que los hombres participan en algún grupo (51%), que los hogares en los que quienes participan son las mujeres (22%).• De las parcelas propias, el 81.4% pertenecen exclusivamente a hombres, el 7.9% son propiedad exclusiva de mujeres y el 10.7% tienen propiedad conjunta.• El 51.8% de los hogares presentaron solicitudes de crédito. Y del total de solicitudes (607), la mayoría fueron hechas por hombres (82.8%).• De los 437 hogares que recibieron servicios de información en la ultima campaña de referencia, en la mayoría fueron los hombres quienes la recibieron.n=437.Variable dependiente• Variedad moderna: liberada a partir del 2001.• Un productor decide utilizar variedades modernas, si espera obtener mejores beneficios (rendimiento, ingresos, etc) con estas variedades en comparación a sus variedades tradicionales (antiguas).• Buscamos identificar que factores favorecen o limitan la adopción.• La adopción se entiende como la decisión de un productor de utilizar o no una variedad moderna.• Se plantea un modelo de regresión donde tratamos de explicar la adopción o no de variedades modernas (Modelos binarios) por una serie de factores, entre ellos género.• Limitaciones y capacidades de los productores, además de factores socio-institucionales. Nivel educativo (+) Número de integrantes en edad de trabajar (+) Área sembrada -como indicador de riqueza (+) Acceso a crédito, servicios de extensión y grupo de productoresVariables explicativas usadas en el análisis ***La categoría base de esta variable dummy agrupa a las mujeres que toman decisiones sobre que variedad usar o no usar, ya sea de manera individual o en conjunto con un hombreQué significa?• Género muy importante en la decisión de adopción de variedades de arroz. Cuando mujer participa en esta decisión, mayor adopción.• Las mujeres están siendo claves para la adopción de variedades modernas el país.• La perspectiva de género en el diseño y diseminación, podría contribuir potencialmente a un sector más productivo (o los objetivos de las variedades) y a objetivos de género. Acceso a recursos productivos de manera equitativa. Empoderamiento de las mujeres (mayor toma de decision).• Para ello sería importantes resolver preguntas: El diseño de variedades modernas incluye la perspectiva de género? Las mujeres reciben información del cultivo en la misma proporción que los hombres? La diseminación de esta tecnología incluye a hombres y mujeres tomadores de decisiones dentro del hogar?Oportunidades para próximos pasos• Profundizar en el análisis sobre la contribución de las mujeres en la adopción de variedades modernas.• Metodologías de diseño de variedades modernas que integren las condiciones y preferencias de la población, con una perspectiva de género. -PVS.• Servicios de extensión e información dirigidos a los que toman decisiones, incluyendo a las mujeres."}
|
main/part_1/0363072903.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":null,"keywords":null,"sieverID":"b707aad9-ba35-42b2-bd01-94b306f5f6e7","content":"\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"}
|
main/part_1/0389132748.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"c1924c58a5404a7e082ef4b75de05368","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/984b0726-1a12-4837-a636-5edd029b160b/retrieve","id":"1031439926"},"keywords":["food analysis","food composition","food biomolecules","omics technology","mass spectrometry"],"sieverID":"de4ca96d-eb62-4252-9b80-af5c47348153","content":"Globally, we are failing to meet numerous nutritional, health, and environmental targets linked to food. Defining food composition in its full chemical and quantitative diversity is central to data-driven decision making for supporting nutrition and sustainable diets. \"Foodomics\"-the application of omics-technology to characterize and quantify biomolecules to improve wellbeing-has the potential to comprehensively elucidate what is in food, how this composition varies across the food system, and how diet composition as an ensemble of foods guides outcomes for nutrition, health, and sustainability. Here, we outline: (i) challenges of evaluating food composition; (ii) state-of-the-art omics technology and innovations for the analysis of food; and (iii) application of foodomics as a complementary data-driven approach to revolutionize nutrition and sustainable diets. Featuring efforts of the Periodic Table of Food Initiative, a participatory effort to create a globally shared foodomics platform, we conclude with recommendations to accelerate foodomics in ways that strengthen the capacity of scientists and benefit all people.Globally, we are failing to meet numerous nutritional, health, and environmental targets linked to food. Unacceptable levels of malnutrition in all its forms (undernutrition, micronutrient deficiency, and overweight and obesity) persist in every country, inequitably affecting the most vulnerable (1). Poor diets are responsible for one in five deaths globally, more than any other risk factor (2). While poor diets vary, they are crudely characterized by low intake of whole grains, fruits, nuts, and seeds, and vegetables and, in some contexts, as having excess intake of sugars (3), saturated fats, calories, and highly processed foods of non-nutritive substances (4,5). Dietary challenges have compounded with the homogenization of food supplies over the past eight decades (6)(7)(8).As a threat multiplier, malnutrition perpetuates ill-health and cycles of poverty. Poor diets are associated with reduced educational outcomes and labor productivity (2). Concurrently, unsustainable agricultural practices, food-based greenhouse gas emissions, market disruptions, food distribution, and waste, and a growing population are degrading the natural resource base that supports nutrition and food security (9)(10)(11). Overall, poor diets impede achieving multiple sustainable development goals (12).Food composition databases emerged in the 1900s as an essential public health tool to combat malnutrition. Tremendous progress on food composition evaluation has occurred since the 1895 publication of the United States Department of Agriculture (USDA) bulletin featuring Wilbur O. Atwater's data on food composition and nutritional needs (13). Numerous food composition database efforts, including those of the USDA's FoodData Central and the International Network of Food Data Systems (INFOODS) administered by the Food and Agriculture Organization (FAO) of the United Nations, have led efforts for multiple decades to advance guidelines, tools, and harmonization of data on food and nutrient profiles for the global community. As the science of human nutrition has evolved from consideration of foods simply as sources of energy and essential nutrients, to recognizing the role of dietary bioactive components to modulate metabolic processes and reduce disease risk (14) within the context of sustainable diets and food systems, food composition data also needs to continue to evolve. Phenol-Explorer (15), Carotenoids Database (16), PhytoHub (17), and FoodDB (18) have emerged to offer food composition data focused on dietary bioactive components.Foodomics, or the application of omics-technology to characterize and quantify biomolecules in food to explicitly improve wellbeing (19), has the potential to meet food composition needs with unprecedented knowledge (14,(20)(21)(22)(23). In a post-genome biology era, advances in analytical chemistry, omics technology (approaches that enable a global assessment of a set of molecules), and computational science provide an enabling environment to address technical challenges of evaluating food composition (21). Innovations in foodomics can complement existing approaches to drive a revolution where we can apply knowledge of food composition across food systems to advance nutrition, health, and environmental targets (Figure 1). This Perspective outlines: (i) challenges of evaluating food composition; (ii) state-of-the-art omics; and; (iii) application of foodomics. Featuring efforts of the Periodic Table of Food Initiative (PTFI), a participatory effort to create a globally shared foodomics platform, we conclude with recommendations to accelerate foodomics as a complement to other food and dietary approaches in ways that benefit people and the planet.Three key technical challenges limit the potential of evaluating food composition: (i) reproducibility and standardization; (ii) representation and quantification; and (iii) accessibility.Beyond the most commonly measured nutrients, there are limited globally accepted standardized methods to evaluate the multitude of bioactive molecules in food. Labs generally use different protocols for evaluating food biomolecules and focus on identifying and quantifying different sets of biomolecules. The lack of standardized pipelines for data processing results in variation in what biomolecules are identified and quantified. For example, the PTFI sent identical apple reference sample material to three high-profile laboratories and found (Figure 2). The lack of standardized analytical protocols, along with divergent sets of biomolecules measured, are limiting factors to compare data across studies that prevent the identification of global trends in food composition over time (24)(25)(26).The planet has abundant edible biodiversity, with some estimates of over 30,000 edible species (27). However, only the most commonly consumed foods are generally represented in food composition databases (approximately 300-400 single-ingredient foods in many food composition databases) due to resource constraints. The FAO/INFOODS Food Composition Database for Biodiversity was developed to broaden the representation of edible biodiversity reported below the species level (i.e., variety/cultivar/breed level) and wild foods in food composition databases (28). Given the impact of socio-ecological factors (i.e., cultivar, soil, climate, growing practices, season, elevation, geography, processing, storage, and cooking) on variability of the presence and quantity of food biomolecules (25), there is a need for food composition databases to provide metadata on these factors as well as update food composition data over time. The Foundation Foods data type of USDA FoodData Central has evolved to focus on the variability of raw foods in the US food supply with metadata associated with foods including genetics, environment, management, and processing (13).Comprehensive profiling of the broad diversity of food biomolecules is missing from food composition databases (29). Most highlight up to 150 biomolecules of the most well studied macro-and micronutrients in food, which represent less than 1% of the more than 26,000 distinct, definable biochemicals in the scientific literature (29). There are thousands of additional unknown compounds in food based on unidentified spectral data, which collectively with poorly studied identified compounds represent the dark matter of nutrition that may play a powerful role in health (29). A notable percentage of biomolecules in food composition databases are not quantified (29), which limits the utility of these data for informing health and nutrition. The specific concentration of biochemicals can be critical for preventing deleterious health impacts, or providing sensory benefits for consumers.Further, food composition databases need quantitative data on biomolecules both endogenous (produced through a species' metabolic and survival processes) and exogenous (natural and synthetic compounds derived from production, postharvest handling, processing, and packaging) to food species. While FIGURE 1 | Application of foodomics across the food system. Foodomics can be applied across the food system to enhance human and planetary health.endogenous food compounds often have the potential for healthpromoting effects (15,16), many exogenous food components can have adverse effects on human and environmental wellbeing. For example, multiple exogenous food components are associated with metabolic diseases, neurodevelopmental disorders, estrogenic activity, and carcinogenicity (17)(18)(19)(20).The complexity of food drives accessibility challenges of costly, time-consuming, and low-throughput extraction and analytical