Datasets:
Update README.md
Browse files
README.md
CHANGED
|
@@ -3,3 +3,167 @@ license: other
|
|
| 3 |
license_name: cc-by-nc-sa-4.0
|
| 4 |
license_link: https://creativecommons.org/licenses/by-nc-sa/4.0/deed.en
|
| 5 |
---
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
|
| 3 |
license_name: cc-by-nc-sa-4.0
|
| 4 |
license_link: https://creativecommons.org/licenses/by-nc-sa/4.0/deed.en
|
| 5 |
---
|
| 6 |
+
|
| 7 |
+
|
| 8 |
+
# BIOSCAN_1M Insect Dataset
|
| 9 |
+
|
| 10 |
+
|
| 11 |
+
<div align="center">
|
| 12 |
+
<img src="images/Fig1.png" alt="Alt Text" width="800" style="display: block; margin: 0 auto;">
|
| 13 |
+
</div>
|
| 14 |
+
|
| 15 |
+
|
| 16 |
+
|
| 17 |
+
Website: https://biodiversitygenomics.net/1M_insects/
|
| 18 |
+
|
| 19 |
+
GitHub: https://github.com/zahrag/BIOSCAN-1M
|
| 20 |
+
|
| 21 |
+
Zenodo: https://zenodo.org/records/8030065
|
| 22 |
+
|
| 23 |
+
Kaggle: https://www.kaggle.com/datasets/zahragharaee/bioscan-1m-insect-dataset
|
| 24 |
+
|
| 25 |
+
Paper: https://arxiv.org/abs/2307.10455
|
| 26 |
+
|
| 27 |
+
```
|
| 28 |
+
cite as:
|
| 29 |
+
|
| 30 |
+
@inproceedings{gharaee2023step,
|
| 31 |
+
title={A Step Towards Worldwide Biodiversity Assessment: The {BIOSCAN-1M} Insect Dataset},
|
| 32 |
+
booktitle = {Advances in Neural Information Processing Systems ({NeurIPS}) Datasets \& Benchmarks Track},
|
| 33 |
+
author={Gharaee, Z. and Gong, Z. and Pellegrino, N. and Zarubiieva, I. and Haurum, J. B. and Lowe, S. C. and McKeown, J. T. A. and Ho, C. Y. and McLeod, J. and Wei, Y. C. and Agda, J. and Ratnasingham, S. and Steinke, D. and Chang, A. X. and Taylor, G. W. and Fieguth, P.},
|
| 34 |
+
year={2023},
|
| 35 |
+
}
|
| 36 |
+
```
|
| 37 |
+
|
| 38 |
+
|
| 39 |
+
|
| 40 |
+
## A Dataset Record
|
| 41 |
+
BIOSCAN dataset provides researchers with information about insects.
|
| 42 |
+
Each record of the BIOSCAN-1M Insect dataset contains four primary attributes:
|
| 43 |
+
|
| 44 |
+
* DNA barcode sequence
|
| 45 |
+
* Barcode Index Number (BIN)
|
| 46 |
+
* Taxonomic group ranking annotations
|
| 47 |
+
* RGB image
|
| 48 |
+
|
| 49 |
+
|
| 50 |
+
|
| 51 |
+
###### <h4> I. DNA barcode sequence
|
| 52 |
+
The provided DNA barcode sequence showcases the arrangement of nucleotides:
|
| 53 |
+
|
| 54 |
+
* Adenine (A): Red
|
| 55 |
+
* Thymine (T): Blue
|
| 56 |
+
* Cytosine (C): Green
|
| 57 |
+
* Guanine (G): Yellow
|
| 58 |
+
|
| 59 |
+
```
|
| 60 |
+
TTTATATTTTATTTTTGGAGCATGATCAGGAATAGTTGGAACTTCAATAAGTTTATTAATTCGAACAGAATTAAGCCAACCAGGAATTTTTA ...
|
| 61 |
+
```
|
| 62 |
+
|
| 63 |
+
<div align="center">
|
| 64 |
+
<img src="images/DNA_sequence.png" alt="Alt Text" width="800" style="display: block; margin: 0 auto;">
|
| 65 |
+
</div>
|
| 66 |
+
|
| 67 |
+
|
| 68 |
+
###### <h4> II. Barcode Index Number (BIN)
|
| 69 |
+
BINs, acting as an alternative to Linnean names, provide a genetic-centric classification for organisms,
|
| 70 |
+
emphasizing the significance of genetic code in taxonomy.
|
| 71 |
+
|
| 72 |
+
```
|
| 73 |
+
BOLD:AER5166
|
| 74 |
+
```
|
| 75 |
+
|
| 76 |
+
<div align="center">
|
| 77 |
+
<img src="images/BIN.png" alt="Alt Text" width="800" style="display: block; margin: 0 auto;">
|
| 78 |
+
</div>
|
| 79 |
+
|
| 80 |
+
###### <h4> III. Taxonomic group ranking annotations
|
| 81 |
+
|
| 82 |
+
<div align="center">
|
| 83 |
+
<img src="images/Taxonomy_horiz_upd1.png" alt="Alt Text" width="800" style="display: block; margin: 0 auto;">
|
| 84 |
+
</div>
|
| 85 |
+
|
| 86 |
+
|
| 87 |
+
###### <h4> IV. RGB image
|
| 88 |
+
Original insect images from 16 most densly populated orders of the BIOSCAN-1M Insect dataset.
