Update README.md

README.md

@@ -39,6 +39,15 @@ author:
   <img src="images/Fig1.png" alt="Alt Text" width="1000" style="display: block; margin: 0 auto;">
 </div>
 
+### Overview
+
+The BIOSCAN-1M dataset offers researchers detailed information about insects, with each record containing four primary attributes:
+
+- DNA Barcode Sequence
+- Barcode Index Number (BIN)
+- Biological Taxonomy Classification
+- RGB image
+
 
 
 ### Citation
@@ -89,7 +98,7 @@ Each record of the BIOSCAN-1M Insect dataset contains four primary attributes:
 
 
 
-###### <h4> I. DNA barcode sequence
+### I. DNA barcode sequence
 The provided DNA barcode sequence showcases the arrangement of nucleotides:
 
 * Adenine (A): Red 
@@ -106,7 +115,7 @@ TTTATATTTTATTTTTGGAGCATGATCAGGAATAGTTGGAACTTCAATAAGTTTATTAATTCGAACAGAATTAAGCCAAC
 </div>
 
 
-###### <h4> II. Barcode Index Number (BIN)
+### II. Barcode Index Number (BIN)
 BINs, acting as an alternative to Linnean names, provide a genetic-centric classification for organisms, 
 emphasizing the significance of genetic code in taxonomy.
 
@@ -118,7 +127,7 @@ BOLD:AER5166
   <img src="images/BIN.png" alt="Alt Text" width="1000" style="display: block; margin: 0 auto;">
 </div>
 
-###### <h4> III. Biological taxonomy ranking annotations
+### III. Biological taxonomy ranking annotations
 Taxonomic group ranking annotations categorize organisms hierarchically based on evolutionary relationships.
 It organizes species into groups based on shared characteristics and genetic relatedness.
 
@@ -127,7 +136,7 @@ It organizes species into groups based on shared characteristics and genetic rel
 </div>
 
   
-###### <h4> IV. RGB image
+### IV. RGB image
 Original insect images from 16 most densly populated orders of the BIOSCAN-1M Insect dataset. 
 The numbers below each image identify the number of images in each class, and clearly illustrate the degree of class imbalance in the BIOSCAN-1M Insect dataset.