methods. Highly sensitive regulatory assays used to populate many national food composition databases are cost-prohibitive. As a result, many lower and middleincome countries maintain and utilize incomplete and/or outdated food composition databases, although some have championed efforts for food composition databases that represent a diversity of their local foods. Further, some national food composition tables are not open-access and/or are only available in the local language with ambiguous codes. With scientific data on more detailed food composition typically staying within peer reviewed journals, only a small fraction of food composition data informs databases. These limitations make it near impossible to use advanced datamining approaches to discover food compositional patterns and drivers. Additionally, data that are presented in databases are often not in a format for users beyond the research or clinical community.Foodomics is driving a knowledge revolution toward a comprehensive understanding of what is in our food, how this composition varies with production and processing factors, and application of detailed food composition knowledge to improve nutrition and health. Here, we highlight three key advances in omics technology enabling unprecedented food composition analysis and application: (i) high-throughput platforms for analysis of a broad range of food molecules; (ii) highresolution biochemical libraries; and (iii) data integration and machine learning.State-of-the-art foodomics is based on high-throughput omics platforms (including metabolomics, glycomics, lipidomics, ionomics, and proteomics) to comprehensively profile complex mixtures of biomolecules using mass spectrometry (MS) techniques, nuclear magnetic resonance, and bioinformatics tools (21). The analytical capability of MS, including high-resolution MS instrumentation such as quadrupole time-of-flight and orbitrap systems, coupled with separation instrumentation, enables characterization of the complex components in food at the biomolecule level. More recently, low-cost benchtop instrumentation and software to manage data from complex mixtures are FIGURE 2 | Variability of apple analytes across labs. The Periodic Table of Food Initiative sent identical apple reference sample material to three high-profile laboratories and found tremendous variation in the analytes identified and annotated between the labs. These findings highlight the lack of standardization in food composition analysis while calling for the need for standardized pipelines for analysis and data processing.allowing for reengineering and integration of MS methods into cost-effective high-throughput versions to profile food with high sensitivity.High-resolution MS for food composition analysis has led to robust chemical libraries to provide standard reference for identifying biomolecules based on their mass spectra with greater accuracy and confidence. The physical availability of compounds allows us to confirm the presence of a molecule in a sample, while spectral libraries are beginning to allow us to categorize unknown molecules based on chemical similarity, leading to more accurate annotation of unknowns. Emerging open-source high-resolution biochemical libraries offer comprehensive spectral libraries that increase the efficiency of identifying and quantifying thousands of food biomolecules.Advances in data science and informatics are enabling data integration across multiple omics platforms as well as opportunities for untargeted analysis of food components (21,23). Data integration opportunities are allowing us to make linkages between diverse datasets for addressing critical questions across the food system. Once we can comprehensively profile food using standardized means, we can identify agricultural and production drivers of food composition, while identifying health attributes of food biomolecules. We can further mine integrated datasets on dietary interventions to explore health attributes of food biomolecules and dietary patterns (30,31).Since the emergence of the concept in 2009, foodomics has been applied to create solutions to address global challenges (22,23). As a data-driven approach, foodomics can be applied in complement to other approaches across the food system for informing evidence-based programs, policies, and practices to improve human and planetary health (Figure 1).Foodomics can provide solutions for malnutrition through data on the beneficial and adverse effects of food biomolecules at the biochemical, molecular, and cellular levels (22,23). The creation of population and individualized diets was considered unapproachable just a few years ago because of the complexities of food, technical challenges, bioavailability and transformation of food biomolecules in the human digestive tract, and the numerous health targets in the human body (23). While still having accessibility challenges to benefit the global community, precision diets are being made possible by identifying foods and dietary patterns on the basis of individual genomes, lifestyles, food preferences, and food access (22).Data from foodomics can be applied to improve dietary quality by informing dietary guidelines, food procurement, food safety, food labels, product development, food authenticity and traceability, and agricultural guidelines. For example, application of foodomics has proven valuable for identifying dietary biomarkers (32) to elucidate dietary intake to complement traditional dietary assessment methods (33)(34)(35) for a more comprehensive understanding of food intake patterns. Governments can include foodomics as part of their food risk assessment (23). Food composition data with associated metadata can be applied to inform food supply and food procurement by enabling enterprises in the food environment to optimize for food composition, price, diversity, and sustainability attributes. Such data can be used to inform purchasing for national nutritional assistance programs.Foodomics can be applied to develop food products with biomolecules that support healthy and sustainable diets (36) without sacrificing desirable food properties. For example, peptidomic efforts led to the identification of an immunodominant peptide in gluten responsible for inflammation and subsequent symptoms for people with Celiac disease (37), which has enabled efforts to precisely and efficaciously tackle Celiac disease, ranging from engineering varieties of wheat (38) that lack these epitopes to new drugs and supplements that detoxify the epitope in real time within the stomach (39,40). Another example of the application of foodomics for product development is the recent discovery of a natural product to replace synthetic blue dye #1 with a unique anthocyanin discovered in red cabbage (41).Imagine a world where we can use half the land and water for growing nutrient-dense foods by optimizing production for multiple nutritional and environmental targets. Foodomics applied to agriculture can support sustainability through evidence on impacts and mechanisms of abiotic and biotic factors on crop metabolome and proteome toward informing farmand crop-improvement investments and policies. While health outcomes remain unknown, a meta-analysis demonstrated that organically produced crops and foods have statistically higher concentrations of antioxidant phytochemical concentrations compared to those produced in conventional systems (42). Additionally, foodomics can provide nuanced understanding of food composition in underutilized crops and next-generation crop varieties to support population health while considering multiple sustainability targets. Foodomics applied to the food industry can reduce barriers to enter regulated markets while driving a paradigm shift toward increased availability of affordable functional foods from sustainable agriculture as mainstream in a knowledge-based bioeconomy (43).Foodomics approaches can provide evidence for the conservation of biocultural diversity associated with Indigenous Peoples' Food Systems. Efforts led by, or in partnership with, Indigenous communities can apply foodomics to validate biochemical, sensory, and health attributes of Indigenous foods. For example, Lin et al. (44) demonstrated variation of microbiological and biochemical profiles during ripening of Laowo dry-cured ham, an Indigenous fermented food.There is much to be gained by deepening our knowledge of food composition. Foodomics provides data-driven opportunities to complement existing approaches such as those on dietary quality for advancing nutrition and sustainable diets. Highlighting efforts of PTFI, a participatory effort to create a globally shared foodomics platform, we outline three recommendations to move foodomics forward for people and the planet while addressing unintended consequences.Foodomics needs to draw from the globally coordinated approach of the Human Genome Project to advance the contribution of food for health. PTFI is developing standardized and democratized protocols to comprehensively evaluate what is in food. This data will be shared in an accessible database that is connected and integrated with existing food composition databases. The success of foodomics requires partnership across sectors and disciplines in ways that respond to evolving needs and opportunities.Given the complexity of the diet, we need to shift the paradigm away from a reductionist approach, focusing on a limited set of biomolecules. Rather, we need a sustainable food systems approach that evaluates a broad range of what is in food and recognizes the connections of food composition with the environment, socio-economics, equity, and health. PTFI is creating a data platform that brings together socio-ecological metadata associated with foods and health outcomes to understand the complex interactions and trends in food composition.For foodomics to realize benefits for societies globally, inclusive and co-creative processes are called for that build on existing knowledge and resources. Food and health outcomes data must be representative and generated by scientists in all countries, as well as shared in ways that are accessible and have meaning to all. PTFI strives to boost foodomics capacity in low-and middleincome countries through laboratory infrastructure development while offering continuing education modules for different users of food composition data.Given the reliance of foodomics on genetic resources, it is critical to co-create and operationalize clear access and benefit-sharing statements of genetic resources to protect Indigenous groups and other populations and prevent biopiracy. Foodomics efforts need to abide by the guiding philosophies for genetic resource acquisition set by the International Treaty on Plant Genetic Resources for Food and Agriculture, the Convention on Biodiversity, and the Nagoya Protocol. It is the highest hope that PTFI can act to protect the inherent value of underutilized crops and Indigenous resources from private interests that may seek to benefit unfairly from data.It is essential for foodomics to acknowledge the conservation status of species and not promote overharvesting. Multiple food species utilized by populations around the world are on the IUCN Red List. These foods may have been historically important to the culture, nutrition, and survival of a population and may continue to be part of cultural identity. Foodomics efforts should not include resources listed as endangered or vulnerable on the IUCN Red List, or listed under CITES. PTFI seeks to promote sustainable use of biodiversity and conservation of habitats that support culturally relevant foods and nutrition.Foodomics approaches must intentionally foster inclusion and justice in food and health systems. Researchers, practitioners, and policy makers need to identify and tackle the technical issues in the application of foodomics that impede equity and exacerbate disparities. The PTFI is developing a health equity framework to guide the application of foodomics in research, programming, practice, and policy.Foodomics is leading the way for a data-driven revolution for improving nutritional, health, and environmental targets linked to food. With foodomics data, we have the potential to more precisely define what comprises poor diets as well as healthy and sustainable diets at the biomolecule level. Foodomics is enabling robust determination of environment-diet-health associations. We are at a legacy moment for changing the history of food knowledge. However, without a globally coordinated approach, the potential of foodomics will be stalled. We call for global intersectoral collaboration through PTFI for long-term translational impacts for human and planetary health."}