|
| 89 |
+
|
| 90 |
+
<div align="center">
|
| 91 |
+
<table>
|
| 92 |
+
<!-- First Row -->
|
| 93 |
+
<tr>
|
| 94 |
+
<td align="center"><img src="images/Diptera.jpg" width="200px" class="image"></td>
|
| 95 |
+
<td align="center"><img src="images/Hymenoptera.jpg" width="200px" class="image"></td>
|
| 96 |
+
<td align="center"><img src="images/Coleoptera.jpg" width="200px" class="image"></td>
|
| 97 |
+
<td align="center"><img src="images/Hemiptera.jpg" width="200px" class="image"></td>
|
| 98 |
+
</tr>
|
| 99 |
+
<tr>
|
| 100 |
+
<td align="center"><strong>Diptera</strong></td>
|
| 101 |
+
<td align="center"><strong>Hymenoptera</strong></td>
|
| 102 |
+
<td align="center"><strong>Coleoptera</strong></td>
|
| 103 |
+
<td align="center"><strong>Hemiptera</strong></td>
|
| 104 |
+
</tr>
|
| 105 |
+
<!-- Second Row -->
|
| 106 |
+
<tr>
|
| 107 |
+
<td align="center"><img src="images/Lepidoptera.jpg" width="200px" class="image"></td>
|
| 108 |
+
<td align="center"><img src="images/Psocodea.jpg" width="200px" class="image"></td>
|
| 109 |
+
<td align="center"><img src="images/Thysanoptera.jpg" width="200px" class="image"></td>
|
| 110 |
+
<td align="center"><img src="images/Trichoptera.jpg" width="200px" class="image"></td>
|
| 111 |
+
</tr>
|
| 112 |
+
<tr>
|
| 113 |
+
<td align="center"><strong>Lepidoptera</strong></td>
|
| 114 |
+
<td align="center"><strong>Psocodea</strong></td>
|
| 115 |
+
<td align="center"><strong>Thysanoptera</strong></td>
|
| 116 |
+
<td align="center"><strong>Trichoptera</strong></td>
|
| 117 |
+
</tr>
|
| 118 |
+
<!-- Third Row -->
|
| 119 |
+
<tr>
|
| 120 |
+
<td align="center"><img src="images/Orthoptera.jpg" width="200px" class="image"></td>
|
| 121 |
+
<td align="center"><img src="images/Blattodea.jpg" width="200px" class="image"></td>
|
| 122 |
+
<td align="center"><img src="images/Neuroptera.jpg" width="200px" class="image"></td>
|
| 123 |
+
<td align="center"><img src="images/Ephemeroptera.jpg" width="200px" class="image"></td>
|
| 124 |
+
</tr>
|
| 125 |
+
<tr>
|
| 126 |
+
<td align="center"><strong>Orthoptera</strong></td>
|
| 127 |
+
<td align="center"><strong>Blattodea</strong></td>
|
| 128 |
+
<td align="center"><strong>Neuroptera</strong></td>
|
| 129 |
+
<td align="center"><strong>Ephemeroptera</strong></td>
|
| 130 |
+
</tr>
|
| 131 |
+
<!-- Fourth Row -->
|
| 132 |
+
<tr>
|
| 133 |
+
<td align="center"><img src="images/Dermaptera.jpg" width="200px" class="image"></td>
|
| 134 |
+
<td align="center"><img src="images/Archaeognatha.jpg" width="200px" class="image"></td>
|
| 135 |
+
<td align="center"><img src="images/Plecoptera.jpg" width="200px" class="image"></td>
|
| 136 |
+
<td align="center"><img src="images/Embioptera.jpg" width="200px" class="image"></td>
|
| 137 |
+
</tr>
|
| 138 |
+
<tr>
|
| 139 |
+
<td align="center"><strong>Dermaptera</strong></td>
|
| 140 |
+
<td align="center"><strong>Archaeognatha</strong></td>
|
| 141 |
+
<td align="center"><strong>Plecoptera</strong></td>
|
| 142 |
+
<td align="center"><strong>Embioptera</strong></td>
|
| 143 |
+
</tr>
|
| 144 |
+
</table>
|
| 145 |
+
</div>
|
| 146 |
+
|
| 147 |
+
|
| 148 |
+
## Class Distribution
|
| 149 |
+
|
| 150 |
+
Class distribution and class imbalance in the BIOSCAN-1M Insect dataset. Orders (top) and diptera families (bottom).
|
| 151 |
+
|
| 152 |
+
|
| 153 |
+
<div align="center">
|
| 154 |
+
<img src="images/BIOSCAN_Fig2_upd3.png" alt="Alt Text" width="800" style="display: block; margin: 0 auto;">
|
| 155 |
+
</div>
|
| 156 |
+
|
| 157 |
+
|
| 158 |
+
|
| 159 |
+
|
| 160 |
+
|
| 161 |
+
|
| 162 |
+
|
| 163 |
+
|
| 164 |
+
|
| 165 |
+
|
| 166 |
+
|
| 167 |
+
|
| 168 |
+
|
| 169 |
+
|