|
main/part_1/0407348078.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"7a2492848bfaff4321d9c9b26b035870","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/74686bfa-8bf7-42dc-a888-79ed55051ea8/retrieve","id":"1968562077"},"keywords":["Agroécologie transformationnelle à travers les systèmes alimentaires","terrestres et aquatiques Fiche d'information et budgett Nom de l'initiative L'agroécologie transformationnelle dans les systèmes alimentaires","terrestres et hydriques Nom abrégé de l'initiative Domaine d'action Transformation des systèmes"],"sieverID":"a9bd9471-6c35-4ce3-a5d1-b4fb08c0a6a7","content":"Mentions légales: Cette publication a été préparée dans le cadre de l'Initiative sur l'agroécologie. Les points de vue et opinions exprimés dans cette publication sont ceux des auteurs et ne sont pas forcément représentatifs ou approuvés par le CGIAR.Section 1: Fiche d'information et budget Le rapport technique du CGIAR a été élaboré conformément à l'accord sur les rapports techniques du CGIAR. Ce rapport d'initiative (rapport de type 1) fait partie intégrante du rapport technique général du CGIAR. Chaque initiative du CGIAR soumet un rapport annuel de type 1 qui fournit une attestation des progrès réalisés au niveau de l'initiative en vue de la réalisation de ses objectifs.Le rapport technique du CGIAR comprend:• Les rapports de type 1 sur les initiatives, les plateformes d'impact et les projets des groupes scientifiques (PGS), avec les résultats de qualité garantie rapportés par les initiatives, les plateformes et les PGS, qui sont disponibles sur le tableau de bord des résultats du CGIAR.En 2023, l'initiative a amplement démontré la valeur des bases qu'elle a établies en 2022 afin de développer et évaluer les innovations en matière d'agroécologie dans diverses conditions. Sur 11 territoires distincts, appelés paysages agroécologiques vivants (PAV), situés dans huit pays, l'analyse des conditions existantes et le processus d'engagement mené auprès de 6 159 acteurs du système alimentaire ont permis de sélectionner, de manière participative, des points de départ pour une transition vers l'agroécologie. Aujourd'hui, tous ces territoires font partie du Réseau international des PAV (RIPAV) lancé lors d'une visite d'échange dans l'Andhra Pradesh, en Inde.Pour évaluer les performances de l'agroécologie en fonction du contexte, l'initiative a mis au point un cadre global permettant de recueillir des données à différentes échelles et à différents stades de la transition agroécologique. Une collecte et une analyse complète de ces données sont en cours. Ces recherches portent également sur les pratiques agricoles, les modèles d'entreprise et les mécanismes financiers relatifs aux chaînes de valeur agroécologiques, les innovations politiques et institutionnelles, ainsi que sur les changements de comportement. Les résultats des analyses rapides des chaînes de valeur ont permis d'identifier les possibilités d'intégration des principes agroécologiques dans huit chaînes de valeur à travers six pays. Des partenariats visant à codévelopper des modèles commerciaux agroécologiques ont été établis au Pérou (cacao), en Tunisie (semences fourragères) et au Zimbabwe (sorgo et volaille). L'initiative s'est engagée avec les acteurs politiques de chaque secteur et a considérablement amélioré la base de connaissances concernant les questions politiques. Une analyse réalisée dans cinq pays a permis d'identifier les premières possibilités de renforcement des politiques et institutions au Kenya, en Tunisie, au Burkina Faso et au Pérou. Cinq pays (Burkina Faso, Pérou, Kenya, Tunisie et Zimbabwe) ont entrepris des recherches approfondies sur le changement de comportement en ce qui concerne les catalyseurs et les obstacles, ce qui a permis d'élaborer des stratégies et des plans d'action spécifiques à chaque contexte.Trois mois après la mise en place d'essais pour des innovations agroécologiques sélectionnées et conçues en commun, agriculteurs du comté de Kiambu, au Kenya, échangent leurs premières expériences sur les effets de l'agroécologie sur la productivité et les moyens de subsistance. Crédit : B. Adoyo, CIFOR-ICRAF L'initiative fait état de 233 résultats, 16 développements en matière d'innovation, cinq adoptions de ces innovations, trois changements de politique et 105 outils de connaissance (tableau de bord du CGIAR du 03/06/2024). Dans le cadre de 72 activités de partage des compétences, 766 participants, dont une majorité de femmes (462), se sont principalement concentrés sur les pratiques agroécologiques sélectionnées par les membres des PAV.L'évaluation des impacts fait appel à des méthodes quantitatives et qualitatives permettant de déterminer comment l'initiative favorise les principes de l'agroécologie par le biais du développement et de l'adoption d'innovations. Trois enquêtes de référence (au Pérou, en Tunisie et en Inde) fournissent des informations importantes sur l'adoption des pratiques agroécologiques.Des partenariats ont été établis avec 67 partenaires, dont huit centres du CGIAR, les deux centres de recherche internationaux CIRAD et CIFOR-ICRAF, 24 partenaires chargés de la mise en oeuvre, et 18 partenaires chargés de la mise à l'échelle. L'initiative travaille en étroite collaboration avec les SNRA de presque tous les pays, et enregistre des innovations et des résultats au Kenya, au Pérou et en Tunisie.Les liens entre les différents programmes de l'initiative (avec Nature-Positive Solutions, Low-Emission Food Systems, Livestock and Climate, Diversification in East and Southern Africa, ainsi qu'avec des programmes bilatéraux et des plateformes internationales) démontrent à quel point l'agroécologie retient l'attention des partenaires et des donateurs, et comment les équipes de l'initiative dépassent le cadre de l'exploitation agricole pour aborder les dimensions sociopolitiques de l'agroécologie.L'historique des principaux résultats de cette année met en lumière la Tunisie, qui s'est engagée dans une transition agroécologique holistique visant à renforcer sa résilience climatique. De nouveaux partenariats publicprivé stimulent la production et la vente de semences fourragères, ce qui permet à des centaines d'agriculteurs d'accroître la productivité de leurs animaux grâce à une meilleure alimentation, tout en améliorant la santé des sols. • Une étude analyse les expériences du mécanisme de passage de la vision à l'action que l'initiative a mis en place dans huit pays afin de faire progresser la transition agroécologique.Une autre étude analyse les progrès réalisés dans le codéveloppement d'innovations technologiques.• Un rapport général synthétise les résultats des analyses rapides des chaînes de valeur de chaque pays afin de mettre en évidence les similitudes et les différences majeures dans la manière dont les chaînes de valeur prioritaires peuvent contribuer à la transition.• En plus de l'analyse politique achevée en 2023 (page web des publications), les chercheurs de l'initiative ont commencé à élaborer un document de travail portant sur la politique économique de la transition agroécologique.Progrès réalisés à la fin de l'initiative Les ASA ont participé aux évaluations agroécologiques dans tous les pays, y compris les agriculteurs, conseillers agricoles, ONG, chercheurs, décideurs politiques et le secteur privé. Les documents relatifs à l'évaluation finale de ces contextes ont été publiés pour tous les pays, et le cadre d'évaluation holistique des performances localisées (HOLPA) a été mis au point. La collecte de données via HOLPA se poursuit dans tous les pays, avec plus de 800 foyers interrogés avant fin 2023. Les résultats seront intégrés dans une base de connaissances et analysés au niveau mondial avec les parties prenantes afin de favoriser une prise de décision fondée sur des données probantes et adaptée à chaque contexte.Trois partenariats visant à développer des business modèles agroécologiques ont été conclus. Au Pérou, l'ONG Terra Nuova fait connaître les produits amazoniens, soutient les organisations d'agriculteurs et aide les entreprises locales à adopter les principes agroécologiques. En Tunisie, la société privée de semences COTUGRAIN et l'Institut national de recherche agricole de Tunisie (INRAT) augmentent l'offre de mélanges de fourrage pour petits ruminants. Au Zimbabwe, les modèles d'entreprise se concentrent sur l'agriculture contractuelle du sorgho et l'élevage de poulets SASSO.Des possibilités ont été identifiées pour renforcer les politiques et institutions. Au Kenya, l'initiative contribue à la formulation de recommandations politiques concernant la transition agroécologique au niveau régional, ainsi qu'à l'élaboration d'une stratégie nationale en matière d'agroécologie. En Tunisie, elle a participé à des dialogues politiques axés sur une stratégie améliorée en matière de plantes fourragères et aliments destinés au bétail. Au Burkina Faso, la mise en place d'une liste participative des parties prenantes a permis d'inclure un plus grand nombre d'organisations dans la plateforme d'innovation laitière. Au Pérou, la collaboration avec le gouvernement régional et les partenaires locaux a permis de soutenir un plan stratégique pour la promotion du biocommerce.The Initiative significantly improved the knowledge base on behavior change. Five countries (Burkina Faso, Peru, Kenya, Tunisia, and Zimbabwe) have undertaken substantial research to identify actor-specific changes as well as their enablers and barriers, leading to the establishment of trials for the development of strategies and action plans that can foster behavior change, using the co-designed ACT framework. Research and support on GEYSI were strengthened. • Toutes les initiatives nationales ciblent les producteurs en vue d'un changement de comportement, le plus souvent par le biais d'une assistance technique, de formations, de démonstrations ou d'autres approches individuelles.• Cependant, on considère que 46 % des initiatives ont manqué des points d'entrées essentiels, ce qui a empêché les changements de comportement escomptés.• Les comportements des consommateurs et des acteurs du système de gouvernance ont été les moins ciblés, tout comme les approches systémiques visant à influencer le changement de position et de comportement, ce qui constitue une piste de travail pour les initiatives futures dans le cadre des WPl 3 et 4.• La garantie de liens avec le marché et la chaîne de valeur, la qualité du soutien des partenaires et des institutions, l'apprentissage social et la collaboration entre les acteurs du système alimentaire, ainsi que les efforts déployés pour aborder la question du pouvoir et de la position de chacun dans l'engagement multipartite ont été perçus comme des facteurs clés pour parvenir à un changement.Les innovations agroécologiques ont été priorisées dans huit pays, grâce au processus de transition de la vision à l'action, en collaboration avec le WP1. Les progrès annuels sont en grande partie conformes au plan de résultats, au budget et à la théorie du changement du module de travail.L'état d'avancement annuel montre de légers retards dans le plan de résultats et le budget, ainsi que dans la théorie du changement du module de travail dans des domaines clés.Les progrès annuels montrent clairement des retards par rapport au plan de résultats, au budget et à la théorie du changement du module de travail dans la plupart/toutes les domaines. Peut inclure des déviations/problèmes/ retards/risques mineurs qui ne compromettent pas le succès du module de travail.Les déviations/problèmes/retards/risques pourraient compromettre la réussite du module de travail s'ils ne sont pas correctement gérés.Les déviations/problèmes/retards/ risques compromettent la réussite du module de travail.Section 4: Principaux résultats de l'initiative Cette section présente une vue d'ensemble des résultats de 2023 ? rapportés par l'Initiative pour l'Agroécologie. Ces résultats sont conformes au cadre de référence du CGIAR et à la théorie du changement de l'initiative. De plus amples informations sur ces résultats sont disponibles dans le tableau de bord des résultats du CGIAR. Not targeted: The result did not target any of the Impact Area objec�ves.The result has made a significant contribu�on to any of the Impact Area objec�ves, even though the objec�ve(s) is not the principal focus of the result.The result is principally about mee�ng any of the Impact Area objec�ves, and this is fundamental in its design and expected results. The result would not have been undertaken without this objec�ve. Les innovations signalées en 2023 comprennent le développement de cadres conceptuels (engagement des parties prenantes, évaluations agroécologiques, liens entre les chaînes de valeur et les opportunités commerciales, changements de comportements) et d'innovations techniques (production de granulés pour l'alimentation animale, traitements biologiques pour améliorer les rendements ou lutter contre les nuisibles et maladies). Plusieurs innovations ont été réalisées en collaboration avec d'autres initiatives (Low-Emission Food Systems, Livestock and Climate, Nature-Positive Solutions). Les cinq applications d'innovations rapportées incluent la Tunisie, pour la production d'aliments pour le bétail et les chaînes d'alimentation, ainsi que le Kenya, où les parties prenantes de l'organisation partenaire CSHEP (Programme communautaire pour une agriculture durable et un environnement sain) ont intégré le concept de conception agroécologique commune dans leurs activités de partage des ressources. The innova�on is validated for its ability to achieve a specific impact under uncontrolled condi�onsThe innova�on is being tested for its ability to achieve a specific impact under uncontrolled condi�onsThe innova�on is validated for its ability to achieve a specific impact under semi-controlled condi�onsThe innova�on is being tested for its ability to achieve a specific impact under semi-controlled condi�onsThe innova�on is validated for its ability to achieve a specific impact under fully-controlled condi�onsThe innova�on is being tested for its ability to achieve a specific impact under fully-controlled condi�onsThe innova�on's key concepts have been validated for their ability to achieve a specific impact F���������� The innova�on's key concepts are being formulated or designedThe innova�on's basic principles are being researched for their ability to achieve a specific impactThe innova�on is at idea stage Research organiza�ons and universi�es (all types, most na�onal or regional) Research organiza�ons and universi�es (all types, most na�onal or regional)Organiza�on, other than financial or research (regional + interna�onal) Organiza�on, other than financial or research (regional + interna�onal)Principaux résultats de recherche • Expanded crop-livestock integration and agroforestry to improve yields and productivity.• Increased value of local food systems related to milk and millet production and value chains.• Integration with the framework and action plan of the existing national movement that promotes agroecology transitions.26 results I 5 innovation developments I 6 knowledge products 7 capacity sharing for developmentEntry points and first results• Enhanced sustainable production of organic cacao systems, including ecological alternatives for prevention of pests and diseases, and diversification of smallholder farming.• Carbon markets as a complementary financial strategy for the agroecology transition.• Increased involvement of youth in agroecological cacao business models.• Co-development of the Regional Strategic Plan for Biotrade with an agroecology approach. • Expanded crop-livestock integration: Enhanced crop diversification and rotation, feed management to cope with forage scarcity during dry periods, reduced inputs, biofertilization and increased recycling in a variety of crop or tree-based systems.• Recycling and valuing olive trees (co-) products and improved business models for olive oil to increase market value.• Supported the development of national agroecology, and feed and forage strategies.82 results I 11 innovation developments I 44 knowledge products 2 innovation use I 22 capacity sharing for development Burkina Faso Bobo-DioulassoEntry points and first results• Improved cow feeding with diversified fodder, manure recycling and wholefarm management of crop-livestock co-products.• Diversified milk products and milk collection centers developed to improve the distribution system.• Consolidation of the dairy innovation platform as a result of participatory stakeholder mapping.In each country, the Agroecology Initiative concentrates on one or two distinct territories referred to as \"agroecological living landscapes\" (ALLs), where it engages with food system actors and partners in a vision-toaction process. The identified entry points for the agroecology transitions are tailored to specific ALL contexts ways to a single destination India Andhra Pradesh & Madhya PradeshEntry points and first results• Integrated rice and fish farming to improve farmer incomes, soil health, biodiversity, and climate change resilience.• Strengthened fairness and economic diversification along the groundnut value chain, building on women self-help groups in Anantapur District.• Integration with institutional efforts to restore the commons and benefit from the ecosystem services. • Expanded mechanization to address labor, transport, and postharvest challenges.• Push-pull, conservation agriculture with dead or live mulch, biochar, integrated pest management, seed and livestock fairs.• Poultry value chain: Sorghum contract farming and brooding SASSO chickens.• Priority policy research identified for the Initiative with partners through local and national meetings. • Improved gate price for farmers in the organic rice market system.• Multistakeholder platform joint with partners to achieve coherence across national food, land, and water policies. • Advanced sustainable production systems, including practices such as plant-based biopesticides, farmyard manure, terraces, water harvesting, and agroforestry.• Strengthened farmers' networks and connectivity to markets along with creation of inclusive business models in prioritized value chains (mango and green leafy vegetables).• Kenyan partner organizations DNRC and PELUM adapted trainings, and outreach programs to incorporate the co-designed practices in support of agroecological transformation.• Connected with country-level efforts led by ISFAA to implement a national agroecology policy and support in policy recommendations for selected value chains at the regional level.44 results I 9 innovation developments I 10 knowledge products 2 innovation use I 1 policy change I 3 other outcomes 17 capacity sharing for development which differ markedly in terms of climate, farming systems, soils, and other conditions that rural communities face. In seeking suitable entry points, the Initiative has built on important experience that each country gained previously in applying some of the 13 agroecology principles. En 2023, l'initiative a forgé des partenariats avec un total de 67 organisations, dont huit centres du CGIAR, deux centres de recherche internationaux (le CIRAD et le CIFOR-ICRAF), 24 partenaires de mise en oeuvre locaux ou nationaux, et 18 partenaires de mise à l'échelle opérant dans ces différents pays. Ces partenariats impliquent 13 SNRA, 14 ONG, 13 organismes gouvernementaux, cinq plateformes ou réseaux agricoles, quatre associations d'agriculteurs et quatre entreprises privées qui collaborent dans le cadre de partenariats public-privé en vue de la production de cacao biologique au Pérou, de la fourniture de mélanges fourragers pour petits ruminants en Tunisie, et d'une race de poulet à double utilité (chair et oeufs) au Zimbabwe. L'excellente collaboration entre les huit centres du CGIAR a été renforcée par la mise en place d'équipes opérationnelles dans les pays qui intègrent les diverses compétences des centres et celles des partenaires.L'initiative a établi des alliances en fonction des demandes des partenaires, de leur capacité à codévelopper des innovations agroécologiques et à les transposer à plus grande échelle, ainsi que de leur influence sur les acteurs censés changer de pratiques. Nous décrivons ici les partenariats réussis reposant sur les transitions agroécologiques spécifiques conçues par les parties prenantes de chaque pays.Dans la plupart des TAV, l'initiative s'appuie sur des plateformes multipartites déjà existantes. Au Sénégal, par exemple, l'initiative travaille par l'intermédiaire d'un réseau national d'organisations de la société civile (DyTAES), qui a uni ses forces à celles de chercheurs promouvant l'agroécologie par le biais de campagnes de sensibilisation.Les L'initiative a permis d'accroître l'offre de mélanges fourragers, augmentant la productivité des petits ruminants, mais améliorant aussi la fertilité des sols, tout en renforçant la résilience. Les différents partenaires ont déjà mis en place 362 parcelles participatives expérimentales impliquant 276 bénéficiaires, afin de produire des fourrages à l'aide de biofertilisants. Ces parcelles ont permis de stimuler la demande de ces nouveaux fourrages et incité les entreprises distributrices de graines à élargir le marché. Par conséquent, des partenariats public-privé ont été établis et facilités par l'initiative, en particulier entre la société semencière privée COTUGRAIN et l'Institut national de recherche agricole de Tunisie (INRAT).Ces partenariats ont permis de combler d'importantes lacunes dans l'approvisionnement en semences, garantissant ainsi une plus grande disponibilité pour les agriculteurs. Le dynamisme de cette chaîne de semences fourragères a ouvert aux agriculteurs de nouvelles perspectives de diversification. Par exemple, certains se sont engagés dans des contrats avec le secteur privé afin de produire des semences de haute qualité sur une superficie cumulée de 300 hectares au cours des trois prochaines années. Pour renforcer la dynamique de ces changements, l'Initiative pour l'agroécologie, en collaboration avec l'Initiative du CGIAR sur l'élevage et le climat, a participé à des dialogues politiques et a codéveloppé une feuille de route destinée à l'usage national, visant à améliorer les ressources en aliments pour le bétail au cours de la prochaine décennie, dans le but de réduire la dépendance à l'égard de l'importation d'aliments pour le bétail. En Tunisie, le changement climatique raréfie le fourrage destiné au bétail. Compte tenu de l'importance de l'élevage dans ce pays, deux partenaires de l'Initiative pour l'agroécologie, l'OEP et l'INRAT, souhaitent bénéficier de son soutien par le biais de la diffusion d'un ensemble de mesures techniques relatives à la production de légumineuses fourragères dans les systèmes mixtes de culture et d'élevage.M. Anis Zaiem, ingénieur général au département des ressources fourragères à l'OEP (Office de l'Élevage et des Pâturages de Tunisie)Mélange de semences fourragères prêt à l'emploi. Crédit : Z. Idoudi / ICARDA"}
|
main/part_1/0414550376.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"8dad41aeb437eb58116ae6c6ccc19c0a","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/19645c2c-427c-4cd4-aa9b-0500511fa53b/retrieve","id":"-44611819"},"keywords":[],"sieverID":"04ff9a81-6c0b-4466-922f-fbfeeb3f7c1b","content":"A key aim of this network is to maintain synergies and coordination in dairy research across ILRI and partners, given the end of the Market-Oriented Smallholder Dairy project in 2003. Discussions thus centred on identifying ways of dovetailing ILRI's dairy research activities, conducted under different projects by multidisciplinary teams, into the institute's new strategic plan where research themes form the organisational units for research activities.Specific objectives of the session were:• Identification of the current and planned smallholder dairy research activities across the ILRI sites• Discussion of main priorities for small-Smallholder Dairy Network is born! holder dairy systems research, by locations and partners• Discussion of how to facilitate the implementation of cross-thematic smallholder dairy research• Establishment of a smallholder dairy network within ILRI, and among partners A total of 20 current and planned dairy-related projects in ILRI were identified. These projects differ in their content of dairy research, with some projects having dairy research as the core activity while in others the dairy component is only part of a broader research agenda. These projects, distinguished between \"mainly dairy\" and \"partly dairy\", are summarised in the table on page 1, along with their relationship to the new Research Themes. The Smallholder Dairy Project, jointly implemented by ILRI and local partners in Kenya, is an example of a core dairy project.\"The Milk Run\" Listing of current and potential dairy projects helped to answer the \"what\" and \"where\" questions of the projects.Once the projects were identified, focus changed to considering current and potential research issues addressed by these projects. This was important because it indicated areas of possible collaboration, which would limit duplication of research and optimise synergy between projects.Each research issue was analysed and scored on its current and potential strength for future collaboration. It was noted that some listed research issues have already been covered adequately in the past. This indicated the need for a thorough retrospective review of research agenda to avoid repetition. It was also pointed that we need to maintain a balance between national and international components when designing our research. This point arose from the observation that most of the research pursued in the past had a disproportionate focus on national issues at the expense of international issues.There was a debate about whether we should concentrate in areas where we have strong comparative advantage or also venture into other areas where our comparative advantage is relatively weak. Most participants favoured a position where we do not limit ourselves to areas of our current strengths. It was argued that comparative advantage is accumulated over time through experience and we should thus venture even in areas where we do not have comparative advantage. In such situations, the optimal scenario would be to partner with others and bring our individual strength to bear on the problem at hand.Finally the meeting resolved to form a new dairy network or collaborating group to steer dairy research activities, particularly those that were identified as important for future collaboration. One of the recommended forms of collaboration is joint research proposals on key issues of dairy research. ILRI's Markets research Theme (T3) volunteered to coordinate the new dairy network. In subsequent discussions, Dr Bill Thorpe agreed to help facilitate coordination from the Asia side. To keep everyone informed and exchange news between members and projects, the session recommended the inauguration of a quarterly newsletter. We welcome your suggestions to improve on future issues of the newsletter.Raw vs. processed milk debate: Crying over boiled milk?F ollowing the \"Safe Milk\" media campaign, launched last November by the Kenya Dairy Board (KDB), debate has raged in the local press as to whether pasteurized packaged milk is indeed safer than boiled hawked milk.The KDB campaign exhorts the public to \"be safe and buy processed milk\" because hawked raw milk poses a \"health hazard\". This stand may threaten livelihoods of small dairy farmers, small scale traders, and the majority of Kenya's poor who cannot afford to buy processed milk.In an article in the Daily Nation, a postgraduate student at the University of Nairobi, Ms Tezira Lore, refuted the potentially alarmist claims in KDB's advertisements by quoting key findings of a recent study by the Smallholder Dairy Project (SDP).In a 2002 report entitled \"Assessing and Managing Milk-borne Health Risks for the Benefit of Consumers in Kenya\", SDP researchers found that hawked milk is just as safe as processed, packaged milk as long as it is boiled. Almost all sampled households reported boiling of milk before consumption, thereby eliminating any pathogen hazard.SDP is now working closely with the KDB to arrive at a common approach to raw milk market policies. This includes training small-scale milk traders to improve milk quality and meet minimum standards and practices, and in turn licensing and so \"formalizing\" their activities. This will provide a positive policy environment for sustained small scale market development. This consensus SDP-KDB position is being put down in a joint policy brief that will be presented in a joint National Policy Forum in April (see Dairy Diary).In the next issue of \"The Milk Run\", we shall highlight planned and on-going smallholder dairy projects in other ILRI sites and Themes. To this end, we invite you to send brief articles (up to 300 words) that you wish to be featured in the newsletter. Email your articles to Steve Staal on s.staal@cgiar.org.A study on the assessment of dairy cattle breeding services and strategies in Kenya is currently in progress, including ILRI, the USAID-supported Kenya Dairy Development Project (KDDP), the DFID-supported Smallholder Dairy Project (SDP) and partners from Kenya's Veterinary Department.This Theme 2 (Innovations) and Theme 3 (Markets) study aims at assessing the current status of breeding services in the country, and the broader issues related to breeding policies for dairy cattle, particularly in the context of smallholder strategies and needs. The assessment entails a critical analysis of both the supply of breeding services (e.g., production and delivery of semen, bull services) and smallholder farmers' demand for livestock breeding services. Particular focus is on the demand side, which is intended to respond to the perception that dairy cattle breeding services have typically been \"top-down\" in their approach, and have not always addressed small farmers needs adequately. The collapse in use of AI in Kenya over recent years, for example, may partially be a consequence of a supply-driven perspective. This study will generate insights into marketoriented smallholder farmer needs for breeding services and the current strengths and weaknesses of the system in meeting those and, with partners, identify strategies for more demand-driven breeding policies and services.Preliminary analysis of dairy characterisation survey data collected in key dairy farming regions of Kenya indicates that only 18% of dairy households used artificial insemination (AI) services. This is despite the fact that 60% of the respondents reported that AI services were available in their area. Therefore, availability is not matched by use, and the study will investigate socio-economic (farmer and market) and bio-physical (locational) factors determining not just use of AI, but farmer choice of breeding strategy in general. A qualitative response model is being applied in the investigation, as well as some farmerparticipatory methods. Besides the knowledge and practical input into the dairy breeding policy and strategies for Kenya this study will generate, it is also intended to develop and refine learning and methodologies that can be applied in other countries. In Bangladesh, for example national partners have expressed strong demand for support in this research area. "}
|
main/part_1/0425122559.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":{"gardian_id":"cf09cb7a195b5e7eaec3d24e892a5d44","source":"gardian_index","url":"https://cgspace.cgiar.org/rest/bitstreams/835a949c-1dd5-4dfb-ab1a-cd268da8dd74/retrieve","id":"-1748535017"},"keywords":[],"sieverID":"8cb9d19d-bae0-44f9-9f0f-d37a266564aa","content":"One of the outstanding attributes of the first two hybrid Brachiaria cultivars (Mulato and Mulato II) is their very high nutritive quality, which leads to outstanding animal productivity. Hoping to maintain or improve forage quality in future commercial hybrids, special attention is required to monitor quality attributes (crude protein and dry matter digestibility), particularly in our synthetic, tetraploid breeding population where genetic gain can be achieved by selection.Vegetative propagules of 209 BR05 and RZ05 hybrids were delivered to the Forage Quality laboratory in April 2006. Individual plants were propagated vegetatively and transplanted to single-plant experimental units in a 3-replicate, space planted (1.00 x 0.75 m) field experiment on 07 June 2006. Plants were cut to a uniform height on 27 July. Individual plants were sampled three times, at 6-wk intervals, on 07 September, 19 October, and 30 November 2006. Urea was applied at a rate of 1 gm per plant following each sampling harvest. Approximately 23-25% of plants failed to establish or died and could not be sampled. On each of the three sampling dates, 300-gm samples of leaf tissue were taken, dried at 45 o C for 48 hours, and ground to pass through a 1 mm screen. Dried, ground leaf tissue samples were analyzed in a NIRS System 6500 using software ISISCAN (IS-2250) version 2.71, Win ISI-III IS-1485.Sampling date was by far the major source of variation. Genotypes differed at each sampling date and over sampling dates. Differences among genotypes were on the order of 15 percentage points for IVDMD and 12 percentage points for CP. Ten hybrids had IVDMD > 59% with CP in excess of 14%.Mean squares for genotypes were 2.9 times or 4.7 times larger than the mean squares for the genotype-sampling date interaction for IVDMD or CP, respectively. Correlations of genotype values between sampling dates were positive, but of only moderate magnitude: on the order of 0.3 to 0.4 for IVDMD, and on the order of 0.3 to 0.6 for CP. These results suggest that there is ample variability for genetic improvement in forage quality parameters in the Brachiaria breeding populations. While the digestibility and protein data reported were determined on sexual-byapomictic hybrids, breeding progress will (or will not) be made in our synthetic tetraploid sexual breeding population. The logistics of obtaining reliable forage quality data on candidate sexual clones in an opportune manner needs to be worked out.• Feeding Canavalia brasiliensis to sheep as a supplement to a low quality grass resulted in a linear increase in dry matter intake as level of the legume offered increased• Rumen degradability of tropical legume fibers is highly variable and at least as important to plant quality as secondary plant metabolite (tannin, saponin) content.Contributors: J. Carabalí, C. Lascano, P. Avila and M. Peters (CIAT)The evaluation of herbaceous legumes with farmer participation in hillsides of Central America resulted in the selection of Canavalia brasiliensis (Canavalia) given its high biomass production and dry season tolerance. On farm evaluation of Canavalia demonstrated that it was an excellent cover legume and that when sown at the end of the dry season with maize resulted in higher grain yield in the subsequent rainy season. Anecdotal evidence suggested that Canavalia was well accepted by grazing cows in the dry season. However, given the presence of a toxic amino acid (canavalin) in Canavalia species, known to affect monogastric animals, there was concern that cows consuming the legume could exhibit some form of toxicity leading to mortality.To investigate the feed value of Canavalia as a supplement to low quality grasses and to define if animals consuming the legume showed toxicity problems a feeding trial with sheep was carried out. Results of the feeding trial are reported in this section.In the Quilichao research station 10 African hair sheep grouped as light (5) and heavy (5) were assigned to 5 treatments in a replicated 5 X 5 Latin Square design.The feeding trial had duration of 70 days, divided in 5 experimental periods (14 days/ period). Each period in turn was divided in 7 days for adjustment and 7 days for measurements. Animals were housed in metabolism crates and offered sun dried Canavalia brasiliensis and a low quality grass (Brachiaria humidicola) as a basal diet in the following arrangement of treatments:T1: Canavalia 100% T2: 25% Canavalia + 75% Grass T3: 50% Canavalia + 50% Grass T4: 75% Canavalia + 25% Grass T5: 100% Grass Each animal received a total of 80 g of DM /kg of BW 0.75 daily in two rations AM and PM. The legume was offered alone from 8 to 10 AM and from 1 to 3PM. After the end of the two hour period the legume not consumed was measured and animals were offered the grass basal diet. In addition all animals received water and a mineral mix ad lib. Forage consumed by each animal daily was calculated by difference of grass and legume offered and grass and legume refused.Animals were fitted with fecal collection bags on day 6 of the adjustment period. Feces from each animal were weighed from day 7 to day 14 of the measurement period. A 10% aliquot was taken from each animal and stored in a freezer for subsequent freeze drying and chemical analysis.Laboratory measurements in freeze dried feed offered and refused and in feces included DM, OM, NDF, ADF, IVDMD, CP (N x 6.25) and minerals (P, Ca, M, K and S).Daily intake of total DM and of grass and legume were calculated by difference of forage offered and forage refused. Digestibility of DM was calculated as follows: DM Digestibility = DM consumed (g) -DM excreted in feces (g)/ DM consumed (g).The data was subject to an analysis of variance with animal group (heavy and light), period, animal (group), Treatment (group) and Group x Treatment as sources of variation. Given that one animal died (not related to the diet received) the SAS GLM procedure was used.As expected the CP content of Canavalia (17%) offered was higher than in the grass (7 %). The levels of P and Ca were also higher in Canavalia (0.26 and 1.9%) than in the grass (0.09 and 0.22%). The fiber content (NDF) was lower in Canavalia (59.7%) than in the grass (83%), which did not result in higher IVDMD in the legume (61 %) as compared to the grass offered (59%).Total intake of DM was higher for the light (31.6 g/ BW 0.75 ) than for the heavy sheep group (31.6 g / BW 0.75 ). However more interesting was that DM intake increased linearly regardless of weight of the animals as the proportion of Canavalia increased in the forage offered (Table 1 ).However, results showed that DM digestibility did not differ among treatments as shown in Table 1. These results are consistent with the in vitro digestibility values recorded for Canavalia and for the grass.One important reason for running this feeding experiment was to define if the forage of Canavalia brasiliensis produced toxicity symptoms when feed to sheep alone or in mixture with a low quality grass. To define if Canavalia had any effect on liver function we measured two enzymes (GGT-Gamma Glutamil Transferase and ASAT-Aspartate amino transferase). Our results showed that GGT ranged from 13 to 22.0 with an average of 17 U/ L (reference values 22 -44 U/l).In the case of ASAT the values recorded ranged from 38 to 97 with an average of 65 U/L (reference values 49 -123 U/L). Thus it would seem that short term intake of Canavalia brasiliensis did not result in any apparent liver damage. Through out the trial light or heavy sheep did not exhibit any strange behavior or toxicity symptom.From the results of the feeding experiment we conclude that the Canavalia brasiliensis fed to sheep as a protein supplement resulted in a 5 to 19% increase in dry matter intake as the legume supplement increased from 25 to 75% of the forage offered. In addition, it would seem that forage of Canavalia does not produce toxic effects on sheep at least in short periods of time (70 + days). Fiber content and degradability are key factors in determining forage quality. Ruminants in tropical regions derive a major portion of their energy from the fiber fraction of forages. The low rumen digestibility of tanniniferous legumes has been mostly associated with their high tannin contents.The present experiment was conducted to better define the role of fiber quality of two tanniniferous shrub legumes (Calliandra calothyrsus and Flemingia macrophylla) on ruminal fermentation of legumes with tannins.Plant material of Calliandra calothyrsus (CIAT 22310) and Flemingia macrophylla (CIAT 21083) was harvested manually eight weeks after a uniformization cut. The material was immediately stored at 20°C and subsequently freeze dried. For Vigna unguiculata (cowpea; CIAT 391) eight week old herbage (the whole plant, before flowering) was harvested and sun dried for three days. The tropical low quality grass Brachiaria humidicola (CIAT 6133; formerly B. dictyoneura) was cut after a growing period of 12 weeks and sun dried for two days. The dried plant material of all species was ground in a laboratory mill using a 5 mm screen.The material harvested was analyzed for dryand organic matter, nitrogen, fiber, lignin and ruminal degradability. The N associated to fiber (NDF-N) was measured. Fiber content of B. humidicola, C. calothyrsus, F. macrophylla and V. unguiculata was determined with the detergent method. In the case of fiber determination in Calliandra and Flemingia sodium sulfite was added to the detergent solution.The fiber used in the in vitro experiment was obtained applying a slightly modified detergent method. The amount of plant material used to extract NDF was 5 g placed in 250 ml of detergent solution instead of 0.5 g in 100 ml solution. The detergent was removed by intensive washings with water and ethanol 70-95% in 20 to 25 washing steps, till the detergent could not be perceived not by smell nor flavor and the fiber did feel fluffy and not sticky anymore. The isolated fiber fraction was analyzed for the same parameters as described above for the entire plant material.Employing the in vitro rumen simulation technique (RUSITEC) fiber extracted from the three legumes was evaluated for its rumen degradability during 2 × 10 days periods with two replications of each treatment per period (n=4).The first four days served for adaptation of microbes to the fermentation substrates and the following 6 days for data and sample collection.As a protein source for the fermentation media, 3 g of casein were added per day.The daily dry matter supply to the fermenters was maintained constant at 10 g fiber + 3 g casein. Gas production and methane concentration were determined daily. Substrates and solid fermentation residues were analyzed for organic matter, N, neutral detergent fiber (NDF), and acid detergent fiber (ADF). Data were statistically analyzed with an ANOVA using the GLM procedure in SAS.Chemical composition of the tested plants.The chemical analysis of the test plants showed large differences in fiber composition and N bound to fiber (Table 2). The grass Brachiaria had by far the highest NDF value of all tested plants. Of the legumes Flemingia had the highest NDF content (590 mg/g) followed by Vigna (530 mg/g) and Calliandra (358 mg/g). Lignin content was highest in Flemingia (154mg/g) followed by Calliandra (99 mg/g), Vigna (82 mg/g) and Brachiaria (56 mg/g).Indigestible fiber was highest in Flemingia with 508 mg/g that corresponds to 86% of the total fiber content. In Calliandra the indigestible fiber content was 273 mg/g, corresponding to 76% of the total fiber content of the plant (Table 2). In Vigna and Brachiaria the indigestible fiber was only 170 and 192 mg/g (32% and 25% of total fiber), respectively. The hemicelluloses fraction was highest in Brachiaria followed by Vigna, Flemingia and Calliandra. Relatively to the total fiber content hemicellulose proportion in Flemingia was lower than in Calliandra, Brachiaria and Vigna (Table 2). With the fiber purification procedure used only 90-95% purity of NDF could be achieved. As we could not identify the impurities, the purified fiber was treated as homogeneous fraction.The N bound to fiber in the plants was 59% in Brachiaria, 56% in Flemingia and 37 and 36% for Vigna and Calliandra (Table 2). Previous Rusitec trials had shown that the availability of this NDF-N for the rumen microorganisms was not sufficient to cover their needs. Thus casein was added to the medium since it is considered a good source of N for rumen microbes.The in vitro dry matter degradation (DMD) and the degradation of organic matter (OMD) and neutral detergent fiber (NDF) differed (P<0.05) between all purified fibers tested. Vigna showed always the highest degradability followed by Brachiaria, Calliandra and Flemingia. Acid detergent fiber degradation was highest in Calliandra and Brachiaria and by far lowest (P<0.05) in Flemingia. Hemicelluloses degradation was highest (P<0.05) in Vigna, followed by Brachiaria, Flemingia and Calliandra.Celluloses degradation was lowest (P<0.05) in Flemingia and highest in Calliandra and Brachiaria.In general, results in fiber degradation in vitro showed clear differences among legumes in fiber quality. The tanniniferous species had overall less digestible fibers than Vigna or Brachiaria. Legumes with tannins also showed particularly much lower digestibility of the hemicelluloses fraction. Methane emission expressed as ml/d as well as methane emitted per unit of degraded organic matter differed (P<0.05) among species and was highest with Vigna, followed by Brachiaria, Calliandra and Flemingia (Table 3). Methane produced per unit of NDF did not differ between Brachiaria and Calliandra, and was highest with Vigna and lowest with Flemingia. These results • The cellulolytic bacteria Ruminococcus flavefaciens was not affected by tannins extracted from legumes which was not the case for Fibrobacter succinogenes.• Mixing of legumes with and without tannins for silage production did not decrease nitrogen losses during storage but decreased ruminal degradability of protein which in turn could result in a more efficient utilization of nitrogen.• Feeding tanniferous legumes to sheep as a supplement to a low quality grass decreased methane production as a result of reduced ruminal fiber degradation and not by adverse action on methanogenic microbes.• Confirmed the high value of V. unguiculata (cowpea) as supplement for dual purpose cows grazing low quality pastures during the dry season as milk production increased with increasing proportion of the legume in the supplement.• The feed value of a legume supplement based on C. calothyrsus high in tannins can be significantly improved by including a small proportion (e.g. 1/3) of V. unguiculata (cowpea) in the mixture.indicate that the reduction in methane observed in other in vitro experiments and in an in vivo experiment reported in a different section when legumes with tannins were used to supplement low quality grasses was due not to the tannins per se affecting rumen methanogenic bacteria but rather to the very low degradability of the fiber of such legumes.Contributors: C. Sanabria, R. Barahona, D.A Rodríguez, E. Martin, and F. Rodríguez (CORPOICA)The composition of the rumen microflora can be affected by many factors one of them being the nature of the diet. A diet with high proportion of fiber tends to favor the growth of cellulolitic bacteria such as Fibrobacter succinogenes and Ruminococus flavefaciens. Thus it is possible that the inclusion in the diet of ruminants of tropical shrub legumes could favor the growth of cellulotic bacteria given their relative high fiber content. However, it is also possible that condensed tannins (CT) present in some shrub legumes could limit the availability of protein and energy needed for bacterial growth.The present experiment was conducted to assess the effect of adding tannins extracted from Leucaena leucocephala and Desmodium heterocarpum (ovalifolium) on microbial ecology and in vitro fermentation of alfalfa.A series of in vitro fermentations were carried out with rumen fluid and the addition of tannins (CT) extracted from Leucaena leucocephala (Leucaena) and Desmodium heterocarpum (Desmodium). Volatile fatty acid (VFA) production (mM), gas production (ml), and the relative abundance of the cellulolytic species Fibrobacter succinogenes and Ruminococcus flavefaciens by qRT-PCR were measured.The effects of purified CT were evaluated after 24 hours of in vitro fermentation. The fermentation took place in 50 ml bottles following standard protocols. Each bottle contained 100 mg of dried and ground alfalfa, 10 mg of CT from Leucaena or Desmodium and 10 ml of a buffer solution (20% of rumen liquor and 80% of growth medium).The CT of Leucaena or Desmodium did not cause negative effects on the abundance of Ruminococcus flavefaciens. In contrast numbers of Fibrobacter succinogenes decreased (P < 0.05) after treatment with CT from Leucaena and Desmodium (Table 4). It is possible that the presence of glycocalix that is associated to cell-wall topology and chemical composition of Gram + celluloytic rumen microbes (i.e. Ruminococcus flavefaciens) protect them from the negative effects of CT. The mechanisms by which CT of the two tanniniferous forages increased (P < 0.05) numbers of Ruminococcus flavefaciens remain unknown. Until now there is no evidence that rumen bacteria use tannins as a carbon source. Gas production was significantly (P<0.05) higher when CT from Leucaena were added as compared to CT from Desmodium.Degradability of the substrate was correlated to gas production in presence of CT of both tanniniferous legumes. Other researchers also found a negative effect of CT from D. ovalifolium on IVDMD degradability. Total VFA production decreased in presence of tannins extracted from Desmodium, although a positive effect was found on propionate accumulation (Table 5).Favoring propionate production by using tannins of some tropical forage would offer an optimal scenario in the energy balance of rumen function. As found by other researchers, the CT of Leucaena increased (P < 0.05) VFA production as compared to the control or to the treatment with Desmodium. In summary, our results indicate that the cellulolytic bacteria Ruminococcus flavefaciens was not affect by tannins extracted from legumes which was not the case for Fibrobacter succinogenes. These results are interesting since they suggest that different species from the rumen cellulolytic population would show different tolerance to tannins present in tropical forages.Forage conservation represents an interesting alternative for dry season supplementation of ruminant livestock in the tropics. The Tropical Grass and Legume Project of CIAT has developed alternative technologies such as the \"bag silage\" that are appropriate for livestock systems operated by smallholders. However, one important constraint of silage preparation is the loss of nitrogen during the fermentation process, particularly when legumes with high concentrations of soluble nitrogen are conserved.Since tannins which are present in many tropical forage legumes protect proteins form microbial degradation, mixing legumes with and without tannins could contribute to reduce N losses during silage preparation and storage. The objective of the present investigation was to evaluate the ruminal fermentation characteristics and nutrient degradation of hay and silage of tropical forage legumes with (Calliandra calothyrsus, Flemingia macrophylla) or without (Cratylia argentea, Vigna unguiculata) tannins incubated either alone or in mixtures.In Experiment 1, the shrub legume species Calliandra calothyrsus (CIAT 22310), Flemingia macrophylla (CIAT 17403) and Cratylia argentea (CIAT 18516 and 18668), and the herbaceous legume Vigna unguiculata (CIAT 1088/4, 288, 391, 9611 and 715) were cultivated at CIAT's research station Quilichao (Cauca, Colombia). All legumes were tested individually and the shrub legumes were additionally incubated in combination with V. unguiculata in a proportion of 1:2. Individual legumes and legume mixtures were evaluated as hay and as silage and all diets were incubated with or without the addition of polyethylene glycol (PEG) to inactivate tannins. This resulted in a total of 28 treatments (7 diets x 2 conservation methods x 2). The experiment was conducted using the gas-transducer technique.In Experiment 2, the tanniniferous shrub legume Calliandra calothyrsus (CIAT 22310) and the herbaceous legume V. unguiculata (CIAT 1088/4, 288, 391, 9611 and 715) were tested either alone or in combination with each other in proportions of 1:2 and 2:1. Individual legumes and mixtures were evaluated as hay and as silage. This resulted in a total of 8 treatments (4 diets x 2 conservation methods). Hay was prepared by sun-drying for 3 days and silage was stored for 56 days. The experiment was conducted using a rumen simulation technique (RUSITEC).In Experiment 1, accumulated gas production and rate of gas production were higher (P<0.05) with silage than with hay and were not affected (P>0.05) by the addition of PEG. Fermentation dynamics were clearly affected be the botanical composition of the diets. The highest (P<0.05) accumulated gas production and gas production rate were observed with V. unguiculata alone and with the mixture consisting V. unguiculata and C. argentea. The lowest values (P<0.05) were observed in the treatments with tanniniferous legumes alone. The treatments with C. argentea alone and the mixtures with V. unguiculata and tanniniferous legumes showed intermediate values.In Experiment 2, chemical composition of hays and silages varied depending on the botanical composition and the conservation method. Compared to hay preparation, ensiling decreased the crude protein (CP) content in legumes without tannins (V. unguiculata, C. argentea and their mixtures with legumes with tannins). On the other hand, the fiber content increased with ensiling in the legumes with no tannins (V. unguiculata and C. argentea) and corresponding mixtures with legumes that had tannins. Apparent organic matter (OM) degradation was also affected by the botanical composition and the conservation method. The highest (P<0.05) OM degradability was observed in the treatments with V. unguiculata alone and in the mixtures with high proportion of this legume. The mixtures with low proportion of V. unguiculata showed intermediate values and the lowest OM degradability was found in the treatments with C. calothyrsus alone. Compared to sun drying, ensiling increased (P<0.05) the OM degradability in all forages except with C. calothyrsus alone. Apparent CP degradability was highest (P<0.05) with V. unguiculata alone and with the mixtures containing a high proportion of this legume. Ensiling increased (P<0.05) apparent CP degradability in V. unguiculata alone but had no effect (P>0.05) on protein degradation in the legume mixtures.These results confirm that ensiling may result in losses of nitrogen in legumes with no tannins. However, these losses could not be minimized by mixing legumes with and without tannins. On the other hand these results indicate that ensiling compared to sun drying increases the apparent ruminal CP degradability in tannin-free legumes, which was not the case in tannin-rich legumes. It can be concluded that mixing of legumes with and without tannins for silage production does not decrease nitrogen losses during ensiling and storage of the forage but decreases the ruminal degradability of CP which in turn could result in a more efficient utilization of nitrogen.Nutrition of ruminant livestock in the tropics is mainly based on grasses. In general tropical grasses are of low to moderate digestibility, deficient in one or more essential nutrients (e.g. crude protein) and contain high amounts of fiber and low concentrations of soluble carbohydrates and starch. This in turn, results in low microbial activity in the rumen and may cause imbalances in digestive products and result in an inefficient use of metabolizable energy. Therefore alternative feeding strategies are needed which contribute to improve fermentation efficiency in animals fed diets based on grasses of low quality by assuring adequate ruminal ammonia levels, microbial protein synthesis and duodenal flow of undegraded feed protein. This may be achieved by supplementation with legumes which generally contain higher amounts of both rumen degradable and undegradable protein than tropical grasses. If the deficiency of fermentable nitrogen in the diet is eliminated, this may increase the activity of fibrolytic microorganisms resulting in an improved degradation of fibrous feeds.Many of the legumes which could be used to supplement ruminant livestock in the tropics contain condensed tannins (CT). In higher concentrations, CT may have detrimental effects on animal production (e.g. suppressed intake and digestibility of nutrients). However, in lower concentration CT could have beneficial effects, such as reducing nitrogen losses during ruminal fermentation and increasing the flow of protein to the duodenum and the absorption of amino acids in the lower gut. The objective of the present investigation was to evaluate the effects of supplementing legume mixtures with different types and concentrations of CT on ruminal fermentation and the utilization of nitrogen in sheep fed a basal grass diet of low quality.A feeding trial with sheep was conducted at CIAT's research station Quilichao (Cauca, Colombia). Then adult, castrated male sheep, fitted with rumial and duodenal canulae were divided into two groups with an average bodyweight of 26.1 and 34.6 kg, respectively. Animal were kept in metabolic crates and assigned to five treatments according to a repeated 5x5 Latin square design.Diets consisted of Brachiaria humidicola (55% of dietary dry matter) and Vigna unguiculata either alone or in mixtures with the tanniniferous shrub legumes Calliandra calothyrsus and Flemingia macrophylla. The proportion of tanniniferous shrub legumes in the legume mixtures was either 1/3 or 2/3. This resulted in a total of 5 treatments. Animals were offered daily 45 g of forage dry matter per kg of metabolic bodyweight (BW 0.75 ). Animals were offered fresh water three times per day and had free access to a mineralized salt mixture. The experimental periods consisted of 18 days each, 10 days adaptation to the experimental diets and 8 days of data and sample collection. Bodyweight was determined at the beginning and the end of each experimental period after a fasting period of 17 hours.During days 1 to 6 of each collection period, feed refusals, and urine and feces excreted were recorded daily and samples of feeds offered and refused and of urine and feces were taken.Duodenal digesta was sampled on days 6 and 7 and on day 8 ruminal fluid was sampled every 6 hours. Indigestible acid detergent fiber (IADF) was used as internal marker to estimate duodenal dry matter and nutrient flow. Forage offered, refusals, feces and the solid phase of duodenal digesta were analyzed for organic matter (OM), neutral detergent fiber (NDF), acid detergent fiber (ADF), FAID and total nitrogen (crude protein (CP) = N x 6.25). Microbial nitrogen in duodenal digesta was estimated using purines as marker. Ruminal fluid and duodenal digesta were further analyzed for ammonia concentration and feeds offered for total condensed tannin concentration.The grass used in this investigation presented a low CP content (64 g/kg) and high contents of NDF and ADF (810 and 425 g/kg, respectively). The tanniniferous shrub legumes presented a high CP content which was similar to that found in V. unguiculata. Condensed tannin content was almost three times higher in C. calothyrsus than in F. macrophylla.One factor which probably affected the animal response variables was the fact that the proportions of tanniniferous legumes consumed were clearly below the proportions in the diets offered. As a result of this, the proportions of tanniniferous legumes in the diets consumed were 10 and 15%, respectively and not 15 and 30% as intended. Furthermore there was a relatively high variability among individual animals.In general, OM intake tended to decrease with increasing proportion of tanniniferous legumes in the diet, and was clearly lower (P<0.001) with diets containing F. macrophylla or C. calothyrsus than with the diet free of tannins.No differences in OM intake were observed between the two tanniniferous legumes. Apparent OM and ADF digestibilities were lower (P<0.05) with diets containing high proportions of tanniniferous legumes than in the diet free of tannins. Nitrogen intake and rumen ammonia concentrations and duodenal flow of total nitrogen were also decreased (P<0.05) by the inclusion of tanniniferous legumes. The proportion of undegraded feed protein reaching the duodenum was not increased by the inclusion of tanniniferous legumes in the diet.The reasons for these unexpected results are unknown but could be related to the relatively high variability in legume consumption among individual animals.The intake of small proportions of tanniniferous legumes in mixtures with a legume free of tannins decreased OM and CP intake and suppressed fiber digestibility in sheep fed a basal grass diet of low quality. On the other hand, consumption of tanniniferous legumes did not affect N utilization in the way as it was expected. Although the inclusion of higher proportions of tanniniferous legumes decreased ruminal ammonia concentration, duodenal flow of total nitrogen was also decreased when compared to the diet free of tannins.It can be concluded that the inclusion of small proportions of tanniniferous legumes in mixtures with legumes free of tannins did no have any positive effects on digestion and utilization of nitrogen.Contributors: T. Tiemann (ETH Zurich), Patricia Avila (CIAT), H.R. Wettstein (ETH Zurich), M. Kreuzer (ETH Zurich), H.D. Hess (ALP Posieux) and C.E. Lascano (CIAT) Tropical fodder legumes are often characterized by high contents of condensed tannins (CT). The effect of CT on protein digestion is well-known but few data are available on their effects on energy utilization and methane production. To investigate effects of CT in legumes on energy and protein utilization and on methane production, an in vivo feeding trial in metabolic cages and respiratory chambers was conducted. This study formed part of a larger project on the use of tanniniferous shrub legumes as potential forage supplements in smallholder systems.The study carried out in the ETH animal facilities in Zurich, Switzerland focused on two promising tanniniferous tropical shrub legumes: Calliandra calothyrsus and Flemingia macrophylla. Six diets were tested for their effect on energy turnover and methane release in a respiratory chamber experiment in a 6 x 6 Latin square design with six lambs of the Swiss White Mountain breed (n=6) (Table 6). Dry matter offered daily was 60 g/kg of metabolic bodyweight (BW 0.75 ). Five of the diets consisted of mixtures of grass (Brachiaria brizantha) and legume (55% grass and 45% legume foliage), with a grass-only diet serving as control. The legume supplements consisted either of sun-dried CT-free Vigna unguiculata alone or of mixtures of V. unguiculata with air-dried leaves of C. calothyrsus or F. macrophylla in ratios of 2:1 and 1:2.Animals were adapted to the experimental diets for 2 weeks. In the third week we measured intake, and fecal and urine excretion. In addition, samples of rumen fluid and blood were taken. For 2 consecutive days, the gaseous exchange of the animals was measured using dual open-circuit respiratory chambers.Subsequently diets and samples of feces and urine were analyzed for nitrogen, carbon and energy content, as well as fiber composition.Blood was analyzed for nitrogen (BUN) and in the rumen fluid bacteria, protozoa, ammonia and volatile fatty acids (by HPLC) were measured. Data were subjected to analysis of variance with SAS considering diet, animal and experimental periods as sources of variation.It is often stated that legumes with high tannin content are not palatable and therefore avoided by herbivores. However in this trial the intake of the tanniniferous legumes was high (>85% of the amounts offered) despite relatively high total CT content in Calliandra (182 g kg -1 ) and Flemingia (219 g kg -1 ). The differences in intake due to plant species were much smaller than differences due to animals. Also some animals became used to the tanniniferous legumes and showed intake rates of 100% while others did not. The intake of the basal grass diet exceeded 90% of the forage offered throughout the experiment.Rumen ammonia concentration was low in the treatment with Brachiaria only (3.9 mmol/l) and with the high proportion of Calliandra (3.8 mmol/l), which in both cases is below the minimum requirement of ruminants. The ammonia level with the Brachiaria-Vigna only diet was high (6.5 mmol/l) compared to the other treatments. Plasma urea nitrogen (PUN) was also lowest for the grass alone and high Calliandra diets, followed by the two Flemingia treatments and the diet with the low Calliandra level.The apparent digestibility of OM was low in diets with high proportions of tanniniferous legumes and increased when their proportion was reduced. The apparently digested N in relation to the BW 0.75 was for all diets (except for the high Calliandra diet) higher than for the pure Brachiaria diet. Apparent N digestibility was lowest for the high Calliandra and for the diets with high Flemingia and low Calliandra. However, the amount of protein retained did not differ (P > 0.05) between diets.Fecal N relative to N intake was elevated as the proportion of tanniniferous species increased in the diets. On the other hand N loss through urine in relation to total N loss was higher when tanniniferous legumes were include at low levels. These results suggest that N of tanniniferous legumes is mainly lost via feces as tannins protect protein from degradation in the rumen. Results also showed that the expected increase in CP absorption due to tannins in the legumes fed did not take place in a significant degree. Total N loss and N retention did not differ between diets.Apparent digestibility of NDF showed a tendency (P<0.1) to be lower with higher proportions of tanniniferous legumes. Apparent digestibility of ADF was reduced in all diets containing Calliandra or Flemingia.Apparent energy digestibility and energy metabolizability were lower in the diets with tanniniferous legumes as compared to the diet with the high quality legume and the pure Brachiaria diet. The heat energy/kg BW 0.75 was lower (P<0.01) for the high tannin diets than for the high quality diet. The metabolizable energy was utilized mainly for fat tissue deposition, whereas the high tannin diets also showed lower fat gain than the high Vigna diet.Volatile fatty acids did not differ between treatments. In contrast, methane production/ BW 0.75 was reduced by the inclusion of tanniniferous legumes. This reduction was 8.4% and 25.7% for the diets containing low and high proportions of Calliandra, respectively and 9.1% and 21.8% for the diets containing low and high Flemingia, respectively. When related to intake of gross energy this effect was significant only for the diets with high proportions of legumes with tannins. There was no effect of treatments on methane production when expressed per unit of digested energy, digested NDF or digested OM.In general, our results demonstrate that a high level of Calliandra calothyrsus in the diet resulted in lower metabolic protein and energy supply as compared to the high-quality legume diet. It was also evident that Flemingia macrophylla supplementation was less detrimental than that of Calliandra calothyrsus in metabolic protein supply, but not in energy supply. However, a high proportion of Flemingia macrophylla in the diet had a similar adverse effect on protein supply as the low Calliandra calothyrsus diet. Regarding energy supply both legume species had similar effects.The suppressing effect of tanniniferous legumes on methane seems to have been mainly mediated by reductions in ruminal fiber and organic matter degradation and less by a direct adverse action against the methanogenic microbes. Finally, our results suggest that the CT-free Vigna could be partially replaced by Flemingia macrophylla for improving low-quality tropical grass-only diets in the tropics if no other option is available. Previous studies had shown that supplementation with hay of Calliandra calothyrsus (Calliandra) did not increase milk production of dual purpose cows grazing low quality pastures during the dry season. This lack of response to supplementation with Calliandra has been associated to its high level of tannins, which results in low levels of ammonia production in the rumen and as a result bacterial protein synthesis is reduced. It has been hypothesized that mixing legumes with and without tannins could contribute to maximize the effects of legume supplementation on milk production due to increased production of rumen ammonia and flow of total nitrogen to the lower digestive tract.A feeding trial with lactating dual purpose cows was conducted to test the effect of mixtures of legumes with and without tannins as supplements for milking cows grazing a low quality pasture.The feeding trial was performed at CIAT's research station Quilichao (Cauca, Colombia). Eight Holstein x Cebu crossbred cow were assigned to 4 supplementation treatments using a repeated 4 x 4 Latin square design. The 4 supplements consisted either of the tanniniferous Calliandra calothyrsus (CIAT 22310) or the tannin free Vigna unguiculata (CIAT 1088/4, 288, 391, 9611 and 715) alone or of mixtures of these 2 legumes in proportions of 1:2 or 2:1. Legume foliage was harvested and sun dried for 3 days prior to the experiment.The supplements were offered at a level of 1% of the cows bodyweight in two meals per day (at 05:00 and 13:00) during milking. To improve palatability of the legume foliages, the individual portions of the supplements were mixed with 100 g of molasses and 50 g of a mineralized salt for dairy cattle. The remaining time of the day, cows were grazing a pasture based on Paspalum notatum with an average dry matter availability of 983 kg/ha. The pasture area of 3 ha was divided into 2 paddocks of 1.5 ha each which were grazed alternately with 7 days of grazing and 7 days of rest period. The average stocking rate during the experiment was 2.6 animal units per hectare.The experimental periods were of 14 days each, with 7 days of adaptation to the respective supplements and 7 days of measurement of daily milk production. Additionally samples of milk were taken for the determination of the contents of fat, total solids and urea nitrogen.Despite the addition of molasses and salt to the legume foliage, consumption of the supplement was affected by its composition (Table 7). The highest (P<0.05) intake was observed when the supplement consisted of V. unguiculata (cowpea) alone or of the mixture containing 2/3 of this legume. With the supplement containing only 1/3 of cowpea, intake was intermediate and the lowest (P<0.05) supplement intake was observed with Calliandra alone. These differences in the consumption of the supplements were also reflected in daily milk production.The lowest (P<0.05) amount of fat corrected milk was produced in the treatment with Calliandra alone. When legume mixtures were supplemented, milk production was intermediate and when cowpea was supplemented alone, milk production was higher (P<0.05) than in any other treatment. Milk contents of fat and total solids were not affected (P>0.05) by supplementation. However, milk urea nitrogen was higher (P<0.05) with cowpea than with Calliandra, which is probably due to the higher content of readily fermentable crude protein in V. unguiculata.These results confirm the high potential of cowpea as supplement for dual purpose cows grazing low quality pastures during the dry season and they indicate that milk production increases with increasing proportion of cowpea in the legume supplement.It can be concluded that a legume supplement based on Calliandra can be significantly improved by including a small proportion (e.g. 1/3) of cowpea in the mixture. It is worth mentioning that milk urea nitrogen levels were very low throughout the experiment, indicating that rumen degradable crude protein was a limiting nutrient even in the treatment with Cowpea alone. Therefore it is not surprising that the mixtures of Calliandra and cowpea did not result in a higher milk production than cowpea alone, because a positive effect of such legume mixtures can only be expected when degradable crude protein is not limiting ruminal fermentation."}
|
main/part_1/0439655938.json
ADDED
|
@@ -0,0 +1 @@
|
|
|
|
|
|
|
| 1 |
+
{"metadata":null,"keywords":null,"sieverID":"76a1dc8c-21af-4f02-9f42-52278debcb71","content":"\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n\n"}
|